article
stringlengths 0
328k
| abstract
stringlengths 261
2.35k
|
|---|---|
cyclooxygenases ( coxs ) , also known as prostaglandin h synthases or prostaglandin endoperoxide synthases ( e.c .
1.14.99.1 ) , are fatty - acid oxygenases of the myeloperoxidase superfamily that are most closely related to the pathogen - inducible oxidases and linoleate diol synthases of plants and fungi .
the purification of cox-1 ( then called simply cox ) from sheep and bovine seminal vesicles in 1976 led to the cloning of the cox-1 gene in 1988 [ 4 - 6 ] . for many years
, it was thought that the constitutively active cox-1 protein was the only cyclooxygenase in eukaryotic cells , but in 1991 a second , inducible enzyme was identified through studies of cell division ; this second enzyme is now called cox-2 .
the structure of the human cox-1 and cox-2 genes are shown in figure 1a , and the properties of cox-1 and cox-2 and the genes encoding them are compared in table 1 .
all vertebrates investigated , including cartilaginous fishes , bony fishes , birds , and mammals , have two cox genes : one encoding the constitutive cox-1 and another the inducible cox-2 .
cox-1 and cox-2 share approximately 60 - 65% amino - acid identity with each other ; cox-1
orthologs ( without the signal peptide ) share approximately 70 - 95% amino - acid identity across vertebrate species and cox-2 orthologs share 70 - 90% .
additionally , coral ( of the phylum cnidaria ) and sea squirt ( ascidian ) each have two cox genes , which may have arisen from gene - duplication events independent from those that produced vertebrate cox-1 and cox-2 .
it is clear that the vertebrate , coral and ascidian cox genes all descend from a common ancestor .
intron - exon junctions are highly conserved in all species , with a few notable exceptions : the vertebrate cox-1 genes contain an extra intron ( intron 1 ) , and the ascidian and coral genes have extra introns or lack some exons in the regions that encode exons 6 , 7 or 11 in vertebrate cox-1 .
the exon structures of cox genes largely reflect the domains encoded by the proteins ( figure 1b ) .
the structure of human cyclooxygenase genes and their expression and regulation have been reviewed elsewhere .
cox genes have not been found in insects , unicellular organisms , or plants , although prostaglandins , their products , have been found in some of these organisms .
recently , an enzyme that catalyzes the synthesis of prostaglandin e2 from arachidonic acid ( the substrate of coxs ) was cloned from the protozoan entamoeba histolytica .
this enzyme shows no clear structural similarity to coxs , suggesting that alternative evolutionary paths to prostaglandin synthesis have evolved in some organisms .
coxs are all close to 600 amino acids in size and have a similar primary structure ( figure 1b ) . the crystal structure of sheep cox-1 ( minus the post - translationally cleaved signal peptide ) ,
was obtained in 1994 ; human and mouse coxs have since been crystallized and show strikingly similar features . after the signal peptide , the amino terminus of the protein contains a single epidermal growth factor ( egf ) module with conserved disulfide bonds that functions as a dimerization domain .
this is followed by a series of four amphipathic helices that anchors the protein to one leaflet of the membrane .
this ' monotopic ' type of insertion into a membrane has been found only in this enzyme and a few other proteins such as squalene cyclase and s - mandelate dehydrogenase .
the remainder of the protein consists of the catalytic domain , which has two distinct cyclooxygenase and peroxidase active sites .
coxs are highly conserved , and few significant differences are seen in the dimerization , membrane - binding and catalytic domains between coxs from different species .
the amino - terminal hydrophobic signal peptides differ significantly in length between species . in the case of two splice variants of canine cox-1
, the signal peptide has been found not to be cleaved from the enzyme when expressed in insect cells .
the catalytic domain contains conserved alpha - helical structures and a heme - binding motif shared with other peroxidases .
one n - glycosylation site ( asn143 , using the numbering of human cox-1 ) is absolutely conserved , and other sites are shifted only slightly in different homologs .
for example , asn410 in sheep cox-1 ( orthologous to asn4o9 in human cox-1 ) , found to be essential for folding , is shifted to asn394 in coral coxs . the cyclooxygenase active site is a narrow tunnel , approximately 8 wide and 25 long , that opens in the membrane - binding domain ( figure 2 ) .
this site accepts the arachidonic acid that is liberated from the membrane by cellular phospholipases .
amino acids lining this site are largely hydrophobic and serve to ' solvate ' the hydrophobic substrate into the site .
exceptions to this hydrophobicity are arg119 , tyr384 and ser529 ( numbered according to the human cox-1 enzyme sequence ) .
arg119 coordinates the carboxyl group of arachidonic acid by a salt bridge or hydrogen bond ; ser529 coordinates the geometry of attack in the complex bis - dioxygenation reaction performed ; and tyr384 forms a critical tyrosyl radical that initiates the cyclooxygenase reaction by abstraction of hydrogen from arachidonic acid ( see mechanism section ) .
non - steroidal anti - inflammatory drugs ( nsaids ) competitively inhibit the cyclooxygenase active site ; an exception is the nsaid aspirin , which covalently modifies the enzyme by acetylating ser529 .
in contrast to the cyclooxygenase active site , the peroxidase site is a solvent accessible cleft located on the surface of the enzyme furthest from the membrane ( figure 2 ) .
cox-1 is ubiquitously and constitutively expressed in mammalian tissues and cells , whereas cox-2 is highly inducible and is generally present in mammalian tissues at very low levels , unless increased by one of many types of stimuli such as cytokines and growth factors .
both coxs are largely located on the lumenal side of the endoplasmic reticulum ( er ) membrane and the nuclear envelope , although they have also been detected in some situations in lipid bodies , mitochondria , filamentous structures , vesicles and in the nucleus [ 23 - 26 ] .
the lumen of the er is important for both the structure and function of coxs : its oxidative potential allows formation of the disulfide bonds of the enzymes , and n - linked glycosylation - which occurs in the er - appears to be necessary for proper protein folding .
moreover , the final product of coxs , prostaglandin h2 , is sufficiently non - polar to diffuse through the membrane of the er to isomerases located on the cytosolic surface of the er or in the cytosol ( figures 2 , 3 ) .
lipid bodies may provide a similar environment , but the role of coxs in the nucleus is unknown .
both classes of cox are bifunctional enzymes with two distinct catalytic activities : cyclooxygenase ( or bis - dioxygenase ) activity and peroxidase activity ( figure 3a ) .
the primary products of coxs were first detected in human seminal fluid by clinicians studying uterine contraction . thought to be the product of the prostate gland , these highly potent bioactive compounds were given the name prostaglandins .
they are synthesized in virtually all tissues in vertebrates , however , and some organisms that lack prostate glands , such as corals , also synthesize prostaglandins .
initially , the enzyme activity that synthesized prostaglandins was frequently called prostaglandin synthetase , but because it does not require atp it is now called prostaglandin g / h synthase to fit the nomenclature convention .
it is more popularly known as cyclooxygenase , a name that only partially describes the enzyme since it refers to only one of its two enzymatic activities .
prostaglandin isomers - including thromboxane and prostaglandins d2 , e2 , f2 , and i2 ( prostacyclin ; figure 3b ) - function in numerous physiological and pathophysiological processes , such as pyresis ( fever ) , algesia ( sensitivity to pain ) , inflammation , thrombosis , parturition , mitogenesis , vasodilation and vasoconstriction , ovulation , and renal function .
prostaglandin isomers act upon g - protein - coupled receptors , and there are multiple receptors for some isoforms ( such as prostaglandin e2 ) .
prostaglandins are short - lived in vivo ( with half - lives of seconds to minutes ) , and act in an autocrine or a paracrine rather than an endocrine fashion .
cox-1 was first studied in tissue and cell homogenates , and in this context was shown by vane to be the inhibitory target of nsaids .
the cyclooxygenase activity of coxs oxygenates arachidonic acid to produce prostaglandin g2 , a cyclopentane hydroperoxy endoperoxide ; the peroxidase activity of coxs then reduces this to prostaglandin h2 ( figure 3a ) .
the two reactions are functionally interconnected ( see below and figure 3c ) . a branch - chain reaction mechanism for cox , indicating that the two reaction cycles are coupled , was first proposed by ruf and colleagues .
the mechanism by which arachidonic acid is converted to prostaglandin h2 has been the subject of excellent reviews .
the newly synthesized cox enzyme needs to be activated at tyr384 ( in human cox-1 ; tyr371 in human cox-2 ) to produce a tyrosyl radical ; this activation involves the heme in the peroxidase site ( see figure 3b ) .
the tyrosyl radical converts arachidonic acid to an arachidonyl radical , which reacts with two molecules of oxygen to yield prostaglandin g2 this then diffuses to the peroxidase site and is reduced to prostaglandin h2 by the peroxidase activity .
the cyclooxygenase activity is dependent on heme oxidation - that is , on the peroxidase activity - but continuous peroxidase activity is not necessary for cyclooxygenase activity , as the tyrosyl radical is regenerated in each catalytic cycle ( figure 3c ) .
prostaglandin h2 is the root prostaglandin from which prostaglandin isomers such as thromboxane and prostacyclin are made by downstream synthases , via isomerization and oxidation or reduction reactions ( figure 3b ) .
cyclooxygenases have short catalytic life spans ( frequently 1 - 2 minutes at vmax in vitro ) because the enzyme is autoinactivated .
the mechanism of autoinactivation is unknown , but reactive tyrosyl radicals may cause internal protein modification .
there is increasing evidence for the involvement of coxs in the development and progression of cancer , alzheimer 's disease and other pathophysiological states .
moreover , variants of cyclooxygenase derived from alternative splicing have been reported ( reviewed in ) .
elucidation of the roles played by these variants could provide greater insight into the roles of coxs in physiology and disease .
the cyclooxygenase activity of coxs oxygenates arachidonic acid to produce prostaglandin g2 , a cyclopentane hydroperoxy endoperoxide ; the peroxidase activity of coxs then reduces this to prostaglandin h2 ( figure 3a ) .
the two reactions are functionally interconnected ( see below and figure 3c ) . a branch - chain reaction mechanism for cox , indicating that the two reaction cycles are coupled , was first proposed by ruf and colleagues .
the mechanism by which arachidonic acid is converted to prostaglandin h2 has been the subject of excellent reviews .
the newly synthesized cox enzyme needs to be activated at tyr384 ( in human cox-1 ; tyr371 in human cox-2 ) to produce a tyrosyl radical ; this activation involves the heme in the peroxidase site ( see figure 3b ) .
the tyrosyl radical converts arachidonic acid to an arachidonyl radical , which reacts with two molecules of oxygen to yield prostaglandin g2 this then diffuses to the peroxidase site and is reduced to prostaglandin h2 by the peroxidase activity .
the cyclooxygenase activity is dependent on heme oxidation - that is , on the peroxidase activity - but continuous peroxidase activity is not necessary for cyclooxygenase activity , as the tyrosyl radical is regenerated in each catalytic cycle ( figure 3c ) .
prostaglandin h2 is the root prostaglandin from which prostaglandin isomers such as thromboxane and prostacyclin are made by downstream synthases , via isomerization and oxidation or reduction reactions ( figure 3b ) .
cyclooxygenases have short catalytic life spans ( frequently 1 - 2 minutes at vmax in vitro ) because the enzyme is autoinactivated .
the mechanism of autoinactivation is unknown , but reactive tyrosyl radicals may cause internal protein modification .
there is increasing evidence for the involvement of coxs in the development and progression of cancer , alzheimer 's disease and other pathophysiological states .
moreover , variants of cyclooxygenase derived from alternative splicing have been reported ( reviewed in ) .
elucidation of the roles played by these variants could provide greater insight into the roles of coxs in physiology and disease .
this work was supported by national institute of health grant ar 46688 and merck , usa .
primary structures of cox genes and cox proteins . ( a ) schematic representation of human cox-1 and cox-2 genes and the mrnas they encode ( shown as white bars below the genes ) .
black boxes in the genes and white boxes in the mrnas denote exons ; numbers above each gene are exon numbers while numbers within the white boxes indicate the size of each exon in nucleotides ; single lines in the genes indicate introns and untranslated regions of first and last exons ( the latter being shown as gray boxes in the mrnas ) .
( b ) schematic representation of human cox proteins ( all known vertebrate proteins have the same general arrangement ) .
numbers denote amino - acid residues ; the exons encoding each domain are shown on bars below the proteins ; important residues are indicated as shown in the key ( and with letters in the single - letter amino - acid code , with a subscript number indicating the residue number ) .
sp , signal peptide ; dm , dimerization domain ; eg ; epidermal growth factor domain ; mb , membrane - binding domain ; cat , catalytic domain .
cross - section of a cyclooxygenase monomer in the lumen of the endoplasmic reticulum , showing the two distinct catalytic sites .
cx , cyclooxygenase catalytic site ; mb , membrane - binding domain ; px , peroxidase catalytic site .
( a ) the two reactions performed by cyclooxygenases : the conversion of arachidonic acid to prostaglandin g2 by the cyclooxygenase activity and the conversion of prostaglandin g2 to prostaglandin h2 by the peroxidase activity .
( b ) the cell - specific synthases that are involved in the conversion of prostaglandin h2 to the five principal prostaglandins .
( 1 ) first , a ferryl - oxo ( feiv ) protoporphyrin radical in the heme in the peroxidase active site is produced when endogenous oxidant(s ) oxidizes ferric heme ( feiii ) to ferryl - oxo ( feiv ) protoporphyrin radical through a two - electron oxidation .
( 2 ) the tyr384 residue in the cyclooxygenase active site is activated , through a single - electron reduction reaction with the feiv protoporphyrin radical , to produce a tyrosyl radical . in the first step of the oxygenation process ( 3 ) , the 13-pro(s ) hydrogen of arachidonic acid in the cox site
( 4 ) this is followed by the reaction of the arachidonyl radical with two molecules of oxygen , to yield prostaglandin g2 .
( 5 ) prostaglandin g2 then diffuses ( dotted line ) to the peroxidase active site and is reduced to prostaglandin h2 by the peroxidase activity ( 1 ) .
aa , arachidonic acid ; enr , an endogenous reductant ; fe , ferric heme ; fe = o , ferryl - oxo feiv porphyrin radical ; tyr - oh , active site tyrosine ; tyr - o , tyrosyl radical . properties of human cox-1 and cox-2 and the genes encoding them information from . *
abbreviations : cre , cyclic amp response element ; gata-1 , binding site containing gata sequence bound by the gata 1 transcription factor ; gre , glucocorticoid - response element ; ssre , shear - stress response element ; other abbreviations denote the transcription factors bound by the regulatory elements shown : ap-2 , activator protein 2 ; c / ebp , ccaat / enhancer - binding protein ; nf - il6 , nuclear factor for interleukin 6 ; nfb , nuclear factor b ; pea-3 , polyoma enhancer activator ; sp-1 , transcription factor sp-1 . | cyclooxygenases ( coxs ) catalyze the rate - limiting step in the production of prostaglandins , bioactive compounds involved in processes such as fever and sensitivity to pain , and are the target of aspirin - like drugs . in mammals ,
the two cox genes encode a constitutive isoenzyme ( cox-1 ) and an inducible isoenzyme ( cox-2 ) . |
he developed a bronchopleural fistula ( bpf ) and underwent an eloesser operation following bpf closure with an omental flap in 1998 .
however , in 2015 , he was referred to samsung medical center because of increased wound discharge and pain .
chest computed tomography ( ct ) demonstrated pleural thickening and irregularity , along with bony destruction in the left 10th rib , at the eloesser aperture ( fig .
a f-18 fluorodeoxyglucose positron emission tomography ( fdg - pet ) revealed hyper - metabolic pleural thickening with invasion into the left 10th rib ( maximum standardized uptake value [ suv]=21.0 ) ( fig .
the biopsied specimen was examined microscopically ; the results led to a diagnosis of squamous cell carcinoma .
the patient then received definitive radiotherapy with a dose of 60 gy in 20 fractions , and the tumor regressed markedly .
he is currently in a good general condition and is being followed up as an outpatient .
a 53-year - old woman underwent right pneumonectomy because of a destroyed tuberculous lung with pleurisy in 1990 .
she was diagnosed with post - pneumonectomy empyema without bpf in 2006 and underwent repeated irrigation and debridement , followed by the clagett procedure .
she visited samsung medical center complaining of right shoulder and chest pain in october 2010 .
chest ct revealed extra - thoracic extension of enhancing soft - tissue lesions originating from the right pneumonectomy space .
percutaneous needle biopsy was performed , and the pathologic findings included a fibrinous exudate and inflammatory cells .
the patient was treated with antibiotics ; however , her pain was progressive , and she received a follow - up chest ct scan in march 2011 .
the chest ct revealed progression of the extra - thoracic extension of the enhancing soft - tissue lesion , including rib invasion and particularly involving the neural foramen and the epidural space at the level of the thoracic spine ( t7 vertebral body ) , indicating an empyema - associated malignancy ( fig .
an f-18 fdg - pet scan showed a hypermetabolic malignant mass in the right pneumonectomy space , right chest wall , right seventh rib , and t7 spine ( suv=35.3 ) ( fig .
pathologic diagnosis of the squamous cell carcinoma was confirmed by the percutaneous needle biopsy of the soft - tissue lesions .
the patient received palliative radiotherapy with a total dose of 42 gy in 12 fractions .
a spine ct showed an increase in the size of the malignant mass involving the t6 , t7 , and t8 vertebral bodies .
he developed a bronchopleural fistula ( bpf ) and underwent an eloesser operation following bpf closure with an omental flap in 1998 .
however , in 2015 , he was referred to samsung medical center because of increased wound discharge and pain .
chest computed tomography ( ct ) demonstrated pleural thickening and irregularity , along with bony destruction in the left 10th rib , at the eloesser aperture ( fig .
a f-18 fluorodeoxyglucose positron emission tomography ( fdg - pet ) revealed hyper - metabolic pleural thickening with invasion into the left 10th rib ( maximum standardized uptake value [ suv]=21.0 ) ( fig .
the biopsied specimen was examined microscopically ; the results led to a diagnosis of squamous cell carcinoma .
the patient then received definitive radiotherapy with a dose of 60 gy in 20 fractions , and the tumor regressed markedly .
he is currently in a good general condition and is being followed up as an outpatient .
a 53-year - old woman underwent right pneumonectomy because of a destroyed tuberculous lung with pleurisy in 1990 .
she was diagnosed with post - pneumonectomy empyema without bpf in 2006 and underwent repeated irrigation and debridement , followed by the clagett procedure .
she visited samsung medical center complaining of right shoulder and chest pain in october 2010 .
chest ct revealed extra - thoracic extension of enhancing soft - tissue lesions originating from the right pneumonectomy space .
percutaneous needle biopsy was performed , and the pathologic findings included a fibrinous exudate and inflammatory cells .
the patient was treated with antibiotics ; however , her pain was progressive , and she received a follow - up chest ct scan in march 2011 .
the chest ct revealed progression of the extra - thoracic extension of the enhancing soft - tissue lesion , including rib invasion and particularly involving the neural foramen and the epidural space at the level of the thoracic spine ( t7 vertebral body ) , indicating an empyema - associated malignancy ( fig .
an f-18 fdg - pet scan showed a hypermetabolic malignant mass in the right pneumonectomy space , right chest wall , right seventh rib , and t7 spine ( suv=35.3 ) ( fig .
pathologic diagnosis of the squamous cell carcinoma was confirmed by the percutaneous needle biopsy of the soft - tissue lesions .
the patient received palliative radiotherapy with a total dose of 42 gy in 12 fractions .
a spine ct showed an increase in the size of the malignant mass involving the t6 , t7 , and t8 vertebral bodies .
chronic empyema , due to either tuberculosis or bacterial causes , can result in the development of a malignancy .
the most common tumor is non - hodgkin lymphoma ; however , thus far , only a few cases of epithelial tumors have been reported [ 24 ] . in the literature ,
only 6 cases of squamous cell carcinoma arising from the pleura have been reported . at our medical center ,
nineteen of these 72 patients underwent a pneumonectomy because of an infective disease resulting from tuberculosis , aspergillosis , or chronic empyema due to bpf .
the pathogenesis of a malignant tumor arising in the post - pneumonectomy cavity associated with chronic empyema remains unknown . according to deaton ,
squamous cell carcinoma may originate from the metaplasia of the pleural endothelium , metaplastic bronchial epithelium that has extended into the cavity , or metaplastic skin epithelium growing into the cavity . in the cases discussed her , 2 patients experienced tuberculous empyema for several years before undergoing pneumonectomy .
both patients developed post - pneumonectomy empyema with or without bpf , and underwent a thoracotomy ( eloesser or clagett ) .
the tumors in these 2 cases were diagnosed after 17 years and 4 years , respectively .
the chronic inflammatory state after post - pneumonectomy empyema is believed to have led to the development of the malignancy .
radiographic findings in patients with chronic empyema , such as increased opacity in the thoracic cavity , soft - tissue bulging , nodular pleural thickening , and destruction of the bone near the empyema , suggest the possibility of a chronic empyema - associated malignancy .
osteolytic changes with pleural thickening in the imaging findings were observed in the 2 cases reported , and were suggestive of a malignancy .
the treatment of tumors arising from the post - pneumonectomy space should be determined on the basis of the patient s condition .
most of the patients who underwent pneumonectomy had poor pulmonary function ; therefore , radiation therapy was recommended .
these are rare case reports of squamous cell carcinoma arising from the pleural cavity after pneumonectomy for chronic empyema .
we suggest that the possibility of a malignancy originating from the pleural cavity be considered in patients who experience post - pneumonectomy empyema . | malignant tumors associated with chronic empyema have been reported in the literature , and a majority of these tumors are lymphomas .
epithelial tumors originating from the post - pneumonectomy space in patients with chronic empyema are extremely rare . here
, we present the cases of 2 patients with squamous cell carcinoma arising from the pleural cavity after pneumonectomy for chronic empyema . |
clozapine has been known to cause haematological side effects like agranulocytosis , neutropenia , leucocytosis , eosinophilia and thrombocytopenia .
although some data is available with regard to leucopenia , data for thrombocytopenia is limited . in this report
we present the case of a patient who developed thrombocytopenia with clozapine and review the existing literature .
a woman aged 22 , suffering from paranoid schizophrenia ( as diagnosed by dsm - iv ) for the past three years , presented with an acute episode .
she had received adequate trials of olanzapine , risperidone and quetiapine along with electroconvulsive therapy .
taking this into account she was started on clozapine . prior to starting of clozapine her hemogram including
platelet count did not reveal any abnormality . for the management of acute symptoms in view of the suicidal risk , she was treated with electroconvulsive therapy , lorazepam up to 4 mg / day and
was started on clozapine and the dose was gradually increased to 187.5 mg / day over the period of four weeks because of side effects of hypersalivation and constipation .
while clozapine was increased , leucocyte count and platelet counts were monitored regularly on weekly basis and serial monitoring did not reveal any abnormality . with this she achieved symptomatic remission following which lorazepam was stopped . while on clozapine 187.5 mg / day , low platelet count ( 101,000 and 98,000/l on two occasions ) was noted for the first time after 17 weeks of continuation of clozapine at the above said dose without reduction in the leucocyte count or haemoglobin levels . following this monitoring
was increased and platelet count kept on fluctuating between 1,20,000/l to 1,35,000/l . over the period , platelet count started dropping . by another 24 weeks of clozapine therapy ,
the platelet count dropped to 60,000/l without any reduction in the leucocyte count and the haemoglobin levels .
the drop occurred despite reduction in the dose of clozapine upto 125 mg / day .
clozapine was stopped completely as a result . throughout this period she never had any fever , skin rash , purpura , excessive menstrual bleeding or bleeding from any other source , arthritis , arthralgia , muscle pain and muscle weakness .
her investigations in the form of serum electrolytes , liver function test , renal function test , prothrombin time , bleeding time , clotting time and ultrasound abdomen and pelvis did not reveal any abnormality .
she was also evaluated by physician and the opinion was that the low platelet count may be related to clozapine . within a week of
stopping clozapine platelet counts started improving and by six weeks her platelet count was 1,80,000/l . in the meanwhile , with stoppage of clozapine , she had relapse of symptoms and required inpatient care , was treated with electroconvulsive therapy , lorazepam and chlorpromazine , with which she achieved remission . during this period her platelet count remained within the normal range .
thrombocytopenia is defined as platelet count of less than 100 10/l . only two studies and a small case series
have reported incidence of thrombocytopenia associated with clozapine and only few case reports have focused on this association.[410 ] the findings are summarized in table 1 .
literature reporting clozapine associated thrombocytopenia although in most of the literature thrombocytopenia associated with clozapine has been reported to be transitory to at best last for 13 weeks , in a case report thrombocytopenia persisted for 40 months after stopping clozapine .
there are also few case reports of clozapine associated thrombocytosis . in one of this case
reports thrombocytosis was seen in a patient treated with granulocyte colony stimulating factor for clozapine associated agranulocytosis . as with thrombocytopenia , an immunological mechanism
thrombocytopenia was noted for the first time after 17 weeks of stable dose of clozapine , which kept on worsening with continuation of clozapine , even on the lower dose and subsided only after stoppage of clozapine and normalization of platelet count required six weeks .
however , in contrast to some of the reports , in the index case , platelet count kept on falling consistently with continuation of clozapine and improved only after stoppage of clozapine , suggesting that in certain cases the side effects may be transitory and can lead to fatal outcome . from the above literature
it can be concluded that there is a wide variation in the incidence of thrombocytopenia with clozapine , which possibly is influenced by the sample size studied .
there is lack of consensus with regard to resolution , with some reports suggesting that resolution requires stoppage of clozapine , as was seen in the index case too ; whereas others suggest that thrombocytopenia resolves on its own .
most of the available literature is silent about the possible mechanism , except for one report which demonstrated underlying immunological mechanism in a case of persistent thrombocytopenia even after stopping clozapine .
considering the fact that the thrombocytopenia may be transitory as suggested in some of the case reports , an informed decision about rechallenge must be made after weighing the risk and benefits . from the above it
hence , besides monitoring the leucocyte count , platelet count of patients receiving clozapine should also be monitored . | although agranulocytosis as a side effect of clozapine is well known , there is scarcity of data with regard to thrombocytopenia associated with clozapine . in this report
we describe a case of clozapine induced thrombocytopenia and review the existing literature . a 22 year old female patient developed thrombocytopenia while on clozapine 187.5 mg / day for 17 weeks .
thrombocytopenia persisted for 24 weeks even after reduction in the dose of clozapine and ultimately clozapine had to be stopped , which led to resolution of thrombocytopenia .
clozapine - induced thrombocytopenia is a less well - known , but potentially serious , adverse effect that should be screened for in practice .
the case highlights the fact that besides monitoring the leucocyte count , platelet count of patients receiving clozapine should also be monitored . |
reactive arthritis is the specific entity of aseptic inflammatory arthritis and follows the previous infection in other parts of the body .
current name , reactive arthritis , dates back from the 70 of last century , as proposed by ahvonen and aho with their colleagues ( 1 , 2 ) .
according to them , reactive arthritis :
appears after an infection with known etiology.from the end of infection to the onset of arthritis , there is a latent period which usually lasts 1 3 weeks.synovial fluid is always sterile.antibiotics are efficient in the treatment of infection , but they do not work in arthritis .
appears after an infection with known etiology . from the end of infection to the onset of arthritis
antibiotics are efficient in the treatment of infection , but they do not work in arthritis .
reactive arthritis is a negative spondyloarthropathy usually associated with hla b27 and mostly is found among caucasian race in the group age 20 to 40 year old more frequent among males than females ( 3 , 4 ) .
this condition is rarer among children and accounts for 3% of totally affected patients with reactive arthritis ( 5 ) .
onset of illness is usually associated with urinary symptoms which are followed by arthritis ( t / c articulation , knees , etc . ) , this correlation accounts for 50% of patients with urogenital symptoms , for 75% of patients with gastrointestinal symptoms and at the end conjunctivitis is also correlated with symptoms of reactive arthritis .
onset of illness is characterized with tiredness , slight fever , joint swelling - usually on the lower limbs with asymmetrical affection of joints .
sometimes edema and pain involve fingers of both hands which in turn take the shape of sausages , whereas on the insertion spot of tendon to calcaneus we often see the enthesopathy of heel
. most common clinical presentation of reactive arthritis is an oligoarthritis , sometimes monoarthritis , and rarely non - symmetrical polyarthritis with onset two or three weeks after a urogenital or gastrointestinal infection which is featured with pain , fever , occasional redness , usually in the talocrural joint or knees .
bacterial causative agents isolated in our work are : e. coli , staphylococcus aureus , chlamydia , ureaplasma urealticum , shigella , salmonella enteritidis , yersinia , campliobacter jejuni , streptococcus beta haemoliticus gr . a , streptococcus pn .
the source of infection .
identification and analysis of bacterial causative agent with the help of direct and indirect microbiological methods.from
the study were excluded : a ) patients with negative results ( bacterial causative agent is not isolated ) ; b ) patients with any other rheumatic comorbidity , and c ) patients who were undergoing antibiotic therapy .
identification and analysis of bacterial causative agent with the help of direct and indirect microbiological methods . from the study were excluded : a ) patients with negative results ( bacterial causative agent is not isolated ) ; b ) patients with any other rheumatic comorbidity , and c ) patients who were undergoing antibiotic therapy .
as a material for work we have utilized the study in which were included 100 patients diagnosed with reactive arthritis who have been visited in the rheumatology clinic in prishtina during the period 01.03.2013 01.03 2015 .
object of study were 100 patients , 66 of them were males and 34 females .
youngest patient was 13 years old , and the oldest was a 54 year old .
upon admission to the rheumatology clinic patients were interviewed in detail , clinical examinations were undertaken , and main complaints were recorded .
patients underwent necessary laboratory analyses , including hematological and biochemical examinations , rheumatism testing , immune - electrophoresis , also microbiological examinations were requested ( cultures , samples , serum ) etc .
we have employed direct and indirect microbiological methods . at the direct method with the help of cultures : ( urine culture , coproculture , hemoculture ) , followed by sample collection : ( pharyngeal sample , nasal sample , urethral sample , vaginal sample , prostate exprimat , etc ) . with the help of indirect methods such as determination of antibodies in serum for
data are presented in the tables : prevalence broken down on sex . prevalence broken down by sex data on the source of infection .
from the study we conclude that : reactive arthritis is an illness which affects mostly males with proportion 2:1 in the cases of reactive arthritis with post urogenital etiology , and 3:1 in proportion among the cases of reactive arthritis with post nasopharyngeal etiology .
situation is different in the cases of reactive arthritis with post enteral etiology where we noticed a slight domination of female sex .
the data obtained from the study were approximate with findings of many authors , such as : leiri salo m. et al .
( 6 ) , braun j. et al . ( 7 ) , and authors rapo m ( 8) , becks , kingsley g , van der heijde d , siepre j , etc .
many authors believe that reactive arthritis is much more frequent among males , particularly arthritis of urogenital etiology .
our findings are identical with the work of wiliams and calin with reactive arthritis caused by yersinia ( 9 ) .
there are also authors who concluded that this illness is manifested in equal proportion in both sexes ( oatas jk , pavlica lj , mitrovic d , paronen i. eastmond jc .
( 10 , 11 , 12 , 13 ) . as for the source of infection concerns , in our study
the most frequent were infections of urogenital with 66% of patients , followed by infections of nasopharyngeal cavity with 19% of patients , and the third were infections of enteral etiology with the total of 15% patients .
a , mycoplasma ( ureaplasma urealithicum ) , yersinia , entercoccus spp . , salmonella , shigella , campilobacter jejuni etc .
it is not worthy to mention that our paper is in line with most up to date findings , because the causative agents of reactive arthritis have significantly changed in recent times .
are becoming more prevalent in the isolated samples of patients ( mostly among youth ) . in our study ,
there are opposing opinions too : hill gaston js , lillicrap ms ( 2003 ) in his work arthritis associated with infection does not attribute any significant role to e. coli and staphylococcus aureus ( 15 ) . as for the staphylococcus ,
lately he has become the most frequent pathogenic agent isolated in the urethral sample , urine culture , hemoculture , etc .
prevalence of isolated staphylococcus aureus reaches 0.6% in denmark , 0.9% in netherland and sweden , 18.2% in germany , 36.9% in croatia , and 51.4% in greece ( 16 ) .
our findings and treatment of cases with staphylococcus corresponds with authors : james mc carty et al.and piercy et al ( 17 , 18 ) . as for the etiological agents such as
: chlamydia , yersinia , salmonella and campylobacter jejuni , our results are correlated with authors : glenas a. , melby k. et al .
were identified 15 cases of reactive arthritis with enteral etiology ( 8 of them are females ) which are identified with sharp results , while our preoccupation with scarce symptomatology among cases of infection caused by chlamydia we have encountered also with authors kousa m. , saiku p. et al . an important entity which causes reactive arthritis is also a post - streptococcic reactive arthritis .
b hemolytic streptococcus a has been isolated in 16 cases of post - streptococcic reactive arthritis .
our study , treatment and health management was in full correlation with studies of authors such as van der helm , van mil ah et al .
our findings correspond with those of authors kobayashi s. ishikava g. et al ( 21 ) , and izairi r. rexhepi s. et al .
coli , beta hemolytic streptococcus , staphylococcus , giardia lamblia , borellia burgdorferi , n. gonorrheae , interpheron , vaccine against hepatitis b , vaccine bcg in the cancer of urine bladder are considered as a possible causative agents of reactive arthritis .
classic causative agents such as : chlamydia , ureaplasma , yersinia , shigella , campylobacter jejuni , etc .
results from our study have indicated the following :
out of 100 patients diagnosed with reactive arthritis , 66 were males and 34 females.illness was more frequent among males in ratio 2:1 at urogenital infections . among the patients with nasopharyngeal infections this ratio was 3:1 in favor of males , whereas in patients with reactive arthritis with enteral etiology ratio was almost equal with only slight domination of females.in 66% of all cases source of infection was urogenital tract , in 19% gastrointestinal tract , and in 15% of cases source of infection was nasopharyngeal tract.as for the distribution of the source of infection among sexes , 45 males and 21 females had diagnosed urogenital infection , among 14 males and 5 females the source of infection was nasopharyngeal cavity , whereas the enteral tract was the source of infection for 7 males and 8 females.among causative bacterial agents are leading : e. coli with 21% patients , staphylococcus aureus with 20% , streptococcus b. hem gr .
a 16% , chlamydia with 12% , ureaplasma urealiticum with 9% , followed by yersinia with 6% , enterococcus spp . with 4% , streptococcus pn .
, campylobacter jejuni and shigella with 3% of patients , etc.if we observe the season of onset for causative bacterial agents , we notice that : reactive arthritis caused by bacteria from urinary tract is present throughout the year .
reactive arthritis caused by bacterial agents from enteral tract is more frequent during the summer season , whereas reactive arthritis caused by nasopharyngeal agents is more present during the winter season .
out of 100 patients diagnosed with reactive arthritis , 66 were males and 34 females .
illness was more frequent among males in ratio 2:1 at urogenital infections . among the patients with nasopharyngeal infections this ratio was 3:1 in favor of males , whereas in patients with reactive arthritis with enteral etiology ratio was almost equal with only slight domination of females . in 66% of all cases source of infection was urogenital tract , in 19% gastrointestinal tract , and in 15% of cases source of infection was nasopharyngeal tract .
as for the distribution of the source of infection among sexes , 45 males and 21 females had diagnosed urogenital infection , among 14 males and 5 females the source of infection was nasopharyngeal cavity , whereas the enteral tract was the source of infection for 7 males and 8 females . among causative bacterial agents are leading : e. coli with 21% patients , staphylococcus aureus with 20% , streptococcus b. hem gr .
a 16% , chlamydia with 12% , ureaplasma urealiticum with 9% , followed by yersinia with 6% , enterococcus spp . with 4% , streptococcus pn .
if we observe the season of onset for causative bacterial agents , we notice that : reactive arthritis caused by bacteria from urinary tract is present throughout the year .
reactive arthritis caused by bacterial agents from enteral tract is more frequent during the summer season , whereas reactive arthritis caused by nasopharyngeal agents is more present during the winter season . | introduction : reactive arthritis is an autoimmune condition which emerges as a counteraction towards an infection which has a focus elsewhere in the body . the purpose of this study is isolation of causative agents of reactive arthritis and ascertains the source of infection .
the study has been carried out in the rheumatology clinic in prishtina and specialized ambulance o.s . vendenisi - al in besiana , whereas isolation of causative agents has been carried out in the national institute for public health ( niph ) .
the study has prospective , comparative and analytical feature.results:out of 100 patients , 66% were males and 34% females . among males
we have noticed domination of post - urethritis and post - streptococcic reactive arthritis , whereas among females dominates reactive arthritis of enteral etiology .
the study concludes that : urogenital tract was the source of infection with 66% of cases , nasopharyngeal tract with 19% of cases , and enteral tract with 15% of cases respectively .
predominantly presents bacteria are e. coli with 21% , staphylococcus aureus with 20% , streptococcus b. hem .
gr .
a with 16% of cases respectively and other species.conclusion:frequency of arthritis with urogenital etiology was 2:1 in favor of males , with nasopharyngeal etiology 3:1 in favor of males , whereas in arthritis with enteral etiology we have noticed a slight dominance in favor of females . |
noncarious tooth surface loss is a normal physiological process occurring throughout the life , but it can often become a problem affecting function , esthetics or cause pain . this loss of tooth structure or wear is often commonly termed abrasion , attrition , erosion and abfraction .
tooth wear can be due to carious or noncarious reasons and can be physiological or pathological .
the various causes of pathological tooth wear are erosion , abrasion , attrition , and abfraction .
erosion and abrasion are the regressive alterations of the teeth that occur as a result of tissue injury .
they have apparently increased in the last few decades partly because of an increasing trend in the consumption of carbonated and citrus drinks and also because of the adult population retaining more natural teeth as they age .
erosion is defined as the local , chronic , pathologic and painless loss of tooth structure , through a chemical process of acidic dissolution without involving bacteria and acids of bacterial plaque origin . the term biocorrosion has been supplanted for erosion these days .
the etiology of erosion is multifactorial , that is , the causes can be extrinsic or intrinsic .
the extrinsic causes of dental erosion can be environmental , diet , medications and lifestyle .
the intrinsic causes of erosion are the gastric juice entering the mouth due to reflux disease , psychological problems ( bulimia nervosa and stress rumination ) , chronic alcoholism and pregnancy .
the most common cause is faulty brushing with inappropriate oral hygiene aids , occupational or habitual causes and ill - fitting clasps of partial dentures , which may also induce localized abrasive lesions .
it usually occurs on the exposed root surfaces and usually manifests as a v - shaped or wedge - shaped ditch , although it can also appear in other shapes like c - shaped defect , the undercut concave defect or as a divergent box .
abrasive lesions are usually generalized and most commonly seen on facial surfaces of canines and premolars .
restorations may be performed in erosion and abrasion lesions to restore tooth structure , function and esthetics , as well as to control the hypersensitivity .
these include the microfilled composites , resin modified glass ionomer cements ( rmgics ) and most recently , nanofilled composites .
supra - additive interaction was found between the erosive attack and abrasive attack on the substance loss for enamel , polyacid modified composite and glass ionomer cement .
the oral hygiene methods may produce abrasive lesions that can also affect the physical properties of restorative materials .
this knowledge would be important to dentists in planning , which kind of restorative materials to be used for restoration of teeth , which might frequently be exposed to erosion and/or abrasion .
the methods used for measurement of the superficial alterations in this study include surface microhardness and surface wear .
hence , the purpose of this study was to assess the effect of erosive and abrasive challenges on the surface microhardness and surface wear of enamel and three different restorative materials , that is , nanofilled composite , microfilled composite and rmgic by using vickers microhardness tester and profilometer respectively .
artificial saliva was prepared for the study . the composition per liter of the solution was : 14.4 mm nacl , 16.1 mm kcl , 0.3 mm mgcl2.6h2o , 2.9 mm k2hpo4 , 0.75 mm cacl2.2h2o , 0.10 g/100 ml sodium carboxymethylcellulose ( ph of solution = 7 ) .
sixty - four sound freshly extracted , noncarious human maxillary incisors teeth from the age group 18 to 40 years were taken .
the enamel surface was ground flat with different grits of sand papers [ figure 1 ] .
the specimens were mounted in acrylic blocks and were then divided into four groups based on the type of restorative material used to restore them [ figures 2 and 3 ] .
each group was further divided into subgroups depending on the treatment to which they were subjected [ figure 4 ] .
cavities of a standardized size ( 6 mm 4 mm 1.5 mm ) were prepared on the surface using mani dia - bur sf-12 . only group a was left intact . in group
( a ) armamentarium used in the study , ( b ) materials used in the study ( a ) enamel , ( b ) nanofilled composite , ( c ) microfilled composite , ( d ) resin modified glass ionomer cement grouping of 64 samples into four groups subgroup 1 : control subgroup , subgroup 2 : erosion subgroup , subgroup 3 : abrasion subgroup , subgroup 4 : erosion and abrasion subgroup materials used in study in group c , the enamel specimens were restored with microfilled composite ( heliomolar ) . in group d , the enamel specimens were restored with rmgic .
the same specimens were then subjected to microhardness determination test under vickers microhardness tester : shimadzu , japan available at research and development centre for bicycle and sewing machine , ludhiana , punjab [ figure 5 ] .
the microhardness tester produced the indents at a load of 100 g for 15 s. the average surface roughness ( ra ) was determined on the same specimens by using profilometer : mitutoyo surftest-4 available at research and development centre for bicycle and sewing machine , ludhiana , punjab .
it was determined by a contact stylus having tip diameter of 5 m . for wear references ,
two layers of nail varnish were applied on half of the surface of the enamel and restorative material after microhardness and roughness assessment [ figure 6 ] .
( a ) vickers microhardness tester : shimadzu , japan , ( b ) profilometer : mitutoyo surftest-4 ( a ) microhardness tester producing indent using a load of 100 g , ( b ) profilometer stylus moving on the surface for assessment of surface roughness ( ra ) later , all the groups were further divided into four subgroups : the subgroup 1 ( control subgroup ) specimens of each group were stored in artificial saliva throughout the experimental period of 7 days .
the subgroup 2 ( erosive subgroup ) specimens of each group were subjected to an erosive ph cycle .
it consisted of exposure to coca - cola for 5 min , thrice a day for 7 days .
for the rest of the duration , the teeth were stored in artificial saliva . in subgroup 3 ( abrasive subgroup ) , the specimens were subjected to the abrasive challenge with the oral - b powered toothbrush with a dentifrice ( colgate ) equal to the size of brush head for 2 min thrice a day for 7 days . for the rest of the duration , the teeth were stored in artificial saliva . in subgroup 4 ( erosive and abrasive subgroup ) , the specimens were subjected to an erosive ph cycle for the same duration , followed by a similar abrasive cycle as above .
after the surface treatment , nail varnish was carefully cleaned from the specimens with acetone - soaked cotton wool and a final microhardness was done .
the readings were tabulated and subjected to statistical analysis using anova test . mean and standard deviation were calculated for each group using anova test and tukey test .
the standard value considered to demonstrate statistically significant differences was set at p 0.05 .
results of analysis were tabulated [ table 2 ] and [ graphs 110 ] were plotted as enclosed .
the results of the study showed that the overall percentage surface microhardness change for groups was in the following order : multiple comparisons dependent variable : percentage change hardness tukey hsd average surface microhardness at baseline for four groups ( vhn ) mean average surface microhardness of all subgroups at baseline ( vhn ) mean of average surface microhardness ( vhn ) posttreatment ( groups ) mean of average surface microhardness ( vhn ) posttreatment ( subgroups ) percentage surface microhardness change for groups ( vhn ) percentage surface microhardness change for 16 subgroups ( vhn ) percentage surface microhardness change for four subgroups ( vhn ) wear for 16 subgroups ( m ) wear for four subgroups ( m ) group a ( enamel group : 10.65% 9.45012 ) > group d ( rmgic group : 8.05% 7.60738 ) > group c ( microfilled group : 6.62% 5.95222 ) > group b ( nanofilled group : 4.41% 5.61701 ) . the results of the surface wear were as : group a ( enamel group : 2.07 m 1.37912 ) > group d ( rmgic group : 1.42 m 1.01301 ) > group c ( microfilled group : 0.96 m 0.60346 ) > group b ( nanofilled group : 0.79 m 0.58986 ) . in microhardness changes and wear , the values of all groups were statistically significant when compared to the other three groups ( p < 0.05 ) .
it poses the next most significant threat to the function and longevity of human dentition after trauma , caries and periodontal disease .
it appears that the consumption of citrus fruits and soft drinks may be a major factor in the etiology of the disease .
the most important aspect in development of tooth wear is the frequency of consumption followed by method of consumption .
hence , soft drinks consumed at meal times are less injurious than those consumed alone and continuous sipping is considered more harmful to dentition than consuming an entire beverage at once .
it has been reported that cola beverages are retained on dental enamel and are less likely to be removed by saliva as compared to other beverages , which increases its cariogenicity .
oral products and toothpastes are used to prevent or to decrease the progression of erosion .
but in reality it has been seen that erosion can act in synergy with abrasive factors , including toothpaste .
the abrasion resistance of softened dental hard tissues is lower than that of sound surfaces .
the present study aimed to study the effects of erosive and abrasive challenges on the percentage microhardness change and surface wear of enamel , nanofilled composite , microfilled composite and rmgic .
standardized rectangular specimens of teeth were prepared in accordance with the study of francisconi et al . in our study
although the esthetic restorative materials that are light cured against a matrix strip are not devoid of imperfections , they present the smoothest surface that is possible to achieve . coca - cola was used for the abrasive challenge in the study because it is the most common soft drink consumed among youngsters .
the erosive cycle of 3 times a day for 1-week was carried out to simulate daily intake of the drink in accordance with the study of francisconi et al . in previous studies , substrates usually contacted acidic solution for a prolonged period of time or did not account for the role of saliva
the current study used artificial saliva and was designed to overlap the above - mentioned limitation of in vitro studies and simulate the clinical situation maximally in accordance with other studies .
the artificial saliva provides protection in between erosive and abrasive attacks . in order to standardize abrasion ,
the specimens were brushed extraorally with an electric toothbrush using a common toothpaste used in the region ( colgate ) . in this study , each respective specimen was brushed for 2 min 3 times a day making a total of 6 min brushing per day for 1-week .
enamel and three restorative materials were used for the study which were divided into groups a , b , c and d. group a was enamel group .
the nanofilled composites have increased strength , owing to a higher filler content , improved filler technology , modifications in the organic matrix and better polymerization .
the main characteristics of these composites are the high polish that can be maintained over time and excellent enamel - like translucency .
therefore , they are indicated for the restoration of anterior teeth and cervical abfraction lesions .
they should not be used in heavy stress - bearing areas because they frequently exhibit marginal chipping and bulk fracture .
very small particles contained in microfilled resins result in an even wear pattern and thus retention of a smoother surface . their physical properties are inferior to those of hybrid composites because of their lower filler content ; but their compressive strength is relatively high .
rmgic 's are widely used because of various favorable properties which include their coefficient of thermal expansion being close to that of dentin , low volumetric contraction during the setting reaction , chemical adherence to the dental structure , biocompatibility with the pulp tissue , fluoride release , aesthetics , anti - cariogenic action and antimicrobial activity .
surface hardness loss and wear develops in response to abrasion and acid erosion of restoration surfaces .
if present in a significant amount , they significantly compromise their longevity and limit their indications . to assess the surface microhardness and wear of the above groups , we have used vickers microhardness tester and profilometer respectively .
vickers microhardness test involves the use of a static diamond tip under a specific load , over a tested material and over a specific period of time , which forms a pyramid - square shaped microscopic indent after removal of the load . to assure an optimized clinical performance of restorations , it is of paramount importance to employ materials with hardness at least similar to that of the dentinal substrate , not only superficially , but also in depth , since an accentuated decrease in hardness would adversely affect their mechanical properties and marginal integrity . the surface wear was measured in this study by profilometry , which measures the bulk tissue loss occurring after erosive impacts and is the most illustrative method when the clinical appearance of tooth wear defects is considered .
this method is appropriate for the evaluation of enamel and restorative materials since the subsurface changes in mineral content are relatively small .
clinically , surface roughness must be observed , as it plays a decisive role in the retention and accumulation of dental biofilm .
it is defined as the arithmetic average value of all absolute distances of the roughness profile from center line within the measuring length .
wear was determined as the difference between the average roughness values at baseline level ( pretreatment ) and after treatment ( posttreatment ) .
the negative values in the wear results indicate increased roughness or wear after treatment . the results for group a are explained as the flattening and polishing of specimens in this study which possibly rendered enamel surfaces more susceptible to acid and toothbrush than would be the case under normal clinical conditions .
yu et al . ( 2009 ) the resistance of enamel to acid and toothbrush was less than the three restorative materials .
the results for group d are explained as resulting from the matrix dissolution peripheral to glass particles of rmgic , which could result from dissolution of the siliceous hydrogel layer .
the facts that rmgic exhibited significantly greater surface changes and wear than the nanofilled and composite resin may be due to the higher acid resistance of polymer matrices in resin based materials ( yu et al .
the wear rates of resin modified glass ionomers are high . the results for groups c and b
are explained as the acid also attacks the resin , but to a lesser extent , resulting in a possible degradation of the surrounding resin matrix or silane coupling agent and loss of filler particles of composite resin ( yu et al .
2009 ) . for group c , the higher percentage microhardness change and wear may be attributable to the lower filler content in microfilled composites . in group b ,
significant improvement in surface smoothness / polish retention has been reported for nanofilled composites compared with conventional microfilled composites . in group
a ( enamel group ) , subgroup 2 produced the maximum percentage change microhardness among all groups , followed by subgroups 4 , 3 and 1 respectively .
the highest results for subgroup 2 in microhardness changes are due to flattening and polishing of specimens in this study , which possibly rendered enamel surfaces more susceptible to acid dissolution than would be the case under normal clinical conditions .
erosion may have resulted from some direct loss of the superficial enamel layer , and in addition , may have softened the underlying layer , thus resulting in such results .
this was followed by subgroup 4 , which can be explained as the eroded and softened enamel was extraordinarily susceptible to toothbrushing performed immediately after an erosive challenge , resulting in exposure of a harder enamel surface .
the highest results for wear were seen in subgroup 4 due to supra - additive interaction between the erosive attack and abrasive attack on the substance loss for enamel ( yu et al .
2009 ) . in subgroup 2 acid exposure alone lead to enamel wear , but the wear was less than that when combined with toothbrush .
this finding is supported by eisenburger and addy who proposed that enamel wear increased with acid exposure . in subgroup 3 ,
the enamel samples showed high hardness and wear resistance compared to erosion or combined erosion and abrasion .
, there was slight increase in surface microhardness due to partial rehardening of the enamel specimens immersed in saliva and a slight gain in surface profile leading to decreased wear . in group
b , subgroup 4 produced the maximum percentage change microhardness and wear among all groups followed by subgroups 2 , 3 and 1 respectively .
for subgroup 4 , supra - additive interaction was found between erosion and abrasion on microhardness change and wear . in subgroup 2 , the application of nanotechnology and high filler loading makes the nanofilled composites extremely resistant to acid attack ( saunders 2009 ) .
previous studies have reported that acidic challenge had detrimental effects on wear of composite resins . in subgroup 3 ,
water sorption of the samples was seen which resulted in a small gain of surface profile as suggested by okada et al .
this may be attributable to the higher filler content . in group c ( microfilled group ) ,
subgroup 4 produced the maximum percentage change microhardness and wear among all groups followed by subgroups 2 , 3 and 1 respectively .
the microhardness change in group c was higher than group b due to the lower filler content , hence resulting in decreased mechanical properties .
( saunders 2009 ) subgroup 4 supra - additive interaction was found between the erosive attack and abrasive attack on the microhardness change and substance loss for composites as explained above ( yu et al .
the composites with larger fillers presented higher weight loss and roughening than the finer materials .
in group d ( rmgic ) , subgroup 4 produced the maximum percentage change microhardness and wear among all groups followed by subgroups 2 , 3 and 1 respectively .
mckinney et al . ( 1987 ) suggested that the wear pattern is more uniform in glass ionomer cements than the conventional resin - based composites , where filler pluck - out predominates . in subgroup 1 ,
hence , in all groups the maximum wear was produced in case of combined erosion and abrasion followed by erosion , abrasion and control group respectively .
it can be concluded that toothbrush abrasion has a synergistic effect with erosion on substance loss of human enamel , nanofilled composite , microfilled composite and rmgic .
it also should be emphasized that the surface demineralization of enamel caused by acidic substances may also be repaired by the influence of saliva .
therefore , patients have been advised to avoid toothbrushing for at least 1 h after having soft drinks in order to minimize tooth substance loss by toothbrush abrasion .
addition of low concentrations of calcium , phosphate and fluoride may exert a significant protective potential with respect to dental erosion .
the potential drawbacks of this approach include a detrimental effect on taste and a potential reduction in the shelf life of the product .
other preventive strategies include the salivary stimulation by chewing gum after an erosive or erosive / abrasive attack .
rinsing with an iron solution after an erosive attack , followed or not by an abrasive episode , may be a viable alternative to reduce the loss of dental structure .
high - concentration sodium fluoride applications ( 5000 ppm and 19,000 ppm ) have been shown to improve the abrasion resistance of eroded enamel and dentine in vitro and in situ . in vivo , the salivary pellicle provides a physical barrier that confers a degree of protection against an erosive challenge , however the pellicle is susceptible to desorption under acidic conditions .
according to ganss et al . , sound enamel is relatively resistant to physical impacts , whereas significant tissue loss can occur after exposure to acids .
similar to sound enamel , the main effect on tissue loss appears to be due to the action of abrasives rather than to the impact of the toothbrush itself , at least in early stages .
this result highlights the need to control factors that contribute to enamel loss by diet modification and by performing restorations , or to resort to full - coverage restorations under extreme situations .
importantly , it must be noted that , at least in the case of human enamel , the results of the present study must be interpreted with caution because the erosion and abrasion process might be influenced by the presence of pellicle in the oral cavity .
hence , further research to better understand the exact mechanism of the progression of tooth wear and how materials respond to such erosive and abrasive challenges in the complex oral environment is needed .
tooth wear is a well - recognized problem that has apparently increased in the last few decades .
various restorative materials may be used in erosion and abrasion lesions in our study were nanofilled composites , microfilled composites and rmgics . since the longevity of these restorations depends on its properties , such as surface microhardness and
wear resistance , the aim of our study was to assess the effect of erosive and abrasive challenges on the above - mentioned properties of enamel and restorative materials .
standardized cavities were prepared on enamel specimens and were either left intact ( for enamel group ) or restored with restorative materials .
they were then subjected to erosion , abrasion , combined erosion and abrasion or immersed in artificial saliva .
the microhardness and wear of the samples were assessed using vickers microhardness tester and profilometer respectively . within the limitations of the present study
, it can be concluded that :
toothbrush abrasion has a synergistic effect with erosion on substance loss of human enamel , composites and rmgicthe susceptibility to acid and/or toothbrush abrasion of human enamel was higher compared to restorative materialsnanofilled composite resin has the best resistance to erosion and/or abrasion among all the materials tested , followed by microfilled composite and rmgic respectively .
toothbrush abrasion has a synergistic effect with erosion on substance loss of human enamel , composites and rmgic the susceptibility to acid and/or toothbrush abrasion of human enamel was higher compared to restorative materials nanofilled composite resin has the best resistance to erosion and/or abrasion among all the materials tested , followed by microfilled composite and rmgic respectively . | introduction : noncarious tooth surface loss is a normal physiological process occurring throughout the life , but it can often become a problem affecting function , esthetics or cause pain.aim:the purpose of this study was to assess the effect of erosive and abrasive challenges on the surface microhardness and surface wear of enamel and three different restorative materials , that is , nanofilled composite , microfilled composite and resin - modified glass ionomer cement ( rmgic ) by using vickers microhardness tester and profilometer respectively.subjects and methods : nanofilled composite ( filtek z350 t ) , microfilled composite ( heliomolar ) and rmgic ( fuji ii lc ) were used in the study.results:nanofilled composite resin has the best resistance to erosion and/or abrasion among all the materials tested , followed by microfilled composite and rmgic respectively.conclusion:toothbrush abrasion has a synergistic effect with erosion on substance loss of human enamel , composites , and rmgic . the susceptibility to acid and/or toothbrush abrasion of human enamel was higher compared to restorative materials . |
prepare shell - less fertilized chicken embryos as described . on day 9 of embryonic development , assemble a micro - injector using an 18-gauge needle connected onto 1 ml syringe . cut a 5 - 6 inches piece of tygon tubing ( 1/32 " inner diameter , 3/32 " outer diameter,1/32 " wall thickness ) and carefully insert bevel of needle into the tubing . approximately 4 - 5 inches of tubing should extend from the tip of the needle ( figure 1a ) .
then , insert a microinjection glass needle at the end of the tubing and carefully remove any air bubbles .
inject day 9 embryos ( figure 1b ) under a dissection scope with an illuminator with 10,000 - 100,000 cancer cells as a bolus within the cam ( figure 1c ) .
slowly inject cells and carefully ensure that the needle is in the correct place for the cells to form a visible bolus within the cam .
cells that drip onto the cam surface can be cleaned using kimwipe or other applicator .
return embryos to humidified incubator at 38c at 60% humidity and allow tumor to grow and vascularize ( up to 7 days ) . to prepare fluorescently labeled cpmv nanoparticles for injection into the chicken embryo ; dilute the viral nanoparticles ( synthesized as in in pbs , ph 7.4 , to a concentration of 100 g / ml . vortex mixture well before using and centrifuge for one minute to remove any aggregates .
stocks of fluorescently labeled cpmvs are stable for at least 1 year when stored at 4c in the dark .
check stocks periodically by putting a couple drops onto a glass slide and checking for fluorescence .
transmission electron microscopy ( tem ) can also be used to determine if the particles remained intact after conjugation .
briefly , one microgram of viral nanoparticles ( in a final volume of 2 l ) can be added to copper coated grids .
next , add an equal volume of 2% uranyl acetate for 1 minute at electron microscope ( philips em 410 ) . on day 16 , assemble micro - injector as described above . draw up desired volume of viral nanoparticle through the tubing into the syringe ( > 200 l ) .
ensure that the needle is as long and tapered as possible ( figure 2a ) .
if the needle is too blunt , it will not be able to pierce through the ectoderm and will fail to penetrate the vessel .
intravenously inject 100 l of 1 mg / ml fluorescein dextran ( mw 70,000 da , invitrogen ) into tumor bearing embryo distal from the desired site to be visualized ( figure 3d )
. successful cannulation of cam vein is evident by the clearing of blood in the path of the injection flow ( figure 2b ) .
intravenously inject 50 l of 1 mg / ml solution of cpmv - alexa fluor 647 ( cpmv - af 647 ) or pegylated cpmv - alexa fluor 647 ( cpmv - peg - af 647 ) into embryos containing tumors with vascular leak distal from the desired site to be visualized .
image tumors immediately and every hour after injection using a zeiss examiner z1 upright microscope fitted with a yokogawa spinning disk , hamamatsu imagem 9100 - 12 em - ccd camera . to assemble the embryo imaging unit ,
apply a thin layer of vacuum grease around the circumference of the imaging port on the underside of the lid of the embryo imaging unit , and fit an 18 mm glass coverslip onto the port .
slowly lower the lid until the coverslip just makes contact with the embryo , and then screw the lid onto the unit to hold it in place ( figure 2c ) . add water heated to 37c into the embryo imaging unit outside of the dish containing the embryo , and then place the entire unit onto the stage of an upright confocal microscope with the inside environmental chamber equilibrated to 37c .
position the imaging unit containing the embryo under the spinning disk confocal fluorescence microscope ( figure 2e ) .
the imaging unit will hold the embryo in place and keep the field of view fixed while capturing images , allowing for both three - dimensional z stacks and time - lapse images to be captured .
we acquire and analyze three - dimensional time - lapse images using perkin elmer s ( formerly improvision ) volocity software package ( figure 3a ) .
acquire a high - resolution three - dimensional stack of the tumor and surrounding vasculature to visualize detailed structural analyses at specific time - points .
acquire three - dimensional stacks at regular time - points to map detailed structural changes in the tumor vasculature .
quantitate the uptake of viral nanoparticles by calculating the mean alexa fluor ( af ) 647 signal within selected regions in the tumor or in the stroma ( non - tumor area ) using image quantitation software such as volocity ( perkin elmer ) .
the tumor to stroma ratio was calculated by dividing the mean af 647 signal in the tumor over the mean af 647 signal in the stroma .
a tumor / stroma ratio higher than 1 indicates that the nanoparticle is being taken up by the tumor . in the example described here
, we injected ht-29 colon cancer cells to form a bolus approximately 1 mm in size within the cam of day 9 chicken embryos ( figure 1b ) .
after inoculation , the embryos were cultured for 7 days in a humidified incubator to permit sufficient tumor growth and vascularization ( figure 1c ) .
embryos were injected intravenously with a low molecular weight dextran to confirm tumor vascularization , and the tumors were visualized under the zeiss axioexaminer z1 upright microscope ( figure 2d ) .
after intravenous administration of cpmv - af 647 or cpmv - peg - af 647 nanoparticles ( figure 3a and b ) , high - resolution real time confocal imaging ( figure 2e ) revealed that both cpmv and cpmv - peg nanoparticles rapidly labeled the entire vasculature , but the uptake of cpmv - peg by the tumor was approximately 3 times higher than cpmv after 12 hours ( figure 3a ) .
the relative tumor uptake of nanoparticles was determined using image analysis software ( volocity from perkin elmer ) .
regions of interest were selected within and outside the tumor ( in the stromal compartment ) and the mean fluorescence intensity of each was determined .
( b ) avian embryos at day 9 are ready to be inoculated with tumor when the cam has spread to cover the entire surface .
( c ) at day 16 , the tumor will have grown to up to 1 cm in diameter ( dashed line ) and is ready for injection with nanoparticles .
injection under a dissection microscope showing ( a ) the tip of the microinjector needle ready to be injected into the cam vein and ( b ) the microinjector needle inserted into the vein ( indicated by arrow ) and nanoparticles injected into the blood flow ( seen by clearing of blood ) .
( c ) imaging unit containing avian embryo with the coverslip interfaced directly with the cam .
( d ) prior to nanoparticle injection , tumor vascularization is assessed using intravital imaging after injection of fluorescein dextran .
( e ) imaging unit containing the embryo positioned on the stage of an upright confocal microscope within a temperature - regulated enclosure set to 37c .
tumors are visualized 7 hours after injection of ( a ) cpmv - af647 and ( b ) cpmv - peg - af647 .
prepare shell - less fertilized chicken embryos as described . on day 9 of embryonic development , assemble a micro - injector using an 18-gauge needle connected onto 1 ml syringe . cut a 5 - 6 inches piece of tygon tubing ( 1/32 " inner diameter , 3/32 " outer diameter,1/32 " wall thickness ) and carefully insert bevel of needle into the tubing . approximately 4 - 5 inches of tubing should extend from the tip of the needle ( figure 1a ) .
then , insert a microinjection glass needle at the end of the tubing and carefully remove any air bubbles .
inject day 9 embryos ( figure 1b ) under a dissection scope with an illuminator with 10,000 - 100,000 cancer cells as a bolus within the cam ( figure 1c ) .
slowly inject cells and carefully ensure that the needle is in the correct place for the cells to form a visible bolus within the cam .
cells that drip onto the cam surface can be cleaned using kimwipe or other applicator .
return embryos to humidified incubator at 38c at 60% humidity and allow tumor to grow and vascularize ( up to 7 days ) .
to prepare fluorescently labeled cpmv nanoparticles for injection into the chicken embryo ; dilute the viral nanoparticles ( synthesized as in in pbs , ph 7.4 , to a concentration of 100 g / ml . vortex mixture well before using and centrifuge for one minute to remove any aggregates .
stocks of fluorescently labeled cpmvs are stable for at least 1 year when stored at 4c in the dark . check stocks periodically by putting a couple drops onto a glass slide and checking for fluorescence .
transmission electron microscopy ( tem ) can also be used to determine if the particles remained intact after conjugation .
briefly , one microgram of viral nanoparticles ( in a final volume of 2 l ) can be added to copper coated grids .
next , add an equal volume of 2% uranyl acetate for 1 minute at electron microscope ( philips em 410 ) .
on day 16 , assemble micro - injector as described above . draw up desired volume of viral nanoparticle through the tubing into the syringe ( > 200 l ) . carefully remove any air bubbles . insert microinjection glass needle at the end of the tubing .
ensure that the needle is as long and tapered as possible ( figure 2a ) .
if the needle is too blunt , it will not be able to pierce through the ectoderm and will fail to penetrate the vessel .
intravenously inject 100 l of 1 mg / ml fluorescein dextran ( mw 70,000 da , invitrogen ) into tumor bearing embryo distal from the desired site to be visualized ( figure 3d )
. successful cannulation of cam vein is evident by the clearing of blood in the path of the injection flow ( figure 2b ) .
intravenously inject 50 l of 1 mg / ml solution of cpmv - alexa fluor 647 ( cpmv - af 647 ) or pegylated cpmv - alexa fluor 647 ( cpmv - peg - af 647 ) into embryos containing tumors with vascular leak distal from the desired site to be visualized .
image tumors immediately and every hour after injection using a zeiss examiner z1 upright microscope fitted with a yokogawa spinning disk , hamamatsu imagem 9100 - 12 em - ccd camera .
to assemble the embryo imaging unit , apply a thin layer of vacuum grease around the circumference of the imaging port on the underside of the lid of the embryo imaging unit , and fit an 18 mm glass coverslip onto the port .
slowly lower the lid until the coverslip just makes contact with the embryo , and then screw the lid onto the unit to hold it in place ( figure 2c ) . add water heated to 37c into the embryo imaging unit outside of the dish containing the embryo , and then place the entire unit onto the stage of an upright confocal microscope with the inside environmental chamber equilibrated to 37c .
position the imaging unit containing the embryo under the spinning disk confocal fluorescence microscope ( figure 2e ) .
the imaging unit will hold the embryo in place and keep the field of view fixed while capturing images , allowing for both three - dimensional z stacks and time - lapse images to be captured .
we acquire and analyze three - dimensional time - lapse images using perkin elmer s ( formerly improvision ) volocity software package ( figure 3a ) .
acquire a high - resolution three - dimensional stack of the tumor and surrounding vasculature to visualize detailed structural analyses at specific time - points .
acquire three - dimensional stacks at regular time - points to map detailed structural changes in the tumor vasculature .
quantitate the uptake of viral nanoparticles by calculating the mean alexa fluor ( af ) 647 signal within selected regions in the tumor or in the stroma ( non - tumor area ) using image quantitation software such as volocity ( perkin elmer ) .
the tumor to stroma ratio was calculated by dividing the mean af 647 signal in the tumor over the mean af 647 signal in the stroma .
a tumor / stroma ratio higher than 1 indicates that the nanoparticle is being taken up by the tumor .
in the example described here , we injected ht-29 colon cancer cells to form a bolus approximately 1 mm in size within the cam of day 9 chicken embryos ( figure 1b ) .
after inoculation , the embryos were cultured for 7 days in a humidified incubator to permit sufficient tumor growth and vascularization ( figure 1c ) .
embryos were injected intravenously with a low molecular weight dextran to confirm tumor vascularization , and the tumors were visualized under the zeiss axioexaminer z1 upright microscope ( figure 2d ) . after intravenous administration of cpmv - af 647 or cpmv - peg - af 647 nanoparticles ( figure 3a and b ) , high - resolution real time confocal imaging ( figure 2e ) revealed that both cpmv and cpmv - peg nanoparticles rapidly labeled the entire vasculature , but the uptake of cpmv - peg by the tumor was approximately 3 times higher than cpmv after 12 hours ( figure 3a ) .
the relative tumor uptake of nanoparticles was determined using image analysis software ( volocity from perkin elmer ) .
regions of interest were selected within and outside the tumor ( in the stromal compartment ) and the mean fluorescence intensity of each was determined .
( b ) avian embryos at day 9 are ready to be inoculated with tumor when the cam has spread to cover the entire surface .
( c ) at day 16 , the tumor will have grown to up to 1 cm in diameter ( dashed line ) and is ready for injection with nanoparticles .
injection under a dissection microscope showing ( a ) the tip of the microinjector needle ready to be injected into the cam vein and ( b ) the microinjector needle inserted into the vein ( indicated by arrow ) and nanoparticles injected into the blood flow ( seen by clearing of blood ) .
( c ) imaging unit containing avian embryo with the coverslip interfaced directly with the cam .
( d ) prior to nanoparticle injection , tumor vascularization is assessed using intravital imaging after injection of fluorescein dextran .
( e ) imaging unit containing the embryo positioned on the stage of an upright confocal microscope within a temperature - regulated enclosure set to 37c .
tumors are visualized 7 hours after injection of ( a ) cpmv - af647 and ( b ) cpmv - peg - af647 .
the chorioallantoic membrane ( cam ) of the avian embryo is a useful model to assess the vascular dynamics and pharmacokinetics of human tumors .
the structure and position of the cam allows high quality image acquisition and accommodates of many kinds of cancer xenografts without invasive surgical procedures .
moreover , cancer tumor xenografts implanted into the chorioallantoic membrane become vascularized within 7 days , offering a rapid , inexpensive and semi - high - throughput means to assess the accumulation of nanoparticles in tumor tissue . since cancer xenografts implanted in the cam of shell - less chicken embryos are accessible to the high - resolution optics of an upright epifluorescence or confocal microscope , contextual and temporal information regarding nanoparticle uptake in the tumor vasculature can be readily obtained .
cancer xenografts in this model tend to grow laterally across the cam , resulting in tumors that are large while remaining less than 200 m in depth .
this makes them particularly well - suited for intravital imaging because standard epifluorescence microscopes can effectively penetrate the entire tumor mass .
in contrast , tumors implanted in either superficial or orthotopic sites within the mouse proliferate in three dimensions , making it difficult to accurately localize nanoparticles deep within these tumors by non - invasive techniques .
we have utilized this model to assess the uptake of quantum dots , liposomes , and iron oxide nanoparticles in a number of human tumor xenografts , highlighting the potential for this model to be suitable for the in vivo analysis of a broad range of nanoparticle formulations .
| current technologies for tumor imaging , such as ultrasound , mri , pet and ct , are unable to yield high - resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3 , highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses . here , we use high - resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified , shell - less chicken embryo model .
the chicken embryo model is particularly well - suited for these in vivo analyses because it supports the growth of human tumors , is relatively inexpensive and does not require anesthetization or surgery 4,5 .
tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane ( cam ) 6 .
the resulting tumors are visualized by non - invasive real - time , high - resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems .
nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream , extravasate from leaky tumor vasculature , and accumulate at the tumor site .
we describe here the analysis of nanoparticles derived from cowpea mosaic virus ( cpmv ) decorated with near - infrared fluorescent dyes and/or polyethylene glycol polymers ( peg ) 7 , 8 , 9,10,11 . upon intravenous administration , these viral nanoparticles are rapidly internalized by endothelial cells , resulting in global labeling of the vasculature both outside and within the tumor7,12 .
pegylation of the viral nanoparticles increases their plasma half - life , extends their time in the circulation , and ultimately enhances their accumulation in tumors via the enhanced permeability and retention ( epr ) effect 7 , 10,11 .
the rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software .
this technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors . |
ache is expressed in cholinergic neurons , neuromuscular junctions , hematopoietic cells , including erythrocytes ( grisaru et al . , 1999 ) and megakaryocytes ( paulus et al . , 1981 ; tranumjensen and behnke , 1981 ) , as well tissues that are not innervated by cholinergic neurons ( small et al . , 1996 ) .
there is mounting evidence , however , that ache expression is induced during apoptosis in a variety of other cell types ( zhang et al . , 2002 ) .
human lung fibroblast ( hlf ) cells and rat kidney ( nrk ) cells do not normally express ache , but have been shown to express high levels of ache when undergoing apoptosis or when moving from an inactive to an active state ( zhang et al .
. in general , cells that normally express low levels of ache , such as pc-12 , showed increased levels of ache and ache activity whilst undergoing apoptosis ( yang et al .
( 2007 ) reported that increased ache activity was found in sulfur mustard ( sm)-treated a549 cell culture , as determined by ellman assay and western blotting .
interestingly , ache activity showed a strong correlation with the number of tunel - positive cells .
furthermore , ache activity may be a potential marker of apoptosis in a549 cells after sm injury ( steinritz et al . , 2007 )
. other diseases with a possible apoptotic role in disease pathogenesis such as alzheimer s disease and diabetes also show cholinesterase involvement .
allam et al . observed that butyrylcholinesterase and ache - related proteins were found to be common to both alzheimer s disease and diabetes ; these proteins may play an etiological role via their influence on insulin resistance and lipid metabolism ( allam et al . ,
( 2008 ) showed that in transfected primary brain cultures , an alternative n terminal extended transcript of ache ( n - ache - s ) induced cell death , morphological impairments and caspase-3 activation .
in addition in cortical tissues from ad patients , n - ache - s overexpression coincides with tau hyper - phosphorylation .
( 2009 ) showed increased expression levels of ache and caspase-3 in the brain and peripheral immune system of focal cerebral ischemic rats .
( 2006 ) utilized ache with bax , c - fos , and p53 genes as markers of apoptosis .
( 2005 ) have developed a novel assay that utilizes fluorochrome - tagged physostigmine ( ph - f ) in situ to detect active ache that has been induced during apoptosis .
cells that show an increase in ache activity during apoptosis are summarized in table 1 .
summarized cell lines in which ache expression or activity were increased by the apoptotic stimuli with various apoptotic inducers .
ache is not a universal activators of apoptosis as it has been well - established that cholinergic neurons and neuromuscular junctions that express ache do not initiate apoptosis under normal conditions without an apoptotic stimulus .
however , ache - positive cells , such as pc-12 ( yang et al . , 2002 ; jing et al . ,
2008 ) as well as neurons have been shown to respond more sensitively to apoptotic stimuli than ache - negative cells ( jin et al . , 2002 , 2004 ) .
to investigate this , a stable cell line that overexpressed ache was established from nrk cells .
overexpression of ache was shown to inhibit cell proliferation and promote apoptosis in these cells .
transgenic mice which overexpress catalytically active ache - s and have a higher levels of ache hydrolytic activity than control mice , show increased levels of cell labeling by both bromodeoxyuridine and caspase-3 ; which reflects increased neural apoptosis ( cohen et al . ,
2008 ) though these transgenic mice also showed increased neuronal survival through an as yet unidentified compensatory mechanism .
ache was also shown to suppress cell proliferation via catalytic hydrolysis of acetylcholine in human colorectal carcinoma ( hcc ) ( montenegro et al . , 2006 ) .
2002 ) showed that the downregulation of ache expression with antisense inhibited apoptosis , and they suggest that ache is potentially a marker and a regulator of apoptosis .
park et al . ( 2004 ) explored the role of ache in apoptosis by silencing the ache gene .
silencing of ache abolished the expression of ache and prevented caspase-9 activation , decreased cell viability , nuclear condensation , and poly(adenosine diphosphate - ribose ) polymerase cleavage .
animal models of degenerative diseases were found to be more easily established in ache mice than ache mice .
( 2010 ) showed that the intracerebroventricular injection of amyloid - beta ( 2535 ) failed to induce learning deficits in ache mice , but impaired learning in ache controls .
the peptide showed reduced toxicity in the forebrain structures of ache mice , as an increase in lipid peroxidation levels was measured in the hippocampus of ache but not ache mice .
they concluded that the increase in cholinergic tonus observed in ache mice did not result in increased memory functions but allowed a significant prevention of the deleterious effects of muscarinic blockade or amyloid toxicity .
ye et al . ( 2010 ) recently reported that ache is expressed during ischemia reperfusion ( i / r)-induced apoptosis in vivo .
their study demonstrated that ache may be a pro - apoptotic factor and that the inhibition of ache reduces the degree of renal i / r injury .
papers reporting the presence of ache in tumors have first been reported almost 40 years ago ( gearhart and mintz , 1974 ) .
the exact role of ache in oncogenesis or tumor progression is still unclear and beyond the scope of this review .
however a number of studies ( gearhart and mintz , 1974 ; takahashi et al .
, 1995 ; johnson and cotter , 1997 ) have shown an genetic alterations in the long arm of chromosome 7 the genetic locus of the ache gene , in several tumors .
furthermore , the agricultural use of ache inhibitors is known to induce several types of tumors ( dich et al . , 1997 ; cabello et al . , 2001
stephenson et al . ( 1996 ) investigated gene copy - number alterations at these genes in myelodysplastic syndrome ( mds ) and acute myeloid leukemia ( aml ) .
these data raise the intriguing possibility that the proaptotic role of ache could play a role in tumor suppressor .
cholinesterases are downregulated in hcc ( montenegro et al . , 2006 ) , squamous cell carcinoma , and retinoblastoma ( qavi and al - rajhi , 2009 ) .
( 2011 ) demonstrated that ache was significantly downregulated in the cancer tissues of 69.2% of hcc patients , and the low level of ache expression in hcc was correlated with tumor aggressiveness , the elevated risk of postoperative recurrence , and a low survival rate .
both the recombinant ache protein and the enhanced expression of ache significantly inhibited hcc cell growth in vitro and tumorigenicity in vivo .
the studies describe the function of ache as a tumor growth suppressor that acts in the regulation of cell proliferation , relevant signaling pathways , and the chemosensitivity of hcc cells .
ache is a promising independent prognostic predictor for hcc recurrence and the survival of hcc patients ( montenegro et al . , 2006 ) .
ache - r was shown to increases germ cell apoptosis ( mor et al . , 2008 ) .
zhang et al . ( 2002 ) have shown by cytochemical staining and immunohistochemistry that the presence of ache is not homogeneous in either the cytoplasm or in the nucleus . to establish whether this heterogeneity is due to the stage of apoptosis induction ,
the authors examined the time course of ache expression in the leukemic meg-01 cell line after treatment with transforming growth factor ( tgf)-. cytochemical staining showed ache initially appears in the cytosol and afterward in the nucleus .
ache - positive staining follows the nuclear morphological changes such as condensation and fragmentation . eventually , when the cell membrane ruptures , ache is released .
they also examined the expression of ache by transmission electron microscopy . at 2 h after tgf- treatment ,
ache was observed only in the cytosol but by 4 h had moved entirely to the nucleus .
therefore , during the induction of apoptosis , ache is first synthesized in the cytosol and then accumulates in the nucleus . in general ache is present in the nucleus at the mid- and late - stages of apoptosis ( yang et al .
2007 ) initially investigated the expression and subcellular localization of acetylcholinesterase ( ache ) in endothelial cells and showed the expression of a 70-kda ache in both the cytoplasmic and nuclear compartments .
the levels of this novel isoform are decreased in response to vascular endothelial growth factor via the proteasome pathway .
they found that ache was downregulated in human leukemic t cells compared with normal t cells , which suggested that the decreased expression of the 55-kda ache protein may contribute to an angiogenic response and be associated with tumorigenesis .
importantly , nuclear expression is not specific to endothelial cells , but is also present in non - neuronal and neuronal cells .
( 2011 ) showed that the 55-kda ache protein was induced during apoptosis and was negatively regulated by the akt pathway .
pc-12 express ache at basal levels in normal cells , but a 55-kda ache protein can be found during the progression of apoptosis .
this 55 kda ache protein was temporally expressed after the activation of caspases and was caspase - dependent .
the inhibition of protein synthesis with chx indicated that the 55-kda ache protein resulted from the cleavage of the 68-kda ache ( xie et al . , 2011 ) .
there are still questions regarding ache that need to be addressed , including its function when it enters the nucleus . furthermore , whether ache entry into the nucleus is an active or passive event , how is it transported and what is the signal that allows it to enter the nucleus are all questions which still need to be resolved .
park et al . ( 2004 ) showed that silencing of the ache gene inhibited the interaction between apaf-1 and cytochrome c. they concluded that ache plays an important role in apoptosome formation .
their data showed that an antisense ache oligonucleotide showed a similar effect by silencing the ache gene .
small interfering rna ( sirna ) against the cytochrome c gene blocked the interaction of ache with apaf-1 , whereas sirna targeting the apaf-1 gene did not block the interaction of ache with cytochrome c. these findings indicated that the interaction of ache with cytochrome c is required for the interaction between cytochrome c and protease - activating factor-1 .
park et al . ( 2008 ) also showed that the interactions of ache with caveolin-1 and , subsequently with cytochrome c , appear to be indispensable for the formation of apoptosomes .
to date , however , these findings have only been shown in one study and more evidence is required to confirm how ache participates in the formation of the apoptosome .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .
ache , acetylcholinesterase ; ache - e , erythrocytic acetylcholinesterase ; ache - s , synaptic acetylcholinesterase ; ache - r , readthrough acetylcholinesterase ; aml , acute myeloid leukemia ; buche , butyrylcholinesterase ; hcc , human colorectal carcinoma ; icv , intracerebroventricular ; ra , refractory anemia ; tgf- , transforming growth factor - beta ; tgf- , transforming growth factor - alpha ; tgs mice , transgenic mice overexpressing ache - s . | to date , more than 40 different types of cells from primary cultures or cell lines have shown ache expression during apoptosis and after the induction apoptosis by different stimuli .
it has been well - established that increased ache expression or activity is detected in apoptotic cells after apoptotic stimuli in vitro and in vivo , and ache could be therefore used as a marker of apoptosis .
ache is not an apoptosis initiator , but the cells in which ache is overexpressed undergo apoptosis more easily than controls .
interestingly , cells with downregulated levels of ache are not sensitive to apoptosis induction and ache deficiency can protect against apoptosis .
some tumor cells do not express ache , but when ache is introduced into a tumor cell , the cells cease to proliferate and undergo apoptosis more readily .
therefore , ache can be classified as a tumor suppressor gene .
ache plays a pivotal role in apoptosome formation , and silencing of the ache gene prevents caspase-9 activation , with consequent decreased cell viability , nuclear condensation , and poly ( adenosine diphosphate - ribose ) polymerase cleavage .
ache is translocated into the nucleus , which may be an important event during apoptosis .
several questions still need to be addressed , and further studies that address the non - classical function of ache in apoptosis are needed . |
the need for a safe and effective human immunodeficiency virus ( hiv ) vaccine has never been greater .
the acquired immune deficiency syndrome ( aids ) epidemic update released by unaids on december 2009 , documented that the overall number of people with hiv has stabilized , albeit at an unacceptably high level of about 33.4 million people living with hiv and 2.7 million individuals being newly infected with the virus in 2008 .
the global aids epidemics killed 2 million people in 2008 , and the number of children orphaned by aids may reach 25 millions by 2010 . about 85% of these new infections occur in developing countries where access to antiretrovirals is still an enormous challenge [ 1 , 2 ] .
there is strong evidence to support a role of cytotoxic t lymphocytes ( ctls ) in the containment of hiv replication [ 36 ] and several vaccine approaches have been pursued to elicit anti - hiv ctl responses .
one promising approach is to use mycobacterium bovis bacillus calmette - gurin ( bcg ) as a live recombinant bacterial vaccine vector .
bcg vaccine has been used to immunize more than two billion individuals against tuberculosis with a long record of effectiveness and safety for use in humans .
ctl induction against hiv-1 and simian immunodeficiency virus ( siv ) gag or env antigens has been described following the immunization of mice or nonhuman primates with recombinant bcg ( rbcg ) expressing these antigens [ 8 , 9 ] .
more recently , recombinant mycobacterium bovis bacillus calmette - gurin ( bcg ) expressing hiva immunogen has been generated and shown to be stable and to induce durable and high - quality hiv-1-specific cd4 + and cd8 + t - cell responses in balb / c mice .
furthermore , when the recombinant bcg vaccine was used in a priming - boosting regimen with heterologous components , the hiv-1-specific responses provided protection against surrogate virus challenge , and the recombinant bcg vaccine alone protected against aerosol challenge with m. tuberculosis .
three issues are critical for engineering a stable and immunogenic mycobacterial - based vaccine vector : ( i ) antigen localization , ( ii ) codon optimization , and ( iii ) in vivo plasmid dna stability and genetic rearrangements .
the antigen secretion and fusion of foreign antigens to mycobacterial surface lipoproteins will provide these antigens with access to the major histocompatibility complex ( mhc ) class i pathway and subsequently enhance the immunogenicity and to prevent foreign proteins from becoming toxic to bcg .
the use of mycobacterial optimal codons will enhance the transcriptional / translational activity of the foreign gene .
homologous recombination , which takes place between repeated dna sequences , is one of the most important mechanisms for bacterial genome rearrangements .
any repeated dna sequences on a chromosome can induce homologous recombination , but insertion sequences ( is ) are among the most abundant of these [ 1315 ] .
mycobacteria have been reported to contain several is . in mycobacterium tuberculosis , it has been suggested that is6110 is an important source of genome variation .
however , the role of such is elements has not been thoroughly explored in heterologous gene expression in mycobacteria [ 1618 ] .
the extent of this burden will determine the degree to which fitness of the recombinant bcg is compromised .
thus , the relative level of fitness of the recombinant and any derived mutants will determine the rate at which the inserted element ( structural instability ) or its expression ( functional instability ) is lost from the bacterial population .
husson et al . constructed a plasmid shuttle vector that allows insertion of foreign dna and stable integration in the mycobacterial genome by homologous recombination .
the structural instability of several recombinant plasmids expressing the cirscumsporozoite protein ( csp aa 18391 ) from plasmodium falciparum was described by haeseleer .
the analysis in m. smegmatis and bcg of numerous rearranged plasmids showed that the presence of a functional specific expression cassette was responsible for the plasmid instability and that the observed deletions seemed to come from recombination between homologous and nonhomologous sequences .
monitored the role of such genetic rearrangement events in the expression of cloned escherichia coli lacz gene in mycobacterium smegmatis host strain using integrative ( pmv361::lacz ) and episomal ( pmv261::lacz ) vectors .
the lacz gene present in both vectors was the mutable target within the vector and simple color detection assay in mycobacteria was used to screen the genetic rearrangements during replication in mycobacterium smegmatis .
they reported that a loss of lacz phenotype was due to the insertion of an is element in the lacz gene of the integrative vector ( frequency 1.7 10 ) , whereas in the case of the replicative vector , the loss of lacz phenotype was due to deletions of different sizes in the lacz gene and the hsp60 promoter region ( frequency 2 10 ) . in this study
we evaluated the expression of disrupted heterologous hiv-1gp120 gene , from shiv - hxbc2p 3.2 clone ( genbank accession number af041850 ) , by genetic rearrangements in mycobacterium bovis bcg host strain using a replicative vector ( pmv261 ) regulated by bcg hsp60 promoter ( strong promoter ) . to compare the hiv-1gp120 gene expression and plasmid dna stability in vivo , the replicative ( pjh222 ) and integrative ( pjh223 ) vectors carrying a wild - type lysine - complementing gene in the lysine auxotroph of bcg host strain
-antigen promoter ) to regulate hiv-1gp120 gene expression and bcg lysine auxotrophs complemented with a lysine gene do , in fact , prevent the disruption of gene expression caused by genetic rearrangements .
escherichia coli cultures were grown in luria - bertani ( lb ) broth ( sigma - aldrich , usa ) or on lb agar plates ( sigma - aldrich , usa ) at 37c .
lb was supplemented with kanamycin ( 40 g / ml ) ( sigma - aldrich , usa ) .
mycobacterial cultures were grown in middlebrook 7h9 broth ( becton - dickinson , usa ) or on middlebrook 7h10 agar medium ( becton - dickinson , usa ) supplemented with 10% albumin - dextrose - catalase ( adc ) ( becton - dickinson , usa ) and containing 0.05% tween 80 ( sigma - aldrich , usa ) and kanamycin ( 25 g / ml ) .
the l - lysine monohydrochloride was purchased from sigma - aldrich ( usa ) , dissolved in distilled water and used at a concentration of 40 g / ml .
tables 2 and 3 listed the parental e. coli / mycobacterial shuttle vectors used for cloning the hiv-1gp120 gene from shiv - hxbc2p 3.2 clone ( genbank accession number af041850 ) and the constructs
. plasmid dna vectors pmv261 ( 4,480 bp ) , pjh222 ( 6,423 bp ) , and pjh223 ( 6,313 bp ) were used as parental plasmids for all plasmid dna constructs obtained as described below .
the entire dna coding sequence of hiv1gp120 ( 1,578 bp ) antigen was synthesized by polymerase chain reaction ( pcr ) , using oligonucleotide primers specific for hiv-1 gp120 gene and cloned into the different e.coli/mycobacterial shuttle vectors .
plasmid dna pmv261 is a replicative vector ( multicopy , extrachromosomal ) that contains a dna cassette encoding kanamycin resistance ( tn903-derived aph gene ) , an e. coli origin of replication ( orie ) , a mycobacterial plasmid dna origin of replication ( orim ) , an expression cassette containing a mycobacterial promoter , a multiple cloning site , and a transcriptional terminator . for pmv261::hivgp120
, the hivgp120 gene was fused to the first six codons of the cytoplasmically expressed bcg hsp60 protein .
for immunodetection purposes , we fused downstream of the hiv-1 gp120 gene with the influenza virus hemagglutinin epitope ( ha ) coding sequence and six residues of histidine .
the primers were designed to incorporate bamhi ( forward 5-caaggatccgaaattgtgggtcacagtc-3 ) and hindiii ( reverse 5-cagaagcttctagtggtggtggtggt-3 ) sites at the 5 and 3 termini of the amplified dna fragment to be cloned into the pmv261 plasmid dna at 4,326 bp - bamhi/4,346 bp - hindiii .
plasmid dna pjh222 , a derivative of pmv261 , contains also the lysa complementing gene , under the regulatory control of bcg hsp60 promoter . for the pjh222::hiv-1 gp120 construct
, the hiv-1 gp120 gene was fused to the 5 region encoding the 19 kda lipoprotein signal sequence from mycobacterium tuberculosis , and the ha epitope and six residues of histidine were fused downstream .
the primers were designed to incorporate hindiii ( forward 5-cagaagcttgggcccgaaaaa-3 ) and psti ( reverse 5-caactgcagctagtggtggt-3 ) sites at the 5 and 3 termini of the amplified dna fragment to be cloned into the pjh222 plasmid dna ( 335 bp - hindiii/341 bp psti ) .
it contains a dna cassette encoding kanamycin resistance ( tn903-derived aph gene ) , an e. coli origin of replication ( orie ) , a dna segment carrying the attachment site ( attp ) and the integrase ( int ) gene from the mycobacteriophage l5 , the lysa complementing gene under the regulatory control of bcg hsp60 promoter , and an expression cassette containing a mycobacterial promoter , a multiple cloning site and a transcriptional terminator .
the pjh223::hiv-1 gp120 plasmid dna was constructed using the same method as for pjh222::hiv-1 gp120 .
the primers were designed to incorporate hindiii sites ( forward 5-cagaagcttgggcccgaaaaa-3 and reverse 5-caaaagcttctgcagctagtggtgg-3 ) at the 5 and 3 termini of the amplified dna fragment to be cloned into the pjh223 plasmid dna ( 2,134 bp - hindiii ) .
the correct cloning of the hiv-1gp120 gene into the plasmid dna and the deletion of the ~900 bp fragment were confirmed by dna sequencing , pcr and enzyme restriction analysis performed following standard protocols .
the bcg wild type host strain was transformed with pmv261::hiv-1 gp120 plasmid dna and lysine auxotroph of bcg was transformed with pjh222::hiv-1gp120 and pjh223::hiv1gp120 plasmid dna by electroporation .
bcg cultures were grown to an od of 0.9 ( 600 nm ) , pelleted at 3,000 rpm , washed twice by resuspension and centrifugation ( 3,000 rpm ) in 10% glycerol at 4c and finally resuspended in 1/20th of the original culture volume with cold 10% glycerol . then 100 l of the cold bcg suspension was mixed with plasmid dna ( 50500 ng ) in a prechilled 0.2 cm electroporation cuvette and transformed using the biorad gene pulser electroporator at 2.5 kv , 25 mf , and 1,000 . after electroporation 1 ml of 7h9 medium , supplemented with adc and containing 0.05% tween 80 , was added and incubated at 37c for 12 hours before plating on middlebrook agar 7h10 medium supplemented with 10% adc and containing 0.05% tween 80 and kanamycin ( 25 g / ml ) .
after transformation by electroporation , the rbcg colonies were used as templates for the pcr analysis .
different rbcg colonies were inoculated into 50 l of distilled water , vortexed and 1 l was used for the pcr analysis .
specific primers for cloning the hiv-1 gp120 gene into pmv261 , pjh222 and pjh223 vectors were used . the plasmid dna before bcg transformation ( pre - bcg ) was used as positive control for the pcr analysis . the qiaprep spin miniprep kit (
qiagen , hilden , germany ) was used for e. coli and mycobacteria plasmid dna purification .
different rbcg colonies that showed the dna fragment deletion by pcr analysis were inoculated in mycobacterial broth culture up to an od of 0.9 ( 600 nm ) .
the standard qiaprep spin miniprep protocol was used with a slight modification : after resuspension in buffer p1 , lysozyme was added at a concentration of 10 mg / ml and samples were incubated at 37c overnight .
for improving the purified plasmid yield , the mycobacterial plasmid dnas from selected rbcg colonies were transformed in e. coli jm109 using 5 l of the isolated plasmid dnas , and purified according to the manufacturer 's instructions for dna sequencing and enzyme restriction mapping . the plasmid dna before bcg transformation ( pre - bcg ) was used as positive control for the enzyme restriction analysis .
the nucleotide sequences were obtained using the bigdye terminator v3.1 cycle sequencing kit ( applied biosystems , usa ) and abi prism 3100 genetic analyzer .
bcg transformants were grown to mid - logarithmic phase in liquid 7h9 medium supplemented with 10% adc and containing 0.05% tween 80 and kanamycin ( 25 g / ml ) .
pellets were washed twice in phosphate buffered saline ( pbs ) plus 0.02% tween 80 and resuspended in 1 ml of extraction buffer ( 50 mm tris - hcl ph 7.5 , 5 mm edta , 0.6% sodium dodecyl sulfate ) , and added with 5 l of 100x protease inhibitor cocktail ( 1 mg / ml aprotinin , 1 mg / ml e-64 , 1 mg / ml leupeptin , 1 mg / ml pepstatin a , 50 mg / ml pefabloc sc , and 10 ml dimethyl sulfoxide ) .
cells were sonicated for 4 minutes on ice with a branson sonicator at output control seven and duty cycle of 50% .
extracts were centrifuged at 13,000 rpm for 10 minutes at 4c and supernatants were collected .
after electroblotting , nitrocellulose membranes were first probed with a 1 : 1000 dilution of mouse monoclonal antibody ha.11 ( covance , usa ) directed to influenza virus hemagglutinin epitope ( ypydvpdya ) followed by a 1 : 2000 dilution of horseradish peroxidase ( hrp)-conjugated antibodies .
the membranes were developed using chemoluminiscent ecl ( ge healthcare , usa ) as hrp substrate .
as shown in figure 1 , pcr analysis of rbcg : hiv-1gp120(pmv261 ) colonies detected a partial deletion of the hiv-1gp120 dna coding sequence using the specific primers that were used for cloning the dna sequence into the pmv261 vector .
this deletion was reproduced in 12 out of 14 rbcg : hiv-1 gp120 ( pmv261 ) colonies analyzed ( data not shown ) .
in addition , this partial deletion was observed only by pcr of plasmid dna from bcg colonies in which the hiv-1gp120 dna fragment was inserted into the pmv261 vector and the gene expression was regulated by the hsp60 promoter from bcg ( figure 1 , lane 2 ) .
the deletion was not detected when the dna fragment encoding the hiv-1gp120 antigen was cloned into pjh222 and pjh223 vectors under mycobacteria spp .
the deletion was not detected in all 10 rbcg : hiv-1gp120 ( pjh222 ) colonies screened by pcr ( data not shown ) .
we also compared the restriction enzyme digestion profile of the pmv261 and pjh222 plasmid dna vectors with and without heterologous hiv-1gp120 dna insert , pre- and post - bcg transformation ( figure 2 ) .
the pmv261 plasmid dna vector without the dna insert corresponding to hiv-1gp120 gene did not show any difference in the enzymatic restriction profiles from pre- and post - bcg transformations ( figure 2 , lanes 1 and 2 ) .
the same result was obtained for the pjh222 plasmid dna vector containing the dna insert ( figure 2 , lanes 5 and 6 ) .
in contrast , the pmv261 containing the hiv-1gp120 insert showed different enzymatic restriction profiles from pre- and post - bcg transformations ( figure 2 , lanes 3 and 4 ) . following sequence analysis and molecular characterization of the deleted dna fragment in the 10 rbcg : hiv-1gp120 ( pmv261 ) mutant colonies
, we demonstrated that the partial deletion ( ~900 bp ) corresponds to gp120 core rich in potential glycosylation sites and the variable regions v3 , v4 , and v5 of hiv-1 env , a key structure involved in the hiv union to its receptor ( cd4 ) and co - receptor on the host cell surface .
strikingly , the deleted dna fragment in the rbcg mutants contained the dna sequence coding for hiv-1 envelope immunodominant ctl , murine h-2d - restricted epitope p18-i10 ( figure 3 ) .
deletion in hiv-1gp120 gene was not observed in any rbcg : hiv-1gp120 ( pjh222 ) and rbcg : hiv1gp120 ( pjh223 ) colonies that carry the pjh222:hiv-1gp120 and pjh223:hiv1gp120 vectors containing the mycobacteria spp .
-antigen promoter to regulate the hiv1gp120 gene expression , indicating that the deletions were not due solely to the toxic effects of hiv-1gp120 expression during growth of the recombinant bcg strains .
expression of hiv-1gp120 protein by rbcg : hiv-1gp120 ( pmv261 and pjh222 ) strains was confirmed by sds - page and western blot analysis of whole - cell bcg lysates . the chimeric 19 kda lipoprotein signal sequence - hiv-1gp120-flu - his recombinant protein , with a relative molecular mass ( mr ) of 67 kilodalton ( kda ) was present in lysates of rbcg : hiv-1gp120 ( pjh222 ) bacterial cells containing the 1.82 kilobase - pair ( kbp ) hiv-1gp120 dna coding sequence in pjh222 vector .
the apparent mr of hiv-1gp120 protein was consistent with that predicted by the gene sequence without post - translation modification .
by contrast , when all rbcg : hiv-1gp120 ( pmv261 ) mutant colonies were analyzed by western blot , we detected a band of 28 kda ( truncated protein ) instead of the expected 67 kda protein ( figure 4 ) .
mycobacterium tuberculosis infection is a major cause of human morbidity and mortality , and vaccine is the most cost - effective intervention to prevent disease .
mycobacterium bovis bcg is a widely used vaccine against tuberculosis , and a single dose given at birth confers long - lasting immunity .
mycobacterium bovis bcg has been suggested as an ideal delivery system for expression of foreign antigens due to the long persistence of bcg in the immunized host .
thus , mycobacterium bovis bcg not only is used as vaccine against tuberculosis , but also offers great potential for innovative approaches for development of polyvalent vaccines [ 25 , 2830 ] . in vivo genetic stability and persistence
a mutant bcg which is rapidly eliminated by the host immune system is unlikely to be an effective vaccine .
the rearrangement of dna is one of the fundamental properties of life , including both prokaryotes and eukaryotes , with great biological significance .
some of these dna rearrangements are important in controlling gene expression in specific cell types ; others may play an evolutionary role by contributing to genetic diversity .
for example , plasmids responsible for expressing m. tuberculosis -antigen in bcg were stable over six consecutive 4-week cultures without selection and changes in the level of expression .
an -antigen - hiv-1 v3j1 chimeric protein was secreted by rbcg for at least 450 passages in vitro . however , in vitro instability of episomal vectors has also been reported regularly .
lim et al . described that expression of siv mac 251 env ( aminoacids , aa , 1 - 245 ) by rbcg was stable in culture ( pblaf promoter ) , but rbcg harboring the same vector containing aa 1 - 521 or aa 215 - 521 were unstable .
chawla and das gupta reported that the disruption of pal5000-derived vectors in m.smegmatis through transposition of an insertion sequence upstream of the kanamycin resistance gene led to structural instability and large deletions .
studied the stability of the expression of escherichia coli -galactosidase under the control of hsp60 promoter in mycobacterium smegmatis using integrative and replicative vectors . in the case of replicative vectors , they detected higher frequencies of lacz expression inactivation as compared with the same lacz cassette , when present in integrated state .
however , springer et al . reported a high - frequency loss of pmv361-based integrating vectors from m. smegmatis and bcg .
al - zarouni and dale investigated the effects of various combinations of posttranslational signals and promoters on heterologous gene expression and stability in different bcg strains .
plasmid dnas were constructed using mycobacterial promoters ( hsp60 , 19-kda antigen , 85a antigen , from mycobacterium tuberculosis complex , and the 18-kda antigen from mycobacterium leprae ) and post - translation signals ( 85a antigen secretion and 19-kda antigen acylation signals ) , coupled with reporter genes .
they provided evidence that the 85a secretion signal markedly enhanced the levels of cell - associated product , while the 19-kda acylation signal had little effect on gene expression .
this group also demonstrated that the hsp60 promoter caused plasmid dna instability and showed that various deletions in the promoter region occurred during or soon after transformation , but not during subsequent growth of the transformants , nor with other promoters .
gross instability was also observed when the episomal vectors were used to express rotavirus vp6 protein under the control of hsp60 promoter .
the possibility of inserting foreign genes into the chromosome at precise positions to ensure the persistence of the heterologous genetic information in the recombinant vaccine strains would represent a crucial step in the development of mycobacterium bovis bcg as a live vaccine vector for expression of heterologous antigens [ 28 , 39 ] .
even though integrative plasmid dnas have been shown to be more stable as they are incorporated into the chromosome via homologous recombination , baulard and colleagues demonstrated that with replicating plasmid dnas , relatively high levels of homologous recombination were obtained in fast- and slow - growing mycobacteria , and 100% of the selected clones underwent homologous recombination .
thus , if bcg is to be used as a live bacterial carrier for generating novel vaccine candidates and as an immunotherapeutic agent , it is essential that a more genetically stable strain be developed .
sander and collaborators demonstrated that mycobacterium bovis bcg reca mutants are a valuable tool for the further development of bcg as an antigen delivery system to express foreign antigens and as a source of a genetically stable vaccine against tuberculosis .
this was confirmed in a study performed by keller and coworkers where it was observed that reca inactivation in bcg russia strain was in part responsible for its high degree of genomic stability , resulting in a substrain that has fewer genetic alterations than other vaccine substrains with respect to m. bovis af2122/07 wild - type .
lack of success in this respect may be due to overexpression of lethality or other forms of protein toxicity .
stover et al . were unable to express hiv-1 gp120 ( hsp60 promoter ) from an episomal vector , but could express it from an integrative vector [ 19 , 25 ] . in our study , we have observed that , in the case of the replicative pmv261 vector , disruption of hiv-1gp120 gene expression was due to a consensus dna fragment deletion in the hiv1gp120 gene detected in all ten different bcg clones . by contrast , we did not detect any hiv-1gp120 gene expression disruption in the replicative ( pjh222 ) and integrative ( pjh223 ) vectors .
sequence analysis indicated that the dna fragment deletion contained several potential glycosylation sites , the variable regions v3 , v4 and v5 and a ctl immunodominant epitope ( p18-i10 peptide ) .
based on this observation , we hypothesized that the loss of expression of this immunodominant epitope could help mycobacteria to escape the host 's immunological response and may represent part of an ongoing adaptation to survival in host environments that are screened by immunological defense mechanisms .
huber and collaborators have described a natural loss of expression of highly immunogenic proteins caused by a variety of genomic changes in mycobacterium ulcerans that may confer a selective advantage to this emerging pathogen . on the other hand ,
the deleted dna sequence in the rbcg : hiv-1gp120(pmv261 ) mutant colonies analyzed in our study ( n = 10 ) was highly conserved , which is in disagreement with dennehy et al . that deletions in the vp6 heterologous gene ( hsp60 promoter ) in rbcg were random and different among clones examined .
-antigen promoter ) to regulate hiv-1gp120 gene expression and bcg lysine auxotrophs complemented with a lysine gene do , in fact , prevent the disruption of gene expression caused by genetic rearrangements .
the results showed that such genetic rearrangements can significantly affect the expression of foreign genes in mycobacteria .
thus , it could result in an rbcg that does not induce optimal immune responses to the hiv antigen .
mycobacterium bovis bacillus calmette - gurin ( bcg ) as a live vector of recombinant bacterial vaccine is a promising system to be used .
however , few promising approaches have emerged in the last five years to overcome the genetic instability in rbcg - based vaccines . to prevent the plasmid instability in vivo and in vitro and the genetic rearrangement by mycobacteria
, different approaches should be considered : ( i ) the use of expression vectors containing small hiv dna coding sequences , ( ii ) dna fragments lacking glycosilation sites , ( iii ) the use of weak promoters , ( iv ) the use of bcg auxotrophic strains ( containing the complementing gene in the expression vectors ) , ( v ) the use of inducible promoters , ( vi ) codon optimization of the recombinant gene , ( vii ) the choice of expression vector backbone and ( viii ) antigen secretion to enhance the immunogenicity and to prevent foreign proteins from becoming toxic to bcg . in five years ' time
we will have a better picture of how the immune responses induced by rbcg could be enhanced , and what sort of route , doses , immunization schedule , timing for immunological assays are likely to induce optimal responses in mice and monkeys .
heterologous prime - boost regimen , different immunization schedule , routes and doses , should be performed to evaluate the potential for enhancing specific immune responses .
bcg has a long record of safe use in humans and is able to induce long - lasting immunity .
in addition , it could be the best hope for protecting newborn infants , reducing the adult burden of hiv infection and protecting neonates against vertical transmission . | mycobacterium bovis bacillus calmette - gurin ( bcg ) as a live vector of recombinant bacterial vaccine is a promising system to be used . in this study
, we evaluate the disrupted expression of heterologous hiv-1gp120 gene in bcg pasteur host strain using replicative vectors pmv261 and pjh222 .
pjh222 carries a lysine complementing gene in bcg lysine auxotrophs .
the hiv-1 gp120 gene expression was regulated by bcg hsp60 promoter ( in plasmid pmv261 ) and mycobacteria spp .
-antigen promoter ( in plasmid pjh222 ) . among 14 rbcg :
hiv-1gp120 ( pmv261 ) colonies screened , 12 showed a partial deletion and two showed a complete deletion .
however , deletion was not observed in all 10 rbcg : hiv-1gp120 ( pjh222 ) colonies screened . in this study , we demonstrated that e. coli / mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of bcg could prevent genetic rearrangements and disruption of hiv 1gp120 gene expression , a key issue for engineering mycobacterial based vaccine vectors . |
during the last years , changes in diagnosis and treatment have caused a significant increase in the number of young adults who experienced cancer in childhood . with the current treatments protocols the 5-year event - free survival ( efs )
is over 80% [ 1 , 2 ] . according to one of the world 's largest studies ( childhood cancer survivors study ) based on 10,397 participants ,
there are 62.3% of survivors with at least one chronic condition and 27.5% with severe or life - threatening sequelae .
it has also been estimated that 70% of pediatric cancer survivors will develop at least one medical complication or disability within 30 years from the time of diagnosis [ 3 , 4 ] .
this enlarging population is affected by many health problems , including multiple hormone deficiencies and bone mineral deficits .
endocrine disorders are among the most frequently reported complications in pediatric cancer survivors , affecting up to 50% of patients [ 5 , 6 ] .
some , but not all , studies have shown that reduced bone mineral density ( bmd ) is an important consequence occurring after childhood cancer [ 712 ] . despite many available data in this field , the influence of endocrinological disorders on bone mineral density is still unclear .
nowadays , with the increasing life expectancy , it is necessary to identify patients at high risk for developing late effects of pediatric cancer and its treatment early .
furthermore , continuous follow - up of these individuals seems to be of utmost importance .
this is the first polish study assessing bone mineral density and endocrine status in young adult cancer survivors .
a total of 76 long - term survivors ( 43 men and 33 women ) treated for pediatric cancer at the department of pediatric oncology and hematology of the medical university of bialystok were identified . among those 29 ( 38% )
had leukemia , 27 ( 36% ) lymphoma and 20 ( 26% ) were diagnosed with solid tumors .
the mean age at the time of study was 24.1 3.5 ( range 1834 ) and the average time from the end of treatment was 11.9 5.2 years .
all patients were treated according to international protocols approved by the polish pediatric leukemia / lymphoma study group .
a bone marrow transplantation ( bmt ) procedure was performed in 6 patients treated previously for leukemia . written informed consent was obtained from all subjects and the study was approved by the ethics committee of the medical university of bialystok .
an overview of all medical records was performed to obtain data concerning age and type of diagnosis , and dxa results at the time of diagnosis , if available . during an interview
, each participant was asked questions to determine previous fractures , current diet , medical history and use of medications .
weight was measured on an electronic scale ( seca , germany ) and height was taken using a martin anthropometer .
abnormal height was defined as below the third percentile for a given gender at 18 years of age according to the polish reference data . in order to classify underweight , overweight and obesity we used the bmi international classification by who .
body mass index ( bmi ) was calculated as weight in kilograms divided by height in meters squared ( kg / m ) .
waist - hip ratio ( whr ) was assessed as a marker for visceral fat .
bone mineral density ( bmd ) was evaluated by dual - energy x - ray absorptiometry ( dxa ) ( dpx - l , ge - healthcare lunar , madison , wi ) , which provided z - scores for total body mineral density ( t bmd , g / cm ) and lumbar spine ( ls bmd g / cm ) .
results of the study subjects were compared to their age- and sex - matched controls in accordance with the manufacturer 's database . according to the official position of the international society for clinical densitometry we used the z - score instead of the world health organization classifications ( t - score ) .
consequently , low bone density was defined as a z - score 2 , and osteoporosis as a z - score 2 accompanied by clinically significant fracture history .
due to the fact that just a few patients met the criteria of low bmd and following the other authors [ 15 , 16 ] we decided to also use another cutoff point in order to show mild bmd deficits .
the rationale for this approach is that those with lower bone mineral density are presumably to remain in the low end of the normal range and reach a lower peak bone mass .
additional , any bone mineral deficits might predispose young adults to an increased risk of fracture in the future .
blood samples were acquired by venipuncture . an automatic system for chemiluminescence analysis ( immulite 1000 , siemens , washington , d.c . )
was used to assay serum luteinizing hormone ( lh ) , follicle - stimulating hormone ( fsh ) , estradiol , or testosterone levels and an elecsys analyzer ( system , roche , usa , indiana ) was used to measure serum thyroid - stimulating hormone ( tsh ) , triiodothyronine ( ft3 ) and thyroxine ( ft4 ) levels .
participants with high tsh and normal / low ft4 were diagnosed with subclinical or clinical hypothyroidism . those with a high lh and/or fsh or low lh and/or fsh level were considered to have suspected gonadal dysfunction .
all hormonal results were compared to the control group which consisted of 49 healthy young adults .
statistical analysis was performed with stata version 11.0 ( statacorp , college , texas ) .
data were expressed as means standard deviation ( sd ) , or median and quartiles when appropriate . in the univariate analysis ,
fisher 's exact test and test were used , whereas continuous variables were compared with the mann - whitney test or student t - test .
analysis of variance ( anova ) was used to assess the relationship between diagnosis and bone mineral density .
a total of 76 white young adults , 33 men ( 43% ) and 43 women ( 57% ) , were enrolled in the study .
the mean age at the follow - up visit was 24.1 years 3.5 ( range 1834 ) .
depending on diagnosis , patients were divided into three groups : leukemia , lymphoma and solid tumors .
no statistically significant difference was observed between groups for sex , age at dxa scans or time after treatment .
patient characteristics , n ( % ) or mean sd seventy - four out of 76 patients had reached the final height at the time of the study .
we found one female treated for hypothyroidism with an abnormal height ( 1.43 m ) and one man with normal hormonal status who presented a low height ( 1.63 m ) . at the follow - up visit 15 ( 19.7% ) patients were overweight ( bmi 25 ) , 7 ( 9.2% ) were obese ( bmi > 30 ) , whereas 50 ( 65.8% ) had a normal body mass index ( bmi ) .
no significant differences in height , weight , bmi and whr were found between groups according to the diagnosis .
we observed greater values of these parameters in men than in women ( p < 0.05 ) .
thyroid tests ( ft3 , ft4 and tsh ) were carried out in a total of 72 patients . during the follow - up visit
nine subjects ( 12.5% ) with high tsh and normal ft3 and ft4 levels ( 4 male and 5 female ) were diagnosed with subclinical hypothyroidism ( 4 patients were diagnosed with all , 3 with hodgkin lymphoma , 1 with wilms tumor and 1 with soft tissue sarcoma ; all of them were treated in accordance with relevant protocols approved by the polish pediatric leukemia / lymphoma study group at the time ) . among these patients ,
2 were treated with levothyroxine at the time of the study , whilst 7 did not receive any treatment .
another patient , who underwent strumectomy because of thyroid cancer , had an increased level of ft4 during treatment with levothyroxine .
there was no significant difference in the number of patients with thyroid hormone disorders between leukemia , lymphoma or solid tumor groups .
we found a higher level of tsh in the study group , in comparison with the control group ( 2.65 1.4
miu / l vs. 1.99 0.97 miu / l respectively , p = 0.015 ) .
these values were however within normal ranges and there was no statistical difference in the number of patients with subclinical hypothyroidism between study and control groups .
assessment of gonadal function ( fsh , lh , estrogen , testosterone ) was performed in a total of 74 patients .
two females were treated with hormone replacement therapy ( hrt ) . in the first case abdomen
radiotherapy was used because of wilms tumor , while the second patient was treated with total body irradiation during acute lymphoblastic leukemia therapy .
eleven participants ( 6 female ) had increased levels of both lh and fsh . among these patients 3 females had abnormal estrogen concentration ( 2 out 3 were treated with hrt ) .
one female with decreased gonadotropins ( lh , fsh ) and a normal estrogen level was reported .
we found a higher number of patients with a high fsh level in comparison with the control group ( 18/74 vs. 5/49 , respectively ; p = 0.049 ) .
table 2 shows total body and lumbar spine bone mineral density ( expressed in z - scores ) and the number of patients with low mineral density as well .
there were no significant differences in the mean t bmd z - scores ( fig . 1 ) and ls bmd z - scores ( fig .
2 ) between survivors of leukemia , lymphoma or solid tumors . a low bmd ( defined as a t bmd and/or ls bmd z - score 2 ) was observed in a total of 7 out of 76 patients ( 9% ) whereas mild bmd deficits ( defined as a t bmd and/or ls bmd z - score 1 ) were found in 19 participants ( 25% ) 8 women and 11 men .
nine of them were diagnosed with leukemia , 5 with lymphoma and 4 with solid tumors .
cranial radiation therapy ( 18 gy ) was used in 9 cases as part of comprehensive treatment of acute lymphoblastic leukemia ( all ) .
total body bone mineral density ( t bmd ) and lumbar spine bone mineral density ( ls bmd ) z - scores , n ( % ) or mean sd there were no statistically significant differences in hormonal abnormalities between patients with normal and abnormal bone mineral density ( p < 0.05 ) .
we also did not find any differences in the number of subjects with low bmd depending on whether they had endocrine disturbances or not .
in the whole study group , 3 participants with both high tsh and fsh / lh levels were found ( 1 of them had low bone mass ) . among patients who received bone marrow transplantation ( 6/76 ) ,
we did not find any significant relations between t bmd z - score and tsh ( r = 0.08 , p = 0.51 ) , ls bmd z - score and tsh ( r = 0.12 , p = 0.37 ) , t bmd z - score and ft3/ft4 ( r = 0.04 , r = 0.30 ; p = 0.76 , p = 0.34 respectively ) , ls bmd z - score and ft3/ft4 ( r = 0.10 , r = 0.14 ; p = 0.43 , p = 0.31 respectively ) , as well as between t bmd , ls bmd and lh / fsh level ( p > 0.05 ) . results on bone mineral density were analyzed for the whole group , and separately for males and females . among all patients , we identified 34 subjects who had a dxa scan at the time of diagnosis and we compared it with the dxa results at the time of our study .
we did not note any significant differences in densitometry outcomes ( z - scores for t bmd and ls bmd ) .
no patient was diagnosed with osteoporosis according to the international society for clinical densitometry . in accordance with the iscd recommendations a clinically significant fracture history is one or more of the following : long bone fracture of the lower extremities , vertebral compression fracture and two or more long - bone fractures of the upper extremities . in the study group ,
only 2 of them were clinically significant and all occurred at the time of treatment .
seventy - four out of 76 patients had reached the final height at the time of the study .
we found one female treated for hypothyroidism with an abnormal height ( 1.43 m ) and one man with normal hormonal status who presented a low height ( 1.63 m ) . at the follow - up visit 15 ( 19.7% ) patients were overweight ( bmi 25 ) , 7 ( 9.2% ) were obese ( bmi > 30 ) , whereas 50 ( 65.8% ) had a normal body mass index ( bmi ) .
no significant differences in height , weight , bmi and whr were found between groups according to the diagnosis .
we observed greater values of these parameters in men than in women ( p < 0.05 ) .
thyroid tests ( ft3 , ft4 and tsh ) were carried out in a total of 72 patients . during the follow - up visit 4 patients were on thyroid hormone replacement therapy .
nine subjects ( 12.5% ) with high tsh and normal ft3 and ft4 levels ( 4 male and 5 female ) were diagnosed with subclinical hypothyroidism ( 4 patients were diagnosed with all , 3 with hodgkin lymphoma , 1 with wilms tumor and 1 with soft tissue sarcoma ; all of them were treated in accordance with relevant protocols approved by the polish pediatric leukemia / lymphoma study group at the time ) . among these patients ,
2 were treated with levothyroxine at the time of the study , whilst 7 did not receive any treatment .
another patient , who underwent strumectomy because of thyroid cancer , had an increased level of ft4 during treatment with levothyroxine .
there was no significant difference in the number of patients with thyroid hormone disorders between leukemia , lymphoma or solid tumor groups .
we found a higher level of tsh in the study group , in comparison with the control group ( 2.65 1.4
miu / l vs. 1.99 0.97 miu / l respectively , p = 0.015 ) .
these values were however within normal ranges and there was no statistical difference in the number of patients with subclinical hypothyroidism between study and control groups .
assessment of gonadal function ( fsh , lh , estrogen , testosterone ) was performed in a total of 74 patients .
two females were treated with hormone replacement therapy ( hrt ) . in the first case abdomen
radiotherapy was used because of wilms tumor , while the second patient was treated with total body irradiation during acute lymphoblastic leukemia therapy .
eleven participants ( 6 female ) had increased levels of both lh and fsh . among these patients 3 females had abnormal estrogen concentration ( 2 out 3 were treated with hrt ) .
one female with decreased gonadotropins ( lh , fsh ) and a normal estrogen level was reported .
we found a higher number of patients with a high fsh level in comparison with the control group ( 18/74 vs. 5/49 , respectively ; p = 0.049 ) .
table 2 shows total body and lumbar spine bone mineral density ( expressed in z - scores ) and the number of patients with low mineral density as well .
there were no significant differences in the mean t bmd z - scores ( fig . 1 ) and ls bmd z - scores ( fig .
2 ) between survivors of leukemia , lymphoma or solid tumors . a low bmd ( defined as a t bmd and/or ls bmd z - score 2 ) was observed in a total of 7 out of 76 patients ( 9% ) whereas mild bmd deficits ( defined as a t bmd and/or ls bmd z - score 1 ) were found in 19 participants ( 25% ) 8 women and 11 men .
nine of them were diagnosed with leukemia , 5 with lymphoma and 4 with solid tumors .
cranial radiation therapy ( 18 gy ) was used in 9 cases as part of comprehensive treatment of acute lymphoblastic leukemia ( all ) .
total body bone mineral density ( t bmd ) and lumbar spine bone mineral density ( ls bmd ) z - scores , n ( % ) or mean sd there were no statistically significant differences in hormonal abnormalities between patients with normal and abnormal bone mineral density ( p < 0.05 ) .
we also did not find any differences in the number of subjects with low bmd depending on whether they had endocrine disturbances or not . in the whole study group ,
3 participants with both high tsh and fsh / lh levels were found ( 1 of them had low bone mass ) . among patients who received bone marrow transplantation ( 6/76 ) ,
we did not find any significant relations between t bmd z - score and tsh ( r = 0.08 , p = 0.51 ) , ls bmd z - score and tsh ( r = 0.12 , p = 0.37 ) , t bmd z - score and ft3/ft4 ( r = 0.04 , r = 0.30 ; p = 0.76 , p = 0.34 respectively ) , ls bmd z - score and ft3/ft4 ( r = 0.10 , r = 0.14 ; p = 0.43 , p = 0.31 respectively ) , as well as between t bmd , ls bmd and lh / fsh level ( p > 0.05 ) .
results on bone mineral density were analyzed for the whole group , and separately for males and females . among all patients , we identified 34 subjects who had a dxa scan at the time of diagnosis and we compared it with the dxa results at the time of our study .
we did not note any significant differences in densitometry outcomes ( z - scores for t bmd and ls bmd ) .
in accordance with the iscd recommendations a clinically significant fracture history is one or more of the following : long bone fracture of the lower extremities , vertebral compression fracture and two or more long - bone fractures of the upper extremities . in the study group ,
only 2 of them were clinically significant and all occurred at the time of treatment .
endocrinological disturbances , reduced bone mineral density and high risk of fractures are considered as results of childhood cancer and treatment management .
the major factors increasing the risk of these late complications are mainly associated with the disease itself and its treatment ( glucocorticoids , multi - agent chemotherapy and the amount as well as location of radiotherapy ) [ 9 , 19 ] .
the aim of this study was to assess bmd and endocrine status in young adult cancer survivors .
the reason for this was the fact that a long time has elapsed since the diagnosis and therefore the authors did not have full access to all medical reports .
all patients were treated according to various protocols accepted by the polish pediatric group for leukemia and lymphoma treatment . to our knowledge , this is the first polish study to describe hormone complications and bone status in young adult cancer survivors . both height and weight are closely related to endocrine status .
radiotherapy is one of the most known factors which increase the likelihood of height deficits even when the cranial dose is 12 gy [ 21 , 22 ] .
moreover , approximately 70% of patients who did not receive cranial radiation during therapy show catch - up growth several years after completion of treatment . in our study 2
patients had height below the normal range [ 1 of them received cranial radiation as part of acute lymphoblastic leukemia ( all ) treatment ] .
survivors of childhood cancer are particularly vulnerable to abnormal weight gain . among our patients 22 ( 28.95% )
despite the fact that we did not find any differences between groups of adults with different previous pediatric cancer diagnosis , our study showed a high percentage of patients with abnormal bmi .
this is in accordance with the latest world 's largest study in this field [ 24 , 25 ] .
however , when we compared it to the polish who pol - monica - bis study we did not notice any significant differences .
primary hypothyroidism , hyperthyroidism and thyroid cancer have been reported to occur at a higher rate in survivors compared with the general population .
hypothyroidism is common among children who have been treated with chest or mantle radiotherapy for hodgkin 's disease , craniospinal radiation for central nervous system tumors , and total body irradiation before stem cell transplantation .
one of the world 's largest studies ( ccss ) based on 13,674 participants with hodgkin 's lymphoma showed increased risk of hypothyroidism with an increased dose of radiation 4500 cgy ( rr 10.7 ; 95% ci : 4.730.6 ) , time since diagnosis < 5 years ( rr 2.1 ; 95% ci : 1.72.6 ) , age at diagnosis > 15 years ( rr 1.5 ; 95% ci : 1.21.9 ) and female sex ( rr 1.7 ; 95% ci : 1.42.1 ) . relative risk for hypothyroidism was 16.1 times higher in comparison to siblings in the control group .
higher risks for nodules and hyperthyroidism have been reported as well [ 21 , 23 ] . in our study
we found 9 young adults ( 12.5% ) with subclinical hypothyroidism , whereas in the general population it reaches 10% and occurs mainly in older age .
interestingly , in 7 patients hypothyroidism was first diagnosed during this study , which shows the importance for thyroid function screening in survivors . despite the fact that we did not notice any differences in the number of patients with thyroid abnormalities between the study and control group , a higher level of tsh in the study group was found .
gonadal damage might be caused by alkylating agents which have a particularly detrimental impact on testicular / ovarian function .
all of the listed drugs were used during anticancer treatment of patients from the study group .
it has been established that radiation therapy ( directly to the gonads or to the brain ) has caused gonadal damage .
younger females are more resistant to treatment - induced failure than older female patients , because of increased numbers of follicles .
tromp et al . conducted research in young adults of childhood cancer male survivors and established that one - third of participants of the study have an elevated fsh level ( study based on 488 subjects ) .
they also found that all men whose partners conceived by assisted reproductive technology had a high fsh level and all men with a normal range of fsh achieved conception naturally . in our study
we found a higher incidence of abnormal fsh level compared with the control group , which might indicate problems with infertility .
several studies have shown that childhood cancer survivors are a risk group for bone mineral deficits including low bone mass and skeletal complications .
the available data in this field appear to be mostly conflicting , generally due to a lack of prospective studies and insufficient data [ 79 , 12 , 15 , 3035 ] . in our research 7
( 9% ) patients with low bone mass and 19 ( 25% ) patients with mild bmd deficits were identified .
the number of patients with hormonal dysfunction in our group was limited so we could not carry out a proper statistical analysis between studied groups of adults . due to the lack of full information ,
however , we noticed the importance of fragility fractures in adult survivors life ; therefore , the risk of fractures should be determined in this group of patients . every patient diagnosed with hormonal abnormalities
our data show that young adult cancer survivors might experience various hormonal problems including low bone mass , thyroid impairment and gonadal dysfunction .
some of the patients required treatment , yet they were not diagnosed before this study . furthermore , it seems that subclinical development of endocrine diseases might increase the number of complications in later life .
there is a lack of proper clinical assessment among adult childhood cancer survivors in poland .
therefore , we demonstrated the need for a comprehensive plan for longitudinal follow - up for late effects in this population .
| introductionduring the last years , changes in the diagnosis and treatment have caused a significant increase of the number of young adults who experienced cancer in childhood .
this enlarging population is affected by many health problems , including multiple hormone deficiencies and bone mineral deficits .
this is the first polish study assessing bone mineral density and endocrine status in young adult cancer survivors.material and methodsa total of 76 long - term survivors treated for pediatric cancer were identified .
the mean age at the time of study was 24.1 3.5 years .
bone mineral density and tsh , ft3 , ft4 , fsh , lh , estradiol and testosterone level were assessed for each patient.resultsnine subjects were diagnosed with subclinical hypothyroidism .
we found higher level of tsh in the study group , in comparison with control group ( p = 0.015 ) .
eighteen patients had increased level of fsh . in the study group higher number of patients with high fsh level was found in comparison with the control group ( p = 0.049 ) . a low bmd was observed in 7 patients whereas mild bmd deficits were found in 19 participants.conclusionsin conclusion , our data show that young adult cancer survivors might experienced various hormonal problems including low bone mass , thyroid impairment and gonadal dysfunction .
some of the patients required treatment , but they were not diagnosed before this study .
there is the lack of proper clinical assessment among adult childhood cancer survivors in poland .
therefore , we demonstrated the need for a comprehensive plan for longitudinal follow - up for late effects in these population . |
cutaneous aging is a natural inevitable process leading to a considerable desire for many patients to achieve a more youthful look .
many treatment modalities exist , both medical and nonmedical , to improve an individual s physical appearance as well as their perception of their appearance , consequently influencing psychological well - being.1 cutaneous aging results from a combination of intrinsic biological factors and extrinsic environmental factors2 leading to a variety of clinical manifestations , including fine lines and rhytides , dyspigmentation , telangiectasia , elastosis , and textural irregularities.3 histologically , aged skin presents with epidermal thickening , diminished collagen synthesis leading to dermal atrophy and loss of dermal papillae , as well as a fragmented and disorganized elastin network.38 extrinsic factors are many and include tobacco use , sleeping positions , repetitive facial expressions , and ultraviolet radiation from the sun.1,3 current nonsurgical therapies are centered on ablative methods of skin rejuvenation .
these include chemical peels , dermabrasion , and laser resurfacing.913 ablative methods remove the epidermis and induce a controlled form of wounding , thus promoting collagen synthesis and dermal extracellular matrix remodeling.1315 these procedures may require complex postoperative care , can be quite painful , and can also lead to significant complications.9,16,17 the development of nonablative techniques stems from patients desire to decrease discomfort and downtime and clinicians desire to offer simpler , effective alternatives with fewer side effects.13,1821 nonablative skin rejuvenation can be classified into two types : type i photorejuvenation targets primarily telangiectasia and irregular pigmentation , whereas type ii photorejuvenation aims for wrinkle and fine line reduction and skin tightening.13,22 light - emitting diode ( led ) photorejuvenation is a novel noninvasive procedure that is nonthermal , atraumatic , and induces collagen synthesis through biophotomodulatory pathways.9 subtypes of led photomodulation include , but are not limited to , the photodynamic and the biophotonic platforms .
the biophotonic platform is distinct from the photodynamic one in that both use a combination of led light and a chromophore - rich gel ; however , in the biophotonic platform , chromophores act topically to enhance the effects of the led light and are neither absorbed nor metabolized .
many clinical trials have shown the efficacy of led therapy in skin rejuvenation.9,20,2329 they include increased collagen deposition and decreased collagen degradation by upregulation of fibroblast activity.9,19 preliminary studies with the klox-001 formulation demonstrate in vitro antibacterial efficacy and a stimulatory effect on human dermal fibroblasts .
additionally , klox-001 gel formulation and klox led light biophotonic combination has been shown to decrease necrosis in the rat flap model , as well as increase collagen fibrin deposition.30 the klox-001 topical gel formulation comprises principally of an oxidant , chromophores , and a hydrophilic gel carrier .
the klox led light delivers symmetrical peak wavelengths in the visible range ( 400470 nm ) with a peak at 446 nm .
it produces a power density of 150 mw / cm at a distance of 5 cm from the light source , which meets the us food and drug administration and the american national standard institute z135 regulations on optical exposure to skin . as the blue light illuminates the chromophores ,
this study was designed to assess the efficacy , tolerability , and safety of klox-001 gel formulation with klox led light on skin rejuvenation in women .
the primary endpoint was subjective clinical assessment of klox-001 gel formulation and klox led light , alone or in combination , on skin rejuvenation of the face after four weekly treatments .
secondary endpoints included the effects of treatment with klox-001 gel formulation and klox led light on the severity of glabellar lines , marionette lines and perioral wrinkling , nasolabial wrinkle severity , forehead wrinkling , periocular wrinkling and crow s feet , cheek wrinkling , overall photo - damage , subjective patient satisfaction with treatment , pain , and erythema , histologic changes , as well as patient safety and tolerability .
a single - center , randomized , single - blinded , placebo - controlled , split - control - faced clinical trial was designed .
ethics approval was obtained from the canadian shield ethics review board , which reviewed the study protocol and found it to be acceptable .
written consent was also obtained from the patients by klox technologies for the use of the photos in this paper .
all eligible patients ( table 1 ) who agreed to participate in the study and signed an informed consent form were randomized in a 1:1:1:1 ratio into one of the following four groups : group a received treatment for half the face with klox-001 gel formulation and white led ( placebo ) light and the contralateral side was treated with a placebo ( base gel no chromophores ) formulation and light ; group b received treatment for half the face with a placebo / base gel formulation and klox led light and the contralateral side was treated as group a ; group c received treatment for half the face with klox-001 gel formulation and klox led light and the contralateral side was treated as the other controls ; and group d received treatment for half the face with the standard skin rejuvenating treatment ( 0.1% retinol - based cream ) and the control side received a basic moisturizer .
after initial randomization , patients were randomly allocated in a 1:1 ratio to treatment of either right or left side .
prior to treatment , all patients received a single microdermabrasion treatment of the full face at a maximum of 48 hours from the beginning of the trial .
skin biopsies were taken from the retroauricular region at weeks 0 and 12 for a direct comparison of the effects of the treatment while minimizing confounding factors . during the active treatment period
groups a and c were treated with a 2 mm thick layer of klox-001 gel formulation on the experimental side and a nonchromophore placebo / base gel formulation on the control side .
groups b and c were treated with klox led light by the light source at a distance of 5 cm from the skin surface ( power density of 150 mw / cm ) for a duration of 5 minutes per facial subunit to ensure complete facial coverage on the experimental side and with sham placebo light ( white led ) on the control side .
group d received a standard skin rejuvenating treatment ( 0.1% retinol - based cream ) on the experimental side and a basic moisturizer on the control side . during treatment , all patients were blinded with external eyelid protectors to shield the retina from direct illumination .
patients were asked to complete a short questionnaire for assessing their degree of satisfaction following each visit .
the primary endpoint of the study was the change in the clinical index from baseline ( week 0 ) to week 12 following treatment , as determined by an independent , blinded committee of three physicians using a subjective 5-point scale from 0 to 4 ( 0 = worse ; 1 = little or no improvement [ 0%25% ] ; 2 = some improvement [ 26%50% ] ; 3 = good improvement [ 51%75% ] ; and 4 = excellent improvement [ 76%100% ] ) .
in addition , the committee of physicians assessed : 1 ) severity of glabellar lines using the 4-point score for glabellar frown lines;31 2 ) perioral and periorbital wrinkling using fitzpatrick s 9-point wrinkle scoring system32 ( perioral wrinkling was also assessed using the validated grading scale for marionette lines33 and the validated lip fullness grading scale);34 3 ) nasolabial wrinkling using the modified fitzpatrick wrinkle scale;35 4 ) forehead wrinkling using the 5-point photonumeric forehead lines grading scale;36 5 ) periocular wrinkling using the 5-point photonumeric crow s feet grading scale;37 6 ) cheek wrinkling using lemperle s 6-point wrinkle assessment scale , day s wrinkle severity rating scale , and fitzpatrick s wrinkle scoring system;32,38,39 7 ) overall photo - damage using glogau s classification of patient photoaging types and fitzpatrick s wrinkle scoring system;32,40 and 8) patient s subjective satisfaction with treatment , as measured by the 5-point patient assessment index .
the committee consisted of board - certified physicians who were trained in scoring using standardized patient photographs .
they were not blinded to time elapsed from treatment , but were blinded to treatment type and side .
sample size was calculated on the basis of detecting a 20% difference in primary outcome measure with a power of 80% .
the secondary outcome measure was the change in the total wrinkle score ( tws ) from baseline to 4 , 8 , and 12 weeks .
the tws was calculated as the sum of patient s self - assessment of the horizontal , marionette , glabellar , and crow s feet wrinkle severity classified as 1 = none , 2 = mild , 3 = moderate , and 5 = severe .
the tws had a minimum value of 4 and maximum value of 20 , with higher values indicating higher severity .
tolerability of treatment was assessed using the 4-point pain assessment scale ( 1 = no pain ; 2 = some pain ; 3 = very painful , but bearable ; and 4 = unbearable pain ) .
descriptive statistics ( including mean , standard deviation , median , range , and 95% confidence intervals ) were produced for continuous scale variables and frequency distributions for categorical scale variables .
the chi - square statistic was used to assess the between - group differences with respect to the primary outcome measure . for the secondary outcome measures ,
the statistical analysis involved the use of multivariate general linear models , adjusting for patient s age and baseline values of the tws .
the general linear models were used to produce estimates of placebo - adjusted least - square mean estimates for the change in tws at each visit .
this was done by estimating the placebo - adjusted estimate of the tws at each visit for each patient using a predictive linear regression model to offset the tws of each klox - treated patient by the estimated standard of care ( soc ) value .
when compared to group - based adjustments , this method allows for less - biased placebo adjustment since each patient s tws was offset by the estimated value that the individual patient would have achieved if she was treated by soc .
least significant difference test was used to estimate the pair - wise statistical significance while adjusting for multiplicity due to the six different pair - wise comparisons for each outcome every week .
a skin biopsy behind one ear was performed at weeks 0 and 12 on all subjects and stained with hematoxylin , phloxine , and eosin , gomori trichrome , and luna s methods according to standard protocols
. a thorough histopathological examination of the sections at weeks 0 and 12 was performed by an experienced pathologist blinded to the treatment assignment .
treatment - emergent adverse events ( aes ) were summarized within each treatment group and presented according to the severity and the relationship to study treatment ( probably related , possibly related , not related ) .
thirty - two patients satisfied the inclusion / exclusion criteria . only two ( 6.2% )
subjects discontinued the study prior to completion ; they were only lost to follow - up at week 12 ( table 2 ) .
analysis of subjective physician assessment demonstrated that the group treated with klox led light + klox-001 gel formulation had superior performance when compared to the other treatment groups , with statistically significant results seen for changes in brow positioning ( p=0.001 ) and perioral wrinkling ( p=0.018 ) ( table 3 , figures 14 ) .
analysis of tws least - square mean adjusted predicted value changes demonstrated that while the klox led light with base klox-001 gel group was superior in the majority of the comparisons , the klox led light + klox-001 gel group was also superior to soc and klox-001 gel alone .
this is seen across all treatment weeks ( figure 5 ) with statistically significant p - values for regression slopes when subjected to student s t - test against the null hypothesis ( figure 6 ) .
while interpreting tws results , higher values correlate to a less - favorable esthetic result , as they constitute a sum of four different scales . due to the small sample size
the average score and % of change from baseline with the gomori trichrome for each group was calculated , as it was the only parameter that did stand out clearly indicating an increase in the collagen from baseline to week 12 that was particularly notable ( 400% increase ) in the group treated with the combination of klox-001 gel formulation and klox led light ( table 4 , figure 7 ) .
the most commonly reported treatment - related aes were brow edema ( 13% ) , erythema ( 19% ) , and eyelid edema ( 9% ) ( table 5 ) .
all the aes reported were transient and mild in intensity , without any subject being discontinued from the study due to ae .
the number of subjects reporting aes was small and no clear differences were noted between the groups .
the effects are thought to occur primarily through photomodulation of fibroblast , collagen deposition , as well as metalloprotease pathways .
this study evaluated a biophotonic model of skin rejuvenation through a randomized and placebo - controlled clinical trial .
clinical outcome measures were assessed through compilation of various wrinkle severity and facial esthetic grading scales .
the use of multiple scales with various weight values on the subjective assessment of skin appearance in a small sample number of patients led to challenges in data analysis . the decision to consolidate multiple outcome measures into a tws for data analysis
was made in order to compensate for discrepancies and variability in clinical scoring , as well as to allow ease of analysis and interpretation of results .
analysis of both subjective physician assessment and tws least - square mean adjusted predicted value changes demonstrated that the groups treated with klox led light with klox placebo / base gel and klox led light + klox-001 gel formulation had superior performance when compared to the other treatment groups , with statistically significant results obtained for subjective brow position and tws .
the patients receiving soc treatment showed significant deterioration in patient assessment and perception during the course of the study .
this necessitated placebo and predicted value adjustments to be made for analysis , as a positive therapeutic effect would have constituted less deterioration relative to the standard group .
the use of a large number of scales with variable weight values on the subjective assessment of skin appearance is an important problem that confounds the study results and may prevent the demonstration of benefits of the combined treatment with klox gel and klox led light .
although the klox led light + klox-001 gel formulation group demonstrated superior performance in the subjective clinical assessment wing of the study , tws analysis favored the klox led light with klox placebo / base gel group .
this may be due to the analysis of tws as an amalgamation of various differently weighted scales , as well as the small patient population
. a larger study may be able to further elucidate the actual discrepancies between the treatments ; nevertheless , both the klox led light with klox placebo / base gel and klox led light + klox-001 gel formulation groups fared better than the other two groups .
the rate of collagen deposition was increased in a substantial fashion with klox-001 gel formulation + the klox led light compared to other treatment groups .
klox-001 gel formulation and klox led light , used alone or in combination , were found to be safe and well tolerated .
all aes reported in each treatment group were mild in intensity , without any subject being discontinued from the study due to ae .
brow edema , which did occur in 13% of patients , did not affect the patients overall appearance , was considered mild , and may , in fact , have contributed to the improved skin appearance in the region .
histopathological results did not demonstrate any safety concern with the use of klox topical formulation and klox led light , when used alone or in combination .
finally , an extensive list of factors was evaluated by a blinded committee , and direct physician evaluation , using standardized and validated questionnaires as well as tissue biopsies and direct patient feedback demonstrating several outcomes repeatedly being reported following treatment .
several patients commented on a subjective tightening of their skin , improvement in pore size , skin texture , and overall appearance ( figure 8) . the use of specific klox chromophores has been demonstrated to specifically up- or downregulate cellular mechanisms that impact the normal healing cascade .
the use of blue light itself has been shown to affect signaling mechanisms ( eg , fibroblast growth factor ) , while natural cutaneous chromophores may have a bigger impact than what was previously understood , when combined with light that supports an appropriate wavelength or energy transfer .
the true role of a chromophore - based rejuvenation strategy is in the combination of up- and downregulating signals leading to a favorable rejuvenation outcome .
although increased collagen deposition is of principal and paramount importance in any rejuvenation regimen , it does not account for all aspects of the results demonstrated in the present study .
future directions will require the following : an evaluation of the moisture / hydration effect of the technology using capacitance tools , photometric evaluation of skin sebum production , measurement of skin ph , and measurement of skin s viscoelastic properties following treatment with the current biophotonic platform .
the study results demonstrate that klox led light with placebo / base gel and klox-001 gel formulation combined with klox led light are effective , safe , well - tolerated , and painless treatment modalities for skin rejuvenation .
they avoid the inherent disadvantages and risks of ablative and nonablative thermal techniques , thereby decreasing costs , patient discomfort , and downtime . | purposemany treatment modalities exist to counteract the effects of cutaneous aging .
ablative methods have been the mainstay for nonsurgical facial rejuvenation . in recent years
, nonablative techniques have been developed with the aim of achieving facial rejuvenation without epidermal damage .
light - emitting diode ( led ) photorejuvenation is a novel nonablative technique that induces collagen synthesis through biophotomodulatory pathways.materials and methodsa single - center , randomized , single - blinded , placebo - controlled , split - faced clinical trial was designed .
thirty - two patients were enrolled for a 12-week study .
patients were randomized into one of four groups : group a , treatment with klox-001 gel formulation and white led ( placebo ) light ; group b , treatment with a placebo / base gel ( no active chromophore ) formulation and klox led light ; group c , treatment with klox-001 gel formulation and klox led light ; and group d , treatment with the standard skin rejuvenating treatment ( 0.1% retinol - based cream ) .
patients received treatment at weeks 0 , 1 , 2 , and 3 , and returned to the clinic at weeks 4 , 8 , and 12 for clinical assessments performed by an independent , blinded committee of physicians using subjective clinician assessment scales .
tolerability , adverse outcomes , and patient satisfaction were also assessed.resultsanalysis demonstrated that the klox led light with klox placebo / base gel and the klox led light + klox-001 gel formulation groups were superior to standard of care and klox-001 gel formulation with placebo light on subjective clinical assessment and multiple wrinkle scales , with statistically significant results obtained for brow positioning , perioral wrinkling , and total wrinkle score.conclusionthe study results show that klox led light with klox-001 gel formulation and klox led light with klox placebo / base gel are effective , safe , well - tolerated , and painless treatment modalities for skin rejuvenation . |
the study was reviewed and determined to be exempt from further review by the university of north carolina at chapel hill institutional review board .
the study protocol was registered in the european network of centres for pharmacoepidemiology and pharmacovigilance ( encepp ) electronic register of studies ( http://www.encepp.eu/encepp/viewresource.htm?id=2334 ) .
the eligible study population consisted of all patients with at least one diagnostic code for diabetes ( icd-9-cm 250.xx ) enrolled in a u.s .
health plan covered by the inovalon medical outcomes research for effectiveness and economics registry ( more registry ) ( bowie , md ) any time between 1 january 2003 and 31 december 2010 .
the more registry contains data for > 76 million patients , 295,000 physicians , and 185,000 clinical facilities and is often able to track patients who change health plans ( 24 ) .
the more registry is comprised of all inpatient and outpatient claims , dispensed prescription medication claims , and mortality data from the social security administration s death master file .
we identified the first ( if any ) dispensed prescription for human nph or a premixed formulation of human nph and regular insulin ( hereafter collectively referred to as
we then excluded patients without continuous enrollment for 19 months prior to the index prescription , defined as having a claim for any medication during each of four 6-month periods prior to the index prescription . within this population with active use of drug insurance , we then excluded patients with any dispensed insulin prescriptions in the 19 months prior to the index prescription with the exception of a single prescription for short - acting insulin ( animal or human regular insulin or rapid - acting analog insulin ) .
the 19-month period was chosen to represent a usual 30-day supply plus a grace period of 6 months plus a washout period of 12 months . from our cohort of initiators of long - acting insulin ( glargine or nph ) , we excluded patients with any evidence of cancer or cancer - related procedures ( supplementary table 1 ) .
this definition was chosen to be as sensitive as possible without implying specificity ( i.e. , erring on the side of excluding some patients that may not have cancer ) .
we then excluded patients younger than 18 years old at the index prescription . to increase the likelihood that dispensed insulin
was actually used by patients included in the cohort , we further restricted our cohorts to patients with a second prescription for the same insulin ( glargine or nph ) dispensed within 6 months after the index prescription . finally , we excluded patients with any evidence of cancer between the index prescription and the second prescription .
all covariates were assessed during the 12 months prior to the index prescription , and all analyses were controlled for a wide variety of variables , including calendar year of initiation , age , comorbidity , number of physician visits , number of hospitalizations , various screenings ( mammography , prostate specific antigen , endoscopy ) , and medications . for a complete list of variables , see table 1 . using these variables
, we predicted the propensity for initiating glargine versus initiating nph for each patient based on observed covariates ( the propensity score ) ( 25 ) .
we then created pseudopopulations , weighting each patient s contribution by the inverse probability of receiving the treatment actually received , i.e. , inverse probability of treatment weights ( iptw ) ( 26 ) .
after checking the maximum weight ( 7.722 ) and that the mean weight was close to 1.0 ( 1.003 ) , which limits the potential for influential patients to bias results , we assessed the balance of observed covariates across treatment cohorts in the pseudopopulations ( 27 ) . to avoid treatment comparisons outside a common range of the propensity score ( and thus possibly covariates ) , we excluded patients initiating glargine with a propensity score higher than the highest one observed in patients initiating nph and vice versa .
distribution of selected baseline characteristics in initiators of glargine and initiators of nph and their effect on choice between initiating glargine versus nph * the cancer end points of interest were breast , prostate , colon , and any ( excluding nonmelanoma skin cancers ) .
these end points were considered separately and defined based on having at least two codes for a specific cancer within 2 months ( 28 ) .
breast cancer was defined as a primary or secondary diagnosis ( icd-9-cm 174.x or 233.0 ) ; prostate cancer ( icd-9-cm 185.x ) and colon cancer ( icd-9-cm 153.x ) were defined accordingly .
patients accrued person - time of follow - up starting from the second prescription until they stopped using the drug ( no new prescription for glargine or nph , respectively , within the recorded number of days supply plus a 180-day grace period to allow for dose adjustment and irregular use ) , filled a prescription for another long - acting insulin ( all patients were allowed to augment with short - acting insulin ) , died , or ended enrollment ; the study period ended ( 31 december 2010 ) ; or they had a claim for any incident cancer ( except nonmelanoma skin cancer ) .
after checking the proportional hazards assumption by adding an interaction term between ( log ) time and treatment , we then fit cox proportional hazards models for the various cancer outcomes in the weighted pseudopopulations without controlling for covariates ( potentially affected by treatment ) .
bmi is associated with an increased risk of some cancers including colon and postmenopausal breast but not prostate cancer ( 29 ) and could confound the association between glargine versus nph initiation and cancer incidence if bmi would affect the choice between initiating these two treatments . to test this possibility , we estimated the association between bmi and choice between initiating glargine versus nph independent of other covariates , fitting propensity score models equivalent to the one in the main cohort but using two electronic medical record ( emr ) databases where information on bmi is available .
we used emr data from the massachusetts general hospital ( mgh ) and from ochsner .
initiation of nph or glargine in the mgh and ochsner databases was defined as for the inovalon database ; however , only one prescription record from the emr was required to define initiation , as these databases do not contain a record for dispensing .
additional sensitivity analyses were performed to enhance the probability of having type 2 diabetes ( by restricting cohorts to those > 40 years of age and with prior use of oral antihyperglycemic agents ) , varying induction periods ( excluding patients with early cancer diagnosis ) , varying carryover effects , and excluding increasing proportions of those treated contrary to prediction ( i.e. , to assess the potential for bias assuming unmeasured confounding ) .
the eligible study population consisted of all patients with at least one diagnostic code for diabetes ( icd-9-cm 250.xx ) enrolled in a u.s . health plan covered by the inovalon medical outcomes research for effectiveness and economics registry ( more registry ) ( bowie , md ) any time between 1 january 2003 and 31 december 2010 .
the more registry contains data for > 76 million patients , 295,000 physicians , and 185,000 clinical facilities and is often able to track patients who change health plans ( 24 ) .
the more registry is comprised of all inpatient and outpatient claims , dispensed prescription medication claims , and mortality data from the social security administration s death master file .
we identified the first ( if any ) dispensed prescription for human nph or a premixed formulation of human nph and regular insulin ( hereafter collectively referred to as nph ) or analog insulin glargine after 1 july 2004 ( supplementary fig .
we then excluded patients without continuous enrollment for 19 months prior to the index prescription , defined as having a claim for any medication during each of four 6-month periods prior to the index prescription . within this population with active use of drug insurance , we then excluded patients with any dispensed insulin prescriptions in the 19 months prior to the index prescription with the exception of a single prescription for short - acting insulin ( animal or human regular insulin or rapid - acting analog insulin ) .
the 19-month period was chosen to represent a usual 30-day supply plus a grace period of 6 months plus a washout period of 12 months . from our cohort of initiators of long - acting insulin ( glargine or nph ) , we excluded patients with any evidence of cancer or cancer - related procedures ( supplementary table 1 ) .
this definition was chosen to be as sensitive as possible without implying specificity ( i.e. , erring on the side of excluding some patients that may not have cancer ) .
we then excluded patients younger than 18 years old at the index prescription . to increase the likelihood that dispensed insulin
was actually used by patients included in the cohort , we further restricted our cohorts to patients with a second prescription for the same insulin ( glargine or nph ) dispensed within 6 months after the index prescription .
finally , we excluded patients with any evidence of cancer between the index prescription and the second prescription .
all covariates were assessed during the 12 months prior to the index prescription , and all analyses were controlled for a wide variety of variables , including calendar year of initiation , age , comorbidity , number of physician visits , number of hospitalizations , various screenings ( mammography , prostate specific antigen , endoscopy ) , and medications . for a complete list of variables , see table 1 . using these variables , we predicted the propensity for initiating glargine versus initiating nph for each patient based on observed covariates ( the propensity score ) ( 25 ) .
we then created pseudopopulations , weighting each patient s contribution by the inverse probability of receiving the treatment actually received , i.e. , inverse probability of treatment weights ( iptw ) ( 26 ) .
after checking the maximum weight ( 7.722 ) and that the mean weight was close to 1.0 ( 1.003 ) , which limits the potential for influential patients to bias results , we assessed the balance of observed covariates across treatment cohorts in the pseudopopulations ( 27 ) . to avoid treatment comparisons outside a common range of the propensity score ( and thus possibly covariates ) , we excluded patients initiating glargine with a propensity score higher than the highest one observed in patients initiating nph and vice versa .
distribution of selected baseline characteristics in initiators of glargine and initiators of nph and their effect on choice between initiating glargine versus nph *
the cancer end points of interest were breast , prostate , colon , and any ( excluding nonmelanoma skin cancers ) .
these end points were considered separately and defined based on having at least two codes for a specific cancer within 2 months ( 28 ) .
breast cancer was defined as a primary or secondary diagnosis ( icd-9-cm 174.x or 233.0 ) ; prostate cancer ( icd-9-cm 185.x ) and colon cancer ( icd-9-cm 153.x ) were defined accordingly .
patients accrued person - time of follow - up starting from the second prescription until they stopped using the drug ( no new prescription for glargine or nph , respectively , within the recorded number of days supply plus a 180-day grace period to allow for dose adjustment and irregular use ) , filled a prescription for another long - acting insulin ( all patients were allowed to augment with short - acting insulin ) , died , or ended enrollment ; the study period ended ( 31 december 2010 ) ; or they had a claim for any incident cancer ( except nonmelanoma skin cancer ) . after checking the proportional hazards assumption by adding an interaction term between ( log ) time and treatment , we then fit cox proportional hazards models for the various cancer outcomes in the weighted pseudopopulations without controlling for covariates ( potentially affected by treatment ) .
bmi is associated with an increased risk of some cancers including colon and postmenopausal breast but not prostate cancer ( 29 ) and could confound the association between glargine versus nph initiation and cancer incidence if bmi would affect the choice between initiating these two treatments . to test this possibility , we estimated the association between bmi and choice between initiating glargine versus nph independent of other covariates , fitting propensity score models equivalent to the one in the main cohort but using two electronic medical record ( emr ) databases where information on bmi is available .
we used emr data from the massachusetts general hospital ( mgh ) and from ochsner .
initiation of nph or glargine in the mgh and ochsner databases was defined as for the inovalon database ; however , only one prescription record from the emr was required to define initiation , as these databases do not contain a record for dispensing .
additional sensitivity analyses were performed to enhance the probability of having type 2 diabetes ( by restricting cohorts to those > 40 years of age and with prior use of oral antihyperglycemic agents ) , varying induction periods ( excluding patients with early cancer diagnosis ) , varying carryover effects , and excluding increasing proportions of those treated contrary to prediction ( i.e. , to assess the potential for bias assuming unmeasured confounding ) .
we present the baseline distribution of covariates in the two cohorts of glargine initiators and nph initiators in table 1 .
our cohort of patients being initiated on glargine is slightly older , more likely to be male , and more likely to initiate treatment after 2008 than patients initiating nph ( first two columns ) .
patients initiating glargine are more likely to have filled prescriptions of antihypertensive , antihyperglycemic , and lipid - lowering drugs .
in contrast , patients initiating nph are more likely to have filled prescriptions for estrogens and progestins .
the prevalence of comorbidities is very similar in both cohorts , as is health care use .
patients initiating glargine are more likely to have had a cancer - screening test performed in the year prior to baseline than patients initiating nph . in the third column
, we present the multivariable effect of these covariates on channeling between initiating glargine and nph ( i.e. , results from the propensity score model ) .
the virtually identical distribution of the covariates in the propensity score weighted pseudopopulation ( last two columns ) proves that we were able to balance cohorts on all measured covariates , thus eliminating confounding by these covariates . in table 2
, we present rates per 100,000 person - years and the crude and adjusted hazard ratios ( hrs ) for incident cancer for breast cancer ( women only ) , prostate cancer ( men only ) , colon cancer , and any cancer .
all numbers are based on our primary analysis , i.e. , as treated , where patients stopping , switching , or augmenting their corresponding baseline treatment are censored at that point in time .
the median duration of follow - up in this analysis is 0.9 years in the glargine cohort and 0.8 years in the nph cohort .
initiation of long - acting insulin treatment and cancer incidence * the breast cancer analysis , based on 22,936 patients initiating glargine and 5,536 patients initiating nph and 122 incident breast cancers , reveals an adjusted hr of 1.07 ( 95% ci 0.651.75 ) .
the corresponding hr for prostate cancer ( 1.19 [ 0.731.94 ] ) , colon cancer ( 0.89 [ 0.491.60 ] ) , and any cancer ( 1.12 [ 0.951.32 ] ) are all close to 1 , indicating no increased risk for cancer in glargine initiators compared with nph initiators .
we then stratified the analysis presented in table 2 by duration of use since initiation ( table 3 ) .
given the median duration of treatment presented above , there are sparse data for the > 24-month strata , especially for the nph cohort .
based on only 3,415 person - years and 14 incident breast cancers , we found no indication for an increased risk for breast cancer in the few women using glargine or nph for > 2 years ( hr 0.67 [ 0.182.54 ] ) .
the corresponding hrs for the other cancer outcomes are all close to 1.0 , with the exception of > 1224 months and prostate cancer ( 2.66 [ 0.6510.9 ] ) .
this outlier result should be interpreted taking into account the absence of a monotonic pattern over duration of use and the small number and the unusually low incidence rate of prostate cancer in the nph cohort .
initiation of long - acting insulin treatment and cancer incidence by duration of treatment * in table 4 , we present the results of our two external validation studies to assess the role of various covariates not available in claims data . in both validation studies , bmi does not influence the choice between initiating long - acting insulin therapy with glargine versus nph .
the corresponding adjusted odds ratios for bmi ( 1-unit increase ) and initiating glargine versus nph were 1.00 ( 0.981.02 ) in the mgh cohort and 0.99 ( 0.961.03 ) in the ochsner cohort .
effect of bmi on channeling between initiating glargine versus initiating nph : external validation studies all results were consistent when we restricted the patient population to those > 40 years old and with prior use of oral antihyperglycemic agents ( i.e. , limited to patients with a very high probability of having type 2 diabetes ) , varied induction periods ( i.e. , excluding incident cancer cases for up to 12 month after insulin initiation ) , varied carryover effects ( i.e. , allowing for effects to carry on for up to 24 months or indefinitely after stopping treatment [ first treatment carried forward or intention - to - treat analysis ] ) , and excluded increasing proportions of those treated contrary to prediction ( i.e. , to assess the potential for bias assuming unmeasured confounding ) ( data not presented ) .
for example , the following hrs were observed in the intention - to - treat analysis : 1.30 for breast cancer ( 0.832.05 ) , 1.21 for prostate cancer ( 0.801.84 ) , 0.97 for colon cancer ( 0.581.63 ) , and 1.09 for any cancer ( 0.951.25 ) .
in our large , new user , active comparator cohort study , we found no evidence that initiating patients with diabetes with insulin glargine leads to a higher risk of cancer compared with initiating similar patients on nph .
this result was consistent for overall and specific cancers ( breast , prostate , colon ) and a variety of sensitivity analyses addressing the relation of timing of insulin initiation with the risk for cancer ( time after initiation , induction periods , lag times ) , subgroups , and the potential for unmeasured confounding by bmi and severity of diabetes .
a recent meta - analysis reported that there was no difference in the rates of breast cancer incidence in patients treated with insulin glargine compared with other formulations of insulin , but there was evidence for heterogeneity across studies ( 31 ) .
there are several studies that have suggested an increased risk of breast cancer ( 1012,16 ) . in particular , in a cohort of 15,227 women with type 2 diabetes followed for up to 8 years
, breast cancer risk was not increased during the first 5 years of glargine use but there was a suggestion of increased risk among those with > 5 years exposure ( hr 1.8 [ 95% ci 0.840 ] ) .
there was insufficient exposure among new users to examine those with 5 years of treatment .
the results of two collaborating groups from northern europe and kaiser permanente were recently reported at 72nd scientific sessions of the american diabetes association , philadelphia , pennsylvania , 812 june 2012 ( http://www.diabetes.org/for-media/2012/sci-sessions-insulin-cancer.html ) . both studies reported an increased hr for breast cancer in the new user cohort with longer duration of treatment .
the lack of an association among new users of glargine compared with new users of nph for breast cancer , including those with treatment over 2 years , is reassuring , but further study of breast cancer risk with long - standing glargine use is necessary .
we could have used a measure of cumulative dose instead but , based on the small number of nph initiators and the potential for time - varying confounding , opted to focus on the duration of treatment irrespective of dose analysis . we combined the new user design with an active comparator cohort . rather than comparing treated with untreated , this design allowed us to address a clinically more important question : if i need to initiate insulin therapy in my patients with diabetes , does choosing insulin glargine over nph increase the risk for cancer ? results of studies using active comparators , while answering clinically more important questions , are inherently dependent on the comparator chosen .
we chose nph insulin as a comparator because 1 ) most guidelines provide nph insulin as the alternative to long - acting basal analog insulins like glargine and 2 ) there is insufficient exposure to other long - acting analog insulins in the u.s . compared with patients initiating nph ,
patients initiating glargine were generally more likely to have filled prescriptions for metformin , sulfonylureas , thiazolidinediones , and other diabetes drugs during the 12 months before initiating insulin .
glargine initiators were also more likely to have filled prescriptions for statins , have blood lipids tested , and have had a mammography , suggesting that glargine initiators are more likely to follow guidelines of disease prevention , i.e. , healthy users ( 32 ) .
we successfully balanced the cohorts of glargine and nph initiators on all these factors using propensity scores .
our study has to be interpreted in the context of its limitations . while our study contributes considerably to the evidence base for longer - term treatment with glargine ,
this limitation was mainly a function of patients not using insulin glargine ( or nph ) over prolonged periods of time rather than lack of long - term observation of patients .
of note , these actual dynamics also affect other studies , including the hemkens et al .
( 1 ) study that reported an increase in cancer risk early after initiation of glargine treatment , and thus can not explain the discrepancies in results observed . while all patients in our cohort initiated long - acting insulin after a period of at least 19 months without insulin use , some patients may have used insulin prior to that period and then stopped .
we found ~100 out of the 52,453 patients meeting new use criteria more than once , indicating that new use equates to initiation for the great majority of patients . while health care claims data include prospective , longitudinal records of almost all dispensed prescriptions and are therefore almost ideal to track drug exposures ( 32 ) , they are limited with respect to their sensitivity and specificity to detect cancer and capturing potentially important covariates .
we used an algorithm with high specificity to define incident cancer ( 28 ) because a high specificity limits bias of ratio estimates ( 33 ) .
we used two external validation studies to assess the potential for unmeasured confounding by bmi ( 34 ) and could show that bmi does not affect the decision to initiate insulin treatment with glargine versus nph .
given that we observed similar patterns in two distinct settings , we find it plausible that this finding is generalizable to our cohorts
. we could not control for a wide variety of other covariates , including e.g. , smoking and socioeconomic status .
while smoking increases the risk for a wide variety of cancers , the potential for confounding by socioeconomic status is limited because the impact of income on cancer incidence is complex and far from strong .
our data include a variety of different health care plans with different copayment structures that could influence channeling , but it is reasonable to assume that health care plan membership would not be associated with cancer risk independent of the factors we controlled for in our analyses ( e.g. , age , sex , and various health care seeking behaviors , e.g. , screening examinations ) . to assess the potential for socioeconomic status affecting channeling , we stratified our new user cohorts by medicaid versus commercially insured . of all medicaid beneficiaries initiating insulin therapy in 2010 ,
84.3% were initiated on glargine ; the corresponding number was very similar ( 88.7% ) in commercially insured patients , further limiting the potential for confounding .
the number of patients initiated on nph was much smaller than the number initiated on glargine in our study of u.s .
patients with diabetes . while this reflects the reality of most patients being initiated on glargine rather than nph in the u.s .
, it decreases the precision of our estimates , especially for long - term use .
based on previous studies and the substantial contribution of our study , we conclude that there does not seem to be an increased risk for cancer , including breast cancer , after initiation of glargine compared with nph in patients with ( mostly type 2 ) diabetes .
the current evidence on long - term use is limited , however , mainly based on the actual dynamic in insulin treatment in the real world .
while limiting our evidence base with respect to risk for cancer , this relative lack of empirically observed long - term use also limits the hypothetical potential for negatively affecting public health . as always , physicians should weigh potential benefits and harms when making treatment decisions .
| objectiveto add to the evidence on comparative long - term effects of insulin analog glargine versus human nph insulin on the risk for cancer.research design and methodswe identified cohorts of initiators of glargine and human nph without an insulin prescription during the prior 19 months among patients covered by the inovalon medical outcomes research for effectiveness and economics registry ( more2 registry ) between january 2003 and december 2010 .
patients were required to have a second prescription of the same insulin within 180 days and to be free of cancer .
we balanced cohorts on risk factors for cancer outcomes based on comorbidities , comedication , and health care use during the prior 12 months using inverse probability of treatment weighting .
incident cancer was defined as having two claims for cancer ( any cancer ) or the same cancer ( breast , prostate , colon ) within 2 months .
we estimated adjusted hazard ratios ( hrs ) and their 95% ci using weighted cox models censoring for stopping , switching , or augmenting insulin treatment , end of enrollment , and mortality.resultsmore patients initiated glargine ( 43,306 ) than nph ( 9,147 ) .
initiators of glargine ( nph ) were followed for 1.2 ( 1.1 ) years and 50,548 ( 10,011 ) person - years ; 993 ( 178 ) developed cancer .
the overall hr was 1.12 ( 95% ci 0.951.32 ) .
results were consistent for breast cancer , prostate cancer , and colon cancer ; various durations of treatment ; and sensitivity analyses.conclusionspatients initiating insulin glargine rather than nph do not seem to be at an increased risk for cancer . while our study contributes significantly to our evidence base for long - term effects , this evidence is very limited mainly based on actual dynamics in insulin prescribing . |
the incidence of chromafine tissue tumours is about 12/100 000/year in the adult population [ 1 , 2 ] .
paragangliomas represent an extra - adrenal form of the disease and account for approximately 10% of all pheochromocytomas .
about 70% of paragangliomas are intra - abdominal , with various localizations being described , mostly adjacent to main vessels or retroperitoneal organs [ 3 , 4 ] .
extra - adrenal pancreatic paragangliomas are exceptionally rare . there have been only 15 cases published up to 2011 . because paragangliomas have notoriously unpredictable behaviour and often metastasize late , surgical resection is a treatment of choice .
critical appreciation of vascular anatomy may define operability , enable planning a surgical strategy and may prove extremely useful during the resection . in case of an inoperable tumour with malignant behaviour , chemotherapy or therapy with radionucleotides may be used [ 6 , 7 ] .
a 53-year - old , obese ( body mass index 30.9 kg m ) , caucasian woman was referred to our department with non - specific abdominal discomfort as the only presenting symptom .
a large hypervascularized mass in the area of the pancreatic head was shown on abdominal ultrasonography and computed tomography ( ct ) .
pre - operative imaging revealed an extremely hypervacularized tumour with abundant collateral vessels from the superior mesenteric artery ( sma ) , replaced right hepatic artery ( ha ) , gastroduodenal artery ( gda ) and right renal artery ( rra ) , with an early venous filling of the dilated superior mesenteric vein ( smv ) and portal vein ( pv ) ( fig .
the replaced right ha arising from sma was crossing in between the dilated pv and overfilled tumour - draining veins ( fig .
extreme dilation of smv and pv in both extra- and intra - hepatic course could be expected as numerous av shunts within the tumour were present , but surprisingly , only a non - dilated , gracile splenic vein was found and no spleen enlargement was present ( fig .
1c ) . for better evaluation of vascular anatomy , selective digital substraction angiography ( dsa )
the upper portion of the tumour received main inflow via gda and replaced right ha , the lower part via several branches of sma ( fig .
( a ) hypervascularized tumour with early venous filling in the arterial phase of ct .
( b ) variant subtle right hepatic artery originating from sma , passing between the dilated pv and draining veins of a paraganglioma .
( c ) isolated dilation of the pv with surprisingly gracile splenic vein without any spleen enlargement .
figure 2:(a and b ) ct volume rendering images with dilated pv and an early contrast filling of dilated peritumoral veins .
( e ) complementary tumour blood supply via capsular branch of rra draining into the portal system .
( f ) pv dilation in the venous phase of angiography . cross - sectional ct imaging .
( a ) hypervascularized tumour with early venous filling in the arterial phase of ct .
( b ) variant subtle right hepatic artery originating from sma , passing between the dilated pv and draining veins of a paraganglioma .
( c ) isolated dilation of the pv with surprisingly gracile splenic vein without any spleen enlargement .
( a and b ) ct volume rendering images with dilated pv and an early contrast filling of dilated peritumoral veins .
( e ) complementary tumour blood supply via capsular branch of rra draining into the portal system .
( f ) pv dilation in the venous phase of angiography . during the laparotomy a tumour with numerous , large pulsating veins running on its surface was found .
after partial mobilization was completed , all main inflow and outflow vessels were secured prior to pancreaticoduodenectomy .
after division of gda and capsular branch of rra , the tumour diminished to about one half of the original size .
the neck of the pancreas was divided and dilated arterial and venous branches towards the tumour isolated . the major problem during this step turned out to be severe venous congestion caused by local av shunts .
the draining venous branches had to be divided first to gain access to hypertrophied feeding arteries at the very end of the dissection .
we considered dissection too lengthy to clamp the main arterial stems ( sma and celiac trunk ) for a prolonged period of time , and so a blood loss of 2000 ml during almost 9 h of surgery was tolerated .
histopathologically , the tumour characteristics typical of paraganglioma were present with chromogranin , synaptophysin , neuron - specific enolase and s-100 protein positivity in the immunohistochemical assay ( fig .
the tumour had a strong fibrous capsule , no invasion to neighbouring tissue , lymphatic or blood vessels was found .
the only abnormality in a post - operative period was an unexpected transient hepatal panel elevation with a peak on post - operative day 7 ( fig .
although no invasive haemodynamic measurements were performed neither pre - operatively nor in the post - operative period , we speculate that this could have been an effect of changed liver inflow haemodynamics after the tumour excision .
extreme pre - operative smv and pv dilation without splenic vein dilation in the presence of av shunts could be a result of a high flow
pre - operatively , the large proportion of the arterial inflow consisted of arterial blood shunting directly into the pv from tumour feeding arteries .
as both the left and the right ha were subtle , they provided for only non - substantial oxygen - rich hepatic inflow .
thus , tumour removal could lead to a critical decrease of oxygen delivery to the liver .
the patient is now 49 months after pylorus preserving pancreaticoduodenectomy , the regular follow - up with positron emission tomography - computed tomography ( pet / ct ) has been performed and no recurrence has been observed so far .
a large tumour may require an extensive surgical approach , careful dissection and en bloc resection irrespective of whether it actually represents intraparenchymatous or only a perivascular , organ adjacent paraganglioma .
special attention shoud be paid to the possibility of av shunting within a tumour , either for the unestimated risk of a paradoxical embolism into the portal system ( when attempting pre - operative embolization ) , or for possible intra - operative technical problems ( bleeding caused by venous congestion or while manipulating the tumour ) .
low resistance hepatic inflow in the presence of significant av shunts within the tumour in this localization may result in a significant change of hepatic perfusion after tumour removal . even though this is the first report to describe such changes and no invasive haemodynamic measurements
this research received no specific grant from any funding agency in the public , commercial or not - for - profit sectors . | pancreatic paragangliomas are extremely rare with less than 20 cases ever described in the world literature .
there is no detailed report of the vascular anatomy in this entity and its possible impact on patient management .
we present a case of large pancreatic head paraganlioma in a 53-year - old woman .
the tumour had a predominant arterial blood supply via both the hepatic artery and the superior mesenteric artery .
complex inflow was complemented by supplementary branches from the right renal artery .
the arteriovenous communications within the lesion represented the most dangerous aspect of excision and the tumour removal was accompanied with a considerable blood loss .
after pancreaticoduodenectomy , patient experienced transient elevation of liver function tests with no other identifiable cause than a change in portal haemodynamics .
it is advisable that the precise knowledge of vascular anatomy in pancreatic head paraganglioma should be obtained prior to any intervention . |
bite marks may be found at the scene of a crime and their analysis has been used for many years as an aid in forensic investigation . bite marks
can occur on the skin of a victim or on other objects , including foods such as cheese , chocolate , apples , or chewing gums .
bite marks tend to have a double horseshoe pattern showing the six central teeth of the upper jaw and the corresponding six teeth in the lower jaw .
bite marks made in food are usually well defined ; but the bite marks made in flesh are usually less defined .
bite marks reveal features such as gaps between the teeth , ridges on the biting surfaces of the teeth , rough fillings , as well as missing , broken , chipped , or distorted teeth . in fact , human teeth patterns are individual and careful expert analysis of a bite is able to relate the mark to a suspect .
it must be again emphasized that the bite marks obtained on food items tend to be more accurate and reproducible than on skin of a person and many studies have proved the fact .
there are many different ways of analysis of bite marks on food substances like impression making and hand tracing from dental study casts , photography method , photocopying , and computer assisted methods of overlay generation . in this study
, an attempt is made to compare the bite mark overlays generated by three methods , i.e. , manual , photocopying , and computer assisted methods of overlay generation to find the most reliable method out of the three methods used .
impressions of maxillary and mandibular arches of 25 individuals participating in the study were made and dental study models prepared in dental stone .
overlay production was done by manual , photocopying , and computer assisted method of overlay generation . in manual method a sheet of transparency film and a fine tipped pen were used to mark the perimeter of the biting surface .
the transparent sheet was directly placed over the biting edges of the dental model [ figure 1 ] . then with the help of a black fine tipped marker the biting edges were traced .
both the maxillary and mandibular models were traced individually in horse shoe shape pattern [ figure 2 ] to simulate a human bite . biting edges
being traced in the photocopying method an accurate image of the dental model was made by placing the biting edges of the dental model over the glass plate of the photocopying machine [ figure 3 ] .
this image [ figure 4 ] was then placed upside down on a radiograph view box and the tooth edge outlines were traced [ figure 5 ] .
these outlines were then photocopied on a transparent sheet [ figure 6 ] . dental model being photocopied photocopied dental model in the computer assisted method first the study models were scanned with the biting edges of the dental model over the glass plate of the scanner [ figure 7 ] .
then a gradual selection of biting edges of the teeth was done using magic wand selection tool [ figure 9 ] resident in the photoshop software version 7.0 .
thus , three overlays were made for one set of dental model and in total 75 overlays were made .
the three overlays corresponding to a set of dental model was placed directly over the biting edges one by one for matching and assigned one out of the four values ( 0 - 3 ) with 0 assigned to no matching and 3 assigned to excellent matching [ tables 1 and 2 ] . dental model
being scanned biting edges selected by magical wand selection tool borders of biting edges being reproduced computer assisted overlay numeric values for matching
kruskal wallis anova h test was used for the comparison of manual , photocopying , and computer assisted overlay production methods .
h value for manual vs. photocopying overlay the generation method was 5.74 ( p < 0.05 significant at 5% level ) [ table 3 ] ; for manual vs. computer overlay the generation method was 19.17 ( p < 0.01 significant at 1% level ) [ table 4 ] and for photocopying vs. computer overlay the generation method was 22.97 ( p < 0.01 significant at 1% level ) [ table 5 ] .
the principle of bite mark analysis is based on the premise that no two people have similar teeth , and hence the bite marks made are also dissimilar . historically , the manual method was the only method known for generating overlays and was used first in about 1966 .
dailey ( 1991 ) presented a quick , inexpensive , and accurate technique for generating transparent overlays , using office photocopy machines , for use in bite mark case analysis .
he discussed the critical step in the fabrication process involves determination of the accuracy of the product produced by the photocopy machine .
naru and dykes ( 1996 ) introduced the computer assisted overlay generation method to forensic odontology .
they advocated a method of selection of tooth edges from the image by a technique known as edge detection .
the present study was undertaken to find the best method out of these three methods , i.e. , manual , photocopying , and computer assisted method for overlay generation .
one of the limitations of the overlays is that they are two dimensional representatives of three dimensional bite marks .
sweet et al . ( 1998 ) in their study compared five different methods of overlay generation .
the computer - based production method was determined to be the most accurate of those studied .
it produced accurate representations of the biting edges of the teeth in an objective manner .
2004 ) in their study to compare direct and indirect methods available for human bite mark analysis found that the photocopier - generated overlays were significantly more accurate at matching the correct bite mark to the correct models .
( 2005 ) conducted a study to compare the reliability of two methods used to produce computer - generated bite mark overlays with adobe photoshop .
one method was , by using magical wand selection tool , while the other method is by inverting the glowing edges .
it was concluded that both techniques were reliable methods to produce bite mark overlays in assessing tooth position .
( 2005 ) conducted an experimental study on human bite marks digital analysis and its accuracy .
their result showed that the human bite marks digital analysis was a more accurate approach to human bite marks identification .
( 2009 ) presented their experiments describing the development of a semi - automated method to compare 3d dental models taken from candidate humans and bite mark impression images left in the scene of the crime .
( 2011 ) conducted a study to evaluate the accuracy of two methods for the bite mark analysis in foodstuff .
the results of their study showed that the computer - based method of bite mark analysis was as accurate as the docking procedure .
( 2011 ) in their study to determine the most accurate bite mark overlay fabrication technique by studying two physical characteristics , i.e. , area and rotation of biting edges of anterior teeth , they concluded that forensic odontologists should discontinue the use of hand traced overlays in bite mark comparison as there is lot of scope for manipulation and observer bias . a recently developed new software package , dental print ( 2004 , university of granada , department of forensic medicine and forensic odontology , granada , spain ) generates comparison overlays from 3d images of the suspect 's dental cast .
this software allows users to accurately and objectively select the biting edges of interest from the suspect 's teeth when compared to 2d images .
the procedure for generating comparison overlays is entirely automatic and it is impossible for third parties to manipulate or alter the 3d images .
this dental print software is an important step forward in forensic sciences for bite mark analysis . in our study , the computer assisted overlay generated matched excellently with study models in 13 cases . in comparison ,
none of the overlay generated in a manual method matched excellently with the study models .
thus , the results of our study show that photocopying method is better than manual method , but computer assisted method is more reliable than both manual method and photocopying method .
although many newer and sophisticated methods of bite mark comparison have evolved , comparison by overlay generation remains one of the best and easiest methods . within various overlay generation methods ,
computer assisted overlay generation method enjoys widest acceptance because of its objectivity , ease of production , and being inexpensive along with being well researched .
so it can be concluded that computer assisted overlay generation method is the best method of overlay generation . | aim : to evaluate the best method of overlay generation out of the three methods , i.e. , manual , photocopying , and computer assisted method.materials and methods : impressions of maxillary and mandibular arches of 25 individuals participating in the study were made and dental study models were prepared .
overlay production was done by manual , photocopying , and computer assisted methods . finally , the overlays obtained by each method were compared.results:kruskal wallis anova h test was used for the comparison of manual , photocopying , and computer assisted overlay generation methods .
h value being highest in case of computer assisted overlays , thus , making it the best method of overlay generation out of the three methods.conclusion:we conclude that the method of computer assisted overlay generation is the best among the three methods used in our study . |
pneumatic tourniquets have been commonly utilized during orthopedic extremity surgeries to attain a bloodless field facilitating operative procedures . although tourniquet associated complications including postoperative swelling , delay of recovery of muscle power , compression neuropraxia , wound hematoma with the potential for infection , vascular injury , tissue necrosis , compartment syndrome , and systemic complications
have been reported in the literature , the iatrogenic chemical burn during pneumatic tourniquet use has been rarely reported.14 here , we report two cases of chemical burn to sensitize the orthopaedic surgeons about its possible occurrence .
the tourniquet cuff used was a standard leg tourniquet ( 18 cm ) and was applied with four layers of adequate wool padding .
the set pressure was 250 mmhg which was about 100 mmhg higher than the patient 's systolic pressure .
when the tourniquet was removed after operation , the burn was seen on the medial aspect of thigh [ figure 1a ] . while inspecting
the padding where the burn was present , the drape preparation seemed to have run down the patient 's thigh during painting and had been left in wet condition underneath the tourniquet .
the wound was of intermediate to deep second degree burn with blisters of size about 5 6 cm .
the patient was treated conservatively with a furazone gauze occlusive dressing and was discharged from orthopedic department without skin grafting .
however , he underwent multiple treatments with the dermatologist for complete healing which took almost 12 months [ figure 1b ] . even to this time ( 2 years postoperation ) , the patient continuously complains of hypersensitivity on the scar area , which aggravates during normal gait .
tourniquet - associated chemical burn developed on medial aspect of thigh : ( a ) immediate postoperative ; ( b ) 1year and 9 months postoperative a 65 year old female patient , underwent elective unicompartmental knee arthroplasty for medial compartment osteoarthritis of the knee .
the tourniquet cuff used was a standard leg tourniquet and was applied with four layers of adequate wool padding .
the set pressure was 250 mmhg which was about 100 mmhg higher than the patient 's systolic pressure .
when the tourniquet was removed , the burn was seen on the medial aspect of thigh .
one week postoperatively , blisters and crusts were found roughly at the proximal margin of tourniquet [ figure 2a ] .
local furazone gauze was applied for dressing and complete healing needed almost 1 year after operation . during this followup period ,
scar revision excising this hypersensitive , hypertrophic scar was needed after 1 year 4 months postoperatively [ figure 2b ] .
tourniquet - associated chemical burn developed on medial aspect of thigh : ( a ) 1 week postoperative ; ( b ) 1 year and 4 months postoperative ( just prior to scar excision )
the tourniquet cuff used was a standard leg tourniquet ( 18 cm ) and was applied with four layers of adequate wool padding .
the set pressure was 250 mmhg which was about 100 mmhg higher than the patient 's systolic pressure .
when the tourniquet was removed after operation , the burn was seen on the medial aspect of thigh [ figure 1a ] . while inspecting
the padding where the burn was present , the drape preparation seemed to have run down the patient 's thigh during painting and had been left in wet condition underneath the tourniquet .
the wound was of intermediate to deep second degree burn with blisters of size about 5 6 cm .
the patient was treated conservatively with a furazone gauze occlusive dressing and was discharged from orthopedic department without skin grafting .
however , he underwent multiple treatments with the dermatologist for complete healing which took almost 12 months [ figure 1b ] . even to this time ( 2 years postoperation ) , the patient continuously complains of hypersensitivity on the scar area , which aggravates during normal gait .
tourniquet - associated chemical burn developed on medial aspect of thigh : ( a ) immediate postoperative ; ( b ) 1year and 9 months postoperative
a 65 year old female patient , underwent elective unicompartmental knee arthroplasty for medial compartment osteoarthritis of the knee .
the tourniquet cuff used was a standard leg tourniquet and was applied with four layers of adequate wool padding .
the set pressure was 250 mmhg which was about 100 mmhg higher than the patient 's systolic pressure .
when the tourniquet was removed , the burn was seen on the medial aspect of thigh .
one week postoperatively , blisters and crusts were found roughly at the proximal margin of tourniquet [ figure 2a ] .
local furazone gauze was applied for dressing and complete healing needed almost 1 year after operation . during this followup period ,
scar revision excising this hypersensitive , hypertrophic scar was needed after 1 year 4 months postoperatively [ figure 2b ] .
tourniquet - associated chemical burn developed on medial aspect of thigh : ( a ) 1 week postoperative ; ( b ) 1 year and 4 months postoperative ( just prior to scar excision )
the chemical burn resulting from tourniquet application cause more in - depth injury to the skin than the abrasion wound because there is greater time exposure and the anesthesia prevents the patient from reacting to the noxious burn stimulus.5 consequently , multiple debridement , skin graft , and even flap surgeries may be needed in such injuries with prolonged treatment period . both of our cases had intermediate to deep second degree burn extending into deep dermis .
not only a long duration of healing time ( up to 1 year postoperatively ) was needed , but also hypersensitive and painful scar remained thereafter .
the iatrogenic chemical burn induced by tourniquet application can have an impact on surgeon patient relationship .
dickinson and bailey1 reported four burns beneath the cuffs of pneumatic tourniquets . in all cases ,
the area of iodine staining corresponded exactly with the area of the burn , while in the other two cases the burns were smaller .
all burns were of partial thickness and healed within 4 weeks , leaving minimal scarring .
one of these patients had a partial thickness burn under the tourniquet cuff , after a 2-h surgery on his right palm .
similar experiences were reported by other authors.36 the scars described in these reports seem to have healed without much complications . unlike the previous reported cases ,
our cases required prolonged healing time and patients continuously complained discomfort in the scar area .
the basic mechanism of tourniquet induced chemical burn involves irritation by antiseptics2478 coupled with maceration,911 compression pressure,1214 duration of compression,1314 and wetness underneath the tourniquet.1516 polyvinylpyrrolidone - iodine ( pi ) is a widely used antiseptic which was introduced by shelanski and shelanski in 1965.17 it is a water - soluble compound that results from the combination of molecular iodine and polyvinylpyrrolidone .
the preparations of commercially available pi are povidone - iodine ( betadine ) solution , scrub , ointment , tincture , and foam ; of these , the solution is the most commonly used .
the 10% pi solution generally contains 90% water , 8.5% polyvinylpyrrolidone , and 1% available iodine and iodide ( ph 4.55.5 ) .
although uncommon , chemical burns have been reported with this solution.251821 alcohol ( 70% ) , which is used for draping , may also cause hypersensitivity.247 by using alcohol , the epidermal lipid barrier acting to the skin may be decreased by de - esterification . to prevent tourniquet associated chemical burn , two important points should be noted .
first , friction between the skin and the tourniquet should be avoided because macerated skin becomes more permeable to pi which may become prone for damage .
an elastic stockinette is known to be effective in preventing the development of maceration induced blisters.22 the shape mismatch between the tourniquet and the thigh should be considered when applying tourniquet to minimize friction . very muscular or obese patients tend to have conical shaped thigh.14 even distribution moving the skin and the soft tissues distally underneath the tourniquet may overcome this mismatch .
second , emphasis should be made on some form of barrier occluding the tourniquet , preventing wool soaking from antiseptics.1516 in addition to a number of commercial covers , a variety of simple , non commercial alternatives have been proposed .
sarkhel and stride15 suggested using the disposable reservoir bag from a single use anesthetic circuit , while the use of surgical glove was proposed by tomlinson and harries.16 our department has been using adhesive plaster ( sinsin pharm co. ltd .
, korea ) and antimicrobial incise drape ( ioban 2 , 3 m health care , usa ) for mechanical barrier [ figure 3a and b ] . on taking these precautions , further occurrence of tourniquet
associated chemical burns was prevented . suggested method for tourniquet application with elastic stockinette and wool padding .
note the adhesive plaster ( black arrow ) ( a ) and antimicrobial incise drape ( white arrow ) ( b ) used for mechanical barrier the chemical burn due to pneumatic tourniquet is a relatively under - reported problem which may be more frequent than believed .
the pi related chemical burn in tourniquet use may be prevented by understanding the mechanism of occurrence of this complication to prevent this devastating iatrogenic injury . | chemical burn under pneumatic tourniquet is an iatrogenic preventable injury and is rarely reported in the literature .
the two important mechanisms are maceration ( friction ) and wetness underneath the tourniquent . in this report , our experience with two illustrative patients who presented with iatrogenic tourniquet associated burn is described . |
the incretin effect is the potentiation of the glucose - mediated insulin secretion due to the gut hormones , namely , glucose - dependent insulinotropic polypeptide ( gip ) and glucagon - like peptide-1 ( glp-1 ) .
they are released by the intestine in the blood stream after oral glucose load , such as during an oral glucose tolerance test or a meal .
the incretin effect has been demonstrated by comparing insulin concentration during oral and intravenous glucose administration that yielded the same peripheral glucose concentration ; however , insulin concentration was significantly higher after the oral load .
since this happened despite the same glucose levels than with the intravenous load , the difference in insulin concentration was ascribed to the effect of the incretin hormones . in type 2
diabetic patients , a reduction of this effect has been reported [ 3 , 4 ] and pharmacological agents have been developed to restore this effect , important for maintaining a good glucose homeostasis .
women with former gestational diabetes ( fgdm ) exhibit markedly increased risk for the later development of type 2 diabetes and related complications .
they often present metabolic abnormalities in insulin sensitivity compared to control subjects , but even greater differences have been observed for beta - cell function . in a previous study on fgdm ,
we have assessed beta - cell function by the analysis of two independent tests , intravenous ( ivgtt ) and oral ( ogtt ) glucose tolerance tests and found that the impairment in beta - cell function was observable only with ogtt .
we hypothesize that the incretin effect may play a pivotal role in the subtle derangement of beta - cell function observed in fgdm .
therefore , the aim of this study was to evaluate the incretin effect in a larger group of fgdm , who underwent both ivgtt and ogtt immediately after partum .
they were also divided according to their glucose tolerance to evaluate if it plays some role on the possible changes of the incretin effect in fgdm .
a total of 104 fgdm were studied within 6 months after delivery and compared to 35 healthy women after normal pregnancy ( cnt ) .
table 1 shows the main characteristics of the two groups ; body mass index ( bmi ) of fgdm was borderline higher , but in general still in the overweight range .
every subject randomly underwent a 75 g ogtt with sampling at 10 , 20 , 30 , 60 , 90 , 120 , 150 , 180 min and a 0.33 g / kg frequently sampled intravenous glucose test ( ivgtt ) with insulin ( 0.03 iu / kg , humulin r ; eli lilly , indianapolis , in , usa ) intravenous infusion at time 20 for 5 min .
less than 3 weeks elapsed between the two tests , without any diet or habit changes in between .
both tests lasted 3 h ; glucose and c - peptide were determined in duplicate by commercially available radioimmunoassay kits with an interassay coefficient of variation < 5% .
further details on the performance of the two tests were reported previously [ 7 , 8 ] . out of 104 fgdm , 77 resulted with normal glucose tolerance ( fgdmngt ) according to the ogtt criteria of the american diabetes association , 6 with type 2 diabetes and 21 with impaired glucose regulation ( fgdmigr ) , which included both impaired fasting glucose and impaired glucose tolerance .
all cnt exhibited normal glucose tolerance . for the purpose of this study , we calculated the area under the concentration curves ( auc ) for glucose ( aucgl ) and c - peptide ( auccp ) for 3 h in both tests , by using the trapezoidal rule .
the suprabasal , dynamic auc ( dauc ) were computed by subtracting from the auc the basal area ( i.e. , fasting value 180 min ) .
the beta - cell function describes the ability of glucose to stimulate insulin release from the beta - cell .
beta - cell function during ogtt ( bcog ) and that during ivgtt ( bciv ) were calculated according to the respective ratio dauccp / daucgl in both tests : units nmolcp / mmolgluc .
the incretin action occurs only during an oral administration of glucose ; thus , it can be estimated by subtracting the glucose stimulated secretion during the ivgtt from that evaluated during the ogtt : the formula 100 ( bcog bciv)/bcog yields therefore the percent incretin effect .
this approach has been already successfully exploited in previous studies [ 9 , 10 ] . in order to evaluate whether different glucose tolerance within the fgdm plays a role in the assessment of beta - cell function and incretin effect , these parameters were also computed in the single subgroups of normotolerant and impaired metabolism .
data are expressed as mean se ; means have been compared with the student 's t - test .
fasting and total auc glucose in both tests were markedly higher in fgdm ( table 1 ) ; fasting c - peptide was not different , while the dynamic c - peptide response to glucose stimulation only tended to be higher in fgdm , but only with borderline significance .
suprabasal auc of glucose ( daucgl ) , which represents the main stimulus to the secretory response of the beta - cell , was higher in fgdm than that of cnt for both tests ( 338 20 mmol / l 3 h versus 189 21 , p = 0.0001 for ogtt ; 206 13 versus 119 16 , p = 0.0002 for ivgtt ) .
dynamic insulin secretion , dauccp was not different between fgdm and cnt in both tests , but much higher ( p < 0.00001 ) during ogtt ( 285 9 nmol / l 3 h versus 257 15 , p = 0.13 fgdm versus cnt for ogtt ; 61 3 versus 55 5 , p = 0.36 for ivgtt ) .
beta - cell function and incretin effect are shown in table 2 , where fgdm was also divided into fgdmngt and fgdmigr , the latter presenting with higher bmi . from these subgroups
the 6 type 2 diabetics were excluded , since their small number allowed no statistical power for any possible comparison .
bcog was markedly higher than bciv in both fgdm and cnt ( p = 0.003 ) ; both bcog and bciv were lower in fgdm ( all together ) compared to cnt ; and were lower in fgdmigr compared to fgdmngt . when comparing the normotolerant fgdmngt to cnt , both bcog and bciv were not different , while beta - cell functions of fgdmigr were significantly lower than those of cnt .
incretin effect resulted similar between fgdm all together and cnt ; that of fgdmngt was not different from that of cnt ( p value ranging in both cases 0.20.8 ) ; while that of fgdmigr was significantly lower than that of women with normal pregnancy ( table 2 ) .
when incretin effect was normalized to bmi , to take into account that the main determinant of igr was the increased bmi , the differences in the incretin effect were even more substantial .
the value for cnt was 2.77 0.19% m / kg , still higher than that of fgdmigr ( 1.75 0.21 ; p = 0.019 ) , but also the difference with that of fgdmngt ( 2.33 0.11 ) became significant ( p = 0.038 ) .
incretin effect normalized to bmi was 2.21 0.10 ; p = 0.006 versus cnt ) .
within a short period after partum , beta - cell function , evaluated both with the oral and with the intravenous glucose tests , was reduced in a general population of overweight women who exhibited gestational diabetes mellitus during pregnancy .
indeed , in both tests , fgdm exhibited c - peptide release only slightly increased despite markedly higher glucose .
results of this study show that incretins do not play a fundamental role in this observed reduced beta - cell function characterizing fgdm : in fact , the surrogate index of incretin effect used here did not differ from the same index evaluated in a population of healthy women , who had a normal pregnancy , studied within the same period after partum . in both cnt and fgdm ,
the beta - cell function obtained with the ogtt was much higher than that with ivgtt , showing that incretins have a potent effect in both groups .
the elevated beta - cell response during ogtt could mask possible significant differences in the beta - cell sensitivity to glucose between fgdm and cnt ; however , no difference is also highlighted by the ivgtt , which provides the evaluation independent on incretins .
our results on beta - cell function seem to be in contrast with a previous study , where it is reported an unchanged beta - cell function in fgdm .
however , in that study , the authors used the 30 min insulinogenic index with insulin , which is known to be not fully reliable , while the present investigation exploited c - peptide evaluated during the whole 3 h duration of the test : a more reliable figure of the incretin - mediated sensitivity of the beta - cell to the glucose stimulation . to quantify this process
, we have used the percent ( normalized ) difference of the beta - cell function between the tests , which gauges the relative contribution of the incretins in fostering glucose - dependent insulin release .
we have used the beta - cell function instead of the simple aucs as previously done [ 3 , 9 , 10 ] , because the ogtt and the ivgtt did not yield isoglycemic patterns ; thus , we had to normalize the insulin release to glucose with the ratios dauccp / daucgl .
the incretin effect we estimated is a kind of general measurement and can not discriminate between the real effect of the incretins and the possible reduction in fgdm of the incretins production .
in fact , our measurement is an indirect surrogate , since we have not measured the incretin hormones concentration .
having for instance the pattern of glp-1 , we could apply another straightforward method that quantifies the direct incretin action , independently on the actual hormone secretion .
some investigators found a mildly reduced glp-1 response to oral glucose only during the first 30 min , while the entire 2 h glp-1 auc did not differ from that of the control subjects .
this was substantiated by other studies that reported no differences in the secretion of incretin hormones after oral glucose ingestion in women with a history of gestational diabetes .
therefore , we are quite confident that the incretin effect we observed in our study is prevalently due to the action of incretins in sensitizing the beta - cell .
a recent report showed that incretin effect is reduced with obesity , which is known to be characterized by insulin resistance and reduced glucose tolerance .
these findings in a general population were then verified in our fgdm , who were divided into normo- and impaired tolerant . to the best of our knowledge ,
. the reason may be in the fact that igr have a slightly higher bmi , though not reaching overt obesity yet .
this fact corroborates more our point , since it is known that obesity is accompanied by hyperinsulinemia before the onset of overt diabetes .
thus the circumstance that fgdmigr still presents reduced beta - cell sensitivity to glucose , despite higher bmi , appears to be an intrinsic defect of this population . in fact , when the incretin effect was normalized to bmi , fgdmngt too had a lower index , despite similar bmi than cnt . since the majority of fgdm return normal after delivery , in general
, we can claim that a reduced incretin effect likely remains a characteristic of this condition .
in conclusion , normotolerant women with previous gestational diabetes exhibit an incretin effect similar to that of healthy women , who had a normal pregnancy .
compromised incretin effect , proper of obese and type 2 diabetic subjects , characterizes instead fgdm with impaired glucose tolerance , probably related to their , though slightly , augmented body weight . when the incretin effect was evaluated after normalization to bmi , it resulted in reduced in both categories , giving the impression of an intrinsic characteristic of fgdm , regardless of their glucose tolerance .
the diminished incretin effect of fgdm seems therefore to reflect an early abnormality of the general beta - cell dysfunction in the progression toward type 2 diabetes . | background and aims . women with former gestational diabetes ( fgdm ) are characterized by impaired beta - cell function ( bc ) .
incretin hormones contribute to insulin secretion after oral administration of glucose .
we aimed to assess the possible role of incretins on altered insulin release in fgdm .
materials and methods .
we studied 104 fgdm women within 6 months after delivery and 35 healthy women after normal pregnancy ( cnt ) with a 75 g oral ( ogtt ) and a 0.33 g / kg intravenous ( ivgtt ) glucose test , both lasting 3 h. the ratio of suprabasal areas under the concentration curves for glucose ( daucgl ) and c - peptide ( dauccp ) evaluated bc during ogtt ( bcog ) and ivgtt ( bciv ) .
incretin effect was computed in all fgdm and in fgdm with normal tolerance ( fgdmngt ) and with impaired glucose regulation ( fgdmigr ) .
results .
daucgl of fgdm was higher ( p < 0.0001 ) than cnt for both tests ; while dauccp were not different .
bcog and bciv were lower in fgdm versus cnt ( 1.42 0.17nmolcp / mmolgluc versus 2.53 0.61 , p = 0.015 and 0.41 0.03 versus 0.68 0.10 , p = 0.0006 , respectively ) .
ie in cnt ( 66 4 % ) was not different from that of all fgdm ( 59 3 ) and fgdmngt ( 60 3 ) , but higher than that of fgdmigr ( 52 6 ; p = 0.03 ) .
ie normalized to bmi was 2.77 0.19 % m2/kg in cnt , higher than that of fgdmigr ( 1.75 0.21 ; p = 0.02 ) and also of fgdmngt ( 2.33 0.11 ; p = 0.038 ) . conclusion .
compromised ie characterizes fgdmigr . in both fgdm categories , regardless their glucose tolerance , ie normalized to bmi was reduced , signifying an intrinsic characteristic of fgdm .
therefore , the diminished ie of fgdm seems to reflect an early abnormality of the general beta - cell dysfunction in the progression toward type 2 diabetes . |
it is associated with an accelerated decline in lung function , increased hospitalization ( 1 ) , and an increase in all - cause mortality ( 2 ) .
the prevalence of chronic cough and sputum production consistently augment with increasing airflow limitation ( 3 ) .
a few reports underline that chronic cough and sputum production before airflow obstruction can offer a unique opportunity to identify subjects at risk for chronic obstructive pulmonary disease ( copd ) for an early intervention ( 4 ) .
chronic sputum has been recognized as a result of tobacco smoking and exposure to industrial dusts or fumes .
other causes of chronic sputum include many respiratory diseases , such as copd , lung cancer , respiratory tract infection , bronchiectasis , etc .
prevalence of chronic sputum varies from 1.2 to 13% according to the country ( 2 , 8 , 9 , 10 )
. however , there are a few studies that assess the prevalence and risk factors of chronic sputum production in the general population , but no report about the prevalence and risk factors of chronic sputum in korea .
this study was planned to estimate the prevalence of chronic sputum and to study its associated factors in a general korean population aged over 40 yr .
this study collected information from the first and second periods of the 5th korea national health and nutrition examination survey ( knhanes v ) 2010 and 2011 .
knhanes is a cross - sectional survey that consists of a health interview , a health behavior questionnaire , a health examination , and a nutrition survey for the general population of korea ( 11 , 12 , 13 , 14 ) .
knhanes subjects include a representative national sample of the korean population who were selected using a complex , stratified , multistage probability cluster sampling design ( 12 , 13 , 14 ) .
because the spirometry and respiratory questionnaire were not performed on adults aged < 40 yr who participated in the knhanes ( 15 ) , the sample for this study was limited to adults aged 40 yr . the subjects eligible for the present study were those who 1 ) participated in the knhanes v and aged 40 yr old , 2 ) had lung function measurements , 3 ) had a response to the question : " have you had sputum almost every day at least three consecutive months one year ? " .
demographic data selected from knhanes v included age , gender , level of education , occupation , type of house , smoking status , pulmonary function test , and tuberculosis .
chronic sputum was defined as daily emission of sputum that lasted for at least 3 months a year , for more than 1 yr ( 16 ) .
airflow obstruction was defined as a ratio of the forced expiratory volume in 1 second ( fev1 ) to the forced vital capacity ( fvc ) less than 0.7 , using data from pre - bronchodilator test .
the smoking status was classified as never smokers , past smokers or current smokers ( < 15 pack - years " light smokers , " 15 pack - years " moderate - heavy smokers " ) .
never smokers were defined as subjects who had never smoked . past smokers were defined as subjects who stopped smoking at least in the last year , and current smokers were defined as subjects who continued to smoke ( 10 ) .
occupation was classified into seven categories : managers and professionals , clerks , service and sales workers , skilled agricultural , forestry and fishery workers , plant and machine operators and assemblers , elementary occupations , and unemployed .
the data analysis was carried out utilizing spss version 18 to estimate the prevalence of chronic sputum and to evaluate the associated factors for chronic sputum .
the dummy variable approach was used to derive the odds ratio for each of the variables , which were of categorical nature , such as age , occupation , and education .
the dummy variables were prepared considering each of the classification within the variable as a separate " risk factor " and the remaining subjects as " no risk factor . "
the multivariate analysis was carried out to study the independent association of the factors , which were observed to be significant in the univariate analysis .
differences in pulmonary function parameters between subjects with and without chronic sputum were examined using independent t - test .
all examination protocols were approved by the institutional review board of the korea centers for disease control and prevention ( no .
this study collected information from the first and second periods of the 5th korea national health and nutrition examination survey ( knhanes v ) 2010 and 2011 .
knhanes is a cross - sectional survey that consists of a health interview , a health behavior questionnaire , a health examination , and a nutrition survey for the general population of korea ( 11 , 12 , 13 , 14 ) .
knhanes subjects include a representative national sample of the korean population who were selected using a complex , stratified , multistage probability cluster sampling design ( 12 , 13 , 14 ) .
because the spirometry and respiratory questionnaire were not performed on adults aged < 40 yr who participated in the knhanes ( 15 ) , the sample for this study was limited to adults aged 40 yr . the subjects eligible for the present study were those who 1 ) participated in the knhanes v and aged 40 yr old , 2 ) had lung function measurements , 3 ) had a response to the question : " have you had sputum almost every day at least three consecutive months one year ? " .
demographic data selected from knhanes v included age , gender , level of education , occupation , type of house , smoking status , pulmonary function test , and tuberculosis .
chronic sputum was defined as daily emission of sputum that lasted for at least 3 months a year , for more than 1 yr ( 16 ) .
airflow obstruction was defined as a ratio of the forced expiratory volume in 1 second ( fev1 ) to the forced vital capacity ( fvc ) less than 0.7 , using data from pre - bronchodilator test .
the smoking status was classified as never smokers , past smokers or current smokers ( < 15 pack - years " light smokers , " 15 pack - years " moderate - heavy smokers " ) .
never smokers were defined as subjects who had never smoked . past smokers were defined as subjects who stopped smoking at least in the last year , and current smokers were defined as subjects who continued to smoke ( 10 ) .
occupation was classified into seven categories : managers and professionals , clerks , service and sales workers , skilled agricultural , forestry and fishery workers , plant and machine operators and assemblers , elementary occupations , and unemployed .
the data analysis was carried out utilizing spss version 18 to estimate the prevalence of chronic sputum and to evaluate the associated factors for chronic sputum .
the dummy variable approach was used to derive the odds ratio for each of the variables , which were of categorical nature , such as age , occupation , and education .
the dummy variables were prepared considering each of the classification within the variable as a separate " risk factor " and the remaining subjects as " no risk factor . "
the multivariate analysis was carried out to study the independent association of the factors , which were observed to be significant in the univariate analysis .
differences in pulmonary function parameters between subjects with and without chronic sputum were examined using independent t - test .
all examination protocols were approved by the institutional review board of the korea centers for disease control and prevention ( no .
in the 2010 - 2011 knhanes v , 9,159 subjects aged 40 yr were included . among them
, 2,317 subjects did not undergo spirometry and 59 were excluded because of missing or inadequate answer to the question for chronic sputum .
a total of 6,783 subjects were eligible for the present study : 430 with chronic sputum , 6,353 without chronic sputum ( fig .
the mean age of the participants was 57 yr ( range : 40 - 97 ) .
most of the males were smokers ( 2,539 , 85.3% ) , whereas most of the females were never smokers ( 3,473 , 92.5% ) . among smokers , moderate to heavy smokers were more than light smokers .
the prevalence of copd was 12.9% , higher in men ( 21.5% ) than in women ( 6.0% ) .
the number of subjects with current tuberculosis treatment or a history of tuberculosis was 391 ( 5.8% ) .
the prevalence of chronic sputum in the population studied was 6.3% ( n=430 ) . among the subjects with chronic sputum
the prevalence of chronic sputum was higher in men than in women ( or , 2.517 ; 95% ci , 2.051 - 3.089 ) , was positively associated with age ( 70 yr ) ( or , 1.808 ; 95% ci , 1.355 - 2.411 ) , and was higher in both past and current smokers than in never smokers ( or , 1.675 ; 95% ci , 1.284 - 2.186 , or , 4.378 ; 95% ci , 3.489 - 5.493 , respectively ) , especially in moderate to heavy smokers ( or , 3.488 ; 95% ci , 2.803 - 4.340 ) .
also , copd and tuberculosis were associated with an increased risk of chronic sputum ( or , 2.580 ; 95% ci , 1.991 - 3.342 , or , 2.266 ; 95% ci , 1.650 - 3.111 , respectively ) .
the level of education , occupation , and type of house were not associated with a risk of chronic sputum .
the multivariate logistic regression analysis was carried out to find the independent factors associated with chronic sputum ( table 3 ) , utilizing the factors that were significant in the univariate analysis .
independent association with chronic sputum was observed for age , copd , tuberculosis , and smoking , but not for gender . because odds ratio for chronic sputum increased with age , the older age groups had higher risk . regarding smoking status , current smoking was a significantly associated factor for chronic sputum .
pulmonary function parameters between subjects with and without chronic sputum are shown in table 4 . compared with subjects without chronic sputum , significant reduction of fev1 ( % predicted ) , fvc ( % predicted ) , and
the present study evaluated the prevalence of chronic sputum and its associated factors in a general korean population .
older age , copd , tuberculosis , and current smoking were independently associated with chronic sputum .
previous studies from other countries reported that the prevalence of chronic sputum varied from 1.2 to 13% ( 2 , 8 , 9 , 10 ) . in a cross - sectional survey by mahesh et al .
( 10 ) , the prevalence of chronic sputum was found to be 1.2% in india , and significant association was observed between chronic sputum , age , and smoking in 4,333 adults aged more than 40 yr living in the rural area of india . in another cross - sectional survey by cerveri et al .
( 8) , the prevalence of chronic sputum was 11.9% in italian people aged between 20 - 44 yr , and the survey showed that gender ( female ) , smoking , and low socioeconomic status were significantly and independently associated with chronic cough and sputum , with current smoking being the major associated factor .
the prevalence of chronic sputum in the present study was in the intermediate range ( 6.3% ) compared with other countries .
increasing age was found to be an important factor associated with chronic sputum in our study , probably reflecting a higher prevalence of diseases associated with chronic sputum , like bronchiectasis , and a longer duration of exposure to other risk factors .
the prevalence of chronic sputum of 8.7% seen in subjects above 70 yr was less than the prevalence observed in another study ( 2 ) that included subjects above 65 yr , but more than that in the indian study ( 10 ) .
current smoking was found to be an important association identified in this study for chronic sputum , and both light and moderate to heavy smokers had a higher prevalence of chronic sputum than never smokers . a dose response relationship ( association between amount of smoking and chronic sputum )
was observed in multivariate analysis , when the amount of smoking was included as a variable ( data not shown ) .
previous studies ( 8 , 10 , 18 ) have demonstrated that smoking is a major risk factor for many respiratory diseases and symptoms with a dose - response relationship .
this supports that smoking is an important factor for chronic sputum irrespective of geographical location as well as other smoking - related diseases ( 10 , 19 , 20 ) , and that smoking cessation should be encouraged in subjects with chronic sputum to relieve their symptoms .
it is well known that chronic sputum is one of common symptoms in copd ( 5 ) .
chronic mucus hypersecretion was considered as a marker of airway inflammation ( 1 , 21 ) .
sputum production has been shown to associate with cellular and structural components of inflammation in copd ( 22 ) .
also , it has been considered as an important indicator of respiratory morbidity and mortality .
( 1 ) reported that chronic cough and sputum production were associated with an excessive fev1 decline and increased risk of hospitalization because of copd .
these symptoms were associated not only with increased mortality risk ( 23 , 24 ) but also with exacerbations of copd ( 16 , 25 ) .
current tuberculosis or history of tuberculosis was independently associated with chronic sputum in the present study .
we speculated that these are probably due to inflammation of respiratory tracts , complication of tuberculosis , such as bronchiectasis ( 26 ) , extensive pulmonary destruction ( 26 , 27 ) , and chronic pulmonary aspergillosis ( 28 ) .
other risk factors or diseases can be also responsible for chronic sputum in the community .
for instance , underlying respiratory diseases , such as rhinitis , sinusitis , asthma , bronchiectasis , or cystic fibrosis can cause chronic sputum by increasing mucus production ( 29 , 30 , 31 ) .
moreover , comorbidities such as gastroesophageal reflux , diabetes , cerebrovascular disease , neuromuscular disease can cause chronic sputum by increasing risk of pulmonary aspiration ( 32 , 33 ) .
in addition , biomass fuel exposure in rural area is associated with diverse respiratory disease that can cause chronic sputum ( 34 ) .
however , knhanes v did not obtain enough information about various underlying respiratory diseases and comorbidities .
accompanying symptoms of chronic sputum , such as chronic cough , increasing dyspnea , and increased sputum volume / purulence should be investigated , because these symptoms can provide important clinical information about pathology in the bronchopulmonary system ( 29 , 35 ) .
however , we could not describe other symptoms except chronic cough , because knhanes v did not obtain information about other respiratory symptoms .
baseline dermographic characteristics of all subjects aged 40 yr in knhanes v were similar to those finally included in the present study .
in addition , age , tuberculosis , smoking , and copd were also significant risk factors for chronic sputum when we analyzed the data from all participants in knhanes v. these results suggest that sample selection bias was not meaningful in this study .
first , we could not evaluate all age group because the spirometry and respiratory questionnaire were performed only on adults aged 40 yr .
second , knhanes v did not obtain enough information about underlying respiratory related diseases , comorbidities , and accompanying symptoms that can be related with chronic sputum as mentioned in the above paragraphs .
there is a need for studies to identify more various diseases and factors other than copd and tuberculosis responsible for chronic sputum in the community .
finally , given the cross - sectional nature of the surveys , we were unable to determine causal relationships between chronic sputum production and other independent variables .
this study has powerful strength , because the subjects of the current study are representative of the general korean population . in conclusion ,
our findings demonstrate that the prevalence of chronic sputum in the korean general population is in the intermediate range compared to other countries .
current smoking is an important preventable risk factor identified in this study , and efforts towards smoking cessation are important for respiratory health .
furthermore , major respiratory diseases , such as copd and tuberculosis , should be considered in subjects with chronic sputum . | chronic sputum is a troublesome symptom in many respiratory diseases .
the prevalence of chronic sputum varies from 1.2% to 13% according to the country .
the purpose of this study was to estimate the prevalence of chronic sputum and to find its associated factors in a general korean population .
we analyzed the data of the korea national health and nutrition examination survey 2010 and 2011 .
a total number of 6,783 subjects aged 40 yr or more were enrolled in this study with 3,002 men and 3,781 women . as a result ,
the prevalence of chronic sputum was 6.3% ( n=430 ) .
significant risk factors for chronic sputum by multivariate analysis were : age ( 70 yr ) ( odds ratio [ or ] , 1.954 ; 95% confidence interval [ ci ] , 1.308 - 2.917 ) , current smoking ( or , 4.496 ; 95% ci , 3.001 - 6.734 ) , chronic obstructive pulmonary disease ( copd ) ( or , 1.483 ; 95% ci , 1.090 - 2.018 ) , and tuberculosis ( or , 1.959 ; 95% ci , 1.307 - 2.938 ) .
in conclusion , the prevalence of chronic sputum in korea was in the intermediate range compared with other countries .
smoking is a preventable risk factor identified in this study , and major respiratory diseases , such as copd and tuberculosis , should be considered in subjects with chronic sputum.graphical abstract |
the safety profile of hibmency was compared with licensed hib conjugate vaccines in a pooled analysis that included more than 8,500 subjects who were administered a four - dose series of hibmency or commercially available hib vaccines at 2 , 4 , 6 and 1215 mo of age in two primary vaccination and two fourth dose phase 3 studies . in all studies , hibmency or
hib vaccine was co - administered with age - appropriate , routinely recommended vaccines . in one primary and one fourth dose study ( n = 4180 ) , local and general symptoms were solicited using diary cards for 4 d after each dose .
serious adverse events ( saes ) and the occurrence of adverse events ( aes ) indicating new onset of chronic disease ( nocd ) , rash , and conditions prompting emergency room ( er ) visits were reported from dose 1 until 6 mo after dose 4 .
the incidences of solicited local and general symptoms were similar following hibmency and commercially available hib vaccines .
for some solicited symptoms ( pain at the injection site and irritability ) , rates were lower in the hibmency group compared with the hib control group ( p value < 0.05 ) . there were no statistically significant differences between groups in the incidences of saes , nocds , rash , or aes leading to er visits , with the exceptions of anemia and viral gastroenteritis , which occurred significantly less frequently in those receiving hibmency than those receiving commercially available hib vaccines . in this pooled safety analysis ,
the safety profile of hibmency was similar to the safety profile of licensed monovalent hib vaccines , despite the addition of meningococcal antigens .
these studies are registered at www.clinicaltrials.gov nct00345579 ( primary vaccination study ) , nct00345683 ( fourth dose vaccination study ) and nct00289783 ( primary and fourth dose vaccination studies ) |
|
exposure to environmental contaminants poses a significant threat to normal growth and differentiation of the developing brain .
it has also been reported that nervous system is susceptible to toxic chemicals and subsequent developmental perturbation may lead to long - term irreversible consequences that affect nervous system function in adult animals .
benzo[a]pyrene ( b[a]p ) , a polycyclic aromatic hydrocarbon ( pah ) , is known for its neurotoxic potential causing neurobehavioral alterations in animal models .
reports also suggest that exposure to b[a]p through early postnatal development leads to impairment in locomotor activity in adolescence .
a recent report revealed that subchronic oral administration of b[a]p in rats leads to spontaneous locomotor hyperactivity .
behavioral and motor dysfunction following exposure to environmental toxicants like b[a]p is well documented but the neurodegenerative potential of these compounds can not be ignored .
exposure to b[a]p produces neuromuscular , physiological , autonomic abnormalities and also shows decreased responsiveness to sensory stimuli [ 6 , 7 ] .
earlier reports suggest that microinjection of diesel exhaust fraction containing pah into rat hippocampus and striatum leads to neuronal lesions .
epidemiological study also revealed that parental occupational exposure to pah was associated with an increased risk of neuroectodermal tumors in children .
maternal exposure to airborne pahs during pregnancy was associated with a reduction in head circumference , lower iq , and reduced cognitive functioning in children .
investigation into pathophysiological manifestations following exposure to persistent anthropogenic neurotoxicants like benzo[a]pyrene might address new insight into their neurodegenerative potential .
studies have also addressed the effect of highly specific neurotoxin 6-hydroxydopamine ( 6-ohda ) on catecholaminergic neurons with an extensive and irreversible loss of dopaminergic neurons in the mesencephalon which is associated with behavioral deficits [ 1113 ] .
investigation of potential environmental neurotoxicants like b[a]p in animal model provides a new insight into serious human neurodegenerative diseases .
the purpose of the present study was to investigate the neurotoxic potential of b[a]p following intracisternal administration during early phase of postnatal development and its consequences in early adolescent period of rats .
we also investigated the neurotoxic effect of benzo[a]pyrene and its possible association with 6-hydroxydopamine induced neurobehavioral changes during early adolescence period .
the chemicals used in this experimentation were procured from sigma - aldrich chemicals ( st . louis , mo , usa ) , unless otherwise mentioned such as benzo[a]pyrene ( b[a]p , catalogue number b1760 ) , corn oil ( catalogue number c8267 ) , 6-hydroxydomine hydrochloride ( 6-ohda , catalogue number h4381 ) , and paraformaldehyde .
pregnant wistar rats ( rattus norvegicus ) were maintained in home cages in standard laboratory conditions and fed laboratory chow and filtered water ad libitum .
the animals were subjected to 12 hr light and 12 hr dark cycle in standard laboratory environment .
five - day - old male wistar pups were arbitrarily consigned to lactating dams and intracisternal administration of b[a]p and 6-ohda was carried out at postnatal day 5 .
the b[a]p solution was freshly prepared by dissolving 2 g / kg bw of b[a]p into 10 l of corn oil and was subsequently used for intracisternal administration while the control rats received only corn oil ( 10 l ) .
rats of 6-ohda group were injected with 25 g / kg , desipramine in 100 l ( i.p . ) , 30 minutes before 6-ohda injection .
then 150 g / kg bw of 6-ohda dissolved in 10 l of saline ( containing 0.2% ascorbic acid as antioxidant ) was injected into rats of 6-ohda group while rats of control group received 10 l saline solution , respectively .
five - day - old male wistar pups were designated into four groups ( 12 male pups / group ) , namely , control a ( corn oil ) ; b[a]p ( b[a]p dissolved in corn oil ) ; control b ( saline ) ; and 6-ohda ( 6-ohda dissolved in saline ) .
we aimed to study the neurodegenerative potential of b[a]p and its symptomatic similarities with 6-ohda induced neurobehavioral alteration , rather than address the confounding effect as a result of coadministration of these neurotoxicants .
sma of rats at pnd 30 was individually measured in a home cage with a supermex system ( muromachi kikai , ikeda , japan ) .
rats were maintained on a 12 h light : dark cycle during the recording and total distance covered for a period of 24 hr was recorded and the data was represented in 2 hr intervals as absolute time .
food and water were supplied at the beginning of recordings and rats were never disturbed in anyway .
open field activity was monitored in a circular arena ( 75 m diameter and 1.5 cm height ) wall with grey color paint .
the animals were placed individually in a specific side of the wall of the arena and the time spent in the central zone and total distance travelled were automatically monitored for 5 min using any maze software ( stoelting co. , usa ) .
briefly , elevated plus maze consisted of two opposite open arms ( 50 cm long 10 cm wide ) and two enclosed arms ( 50 10 40 cm ) that extended from a common central platform ( 10 10 cm ) , elevated 75 cm above the floor .
time spent in open arm and total distance travelled were recorded and considered as an indicator of general locomotor activity independent of anxiety . the video - tracking system ( any maze software , stoelting co. , usa )
the apparatus was cleaned with 70% ethanol and dried with paper towels before testing with another rodent .
after completion of behavioral recording , rats of all the experimental groups were sacrificed after being deeply anesthetized with sodium pentobarbital and subsequently perfused intracardially with ice - cold 0.1 m phosphate buffer saline ( pbs ) followed by 4% paraformaldehyde .
brain samples were cryoprotected in 30% sucrose in pbs for 48 hr and then serial cryosectioning was carried out for histopathological studies . for biochemical and molecular study ,
rats were sacrificed by cervical dislocation and the requisite brain region was immediately dissected out at 4c in ice - cold 0.1 m pbs and then snap frozen in liquid nitrogen .
quantification of striatal dopamine level was carried out by high performance liquid chromatography - electrochemical detector ( hplc - ecd ) with minor modification .
briefly , 100 mg wet brain tissue ( striatum ) was homogenized by sonification in 0.5 ml of 0.2 m hclo4 ( perchloric acid ) containing isoproterenol as an internal standard substance .
then the supernatant was added with 1 m sodium acetate to adjust the ph 3.0 .
after that 10 l of sample solution was injected into a separation column ( eicompak sc-5ods , i d 3.0 100 mm ) in a hplc - ecd system for measurement of dopamine and the result was expressed as ng / mg of protein .
brains were postfixed in 4% paraformaldehyde for 24 hr and then washed for 24 h under running tap water and dehydrated in graded series of ethanol concentrations ( 50% , 70% , 90% , and 100% ) .
then they were cleared in xylene , embedded in paraffin wax , serially sectioned at 7 mm thickness , and stained with hematoxylin and eosin ( h&e ) .
the slides were observed under microscope and images of striatal region were taken with requisite magnification with the help of a digital camera ( olympus , bx43f , japan ) .
the area and perimeter of the neurons were measured with the help of ocular micrometer .
the mean and standard error of mean of each set , that is , control a , b[a]p , control b , and 6-ohda , were calculated .
the post hoc analysis was done by the newman - keuls test in all experimental groups by using one - way anova .
bonferroni posttest was conducted to study the effect of b[a]p and 6-ohda on sma by using two - way anova and difference below the probability level p < 0.001 was considered statistically significant .
b[a]p administration to rat neonates at pnd 5 led to significant increase in spontaneous motor activity during 24 hr of recording ( f(3,528 ) = 380.8 , p <
similarly , intracisternal administration of 6-ohda to rats pups significantly increased the spontaneous motor activity ( f(3,528 ) = 380.8 , p < 0.001 ) with respect to control b and b[a]p treated rats ( figure 1 ) .
open field test showed significant increase in the stay time at center in b[a]p group as compared to control a ( f(3,44 ) = 11.71 , p < 0.05 ) ( figure 2(a ) ) .
however the total distance travelled in oft was significantly augmented following 6-ohda administration ( f(3,44 ) = 14.69 , p < 0.05 ) as compared to control b group ( figure 2(b ) ) .
similarly , there was a significant increase in total distance travelled in b[a]p treated group when compared to control a ( f(3,44 ) = 14.69 , p < 0.05 ) .
the results showed significant increase in total distance travelled in oft following 6-ohda administration ( f(3,44 ) = 14.69 , p < 0.05 ) which showed similar effects following b[a]p administration .
the analysis of the stay time in open arm following b[a]p administration showed significant increase when compared to the control a group ( f(3,44 ) = 84.96 , p < 0.05 ) whereas no significant difference was observed between 6-ohda and control b
the b[a]p and 6-ohda administration also showed significant increase in total distance travelled in epm ( f(3,44 ) = 28.23 , p < 0.05 ) as compared to control a and control b , respectively ( figure 3(b ) ) .
dopamine ( da ) level in striatum significantly ( f(3,20 ) = 14.79 , p < 0.05 ) declined in b[a]p treated group as compared to control a ( figure 4 ) .
comparable depletion of da was detected in striatum following intracisternal administration of b[a]p as compared to 6-ohda group ( f(3,20 ) = 14.79 , p < 0.05 ) ( figure 4 ) .
the histopathological examination of striatal region following h&e staining showed significant increase in abnormal striatal neuron morphology in b[a]p and 6-ohda treated groups ( figure 5(a ) ) .
the mean area ( f(3,20 ) = 7.985 , p < 0.05 ) and perimeter ( f(3,20 ) = 8.603 , p < 0.05 ) of striatal neurons were significantly decreased in b[a]p treated group as compared to control a and similar alleviation of mean area ( f(3,20 ) = 7.985 , p < 0.05 ) and perimeter ( f(3,20 ) = 8.603 , p < 0.05 ) of striatal neurons was also observed in 6-ohda group as compared to control b ( figures 5(b ) and 5(c ) ) .
however , there was a significant increase in pyknotic cell counts in 6-ohda group when compared with b[a]p .
polycyclic aromatic hydrocarbons ( pahs ) are predominantly anthropogenic in source and are liberated as a consequence of partial combustion carbon containing organic compounds [ 21 , 22 ] .
benzo[a]pyrene ( b[a]p ) is extensively used as a prototype of pah which demonstrates significant genotoxicity .
further , humans and rodents differ with respect to their sensitivity to varying doses of b[a]p and previous findings suggested that humans were 10100 times more sensitive to toxic effects of b[a]p than rodents .
additionally , infants and children are exceptionally susceptible to environmental neurotoxicants at levels far below those known to harm adults . as the early phase of postnatal life
is involved with rapid phase of growth and development , it becomes a target of exposure to environment neurotoxicants , the rapid growth period in rat neonates straddling the first ( 1 - 2 ) weeks of life to acquire numerous novel motor and sensory skills during the early stage of development .
b[a]p induced motor dysfunction leading to spontaneous motor hyperactivity in rodents addresses possible consequences of serious neurological problems .
several studies have been conducted to show spontaneous motor dysfunction and its association with neurodegenerative symptoms following administration of potent neurotoxicants [ 26 , 27 ] .
this neurodegenerative predisposition is potentially related to alleviated dopamine level at striatum . during early stage of postnatal development striatal dopaminergic neurons
regulate the storage and release of dopamine . as the blood - brain barrier is not fully developed in rat neonates , 6-ohda , a potent neurotoxicant , might adversely affect the brain development during early adolescence period .
hence , the present study was conducted at pnd 5 in male wistar pups following single intracisternal administration of b[a]p that showed significant increase in spontaneous motor activity at pnd 30 .
further investigation showed that neonatal 6-ohda administration leads to spontaneous motor hyperactivity in adolescent rats and the findings are in agreement with previous reports .
our results demonstrated that 6-ohda administration leads to significant increase in total distance travelled in both oft and epm and similar behavioral change was also found after b[a]p administration .
the motor dysfunction following b[a]p administration was found to be positively associated with the neurobehavioral manifestation induced by potent neurotoxicant , that is , 6-ohda , and the above findings are in agreement with previous reports [ 32 , 33 ] .
the behavioral observations as stay time in oft and epm significantly increased in the group to which b[a]p was administered as compared to control .
however , no significant difference was observed after 6-ohda administration , from which it can be inferred that intracisternal b[a]p administration has anxiolytic potential and the findings are in agreement with the previous report .
we extended our findings to ascertain the possible relationship of neurobehavioral manifestation induced by intracisternal administration of b[a]p with that of dopamine level in striatum of adolescent rats .
our results showed significant alleviation of striatal dopamine level following b[a]p administration and the result finds support from previous report . similarly
, 6-ohda administration leads to significant decrease in dopamine level as compared to b[a]p and the above findings are in agreement with previous report [ 34 , 35 ] .
the possible effect of neonatal b[a]p administration on striatal dopamine level during adolescence was found to be linked with the effect of 6-ohda .
the findings of striatal dopamine alleviation by b[a]p administration were significantly associated with altered histopathological observation .
our results demonstrated a significant decrease in area and perimeter of striatal neurons following b[a]p administration .
the above findings are comparable with the neurodegenerative symptoms exhibited by 6-ohda and our results are supported by previous report .
the possible neurodegenerative consequences following b[a]p administration at pnd 5 and its neurobehavioral manifestation in adolescent rats may be associated with reduced striatal dopamine level .
the basic findings of the present study indicate that 6-ohda produces alterations in behavior that are similar to those produced by b[a]p .
in conclusion , the findings suggest that early postnatal life is highly susceptible to environmental neurotoxicants leading to neurobehavioral perturbation in adolescence .
early exposure to potent environmental neurotoxicants like b[a]p may lead to reduction in dopamine neurotransmitter level that can cause striatal neurodegeneration .
we addressed a pioneer effect of b[a]p exposure during early postnatal life leading to neurodegenerative processes and its symptomatic similarities with progressive neurodegenerative diseases . | exposure to persistent genotoxicants like benzo[a]pyrene ( b[a]p ) during postnatal days causes neurobehavioral changes in animal models . however , neurotoxic potential of b[a]p and its association with 6-hydroxydopamine ( 6-ohda ) induced neurobehavioral changes are yet to be explored .
the growth of rat brain peaks at the first week of birth and continues up to one month with the attainment of adolescence .
hence , the present study was conducted on male wistar rats at postnatal day 5 ( pnd 5 ) following single intracisternal administration of b[a]p to compare with neurobehavioral and neurotransmitter changes induced by 6-ohda at pnd 30 .
spontaneous motor activity was significantly increased by 6-ohda showing similar trend following b[a]p administration .
total distance travelled in novel open field arena and elevated plus maze was significantly increased following b[a]p and 6-ohda administration .
neurotransmitter estimation showed significant alleviation of dopamine in striatum following b[a]p and 6-ohda administration .
histopathological studies of striatum by hematoxylin and eosin ( h&e ) staining revealed the neurodegenerative potential of b[a]p and 6-ohda .
our results indicate that b[a]p - induced spontaneous motor hyperactivity in rats showed symptomatic similarities with 6-ohda . in conclusion
, early postnatal exposure to b[a]p in rats causing neurobehavioral changes may lead to serious neurodegenerative consequences during adolescence . |
the world health organization defines suicide act as the injury with varying degrees of lethal intent and that suicide may be defined as a suicidal act with fatal outcome .
deliberate self - harm is a major issue in the health care all over the world .
many factors including biological , socio - cultural , and personality traits can modify this complex behavior .
suicide is a significant problem in india also with a reported rate of 10.8 per 100,000 population
. however it may be considerable under estimate due to underreporting and false reporting of many of the cases of suicides in india .
however , some of the important psychosocial variables such as life events or stressors , social support , coping strategies , and quality of life have not yet been assessed in relation to deliberate self - harm in india .
life change could act as a stressor causing physiological arousal and enhanced susceptibility for illness .
suicide victims have experienced more changes in living conditions , work problems , and object losses than normal controls .
a review of indian studies on stressors in suicide shows maladjustment with significant family members and domestic strife as the most important causes , followed by physical factors and mental illness .
however , most of the indian studies have not used a proper scale to assess life events and many of them were descriptive and retrospective studies . a body of research in recent years has focused on the role of social support in maintaining emotional well - being and moderating the effects of life events . there is evidence that social network among suicide attempters are weaker than in nonsuicidal individuals .
life events can alter the social support system in terms of size , frequency of interaction and stability , and such changes may be associated with suicidal behaviors . coping behavior , or the things people do to reduce the stress , has been a variable that has recently become the focus of research .
coping behavior is operationally defined as the responses to external life stress that serve to prevent , avoid , reduce or control stress and emotional distress .
reported a negative correlation with minimization , replacement , mapping , and reversal , and a positive correlation with suppression , blame and substitution in suicide victims .
quality of life is another factor to assess with regard to suicide risk and a focus recent research in suicidology .
it has been increasingly recognized in recent years that people who attempt suicide have certain individual predispositions , part of which is given by personality traits , in particular , impulsive , aggressive , and violent proneness .
studies from india and west show identifiable personality disorder in suicide attempters . considering the paucity of such work from the indian context the present study was conducted to analyze and compare the type and severity of life events , coping strategies and social support , and quality of life of suicide attempters and matched normal controls and to identify the risk factors leading to suicide attempt .
the sample comprised 50 suicide attempters qualifying the criteria for suicide attempt as defined by who admitted to different departments of a general hospital .
patients below the age of 18 years and those whose physical condition did not allow detailed evaluation were excluded from study . wherever possible , relatives , friends , and other possible sources of information such as spouse and colleagues were also interviewed for eliciting further information .
age , sex , and marital status - matched healthy controls from the community formed the comparison group .
these subjects were initially screened by ghq-12 version to exclude the presence of common mental disorders .
those who scored ( cut - off score 2/3 mode ) were excluded from the control group .
a specially designed proforma was used for documenting socio - demographic variables , illness variables , and details of the current suicide attempt .
presumptive stressful life events scale the scale consists of 51 life events commonly experienced by the normal indian adult population .
scale items were further classified into ( a ) desirable , undesirable or ambiguous and ( b ) personal or impersonal ( not dependent on the individual action ) .
life event data collected from each patient were compared with life event data about the patient given by his relative and was found to be satisfactory ( 0.8 ) .
social support questionnaire the scale was specially developed by poling items from social support scale of asha and the social support scale of nehra , kulhara , and verma by item analysis .
the positive statements were intermingled with negative statements to reduce the likelihood of response set occurring .
aecom coping style scale this is a 95-item scale with a four - possibility spectrum ranging from never to very often . the scale measures eight basic coping styles that may be used for reducing stress and coping with life problems .
these coping styles are ( 1 ) suppression , ( 2 ) help seeking , ( 3 ) replacement , ( 4 ) blame , ( 5 ) substitution , ( 6 ) mapping , ( 7 ) reversal , and ( 8) minimization .
the internal validity of the scale was found to have an value of between 0.58 and 0.79 with a mean value of 0.70 .
the scale has been shown to have good discriminant validity , sound content validity , and good test -- retest reliability at several international whoqol centers .
for comparison of quantitative variables we used a paired t - test or wilcoxon signed rank test applied depending on whether the data were normally distributed or not .
the sample comprised 50 suicide attempters qualifying the criteria for suicide attempt as defined by who admitted to different departments of a general hospital .
patients below the age of 18 years and those whose physical condition did not allow detailed evaluation were excluded from study . wherever possible , relatives , friends , and other possible sources of information such as spouse and colleagues were also interviewed for eliciting further information .
age , sex , and marital status - matched healthy controls from the community formed the comparison group .
these subjects were initially screened by ghq-12 version to exclude the presence of common mental disorders .
those who scored ( cut - off score 2/3 mode ) were excluded from the control group .
a specially designed proforma was used for documenting socio - demographic variables , illness variables , and details of the current suicide attempt .
presumptive stressful life events scale the scale consists of 51 life events commonly experienced by the normal indian adult population .
scale items were further classified into ( a ) desirable , undesirable or ambiguous and ( b ) personal or impersonal ( not dependent on the individual action ) .
life event data collected from each patient were compared with life event data about the patient given by his relative and was found to be satisfactory ( 0.8 ) .
social support questionnaire the scale was specially developed by poling items from social support scale of asha and the social support scale of nehra , kulhara , and verma by item analysis .
the positive statements were intermingled with negative statements to reduce the likelihood of response set occurring .
aecom coping style scale this is a 95-item scale with a four - possibility spectrum ranging from never to very often . the scale measures eight basic coping styles that may be used for reducing stress and coping with life problems .
these coping styles are ( 1 ) suppression , ( 2 ) help seeking , ( 3 ) replacement , ( 4 ) blame , ( 5 ) substitution , ( 6 ) mapping , ( 7 ) reversal , and ( 8) minimization .
the internal validity of the scale was found to have an value of between 0.58 and 0.79 with a mean value of 0.70 .
the scale has been shown to have good discriminant validity , sound content validity , and good test -- retest reliability at several international whoqol centers .
a specially designed proforma was used for documenting socio - demographic variables , illness variables , and details of the current suicide attempt .
presumptive stressful life events scale the scale consists of 51 life events commonly experienced by the normal indian adult population .
scale items were further classified into ( a ) desirable , undesirable or ambiguous and ( b ) personal or impersonal ( not dependent on the individual action ) .
life event data collected from each patient were compared with life event data about the patient given by his relative and was found to be satisfactory ( 0.8 ) .
social support questionnaire the scale was specially developed by poling items from social support scale of asha and the social support scale of nehra , kulhara , and verma by item analysis .
the positive statements were intermingled with negative statements to reduce the likelihood of response set occurring .
this scale has approximately the same number of items from each area . the retest reliability obtained for this scale was 0.89 .
aecom coping style scale this is a 95-item scale with a four - possibility spectrum ranging from never to very often .
the scale measures eight basic coping styles that may be used for reducing stress and coping with life problems .
these coping styles are ( 1 ) suppression , ( 2 ) help seeking , ( 3 ) replacement , ( 4 ) blame , ( 5 ) substitution , ( 6 ) mapping , ( 7 ) reversal , and ( 8) minimization .
the internal validity of the scale was found to have an value of between 0.58 and 0.79 with a mean value of 0.70 .
the questionnaire had both predictive validity and discriminative validity . who qol - bref contains 26 items with four domains 1 .
the scale has been shown to have good discriminant validity , sound content validity , and good test -- retest reliability at several international whoqol centers .
for comparison of quantitative variables we used a paired t - test or wilcoxon signed rank test applied depending on whether the data were normally distributed or not .
the sample comprised 50 suicide attempters and 50 controls matched on age , sex , and marital status .
the mean age of attempters versus control was 30.8213.56 vs. 31.5413.1 ( p=0.787 ) and the male female ratio was male attempters 22 ( 44% ) vs. male control 22 ( 44% ) and female attempters 28 ( 56% ) vs. female control 28 ( 56% ) ( p=1.0 ) . in both groups
sample characteristics comparison of mean scores of different types of life events in attempters versus controls showed significantly higher total life events , and undesirable and personal life events in attempters [ table 2 ] .
comparison of different types of life events comparison of social support variables between attempters and controls showed that the confiding relationship was significantly less ( 35 ( 70% ) vs. 49 ( 98% ) , pearson chi - square p=0.000 ) often present and loneliness was significantly more frequent ( 14 ( 28% ) vs. 3 ( 6% ) , pearson chi - square p = 0.003 ) in attempters .
comparison of various items from the social support scale showed significantly lower scores in attempters , except for religion [ table 3 ] .
comparison of variables in social support scale comparison of different types of coping behavior between attempters and controls showed that scores for minimization , replacement , and mapping were significantly higher in controls [ table 4 ] .
comparison of coping pattern between attempters and controls the mean scores of all the four domains of qol ( physical health and well - being , psychological health and well - being , social relations and environment ) were significantly lower in the attempters [ table 5 ] .
comparison of qol between attempters and controls all factors which were significant in one to one comparison were entered into a stepwise conditioned regression analysis .
the final result showed that the lifetime score of desirable life events , longer education , and good social support were protective factors against suicide [ table 6 ] .
the present study attempted to differentiate suicide attempters from healthy controls based on their profile of life events , social support , coping strategies , psychiatric diagnosis , and quality of life .
attempters had accumulation of life events especially unpleasant and personal events , lower social support , poor coping styles , and poor quality of life .
life events and other psychosocial stressors are commonly associated with suicidal behavior when attempters were compared to the general population and nonsuicidal psychiatric patients osvath et al .
reported recent life events in 80% of suicides ; job problems ( 28% ) , family discord ( 23% ) , somatic illness ( 22% ) , financial problems ( 18% ) , unemployment ( 16% ) , separation ( 14% ) , death ( 13% ) , and illness in a family member . in the present study psychosocial stressors like financial loss ( 34% vs. 14% ) , family conflict ( 30% vs 6% ) , marital conflict ( 18% vs 05 ) , broken engagement , and love failure ( 12% vs. 2% ) and major personal illness ( 10% vs 2% ) were significantly higher in attempters than controls .
hagnell and rorsman found more objective losses and humiliating experience in the week before death among suicide victims than people dying from natural causes and more changes in living condition , work problems , and objects losses in the final year .
maladjustment with significant family members and domestic strife has been cited as the most important causes of attempted suicide in many indian studies the present study also figures out interpersonal problems such as the common life events experienced by attempters .
coping skills are important protective factors against suicide . in the present study healthy coping behaviors such as minimization ( ability to de - emphasize the burden of stressful events ) , replacement ( ability to overcome stressful events by engaging in alternative behaviors ) , and mapping ( ability to collect information for planning and to seek out alternative solutions to problems ) were higher in controls .
reported negative correlation of healthy coping mechanisms such as mapping , minimization , and replacement and positive correlation of coping styles of suppression ( avoiding the problem or situation ) with suicide risk .
some other coping behaviors such as reversal , substitution and help seeking , which have been reported to be excessive in suicide attempters , were not found in this study .
excessive use of substitution in attempters is harmful as it may predispose the individual to suicidal behavior reflecting the destructive nature inherent in excessive dependence on the environment .
social support is provided by networks comprising family , relatives , friends , neighbors , and coworkers , especially when the interaction is positive .
the personal networks may provide social support that helps to maintain emotional well - being and buffer the effect of adverse life events , or it can have a direct , independent effect on mental health irrespective of presence or absence of stressful life events . in the present study , confiding relationship , support from reliable attachment , friends , teachers , parental figures , elders , and other sources were significantly lower and loneliness was higher in attempters .
there is evidence from comparative studies that social support systems are undermined among suicide attempters compared with nonsuicidal individuals .
a psychological autopsy study by vijayakumar and rajkumar from india also showed low religiosity in suicide victims .
social and family factors , negative life events , and medical illness may interact with psychiatric and personality disorders , genetic variables , biological factors , and psychosocial stressors and ultimately act as predisposing and precipitating or contributing factors to suicidal behavior .
morano and cisler reported an influence of recent loss on serious suicide attempts , especially when paired with a perceived lack of family support and hopelessness , which provides evidence for a stress vulnerability model of suicide behavior .
since this is relatively a new area , only few studies have looked into this aspect in suicide attempters .
the score on all the four domains namely physical health and well - being , psychological health and well - being , social relations and environment were significantly lower in attempters in this study .
the association was somewhat stronger in the first decade than in the second decade . throughout the entire follow - up ,
subjects who reported dissatisfaction at baseline and again 6 years later showed a high risk of suicide compared to those who repeatedly reported dissatisfaction .
therefore it is beyond dispute that in a significant number of attempted suicides there are only minor psychiatric problems in the background but ratios mentioned in the literature seem to be exaggerated .
the relationship between suicidal behavior and psychiatric diagnosis has always been a matter of debate pertaining to the indian context with low rate of psychiatric morbidity .
western literature reports that about 90% of all those who attempt suicide suffer from a psychiatric disorder . in a series of studies from the indian context ,
the predominant psychiatric problem was adjustment disorder closely followed by major depression and alcohol abuse / dependence .
moreover several of these attempts were of impulsive type and for 10% of the sample the diagnosis was emotionally unstable personality disorder . in a study from india on suicide attempters ,
han et al . identified personality disorder in 45.9% of his patients who attempted suicide . in the present study
there were quite a few number of alcoholic / drug abusers who attempted suicide ( 14% ) .
a chronic alcoholic in the course of his illness is more likely to face variety of stressors , interpersonal difficulties of weakening of social support all of which could push the person to suicide .
it needs to be mentioned that social drinking is not a way of life in india .
pondichery ( which has a high rate of alcohol consumption ) also has the highest suicide rate in ( 58% ) in india .
wasserman found that the suicide rate came down by 34% in 1984 - 1988 following strict restriction in the sale of alcohol in former ussr .
hence there is an urgent need to address this issue at the societal and individual level .
policies and programs should be initiated for reducing the alcohol availability and consumption and at the individual level there should be better availability and follow - up strategies for the treatment of alcoholics and their families .
stepwise regression analysis shows that desirable life events , good education , and good social support are protective factors against suicide .
desirable life events by virtue of its positive nature may prevent the individual from attempting suicide .
good educational achievement may also help the individual to appraise the situation and to seek alternate solutions .
adequate education is also a prerequisite for problem solving skills and to deal adequately with stressful situations .
though lower education has not been directly cited as a risk factor , lower socio - economic status has been repeatedly shown as risk factor for suicide .
moreover lower education may also invite more adverse life events because of related consequences such as unemployment , poverty , lower social economic status , etc .
lower education and subsequent poor social status can also indirectly reduce the social support vulnerable individuals .
good social support has always been cited as a protective factor against suicide . in an integrative path model analysis of
the relationship between several variables and suicidal ideations found a significant relationship between social support and suicidal ideation .
another one is the selection of a biased control group which was purposefully done to match the psycho - socio - demographic characteristics with the study group in order to reduce the confounding variables as much as possible .
it seems that the quality of individual life events experienced by attempters and controls is unique .
however one to comparison of these events requires higher frequency of events , which can be fulfilled with only larger sample size .
other variables pertaining to suicidal behavior such as personality profile , proneness to violent behavior , and impulsivity should also be considered to differentiate suicidal individuals from controls . in the context of the present study ,
probably studies with long - term follow up would throw more light on suicidal tendency in individuals with lower social support , poor coping skills , poor qol , and excessive life stressors .
an interventional study design may provide more information on the role of enhancing social support , improving coping styles and qol , and exposure to better life experiences in reducing the suicidal tendency .
moreover , only qualitative individual case studies can provide in - depth exploration of multitude of factors operating in this complex behavioral problem .
another one is the selection of a biased control group which was purposefully done to match the psycho - socio - demographic characteristics with the study group in order to reduce the confounding variables as much as possible .
it seems that the quality of individual life events experienced by attempters and controls is unique .
however one to comparison of these events requires higher frequency of events , which can be fulfilled with only larger sample size .
other variables pertaining to suicidal behavior such as personality profile , proneness to violent behavior , and impulsivity should also be considered to differentiate suicidal individuals from controls .
in the context of the present study , the following few suggestions seem to be relevant in planning for future research .
probably studies with long - term follow up would throw more light on suicidal tendency in individuals with lower social support , poor coping skills , poor qol , and excessive life stressors .
an interventional study design may provide more information on the role of enhancing social support , improving coping styles and qol , and exposure to better life experiences in reducing the suicidal tendency .
moreover , only qualitative individual case studies can provide in - depth exploration of multitude of factors operating in this complex behavioral problem .
this study concludes that suicide attempters experienced significantly more life events especially untoward events whereas the control group experienced more desirable and impersonal life events . social support , positive coping behaviors , and qol
desirable life events , good education , and good social support were found to be protective against suicide .
it is the complex interplay of various interrelated factors and the resultant buffering effect , which is protecting the individual against suicide .
the present finding suggests that enhancing the social support , training individuals to adapt good coping skills , exposing the individuals to positive life experiences , promotion of good physical and psychological health and healthy environment are the most effective preventive strategies against individuals attempting suicide . | background : though deliberate self - harm encompasses a wide variety of medical and social disciplines some of the important psychosocial variable such as life events , social support , coping strategies , and quality of life have not yet been explored in depth in india.aims:the aim was to analyze and compare the type and severity of life events , coping strategies , social support , and quality of life of suicide attempters versus matched normal controls , and to identify the risk factors leading to suicide.materials and methods : a total of 50 consecutive suicide attempters were compared with same number of age , sex , and martial status matched healthy controls using presumptive stressful life events scale , social support questionnaire , aecom coping style scale , and who qol-bref.results:attempters experienced significantly more life events especially untoward events whereas the control group experienced more desirable and impersonal life events . social support ,
positive coping , and of qol were significantly lower in attempters . among all risk factors desirable life events , good education , and good social support were protective against suicide.conclusion:suicide attempters were differentiated from healthy controls based on more stressful life events , lower social support , less healthy coping , and poor qol .
positive life events , good education , and good social support were protective factors against suicide . however , it is difficult to pinpoint a single factor responsible for suicidal behavior .
it is the complex interplay of various interrelated factors and the resultant buffering effect , which is protecting the individual against deliberate self - harm . |
there is evidence that stress is linked with many diseases , playing a crucial role in the development of cardiovascular diseases , diabetes , or asthma , and it also significantly influences the later course of these diseases .
stress is related to life style ; therefore , especially for mobile automated lifestyle counseling and analysis services , the need arises to identify stress automatically during daytime , using physiological data from various sensors . if stress could be reliably and automatically identified , this could directly help users manage stress situations , and it could also be used in medical intelligence applications , for example , in refining blood glucose predictions for diabetics during daytime under influence of stress . however , the available methods for automated stress detection based on low price , ubiquitous sensors , are yet immature . telemonitoring and self - management systems [ 59 ] extend the horizons of traditional health care using only point of care measurement data , but the proper interpretation and reliability of the results depend on the reliability of the measured data and the sensor itself .
the two crucial questions related to this problem are as follows : ( i)whether low price physiological sensors are reliable enough compared to gold standard
( ii)which sensors and algorithms can provide a reliable method for stress detection , at an affordable price and minimal user interaction.this paper describes our efforts and results in answering these questions .
, we describe our methods for a small scale device validation and the methods used in the main clinical study that compared heart rate variability ( hrv ) features between relaxation and mental stress periods .
section 3 presents the measurement results of the two studies , with the latter compared with two state - of - the - art algorithms .
we conclude the strengths and weaknesses of this study and the newly designed stress detection algorithm in section 4 . whether low price physiological sensors are reliable enough compared to gold standard devices accepted by and used in clinical practice . which sensors and algorithms can provide a reliable method for stress detection , at an affordable price and minimal user interaction .
the most commonly used physiological markers of stress are as follows : ( i)galvanic skin response ( gsr ) : using changes in skin conductivity . during stress , resistance of skin drops due to increased secretion in sweating glands .
stress causes differences in the contraction of the muscles which can be used to identify stress [ 11 , 12 ] .
( iii)skin temperature : changes in temperature of the skin are related to the stress level .
( iv)electrical activity of the heart : the most commonly used stress marker parameters derived from the electrocardiograph ( ecg ) are the heart rate ( hr ) and the heart rate variability ( hrv ) .stress can also be detected using other , less common markers like accelerometer , key stroke dynamics , or blinking .
it is also common to use a combination of several markers at the expense of an increased system cost and user involvement .
fernandes et al . used gsr and blood pressure ( bp ) markers for determining stress .
used ecg , respiration , gsr , and emg of trapezius muscles for mental stress detection .
singh and queyam used gsr , emg , respiration , and hr for detecting stress during driving .
pupil diameter , ecg , and photoplethysmogram were used as markers by mokhayeri et al .
baltaci and gokcay used pupil diameter and temperature features in stress detection , while choi used hrv , respiration , gsr , emg , acceleration , and geographical location .
stress causes differences in the contraction of the muscles which can be used to identify stress [ 11 , 12 ] .
skin temperature : changes in temperature of the skin are related to the stress level .
electrical activity of the heart : the most commonly used stress marker parameters derived from the electrocardiograph ( ecg ) are the heart rate ( hr ) and the heart rate variability ( hrv ) .
some of them are hyperspectral imaging technique , human voice [ 29 , 30 ] , pupil diameter , visible spectrum camera , or using stereo thermal and visible sensors . however , observing several markers for identifying stress requires an increasing number of input sensors which in turn increases the overall price and lowers applicability .
prices for heart rate meters range from $ 70 to $ 500 usd ; gsr devices range from $ 100 to $ 500 usd , while emg devices have price ranges from $ 450 usd up to $ 1750 usd .
fall between $ 550 usd and $ 5700 usd , which already can be considered excessive for a mass telemedical lifestyle counseling application .
therefore , in an ambient assisted living ( aal ) system , the number of input sensors should be kept minimal . in the rest of the paper ,
we focus on the simplest and most researched sensor input , that is , the electrical activity of the heart .
as for the reliability of hrv sensors , there are still surprisingly few reviews reported in the literature to date on the validation of the information content of low cost sensors compared to a clinically accepted gold standard
some devices that were tested for validity are the sensewear hr armband , the smart health watch , the actiheart [ 36 , 37 ] , the equivital lifemonitor , and the pulseon ; and also the bioharness multivariable monitoring device from zephyr has been tested for validity [ 40 , 41 ] and reliability [ 41 , 42 ] . in all cases , a gold standard device was used simultaneously with the device under test as a method for validating data .
however , the validated devices above are high - end devices with a considerable price which present an obstacle for the penetration of telemedicine . for example
, the bioharness device has a price around $ 550 usd , whereas the price of low cost heart rate meters varies from $ 70 usd to $ 100 usd .
the lack of reliability tests of low cost devices was our motivation for our device validation study .
for automated stress detection , several methods have been published which use only hrv . in 2008 , kim et al .
melillo et al . in 2011 used nonlinear features of hrv for real - life stress detection .
hrv data were collected two times , during university examination and after holidays , on 42 students .
stress detection with classification accuracy of 90% was reported using two poincar plot features and approximate entropy .
one year later , using the same data , they designed a classification tree for automatic stress detection based on lf and pnn50 hrv features with sensitivity of 83.33% . in 2013 , karthikeyan et al . created stress detection classifiers from ecg signal and hrv features
vanitha and suresh used a hierarchical classifier to classify stress into four levels with a classification efficiency of 92% in 2014 . in 2015
munla et al . used an svm - rbf classifier to predict driver stress with an accuracy of 83% .
the main goal of this study is the development of a reliable , robust , low price stress detection method suitable for mobile health applications .
the study included two distinct phases . in the first phase ( device validation study ) we tested the reliability of a low cost telemedical heart rate sensor against an accepted medical device . in the second phase we performed and evaluated a clinical study , using the validated telemedical sensor . among many low cost devices ,
we have chosen and analyzed cardiosport tp3 heart rate transmitter device , a simple commercial chest belt , as a source of heart rate data , because this is one of the few devices that can measure both heart rate and millisecond accurate rr time interval data .
since this device does not have its own memory for storing data , we used a nexus 7 tablet with android version 4.4.2 to connect to the device with the bluetooth 4.0 protocol and store the measured data on the tablet .
device was a schiller mt-101/mt-200 holter device which was designed for clinical use ( see figure 1 ) .
five healthy male volunteers used the two devices simultaneously during a 24-hour long period in order to make the measurements ( see figure 1 ) . for chest belt sensors ,
the temporary detachment or dislocation of the sensor during physical activity or sleep is a common source of errors according to our experiences .
though this problem could be mitigated by using tapes for fixing the device firmly to the body , we felt that such discomfort would not be tolerated in a real aal situation , so we did not use tapes and used only the daytime 12 hours of the overall signal for analysis .
after the monitoring period , we collected the devices and stored the measured data in a unified database . the protocol was reviewed and approved by the institutional ethics review board in january 2014 .
the volunteers expressed their informed consent to participate and expressed that they understand the goals of the study before the experiment .
the comparison of the measured data was a hard task due to the different designs of the gold standard and the telemedical device .
however , we wanted to compare signals directly in the time domain and also to develop a data cleaning algorithm for the removal of the noisy parts of the cardiosport device measurements , without using the gold standard data .
as the chest belt is not firmly attached to the body , even a slight movement of the device could sometimes cause signal loss ( especially during sleep ) .
therefore , we created a software module for synchronization and data cleaning before any further analysis .
data cleaning meant to remove obviously bad data ( artifacts ) and to keep only good data segments of sufficient length , because , as a rule of thumb , both hrv and poincar plot computation require data chunks of at least 5 minutes .
even though the data cleaning algorithm removes lots of data from the original signal , such a procedure poses no great obstacles for further calculations since we still have enough good data during daytime .
since the time stamps of the measured records can shift due to device buffering , we used a simple procedure to synchronize the data measured by the cardiosport device with those measured by the gold standard device in order to facilitate their comparison .
the algorithm uses a sliding window that passes from the beginning of the chest belt signal to the end and calculates the absolute error between the two signals .
when sliding is over , the location of the sliding window with the minimum absolute error is considered as the point where the two signals should be synchronized .
this applies only if the correlation of the data in the sliding window and the same amount of data from the gold standard are higher than a minimum set by the user
. if these conditions are met , the algorithm copies data from the sliding window into a newly generated third signal which represents the chest belt signal fully synchronized with the gold standard signal .
if conditions are not met , the third signal is filled with zeros . at the end
, the algorithm extracts all the highly correlated segments from the third signal skipping zero values . also , a file with all the merged segments
the algorithm uses the following 5 main parameters , with their values determined empirically in parentheses : ( i)window size : how much data is copied from the signal into the sliding window ( default : 200 ) .
( ii)window shift step : number of samples by which we shift the sliding window in each iteration ( default : 50 ) .
( iii)absolute error window : how much data will be used to calculate the minimum absolute error ( default : 200 ) .
( iv)maximum error distance : number of samples by which we shift the absolute error window in order to find the minimum absolute error ( default : 1000 ) .
( v)minimum correlation : minimum correlation , expressed as a percentage , required for the two signals to consider data in the chest belt signal accurate ( default : 97% ) .
window size : how much data is copied from the signal into the sliding window ( default : 200 ) .
window shift step : number of samples by which we shift the sliding window in each iteration ( default : 50 ) .
absolute error window : how much data will be used to calculate the minimum absolute error ( default : 200 ) .
maximum error distance : number of samples by which we shift the absolute error window in order to find the minimum absolute error ( default : 1000 ) .
minimum correlation : minimum correlation , expressed as a percentage , required for the two signals to consider data in the chest belt signal accurate ( default : 97% ) .
we performed time- and frequency - domain analysis and computed the correlation and mean absolute percentage error of the two measurements .
the time- and frequency - domain analysis for hrv was performed in kubios hrv analysis software , while the rest of the analysis was performed in microsoft excel .
we developed a simple data cleaning algorithm to be used in a real telemedical scenario , for automatically finding good parts of the signal , even without gold standard data .
first , we compare the timestamp of each data item with the timestamp of the previous one .
if the difference between the timestamps is bigger than 3 seconds , we mark this data as a gap .
three seconds is used for gap detection because the chest belt has a buffering system that can tolerate short detachments of the device from the body .
if more than 3 seconds is used , some data could be missing which could cause errors in further data analysis . in the second step
it is important to emphasize that we do not modify the data in any way as this could potentially result in false results in the subsequent analysis . instead
the abnormal values are identified by observing the mean value of 20 contiguous samples ( 10 previous and 10 following ones ) . if this mean value differs from the value of the current sample by more than 300 , we consider it invalid and mark as gap / error in the signal .
finally , we extract the good segments from the signal with a length of more than 5 minutes .
46 healthy volunteers , mostly university and high school students ( 27 men and 19 women ; average age : 24.6 years ) , participated in the experiment .
the experiment was divided into two parts with a duration of 10 minutes each , so the whole procedure lasted for 20 minutes . in the first part
, the participants were asked to try to relax in upright sitting position while listening to relaxation music .
the second part of the experiment was a mental task designed to serve as a source of mental stress .
we used the stroop color test smartphone game which is commonly applied to induce mental stress in similar studies . in this game
, the user must connect colors to labels at an ever increasing pace . since controlled breathing and posture
have been reported before influencing hrv features , we asked the participants not to control their breathing and to sit still in the same position during the whole experiment .
this was also necessary to prevent the detachment of the chest belt from the body .
the participant was asked about her / his subjective stress levels on a relative scale three times , that is , before the experiment , after the relaxation part , and after the game playing part . the answers along with her / his age and gender were recorded in a simple questionnaire ( see appendices a - b ) .
the reason for such questions was that , though less expected , game playing may be more relaxing for some people than music , and only if we actually succeeded in raising the stress level in the second part compared to the first part , can we expect any algorithm or method to detect the stress .
the protocol was reviewed and approved by the institutional ethics review board in january 2014 .
the volunteers expressed their informed consent to participate and expressed that they understand the goals of the study before the experiment .
after the experiment all data was stored in a unified database , and the data cleaning algorithm described in section 2.1 was run on both 10-minute parts of each record .
segments of at least 5 minutes in both parts were excluded from the further analysis .
similarly , we excluded those who despite our efforts for provoking stress in the experiment reported no increase of stress level due to game playing .
we used the kubios software package for getting hrv features and later we analyzed and compared data using the medcalc software and microsoft excel .
wilcoxon paired - samples test was used as a tool for determining significant changes between the two parts of the experiment for the measured values of the hrv features and a p value of < 0.05 was considered as significant .
correlation , percentage differences , average percentage differences , and minimum percentage differences were also calculated for all the observed hrv features .
we developed a simple algorithm to detect stress that uses only time - domain hrv features .
the reason for excluding frequency - domain features is that they require much more computing power to calculate than time - domain features , an argument that we should consider in a solution designed for mobile devices .
we used a combination of the mean hr , pnn50 , and rmssd features to identify stress . a sliding window over the hr signal
we tested various lengths of the sliding window and the shortest width of the window that achieved good result was 560 rr intervals with shift of 20 rr intervals in each step .
we used brute force technique to find best threshold values for each hrv feature . as a result
, stress is detected by the algorithm if the mean heart rate in the fourth part compared to the first part increases by more than 5% , and rmssd and pnn50 values decrease by more than 9% in the fourth part compared to the third part .
so for the sake of calculating accuracy , specificity , and sensitivity , rest state is considered if stress was not detected .
therefore , instead of detecting the subject 's physiological state of stress , the purpose of our algorithm is to detect those stressful events which have negative impact on the subject 's current state but which may or may not lead the subject into a stressful state .
a series of stressful events instead of a single major event can also gradually put the subject into a stressful condition . in a binary classification model
this could lead to the false conclusion that only the last event was the one which caused stress , while all the previous events are not taken into consideration and remain hidden .
we note that though it is true that the hrv features may be due to other factors such as depression and mood , we postulate that these factors do not change during the experiment .
in contrast , the proposed method uses a well - defined change in the hrv features to detect the beginning of the ( induced ) stressful state ; therefore we expect no false positive stress detections due to such factors .
figure 2 shows a summary flow chart of the proposed stress detection algorithm which implements the above procedure . in order to test the power of this algorithm
, we compared its performance to two state - of - the - art algorithms from the same author , melillo et al .
the algorithm described in uses the pnn50 feature from the time domain and the lf feature from the frequency domain to create a simple classification tree .
stress is detected if lf < 899.58 and pnn50 > 0.9873 or if lf > 277.28 and pnn50 < 0.9873 .
restful state is detected if lf > 899.59 or if lf > 277.28 and pnn50 < 0.9783 .
for extracting the lf and pnn50 features , we used the same software as the authors of this algorithm , kubios .
our experiment consisted of two 10 minutes long periods so we extracted two 5 minutes long segments from relaxation part and two 5-minute segments from game playing part .
if stress was detected in any one of them , we marked the whole 10-minute part as stress .
if both parts were detected as rest , then whole 10-minute part was marked as rest .
a stress detection method based on nonlinear analysis was the next algorithm we used .
this algorithm uses three nonlinear features : poincar plot sd1 , poincar plot sd2 , and approximate entropy ( en ) . according to the method
, stress is found if(1)10.64 + 203.99sd1108.74sd28.26en0.2>0.to reconstruct this algorithm we used microsoft visual c # to calculate approximate entropy based on formula described by authors .
a sliding window was used to scan the whole relaxation part as well as the game playing part .
if stress was found in any step , we marked the whole 10-minute period as stress and , similarly , if rest was detected on all steps of whole part , we marked that part as rest . in order to compare the performances of the three methods , we computed the accuracy , specificity , and sensitivity for each of them . for this , we registered a true positive result if the method marked the game playing part as stress , a true negative result if the relax music part was marked as rest , a false positive result if the relax music part was marked as stress , and a false negative result if the game playing part was marked as rest .
the longest segment that is highly correlated with the gold standard data is 110 minutes long .
the default parameter settings minimize the number of overly short ( < 5 min ) segments .
most of the bad segments ( figure 3 ) are shorter than one minute , and only one bad segment was 60 minutes long .
the synchronization procedure resulted in highly ( > 97% ) correlated synchronized data segments with various durations .
subject # 1 had the lowest usable time with only 2 hours and 6 minutes .
the most probable reason for such a low time is the chest hair which reduced the contact between electrodes and the skin .
table 2 shows results in time domain for the schiller and the cardiosport devices after using our algorithm for the synchronization of signals .
the time - domain analysis shows pretty close values for both mean rr values and standard deviation .
the formula used for computing the standard deviation of rr intervals is as follows:(2)std rr=1n1j=1nrrjrr2.average mean rr values for schiller and cardiosport devices are 850.80 and 870.69 , respectively .
average std rr for the schiller device is 108.42 and it is 110.93 for the cardiosport device . the frequency - domain analysis is presented in table 3 . the absolute power was compared for very low frequency ( vlf : 00.04 hz ) , low frequency ( lf : 0.040.5 hz ) , and high frequency ( hf : 0.150.4 hz ) and ratio between low frequency and high frequency ( lf / hf ) .
the results show no significant difference between schiller and cardiosport device values . the average mean absolute percentage error ( mape ) between the two signals is 2.32% with a high average correlation of 99.67% .
we run the data cleaning algorithm described in section 2 on the data recorded by the chest belt .
similar to the synchronization process , we got a very short duration for one subject and we excluded this subject from further analysis .
it is important to note that , due to the noise on schiller device records , we had to remove noisy parts from the gold standard signal as well .
therefore , even though the signal was recorded for 12 hours continuously , the overall duration is much less .
the calculation shows that , in the worst scenario , only 45% of the signal can be used for analysis using this data cleaning method .
table 5 shows the results of data analysis in the time domain after removing bad parts with the data cleaning algorithm .
we can see that the mean rr intervals for the schiller and the cardiosport devices are 851.14 and 871.23 and the standard deviations are 104.61 and 106.35 , respectively .
in general , the cardiosport device has slightly greater values but they are very close .
the minimum , maximum , and average percentage errors on the whole signal were calculated using a 5 minutes long sliding window with one - minute shift step ( table 6 ) . only one subject had a very high maximum error value of 33.86% . by visual examination
, we determined that the cause of this high error percentage was in fact the presence of artifacts in the gold standard schiller device measurements . despite that , average error values are at a very low level of 2.20% .
figure 4 demonstrates the typical relationship between the cardiosport and schiller measurements using a scatter plot for subject # 5 .
the average mean absolute percentage error ( mape ) between the two signals was 2.62% with a high average correlation of 98.76% .
five subjects were excluded from further analysis because they reported a decrease ( instead of the expected increase ) of their stress level while playing the stroop game .
as an explanation , some participants reported that playing the game was much more joyful than relaxation music .
others reported that the game kept their mind focused and that the relaxation music brought them back to their problems and duties of the day .
after removing these records , we run the data cleaning algorithm which identified 10 noisy records , probably due to too much movement .
these were also excluded , so the active dataset decreased to 31 subjects ' records ( 20 men and 11 women ; average age = 24.7 years ) .
table 7 shows p values of the wilcoxon paired - samples test , for the relax versus stress parts , for the relevant hrv features ( n = 31 ) .
we found a statistically significant difference for the following time - domain features : mean rr ( p = 0.0001 ) , mean hr ( p = 0.0001 ) , pnn50 ( p = 0.0103 ) , nn50 ( p = 0.0128 ) , rmssd ( p = 0.0255 ) , and hrv triangular index ( p = 0.0456 ) . in frequency domain
, two features showed statistically significant difference : hf ( ms ) with p = 0.0054 and lf ( ms ) with p = 0.0128 .
the vlf ( % ) feature was also close but not significantly different ( p = 0.0745 ) .
in nonlinear analysis , the sd1 feature showed a statistically significant difference ( p = 0.0268 ) .
the average percentage differences and the minimum percentage differences are shown in table 8 .
table 9 shows the correlations between the important features during the relaxation part of experiment .
we can see very high positive correlation ( higher than 0.9 ) between the following features : nn50 and rmssd ( 0.94818 ) , pnn50 and rmssd ( 0.935664 ) , and pnn50 and nn50 ( 0.98966 ) .
only one very high negative correlation was found between features mean rr and mean hr ( 0.99452 ) .
figure 5 shows , as an example , the values of an observed feature ( mean hr ) for the relaxation period and the game playing period , respectively .
the accuracy , sensitivity , and specificity values for correctly detecting stress are shown in table 10 for our algorithm , the linear algorithm proposed by melillo et al . , and the nonlinear algorithm proposed by the same authors .
there are many markers that could be used , many algorithms that could be applied , and many forms of stress which could be observed . heart rate variability , being simple and noninvasive , has recently become one of the most popular methods for detecting stress .
still , this is not an easy task , since hrv is not a single value ; rather , it consists of many features that can be observed in time domain and frequency domain or using nonlinear analysis .
the literature generally reports that , under mental stress , the mean rr , pnn50 , std rr , and rmssd features decrease , while the mean hr and lf features increase significantly .
however , significant differences for the same features and sometimes even opposite results ( e.g. , lf feature ) are also reported .
one probable cause for this inconsistency in literature could be the fact that stress is not the only condition that influences changes in hrv .
physical activity , body posture , breathing , age , gender , and illnesses all have a great influence on hrv . in this paper
, we analyzed various hrv features in order to find those that change significantly under mental stress and proposed a simple stress detection algorithm .
in the device validation study , we tested the reliability of a low cost heart rate meter .
the cardiosport tp3 heart rate meter device was used simultaneously with a professional ecg recorder ( holter ) device .
we compared the results using standard deviation , correlation , and scatter plot diagram with slope of the regression line which are commonly used in literature [ 36 , 40 , 50 ] .
however , before we analyzed the results , we used a simple data cleaning algorithm to eliminate noisy parts without using any data correction .
the data cleaning process reduces the overall duration of the signal but it increases its quality . after data cleaning ,
all results of the cardiosport device were very close to the schiller device with an average correlation of 98.73% .
the downside of the data cleaning algorithm is that it will delete sections of the signal even with the slightest detachment .
hopefully , with advance in wearable sensors , new forms of heart rate monitors like rings or bracelets with firmer attachment to body will be available . in the next step
our findings are not very different from previous research , showing that hrv can indeed be used as an indicator of mental stress .
we found that , under the influence of mental stress , mean hr increased , while mean rr , pnn50 , rmssd , and hrv triangular index decreased .
contrary to the results from literature , we did not find a statistically significant difference in std rr feature ( p = 0.1583 ) .
this could be explained by the fact that we analyzed only 10 minutes in each part of the experiment , while std rr feature describes long - term variability .
a limitation of our study is that we only analyzed the influence of mental stress .
for some subjects , the experiment failed to provoke mental stress which is of course a shortcoming of the experiment setup ; however , it would be very hard to design a method that is successful in all cases .
the stroop test was chosen because it is easy to implement and is generally accepted in the literature for such purposes . since it increases the speed of the game proportionally with the user 's results , it should increase the stress level regardless of the subjects ' cognitive level .
we believe that other factors , such as the subject 's prior experience and motivation for playing computer games , are harder to control . as a conclusion of this study we created a robust stress detection algorithm . unlike other stress detection algorithms which use several stress markers [ 51 , 52 ] , we used only hrv features for stress detection but with relatively high stress identification ratio . we were able to get an accuracy rate of 74.60% , somewhat below the 85% reported by the algorithm in ; however , the latter uses the full electrocardiogram ( ecg ) measurement compared to using only rr intervals in our case .
if we compare our algorithm with other algorithms for stress detection using only hr and hrv parameters , we can say that we achieved higher identification rate than the algorithm in and a worse result than or and around 15% worse compared to [ 44 , 47 ] but we used only time - domain features for stress identification instead of frequency - domain features or using nonlinear analysis which are much more expensive to calculate . since performance of particular algorithm depends on multiple parameters like type of stressor , number of subjects , methods used , and so forth , we compared the performance of our algorithm with two state - of - the - art algorithms .
although our algorithm showed lower declared accuracy , the comparison of its performance on the same dataset showed much better results than the algorithm that uses nonlinear hrv features and slightly better performance than the algorithm that uses linear hrv features for stress detection . we think that the poor performance of the two tested methods could partly be due to the fact that our stressor , the stroop game , was not as strong as the university exam stressor used for the development of the melillo algorithms or driving .
such results show that the same algorithm can give very different results on different dataset meaning that comparing strictly by accuracy values is not good indicator if comparison is not performed on the same dataset .
a weakness of the proposed algorithm is that it only detects events that provoke stress for a particular subject .
however , this was not the intention of our algorithm from the beginning and we propose using combination of our algorithm with typical classification algorithms for achieving greater insight into stressful events and a subject 's current state .
a strength of our algorithm is that an event or a series of stressful events could be detected before entering into a stressful state defined by classification algorithms .
the user could be informed by sound , vibration , or other kinds of alert when stressful event happens , leading to greater awareness about daily stressors .
also , this algorithm is very simple and easy to implement in mobile environments due to the fact that all hrv features are chosen only from time domain .
from this research we can conclude that even a simple low cost heart rate monitor device can detect features that change significantly under the influence of mental stress . using these results we created a simple stress detection algorithm that is being integrated in the lavinia lifestyle counseling mobile application for further testing and refinement in real - life stress situations .
if stress detection proves to be reliable for larger samples , it will be used in the blood glucose prediction models developed for diabetics . | the automated detection of stress is a central problem for ambient assisted living solutions .
the paper presents the concepts and results of two studies targeted at stress detection with a low cost heart rate sensor , a chest belt . in the device validation study ( n = 5 ) , we compared heart rate data and other features from the belt to those measured by a gold standard device to assess the reliability of the sensor . with simple synchronization and data cleaning algorithm , we were able to select highly ( > 97% ) correlated , low average error ( 2.2% ) data segments of considerable length from the chest data for further processing .
the protocol for the clinical study ( n = 46 ) included a relax phase followed by a phase with provoked mental stress , 10 minutes each .
we developed a simple method for the detection of the stress using only three time - domain features of the heart rate signal .
the method produced accuracy of 74.6% , sensitivity of 75.0% , and specificity of 74.2% , which is impressive compared to the performance of two state - of - the - art methods run on the same data .
since the proposed method uses only time - domain features , it can be efficiently implemented on mobile devices . |
understanding the cellular and molecular basis of nociception is a challenge that has important implications for pain management and the development of new analgesics .
nociception plays a vital role in the survival of the organism , serving to transmit warning signals of impending harm.13 however , beyond this function , the experience of prolonged nociceptive and inflammatory pain , such as following surgery or other trauma , requires effective management , both to provide comfort for the patient and to reduce the possible risk of development of chronic pain.4,5 as somatosensory neurons of the peripheral nervous system , nociceptors innervate the periphery and function to detect noxious mechanical , temperature , and chemical stimuli . via communication with the central nervous system ,
nociceptor activity functions to evoke pain sensation at the site of injury , and nociceptor sensitivity ( ie , firing threshold ) to stimuli at the site can be modulated by soluble factors released by local nonneuronal cells , eg , keratinocytes , fibroblasts , and infiltrating immune cells.13 certain factors , such as nerve growth factor alpha , prostaglandins , eg , prostaglandin e2 , and proinflammatory cytokines , eg , tumor necrosis factor - alpha ( tnf- ) and interleukin ( il)-1 , can promote nociceptor hypersensitivity,1,3,6 whereas other factors , such as anti - inflammatory cytokines , eg , il-10 and il-4 , and endogenous opioids , can have the opposite effect on nociceptor firing , thereby acting as analgesics.3,6 new analgesic pharmaceuticals are actively being pursued .
many of these drugs fall into the class of nonsteroidal anti - inflammatory drugs , which primarily target cyclooxygenases ( ie , cox-1 and cox-2),7 which are enzymes involved in prostaglandin synthesis .
opioids are still the most widely used drugs for treatment of severe and pathological pain . however , important side effects associated with these pharmacological options continue to be a major drawback.8,9 this has spurred an interest in multimodal therapy as a way of facilitating decreased intake of any one type of analgesic.10 to optimize such an approach , novel adjunctive therapy options with limited side effects are needed .
recently , biophysical treatment modalities have been shown to be useful as an adjunctive analgesic therapy option .
one such modality , pulsed radiofrequency energy ( prfe ) , is an adjunctive therapy which involves local noninvasive delivery of prfe ( 27.12 mhz carrier frequency ) to superficial soft tissue , a treatment which has been reported to provide analgesic benefit in patients following surgery or other soft tissue trauma , with few reports of side effects.11 three recent , randomized , double - blind clinical trials that used prfe field treatment for pain in post - surgical patients found significantly reduced levels of reported pain as well as analgesic consumption in patients treated with prfe relative to control patients treated with a sham device.1214 a meta - analysis of studies assessing the clinical efficacy of prfe also found that a significant proportion of studies that assessed prfe use for pain reported a beneficial outcome ( 11 positive studies).15 while clinical results are promising , little is known regarding the underlying mechanism of action of prfe - mediated analgesia . in previous studies using cultured human keratinocytes and fibroblasts , prfe treatment was found to mediate rapid and widespread upregulation of endogenous transcripts of multiple factors that , in vivo , are involved in cutaneous wound healing.16,17 in the current study , we used the same system to examine whether prfe treatment has an effect on the expression of factors known to modulate nociception , including endogenous targets of other analgesic therapeutics .
the results suggest that , unlike nonsteroidal anti - inflammatory drugs , prfe does not inhibit cyclooxygenase enzymes , but instead has a positive effect on the expression of endogenous opioids as well as their secretion , possibly via an endothelin pathway - based mechanism .
culture medium ( minimal essential medium ) was purchased from cell applications inc ( san diego , ca ) and from mediatech inc ( herndon , va ) for general culture of human dermal fibroblasts ( hdf ) .
fetal calf serum , penicillin - streptomycin , trypsin , 1 phosphate- buffered solution , sodium pyruvate , and nonessential amino acids were purchased from hyclone ( logan , ut ) .
reagents for reverse transcription polymerase chain reaction ( rt - pcr ) were from life technologies ( carlsbad , ca ) .
oligonucleotide primers for pcr were purchased/ synthesized by real time primers ( elkins park , pa ) .
general chemicals were purchased from sigma- aldrich ( st louis , mo ) or vwr international ( radnor , pa ) .
endothelin a and b receptor antagonists were purchased from american peptide ( sunnyvale , ca ) .
routine culture was performed as recommended by the manufacturer in a 5% co2 humidified incubator at 37c.18 for the experiments , cells were cultured on 10 cm plates at a density of 1.14 10 cells / cm in minimum essential medium supplemented with 1 mm sodium pyruvate , 1 mm nonessential amino acids , 100 units penicillin , 100 g streptomycin , and 5% fetal calf serum .
cells were used for experimentation after 16 hours in a humidified incubator at 37c with 5% co2 .
routine culture was performed as recommended by the manufacturer in a 5% co2 humidified incubator at 37c . for experiments
, keratinocytes were cultured on 10 cm plates at a density of 0.75 10 cells / cm in keratinocyte growth medium supplied by the manufacturer .
hek were used for experimentation after 16 hours in a humidified incubator at 37c with 5% co2 .
treatment was performed by exposing cells to the prfe field of a provant device from regenesis biomedical inc ( scottsdale , az ) .
this device emits a 27.12 mhz radiofrequency signal transmitted from a flat spiral antenna with a radius of 7.5 cm made up of six turns at a width of 0.70 cm spaced with a separation of 0.3 cm .
this corresponds to energy parameters of 591 v / m and 6.7 a / m in electrical and magnetic fields , respectively , when measured 5 cm from the surface of the radiating antenna .
treatment was performed at room temperature for 30 minutes after which the cells were returned to the incubator .
cells were harvested for protein or total rna at the times indicated in the figures .
cells were treated with prfe for 30 minutes , and total rna was isolated using an rneasy mini kit ( qiagen , valencia , ca ) isolation kit .
total rna 1 g was reverse - transcribed using a high - capacity rna to cdna master mix ( life technologies ) following the manufacturer s instructions .
pcr was performed using the following reaction times and temperatures : denaturation for 15 seconds at 94c , annealing for 30 seconds at 55c , and elongation for 30 seconds at 72c in 20 l reaction volumes , and run out to 45 cycles using a rotor - gene device ( qiagen ) .
quantitation and analysis of relative gene expression was performed using the 2 method described by livak and schmittgen.19 glyceraldehyde phosphate dehydrogenase was used to normalize product expression between different rna samples and treatments .
rna was isolated from at least four independent experiments and pcr was performed in triplicate .
products were electrophoresed on 2% agarose gel and stained with ethidium bromide to determine the fidelity of the pcr reaction .
the relationship between the concentration of input rna and amount of pcr product was linear for each pcr product .
we used an enzyme - linked immunosorbent assay to measure cytokine and opioid levels in cell supernatants after treatment with prfe . for cytokine and opioid measurement ,
cells were plated at 5.0 10 per well in 24-well dishes ( bd biosciences , franklin lakes , nj ) .
the cells were incubated for 24 hours , after which 400 l of fresh medium was added .
cells were then treated with prfe , and the media and cell lysate were harvested at the times indicated in the figures and then analyzed for opioid , substance p ( phoenix pharmaceuticals , burlingame , ca ) , or endothelin-1 expression .
b- endorphin , substance p , dynorphin , and enkephalin ( wuhan eiaab science co , ltd , wuhan , china ) were analyzed by enzyme - linked immunosorbent assay .
assays were based on competition with a known concentration of a specific opioid or substance p standard .
cells were inoculated at a density of 5 10 cells per plate and grown for 24 hours .
prfe treatment was performed using standard conditions and cells were harvested at the indicated times .
cell lysates were made up in 0.1 m tris - hcl ( ph 7.4 ) containing aprotinin 3.3 g / ml , leupeptin 10 g / ml , and pepstatin 4 g / ml ( sigma - aldrich ) .
cells were lysed by freeze thawing three times followed by passage through a 26-gauge needle .
the protein concentration was then determined , and cyclooxygenase activity was assayed using a fluorescent activity assay kit ( cayman chemicals , ann arbor , mi ) by determining the conversion of 10-acetyl-3 , 7-dihydroxyphenoxazine to resorufin by the peroxidase component of cyclooxygenase .
resorufin fluorescence is then analyzed with an excitation wavelength of 530540 nm and an emission wavelength of 585595 nm using a biotek fl 800 fluorescent plate reader .
assays were performed with at least three separate protein isolations , and enzyme activity was run in triplicate .
enzyme - linked immunosorbent assay and rt - pcr data were analyzed using one - way analysis of variance . if the equal variance test failed for one - way analysis of variance , dunn s method for multiple comparisons
for all the experiments , reporting p < 0.05 was considered to be statistically significant .
culture medium ( minimal essential medium ) was purchased from cell applications inc ( san diego , ca ) and from mediatech inc ( herndon , va ) for general culture of human dermal fibroblasts ( hdf ) .
fetal calf serum , penicillin - streptomycin , trypsin , 1 phosphate- buffered solution , sodium pyruvate , and nonessential amino acids were purchased from hyclone ( logan , ut ) .
reagents for reverse transcription polymerase chain reaction ( rt - pcr ) were from life technologies ( carlsbad , ca ) .
oligonucleotide primers for pcr were purchased/ synthesized by real time primers ( elkins park , pa ) .
general chemicals were purchased from sigma- aldrich ( st louis , mo ) or vwr international ( radnor , pa ) .
endothelin a and b receptor antagonists were purchased from american peptide ( sunnyvale , ca ) .
routine culture was performed as recommended by the manufacturer in a 5% co2 humidified incubator at 37c.18 for the experiments , cells were cultured on 10 cm plates at a density of 1.14 10 cells / cm in minimum essential medium supplemented with 1 mm sodium pyruvate , 1 mm nonessential amino acids , 100 units penicillin , 100 g streptomycin , and 5% fetal calf serum .
cells were used for experimentation after 16 hours in a humidified incubator at 37c with 5% co2 .
routine culture was performed as recommended by the manufacturer in a 5% co2 humidified incubator at 37c . for experiments
, keratinocytes were cultured on 10 cm plates at a density of 0.75 10 cells / cm in keratinocyte growth medium supplied by the manufacturer .
hek were used for experimentation after 16 hours in a humidified incubator at 37c with 5% co2 .
treatment was performed by exposing cells to the prfe field of a provant device from regenesis biomedical inc ( scottsdale , az ) .
this device emits a 27.12 mhz radiofrequency signal transmitted from a flat spiral antenna with a radius of 7.5 cm made up of six turns at a width of 0.70 cm spaced with a separation of 0.3 cm .
this corresponds to energy parameters of 591 v / m and 6.7 a / m in electrical and magnetic fields , respectively , when measured 5 cm from the surface of the radiating antenna .
treatment was performed at room temperature for 30 minutes after which the cells were returned to the incubator .
cells were harvested for protein or total rna at the times indicated in the figures .
cells were treated with prfe for 30 minutes , and total rna was isolated using an rneasy mini kit ( qiagen , valencia , ca ) isolation kit .
total rna 1 g was reverse - transcribed using a high - capacity rna to cdna master mix ( life technologies ) following the manufacturer s instructions .
pcr was performed using the following reaction times and temperatures : denaturation for 15 seconds at 94c , annealing for 30 seconds at 55c , and elongation for 30 seconds at 72c in 20 l reaction volumes , and run out to 45 cycles using a rotor - gene device ( qiagen ) .
quantitation and analysis of relative gene expression was performed using the 2 method described by livak and schmittgen.19 glyceraldehyde phosphate dehydrogenase was used to normalize product expression between different rna samples and treatments .
rna was isolated from at least four independent experiments and pcr was performed in triplicate .
products were electrophoresed on 2% agarose gel and stained with ethidium bromide to determine the fidelity of the pcr reaction .
the relationship between the concentration of input rna and amount of pcr product was linear for each pcr product .
we used an enzyme - linked immunosorbent assay to measure cytokine and opioid levels in cell supernatants after treatment with prfe . for cytokine and opioid measurement ,
cells were plated at 5.0 10 per well in 24-well dishes ( bd biosciences , franklin lakes , nj ) .
the cells were incubated for 24 hours , after which 400 l of fresh medium was added .
cells were then treated with prfe , and the media and cell lysate were harvested at the times indicated in the figures and then analyzed for opioid , substance p ( phoenix pharmaceuticals , burlingame , ca ) , or endothelin-1 expression .
b- endorphin , substance p , dynorphin , and enkephalin ( wuhan eiaab science co , ltd , wuhan , china ) were analyzed by enzyme - linked immunosorbent assay .
assays were based on competition with a known concentration of a specific opioid or substance p standard .
cells were inoculated at a density of 5 10 cells per plate and grown for 24 hours .
prfe treatment was performed using standard conditions and cells were harvested at the indicated times .
cell lysates were made up in 0.1 m tris - hcl ( ph 7.4 ) containing aprotinin 3.3 g / ml , leupeptin 10 g / ml , and pepstatin 4 g / ml ( sigma - aldrich ) .
cells were lysed by freeze thawing three times followed by passage through a 26-gauge needle .
the protein concentration was then determined , and cyclooxygenase activity was assayed using a fluorescent activity assay kit ( cayman chemicals , ann arbor , mi ) by determining the conversion of 10-acetyl-3 , 7-dihydroxyphenoxazine to resorufin by the peroxidase component of cyclooxygenase .
resorufin fluorescence is then analyzed with an excitation wavelength of 530540 nm and an emission wavelength of 585595 nm using a biotek fl 800 fluorescent plate reader .
assays were performed with at least three separate protein isolations , and enzyme activity was run in triplicate .
enzyme - linked immunosorbent assay and rt - pcr data were analyzed using one - way analysis of variance . if the equal variance test failed for one - way analysis of variance , dunn s method for multiple comparisons
for all the experiments , reporting p < 0.05 was considered to be statistically significant .
prostaglandins are an important group of compounds that are closely involved in pain via the inflammation process , and inhibition of their synthesis is the target for nonsteroidal anti - inflammatory drugs .
there are many prostaglandins synthesized , all of which proceed through the rate - limiting enzyme , cyclooxygenase .
we treated hdf and hek cells in culture with prfe fields to determine the effect on cox gene expression .
hdf cells treated with prfe showed a 1.512.3 increase in inducible cox-2 gene expression and no increases in mrna expression of cox-1 ( figure 1b and c ) . in hek cells ,
no significant changes were observed in levels of either cox-1 or cox-2 gene expression ( figure 1a or c ) . because prfe field treatment had an increasing or no effect on cells in culture (
hdf and hek , respectively ) , expression of enzymes subsequently involved in the synthesis of prostaglandins was assayed .
prostaglandin e2 has been shown to be proinflammatory and involved in eliciting pain in the peripheral and central nervous systems .
prostaglandin d plays an important role in the resolution of inflammation . using rt - pcr , we determined the effects of prfe on mrna expression levels of these enzymes .
we found increases in prostaglandin e synthase levels in hdf cells ( 2.0-fold ) with no changes in prostaglandin d synthase levels . in hek
, we found no significant changes in prostaglandin e synthase expression levels and low mrna levels of prostaglandin d synthase .
we next determined the effects of prfe on protein activity to address any post - translation modification that prfe may induce in cyclooxygenase activity .
as shown in figure 2a and b , total cyclooxygenase activity changes mimic those found in changes in mrna levels of hdf and hek . peripheral expression of endogenous opioids is becoming recognized as an increasingly important analgesic mechanism in pain pathways due to tissue damage and injury , especially in skin , muscles , and viscera .
we determined the effect of prfe treatment on pro - opiomelanocortin ( pomc ) , pro - enkephalin ( penk ) , and prodynorphin ( pdyn ) gene expression in hek and hdf .
these endogenous opioids have been shown to be involved in antinociceptive pathways in peripheral tissue .
in particular , immune cells and keratinocytes have been shown to express endogenous opioid peptides , which are thought to elicit an analgesic effect during trauma to skin .
cells treated with prfe showed an increase in endogenous opioid gene expression with a maximum at 2 hours following treatment . both hek and hdf showed increases of all three opioid mrna levels as shown in figure 3a
this suggests that , at least in part , the analgesic effects of prfe fields may be through increased expression of pro - opioid mrna .
we next looked at the levels of -endorphin , enkephalin , and dynorphin peptides after prfe treatment .
both enkephalin and dynorphin peptides are increased in hek and hdf ( figure 3b and c ) .
we could not detect b - endorphin peptide , probably due to the sensitivity of the assay .
these results suggest a biological mechanism whereby treatment of injured tissue with prfe fields decreases pain associated with the trauma in a localized manner .
we have previously shown that prfe field treatment of hek and hdf increases many cytokines and other proteins involved in the inflammation phase of wound healing .
proinflammatory cytokines such as il-1 have been shown to be particularly important in the release of endogenous opioids from leukocytes .
we determined the effects of prfe field treatment on several cytokines and neurokine factors , which have been shown to be involved in pain produced by neuroinflammation and resolution of the inflammation process ( figure 4 ) .
the proinflammatory cytokine il-1 has been implicated in stimulating release of endogenous opioids from immune cells . in our studies ,
compared with control cells , prfe - treated hek and hdf expressed higher levels of il-5 , il-6 , and il-10 ( figure 4 ) .
nerve growth factor alpha mrna levels were increased in prfe - treated fibroblasts , while a lower level of nerve growth factor alpha mrna relative to control was observed following treatment of keratinocytes .
in addition , prfe - treated hek also had lower levels of tnf- mrna compared with the control .
substance p expression was not found in either of the cell types ( data not shown ) .
previous results of a microarray analysis found upregulation of several cytokine mrnas following prfe treatment;16 however , as here , these cytokines did not include those commonly implicated in stimulating endogenous opioid release from immune cells , eg , il-1 and tnf-. combined , these results indicate that prfe fields do not act through traditional cytokine mechanisms , which stimulate endogenous opioid release from immune system cells via factors such as il-1. endothelin-1 is associated with the pathogenesis of ischemia and cancer , and is a potent vasoconstrictor often associated with peripheral pain .
its pain response is associated with its binding to the endothelin a receptor ( eta ) on nociceptors .
in contrast , binding of et-1 to endothelin b ( etb ) receptors has been shown to produce localized analgesia by inducing expression of endogenous opioids in hek .
prfe treatment of hek increased expression of the etb receptor as well as mrnas for penk , pdyn , and pomc .
eta and endothelin-1 showed no significant increases in mrna levels . in hdf , prfe treatment showed increases in all three of the pro - opioid mrnas , with decreasing expression of endothelin-1 mrna ( figure 5a and b , p < 0.05 ) .
eta and etb receptors showed no statistically significant differences in expression after prfe treatment over controls in hdf .
these results suggest that prfe treatment produces peripheral analgesia by increasing endogenous opioid expression via endothelin-1 binding to its etb receptor in hek , but via multiple pathways in hdf .
khodorova et al20,21 have shown that increases in endogenous opioid expression via the endothelin-1 pathway are mediated through binding to the etb receptor .
bq-123 is a selective antagonist for eta receptors whereas bq-788 is a selective antagonist for etb receptors .
levels of endogenous opioid mrna expression were measured at 2 hours after treatment ( figure 6 ) . both antagonists inhibited prfe - induced increases in opioid expression in hek . in hdf , both bq-788 and bq-123 inhibited endogenous penk and pomc expression , but pydn expression was unaffected after prfe field treatment .
these results show that increases in opioid expression in hek are induced at least in part by an endothelin-1-dependent mechanism binding to its receptors , ie , eta and etb . in fibroblasts ,
the role for induction by endothelin-1 is less clear , with endothelin receptor antagonist blockade inhibiting pomc and penk expression but having no effect on induction of pydn after treatment with prfe .
prostaglandins are an important group of compounds that are closely involved in pain via the inflammation process , and inhibition of their synthesis is the target for nonsteroidal anti - inflammatory drugs .
there are many prostaglandins synthesized , all of which proceed through the rate - limiting enzyme , cyclooxygenase .
we treated hdf and hek cells in culture with prfe fields to determine the effect on cox gene expression .
hdf cells treated with prfe showed a 1.512.3 increase in inducible cox-2 gene expression and no increases in mrna expression of cox-1 ( figure 1b and c ) . in hek cells ,
no significant changes were observed in levels of either cox-1 or cox-2 gene expression ( figure 1a or c ) . because prfe field treatment had an increasing or no effect on cells in culture (
hdf and hek , respectively ) , expression of enzymes subsequently involved in the synthesis of prostaglandins was assayed .
prostaglandin e2 has been shown to be proinflammatory and involved in eliciting pain in the peripheral and central nervous systems .
prostaglandin d plays an important role in the resolution of inflammation . using rt - pcr , we determined the effects of prfe on mrna expression levels of these enzymes .
we found increases in prostaglandin e synthase levels in hdf cells ( 2.0-fold ) with no changes in prostaglandin d synthase levels . in hek
, we found no significant changes in prostaglandin e synthase expression levels and low mrna levels of prostaglandin d synthase .
we next determined the effects of prfe on protein activity to address any post - translation modification that prfe may induce in cyclooxygenase activity .
as shown in figure 2a and b , total cyclooxygenase activity changes mimic those found in changes in mrna levels of hdf and hek .
peripheral expression of endogenous opioids is becoming recognized as an increasingly important analgesic mechanism in pain pathways due to tissue damage and injury , especially in skin , muscles , and viscera .
we determined the effect of prfe treatment on pro - opiomelanocortin ( pomc ) , pro - enkephalin ( penk ) , and prodynorphin ( pdyn ) gene expression in hek and hdf .
these endogenous opioids have been shown to be involved in antinociceptive pathways in peripheral tissue .
in particular , immune cells and keratinocytes have been shown to express endogenous opioid peptides , which are thought to elicit an analgesic effect during trauma to skin .
cells treated with prfe showed an increase in endogenous opioid gene expression with a maximum at 2 hours following treatment . both hek and
this suggests that , at least in part , the analgesic effects of prfe fields may be through increased expression of pro - opioid mrna .
we next looked at the levels of -endorphin , enkephalin , and dynorphin peptides after prfe treatment .
both enkephalin and dynorphin peptides are increased in hek and hdf ( figure 3b and c ) .
we could not detect b - endorphin peptide , probably due to the sensitivity of the assay .
these results suggest a biological mechanism whereby treatment of injured tissue with prfe fields decreases pain associated with the trauma in a localized manner .
we have previously shown that prfe field treatment of hek and hdf increases many cytokines and other proteins involved in the inflammation phase of wound healing .
proinflammatory cytokines such as il-1 have been shown to be particularly important in the release of endogenous opioids from leukocytes .
we determined the effects of prfe field treatment on several cytokines and neurokine factors , which have been shown to be involved in pain produced by neuroinflammation and resolution of the inflammation process ( figure 4 ) .
the proinflammatory cytokine il-1 has been implicated in stimulating release of endogenous opioids from immune cells . in our studies ,
compared with control cells , prfe - treated hek and hdf expressed higher levels of il-5 , il-6 , and il-10 ( figure 4 ) .
nerve growth factor alpha mrna levels were increased in prfe - treated fibroblasts , while a lower level of nerve growth factor alpha mrna relative to control was observed following treatment of keratinocytes .
in addition , prfe - treated hek also had lower levels of tnf- mrna compared with the control .
substance p expression was not found in either of the cell types ( data not shown ) .
previous results of a microarray analysis found upregulation of several cytokine mrnas following prfe treatment;16 however , as here , these cytokines did not include those commonly implicated in stimulating endogenous opioid release from immune cells , eg , il-1 and tnf-. combined , these results indicate that prfe fields do not act through traditional cytokine mechanisms , which stimulate endogenous opioid release from immune system cells via factors such as il-1.
endothelin-1 is associated with the pathogenesis of ischemia and cancer , and is a potent vasoconstrictor often associated with peripheral pain .
its pain response is associated with its binding to the endothelin a receptor ( eta ) on nociceptors .
in contrast , binding of et-1 to endothelin b ( etb ) receptors has been shown to produce localized analgesia by inducing expression of endogenous opioids in hek .
prfe treatment of hek increased expression of the etb receptor as well as mrnas for penk , pdyn , and pomc .
eta and endothelin-1 showed no significant increases in mrna levels . in hdf , prfe treatment showed increases in all three of the pro - opioid mrnas , with decreasing expression of endothelin-1 mrna ( figure 5a and b , p < 0.05 ) .
eta and etb receptors showed no statistically significant differences in expression after prfe treatment over controls in hdf .
these results suggest that prfe treatment produces peripheral analgesia by increasing endogenous opioid expression via endothelin-1 binding to its etb receptor in hek , but via multiple pathways in hdf .
khodorova et al20,21 have shown that increases in endogenous opioid expression via the endothelin-1 pathway are mediated through binding to the etb receptor .
bq-123 is a selective antagonist for eta receptors whereas bq-788 is a selective antagonist for etb receptors .
levels of endogenous opioid mrna expression were measured at 2 hours after treatment ( figure 6 ) . both antagonists inhibited prfe - induced increases in opioid expression in hek . in hdf ,
both bq-788 and bq-123 inhibited endogenous penk and pomc expression , but pydn expression was unaffected after prfe field treatment .
these results show that increases in opioid expression in hek are induced at least in part by an endothelin-1-dependent mechanism binding to its receptors , ie , eta and etb . in fibroblasts ,
the role for induction by endothelin-1 is less clear , with endothelin receptor antagonist blockade inhibiting pomc and penk expression but having no effect on induction of pydn after treatment with prfe .
many analgesic therapies have historical derivations that are still used today , such as opioid - based medications and nonsteroidal anti - inflammatory drugs , which are currently the mainstay of treatment for postoperative pain .
although effective for many types of pain , the data suggest that adverse effects associated with postoperative pain medication are an issue of patient concern.22 a survey by apfelbaum et al found that 23% of their postoperative patients experienced side effects related to postoperative pain medication , with 72% of patients surveyed stating that , if given a choice , they would choose a non - narcotic pain medication.22 this highlights the need for novel analgesic therapies that are effective with fewer side effects . in our study , we sought to gain insight into the underlying molecular mechanism of a relatively new modality which uses pulsed electromagnetic f ields to treat pain due to postoperative or other soft tissue trauma .
unlike exogenous opioid and nonsteroidal anti - inflammatory therapeutics , little is known about the biological mechanism of action of prfe in mediating analgesia . in injured skin , factors expressed and secreted by non - neuronal cells ( ie , resident dermal and epidermal cells , such as fibroblasts and keratinocytes , as well as infiltrating immune cells ) in the proximity of nociceptive nerve termini can modulate nociceptor sensitivity , and thus can have an effect on downstream pain sensation , with either a proalgesic or analgesic effect . in the current study , we sought to gain insight into the molecular mechanism of prfe - mediated analgesia by investigating the effect of prfe field treatment on the expression of such factors by cultured fibroblasts and keratinocytes following prfe treatment .
this hypothesis was based on the previous finding that prfe mediates widespread mrna level increases for diverse endogenous factors in the same in vitro system .
unlike nonsteroidal anti - inflammatory drugs , which inhibit cyclooxygenase activity , prfe had a modestly positive effect on cyclooxygenase activity in hdf .
it also had a positive effect on mrna levels of enzymes involved in prostaglandin synthesis ( cyclooxygenase-2 , prostaglandin e synthase , figure 1 ) .
in contrast , prfe treatment of these cells led to significant increases in endogenous opioid precursor mrna ( figure 3a ) and secreted opioid peptides ( figure 3b and c ) , an effect that , in most cases , was dependent on endothelin receptors ( figure 6 ) .
in addition , prfe also had an effect on mrna levels of several cytokines and neurokines ( figure 4 ) .
it should be noted that it is not unusual that the two cell types , which in vivo are resident cells from different parts of the skin ( keratinocytes derived from the epidermal layer and fibroblasts derived from the dermis ) , were found to have different gene expression profiles for some of the mrnas examined here , considering the complexity of individual cell types .
for example , in other models , these two cell types have been found to show quantitative differences in levels of mrnas encoding oxidative stress response proteins23 and cytokines.24 although the role of immune cells in antinociception is well accepted,25 the precise role of opioid expression by keratinocytes and fibroblasts in peripheral analgesia is not well understood .
khodorova et al have previously shown that etb receptor activation by endothelin-1 stimulates -endorphin secretion by keratinocytes,20 supporting their finding that etb receptor activation mediates analgesia through a mechanism involving opioid receptors.20 in our study , using selective antagonists for endothelin receptors ( eta and etb ) , we found that the prfe - mediated increases in pyn , penk , and pomc mrna in hek were blocked by both eta and etb receptor antagonists ( figure 6 ) , suggesting that both types of endothelin receptors play a role in regulating endogenous expression of opioids at either the transcriptional or post - transcriptional level . in hdf , while endothelin receptor antagonists reduced the positive effect of prfe on levels of penk and pomc mrna , both receptor antagonists appeared to enhance the prfe - mediated increase in pydn mrna levels , suggesting that prfe can induce endogenous opioid expression through more than one pathway .
in both cell types , the prfe - mediated increase in opioid mrna occurred concomitantly with an increase in etb receptor mrna ( figure 6 ) , an effect which was also diminished by endothelin receptor antagonists .
while the effect of prfe on enzymes that synthesize prostaglandins may seem counter to what one might expect for an analgesic , recent findings by serhan et al show that prostaglandins e2 and d2 , while important for acute inflammation , upon modification ( lipid mediator class - switching ) could play an important role in the resolution of inflammation and return to homeostasis.26,27 both prostaglandins e2 and d2 are thought to act as important transcriptional regulators of enzymes involved in the generation of lipoxins and resolvins,8,28 which have been shown to play an important role in the resolution of acute inflammation and pain .
future studies to examine what effect prfe may have on the resolvin and lipoxin pathways are of interest . several cytokines and neurokines
for example , cytokines play an important role in the recruitment of immune cells to the site of trauma , and can function in stimulating these cells to release opioid peptides,29,30 and nerve growth factor alpha can bind directly to receptors on nociceptors to elicit a direct effect.1,3 using our in vitro culture system , we found that prfe can impact the endogenous expression of some of these factors as well .
il-1 mrna levels were lower in both cell types ( figure 4 ) following prfe treatment relative to control cells , a finding in agreement with clinical findings in which prfe therapy used postoperatively was associated with lower levels of il-1 in wound exudates of prfe - treated patients relative to control - treated patients as early as 1 hour after treatment was initiated , an observation which coincided with lower reported pain.14 prfe treatment of hek resulted in a lower level of nerve growth factor alpha and tumor necrosis factor alpha factor alpha mrna relative to control cells ( figure 4 ) , while there were higher levels of nerve growth factor alpha in prfe - treated hdf relative to control cells .
prfe treatment was also followed by an increase in il-5 , il-6 , and il-10 mrna in both cell types .
we found no detectible expression of substance p in either cell type . in order to get a sense of the direct effects of prfe treatment
, we evaluated the effect of prfe in our culture system at relatively early time points ( ie , hours ) after treatment .
while changes in mrna levels detected could be due either to an upregulation of transcription or greater mrna stability , an increase in peptide levels measured at 2 hours post - treatment reflects an increase in intracellular opioid precursor protein measured at 2 hours post - treatment is more likely to reflect a positive effect on translation or protein stability , indicating that prfe can have an effect on multiple steps involved in regulating the opioid pathway . because the current study was done out of interest to understand the molecular mechanism behind how prfe mediates analgesia in the clinical setting , it is worthwhile to compare the timing of prfe - mediated effects observed here relative to findings reported in vivo . in randomized ,
controlled postoperative studies , a clinically observable benefit ( eg , reduced pain scores and/or reduced analgesic consumption ) has been reported as early as 1 hour after initiation of prfe treatment.14 in other postoperative pain studies , a statistically significant difference in pain scores reported for prfe - treated versus sham device - treated control subjects occurred as early as 13 days postoperatively , depending on the study,12,13 and persisted through to the end of each study ( both studies followed patients through postoperative day 7 ) .
a rapid response to treatment , as reported by rohde et al,14 implies a mechanism that can , in a short amount of time , act on local nociceptors to promote analgesia ( such as promoting increased opioid levels ) .
later onset of analgesia in other studies , as well as long - lasting analgesic effects , could also involve a mechanism that requires more time before an effect on nociception occurs , such as changes in transcription .
in addition to reduced pain scores , each of these studies also reported lower narcotic pill consumption in prfe - treated patients following surgery relative to sham device - treated control subjects .
we propose a working model in which prfe treatment leads to an increase in both opioid precursor expression and opioid peptide release by keratinocytes and fibroblasts , an effect , which , in vivo , could mediate local analgesia .
upregulation of opioid precursor mrna in keratinocytes appears to be dependent on activation of endothelin receptors ( eta and etb ) , whereas an additional pathway also appears to be necessary for prfe - mediated opioid precursor expression in fibroblasts .
in addition , prfe modulation of cytokine expression in these cells may lead to an altered cytokine environment at the local site of injury , which could also affect analgesia . based on the finding that mrna levels of enzymes involved in prostaglandin synthesis are upregulated in fibroblasts following prfe treatment
, it needs to be investigated further whether prfe - mediated analgesia might also involve lipoxins and/or resolvins .
treatment of hdf and hek in culture with prfe led to changes in the expression of several endogenous factors , which , in vivo , may participate in modulating peripheral nociception .
notably , prfe treatment led to an increase in endogenous opioid expression and secretion in both cell types tested .
modulation of the endogenous opioid system in different in vivo models has been reported previously following exposure to certain types of extremely low frequency magnetic fields,31,32 as well as following electrical stimulation , such as electroacupuncture33,34 and transcutaneous electrical nerve stimulation.35 to our knowledge , this is the first report showing a positive effect of prfe on an endogenous opioid pathway .
these findings may provide a new insight into the molecular mechanism underlying prfe - mediated analgesia reported in the clinical setting . | backgroundpulsed radiofrequency energy ( prfe ) fields are being used increasingly for the treatment of pain arising from dermal trauma . however , despite their increased use , little is known about the biological and molecular mechanism(s ) responsible for prfe - mediated analgesia . in general , current therapeutics used for analgesia target either endogenous factors involved in inflammation , or act on endogenous opioid pathways.methods and resultsusing cultured human dermal fibroblasts ( hdf ) and human epidermal keratinocytes ( hek ) , we investigated the effect of prfe treatment on factors , which are involved in modulating peripheral analgesia in vivo .
we found that prfe treatment did not inhibit cyclooxygenase enzyme activity , but instead had a positive effect on levels of endogenous opioid precursor mrna ( proenkephalin , pro - opiomelanocortin , prodynorphin ) and corresponding opioid peptide . in hek cells , increases in opioid mrna
were dependent , at least in part , on endothelin-1 . in hdf cells
, additional pathways also appear to be involved .
prfe treatment was also followed by changes in endogenous expression of several cytokines , including increased levels of interleukin-10 mrna and decreased levels of interleukin-1 mrna in both cell types.conclusionthese findings provide a new insight into the molecular mechanism underlying prfe - mediated analgesia reported in the clinical setting . |
animals - the bovines used in this study were examined in
slaughterhouses in three provinces of argentina , namely buenos aires , crdoba and santa
fe .
the animals were classified according to age and weight as follows : calves 10% ( <
12 months , < 220 kg ) , young steers 5% ( 12 - 18 m
< 350 kg ) , steers 14% ( > 18 m ,
> 350 kg ) , heifers 8.5% ( 12 - 30 m , 260 kg ) , cows 60.5% ( > 30 m , > 350 kg ) and
bulls 0.5% ( > 24 m ) .
bacterial cultures - tissue samples collected from 378 bovines with
lesions classified as tuberculous were detected during regular post
mortem inspections in national abattoirs . a convenience ,
non - probabilistic sampling was performed at each slaughterhouse with the
assistance of the local animal health service staff ( national health service and food
quality ) . for bacteriological analysis ,
each sample was inoculated on stonebrink and
lwenstein - jensen media at 37c for 60 days .
the cultures were examined every seven days and when growth was
visible , smears were prepared and stained with ziehl - neelsen to observe acid - fast
bacilli .
the bacteriological identification of the isolates was performed on the basis
of the culture media , incubation temperature , growing time , colony morphology and
ziehl - neelsen staining .
isolates - a total of 261 m. bovis isolates were
included in this study .
the isolates originated from bovines at slaughterhouses in
buenos aires ( n = 67 ) , crdoba ( n = 112 ) and santa fe ( n = 82 ) .
these three argentinean provinces are inhabited by 60% of
the cattle in the country .
bovine
tissue samples were decontaminated by using petroff s method and cultured in
lwenstein - jensen and stonebrink media at 37c for 60 days .
a loopful of colonies was
transferred into a microcentrifuge tube containing 250 l of distilled water and heated
at 96c for 45 min .
the samples were then centrifuged at 12,000 rpm for 10 min and 5 l
of the supernatant was used for polymerase chain reaction ( pcr ) to amplify the dr
region .
spoligotyping was performed with a spoligotyping kit ( ocimun biosolutions ,
hyderabad , india ) .
m. tuberculosis h37rv ( atcc 27294 ) and m.
bovis bacillus calmette - guerin ( bcg ) ( atcc 27289 ) were included as reference
strains in each spoligotyping experiment .
the spoligotypes were collected in binary
format in an excel database and scanned images of the films were analysed by using
bionumerics ( v.3.5 , applied maths , sint - martens - latem , belgium ) .
spoligotypes were
compared with the m. bovis spoligotypes contained in the biotechnology
institute of national institute of agricultural tecnology database , argentina , and in
the mbovis.org database from the veterinary laboratories agency ( vla ) ( servers hosted at
the university of sussex in the united kingdom ) .
we defined the following criteria for the purpose of this study : a
unique spoligotype or vntr type was observed only once within a province ; an orphan
spoligotype was observed only once during the study and an exclusive spoligotype was
clustered or not clustered , in only one province .
vntr typing - the analysis of the six vntr loci
originally identified by frothingham and meeker - oconnell ( frothingham & meeker - oconnell 1998 ) was limited
to the exact tandem repeat ( etr ) of etr - a to -d loci , as previously
performed by smith et al .
the vntr
genotype of a strain , which represents the number of repeat elements at each
locus , is presented as a series of four integers between 1 - 12 that
are separated by hyphens .
when the variant of an integer was identified , it was marked
by an asterisk ( * ) .
multiplex pcrs were used to combine primer pairs etr - a / b and etr - c / d .
the pcr mix was
prepared in 96-well plates using the hot start master mix kit ( qiagen , germany ) .
five
nanograms of dna were added to a final volume of 20 l containing 0.4 m of each primer .
for each multiplex mixture , one primer of each oligonucleotide pair was tagged with a
different fluorescent dye ( table i ) .
the pcrs were
performed with an initial denaturation of 15 min at 94c followed by 35 cycles of
denaturation at 94c for 30 s , annealing at 68c for 1 min and extension at 72c for 2
min , followed by a final extension at 72c for 10 min .
table iprimers for exact tandem repeat ( etr)-a - d typing variable number of tandem repeats
locus
primer sequence ( 5 - 3 )
( labelling ) etr - a aaatcggtcccatcaccttctta-(fam )
cgaagcctggggtgcccgcgattt etr - b gcgaacaccaggacagcatcat
( joe)-ggcatgccggtgatcgagtgg etr - c gtgagtcgctgcagaacctgcag-(hex )
ggcgtcttgacctccacgagtg etr - d caggtcacaacgagaggaagagc-(fam )
gcggatcggccagcgactcctc
statistical analysis - the discriminatory index ( d ) described by hunter
and gaston and expressed by the simpson formula was calculated to determine the
discriminatory power of spoligotyping in each province ( insilico.ehu.es ) ( rodrguez et al .
this index is given by the
following equation ( n : total number of strains in the sample population ; s : total number
of types described ; xj : number of strains belonging to the j type ) ( hunter & gaston 1988 ) : this index is based on the probability that two unrelated strains sampled from the test
population will be placed into different typing groups ( hunter & gaston 1988 ) .
geographical distribution of isolates and spoligotypes - valid
spoligotypes were obtained for 261 isolates across 32 patterns . of these spoligotypes ,
13 patterns were orphans and 248 ( 94.6% ) isolates were grouped in 18 clusters of more
than two isolates ( table ii ) , with a
discrimination index of 0.80 .
the isolates from crdoba specifically came from slaughterhouses located in the juarez
celman department .
the numbers of spoligotypes detected in buenos aires , crdoba and
santa fe were nine , 21 and 19 , respectively .
a map showing the distribution of the four
major spoligotypes is shown in fig .
1b ) and it should be noted that in general samples were taken from
departments with higher numbers of cattle .
in buenos aires , sb0140 comprised 28.4% ( n =
19 ) of the isolates , sb0145 , 35.8% ( n = 24 ) , sb0120 , 16.4% ( n = 11 ) and sb1055 , 10.4% ( n
= 7 ) . in crdoba , sb0140 comprised 45.5% of the isolates
( n = 51 ) , sb0145 , 8.9% ( n = 10 )
and sb0153 and sb0484 , 8% ( n = 9 each ) .
in santa fe , which has a strong dairy cattle
industry , sb0140 comprised 41.4% ( n = 34 ) , sb0130 , 14.6% ( n = 12 ) and sb0120 , 10.9% ( n =
9 ) .
buenos aires had the lowest number of unique spoligotypes ( n = 4 ) followed by
crdoba ( n = 11 ) and santa fe ( 10 ) . regarding orphan spoligotypes , buenos aires
presented only one orphan spoligotype ( xx138 ) , crdoba had seven ( sb0996 , 1043 , 1068 ,
1776 , xx126 , xx131 and xx134 ) and santa fe had six ( sb0678 , 1066 , 2117 , 2165 , 2166 and
xx139 ) . the number of major spoligotypes , the remaining clustered spoligotypes and the
orphan types are shown in fig .
2 .
table iispoligotypes distribution , number of patterns per province spoligotype ( sb code ) total of isolates buenos aires crdoba santa fe sb0120 24 11 4 9 sb0130 18 - 6 12 sb0131 8 2 2 4 sb0140 104 19 51 34 sb0145 36 24 10 2 sb0153 11 - 9 2 sb0267 2 - 1 1 sb0269 2 - 2 - sb0273 4 - 4 - sb0484 13 - 9 4 sb0520 4 - 4 - sb0678 1 - - 1 sb0820 2 1 1 - sb0980 4 - 1 3 sb0996 1 - 1 - sb1033 2 1 - 1 sb1043 1 - 1 - sb1055 7 7 - - sb1066 1 - - 1 sb1068 1 - 1 - sb1776 1 - 1 - sb1787 2 1 - 1 sb1790 2 - - 2 sb1799 2 - 1 1 sb2117 1 - - 1 sb2165 1 - - 1 sb2166 1 - - 1 sbxx126 1 - 1 - sbxx131 1 - 1 - sbxx134 1 - 1 - sbxx138 1 1 - - sbxx139 1 - - 1
total 261 67 112 82
fig .
1a : distribution per department of the four major spoligotypes in the three
provinces ( 1 dot = 1 case ) .
department are the secondary administrative and
political division of provinces in argentina ; b : number of cattle per
department ( source : rian.inta.gov.ar/ganaderia/stock2011 ) .
2 : pie chart representing the major spoligotypes , the rest of clustered
spoligotypes and orphan types in the three provinces and in each
province .
the exclusive spoligotypes were composed of the orphans in addition to four clustered
spoligotypes , with one from buenos aires ( sb1055 , n = 7 ) , three from crdoba ( sb0269 , n
= 2 , sb0273 , n = 4 and sb0520 , n = 4 ) and one from santa fe ( sb1790 , n = 2 ) .
four spoligotypes ( sb0120 , sb0131 , sb0140 and sb0145 ) were
shared among the three provinces and they made up 65.9% of the isolates .
six
spoligotypes were present in crdoba and santa fe ( sb0130 , sb0153 , sb0267 , sb0484 ,
sb0980 and sb1799 ) , which represented 26.8% of the isolates from these provinces .
another spoligotype was detected in crdoba and buenos aires ( sb0820 ) ( with 1.1% of the
isolates from these 2 provinces ) and two spoligotypes were in buenos aires and santa fe
( sb1033 and sb1787 ) ( with 2.7% of the isolates from these 2 provinces ) . with regards to the distribution of spoligotypes per animal category , we observed that
in the calf category ( n = 27 ) , sb0145 was predominant , with 19 isolates .
the animals
from this specific category were primarily sampled from buenos aires ( 81.5% ) .
all of these samples came from crdoba and
sb0140 was the predominant spoligotype ( n = 5 ) in this category .
samples from 35 animals
were included in the steer category ( 65.7% from crdoba and 31.4% from santa fe ) .
out of
these samples , 16 belonged to sb0140 and five to sb0145 . in the heifer category ,
of the 24 animals from this particular category , nine
belonged to sb0140 and six to sb0145 . in the cow category ( n = 158 )
( buenos aires , n =
40 ; crdoba , n = 49 and santa fe , n = 69 ) , the following spoligotypes were described :
sb0120 ( 19 ) , sb0130 ( 13 ) , sb0140 ( 68 ) , sb0153 ( 5 ) , sb0484 ( 11 ) and sb1055 ( 7 ) .
only one
animal , which came from crdoba , was included in the bull category and it exhibited
spoligotype sb0140 . in santa fe , there were 11 isolates from the steer category and
spoligotype sb0140 included 45.5% of the isolates . from cows , we obtained 69 isolates
and the spoligotypes were distributed as follow : sb0140 ( 28 ) , sb0130 ( 12 ) , sb0120 ( 7 )
and sb0484 ( 4 ) . in crdoba , sb0140 predominated in all categories [ young steers ( 38.5% ) ,
steers ( 47.8% ) , heifers ( 45% ) and cows ( 49% ) ] .
vntr typing - a total of 197 isolates were also typed by vntr ( buenos
aires , n = 64 , crdoba , n = 69 and santa fe , n = 64 ) .
there were 55 combined vntr types
that were determined by using primers directed to etr a , b , c and d ( table iii ) .
the predominant
cluster was 7 - 5 - 5 - 4 * with 48 isolates present in the three provinces .
the second most
prevalent cluster was 6 - 5 - 5 - 4 * with 20 isolates present in the three provinces , followed
by 6 - 5 - 5 - 1 with 12 isolates from santa fe .
table iiivariable number of tandem repeats ( vntr ) types distribution , number of
patterns per province vntr types total of isolates buenos aires crdoba santa fe 2 - 3 - 5 - 3 1 1 - - 2,5 * -5 - 4 , * 1 1 - - 3 - 10 - 5 - 4 * 1 - - 1 3 - 3 - 5 - 1 5 5 - - 3 - 5 - 1 - 4 * 1 1 - - 3 - 5 - 5 - 1 1 1 - - 3 - 5 - 5 - 4 * 1 3 1 - 4 - 4 - 5 - 1 1 1 - - 4 - 5 - 5 - 1 3 2 - 1 4 - 5 - 5 - 4 * 3 - 2 1 5 - 4 - 5 - 1 1 - - 1 5 - 5 - 1 - 4 * 2 - - 2 5 - 5 - 5 - 4 * 3 - 2 1 5 - 8 - 4 - 4 * 1 1 - - 6 - 1 - 5- 4 * 1 - 1 - 6 - 2 - 1 - 4 * 1 - 1 - 6 - 3 - 5 - 1 3 - - 3 6 - 3 - 5 - 4 * 1 - - 1 6 - 3 * -5 - 4 * 2 - 1 1 6 - 4 - 5 - 4 * 1 - 1 - 6 - 5 - 4 - 4 * 1 - 1 - 6 - 5 - 5 - 1 12 - - 12 6 - 5 - 5 - 3 2 1 - 1 6 - 5 - 5 - 4 * 20 4 12 4 6 - 9 - 4 - 4 * 1 - - 1 6 - 9 - 5 - 1 2 - - 2 6 - 9 - 5 - 3 1 - - 1 6 - 9 - 5 - 4 * 6 4 - 2 6 - 9 * -5 - 4 * 1 1 - - 7 - 10 - 4 - 1 1 - 1 - 7 - 10 - 4 - 3 1 - 1 - 7 - 10 - 4 - 4 * 1 - - 1 7 - 10 - 5 - 1 6 1 - 5 7 - 10 - 5 - 3 1 - - 1 7 - 10 - 5 - 4 * 2 1 - 1 7 - 3 - 5 - 4 * 1 - - 1 7 - 3 * -5 - 4 * 1 1 - - 7 - 4 - 4 - 1 1 - - 1 7 - 4 - 5 - 1 5 2 - 3 7 - 4 - 5 - 4 * 6 4 1 1 7 - 5 - 1 - 4 * 2 - 1 1 7 - 5 - 2 * -4 2 2 - - 7 - 5 - 3 - 1 1 - - 1 7 - 5 - 4 - 4 * 1 1 - - 7 - 5 - 5 - 1 5 - 4 1 7 - 5 - 5 - 3 9 6 2 1 7 - 5 - 5 - 4 * 48 10 29 9 7 - 5 - 6 - 4 * 2 - 2 - 7 - 5 - 7 * -4 * 1 - 1 - 7 - 6 - 4 - 1 1 - - 1 7 - 6 - 5 - 4 * 4 - 4 - 7 - 7 - 5 - 4 * 1 - 1 - 7 - 9 - 5 - 1 1 - - 1 7 - 9 * -5 - 4 * 10 10 - -
total 197 64 69 64
subtyping of spoligotypes by vntr - the highly predominant spoligotype
sb0140 was divided in 26 vntr types , where 7 - 5 - 5 - 4 * included 15 of the 64 isolates ( data
not shown ) .
the 34 isolates belonging to sb0145 were divided into eight vntr types . in
turn , the third most frequent spoligotype , namely sb0120 ( with 21 isolates ) , was
subdivided into 11 vntr types . with regards to the major vntr types , the predominant
7 - 5 - 5 - 4 * with 48 isolates was split into 14 different spoligotypes , which were primarily
distributed into the following three spoligotypes : sb0153 , sb0145 and sb0140 .
the second
most prevalent vntr was 6 - 5 - 5 - 4 * , with 20 isolates composing spoligotype sb0140 in 14/20
isolates and this vntr was split into six different spoligotypes .
finally , 6 - 5 - 5 - 1
comprised sb0140 and sb0130 with 12 isolates each .
combined discrimination by spoligotyping and vntr typing - when both
typing methods were combined , we detected 96 spoligotypes and vntr types ( table iv ) with 30 clusters ( comprising 131
isolates ) and 66 orphan types and a discrimination index of 0.98 .
sb0140 - 7 - 5 - 5 - 4 * was
the predominant cluster with 15 isolates distributed in south crdoba , santa fe and
buenos aires , followed by sb0140 - 6 - 5 - 5 - 4 * with 14 isolates distributed in the three
provinces .
then , sb0145 - 7 - 5 - 5 - 4 * was present in crdoba and buenos aires and sb0145-
7 - 9 * -5 - 4 * was observed only in south buenos aires with 10 isolates each .
table iv distribution of combined spoligotyping - variable number of tandem repeats
( vntr ) types , number of patterns per province spoligotype vntr total of isolates buenos aires crdoba santa fe sb0120 2- 3- 5- 3 1 1 - - sb0120 3- 5- 5- 1 1 1 - - sb0120 5- 5- 1- 4 * 2 - - 2 sb0120 5- 5- 5- 4 * 1 - 1 - sb0120 7- 10- 5- 4 * 1 1 - - sb0120 7- 3- 5- 4 * 1 - - 1 sb0120 7- 4- 5- 1 3 2 - 1 sb0120 7- 4- 5- 4 * 5 4 - 1 sb0120 7- 5- 5- 3 1 - 1 - sb0120 7- 5- 5- 4 * 4 2 1 1 sb0120 7- 6- 5- 4 * 1 - 1 - sb0130 6- 2- 1- 4 * 1 - 1 - sb0130 6- 3- 5- 1 2 - - 2 sb0130 6- 3 * - 5- 4 * 2 - 1 1 sb0130 6- 5- 5- 1 6 - - 6 sb0130 6- 5- 5- 4 * 2 - 2 - sb0130 6- 9- 5- 4 * 1 - - 1 sb0130 7- 5- 5- 4 * 3 - 2 1 sb0131 3- 10- 5- 4 * 1 - - 1 sb0131 4- 4- 5- 1 1 1 - - sb0131 7- 4- 5- 4 * 1 - 1 - sb0131 7- 5- 3- 1 1 - - 1 sb0131 7- 5- 5- 1 1 - - 1 sb0131 7- 5- 5- 4 * 1 1 - - sb0140 2 * - 5- 5- 4 * 1 1 - - sb0140 3- 5- 5- 4 * 2 1 1 - sb0140 4- 5- 5- 1 2 2 - - sb0140 4- 5- 5- 4 * 2 - 1 1 sb0140 5- 4- 5- 1 1 - - 1 sb0140 5- 5- 5- 4 * 1 - 1 - sb0140 5- 8- 4- 4 * 1 1 - - sb0140 6- 1- 5- 4 * 1 - 1 - sb0140 6- 3- 5- 1 1 - - 1 sb0140 6- 5- 4- 4 * 1 - 1 - sb0140 6- 5- 5- 1 6 - - 6 sb0140 6- 5- 5- 3 1 - - 1 sb0140 6- 5- 5- 4 * 14 4 6 4 sb0140 6- 9- 4- 4 * 1 - - 1 sb0140 6- 9- 5- 3 1 - - 1 sb0140 6- 9- 5- 4 * 4 4 - - sb0140 6- 9 * - 5- 4 * 1 1 - - sb0140 7- 10- 4- 4 * 1 - - 1 sb0140 7- 10- 5- 4 * 1 - - 1 sb0140 7- 3 * - 5- 4 * 1 1 - - sb0140 7- 4- 4- 1 1 - - 1 sb0140 7- 5- 4- 4 * 1 1 - - sb0140 7- 5- 5- 3 1 - - 1 sb0140 7- 5- 5- 4 * 15 1 10 4 sb0140 7- 5- 7 * - 4 * 1 - 1 - sb0140 7- 6- 4- 1 1 - - 1 sb0145 3- 5- 1- 4 * 1 1 - - sb0145 6- 5- 5- 4 * 1 - 1 - sb0145 7- 4- 5- 1 1 - - 1 sb0145 7- 5- 2 * - 4 2 2 - - sb0145 7- 5- 5- 3 7 6 1 - sb0145 7- 5- 5- 4 * 10 5 5 - sb0145 7- 6- 5- 4 * 2 - 2 - sb0145 7- 9 * - 5- 4 * 10 10 - - sb0153 6- 3- 5- 4 * 1 - - 1 sb0153 6- 5- 5- 4 * 1 - 1 - sb0153 7- 5- 1- 4 * 1 - 1 - sb0153 7- 5- 5- 4 * 4 - 3 1 sb0153 7- 5- 6- 4 * 2 - 2 - sb0153 7- 6- 5- 4 * 1 - 1 - sb0153 7- 7- 5- 4 * 1 - 1 - sb0267 7- 5- 5- 4 * 1 - - 1 sb0269 6- 4- 5- 4 * 1 - 1 - sb0273 7- 10- 4- 1 1 - 1 - sb0273 7- 10- 4- 3 1 - 1 - sb0273 7- 5- 5- 4 * 2 - 2 - sb0484 4- 5- 5- 1 1 - - 1 sb0484 7- 10- 5- 1 2 - - 2 sb0484 7- 5- 5- 1 4 - 4 - sb0484 7- 5- 5- 4 * 1 - 1 - sb0520 7- 5- 5- 4 * 3 - 3 - sb0820 7- 10- 5- 1 1 1 - - sb0980 5- 5- 5- 4 * 1 - - 1 sb0980 6- 9- 5- 1 1 - - 1 sb0980 7- 9- 5- 1 1 - - 1 sb0996 6- 5- 5- 4 * 1 - 1 - sb1033 6- 5- 5- 3 1 1 - - sb1033
6- 9- 5- 1 1 - - 1 sb1043 7- 5- 5- 4 * 1 - 1 - sb1055 3- 3- 5- 1 5 5 - - sb1055 3- 5- 5- 4 * 2 2 - - sb1068 4- 5- 5- 4 * 1 - 1 - sb1787 7- 4- 5- 1 1 1 - - sb1787
7- 5- 1- 4 * 1 - - 1 sb1790 7- 10- 5- 1 2 - - 2 sb1799 7- 5- 5- 4 * 1 - 1 - sb2117 7- 10- 5- 1 1 - - 1 sb2165 6- 9- 5- 4 * 1 - - 1 sb2166 7- 10- 5- 3 1 - - 1 spo126 6- 5- 5- 4 * 1 - 1 - spo138 7- 5- 5- 4 * 1 1 - - spo139 7- 5- 5- 4 * 1 - - 1
total - 197 64 69 64
in addition to the orphan types , there were 18 spoligo - vntr types that were exclusives
( 6 of each province ) , which were clustered in 60 isolates ( buenos aires , 25 , crdoba , 15
and santa fe , 20 ) .
temporal trends - a study of temporal trends was performed with a
meta - analysis of spoligotypes .
we used data from 1994 - 2011 that were recorded in our
genotyping database .
the analysis was performed by dividing the data into periods of
four years ( except for the 1st period that includes only the years 1994 and 1995 ) .
the
predominant spoligotype was sb0140 and its prevalence percentage remained high
throughout the different periods , varying from 25.5 - 57.8% ( fig .
sb0130 was the second most prevalent in the database
registers and experienced an important fluctuation and it reached a peak of 65.2% in
2000 - 2003 .
similarly , sb0145 also displayed fluctuations , although they were at lower
prevalence levels . by contrast , other minor spoligotypes had low representation , but
they were constant or sporadic .
3 : percentage of incidence of major spoligotypes in the three studied
provinces along different sampling periods .
when temporal trends are taken into account by province ,
the most predominant
spoligotype in buenos aires was sb0140 , which is in line with the rest of the country .
however , the prevalence percentage highly differs throughout the different time periods
( fig .
sb0145 , the second most
predominant type in buenos aires , increased sharply during the last study period .
additionally , important fluctuations are observed in the periodical frequency of sb0130 .
in some cases ,
the sampling number was too low to validate the analysis ( data not
shown ) .
this challenge was also the case for the analysis in crdoba , where the number
of collected isolates was too low during some periods ( data not shown ) .
in santa fe ,
sb0140 was the predominant spoligotype with a percentage above 37% during all periods ,
except for 2000 - 2003 .
the second most predominant spoligotype was sb0130 , which varied
from 0 - 93.75% .
finally , sb0120 rose from 0 - 10.2% in 2008 - 2011 ( data not shown ) .
among the 32 spoligotypes detected , 10 have not been previously included or described in
argentina and are not included in the databases from mbovis.org ; therefore , they were
considered to be new spoligotypes .
of these 10 spoligotypes , three formed clusters of
two isolates each , that is , sb1790 of santa fe , sb1787 of santa fe and buenos aires and
sb1799 of santa fe and crdoba .
the other new spoligotypes were also orphans , namely
sbxx138 from buenos aires , sbxx131 and 1776 from crdoba and sb2165 , 2166 , xx126 and
xx139 from santa fe .
santa fe had the majority of new spoligotypes , most likely because
of the active tb eradication program in that province .
this program , which was
implemented across the whole country , consists of the sacrifice of infected bovines and
the inspection of carcasses in slaughterhouses . in this way , when a new m.
bovis strain is introduced into a herd , the infected animals are detected
early and sacrificed , so a new m. bovis genotype can be detected before
it can spread among the other animals .
other authors have proposed that if a human or
bovine tb control program is active and long - lasting , then a reduction in predominant
clones should be observed as transmission is halted ( van
soolingen et al .
early in the application of vntr elements to m. bovis , the method s
discriminatory power was observed to be higher than that of spoligotyping ( roring et al .
specifically , etr a and etr b
exhibited an important allelic variation in m. bovis ( romero et al .
the etr a - c elements were
previously shown to have a discrimination index higher than 0.4 ( martinez et al . 2008 , boniotti et al .
.
however , the individual discrimination indexes in m. bovis for etr a - d
may be highly variable according to the geographic setting ( sahraoui et al .
this discrimination index increases when etrs a - d are evaluated
together . additionally , the combination of vntr typing and spoligotyping increases the
discrimination index above that of vntr alone ( martinez
et al .
in contrast with the etr - vntr elements , minimum inhibitory
concentration ( miru)-vntr ( with the exception of miru26 ) yields a low discriminatory
power for m. bovis ( rodriguez et al .
one important aspect to evaluate is the discrimination conferred by vntr typing in
predominant spoligotypes .
we observed that the predominant sb0140 spoligotype was split
into 26 different etr a - d types .
( 2009 ) observed that 408 isolates of
sb0120 , which is the most predominant spoligotype in italy , were split into 64 different
patterns ( boniotti et al .
the presence of combined cluster patterns is an index for the active transmission of tb .
there were 66.5% of the isolates distributed into 30 different spoligotyping - vntr
combined patterns .
( 2003 ) suggested
that the clonal expansion of a genotype is caused either by the spread of a favourable
mutation or by the invasion of a geographic region by a few genotypes ( smith et al .
, we detected 18 combined and clustered spoligotyping - vntr patterns ( 6 in
each province ) that were exclusives in the sampled provinces .
these combined patterns
represented 30.5% of the analysed isolates . together with the 66 orphans , these patterns
yielded 84 combined and exclusive patterns .
however , this putative association must be
demonstrated with more isolates in the future ; the association was supported by a
chi - square test because of the low number of isolates ( data not shown ) .
our database consists of m. bovis molecular typing data from 1994 until
the present .
when we divided this 17-year span into regular periods , we observed that
although the incidence of different spoligotypes fluctuated , the most predominant
spoligotypes were unaltered .
to the best of our knowledge , only one previous publication
on the evolution of the m. bovis population structure has been reported
( haddad et al . 2001 ) .
the predominance of major spoligotypes in cattle from the primary cattle farms in these
argentine provinces suggests that there is still an active transmission of the pathogen ,
in spite of the reduced incidence of animals with visible lesions in slaughterhouses .
spoligotypes are more stable than vntr types . in fact , the bcgs obtained in 1921 from
which the substrains originated can not be differentiated by spoligotyping ( de la salmonire et al .
1997 , bauer et al . 1999 ) and vntr subdivides bcg ( magdalena et al .
, the predominant spoligotypes may ancient , as
suggested by the subdivision of the main spoligotypes by vntr typing . | mycobacterium bovis is the causative agent of bovine tuberculosis
( tb ) , a disease that affects approximately 5% of argentinean cattle . among the
molecular methods for genotyping , the most convenient are spoligotyping and variable
number of tandem repeats ( vntr ) .
a total of 378 samples from bovines with visible
lesions consistent with tb were collected at slaughterhouses in three provinces ,
yielding 265 m. bovis spoligotyped isolates , which were distributed
into 35 spoligotypes .
in addition , 197 isolates were also typed by the vntr method
and 54 combined vntr types were detected .
there were 24 clusters and 27 orphan types .
when both typing methods were combined , 98 spoligotypes and vntr types were observed
with 27 clusters and 71 orphan types . by performing a meta - analysis with previous
spoligotyping results
, we identified regional and temporal trends in the population
structure of m. bovis .
for sb0140 , the most predominant spoligotype
in argentina , the prevalence percentage remained high during different periods ,
varying from 25.5 - 57.8% ( 1994 - 2011 ) .
by contrast , the second and third most prevalent
spoligotypes exhibited important fluctuations .
this study shows that there has been
an expansion in ancestral lineages as demonstrated by spoligotyping .
however , exact
tandem repeat typing suggests dynamic changes in the clonal population of this
microorganism . |
group 1 consists of human coronavirus 229e ( hcov-229e ) , porcine epidemic diarrhea virus , and feline infectious peritonitis virus ( fipv ) .
group 2 includes bovine coronavirus , murine hepatitis virus , and human coronavirus oc34 ( hcov - oc43 ) .
sars - cov is a new member of the genus coronavirus , but it does not belong to any of the 3 antigenic groups , although some reports suggest that it most resembles the group 2 coronavirus ( 2 ) .
sars - cov like virus with > 99% nucleotide homology with human sars - cov was identified in palm civets and other animals found in live animal markets in guangdong , china ( 3 ) .
the sars - cov like virus that exists in animals does not cause typical sars - like disease in the natural hosts and is not transmitted from animals to humans . under certain conditions ,
the virus may have evolved into the early human sars - cov , with the ability to be transmitted from animals to humans or even from humans to humans , resulting in localized outbreaks and mild human disease . under selective pressure in humans
, the early human sars - cov may further evolve into the late human sars - cov , which can cause local or even global outbreaks and typical sars in humans with high death rates .
early human sars - cov is closer genetically to animal sars - cov like virus than to late human sars - cov , which has a 29-nucleotide ( in some isolates a 415-nucleotide ) deletion in open reading frame 8 ( 3,4 ) .
sars - cov , severe acute respiratory syndrome associated coronavirus ; ace2 , angiotensin - converting enzyme 2 .
sars - cov can be efficiently grown in cell culture ( 1 ) and rapidly spread from person to person ( 7 ) .
it can survive in feces and urine at room temperature for > 2 days ( http://www.who.int/csr/sars/en ) and may cause serious , even fatal , disease .
sars - cov , a national institute of allergy and infectious diseases biodefense category c priority pathogen ( http://www2.niaid.nih.gov/biodefense/bandc_priority.htm ) could be used by bioterrorists as a biological weapon .
therefore , development of effective and safe vaccines is urgently needed to prevent a new sars epidemic and for biodefense preparedness . currently , 3 major classes of sars vaccines are under development : 1 ) inactivated sars - cov ( figure 1 ) , 2 ) full - length s protein ( figure 2a ) , and 3 ) those based on fragments containing neutralizing epitopes ( figure 2b ) .
strategy for designing vaccines for severe acute respiratory syndrome ( sars ) using inactivated sars - associated coronavirus .
this virus expresses several structural proteins , including nucleocapsid ( n ) , membrane ( m ) , envelope ( e ) , and spike ( s ) .
strategies for designing vaccines for severe acute respiratory syndrome ( sars ) using a ) spike ( s ) protein and b ) fragments containing neutralizing epitopes .
sp , signal peptide ; rbd , receptor binding domain ; fp , fusion peptide ; hr , heptad repeat ; tm , transmembrane domain ; cp , cytoplasm domain .
ids , immunodominant sites i to v corresponding to the sequences of amino acid residues 971 , 171224 , 271318 , 528635 , and 842913 , respectively .
the residue numbers of each region correspond to their positions in the s protein of sars associated coronavirus ( sars - cov ) strain tor2 .
the recombinant rbd may be used as an efficacious and safe vaccine for preventing infection by sars - cov strains with distinct genotypes .
sars - cov expresses several structural proteins , including nucleocapsid , membrane , envelope , and spike ( s ) proteins ( 1 ) .
in general , prior to identification of the protein that contains the major neutralizing epitopes , the inactivated virus may be used as the first - generation vaccine because it is easy to generate whole killed virus particles . however ,
once the neutralizing epitopes are identified , the inactivated virus vaccine should be replaced by vaccines based on fragments containing neutralizing epitopes since they are safer and more effective .
several reports have showed that sars - cov inactivated with formaldehyde , uv light , and -propiolactone can induce virus - neutralizing antibodies in immunized animals ( 811 ) , and the first inactivated sars - cov vaccine is being tested in the clinical trials in china . however , safety of the inactivated vaccine is a serious concern ; production workers are at risk for infection during handling of concentrated live sars - cov , incomplete virus inactivation may cause sars outbreaks among the vaccinated populations , and some viral proteins may induce harmful immune or inflammatory responses , even causing sars - like diseases ( 12,13 ) .
the s protein of sars - cov , a type i transmembrane glycoprotein , is responsible for virus binding , fusion , and entry and is a major inducer of neutralizing antibodies ( 1,14 ) .
s protein consists of a signal peptide ( sp : amino acids [ aa ] 112 ) and 3 domains : an extracellular domain ( aa 131193 ) , a transmembrane domain ( aa 111941215 ) , and an intracellular domain ( aa 12161255 ) .
its extracellular domain consists of 2 subunits , s1 and s2 ( 14 ) , although the cleavage site between these subunits has not been clearly defined .
the s1 subunit is responsible for virus binding to the receptor , angiotensin - converting enzyme 2 ( ace2 ) ( 15,16 ) .
a fragment located in the middle region of the s1 subunit ( aa 318510 ) is the receptor - binding domain ( rbd ) for ace2 ( 1719 ) .
sars - cov may also bind to cells through the alternative receptors dc - sign or l - sign ( 20,21 ) , but the binding sites for these alternative receptors have not been defined . the s2 subunit , which contains a putative fusion peptide and 2 heptad repeats ( hr1 and hr2 ) , is responsible for fusion between the viral and target cell membranes .
infection by sars - cov is initiated by binding of rbd in the viral s protein s1 subunit to ace2 on target cells .
this forms a fusogenic core between the hr1 and hr2 regions in the s2 domain that brings the viral and target cell membranes into close proximity , which results in virus fusion and entry ( 2224 ) .
this scenario indicates that the s protein may be used as a vaccine to induce antibodies for blocking virus binding and fusion .
several recombinant vector - based vaccines expressing sars - cov s protein have been assessed in preclinical studies .
yang et al . ( 25 ) reported that a candidate dna vaccine encoding the full - length s protein induced neutralizing antibodies ( neutralizing titers ranging from 1:50 to 1:150 ) and protected mice from sars - cov challenge . using dna vaccines encoding the full - length and segments of s protein to immunize rabbits , wang et al .
have produced higher titers of neutralizing antibodies and demonstrated that major and minor neutralizing epitopes are located in the s1 and s2 subunits , respectively ( 26 ) .
( 29 ) have shown that intranasal or intramuscular inoculations of mice with highly attenuated modified vaccinia virus ankara ( mva ) vaccines encoding full - length sars - cov s protein also produce neutralizing antibodies with mean neutralizing titers of 1:284 .
( 30 ) reported that mucosal immunization of african green monkeys with an attenuated parainfluenza virus expressing s protein resulted in production of neutralizing antibodies and protected animals from infection by challenge with sars - cov .
these data suggest that the s protein can induce neutralizing antibodies and protective responses in immunized animals . using convalescent - phase sera from sars patients and a set of peptides spanning the entire sequence of the sars - cov s protein ,
we have identified 5 linear immunodominant sites ( ids ) in the s protein ( figure 2a ) . ids
i , ii , iii , and v reacted with > 50% of the convalescent - phase sera from sars patients , while ids iv was reactive with > 80% of sars sera , suggesting that ids iv is the major immunodominant epitope on the s protein ( 31 ) . synthetic peptides corresponding to ids could induce high titers of s protein specific antibodies , but none of these antibodies possesses neutralizing activity .
whether these antibodies enhance infection by heterologous sars - cov strains or mediate harmful immune responses is unclear .
the s protein of fipv expressed by recombinant vaccinia can cause antibody - dependent enhancement of disease if vaccinated animals are subsequently infected with wild - type virus ( 32 ) .
our previous studies on hiv-1 showed that antibodies against some immunodominant epitopes in the hiv-1 envelope glycoprotein could enhance infection by heterologous hiv-1 strains ( 33 ) .
most recently , yang et al . ( 6 ) demonstrated that the polyclonal and monoclonal antibodies against s protein of the late sars - cov ( urbani strain ) could neutralize infection by the relevant late sars - cov strains .
however , these antibodies enhanced infection by an early human sars - cov isolate ( gd03t0013 ) and the civet sars - cov like viruses .
these investigators have shown that the ace2-binding domain mediates the antibody - dependent enhancement of civet sars - cov like virus entry ( 6 ) . theoretically , some antibodies to the ace2-binding domain may enhance infection if these antibodies closely mimic the receptor ace2 and induce similar conformational changes , as the receptor likely does . the s protein with truncation at aa 1153 failed to cause antibody - dependent enhancement of infection , although it still induced neutralizing antibodies .
this finding suggests that removal of the aa 11531194 region may abrogate induction of virus infection enhancing antibodies ( 6 ) .
vaccination of ferrets with mva - based sars vaccine expressing full - length s protein caused liver damage after animals were challenged with sars - cov ( 34 ) .
these findings raised concerns about the efficacy and safety of the vaccines containing or expressing full - length s protein .
rbd , a fragment ( 193 aa residues ) in the middle of s1 subunit of s protein ( figure 2b ) , is responsible for virus binding to the receptor on target cells .
we have demonstrated that the antisera from sars patients and from animals immunized with inactivated sars - cov reacted strongly with rbd ( 9,35 ) .
absorption of antibodies by rbd from these antisera results in the removal of most of the neutralizing antibodies , and rbd - specific antibodies isolated from these antisera have potent neutralizing activity ( 35,36 ) .
we have also shown that rabbits and mice immunized with rbd produced high titers of neutralizing antibodies against sars - cov with 50% neutralizing titers at a > 1:10,000 serum dilution ( 37 ) .
the antibodies purified from the antisera against sars - cov significantly inhibited rbd binding to ace2 ( 9,3638 ) . using spleen cells from mice immunized with rbd ,
we have generated a panel of 25 monoclonal antibodies ( mabs ) that recognize different conformational epitopes on rbd and possess potent neutralizing activity ( 38 ) .
( 39 ) , who identified 3 human neutralizing anti - s mabs from antibody phage display libraries by using inactivated sars - cov as the target .
these researchers also found that all of these mabs specifically bound to rbd and blocked interaction between rbd and ace2 .
these findings suggest that rbd contains the major neutralizing epitopes in the s protein and is an ideal sars vaccine candidate because rbd contains the receptor - binding site , which is critical for virus attachment to the target cell for infection ( 15,1719 ) .
antibodies specific for rbd are expected to block binding of virus to the target cell .
rbd induces higher titers of neutralizing antibodies than those vaccines expressing the full - length s protein ( 25,26,29,30,37,38 ) .
rbd sequences among the late sars - cov strains are highly conserved . when the early and late sars - cov strains are compared , only 3 to 5 aa residues are variable among the 193 residues in rbd and most of the isolates vary by only 1 residue ( 4 ) .
( 39 ) showed that 1 human mab ( cr3014 ) specific for rbd of sars - cov strain fm1 can effectively bind to most rbds of the early and late sars - cov strains .
these data suggest that antibodies directed against rbd of a sars - cov isolate may neutralize infection by a broad spectrum of sars - cov strains .
therefore , recombinant proteins containing rbd or vectors encoding rbd may be used as vaccines for preventing infection by sars - cov with distinct genotypes .
sars - cov expresses several structural proteins , including nucleocapsid , membrane , envelope , and spike ( s ) proteins ( 1 ) .
in general , prior to identification of the protein that contains the major neutralizing epitopes , the inactivated virus may be used as the first - generation vaccine because it is easy to generate whole killed virus particles . however , once the neutralizing epitopes are identified , the inactivated virus vaccine should be replaced by vaccines based on fragments containing neutralizing epitopes since they are safer and more effective .
several reports have showed that sars - cov inactivated with formaldehyde , uv light , and -propiolactone can induce virus - neutralizing antibodies in immunized animals ( 811 ) , and the first inactivated sars - cov vaccine is being tested in the clinical trials in china
. however , safety of the inactivated vaccine is a serious concern ; production workers are at risk for infection during handling of concentrated live sars - cov , incomplete virus inactivation may cause sars outbreaks among the vaccinated populations , and some viral proteins may induce harmful immune or inflammatory responses , even causing sars - like diseases ( 12,13 ) .
the s protein of sars - cov , a type i transmembrane glycoprotein , is responsible for virus binding , fusion , and entry and is a major inducer of neutralizing antibodies ( 1,14 ) .
s protein consists of a signal peptide ( sp : amino acids [ aa ] 112 ) and 3 domains : an extracellular domain ( aa 131193 ) , a transmembrane domain ( aa 111941215 ) , and an intracellular domain ( aa 12161255 ) .
its extracellular domain consists of 2 subunits , s1 and s2 ( 14 ) , although the cleavage site between these subunits has not been clearly defined .
the s1 subunit is responsible for virus binding to the receptor , angiotensin - converting enzyme 2 ( ace2 ) ( 15,16 ) .
a fragment located in the middle region of the s1 subunit ( aa 318510 ) is the receptor - binding domain ( rbd ) for ace2 ( 1719 ) .
sars - cov may also bind to cells through the alternative receptors dc - sign or l - sign ( 20,21 ) , but the binding sites for these alternative receptors have not been defined
. the s2 subunit , which contains a putative fusion peptide and 2 heptad repeats ( hr1 and hr2 ) , is responsible for fusion between the viral and target cell membranes .
infection by sars - cov is initiated by binding of rbd in the viral s protein s1 subunit to ace2 on target cells .
this forms a fusogenic core between the hr1 and hr2 regions in the s2 domain that brings the viral and target cell membranes into close proximity , which results in virus fusion and entry ( 2224 ) .
this scenario indicates that the s protein may be used as a vaccine to induce antibodies for blocking virus binding and fusion .
several recombinant vector - based vaccines expressing sars - cov s protein have been assessed in preclinical studies .
yang et al . ( 25 ) reported that a candidate dna vaccine encoding the full - length s protein induced neutralizing antibodies ( neutralizing titers ranging from 1:50 to 1:150 ) and protected mice from sars - cov challenge . using dna vaccines encoding the full - length and segments of s protein to immunize rabbits ,
wang et al . have produced higher titers of neutralizing antibodies and demonstrated that major and minor neutralizing epitopes are located in the s1 and s2 subunits , respectively ( 26 ) .
( 29 ) have shown that intranasal or intramuscular inoculations of mice with highly attenuated modified vaccinia virus ankara ( mva ) vaccines encoding full - length sars - cov s protein also produce neutralizing antibodies with mean neutralizing titers of 1:284 .
( 30 ) reported that mucosal immunization of african green monkeys with an attenuated parainfluenza virus expressing s protein resulted in production of neutralizing antibodies and protected animals from infection by challenge with sars - cov .
these data suggest that the s protein can induce neutralizing antibodies and protective responses in immunized animals . using convalescent - phase sera from sars patients and a set of peptides spanning the entire sequence of the sars - cov s protein ,
we have identified 5 linear immunodominant sites ( ids ) in the s protein ( figure 2a ) .
ids i , ii , iii , and v reacted with > 50% of the convalescent - phase sera from sars patients , while ids iv was reactive with > 80% of sars sera , suggesting that ids iv is the major immunodominant epitope on the s protein ( 31 ) . synthetic peptides corresponding to ids could induce high titers of s protein specific antibodies , but none of these antibodies possesses neutralizing activity .
whether these antibodies enhance infection by heterologous sars - cov strains or mediate harmful immune responses is unclear .
the s protein of fipv expressed by recombinant vaccinia can cause antibody - dependent enhancement of disease if vaccinated animals are subsequently infected with wild - type virus ( 32 ) .
our previous studies on hiv-1 showed that antibodies against some immunodominant epitopes in the hiv-1 envelope glycoprotein could enhance infection by heterologous hiv-1 strains ( 33 ) .
( 6 ) demonstrated that the polyclonal and monoclonal antibodies against s protein of the late sars - cov ( urbani strain ) could neutralize infection by the relevant late sars - cov strains .
however , these antibodies enhanced infection by an early human sars - cov isolate ( gd03t0013 ) and the civet sars - cov like viruses .
these investigators have shown that the ace2-binding domain mediates the antibody - dependent enhancement of civet sars - cov like virus entry ( 6 ) .
theoretically , some antibodies to the ace2-binding domain may enhance infection if these antibodies closely mimic the receptor ace2 and induce similar conformational changes , as the receptor likely does . the s protein with truncation at aa 1153 failed to cause antibody - dependent enhancement of infection , although it still induced neutralizing antibodies .
this finding suggests that removal of the aa 11531194 region may abrogate induction of virus infection enhancing antibodies ( 6 ) .
vaccination of ferrets with mva - based sars vaccine expressing full - length s protein caused liver damage after animals were challenged with sars - cov ( 34 ) .
these findings raised concerns about the efficacy and safety of the vaccines containing or expressing full - length s protein .
rbd , a fragment ( 193 aa residues ) in the middle of s1 subunit of s protein ( figure 2b ) , is responsible for virus binding to the receptor on target cells .
we have demonstrated that the antisera from sars patients and from animals immunized with inactivated sars - cov reacted strongly with rbd ( 9,35 ) .
absorption of antibodies by rbd from these antisera results in the removal of most of the neutralizing antibodies , and rbd - specific antibodies isolated from these antisera have potent neutralizing activity ( 35,36 ) .
we have also shown that rabbits and mice immunized with rbd produced high titers of neutralizing antibodies against sars - cov with 50% neutralizing titers at a > 1:10,000 serum dilution ( 37 ) .
the antibodies purified from the antisera against sars - cov significantly inhibited rbd binding to ace2 ( 9,3638 ) . using spleen cells from mice immunized with rbd ,
we have generated a panel of 25 monoclonal antibodies ( mabs ) that recognize different conformational epitopes on rbd and possess potent neutralizing activity ( 38 ) .
( 39 ) , who identified 3 human neutralizing anti - s mabs from antibody phage display libraries by using inactivated sars - cov as the target .
these researchers also found that all of these mabs specifically bound to rbd and blocked interaction between rbd and ace2 .
these findings suggest that rbd contains the major neutralizing epitopes in the s protein and is an ideal sars vaccine candidate because rbd contains the receptor - binding site , which is critical for virus attachment to the target cell for infection ( 15,1719 ) .
antibodies specific for rbd are expected to block binding of virus to the target cell .
rbd induces higher titers of neutralizing antibodies than those vaccines expressing the full - length s protein ( 25,26,29,30,37,38 ) .
when the early and late sars - cov strains are compared , only 3 to 5 aa residues are variable among the 193 residues in rbd and most of the isolates vary by only 1 residue ( 4 ) .
( 39 ) showed that 1 human mab ( cr3014 ) specific for rbd of sars - cov strain fm1 can effectively bind to most rbds of the early and late sars - cov strains .
these data suggest that antibodies directed against rbd of a sars - cov isolate may neutralize infection by a broad spectrum of sars - cov strains .
therefore , recombinant proteins containing rbd or vectors encoding rbd may be used as vaccines for preventing infection by sars - cov with distinct genotypes .
an ideal sars vaccine should 1 ) elicit highly potent neutralizing antibody responses against a broad spectrum of viral strains ; 2 ) induce protection against infection and transmission ; and 3 ) be safe by not inducing any infection - enhancing antibodies or harmful immune or inflammatory responses .
recombinant vector - based vaccines expressing full - length s protein of the late sars - cov are under development
. these vaccines can induce potent neutralizing and protective responses in immunized animals but may induce antibodies that enhance infection by early human sars - cov and animal sars - cov like viruses ( 6 ) .
recent studies have demonstrated that recombinant rbd consists of multiple conformational neutralizing epitopes that induce highly potent neutralizing antibodies against sars - cov ( 9,26,3538 ) . unlike full - length s protein
thus , recombinant rbd or vectors encoding rbd may be used as safe and efficacious vaccines for preventing infection by sars - cov with distinct genotypes . | developing effective and safe vaccines is urgently needed to prevent infection by severe acute respiratory syndrome ( sars)associated coronavirus ( sars - cov ) .
the inactivated sars - cov vaccine may be the first one available for clinical use because it is easy to generate ; however , safety is the main concern .
the spike ( s ) protein of sars - cov is the major inducer of neutralizing antibodies , and the receptor - binding domain ( rbd ) in the s1 subunit of s protein contains multiple conformational neutralizing epitopes .
this suggests that recombinant proteins containing rbd and vectors encoding the rbd sequence can be used to develop safe and effective sars vaccines . |
acinetobacter ( a. ) baumannii can be found in various environmental sources such as soil and foods , including vegetables , meat , and fish .
a. baumannii may infrequently colonize the skin of healthy human , typically at a low - density and for short - term duration .
colonization of other body sites , such as the throat , nares , and the intestinal tract , was seen rarely in healthy individuals.15 the organism has known as an important and common pathogen creating nosocomial pneumonia and bacteremia among patients who admitted in the intensive care unit ( icu ) worldwide,69 followed by skin , soft tissue , and urinary tract infection,61011 and secondary meningitis1213 over the past few decades .
the incidence of a. baumannii infections has raised over the past decades,68 which could be related to a rise in the proportion of the susceptible population as a result of advancements in medical support of critically ill and frail patients.11 the rate of multidrug resistance a. baumannii strains accounted for non - icu inpatients ( 27.6 to 32.5% ) and icu patients ( 11.6 to 24.2% ) between 1998 and 2001.15 the rate of multidrug - resistant a. calcoaceticus - baumannii complex was 29.3% of isolates in the middle atlantic and east south central regions.16 this seems very difficult to treat a. baumannii infections due to the increasing number of multi - drug resistant and the outcome in patients without commencing on appropriate empiric therapy might be worse.1719 the mortality rate of 7.8% to 23% accounted for hospitalised patients with a. baumannii infection and the rate was 10% to 43% among icu admitted patients with a. baumannii infection.16 the outcomes of patients with a. baumannii infections seem to be poorer if caused by isolates with resistance to multiple classes of antimicrobial agents.8 the aim of this study was to determine the prevalence of drug resistance in a. baumannii and predisposing factors for acquisition of infection caused by this organism in one teaching hospital in the southern tehran .
this study was conducted in loghman hakim hospital with 400 beds located in the south of tehran , iran . between july 2007 and june 2009
, a. baumannii isolates of patients admitted at least 48 hours in the hospital were tested .
the identification of a. baumannii and resistant pattern was performed by using conventional bacteriological methods and clinical laboratory and standards institute ( clsi ) .
this study included two parts : filling a questionnaire form up and taking laboratory tests .
the questionnaire included demographic characteristics ( age and gender ) , underlying diseases , presence of catheters ( such as intravenous and intraurethral catheters ) , the name of admission ward , history of being in intensive care unit ( icu ) , the length of icu admission , using mechanical ventilation , taking antibiotic therapy in the past history of recent hospitalization and recent operation .
recent hospitalization was meant as an admission in any hospital ward over the last year .
recent operation was defined as any major surgical procedure performing in the operating room within current admission .
taking antibiotic therapy was noticed if patient was given any antibiotics for at least 2 days within 3 months before isolating the organism .
laboratory tests were performed including macconkey and blood agar plates for all specimens as routine , trypticase soy broth ( tsb ) , and sub - cultured on chocolate agar for blood specimens , and chocolate agar for specimens other than urine .
all of the suspected colonies were assessed by gram - staining , colonial morphology , negative oxidize , and other biochemical reactions.20 disk diffusion method recommended by clinical laboratory and standards institute ( clsi ) was used to evaluate antimicrobial susceptibility of the isolated organisms21 the brand of all antibiotic disks used in this research were oxoid ltd .
briefly , a suspension of each isolate was prepared ; so that the turbidity was equal to 0.5 mcfarland standards and then plated onto mueller - hinton agar .
after incubation at 35c for 18 - 24 hours , diameter of inhibition zones was measured and data were reported as susceptible , intermediate , and resistant .
the study was approved by the ethics committee of school of medicine , shaheed beheshti university of medical sciences .
chicago , il ) . a two - tailed p - value < 0.05 was considered statistically significant .
overall , 101 strains of a. baumannii were isolated from the hospitalized patients between july 2007 to june 2009 from different wards of loghman hakim hospital , tehran , iran .
the men were 80 ( 70% ) , 77 ( 67% ) patients had mechanical ventilation , 15% had diabetes mellitus , 85 ( 74% ) patients were admitted in icu wards and 60 ( 52% ) had surgical procedures , 87 ( 76% ) took antibiotic , 85 ( 74% ) were discharged from hospital and 30 ( 26% ) died .
respiratory tract was the most common place ( 39% ) of acinetobacter isolation including tracheal secretion ( 31.3% ) , sputum ( 7% ) , and bronchoalveolar lavage ( 0.9% ) ; other common sites were urine ( 22% ) , blood ( 5% ) , csf ( 17.5% ) , wound ( 9.5% ) , catheter ( 4.5% ) , and other ( 1.5% ) .
the rate of resistance was 93% for ceftriaxone , 95% for ceftizoxime , 96% for ceftazidime , 58% for amikacin , 68% for gentamicin , 85% for co - terimoxazole , 83% for norfloxacin , 85% to ciprofloxacin , and 19% for imipenem .
statistical analysis showed that icu admission and length of using mechanical ventilation were confounding factors significantly associated with the acquisition of resistant a. baumannii isolates .
acinetobacter baumannii isolated from tracheal aspirate had also higher rates of resistance to tested antibiotics .
present study showed that most of the isolates of a. baumannii were obteained from tracheal tube aspiration ; and mechanical ventilation was the most important risk factor for these infections .
this organism has been known as the most frequent cause of respiratory tract infections , with strains being isolated from 3 to 5% of patients with nosocomial pneumonia.22 a substantial increase in the rates of antibiotic resistance of a. baumannii has also been documented during the past decades.68 in our study , more than 90% of a. baumannii isolates were resistant to the third - generation cephalosporins and 80% of isolates were resistant to floroquinolones .
rahbar and hajian23 showed that the rate of resistance of a. baumannii to imipenem was low in 2005 - 2006 .
the important risk factors for acquiring an imipenem - resistant a. baumannii include previous carbapenem use , longer duration of hospital admission before occuring infection , icu admission , urgent surgery , being on total parenteral nutrition , and using tubes and catheter such as central venous catheter , endotracheal tube , urinary catheter , and nasogastric tube.24 , 25 furthermore , improved adherence of health - care workers to hand - hygiene protocols is of paramount importance for the containment of a baumannii transmission . mortality rate in this study was 26% .
it seems that infection control strategies may help to control the evolving problem of a. baumannii infections and prevent an epidemic nosocomial life threatening infections . | objectives : acinetobacter baumannii is an omnipresent pathogen known as a major agent in healthcare and nosocomoal - associated infections . its ability to develop resistant pattern to the major and broad spectrum antibiotics is an important issue to be studied.methods:in this study , 101 strains of acinetobacter baumannii were isolated from the hospitalized patients during july 2007 to june 2009 in one teaching hospital in the southern tehran .
the identification of acinetobacter baumannii and resistant pattern was performed by using conventional bacteriological methods and clinical laboratory and standards institute ( clsi).results : respiratory tract specimens were the most common place of acinetobacter isolation .
the organism was resistant to ceftazidime ( 96% ) , ceftizoxime ( 95% ) , ceftriaxone ( 93% ) , amikacin ( 58% ) , gentamicin ( 68% ) , co - terimoxazole ( 85% ) , and ciprofloxacin ( 85% ) .
this pattern also pointed that imipenem had the lowest resistance rate ( 9%).conclusions : susceptibility rates of acinetobacter baumannii isolates to third - generation cephalosporins , fluoroquinolones , amikacin , gentamicin , and trimethoprim / sulfamethoxazole ( sxt ) were very low and the rate of resistant acinetobacter baumannii to imipenem was significant .
it would be a good idea to consider surveillance of antibiotic usage and restriction of using broad spectrum antibiotics before development of resistance to these agents . |
in many parts of the world , attaining old age is a rare privilege , though old age is often associated with some health challenges . whether the added years at the end of the life cycle are healthy , enjoyable , and productive depends in part upon preventing and controlling a number of chronic diseases and conditions .
this is because around the age of 60 years chronic diseases associated with age increase and a slow and progressive deterioration of the oral health appears .
edentulousness , multiple restorations , root caries , attrition , periodontal diseases , and certain diseases of the oral mucosa are the main oral diseases of the elderly .
are oral pathologies ; though considered negligible in terms of gravity , they constitute a nonnegligible factor of comorbidity .
these pathologies exert physiological , biological , and psychological changes associated with aging affecting their quality of life .
more than 17% of the population is more than 65 years old , compared to 12.4% in the united states . in 2025 ,
the global population has been previewed to be more than 830 million of people aged 65 years and above living mainly in developing countries . as people age ,
their susceptibility to chronic and life - threatening diseases as well as acute infections increases , exacerbated by compromised immune systems .
in addition to cancer , cardiovascular diseases , diabetes , and infections , poor oral health most notably tooth loss and severe periodontal conditions is prevalent in this age group .
consequently population growth and longevity will project dental surgery in such a way that dental care for the elderly will be increased because of their increased oral health needs . in cameroon between 1976 and 1987 ,
the number of elderly people had increased at an annual average rate of 2.1% whereas between 1987 and 2005 this subpopulation has an annual growth rate of 2.5% . at this rate
cameroon is one of the sub - saharan african countries where the population is rapidly increasing .
reports from the 3rd cameroon household survey conducted in 2010 stated that cameroon had approximately one million people above 60 years at january 2010 and predicted that this figure would increase to 1.1 million in 2015 and to 1.3 million in 2020 .
the results of the national population censuses and surveys have shown that , between 19501955 and 19902000 , the decrease in mortality was spectacular , passing life expectancy of 36 years to 50 years or a life gain of 15 years in about 45 years , with an annual average gain of four months .
the number of people aged of at least 60 years increased from 441.450 in 1976 to 870.642 in 2005 , with an average annual growth rate of 2.6% .
most of the old people in cameroon like in most developing countries enter old age after a life of poverty and deprivation , with poor access to healthcare , and inadequate diet in quality and quantity .
majority of these elderly people suffer from various problems ranging from extreme poverty , ill - health , poor nutrition , lack of adequate care , shelter , clothing , isolation , and mental and physical abuse .
many of them also suffer from age related health problems such as hypertension , diabetes , cancer , tuberculosis , arthritis , and ophthalmologic diseases especially poor eyesight [ 7 , 8 ] .
factors associated with old age such as reduced salivary flow ( in quality and quantity ) , lowered immunity , and the reduced ability of the body to repair may aggravate the process of the degradation of the oral tissues .
this may in turn lead to selection of soft diets , which in most cases are composed of refined carbohydrates .
other difficulties associated with poor oral health status include difficulties in speech , deformed facial profile , and loss of self - esteem which all together affect the quality of life of individuals .
impaired mobility , disabilities , poverty , inadequate financing for oral health care , and lack of oral health facilities impede access to care particularly for those who reside in rural areas .
in the recent years there has been a growing awareness in the dental profession that the dental needs of the elderly people have been generally neglected and that the problem requires attention . in 1981 , a collaboration working group of who / fdi formulated a number of oral health goals to be achieved as a measure of the attainment of
as declared in 1979 , one of these goals covered the elderly and stated that , by the year 2000 , a 25% reduction in the present ( 1981 ) level of edentulousness at the age greater than 65 years will be achieved .
it was also recommended that , greater than 50% of persons in this age group should be able to retain a minimum of 20 functional teeth .
data on the oral health status and treatment needs of the elderly in majority of african countries and cameroon in particular in a rural community are insufficient .
the aim of this study was to determine the oral health status of elderly persons in tonga ( a typical rural area ) , nde division of the west region of cameroon .
a cross - sectional survey was carried out for three months from may 1 , to july 30 , 2014 , in tonga , a subdivision of the nde division in the west region of cameroon ( see appendix 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/820416 ) .
the tonga subdivision is comprised of 3 major village groups : badoumga ( banounga ) , baloua , and babitchoua with a surface area of 342 km and a population of 10000 inhabitants .
the headquarters of this subdivision are tonga town which is located 90 km from the regional capital bafoussam and 30 km from the divisional capital , bangangte .
tonga is located along the yaounde - bafoussam road and is about 220 km from yaounde the political capital of cameroon .
the population is typically made up of 98% subsistent farmers producing food crops ( rice cultivation , vegetables , and fruits ) and cash crops like cocoa and coffee in small farms .
it has a social welfare centre and 2 health centres ( tonga catholic health centre , maham health centre ) and 1 medical doctor .
there is no dental facility in this area and no oral health worker is known to have worked in this area .
the climate is equatorially characterized by the alternation of two dry seasons and two rainy seasons .
the study population consisted of the elderly of 65 years and above ( as indicated by their age in their national identity card and medical records ) who live in tonga regardless of the gender .
the patients were selected using a stratified sampling technique as one of the 3 communities ( tonga village ) was selected for the sampling .
subjects were now selected from house to house ; therefore all individuals in each stratum who fulfilled the study criteria were invited to participate .
the sample size was known at the end of the study as all houses were visited .
an interviewer administered questionnaires to collect information from the subjects followed by a clinical oral examination carried out on the subject on a portable dental couch in a suitable place in the subject 's resident .
inclusion criteria were only people of 65 years old and above , recently resident in tonga permanently .
data was collected using a structured open ended and closed ended questionnaire and a data captured sheet attached to the questionnaire for charting clinical examination results . after obtaining administrative clearance ,
respondents were interviewed after reading and filling the consent form and their basic medical history obtained from the medical records and confirmed by an interview .
other pieces of information were obtained from a clinical examination out using examinations instruments under bright light .
this included the examination of the oral hard and soft tissues and the presence and types of dental appliances in the oral cavity .
the questionnaire was used for collecting information on the sociodemographic profile of the subjects , their general health status , their perception on their oral health , oral health seeking behaviour , mucosa , type of appliances used by the subject , and so forth .
clinical examination was used in assessing possible risk factors and pathologies of oral pathologies using some indices as follows:(i)the silness and loe 's plaque index : to estimate the amount of soft and mineralized deposits on tooth surfaces , the scores were as follows : 0 = no plaque ; 1 = presence of a thin visible layer of plaque by scraping the surface of the tooth with periodontal probe ; 2 = plaque deposits visible to the eye ; 3 = significant accumulation of plaque on tooth surfaces.(ii)dmft index ( decayed , missing , and filled teeth ) : to determine the impact of dental caries on the teeth , we classified each tooth in one of the following categories : d stands for tooth decay .
it is used for any tooth which is observed to have visible recurrent caries and broken crown as a result of tooth decay or retained roots .
m stands for missing tooth for any tooth that is lost as a result of tooth extraction or for any other reason .
f stands for filled tooth as any tooth that has a permanent filling intact with no sign of caries lesion .
dmf index = d + m + f / n+ .(iii)the cpi ( community periodontal index ) : it was used to determine the periodontal status of the patients .
it consists in dividing the mouth into six sextants and evaluating all teeth using a periodontal probe .
each sextant must have at least two functional teeth ( i.e. , teeth that are not extracted ) .
the rating scale has five codes : 0 = healthy ; 1 = spontaneous bleeding ; 2 = calculus ; 3 = pocket depth of 46 mm ; 4 = pocket depth > 6 mm .
the silness and loe 's plaque index : to estimate the amount of soft and mineralized deposits on tooth surfaces , the scores were as follows : 0 = no plaque ; 1 = presence of a thin visible layer of plaque by scraping the surface of the tooth with periodontal probe ; 2 = plaque deposits visible to the eye ; 3 = significant accumulation of plaque on tooth surfaces . 1 = presence of a thin visible layer of plaque by scraping the surface of the tooth with periodontal probe ; 2 = plaque deposits visible to the eye ; 3 = significant accumulation of plaque on tooth surfaces .
dmft index ( decayed , missing , and filled teeth ) : to determine the impact of dental caries on the teeth , we classified each tooth in one of the following categories : d stands for tooth decay .
it is used for any tooth which is observed to have visible recurrent caries and broken crown as a result of tooth decay or retained roots .
m stands for missing tooth for any tooth that is lost as a result of tooth extraction or for any other reason .
f stands for filled tooth as any tooth that has a permanent filling intact with no sign of caries lesion .
it is used for any tooth which is observed to have visible recurrent caries and broken crown as a result of tooth decay or retained roots .
m stands for missing tooth for any tooth that is lost as a result of tooth extraction or for any other reason .
f stands for filled tooth as any tooth that has a permanent filling intact with no sign of caries lesion .
the cpi ( community periodontal index ) : it was used to determine the periodontal status of the patients .
it consists in dividing the mouth into six sextants and evaluating all teeth using a periodontal probe .
each sextant must have at least two functional teeth ( i.e. , teeth that are not extracted ) .
the rating scale has five codes : 0 = healthy ; 1 = spontaneous bleeding ; 2 = calculus ; 3 = pocket depth of 46 mm ; 4 = pocket depth > 6 mm . 1 = spontaneous bleeding ; 3 = pocket depth of 46 mm ; 4 = pocket depth > 6 mm
. the data obtained were analysed using spss version 17 software and microsoft excel 2007 .
the statistical test used was the chi 2 with the significance level of p 0.05 .
ethical clearance was obtained from the institutional research review board ( research and ethics committee ) of the universit des montagnes - bangante .
a research authorisation was obtained from the sub - divisional officer of tonga and an informed consent from participants was also obtained ( appendices 2 , 3 , and 4 ) .
during our study the response rate was 97% ; 183 persons aged between 65 and 94 years , with a mean age of 73 years 7 s.d . ,
83 ( 45,4% ) males , and 100 ( 54,6% ) females participated in the study .
the proportion of elderly people above 65 years old in tonga was estimated to be 1.8% of the total population .
almost half 86 ( 47.3% ) of the subjects were retired , 82 ( 45.1% ) were farmers , 10 ( 5.46% ) were house wife , and 5 ( 2.75% ) are small traders . the mean age was 77.5 years for women and 72.9 years for men .
the most represented age range was 6574 years ( 60.1% ) ( table 1 ) . digestive disorders 60 ( 33% ) and joint disease 57 ( 31% ) , 42 ( 23% ) multiple pathologies , and 35 ( 19% ) ophthalmic problems were the most frequent ( figure 1 ) .
more than a third 69 ( 38.0% ) of the respondents had poor oral hygiene , 55 ( 32.1% ) had good oral hygiene , and 55 ( 30.1% ) were fair .
a third ( 36.5% ) presented with plaque after scrabbling , the majority ( 41.4% ) had visible dental plaque , and 12.7% had abundant plaque ( figure 2 ) .
three quarters 138 ( 75.4% ) brush in the morning only , 36 ( 19.7% ) had never brushed their mouth , and 9 ( 4.9% ) brush in the morning and evening .
more than three quarters 143 ( 83.6% ) of the subjects clean their mouth with a toothbrush , more than half 105 ( 57.4% ) use toothpaste , almost half ( 42.6% ) use the wood ash , 30 ( 16.4% ) chew sticks , and only 1.6% use floss ( table 2 ) .
three quarters 142 ( 78% ) had gingivitis , 71 ( 39% ) periodontitis , 56 ( 30% ) dental caries , and 29 ( 15.8% ) tooth wear ( table 3 ) .
periodontal pocket of 46 mm is the most represented ( 39.3% ) dental pathology .
a third 56 ( 30% ) did not have any carious tooth , 27 ( 14% ) had 1 missing tooth , and 26 ( 14% ) had two missing teeth .
more than a third 70 ( 38.3% ) of the subjects had not lost a tooth , 23 ( 12.6% ) have lost 1 tooth , 19 ( 10.4% ) have lost at least 2 teeth , and 17 ( 9.3% ) had more than 10 missing teeth ( table 4 ) . only 1 ( 0.5% )
the majority had decayed teeth 127 ( 69 , 4% ) , 112 ( 61 , 7% ) were with missing teeth , and 99 ( 54 , 1% ) were with teeth with total crown destruction .
the association between tooth decay and brushing only in the morning was statistically significant ( p = 0,001 ) .
there was a strong association between tobacco consumption and tooth decay ( p = 0,001 ) and also between visible dental plaque and pocket depth of 46 mm ( p = 0,001 ) ( table 5 ) .
more than half were partially edentulous , 100 ( 55.7% ) at the maxilla and 98 ( 53.6% ) at the mandible .
a small proportion of the subjects were completely edentulous : 2 ( 1.1% ) at the maxilla and 3 ( 1.6% ) at the mandible ( figure 5 ) . the majority ( 96.2% ) of the edentulous subjects
the main barrier of access to oral health care facilities were financial 124 ( 67.8% ) , distance from clinic 12 ( 6.5% ) , and no reasons in particular 47 ( 25.7% ) ( table 6 ) .
this study was carried out to assess the oral health status of the elderly in tonga , a typical rural setting in cameroon .
the age group of 6574 years is the most represented and the female was also dominant in this age groups .
the reason for this female dominance is because most males are exposed to hazards during their active life and therefore die before old age .
this is also reflected in the demographic pyramid of cameroon where there are more males below the ages of 50 but more females above the ages of 55 .
the proportion of the elderly in the current study was estimated to be 1.8% of the entire study population ; this is a deviation of the current demographic profile of the country that estimates the population of the elderly above 65 years to be 3.1% of the entire population . the reasons for this could be that because of the improvement of the socioeconomic status of the country , many old people now reside in urban areas with their children where they are being catered for as culture demands that children should take care of the elderly ; besides facilities for old people 's home are nonexistent in the country .
old people stay with their children who are still procreating to cater for their grandchildren .
most of the elderly were farmers and retired workers ; this is because some cameroon most civil servants who are still active , retire in the village because they can easily farm and live in a community which is less expensive and their immediate relations can cater for their immediate needs .
the reasons for this are that the social security system of the country is not well developed to cater for the needs of the elderly .
the main systemic pathologies encountered amongst the elderly of our study were essentially digestive disorders , joint pains , ophthalmologic disorders , and cardiovascular diseases .
this result is similar to that of kanout in senegal who identified the main diseases encountered in these categories of persons , including heart disease , joint disease , and diabetes .
this is because in rural areas , dental services are completely absent and the distance to the nearest dental facility is very long . besides
most patients visit the clinic only when they have pain or an emergency dental problem .
three quarters 138 ( 75.4% ) brush in the morning only and 11.5% brush their teeth occasionally .
this result is similar to macqueronen in france which showed that 12% brushed their teeth occasionally .
he identified neglect as the main factor influencing the frequency of implementation of oral hygiene habits .
apart from neglect , lack of oral health education or motivation was identified as the main cause of poor oral hygiene in our study .
apart from the use of tooth brushes and pastes in taking care of the oral hygiene , the elderly in the current study used materials like tooth picks , wood ashes and charcoal for their oral health care .
these materials present with adverse effects on the hard and soft tissues of the teeth because of their abrasive nature .
chewing sticks is widely used for cleaning the teeth for religious and socio - cultural reasons [ 15 , 16 ] in the west and central africa countries .
norton and addy ( 1989 ) compared the effectiveness of toothbrushes with chewing sticks on the oral hygiene and gingival health of adult ghanaians revealed that plaque and gingivitis scores were higher in the chewing stick users , although these were primarily due to differences in men .
men had poorer oral hygiene and gingival health than women , irrespective of the oral hygiene regimen .
the same differences were apparent for city and rural dwellers , with no overall differences observed between these two groups .
they concluded that the longer time that is necessary for cleaning with chewing sticks may explain the apparent reduced cleaning efficiency in men .
the antimicrobial substances contained in chewing sticks appear to provide no additional benefits to those produced by the antimicrobial activity of commercially available toothpastes .
this is contrary to another study carried in nigeria which revealed that there was no significant difference on the effectiveness of toothbrushes and chewing sticks ; after a six - week intervention period , postintervention readings were taken .
they further noted that slight improvements were detected in the gingival status of those using the chewing sticks relative to those in the group using toothbrush .
the fact that , in the current study , visible plaque was found on the surface of the teeth of almost half of the participants means that their brushing frequency and technique need to be improved ; another reasons for high plaque accumulation is because in rural areas , dental services are completely absent and the distance to the nearest dental facility is very long .
the average income in most dependent elderly in rural areas is very small and very few of them can afford a toothbrush and toothpastes .
toothbrushing patterns using chewing sticks or twigs should be studied , standardised , and improved so that chewing sticks should be encouraged to be used in resource poor settings .
most patients visit the clinic only when they have pain or an emergency dental problem .
this was also reported by macqueron in france who showed that 34% of the elderly presented with visible dental plaque . in the current study ,
the periodontal status was generally poor as the patients presented with high calculus deposits and more than a third presented with periodontal pockets of 46 mm .
this result is similar to a study carried out in saudi arabia where calculus was the most prevalent ( 48.2% ) finding among the subjects and was significantly more prevalent in men .
bleeding on probing and periodontal pockets was recorded in 24.1% and 19.3% of the subjects , respectively , with no statistically significant difference between men and women .
the frequency of periodontal pockets was similar to the findings of kanout ( 10.0% ) and vatsana in vietnam ( 9.8% ) .
inappropriate brushing technique and poor hygiene could explain the reasons for the deep periodontal pockets > 4 mm .
this number is lower than the one found by kanout in senegal and norway .
this could be as a result of the diet in rural areas which mostly are unrefined and fibrous .
this result is similar to other studies carried out in france , canada , south africa , and senegal [ 4 , 10 , 21 , 22 ] .
the level of education and access to oral health facilities of the population in these countries are different from that of cameroon , which could explain why tooth decay is less common in canada .
beside , most of these studies were carried in urban areas where health care facilities are easily accessible .
severe periodontitis , which may cause tooth loss , is found in 515% of most populations .
the proportion of individuals with missing teeth in the current study is high as compared to another study carried out in france where the proportion of edentulousness was 26.9%
. this could be because of the high prevalence of periodontal diseases in rural areas .
the current study demonstrated that 9.8% of subjects presented with mobile teeth which signifies that more teeth will be missing as the subjects grow older if intervention is not given .
lack of medical intervention is always neglected in rural communities in cameroon because tooth loss and mobility is seen as a physiological process among the elderly .
the high level of tooth mobility is because of ignorance about the causes of tooth loss and mobility as a result of periodontal diseases .
it has also been observed that poor oral health status , together with a reduction of autonomy , can seriously affect the general health and increase the risk of death in elderly people .
more than half of the subjects in the present study presented with retained roots , a definite indication for tooth extractions .
the fact that there are more people with missing teeth than people without missing teeth can be interpreted by the importance of the place of tooth extraction in our dental services . indeed , in cameroon , oral care is mainly dominated by tooth extractions
. the low rate of people with filled teeth demonstrates at a certain level , the low level of conservative treatment , delay diagnosis , and late presentation to the dental clinic at the stage where the tooth can no longer be restored which limits the patients to tooth extraction .
this is a result of poor access to oral health care and inequalities in the distribution of the oral care workforce .
it has been reported that , in some places in cameroon , patients travel for at least 8 hours to get access to the nearest oral health care facility ; because of this , patients are obliged to visit traditional healers or self - medicate .
the levels of edentulous at the maxilla and the mandible were very low as compared to other studies carried out in france and kenya [ 7 , 24 ] .
this could be explained by the fact that the majority of persons in our study have several teeth indicated for extraction .
the wearing of dental prosthesis is one of the factors that can improve the quality of life of the subjects . in the current study a very low proportion of the subjects had dentures
this is very low compared to that of agbor et al . in france ( 65.9% )
this is because dental prosthesis is expensive and not affordable by people in developing countries where the socioeconomic level is low ; besides access to oral health care is limited and the rehabilitation prosthetic techniques are limited and insufficient .
finances and distance to the nearest health care facility are factors serving as barriers to access to oral health care facilities in most countries where there is inequality in oral health care delivery .
the nearest oral health care facility to tonga is bangangte which is 30 km away .
some elderly people in the current study did not give any reasons for not attending a dental clinic .
this might be because of ignorance , neglect , the utilisation of traditional and alternative medicine , and their nonbelief in orthodox medicine .
poor oral hygiene techniques and tobacco consumption where identified as risk factors for dental caries in the current study .
this is similar to another study carried out in fokoue a village in the west region of cameroon where there was high caries rates amongst tobacco smokers .
the strong association between visible dental plaque and the periodontal pocket indicated that patients are not motivated and do not have access to basic oral health care . therefore tobacco consumption and dental plaque can be noted as common risk factors in some dental problems and other systemic pathologies in the current study .
the elderly in tonga presented with many systematic pathologies as well as poor oral health status : the oral pathologies commonly encountered are tooth decay , missing teeth , teeth with total crown destruction , and deep periodontal pockets of 46 mm .
barriers to access to oral health care facilities are distance , finance , and lack of interest in consulting a dentist .
the major reasons for these dental problems are gross inequalities as a result of inadequate impact of the oral health care work force and facilities in rural areas in cameroon and also no programme to take care of the oral health needs of the elderly .
the oral health needs of the subjects and correlation of risk factors to specific diseases in the early was not also included .
only individuals resident in tonga for at least 6 months were selected for the study .
oral health care policy making organization should advocate the inclusion and implementation of programmes that will facilitate the promotion of oral health care in rural areas in cameroon .
the elder should be given free or low cost care during outreaches or in government facilities .
studies should be conducted in other demographic settings ( urban , semiurban , and rural areas ) in cameroon to evaluate the oral health status , treatment needs , and quality of life of the elderly in cameroon .
the district health care community of tonga health district should organise dental screening , oral health education , and training for the elderly at least once a year . | objectives . the aim of this study was to determine the oral health status of elderly persons in tonga , west region of cameroon . methodology .
this is a cross - sectional study of persons of at least 65 years , living in tonga village , west region of cameroon
. results .
a total of 183 persons aged between 65 and 94 years , mean age of 73 years 7
s.d . , 83 ( 45,4% )
males , and 100 ( 54,6% ) females participated in the study .
the most represented age range was 6574 years ( 60.1% ) ; 86 ( 47.3% ) and elders above 65 constituted 1.8% of the total population .
more than a third 117 ( 41.4% ) had visible dental plaque , 117 ( 48,6% ) had periodontal pockets > 4 mm , 153 ( 54,1% ) had teeth with total crown destruction , 70 ( 38.3% ) had not lost a tooth , 23 ( 12.6% ) had lost 1 tooth , 19 ( 10.4% ) have lost at least 2 teeth , 100 ( 55.7% ) were partially edentulous at the maxilla and 98 ( 53.6% ) at the mandible , 2 ( 1.1% ) were completely edentulous at the maxilla and 3 ( 1.6% ) at the mandible , and 3.8% had removable dentures .
the mean dmf index was 6.11 and 69.4% had dental caries .
risk factors to dental caries were toothbrushing and tobacco consumption while dental plaque was associated to pocket depth of 46 mm .
barriers to oral health care included ignorance 47 ( 25.7% ) , financial difficulties 124 ( 67.8% ) , and distance to the nearest clinic 12 ( 6.5% ) .
conclusion .
the oral status of the elderly was generally poor . |
although mallet fracture is a common sports or work - related injury , its treatment remains controversial .
wehbe and schneider concluded that splinting is a safe and reliable treatment for most mallet injuries and that reduction is not crucial because of bone remodeling .
however , surgical treatment has been suggested for fractures involving > 30 % of the articular surface or for fractures with volar subluxation [ 2 , 3 ] .
patients with such fractures are at an increased risk for secondary osteoarthritis and esthetically unacceptable outcomes .
various surgical techniques such as kirschner wire ( k - wire ) pinning [ 46 ] , pull - out wiring , compression pin fixation , hook plate fixation , and microscrew fixation have been described .
although open reduction has been proposed , soft tissue damage may occur with this approach ; furthermore , complications such as infection , skin necrosis , nail deformities , and joint stiffness are a possibility .
therefore , closed reduction with extension block was described in 1988 by ishiguro et al . to avoid the disadvantages of open reduction . as per previous studies ,
however , many patients complain about exposed wires , which delay their return to sports and causes inconvenience while performing tasks requiring the hands during the early postoperative period . therefore , we introduced a novel microscrew fixation technique that leaves no exposed wire on the skin .
this report presents our novel closed reduction technique with extension block and flexion block using k - wires followed by microscrew fixation for mallet fractures and retrospectively evaluates the clinical results of this procedure .
we treated 20 displaced mallet fractures ( 14 males and six females ; mean age 38.4 years ; range 1768 years ) using our novel technique between january 2009 and january 2012 .
the institutional review board approved this study , and informed consent was obtained from each patient .
the fingers affected included seven middle fingers , five ring fingers , five little fingers , and three index fingers .
no patient had any medical history of bone diseases that could have influenced surgical outcomes .
the indication for surgery was the presence of a displaced fracture involving > 30 % of the articular surface .
according to wehbe and schneider s classification ( table 1 ) , there were 12 type ib , six type iib , and two type ia fractures .
the mean duration from injury to surgery was 9.2 days ( range 116 days ) .
functional outcomes were determined using crawford s evaluation criteria ( table 2 ) .
full flexion of the distal interphalangeal ( dip ) joint was considered for the angle of the uninjured joint on the opposite hand .
radiographs were obtained at 2 , 4 , 6 , 8 , and 10 weeks , followed by every 6 months after bone union was complete .
the mean follow - up duration was 12.6 months ( range 631 months).table 1wehbe and schneider s classification classificationnumbertype i ( no joint subluxation ) subtype a2 subtype b12 subtype c0type ii ( subluxation of dip joint ) subtype a0 subtype b6 subtype c0type iii ( physis of the distal phalanx involved ) subtype a0 subtype b0 subtype c0subtype a : < 1/3rd of the articular surfacesubtype b : 1/32/3rd of the articular surfacesubtype c : > 2/3rd of the articular surfacetable 2crawford s evaluation criteria excellentfull distal joint extension , full flexion , no paingood010 of extension deficit with full flexion , no painfair1025 of extension deficit , any flexion loss , no painpoor>25 of extension deficit , persistent pain wehbe and schneider s classification subtype a : < 1/3rd of the articular surface subtype b : 1/32/3rd of the articular surface subtype c : > 2/3rd of the articular surface crawford s evaluation criteria this novel procedure , combining extension block and flexion block using k - wires with closed reduction followed by microscrew fixation , is a less invasive procedure and leaves no exposed wires on the skin .
all procedures were performed under digital block anesthesia with an image intensifier . with the dip joint passively maintained in maximum flexion ,
the first 1.0-mm k - wire was placed into the head of the middle phalanx from the dorsal side of the bone fragment for extension block ( fig .
, we have been performing a two extension block technique to stabilize the bone fragment ( fig .
2a , b ) , and this technique was used in six patients in this study .
the k - wire on the ulnar side was inserted 3 mm apart from and parallel to the radial side k - wire .
the second 1.0-mm k - wire was inserted into the head of the middle phalanx from the center of the volar side for flexion block following closed reduction by extending the dip joint ( fig .
we used the third 0.7-mm k - wire as a substitute for a 0.7-mm drill bit .
this wire , which is perpendicular to the fracture line , was inserted through the center of the bone fragment from the dorsal to the volar side ( fig .
the length of the screw can be determined using another k - wire of the same length and an image intensifier .
a digital tourniquet with a nelaton s catheter tube was placed . a 1.0-mm microscrew ( nippon martin k.k .
, osaka , japan ) was inserted following placement of a transverse minimum incision ( approximately 3 mm ) along the skin crease ( fig .
the first and second blocking k - wires were removed once the screw was fixed ( fig .
suturing of the wound was not considered necessary ; this was confirmed by an image obtained 3 days after surgery , which showed that the wound had already healed ( fig .
the dip joint was immobilized with a splint for 13 weeks on an individual case basis .
passive and active dip joint exercises were encouraged after splint removal.fig . 1
a the kirschner wire for extension block is inserted .
f an image of the wound 3 days after surgeryfig . 2
a two extension blocks are performed since january 2011 .
b a 1.0-mm microscrew is inserted between the two extension blocks
a the kirschner wire for extension block is inserted .
f an image of the wound 3 days after surgery
a two extension blocks are performed since january 2011 . b a 1.0-mm microscrew is inserted between the two extension blocks
this novel procedure , combining extension block and flexion block using k - wires with closed reduction followed by microscrew fixation , is a less invasive procedure and leaves no exposed wires on the skin .
all procedures were performed under digital block anesthesia with an image intensifier . with the dip joint passively maintained in maximum flexion ,
the first 1.0-mm k - wire was placed into the head of the middle phalanx from the dorsal side of the bone fragment for extension block ( fig .
, we have been performing a two extension block technique to stabilize the bone fragment ( fig .
2a , b ) , and this technique was used in six patients in this study .
the k - wire on the ulnar side was inserted 3 mm apart from and parallel to the radial side k - wire .
the second 1.0-mm k - wire was inserted into the head of the middle phalanx from the center of the volar side for flexion block following closed reduction by extending the dip joint ( fig .
we used the third 0.7-mm k - wire as a substitute for a 0.7-mm drill bit .
this wire , which is perpendicular to the fracture line , was inserted through the center of the bone fragment from the dorsal to the volar side ( fig .
the length of the screw can be determined using another k - wire of the same length and an image intensifier .
a digital tourniquet with a nelaton s catheter tube was placed . a 1.0-mm microscrew ( nippon martin k.k . ,
osaka , japan ) was inserted following placement of a transverse minimum incision ( approximately 3 mm ) along the skin crease ( fig .
the first and second blocking k - wires were removed once the screw was fixed ( fig .
suturing of the wound was not considered necessary ; this was confirmed by an image obtained 3 days after surgery , which showed that the wound had already healed ( fig .
the dip joint was immobilized with a splint for 13 weeks on an individual case basis .
passive and active dip joint exercises were encouraged after splint removal.fig . 1
a the kirschner wire for extension block is inserted .
b a 1.0-mm microscrew is inserted between the two extension blocks
a the kirschner wire for extension block is inserted .
f an image of the wound 3 days after surgery
a two extension blocks are performed since january 2011 . b a 1.0-mm microscrew is inserted between the two extension blocks
bone union was achieved in all 20 fractures within a mean period of 6.8 weeks ( range 410 weeks ) .
minimum displacement was observed in one patient and immobilization with a splint was continued for 4 weeks . at the final follow - up , anatomical reduction
was observed in 14 patients and articular incongruity was < 1.0 mm in four patients and 1.02.0 mm in two .
mean dip extension loss was 6.5 ( range 020 ) and mean dip flexion was 67.8 ( range 4580 ) .
no infection , skin necrosis , permanent nail deformity , or secondary osteoarthritis was observed .
only two complications were observed ; nail ridging in one patient , which disappeared after 5 months , and a dorsal bump caused by the screw in one patient , which was removed . according to crawford 's evaluation criteria ,
the surgical outcomes were excellent in seven patients , good in nine , and fair in four .
a 38-year - old male industry worker injured his left middle finger while he was on duty .
radiographs showed a displaced mallet fracture involving > 50 % of the articular surface , without volar subluxation of the distal phalanx ( fig .
he wished to resume work as early as possible ; therefore , we treated the fracture using the procedure described above .
we used a 0.7-mm k - wire as a substitute for a 0.7-mm drill bit and inserted a 1.0-mm microscrew with closed reduction ( fig .
this patient exhibited active dip motion from 0 to 75 without pain 12 months after surgery , and his surgical outcome was excellent as per crawford s evaluation criteria.fig .
3
a radiograph of a 38-year - old man with a type iib mallet fracture .
b radiograph showing achievement of anatomical reduction
a radiograph of a 38-year - old man with a type iib mallet fracture .
a 38-year - old male industry worker injured his left middle finger while he was on duty .
radiographs showed a displaced mallet fracture involving > 50 % of the articular surface , without volar subluxation of the distal phalanx ( fig .
he wished to resume work as early as possible ; therefore , we treated the fracture using the procedure described above .
we used a 0.7-mm k - wire as a substitute for a 0.7-mm drill bit and inserted a 1.0-mm microscrew with closed reduction ( fig .
this patient exhibited active dip motion from 0 to 75 without pain 12 months after surgery , and his surgical outcome was excellent as per crawford s evaluation criteria.fig .
3
a radiograph of a 38-year - old man with a type iib mallet fracture .
b radiograph showing achievement of anatomical reduction
a radiograph of a 38-year - old man with a type iib mallet fracture .
various surgical techniques for displaced mallet fractures , such as k - wire pinning , pull - out wiring , compression pin fixation , hook plate fixation , and microscrew fixation have been described .
however , the ideal treatment for fractures involving > 30 % of the articular surface remains controversial .
ishiguro s method is easier and less invasive than most currently available methods ; moreover , it facilitates closed reduction and is a reliable method that permits indirect anatomical reduction of the fracture .
we routinely performed ishiguro s method at our hospital for cases of mallet fracture with involvement of > 30 % of the articular surface .
however , some patients complained of exposed wires that delayed their return to physical activity and affected their work during the early postoperative period .
therefore , we developed a novel microscrew fixation procedure that leaves no exposed wire , allows rapid healing with good mobility , and does not delay the patient s return to physical activity and work .
the microscrew fixation procedure for mallet fractures was described in 2004 by kronlage et al . .
in their surgical technique , the fracture site is opened and cleared of hematoma and callus , the fragment is repositioned and held in a reduced position with forceps or a towel clip , and two or more 0.8-mm microscrews are inserted .
hiwatari et al . reported the chased method for mini - screw fixation in cases of mallet fractures in 2012 .
the chased method is a percutaneous procedure in which the fixation screw chases the k - wire as a substitute for a drill bit .
first , there is a possibility of inducing cracks in the bone fragment , and second , there can be a reduction loss during drilling and screw insertion .
we consider that less invasive reduction is achieved using extension and flexion block without forceps . to decrease the possibility of cracking a bone fragment , we use a third 0.7-mm k - wire as a substitute for the 0.7-mm drill bit and insert a 1.0-mm microscrew into the bone fragment using blocked k - wires .
reported a comparison among three different techniques ( extension block pinning , k - wires used as joysticks and miniscrew fixation with open reduction and internal fixation ) for unstable mallet fractures , and no statistically significant difference was observed in the functional results .
open reduction and screw fixation allows for earlier mobilization and faster return to work . if the treatment results of these methods are not much different , then an early return to sports or work and a low rate of complications are important .
most surgical techniques have the disadvantages of an open incision , difficulty in achieving earlier mobilization , and the incidence of nail deformity , skin necrosis , and pin tract infection .
kang et al . reported that 41 % of surgically treated mallet fractures developed postoperative complications .
therefore , we consider that the complication rate in our study ( 2/20 patients ) was acceptable .
our novel surgical procedure combining closed reduction with extension block and flexion block using k - wires followed by microscrew fixation for mallet fractures produces good clinical results with relatively few complications . | background
some patients with mallet fractures who undergo extension block pinning complain of exposed wires , which delay their return to sports and causes inconvenience while performing tasks that require the use of hands during the early postoperative period .
the purpose of this retrospective study was to present and evaluate a novel surgical procedure for mallet fractures.methodswe treated 20 patients ( 14 males and six females ; mean age , 38.4 years ; range 1768 years ) with displaced mallet fractures involving > 30 % of the articular surface using the closed reduction and microscrew fixation between january 2009 and january 2012 .
the distal interphalangeal joint ( dip ) joint was immobilized with a splint for 13 weeks on an individual case basis . according to wehbe and schneider s classification
, there were 12 type ib , six type iib , and two type ia fractures .
the mean follow - up duration was 12.6 months ( range 631 months).resultsbone union was achieved in all patients within a mean period of 6.8 weeks , with no incidence of infection , skin necrosis , permanent nail deformity , or secondary osteoarthritis .
only two complications temporary nail ridging in one patient and a dorsal bump caused by the screw in one patient were observed .
minimum postoperative displacement was observed in one patient , for whom immobilization with a splint was continued for 4 weeks .
articular incongruity was < 1.0 mm in four patients and 1.02.0 mm in two patients .
mean dip joint extension loss was 6.5 and mean flexion was 67.8. the surgical outcomes were excellent in seven patients , good in nine , and fair in four according to crawford s evaluation criteria.conclusionour novel surgical procedure combining closed reduction with extension block and flexion block using kirschner wires and microscrew fixation produces good clinical results with relatively few complications . |
fatty liver is the most common and earliest response of the liver to heavy alcohol consumption and may develop into alcoholic hepatitis and fibrosis .
it has been traditionally held that , during alcohol metabolism , the increase in the cellular nadh concentration generated by alcohol and aldehyde dehydrogenases impairs -oxidation and tricarboxylic acid cycle activity in the liver , which in turn leads to severe ffa overload and enhanced synthesis of triacylglycerol in the liver .
more recently , two transcription factors , the peroxisome proliferator - activated receptor ( ppar ) and ppar , have been discovered as new mechanisms that control hepatic fatty acid oxidation and synthesis , respectively [ 3 , 4 ] .
ethanol feeding impairs fatty acid catabolism in the liver partly by blocking ppar-mediated responses in c57bl/6j mice . in the meantime
, dietary supplementation of ethanol - fed animals with a ppar agonist induces the expression of ppar target genes and stimulates the rate of fatty acid -oxidation , which prevents alcoholic fatty liver .
in contrast to ppar , hepatic ppar contributes to triglyceride homeostasis , which regulates both triglyceride clearance from the circulation and the lipogenic program .
ethanol increases the mrna expressions of ppar and lipid synthetic enzymes , atp citrate lyase ( acl ) , and fatty acid synthase ( fas ) in mice liver .
ethanol is well known to stimulate increased extracellular adenosine concentration through its action on the nucleoside transporter .
ethanol ingestion increases purine release into the bloodstream and urine in normal volunteers [ 79 ] and into the extracellular space in liver slices obtained from mice [ 10 , 11 ] .
extracellular adenosine regulates various physical processes , including hepatic fibrosis [ 10 , 11 ] , ureagenesis [ 13 , 14 ] , and glycogen metabolism [ 15 , 16 ] , as well as peripheral lipid metabolism [ 17 , 18 ] .
these physiological effects of adenosine are mediated by a family of four g - protein - coupled receptors : a1 , a2a , a2b , and a3 ( a1r , a2ar , a2br , and a3r ) , each of which has a unique pharmacological profile , tissue distribution , and effector coupling . recently , peng et al .
reported that ethanol - mediated increases in extracellular adenosine , which act via adenosine a1r and a2br , link the ingestion and metabolism of ethanol to the development of hepatic steatosis .
thus , they suggested that targeting adenosine receptors may be effective in the prevention of alcohol - induced fatty liver .
although fatty liver was thought to be relatively benign , more recent studies show that fat accumulation makes the liver more susceptible to injury from other agents such as drugs and toxins , especially endotoxins , which are believed to be involved in the pathogenesis of alcoholic hepatitis and fibrosis [ 21 , 22 ] .
alcohol consumption induces a state of a leaky gut that increases plasma and liver endotoxin levels and leads to the production of the tumor necrosis factor ( tnf ) by kupffer cells via the toll - like receptor ( tlr ) 4 , which is known to mediate lipopolysaccharide- ( lps- ) induced signal transduction and to eventually contribute to liver injury .
ethanol - fed mice exhibited an oxidative stress that was dependent on the upregulation of multiple tlrs ( tlr1 , 2 , 4 , 6 , 7 , 8 , and 9 ) in the liver and was sensitive to liver inflammation induced by multiple bacterial products recognized by the tlrs .
codonopsis lanceolata ( c. lanceolata ) , which belongs to the campanulaceae family , is a perennial herb that grows naturally in moist places in woods , low mountains , and hills .
it is commonly found in east asia , particularly in china . c. lanceolata , which is composed of various active components including tannins , saponins , polyphenolics , alkaloids , essential oils , and steroids ,
has long been prescribed in traditional folk medicine in korea , japan , and china [ 2628 ] .
the dried roots of c. lanceolata have been used as a traditional remedy for lung inflammatory diseases such as asthma , tonsillitis , and pharyngitis .
the total methanol extracts of the fresh leaves or roots of c. lanceolata significantly suppress the production of tnf and nitric oxide , the expression of interleukin ( il)-3 and il-6 , and lps - mediated phagocytic uptake in raw 264.7 cells . in a rat model , c. lanceolata water extract significantly improved the hepatic accumulation of triglyceride and cholesterol induced by a high - fat diet .
although the lipid - lowering effect of c. lanceolata extract has been demonstrated in a rodent model with diet - induced obesity , the protective effects of this plant against alcoholic fatty liver diseases have not yet been explored . in this study ,
the potent bioactivities of the c. lanceolata methanol extract that can be used as natural compound or pharmaceutical supplements for the prevention and/or treatment of alcoholic fatty liver were demonstrated .
the mechanisms by which the c. lanceolata methanol extract performs its antilipogenic and anti - inflammatory actions were investigated in the hepatic tissues of mice with chronic ethanol consumption .
c. lanceolata , which is cultivated in gangwon - do , korea , was purchased and freeze dried . freshly dried material was ground into fine powder in an electric grinder and stored in dessicator .
200 g plant powder was refluxed with 95% methyl alcohol ( meoh ) in a round bottom flask on a water bath for 3 h. crude meoh extract was filtered out and evaporated to dryness for the preparation of the c. lanceolata methanol extract ( cme ) .
the residual methanol extract was again refluxed with distilled water for 5 h and filtered .
the filtrate , thus obtained , was again added with ethanol at the ratio of 1 : 4 and then stirred for 1 h at 4c . following their centrifugation at 5,000 g for 30 min at 4c ,
the supernatant was concentrated in a rotary vacuum evaporator and freeze dried for the preparation of the c. lanceolata ethanol supernatant ( ces ) , and the pellets were air dried and freeze dried for the preparation of the c. lanceolata ethanol precipitate ( cep ) .
the yields of these three extracts were 3.84% ( cme ) , 5.05% ( ces ) , and 3.30% ( cep ) of the wet c. lanceolata root , respectively .
specific pathogen - free male c57bl/6n mice ( eight weeks old ) were purchased ( orient , gyeonggi - do , korea ) and acclimatized to the authors ' animal facility for one week prior to the experimentation .
the mice were kept individually in sterilized animal quarters with controlled temperature ( at 21 2c ) and humidity ( at 50 5% ) and with 12 h light and dark cycles and were allowed free access to standard chow and tap water during the acclimatization period .
the animals were then randomly divided into five groups ( n = 8) and fed the normal diet ( nd ) , the ethanol diet ( ed ) , the cme - supplemented ethanol diet ( med ) , the ces - supplemented ethanol diet ( esd ) , or the cep - supplemented ethanol diet ( epd ) for nine weeks .
the mice in the ed group consumed a liquid diet wherein ethanol provided 36% of the energy , as described by lieber et al . .
ethanol was introduced into the diet by gradually mixing it with distilled water , from 0% ( wt / v ) to 5% ( wt / v ) , over a one - week period for adaptation , and was provided at 5% ( wt / v ) for the next eight weeks .
the nd mice received the same diet but with isocaloric amounts of dextrin - maltose instead of ethanol , and the med , esd , and epd mice were fed the ethanol diet that contained 0.091% ( wt / v ) cme , ces , and cep , respectively .
the nd , med , des , and epd mice were pair fed so that their consumption would be isocalorically equivalent to the consumption on the previous day of the ed mice that were individually paired with them .
the animals that were used in this study were treated in accordance with the guide for the care and use of laboratory animals ( institute of laboratory animal resources , commission on life sciences , national research council , 1996 ) , as approved by the institutional animal care and use committee of yonsei university .
the liver tissue specimens were fixed in 10% buffered formalin and embedded in paraffin , cut at thicknesses of 5 m , and later stained with hematoxylin and eosin ( h&e ) for the histological examination of fat droplets .
the serum concentrations of total cholesterol , hdl cholesterol , triglyceride , and free fatty acid were determined using commercial kits ( bioclinical system , gyeonggi - do , korea ) .
, using a chloroform - methanol mixture ( 2 : 1 , v / v ) .
the dried lipid residues were dissolved in 1 ml of ethanol for the cholesterol and triglyceride measurements .
the hepatic cholesterol , triglyceride , and free fatty acid concentrations were analyzed using the same enzymatic kit that was used in the serum analyses .
the serum alanine aminotransferase ( alt ) and aspartate aminotransferase ( ast ) activities were measured using commercial reagents ( bayer , usa ) .
the total rna was extracted from the liver using a trizol reagent ( invitrogen , usa ) and was reverse transcribed using the superscript ii kit ( invitrogen , usa ) according to the manufacturer 's recommendations .
the primers for the pcr analysis were synthesized by bioneer ( korea ) . the forward ( f ) and reverse ( r ) primer sequences for the genes that were involved in the experiment are shown in the supplementary material available online at doi : 10.1155/2012/141395 .
the pcr for the glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) was performed on each sample as an internal positive - control standard . the number of cycles and the annealing temperature were optimized for each primer pair .
amplification of the gapdh , a1r , a2ar , a2br , a3r , ppar , carnitine palmitoyltransferase ( cpt-1 ) , microsomal triglyceride transfer protein ( mtp ) , long - chain acyl - coa dehydrogenase ( lcad ) , medium - chain acyl - coa dehydrogenase ( mcad ) , ppar , retinoid x receptor ( rxr ) , ccaat - enhancer - binding protein- ( c / ebp ) , lipoprotein lipase ( lpl ) , adipocyte protein 2 or fatty acid binding protein 4 ( ap2 ) , fas , tlrs , lps binding protein ( lbp ) , cluster of differentiation 14 ( cd14 ) , myeloid differentiation primary response gene 88 ( myd88 ) , myelin and lymphocyte protein ( mal ) , tlr adaptor molecule ( trif ) , tnf - receptor - associated factor 6 ( traf6 ) , interferon regulatory factors ( irfs ) , nuclear factor kappa b - p50 ( p50 ) , p65 , interferon ( ifn ) , ifn , il-12-p40 , chemokine ( c - x - c motif ) ligand 2 ( cxcl2 ) , adiponectin receptor 1 ( adipor1 ) , adipor2 , silent - mating - type information regulation 2 homolog 1 ( sirt1 ) , peroxisome proliferative activated receptor gamma coactivator 1 alpha ( pgc1 ) , and sterol regulatory element binding transcription factor 1 ( srebp-1c ) was initiated via 5 min of denaturation at 94c for 1 cycle , followed by 30 or 35 cycles at 94c for 30 s , 55 or 60c for 30 s , and 72c for 1 min and via 10 min of incubation at 72c .
the sequences of the primer pairs and pcr conditions ( annealing temperatures , cycles , and product sizes ) that were used in the rt - pcr experiments are shown in the supplementary material .
the pcr products were then separated in a 2% agarose gel and visualized in a gel documentation system ( alpha innotech , usa ) .
the intensity of the bands on the gels was converted into a digital image with a gel analyzer .
for the western blot studies , protein extracts were obtained from the mice livers using a commercial lysis buffer ( intron , usa ) that contained a protease inhibitor cocktail ( roche , usa ) .
the protein concentrations were determined with the bio - rad protein assay kit ( bio - rad , usa ) .
the western blot analysis was performed with antibodies that were specific to amp - activated protein kinase ( ampk ) , phospho - ampk ( thr 72 ) , acetyl - coa carboxylase ( acc ) , phospho - acc ( ser 79 ) ( cell signaling , usa ) , and -actin ( santa cruz , usa ) .
after the sds - page at 10% acrylamide concentrations , the proteins were transferred to the nitrocellulose membrane , blocked with 5% skim milk in a tris - buffered saline / tween buffer ( 10 mm tris - hcl , ph 7.5 , 150 mm nacl , and 0.05% tween 20 ) , and incubated with appropriate antibodies overnight .
the blots were washed extensively , incubated with a horseradish - peroxidase - linked anti - rabbit or -mouse ig ( santa cruz , usa ) , and washed again .
the detection was carried out with the ecl western blotting kit ( animal genetics , korea ) , after which the blots were exposed to an x - ray film ( agfa , belgium ) .
the results of the body weight gain , liver weight , and serum and hepatic biochemistries were expressed as the mean values sem of the eight mice in each group .
the results of the semiquantitative rt - pcr and western blot were expressed as the mean values sem of the three independent experiments in which the rna and protein samples from the eight mice were used , respectively .
the analysis of the variance ( anova ) and the duncan 's multiple range method were used to compare significant differences among the groups .
the level of significance was set at p < 0.05 for all the statistical tests .
the nine - week body weight gain of the mice in the ed group was 51% lower than the value for the pair fed nd mice .
the animals that were fed the med ( 43% greater ) or the esd ( 41% greater ) exhibited significantly greater body weight gains than the ed mice , whereas the mice that were fed the epd did not recover the weight they lost from ethanol consumption ( table 2 ) . compared to the values for the ed mice , the mice that were fed the med exhibited significantly lower levels of serum ffa ( 17% reduction ) and lower activities of serum alt ( 17% reduction ) and ast ( 22% reduction ) .
they also demonstrated a tendency towards decreasing serum triglyceride , total cholesterol , vldl + ldl cholesterol , and atherogenic indices , albeit at statistically insignificant levels than those for the mice that were fed the ed .
in contrast , the esd or epd failed to improve both the lipid levels and enzyme activities in the blood of the mice with chronic ethanol consumption ( table 2 ) .
histological analysis of the livers with h&e staining revealed prominent lipid accumulation in the livers of the ed fed mice whereas lipid droplets were rare in the livers of the med , esd , and epd - fed mice ( figure 1 ) .
ed feeding of the mice for nine weeks resulted in more significant increases in the relative weight of their livers ( by 8% ) and in the hepatic levels of their triglycerides ( 43% increase ) , cholesterol ( 36% increase ) , and ffa ( 52% increase ) than in the nd group ( figure 1 ) .
the med or esd significantly improved the ethanol - induced enlargement of the liver ( the relative liver weight was 7% or 6% lower , resp . ) .
the med , esd , or epd significantly reversed the ethanol - induced hepatic accumulations of triglycerides ( 18% , 11% , and 18% reductions , resp . ) , cholesterol ( 22% , 12% , and 18% reductions , resp . ) , and ffa ( 29% , 14% , and 22% reductions , resp . ) .
the triglyceride and cholesterol levels in the liver were lowest after the med consumption among the diets that were supplemented with different fractions of the c. lanceolata root , but the differences between the diets were not statistically significant .
the med group exhibited the most prominent and the most significant improvement in the reduction of the hepatic ffa accumulation , better than did the esd and epd groups ( p < 0.05 ) ( figure 1 ) .
med feeding significantly reversed the ethanol - induced upregulation of the a1r and a2br genes in the livers of the mice and restored the ethanol - induced downregulation of the ppar , cpt-1 , mtp , lcad , and mcad genes in the livers of the mice ( figures 2(a ) and 2(b ) ) .
the supplementation of the ethanol diet with cme significantly blunted the upregulation of these transcription factors and of their target genes due to ethanol .
chronic ethanol ingestion led to more significant decreases in the hepatic expression of the adipor1 and adipor2 genes than in the nd mice , and med feeding significantly restored these ethanol - induced changes in the adiponectin receptor genes .
similarly , the med feeding significantly reversed the marked decreases in the mrna levels of the hepatic sirt1 and pgc1 , which were induced by ethanol feeding .
in addition , the med efficiently counteracted the ethanol - induced upregulation of the srebp-1c gene ( higher 57% reduction than in the ed mice , p < 0.05 ) ( figure 3 ) .
the med significantly blunted the downregulation of the phospho - ampk / total ampk ( 146% increase ) ratio and of the phospho - acc / total acc ratio ( 700% increase ) , which were caused by chronic ethanol ingestion , in the livers of the mice ( figures 3(b ) and 3(c ) ) .
the hepatic expression of the tlr mrnas was measured after nine weeks of ethanol exposure .
more significant increases in the tlr1 , tlr2 , tlr3 , tlr4 , tlr6 , tlr7 , tlr8 , tlr9 , tlr12 , and tlr13 mrna levels were observed in the livers of the ethanol - fed control mice than of the pair fed nd mice .
the med significantly alleviated the ethanol - induced upregulation of the hepatic tlr1 , tlr2 , tlr4 , tlr6 , tlr7 , tlr8 , tlr9 , tlr12 , and tlr13 gene expressions .
the hepatic tlr3 , which was upregulated by the ethanol feeding , and the hepatic tlr5 , which was unaffected by the ethanol feeding , did not respond to the med feeding ( figure 4 ) .
after endotoxin bound itself to the lps - binding protein ( lbp ) , it associates in the portal blood with the cd14 prior to its binding to tlr4 and all the tlrs that were recruited by myd88 , mal , trif , and traf6 for their proinflammatory signaling .
the mrna levels of the lbp and cd14 , as well as of the adaptor molecules of the tlrs ( myd88 , mal , trif , and traf6 ) , all more significantly increased in the livers of the ed mice than of the nd mice , whereas the med feeding led to more significant decreases in the hepatic mrna levels of the lbp , cd14 , myd88 , mal , trif , and traf6 than in the ed mice ( figure 5(a ) ) . among the extremely significant recent discoveries on tlr
signaling is that the myd88-dependent pathway also activates some irfs , such as irf1 , 3 , 5 , and 7 . in this study ,
the mrna levels of the irf1 , 3 , 5 , and 7 genes more significantly increased in the livers of the ed mice than of the nd mice and these ethanol - induced upregulations of the hepatic irfs were significantly reversed by the med feeding ( figure 5(b ) ) .
the rt - pcr analysis of the hepatic mrnas of nfb ( p50 and p65 ) and of its target cytokine genes such as tnf , il-6 , ifn , ifn , il-12-p40 , and cxcl2 was performed next . the med feeding significantly downregulated the expressions of the p50 , p65 , tnf , il-6 , ifn , ifn , il-12-p40 , and cxcl2 genes compared to the ed mice ( figure 5(c ) ) .
the authors ' previous study showed that the supplementation of the lieber - decarli ethanol diet with c. lanceolata water extract ( 5 mg / l of a liquid diet ) showed a significant improvement in the amount of weight that was gained and in the hepatic lipid levels ( in the press ) . in this study , the effects of three different fractions of c. lanceolata roots , which were prepared using different solvents , on the protection from alcoholic fatty liver were tested .
several studies have demonstrated that the protective effects of various plant extracts from alcoholic liver injury in animals , such as of fenugreek seed ( trigonella foenum fraecum ) methanol extract , and hot water extracts of avaram leaves ( cassia auriculata ) and green tea ( camellia sinensis ) were manifested at dosages of between 200 and 500 mg / kg of body weight . based on these studies , c. lanceolata root fractions were added to a liquid diet at 0.091% ( wt / v ) , which is equivalent to a daily intake of 300 mg / kg of body weight , assuming that a mouse weighs 30 g and consumes 10 ml of a liquid diet per day . among the three different fractions that were prepared from the c. lanceolata root , cme exhibited the most remarkable attenuation of alcohol - induced fatty liver in terms of various parameters .
for example , cme more significantly reduced the serum alt and ast activities and the hepatic ffa concentration in the mice that were fed ethanol than did ces or cep . besides , alcohol - induced body weight loss and hepatic accumulations of triglycerides and cholesterol more significantly improved in mice that were supplemented with cme than in animals that were supplemented with esd or epd , although the difference was statistically insignificant .
therefore , cme appeared to be the most potent , among the fractions that were obtained from the c. lanceolata root , in protecting animals from alcohol - induced hepatic accumulation of lipids .
further investigated were the underlying mechanisms of cme against hepatic steatosis induced by chronic ethanol administration .
the ethanol - induced elevation of the plasma hdl cholesterol concentration , as observed in the current study , has been suggested as a cardioprotective response in animals chronically loaded with ethanol . the elevated hdl concentration and the reduced ldl concentration , which are characteristic of the lipoprotein pattern in chronic alcoholics , could well explain the reduced risk of coronary heart disease in alcoholics .
in this present study , the mrna expression of the hepatic a2br and a1r was markedly elevated by chronic ethanol feeding .
furthermore , the expression of ppar and of its target genes , such as cpt-1 , mtp , lcad , and mcad , all significantly decreased , whereas the expression of ppar and of its target genes , such as rxr , c / ebp , lpl , ap2 , and fas , all significantly increased in the livers of the ethanol - fed ed mice than of the nd mice ( figure 6 ) .
these results are in accordance with recent findings from experiments with mice that adenosine generated by ethanol metabolism plays an important role in ethanol - induced hepatic steatosis via a1r and a2br , which leads to the upregulation of ppar and the downregulation of ppar , respectively .
it was observed that cme supplementation reversed ethanol - induced elevation of the expressions of a2br , a1r , ppar , and their target genes in the liver tissues of mice .
these results suggest that cme ameliorates hepatic steatosis in mice , at least partly by modulating adenosine - receptor - mediated signaling molecules that are responsible for fatty acid oxidation and lipogenesis .
adiponectin stimulates hepatic ampk , which , in turn , phosphorylates acc on ser-79 and attenuates acc activity .
inhibition of acc directly reduces lipid synthesis and indirectly enhances fatty acid oxidation by blocking the production of malonyl - coa , an allosteric inhibitor of cpt-1 .
activation of ampk by adiponectin in the liver also leads to decreased mrna and protein expression of srebp-1c [ 3841 ] , which results in decreased hepatic lipid synthesis .
adiponectin is also known to stimulate the activities of both pgc1 and ppar , which mainly control the transcription of a panel of genes that encode fatty acid oxidation enzymes [ 42 , 43 ] . as a result
, adiponectin - mediated ampk activation favors lipid catabolism and opposes lipid deposition in the liver [ 4449 ] .
chronic ethanol administration is known to significantly decrease the plasma adiponectin level in mice . in this study ,
more significant decreases in the mrna levels of adipor1 and adipor2 were observed in the livers of the ed mice than of the pair fed nd mice .
these alcohol - induced reductions in the hepatic adipors expression appear to have been associated with the subsequent decreases in the phosphorylation of ampk and acc as their phosphorylations in the liver more significantly decreased in the ed mice than in the nd mice ( figure 6 ) .
besides , the hepatic mrna levels of sirt1 , pgc1 , srebp-1c , ppar , and cpt1 were also more significantly reduced in the ed mice than in the nd mice ( figure 6 ) .
sirt1 has been gaining recognition as one of the critical agents in the mediation of adiponectin signaling to ampk , which is the central mechanism in the regulation of lipid metabolism [ 5255 ] .
although pgc1 was initially identified as a coactivator of ppar , it has subsequently been shown to serve as a cofactor of several other transcription factors , including ppar [ 56 , 57 ] .
treatment with adiponectin restored the ethanol - inhibited pgc1/ppar activity in cultured hepatic cells and in animal livers , which suggests that the stimulation of adiponectin - sirt1 signaling may serve as an effective therapeutic strategy for treating or preventing human alcoholic fatty liver [ 3840 ] . in this study ,
cme significantly restored the ethanol - induced downregulation of adiponectin - mediated signaling molecules , including adipor1 , adipor2 , pampk / ampk , pacc / acc , sirt1 , and pgc1 , which led to increased fatty acid oxidation and decreased lipogenesis in the livers of the mice .
it was recently shown that innate immune cells recognize conserved pathogen - associated molecular patterns through pattern recognition receptors , among which the family of tlrs occupies an important place .
lbp , which is present in normal serum , recognizes and binds to lps with high affinity through its lipid moiety [ 58 , 59 ] .
lps - lbp complexes then activate cells through the second glycoprotein , the membrane - bound cd14 , to produce inflammatory mediators [ 6062 ] in the presence of only a functional tlr4 .
although lps was not detected in the blood , more significant increases in the mrna levels of lbp and cd14 were observed in the livers of the ed mice than of the nd mice ( figure 6 ) .
tlrs have a tir domain that initiates the signaling cascade through tir adapters , such as myd88 , mal [ 65 , 66 ] , and trif , which interact with traf6 , the downstream adaptor .
traf6 activates the irfs , which leads to nf-b activation and induction of the expressions of proinflammatory cytokines , such as of tnf , il-6 , ifn , and ifn. it was demonstrated that chronic ethanol feeding induces hepatic steatosis and clear upregulation of tlr1 , 2 , 3 , 4 , 6 , 7 , 8 , 9 , 12 , and 13 in the liver .
these findings are supported by previous reports that ethanol - fed mice exhibited hepatic inflammation that was dependent on the upregulation of multiple tlrs in the liver .
the expressions of the myd88 , mal , trif , traf6 , irf1 , 3 , 5 , and 7 genes , along with the mrna levels of nfb and proinflammatory cytokines , were all more significantly elevated in the livers of the ed mice than of the nd mice ( figure 6 ) .
these results are also in accordance with previous observations that myd88 is required for the development of fibrosis , a predisposing condition for hepatocellular cancer development , and that irf7 expression more significantly increased in the livers of alcohol - fed myd88-deficient mice than of pair fed control mice .
these results suggest that chronic ethanol intake may activate tlr - mediated proinflammatory signaling cascades .
the study data show that these hepatic inductions of tlr - mediated signaling cascade molecules , which involve both myd88-dependent and -independent pathways , along with their target proinflammatory cytokine genes , such as tnf , il-6 , ifn , ifn , il-12-p40 , and cscl2 , due to ethanol feeding were all dramatically reversed with cme supplementation . taken together ,
these beneficial effects of cme against alcoholic fatty livers in mice appear to have occurred with adenosine- and adiponectin - mediated regulations of hepatic steatosis and tlr - mediated modulation of hepatic proinflammatory responses , since ethanol - induced changes in the expression of the molecules that are involved in these three signaling pathways were all significantly reversed with cme feeding .
although alcoholic fatty liver is a major risk factor for advanced liver injuries such as steatohepatitis , fibrosis , and cirrhosis , previous studies have mostly focused on the antilipogenic or -inflammatory activity alone , but not in combination , of a compound and extracts .
evaluated the effect of the cassia auriculata leaf extract on lipid metabolism in alcohol - induced hepatic steatosis .
resveratrol prevents the development of hepatic steatosis induced by alcohol , by restoring the inhibited hepatic sirt1-ampk signaling system .
this study demonstrated that both lipogenesis and inflammation are associated with the development of alcoholic fatty liver and that cme has both antilipogenic and anti - inflammatory effects through coordinated multiple signaling pathways .
although much further study is required concerning the exact identities of the chemical constituents of the c. lanceolata methanol extract that are responsible for the findings described herein , the results of this study provide some insights on the basic mechanism that underlies the therapeutic effect of the extract on mice hepatic tissues after chronic ethanol feeding . | this study evaluated the antilipogenic and anti - inflammatory effects of codonopsis lanceolata ( c. lanceolata ) root extract in mice with alcohol - induced fatty liver and elucidated its underlying molecular mechanisms .
ethanol was introduced into the liquid diet by mixing it with distilled water at 5% ( wt / v ) , providing 36% of the energy , for nine weeks . among the three different fractions prepared from the c. lanceolata root , the c. lanceolata methanol extract ( cme ) exhibited the most remarkable attenuation of alcohol - induced fatty liver with respect to various parameters such as hepatic free fatty acid concentration , body weight loss , and hepatic accumulations of triglyceride and cholesterol .
the hepatic gene and protein expression levels were analysed via rt - pcr and western blotting , respectively .
cme feeding significantly restored the ethanol - induced downregulation of the adiponectin receptor ( adipor ) 1 and of adipor2 , along with their downstream molecules .
furthermore , the study data showed that cme feeding dramatically reversed ethanol - induced hepatic upregulation of toll - like receptor- ( tlr- ) mediated signaling cascade molecules .
these results indicate that the beneficial effects of cme against alcoholic fatty livers of mice appear to be with adenosine- and adiponectin - mediated regulation of hepatic steatosis and tlr - mediated modulation of hepatic proinflammatory responses . |
a 44-year - old woman without any specific medical history presented to the emergency room of our hospital after a snake bite , ( agkistrodon ussuriensis , chinese viper ) near the right lateral malleolus , in a parking lot three months before being referred to the pain clinic . at that time ,
the patient complained of severe edema up to the right femoral region , acute pain , abdominal pain , muscle pain , double vision , dizziness , and nausea .
agkistrodon halys antivenin ( 6,000 iu ) was intravenously injected , followed by the administration of antitetanus immunoglobulin , an antihistamine , a steroid , and antibiotics . at the time of the injury ,
the visual analogue scale ( vas ) pain intensity score was 100/100 ( the patient felt as if her foot was exploding ) .
the score gradually reduced up to 4 days after the injury as the swelling decreased . when the patient was referred to our pain clinic during the 3 month after the injury ( fig .
1 ) , she had static allodynia on the 2 , 3 , and 4 digits of the right foot along with repetitive pain that felt like needle stabs .
the patient also exhibited hyperalgesia in the entire foot as well as constant tingling sensation the upper lateral malleolus .
the pain worsened during walking ; she experienced stiffness and edema with a vas intensity of approximately 50/100 on the lateral sole and the top of the foot in addition to pain in the foot at the slightest exertion , such as walking up or down the stairs . the patient felt a sickly cold sensation in the heel that was alleviated by using a hot or cold pack .
an electrophysiologic study performed at the end of 1 month after the injury indicated findings suggestive of damage to the right superficial peroneal nerve or around peripheral nerve ; however , no abnormal features were observed in a 3-phase bone scan or on thermographic examination . on the first day of the visit ,
an intravenous regional block was performed with 40 cc of 0.5% mepivacaine and 30 mg of ketorolac .
in addition , 300 mg / day of gabapentin was administered in three divided dose .
the constant tingling sensation and pain the upper lateral malleolus completely disappeared but she sporadically felt tingling pain near the bite area .
the pain during walking decreased to a vas intensity of 20/100 , but the cold sensation in the heel persisted . on the 3 day , when performing a secondary intravenous regional block with 40 cc 0.5% mepivacaine and 30 mg ketorolac , the patient developed urticaria in the entire calf with severe pain on the bite site and in the stiff and painful regions during walking .
therefore , dexamethasone 5 mg was injected through the same intravenous route as the mepivacaine injection . the severe pain diminished immediately after the injection .
the next day , the patient had minimal pain , when relaxed , and experienced pain with a vas intensity of 15/100 on the lateral dorsal part of the foot while wearing shoes and walking . however , the sickly cold sensation was still present in the heel .
on the 5 day , a lumbar sympathetic ganglion block was performed on the 2 and 3 vertebrae .
the cold sensation in the heel reduced for 2 - 3 days after the block but returned at the same level as before ; therefore , we decided to perform a sympathectomy using alcohol .
the preoperative temperature of both heels was almost the same ( left heel , 31.1 ; right heel , 31.0 ) .
2 ml of contrast medium and 2 ml of 4% lidocaine were injected in the sympathetic ganglia at the l2 and l3 level . after a 10-min wait to confirm the absence of motor weakness and other abnormalities , 3 ml of 99% alcohol was injected on each side .
the foot temperature at 15 min after the injection indicated a difference of 3.3 between the left ( 32.1 ) and right ( 35.4 ) side , and the patient felt a burning sensation on her foot .
the following day , the patient was discharged with a vas score of 10/100 and similar levels of pain while walking and relaxing .
a reduced dose of gabapentin ( 300 mg tid ) was administered for the next 2 months .
when the pain disappeared , administration of the drug ( gabapentin 300 mg tid ) as well as follow - up were discontinued .
complex regional pain syndrome ( crps ) , characterized by continuous pain regardless of the inducing stimulus , manifests as at least 3 of 4 categories including sense , vascular mobility , edema , and motor function , and it is diagnosed as such when > 2 positive symptoms of the 4 categories mentioned above are present . in the present case ,
the patient complained of hyperalgesia , allodynia , edema , and decreased range of motion after receiving a noxious stimulus due to the snake bite .
physical examination also indicated hyperalgesia , allodynia , and edema as well as peripheral nerve damage .
crps has several causes , including sympathetic mediated disorder , central sensitization , autoimmunity , ischemia , cortical reorganization , nerve damage , and inflammation ; however , the underlying mechanisms are not yet clearly understood .
the development of crps due to a snake bite is very rare , with only 2 reported cases worldwide reported thus far .
two million people worldwide experience snakebites each year , of whom 20,000 die . depending upon the type of snakes , bite cases are classified into those resulting in local edema and necrosis of the bitten limbs and those resulting in systemic neurological symptoms .
although snakebites cause edema and pain that are sufficiently severe to induce compartment syndrome with life - threatening systemic symptoms , local symptoms are often insufficiently treated as they are hidden by systemic symptoms . of the cytotoxic enzymes in snake venom , phospholipases - a2 and metalloproteases result in inflammation and
agkistrodon brevicaudus , a. ussuriensis , and a. saxatilis are mainly found in korea , and common venom components among these snakes include the enzymes that belong to phospholipase - a2 and metalloprotease categories .
animal studies reported the occurrence of hyperalgesia and allodynia when phospholipase - a2 was injected into subcutaneous tissues and muscle .
inflammatory and proinflammatory cytokines ( interleukin-1 , tumor necrosis factor- , bradykinin , substance p , and calcitonin gene - related peptide ) increased , and the development of hyperalgesia was inhibited when proinflammatory cytokine inhibitors were used [ 8 - 10 ] .
another study reported that noticeable edema is observed in cases of snake bites , and that local edema due to inflammation causes ischemia and neural compression of the peripheral tissues , resulting in permanent tissue damage . in the early stage of edema ,
patients with crps also experience plasma extravasation - induced edema due to an increase in substance p , which is a proinflammatory cytokine .
edema due to extravasation by a 5% dextrose solution was reported to cause compartment - like syndrome , which results in crps . in an animal study with reperfusion after 3 h of ischemia , crps symptoms manifested without any evidence of neural damage .
in particular , the study found that free radical accumulation in ischemic conditions induced edema and inflammation because of blood vessel damage in the deep tissues during reperfusion , which could explain how crps type 1 might develop in the absence of clear neural damage .
thus , in our case , hyperalgesia and allodynia due to excessive inflammation by snake venom , decreased movement to avoid pain , free radical accumulation due to edema - induced reperfusion , and constant pain induced by autonomic nervous system stimulation could result in crps . despite many studies on crps treatment methods ,
considering that the patient 's pain was still localized in the ankle region and that local edema and inflammation were present , the authors performed an intravenous regional block ( ivrb ) utilizing local anesthetics and ketorolac .
many pain clinicians have conducted ivrb using various sympatholytics , anesthetics , and anti - inflammatory drugs to treat crps - affected limbs because of its convenience and reliability .
ivrb with ketorolac is reported to be especially useful for the treatment of hyperalgesia , joint pain , and edema .
ketorolac decreases the sensitization associated with prostaglandin e2-mediated bradykinin hyperalgesia , tissue ischemia , vasodilation , and k - opioid receptors , by inhibiting thromboxane . in the present case ,
the short - term effects of ivrb have been reported in a case series , whereas the evidence regarding its long - term effects has not yet been sufficiently provided . however , because multimodal treatment is generally preferred to single treatment for addressing crps and since crps is an obstinate disease that is difficult to cure , the application of multimodal treatment for its short - term effects ( if any ) seems reasonable , even though its therapeutic effects are not well understood .
although the thermographic findings in our patient were normal , we performed a sympathetic ganglion block as her complaints of a cold sensation persisted . to maintain the reduced pain level ,
a chemical sympathectomy was performed by using alcohol , and the pain was remarkably reduced . in the current case , intense treatments appear to have been helpful because of the relatively short duration of the symptoms . in conclusion
, clinicians should acknowledge that the development of inflammation and edema due to snake bites can result in crps . to reduce the occurrence of crps , aggressive treatment of early - stage symptoms is necessary . | the occurrence of crps after a snake bite was very rare , only two cases were reported worldwide . here
we report a case that the 44-year - old female patient bitten by snakes crps type 1 was treated consecutive intravenous regional block , lumbar sympathectomy and antiepileptic drug therapy , also discuss the possible pathophysiology . |
by 1856 , the capital of belgium had gained international appeal in terms of finance , culture , politics and economy .
the local leading circles loved to cultivate this image and were keen to label brussels a first - rate city .
brussels , however , with its many narrow streets and old , small houses was rapidly becoming inadequate to accommodate a growing population , which resulted in numerous sanitary problems .
one of these problems related to the firm conviction that food was much more adulterated than ever before .
millers and bakers were suspected of adding chalk , field beans , maize , potato flour , plaster , potash or copper sulphate to bread ; the latter in particular caused widespread outrage .
some demanded tougher action given the disappearance of control as a result of the demise of the ancien rgime .
it is impossible to track the actual food fraud that occurred in that period , but in order to assess the general state of alertness regarding this fraud and its repression i used the brussels newspaper lindpendant ( after 1843 : lindpendance belge ) , of liberal tendency , esteemed , and regularly referred to in other contemporary writings .
i counted the frequency of two significant word combinations between 1831 and 1856 ( pharmaciens
alimentation , and chimiste
fraude ) .
of course , this approach excludes qualitative attention : some word combinations are part of extremely brief , title - less messages simply mentioning , for example , that a chemist has analysed a bottle of wine , but another word combination may be part of a far longer text bearing title and author s name .
graph 1 shows the incidence of these messages between 1831 and 1856 : low attention in the early 1830s ( less than 10 mentions per year ) and moderate rise up till the early 1840s ( about 20 mentions ) ; there was then a first peak in 1846 ( 42 mentions ) and a second in 1849 ( 69 mentions ) , after which the number remained high ( circa 60 per year ) . a high number of mentions concurred with high food prices in 1846 , but not in other expensive years ( 1847 , 1853 , 1854 ) .
if these data can not ascertain the actual increase in food fraud , they definitely reflect growing interest in the phenomenon .
obviously , the brussels councillors had no way of referring to such a graph when they debated setting up the laboratory , but by 1856 they must have become quite alert to matters of food fraud , worried as they also were by a great many other issues of public hygiene such as filthy streets , recurrent epidemics or the state of cemeteries . additionally , rising prices in early 1856 was also a matter of concern to the city s administration . rather than limiting prices or monitoring trade , the brussels administration preferred to intervene in an innovative way .
the city , then , was governed by a progressive liberal administration with an entirely liberal council , whose aim was to promote brussels according to modern models ( imitating paris and london ) , and preferring non - interventionism , which did not preclude a sense of public responsibility .
on april 26th , the mayor of brussels , charles de brouckre ( 17961860 ) , gave a short speech in which he proposed the appointment of a chemist and the setting up of a municipal laboratory .
his opening line was clear and straightforward : the council believes it is indispensable that the municipality should employ a chemist to restrain food adulteration as much as possible. by using the word
chimiste and not pharmacien or apothicaire , he differentiated between science and commerce ( this distinction will be addressed below ) . he acknowledged that existing food analyses produced good results , but insisted they took too much time .
moreover , he went on , it was necessary to carry out checks on a daily basis , and he stressed that the head of police would be responsible for the laboratory s operation .
two councillors reacted briefly to the mayor s speech , while not questioning its baseline .
chemist - pharmacist jean - baptiste depaire ( 18241910 ) supported the mayor s view , but stressed that it was not only bread and flour that were adulterated , but other foodstuffs too .
depaire wondered whether it was necessary to appoint a chemist : the creation of a new committee of experts would suffice .
d. kaieman ( 17961857 ) , a lawyer at the brussels court of appeal , commented further on this appointment : there was the risk of bribery , he said , if only one person was employed . the mayor , then , suggested submitting the proposal to the section de police ( a committee that advised on the police budget ) , which was accepted .
after a delay of two weeks , the report of the section stated that the principle of having tougher municipal control of food quality was indisputable .
the recent national law ( 17 march 1856 see below ) had moreover provided for increasing municipal initiatives in matters of sanitation .
with regard to appointing one person or a committee of specialists , the section de police argued that a committee would only act after complaints had been made , whereas the chemist would work on a daily basis within initiatives taken by the mayor or the police , which could lead to direct legal action . in short , the municipal laboratory would have a preventive character , the chimiste de la ville would not interfere with the dealings of millers , bakers or retailers , and the mayor would be fully responsible . as a result
the mayor , while emphasising the temporary nature of the appointment , added that the appointment would become permanent if the test period proved satisfactory .
five council members ( out of twenty - seven ) reacted very summarily to this report ; they addressed a number of themes : the location and the mode of functioning of the laboratory , the role of the chemist and his relationship with the mayor and the retailers , and how to appoint the chemist .
kaieman feared that the city s chemist would encounter bakers and grocers when accompanying the police , which would endanger his neutral position .
the sixth and last debater , depaire , delivered a slightly longer speech that entirely supported the mayor s proposal .
he explained that he had at first feared that the city chemist would interfere directly with the retail trade ( an active control of food retailing ) and actually regulate millers , bakers and retailers , but that the words of the section de police and those of the mayor had appeased him . immediately after depaire
his name was mentioned once in the bulletin communal ( 12 december 1857 ) , but did not appear in a public document , as though this person had to remain anonymous .
a budget of 3000 francs was allocated ( a salary of 2000 francs for the chemist , plus 1000 francs to cover costs ) , whereas the commission mdicale ( see below ) received only 1800 francs .
the laboratory was set up in the htel de ville at the grandplace ( where it remained till the 1880s ) .
the test period did not cause a problem , and up till 1914 , the municipal laboratory was given more means and staff , and analysed hundreds of food items every year .
also , it was referred to as a model for setting up other municipal laboratories in and outside belgium . although the brussels council was unwilling to immediately take drastic innovative action in matters of food commerce and safety
, it appears that decision - making with regard to the laboratory was extremely fast .
by contrast , for example , setting up the municipal laboratory of grenoble took several years .
the brussels discussion reveals relevant features : no reference was made to practices in other towns or to the opinions of experts ( such opinions existed , as will be made clear below ) , no lobby groups were given any say , no discussion occurred about the cost of the laboratory or the role of the municipality in interfering with food trade , no discussion took place about staff skills , and no provisions were provided for the laboratory to fit into a judicious sanitation policy .
the creation of a permanent service was never questioned , and alternatives ( eg . a committee of experts ) were barely discussed .
it seems that the mayor s proposition was received as self - evident or that when viewed from a different angle the rhetoric was convincing : the speeches by the mayor and depaire had gently convinced the members of the council . in early may 1856 ,
the brussels administration took a decision that implied radical innovation concerning intervention in matters of food control ; it was all as though control was urgently needed and had arisen in a vacuum a situation which was far removed from daily practices .
since the 1800s at least , chemists , and primarily pharmacists , had played a role in assessing the quality of food .
this much was made clear by newspapers , reports by learned societies , brochures by physicians , and , indeed , acknowledgments by the brussels municipal council .
the role of pharmacists in particular was highlighted in lindpendant from 1831 to 1856 : a considerable number of newspaper articles announced that a pharmacist had analysed bread , flour , milk , wine or some other foodstuff ; that a grocer had been sentenced after a pharmacist has established fraud , or that chemical investigation had revealed considerable food fraud .
these articles report on people taking the initiative in bringing foodstuffs to be analysed by a professional , as if this were common practice .
often , such an initiative would be taken by legal professionals ( police officer or mayor ) , but also by physicians , pharmacists , professors , traders and consumers , or , in one case , by a newspaper .
( about the latter : lindpendant , 20 september 1838 , wrote , we did not wish to cause alarm , but yesterday a citizen brought a suspect piece of bread to the newspaper s bureau , and we hurried to show this to a competent chemist. ) one testimony in 1840 , worrying about careless reactions that lead to food scares , even claimed that there is nt a day without citizens bringing bread to a pharmacist to have it analysed. were some pharmacists or some chemists in particularly great demand ? did some specialise in analysing food ? or was it , for pharmacists , no more than routine business , known to every citizen ?
i have searched newspapers for advertisements and tariffs relating to food analysis in the first half of the nineteenth century , but though much advertising can be found , none of it relates specifically to food analysis or a laboratory ( only to pills , emulsions or ointments ) . did serious pharmacists not advertise ? was analysing food such a self - evident activity for pharmacists that it did not need to be promoted ?
food analysis and laboratory work were not referred to in the lists of occupations in brussels .
these lists or directories contained the names of all the pharmacists with their addresses and , occasionally , qualifications ( eg . in 1840 : gripekoven , grande rue au beurre , fournisseur brevet deaux minrales de la cour , fabricant de produits chimiques et pharmaceutiques ) .
the aim of the qualifications was to secure commercial gain , but also , and perhaps primarily , to delineate the difference between serious chemists or pharmacists and common merchants or swindlers .
these lists , incidentally , make it possible to estimate the growth of the number of pharmacists in brussels in the first half of the century : 36 in 1806 , 45 in 1830 , 56 in 1840 , 60 in 1850 , and 73 in 1856 .
slightly less than the rise of the brussels population ( 1.45 per cent ) . in 1806
, there was one pharmacist for 1900 inhabitants and in 1856 , one for 2090 bruxellois .
it is likely , then , that pharmacists were able to deal with the apparently increasing demand for food analysis up till the 1850s , particularly given the fact that some considered one pharmacist for 4000 inhabitants to be sufficient . yet , not all pharmacists possessed the equipment to perform analyses .
that much was made clear during a debate in the council of the province of brabant in 1860 , when a member stated that
several pharmacists have declared that they do not have the necessary tools for analysing food. according to some , the status of pharmacists had deteriorated compared to what it was in the eighteenth century .
this appeared very clearly in 1851 , in a plea to limit the number of pharmacists , which would guarantee sufficient income , quality of service , and , above all , reliable products .
serious pharmacists and chemists constantly complained about the many charlatans or ordinary merchants who sold ready - made and cheap pills of all sorts , but were not capable of preparing or providing appropriate medicine .
the law of 1818 ( valid after belgium s independence in 1830 ) had created provincial commissions mdicales de lexamen et de la surveillance de tout ce qui a rapport lart de gurir responsible for accrediting pharmacists ( as well as midwives , ophthalmologists and druggists ) .
the criteria differed depending on the provinces , and candidates had to prepare through personal study ; also , at least three years experience assisting a pharmacist was required .
academic education in pharmacology was lacking ; additionally , the degree of doctor in pharmacology had been abolished in 1835 . around that same year
, local associations of pharmacists were set up , and in 1842 , an ecole de pharmacie was created as part of the university of brussels ( that provided chemistry and toxicology courses , and of which depaire was one of the first to graduate ) . in 1845 ,
a national journal was launched ( journal de pharmacologie ) ; in 1846 , a national association of pharmacists was created ; and in 1849 , university education was , at last , established .
, all these initiatives remained insufficient to restore the reputation of the profession and , in 1856 , the socit royale de pharmacie de bruxelles was set up whose goals ( still ) involved getting rid of charlatans .
was the chemical analysis of food part of this struggle over competence , and did running a laboratory make a difference between serious pharmacists and charlatans ?
the comit central de salubrit publique de bruxelles was established in 1835 to advise municipal authorities on issues of public health and hygiene . alongside lawyers , administrators , architects , and many physicians , the comit had two pharmacists .
it considered a variety of issues including slaughterhouses , the diet of the working classes , public heating during winter , food prices , gin abuse and food quality . in 1838 , 1839 and
again in 1840 , the comit set up a special section for testing suspect bread .
it appeared that the bread was safe , which prompted the physician j. dieudonn , the conseil s secretary , to make some observations about food safety in the capital .
he was upset by the fact that not for the first time in a couple of years
bakers had been falsely accused of selling harmful bread ( he did not say by whom ) , which was damaging for commonly held beliefs about safe food in general .
dieudonn proposed that the brussels municipality should send policemen to frequently visit and control millers and bakers ; such an initiative would largely appease the inhabitants and dissuade them from all too often relying on the services of a pharmacist to analyse bread .
also , in 1840 , dieudonn relates a most telling episode that perfectly illustrates the conflict between serious work and amateurism .
le courrier belge , a brussels daily , had published an article about a pamphlet that denounced bread adulteration ; in so doing , the paper had generated some public anxiety .
the author of the article , kopzcynski , had analysed bread samples sold in brussels , and though the samples did not contain copper sulphate , it was revealed that spoiled rye ( seigle ergot ) had been used .
this , so claimed kopzcynski , had caused the recent upsurge of gastro - intestinal problems .
the conseil saw this as a great opportunity to act resolutely and prove its own efficiency ( une belle mission remplir ) ; if kopzcynski was right , then the conseil would grant his findings genuine authority based on the most rigid testing , but if he was wrong , the conseil would immediately reassure the public about safe bread and , moreover , vigorously defend the bakers reputation .
so , a team of two physicians and two pharmacists , members of the conseil , was appointed to analyse the bread .
it turned out that kopzcynski had it wrong , which the conseil made public in rather diplomatic , but in no uncertain terms .
more so even , the conseil re - iterated the suggestion of having a policeman accompany the members of the conseil when they visited millers and bakers something that should be done regularly and very openly to appease the general public .
the brussels municipality turned down the proposal , which caused indignation among the conseil members .
the kopzcynski - incident illustrates the conflict over authority between serious pharmacists and a random chemist ; it also highlights the request for support by the public authority ( police presence ) , which was denied : it was no business of the local police to accompany private persons , even if the latter belonged to a board that advises the city .
the conseil s actions and views clearly demonstrated the awareness that food adulteration was no longer to be detected by simply smelling or tasting : effective control required expert and skilful intervention that went well beyond the mere ability of manufacturers , traders and consumers .
a similar call for professionalisation also appeared in a report by the acadmie royale de mdecine of 1848 .
this acadmie was established in 1841 , and as early as 1842 the status of pharmacists had been addressed when debating their academic degrees .
the 1848 report was the outcome of a request by the government in 1844 to investigate food fraud as well as of two enquiries into food fraud , which were the result of private initiative . to solve the problem of food adulteration , the acadmie noted that
, broadly speaking , producers , traders and consumers ought to be aware of modern scientific methods to discover fraud , but that people who have no sufficient education should be able to call upon an expert .
one proposal was aimed at organising national control : the state would appoint chemists specialised in analysing food .
another proposal included appointing pharmacists who would assist the local police when inspecting food manufacturers and retailers . both proposals called upon ( local or national ) authorities to intervene .
the conclusion of the acadmie , however , was not very forceful to say the least : the government might consider appointing experts to control food , though it was stated that current legislation was adequate .
furthermore , the report concluded , though the possibility of food fraud should not be ruled out , the experience of most of the members of the acadmie shows that cheating in food matters was exaggerated. the controversy surrounding food fraud and its implications concerning the authorities and public responsibility was particularly highlighted in la sant , journal dhygine publique et prive , salubrit publique et police sanitaire , published in brussels from 1849 to 1859 by two doctors assisted by administrators , politicians , professors , journalists , and physicians , all of them members of learned societies or health boards , such as the acadmie royale de mdicine or the conseil de salubrit publique .
la sant focused on three areas ( les plus urgents de notre poque ) : hygiene , public health , and sanitation policy .
it paid attention to housing , diets , mortality , sanitation , education and food adulteration . with regard to the latter ,
for example , in december 1849 it was said that chicory , sold in brussels , was generally adulterated , but that the additions were not harmful to health ( nonetheless , they were illegal and should therefore be prohibited ) .
more attention to food adulteration arose in 1852 , when victor vandenbroeck , a physician and professor of chemistry at the ecole des mines ( mons , province of hainault ) was warmly supported in his battle against food fraud . in 1846
, vandenbroeck had published a brochure in which he had called upon the government to intervene more vigorously in matters of food adulteration .
since then , vandenbroeck had campaigned vigorously in favour of strict food control and severe penalties , reporting on analyses he had performed , denouncing the real health hazards of adulterated food , and proposing new legal measures . in 1852 , la sant acclaimed the brochure , as well as vandenbroeck s other initiatives in the same area , and excoriated the fairly mild punishments inflicted on manufacturers and traders who were caught red - handed .
the attention that was paid to vandenbroeck s brochure in la sant occurred in the context of the international congrs dhygine held in brussels in 1852 .
it was there that vandenbroeck held a speech in which he presented rather radical views .
vandenbroeck claimed that he had investigated food fraud since 1843 and was probably the best - informed person on the subject in belgium .
two issues were at stake : fair trade and public health , on which current laws ( not only in belgium ) were inadequate .
vandenbroeck argued that stricter laws were badly needed , though new laws would not be enough .
first , honest manufacturers and traders should be rewarded : when chemical analyses proved that their products were unadulterated , it should be made public , like an advertisement. conversely , when manufacturers and traders were caught in the act of committing fraud , their names and addresses should be published in local and national newspapers . an equally radical new suggestion proposed establishing chemical laboratories for analysing food ,
where each citizen could present food , under a guarantee from the municipal administration ; this analysis would be free for the poor. four preventive actions were proposed at the end of the deliberations on food adulteration : the obligation by the communes to strictly observe the legislation ; the establishment of local health committees ; the obligation for merchants to allow the police to carry out inspections and take food samples , and the establishment of local laboratories for food analysis .
these proposals were unanimously adopted ( after some debate about whether the analysis of food would be free for all citizens , which was not accepted ) .
it was not mentioned who should establish and pay for the laboratories , but the role of municipalities was obvious .
however , when it came to the conclusions , only three of the four were mentioned : no mention was made of the proposal to create municipal laboratories .
some participants were in favour of free analyses , but vandenbroeck himself argued during the debate that this would leave the door open for anybody to have his butter or bread tested :
you ll need an army of chemists and a mass of laboratories. maybe la sant s reluctance can be explained by financial considerations .
this financial aspect ( ie . the burden for public authorities ) re - appeared in an article of 1858 , in which la sant warned that most communes would find it impossible to pay the salary of a chemist . in sum , la sant seems to have favoured more control by public authorities , while at the same time remaining hesitant with regard to increasing public intervention .
a decade later , the proposals of the 1852 congrs dhygine , including the setting up of municipal laboratories for food analysis , were still being supported .
vandenbroeck was still determined , even though he had tempered his more radical views . in 1853
, he published a leaflet in which he accused the law of being too permissive ( fines for food fraud were the same as those applied for not keeping one s dog on a leash ) . also , he proposed a new law to prevent and discover food fraud that no longer relied on municipal laboratories , but on provincial committees of three experts that would immediately analyse any foodstuff provided by any legal authority whatsoever. his proposal was never discussed .
the silence surrounding the setting up of chemical laboratories was not due to the journal s lack of interest in matters of food fraud . on the contrary
, the table of contents between 1849 and 1855 shows a growing interest in these issues ( from one reference to seventeen ) . in 1853 ,
la sant ran a series about food adulteration ( one article every month ) , while the publication reported on the development of the brussels administration in its struggle against food adulteration .
when , in 1854 , the annual report on brussels was published ( see below ) , which revealed food analyses that were reassuring , la sant concluded that communes should do whatever was needed to eradicate the abuse of chemical progress ( user de toute leur autorit pour rprimer cet abominable abus des progrs de la chimie ) .
la sant frequently mentioned the progress of chemistry by which the journal meant monstrous sophistications , a shame for the food industry , slow but permanent murder , and a crime in disguise. these were all references to fast evolving food manufacturing that had started to introduce additives ( colouring , conservation , or taste enhancing ) without any regulatory restraint all of which were practices that differed from the
pharmacists , so la sant predicted , were confronted with a huge task : they would have to assist medicine in its battle against food alteration .
la sant kept a close watch on how the municipality of brussels handled food adulteration .
weak interventions were rebuked , as appeared clearly in a comment on a session of the brussels council of september 1854 .
the mayor had explained that he had ordered the testing of 119 bread samples , 63 of which contained bean flour in relatively small quantities .
the mayor had no alternative but to reprimand the miller , but did not go so far as to take him to court .
frequent police visits to food retailers or the setting up of a municipal laboratory ) beyond the strict application of the law .
when , in may 1856 , the municipal laboratory of brussels was created , la sant made no comment ( lack of awareness , maybe ) .
the law of 17 march 1856 on the curbing of food adulteration , however , did get some attention : it would not work , argued la sant , because most communes could not pay for adequate chemical analysis , which is why food control should be organised at the level of provinces .
this also became gorrissen s concern when , in 1860 , he proposed to the council of the province of brabant the establishment of municipal laboratories based on the brussels model .
his speech severely criticised the law of 1856 for not providing for scientific backing of chemical analyses , which led to some communes in brabant not analysing food . in some respects ,
the 1856 law was more lenient than that of 1829 ( eg . in terms of punishment ) , and in general more attention was paid to trade relations than to food safety .
so , when in may 1856 , the brussels council adopted the mayor s proposal to set up a city laboratory , decades of growing attention to food fraud had gone by .
physicians , chemists and pharmacists , that is new experts ( vis - - vis the traders , manufacturers and consumers ) , analysed food frequently ; they published many leaflets and books , appeared in the media , proposed new measures and eagerly sought to achieve recognition . in short , private initiative was very present .
often , proposals implied the more or less discrete presence of some form of public authority , as though private initiatives ought to be backed by higher power , and on a rare occasion the latter even referred to substitution of private by public initiative . yet
since the 1830s , the brussels administration had been sensitive to all matters linked to food fraud : it was highly aware of the problem of correct trade , health , and public trust and order .
the municipality could refer to various laws on pure food and correct trade , which had existed since the southern netherlands had been part of the french empire ( 17941814 ) and of the united kingdom of the netherlands ( 181530 ) . laws of 1790 , 1791 , 1810 , and particularly 1829 , explicitly allocated the control of food trade to the communes , but gave rather vague definitions of fraud ( addition of dangerous ingredients and , later , addition of damaging or poisonous matters ) , and dealt with the task of policing , punishment and the appointment and aptitude of experts . in 1836 ,
a new communal law extended the responsibility of communes , allowing them to take measures regarding food safety . since the mid-1840s , and most likely in connection with rising prices in 1846 and 1847 , which caused growing general interest in safe food , the brussels mayor reported annually on food adulteration , mostly to reassure the council and the citizens about food quality in the city .
thus , in the 1849 rapport annuel on the situation of the city it was noted that ,
several analyses had been performed , at the request of private persons or the administration , and carried out with the greatest care ; no sophistication had been detected. it was not mentioned who these private persons were ( traders , ordinary consumers , physicians or other people or institutions ) ; neither was it mentioned why and under which circumstances the administration took the initiative to request food analyses .
no statistics were made available ( number of tests , results or sorts of food ) .
reassuring , short notes appeared in following years as well . in 1850 , it was said that no food adulteration had been detected , but that a professor at the ecole des mines of hainault ( most likely , the above - mentioned vandenbroeck ) had warned against the use of harmful wrapping paper . in 1851 and 1852 , it was once again reported that no adulteration had been found . in 1852 , however , this trouble - free image could no longer be maintained .
the report revealed that the baker rotsaert had used copper acid , for which he was sent to prison for two years .
it may come as a surprise at this stage that the resolutions with regard to food fraud of the 1852 congrs dhygine were not referred to in the city council , although these involved relevant discussions about municipal action . in 1853 , 1854 and 1855 ,
particular events however occurred in those years , which revealed new concerns and led to new initiatives . in 1853 ,
the mayor deemed it necessary to mention ( due to the extreme gravity of the case ) that he had been requested by a miller to explicitly state in the city council that the police had definitely not visited the miller s workshop .
the miller was worried about rumours that accused him of adding ingredients to his flour .
the mayor confirmed that , until now , there is no reason to believe that this miller mingles ingredients ( but why until now ? ) .
the mayor ended by stressing that , our eyes are wide open , because fraud may become common in this year of high prices. the other relevant occasion sheds light on the mode of analysing food .
the 1854 report mentioned that the commission mdicale had performed several food analyses ( see below ) , but that the city administration , in turn , has conducted in - depth control of all flour that is used for bread , which showed that only the flour of beans had been added ( which was penalised ) .
thanks to the unofficial intervention [ intervention officieuse ] of a member of the council. the member concerned was j .- b .
it appeared that out of 119 samples , 56 were pure ( 47% ) , while all the others contained beans to various degrees .
it is not clear when the brussels commission mdicale was created , but it existed in 1830 , and included physicians , pharmacists , and other experts . according to the law of 1818 , a local commission could take over particular tasks from the provincial medical committee , and advise it on a wide variety of sanitary issues .
initially , the local commission was granted 1500 francs per year by the brussels administration for everyday costs ( meaning that the municipality did not pay staff ) , which was increased to 1800 francs in 1856 , the year when the municipal laboratory was established ( the sum remained unchanged until 1873 , when it was raised to 2400 francs until 1914 ) .
two of the tasks of the commission mdicale are relevant here : the control of pharmacists and concern with regard to food quality .
annually , it was reported that all pharmacists of brussels had been carefully inspected , and that some apothecaries were in need of particular attention . in 1851 ,
the annual report went further , when the names of defective pharmacists were mentioned . in rare cases ,
the condition of the pharmacy was judged excessively bad , which led to its closing .
such messages appeared annually in the 1850s ( even after the obligation for pharmacists to have a university degree ) , though they never gave information about the nature of the inadequacy .
the fact that all brussels pharmacists were inspected every year says much about the image of the profession : did the city administration doubt the pharmacists abilities , or did it question the remedies and ointments that were sold ?
the commission mdicale also dealt with the prohibition of advertising and selling of specific remedies ( remdes secrets ) as well as with arbitration between pharmacists and customers .
it appears that all reassuring reports by the city s administration in the 1840s and 1850s were based on the commission mdicale s checking of food samples .
the 1849 annual report of the city council mentioned that in 1848 the commission had conducted various tests on bread at the request of private persons and the city council ; very small quantities of chalk had been discovered in the flour , which had been reported to the legal authorities .
private persons brought food samples to the commission : why would they have done this ?
did the committee have a fixed location or were the names of the members known ? how did people know about this possibility ?
even more relevant : were people suspicious of local pharmacists ? or would food analysis be a very costly and highly qualified activity , which could only be performed by a handful of expensive pharmacists ? this , then , highlights social inequality with regard to safe food . the fact remains , however that private persons knew about the possibility of having food analysed by the commission . moreover , to have food analysed under the authority of the city council seemed to have been appreciated
unfortunately , it is impossible to know how many analyses were performed in those years , or who took the initiative ( the council , the police , or consumers ) , nor which foods were analysed . generally speaking
the commission mdicale continued to ensure with laudable vigilance the enforcement of the laws on the medical arts. during the mayor s speech in april 1856 , the sentence that immediately followed the proposal to set up the municipal laboratory , referred to the commission in these terms : we can not but admire the support of the local commission mdicale.
la san also wrote very favourably about the brussels initiatives .
so , why not continue to use the services of the commission mdicale and possibly even extend them in 1856 ? what was wrong with the commission ?
it certainly did not have a very visible presence : not once did i find it mentioned in la sant , the conseil de salubrit publique , lindpendant or any other brussels paper .
the way the commission mdicale operated was not explained in the bulletin communal ( nor did i find the modus operandi elsewhere ) .
the members of this committee performed the analysis , as was mentioned in the 1856 report of the city council .
the whole process of analysing food , however , was fairly time - consuming , as was made clear on several occasions . on 2 january 1840
dieudonn examined the bread and brought it to the conseil central de salubrit publique de bruxelles to have it analysed . in its session of 8
january , the conseil decided to send the bread to a special committee of three pharmacists , who did not detect any fraud .
it was not mentioned when the three pharmacists reported the result of the analysis ; even so , one week had passed between the allegation and the decision to have the bread analysed .
in january 1849 , v. vandenbroeck was invited by the municipality of mons to control the local food quality . with the help of three colleagues , he started his investigations on 24 february , and completed them on 8 august ( eight in twelve samples of bread turned out to be adulterated ) .
the time needed for analysing food , was addressed in the mayor s speech in april 1856 : having said how much the activities of the commission mdicale were appreciated , he continued by saying : when an allegation is uttered , we need the analysis within the day . as it is now , we bring the bread to the commission mdicale that instructs one of its members who , two to three days later , performs the analysis and writes a report to the chairman , who then forwards it to us .
when an allegation is uttered , we need the analysis within the day . as it is now , we bring the bread to the commission mdicale that instructs one of its members who , two to three days later , performs the analysis and writes a report to the chairman , who then forwards it to us . in his brochure of 1860 , gorrissen also criticised this inefficiency , adding that the commission mdicale only convened irregularly , hardly took initiatives and had no more than a purely advisory role .
in 1856 , it was emphasised that the establishment of the municipal laboratory would do no harm whatsoever to the
general surveillance of the commission mdicale and the valuable action of this illuminated group ; rather , this group will support with more strength the relentless action of the police.
prior to 1856 , pharmacists and chemists analysed food at the request of citizens and institutions , or on their own initiative .
this attention should be linked to rapidly increasing awareness of food adulteration in those years , which was caused by urbanisation , the lengthening of the food supply chain , increased competition , profit , and the deregulation of previous control systems . the pharmacists work was generally praised by the media and learned circles
so , around 1850 , as in any other european city , there did not seem to be an urgent need to create a municipal laboratory , all the more since the city administration used the services of a committee of experts ( the commission mdicale ) , which regularly performed food analyses .
when in 1856 , the municipal laboratory was created , three distinct regimes of food control thus co - existed : private pharmacists , semi - official board(s ) of experts , and municipal action .
these regimes competed ( as illustrated by the kopzcynski case in the early 1840s or the extra check by depaire in 1854 ) , but also negotiated and sometimes collaborated ( as shown by vandenbroeck s proposals in 1852 ) , thus creating new criteria for food safety .
together , it highlights the specific position of brussels within europe where trading zones of expertise were dominated by one of the actors . in this
, brussels did not imitate london or paris , but showed the way . in france , around 1850 , the expert committee was successful , with private physicians mandated by the local administration , but no direct municipal interventionism ; the same goes for dutch communes fifty years later .
in england , around 1850 , health laboratory provision was typically very patchy and provided largely on a commercial basis by hospitals and independent laboratories. the brussels example nuances the view that public intervention in this field occurred rather late , whereas the apparently distinct initiative of the city administration backs theories of imperfect market functioning regulations .
indeed , a key argument of the mayor s speech in 1856 referred to time .
he insisted on daily interventions and instant reactions and , apparently , the actual practice of food analysis in those days could not guarantee fast intervention .
this , however , was a necessity in a city that was confronted with a growing number of inhabitants , more retailers and merchants , rising prices , and more risk of fraud . too long a time span between rumours or allegations of fraud on the one hand , and control and result of the analysis on the other , was jeopardising two major factors of the nineteenth - century city : business reputations and social peace .
the municipal laboratory of brussels may thus be seen as a step toward efficiency . to obtain the latter
, it was not enough to call upon existing expertise , but new expertise had to be created .
the latter materialised quite pragmatically and in mediation with existing expertise : two nicely argued and short speeches were enough to convince the brussels councillors .
nevertheless , although the setting up of a laboratory did not result from a clear , pre - set ideological plan , ideology was very present in as much as a chemist ( and not a pharmacist ) was chosen and that the political environment was ideal to create this type of interventionism .
this new expertise had legal authority , because the municipal chemist operated under direct supervision of the mayor and the chief of police , thus tightening the process of legal control , which is another element of efficiency . since the early 1840s
, several people and circles had demanded tougher public intervention , but presumably they did not expect the city s radical initiative .
the brussels municipality had considered that private initiative was unable to solve a problem that could only be addressed within a context of public and legal authority . to
what extent this laboratory actually solved the problem of food fraud is another issue that can not be dealt with here ; yet , the psychological impact was important : the city s chemist definitely had more power than most of his colleagues with a private officine , who also had a commercial image .
the brussels municipal laboratory should be situated within the canvas of increasing public interventionism in the second half of the nineteenth century , although it certainly can not be seen as the outcome of a linear , well - advised process that fits within a master sanitation plan : during the nineteenth century the laboratory was questioned ; it performed only weakly in particular periods , and its financing , although growing , did not concur with the general rise in the city s finances .
certainly , without the progressive - liberal views of de brouckre and his colleagues , brussels would never have had this type of institution . | in 1856 , the mayor of brussels proposed the establishment of a municipal laboratory with a chemist to analyse food and beverages to restrain fraud . his proposal was accepted and a laboratory possibly one of the first municipal laboratories in europe was set up .
the laboratory still exists today .
this paper aims at tracing the conditions in which it emerged , situating it within the laissez - faire context of the time .
it was brought into existence by a liberal administration , in a period of little interventionism replete with unencumbered private interests ( those of bakers , butchers , grocers , millers , pharmacists , doctors and so on ) . what will be considered here
is the general mood with regard to food fraud , fair trade , correct price , and the quality of food in the first half of the nineteenth century . on a broader level
, this contribution addresses the frictions between private and public initiative , while focusing on the process of construction of expertise .
the paper makes use of contemporary documents such as reviews , newspapers , association reports and city council chronicles . |
in october 2012 , we conducted a cross - sectional study in the ban mai nai soi refugee camp on the thailand myanmar border . this camp was established in 1996 to house persons displaced by conflicts between ethnic minorities and the myanmar government .
approximately 13,591 persons in roughly 3,000 households lived in the camp as of october 2012 ( 11 ) .
camp residents live in closely packed bamboo housing ; many have small yards with an enclosed pit latrine .
residents do not have access to electricity and obtain treated water from communal water stations located throughout the camp .
we randomly selected participants from all houses in the camp by using hand - drawn maps provided by the camp s governing committee and invited all household residents , regardless of age , to participate .
we interviewed all consenting residents using a standard questionnaire in karenni , their primary language , and collected a fecal sample and blood sample from them .
we attempted to interview all participants directly , but allowed parents to answer questions for their young children .
we examined whole fecal samples macroscopically in a field laboratory for taenia sp . proglottids or scoleces ( i.e. , segments or anterior ends ) but did not use morphologic characteristics to identify the species of the recovered tapeworm material .
fecal and blood samples were transported on ice each day to the laboratory at chiang mai university for further processing .
fecal samples were concentrated by sedimentation and examined by light microscopy for taenia sp . eggs .
pig blood was analyzed by enzyme - linked immunoelectrotransfer blot ( eitb ) for antibodies against t. solium cysticerci ( 12 ) .
human blood was analyzed by eitb for antibodies against recombinant antigens specific to t. solium tapeworms ( res33 ) and cysticerci ( rt24 ) ( 12,13 ) .
the sensitivity and specificity of these tests are 97% and 100% , respectively , for res33 , and 94% and 98% , respectively , for rt24 .
participants with taeniasis were given a single oral dose of niclosamide with bisacodyl to assist in tapeworm elimination ( additional methods are provided in the technical appendix .
we interviewed 738 persons in 205 randomly sampled households , representing roughly 5% ( 738/13,591 ) of the total camp population ( table ) .
our sample included a higher proportion of girls and women ( 394 , 53.4% ) , and participants mean age was 23.7 years ( sd 19.8 ) , ranging from a few months to 84 years of age .
participants had a mean of 2.8 years of education ( sd 3.6 ) and had lived in the camp for an average of 9.9 years ( sd 5.9 ) .
most participants were unemployed ( 575 , 80.0% ) and owned at least 1 pig ( 549 , 74.4% ) ; none owned a cow . among the 138 ( 67% ) households in
which pigs were raised , all but 1 ( 100% ) household maintained their pigs in a corral . approximately one quarter of participants reported eating raw pork ( 190 , 26.1% ) and raw beef ( 178 , 24.6% ) .
of these , 18 ( 3.3% ) participants tested positive for taeniasis ( i.e. , eggs or proglottids were detected by microscopy ) , ranging from 1 ( 0.6% ) person < 10 years of age to 7 ( 11.7% ) persons > 54 years of age ( figure ) .
after accounting for intrahousehold clustering and sampling weight , the prevalence of taeniasis as determined by microscopy was 2.9% ( 95% ci 1.4%4.3% ) . among the 671 persons with blood sample results , only 1 ( 0.1% ) had serologic test results indicating t. solium taeniasis .
this person was negative for taenia sp . eggs or proglottids via fecal microscopy and was not seropositive for antibodies indicating t. solium cysticercosis .
taenia solium taeniasis and cysticercosis in refugees living on the thailand myanmar border , 2012 .
blood samples were collected from 671 ( 91% ) participants . of these , 29 ( 4.3% ) were seropositive for antibodies against t. solium cysticerci by using eitb rt24 , ranging from 6 ( 2.9% ) persons < 10 years old to 10 ( 15% ) persons > 54 years old ( figure ) . after accounting for household clustering and sampling weight , seroprevalence was 5.5% ( 95% ci 2.9%8.1% ) .
of the 258 pigs whose blood we collected , 11 ( 4.3% ) were seropositive for antibodies against t. solium cysticerci by eitb lentil - lectin purified glycoprotein .
after adjustment for household clustering and sampling weight , 3.2% ( 95% ci 0.8%5.5% ) were seropositive .
the overall prevalence of 2.9% is consistent with estimates from other regions where taenia sp . are endemic .
although we did not definitively identify the species of taeniasis present , serologic results suggest that t. solium is not the dominant taenia species in this population .
we found only 1 person with serum antibodies indicating t. solium taeniasis using an assay that is 100% specific for t. solium .
the prevalence of antibodies indicating t. solium cysticercosis in humans was also low . given this combination of findings , t. asiatica or t.
the risk of acquiring neurocysticercosis in ban mai nai soi is therefore likely to be relatively low .
however , the distribution of taenia sp . tapeworms varies considerably among geographic areas and ethnic groups , so these results might not be generalizable to other camps or communities along the thailand myanmar border .
the universal availability of sanitary infrastructure and wholesale adoption of animal corralling within the camp limit the conditions necessary for the t. solium tapeworm to complete its lifecycle .
these prevention measures might control transmission despite the pervasive poverty and common practice of eating raw pork .
sanitation and pig restraint within the camps and surrounding communities might reduce the risk for t. solium taeniasis and neurocysticercosis in this region .
because we collected only 1 fecal sample from each participant , we might have underestimated the prevalence of taeniasis .
although we recovered tapeworm material from fecal samples , we were not able to perform any molecular analyses , so the exact species of taenia remains unconfirmed .
many of the variables collected were self - reported and therefore subject to participants recall bias .
screening and treatment for taeniasis among refugees before resettlement might also reduce the risk of further transmission in the receiving country .
detailed methods for study of taenia solium taeniasis and cysticercosis in refugees living on the thailand myanmar border , 2012 . | we tested refugee camp residents on the thailand myanmar border for taenia solium infection .
taeniasis prevalence was consistent with that for other disease - endemic regions , but seropositivity indicating t. solium taeniasis was rare .
seropositivity indicating cysticercosis was 5.5% in humans , and 3.2% in pigs . corralling pigs and providing latrines may control transmission of these tapeworms within this camp . |
the initial 8-component model of the csh approach was first introduced in 1987then termed comprehensive school healthvia a special issue of the journal of school health.1 previously , school health was conceptualized as a 3-legged stool comprised of health education , health services , and the healthy school environment.1 csh involved both implementation of programs and services within 8 high - quality components and systemic coordination in order to eliminate gaps and overlaps and best use available personnel , time and resources.1 the 8-components approach , and variants of it adopted by some states,2,3 is an innovation that has enjoyed an impressive dissemination and adoption curve.4 this likely was facilitated by the decision of cdc 's division of adolescent and school health to embrace the model.4 cdc , in collaboration with other organizations including the american school health association ( asha ) , implemented a number of actions in support of this new approach .
for example , cdc funded development of a book , health is academic : a guide to coordinated school health programs,5 that provided a broad delineation of csh and its components along with state and local dissemination strategies .
in addition , cdc issued cooperative agreements to national organizations and state education agencies for the purpose of developing and disseminating policies and programs in support of csh.6,7 in 1992 , 5 state education agencies were initially selected to implement csh infrastructure such as funding and authorization , personnel and organizational placement , communication and linkages , and resources8 internally and with their sister state health agency over 5 years ; under this agreement , a csh coordinator position was funded in both the state - level education and health agencies and a health education specialist was funded in the education agency .
their collective charge was to organize the analogous 8 csh components between their respective agencies and , then , to instigate csh adoption in local education agencies / school districts via technical assistance and training.8 in the late 1990s , cdc shifted the funding focus to encourage education agencies at both the state and local levels to achieve specific health - related outcomes such as increased physical activity , improved nutrition , prevention of tobacco use , and reduction in sexual risk behaviors through use of the csh approach . to date , cdc continues to support the tenets of csh , now incorporated into the wscc model , as a foundation for improving health outcomes of students in schools .
along with the publication of the book health is academic,5 documents from the american cancer society emerged to provide detailed guidance for implementing the essential structures of csh including employment of a health coordinator,9 and differentiation of a system - wide csh coordinating council10 from school building - level csh teams .
thereafter , the american cancer society , with funding from cdc , conducted 2 sequential 18-month long school health coordinator leadership institutes designed to assist school districts ' adoption and implementation of csh.11 the initial institute was inaugurated in 1999 for 50 participants from across the united states ; these participants subsequently were expected to assume the role of csh coordinator in their respective school districts .
the second institute involved teams from 6 large urban school districts that enrolled hundreds of thousands of pre - k12 students .
thereafter , the csh leadership institute model was replicated regionally by cdc - funded state education agencies , sometimes in collaboration with american cancer society affiliates , in the us northeast , mid - atlantic , midwest , and southwest regions plus california .
this strategy of supporting school district coordinators and teams to implement csh was shown to be effective.1216 in addition , the american cancer society has worked with cdc in more recent years to provide csh - related trainings to professionals teaching in higher education so that they can better prepare their students for teaching school health .
ascd 's initial foray into csh occurred in 2003 when the robert wood johnson foundation provided funding to develop a tool that educators could use to assess the status of csh in schools . following an extended development process that involved an expert panel review and conferences followed by field testing,15,16
the assessment tool was published as an ascd book entitled creating a healthy school using the healthy school report card.16 thereafter , the tool was used in several leadership institute replications,12,15,17 a canadian version was disseminated,18 and an extensive evaluation was conducted at 11 funded schools in both the united states and canada .
this evaluation , for the first time , documented the participation of the school principal as essential to successful csh implementation.19,20 these activities aligned and supported ascd 's subsequent development of a whole child approach launched in 2006 . in 2006 , ascd convened the commission on the whole child .
this commission was composed of leading thinkers , researchers , and practitioners all drawn from a wide variety of sectors and was charged with recasting the definition of a successful learner from one whose achievement is measured solely by academic tests , to one who is knowledgeable , emotionally and physically healthy , civically inspired , engaged in the arts , prepared for work and economic self - sufficiency , and ready for the world beyond formal schooling .
the commission was convened to start a dialogue to change what is meant by a successful school , a successful education , and ultimately a successful student .
it was a discussion directly aimed at the current educational landscape of 2007dominated by the no child left behind act of 2001which was moving the nation toward an ever greater focus on an academics - above - all - else educational system .
it asked how resources , both personnel and facilities , would be arranged if the child was key in the equation . in 2007 , dr gene r. carter , executive director of ascd , summed this up as follows : if decisions about education policy and practice started by asking what works for the child , how would resources time , space , and human be arrayed to ensure each child 's success ?
if the student were truly at the center of the system , what could we achieve?21 the whole child initiative was borne out of this discussion and this commission .
it established 5 tenets which provide the framework for what a well - rounded , holistic , and effective education must focus upon , ensuring that each child , in each school , and in each community , is healthy , safe , engaged , supported , and challenged .
the tenets refer directly back to abraham maslow 's hierarchy of needs which was set out in the 1943 paper , a theory of human motivation.22 the original hierarchy established the foundational or base needs ( physiological ) at the bottom of the pyramid , followed subsequently by safety , love , and belongingness , esteem , and self - actualization .
it established , via its pyramid structure , the understanding that achieving certain needs was possible only after others had been met .
based on this structure , the whole child tenets were arranged to demonstrate that health and then safety were fundamental in establishing environments in which students truly can be engaged , supported , and , ultimately , challenged . by focusing initial attention on healthy , the whole child initiative actively promoted the role of school health services and health - promoting entities in the school and community .
it shined a light on the imperative need for schools to consider not just the academic outcomes of the students but their health and well - being , as well , both as ways of improving educational outcomes and for fostering the holistic development of the individual child beyond the academic .
it proposed that districts and schools place additional initial attention on the environment in which learning takes place before embarking directly upon that learning .
again , the whole child initiative was borne out of an understanding that students can not learn if they are not healthy and safe , and subsequently , will not learn if they are not engaged , supported , and challenged . in 2013 ,
ascd and cdc jointly convened a group of leaders in school health , education , and public health .
strengthen a unified and collaborative approach to learning and health23 building off the valuable tenets of both the whole child initiative , which was often viewed as primarily education - focused , and the csh approach , which was often viewed as primarily health - focused.23 the result was the whole school , whole community , whole child model the next iteration in the evolution of these 2 conceptual approaches merged into 1 unified framework .
the use of csh and whole child approaches over time has provided many lessons learned .
csh , from its inception , has provided education and health professionals with a well - planned and easily understood framework for addressing the health - related aspects of the whole child . in the original model presented by allensworth and kolbe , 8 program components of csh stretched across a variety of student needs , and outcomes reflected in the model extended beyond health behaviors to include outcomes related to cognitive performance and educational achievement , both of which are linked to health.1 the innovation of the model was that it brought to the forefront the interplay between varied aspects of health and related school activities , and highlighted the interdependence of each component with the others .
the csh model provides a framework for conceptualizing interventions to address a wide spectrum of students ' needs that are often foundational for both students ' health and ability to learn in school .
csh is not simply a framework to inform and support implementation of health - related interventions ; research indicates that interventions conducted in the context csh can be successful . to date , most research has investigated either health education or health promotion interventions that focus on key topics within the csh model such as physical education or nutrition education2427 or use of csh processes and structures to bring about improvements in policies , programs , or partnerships.12,15,28,29 researchers have found evidence of effectiveness among several more narrowly focused programs implemented in the context of csh , including programs for physical activity,25 nutrition,26 and childhood obesity.24,27 the literature also contains several examples of csh approaches and related infrastructure facilitating success in the implementation of program activities.15,24,29 in addition , researchers have provided some support for an association between csh programs and outcomes related to academic achievement.30,31 one challenge for csh is that although csh provides a framework for addressing multiple aspects of children 's health , research , and evaluation activities that address student - level health and academic outcomes have rarely reflected the comprehensive nature of csh .
this may be part of the reason that , even as far back as 1998 , leaders in school health described csh as a program for which the promise thus far outshines its practice.5 much of the research on outcomes and effect of csh has been among the more narrowly defined programs situated within the context of csh , as described above .
similarly , researchers have commented about the challenges of sustainability and resulting change from such narrowly focused and more programmatic - oriented approaches to csh.19 in a 2015 publication , valois et al discuss limitations of mere programmatic change and suggest that , instead , health and school improvement efforts can be enhanced and better sustained when they are founded on systemic changes within schools.20 likewise , cdc has recently explored csh through the perspective of a systemic framework in an attempt to better understand what makes the strongest programs successful.32 ultimately , schools are the domain of education and , as such , any initiative must have educational benefit to be successfully implemented and must be aligned to processes in the existing educational setting .
one challenge for csh has been that viewing it as a health initiative , focused on health for health 's sake only , has not required health and well - being to be conceptualized as a core component of an effective school and an effective educational system .
each benefits from the other.33,34 it is why in 2002 the then director of cdc 's division of adolescent school health , lloyd kolbe wrote , in sum , if american schools do not coordinate and modernize their school health programs as a critical part of educational reform , our children will continue to benefit at the margins from a wide disarray of otherwise unrelated , if not underdeveloped , efforts to improve interdependent education , health , and social outcomes .
and , we will forfeit one of the most appropriate and powerful means available to improve student performance.35 fortunately , several key lessons from csh suggest ways in which csh and related whole child approaches can be positioned in school settings . across the literature on csh , one of the key lessons to emerge is the critical nature of infrastructure within the school and district to support health - related activities . although infrastructure may vary from school to school and district to district
, a few standard infrastructure recommendations for supporting csh implementation have included the presence of a school health coordinator , a district - level school health advisory or coordinating council , and school - level health teams or committees.3641 district - level and school - level councils / teams typically include school or district representatives from all 8 components of csh as well as community members , parents , and students .
these teams , with leadership and guidance from a school health coordinator , are typically responsible for coordination between the 8 csh components and implementing activities to improve health within schools.38 once this infrastructure is in place , the use of a systematic assessment and planning process can help coordinators and councils / teams identify their school or district 's specific health - related needs , prioritize those needs , and develop plans to effectively address them .
this assessment and planning process can take several different forms : some councils / teams structure this around use of the school health index42 or the healthy school report card.16,18 regardless of the tool or format used , this process can be most effective when it is data - driven and includes defining priorities , assessing existing and available resources , developing clear and measurable goals and objectives , and developing an action plan with a timeline for reaching those goals and objectives.38,39 in addition to having key infrastructure in place , the importance of having strong leaders / champions40,43 and administrative support and buy - in38 is well supported by the literature about csh.4,37,43 leaders and champions , from both within and outside of schools , can build support for csh in ways that allow its proponents to overcome challenges and barriers that might otherwise impede progress.40 in particular , one recent study conducted for and released by ascd found that leadership from school principals was critical for bringing about meaningful change in schools.19,20 administrative support and buy - in are critical for ensuring sustained commitment to csh and health - related goals .
this support may be evidenced by incorporation of health - related goals into vision and mission statements and/or school improvement plans , assignment of staff to oversee school health , and allocation of resources to address health - related needs .
the role of leadership and integration into school improvement plans is further articulated in a 2011 report from ascd that described findings from its work in integrating a whole child approach with a focus on health and well - being into the systems and functions of the school.19 the report summarized key actions schools had undertaken to ensure integration and sustainability , and as a result , identified 9 levers that mobilized change in school communities : ( 1 ) the principal as leader ; ( 2 ) active and engaged leadership ; ( 3 ) distributive leadership ; ( 4 ) integration with the school improvement plan ; ( 5 ) effective use of data for continuous school improvement ; ( 6 ) ongoing and embedded professional development ; ( 7 ) authentic and mutually beneficial community collaborations ; ( 8) stakeholder support of the local efforts ; ( 9 ) the creation or modification of school policy related to the process.19,20 of these 9 levers , 2 appeared particularly influential the principal as leader and integration with the school improvement plan .
these were particularly important for initiatives , especially ones that may at first glance be viewed as superfluous to the school 's primary mission , to be successfully implemented and sustained .
the commonality across these 2 levers is that they establish an educational rationale to the process and the initiative .
having tangible acceptance , commitment , and active engagement of the principal as seminal to any health - related improvement initiative allows the school , staff , students , and families to view that initiative as educationally beneficial .
subsequently they are more accepting and open to seeing the connections between health , well - being , safety , connectedness , and pedagogy ; and any changes or adaptations related to the initiative are more likely to be integrated into the broader policies affecting the school . by integrating the initiative or
focus with the school improvement plan , one additionally aligns it to effective education and pedagogy , thereby allowing the initiative to become a key part of what the administration and its teachers discuss and target annually , and the initiative becomes further integrated into adjunct policies .
the school improvement plan provides the direction for and purpose of the school , as well as the implementation pathway.19,20 a whole child approach to education one which seeks to ensure that each child is healthy , safe , engaged , supported , and challenged appreciates that ,
children do not develop and learn in isolation , but rather grow physically , socially , emotionally , ethically , expressively , and intellectually within networks of families , schools , neighborhoods , communities , and our larger society.21 initiatives to help address these aspects of growth , whether framed as whole child or csh initiatives , can best gain footing when those initiatives are aligned with the purpose of the school its mission , policies , and pedagogy .
finally , from years of research and practice in csh and a whole child approach , the vital role of the community has emerged . in a whole child approach ,
authentic and mutually beneficial community collaborations have been identified as a key lever of shifting a school 's culture,19 and in csh , it has become clear that community assets can be a lifeline for csh activities . furthermore , csh offers a framework by which a school or district can harness community assets .
as other researchers have previously suggested , the csh approach may be best explained and understood in the context of an ecological framework,4,40 which can help account for the context and influence of community on health . with the integration of community members as stakeholders and participants in district - level councils and school - level teams , csh structures and processes
offer a natural opportunity for community organization and community building that can help make key community resources available to students and staff and can strengthen the overall community at the same time .
although the appreciation of what constitutes an effective education is changing and has changed since both the introduction of no child left behind44 and , somewhat coincidentally with the introduction of the whole child initiative , there is still and likely always will be a necessity to link any new initiative back to the processes and functions of the school and its educational outcomes whether these be academic , cognitive , or developmental . as other researchers have suggested , shifting the language and framing of csh and a whole child approach to reflect more of a general school - improvement focus , one that can meet the needs of the whole child and resonate with both educators and community members outside of the health profession , may enable health professionals to better achieve the goal of healthy students.19,45 in a 2010 article , hoyle et al went so far as to say insistence on alignment of programs under the
health banner is detrimental to the purpose and mission of both school health and school improvement.45 instead , they suggested that school health professionals could offer knowledge and skills in the processes of developing , implementing , and evaluating health - related interventions.45 these processes , implemented through the foundational infrastructure components used to support csh and seen in the 9 levers explored through the whole child approach , can facilitate improvement in a variety of student outcomes , including those related to health .
the initial 8-component model of the csh approach was first introduced in 1987then termed comprehensive school healthvia a special issue of the journal of school health.1 previously , school health was conceptualized as a 3-legged stool comprised of health education , health services , and the healthy school environment.1 csh involved both implementation of programs and services within 8 high - quality components and systemic coordination in order to eliminate gaps and overlaps and best use available personnel , time and resources.1 the 8-components approach , and variants of it adopted by some states,2,3 is an innovation that has enjoyed an impressive dissemination and adoption curve.4 this likely was facilitated by the decision of cdc 's division of adolescent and school health to embrace the model.4 cdc , in collaboration with other organizations including the american school health association ( asha ) , implemented a number of actions in support of this new approach .
for example , cdc funded development of a book , health is academic : a guide to coordinated school health programs,5 that provided a broad delineation of csh and its components along with state and local dissemination strategies .
in addition , cdc issued cooperative agreements to national organizations and state education agencies for the purpose of developing and disseminating policies and programs in support of csh.6,7 in 1992 , 5 state education agencies were initially selected to implement csh infrastructure such as funding and authorization , personnel and organizational placement , communication and linkages , and resources8 internally and with their sister state health agency over 5 years ; under this agreement , a csh coordinator position was funded in both the state - level education and health agencies and a health education specialist was funded in the education agency .
their collective charge was to organize the analogous 8 csh components between their respective agencies and , then , to instigate csh adoption in local education agencies / school districts via technical assistance and training.8 in the late 1990s , cdc shifted the funding focus to encourage education agencies at both the state and local levels to achieve specific health - related outcomes such as increased physical activity , improved nutrition , prevention of tobacco use , and reduction in sexual risk behaviors through use of the csh approach . to date , cdc continues to support the tenets of csh , now incorporated into the wscc model , as a foundation for improving health outcomes of students in schools .
along with the publication of the book health is academic,5 documents from the american cancer society emerged to provide detailed guidance for implementing the essential structures of csh including employment of a health coordinator,9 and differentiation of a system - wide csh coordinating council10 from school building - level csh teams .
thereafter , the american cancer society , with funding from cdc , conducted 2 sequential 18-month long school health coordinator leadership institutes designed to assist school districts ' adoption and implementation of csh.11 the initial institute was inaugurated in 1999 for 50 participants from across the united states ; these participants subsequently were expected to assume the role of csh coordinator in their respective school districts .
the second institute involved teams from 6 large urban school districts that enrolled hundreds of thousands of pre - k12 students .
thereafter , the csh leadership institute model was replicated regionally by cdc - funded state education agencies , sometimes in collaboration with american cancer society affiliates , in the us northeast , mid - atlantic , midwest , and southwest regions plus california .
this strategy of supporting school district coordinators and teams to implement csh was shown to be effective.1216 in addition , the american cancer society has worked with cdc in more recent years to provide csh - related trainings to professionals teaching in higher education so that they can better prepare their students for teaching school health .
ascd 's initial foray into csh occurred in 2003 when the robert wood johnson foundation provided funding to develop a tool that educators could use to assess the status of csh in schools . following an extended development process that involved an expert panel review and conferences followed by field testing,15,16
the assessment tool was published as an ascd book entitled creating a healthy school using the healthy school report card.16 thereafter , the tool was used in several leadership institute replications,12,15,17 a canadian version was disseminated,18 and an extensive evaluation was conducted at 11 funded schools in both the united states and canada .
this evaluation , for the first time , documented the participation of the school principal as essential to successful csh implementation.19,20 these activities aligned and supported ascd 's subsequent development of a whole child approach launched in 2006 .
this commission was composed of leading thinkers , researchers , and practitioners all drawn from a wide variety of sectors and was charged with recasting the definition of a successful learner from one whose achievement is measured solely by academic tests , to one who is knowledgeable , emotionally and physically healthy , civically inspired , engaged in the arts , prepared for work and economic self - sufficiency , and ready for the world beyond formal schooling . the commission was convened to start a dialogue to change what is meant by a successful school , a successful education , and ultimately a successful student .
it was a discussion directly aimed at the current educational landscape of 2007dominated by the no child left behind act of 2001which was moving the nation toward an ever greater focus on an academics - above - all - else educational system .
it asked how resources , both personnel and facilities , would be arranged if the child was key in the equation . in 2007 ,
dr gene r. carter , executive director of ascd , summed this up as follows : if decisions about education policy and practice started by asking what works for the child , how would resources time , space , and human be arrayed to ensure each child 's success ?
if the student were truly at the center of the system , what could we achieve?21 the whole child initiative was borne out of this discussion and this commission .
it established 5 tenets which provide the framework for what a well - rounded , holistic , and effective education must focus upon , ensuring that each child , in each school , and in each community , is healthy , safe , engaged , supported , and challenged .
the tenets refer directly back to abraham maslow 's hierarchy of needs which was set out in the 1943 paper , a theory of human motivation.22 the original hierarchy established the foundational or base needs ( physiological ) at the bottom of the pyramid , followed subsequently by safety , love , and belongingness , esteem , and self - actualization .
it established , via its pyramid structure , the understanding that achieving certain needs was possible only after others had been met .
based on this structure , the whole child tenets were arranged to demonstrate that health and then safety were fundamental in establishing environments in which students truly can be engaged , supported , and , ultimately , challenged . by focusing initial attention on healthy , the whole child initiative actively promoted the role of school health services and health - promoting entities in the school and community .
it shined a light on the imperative need for schools to consider not just the academic outcomes of the students but their health and well - being , as well , both as ways of improving educational outcomes and for fostering the holistic development of the individual child beyond the academic .
it proposed that districts and schools place additional initial attention on the environment in which learning takes place before embarking directly upon that learning .
again , the whole child initiative was borne out of an understanding that students can not learn if they are not healthy and safe , and subsequently , will not learn if they are not engaged , supported , and challenged .
in 2013 , ascd and cdc jointly convened a group of leaders in school health , education , and public health .
strengthen a unified and collaborative approach to learning and health23 building off the valuable tenets of both the whole child initiative , which was often viewed as primarily education - focused , and the csh approach , which was often viewed as primarily health - focused.23 the result was the whole school , whole community , whole child model the next iteration in the evolution of these 2 conceptual approaches merged into 1 unified framework .
the use of csh and whole child approaches over time has provided many lessons learned .
csh , from its inception , has provided education and health professionals with a well - planned and easily understood framework for addressing the health - related aspects of the whole child . in the original model presented by allensworth and kolbe , 8 program components of csh stretched across a variety of student needs , and outcomes reflected in the model extended beyond health behaviors to include outcomes related to cognitive performance and educational achievement , both of which are linked to health.1 the innovation of the model was that it brought to the forefront the interplay between varied aspects of health and related school activities , and highlighted the interdependence of each component with the others .
the csh model provides a framework for conceptualizing interventions to address a wide spectrum of students ' needs that are often foundational for both students ' health and ability to learn in school .
csh is not simply a framework to inform and support implementation of health - related interventions ; research indicates that interventions conducted in the context csh can be successful . to date , most research has investigated either health education or health promotion interventions that focus on key topics within the csh model such as physical education or nutrition education2427 or use of csh processes and structures to bring about improvements in policies , programs , or partnerships.12,15,28,29 researchers have found evidence of effectiveness among several more narrowly focused programs implemented in the context of csh , including programs for physical activity,25 nutrition,26 and childhood obesity.24,27 the literature also contains several examples of csh approaches and related infrastructure facilitating success in the implementation of program activities.15,24,29 in addition , researchers have provided some support for an association between csh programs and outcomes related to academic achievement.30,31 one challenge for csh is that although csh provides a framework for addressing multiple aspects of children 's health , research , and evaluation activities that address student - level health and academic outcomes have rarely reflected the comprehensive nature of csh .
this may be part of the reason that , even as far back as 1998 , leaders in school health described csh as a program for which the promise thus far outshines its practice.5 much of the research on outcomes and effect of csh has been among the more narrowly defined programs situated within the context of csh , as described above .
similarly , researchers have commented about the challenges of sustainability and resulting change from such narrowly focused and more programmatic - oriented approaches to csh.19 in a 2015 publication , valois et al discuss limitations of mere programmatic change and suggest that , instead , health and school improvement efforts can be enhanced and better sustained when they are founded on systemic changes within schools.20 likewise , cdc has recently explored csh through the perspective of a systemic framework in an attempt to better understand what makes the strongest programs successful.32 ultimately , schools are the domain of education and , as such , any initiative must have educational benefit to be successfully implemented and must be aligned to processes in the existing educational setting .
one challenge for csh has been that viewing it as a health initiative , focused on health for health 's sake only , has not required health and well - being to be conceptualized as a core component of an effective school and an effective educational system .
each benefits from the other.33,34 it is why in 2002 the then director of cdc 's division of adolescent school health , lloyd kolbe wrote , in sum , if american schools do not coordinate and modernize their school health programs as a critical part of educational reform , our children will continue to benefit at the margins from a wide disarray of otherwise unrelated , if not underdeveloped , efforts to improve interdependent education , health , and social outcomes . and
, we will forfeit one of the most appropriate and powerful means available to improve student performance.35 fortunately , several key lessons from csh suggest ways in which csh and related whole child approaches can be positioned in school settings . across the literature on csh , one of the key lessons to emerge is the critical nature of infrastructure within the school and district to support health - related activities . although infrastructure may vary from school to school and district to district , a few standard infrastructure recommendations for supporting csh implementation have included the presence of a school health coordinator , a district - level school health advisory or coordinating council , and school - level health teams or committees.3641 district - level and school - level councils / teams typically include school or district representatives from all 8 components of csh as well as community members , parents , and students .
these teams , with leadership and guidance from a school health coordinator , are typically responsible for coordination between the 8 csh components and implementing activities to improve health within schools.38 once this infrastructure is in place , the use of a systematic assessment and planning process can help coordinators and councils / teams identify their school or district 's specific health - related needs , prioritize those needs , and develop plans to effectively address them .
this assessment and planning process can take several different forms : some councils / teams structure this around use of the school health index42 or the healthy school report card.16,18 regardless of the tool or format used , this process can be most effective when it is data - driven and includes defining priorities , assessing existing and available resources , developing clear and measurable goals and objectives , and developing an action plan with a timeline for reaching those goals and objectives.38,39 in addition to having key infrastructure in place , the importance of having strong leaders / champions40,43 and administrative support and buy - in38 is well supported by the literature about csh.4,37,43 leaders and champions , from both within and outside of schools , can build support for csh in ways that allow its proponents to overcome challenges and barriers that might otherwise impede progress.40 in particular , one recent study conducted for and released by ascd found that leadership from school principals was critical for bringing about meaningful change in schools.19,20 administrative support and buy - in are critical for ensuring sustained commitment to csh and health - related goals .
this support may be evidenced by incorporation of health - related goals into vision and mission statements and/or school improvement plans , assignment of staff to oversee school health , and allocation of resources to address health - related needs .
the role of leadership and integration into school improvement plans is further articulated in a 2011 report from ascd that described findings from its work in integrating a whole child approach with a focus on health and well - being into the systems and functions of the school.19 the report summarized key actions schools had undertaken to ensure integration and sustainability , and as a result , identified 9 levers that mobilized change in school communities : ( 1 ) the principal as leader ; ( 2 ) active and engaged leadership ; ( 3 ) distributive leadership ; ( 4 ) integration with the school improvement plan ; ( 5 ) effective use of data for continuous school improvement ; ( 6 ) ongoing and embedded professional development ; ( 7 ) authentic and mutually beneficial community collaborations ; ( 8) stakeholder support of the local efforts ; ( 9 ) the creation or modification of school policy related to the process.19,20 of these 9 levers , 2 appeared particularly influential the principal as leader and integration with the school improvement plan .
these were particularly important for initiatives , especially ones that may at first glance be viewed as superfluous to the school 's primary mission , to be successfully implemented and sustained .
the commonality across these 2 levers is that they establish an educational rationale to the process and the initiative .
having tangible acceptance , commitment , and active engagement of the principal as seminal to any health - related improvement initiative allows the school , staff , students , and families to view that initiative as educationally beneficial .
subsequently they are more accepting and open to seeing the connections between health , well - being , safety , connectedness , and pedagogy ; and any changes or adaptations related to the initiative are more likely to be integrated into the broader policies affecting the school . by integrating the initiative or
focus with the school improvement plan , one additionally aligns it to effective education and pedagogy , thereby allowing the initiative to become a key part of what the administration and its teachers discuss and target annually , and the initiative becomes further integrated into adjunct policies .
the school improvement plan provides the direction for and purpose of the school , as well as the implementation pathway.19,20 a whole child approach to education one which seeks to ensure that each child is healthy , safe , engaged , supported , and challenged appreciates that ,
children do not develop and learn in isolation , but rather grow physically , socially , emotionally , ethically , expressively , and intellectually within networks of families , schools , neighborhoods , communities , and our larger society.21 initiatives to help address these aspects of growth , whether framed as whole child or csh initiatives , can best gain footing when those initiatives are aligned with the purpose of the school its mission , policies , and pedagogy .
finally , from years of research and practice in csh and a whole child approach , the vital role of the community has emerged . in a whole child approach ,
authentic and mutually beneficial community collaborations have been identified as a key lever of shifting a school 's culture,19 and in csh , it has become clear that community assets can be a lifeline for csh activities . furthermore , csh offers a framework by which a school or district can harness community assets .
as other researchers have previously suggested , the csh approach may be best explained and understood in the context of an ecological framework,4,40 which can help account for the context and influence of community on health . with the integration of community members as stakeholders and participants in district - level councils and school - level teams , csh structures and processes
offer a natural opportunity for community organization and community building that can help make key community resources available to students and staff and can strengthen the overall community at the same time .
although the appreciation of what constitutes an effective education is changing and has changed since both the introduction of no child left behind44 and , somewhat coincidentally with the introduction of the whole child initiative , there is still and likely always will be a necessity to link any new initiative back to the processes and functions of the school and its educational outcomes whether these be academic , cognitive , or developmental . as other researchers have suggested , shifting the language and framing of csh and a whole child approach to reflect more of a general school - improvement focus , one that can meet the needs of the whole child and resonate with both educators and community members outside of the health profession , may enable health professionals to better achieve the goal of healthy students.19,45 in a 2010 article , hoyle et al went so far as to say insistence on alignment of programs under the
health banner is detrimental to the purpose and mission of both school health and school improvement.45 instead , they suggested that school health professionals could offer knowledge and skills in the processes of developing , implementing , and evaluating health - related interventions.45 these processes , implemented through the foundational infrastructure components used to support csh and seen in the 9 levers explored through the whole child approach , can facilitate improvement in a variety of student outcomes , including those related to health .
for school and education agency staff to be motivated and able to successfully implement the csh and whole child tenants reflected in the wscc model , staff members likely need evidence - based suggestions for the implementation process and articulation of outcomes that can be reasonably expected . to provide this information ,
first , we recommend that researchers investigating csh and the whole child approach , as now reflected in the wscc model , continue to focus on the ecological aspects of the model , particularly the role of community .
school staff involved in csh programs have reported that the csh approach has helped their schools develop new partnerships within their communities,12,46 and these partnerships can be critical for meeting students ' needs .
this vital role of community is reflected in the new wscc model in both the community involvement component as well as the positioning of all of the other csh - based components within the context of community.23 to support school and district staff , we recommend school health experts consider developing tools and recommendations for how the wscc model can best be used to assess and harness community assets to enable schools to meet the needs of the whole child . such tools and recommendations developed using language that can resonate with a broad range of stakeholders including not only health professionals but also educators and community members as well could serve as valuable resources to school and district staff , particularly in an environment filled with more and more demands on fewer and fewer resources .
second , we recommend that researchers exploring the wscc model seek to provide additional insight into the how and not just the what of the model .
specifically , the traditional 8-component csh model and now the wscc model both provide a pragmatic visual representation of the different aspects of health that can be addressed through comprehensive approaches .
the wscc model takes this a step farther by presenting the role of coordinating policy , process , and practice visually within the model .
however , neither model is designed to provide school and health professionals with explanations of how to do that coordination .
although many professionals have sought to add to the how descriptions by delineating key infrastructure and processes used in csh,3641,47 future researchers and practitioners in school health can seek to provide additional information and tools to help articulate how such infrastructure pieces and key processes can be coordinated and implemented effectively . to the extent that the wscc model functions as a system connecting students , families , schools , and communities , the literature on systems change may offer insight into ways school health professionals can better articulate how the coordinated aspect of the model can be accomplished and strengthened .
finally , we recommend research be conducted about the wscc model as a whole , not simply individual components within the model , in order to assess the cumulative effect that can result from a comprehensive approach to addressing health and the whole child . in the last several decades
, researchers have gathered additional evidence to support the use of csh , and importantly , to begin to understand the structures and processes necessary to use csh effectively . what continues to remain largely missing from the scientific literature is a holistic examination of the full csh model that assesses a broad range of outcomes in 1 comprehensive evaluation .
in theory , the value of the csh model comes from the synergistic effect gained from coordinated interventions to address multiple aspects of co - occurring needs .
examining the new wscc model , inclusive of foundational csh concepts , through research that is longitudinal in nature and , ideally , designed to represent schools and communities of various sizes48 may provide researchers with the best opportunity to capture the full impact of the model 's value for improving the health and well - being of youth .
preparation of this paper did not include performing original research requiring inclusion of human subjects .
preparation of this paper did not include performing original research requiring inclusion of human subjects . | backgroundthe new whole school , whole community , whole child ( wscc ) model , designed to depict links between health and learning , is founded on concepts of coordinated school health ( csh ) and a whole child approach to education.methodsthe existing literature , including scientific articles and key publications from national agencies and organizations , was reviewed and synthesized to describe ( 1 ) the historical context for csh and a whole child approach , and ( 2 ) lessons learned from the implementation and evaluation of these approaches.resultsthe literature revealed that interventions conducted in the context of csh can improve health - related and academic outcomes , as well as policies , programs , or partnerships .
several structural elements and processes have proved useful for implementing csh and a whole child approach in schools , including use of school health coordinators , school - level and district - level councils or teams ; systematic assessment and planning ; strong leadership and administrative support , particularly from school principals ; integration of health - related goals into school improvement plans ; and strong community collaborations.conclusionslessons learned from years of experience with csh and the whole child approaches have applicability for developing a better understanding of the wscc model as well as maximizing and documenting its potential for impacting both health and education outcomes . |
this disease is endemic throughout central and south america , representing a major public health problem .
the disease is characterized by an acute phase with high parasitaemia and variable symptoms , including acute myocarditis , meningoencephalitis or generalized infection symptoms ( hepatosplenomegaly ) .
this is followed by a chronic phase that may remain asymptomatic during the whole life or develop into serious digestive or cardiac alterations , which are found in about 30% of infected individuals and may lead to dilated cardiomyopathy ( teixeira et al . ,
the disease is currently treated with benznidazole ( bzl ) ( n - benzyl-2-nitroimidazole acetamide ) , a drug known to reduce parasite burden during acute and early chronic infection ( coura , 2009 ) . during the chronic phase ,
the effect of bzl is more controversial , although some reports have shown that individuals treated with bzl and evaluated decades after the initial infection acquire significant protection from progression of heart pathology ( viotti et al . , 2006 ,
although bzl has been used in clinical settings , its mechanisms of action have not been fully elucidated yet ( maya et al . , 2007 ) .
however , several studies have suggested that bzl treatment should still be recommended at late phases of chagas disease to prevent progression , regardless of the lack of complete parasite clearance ( garcia et al . , 2005 ,
indeed , there is a general premise that etiological treatment contributes to reducing parasite load and rearranging the host immune response , leading to a balanced inflammatory response , which is crucial to control chagas disease morbidity ( garcia et al .
( 2015 ) have recently characterized the phagocytic capacity and cytokine profile of leukocytes from chagas disease patients in the indeterminate and cardiac phases , both before and one year after bzl treatment .
their findings highlighted that bzl treatment contributes to an overall immunomodulation in the indeterminate phase and induces a broad change of the immune response in patients in the cardiac phase , eliciting an intricate phenotypic / functional network compatible with beneficial and protective immunological events .
however , bzl contains a nitro group linked to an imidazole whereby unwanted side effects are common .
the most important adverse reactions observed with bzl are cutaneous reactions ( allergic dermatitis ) ( prez - molina et al . , 2009 ) , digestive intolerance , polyneuritis , bone marrow depression , toxic hepatitis ( viotti et al . , 2009 ) , peripheral neuropathy and angioedema ( miller et al . , 2015 ) .
these side effects , which force about 10% of patients to suspend the treatment , represent the main disadvantage of bzl treatment .
( 2012 ) showed that up to 26% of patients treated with bzl during the chronic phase develop skin reactions and that some show gastrointestinal ( 10% ) and/or neurological ( around 5% ) disorders .
nevertheless , the incidence of adverse reactions has been insufficiently reported , making it difficult to interpret the safety profile of bzl .
current evidence supports the treatment of adults without advanced cardiac disease or significant morbidity using either bzl or nifurtimox , the other drug available ( jackson et al . , 2010 ) .
nifurtimox is associated with gastrointestinal and neuropsychiatric side effects in nearly all patients , only half of whom can tolerate the full treatment course ( priotto et al . , 2009 ) .
bzl is better tolerated , but due to intermittent medication shortages and drug - induced rash including stevens johnson syndrome , many patients fail to complete the treatment .
although , as stated above , it has been proposed that bzl is usually better tolerated than nifurtimox , rojo et al .
( 2014 ) have recently reported about the controversial toxicity of both drugs . however , maya et al .
( 2007 ) found no significant adverse drug effects in a large series of patients treated with these drugs . upon infection ,
the parasite is able to invade and multiply within diverse cell types , including macrophages .
the acute phase of infection is characterized by the presence of parasites in the host bloodstream and diverse tissues . a crucial step in cardiomyopathy
these cells may either inhibit t. cruzi multiplication or provide a favourable environment in which it can divide and be disseminated to other sites within the body ( tanowitz et al .
besides , there is substantial evidence showing that cardiac tissue , an important target of t. cruzi infection , produces marked amounts of pro - inflammatory cytokines , chemokines and enzymes , including inducible nitric oxide synthase ( nos2 ) and metalloproteinases , resulting in inflammation and cardiac remodelling in response to parasite infection ( penas et al . , 2013 ) .
in addition to its antiparasitic activity , bzl exerts immunomodulatory effects in macrophages stimulated with lipopolysaccharide ( lps ) and treated with a high concentration of bzl ( 1 mm ) ( piaggio et al . , 2001 ) .
these immunomodulatory effects of bzl have also been described in lps - challenged mice pre - treated with high doses of bzl , showing the ability of bzl to increase survival and decrease serum levels of il-6 and tnf- in c57bl/6 mice ( pascutti et al . , 2004 ) .
the fact that components of t. cruzi as glycosylphosphatidylinositol - anchored mucin - type glycoproteins and glycoinositolphospholipids through the toll - like receptors tlr2/tlr6 and tlr4 , respectively , induce proinflammatory cytokines ( junqueira et al . ,
2010 ) validates the use of lps in studies that explore the mechanism of action of bzl . in the present study
, we considered the administration of doses of bzl lower than those usually used in experimental models of t. cruzi infection , to evaluate its parasiticidal as well as immunomodulatory effects , to minimize the adverse side reactions that usually lead to cessation of therapy .
mice used in this study were bred and maintained in the animal facility at the instituto de investigaciones en microbiologa y parasitologa mdica , universidad de buenos aires conicet .
all procedures carried out with mice were approved by the institutional committee for the care and use of laboratory animals ( cicual , facultad de medicina de la universidad de buenos aires ) and are in accordance with guidelines of the argentinean national administration of medicines , food and medical technology ( anmat ) , argentinean national service of sanity and agrifoods quality ( senasa ) and also based on the us nih guide for the care and use of laboratory animals .
eight - weeks old balb / c male mice ( 7 per group ) were infected intraperitoneally with 500 bloodstream trypomastigotes of the lethal ra ( pantropic / reticulotropic ) strain of t. cruzi , ( dtu vi ) as previously described ( celentano and gonzlez cappa , 1993 , zingales et al . , 2009 ) .
pubchem compound database cid = 31593 ) , suspended in corn oil , was administered orally at 10 , 25 and 100 mg / kg / day , for 30 consecutive days .
the groups received the following treatments : group 1 = corn oil , group 2 = bzl 10 mg / kg / day , group 3 = bzl 25 mg / kg / day , group 4 = bzl 100 mg / kg / day , group 5 = uninfected , untreated .
treatment started soon after the detection of parasites in blood , which occurred at day 7 post - infection ( p.i . ) .
parasitaemia of infected untreated mice ( group 1 ) peaks between day 10 and 13 .
therefore , they were sacrificed at the time when they began to show signs of cachexia , since they did not survive after 15 days .
presence of parasites in blood was evaluated by microhematocrit method ( feilij et al . , 1983 ) .
parasitaemia was analysed using pizzi 's technique modified by brener ( 1962 ) every three to seven days , and survival was observed daily , until the end of the experiment .
hearts from t. cruzi infected untreated and benznidazole - treated infected mice ( 25 mg / kg / day ) , were fixed in formalin and embedded in paraffin .
six non - contiguous sections ( 5 m ) were cut and stained with haematoxylin - eosin .
cellular infiltrates and the presence of amastigote nests were examined using a nikon eclipse e600 microscope ( nikon inc . ) .
at least thirty random microscopic fields ( 400 ) were analysed in each microscopic section , using the open source image j software ( nih , usa ) .
the activity of ck as a marker heart injury was determined using commercially available assay kits according to manufacturer 's instructions ( wiener lab , rosario , argentina ) .
the kit relies on the reduction of nadp and the increase of absorbance measured at 340 nm .
one - to 3-day old neonatal outbred cf-1 strain mice were euthanized by decapitation after co2 exposure , and cardiomyocytes were obtained as previously described ( hovsepian et al . , 2013 ) .
bloodstream trypomastigotes were obtained by cardiac puncture , from euthanized 21-days old male cf-1 mice infected 7 days previously by intraperitoneal route with 1.0 10 trypomastigotes of ra strain of t. cruzi , as previously described ( gonzlez cappa et al .
briefly , blood diluted 1:5 in culture medium was centrifuged at 400 g at room temperature and then left at 37 c for 1 h in a water bath .
trypomastigotes in the supernatant were essentially devoid of blood cells and platelets according to microscopic examination .
cardiomyocytes were cultured at 37 c under 5% co2 atmosphere and infected at a 5:1 parasite : cell ratio in six well polystyrene plates .
after 3 h , the infected cultures were washed five times with fresh 1% fcs - dmem : m-199 medium to remove free parasites .
the infected cells were cultured for 48 h and then treated with 3 , 15 or 75 m of bzl , for 72 h. then , genomic dna ( gdna ) was obtained and parasitic load in cardiac cells was analysed by quantitative real - time pcr ( qpcr ) . cardiomyocytes in culture were pre - treated for 30 min with bzl 3 , 15 or 75 m and stimulated with lps ( 10 mg / l ) from escherichia coli o26:b6 ( sigma aldrich co ) for the indicated period of time .
mrna and protein extracts were obtained , and rt - qpcr , western blot and immunofluorescence analysis were performed ( see below ) .
total rna was obtained from heart tissue homogenates and from cultured cells using quickzol reagent ( kalium ) , treated with dnase ( life technologies ) and total rna was reversed transcribed using expand reverse transcriptase ( promega corporation ) , following the manufacturer 's instructions .
gdna was obtained from heart tissue or the cultured cells using phenol - chloroform extraction ( laird et al .
both qpcr and rt - qpcr were performed using 5x hot firepol evagreen qpcr ( solis biodyne ) in an applied biosystems 7500 sequence detector .
the parameters were : 52 c for 2 min , 95 c for 15 min , and 40 cycles of 95 c for 15 s , 60 c ( for nos2 , il-6 and 18s rrna ) or 57 c ( for il-1 ) for 30 s and 72 c for 1 min .
expression of 18s rrna was analysed in the samples in the same run for normalization .
quantification of parasite load in heart tissue or cultured cardiac cells was performed by qpcr with the primers tcz ( cummings and tarleton , 2003 , duffy et al . , 2009 ) .
these primers amplify a 146-bp sequence of the highly repetitive ( 10 repeats ) satellite genomic dna .
the high number of copies increases the sensitivity of the technique allowing the detection of less than 1 parasite / ml , which is defined as parasite equivalents .
quantification was calculated using the comparative threshold cycle ( ct ) method and efficiency of the rt reaction ( relative quantity , 2 ) .
the replicates were then averaged and fold induction was determined , considering the value at zero time as 1 ( schmittgen and livak , 2008 ) .
heart tissue ( 100 mg ) was homogenized with 300 l of buffer a ( see below ) , or cultured cells were washed with pbs and scraped off the dishes , with 50 l of the same buffer , and np-40 ( life technologies ) was added to reach 0.5% ( v / v ) .
after 15 min at 4 c , the tubes were gently vortexed for 10 s , and cytosolic extracts were collected by centrifugation at 13,000 g for 90 s. the supernatants were stored at 20 c ( cytosolic extracts ) , and heart pellets were resuspended in 100 l buffer a supplemented with 20% ( v / v ) glycerol and 0.4 m kcl , and mixed for 30 min at 4 c .
nuclear proteins were obtained by centrifugation at 13,000 g for 5 min , and aliquots of the supernatant ( nuclear extracts ) were stored at 80 c .
total protein extracts were obtained after washing the hearts with pbs and adding 300 l of ripa modified lysis buffer ( see below ) , or washing the cultured cells and scraped off the dishes with 50ul of the same buffer .
then , the tubes were kept on ice for 30 min with swirling and the samples were centrifuged at 7000 g at 4 c for 10 min . the supernatant was stored at 20 c .
protein concentrations of sera and protein extracts were determined by the bradford method using the bio - rad protein assay ( bio - rad , usa ) reagent and bovine serum albumin ( bsa ) ( sigma aldrich co. ) as a standard ( kruger , 1994 ) .
proteins extracts were boiled in laemmli sample buffer , and equal amounts of protein ( 50100 mg ) were separated by 812% sds page .
the gels were blotted onto a hybond - p membrane ( ge health - care , madrid , spain ) and incubated with the following antibodies : anti - nos2 , anti - ib- , anti - p65 ( santa cruz biotechnology , ca , usa ) , and anti--actin ( sigma aldrich co ) .
the blots were revealed by enhanced chemiluminescence ( ecl ) in an image quant 300 cabinet ( ge healthcare biosciences , usa ) following the manufacturer instructions .
band intensity was analysed using the image j software . to determine the amount of no released into the culture medium , nitrate
was reduced to nitrite and measured spectrophotometrically by the griess reaction ( bryan and grisham , 2007 , daz - guerra et al . , 1996 ) .
myocardial cells grown on round glass coverslips were fixed with methanol and blocked with 3% bsa in pbs .
the expression of ib and nos2 were determined by immunofluorescence . for this purpose , rabbit polyclonal igg anti - nos2 or igg anti - ib ( santa cruz biotechnology , ca , usa ) and fitc - labelled goat anti - rabbit igg ( sigma aldrich co ) , were used at 1:200 dilutions ( determined by titration ) .
at least 30 random microscopic fields ( 400 ) and 1000 cells per culture were acquired using a spot rt digital camera attached to an eclipse 600 fluorescence microscope ( nikon inc .
hbss : ( in g / l ) : 0.4 kcl , 0.06 kh2po4 , 8.0 nacl and 0.05 na2hpo4 , ph 7.4.hbss plus ( in g / l ) : hbss plus 0.14 cacl2 , 0.047 mgcl2 , 0.049 mgso4 , 0.35 nahco3 and 1.0 d - glucose , ph 7.40.buffer a : 10 mmol / l hepes ph = 7.90 , 1 mmol / l edta , 1 mmol / l egta , 10 mmol / l kcl , 1 mmol / l dtt , 0.5 mmol / l pmsf , 40 mg / l leupeptin , 2 mg / l tosyl - lysyl - chloromethane , 5 mmol / l naf , 1 mmol / l navo4 , 10 mmol / l na2moo4.ripa modified lysis buffer : 150 mm nacl , 50 mm tris hcl ( ph = 7.40 ) , 1% triton x-100 , 1 mm edta , 1 mm pmsf ; 2.5 g / l protease inhibitor cocktail ( sigma aldrich ) , 1 mm na3vo4 , 1 mm naf .
hbss : ( in g / l ) : 0.4 kcl , 0.06 kh2po4 , 8.0 nacl and 0.05 na2hpo4 , ph 7.4 .
hbss plus ( in g / l ) : hbss plus 0.14 cacl2 , 0.047 mgcl2 , 0.049 mgso4 , 0.35 nahco3 and 1.0 d - glucose , ph 7.40 .
buffer a : 10 mmol / l hepes ph = 7.90 , 1 mmol / l edta , 1 mmol / l egta , 10 mmol / l kcl , 1 mmol / l dtt , 0.5 mmol / l pmsf , 40 mg / l leupeptin , 2 mg / l tosyl - lysyl - chloromethane , 5 mmol / l naf , 1 mmol / l navo4 , 10 mmol / l na2moo4 .
hcl ( ph = 7.40 ) , 1% triton x-100 , 1 mm edta , 1 mm pmsf ; 2.5 g / l protease inhibitor cocktail ( sigma aldrich ) , 1 mm na3vo4 , 1 mm naf .
data are expressed as mean of 3 independent experiments sem for each treatment ( 7 mice or 5 culture replicates / group ) .
the kaplan meier method and mantel cox test were used to compare survival curves of the studied groups .
one - way anova was used to analyse the statistical significance of the differences observed between the infected , treated or untreated groups .
the dunnet post - hoc test was performed to compare treated groups against the control group ( t. cruzi or lps according to the experimental setting ) .
differences were considered statistically significant when p < 0.05 . all analyzes were performed using the prism 5.01 software ( graphpad , usa ) .
balb / c mice were infected with 500 trypomastigotes of the virulent and lethal ra t. cruzi strain by the intraperitoneal route to assess whether bzl has effective trypanocidal activity at concentrations lower than those usually used in experimental models ( 100 mg / kg / day ) .
the presence of parasites in blood , evaluated from day 5 post - infection ( p.i . ) by the microhematocrit method , became apparent on day 7 p.i .
( 0.0315 10 0.003 parasites / ml , n = 3 ) , with a maximum on day 13 ( 0.561 10 0.169 parasites / ml ,
different groups were daily treated with 10 mg / kg / day ( low dose ) , 25 mg / kg / day ( mid dose ) or 100 mg / kg / day ( high dose ) of bzl , respectively , from day 7 p.i .
treatment with 25 mg / kg / day of bzl was almost as effective in its trypanocidal action as the usual dose of 100 mg / kg / day on day 13 ( mid dose vs high dose , 0.094 0.020 vs 0.00 0.00 parasites / ml , n = 3 , p < 0.001 ) ( fig .
in contrast , the treatment with the low dose showed no antiparasitic effect on day 13 p.i .
( infected vs infected treated with low dose , 0.561 10 0.169 parasites vs 0.581 10 0.252 parasites / ml ,
a decrease in weight was observed in the infected untreated mice and mice treated with low - dose bzl in comparison with uninfected controls .
moreover , the body weight of mice treated with mid and high bzl doses remained unchanged throughout the study ( fig .
consistently with the increase of parasitaemia , infected untreated mice did not survive longer than day 15 p.i .
, whereas mice treated with 25 mg / kg / day of bzl had survival rates similar to those treated with 100 mg / kg / day ( fig .
given that the effects in reducing parasitaemia and maintaining survival of the dose of 25 mg / kg / day were similar to those of the dose of 100 mg / kg / day , we investigated the presence of parasites and inflammatory reaction in the heart . while t. cruzi - infected untreated mice showed significant numbers of amastigote nests in sinuses and ventricles , as well as inflammatory reaction associated with them , mice treated with 25 mg / kg / day showed neither inflammatory cells nor amastigote nests ( fig .
2a ) . to further confirm that t. cruzi - infected bzl - treated mice were devoid of parasites in the heart , qpcr using tcz primers was performed after gdna extraction from this tissue .
no gdna amplification was obtained in the hearts of mice treated with 25 mg / kg / day ( fig .
we measured changes in serum ck activity as a biochemical marker of heart injury upon infection . a significant increase in the level of ck activity on day 15 p.i .
was observed in infected mice in comparison with uninfected untreated control mice ( uninfected vs infected : 0.448 0.116 vs 1.368 0.149 , n = 3 , p < 0.0001 ) . moreover , 30 days after bzl treatment with 25 mg / kg / day , ck levels dropped to values found in control mice , suggesting that tissue injury was precluded by bzl ( 0.240 0.041 , n
previous studies have shown that bzl treatment modulates pro - inflammatory cytokines in vitro models of lps stimulation ( revelli et al . , 1999 , piaggio et al . , 2001 ) and
an in vivo model of sepsis ( pascutti et al . , 2004 ,
2011 ) . to determine whether bzl modulates inflammatory mediators in experimental acute chagas disease ,
t. cruzi - infected mice were treated with 25 mg / kg / day of bzl , the lowest antiparasitic dose .
the hearts of ra - infected mice expressed considerable amounts of il-1 mrna ( uninfected vs. infected , 0.725 0.275 vs 10.370 4.502 , n = 3 , p < 0.001 ) and il-6 mrna ( uninfected vs. infected , 0.849 0.301 vs 13.260 2.873 n = 3 , p < 0.0001 ) measured by rt - qpcr on day 15 p.i . , before death ( fig . 3a ) .
furthermore , infected mice treated with bzl for 30 days showed a marked decrease in the cardiac levels of both il-1 ( 0.690 0.136 , n
= 3 , p < 0.05 ) and il-6 ( 0.549 0.135 , n = 3 , p < 0.0001 ) mrna expression . fig .
3b shows that the same applied to nos2 mrna ( uninfected vs infected : 1.107 0.475 vs 4.369 0.845 ; infected treated : 1.052 0.202 , n = 3 , p < 0.05 ) and protein expression determined at the same times ( uninfected vs infected : 0.394 0.240 vs 1.718 0.406 ; infected treated : 0.690 0.104 , n
= 3 , p < 0.05 ) . to assess the parasiticidal effect of low concentrations of bzl in vitro , primary cardiomyocyte cultures were infected with t. cruzi at a 5:1 parasite : cell ratio and incubated with different concentrations of bzl for 72 h. fig .
4a shows that 75 m bzl significantly reduced the parasite load in comparison with untreated cells .
furthermore , treatment with 15 m bzl rendered the parasite load to almost negligible levels when measured as equivalent parasites per 50 ng total gdna by qpcr , in this period of time .
we found that cell viability was not affected by any of the concentrations of bzl tested ( fig .
we have previously described that t. cruzi infection produces an intense inflammatory response , which is critical for the control of the evolution of chagas disease . in this regard
, we determined the expression of typical inflammatory markers like nos2 with high levels of nitric oxide ( no ) or inflammatory cytokines like il-1 , il-6 and tnf in infected cardiomyocytes ( hovsepian et al .
other authors have previously reported the inhibitory effect of bzl on the production of nos2-dependent no by raw 264.7 macrophages at high concentrations ranging from 0.1 mm to 1 mm ( revelli et al . , 1999 ) . with the aim to dissociate the antiparasitic effect of bzl from its anti - inflammatory properties ,
the ability of the lowest doses of bzl to inhibit inflammatory mediators were assessed in cultured cardiomyocytes treated with bzl and stimulated with lps . when the cells were pre - incubated with 15 m bzl ( a concentration rendering parasite dna almost undetectable by qpcr ) and stimulated with 10 mg /
moreover , decreased il-1 and il-6 mrna levels were found after 4 h , as shown by rt - qpcr ( fig .
5c ) . to assess whether bzl inhibits inflammatory mediators through inhibition of the nf-b pathway , after an inflammatory stimulus
, cardiomyocyte cultures were pre - treated with bzl and incubated for 30 , 60 or 120 min with lps .
the specific inhibitor of this transcription factor , ib , as well as the p65-nf-b subunit , diminished in the cytoplasmic fraction after 30 min of lps incubation as assessed by western blot , confirming the activation of this pathway ( 0.111 0.006 and 0.403 0.029 respectively , n = 3 , p < 0.0001 ) . significantly ,
pre - treatment with 15 m bzl impaired both ib and p65 disappearance from the cytosolic fraction ( 0.650 0.028 and 0.971 0.064 respectively , n = 3 , p
this suggests that this trypanocidal drug exerts regulation through the nf-b pathway at a concentration lower than that previously reported ( piaggio et al . , 2001 ) .
detection of ib by immunofluorescence showed that it disappeared from the cytoplasm when nf-b was activated by lps .
moreover , ib levels were restored to values similar to those in unstimulated cells when cardiomyocytes were pre - treated with bzl before lps stimulation ( fig .
the current treatment for chagas disease with bzl is effective to cure the infection in the acute phase , limiting the incapacity and preventing morbidity and mortality ( rassi et al . , 2009 ,
however , this treatment has serious limitations , such as the side effects exhibited by some patients ( castro et al . , 2006 ) .
these include organic manifestations indicative of systemic toxicity such as allergic dermatitis , fever , vomiting , gastrointestinal syndromes , bone marrow depression and polyneuropathy .
all these symptoms are evident in the first days of treatment and represent a major threat of bzl in clinical use with frequent therapy discontinuation ( rodriques coura and de castro , 2002 , castro et al . , 2006 ,
thus , finding options to enhance the effectiveness of bzl and to decrease its adverse effects is very desirable , if we consider that this is the only antiparasitic treatment currently available in most countries . the effectiveness of different experimental protocols aiming to modify the dose of this antiparasitic drug has not been thoroughly tested
therefore , in the present study we proposed to test doses lower than normally used in experimental chagas disease treatment to determine the minimal effective dose .
we report for the first time that bzl has parasiticidal properties in vivo as well as in vitro at doses lower than those previously reported for a highly virulent t. cruzi strain . in addition ,
treatment with a lower dose of bzl was also able to inhibit the expression of inflammatory mediators and tissue inflammation .
our results show that , in mice infected with the ra strain of t. cruzi , the treatment with 25 mg / kg / day of bzl was as effective as 100 mg / kg / day , the therapeutic dose usually used to cure experimental chagas disease ( de andrade et al .
, 1996 , guedes et al . , 2011 , molina - berros et al . , 2013 )
this was reflected in the rate of survival after treatment , since no significant differences were observed between the experimental groups using both doses .
moreover , after treatment with low doses of bzl , mice regained the weight they had lost due to infection . an optimal dose of bzl ( 25 mg / kg / day ) was associated with the absence of inflammatory reaction and tissue parasite load as measured by qpcr . in this regard ,
( 2008 ) have previously reported for an experimental murine model , that serological and blood parasitological tests for t. cruzi are less sensitive than tissue qpcr .
thus , our results strongly suggest that this low - dose bzl treatment is able to clear t. cruzi from the infected host .
in contrast , other research groups argue that only the optimal dose of 100 mg / kg / day of bzl confers almost complete protection against death to infected mice ( toledo et al . , 2003 , assria fontes martins et al . , 2015 )
this study was carried out using the t. cruzi ra strain that belongs to dtu vi ( zingales et al . , 2009 ) .
this strain has a wide tissue tropism and is highly lethal for the mouse ( mirkin et al . , 1994 ) .
besides , susceptibility of this strain to benznidazole has been retained upon passage in outbred cf1 mice , since its isolation from a child with acute chagas disease , living in an endemic region of argentina ( gonzlez cappa et al . , 1981a ) .
its high lethality was a desired characteristic , since it allowed us to test the effectiveness of the parasiticidal treatment with benznidazole at the tested doses . in this
regard , as few as 500 parasites kill all mice in a short time period .
thus , in the present work we show that untreated mice or mice treated with the lowest dose , 10 mg / kg / day , succumb to infection . on the contrary , mice treated with 25 mg / kg / day for 30 days and tested 20 days after the end of the treatment , remained without detectable parasites in blood and heart , granting effective cure and leading to 100% survival , as the standard treatment scheme ( 100 mg / kg / day for 30 days ) .
thus , in the context of drug optimization we consider adequate and necessary to test the efficacy of lower doses , using a t. cruzi strain already known to be susceptible to the drug .
( 2013 ) found that treatment with 30 mg / kg / day resulted in the parasitological cure of balb / c mice infected with 500 bloodstream trypomastigotes with the non - lethal dm28c ( dtu i ) after 20 days treatment , beginning on day 2 post - infection .
it must be noted , however , that the advantage of our model is that the use of a lethal strain grants that , in case of inadequate treatment , mice will die . also , the fact that the treatment was effective even when it began after patent parasitaemia was detected ( day 7 post - infection ) , ensures that mice were actually infected which allowed the comparison in effectiveness between the different doses tested .
it may be argued that this study was carried out using only one parasite strain , belonging to a particular dtu .
this may raise issues regarding the effectiveness of such treatment in view of the feasible appearance of resistance to benznidazole in different strains .
it must be noted , however , that no evidence has been found so far , regarding the association between a particular dtu and resistance to benznidazole .
each dtu may include t. cruzi populations of varied resistance to this drug ( gruendling et al . , 2015 ) .
moreover , several studies have shown that resistance may arise at the clonal level if forced by selective drug pressure upon discontinuous treatment schemes in vivo ( dos santos et al . , 2008 ) , or upon continuous drug pressure in vitro ( mejia et al . , 2012 ) .
our results strongly suggest that emergence of parasite resistance was avoided with the reduced dose scheme , since no parasites were detected in blood and heart at least 20 days after treatment cessation . therefore , optimization of the treatment schedule is something that should be considered in the case of human chagas disease , as far as new trypanocidal drugs are not available ( alsford et al . , 2013 ) .
our results show that t. cruzi infection stimulates the inflammatory response in terms of il-1 and il-6 mrna expression and nos2 production in the mouse heart .
accordingly , we have previously described the onset of inflammatory response in mice infected with t. cruzi strains of different lethality ( penas et al . , 2013 ) and in neonatal cardiac cells stimulated with lps or infected with t. cruzi ( hovsepian et al .
the expression of inflammatory genes in the heart plays an essential role in organ dysfunction . in this regard
, it has been shown that nos2 is involved in the pathogenesis of cardiac diseases ( qian et al .
interestingly , in chagas disease , no has been described as a trypanocidal mediator ( muoz - fernndez et al . , 1992 ) .
however , it has also been suggested that excessive release of no by inflammatory cells would lead to heart failure ( massion et al . , 2003 ) . in this study
, we report for the first time that a low dose of bzl ( 25 mg / kg / day ) is able to inhibit the expression of proinflammatory cytokines and nos2 expression in a murine experimental model of t. cruzi infection .
consistently , reduction of ck activity , a typical marker of heart damage , was also observed . in this
regard , our results are in agreement with those previously reported by pereira et al .
the anti - inflammatory properties of this parasiticidal drug had been previously tested in different experimental models of sepsis or macrophages stimulated in culture , but not in an experimental model of chagas disease . in the liver of septic mice , bzl decreases the mrna and protein expression of tnf- and nos2 by inhibition of nf-b and mapk ( p-38 and erk ) ( piaggio et al . , 2001 , ronco et al . , 2011 ) provided evidence that bzl is able to specifically inhibit no production and cytokine release in raw 264.7 macrophages stimulated with lps and/or ifn-. moreover , in raw 264.7 macrophages stimulated with lps , manarin et al .
( 2010 ) determined that treatment with bzl inhibits ib phosphorylation and hence its degradation , but not ib kinase / phosphorylation , despite which , bzl behaves as a broad - range specific inhibitor of nf-b activation , independently of the stimuli tested .
since in those works high concentrations of bzl ( 1 mm ) were used in vitro , in the present work we decided to test the parasiticidal effect of bzl at lower doses in isolated cardiomyocytes in culture , infected with the ra strain of t. cruzi .
we determined that 15 m bzl was the optimal concentration to reduce the parasite load in infected cells as measured by qpcr .
this finding led us to study its anti - inflammatory properties knowing the optimal parasiticidal concentration . in this case , the test system involved stimulation of the cells with lps .
using this approach , we herein demonstrate that , in vitro , a concentration of bzl lower than that usually used inhibits il-1 and il-6 mrna levels in stimulated cardiomyocytes .
furthermore , 15 m bzl was able to inhibit nos2 expression and no release , in comparison to other studies showing that 1 mm bzl impaired lps induction of macrophage nos2 gene transcription ( piaggio et al . , 2001 , manarin et al . , 2010 ) .
( 1999 ) have also demonstrated that a high concentration of bzl down - regulates no and cytokines in macrophages stimulated with lps , suggesting that it may also alter the balance between pro- and anti - inflammatory responses .
thorough studies have been carried out in macrophages stimulated with lps and treated with 1 mm bzl to clarify the mechanism whereby the expression of nos2 and pro - inflammatory cytokines is inhibited ( piaggio et al . , 2001 ,
these studies have shown that inhibition of the nf-b pathway is responsible for the down - regulation of pro - inflammatory mediators .
our present results show that , in lps - stimulated cardiomyocytes , 15 m bzl also inhibited this pathway , demonstrating that the anti - inflammatory effects of this drug may be reached at a concentration lower than the one widely reported .
in conclusion , this study shows for the first time that optimal effects of bzl , in terms of parasite clearance from blood and heart tissue and reduction of inflammatory reaction , can be achieved at doses significantly lower than those usually used for the treatment in an experimental murine model using a highly virulent benznidazole - susceptible t. cruzi strain .
this finding may be a relevant for dose optimization in the treatment of acute human chagas disease .
this is especially true if one considers the number and varied severity of adverse effects generated by the use of bzl , which lead to the abandonment of treatment by a significant proportion of patients . | chagas disease , caused by trypanosoma cruzi , is the main cause of dilated cardiomyopathy in the americas .
antiparasitic treatment mostly relies on benznidazole ( bzl ) due to nifurtimox shortage or unavailability .
both induce adverse drug effects ( ade ) of varied severity in many patients , leading to treatment discontinuation or abandonment .
since dosage may influence ade , we aimed to assess bzl efficacy in terms of parasiticidal and anti - inflammatory activity , using doses lower than those previously reported .
balb / c mice infected with the t. cruzi ra strain were treated with different doses of bzl .
parasitaemia , mortality and weight change were assessed .
parasite load , tissue infiltrates and inflammatory mediators were studied in the heart .
serum creatine kinase ( ck ) activity was determined as a marker of heart damage .
the infection - independent anti - inflammatory properties of bzl were studied in an in vitro model of lps - treated cardiomyocyte culture .
treatment with 25 mg / kg / day bzl turned negative the parasitological parameters , induced a significant decrease in il-1 , il-6 and nos2 in the heart and ck activity in serum , to normal levels .
no mortality was observed in infected treated mice .
primary cultured cardiomyocytes treated with bzl showed that inflammatory mediators were reduced via inhibition of the nf-b pathway . a bzl dose lower than that previously reported for treatment of experimental chagas disease exerts adequate antiparasitic and anti - inflammatory effects leading to parasite clearance and tissue healing .
this may be relevant to reassess the dose currently used for the treatment of human chagas disease , aiming to minimize ade . |
the manipulation of electrical surface charge in a rapid and reversible manner is of great importance for a wide variety of biosensing applications , since electrostatic interactions influence the affinity and residence time of biological molecules in the sensing zone .
charge manipulation in nanoscale sensors , such as nanopores , nanochannels and nanotubes , is particularly useful because of the scale of these devices .
solid - state nanopores are a prototypical class of nanoscale sensors , employing electrophoretic forces to thread and translocate charged single nucleic acids or proteins through a nanoscale aperture in an ultrathin membrane
. nanopore surface charge can affect its direct , coulombic interactions with charged biomolecules , and can indirectly influence sensing by generating electro - osmotic flow .
this net flow can modulate molecular capture rate and molecular residence time in the sensing vicinity via hydrodynamic drag .
this effect has previously been characterized using optical tweezers and by varying the nanopore s zeta potential by changing the solution s ph . the ability to modulate the surface charge of a nanopore and , consequently , the associated electro - osmotic flow could allow control of biomolecule translocation speed .
this could in turn lead to the development of advanced single molecule , low - cost characterization techniques for a broad spectrum of clinical samples , including genomic dna , rnas and proteins .
this challenge must be met without compromising the ability of the sensor to probe extremely dilute analytes in a reasonable time frame .
recent efforts towards this goal have primarily involved the fabrication of metallic electrodes at the nanopore surface to induce an electrical field . yet to date , there has been no experimental report of in situ , opto - electrical manipulation of high - density surface charge in nanopores or other nanoscale sensors .
we show here that an off - the - shelf , low - power visible laser beam can be used to directly manipulate the surface charge of a solid - state nanopore .
first , it allows the translocation speed of dna to be tuned without chemically modifying the nanopore surfaces or altering the buffer properties .
second , it can be used to reliably unblock clogged nanopores , keeping them functional over prolonged periods of time .
third , it permits the detection of extremely low molecular weight proteins , which otherwise are nearly invisible to the resistive pulse sensing technique .
a silicon nitride membrane containing a single nanopore was scanned in a custom - made confocal microscope with a tightly - focused green laser ( 532 nm ) , as illustrated in figure 1a .
the continuously recorded ionic current ( i ) flowing through the pore at a fixed voltage reveals an increase when the laser spot overlaps with the nanopore location .
figure 1b illustrates this effect with an intensity surface plot of the ionic current i flowing through this pore as a function of laser spot position . a line scan through
the image reveals a clear symmetric peak in the ionic current , more than double the baseline current level ( fwhm ~500 nm , right panel ) .
this effect is evident in all tested pores ( 4 - 20 nm diameter ) even for laser powers of just a few mw .
although a tightly focused ir laser at high power ( ~1 w ) can produce a small increase in current by locally heating the solution , laser - induced heating can be ruled out here for two reasons : the electromagnetic absorption of water at 532 nm is extremely small , and the laser powers used in our experiments are only a few mw .
a temperature increase of ~35k would be required to produce the observed increase in i , yet heating is estimated to account for a mere 0.005k per mw of focused light based on measurements performed at 800 nm . we thus conclude that direct interaction of light with silicon nitride must cause this increase in the ion current via a photo - conductive effect .
permanent nanopore blocking by small molecules , tiny air bubbles , or other nanoscale particulates is a common limitation for nanopore sensors , severely reducing their functional lifetime . in some cases ,
a series of electrical pulses clears the pore , but often the system must be disassembled and re - cleaned .
we find that in many of these cases a short exposure to a ~5 mw focused laser beam will immediately clear the nanopore .
figure 1c ( left ) shows a raster scan ( bottom left to top right ) of a fully blocked nanopore ( i 0 at v = + 300 or 300 mv ) .
as soon as the laser beam reaches the nanopore location , the pore is cleared .
this is shown chronologically ( figure 1c , right ) as a time trace of i during the laser scan .
we have found that light - induced nanopore unblocking is a highly robust and efficient tool to extend the functional lifetime of solid - state nanopores from a few hours to several days , as detailed in the supporting information ( si ) .
over 1,000 translocation events of 10 kbp dna were acquired in a nanopore ( 5.4 nm ) in the dark ( laser power p=0 ) . at t=150 s
the laser radiation was switched on ( p=2 mw , pre - aligned with nanopore ) as the software continued to record translocation events .
three features are immediately apparent : ( i ) the open pore current ( io ) and the current during translocation ( ib ) both increased when the laser was turned on , ( ii ) the average event amplitude i = io ib remained at the same level of 0.780.10 na under both conditions , and ( iii ) the mean event dwell - time td increased by roughly a factor of 10 under illumination , as compared to dark conditions .
these features are illustrated in figure 2b , which shows io and i as a function of time throughout the experiment ( top panel ) .
a 150-event running window average over all translocations ( bottom panel ) indeed shows a tenfold increase in the translocation time from ~1 ms to ~10 ms under laser illumination .
we define the retardation factor ( rf ; here rf=10 ) as the increase in mean translocation time under laser light relative to darkness . upon switching off the laser illumination at t=300 s ,
io returned to base level ( 3.6 na ) and the mean translocation dwell time was restored to ~1 ms , suggesting that this effect is completely reversible .
this experiment was repeated for nanopores of various sizes , and in all cases we observed a marked retardation of translocation time under laser illumination ( see si for analysis ) .
previous studies have sensed proteins such as bovine -lactoglobulin or avidin in solid - state nanopores , and antibodies such as anti - biotin fab fragments or anti - biotin in lipid coated nanopores .
however , the detection of small proteins ( mw < 10 kda ) in their native state remains a major challenge , since these proteins translocate through the pore too quickly to produce a resolvable signal given current bandwidth limitations .
we selected ubiquitin ( mw ~ 8.5 kda , 4 nm diameter ) as a representative small protein , relevant to a broad range of biological processes , to demonstrate that the photo - conductive effect can slow small protein translocations and enable their detection and characterization . under dark conditions , purified wild - type ubiquitin ( see si ) translocating through a ~5 nm pore yielded sporadic , brief downward spikes ( red trace , figure 2c ) .
the dwell time of these spikes was estimated to be < 12 s , but neither this nor the current amplitude of ubiquitin translocations could be accurately determined due to bandwidth constraints even at 100 khz , suggesting that the true translocation dwell time of these proteins is shorter than estimated .
laser illumination of the same nanopore at p=4 mw resulted in a marked increase in both the frequency and average dwell time of detected ubiquitin events ( blue trace , figure 2c ) .
the average translocation time increased by at least two orders of magnitude , allowing full characterization of both amplitude and dwell times for ubiquitin translocations .
the increase in event rate under illumination may be attributed to events that were previously undetectable under dark conditions due to bandwidth limitations .
a typical dwell time distribution and fractional blockade current ( ib ) for illuminated ubiquitin translocations are shown in figure 2c ( n > 500 ) .
two prominent timescales are observed for ubiquitin translocation ( 3405 and 89070 s ) , as well as two peaks in the blockade currents ( 0.88 and 0.78 ) , approximated by a sum of two gaussians .
we hypothesize that the two peaks observed in these distributions may be associated with different orientations of the asymmetric mushroom - like ubiquitin ( inset ) during translocation .
this hypothesis is consistent with previous reports for other protein / dna complexes . to elucidate the physical origin of light - induced retardation of translocation
, we first characterized the pore current i at varying laser intensity p for a range of nanopore sizes ( 4 - 20 nm diameter , d ) .
figure 3a displays ionic current enhancement ( i(p)/i(0 ) ) , for four representative pores ( d = 5 , 10 , 15 , 20 nm ) . in all cases
linear fits for p<5 mw characterize the response of each pore to light as the initial slope i/p .
a plot of i/p as a function of diameter for 14 pores ( 4 - 20 nm ) exhibits a clear linear dependence on d ( figure 3b ) .
this suggests that when the sinx thickness l and nanopore drilling conditions are maintained , the pores response to light per their surface area ( dl ) is a constant . from figure 3b
the linear dependence of i/p on nanopore diameter suggests that photo - conductance current enhancement is a surface phenomenon rather than a volumetric one ( which would exhibit d dependence ) .
solid - state nanopores possess weak surface charge , which can dominate pore conductivity at salt concentrations lower than ~100 mm .
however , it has been theorized that high charge densities on nanopore walls can affect electrical conductivity even under high salt conditions .
surface charges induce a diffuse double layer containing an excess of oppositely charged ions , of thickness comparable to the debye screening length . ionic current is enhanced by the electrical double layer in two ways : ( i ) by creating a local imbalance of counter ions within , which ( ii ) drags water molecules with its motion , creating an electro - osmotic flow ( eof ) which in turn pulls along additional current ( see figure 4a ) .
the total ionic current for a nanopore with a charged surface is :
( 1)i = ibulk+idl+ieof
where ibulk is the current due to ions outside the electrical double layer , idl is the current due to ions forming the double layer , and ieof is the current due to net water flow induced by net movement of ions within the double layer .
ieof is proportional to the product of the flow velocity field and the net charge density (r ) , which is only nonzero within . for small compared to the pore diameter , ( i.e. 0.3 nm at 1 m kcl at 21c ) , only ibulk scales with cross sectional area ( ibulk d ) whereas idl and ieof scale with circumference ( idl , ieof d ) .
thus , surface charges can , in principle , explain increased i as well as its linear scaling with d. moreover , if the analyte remains mostly within the bulk pore volume where there is no charge imbalance , distance away from the pore walls , we expect i to be independent of surface charge and thus independent of p. this is consistent with our observations ( figure 2 ) .
previous theoretical work has predicted that surface charge on a nanopore will affect ( i ) translocation times and ( ii ) polymer capture rate .
a negatively charged nanopore produces an eof towards the cathode ( cis chamber , figure 4a ) , increasing drag on a negatively charged translocating polymer , resulting in longer translocation times and reduced polymer capture rates .
our results ( figure 2 ) indicate that the rf for dna translocation grows with laser intensity .
moreover , dna capture rate was reduced by 30% , from 11 s to 8 s , for 2 mw of laser light ( see si ) .
these observations lead us to hypothesize that visible light can induce negative surface charges on silicon nitride , which in turn slows dna translocation through the drag created by eof moving in the opposite direction of dna . to validate this hypothesis
we approximate that for low laser powers the surface charge density ( ) grows linearly with laser intensity , such that = p where is the photo - reactivity of the pore ( c m w ) .
the total ionic current i can be obtained as a function of surface charge density using the following three individual contributions ( see si for full derivation ) : ( i ) ibulk is the electrophoretic movement of each ion species through the nanopore ; ( ii ) idl may be determined from the net charge distribution for a given wall potential , derived analytically from the poisson - boltzmann equation and from the boltzmann distribution , assuming a cylindrical nanopore and using the debye - hckel approximation ; ( iii ) ieof is a product of and the eof velocity profile described by the navier - stokes equation .
the grahame equation may be substituted to give as a function of wall potential . the contributions to the ion current are :
( 2.1)ibulkenkcl(k+cl)d24lv
( 2.2)idl2dklsinh(ep2)v
( 2.3)ieof2d2l2e2[sinh1(ep2)]2v
for elementary charge e , permittivity of aqueous solution , parameter = 1/kbt ( boltzmann constant kb , absolute temperature t ) , pore length l , applied voltage clamp v , and solution viscosity . the number density of potassium or chloride ions is nkcl , with electrophoretic mobilities k and cl ( see si for numerical values ) .
nanopore diameter d can be determined from tem images , enabling a quantitative estimation of the nanopore photo - reactivity via eq.2 ( see si figure s7 ) .
we additionally measured the dependence of i on kcl concentration ( 0.01 m to 1 m ) at different p and found it consistent with the model ( see si figure s8 ) .
additional dna translocations were performed using a range of dna lengths , nanopores , and laser powers to determine the role of surface charge in slowing translocation speed .
the results are summarized in figure 4b ( left ) , where rf is plotted against p for five nanopores ( 4.3 , 5.4 , 5.6 , 6.1 , and 7.4 nm diameters ) and four dna lengths ( 0.4 , 3.5 , 5 , and 10 kbp ) .
td was measured for > 1,000 events per laser intensity , and the td histograms were fitted with exponential functions as previously described .
these measurements suggest that rf per mw of light widely varies with pore size and dna length .
2 as described above to obtain for each of the pores , we then transform the dna rf into surface charge density using the relationship = p.
remarkably , all data points collapse onto a single curve ( figure 4b , right ) .
thus , light - induced slowing is dependent only on the induced surface charge density . controlling the rf value can be achieved either by selecting a highly optically reactive pore ( high ) under low laser intensity , or using a less optically reactive pore under higher laser intensity .
drilling nanopores in sinx with an electron beam reduces the n / si ratio around the pore due to preferential ablation of n atoms .
moreover , the principal defects in silicon - rich cvd amorphous sinx materials are si dangling bonds , which can trap electrons or holes to become charged . when the n / si ratio approaches 0.8 , the band gap is within visible light energies .
when the n / si ratio of the material surrounding the pore is low enough , we propose that visible light can excite electrons from the ground state across the band gap , trapping them in si dangling bonds .
eventually , trapped electrons would recombine with holes , but a high density of arriving photons could maintain a steady state of negatively charged si dangling bonds , creating a net surface charge density .
we tem - drilled four additional nanopores , all with similar diameters , in a freshly deposited sinx membrane .
two were exposed to the e - beam for 60 s , and two were exposed for 500 s , producing different local n / si stoichiometry ( see si ) . as expected , the pores drilled with a low e - beam dose had relatively low photo - reactivity ( =27 c m w ) , whereas the pores exposed to a high e - beam dose had much higher photo - reactivity ( =70 c m w ) , establishing a direct correlation between e - beam dosage and optical reactivity .
over 1,000 translocation events of 10 kbp dna were acquired in a nanopore ( 5.4 nm ) in the dark ( laser power p=0 ) . at t=150
s the laser radiation was switched on ( p=2 mw , pre - aligned with nanopore ) as the software continued to record translocation events .
three features are immediately apparent : ( i ) the open pore current ( io ) and the current during translocation ( ib ) both increased when the laser was turned on , ( ii ) the average event amplitude i = io ib remained at the same level of 0.780.10 na under both conditions , and ( iii ) the mean event dwell - time td increased by roughly a factor of 10 under illumination , as compared to dark conditions .
these features are illustrated in figure 2b , which shows io and i as a function of time throughout the experiment ( top panel ) .
a 150-event running window average over all translocations ( bottom panel ) indeed shows a tenfold increase in the translocation time from ~1 ms to ~10 ms under laser illumination .
we define the retardation factor ( rf ; here rf=10 ) as the increase in mean translocation time under laser light relative to darkness . upon switching off the laser illumination at t=300 s ,
io returned to base level ( 3.6 na ) and the mean translocation dwell time was restored to ~1 ms , suggesting that this effect is completely reversible .
this experiment was repeated for nanopores of various sizes , and in all cases we observed a marked retardation of translocation time under laser illumination ( see si for analysis ) .
previous studies have sensed proteins such as bovine -lactoglobulin or avidin in solid - state nanopores , and antibodies such as anti - biotin fab fragments or anti - biotin in lipid coated nanopores .
however , the detection of small proteins ( mw < 10 kda ) in their native state remains a major challenge , since these proteins translocate through the pore too quickly to produce a resolvable signal given current bandwidth limitations .
we selected ubiquitin ( mw ~ 8.5 kda , 4 nm diameter ) as a representative small protein , relevant to a broad range of biological processes , to demonstrate that the photo - conductive effect can slow small protein translocations and enable their detection and characterization . under dark conditions , purified wild - type ubiquitin ( see si ) translocating through a ~5 nm pore yielded sporadic , brief downward spikes ( red trace , figure 2c ) .
the dwell time of these spikes was estimated to be < 12 s , but neither this nor the current amplitude of ubiquitin translocations could be accurately determined due to bandwidth constraints even at 100 khz , suggesting that the true translocation dwell time of these proteins is shorter than estimated .
laser illumination of the same nanopore at p=4 mw resulted in a marked increase in both the frequency and average dwell time of detected ubiquitin events ( blue trace , figure 2c ) .
the average translocation time increased by at least two orders of magnitude , allowing full characterization of both amplitude and dwell times for ubiquitin translocations .
the increase in event rate under illumination may be attributed to events that were previously undetectable under dark conditions due to bandwidth limitations . as with dna translocations ,
this effect was completely reversible . a typical dwell time distribution and fractional blockade current ( ib ) for illuminated ubiquitin translocations are shown in figure 2c ( n > 500 ) .
two prominent timescales are observed for ubiquitin translocation ( 3405 and 89070 s ) , as well as two peaks in the blockade currents ( 0.88 and 0.78 ) , approximated by a sum of two gaussians .
we hypothesize that the two peaks observed in these distributions may be associated with different orientations of the asymmetric mushroom - like ubiquitin ( inset ) during translocation .
to elucidate the physical origin of light - induced retardation of translocation , we first characterized the pore current i at varying laser intensity p for a range of nanopore sizes ( 4 - 20 nm diameter , d ) .
figure 3a displays ionic current enhancement ( i(p)/i(0 ) ) , for four representative pores ( d = 5 , 10 , 15 , 20 nm ) . in all cases
linear fits for p<5 mw characterize the response of each pore to light as the initial slope i/p . a plot of i/p as a function of diameter for 14 pores ( 4 - 20 nm ) exhibits a clear linear dependence on d ( figure 3b ) .
this suggests that when the sinx thickness l and nanopore drilling conditions are maintained , the pores response to light per their surface area ( dl ) is a constant . from figure 3b
the linear dependence of i/p on nanopore diameter suggests that photo - conductance current enhancement is a surface phenomenon rather than a volumetric one ( which would exhibit d dependence ) .
solid - state nanopores possess weak surface charge , which can dominate pore conductivity at salt concentrations lower than ~100 mm .
however , it has been theorized that high charge densities on nanopore walls can affect electrical conductivity even under high salt conditions .
surface charges induce a diffuse double layer containing an excess of oppositely charged ions , of thickness comparable to the debye screening length . ionic current is enhanced by the electrical double layer in two ways : ( i ) by creating a local imbalance of counter ions within , which ( ii ) drags water molecules with its motion , creating an electro - osmotic flow ( eof ) which in turn pulls along additional current ( see figure 4a ) .
the total ionic current for a nanopore with a charged surface is :
( 1)i = ibulk+idl+ieof
where ibulk is the current due to ions outside the electrical double layer , idl is the current due to ions forming the double layer , and ieof is the current due to net water flow induced by net movement of ions within the double layer .
ieof is proportional to the product of the flow velocity field and the net charge density (r ) , which is only nonzero within . for small compared to the pore diameter , ( i.e. 0.3 nm at 1 m kcl at 21c ) , only ibulk scales with cross sectional area ( ibulk d ) whereas idl and ieof scale with circumference ( idl , ieof d ) .
thus , surface charges can , in principle , explain increased i as well as its linear scaling with d. moreover , if the analyte remains mostly within the bulk pore volume where there is no charge imbalance , distance away from the pore walls , we expect i to be independent of surface charge and thus independent of p.
previous theoretical work has predicted that surface charge on a nanopore will affect ( i ) translocation times and ( ii ) polymer capture rate .
a negatively charged nanopore produces an eof towards the cathode ( cis chamber , figure 4a ) , increasing drag on a negatively charged translocating polymer , resulting in longer translocation times and reduced polymer capture rates .
our results ( figure 2 ) indicate that the rf for dna translocation grows with laser intensity .
moreover , dna capture rate was reduced by 30% , from 11 s to 8 s , for 2 mw of laser light ( see si ) .
these observations lead us to hypothesize that visible light can induce negative surface charges on silicon nitride , which in turn slows dna translocation through the drag created by eof moving in the opposite direction of dna . to validate this hypothesis
we approximate that for low laser powers the surface charge density ( ) grows linearly with laser intensity , such that = p where is the photo - reactivity of the pore ( c m w ) .
the total ionic current i can be obtained as a function of surface charge density using the following three individual contributions ( see si for full derivation ) : ( i ) ibulk is the electrophoretic movement of each ion species through the nanopore ; ( ii ) idl may be determined from the net charge distribution for a given wall potential , derived analytically from the poisson - boltzmann equation and from the boltzmann distribution , assuming a cylindrical nanopore and using the debye - hckel approximation ; ( iii ) ieof is a product of and the eof velocity profile described by the navier - stokes equation .
the grahame equation may be substituted to give as a function of wall potential .
the contributions to the ion current are :
( 2.1)ibulkenkcl(k+cl)d24lv
( 2.2)idl2dklsinh(ep2)v
( 2.3)ieof2d2l2e2[sinh1(ep2)]2v
for elementary charge e , permittivity of aqueous solution , parameter = 1/kbt ( boltzmann constant kb , absolute temperature t ) , pore length l , applied voltage clamp v , and solution viscosity . the number density of potassium or chloride ions is nkcl , with electrophoretic mobilities k and cl ( see si for numerical values ) .
nanopore diameter d can be determined from tem images , enabling a quantitative estimation of the nanopore photo - reactivity via eq.2 ( see si figure s7 ) .
we additionally measured the dependence of i on kcl concentration ( 0.01 m to 1 m ) at different p and found it consistent with the model ( see si figure s8 ) .
additional dna translocations were performed using a range of dna lengths , nanopores , and laser powers to determine the role of surface charge in slowing translocation speed .
the results are summarized in figure 4b ( left ) , where rf is plotted against p for five nanopores ( 4.3 , 5.4 , 5.6 , 6.1 , and 7.4 nm diameters ) and four dna lengths ( 0.4 , 3.5 , 5 , and 10 kbp ) .
td was measured for > 1,000 events per laser intensity , and the td histograms were fitted with exponential functions as previously described .
these measurements suggest that rf per mw of light widely varies with pore size and dna length .
2 as described above to obtain for each of the pores , we then transform the dna rf into surface charge density using the relationship = p. remarkably , all data points collapse onto a single curve ( figure 4b , right ) .
thus , light - induced slowing is dependent only on the induced surface charge density . controlling the rf value can be achieved either by selecting a highly optically reactive pore ( high ) under low laser intensity , or using a less optically reactive pore under higher laser intensity .
drilling nanopores in sinx with an electron beam reduces the n / si ratio around the pore due to preferential ablation of n atoms .
moreover , the principal defects in silicon - rich cvd amorphous sinx materials are si dangling bonds , which can trap electrons or holes to become charged . when the n / si ratio approaches 0.8 , the band gap is within visible light energies .
when the n / si ratio of the material surrounding the pore is low enough , we propose that visible light can excite electrons from the ground state across the band gap , trapping them in si dangling bonds .
eventually , trapped electrons would recombine with holes , but a high density of arriving photons could maintain a steady state of negatively charged si dangling bonds , creating a net surface charge density .
we tem - drilled four additional nanopores , all with similar diameters , in a freshly deposited sinx membrane .
two were exposed to the e - beam for 60 s , and two were exposed for 500 s , producing different local n / si stoichiometry ( see si ) . as expected , the pores drilled with a low e - beam dose had relatively low photo - reactivity ( =27 c m w ) , whereas the pores exposed to a high e - beam dose had much higher photo - reactivity ( =70 c m w ) , establishing a direct correlation between e - beam dosage and optical reactivity .
we have shown that just a few mw of visible laser light focused on a nanopore can induce surface charge densities up to ~1 c m , much larger than the weak native charge of sinx . increased produces net charge near the pore walls , which , under external voltage , creates an electro - osmotic flow moving in opposition to an anionic translocating molecule .
this flow slows translocating dna and proteins , allowing detection and characterization of small analytes , such as ubiquitin .
previous approaches to slowing analyte translocation have introduced permanent modifications to the nanopore walls , inducing stronger interactions of analytes with the pore surface during translocation . by contrast
, the optoelectronic effect allows completely reversible , in - situ control of and translocation speed without permanently altering the surface properties of the nanopore or buffer .
moreover , ultra - fast tuning of surface charge by light completely decouples the capture process from subsequent translocation .
solid - state lasers , as well as other light sources , can be readily switched on / off in sub-s timescales , and hence induce current jumps in the nanopores within milliseconds ( see si ) .
the dynamic range of the photoconductive effect is determined by local n / si stoichiometry , which in turn depends on e - beam exposure during nanopore drilling .
we predict that this method will facilitate a broad range of emerging nanopore sensing applications , including genotyping using peptide nucleic acid ( pna ) probes and quantification of epigenetic markers .
ultra - fast and reversible modulation of surface charge is fundamentally important for the development of novel nanosensors . by exploiting the intrinsically high sensitivity of the nanopore ionic current to small modulations of surface charge
, we were able to explore and characterize a new optoelectronic effect , model the increase in electric conductance under visible laser illumination , and propose an underlying mechanism .
we have shown here three useful applications of the technique : ( i ) clearing blocked nanopores and thus significantly extending their useful lifetime ; ( ii ) slowing and tuning the translocation speed of dna ; and ( iii ) detecting and characterizing translocation events of very small proteins , such as ubiquitin .
together , these milestones broaden the range of molecules that can be probed by solid - state nanopores , enhance nanopore sensitivity , and extend the lifetime and throughput of individual pores .
nanopores were drilled on low - stress ( silicon - rich ) , amorphous lpcv - deposited sinx membranes 30 nm thick .
chips were then cleaned using piranha solution and kept in water until mounted on the teflon holder , rendering two independent chambers connected by the nanopore and filled with an electrolytic solution ( 1 m kcl , 20 mm tris , ph 8.0 , 21 c ) .
a pair of ag / agcl electrodes was used to apply an electrostatic potential difference across the chambers separated by the insulating sinx membrane .
the resulting ionic current through the nanopore was recorded using a patch - clamp amplifier ( axopatch 200b , molecular devices cooperation ) .
the whole apparatus was shielded from external electromagnetic noise by a faraday cage . the electrical readout from the amplifier
was filtered with a 10 khz low - pass bessel filter and digitized using a 16 bit a / d card ( national instruments ) controlled by a custom - written labview ( national instruments ) program ( see si for a detailed diagram of the apparatus ) .
the nano - chip was secured to a closed loop nano - positioner ( physik instrumente ) with sub - nm accuracy , also controlled by the labview program .
the nano - positioner was mounted in a custom - built confocal setup , in order to illuminate the nanopore with a focused laser beam .
a 532 nm line from a laser diode ( new focus ) was cleaned by a glan - thompson polarizer ( thorlabs ) , with the final power adjusted on demand by a half - wave plate mounted on a motorized rotating holder .
this resulted in a final dynamic range of 2 w to 17 mw with 500 intermediate values .
the laser beam was expanded to completely fill the back aperture of a 60 , 1.2 na water immersion objective ( olympus uplanapo ) .
the emission side contained a long - pass filter ( chroma hq560lp ) to remove any elastically scattered light , followed by a motorized mirror that acted as a shutter for the apds and allowed direct visualization of the membrane using a ccd camera ( thorlabs dc111 ) .
| nanopores can be used to detect and analyse biomolecules . however , controlling and tuning the translocation speed of molecules through a pore is difficult , limiting the wider application of these sensors .
here we show that low - power visible light can be used to control surface charge in solid - state nanopores and can influence the translocation dynamics of dna and proteins .
we find that laser light precisely focused at a nanopore can induce reversible negative surface charge densities as high as 1 c / m2 , and that the effect is tuneable on sub - millisecond timescales by adjusting the photon density . by modulating surface charge , we can control the amount of electro - osmotic flow through the nanopore , which affects the speed of translocating biomolecules .
in particular , a few mw of green light can reduce the translocation speed of double - stranded dna by more than an order of magnitude and the translocation speed of small globular proteins such as ubiquitin by more than two orders of magnitude .
the laser light can also be used to unclog blocked pores .
finally , we discuss a mechanism to account for the observed optoelectronic phenomenon . |
atherosclerosis , obesity , and metabolic syndrome are closely linked and constitute , arguably , the most menacing three conditions to modern society .
obesity adversely affects almost all of the major cardiovascular risk factors , including blood pressure , dyslipidemia and insulin sensitivity leading to metabolic syndrome and type-2 diabetes mellitus .
it is not surprising that obesity increases the risk of almost of all cardiovascular disorders including hypertension , coronary artery disease , heart failure , atrial fibrillation and peripheral arterial disease .
however , previous research has questioned whether obesity without cardiometabolic abnormalities metabolically healthy obesity ( mho ) has adverse effects on overall cardiovascular risk .
using data from the second hunt ( nord - trndelag health ) study mrkedal b , et al attempts to evaluate this association .
inhabitants 20 years of age and older in nord - trndelag county in norway were invited to participate in the second hunt from august 1995 to june 1997 . of the 93,898 individuals eligible to participate , 64,726 ( 69% ) accepted the invitation , and attended a clinical examination conducted by trained nurses .
exclusion criteria were ; missing information on body - mass index ( bmi ) or history of acute myocardial infarction ( ami ) , heart failure ( hf ) or cerebral stroke at baseline .
thus 61,299 participants ( 28,255 men and 33,044 women ) were included in the main analyses of bmi and metabolic health with risk of ami and hf . furthermore , 21,796 of participants had information about their bmi from prior analysis ; the tuberculosis screening ( conducted between 1966 and 1969 ) and from hunt-1 ( conducted between 1984 and 1986 ) .
thus , for the latter proportion of participants , bmi measurements ' were available approximately 10 and 30 years before baseline for the present study .
the investigators used a modified definition of metabolic health as described by the international diabetes federation .
participants were categorized as metabolically unhealthy if they had elevated waist circumference ( > 94 cm for men , > 80 cm for women ) or bmi 30 kg / m2 in addition to 2 or more of the following criteria : elevated nonfasting triglycerides ( 1.7
mmol / l ) , reduced high - density lipoprotein cholesterol ( < 1.03 mmol / l for men , < 1.29 mmol / l form women ) , elevated blood pressure ( 130/85 mmhg ) or use of blood pressure medication , elevated nonfasting glucose ( 11.1 mmol / l ) , or diabetes diagnosis .
patients were subdivided into three categories according to their bmi ; 25 < kg / m2 ( normal ) , 25 to 29.9 kg / m2 ( overweight ) and 30 kg / m2 ( obese ) and metabolically healthy or unhealthy .
the investigators also performed sub - analysis using 6 categories of bmi ( underweight < 18.5 kg / m2 , normal weight 18.3 - 24.9 kg / m2 , overweight 25 - 29.9 kg / m2 , class i obese 30 - 34.9 kg / m2 , class ii obese 35 - 39.9 , and class iii obese 40 kg / m2 ) .
a separate analysis was also made for the duration of obesity among participants whom previous bmi measurements had been conducted . in this analysis ,
the participants were divided into 5 categories : long - term normal weight ; long - term overweight ; long - term obese ; recent development of obesity ; and variable body mass ( any other combination of bmi categories ) .
analysis of abdominal obesity ( waist - hip ratio > 0.9 for men and > 0.85 for women ) instead of bmi and outcome was also made .
among the overall participants , 10,059 ( 16.4% ) were classified as obese and 15,576 ( 25.4% ) were classified as metabolically unhealthy . among the obese , the proportion of metabolically healthy ( mho ) was 26.4% .
obese and metabolically healthy participants were more likely to be women younger , and unmarried compared with obese and metabolically unhealthy participants ( muo ) . during a median follow - up of 12.2 years , 2,547 participants had a first ami . the age- and sex - adjusted hr among obese men and women who were metabolically healthy was 1.0 ( 95% ci : 0.8 - 1.2 ) compared with normal weight and metabolically healthy participants .
the corresponding hr for obese and metabolically unhealthy men and women was 1.7 ( 95% : 1.5 - 1.9 ) .
furthermore , the risk of ami was consistently higher among metabolically unhealthy participants across the range of bmi , including the severe obese , compared with metabolically healthy participants .
neither long - term obesity nor recently developed obesity was associated with substantial risk for ami among metabolically healthy participants . during a median follow - up of 12.3 years 1,201 participants developed hf .
there was a stronger risk of hf associated with long - term obesity , regardless of metabolic status , compared with normal - weight and metabolically healthy participants .
there was also a higher risk of hf among metabolically healthy participants who had recently developed obesity .
the results of using abdominal waist circumference were similar to those obtained in he primary analyses using bmi .
during a median follow - up of 12.2 years , 2,547 participants had a first ami .
the age- and sex - adjusted hr among obese men and women who were metabolically healthy was 1.0 ( 95% ci : 0.8 - 1.2 ) compared with normal weight and metabolically healthy participants .
the corresponding hr for obese and metabolically unhealthy men and women was 1.7 ( 95% : 1.5 - 1.9 ) .
furthermore , the risk of ami was consistently higher among metabolically unhealthy participants across the range of bmi , including the severe obese , compared with metabolically healthy participants .
neither long - term obesity nor recently developed obesity was associated with substantial risk for ami among metabolically healthy participants .
during a median follow - up of 12.3 years 1,201 participants developed hf . there was a stronger risk of hf associated with long - term obesity , regardless of metabolic status , compared with normal - weight and metabolically healthy participants .
there was also a higher risk of hf among metabolically healthy participants who had recently developed obesity .
the results of using abdominal waist circumference were similar to those obtained in he primary analyses using bmi .
the investigators concluded that the metabolic status and not obesity was the main determinant risk of ami .
in contrast , the risk of hf was similarly increased in mho and muo participants compared with normal - weight participants with healthy metabolic status , suggesting that metabolic health may not play a central role for these associations .
the results of using abdominal waist circumference were similar to those obtained in he primary analyses using bmi for ami & hf .
this increased risk of hf has been explained in an accompanying editorial by the fact that increased adiposity increases total blood volume , stroke volume , cardiac output and cardiac work leading to significant abnormalities on both the right and left sides of the heart .
the complexity of the association between obesity and cardiovascular diseases is further complicated by the current understanding of the various physiologic functions of adiposity .
adipose tissue in addition to its role in thermogenesis and energy storage , it is a complex endocrine organ and is believed to have a role in the evolution of human brain as well as in myocardial regeneration and repair .
the findings of the current study are not concordant with a recently published meta - analysis
as well as a number of recent studies
( see table 1 ) . a meta - analysis by kramer et al
, which included 8 previously published studies , demonstrated a significant association between being overweight and cardiovascular events .
the whitehall ii study
, an ongoing prospective cohort study , included 7122 participants aged 39 - 63 years who were enrolled between 1991 and 1993 and followed up for 17.4 years .
cardiovascular diseases risk was comparable between metabolically healthy and unhealthy obese participants , although the risk of type-2 diabetes was lower among mho compared to muo .
another recent study from korea by chang and colleagues
, which involved 14,828 metabolically healthy individuals who took part in a comprehensive regional health - screening program compared coronary calcium scores ( cac ) between mho versus metabolically normal weight participants . across a series of analyses adjusting for potential confounding variables ,
the mho group had a significantly greater prevalence of coronary atherosclerosis compared with the metabolically normal weight group .
however following additional adjustment of metabolic risk factors and ldl - c levels , this difference no longer remained significant .
the authors concluded obesity even among metabolically healthy individuals is associated with greater prevalence of subclinical cad .
furthermore , this association appears to be determined by components of metabolic parameters that fell below specific threshold levels .
rush puri , md in an accompanying editorial
suggested that it is probably time to dispel the concept of metabolically healthy obesity .
finally , the interaction between obesity / metabolic syndrome and cardiovascular risk is further complicated by the dietary habit in the community , for example in norway there is higher consumption of fish which may play a protective role when compared to that in the middle east , where the high consumption of red meat needs to be studied . in conclusion , even with these recent studies including that of hunt-2
, the association between metabolically healthy obesity cardiovascular disease risks ( specifically coronary artery disease ) remains controversial and needs further study .
the incidence of obesity - related metabolic disturbances varies widely among obese individuals . whether mho is associated with reduced risk of cardiovascular disease is controversial . | obesity and metabolic syndrome frequently co - exist and are major health problems worldwide .
prior research has questioned whether obesity without cardiometabolic abnormalities metabolically healthy obesity ( mho ) , has adverse effects on overall cardiovascular disease risk ( cvd ) .
the association between mho and the first development of acute myocardial infarction and heart failure ( hf ) was evaluated in the second hunt ( nord - trndelag health ) . |
up until the 1980s , most research in developmental biology involved analyzing the interactions among and within the tissues that participated in some embryologic event ( e.g. , limb development ) and , on the basis of careful experimentation , inferring something about these interactions .
a second and complementary approach was to use kinetics and other theoretical approaches to model a problem in development such as patterning . in either case , where there was more than one possible explanation of a phenomenon
, it seemed obvious and sensible to give preference to the explanation that seemed the most parsimonious on grounds of natural selection .
the gradual and continuing discovery of the intricacy of the signalling conversations between participating tissues , the richness of the activated molecular networks that regulate developmental change , and the complexity of the resulting processes have shown just how nave was that original paradigm . over the past two decades , our ability to use a wide range of molecular technologies to investigate these regulatory networks and to collate the patterns of gene expression characterizing a particular state of differentiation has produced enormous amounts of information , often accessible from online databases ( e.g. , http://www.informatics.jax.org ) , on how development proceeds .
this ability to exploit the new technologies and so to explore complex developmental events at the molecular level has enabled the field , over a period of some 20 years , to progress from a small - scale subject interesting relatively few scientists to an area of major interest and excitement across the world .
one stimulus here has been the realization that mutation - derived errors in these networks underpin many human congenital abnormalities .
the consequent study of these abnormalities , often using mouse models , has the dual benefit of advancing medical research and giving us a tool to pry open these networks .
a second has been the realization that homologous networks do similar things in very different organisms and that we therefore have a means to explore the mechanisms of evolutional change which usually operate , as waddington was probably the first to emphasize , through mediating changes in development ( see below and waddington 1975 ) .
all this work has led to a wonderful increase in our understanding of developmental events , particularly those that involve signalling and those in which the activation of a transcription factor initiates a new process ( for review , see gilbert 2006 ) . that said , it has to be admitted that , for most developmental events , there are now large amounts of molecular expression data that are hard to interpret unambiguously
. often we do not really know in a particular event which proteins are important , which are secondary , and which are background , and knockout and other experimental data can be either ambiguous or unhelpful . in one sense ,
the situation is worse than it was in the 1980s : then we could appeal to parsimony via natural selection to make choices ; now things are so complicated that we have no means of recognizing parsimony , and would not trust the concept anyway .
one approach to this complexity is to say that if only we had enough data , everything would become clear , but it is unlikely that anyone in the field really believes this .
a second is to say that we need better and stronger intellectual frameworks than just relational databases for organizing and analyzing the new data that are pouring out of laboratories .
a third is to take the view that we need not just a better framework for handling data , but better intellectual ideas .
the third view is certainly right , but those ideas have yet to emerge and , in the absence of some deeply original and intuitive thinking , may well emerge from the second approach , which is hard enough at the moment and which is articulated under the general name of systems developmental biology .
this approach is new and does not yet have any formal structure but , in general , seeks to embed the events of a particular developmental event within a computational and hierarchical framework that links tissues , cells , processes , and molecular / genomic data , and often aims to capture the results of high - throughput technology ( e.g. , kimelman 2006 ) .
perhaps the best - known example of a systems approach is the work on sea - urchin development ( e.g. , ben - tabou de leon and davidson 2006 ) , which integrates tissues , genes , and networks ( longabough et al . 2005 ) .
2006 ) and the molecular basis of very early mouse development ( eviskov et al .
this article does not seek to provide a systems approach to any particular phenomenon but to consider how best to take advantage of the computational tools currently available so as to ensure that systems descriptions based on tissues , cells , and processes can be interoperable in the sense that they use a common language .
this would enable them to query one another and use each other s formal knowledge ( much as we can do for genes and proteins that are already linked through their ids to their appropriate database ) .
the key tools here are ontologies and the purpose of this article is to discuss what ontologies are , how they can be used in formalizing systems approaches to development within and across species , and what are the resulting benefits .
at the core of development is the predictable production of functional and differentiated tissues from early , less well - defined tissues . it would therefore be sensible if , when one person uses , for example , the term
e14.5 mouse left atrium in his systems model of heart development , another person using the same term in her model can link to that of the first .
the way that such linkage is done for proteins is to use an i d from a standard database ( e.g. , the protein i d from uniprot , http://www.ebi.uniprot.org ) , and because proteins are all amino - acid strings and hence of the same rank , they can readily be stored in the tables of relational databases .
anatomical tissue organization , in contrast , is hierarchical in nature : the vertebrate hindlimb , for instance , is obviously partitioned into regions ( thigh , knee , calf , foot ) , each of which has its own parts , and the concept of hindlimb would naturally be expected to include these subordinate parts , together with information about their relationship to the hindlimb and to one another . while it is obviously straightforward to assign a unique i d to a given tissue at a given developmental age , it is clear that the hierarchical organization of tissues poses some organizational problems beyond those needed for handling sequence data .
these are domains of knowledge formalized in a way that allows them to be computationally accessible . in practice ,
, a fact is a triad of the general form < term><relationship><term > and terms can have parents and children ( e.g. , the e14.5 left atrium is part of the e14.5 heart ; the e14.5 heart is part of the e14.5 cardiovascular system , etc . ) . although they are tedious to produce ( even the simplest organ system has a great many tissues and a lot of organization ) , there are now part - of ontologies for the tissues of all the main model adult organisms and for the developmental anatomy of the mouse , zebrafish , and drosophila ( accessible from the open bio - ontologies site , http://www.obo.sourceforge.net ) . every term in these ontologies
carries a standard i d of the form < abcd><ijkl > , where abcd gives a short letter code for the ontology ( e.g. , emap for mouse development ) and ijkl gives the number for a specific tissue at a specific developmental age ( e.g. , emap:7917 is the i d for the e14.5 mouse left atrium , with emap standing for the edinburgh mouse atlas project , http://www.genex.hgu.mrc.ac.uk ) .
it is these ids that allow for interoperability because they represent defined concepts ( or terms ) that can be used anywhere , even as synonyms .
it is worth noting that such an anatomical ontology is more than just the list of the parts as it includes a great deal of knowledge about how these parts are organized into larger structures and these larger structures into organ systems ( e.g. , fig . 1 ) .
such an ontology may also include additional knowledge built on other relationships such as derives from ( an ontology of developmental anatomy would well include lineage relationships ) and type data ( e.g. , the femur is a bone ) .
there is also no reason why a child should have only a single parent in the ontology : for example , it is equally appropriate to describe the femur as < part of><the skeleton > as < part of><the hindlimb > , and a rich ontology could well include both relationships ( and this multiparenting of terms means that it would be called by the technical term directed acyclic graph , or dag ) .
this is not the place to include a detailed discussion of how anatomical ontologies are built and used ( the interested reader should consult bard 2005 ) , but it should be mentioned that the internal organization of an anatomy ontology is usually rather complex ( the structure needs to be able to handle many relationships as well as definitions and links ) and is best read in a browser program such as obo - edit or cobra ( figs . 1 and 2 ; aitken et al .
2004 ; harris et al . 2004 ) that is visualized in a gui rather than as a list on paper .
there are several languages in current use for handling ontologies ( the best known are obo and owl ) and they can be translated into each other using the cobra tool .
the left panel shows the tissues in the metanephros of the ts 19 ( e11.5 mouse ) .
the right panel shows the ontology of what is called the abstract mouse and includes all the tissues with range of times at which they are present during embryogenesis .
the left panel shows the ontology with its classes for cell types with the motile cell entry opened and neural crest cell highlighted .
the central panel gives the i d and the definition , while the right panel shows the various places within the graph where the neural crest cell can be found the ontology of mouse developmental anatomy as displayed in the cobra browser .
the left panel shows the tissues in the metanephros of the ts 19 ( e11.5 mouse ) .
the right panel shows the ontology of what is called the abstract mouse and includes all the tissues with range of times at which they are present during embryogenesis .
these terms carry an emapa i d the cell - type ontology visualized in the obo - edit browser .
the left panel shows the ontology with its classes for cell types with the motile cell entry opened and neural crest cell highlighted .
the central panel gives the i d and the definition , while the right panel shows the various places within the graph where the neural crest cell can be found in the context of systems developmental biology and in addition to the appropriate anatomy ontology , there are two general ontologies that are also useful .
the first is the cell - type ontology ( bard et al . 2005 ) and the second is the gene ontology ( ashburner et al .
the former , unlike the anatomy ontologies , not only includes all the common and many of the uncommon cell types that are found across the phyla but it is essentially species - independent and so facilitates cross - species analyses and comparisons .
this ontology is structured to include our knowledge of the many properties of these cell types and each is separately coded under function , morphology , ploidy , development , etc . , using two relationships , is - a and descends - from ( see fig . 2 ) .
this ontology is thus a terse summary of a great deal of knowledge about cell types and their properties .
the gene ontology or go is by far the best known and most used of the standard bio - ontologies ( it is used for protein annotation in uniprot ) . unlike uniprot
, it does not include sequence information but focuses on the properties of proteins and includes hierarchical knowledge about ( 1 ) cellular locations , ( 2 ) molecular functions , and ( 3 ) the functional processes in which they are involved . for systems developmental biology
, it is the latter that is the most important and the process hierarchy includes a wide variety of developmental processes ( although they are distributed across the ontology rather than integrated under a single heading [ fig .
3 ] ) , each of which , of course , has a unique i d .
of particular interest here is the database of proteins that is linked to the go so that a user can easily identify all the stored proteins associated with a go term , or the go terms associated with a chosen protein ( although it should be said that keeping this database up - to - date is a major task ) .
3the process component of the gene ontology ( left panel ) visualized in the obo - edit browser .
the cell differentiation term is highlighted ( left panel ) and found in two contexts ( right panel ) .
the center panel gives the definition and the i d the process component of the gene ontology ( left panel ) visualized in the obo - edit browser .
the cell differentiation term is highlighted ( left panel ) and found in two contexts ( right panel ) .
the center panel gives the definition and the i d one important factor about ontology terms is that they can be associated with data ( usually held in a standard relational database and linked to the ontology via the appropriate ids ) ; examples include the proteins that satisfy the definition of a go term ( http://www.godatabase.org ) , the genes expressed in a particular mouse tissue at a particular time , ( http://www.informatics.jax ) , and the micrographs associated with a pathologic state ( http://www.pathbase.net ) . here
, the hierarchical knowledge within the ontology comes into play : if , for example , a user requires the genes associated with the developing mouse forelimb at e12.5 , the response comes from searching the ontology to identify the constituent tissues in the limb and using their ids to collect all the associated data .
this can be done because this type of part of relationship has the property known as upwards propagation .
this means that if a term has data associated with it , then these data can be associated with the parent ( e.g. , a gene expressed in the tarsus is also expressed in the hindlimb ) .
propagation is associated with some bio - ontology relationships ( e.g. , part of , is a ) but not with others ( e.g. , develops from ; one would not expect pigment cells to have the same properties as their neural - crest - cells precursors ) .
ontologies , together with their linked data , provide an important online resource and have several key roles in systems developmental biology .
the first is the use of well - defined terms ( with their associated ids ) to standardize annotation , the second is for linkage to databases that store data associated with the terms , and the third is to facilitate the identification of similar terms in very different contexts .
these ideas are explored here and in the next section and , while the approach is applicable to the development of any organism and also across organisms ( see discussion ) , the examples focus on the mouse .
this is because our knowledge about its development is now so deep that it is often possible not only to describe how any tissue develops morphologically over time ( kaufman and bard 1999 ) but to identify the processes and changes in cell type that underpin each time slice of a tissue s development ( see http://www.xspan.org ) .
in addition , the mouse community is fortunate to have access to substantial online informatics resources that are available from the jackson laboratory . in the context of this article , the most important of these is gxd , a database of gene - expression
( g - e ) data for the developing mouse in which expression data are annotated with ( and hence searchable by ) tissue name , developmental stage , and go ids , as well as other genetic identities .
although development is complicated , it can be seen as the operation on tissues of relatively few core processes that involvepatterning this sets up future events in groups of cellsproliferation and apoptosis the basis of growth and shapingcell differentiation
changing a cell s phenotypemorphogenesis the generation of spatial organization ( e.g. , via movement)with each process having subprocesses .
such processes are archived in the gene ontology ( see above and fig . 3 ) .
patterning this sets up future events in groups of cells proliferation and apoptosis the basis of growth and shaping cell differentiation
the generation of spatial organization ( e.g. , via movement ) if the formation of a system is to be modeled , then the first step is to lay out its normal pattern of development graphically .
much of the stage - by - stage lineage data for mouse embryogenesis is available in text format ( kaufman and bard 1999 ) and can be linked to the tissues ( with their ids ) in the ontology of mouse developmental anatomy ( bard et al .
staging of mouse embryos is based on the appearance of standard external identifying features as embryogenesis proceeds ; theiler staging for the mouse gives , in essence , two stages a day when things are going rapidly ( e6e12.5 ) and one stage a day when the appearance of new features is slower ( e1e5 and e12.5 onward ) .
annotating the tissue names is straightforward because each tissue at each stage has a unique i d accessible from the ontology of mouse developmental anatomy ( e.g. , fig . 1 ) . for annotating changes in the state of cellular differentiation
the first is to use an appropriate go term , but because the go includes less than 50 cell types , it can not ( and was not intended ) to do justice to developmental anatomy .
a better option , therefore , is to use the higher - level go term cell differentiation and combine it with two terms from the cell - type ontology .
the annotation would thus be \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ < { \rm cell \ , type } \
type } \ , 2 > $ $ \end{document } in the case of metanephric mesenchyme being induced to form nephron epithelium , the annotation is \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ < { \rm mesenchyme}><\ , cell \ , differentiation><{\rm duct \ , epithelium } > $ $ \end{document } or , using the appropriate ids from the two ontologies : \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document }
$ $ { { \rm { < cl:0000134 > < } } go:0030154{\rm { >
< cl:0000068 > } } } $ $ \end{document } where the state of a tissue changes between two theiler periods , one can annotate the developmental change that drives this transition ( this is not the usual way in which development is considered ! ) with the appropriate go process terms . in this way ,
the final graph has , superimposed on the lineage flow of developmental anatomy , the appropriate differentiation and process terms that drive the development of each tissue .
underpinning each of these transitions is the appropriate ontology i d , so that the final graph is set up to be complete , formal , and interoperable .
figure 4 illustrates the result of annotating in this way the development of the mouse urogenital system over theiler stages 1319 ( e8.5e11.5 ) , where classical descriptive embryology has , first , shown that the intermediate mesoderm differentiates to give the nephric duct , mesonephros ( from which develops the gonad ) and the metanephros , and , second , given the cell types associated with each tissue .
the graph also includes the results of experimental work that has clarified the processes that push development from one stage to the next . for clarity
, the figure excludes the ids but they are all readily available from the appropriate ontologies .
4a systems model of mouse urogenital development during the periods ts 1319 ( e8.5e11.5 ) showing the tissues present at each time interval , the cell types , and the processes driving change , all of which have unique ontology ids ( for further details see http://www.bioontology.org/wiki/images/1/1a/caro-ug-development-jb.pdf ) a systems model of mouse urogenital development during the periods ts 1319 ( e8.5e11.5 ) showing the tissues present at each time interval , the cell types , and the processes driving change , all of which have unique ontology ids ( for further details see http://www.bioontology.org/wiki/images/1/1a/caro-ug-development-jb.pdf ) there is one immediate use of this model that derives from annotating terms with standard ontology ids .
the graph as it stands has no molecular data , but all the current gene - expression information associated with a particular developing mouse tissue at a given theiler stage is computationally accessible from gxd through i d interoperability .
it is straightforward , in principle at least , to use these go ids to identify , for example , signals and receptors for tissues that signal to one another ( bard 2002 ) or transcription factors that are synthesized at a particular stage and ready for a future event . in short ,
ontology annotations of developmental systems are not only the key to interoperability and standardization of systems models , they give rich searching possibilities .
there is a further bonus from such annotations : as development proceeds , the same developmental processes are used in very different contexts within one organism .
this similarity goes beyond the differentiation of the same cell type from different tissues ( e.g. , neurons can differentiate directly from neuroepithelium and indirectly after the migration of cells originally from the neural crest or from epithelial placodes ) .
obvious examples are the branching of epithelial tubules ( in glands and in the vascular system ) , epithelial folding in its many forms , the forming of mesenchymal condensations ( the first step in the development of muscles , bones , and cartilage ) , and the initiation of movement ( in tissues as different as neural crest cell , primary germ cells , neurons , and gastrulating epiblast cells ) , pigmentation ( retinal epithelium , neural crest cells ) .
consider the hypothesis that each of these processes can be viewed as a motor driven by the activation of particular set of transcription factors ( tfs ) .
if this hypothesis is correct , then each set of tissues that are about to participate in a particular event should express those tfs and they should be present in the appropriate g - e profile in the associated database ( they may also be missing , but they should not have been shown to be absent ) .
if so , then the overlap of the g - e profiles of tissues about to initiate a particular process should include ( 1 ) those proteins involved in initiating that process and ( 2 ) housekeeping proteins common to all ( or at least most ) cells .
if these housekeeping genes can be excluded , such boolean analysis should yield key proteins involved in that process . a similar analysis of the g - e profiles for those tissues
immediately after they have initiated a particular process should yield those proteins involved in that process .
any analysis along the lines suggested makes several assumptions beyond that of common tfs underpinning common processes .
first , the time resolution of the g - e database has to be fine enough to discriminate between the period of a tissue s competence to undergo a process and the process itself . in the case of mouse development
for which the database archives expression by theiler staging , this means time slices of 24 hours for early and late mouse development and 12 hours over the period e6e12 ; this is probably adequate .
second , the database needs to contain enough data on the expression of all relevant genes .
this latter criterion is unlikely to be met , even for gxd . while this rich resource currently includes some 250,000 expression results for about 7500 genes ( information courtesy of dr .
martin ringwald ) , the data are not uniformly distributed across tissues or time slots .
there is thus an element of chance as to whether the database holds information about the expression of a gene in a particular tissue at a given time . a preliminary analysis of the g - e data associated with some process widely undergone during mouse development
should thus be based on the following lines : collate all the g - e data for each tissue in the 24 hours leading up to the process ( a reasonable estimate of the period of competence ) ; this list should include the infrastructure proteins for establishing that process.collate all the g - e data for each tissue during the stage at which the process is initiated , and probably the following one ; this list should include all the process genes.identify the overlaps of the g - e patterns for steps 1 and 2 . given that gxd is incomplete , this probably means , in the first instance , including any protein expressed before or after the process in more than one tissue ( fig .
5 ) , and particularly any of the latter whose expression is initiated just before the process is initiated ( these are candidate genes for being activated by the tfs ) .remove any of these proteins that can be identified as a housekeeping gene ( this can be done from a standard list or perhaps from the g - e overlap of very different tissues ) ; this will give the candidate infrastructure and process genes.analyze these candidate populations to see which genes ( a ) are heavily represented and ( b ) seem important ( e.g. , tfs ) ; this may involve bayesian statistical analysis.the analysis as a whole should provide a set of candidate genes for the process of interest ( provided that the group of tissues as a whole is undergoing no more than one common development - specific process ) .
however , the process is quite lengthy and , given that gxd may include several hundred expressed genes for even a single tissue at a specific theiler stage , can really only be properly handled through a substantial computational infrastructure that has yet to be put in place .
indeed , the more expressed genes that can be associated with the set of tissues , the more reliable will be the analysis
. the situation will get better but more complicated once gxd includes microarray and other high - throughput data .
5diagrammatic representation of the boolean subtractions of ( left ) the gene - expression patterns of four tissues that undergo the same developmental process ; this gives a mixture of process genes and common ( housekeeping ) genes .
a second subtraction ( right ) eliminates housekeeping genes collate all the g - e data for each tissue in the 24 hours leading up to the process ( a reasonable estimate of the period of competence ) ; this list should include the infrastructure proteins for establishing that process .
collate all the g - e data for each tissue during the stage at which the process is initiated , and probably the following one ; this list should include all the process genes .
given that gxd is incomplete , this probably means , in the first instance , including any protein expressed before or after the process in more than one tissue ( fig .
5 ) , and particularly any of the latter whose expression is initiated just before the process is initiated ( these are candidate genes for being activated by the tfs ) . remove any of these proteins that can be identified as a housekeeping gene ( this can be done from a standard list or perhaps from the g - e overlap of very different tissues ) ; this will give the candidate infrastructure and process genes .
analyze these candidate populations to see which genes ( a ) are heavily represented and ( b ) seem important ( e.g. , tfs ) ; this may involve bayesian statistical analysis .
diagrammatic representation of the boolean subtractions of ( left ) the gene - expression patterns of four tissues that undergo the same developmental process ; this gives a mixture of process genes and common ( housekeeping ) genes .
a second subtraction ( right ) eliminates housekeeping genes fortunately , there is a relatively simple shortcut that can be used for a quick exploration of the approach , and which takes advantage of the go annotations in gxd . if one merely restricts one s searches to ( 1 ) the periods of competence of tissues about to initiate a process and ( 2 ) genes with a go transcription factor i d , the output should be restricted to those tfs associated with the initiation of that process . as an example , consider the mesenchyme - to - epithelium transition that takes place many times during development .
a preliminary examination ( full details will be published elsewhere ) of the gene - expression profiles in gxd shows that there are substantial entries for the formation of blood vessels in the early mouse heart , the differentiation of heart endocardium , the metanephric ducts , the mesenchyme that forms the mesonephric ducts , and the early stages of somite development .
if the search is restricted , using go ids , to tfs in the participating tissues in the two theiler stages before these transitions take place , the data show that three tfs , lhx1 , foxc1 , and meox1 , are present in all these tissues ( apart from a couple where there is incomplete data ) .
a further inspection of the complete distributions of these genes shows that their expression ( insofar as it is fully represented in gxd ) is highly restricted over space and time , and because they do not in general overlap one another , they can not be considered as housekeeping genes ; their coexpression is hence unlikely to be a coincidence .
the tfs lhx1 , foxc1 , and meox1 are thus , as a set , good candidates for collectively initiating a mesenchyme - to - epithelium transition , although they seem not to have been previously identified as fulfilling this role .
it is therefore a prediction that this set be expressed in other tissues undergoing a mesenchyme - to epithelial transition .
examples that might be worth investigating here include the stromal fibroblasts in the cornea that become the corneal endothelium and the splanchnopleure mesoderm that forms mesothelium ( gxd currently includes no relevant expression data for these tissues ) .
if the prediction were confirmed , it would be worth investigating which proteins were synthesized following their activation .
although systems developmental biology is thought of as a relatively new subject , its basis lies in an idea that waddington originally had in the late 1930s and that he expressed graphically as the epigenetic landscape ( fig .
6 ) . in its original form ( left ) , the picture was of a ball rolling down the valleys of a complex hillside . in its final form ( right ) , this picture showed that the topology of this surface was shaped through complex linkage to a set of pegs on an underlying flat surface .
the meaning of this metaphor is that the developmental trajectory of a developing cell over time ( the rolling of the ball down the valleys ) is shaped by its environment ( the undulating surface ) , with the form of the landscape being determined by the interacting properties of many genes ( the pegs and their ties ) .
local development was thus viewed as a gene - based interaction between a particular group of cells and its environment and the system had to be viewed as a whole .
this was a startlingly original view to hold more than 50 years ago , at a time when the scientific community almost uniformly held the view that all genes did was code for enzymes and such trivialities as eye color ( van speybroeck 2002 ) .
its value as a metaphor was shown by waddington s use of it to describe evolution : small changes ( mutations ) in genes led to changes in the landscape and hence to altered patterns of development and so to novel organisms ( see waddington 1975 ) .
fig .
6left waddington s original drawing of the epigenetic landscape showing the developmental trajectory of a cell being shaped by its tissue environment .
right a later drawing showing that this environment is itself underpinned by complex genetic interactions ( waddington 1940 , 1957 , with permission from cambridge university press ) left waddington s original drawing of the epigenetic landscape showing the developmental trajectory of a cell being shaped by its tissue environment .
right a later drawing showing that this environment is itself underpinned by complex genetic interactions ( waddington 1940 , 1957 , with permission from cambridge university press ) we are now beginning to catch up with waddington s thinking .
systems models are starting to be produced that aim to integrate the complexity of the molecular , cellular , and tissue details that underpin development using the computational resources that are now available .
there will be many more such models , and , given the richness and complexity of development , they are bound to overlap .
it is important that such overlaps allow interoperability , and a key point made in this article is that the community should not only use , as it already does , the terms and ids for the gene and protein databases , but also incorporate the terms and ids for cells , tissues , and processes that are to be found in standard bio - ontologies .
this is partly for interoperability across models , but also to allow direct linkage to such databases as those handling g - e data .
this article also points out that there is an additional bonus from using these ids , i.e. , where the same process is used in the development of different tissues , the linking of tissue ids to their associated gene - expression profiles can , in principle , lead through boolean analysis to the identification of candidate genes associated with the initiation and execution of this process .
the databases are currently populated with genes whose roles are still unclear so this computational approach complements experimental approaches because it enables small groups of genes to be linked to the initiation and execution of processes .
this contrasts with the analysis of individual genes whose roles can be analyzed using , for example , transgenic technology and high - throughput technology that picks up a large numbers of genes but yields little about their function .
a further point to be made is that the type of computational approach to the identification of gene function given here allows us to test the hypothesis that common processes are underpinned by common tfs .
if such a search yielded several candidate tfs that are found to be associated with the initiation of a process in some tissues but have yet to be found in all tissues , it suggests that the expression of these tfs should be further examined in these other tissues .
a lack of expression there would cast doubt on or at least narrow the extent of the hypothesis .
this approach to systems biology thus provides assays for testing our ideas . in this article
, the focus has been on formalizing mouse development and analyzing the molecular underpinnings of its underlying processes because it is for this organism that the associated expression database has the finest spatial and temporal granularity .
it should of course be pointed out that the approach is equally applicable to other organisms and even across organisms that share equivalent developmental processes . in the first instance
, the mouse can be used as a model for identifying process - associated genes . where a similar process occurs in other organisms
, the homologs will be candidate genes for that process ( and the xspan facility , http://www.xspan.org , will be helpful in identifying equivalent tissues in model organisms ) .
a further tool under development that may be useful in this context is caro , the common anatomy reference ontology ( http://www.obo.sourceforge.net/cgi-bin/detail.cgi?caro , haendel et al . 2007 ) which aims to provide interoperability across species - specific anatomy ontologies . in the longer term
, one can envision the construction of complex systems models that span organisms and that employ the full richness of the computational resources that are available . at a slightly deeper level , what distinguishes systems developmental biology from other approaches to unpicking the complexities of development is the formalization of the events of embryogenesis .
this in turn enable tissues , cells , and expressed genes to be linked in a way that lends to computational as well as other forms of analysis .
the exercise of formalizing embryogenesis encourages the biologist to think in ways that complement other more traditional approaches . | systems developmental biology is an approach to the study of embryogenesis that attempts to analyze complex developmental processes through integrating the roles of their molecular , cellular , and tissue participants within a computational framework .
this article discusses ways of annotating these participants using standard terms and ids now available in public ontologies ( these are areas of hierarchical knowledge formalized to be computationally accessible ) for tissues , cells , and processes . such annotations bring two types of benefit .
the first comes from using standard terms : this allows linkage to other resources that use them ( e.g. , gxd , the gene - expression [ g - e ] database for mouse development ) .
the second comes from the annotation procedure itself : this can lead to the identification of common processes that are used in very different and apparently unrelated events , even in other organisms .
one implication of this is the potential for identifying the genes underpinning common developmental processes in different tissues through boolean analysis of their g - e profiles .
while it is easiest to do this for single organisms , the approach is extendable to analyzing similar processes in different organisms .
although the full computational infrastructure for such an analysis has yet to be put in place , two examples are briefly considered as illustration .
first , the early development of the mouse urogenital system shows how a line of development can be graphically formalized using ontologies .
second , boolean analysis of the g - e profiles of the mesenchyme - to - epithelium transitions that take place during mouse development suggest lhx1 , foxc1 , and meox1 as candidate transcription factors for mediating this process . |
polymethyl methacrylate ( pmma ) is considered to be the most commonly used material in the field of prosthodontics .
it has achieved great success when used for denture base because it is simple in manufacturing , economical , and light in weight .
however , one of the drawbacks of pmma acrylic resin denture base is the low strength , including low impact strength and low fatigue strength.12 many trials have been done to improve the strength of acrylic denture bases with the use of metal wires and cast metal plates.34 the main drawback with adding metal wire is weak bond between the wire and resin , which leads to insignificant change of mechanical properties .
although metal plates are expected to increase the strength , they are expensive and liable to corrosion.34 other trials have been also done to strengthen acrylic resin materials with either chemical modification with grafted co - polymers and stronger cross linkage or by introducing various organic and inorganic reinforcing fibers into them .
metal , kevlar , glass , sapphire , polyester , carbon graphite , and rigid polyethylene are substances used for fiber strengthening.1456 although the inclusion of the fibers produced encouraging results , this method has various problems including tissue irritation , increased production time , difficulties in handling , the need for precise orientation and placement , and bonding of the fibers within the resin.7 in the case of metal inserts , failure due to stress concentration around the embedded inserts has been reported.8 the incorporation of ceramic particles in various dental materials has been studied and found to be biocompatible and improving mechanical properties.910111213 in addition , due to itswhite color , ceramic powder is not expected to compromise aesthetic appearances .
1415 however , reinforcement methods should not have undesirable effects on the mechanical properties of denture materials .
the roughness of acrylic resin surfaces is a critical property because surface irregularities increase the possibility of the retention of microbes on the denture surface after its cleaning.1617 another property that can have an effect on the surface properties of acrylic resins is the hardness , which is an indication of the simplicity in finishing the material and its resistance to in - service scratching.18 the halloysite ( al2si2o5(oh)42h2o ) differs from micron - sized fibers / whiskers as it is formed of nano - sized crystals ( tubes ) . the halloysite nanotube ( hnt )
1920 halloysite has many advantages over many other nano - sized fillers ( such as carbon nanotubes / nanofibers ) since it is a naturally occurring mineral and is easy to purify .
accordingly , hnts are present in plenty amounts and are economical.21 additionally , halloysite is harmless , biocompatible , and can be simply processed.1921 the diameters of hnts are approximately in tens of nanometers , and the lengths are in the range from ~200 nm to 1 - 2 m.20 the chemical properties of the outer surface of hnts are close to sio2 , while those of the inner surface are close to al2o3 .
nano - sized crystals of hnts have a high degree of structural perfection and the related superior mechanical properties ; for example , the young 's modulus of hnts is expected to be in the range of 230 - 340 gpa , which is very close to that of imogolite nanotubes.2223 furthermore , halloysite has a unique characteristic as it is quite easy to be split into separate hnts and to be evenly distributed in dental matrices .
this is different from layered silicates ( such as montmorillonite ) , which are difficult to completely peel into nano - sized silicate layers and to uniformly spread in dental matrices .
the splitting is due to much larger distance between clustered hnts in halloysite than that between silicate layers in montmorillonite .
accordingly , the interactions between hnts is significantly lower than those between silicate layers in montmorillonite.24 therefore , this study aims to investigate the effect of incorporating hnts into pmma resin on the resin 's mechanical properties regarding flexural strength , hardness , and young 's modulus .
the null hypothesis was that hnts addition to pmma resin would not interfere with its mechanical properties .
a conventional heat - cured resin ( acrostone ; acrostone dental factory , under exclusive license of england , egypt ) was used as a matrix component and the as - received halloysite powder ( sigma - aldrich co. , st .
the specimens were categorized into four groups ( n = 10 ) coded a to d. group a was the control group ( unmodified acrylic resin specimens ) .
the specimens of the remaining three groups ( b - d ) were modified with addition of halloysite powder to attain ratios of 0.3 , 0.6 and 0.9 wt% . in accordance with the studies by ellakwa et al.,8 and sehajpal and sood,25 halloysite powder
was mixed with resin powder and liquid monomer in order to obtain an equal distribution of filler within the polymer matrix .
the halloysite powder and acrylic powder were thoroughly mixed using a mortar and pestle for initial mixing and blending , followed by hand tumbling in a plastic jar until an even color was obtained .
the resin powder was then mixed with monomer in a ratio of 2:1 by volume in a mixing jar with a tightly fitting lid .
specimens were prepared using stone molds made by investing stainless steel rectangles sized 65 mm 10 mm 3 mm and releasing the rectangles after stone setting.8915 the acrylic specimens were prepared by packing the acrylic resin into the stone molds present in denture flasks and curing them for 9 hours at 73.89. the cycle was completed by boiling for an extra 30 minutes .
the rectangular resin specimens were then removed from the flask . after removing flask and trimming the edges , the specimens were ground with 320-grit silicon carbide paper to obtain polished surfaces .
the specimens were stored in water at 37 for 7 days before performing the flexural strength test .
the flexural strength was measured using a three - point bending test in a universal testing machine ( lloyds , lrx , lloyds instruments , hampshire , uk ) at a crosshead speed of 5 mm / min .
the flexural strength ( fs ) and young 's modulus ( e ) could be calculated .
the value of e was the slope of the linear portion of the stress - strain curve , expressed as the ratio of stress / strain .
the calculation of fs ( in mpa ) and e ( in gpa ) was guided by the formulae : 262728 where ; f is the maximum load at the point of fracture ( in n ) , l is the span ( in mm ) , w is the width of the specimen ( in mm ) , and h its height ( in mm ) , while p / y is the slope of the linear part of the stress - strain curve within the elastic portion . for vickers testing ,
a separate group of specimens was prepared in molds obtained by investing stainless steel rectangles ( 12 mm 12 mm 3 mm ) within flasks.29 the liquid and powder were mixed in a predetermined ratio and modified with halloysite powder as mentioned earlier in the specimen preparation .
after polymerization , the specimens were visually examined for having smooth surfaces without voids or porosities.the specimens were manually wet - polished in a circular motion with a sequence of 600-grit , 800-grit , 1000-grit , and 1200-grit silicon carbide papers . to determine vickers values , a load of 30
g was applied for 30 seconds on the specimens using a digital hardness tester ( otto wolpert , werke , ludwigshafen , germany ) .
each specimen was subjected to three indentations ( one at the center and two at the borders ) , and the average value was calculated for each group from a to d.
the mean and standard deviation values for flexural strength , surface microhardness , and young 's modulus are presented in table 1 .
one - way analysis of variance identified significant differences between the mean values of both flexural strength ( p = .018 ) and surface microhardness ( p = .000 ) of the tested groups , while the young 's modulus mean values showed no significant difference ( p = .647 ) .
tukey test showed that there was no statistically significant difference in flexural strength values ( p > .05 ) between the tested groups and the control group ( no addition ) .
there was also no significant difference in flexural strength values ( p > .05 ) between the 0.6%(w / w ) halloysite nanotubes added acrylic resin group and 0.9% group .
the 0.3%(w / w ) halloysite nanotubes addition to acrylic resin increased the flexural strength values significantly in comparison to either 0.6% or 0.9% groups .
both 0.6% and 0.9% groups showed significant decrease in microhardness values when compared to either the control group or 0.3% group .
the addition of 0.3%(w / w ) halloysite nanotubes to acrylic resin significantly increased the resin 's microhardness values in comparison to the control group .
the young 's modulus values of 0.3% group showed a slight increase in comparison to those of all the other groups .
the young 's modulus values of 0.6% and 0.9% groups did not show a significant decrease when compared to those of the control group .
this study primarily aimed to investigate the probable method for the enhancement in the mechanical properties of pmma , especially in the flexural strength , surface microhardness , and young 's modulus , through incorporating halloysite nanotubes .
it was shown that incorporating 0.3 wt% of untreated halloysite nanotubes to a conventional heat - cured resin could improve the mechanical properties of pmma without additional processing steps .
therefore , dentures manufactured this way would not require a lengthy procedure , and the material 's regular use in dental laboratories would be encouraged due to its low cost and ease of handling and processing.1 the results illustrated that the addition of small mass fraction ( 0.3 wt% ) of hnts into pmma resin could result in a significant improvement of hardness values but neither in flexural strength nor young 's modulus values .
the followings were the possible causative factors : ( 1 ) the hnts that were strongly adhered to the resin reinforced the resin and accordingly enhanced the flexural strength , ( 2 ) the young 's modulus of hnts was higher than that of the resin , resulting in an overall increase , and ( 3 ) the hnts that were not strongly adhered to the resin could be scattered or dissociated during the load application ; this produced frictional force that permitted stress distribution across the matrix cracks , increasing the material resistance to indentation ( i.e. , hardness).30 in contrast , pmma resin modified with either 0.6 or 0.9 wt% of the hnts had flexural strength , hardness , and young 's modulus values , which were lower than those of the control specimens .
these results illustrated that the efficient strengthening would not be obtained at high percentage of hnt incorporation .
this may be possibly due to the development of hnt clusters , which could result in mechanical weak points ( structural defects ) .
the presence of such clusters would adversely affect the mechanical properties of the dental resin strengthened with hnts .
other possible explanations for the lower values could be : a reduction in the cross section of the load - bearing polymer matrix ; an increase in the amount of filler particles which increases the stress concentration ; changes in the modulus of elasticity of the resin and mode of crack propagation through the specimen due to an increased amount of fillers ; formation of voids by moisture or entrapment of air ; incomplete wetting of the fillers by the resin ; and the hnts ; behavior as an intervening factor in the integrity of the polymer matrix.313233 these results are similar to those of vojdani et al.,34 who investigated the effects of adding 0.5 - 5 wt% aluminum oxide ( al2o3 ) powder on the flexural strength and surface hardness of a conventional heat - cured acrylic resin and found that 2.5 wt% al2o3 powder addition significantly increased its flexural strength and hardness .
the results are also similar to those of chen et al.,30 who found that incorporation of small percentage ( 1% and 2.5% ) of the silanized hnts in bis - gma / tegdma dental resins / composites increased the mechanical properties effectively .
nevertheless , large percentage ( 5% ) of incorporation did not further enhance the mechanical properties .
accordingly , the results of this study rejected the null hypothesis since the introduction of small percentage of hnts into pmma resin affected its mechanical properties .
within the limitations of this study , the following results were obtained : incorporation of small percentage ( 0.3 wt% ) of hnts into pmma resin produced a significant increase in hardness values while the flexural strength and young 's modulus values did not show a significant increase compared to the control group .
high - percentage incorporation of hnts ( 0.6 or 0.9 wt% ) into pmma did not show a significant decrease in both flexural strength and young 's modulus values compared to the control group or small - percentage incorporation | purposethis study inspects the effect of incorporating halloysite nanotubes ( hnts ) into polymethyl methacrylate ( pmma ) resin on its flexural strength , hardness , and young 's modulus.materials and methodsfour groups of acrylic resin powder were prepared .
one group without hnts was used as a control group and the other three groups contained 0.3 , 0.6 and 0.9 wt% hnts . for each one , flexural strength , young 's modulus and hardness values were measured .
one - way anova and tukey 's test were used for comparison ( p<.05).results at lower concentration ( 0.3 wt% ) of hnt , there was a significant increase of hardness values but no significant increase in both flexural strength and young 's modulus values of pmma resin .
in contrast , at higher concentration ( 0.6 and 0.9 wt% ) , there was a significant decrease in hardness values but no significant decrease in flexural strength and young 's modulus values compared to those of the control group.conclusionaddition of lower concentration of halloysite nanotubes to denture base materials could improve some of their mechanical properties .
improving the mechanical properties of acrylic resin base material could increase the patient satisfaction . |
angina pectoris has been recognized as the cause of a variety of cardiac symptoms , including chest pain and pain that may radiate either to arm or to the neck and jaw .
foreman and colleagues anesthetized a primate and recorded the responses from the spinothalamic tract ( stt ) cells in the t1t5 and c5-c6 segments of the animal 's spinal cord following either occlusion of the coronary artery or the injection of algesic chemicals into the pericardial sac .
the authors also found a convergence of visceral and somatic input to the chest and upper arm .
their findings were consistent with the observation that referred pain associated with an attack of angina pectoris commonly occurs in proximal somatic fields .
the referred pain is explained by the convergence of visceral and somatic inputs to the same dorsal horn neuron in the nociceptive ascending pathway .
the dental literature has described the presence of toothaches attributed to angina attacks and coronary artery disease .
thus , referral to the somatic structures in the territory of the trigeminal nerve is one of the characteristics of anginal pain , and the neural mechanisms of this pain are of particular interest because such mechanisms appear to be due to a convergence of trigeminal and spinal inputs in either the spinal cord or the trigeminal sensory nucleus .
several lines of electrophysiological studies have demonstrated that an injection of algesic chemicals into the pericardial sac results in increased activity in c1-c2 stt cells [ 47 ] .
this finding suggests that angina - induced referred pain in the trigeminal nerve territory is attributed to the convergence of both inputs from the trigeminal nerve territory and inputs from the cardiac region to c1-c2 stt cells because it is known that these cells receive converging somatic information from the neck and jaw regions .
however , angina - induced referred pain in the trigeminal nerve territory induced by the convergence of both inputs from the cardiac region and inputs from the neck and jaw regions to c1-c2 stt cells was not found in clinical or experimental observations .
the trigeminal sensory nuclear complex ( tsnc ) is one of the components of the ascending sensory pathway that transmits sensory signals from the orofacial region to the higher centers of the brain .
therefore , this complex may be considered to a candidate for the relay nuclei that transmits angina - induced referred pain .
it is of particular interest to examine such a possibility because the mechanisms appear to be a convergence of trigeminal and spinal inputs in the tsnc .
one of the objectives of the present study was to determine whether the tsnc is involved in the ascending sensory pathway that transmits nociceptive signals from the cardiac region to the thalamus in the brain . during the twentieth century
, it was believed that nociceptive information from the cardiac region was input to the thoracic segments of the spinal cord via the cardiac sympathetic nerve , while the vagal afferent fibers were thought to transmit innocuous cardiac sensory information [ 1013 ] .
several morphological and electrophysiological studies from the late 1990s showed that vagal afferent fibers and the nucleus tractus solitarius play an important role in angina - related referred pain in the trigeminal nerve territory [ 4 , 5 , 7 , 14 ] .
this finding is consistent with clinical observations that neck and jaw pain continues or develops after the use of a sympathectomy to relieve anginal pain [ 15 , 16 ] .
the second aim of the present study was to identify the peripheral nerve that conducts the nociceptive signals that are input into the tsnc .
all of the experimental protocols used in the present study were approved by the institutional animal care and use committee of showa university and were in accordance with the guideline of the international association for the study of pain .
for example , the number of animals was kept to a minimum to minimize the animal 's discomfort .
the experiments were performed on male wistar rats weighing 400550 g ( n = 30 , charles river , tokyo ) .
the animals were housed in groups of 3 - 4 in a cage containing sawdust bedding and were granted free access to rat chow and water .
the laboratory was equipped with a 12 h/12 h ( 8 a.m./8 p.m. ) light - dark cycle .
the animals were anesthetized with urethane ( 1.2 g / kg i.p . ) .
after a tracheotomy was performed , the animals were artificially ventilated to maintain an end - tidal co2 level between 3.5 and 4.5% . an adequate level of anesthesia was determined by the absence of pupillary dilation or increases in heart rate . under the anesthetic condition in the present study
mean blood pressure was measured directly via a catheter that was inserted into the right femoral artery .
the mean blood pressure and the electrocardiogram were fed into an a / d converter ( ced 1401 + ) and were recorded using spike2 software ( ced , cambridge , uk ) .
the animal 's core body temperature was regulated at approximately 37.5c using a thermostatically controlled heating blanket .
the cardiac nociceptive receptors were stimulated chemically using a modified pain producing chemical mixture that was designed to excite both the vagal and sympathetic afferent endings .
the pps solution contained bradykinin ( 10 m ) , serotonin ( 10 m ) , prostaglandin e2 ( 10 m ) , histamine ( 10 m ) , and adenosine ( 10 m ) , all of which may be released during myocardial ischemia [ 1 , 19 , 20 ] .
the chemicals were individually dissolved in saline solution to a concentration of 10 m and were kept frozen . on the day of the experiment ,
the stock solutions were warmed and further diluted in normal saline to concentrations of 10 m ( except the adenosine which was diluted to a concentration of 10 m ) . using a modification of the procedure that was described by euchner - wamser et al .
the catheter was made of silicone tubing ( 0.020 i d , 0.037 od , 1416 cm length ) and was filled with 0.20.5 ml of warmed normal saline .
a thoracotomy was performed on the left costal cartilages of ribs 13 to expose the thymus gland and the heart .
the thymus gland was opened along the midline , and the catheter was carefully inserted into the pericardial sac over the left ventricle .
the catheter was fixed in place by suturing together the two thymus lobes and the layers of the chest wall . to test the pericardial catheter ,
0.2 ml of saline was easily injected and removed via a 1 ml syringe that was connected to the catheter . for nociceptive chemical stimulation of the heart
, 0.2 ml of the pps solution was infused into the pericardial sac through the catheter over 2030 s. the solution was then allowed to stand for 2 min .
the pps solution was withdrawn over 2030 s , then 0.2 ml of saline flush was infused for 2 min to rinse away the chemicals within the pericardial sac .
the infusion - withdrawal procedure of the pps solution and saline flush comprised one set of the experimental protocol , and three sets of this procedure were repeated at an interval of 2 - 3 min as 1 process . throughout the duration of the experiment ,
at least 10 min elapsed between each process . at 1.5 h after the final infusion process of infusion
, pontamine sky blue dye was infused into the pericardial sac to confirm that the pps solution did not leak through to the outside of the pericardial sac .
saline was substituted for the pps solution in the vehicle - infused group , although the experimental protocol remained identical to that performed on the pps - infused group . in the untreated control group ,
the catheter was inserted into the pericardial sac but no solution was infused . at the end of each experiment
, the animals were perfused intracardially with 0.02 m phosphate buffer ( pbs ) , followed by 4% paraformaldehyde in 0.1 m phosphate - buffered saline ( pbs ) . the spinal cord ( c1-c2 segments ) and the brain
were removed and placed in 4% paraformaldehyde in 0.1 m phosphate - buffered saline ( ph7.4 ) at 4c for 37 days .
the samples were then stored in a cryoprotected 30% sucrose solution in 0.1 m phosphate - buffered saline ( ph 7.4 ) at 4c for 37 days .
consecutive transverse 50 m sections were cut using a cryostat ( iec ) at 20c and then transferred immediately to ten alternate wells of polypropylene plates that contained pbs .
the sections were washed three times in pbs for 10 min each and were then incubated in 3% h2o2 for 30 min to stop endogenous peroxidase activity .
the sections were then incubated in a blocking solution that contained 3% normal goat serum ( ngs ) ( vertor laboratories , usa ) for 30 min . the sections were then incubated overnight in c - fos antibody that was taken from rabbits ( 1 : 5000 ; # sc-52 , santa cruz biotechnology , ca , usa ) at 4c .
at the completion of this incubation , the sections were washed in cold pbs three times for 10 min each at room temperature and then incubated with biotinylated anti - rabbit igg ( 1 : 1000 , dako ) for 120 min and peroxidase - conjugated streptavidin ( 1 : 1000 , dako ) for 60 min at room temperature .
all of the antibodies were diluted with pbs , which contained 1% normal goat serum and 0.5% triton x-100 .
for the peroxidase reaction , 3,3-diaminobenzidine tetrahydrochloride ( dab , sigma ) with nickel ammonium sulfate intensification was used .
the sections were mounted on slides , air - dried overnight , and then counter - stained with neutral red when necessary .
, a tie was gently pulled around the nerve , and then the left and right cervical vagus nerves were separated from the carotid artery and cut with a scissors . in a second group of animals ,
the involvement of c1-c2 neurons in pps - induced referred pain in the trigeminal nerve territory was examined by lesioning the c1-c2 segments of the spinal cord using a small knife without a laminectomy .
after the lesion was performed , the exposed upper cervical enlargement of the spinal cord was covered with bone wax .
the animals were provided at least 30 min rest after the procedure . for each animal ,
the fos - labeled cell profiles in 110 serial sections ( 9.1614.66 mm caudal to bregma ) including the trigeminal brainstem sensory nuclear complex were counted at the light microscope level , and camera lucida drawings were made of the cells .
the trigeminal sensory nuclear complex is divided into the principal sensory trigeminal nucleus ( pr5vl ) , subnucleus oralis ( sp5o ) , subnucleus interpolaris ( sp5i ) , and subnucleus caudalis ( sp5c ) . the nomenclature and nuclear boundaries were defined based on the atlas produced by paxinos and watson .
for each nucleus of the tsnc , the number of identified fos - labeled cells was counted for every three sections , and the total number of fos - labeled cells was calculated for each rat .
statistical analyses were carried out using student 's paired t - test to compare single groups before and after treatment .
the fos data were analyzed using one - way anova ( the multiple comparison test ) and/or student 's t - test , where applicable .
the animal 's mean blood pressure and heart rate after urethane anesthesia were approximately 80100 mmhg and 300350/min , respectively . to accomplish our objectives ,
special attention was given to the change in the mean blood pressure and the electrocardiogram following the infusion of either pps solution or saline into the pericardial sac .
no significant changes were observed in the mean blood pressure and the electrocardiogram for all of the rats that were tested ( data not shown ) . based on this finding , the influence of the infusion - withdrawal procedure of either pps solution or saline flush into the pericardial sac could be excluded in the present study .
figure 1 shows the c - fos expression in the c2 spinal segments following the infusion of the pps solution into the pericardial sac .
the number of fos - labeled cells in the c2 spinal segment was significantly higher in the pps - infused rats compared with the vehicle - infused and uninfused control rats . in the present study ,
data were used only from those animals whose number of fos - labeled cells in the c2 spinal segment increased following the infusion of pps solution into the pericardial sac because several lines of electrophysiological studies have demonstrated that an injection of algesic chemicals into the pericardial sac results in increased activity in c1-c2 stt cells [ 47 ] . in the tsnc , fos - like immunoreactivity was observed in the pps - infused rats ( n = 4 ) , in the vehicle - infused rats ( n = 4 ) , and even in the untreated control rats ( n = 4 ) . examples of c - fos expression are shown in figure 2 , and the number of fos - labeled cells is summarized in figure 3 . the number of fos - labeled cells for the pr5 , the sp5o , and the sp5i did not reveal significant differences across the treated groups .
by contrast , for the sp5c , a significant increase in the number of fos - labeled cells was observed bilaterally in the pps - infused rats .
no difference was observed in the number of increased fos - labeled cells in the pps - infused rats between the left and right sp5c ( figures 3(a ) and 3(b ) ) .
a comparison of the number of fos - labeled cells in the superficial layers ( marginal layer and substantia gelatinosa ) and magnocellular layer in the sp5c indicated that the number of fos - labeled cells in the superficial layers was significantly higher than in the magnocellular layer ( figure 4 ) . following either the vagotomy or a spinal cord lesion , the animal 's mean
blood pressure and heart rate did not significantly change compared to the values that were present before the surgical treatments , although they transiently increased after the lesion of the c1-c2 spinal segments .
for the pps - infused rats ( n = 6 ) , the effects of the vagotomy on c - fos expression in the c2 spinal segments and the sp5c are shown in a representative example in figure 5 , and the number of fos - labeled cells is compared between rats that did and did not receive the vagotomy in figure 6 .
a bilateral section of the cervical vagus nerves showed a significant decrease in the number of fos - labeled cells in both the sp5c and c2 spinal segments .
in contrast , the lesion of the c1-c2 spinal segments produced a significant increase in the number of fos - labeled cells in the sp5c .
this increase in the number of fos - labeled cells was observed in both the pps - infused ( n = 6 ) and the vehicle - infused ( n = 3 ) rats . examples of c - fos expression are shown in figure 7 , and the number of fos - labeled cells is summarized in figure 8 .
in the present study , special attention was given to the change of the mean blood pressure and the heart rate following both the infusion of either pps solution or saline into the pericardial sac and the surgical treatments , which were either the vagotomy or the spinal cord lesion .
the animal 's mean blood pressure and heart rate did not change significantly compared to the values that were present before infusion or surgical treatments , although a slight decrease was observed . from these findings
, the influence of the infusion - withdrawal procedure of either pps solution or saline flush into the pericardial sac was excluded from the present study , as was the influence of surgical treatments .
some electrophysiological studies suggest that angina - induced referred pain in the trigeminal nerve territory is attributed to the convergence of both inputs from the trigeminal nerve territory and inputs from the cardiac region to the c1-c2 stt cells [ 48 ] .
this convergence explained the mechanism that underlies referred pain in the trigeminal nerve territory associated with the angina pectoris .
the present study was the first study to demonstrate that nociceptive signals from the cardiac region are input to the tsnc , specifically to the sp5c . to compare the number of fos - labeled cells among the nuclei in the tsnc
, we counted the total number of fos - labeled cells in each nucleus , because each nucleus differed in area .
counting individual nuclei is considered an acceptable method for counting fos - labeled cells in the trigeminal sensory nuclear complex [ 2228 ] . in the present study , infusion of the pps to
the pericardial sac resulted in a significant increase in fos - labeled cells in the sp5c but not in other nuclei .
the sp5c is a component of the ascending sensory pathway that transmits nociceptive signals from the trigeminal nerve territory to the thalamus .
nociceptive information from the orofacial region is input to the sp5c and then transmits to the ventral posteromedial ( vpm ) nucleus of the thalamus .
therefore , it is likely that the activity of the sp5c neurons that is evoked by sensory signals from the cardiac region induces referred pain that is generally associated with an attack of angina pectoris in the orofacial region .
additionally , the unmyelinated afferent fibers that conduct nociceptive signals terminate to the superficial layers in the sp5c .
the result in the present study that the number of fos - labeled cells in superficial layers was significantly higher than that in the magnocellular layer suggests that the nociceptive signals from the cardiac region are transmitted to the thalamus via the superficial layers of the sp5c .
bilateral sections of the cervical vagus nerves completely reversed the c - fos expression that was found in the sp5c following the infusion of the pps solution into the pericardial sac .
this result shows that the nociceptive signals from the cardiac region to the sp5c were conducted by the vagal afferent fibers .
additionally , a small amount of fos - labeled cells was observed in the c2 spinal segment , which indicates that c - fos expression may be induced by surgical procedures . among the animals that received a lesion in the c1-c2 spinal segments ,
an increase in fos - labeled cells in the sp5c was observed in the vehicle - infused rats .
this result suggests that the lesion of the c1-c2 spinal segments influenced c - fos expression in the sp5c .
therefore , it is apparent that the lesion procedures affected the increase in fos - labeled cells in the pps - infused rats .
the rate of increase in the fos - labeled cells was greater in the pps - infused rats than that in the vehicle - infused rats .
for the animals that received the c1-c2 lesion , the number of fos - labeled cells was not reduced in the pps - infused rats compared with the vehicle - induced rats ; thus , it is possible that the nociceptive signals from the cardiac region were input to the sp5c via a neural pathway in the brain but not via the spinal cord .
unfortunately , the location of this neural pathway was not identified in the present study . in humans ,
the vagal afferent signals from the visceral organs , including the cardiac region , are not input to the sp5c , although the vagal afferent signals from the skin of the ear concha are input to the sp5c .
several morphological and electrophysiological studies have shown that vagal afferent fibers and the nucleus tractus solitarius play an important role in angina - induced referred pain in the trigeminal nerve territory [ 4 , 5 , 7 , 14 ] .
this evidence suggests that the nociceptive signals from the cardiac region are input to the sp5c via the nucleus tractus solitarius .
however , the pathway from the nucleus tractus solitarius to the sp5c has not been confirmed in anatomical studies .
it is possible that the output signals from the nucleus tractus solitarius are projected to the sp5c by way of other nuclei in the brain .
the descending projection from the sp5c to the spinal dorsal horn has been demonstrated anatomically [ 3135 ] .
therefore , the activation of sp5c cells induced by nociceptive signals from the cardiac region may explain the results from prior studies that injection of algesic chemicals into the pericardial sac resulted in an increase in activity among the c1-c2 stt cells [ 47 ] . in conclusion ,
nociceptive signals from the cardiac region are input to the sp5c via an unknown pathway in the brain .
these signals are transmitted to secondary neurons at the superficial layers in the sp5c and then projected to the thalamus .
this ascending pathway may contribute to angina - induced referred pain in the trigeminal nerve territory . | the present study was designed to determine whether the trigeminal sensory nuclear complex ( tsnc ) is involved in angina - induced referred pain in the trigeminal nerve territory and to identify the peripheral nerve conducting nociceptive signals that are input into the tsnc . following application of the pain producing substance ( pps ) infusion ,
the number of fos - labeled cells increased significantly in the subnucleus caudalis ( sp5c ) compared with other nuclei in the tsnc .
the fos - labeled cells in the sp5c disappeared when the left and right cervical vagus nerves were sectioned .
lesion of the c1-c2 spinal segments did not reduce the number of fos - labeled cells .
these results suggest that the nociceptive signals that conduct vagal afferent fibers from the cardiac region are input into the sp5c and then projected to the thalamus . |
kinematic parameters were evaluated in mouse epididymal extracts to monitor maturation of sperm movement in animals exposed to static magnetic fields using the sperm - class analyzer computerized image analysis system . for this purpose , animals were exposed to a field of 0.7 t generated by a permanent magnet over 10 or 35 days for either 1 or 24 hr / day .
the values of the motion endpoints were similar in animals used as controls and in those exposed to the nonionizing radiation , whatever the period of exposure or daily dosage .
changes in motility were observed in all groups : the percentage of total motile and progressive motile spermatozoa increased during passage through the epididymis , with major changes between the caput and corpus epididymides , and the pattern of swimming changed clearly towards more rapid and straighter trajectories .
the processes of initiation of sperm motility and maturation of displacement patterns were not then affected by magnetic treatment .
moreover , it appears that sperm production is unaffected because no changes were observed in testicular or epididymal weights after exposure to static magnetic fields.imagesfigure 1.figure 2.figure 3 . |
|
dislocation of the intraocular lens ( iol ) after cataract surgery has been reported to occur in 0.2% to 1.8% of the patients [ 1 , 2 ] .
this uncommon ocular complication is important because it leads to serious visual disturbance that may need complicated surgical correction .
iol dislocation during the early postoperative period occurs because of inadequate capsular bag or ciliary sulcus support , whereas optic or haptic induced capsular damage can lead to iol dislocation at a later stage [ 3 , 4 ] .
a variety of techniques for managing dislocated iols have been reported which can generally be classified into open- and closed - eye procedures [ 512 ] .
extraction of the dislocated iol in the open eye method involves removal of a dislocated iol through a large corneal incision followed by exchanging with a new secondary iol .
it accompanies the risk of vitreous prolapse , ocular collapse , intraocular hemorrhage , and induction of large amounts of astigmatism .
repositioning of the dislocated iol using a closed - eye method is a desirable alternative ; however , it entails disadvantages such as surgical difficulty and multiple instrument passages . during surgical intervention ,
an important consideration is whether to remove , exchange , or reposition the dislocated iol .
the decision to undertake exchange or refixation of a dislocated iol is usually made based on the clinical features of an individual case .
if dislocated iol is not adequate for reposition , it may be removed and exchanged .
however , when there is no contraindication to reposition and sclera fixation of dislocated original iol , the patient may receive a sclerally sutured iol .
several previous studies have already identified improved best corrected visual acuity ( bcva ) after sclerally fixated sutured posterior chamber intraocular lens ( pciol ) in patients with dislocated iols [ 1 , 4 , 12 ] .
the aim of this study was first to introduce in situ refixation technique , which is a novel repositioning technique using a bilimbal small incision to manage posteriorly dislocated iol , and then to evaluate its surgical efficacy in a retrospective comparative study .
the study protocol was approved by the institutional review board of the kyungpook national university school of medicine .
a retrospective review was conducted on the medical records of 34 eyes of 34 patients with dislocated iols who underwent iol exchange or in situ refixation combined with vitrectomy between january 2010 and may 2015 .
all surgeries were performed by one surgeon ( h. k. kim ) at kyungpook national university hospital , daegu , republic of korea .
patients aging 18 or older , who have suffered dislocated iol without ample capsular support and so have to undergo scleral fixation surgery of dislocated iol , were included .
the exclusion criteria were as follows : ( 1 ) history of underlying corneal disease ( e.g. , corneal laceration , bullous keratopathy , or fuchs ' dystrophy ) ; ( 2 ) glaucoma ; ( 3 ) history of optic neuritis ; ( 4 ) state of aphakia ; ( 5 ) history of previous iol dislocation ; and ( 6 ) follow - up duration less than 6 months .
the 34 patients in the study were divided into two groups based on the surgical techniques for managing dislocated iols : the iol exchange group and the in situ refixation group .
the patients in the iol exchange group underwent removal of dislocated iol and concurrent secondary iol implantation with scleral fixation .
the patients in the in situ refixation group underwent repositioning of the dislocated iol using a bilimbal small incision with double haptic scleral fixation .
the surgical technique was chosen with the following considerations : iol design , kinds of optic material , presence of deformation of the iol , and necessity of refractive change .
patients with dislocated iol , which was 3-piece design without any deformation , were chosen for in situ refixation technique .
patients , who had late haptic or single piece designed iol , any deformation or breakdown of iol , and the needs for refractive correction , were undergone with iol exchange technique .
all patients underwent vitrectomy for anteriorly prolapsed vitreous before the scleral fixation of iol under general anesthesia .
vitrectomy techniques were chosen at the surgeon 's discretion according to the states of dislocated iols and vitreoretinal pathology .
pars plana approach was performed in cases with complete iol dislocation into the vitreous cavity or dislocation posteriorly with one haptics adherent to the vitreous base .
a 23-gauge standard three - port vitrectomy was setup to remove the vitreous and free the dislocated iol from vitreous adhesions .
following placement of the infusion cannula , two sclerotomies were placed through the pars plana . in each cases of ppv ,
the surgeon attempted a complete vitrectomy that extended to the periphery to remove as much vitreous as possible , because the residual vitreous might induce iol kinking and vitreoretinal traction afterward .
after core vitrectomy , the peripheral retina was carefully examined with sclera indentation to remove the vitreous gel and find any retinal break .
two 23-gauge peeling forceps were introduced into the vitreous cavity through the two previously positioned port sites to grasp and raise the dislocated iol up to the back of the iris plane so the iol could be clearly visualized .
in contrast , when prolapsed vitreous was present in the anterior chamber , av was performed with introducing a bimanual port through a corneal incision site to remove and prevent traction on vitreous strands .
after vitrectomy , an iol was sclerally fixated with the two different surgical methods : conventional iol exchange or iol refixation .
a conjunctival incision was created and two - half thickness triangular scleral flaps with 180 apart were performed . in the iol exchange group ,
a slit knife was used to make an approximately 6.0 mm superior corneal incision .
in contrast , 1.5 mm sized two limbal incisions on opposite sides of direction were made in the iol refixation group ( figure 1(a ) ) .
the dislocated iol is visualized at the back of the iris plane after being floated from the vitreous cavity through vitrectomy procedure .
the anterior chamber was maintained using an ophthalmic viscosurgical device ( ovd ) ( sodium hyaluronate 1.65% , chondroitin sulfate 4% [ discovisc ] ) during scleral fixation .
a 10 - 0 polypropylene ( prolene ) suture was inserted with a curved needle under the scleral flap about 1.52.0 mm posterior to the limbus and it was pulled out to the opposite sclera flap ( figure 1(b ) ) . in the iol refixation group , the suture thread was hooked out of the eye through limbal incision site and cut in two pieces .
each haptics was externalized through one of the limbal incision sites , and the cut suture threads were tied to each haptics ( figures 1(c ) and 1(d ) ) .
once the suture was tied and tensed to the haptics , it was reinserted intraocularly . after tightening sutured haptics , centration of the lens
a stromal hydration was performed at both edges of the two limbal incision sites instead of suture to help seal it . in the iol exchange group ,
when we used iol cutter or refolding technique for the removal of dislocated iol , we made 3.5 mm superior limbal incision . in cases of rigid optic material , such as poly(methyl methacrylate ) ( pmma ) , 6 mm sized superior scleral tunnel incision was used .
the dislocated original iol was grasped with an intraocular forceps and carefully extracted through superior incision .
after the dislocated iol was removed , a retrieved suture was pulled out through the same site with h - hook and cut . in all patients in the iol exchange group ,
a new secondary iol was chosen as model mn60ac ( alcon laboratories , inc . ) , which is a foldable 3-piece acrylic iol .
the corneal incision site was sutured using 10 - 0 ethilon and conjunctival suture was made with 8 - 0 vicryl .
the following parameters were included before and after surgery : age , gender , bcva , intraocular pressure ( iop ) , endothelial cell density , and spherical equivalent as determined by biometry using an autorefractometer ( topcon , kr-8800 , autokeratorefractometer , tokyo , japan ) and iol master ( carl zeiss meditec , jena , germany ) . surgically induced astigmatism ( sia ) and surgical complications were also assessed .
potential postoperative complications included marked iop elevation higher than 25 mmhg , corneal decompensation , iol redislocation or capture , suture knot exposure , cystoids macular edema ( cme ) , vitreous hemorrhage , retinal break or detachment , and endophthalmitis .
visual acuities were measured with snellen 's chart , and values were converted to the logarithm of the minimum angle of resolution ( logmar ) .
corneal endothelial cell density ( cells / mm ) was inspected in central corneal endothelial cells with a noncontact specular microscope ( topcon corp .
, sp-3000p , japan ) , and analyzed by manual check of the automatic analysis software before the operation and 3 months after the operation .
macular optical coherence tomography ( oct ) ( carl zeiss meditec , dublin , ca ) was performed in the case of the presence of metamorphopsia or reduced bcva during the follow - up .
all patients in this study underwent ppv or av before the sclera fixation of iol .
undergoing ppv may influence the surgical outcomes and induce the difference among patients so the subjects were also classified into two groups according to the surgical option of vitreous management .
the ppv group included patients with sclera fixation of iol who underwent full vitrectomy , and the av group comprised patients with sclera fixation of iol who underwent av only .
the relationship between the iol exchange and iol refixation groups was compared using student 's t - test .
the subjects included 29 men and 5 women , ranging in the age from 40 to 79 years .
the mean postoperative follow - up was 8.3 months ( range : 612 months ) . of 34 eyes , 17 eyes ( 50% )
were assigned to the iol exchange group and 17 eyes ( 50% ) were assigned to the iol refixation group .
there was no significant difference in terms of preoperative age , axial length , and postoperative follow - up duration between the two groups .
the cause of iol dislocation seemed to be eye trauma in four eyes , pseudoexfoliation syndrome in three eyes , inadequate capsular support after neodymium : yttrium - aluminum - garnet ( nd : yag ) capsulotomy in three eyes , inadequate capsular or zonular support in the absence of nd : yag capsulotomy in four eyes , and unknown cause in 20 eyes .
the preoperative underlying ocular diseases in the iol exchange group were previous rhegmatogenous retinal detachment in 3 eyes ( 2 eyes underwent ppv and 1 eye underwent segmental scleral buckle procedure ) and diabetic retinopathy in 2 eyes .
the iol refixation group included 1 vitrectomized eye owing to previous retinal detachment , 1 eye with diabetic retinopathy , and 1 eye with previous branch retinal vein occlusion history .
mean bcva ( logmar ) significantly improved from 0.35 0.24 preoperatively to 0.11 0.08 postoperatively at 3 months in the iol exchange group and from 0.31 0.20 preoperatively to 0.10 0.08 postoperatively in the iol refixation group ( p < 0.001 , for both groups ) .
however , both preoperative and postoperative visual results were similar between the eyes that underwent iol exchange and the eyes that underwent iol refixation ( p = 0.613 and p = 0.790 , resp . ) . no statistically significant difference was found between bcva at 3 months and bcva at 6 months ( 0.10 0.03 ) ( p = 0.096 ) in iol exchange group and iol refixation group ( 0.10 0.05 ) ( p = 0.065 ) .
notably , the iol refixation group exhibited significantly less sia ( 0.79 0.41 ) compared to the iol exchange group ( 1.29 0.46 ) 3 months after surgery ( p = 0.004 ) .
this significant difference in sia persisted to 6 months ( 1.13 0.18 in the iol exchange group and 0.74 0.11 in the refixation group ; p = 0.006 ) . in the iol exchange group , the mean spherical equivalent ( diopter ) changed from 2.34 6.84 to 0.73 1.29 ( p = 0.083 ) , while , in the iol refixation group , the parameter significantly improved from 2.80 5.97 to 1.18 0.96 ( p = 0.02 ) .
the preoperative and postoperative mean spherical equivalents were similar between the two groups ( p = 0.842 and p = 0.271 , resp . ) .
we also analyzed visual outcomes of the two groups classified according to the surgical method of vitreous management : ppv or av .
mean preoperative bcva ( logmar ) were 0.42 0.63 in ppv group and 0.33 0.30 in av group ( p = 0.56 ) .
mean postoperative bcva ( logmar ) were also similar between the ppv group ( 0.21 0.21 ) and the av group ( 0.10 0.14 ) ( p = 0.08 ) . both groups showed a significant decrease in postoperative endothelial cell density compared to the density before surgery ( p = 0.003 in the iol exchange group and p = 0.015 in the iol refixation group , resp . ) .
however , no significant between - group difference was found before surgery ( p = 0.232 ) and at 6 months after surgery ( p = 0.612 ) ( table 4 ) .
iop elevation over 25 mmhg occurred in 2 out of 34 eyes ( 5.9% ) from the first day after surgery .
elevated iop was well controlled with antiglaucoma topical medication , and iop was maintained within the normal range at the final visit time .
furthermore , the two groups showed reduction of iop from 17.1 4.7 preoperatively to 16.5 2.8 postoperatively in the iol exchange group and from 16.0 3.3 preoperatively to 14.8 3.0 postoperatively in the iol refixation group .
the between - group difference was not statistically significant before surgery ( p = 0.747 ) and after surgery ( p = 0.230 ) .
in addition , the iop reduction was not significantly different between the two groups ( p = 0.421 and p = 0.163 , resp . ) ( table 5 ) .
postoperative complications developed in 3 eyes ( retinal break , transient vitreous hemorrhage , iop elevation ) that underwent iol exchange and 2 eyes ( pupillary optic capture of iol , iop elevation ) that underwent iol refixation .
one case of vitreous hemorrhage developed in the iol exchange group , but it was transient and resolved at the final visit without needing additional vitreous surgery .
after pupil dilatation , the patient remained in a supine position and optic capture resolved spontaneously .
other postoperative complications , such as redislocation of iol , cme , retinal detachment , hypotony , secondary glaucoma , and infective endophthalmitis , were not observed .
in our retrospective study , the results showed that the in situ refixation technique had less sia than iol exchange at 3 months and it persisted at 6-month postoperative follow - up time .
the iol exchange method requires a larger corneal incision to remove dislocated iol , but the in situ refixation technique minimized the cornea incision size .
therapeutic options were typically decided based on the clinical features of individual cases . a variety of methods for managing dislocated iol have been reported , including observation , iol exchange , and iol refixation [ 511 ] .
several comparative clinical studies have been reported , but relatively few studies have considered postoperative outcomes , particularly in terms of sia after iol scleral fixation surgery . theoretically , iol refixation is the optimal surgical option because it is less traumatic than extracting the dislocated iol and it provides structural stability . in the iol exchange technique , extraction of the dislocated iol with an open - system method
carries the risk of ocular structural damage , vitreous prolapse , hypotony , and corneal astigmatism induced by a large corneal wound .
therefore , iol refixation using a closed - eye method is a more preferred surgical technique if it can be performed with intact haptics .
oh et al . reported that there was no significant difference in sia between iol exchange and iol refixation groups despite the considerable sia by corneal incision performed during surgery in the iol exchange group .
however , our study showed significantly less sia in the iol refixation group at postoperative 6 months .
bilimbal incision for haptic externalization might have an impact on lowering sia when compared to the sutureless iol fixation method of the previous study .
notably , the most common postoperative complication was a significant decrease in endothelial cell density in both the iol exchange and the iol refixation groups .
wang et al . reported that corneal endothelial cell density decreased remarkably after iol exchange or refixation surgery without a significant difference in the decrease between the two groups .
we initially predicted that the iol refixation group would have less decrease in endothelial cell density than the iol exchange group because the smaller incision would cause less trauma to the corneal endothelium .
however , all patients in the two groups underwent scleral fixation and the loss of endothelial cell density might be attributable to this increased surgical manipulation .
similar to the previous studies , our results showed significantly decreased endothelial cell density in both groups , but there was no statistically significant difference between the two groups .
there was 1 case of iop elevation in each group during the follow - up period . increased iop occurred in 5.9% of the patients who underwent iol exchange and iol refixation , respectively , which is a relatively lower incidence compared to the previous studies [ 9 , 17 ] .
although we excluded patients with preexisting glaucoma in this study , the reason for a lower incidence of iop elevation remains to be explained .
iop increase in two patients was well managed with iop - lowering medication within 1 month after surgery , so iop elevation may not affect the final functional outcome in the long term . during the follow - up time , both groups showed slight decrease of mean iop at final visit compared to preoperative values .
although the magnitude of iop reduction was not statistically significant either iol exchange or iol refixation group , the reason for iop lowering effect after surgery should be further studied for a longer period .
the iol refixation group had 1 case of pupillary optic capture of iol , and it was spontaneously resolved with pupil dilatation and position change . moreover ,
1 case of postoperative retinal break and transient vitreous hemorrhage occurred in the iol exchange group .
sclerally fixated iol implantation in the posterior capsule carries the risk of vitreous hemorrhage and retinal breaks with consequent retinal detachment . in spite of these postoperative vitreoretinal complications ,
bellamy has reported that 22% of eyes that underwent ppv with iol removal and exchange to open loop anterior chamber iol presented cme . in this study ,
manipulating iol while extracting it through incision site , especially avoiding contact with uvea , might induce this result .
suture - related complications , such as knot exposure , suture degradation or breakage , and iol decentration or tilting were not found in either the iol exchange or the refixation group . a significantly improved final mean bcva was achieved in both groups , but the between - group difference was not statistically significant .
surgical techniques should be selected based on the ophthalmological features of individual patients with regard to the status of the dislocated iol , adequate capsular support , and concurrent ocular complications . in this study ,
the most important factor for consideration was the status of the dislocated iol , such as damaged or highly flexible haptics that were unsuitable for adequate suture support and the size and material of optics .
the postoperative results showed that the iol refixation group had a lower magnitude of sia than the iol exchange group .
although iol exchange technique has the advantage of being useful no matter the type of iol and degree of dislocation , it necessarily leads to a large corneal incision and sia .
removal of the dislocated iol through a large corneal incision site is also accompanied by the possibility of vitreous prolapse , cornea endothelium and iris damage , hypotony , and retinal damage , such as retinal break or retinal detachment [ 21 , 22 ] .
in contrast , iol refixation has the advantage of leading to relatively less sia than iol exchange , owing to the small incision size maintaining structural stability .
however , this surgical technique has limited indication because it can only be conducted in case of intact haptics with adequate suture support .
this technique has disadvantage for the difficulty in manipulating the haptics while extracting it through bilimbal incision site .
iol refixation includes scleral sutured pciol procedure so it also has comparable potential complication like other sclera refixation , such as iol redislocation or capture , suture breakage or suture knot exposure , vitreous hemorrhage , and cme .
[ 8 , 23 ] previously reported that refixation of dislocated iol into the ciliary sulcus using residual capsule for support is the most commonly used surgical technique .
this nonsuturing technique is the least traumatic to the ocular structure compared to fixating the iol into the sclera by suture because it avoids excessive surgical manipulation .
however , it can be performed for selected patients who have adequate residual peripheral capsular support . in patients with a lack of suitable capsular support
numerous methods are currently used for transscleral fixation of iols and each technique has its advantages and drawbacks .
hoffman et al . reported modified sclera fixation technique using a sclera pocket through a clear corneal incision which avoids the need for conjunctival dissection or sclera cautery .
reported sutureless intrascleral pciol fixation technique using a limbus - parallel tunnel of 50% sclera thickness starting from the ciliary sulcus sclerotomies without the need for suturing procedures .
previously reported studies have disadvantages for potential complications of suture erosion , suture - knot exposure , and recurrent dislocation . despite a variety of surgical techniques for managing dislocated iols , a definitive surgical technique for dislocated iol rescue
the surgical option is generally decided based on a surgeon 's best judgment given an individual patient 's characteristics , and it usually provides significantly improved visual acuity without serious irreparable postoperative complications . in this study , we also reorganized the patients into two groups according to the surgical method of vitreous management as ppv group and av group .
a previous study reported similar degree of visual improvement in patients who underwent sclera fixation of pciol with ppv or av .
. limitations of this study include analyses from retrospective design and small number of cases ( 34 eyes ) with relatively short follow - up periods ( 6 months ) .
this study includes lack of measurements with evaluating astigmatism using corneal topography or scheimpflug imaging .
furthermore , we did not consider the effect of ppv except for preoperative and postoperative bcva .
previous studies have reported that the performance of a combined ppv has an impact on a more complicated condition .
future studies with larger scales in patients and longer follow - up with evaluating sia from various methods are highly recommended to confirm true statistical significant difference . in conclusion , in situ iol refixation is a beneficial surgical technique in iol dislocation , producing less sia compared to iol exchange with scleral fixation .
the two groups had similar results for bcva , iop , endothelial cell density , and postoperative complications , with no significant difference at the final follow - up visit .
therefore , iol refixation technique can be the preferred surgical option because it provides early visual rehabilitation in patient with a dislocated iol but no damage in haptics . in situ iol refixation for managing iol dislocation | purpose . to evaluate surgical efficacy of in situ refixation technique for dislocated posterior chamber intraocular lens ( pciol )
. methods .
this was a single - center retrospective case series .
34 patients ( 34 eyes ) who underwent sclera fixation for dislocated iols combined with vitrectomy were studied . of 34 eyes , 17 eyes underwent iol exchange and the other 17 eyes underwent in situ refixation .
results .
mean follow - up period was 6 months .
mean logmar best corrected visual acuity ( bcva ) was not significantly different between the groups 6 months after surgery ( 0.10 0.03 in the iol exchange group and 0.10 0.05 in the refixation group ; p = 0.065 ) .
surgically induced astigmatism ( sia ) was significantly lower in the refixation group ( 0.79 0.41 ) than in the iol exchange group ( 1.29 0.46 ) ( p = 0.004 ) at 3 months , which persisted to 6 months ( 1.13 0.18 in the iol exchange group and 0.74 0.11 in the refixation group ; p = 0.006 ) .
postoperative complications occurred in 3 eyes in the iol exchange group ( 17.6% ) and 2 eyes in the refixation group ( 11.8% ) .
however , all of the patients were well managed without additional surgery .
conclusion .
the in situ refixation technique should be preferentially considered if surgery is indicated since it seemed to produce a sustained less sia compared to iol exchange . |
understanding a protein s structure
is fundamental to understanding
that protein s function . identifying interaction partners ,
sites of interaction , and
the structural architecture of multiprotein
complexes is fundamental to determining their role in cellular processes .
protein cross - linking coupled with bottom - up mass spectrometry ( xl - ms
or cx - ms or clms ) has been gaining ground in recent years as a tool
for elucidating the structure , architecture , and dynamics of large
multiprotein complexes .
xl - ms differs from traditional bottom - up tandem mass spectrometry
( ms / ms ) in that the protein mixture is subjected to a chemical cross - linker
prior to digestion and analysis by mass spectrometry ( for reviews ,
see refs ( 1214 ) ) .
the chemical cross - linker binds
protein residues on both ends and has a spacer arm of known length
in between . after analysis and identification of linked peptides by
mass spectrometry , the linked peptides and positions may be mapped
to proteins and indicate which residues in those proteins are near
one another in solution . these known distances within and between
specific positions in proteins
may serve as unique distance restraints
( udrs ) when used in conjunction with molecular modeling , protein structure
prediction , or other structure - based methods .
although xl - ms promises a wealth of structural
information , the
automated identification of cross - linked peptides from tandem mass
spectra has been a difficult computational problem .
the cross - linking
reaction and digestion may produce different species of peptides ( cross - linked ,
loop - linked , and unlinked ) ( figure 1 ) that have different scoring characteristics .
moreover ,
the search space for candidate pairs of cross - linked peptides matching
a precursor ion s m / z is
prohibitively large for sequence databases typically used in proteomics
analysis .
several algorithms have made significant progress toward
addressing this complexity and have been widely adopted for automated
xl - ms analysis , including kojak , plink , crux , xquest , stavrox , protein
prospector , sim - xl , and hekate . while these software
packages enable many researchers to identify cross - linked peptides
and proteins , the visual interfaces to the data and results are limited .
because each software package produces its own proprietary scores
and reads and writes its own file formats , the data are usually not
portable or compatible with interfaces provided by other software .
direct comparison of results from separate software packages ( or even
different versions of the same software ) is difficult .
depiction of the b- and
y - ion series generated from bottom - up xl - ms
peptide fragmentation and supported by proxl .
proxl treats monolinks
( where only one end of a cross - linker has reacted with a peptide residue )
as a special case of a post - translational modification ( ptm ) .
the ion series is typical of those found in non - xl - ms experiments .
there are separate b- and y - ion series for each of the linked
peptides , where the mass of the other peptide is considered as a modification
of the mass of the linked residue , as if it were a ptm .
several visualization tools have been developed
to extend the data
visualization capabilities provided by the native xl - ms search software .
xlink analyzer is a software extension
to the ucsf chimera molecular modeling
software package that enables import , visualization , and structural
analysis of reported udrs .
xinet is a
dynamic web application and javascript library that provides dynamic
and compelling two - dimensional views of xl - ms search results .
protein
interactions found in tools like cytoscape with scaled horizontal bars representing the lengths of individual
proteins found in protein sequence annotation tools .
xvis is a web application that provides elegant two - dimensional
network topology visualization of xl - ms results , including a topology
display similar to xinet and circos - style displays of the data . unlike xlink analyzer
, xvis does not depend
on third - party software for visualization , and unlike both xlink analyzer
and xinet , xvis provides direct access to the underlying proteomics
data ( e.g. , mass spectra ) .
however , this functionality depends on
xquest for data analysis and the availability of a local xquest server .
xlink - db is a web application and database
for storing , viewing , and disseminating xl - ms results .
it includes
two - dimensional ( 2d ) and three - dimensional ( 3d ) visualization and
analysis tools .
while its emphasis on public dissemination and visualization
of data from any pipeline is a step in the right direction , it depends
on third - party plugins to function , depends on the use of the uniprot database for protein sequence annotation , and
is ( at the time of this writing ) limited to experiments from escherichia coli , homo sapiens , saccharomyces cerevisiae , and arabidopsis thaliana . here
we present proxl ,
a web application and database for storing ,
visualizing , and sharing xl - ms data that is cross - platform and independent
of search software and protein sequence annotation database , does
not require third - party software , provides integrated access to all
underlying proteomics data , and functions equally well for any organism .
proxl provides dynamic 2d and 3d visualization , reporting , and analysis
tools , including quality control tools and data downloads for optional
integration into third - party software for more advanced analysis .
proxl includes advanced data sharing tools , both public and private ,
and is designed to enable collaboration among project researchers .
proxl consists of a web
application , relational
database , and data import program .
the web application was developed
using java , html , css , svg , and javascript and was designed to run
on the apache tomcat ( http://tomcat.apache.org/ ) java servlet
container and the struts application framework ( http://struts.apache.org/ ) .
the built - in protein data bank ( pdb ) structure viewer uses the
pv structure viewer ( https://github.com/biasmv/pv ) , which is pure javascript , and requires no third - party
plugins to run .
spectra are visualized by a version of the lorikeet
spectrum viewer ( http://uwpr.github.io/lorikeet/ ) that we have modified to view loop - linked and
cross - linked ion series .
real - time protein sequence annotations for
disordered regions and secondary structure prediction are provided
by disopred3 and psipred3 and are executed in response to user requests
by the jobcenter job management system running on the authors servers .
the relational database
was developed using the mysql ( https://www.mysql.com/ )
relational database management system .
the import program was developed
using java and xml ( see below for more information on the xml schema ) .
all of the components of proxl are cross - platform and will run on
any platform for which java is available . on
the client side , there is no installation
required for users of proxl ( other than using a current web browser ) .
all viewers and functionality are written using standard worldwide
web technologies and do not require any external programs or web browser
plugins . on the server side , proxl makes use of multiple database
and web application components and will require basic knowledge of
mysql and system administration to install and configure . specifically ,
apache tomcat and mysql will need to be installed ( if not already
installed ) , sql scripts executed to set up the database , and values
changed in the database to configure the web application .
proxl s data design is
independent of any particular software pipeline that generates cross - link
search results ( figure 2 ) .
this is accomplished by abstracting types of data common to all
cross - linking pipelines into a common set of core tables that describe
items such as the identified udrs ( i.e. , which protein loci were found
to be linked to one another ) , the scan data , and the identified peptide
sequences .
the scores assigned to peptide spectrum matches ( psms )
and peptides from individual software pipelines are stored in score
tables that describe which search program was used , which scoring
attributes were present , how to treat those scoring attributes , and
what score for which attribute each psm or peptide received .
a diagram
of the proxl database schema is shown in figure s-1 in the supporting information .
( a ) different
software pipelines produce data files using their own disparate formats .
writing and maintaining programs to import this native data directly
into the complex proxl database schema would be complex , error - prone ,
and difficult for developers of new pipelines .
instead , simple scripts
are used to convert native data into the simple and well - documented
proxl xml format , which is a generalized format for representing xl - ms
data and includes descriptions of which scores are present and how
the scores are to be treated by proxl .
a central program , maintained
by the proxl developers , is used to import proxl xml files into the
database .
( b ) this cartoon overview of the database schema illustrates
how proxl generalizes the association of scores from any pipeline
with xl - ms data .
score types described by proxl xml files are stored
in score - type tables , where the names , descriptions , and properties
of scores present in the xml are stored .
scores for psms and peptides
are associated with both this score type and a generalized abstraction
of psms and peptides applicable to all search programs ( e.g. , sequence
for peptides ) .
psms are associated with scans , psms and peptides with
searches , and searches with udr information , lookup tables , and other
generalized attributes .
importing data into the proxl database is accomplished by
converting
the native output of the respective software pipelines into an xml
file adhering to the proxl xml schema ( figure s-2 ) . like the proxl database schema ,
this xml schema is independent
of any particular software pipeline . which psm - level and peptide - level
scoring attributes are present for the respective software pipeline
are included and described in the xml , including how to label it ,
how to sort it , and default filter values .
this design allows the
output of nearly any conceivable pipeline , regardless of the type
of numeric scores generated , to be represented in this xml format
and imported into proxl for visualization , analysis , and comparison .
additionally , using this xml schema as a common standard for importing
data dramatically simplifies the process of developing and maintaining
importers for new software pipelines , as developers are shielded from
the complexity of the database schema itself .
the schema includes
xml schema validation rules designed to help ensure the integrity
of the data in the file .
the schema xml schema definition ( xsd ) file ,
documentation , and programs for converting kojak ( with and without
the percolator postsearch analysis ) ,
crux , plink , stavrox , and xquest output to proxl xml are available
at https://github.com/yeastrc/proxl-import-api .
proxl
is also designed to be independent of the specific fasta
file or sequence database used to search peptides .
the fasta data
files are preprocessed before the data is uploaded to proxl so that
the strings representing proteins are mapped back to a nonredundant
protein sequence database .
proteins identified
in different experiments using different search databases data can
be directly compared .
usage and installation documentation
for this application are available at our documentation site ( http://yeastrc.org/proxl_docs/ ) .
proxl includes html
tables and dynamic , graphical views of the data . in all cases ,
for example , a table of identified udrs in a given run shows
which positions in which proteins were found to be linked to one another .
if additional information about the identification is required , the
row may be expanded to view all of the underlying peptides .
this may
be further expanded to view all of the underlying psms and associated
spectra .
for all graphical views , the current state of the viewer
( i.e. , all selected options and protein positions ) is encoded in the
current url for the web page .
because of the breadth of options and
complexity of the data , significant time may be invested in achieving
the desired view of the data .
whenever an option changes , the url
is automatically updated to reflect the change in state . as such ,
this url may be bookmarked or shared with other users who have access
to the project to simplify collaboration and sharing of specific views
of the data .
additionally , for all views , the current view of the
data ( including all options ) may be saved as the default view of a
given search s data for the viewer , allowing the desired view
of the data to be shared with other users .
detailed documentation
of all features is available at the proxl documentation site ( http://yeastrc.org/proxl_docs/ ) or by clicking the help icon
near the top right of any page in proxl . proxl s
3d structure viewer
allows cross - links , loop - links , and monolinks to be visualized on
interactive graphical representations of protein structures ( figure 3b ) .
this is accomplished
by providing tools for users to upload a pdb file ( whether their own
or from the pdb ) and then automatically perform pairwise sequence
alignment between protein sequences from their search s fasta
file to sequences present for chains in the pdb .
this alignment is
used to map identified link locations for proteins in the fasta file
to specific locations in the pdb structure , enabling 3d visualization
and distance measurements of observed links ( figure 3a ) .
this design does not require that the
exact sequence from a pdb chain be present in the fasta file used
to search the data and allows for the use of pdb files containing
single proteins or multiprotein complexes where all of the
proteins in the complex may be mapped to proteins from the experiment .
( a ) proxl allows users
to map proteins identified in the experiment to the sequences present
in any pdb - formatted file .
this is accomplished by an automated ( and
user - validated ) pairwise sequence alignment , which may result in gaps
or shifts in the respective alignments .
positions in the experimental
protein use this alignment to map to positions in the pdb sequence ,
which are then used to map the position to 3d space .
positions in
the experimental protein that do not map to the pdb sequence are considered
unmappable and are not represented on the structure
or used for distance reports .
( b ) screenshot from proxl illustrating
a mapping of three s. cerevisiae proteins
( spc97p , spc98p , and tub4p ) to a dimer of the yeast small -tubulin
complex .
two copies each of spc97p and spc98p and four copies of tub4p
are present in the structure .
the right panel shows a distance report for
the currently displayed data , which is color - coded to match the links
on the structure .
all of the links ( in either panel ) may be clicked
to view underlying proteomics data or spectra ; the pdb file , ucsf
chimera script , or pymol script may be downloaded , and distance reports
may be downloaded via links at the bottom of the report .
all visualized
links may be clicked to view the underlying peptide- and psm - level
data , including annotated mass spectra .
distances for all represented
links are calculated and available for viewing as a table or downloaded
as a text file .
the pdb file and link locations may be downloaded
as pymol or ucsf chimera scripts for
visualization and analysis in the respective software .
features
of note include ( 1 ) the ability to pop the structure out
into a separate window for high - resolution viewing and figure generation ,
( 2 ) the ability to shade the displayed links by spectrum counts , and
( 3 ) the ability to color the observed links on the basis of their
calculated distance , their type ( cross - link or loop - link ) , or ( in
the case of merging of multiple searches ) the search(es ) in which
that link was observed at the current cutoff values .
this enables
quick side - by - side structure - based comparison of multiple searches
( including different search programs ) .
all of the observed links and
distances are also displayed as a table , and these data may be downloaded
as a tab - delimited text report .
multiple searches can be combined
by selecting multiple searches and clicking the view merged
structure button .
proxl provides
an interactive ,
customizable , and dynamic 2d view of the data .
proteins are displayed
as horizontal bars scaled to their relative lengths ( figure 4 ) .
proteins found in the experiment
may be added or removed from the display by the user .
interprotein
cross - links are presented as line segments connecting the linked locations
in each protein .
intraprotein cross - links and loop - links are presented
as loops on the top and bottom of the protein bars , respectively ,
and monolinks are presented as short line segments . by default ,
links
are colored according to protein to ease interpretation . when data
from multiple searches are merged , the links may be colored according
to the originating search to ease comparison of the searches .
the
links may be shaded according to spectrum counts to perform basic
relative quantitative estimations . to aid in the interpretation of
complex diagrams , a single protein
may be clicked to highlight only
links involving that protein , or multiple proteins may be clicked
to highlight only the links on and between those proteins .
the black bars , from top to bottom , represent respective sequence
lengths for tub4p , spc97p , and spc98p from the s. cerevisiae small -tubulin complex .
the lines between bars represent
interprotein cross - links , the arcs above the bars represent intraprotein
cross - links , the arcs beneath the bars represent loop - links , and the
balls and sticks on the bottom represent monolinks .
the white vertical
lines on the bars represent sites that may react with the cross - linker
used in the experiment .
the colors are unique to each protein , with
cross - links between proteins being colored according to the protein
above it in the diagram .
the user may click on all of the links to
view underlying proteomics data and spectra .
the interface includes
many customization options , which are fully documented at http://yeastrc.org / proxl_docs/. the protein bars may be moved
horizontally , rescaled , and flipped .
in addition , protein bars may be annotated by sequence coverage , predicted
disordered regions , and predicted secondary structure with
the latter two options being run in real time for proteins without
these annotations in the database .
section
of the project page by clicking the [ image ] link associated
with a given search .
multiple searches can be combined by selecting
multiple searches and clicking the view merged image
quality control for cross - linking proteomics
experiments is complex because cross - linked and loop - linked peptides
are evaluated in addition to the unlinked peptides found in traditional
proteomics experiments .
differences in experimental design , mass spectrometry
performance , or search software may affect the behavior and identification
of cross - linked , loop - linked , or unlinked peptides differently . proxl
provides two quality control visualizations for assessing the relative
performance of these different classes of peptides ( figure s-3 ) .
one visualization assesses the performance of
peptide identifications as a function of retention time .
total scans
and the number of scans resulting in quality identifications are plotted
versus retention time .
the user may select the score to be used for
analysis and the cutoff value for the quality score .
the other visualization assesses the performance of peptide identifications
as a function of psm quality scores ( e.g. , q - value or xcorr ) by showing
the cumulative total of identified psms as a function of score .
explore
data section of the project page by expanding a given search
and clicking either the [ retention time ] or [ psm
scores ] links next to qc plots . in addition to the visual
display of data presented above , proxl provides the data in table
form , including all observed cross - links and loop - links ( udrs ) , all
identified peptides , and all psms . in all cases ,
rows in tables may
be expanded to view the supporting proteomics data and scores from
the search .
for example , rows in the cross - link table may be expanded
to view all of the identified peptides and scores from the search
that indicated that udr .
these peptides may themselves be expanded
to view all of the underlying psms and scores for each peptide , and
the spectrum associated with each psm may be viewed . as with the graphical
views ,
multiple searches may be combined and compared in table form
( figure s-4 ) .
the specific search(es ) that
identified the respective udr , peptide , or psm are indicated , and
all levels of data ( protein , peptide , and psm ) are clearly differentiated
by search to simplify comparison .
additionally , all levels of data
may be downloaded as tab - delimited text for use in other types of
analysis , such as modeling .
these visualizations are available
in the proxl interface in the explore data section
of the project page by clicking either the [ peptides ]
or [ proteins ] link associated with a given run .
a project
may be created by any user of proxl , and a title , an abstract , users ,
and data can then be associated with that project .
to associate researchers
with the project , users may refer directly to existing users or supply
e - mail addresses for new users .
existing users are immediately added
to the project , and new users are invited by e - mail and may use a
link to register and access the project .
researchers may leave notes
or comments about the data that are visible to other researchers on
the project .
most critically , a project serves to limit access
to the data . by default ,
public access is disabled and access to the
data is limited to those users associated with that project .
this
ensures that only researchers associated with the given collaboration
may access the data .
data may be optionally shared with researchers
who do not have proxl accounts by enabling public access on the project .
the most restrictive form of public access requires that external
users use a specially formatted url containing an unguessable key
that provides access to the project and its data .
this ensures that
only individuals who have been given this url may access the data .
the least restrictive form of public access does not require the unguessable
key in the url , making the url much shorter and more appropriate for
referencing in articles .
public access may be enabled and disabled
by the project owner through the project overview page in the proxl
web interface . because each project has a unique url , public
project pages
may
be used as landing pages for sharing data associated with published
articles . to facilitate this ,
projects may be locked by the project
owner , which prohibits any further changes to that project , including
uploading data , changing public access levels , or altering the title
or abstract .
proxl has been in
production use with numerous collaborators , who
have driven its development and helped identify and resolve issues .
as of this writing
, the authors installation of proxl contains
24 cross - linking projects comprising 135 mass spectrometry runs ( searches ) .
these searches found 8 099 216 psms from 6 800 113
distinct scans , identifying 1 385 093 distinct udrs
from cross - links and 22 862 distinct udrs from loop - links .
an example of how proxl may be used and of its impact is illustrated
by the study by zelter et al . , in which
cross - linking mass spectrometry was combined with computational structural
modeling to determine the molecular architecture of the s. cerevisiae dam1 kinetochore complex .
proxl s
visualization tools , search comparison , and data download tools were
critical tools for the authors to evaluate the quality of cross - linking
experiments .
it was used to visualize the differences of observed
cross - links across different experimental conditions and to export
data for use by external analysis tools and the integrative modeling
platform ( imp ) , the software platform
used by the authors to predict the structure of the dam1 complex from
the cross - linking data .
finally , proxl s data sharing tools
were used to publically disseminate the data ( including raw , postprocessed ,
and cross - linking visualization ) as a companion to the published article .
new features are regularly
added and are driven by the needs of collaborators and users . features
and
directions currently under development include new visual displays
( including dynamic network topologies and circos - style views ) , support
for other structural formats ( including nmr or output from 3d modeling
platforms ) , and quantification tools .
we expect that the proxl xml
format will be extended to support new types of cross - linking data
( e.g. , quantification data ) , and we hope to work directly with the
community to develop proxl xml conversion tools for more software
platforms .
proxl is a web application and database
designed to store , visualize ,
compare , and share cross - linking mass spectrometry data .
proxl is
independent of any software analysis pipeline or fasta sequence naming
database .
it has been designed to simplify the development of import
tools for new pipelines and includes tools to combine and compare
data generated from disparate pipelines .
proxl provides visualization
tools particularly suited to structural analysis and quality control ,
tools for exporting the data , and data sharing tools designed for
both private collaboration and public data dissemination . for demonstration
purposes ,
a public proxl project has been set up at http://yeastrc.org / proxl_demo/. proxl is thoroughly documented , open - source , and freely available
at https://github.com / yeastrc / proxl - web - app/. | proxl
is a web application and accompanying database designed for
sharing , visualizing , and analyzing bottom - up protein cross - linking
mass spectrometry data with an emphasis on structural analysis and
quality control .
proxl is designed to be independent of any particular
software pipeline .
the import process is simplified by the use of
the proxl xml data format , which shields developers of data importers
from the relative complexity of the relational database schema .
the
database and web interfaces function equally well for any software
pipeline and allow data from disparate pipelines to be merged and
contrasted .
proxl includes robust public and private data sharing
capabilities , including a project - based interface designed to ensure
security and facilitate collaboration among multiple researchers .
proxl provides multiple interactive and highly dynamic data visualizations
that facilitate structural - based analysis of the observed cross - links
as well as quality control .
proxl is open - source , well - documented ,
and freely available at https://github.com/yeastrc/proxl-web-app . |
dural arteriovenous fistulas ( davfs ) are acquired arteriovenous shunts confined to the dura and are supplied by branches of the extracranial carotid artery , tentorial branches of the internal carotid artery , meningeal branches of the vertebral artery , and pial branches of cerebral arteries4 ) .
persistence of cortical venous reflux in intracranial davfs has a high annual risk of hemorrhage and nonhemorrhagic neurologic deficits .
cognard et al.4 ) noted intracranial hemorrhage in 40% of patients with type iii , and in 65% with type iv davfs .
rebleeding rates may be as high as 35% during the first 2 weeks after initial hemorrhage .
as neuroendovascular technique has developed considerably , open surgery for davfs has become a secondary treatment option .
transvenous coil embolization and transarterial n - butyl-2-cyanoacrylate ( n - bca ) injection were strong treatment methods of davfs . even though transvenous access was not always possible and transarterial nbca injection frequently resulted in partial embolization of feeding arteries .
recently , onyx ( covidien , irvine , ca , usa ) has become the safe and feasible embolic material with higher obliteration rates than n - bca7 ) .
some davfs have an inaccessible lesion with only 1 route , so the combination of transarterial and transvenous embolization results in higher obliteration rates .
even if endovascular embolization has developed remarkably , surgery or radiosurgery are still required in certain patients for complex lesion , failure of both transvenous and transarterial embolization , or palliation9 ) . in this study
, we reviewed our experience with a consecutive series of 13 patients subjected to the multimodal endovascular approach for intracranial davfs treatment .
on the basis of our initial experience with multimodal management of complex davfs , we proposed our current treatment algorism and detailed consideration of the endovascular , combined surgical or surgical treatment options for davfs in the current onyx era .
this retrospective study was approved by institutional review board ( irb ) at our center .
all symptomatic intracranial davfs were diagnosed and treated by the neurovascular team . in our institution ,
endovascular intervention was selected as a primary treatment options in all patients except for anterior cranial fossa davf , which was treated surgically .
after the introduction of onyx and detachable microcatheter , transarterial embolization was preferred in most davf , since davf could be successfully obliterated by the arterial injection for a long time .
we determined which patients were candidates for embolization . if davfs was not amendable to endovascular treatment because of a lack of appropriate arterial or transvenous access , the patient was treated by combined surgical endovascular embolization .
type i fistulas ( 4 patients ) were treated only if the patient had intractable symptoms that did not respond to conservative treatment .
a review of the records of cerebrovascular center at our hospital identified 13 patients with davfs treated by endovascular embolization ( transarterial , transvenous embolization , or both ) or combined surgery between december 2009 and may 2014 .
data collected included age , sex , presenting symptoms , location , type of fistula by cognard et al.4 ) , feeders , approaches , embolization materials , onyx amount , injected artery , angiographic result and prognosis ( table 1 ) .
all endovascular procedures were performed under general anesthesia and monoplane ( before 2013 june ) or biplane angiographic suite with 3-dimensional rotational angiographic capability ( philips medical systems , best , the netherlands ) .
after femoral arterial access , diagnostic angiography was performed on both common carotid artery ( cca ) , internal carotid artery ( ica ) , external carotid artery ( eca ) and both vertebral artery ( va ) .
a 6 fr guiding catheter was placed to the eca for transarterial approach and to the internal jugular vein for transvenous approach .
after femoral sheath insertion , the patients were heparinized with an average 3000 unit initially and 1000 unit per hour intravenously , to maintain an activated coagulation time of between 250 and 300 seconds .
an onyx compatible microcatheter ( apollo , marathon , or echelon-10 ) was navigated through the guiding catheter into the feeding artery as close as possible to the fistula point , allowing for an adequate distance for reflux of embolic agent .
if davfs had multiple feeders , mostly the mma feeder was chosen to target artery to inject onyx to the fistula .
when the fistula was very complex or the reflux set in earlier than expected , more than 1 session of embolization through another feeders were performed .
when some extracranial feeding artery had tortuous and long pathway , embolization was successfully performed by the combined surgical transarterial approach .
the transvenous approach was selected as a primary treatment modality before the introduction of onyx for the treatment of davf .
however , this approach was still used as a primary option for indirect ccf because of dangerous anastomotic channel between dural branches of eca and ica .
after diagnostic angiography , the femoral vein was punctured and using the roadmap obtained from an intra - arterial injection , a 6 fr guiding catheter was introduced and advanced to the internal jugular vein . through this guiding catheter , the microcatheter was advanced to the target lesion .
when some sinus pathway was occluded or had severe stenosis , transvenous embolization with coil was successfully performed by the combined surgical transvenous approach . in case of the inaccessible endovascular route , endovascular embolization was performed after surgical exposure of target artery or venous sinus under general anesthesia .
direct puncture of the target vessel was done under the roadmap obtained through the intra - arterial injection .
subsequently , transarterial onyx injection or transvenous coil embolization was done in the same manner described above . a 56-year - old man presented with semicomatose consciousness .
brain computed tomography ( ct ) showed intracerebral hemorrhage and subdural hematoma with midline shifting .
cerebral angiography demonstrated davf involving the transverse sigmoid sinus ( tss ) with multiple feeders from middle meningeal artery ( mma ) and occipital artery ( oa ) .
davf was completely obliterated with 4.5 cc of onyx through the petrosal branch of mma in a single session followed by surgical evacuation of hematomas .
a 66-year - old woman presented with intermittent paraparesis and generalized tonic - clonic seizure .
cerebral angiography demonstrated davf involving sss , which was associated with sss occlusion on the posterior one third .
the davf was fed by bilateral mmas , superficial temporal arteries ( stas ) and oas with marked retrograde cortical venous reflux .
transfemoral arterial onyx embolization was performed through right mma and sta , but it was insufficient resulting in partial obliteration of dural avf because of tortuous mma preventing the microcatheter from reaching the fistula closely enough .
second procedure was performed through left mma accessed by direct mma puncture following small decortications of cranium overlying the mma using a diamond drill 1 week later .
microcatheter could be located far distally to the fistula through 4 fr sheath placed into the mma and complete obliteration of davf was achieved using 3.9 cc of onyx .
2 ) . a 72-year - old woman presented with tinnitis , intermittent aphasia and generalized tonic - clonic seizure .
brain magnetic resonance image ( mri ) showed the abnormal signal void lesions on left temporal and occipital lobe .
cerebral angiography demonstrated davf involving left tss , which were fed by mma , meningohypophyseal artery , and oa .
we tried to introduce the microcatheter to davf through controlateral ts or ipsilateral jugular vein , but we could not access the fistula point because she had isolated left ts . in the first session , davfs
were partially treated by transarterial n - bca injection through mma and oa . on second session
after exposure of the left tss , 4 fr sheath was placed to the ts directly using a micropuncture needle . then , prowler select plus microcatheter was advanced into the sheath placing the tip into the isolated ts .
cerebral angiography demonstrated the indirect ccf , which was mainly fed by the accessory meningeal artery and drained into engorged superior ophthalmic vein as a retrograde fashion . even though manual carotid compression was performed for two months
after placement of microcatheter into the accessory meningeal artery , onyx injection was started carefully . during onyx injection , sudden migration of onyx cast into the cerebral artery was detected . despite several efforts to retrieve the onyx cast using endovascular technique ,
thus , emergent microsurgical removal of onyx cast from the mca bifurcation was performed with one piece successfully .
all endovascular procedures were performed under general anesthesia and monoplane ( before 2013 june ) or biplane angiographic suite with 3-dimensional rotational angiographic capability ( philips medical systems , best , the netherlands ) .
after femoral arterial access , diagnostic angiography was performed on both common carotid artery ( cca ) , internal carotid artery ( ica ) , external carotid artery ( eca ) and both vertebral artery ( va ) .
a 6 fr guiding catheter was placed to the eca for transarterial approach and to the internal jugular vein for transvenous approach .
after femoral sheath insertion , the patients were heparinized with an average 3000 unit initially and 1000 unit per hour intravenously , to maintain an activated coagulation time of between 250 and 300 seconds .
an onyx compatible microcatheter ( apollo , marathon , or echelon-10 ) was navigated through the guiding catheter into the feeding artery as close as possible to the fistula point , allowing for an adequate distance for reflux of embolic agent . if davfs had multiple feeders , mostly the mma feeder was chosen to target artery to inject onyx to the fistula .
when the fistula was very complex or the reflux set in earlier than expected , more than 1 session of embolization through another feeders were performed .
when some extracranial feeding artery had tortuous and long pathway , embolization was successfully performed by the combined surgical transarterial approach .
the transvenous approach was selected as a primary treatment modality before the introduction of onyx for the treatment of davf . however , this approach was still used as a primary option for indirect ccf because of dangerous anastomotic channel between dural branches of eca and ica . after diagnostic angiography , the femoral vein was punctured and using the roadmap obtained from an intra - arterial injection , a 6 fr guiding catheter was introduced and advanced to the internal jugular vein . through this guiding catheter , the microcatheter was advanced to the target lesion . when some sinus pathway was occluded or had severe stenosis , transvenous embolization with coil was successfully performed by the combined surgical transvenous approach .
in case of the inaccessible endovascular route , endovascular embolization was performed after surgical exposure of target artery or venous sinus under general anesthesia .
direct puncture of the target vessel was done under the roadmap obtained through the intra - arterial injection .
subsequently , transarterial onyx injection or transvenous coil embolization was done in the same manner described above .
brain computed tomography ( ct ) showed intracerebral hemorrhage and subdural hematoma with midline shifting .
cerebral angiography demonstrated davf involving the transverse sigmoid sinus ( tss ) with multiple feeders from middle meningeal artery ( mma ) and occipital artery ( oa ) .
davf was completely obliterated with 4.5 cc of onyx through the petrosal branch of mma in a single session followed by surgical evacuation of hematomas .
1 ) . a 66-year - old woman presented with intermittent paraparesis and generalized tonic - clonic seizure .
cerebral angiography demonstrated davf involving sss , which was associated with sss occlusion on the posterior one third .
the davf was fed by bilateral mmas , superficial temporal arteries ( stas ) and oas with marked retrograde cortical venous reflux .
transfemoral arterial onyx embolization was performed through right mma and sta , but it was insufficient resulting in partial obliteration of dural avf because of tortuous mma preventing the microcatheter from reaching the fistula closely enough .
second procedure was performed through left mma accessed by direct mma puncture following small decortications of cranium overlying the mma using a diamond drill 1 week later .
microcatheter could be located far distally to the fistula through 4 fr sheath placed into the mma and complete obliteration of davf was achieved using 3.9 cc of onyx .
2 ) . a 72-year - old woman presented with tinnitis , intermittent aphasia and generalized tonic - clonic seizure .
brain magnetic resonance image ( mri ) showed the abnormal signal void lesions on left temporal and occipital lobe .
cerebral angiography demonstrated davf involving left tss , which were fed by mma , meningohypophyseal artery , and oa .
we tried to introduce the microcatheter to davf through controlateral ts or ipsilateral jugular vein , but we could not access the fistula point because she had isolated left ts . in the first session , davfs
were partially treated by transarterial n - bca injection through mma and oa . on second session
after exposure of the left tss , 4 fr sheath was placed to the ts directly using a micropuncture needle . then , prowler select plus microcatheter was advanced into the sheath placing the tip into the isolated ts .
cerebral angiography demonstrated the indirect ccf , which was mainly fed by the accessory meningeal artery and drained into engorged superior ophthalmic vein as a retrograde fashion . even though manual carotid compression was performed for two months
after placement of microcatheter into the accessory meningeal artery , onyx injection was started carefully . during onyx injection , sudden migration of onyx cast into the cerebral artery was detected . despite several efforts to retrieve the onyx cast using endovascular technique ,
thus , emergent microsurgical removal of onyx cast from the mca bifurcation was performed with one piece successfully .
brain computed tomography ( ct ) showed intracerebral hemorrhage and subdural hematoma with midline shifting .
cerebral angiography demonstrated davf involving the transverse sigmoid sinus ( tss ) with multiple feeders from middle meningeal artery ( mma ) and occipital artery ( oa ) .
davf was completely obliterated with 4.5 cc of onyx through the petrosal branch of mma in a single session followed by surgical evacuation of hematomas .
a 66-year - old woman presented with intermittent paraparesis and generalized tonic - clonic seizure .
cerebral angiography demonstrated davf involving sss , which was associated with sss occlusion on the posterior one third .
the davf was fed by bilateral mmas , superficial temporal arteries ( stas ) and oas with marked retrograde cortical venous reflux .
transfemoral arterial onyx embolization was performed through right mma and sta , but it was insufficient resulting in partial obliteration of dural avf because of tortuous mma preventing the microcatheter from reaching the fistula closely enough .
second procedure was performed through left mma accessed by direct mma puncture following small decortications of cranium overlying the mma using a diamond drill 1 week later .
microcatheter could be located far distally to the fistula through 4 fr sheath placed into the mma and complete obliteration of davf was achieved using 3.9 cc of onyx .
a 72-year - old woman presented with tinnitis , intermittent aphasia and generalized tonic - clonic seizure .
brain magnetic resonance image ( mri ) showed the abnormal signal void lesions on left temporal and occipital lobe .
cerebral angiography demonstrated davf involving left tss , which were fed by mma , meningohypophyseal artery , and oa .
we tried to introduce the microcatheter to davf through controlateral ts or ipsilateral jugular vein , but we could not access the fistula point because she had isolated left ts . in the first session ,
davfs were partially treated by transarterial n - bca injection through mma and oa . on second session
after exposure of the left tss , 4 fr sheath was placed to the ts directly using a micropuncture needle .
then , prowler select plus microcatheter was advanced into the sheath placing the tip into the isolated ts .
cerebral angiography demonstrated the indirect ccf , which was mainly fed by the accessory meningeal artery and drained into engorged superior ophthalmic vein as a retrograde fashion . even though manual carotid compression was performed for two months
after placement of microcatheter into the accessory meningeal artery , onyx injection was started carefully . during onyx injection , sudden migration of onyx cast into the cerebral artery was detected . despite several efforts to retrieve the onyx cast using endovascular technique ,
thus , emergent microsurgical removal of onyx cast from the mca bifurcation was performed with one piece successfully .
other symptoms were headache , intracerebral hemorrhage , exophthalmos , personality change , and syncope ( table 2 ) .
the locations of fistulas were tss in 6 ( 48% ) , middle fossa dura in 4 ( 31% ) , cs in 2 ( 15% ) , and sss in 1 ( 8% ) patient ( table 3 ) .
cognard types were as follows : i in 4 ( 31% ) , iia in 2 ( 15% ) , iia+iib in 5 ( 39% ) , and iv in 2 ( 15% ) ( table 4 ) .
transvenous approach was tried in 4 patients with or without the transarterial approach ( 1 surgical sinus puncture , 2 transvenous followed by transarterial , 1 transarterial followed by transvenous ) .
nine ( 62% ) patients were treated with transarterial onyx embolization alone ( table 5 ) .
complete obliteration of fistulas was achieved in 11/13 ( 85% ) patients after multimodal treatment .
onyx migration into cerebral artery was observed in 1 patient with indirect ccf , who was treated with transarterial onyx injection after failed transvenous approach ( fig 4 ) .
open surgical removal of migrated onyx cast after unsuccessful endovascular retrieval resulted in a good clinical outcome .
eleven patients had mrs 0 , 2 patients had mrs 3 ( 1 patient was admitted on hunt and hess grade v with subarachnoid hemorrhage , and the other patient had parkinson disease ) .
the first is that arteriovenous shunts between meningeal arteries and dural venous sinuses enlarge in response to elevated local venous pressure , resulting in a pathologic shunt3812 ) .
the second is that venous hypertension due to outflow obstruction causes decreased cerebral perfusion and promotes neoangiogenesis310 ) . predisposing risk factors for venous thrombosis such as antithrombin ,
protein c and s deficiencies , and trauma are associated with davfs development56 ) . in pediatrics ,
the result of birth trauma , infection , in utero venous thrombosis , or maternal hormones are regarded as the etiology of davfs . in our series
, sinus occlusion was observed in 2 patients who were treated by the combined surgical approach . another 2 patients had trauma history .
while the davfs are more commonly diagnosed in perimenopausal women with underlying hormonal influence , the ratio of male to female was similar and mean age was 58 years old in our series .
the incidence of davfs by location is as follows : ts , 50% ; cs , 16% ; tentorium , 12% ; sss , 8% ; and anterior fossa , 2%19 ) .
borden and cognard classification systems associate cortical venous reflux with high risk of intracranial hemorrhage and nonhemorrhagic neurologic deficits24 ) . in our series ,
the most common initial symptom was intractable tinnitus , location was ts sinuses , and they were mostly cognard i and iia+iib .
transvenous coil embolization of fistula has been considered gold standard for the treatment of davf .
transarterial feeder embolization with nbca usually resulted in partial embolization because it is very difficult to penetrate multiple feeders with nbca completely .
however , after introduction of onyx in the treatment of davf , single feeder injection could result in complete obliteration of fistula because of good penetration capability of onyx .
onyx can penetrate the single feeder and fistula and then retrograde obliteration of multiple feeders from different arteries .
slow steady injection using reflux hold reinjection technique is very important to penetrate multiple feeders and fistulas completely from single feeder injection .
even though transarterial approach is preferred option in post - onyx era , transvenous approach is still primary option in davf on the specific location such as cavernous sinus or anterior condylar confluence because there are so many dangerous anastomoses between eca and ica . in our complication case
if we tried transarterial approach in this specific location , we 'd better to occlude the cavernous ica with balloon temporarily during transarterial onyx injection to prevent onyx migration to cavernous ica through dangerous anastomosis between accessory meningeal artery and inferolateral trunk of cavernous ica . in the technical point of view
, location of microcatheter tip is also important to achieve complete obliteration of davf with single feeder injection .
the disadvantage of onyx injection was long injection time and subsequent radiation exposure . to reduce the injection time
when we use balloon microcatheter , we do n't need to make onyx plug around the microcatheter tip because onyx injection under balloon inflation in the feeder makes onyx go forward instead of going backward .
a review of literature on multimodal treatment results of davfs indicated that they were different before and after onyx1415 ) .
mean obliteration rate of davfs was 70% ( 37.575% ) in the pre - onyx era , and 81% in the post - onyx era13 ) .
in our series , complete obliteration rate was 85% in overall , and 80% in high grade ( iii and iv ) davfs .
the reason of high complete obliteration rate at our center was that endovascular embolization with combined surgical approach could overcome the inaccessible route of transarterial or transvenous approach . in our center ,
8 patients were successfully treated by the transarterial approach alone and 2 patients by the combined surgical approach .
mma was used as a main access route of transarterial onyx embolization because the mma was anchored on the dura , and superselection of mma with microcatheter was not difficult in most of the cases .
in addition , mma diameter was usually smaller than other more dilated feeders such as oa .
literature review indicated that the common complication during endovascular onyx embolization was cranial nerve palsy , and sometimes trigeminocardiac reflex .
the petrous branch of mma is often the main supply for davfs in the petrotentorial region .
it also supplies the cranial nerve at the middle cranial fossa , and permanent cranial nerve palsy can occur .
therefore , we always tried to locate the microcatheter tip into petrous mma far distally to avoid complications11 ) .
onyx migration into cerebral circulation may cause disturbed cerebral blood flow and subsequent cerebral infarction , as well as partial obliteration of davf . in our complication case of indirect ccf ,
onyx migration occurred from accessary meningeal artery to internal carotid artery beyond the fistula through probably , infero - lateral trunk .
in this situation endovascular retrieval using microsnare , or retrieval stent should be tried first . unfortunately
, if this retrieval procedure was not successful , prompt surgical retrieval of onyx cast may result in favorable outcome in a selected patient .
recently , balloon assistance has been used to prevent onyx migration to the cerebral arterial system16 ) .
however , the neurosurgeon should consider the risk of onyx migration when it was injected transarterially in patient with indirect ccf , and that the primary treatment route of indirect ccf is the transvenous route .
however , the transvenous approach should be tried first in cavernous sinus davf because of the risk of intracranial migration of liquid embolic materials .
furthermore , combined surgical endovascular approach can be considered as a useful option in case of inaccessible endovascular route . | objectivetreatment of intracranial dural arteriovenous fistulas ( davfs ) remains a challenge .
however , after introduction of onyx , transarterial approach is the preferred treatment option in many centers .
we report our experience of davfs embolization with special emphasis on transarterial approach.methodsseventeen embolization procedures were performed in 13 patients with davfs between jan 2009 and oct 2014 .
clinical symptoms , location and type of fistulas , embolization methods , complications , radiological and clinical outcomes were evaluated using charts and pacs images.resultsall 13 patients had symptomatic lesions .
the locations of fistulas were transverse - sigmoid sinus in 6 , middle fossa dura in 4 , cavernous sinus in 2 , and superior sagittal sinus in 1 patient .
cognard types were as follows : i in 4 , iia in 2 , iia+iib in 5 , and iv in 2 .
embolization procedures were performed 2 times in 3 patients .
nine patients were treated with transarterial onyx embolization alone .
one of these required direct surgical puncture of middle meningeal artery .
complete obliteration of fistulas was achieved in 11/13 ( 85% ) patients .
there were no complications except for 1 case of onyx migration in cavernous davf .
modified rankin scale score at post - operative 3 months were 0 in 11 , and 3 in 2 patients.conclusiontransarterial onyx embolization can be a first line therapeutic option in patients with davfs .
however , transvenous approach should be tried first in cavernous sinus davf because of the risk of intracranial migration of liquid embolic materials .
furthermore , combined surgical endovascular approach can be considered as a useful option in inaccessible route . |
acute respiratory distress syndrome ( ards ) is characterized by alveolar epithelial and vascular endothelial injury in the lungs that is triggered by a wide range of predisposing conditions such as pneumonia , sepsis , and trauma [ 123 ] .
it is a frequent cause of icu admission and has a high rate of mortality and morbidity . as it remains challenging to identify patients who are at the highest risk of developing these syndromes and to differentiate these syndromes from other causes of acute respiratory failure , many studies have focused on biomarkers to identify patients with ards to predict those who are unlikely to have a positive outcome and create evidence - based therapies . until now
, four categories of biomarkers have been studied including inflammatory cytokines ( il-6 , il-8 ) [ 4 , 5 ] , coagulation proteins ( pai-1 , protein c ) [ 6 , 7 ] , epithelial proteins ( kl-6 , sp - d , rage ) [ 810 ] , and endothelial proteins ( ang-2 , icam-1 , vwf ) [ 1113 ] . despite recent advances in our understanding of biomarkers associated with either diagnosis of ards in the at - risk population or ards - related mortality ,
endocan , also called endothelial cell - specific molecule-1 , is a soluble 50 kda dermatan sulfate proteoglycan that is secreted from pulmonary and kidney vascular endothelial cells .
endocan is stable at low levels in the blood of healthy subjects and can be measured in serum . in vitro
, endocan can bind directly to the integrin cd11a - cd18 ( lfa-1 ) and block binding to the intercellular adhesion molecule-1 ( icam-1 ) , consequently inhibit leukocyte - endothelial cell adhesion , and reduce the excessive leukocyte recruitment into the lungs .
some studies showed that endocan can be acknowledged as a good marker of endothelial dysfunction and multiple - organ dysfunction in sepsis , and it can be accepted as a good marker of survival prognosis in sepsis [ 17 , 18 ] .
therefore , the primary aim of our study was to test whether endocan is useful for the prognosis of ards .
this was a multicenter clinical study conducted at the second affiliated hospital of chongqing medical university , first affiliated hospital of chongqing medical university and xinqiao hospital from january 2012 to august 2013 .
we enrolled 42 critical ill adult patients with acute respiratory distress syndrome , which was triggered by some predisposing conditions such as pulmonary infection , sepsis , aspiration , and blood transfusion .
patients were followed until death in hospital or discharge home and were then defined as nonsurvivors or survivors .
diffuse alveolar damage is the pathological process of ards with pulmonary infection , which differs from pneumonia without ards . to analyse the difference between pneumonia patients with ards and those without ards
, we recruited 44 pneumonia patients without ards , compared with 35 pneumonia patients with ards .
patients were excluded if they were less than 18 years old or pregnant or if they had a coexisting malignancy .
the study protocol had been reviewed and approved by the local institutional review board , and written informed consent was obtained from either the patient or from each patient 's next of kin or legal representative before enrollment .
plasma specimens were obtained from patients with ards as soon as possible after the patient met defining criteria , but those obtained more than 24 hours after admission were excluded .
demographic characteristics and clinical data including age , gender , etiology of ards , and admission comorbidities were recorded from each subject .
the acute physiology and chronic health evaluation ( apache ) ii score and pao / fio were recorded based on the lowest value at onset .
we also recorded the duration of mechanical ventilation and length of stay in the intensive care unit and length of hospital stay .
when patients admitted , the wbcs , neutrophils , pct , and crp concentrations were routinely inspected and we recorded the results .
we used a sandwich - based enzyme - linked immunosorbent assay ( elisa ; lunginnov systems , lille , france ) to measure endocan plasma concentrations in duplicate . for continuous variables ,
descriptive results were presented as the median ( iqr ) unless stated otherwise ; we used the student t - test for data that followed normal distribution and the mann - whitney u - test for those that were not normally distributed .
receiver operating characteristic ( roc ) curves were computed and areas under the curves were used to evaluate the predictive value of biomarkers for ards and the ability of the model to distinguish the survivor group from the nonsurvivor group . to assess the relationship between two variables , spearman rank analysis was used for variables that followed abnormal distribution and pearson correlation analysis was used for those with normal distribution . to identify risk factors for hospital mortality , we used a multivariate cox proportional hazards regression model with forward stepwise selection procedures .
a p - value less than 0.05 in the univariate analysis was required for a variable to enter the multivariate model .
medcalcr version 4.20.011 ( frank schoonjans , mariakerke , belgium ) was used to compare the roc curves and graphpad 5.0 software was used to draw a correlation analysis figure .
defined by the survival status after patients with ards discharge home , there were 22 survivors and 20 nonsurvivors in this cohort .
the main etiology of ards was pulmonary infection , included bacterial pneumonia , virus pneumonia , and active pulmonary tuberculosis , while the other causes included aspiration , blood transfusion , and extra pulmonary infection . comparing survivors with nonsurvivors
, we found that nonsurvivors were slightly older than survivors ( p = 0.064 ) and nonsurvivors had a higher apache ii score ( median 24 versus 21 ; p = 0.03 ) and lower pao / fio ratios than survivors ( median 89.5 versus 131 ; p < 0.001 ) .
furthermore , catastrophic complications including shock , acute renal failure , hepatic dysfunction , and coagulopathy were more common among nonsurvivors .
all patients were classified in 3 berlin 's subclasses : mild , moderate , or severe ards , but mild group had no patient in our study .
endocan levels had no significant statistical significance between moderate ards group ( median ( iqr ) 3.21 ( 2.384.96 ) ng / ml ; n = 23 ) and severe group ( median ( iqr)4.35(2.977.28 ) ng / ml ; n = 19 ) ( p = 0.176 ) . in the ards group ,
the median endocan levels in nonsurvivor plasma were significantly higher than in survivor plasma ( median ( iqr ) 5.01 ( 2.988.44 ) ng / ml versus 3.01 ( 2.364.36 ) , respectively ; p = 0.017 ) .
meanwhile , procalcitonin ( pct ) also showed significant statistical significance when comparing the nonsurvivors group with the survivors group ( median ( iqr ) 9.26 ( 3.8816.46 ) ng / ml versus 2.59 ( 0.956.25 ) ng / ml , respectively ; p = 0.007 ) .
however , wbcs , neutrophil counts , and crp were unable to distinguish survivors from nonsurvivors , as shown in table 2 .
figure 1 showed the correlation between endocan expression levels and the other biomarkers of ards subjects .
there were significant correlations between endocan levels and apache ii ( r = 0.676 , p < 0.001 , n = 42 ) , and pct ( r = 0.353 , p = 0.02 , n = 42 ) .
however , correlations between endocan levels and crp ( r = 0.096 , p = 0.546 , n = 42 ) , white blood cells ( r = 0.267 , p = 0.088 , n = 42 ) , and neutrophil counts ( r = 0.278 , p = 0.075 , n = 42 ) were not statistically significant .
additionally , we also found that endocan levels as well as pct , crp , and wbc counts did not exhibit a significant correlation with the duration of mechanical ventilation and the length of hospital stay ( results were not shown ) . to investigate the predictive properties of endocan levels regarding survival , we use the roc - curve analysis and forward stepwise multivariate cox regression .
as shown in figure 2 , the area under the roc curve ( auroc ) of endocan was 0.715 ( 95% ci , 0.5550.875 ) ; this value was similar to the pct ( 0.743 , 95% ci , 0.590.896 ) and slightly higher than the apache ii score ( 0.695 , 95% ci , 0.5350.856 ) .
patients with endocan levels above 4.96 ng / ml ( the optimal cutoff points ) had a particularly negative outcome with a sensitivity of 55% and a specificity of 86.4% .
further , the optimal cutoff points of other parameters for predicting the mortality are 3.4 ng / ml for pct , 103.09 mg /
l for crp , 9.11 10/l for wbc , 7.73 10/l for neutrophil counts , and 20 for the apache ii score .
furthermore , the positive predictive value , negative predictive value , and positive likelihood ratio and negative likelihood ratio for each parameter by individual threshold are listed below the graph in figure 2 . for further risk assessment
, we performed a forward stepwise multivariate cox regression to compute the univariate analysis and hazard ratios , which are displayed in table 3 . among these parameters , only endocan and pao / fio were independently associated with mortality .
the hazard ratio for endocan was 1.374 ( 95% ci , 1.1501.641 ) and 0.958 ( 95% ci , 0.9380.978 ) for pao / fio .
we also compared plasma markers using the area under the roc curves to predict multiple - organ dysfunction ( table 4 ) .
the results showed that baseline endocan levels are able to predict shock , renal failure , and coagulopathy with high values . according to the optimal cutoff point determined from the roc curve
, patients were stratified into a high plasma endocan level ( 4.96 ng / ml ) group and a low endocan level ( < 4.96 ng / ml ) group . we found that endocan can predict the incidence of shock and renal failure with high levels , but it is unable to predict the occurrence of hepatic dysfunction and coagulopathy , which was the same within a 1-week period ( table 5 ) .
endocan was statistically significantly higher among pneumonia patients who developed ards than those who did not ( median ( iqr ) 3.22 ( 2.475.14 ) ng / ml versus 2.45 ( 2.232.79 ) ng / ml , resp .
but pct , crp , wbcs , and neutrophil counts were unable to distinguish them . meanwhile
, endocan can differentiate the above two groups with a sensitivity of 65.71% , a specificity of 86.36% , and an area under receiver operator characteristic curve ( auroc ) of 0.735 , which was superior to the other biomarkers ( table 7 ) .
pulmonary infection is the primary risk factor of ards in china , but not every patient with pneumonia would develop into acute lung injury , so which person is at risk for ards is unknown . in our observational cohort study , levels of plasma endocan
were significantly elevated in pneumonia patients with ards compared with those without ards . as we all know , neutrophils play a critical role in the pathogenesis of ards and when activated they release harmful mediators including cytokines , proteases , reactive oxygen species , and matrix metalloproteinases leading to further damage .
however , endocan was shown to inhibit the interaction between intercellular adhesion molecule-1 ( icam-1 ) and the integrin ( lymphocyte function - associated antigen-1 ) lfa-1 on leukocytes , and can modulate lfa-1 mediated leukocyte functions , such as the firm adhesion of leukocytes to the endothelium and the leukocyte transmigration . in vitro , bacteria endotoxin lps and proinflammatory cytokines such as il-1 and tnf- induce the synthesis and the release of endocan by huvecs [ 14 , 15 ] and sustained release of endocan .
the sustained hypersecretion of endocan stimulated by tnf- and lps may be consistent with the high level of serum endocan in patients with fatal outcome , observed in our patients with ards and also in septic patients [ 17 , 18 ] .
however , the presence of endocan in a storage form within the endothelial cells may also suggest that endocan release could be partly due to endothelial cell injury .
therefore , endocan may represent a novel endothelial cell dysfunction marker . in the last decades ,
aman conducted a systematic review and meta - analysis of all studies on plasma biomarkers associated with either diagnosis of ards in the at - risk population or ards - related mortality.they showed that increased plasma levels of kl-6 , ldh , srage , and vwf are most strongly associated with ards diagnosis in the at - risk population , whereas the strongest association with ards mortality was found for il-4 , il-2 , ang-2 , and kl-6 .
however , we need continue to explore a reliable biomarker of ards to enrich our knowledge . in our study , patients with endocan levels above 4.96 ng / ml had a poor chance for survival and were more likely to develop septic shock and renal failure .
meanwhile , endocan can predict mortality of ards independently with a hazard ratio of 1.374 , specificity of 86.4% , and an auroc of 0.715 .
although its sensitivity was low , it does not exclude high performance of endocan when measured in other compartments , such as bronchoalveolar fluid or exhaled gas , or combining endocan with the other biomarkers of ards to improve the accuracy of the prognosis of ards .
pct is a marker to improve the diagnosis of bacterial infections and to guide antibiotic therapy . in our study , pct had higher sensitivity and similar auroc but lower specificity to predict the mortality of ards , which may be related to most participants with severe lung infections in our study .
however , pct had no discriminative power for prediction between pulmonary infection with ards and without ards .
endocan levels above 4.96 ng / ml were more likely to develop into septic shock and renal failure , in which the auroc of endocan was 0.772 for septic shock and 0.714 for renal failure .
by contrast , pct , crp , and wbc did not show discriminative power for an early prediction of organ failure and sepsis severity .
furthermore , apache ii is frequently used to measure disease severity in intensive care units , but widely adopted apache ii scoring system has its limitations in predicting the outcome in ards .
endocan has high reproducibility of measurement and accessibility of specimens , had a good correlation with apache ii , and was associated with an increased risk of ards death ; therefore , it may well complement the apache ii scoring in outcome prediction and guide therapeutic choices in the early stages of the ards aimed at prevention and provide patient benefits using evidence - based therapies .
plasma endocan levels elevated dramatically in pneumonia patients with ards compared with those without ards .
it suggested that patients with elevated levels of endocan may develop into ards more easily .
found that lower levels of serum endocan on admission are associated with subsequent development of ali in trauma patients ; they explained that it may be associated with endocan - mediated blockade of leukocyte recruitment in the lung .
although trauma and infection may differ clinically and biologically , we could prospectively measure the endocan levels of patients with pulmonary infection to identify whether patients with higher levels of endocan are at high risk for ards .
first , the number of patients recruited was relatively small , it would be useful to repeat the study on a larger sample of patients in future .
second , the concentration of endocan was measured only initially , in the first 24 h after the inclusion in the study , and the dynamics of concentration during the ards evolution has not been evaluated .
third , the study lacks evaluation of the correlation between the plasma endocan and other biomarkers of ards .
fourth , we did not evaluate the diagnose performance of endocan associated with ards in the at - risk population ; therefor , further studies involving large critical ill subjects at risk for ards are needed . in conclusion ,
our study is one of the few studies to study the predictive value of endocan for ards .
we have demonstrated that endocan can predict the mods development and mortality of ards independently .
it may guide effective rescue therapies such as lung protective ventilation strategy , liquid negative balance management , and organ protective treatment , thus reducing the mortality of ards .
in addition , combined clinical variables with biological biomarkers such as endocan may play an important role in early therapeutics or preventative approaches for ards . | purpose . to investigate the prognostic significance of endocan , compared with procalcitonin ( pct ) , c - reactive protein ( crp),white blood cells ( wbc ) , neutrophils ( n ) , and clinical severity scores in patients with ards
. methods . a total of 42 patients with ards were initially enrolled , and there were 20 nonsurvivors and 22 survivors based on hospital mortality .
plasma levels of biomarkers were measured and the acute physiology and chronic health evaluation ii ( apache ii ) was calculated on day 1 after the patient met the defining criteria of ards . results .
endocan levels significantly correlated with the apache ii score in the ards group ( r = 0.676 , p = 0.000 , n = 42 ) . of 42 individuals with ards , 20 were dead , and endocan was significantly higher in nonsurvivors than in survivors ( median ( iqr ) 5.01 ( 2.988.44 ) versus 3.01 ( 2.364.36 ) ng / ml , p = 0.017 ) . according to the results of the roc - curve analysis and cox proportional hazards models ,
endocan can predict mortality of ards independently with a hazard ratio of 1.374 ( 95% ci , 1.1501.641 ) and an area of receiver operator characteristic curve ( auroc ) of 0.715 ( p = 0.017 ) .
moreover , endocan can predict the multiple - organ dysfunction of ards . conclusion .
endocan is a promising biomarker to predict the disease severity and mortality in patients with ards . |
seventy - one individuals were enrolled and were divided into four groups based on their clinical diagnoses : fragile x with autism ( fx+a ) , fragile x without autism ( fxa ) , idiopathic autism ( ia ) , or typically developing control ( c ) .
study enrollment and final group demographics can be seen in fig . 1 and table 1 , respectively .
individuals were age - matched across all groups , and individuals in the fxs+a and ia groups were also iq matched.fig .
1summary of initial study enrollment and breakdown to number of subjects included in the final analysestable 1summary of participant demographics in each study group , including age and gender breakdowngroupnmales ( n)females ( n)age ( mean , range)iq ( mean , sd)fxsa1741315.49 ( 1123)68.65 , 15.2fxs+a1513217.04 ( 1024)55.07 , 3.9ia1513216.83 ( 1423)56.47 , 6.6c1811716.61 ( 1124)119.17 , 11.3 summary of initial study enrollment and breakdown to number of subjects included in the final analyses summary of participant demographics in each study group , including age and gender breakdown thirteen of the individuals included in the final analyses were previously reported in hessl et al .
psychoactive medication use by subjects in each group is shown in table 2.table 2summary of the number of participants in each clinical group taking different types of medication at the time of testinggroup ( n)no medicationssri / snrianti- psychoticsstimulantsanti- convulsantsanti - anxietysedativesother antidepressantsfxsa ( 17)68430102fxs+a ( 15)57340201ia ( 14)45412000c ( 18)180000000 summary of the number of participants in each clinical group taking different types of medication at the time of testing exclusion criteria included known hearing loss , facial motor tics , and central nervous system involvement other than autism or fxs ( e.g. , cerebral palsy , fetal alcohol syndrome , or serious head injury ) .
in addition , control subjects were excluded if they had any history of psychiatric diagnoses or learning disabilities .
fragile x full mutation status was confirmed through fmr1 dna testing using pcr and southern blot as described in tassone et al .
1994 ) and social communication questionnaire ( rutter et al . 2003 ) were utilized to help confirm diagnosis . only those individuals meeting criteria for full autistic disorder or no autism
the ppi data collection and videocoding followed the protocol previously described in detail ( hessl et al .
trial types consisted of 105 db white noise startle stimuli ( ss ) or prepulse trials consisting of 25 ms , 75db , 1 khz tones occurring 60 , 120 , or 240 ms prior to the ss .
the trial order was random , and inter - trial intervals ranged from 25 to 45 s. emg startle data was visually scrutinized , and the validity of each trial was confirmed using standardized videocoding of behavior prior to data analysis as previously described .
a log transformation of the data was employed to normalize the distributions for subsequent analyses .
percent ppi for each prepulse trial type was calculated using following equation : 100 x [ ( response amplitude in the startle stimulus alone trials
mean startle amplitude to the ss ( no prepulse ) was compared across groups ( table 3 ) .
analysis of variance ( anova ) showed no significant between group differences , f ( 3 , 53 ) = 0.29 , p = 0.83 .
transformation of the data was not successful , and therefore group differences were analyzed using non - parametric tests . a kruskal
pairwise group comparisons showed that the ia group had a longer latency than each of the other three groups ( all p < 0.01 ; fig .
nonparametric tests revealed a longer latency in the idiopathic autism group relative to the typical control ( p < 0.001 ) , fxs with autism ( p < 0.002 ) and fxs without autism ( p < 0.004 ) groups . all groups were age - matched , and the fxs+a and ia groups were iq - matched latency of peak startle response by group ( including males and females ) .
nonparametric tests revealed a longer latency in the idiopathic autism group relative to the typical control ( p < 0.001 ) , fxs with autism ( p < 0.002 ) and fxs without autism ( p < 0.004 ) groups .
all groups were age - matched , and the fxs+a and ia groups were iq - matched for ppi , a repeated measures anova , with prepulse interval type as the repeating dependent variable and group as the independent variable revealed main effects of trial type [ f(2 ) = 9.22 , p < 0.001 ] and group [ f(3 , 59 ) = 5.63 , p = 0.002 ] .
post - hoc pairwise comparisons ( fisher s lsd ) showed that participants with fxs+a ( p = 0.002 ) and fxsa ( p = 0.003 ) had lower ppi than c. in addition , the fxsa ( p = 0.03 ) and fxs+a ( p = 0.01 ) groups had lower ppi than the ia group .
all other group comparisons and group by trial type interactions were non - significant , including the comparison between the ia and c groups ( fig . 3 and table 3 ) .
there was a consistent trend across all interval trial types with ppi increasing from fxsa to fxs+a to ia to controls.fig .
3prepulse inhibition ( ppi ) in each group ( including males and females ) , by prepulse interval trial type .
c = typically developing controls , ia = idiopathic autism , fxs+a = fragile x syndrome with autism , fxsa = fragile x syndrome without autism .
ppi was significantly lower in fxs+a ( p = 0.002 ) and fxsa ( p = .003 ) compared with controls .
ppi was also significantly lower in fxs+a ( p = .01 ) and fxsa ( p = .03 ) compared to ia prepulse inhibition ( ppi ) in each group ( including males and females ) , by prepulse interval trial type .
c = typically developing controls , ia = idiopathic autism , fxs+a = fragile x syndrome with autism , fxsa = fragile x syndrome without autism .
ppi was significantly lower in fxs+a ( p = 0.002 ) and fxsa ( p = .003 ) compared with controls .
ppi was also significantly lower in fxs+a ( p = .01 ) and fxsa ( p = .03 ) compared to ia as noted in the participant descriptions , gender ratios across groups were not equivalent , especially within the fxs+a ( higher proportion of males ) and fxsa ( higher proportion of females ) . because different gender ratios may confound observed differences between groups , we analyzed ppi group differences for males only for ia ( n = 9 ) , fxs+a ( n = 11 ) , and c ( n = 10 ) groups , using non - parametric tests .
wallis test revealed a main effect of group for the 60 , 120 , and 240 ms intervals ( p = 0.03 , p = 0.007 , and p = 0.006 , respectively ) .
pairwise group comparisons with mann whitney tests demonstrated significant differences between c and fxs+a ( p < 0.01 for all intervals ) and between ia and fxs+a groups for the 120 and 240 ms intervals ( p = 0.02 and p = 0.02 , respectively ; fig .
all three groups were matched on age ( ia = 17.1 , fxs+a = 17.5 , and c = 16.61 years ) .
the ia and fxs+a groups were additionally matched on iq ( ia = 56.3 and fxs+a = 54.6 ) .
table 3descriptive statistics of the amplitude of startle response to stand - alone startle stimulus ( in mv ) and prepulse inhibition ( ppi ; % inhibition ) in individuals with fxsa , fxs+a , ia and controls ; descriptive statistics of ppi are further broken down by prepulse intervalfxsa ( n = 17)fxs+a ( n = 15)ia ( n = 15)c ( n = 18)meansdmeansdmeansdmeansd105 db ss ( mv)101.7154.894.6491.9890.1771.6195.9975.64prepulse interval ( % ) 60 ms30.1126.9538.5524.4450.4322.3060.2517.43 120 ms33.7528.7635.0021.0747.9423.6158.4922.30 240 ms8.2134.9329.3620.8038.1628.5653.6319.30fig .
4ppi % in males with idiopathic autism ( ia ) , fragile x with autism ( fxs+a ) , and typically developing controls ( c ) .
all three groups were matched on age , and the two autism groups were additionally matched on iq .
males with fragile x with autism had significantly impaired ppi relative to both controls ( p < 0.01 ) and males with idiopathic autism ( p < 0.05 ) descriptive statistics of the amplitude of startle response to stand - alone startle stimulus ( in mv ) and prepulse inhibition ( ppi ; % inhibition ) in individuals with fxsa , fxs+a , ia and controls ; descriptive statistics of ppi are further broken down by prepulse interval ppi % in males with idiopathic autism ( ia ) , fragile x with autism ( fxs+a ) , and typically developing controls ( c ) .
all three groups were matched on age , and the two autism groups were additionally matched on iq .
males with fragile x with autism had significantly impaired ppi relative to both controls ( p < 0.01 ) and males with idiopathic autism ( p < 0.05 )
we directly compared sensorimotor gating in individuals with idiopathic autism and a well - matched group of individuals with autism associated with fragile x syndrome to investigate a possible shared neurobiological endophenotype .
the two fxs groups in the study ( with and without autism ) had significantly lower ppi when compared to age - matched controls , consistent with previous studies documenting deficits in sensorimotor gating and inhibition mechanisms related to the fmr1 mutation .
the direct comparison of the two groups with autism matched on both age and iq demonstrated that ppi is more impaired in individuals with autism associated with fxs than in those with idiopathic autism .
thus , the data do not support a shared trait of sensorimotor gating abnormality in these two populations , even though they manifest similar autistic symptoms such as stereotypic behaviors , social reciprocity deficits , and communication impairment .
this interpretation is consistent with a recent examination of brain morphology in children with autism and children with fxs who demonstrated similar behavioral and cognitive profiles but differed markedly in the volumes of specific brain regions ( cody - hazlett et al .
more robust sample sizes are needed to further investigate whether subtypes exist in ia populations with regard to ppi performance .
nonetheless , we were able to demonstrate significant differences between the two groups with autism in males only .
study groups with a more equal gender distribution ( i.e. greater numbers of males with fxsa or females with fxs+a or ia ) would provide more reliable contrasts in ppi across these groups of interest .
many of our study participants were taking psychoactive medications at the time of data collection .
although the sample size was too small to examine effects of specific types of medications , we found no significant differences in ppi between those taking and not taking medications at the time of testing ( data not shown ) .
a more thorough examination of the potential impact of psychoactive medications on ppi performance in fxs can be found in hessl et al .
significant differences in startle latency were found between the idiopathic autism group and the fragile x groups , as well as typically developing controls .
ornitz et al . ( 1993 ) found longer latency to auditory stimuli in autism relative to controls , though this effect did not reach statistical significance .
the longer startle latency in idiopathic autism may be associated with disruption of the basic startle reflex pathway involving primarily brain stem circuits , such as the auditory brainstem response abnormalities in autism previously reported ( fujikawa - brooks et al . 2010 ) .
( 2002 ) showed ppi deficits associated with autism , these studies included higher functioning adults with autism or asperger s disorder , whereas our sample included much lower functioning children and adolescents .
the only prior work which studied ppi in low - functioning individuals with autism was conducted by ornitz et al .
that study , which included a cohort of individuals with both high- and low - functioning individuals with autism , revealed no significant ppi deficit .
the inconsistency in ppi results may be explained by autism cohort or protocol differences such as type and intensity of prepulse and startle stimuli .
again , larger sample sizes in future studies may be necessary to reveal true deficits in ppi that may exist in children with autism , or specific subgroups .
the mglur theory of fxs postulates that upregulation of mglur5-mediated activity seen in the absence of fmrp may contribute to the clinical features of the disorder . in animal studies ,
mglur5 negative modulators have been shown to rescue behavioral , cognitive , and prepulse inhibition deficits in fmr1 knockout fruit fly and mouse models ( de vrij et al .
; mcbride et al . 2005 ; yan et al . 2005 ) . as such , clinical trials employing the use of similar mglur5 antagonists have moved to the forefront of research efforts to produce clinical improvements in humans with fxs .
if mglur dysregulation plays a role in sensorimotor gating deficits in fxs , it may also play a similar role a subset of individuals with ia demonstrating ppi deficits . thus , demonstration of the commonalities in the neurobiological processes underlying ppi deficits between individuals from phenotypically - related clinical groups may have implications for future collaboration in targeted treatment efforts . | prepulse inhibition ( ppi ) may useful for exploring the proposed shared neurobiology between idiopathic autism and autism caused by fxs .
we compared ppi in four groups : typically developing controls ( n = 18 ) , fxs and autism ( fxs+a ; n = 15 ) , fxs without autism spectrum disorder ( fxsa ; n = 17 ) , and idiopathic autism ( ia ; n = 15 ) .
relative to controls , the fxs+a ( p < 0.002 ) and fxsa ( p <
0.003 ) groups had impaired ppi . the fxs+a ( p < 0.01 ) and fxsa ( p < 0.03 ) groups had lower ppi than the ia group .
prolonged startle latency was seen in the ia group .
the differing ppi profiles seen in the fxs+a and ia indicates these groups may not share a common neurobiological abnormality of sensorimotor gating . |
according to the world health organization , obesity worldwide has nearly doubled since 1980
and over 1.4 billion adults are overweight ( with approximately 200 million men and 300
million women obese)1 . because
cardiovascular diseases , type 2 diabetes , musculoskeletal disorders , and some cancers are
strongly related to obesity ,
this continued rise in
obesity rates and persistent disparities among subpopulations have led to renewed calls to
eliminate disparities and achieve greater health equality for all2 .
many previous studies have reported that socioeconomic factors , such as low household
income , are associated with rising obesity3,4,5 .
regular physical activity is widely perceived to be beneficial for reducing obesity
rates6 , 7 . moreover
, physical activity has a positive effect on preventing
cardiovascular diseases , metabolic disorders , osteoporosis , and all - cause mortality8,9,10,11 .
based on this relationship between obesity and physical activity , several recent studies
have reported that physical activity is also associated with household income12,13,14,15 .
however , in korea , no study has yet examined the relationship between household income and
physical activity .
hence , the present study bridges this gap in the literature by exploring
whether physical activity is related to household income for different age groups of
koreans .
participants : the 9,000 koreans aged 1089 years who participated in the korean survey of
citizens sports participation , a nationally representative survey conducted by the korean
ministry of culture , sports , and tourism16 , were analyzed in the present study . because this survey did not
collect any private information from respondents ( e.g. , name , social security number , home
address , etc . ) , ethical approval was not required .
all study procedures were approved by the
korean ministry of culture , sports , and tourism .
the characteristics of participants are
presented in table 1table 1.the characteristics of the participantsvariablesmen ( n = 4,479)women ( n = 4,521)age ( years)42.27 18.3843.61 18.79physical activitynone2,351 ( 52.5)2,704 ( 59.8)at least weekly2,128 ( 47.5)1,817 ( 40.2)household incomeunder 1,000,000 won ( usd 1,000)210 ( 4.7)303 ( 6.7)1,000,000 1,500,000 won251 ( 5.6)288 ( 6.4)1,510,000 2,000,000 won361 ( 8.1)377 ( 8.3)2,010,000 2,500,000 won616 ( 13.8)606 ( 13.4)2,510,000 3,000,000 won689 ( 15.4)628 ( 13.9)3,010,000 3,500,000 won823 ( 18.4)752 ( 16.6)3,510,000 4,000,000 won586 ( 13.1)587 ( 13.0)4,010,000 4,500,000 won383 ( 8.6)410 ( 9.1)4,510,000 5,000,000 won269 ( 6.0)266 ( 5.9)5,010,000 5,500,000 won176 ( 3.9)208 ( 4.6)5,510,000 6,000,000 won51 ( 1.1)51 ( 1.1)over 6,000,000 won ( usd 6,000)64 ( 1.4)45 ( 1.0)results are expressed as mean sd or n ( % ) .
estimate 1 $ = 1,000 won dependent variables : physical activity was evaluated for each participant by their
responses to the following question : recently , on how many days did you do over 30 minutes
of physical activity ( or exercise ) , except walking , in your leisure time ?
the response
options were none , twice or three times per month , once per week , twice per
week , three times per week , four times per week , five times per week , six
times per week , and every day . based on their responses ,
participants were divided into
two subgroups : ( i ) none ( reference group ) including responses and , and ( ii ) at
least weekly including responses . independent variables :
household income was evaluated based on the answers to the following
question : what is your average monthly household income ? the response options were
under 1,000,000 won ( usd estimate , 1 $ = 1,000 won ) , 1,000,0001,500,000 won ,
1,510,0002,000,000 won , 2,010,0002,500,000 won , 2,510,0003,000,000 won ,
3,010,0003,500,000 won , 3,510,0004,000,000 won , 4,010,0004,500,000 won ,
4,510,0005,000,000 won , 5,010,0005,500,000 won , 5,510,0006,000,000 won , and
over 6,000,000 won .
covariate variables : participants ages , as defined by the korean survey of citizens
sports participation data , were used without any modifications . statistical analysis : multiple logistic regression analyses were conducted in order to
determine whether physical activity is related to the household income of men and women
after adjusting for age .
analyses were performed using spss version 18.0 ( chicago , il , usa )
and statistical significance was accepted for values of p < 0.05 .
the results of the multiple logistic regression analyses are shown in table 2table 2.the results of the multiple logistic regression analyses for the household
income physical activity relation in korea ( n = 9,000)physical activitynone vs. at least weeklymenwomenor95% cip - valueor95% cihousehold incomeunder 1,000,000 won ( usd 1,000)ref.ref.1,000,000 1,500,000 won1.0880.7511.5770.6561.5881.1352.221**1,510,000 2,000,000 won1.2560.8861.7810.2011.9711.4322.715***2,010,000 2,500,000 won1.2480.8971.7350.1892.4501.8053.325***2,510,000 3,000,000 won1.3340.9561.8620.0902.1041.5382.877***3,010,000
5,000,000 won2.0211.3752.970<0.001***2.6871.8573.888***5,010,000 5,500,000 won1.1340.7411.7340.5623.7842.5645.585***5,510,000 6,000,000 won2.8031.470-5.3450.002**3.0431.6395.652***over 6,000,000 won ( usd 6,000)2.2431.2564.0050.006**2.7371.4105.311**estimate 1 $ = 1,000 won . or , odds ratio ; ci , confidence interval ; * p<0.05 ,
* * p<0.01 , * * * p<0.001 ; tested by multiple logistic regression analysis after
adjusting for participant age .. for men , compared with the reference category of under 1,000,000 won , the
odds ratios ( ors ) for reporting at least weekly physical activity according to household
income were : 3,510,0004,000,000 won , 1.503 ( p=0.019 ) ; 4,010,0004,500,000 won , 1.643
( p=0.007 ) ; 4,510,0005,000,000 won , 2.021 ( p<0.001 ) ; 5,510,0006,000,000 won , 2.803
( p=0.002 ) ; and over 6,000,000 won , 2.243 ( p=0.006 ) .
estimate 1 $ = 1,000 won . or , odds ratio ; ci , confidence interval ; * p<0.05 ,
* * p<0.01 , * * * p<0.001 ; tested by multiple logistic regression analysis after
adjusting for participant age . for women , compared with the reference category of under 1,000,000 won , the ors for
reporting at least weekly physical activity according to household income were :
1,000,0001,500,000 won , 1.588 ( p=0.007 ) ; 1,510,0002,000,000 won , 1.971 ( p<0.001 ) ;
2,010,0002,500,000 won , 2.450 ( p<0.001 ) ; 2,510,0003,000,000 won , 2.104 ( p<0.001 ) ;
3,010,0003,500,000 won , 2.683 ( p<0.001 ) ; 3,510,0004,000,000 won , 2.388 ( p<0.001 ) ;
4,010,0004,500,000 won , 2.740 ( p<0.001 ) ; 4,510,0005,000,000 won , 2.687 ( p<0.001 ) ;
5,010,0005,500,000 won , 3.784 ( p<0.001 ) ; 5,510,0006,000,000 won , 3.043 ( p<0.001 ) ;
and over 6,000,000 won , 2.737 ( p=0.003 ) .
the present findings suggest there is a strong relation between household income and
physical activity for korean men and women .
research has shown that obesity is a consistent negative influence
on physical activity17 , 18 and physical fitness19 .
moreover , obesity rates are also affected by socioeconomic
factors13 , 15 , suggesting that socioeconomic factors are also associated with
physical activity .
people that live in low - income households have greater difficulty being physically active
compared with higher - income people owing to various social and environmental barriers such
as long distances to sports facilities , poor transportation services , poor neighborhoods and
traffic conditions , a lack of parks and recreational facilities , air pollution , a lack of
spare time , bad health , and a lack of exposure to social support related to exercise .
even
though these barriers affect other income groups , the impact is much greater on low - income
communities20 .
interestingly , our study shows that men are affected in the over 3,510,000 won income
bracket and that women are affected in the over 1,000,000 won bracket , implying that the
household income physical activity relation is stronger for women than men . in korean
culture
, it is assumed that men , the traditional heads of households , have the economic
responsibility of supporting the family .
therefore , for middle - income earners ( over
3,010,000 won ; estimated usd 3,000 ) , participation in physical activity begins to increase
and show a statistical relationship .
in contrast , with rising incomes women showed a
continuous increase in physical activity ors compared with very low - income earners ( under
1,000,000 won ; estimated usd 1,000 ) .
thus ,
further well - designed studies should be performed in order to determine the individual
effects of household income on physical activity .
first , the survey only investigated
self - reported physical activity ; it did not directly measure subjects physical activity
levels , and it did not investigate other physical activity factors such as intensity , time ,
or duration . therefore , future research should aim to improve the research design
considering these aspects .
second , because this survey was cross - sectional , we did not
provide a cause and effect analysis , only assessing the interrelationship between household
income and physical activity .
nevertheless , by investigating a large and nationally
representative sample in korea , it should be possible to generalize our findings to other
research settings . in summary ,
the present findings show a strong relationship between
household income and physical activity for korean men and women . | [ purpose ] based on the relationship between obesity and physical activity , several recent
studies have reported that level of exercise is associated with household income .
hence ,
the purpose of this study is to explore the relationship between household income and
physical activity in korea .
[ subjects and methods ] in 2012 , 9,000 koreans ( 4,479 men and
4,521 women ) aged 1089 years participated in the korean survey of citizens sports
participation project .
this survey provided us with information on the amount of physical
activity undertaken each week and the household incomes of a nationally representative
sample of respondents .
the relationship between household income and physical activity was
then evaluated by conducting multiple logistic regression analysis after controlling for
participant age .
[ results ] the present findings show a strong relationship between
household income and physical activity for korean men and women .
[ conclusion ] further
well - designed studies should be performed in order to determine the individual effects of
household income on physical activity . |
the goal of a prosthodontic rehabilitation is to fabricate a prosthesis , which is in harmony with the patient 's stomatognathic system .
the most essential consideration in the oral rehabilitation of any patient is the inclination of the condylar path .
condylar path is the path traversed by the condyle in relation to the articular eminence when the mandible is moved either protrusively or laterally from centric relation .
condylar guidance is the mechanical form located in the upper posterior region of an articulator that controls movement of its mobile member .
the purpose of protrusive jaw relation is to set the condylar elements of the articulator so that they will reproduce inclinations , which are similar or comparable to that of the patient 's temporomandibular articulation .
however , many practitioners rely on average values of condylar guidance , which range from 22 to 65. if the individual inclination of the articular eminence is very steep or flat , guidance derived from the mean value settings may vary sufficiently leading to incorporation of inaccuracies while accomplishing a particular clinical objectives such as posterior disocclusion or balanced occlusion .
various intra - oral and extra - oral methods have been used to register the path of the condyle and adjust the articulator accordingly .
centric and eccentric relations of the mandible can be recorded through intraoral or positional wax method , graphic recordings , functional recordings , and cephalometrics . despite accurate registration methods , sources of error
arise in laboratory procedures as a result of instability of materials and changes during their setting or polymerization .
the reliability of wax records for protrusive jaw relation has been questioned as condylar guidance adjusted according to three separate records will yield three different results . moreover ,
if the patient moves the jaw laterally in protrusive movement , the registration of the condyle path will be changed .
the use of supplementary aids such as imaging may help in resolving the above problems and establish accurate registration of sagittal condylar guidance .
the outline of the articular eminence and the glenoid fossa of the temporal bone has been evaluated on panoramic radiographs and proposed to be of valuable aid in setting the condylar guidance in semi - adjustable articulators .
there are no studies in the dental literature , which compare condylar guidance obtained with protrusive interocclusal records using aluwax and panoramic radiographic images .
this study sought to evaluate the two techniques for recording and determining sagittal condylar guidance .
a total of 75 dentulous healthy subjects participated in the study after written informed consent was obtained .
the study was given clearance by the institutional ethical review committee and was completed over a period of 8 months from january to august , 2011 .
subjects within the age group of 20 - 40 years having a minimum of three teeth in each of the posterior quadrants were included , while subjects with less than three teeth in each of the posterior quadrant , facial or skeletal malformations , temporomandibular disorders , and poor neuromuscular co - ordination were excluded from the study .
maxillary and mandibular impressions were made using irreversible hydrocolloid ( zelgan 2002 ; dentsply , india ) impression material and casts were immediately poured using type iii dental stone ( dental stone , kalabhai , india , ) . using face bow ( hanau spring bow , whip mix corporation , usa ) transfer , the maxillary cast was mounted on the semi - adjustable articulator ( hanau wide - vue articulator , whip mix corporation , usa ) .
the protrusive interocclusal record was made at 6 mm protrusion by using aluwax [ figure 1 ] .
protrusive relation was evaluated and reconfirmed before the sagittal condylar inclinations were set and locknuts were tightened with hand pressure [ figure 2 ] . in all the cases ,
protrusive interocclusal record using aluwax condylar guidance obtained by programming of articulator using protrusive interocclusal registration the radiographic procedures were carried out in department of oral radiology of the institute .
all radiographs were made by the single operator in the same radiographic unit ( promax planmeca , helsinki ) with exposure factors of 68 kvp and 10 ma .
the images were printed to 100% scale on agfatm films in an agfa drystartm 5302 printer .
the sagittal outlines of the left and right articular eminence and glenoid fossae were traced on a transparent acetate tracing sheet by two examiners .
( lowest point in the margin of the orbit ) and porion highest point in the margin of the auditory meatus ) were identified and the frankfurt horizontal plane was constructed by joining the two landmarks on each side . the most superior point on the articular eminence and the most inferior point on the articular tubercle were identified and a second line to represent the mean condylar path inclination was constructed by joining the two points . the angle formed by the intersection of the two lines
was determined to represent the angle of sagittal condylar inclination [ figures 3 and 4 ] .
this was determined by the two examiners and the average taken as the true value .
panoramic radiograph of the patient showing the tracing of the angle of sagittal condylar guidance .
red line : outline of articular fossa and eminence , green line : frankfurt horizontal plane , blue line : sagittal condylar path inclination line diagram of the panoramic tracing of the angle of sagittal condylar guidance all statistical analysis was carried out in spss 16 software ( statistical package for the social sciences , ibm software group , usa ) .
spearman - rho 's test was used to find the correlation between the sagittal condylar guidance between left and right sides and between the two methods on each side .
wilcoxon sign rank test was applied to check the difference between the right and left side condylar guidance determined by the two methods .
cronbach 's alpha was used to identify the degree of reliability of the radiographic method .
although , 75 dentulous healthy subjects participated in the study six were excluded due to presence of radiographic artifacts .
there were 30 male and 39 female subjects between 20 years and 42 years of age with a mean age of 26.76 years .
table 1 summarizes the range , mean , and standard deviation of condylar guidance values obtained using both the methods on the right and left side .
the mean difference between the condylar guidance values obtained using both methods was 1.97 for the right side and 3.18 for the left side , with the radiographic values being higher .
this difference between the values was found to be highly significant between the two methods for the right side ( 1395.50 , p = 0.003 ) and left side ( 1651.50 , p = 0.000 ) , respectively .
a significant positive correlation existed between the condylar guidance values of right and left sides in same subjects obtained using the protrusive interocclusal registration [ graph 1 ] and also by the panoramic radiograph separately [ graph 2 ] .
the condylar guidance values obtained from protrusive interocclusal registration and a panoramic radiograph showed a significant positive correlation for the right and left sides separately [ graphs 3 and 4 ] . the inter - observer reliability in identification and determination of condylar guidance by the panoramic radiographic method using cronbach 's alpha showed a high degree of reliability with 0.911 on the right side and 0.933 on the left side , respectively .
distribution of condylar guidance values obtained using both methods correlation between condylar guidance values obtained using protrusive interocclusal registration on right and left side ( r = 0.594 , p = 0.000 ) correlation between condylar guidance values obtained using panoramic radiograph on right and left side ( r = 0.299 , p = 0.013 ) correlation between condylar guidance values obtained using protrusive interocclusal registration and panoramic radiograph on right side ( r = 0.413 , p = 0.000 ) correlation between condylar guidance values obtained using protrusive interocclusal registration and panoramic radiograph on left side ( r = 0.291 , p = 0.015 ) a linear regression coefficient showed a strong degree of association between the two methods by the equation ( y = a + bx ) , where y = dependent variable / condylar guidance set by interocclusal records , a = interceptor , 22.79 for left side and 18.44 for right side , b = coefficient , 0.34 for left side and 0.39 for right side , x = independent variable / condylar guidance set by the panoramic radiographic method .
maxillary and mandibular impressions were made using irreversible hydrocolloid ( zelgan 2002 ; dentsply , india ) impression material and casts were immediately poured using type iii dental stone ( dental stone , kalabhai , india , ) .
using face bow ( hanau spring bow , whip mix corporation , usa ) transfer , the maxillary cast was mounted on the semi - adjustable articulator ( hanau wide - vue articulator , whip mix corporation , usa ) .
the protrusive interocclusal record was made at 6 mm protrusion by using aluwax [ figure 1 ] .
protrusive relation was evaluated and reconfirmed before the sagittal condylar inclinations were set and locknuts were tightened with hand pressure [ figure 2 ] . in all the cases , articulator was programmed by a single operator .
protrusive interocclusal record using aluwax condylar guidance obtained by programming of articulator using protrusive interocclusal registration
all radiographs were made by the single operator in the same radiographic unit ( promax planmeca , helsinki ) with exposure factors of 68 kvp and 10 ma .
the images were printed to 100% scale on agfatm films in an agfa drystartm 5302 printer .
the sagittal outlines of the left and right articular eminence and glenoid fossae were traced on a transparent acetate tracing sheet by two examiners .
( lowest point in the margin of the orbit ) and porion highest point in the margin of the auditory meatus ) were identified and the frankfurt horizontal plane was constructed by joining the two landmarks on each side .
the most superior point on the articular eminence and the most inferior point on the articular tubercle were identified and a second line to represent the mean condylar path inclination was constructed by joining the two points . the angle formed by the intersection of the two lines
was determined to represent the angle of sagittal condylar inclination [ figures 3 and 4 ] .
this was determined by the two examiners and the average taken as the true value .
panoramic radiograph of the patient showing the tracing of the angle of sagittal condylar guidance .
red line : outline of articular fossa and eminence , green line : frankfurt horizontal plane , blue line : sagittal condylar path inclination line diagram of the panoramic tracing of the angle of sagittal condylar guidance
all statistical analysis was carried out in spss 16 software ( statistical package for the social sciences , ibm software group , usa ) .
spearman - rho 's test was used to find the correlation between the sagittal condylar guidance between left and right sides and between the two methods on each side .
wilcoxon sign rank test was applied to check the difference between the right and left side condylar guidance determined by the two methods .
cronbach 's alpha was used to identify the degree of reliability of the radiographic method .
although , 75 dentulous healthy subjects participated in the study six were excluded due to presence of radiographic artifacts . the sagittal condylar guidance values obtained by both methods from 69 subjects
there were 30 male and 39 female subjects between 20 years and 42 years of age with a mean age of 26.76 years .
table 1 summarizes the range , mean , and standard deviation of condylar guidance values obtained using both the methods on the right and left side .
the mean difference between the condylar guidance values obtained using both methods was 1.97 for the right side and 3.18 for the left side , with the radiographic values being higher .
this difference between the values was found to be highly significant between the two methods for the right side ( 1395.50 , p = 0.003 ) and left side ( 1651.50 , p = 0.000 ) , respectively .
a significant positive correlation existed between the condylar guidance values of right and left sides in same subjects obtained using the protrusive interocclusal registration [ graph 1 ] and also by the panoramic radiograph separately [ graph 2 ] .
the condylar guidance values obtained from protrusive interocclusal registration and a panoramic radiograph showed a significant positive correlation for the right and left sides separately [ graphs 3 and 4 ] .
the inter - observer reliability in identification and determination of condylar guidance by the panoramic radiographic method using cronbach 's alpha showed a high degree of reliability with 0.911 on the right side and 0.933 on the left side , respectively .
distribution of condylar guidance values obtained using both methods correlation between condylar guidance values obtained using protrusive interocclusal registration on right and left side ( r = 0.594 , p = 0.000 ) correlation between condylar guidance values obtained using panoramic radiograph on right and left side ( r = 0.299 , p = 0.013 ) correlation between condylar guidance values obtained using protrusive interocclusal registration and panoramic radiograph on right side ( r = 0.413 , p = 0.000 ) correlation between condylar guidance values obtained using protrusive interocclusal registration and panoramic radiograph on left side ( r = 0.291 , p = 0.015 ) a linear regression coefficient showed a strong degree of association between the two methods by the equation ( y = a + bx ) , where y = dependent variable / condylar guidance set by interocclusal records , a = interceptor , 22.79 for left side and 18.44 for right side , b = coefficient , 0.34 for left side and 0.39 for right side , x = independent variable / condylar guidance set by the panoramic radiographic method .
during any prosthodontic rehabilitation , it is of utmost importance to restore the patient 's occlusion which coincides with centric relation and to provide an occlusion free of interference .
most articulators have condylar element glide - in - slots to provide a rectilinear stimulation of the curvilinear path of the condyle thus , producing a difference between the existing biological situation and the mechanical articulator .
sometimes , frictional inhibition of movement of the condylar components of the articulator also introduces errors in the values of the condylar guidance .
radiographic determination of the condylar guidance has been attempted by the temporomandibular joint ( tmj ) transpharyngeal view described by mc queen .
the angle of condylar guidance was determined by relating the sagittal condylar path inclination to the camper 's plane ( ala of the nose to the tragus ) .
however , the reproducibility of these tmj specific views is suspect , as also the use of a reference plane which does not rely on stable bony landmarks can lead to further incorporation of errors .
condylar guidance on an articulator is adjusted utilizing either the patient 's protrusive or lateral interocclusal registrations .
the hanau wide - vue articulator with fixed intercondylar distance can be set using the protrusive interocclusal registration .
following the protrusive interocclusal registration condylar guidance is measured in degrees relative to a plane of reference .
condylar guidance inclination determined by two methods can not be compared when obtained by different planes of reference .
the present study utilized the ( hanau spring bow ) which relies on the frankfurt 's horizontal plane to transfer the patient 's relation to the articulator .
the same plane is readily demonstrable on a panoramic radiograph by joining the porion and the orbitale landmarks [ figures 3 and 4 ] .
the panoramic radiographic image of the sagittal outline of the articular eminence and glenoid fossae was clearly identified in 69 subjects .
when viewing the region of the temporal bone on a panoramic radiograph two radio - opaque lines are apparent , the lighter and superior one depicting the articular eminence and fossa and the heavier , more inferior one representing the inferior border of the zygomatic arch .
inter - examiner reliability in identification of the radiographic outline of the articular eminence and determination of condylar guidance by the radiographic method showed suitable values of 0.911 on the right side and 0.933 on the left side .
the average condylar guidance by the interocclusal method was 34.71 on the right side and 35.00 on the left side .
the mean condylar guidance values obtained using the radiographic method was 36.68 on the right side and 38.18 on the left side .
literature suggests that the right and left eminences seldom have exactly the same slants , contours , and declivities .
the average condyle path angle of left condyle reported using a gnathograph was 35.11 , and that of the right condyle was 36.02. in contrast , a bilateral symmetry of the right and left sagittal condylar guidance angle:31 on both sides has also been reported using protrusive interocclusal records .
similarly , the present study showed a lesser mean difference of 0.29 between the right and left sides by the protrusive interocclusal record method than the 1.5 by the panoramic radiograph method , highlighting the inherent differences in the method of determination of condylar guidance .
a significant positive correlation was observed between the condylar guidance acquired using protrusive interocclusal records and panoramic images for both right ( p 0.000 ) and left sides ( p 0.015 ) . a study comparing the radiographic image of the sagittal condylar path inclination and its actual anatomic outline in dry skulls and found that the radiographic values were on an average 7 greater than the skull values .
the present study found that the condylar guidance values by the radiographic method were greater by 1.97 and 3.18 than the protrusive interocclusal method for the right and left sides , respectively .
there are some limitations of the radiographic method concerning panoramic distortion , head and reference plane orientation , and difficulty in distinguishing the articular eminence outline from the zygomatic arch .
the positions of these two lines relative to each other may vary if there is a change in beam direction due to positioning errors .
further , the articular eminence inclination in the radiographic image was traced by a line joining the heights of curvature in the glenoid fossa and the articular eminence to represent the mean sagittal condylar path inclination .
this may be different from the guiding inclination with approximately 4 - 6 mm of protrusion , which is the clinically significant range of protrusion and condylar guidance . despite these drawbacks ,
the panoramic radiograph is extremely useful for comparison between right and left sides since it shows both the tmjs with relatively same magnification errors ( 1.2 ) .
it is a reproducible radiograph unlike the other tmj specific radiographs which are subject to projection errors .
although direct comparisons between a functional method and a radiographic method would seem improbable ; the present study found a strong degree of correlation between the condylar guidance determined by the two methods .
this was further demonstrated by the linear coefficient equation derived ( y = a + bx ) above .
further studies on the variations in the sagittal condylar path inclination values in the panoramic radiographs are required to obtain normative data for our population
considering the inaccuracies of the interocclusal record technique with inherent errors of up to 30 ; the radiographic method may have clinical relevance .
it suggests that such tracings may be made relative to a suitable horizontal reference plane like the frankfurt horizontal and the resulting condylar guidance angles used to set the condylar guide settings of semi - adjustable articulators . | purpose : to evaluate the correlation between sagittal condylar guidance obtained by protrusive interocclusal records and panoramic radiograph tracing methods in human dentulous subjects.materials and methods : the sagittal condylar guidance was determined in 75 dentulous subjects by protrusive interocclusal records using aluwax through a face bow transfer ( hanau spring bow , whip mix corporation , usa ) to a semi - adjustable articulator ( hanau wide - vue articulator , whip mix corporation , usa ) . in the same subjects ,
the sagittal outline of the articular eminence and glenoid fossa was traced in panoramic radiographs .
the sagittal condylar path inclination was constructed by joining the heights of curvature in the glenoid fossa and the corresponding articular eminence .
this was then related to the constructed frankfurt 's horizontal plane to determine the radiographic angle of sagittal condylar guidance.results:a strong positive correlation existed between right and left condylar guidance by the protrusive interocclusal method ( p 0.000 ) and similarly by the radiographic method ( p 0.013 ) .
the mean difference between the condylar guidance obtained using both methods were 1.97 for the right side and 3.18 for the left side .
this difference between the values by the two methods was found to be highly significant for the right ( p 0.003 ) and left side ( p 0.000 ) , respectively .
the sagittal condylar guidance obtained from both methods showed a significant positive correlation on right ( p 0.000 ) and left side ( p 0.015 ) , respectively.conclusion:panoramic radiographic tracings of the sagittal condylar path guidance may be made relative to the frankfurt 's horizontal reference plane and the resulting condylar guidance angles used to set the condylar guide settings of semi - adjustable articulators . |
success in a root canal treatment depends on the complete removal of canal content through mechanical instrumentation , on the accurate disinfection of the endodontic space by chemical agents followed by an adequate three - dimensional obturation.1 gutta - percha in association with different endodontic sealers has been used for long time as a traditional root canal obturation system.2 several studies indicated that resin based endodontic sealers exhibit superior sealing ability by adhesion to root - canal walls.35 in recent years different resin based dual - cure endodontic sealers were introduced to the clinical practice.6 endorez ( ultradent , south jordan , ut ) is a urethane dimethacrylate - based dual curing self priming sealer .
one of its prime characteristic properties is a high hydrophilicity , allowing the penetration of the material into the dentinal tubules.7 this sealer exhibits a good biocompatibility and performs successfully when used as an endodontic sealer together with gutta - percha cones in clinical cases.8,9 endorez is also compatible when bonding techniques are used , but it polymerizes within 2030 minutes , therefore if the immediate restoration of the tooth is the objective of treatment , the use of a dimethyl - p - toluidine - based accelerator ( ultradent , south jordan , ut ) to be used in conjunction with the sealer has been suggested.10 determination of the degree of conversion ( dc ) of methacrylate monomers to polymer may be used to evaluate the status of polymerization .
the dc indicates the percentage of monomer - polymer conversion and is both a quantitative and qualitative index of the extent of the polymerization ( ep).11 differential scanning calorimetry ( dsc ) is a thermal analysis technique that provides the variation of enthalpy in the exothermic reaction of polymerization ; thus allowing the examination of the behaviour of the materials tested by means of thermal and physical characterizations.12 this exam can be run using small masses of the samples to test11 with many advantages : 1 ) sharper and well defined peaks ; 2 ) less drift from the basis line ; 3 ) a linear proportionality relation between the mass of the specimen and the area under the peak .
dsc is also a convenient method for determining the relative efficacy of the initiator systems,11,13 inhibitors11 or activators at the end of the polymerization of a given material .
a current problem using some resin based endodontic sealers is their long setting time,14,15 probably due to their increased viscosity that may influence the initial reaction rate in the photopolymerization system .
the aim of this study was to determine with the dsc , the dc of three different resin based endodontic sealer systems : endorez ( ultradent , south jordan , ut , usa ) ; realseal ( sybronendo , orange , ca , usa ) ; and endorez in association with the accelerator ( ultradent , south jordan , ut , usa ) , activated with two different led units : ultralume led 5 ( ultradent , south jordan , ut , usa ) ; mini led satelec ( satelec acteon group , mrignac cedex , france ) .
in this study three resin based endodontic sealers were used : endorez ( er ) ( ultradent , south jordan , ut , usa ) ; endorez modified with the addition of a dimethyl - p - toluidine - based accelerator ( er+a ) ( ultradent , south jordan , ut , usa ) ; realseal ( rs ) ( sybronendo , orange , ca , usa ) .
realseal is an endodontic dual curable resin sealer , whose matrix is a mixture of bisphenol - a - glycidyl methacrylate , ethoxylate bis - gma , urethane dimethacrylate resin and hydrophilic difunctional matacrylates.16 two different led light units were used to activate each sealer : ultralume led 5 ( ultradent , south jordan , ut , usa ) ; mini led satelec ( satelec acteon group , mrignac cedex , france ) .
ultralume led 5 lamp produces light with wavelengths between 370 and 500 nm and a light intensity of 800 mw / cm .
mini led lamp has a wavelengths range between 420 and 480 nm and it generates a light intensity of 1250 mw / cm . in this study we did nt use a radiometer to measure the light intensity of these brand new led light sources employed , because these parameters were certified by the manufacturers .
six groups , of three samples each , were therefore created as follows : au ( er + ultralume led 5 ) ; bu ( rs + ultralume led 5 ) ; cu ( er + accelerator + ultralume led 5 ) ; am ( er + mini led ) ; bm ( rs + mini led ) ; cm ( er + accelerator + mini led ) . a differential scanning calorimeter dsc 7 ( perkin elmer inc . ,
wellesley , ma , usa ) was used to evaluate the degree of conversion ( dc ) of methacrylate monomers to polymer in each specimen .
the control ( an empty aluminium pan , called white ) , was prepared before dsc measurements , weighed with an analytic balance , placed in the reference sample holder and then irradiated with the same light units at the same conditions fixed for the sealers .
the exposure of the white served to evaluate the heat flow from the lamps .
specimens were set into previously calibrated dsc standard aluminium pans ( 4.52 mm ) , and weighed using the analytic balance to obtain 4.14.2 mg for each material . to prepare the specimen consisting of er with the accelerator ,
a thin layer of accelerator was applied uniformly on the base of each capsule with a micro - brush , then the sealer was placed to fill the capsule until the whole weight of the sample was reached as for all the other specimens .
a custom - made support was built to hold the lamps in a fixed position during polymerization , in order to assure the reproducibility of the dsc measurements , to fully irradiate only the specimen - containing pan , and to keep the distance lamp - specimen constant .
in addition each lamp was inserted inside an isolation cylinder to avoid the dispersion of the beam .
the photo curing units were used by two different polymerization protocols depending on the unit ( standard mode for the ultralume led 5 , and ramping mode for the mini led ) .
each sample was photopolymerized with 4 irradiations of 20 s each ( the minimum exposure time to obtain an adequate cure)17 at 2 min .
interval from each other ( this time is necessary to exclude the thermal effect of optical fibres ) .
the dsc to measure the enthalpy of polymerization was programmed under isothermal conditions at 32c , under constant flowing argon environment ( 10 ml / min ) to avoid oxidation during the polymerization . after the specimen containing pans were placed in the sample holder , the temperature
was immediately increased to 32c ( a process taking 20 s ) , to start the measurement of the heat flow .
the isothermal measurements were therefore always started exactly 2 min after the initial placement of the materials on the aluminium pan so that all the sealers were tested under the same conditions .
the heat flow in the dsc was calculated by considering the exact initial weight of the specimens since all the data from each sample were recorded in the software supplied with dsc 7 at the beginning of the experiment .
the heat flow generated during the polymerization reaction was recorded and graphically represented in a kinetic curve by means of the dsc 7 software .
the heat of the exothermic reaction obtained from the dsc of each specimen of sealer represented the sum of the exothermic effects caused by the conversion of the monomers and heat flow from the lamp ; while the scanning of the white ( control ) represented only the irradiation heat output from the lamp.18 the heat of polymerization developed during the test of the white was thus subtracted to calculate the heat of polymerization of the specimens .
enthalpy was calculated from the area under the peak of the isothermal curve , based on the extrapolated baseline at the end of the reaction .
the released heat is proportional to the percentage of reacted monomers.19 if the cure reaction is the only thermal event , then the reaction rate is proportional to the heat flow.20 the kinetic data was elaborated with a kaleida - graph software system ( version 4.0 , 2005 , synergy software , reading , pa 19606 , usa ) .
a dc value of 100% was attributed to er + a , which is the sample with maximum enthalpy observed , and the relative degree of conversion of the other sealers was calculated using this as a reference .
the degree of conversion ( ) was calculated using the following formula :
sample=(qssample / qser+a)100where qs and qs correspond respectively to the values of enthalpy of the sample to test and the sample er + a used as a reference .
each group was tested for four repeated irradiation times considering the following factors : material , type of light - curing unit and duration of exposure .
kruskal - wallis one - way anova multiple range test was performed at a p value of .05 .
student - newman - keuls ( snk ) test at a p level of .05 was then applied to identify pairwise differences .
representative relative values of the degree of conversion as a function of irradiation time measured for the materials tested , irradiated with ultralume led 5 and mini led are respectively shown in figure 1 a , b , c .
the results are as follows :
samples tested with ultralume led 5 : group cu showed a degree of conversion significantly higher compared with the other sealers ; no statistical differences were found between groups au and bu ( figure 1a).samples tested with mini led : statistically significant differences were observed between relative dc of all the materials tested , with the highest values for group cm and the lowest recorded values for group bm ( figure 1b ) .
samples tested with ultralume led 5 : group cu showed a degree of conversion significantly higher compared with the other sealers ; no statistical differences were found between groups au and bu ( figure 1a ) .
samples tested with mini led : statistically significant differences were observed between relative dc of all the materials tested , with the highest values for group cm and the lowest recorded values for group bm ( figure 1b ) .
therefore , the values of enthalpy of the groups er + accelerator ( cm and cu ) among the specimens polymerized were higher when compared to the other resin materials tested with the same lamp ( figure 2a ) .
relative dc values were calculated for each specimen as a function of the irradiation time using as only reference the highest value obtained with ultralume led 5 for the specimen er + a ( cu ) to which was attributed 100% of value .
then the relative degree of conversion values were calculated for each specimen using as only reference the highest value obtained with mini led for the specimen er + a ( cm ) to which was attributed 100% of value .
assuming that the heat of reaction corresponds to the extent of the polymerization ( ep ) obtained , statistically significant differences in the degree of conversion were observed in the pairwise comparison between the materials tested and the sealers prepared with the addition of the catalyst . according to the data recorded for each material the group cm ( er + accelerator + mini led ) showed the highest values of enthalpy followed ( in decreasing values of enthalpy ) by these groups : am ( er + mini led ) , bm ( rs + mini led ) , cu ( er + accelerator + ultralume led 5 ) , bu ( rs + ultralume led 5 ) , au ( er + ultralume led 5 ) ( table 1 ) .
the use of the mini led produced values of enthalpy of reaction higher than those produced with the ultralume led 5 in all the materials tested .
figure 1c is representative of relative dc values calculated for each specimen as a function of irradiation time using as only reference the highest value of enthalpy obtained for the specimen er + a + mini led .
statistically significant differences were observed among the behaviour of all the specimens with the exception of cu / bm and au / bu ( table 1 ) .
after the first irradiation all materials tested showed a similar behaviour regarding enthalpy values , which decreased relatively slowly after the successive irradiations and reached a plateau between the third and the fourth irradiation time ( figure 2b ) . among the materials tested with the same lamp , er+a showed the best values of enthalpy produced after the first irradiation time ( figure 2b ) which correspond to a higher conversion than that obtained in the other sealers after 20 s of irradiation time .
in this study we evaluated the polymerization status of two methacrylate - based resin sealers , both self and photo - curing , that are used for root canal obturation : endorez and realseal.21,22 we also investigated the behaviour of endorez used with an accelerator .
the ultimate properties of dental resins are directly related both to the chemical composition of the dental monomer system and to the degree of its conversion ( dc ) to polymer.11 in general the dc influences the mechanical - physical properties and clinical performance of dental resins as it has been underlined by many studies , including compressive strength , flexural strength , hardness and wear.23 two other phenomena connected with the polymerization of the resins are volumetric shrinkage and heating.24 the adequacy of the polymerization is influenced by many factors such as the distance of the light source from the resin ; the type of resin ( shade , translucency and thickness , viscosity);25 the temperature ; the curing and post - irradiation time;24,26 the reactivity of the monomer ; the types and amounts of inhibitors , the light ; the oxygen permeability27 and also the type and amount of photo initiator / co - initiator systems.13,28 it has also been shown that dynamic heating of the resin samples increases the rate of polymerization resulting in higher conversion.29,30 in our study we tested the materials in isothermal conditions . we used dsc because it is one of the most reliable direct methods for analyzing the degree of conversion of resin blends and the kinetics of the curing reaction.18 dsc determines the dc based on the assumption that the heat produced during the reaction ( enthalpy ) is proportional to the percentage of monomers that have reacted.13,19 in addition the enthalpy makes it possible to study how different combinations of photo - initiator and coinitiator systems , or a specific activator , affect the final cure when different light sources are used.13 in this study we also determined the conversion level as a function of the irradiation time .
adequate polymerization of dental resins depends also on the intensity of the light source ( power density measured in mw / cm ) , correct wavelength of the light and duration of the exposure.25,26 if these parameters are not adequate an incomplete polymerization will occur , together with the exhibition of poor physical properties of the material , higher solubility and consequently an early failure.31 in our experiment we used ultralume led 5 and mini led .
light emitting diodes ( led ) units produce light with wavelengths between 450 and 490 nm with a peak at 460 nm : this energy range is nearly ideal for activating materials that employ camphorquinone as a photoactivator ; therefore leds require less power to operate . in addition led units have an extended life and produce less heat thus respecting pulp and gingival tissue.25,31 dental resins cured with blue leds show a larger depth of cure , a higher dc and more stable three - dimensional structures than those cured using halogen lamps.32 in this experiment the values of conversion of the endorez + accelerator system were the highest of all materials tested , both with ultralume led 5 and mini led lamp .
in addition , among the materials tested with the same lamp , endorez + accelerator showed the highest values of enthalpy after the first irradiation time ( 20 s ) . with regard to the groups where endorez + accelerator was tested , the type of led light unit employed did not influence the experimental results in terms of polymerization rate when compared to the other resin materials tested . according to our results relative
dc progressively increased in all the specimens tested from the first to the fourth irradiation .
further irradiations after the first light exposure of 20 s contributed to increase the percentage of cured monomers .
endorez with or without accelerator and realseal polymerized with the mini led showed a better behaviour than the same sealers polymerized with the ultralume led 5 : this was probably due to the major intensity of the light source .
realseal polymerised with the ultralume led 5 showed values of conversion from the second to the fourth irradiation that were higher than those obtained from the endorez polymerized with the same lamp , but these differences were not statistically significant .
in the group realseal + mini led at each irradiation time the conversion was significantly lower than that recorded for the group endorez + mini led , and the values of enthalpy were almost constant during all the polymerization .
the different behaviour among the materials tested may be due to their different components , such as photo initiators , that allow a different response of the material to the irradiation .
it was not possible to use the same curing mode for the two light units .
however in consideration of the exponential increase of the dc as a function of irradiation time , we did not expect significant differences among the two curing modes . in this study
we evaluated the differences in dc of the sealers considering the overall characteristics of the led light units . during the interval between each irradiation the materials did not exhibit significant exothermic signals , thus indicating that the auto - polymerization was very slow and did not influence this experiment .
the sample preparation consisting of er with the accelerator was meant to reflect the situation that occurs in the endodontic system where the contact of the activator with er interests only the interface of the sealer with the gutta - percha cones that are immersed into the accelerator before their placement in the canal previously filled with the endorez .
the higher values of dc exhibited by endorez used in conjunction with the accelerator has a clinical relevance because it decreases the setting time of the material making it possible to complete the restoration of the tooth in one visit .
it has also several advantages in terms of increasing the mechanical properties of the material ( obturation stability , durability and performance after initial polymerization ) .
it must be considered that a higher polymerization corresponds to a major shrinkage of the resin , which may represent an important cause of microleakage : in a recent study , higher leakage was found when using endorez sealer with accelerator than endorez alone in delayed post space preparation.10,33 on the other hand the placement of many accessory cones , as the surface of the canal allows , reduces the amount of sealer , resulting in less polymerization shrinkage . if the immediate completion of the restoration of a tooth is the objective , then the accelerator should be used .
in the methacrylate - based sealers after light activation residual unreacted monomers continue to react slowly even at body temperature . as
these unreacted monomers are responsible for the biological response to the material,26,34,35 we deduce that an increase in the degree of conversion can reduce the cytotoxicity of the sealers . in this
study the reactions of polymerization resulted not complete following the first irradiation time : the dc progressively increased as a function of the irradiation and its values after each subsequent irradiation contributed to a reduction of the percentage of unreacted monomers .
therefore the results of our experiment are qualitatively in accordance with the study of mazinis and lambrianides , according to which there s not correlation between setting time and setting conversion of endodontic sealers as the setting conversion of the material continues after the setting time ( that is the time when the material harden).14
according to the results obtained in this study , it could be concluded that :
either using mini led or ultralume led 5 as light unit , endorez in association with the accelerator exhibits significantly higher values of dc than endorez and realseal , both without catalysts;the use of the mini led produced higher dc than the ultralume led 5 , both in the endorez with or without accelerator and in the realseal;the relative dc progressively increased in all the specimens tested from the first to the fourth irradiation;only further studies can evaluate if the use of endorez with the addition of the accelerator may represent an advantage or a disadvantage for its clinical use .
either using mini led or ultralume led 5 as light unit , endorez in association with the accelerator exhibits significantly higher values of dc than endorez and realseal , both without catalysts ; the use of the mini led produced higher dc than the ultralume led 5 , both in the endorez with or without accelerator and in the realseal ; the relative dc progressively increased in all the specimens tested from the first to the fourth irradiation ; only further studies can evaluate if the use of endorez with the addition of the accelerator may represent an advantage or a disadvantage for its clinical use . | objectives : the aim of this study was to determine the degree of conversion ( dc ) of three resin based endodontic sealers using the dsc technique.methods:the sealers tested were : endorez ( er ) ( ultradent , south jordan , ut ) ; endorez with accelerator ( er+a ) ( ultradent , south jordan , ut ) ; realseal ( rs ) ( sybronendo , orange , ca ) .
two led units were used to activate the sealers : ultralume led 5 ( ultradent , south jordan , ut , usa ) ; mini led satelec ( satelec acteon group , mrignac cedex , france ) .
samples of 4.0 mg were analyzed with a dsc 7 calorimeter ( perkin elmer inc . ,
wellesley , ma , us ) .
each specimen was irradiated by each lamp four times for 20 seconds at an interval of 2 mins , while the dsc 7 recorded the heat flow developed during the treatment .
the degree of conversion and the kinetic curves were calculated from the values of heat developed during each polymerization .
the data were statistically analysed with a kruskal - wallis one - way anova multiple range and student - newman - keuls ( snk ) tests at a p value of .05.results : statistically significant differences were found in the degree of conversion among the sealers : er+a showed the highest values with both lamps.conclusions:the higher polymerization rate in resin sealers is obtained with the addition of a catalyst . |
staphylococcus aureus and streptococcus pneumoniae are two common colonizers of the upper respiratory tract that may cause severe invasive disease , .
s. aureus is the leading cause of skin and soft tissue infections affecting individuals in the community and hospitals and also a leading cause of neonatal sepsis and childhood pneumonia , .
s. pneumoniae is a frequent cause of pneumonia , meningitis and septicaemia . for both bacteria , asymptomatic colonization ( or carriage ) of the nasopharynx
s. aureus is found most frequently in the anterior nares but is also commonly found in the oropharynx and nasopharynx , on the skin and to a lesser extent in the gastrointestinal tract , perineum and axilla .
carriage of s. pneumoniae is most prevalent in children and older adults , while s. aureus shows a different age colonization pattern being highest among neonates , and then relatively constant in older age groups .
worldwide , approximately 20% to 30% of adults are nasal carriers of s. aureus
but there is wide variation in reports of s. aureus carriage rates among paediatric and surgical patient populations in sub - saharan africa , ranging from 14% in ghana to 47% in south africa .
the prevalence of s. aureus was highest among white men in one study which looked at healthy volunteer donors of different ethnic origins .
the introduction of pneumococcal conjugate vaccines ( pcvs ) alters the microbial flora in the nasopharynx of vaccinated individuals and their contacts .
although the overall prevalence of pneumococcal carriage has remained constant in most settings , there has been a substantial decrease of pneumococcal serotypes included in the vaccine , vaccine serotypes ( vt ) and an increase in other serotypes not included in the vaccine , nonvaccine serotypes ( nvt ) , .
one study found that s. aureus also increased after the introduction of pcvs , and several studies have reported an inverse association between asymptomatic carriage of s. pneumoniae and s. aureus
, , . in some instances
there are increasing concerns about a potential increase in s. aureus carriage and disease after the introduction of pcvs into africa . in the gambia
, the epidemiology of pneumococcal carriage , before and after pcv introduction , has been well described , . however
therefore , we used available data to study the epidemiology and risk factors for s. aureus nasopharyngeal carriage in a cohort of gambian infants before the introduction of pcv and evaluated the association with s. pneumoniae carriage .
infants were recruited as part of a large longitudinal carriage survey that was conducted in a rural area of western gambia between 17 december 2003 and 16 june 2005 .
we used samples and data from infants who were part of an ancillary study that assessed the association between routine vaccination and bacterial carriage .
all infants were vaccinated according to the gambia expanded program of immunization 's schedule which then offered bacillus calmette - gurin , oral polio , pentavalent ( diphtheria , pertussis , tetanus hepatitis b and haemophilus influenzae type b ) , measles and yellow fever vaccines .
nasopharyngeal swab samples were taken from infants as soon as possible after birth , every 2 weeks for the first 6 months and then every other month until their first birthday .
swabs were collected from the posterior wall of the nasopharynx using a calcium alginate swab and immediately placed in vials containing skim milk
vials were then transported within 8 hours of collection to the medical research council ( mrc ) unit the gambia , fajara , laboratories and stored at 70c .
samples were tested in batches for s. pneumoniae as part of the initial study . to isolate s. pneumoniae ,
10 l of a stgg sample were streaked onto a gentamicin blood agar plate and incubated for 18 to 24 hours at 35c in 5% co2 .
pneumococci were identified on the basis of colony morphology , optochin susceptibility and/or bile solubility .
serotyping was done with capsular and factor typing sera ( statens serum institute , copenhagen ) using the latex agglutination technique .
, the stgg samples were plated again onto agar plates for the isolation of s. aureus for the ancillary study . to isolate s. aureus , 50 l of thawed stgg sample were plated onto mannitol salt agar plates and incubated for 48 hours at 37c in ambient temperature .
the plates were examined for yellow or white colonies typical of staphylococci and subcultured onto blood agar plates to obtain pure growth .
all suspected colonies were tested with a catalase test , followed by coagulase testing when this was positive , using the remel staphaurex plus kit ( oxr30950201 ; oxoid ) to confirm the identity of s. aureus .
we analysed trends in the prevalence of s. aureus and s. pneumoniae carriage by splitting the sample into 10 groups of equal size , with the first group containing 10% of the samples taken at the youngest ages , the second group containing those taken at the next youngest 10% and so on .
we used logistic regression to model the association between s. aureus and s. pneumoniae carriage ( all serotypes , 13-valent pcv ( pcv13 ) vt and pcv13-nvt ) adjusted for season and age .
season was included in the model as a binary factor ( dry season from june to october and rainy season from november to may ) , and age was included as a restricted cubic spline .
other risk factors including sex , breast - feeding , upper respiratory tract infection ( urti ) and ear discharge at the time of swabbing , antibiotic use and travel out of the study area in the previous 2 weeks were also examined .
confidence intervals ( cis ) were adjusted for clustering at the village level using robust standard errors .
we conducted a secondary analysis using conditional logistic regression to estimate the association between s. aureus and s. pneumoniae carriage within individuals , thereby eliminating any confounding attributable to variation between individuals .
the cohort study was approved by the joint mrc gambia government ( gg ) ethics committee and by the ethics committee of the london school of hygiene and tropical medicine ; the subsequent study that collected additional vaccination data was also approved by the mrc gg ethics committee .
written consent was obtained from the parents or guardians of each infant recruited into the study .
a total of 237 infants were recruited into the original study . here , we included all infants from the previous ancillary study that had data on carriage of s. aureus and s. pneumoniae ( i.e. 57.6% of the original cohort ) ; an additional 11 infants were excluded from that study because their vaccination record was incomplete .
altogether , 147 infants were included in our analysis , providing a total of 1873 samples with median of 14 samples per infant ( range , 217 ) .
the median ages at which routine vaccines were given was 1.9 weeks ( interquartile range ( iqr ) 1.42.4 ) for bacillus calmette - gurin , 26.3 weeks ( iqr 22.733.3 ) for the third dose of the pentavalent vaccine , 43.1 weeks ( iqr 40.648.1 ) for measles vaccine and 44.0 weeks ( iqr 40.948.9 ) for yellow fever vaccine .
the majority of infants were breast - fed ; only on 7/1753 occasions was the infant not breast - feeding at the time of swabbing . of the 1873 samples ,
30.9% were positive for s. aureus , 82.0% positive for s. pneumoniae and 23.2% positive for both bacteria .
the 1535 s. pneumoniae positive samples yielded 1673 isolates with a total of 65 serotypes / groups . among all samples collected ,
51.2% were positive for pcv13-vt and 34.1% were positive for pcv13-nvt ( including 2.9% , n = 49 , nontypeable pneumococci ) .
prevalence of s. aureus was highest immediately after birth at 74.5% in the seven samples taken within the first 24 hours of life and decreased to 21.4% by 20 weeks of age .
prevalence of s. pneumoniae carriage , on the other hand , was low at birth , increased rapidly with age and reached a plateau after 10 weeks of age ( approximately 90% ) .
in infants older than 20 weeks , the prevalence of carriage of both bacteria remained constant until the end of the follow - up at 1 year of age ( fig . 1 ) .
the age pattern of pcv13-vt carriage was similar to that for overall pneumococcal carriage , but the peak was observed in older infants at approximately 40 weeks of age .
for pcv13-nvt , the peak of 51% carriage occurred very early ( 89 weeks of age ) , and carriage subsequently decreased to about 25% after 34 weeks ( fig . 1 ) .
a crude analysis showed an inverse association between carriage of s. aureus and s. pneumoniae ( inverse association with any pneumococcal carriage and pcv13-vt carriage ) and also with age ( table 1 ) .
after adjusting for age and season , s. aureus was positively associated with carriage of any s. pneumoniae ( odds ratio ( or ) 1.32 ; 95% ci 1.071.64 ; p 0.009 ) but was no longer associated with carriage of pcv13-vt ( or 0.99 ; 95% ci 0.701.41 ; p 0.973 ) . in an analysis using conditional regression , the statistical significance of the increased risk of any s. pneumoniae colonization among s. aureus carriers after adjusting for age and season was borderline ( adjusted or 1.41 ; 95% ci 0.992.03 ; p 0.059 ) . apart from urti , which was negatively associated with carriage
, none of the other risk factors tested in the adjusted analysis was associated with carriage of s. aureus ( table 1 ) .
in this study , we demonstrated that the inverse association between s. aureus and s. pneumoniae nasopharyngeal carriage among gambian infants before the introduction of pcv is explained by the difference in age pattern of carriage during the first year of life , and we found that the confounding effect of age masked a potential positive association between s. aureus and s. pneumoniae .
several studies have shown an inverse association between s. aureus and s. pneumoniae in africa and other regions , including studies by bogaert et al . in dutch children aged 1 to 19 years , and madhi et al .
one of them did adjust for age . in a randomized controlled trial in the netherlands which recruited children aged 1 to 7 years with recurrent otitis media ,
s. aureus carriage was higher in children who received pneumococcal vaccines compared to placebo .
. found an inverse association that persisted after adjustment for age among children younger than 40 months old ( median , 1.3 years ) in israel .
there are differences between the latter study and ours in that 80% of the children in the regev - yochay et al .
we also swabbed the children more frequently and included age as a continuous variable in our analysis . in another gambian study ,
an inverse association between overall pneumococcal carriage and s. aureus carriage also disappeared in the adjusted analysis .
a positive association between s. aureus and s. pneumoniae has not previously been reported , although shiri et al . noted increased s. pneumoniae colonization among individuals with dual carriage of h. influenzae and s. aureus .
a possible explanation for this association is that susceptibility to carriage varies within individuals over time , and this variation affects the risk of acquiring both s. aureus and s. pneumoniae .
the positive association is not attributable to variation between individuals in susceptibility to carriage because the association was also observed in the within - individual analysis .
our study showed a very high prevalence of s. aureus nasopharyngeal carriage among gambian infants , as previously reported in another setting in the country .
approximately 70% of newborns carried s. aureus ; the prevalence decreased to 20% between 10 and 20 weeks of life . a rapid drop in prevalence during this first year of life has been reported previously , although possibly later in infancy , as shown among pcv - unvaccinated infants .
carriage trend for vt pneumococci , but not nvt pneumococci , was similar to the trend for any pneumococcal carriage .
found an inverse association between s. aureus and vt pneumococci was stronger than that between s. aureus and nvt pneumococci .
besides being positively associated with s. pneumoniae , we found that carriage of s. aureus was negatively associated with urti .
the reason for this association is unclear , but it might be due to competitive interaction with other bacteria and possibly viruses which we did not explore .
carriage of s. aureus was not associated with breast - feeding , season or antibiotic use .
the absence of an association with breast - feeding is consistent with the findings of a large cohort study . on the other hand ,
the absence of an association with antibiotic use is not consistent with previous studies which have shown that recent antibiotic use lowers s. aureus carriage , but it is unsurprising because antibiotics were rarely used among infants in our study .
seasonality of s. aureus carriage has not been documented , although the prevalence of s. pneumoniae carriage in children increases during the dry season .
other factors including crowding and socioeconomic status may also be important predictors of bacterial carriage , but these data were not collected in the original study . s. aureus is primarily carried in the anterior nares ; therefore , carriage of s. aureus might have been more frequently detected if nasal or oral swabs had been used in addition to nasopharyngeal swabs . in a recent study of gambian infants ,
s. aureus was isolated from 65% of oropharyngeal swabs , but only 36% of nasopharyngeal swabs .
however , we would not expect this to alter the direction of the association between s. aureus and s. pneumoniae .
have shown that other respiratory pathogens remain viable when cultured from original swabs stored in stgg at 70c for up to 12 years .
s. aureus , though not one of the bacteria in their study , is a very robust organism and there is no reason to believe it would behave differently . in assessing the relationship between s. aureus and s. pneumoniae , age should be considered as an important confounder , at least among infants . after controlling for the effect of age ,
our study found a positive association between these two pathogens in the nasopharynx of infants , which suggests that s. aureus will not increase in prevalence after the introduction of pcv .
however , further surveys of bacterial carriage after introduction of pcvs in the gambia are required to confirm this prediction . | staphylococcus aureus and streptococcus pneumoniae commonly colonize the upper respiratory tract and can cause invasive disease .
several studies suggest an inverse relationship between these two bacteria in the nasopharynx .
this association is of particular concern as the introduction of pneumococcal conjugate vaccines ( pcvs ) that affect pneumococcal nasopharyngeal carriage become widespread .
a cohort of children in rural gambia were recruited at birth and followed for 1 year , before the introduction of pcv into the routine immunization program .
nasopharyngeal swabs were taken immediately after birth , every 2 weeks for the first 6 months and then every other month .
the presence of s. aureus and s. pneumoniae was determined using conventional microbiologic methods .
prevalence of s. aureus carriage was 71.6% at birth , decreasing with age to reach a plateau at approximately 20% between 10 to 20 weeks of age .
carriage with any s. pneumoniae increased during the first 10 weeks of life to peak at approximately 90% , mostly of pcv13 serotypes .
although in the crude analysis s. aureus carriage was inversely associated with carriage of any s. pneumoniae and pcv13 serotypes , after adjusting by age and season , there was a positive association with any carriage ( odds ratio 1.32 ; 95% confidence interval 1.071.64 ; p 0.009 ) and no association with carriage of pcv13 serotypes ( odds ratio 0.99 ; 95% confidence interval 0.701.41 ; p 0.973 ) . among gambian infants , s. aureus and s. pneumoniae
are not inversely associated in nasopharyngeal carriage after adjustment for age .
further carriage studies following the introduction of pcv are needed to better understand the relationship between the two bacteria . |
chronic obstructive pulmonary disease ( copd ) is associated with a two- to threefold increased risk of cardiovascular events.1,2 in fact , autopsy studies revealed cardiovascular disease ( cvd ) as the most frequent , but undetected and potentially modifiable , cause of death in patients with copd.3 the underlying mechanisms for the relationship between copd and cvd exceed the effects of traditional risk factors and remain largely unknown .
a long latency period between disease initiation and clinical manifestation allows the identification of subjects at risk at a subclinical , potentially reversible stage of cvd . for this purpose ,
several markers of subclinical atherosclerosis have been identified as predictors of cardiovascular risk.46 intima - media thickness of the brachial artery ( b - imt)7 is a novel and easily accessible parameter for the quantification of subclinical atherosclerosis .
recent studies validating markers of subclinical atherosclerosis against coronary angiography revealed b - imt as an independent predictor of cardiovascular events.8 in a 12-year follow - up study , b - imt clearly outperformed the predictive power of flow - mediated dilation ( fmd ) , the gold standard of noninvasive cardiovascular risk prediction via endothelial function.9 b - imt has not been studied in copd so far . consequently , this study aimed to assess b - imt in patients with copd compared to healthy controls and to investigate potential associations between b - imt and clinical as well as laboratory markers of copd ( ie , airflow limitation and systemic inflammation ) . in this context , the present analysis specifically aimed to assess the relationship between asymmetric dimethylarginine ( adma ) and copd .
adma is an endogenous inhibitor of nitric oxide synthase , providing a potential link between chronic inflammatory disorders and subclinical atherosclerosis.10,11 it was hypothesized that :
b - imt is significantly increased in patients with copd compared to smoking and nonsmoking controls.b - imt is significantly correlated with markers of systemic inflammation as well as adma levels in patients with copd .
b - imt is significantly increased in patients with copd compared to smoking and nonsmoking controls .
b - imt is significantly correlated with markers of systemic inflammation as well as adma levels in patients with copd .
for this observational study , a sample of patients with copd ( n=60 ) previously recruited via the outpatient clinic database of the otto wagner hospital , vienna , was analyzed .
inclusion criteria comprised evidence of airflow limitation on spirometry according to current guidelines,12 a smoking history of at least 20 pack - years and age > 40 years .
subjects were excluded if they were on long - term oxygen therapy , had evidence of an acute exacerbation of copd within the previous 4 months ( requiring antibiotics , oral steroids , and/or hospitalization ) , or suffered from any other relevant lung disease .
other exclusion criteria comprised overt cardiovascular disorders ( ie , coronary artery disease , chronic heart failure , cardiomyopathy , arterial hypertension , atrial fibrillation , and peripheral arterial disease ) , vasoactive medication , malignant diseases , diabetes mellitus , chronic renal failure , or chronic inflammatory conditions other than copd .
the control groups consisted of lifelong nonsmokers ( n=20 ) as well as apparently healthy smokers ( n=20 ) .
exclusion criteria were the same as in the study group plus the absence of obstructive lung disease confirmed by clinical evaluation and spirometry .
control subjects were recruited from the general population during a public awareness campaign on spirometry at the otto wagner hospital . the study was planned and conducted in accordance with the declaration of helsinki .
data handling and reporting followed the strobe - statement ( strengthening the reporting of observational studies in epidemiology).13 ultrasound studies of the brachial artery were conducted as previously reported.8 subjects were instructed to refrain from food , caffeine , tobacco , and vasoactive drugs for 46 h prior to the study visit .
measurements were performed at the antecubital fossa of the right arm after 10 min of rest with subjects placed in a supine position .
investigators blinded to clinical and spirometric results used high - resolution ultrasound ( 13 mhz ) for depiction of the intimal and medial layer of the brachial artery in a longitudinal plane . using a stereotactic device ,
the transducer position was fixed and images were stored at an adequate gain for subsequent offline analysis .
b - imt was assessed from the leading edge between lumen and intima to the leading edge between media and adventitia .
a cutoff value 0.345 mm was regarded as elevated b - imt14 and was therefore used as a discriminator for cardiovascular risk using the framingham risk score.15 lumen diameter was measured as the distance between the leading edge of the near and far intima lumen interface .
finally , the cross - sectional intima - media area ( b - ima ) was calculated following a previously described equation.16 lung function testing was performed according to the current guidelines12 for the verification of copd diagnosis , the classification of the gold stage , and the quantification of the distinct parameters of lung function ( forced expiratory volume in 1 s [ fev1 ] , % predicted ; forced vital capacity [ fvc ] , % predicted ; fev1/fvc ratio ) . a physical examination was conducted in every participant for height , weight , heart rate , and arterial blood pressure measurement .
venous blood samples were collected and analyzed for inflammatory biomarkers ( neutrophil count , interleukin [ il]-6 ) and levels of n - type pro - bnp ( pro b - type natriuretic peptide ) .
circulating adma concentrations were measured via reversed - phase high - performance liquid chromatography following a previously described method.17 the 10-year risk for cardiac events was calculated by means of the framingham risk score15 including the independent cardiovascular risk factors : age , sex , smoking history , arterial blood pressure , cholesterol ( total and high - density lipoprotein [ hdl]-cholesterol ) , and diabetes .
variables of interest are expressed as counts ( % ) for categorical variables , as mean standard deviation or median and interquartile range for interval variables depending on the respective data distribution .
between - group comparisons were performed using independent samples t - test or mann whitney u - test depending on the respective data distribution .
univariate correlations were performed by means of pearson s correlation coefficient or kendall s tau depending on the respective data distribution .
a multiple linear regression model was used to identify the strongest predictors of b - imt . through forward selection ,
the sequence of considered covariates was chosen by means of the highest increase in r. variables remained in the model if they altered the coefficient by at least 10% .
analyses were performed using the statistical package for social sciences ( spss [ version 15 for windows ] ; spss inc . ,
artwork was created using the graphpad software , version 5 for windows ( graphpad inc .
for this observational study , a sample of patients with copd ( n=60 ) previously recruited via the outpatient clinic database of the otto wagner hospital , vienna , was analyzed .
inclusion criteria comprised evidence of airflow limitation on spirometry according to current guidelines,12 a smoking history of at least 20 pack - years and age > 40 years .
subjects were excluded if they were on long - term oxygen therapy , had evidence of an acute exacerbation of copd within the previous 4 months ( requiring antibiotics , oral steroids , and/or hospitalization ) , or suffered from any other relevant lung disease .
other exclusion criteria comprised overt cardiovascular disorders ( ie , coronary artery disease , chronic heart failure , cardiomyopathy , arterial hypertension , atrial fibrillation , and peripheral arterial disease ) , vasoactive medication , malignant diseases , diabetes mellitus , chronic renal failure , or chronic inflammatory conditions other than copd .
the control groups consisted of lifelong nonsmokers ( n=20 ) as well as apparently healthy smokers ( n=20 ) .
exclusion criteria were the same as in the study group plus the absence of obstructive lung disease confirmed by clinical evaluation and spirometry .
control subjects were recruited from the general population during a public awareness campaign on spirometry at the otto wagner hospital . the study was planned and conducted in accordance with the declaration of helsinki .
data handling and reporting followed the strobe - statement ( strengthening the reporting of observational studies in epidemiology).13
ultrasound studies of the brachial artery were conducted as previously reported.8 subjects were instructed to refrain from food , caffeine , tobacco , and vasoactive drugs for 46 h prior to the study visit .
measurements were performed at the antecubital fossa of the right arm after 10 min of rest with subjects placed in a supine position .
investigators blinded to clinical and spirometric results used high - resolution ultrasound ( 13 mhz ) for depiction of the intimal and medial layer of the brachial artery in a longitudinal plane . using a stereotactic device ,
the transducer position was fixed and images were stored at an adequate gain for subsequent offline analysis .
b - imt was assessed from the leading edge between lumen and intima to the leading edge between media and adventitia .
a cutoff value 0.345 mm was regarded as elevated b - imt14 and was therefore used as a discriminator for cardiovascular risk using the framingham risk score.15 lumen diameter was measured as the distance between the leading edge of the near and far intima lumen interface .
finally , the cross - sectional intima - media area ( b - ima ) was calculated following a previously described equation.16 lung function testing was performed according to the current guidelines12 for the verification of copd diagnosis , the classification of the gold stage , and the quantification of the distinct parameters of lung function ( forced expiratory volume in 1 s [ fev1 ] , % predicted ; forced vital capacity [ fvc ] , % predicted ; fev1/fvc ratio ) .
a physical examination was conducted in every participant for height , weight , heart rate , and arterial blood pressure measurement .
venous blood samples were collected and analyzed for inflammatory biomarkers ( neutrophil count , interleukin [ il]-6 ) and levels of n - type pro - bnp ( pro b - type natriuretic peptide ) .
circulating adma concentrations were measured via reversed - phase high - performance liquid chromatography following a previously described method.17 the 10-year risk for cardiac events was calculated by means of the framingham risk score15 including the independent cardiovascular risk factors : age , sex , smoking history , arterial blood pressure , cholesterol ( total and high - density lipoprotein [ hdl]-cholesterol ) , and diabetes .
ultrasound studies of the brachial artery were conducted as previously reported.8 subjects were instructed to refrain from food , caffeine , tobacco , and vasoactive drugs for 46 h prior to the study visit .
measurements were performed at the antecubital fossa of the right arm after 10 min of rest with subjects placed in a supine position .
investigators blinded to clinical and spirometric results used high - resolution ultrasound ( 13 mhz ) for depiction of the intimal and medial layer of the brachial artery in a longitudinal plane . using a stereotactic device ,
the transducer position was fixed and images were stored at an adequate gain for subsequent offline analysis .
b - imt was assessed from the leading edge between lumen and intima to the leading edge between media and adventitia .
a cutoff value 0.345 mm was regarded as elevated b - imt14 and was therefore used as a discriminator for cardiovascular risk using the framingham risk score.15 lumen diameter was measured as the distance between the leading edge of the near and far intima lumen interface .
finally , the cross - sectional intima - media area ( b - ima ) was calculated following a previously described equation.16
lung function testing was performed according to the current guidelines12 for the verification of copd diagnosis , the classification of the gold stage , and the quantification of the distinct parameters of lung function ( forced expiratory volume in 1 s [ fev1 ] , % predicted ; forced vital capacity [ fvc ] , % predicted ; fev1/fvc ratio ) .
a physical examination was conducted in every participant for height , weight , heart rate , and arterial blood pressure measurement .
venous blood samples were collected and analyzed for inflammatory biomarkers ( neutrophil count , interleukin [ il]-6 ) and levels of n - type pro - bnp ( pro b - type natriuretic peptide ) .
circulating adma concentrations were measured via reversed - phase high - performance liquid chromatography following a previously described method.17 the 10-year risk for cardiac events was calculated by means of the framingham risk score15 including the independent cardiovascular risk factors : age , sex , smoking history , arterial blood pressure , cholesterol ( total and high - density lipoprotein [ hdl]-cholesterol ) , and diabetes .
variables of interest are expressed as counts ( % ) for categorical variables , as mean standard deviation or median and interquartile range for interval variables depending on the respective data distribution .
between - group comparisons were performed using independent samples t - test or mann whitney u - test depending on the respective data distribution .
univariate correlations were performed by means of pearson s correlation coefficient or kendall s tau depending on the respective data distribution .
a multiple linear regression model was used to identify the strongest predictors of b - imt . through forward selection ,
the sequence of considered covariates was chosen by means of the highest increase in r. variables remained in the model if they altered the coefficient by at least 10% .
analyses were performed using the statistical package for social sciences ( spss [ version 15 for windows ] ; spss inc . ,
artwork was created using the graphpad software , version 5 for windows ( graphpad inc . , san diego , ca , usa , 2005 ) .
sixty patients with stable copd , free from overt cardiovascular disorders , were available for analysis .
the sample of copd patients comprised 32% gold stage ii , 32% gold stage iii , and 36% gold stage iv .
the three groups were matched for age , sex , body mass index , blood pressure , and lipid levels .
there were significant differences in heart rate , smoking history , and lung function between patients with copd and smoking , as well as nonsmoking controls ( p<0.05 ) .
results of b - imt measurements for the different study groups are depicted in figure 1 . in patients with copd ,
significantly higher b - imt ( 0.370.08 mm vs 0.320.06 mm ; p=0.007 ; vs 0.330.06 mm ; p=0.033 ) as well as b - ima ( 4.71.4 mm vs 3.91.2 mm ; p=0.027
; vs 3.91.3 mm ; p=0.022 ) was observed compared to smoking and nonsmoking controls . within the copd group ,
male participants showed significantly higher b - imt levels ( 0.410.06 mm ) than females ( 0.330.07 mm ) ( p<0.001 ) .
prediction of cardiovascular risk through the framingham risk score revealed a twofold increased 10-year risk for cardiovascular events in copd patients with elevated b - imt ( 127.6 ) compared to those with b - imt levels below the recommended cutoff ( 5.91.8 ) ( p=0.002 ) ( figure 2 ) .
univariate correlations between b - imt and variables of interest are listed in table 2 .
white blood cell count showed normal levels of neutrophils in the study sample without significant differences between copd patients , smokers , and nonsmokers .
there was a significant positive correlation between il-6 plasma levels and b - imt in patients with copd ( figure 3 ) .
there were no significant differences of circulating adma levels between the three study groups . in patients with copd ,
b - imt , however , was positively correlated with adma levels ( figure 4 ) , an observation that was not observed in controls . in a multivariable linear regression model ( table 3 ) with b - imt as the dependent variable , this study included age , male sex , systolic blood pressure , exacerbation rate , fev1/fvc ratio , ln il-6 , ln adma , and ln pro - bnp as independent variables . through forward selection , male sex , and adma remained independent predictors of b - imt in the model .
sixty patients with stable copd , free from overt cardiovascular disorders , were available for analysis .
the sample of copd patients comprised 32% gold stage ii , 32% gold stage iii , and 36% gold stage iv .
the three groups were matched for age , sex , body mass index , blood pressure , and lipid levels .
there were significant differences in heart rate , smoking history , and lung function between patients with copd and smoking , as well as nonsmoking controls ( p<0.05 ) .
results of b - imt measurements for the different study groups are depicted in figure 1 . in patients with copd , significantly higher b - imt ( 0.370.08 mm vs 0.320.06 mm ; p=0.007 ; vs 0.330.06 mm ; p=0.033 ) as well as b - ima ( 4.71.4 mm vs 3.91.2 mm ; p=0.027 ; vs 3.91.3 mm ; p=0.022 ) was observed compared to smoking and nonsmoking controls . within the copd group ,
male participants showed significantly higher b - imt levels ( 0.410.06 mm ) than females ( 0.330.07 mm ) ( p<0.001 ) .
prediction of cardiovascular risk through the framingham risk score revealed a twofold increased 10-year risk for cardiovascular events in copd patients with elevated b - imt ( 127.6 ) compared to those with b - imt levels below the recommended cutoff ( 5.91.8 ) ( p=0.002 ) ( figure 2 ) .
univariate correlations between b - imt and variables of interest are listed in table 2 .
white blood cell count showed normal levels of neutrophils in the study sample without significant differences between copd patients , smokers , and nonsmokers .
there was a significant positive correlation between il-6 plasma levels and b - imt in patients with copd ( figure 3 ) .
there were no significant differences of circulating adma levels between the three study groups . in patients with copd ,
b - imt , however , was positively correlated with adma levels ( figure 4 ) , an observation that was not observed in controls . in a multivariable linear regression model ( table 3 ) with b - imt as the dependent variable , this study included age , male sex , systolic blood pressure , exacerbation rate , fev1/fvc ratio , ln il-6 , ln adma , and ln pro - bnp as independent variables . through forward selection , male sex , and adma remained independent predictors of b - imt in the model .
in the present study , significantly higher b - imt was observed in patients with copd compared to smoking and nonsmoking controls .
patients with elevated b - imt had a twofold higher risk for future cardiovascular events calculated by means of the framingham risk score .
b - imt was correlated with airflow limitation , systemic inflammation , and circulating levels of adma .
the data support further evidence for an increased cardiovascular risk in patients with stable copd , independent from traditional cardiovascular risk factors .
although adma plasma levels were not different between the groups , the correlation with b - imt in copd patients suggests an interaction with circulating adma levels as a determinant of subclinical atherosclerosis in copd .
this is the first study to investigate b - imt in patients with copd free from overt cardiovascular disorders .
these findings support a previous study by iwamoto et al , who assessed intima - media thickness of the carotid artery as a predictor of cvd risk in smokers with airflow limitation.18 the authors similarly observed a thickening of the arterial wall in copd compared to healthy smoking and nonsmoking controls .
direct comparison of brachial versus carotid artery intima - media thickness in patients with coronary artery disease showed comparable diagnostic accuracy of both markers to detect diffuse coronary arteriosclerotic lesions.19 using the brachial artery , however , enables study of both structural and functional properties of systemic vasculature . using brachial artery measurements of fmd ,
impaired endothelial function has been previously demonstrated in copd compared to matched controls.2022 in a direct comparison , however , b - imt appears to be a better and independent predictor of coronary artery disease when compared with fmd , in both cross - sectional23 and prospective studies.9 indeed , stratification of the copd sample via a previously suggested cutoff14 for b - imt of 0.345 mm revealed a twofold higher risk of cardiac events in the framingham risk score for copd patients with elevated b - imt compared to those below the recommended cutoff .
the available literature suggests several potential mechanisms contributing to elevated subclinical atherosclerosis in copd . in this study ,
this observation is consistent with findings from the epidemiological gutenberg heart study.24 in the absence of traditional cardiovascular risk factors , these findings suggest potential vasoprotective effects of estrogen , a hypothesis that is supported by other studies.2527 tobacco smoke remains the major risk factor for both copd and cvd .
patients with copd , however , are at an increased risk of cvd , independent of smoking.21,28,29 indeed , analyses of the framingham study identified airflow obstruction as an independent predictor of cardiac events , with an effect size stronger than traditional cardiovascular risk factors.30,31 in line with these findings , the univariate analysis in this study showed an inverse correlation between b - imt and fev1/fvc ratio in patients with copd . both patients with airflow obstruction and those with cvd exhibit systemic inflammation.28,32,33 significantly higher levels of circulating il-6 were observed in patients with copd compared to controls .
these observations are consistent with previous reports suggesting a link between systemic inflammation and subclinical atherosclerosis.18,34 systemic inflammation may drive the development of cvd via impairments of the nitric oxide pathway , a hypothesis that is supported by earlier findings of the relationship between circulating inflammatory markers and endothelial function in copd.21 adma is an endogenous inhibitor of nitric oxide synthase , and implicated in the pathogenesis of cvd.35 indeed , a meta - analysis10 of 22 original articles recently confirmed the relationship between adma and b - imt .
furthermore , circulating adma levels predict clinical endpoints , such as myocardial infarction or stroke.36,37 the lung has been identified as one of the most important sources of adma formation;38 however , the role of adma in copd remains unknown yet .
recent studies provide conflicting results , demonstrating either higher39 or lower40 circulating adma concentrations in patients with copd compared with controls .
lower concentrations of adma were also found in smokers without copd compared to nonsmokers.41,42 in the present report , there were no statistically significant differences between copd patients and controls with respect to blood adma levels ; however , a relationship of the latter with b - imt exists exclusively in copd .
thus , these findings may suggest a potential role for adma in the development of subclinical atherosclerosis in copd , rather than a marker of lung function impairment as a consequence of smoking .
the relationship between adma and impaired b - imt in copd in this report is novel and may extend earlier findings , providing a further potential interaction between structural , functional , and molecular properties of the systemic vasculature .
a number of potential limitations in the current study need to be acknowledged including but not limited to the small sample size and a highly selected patient population , free from overt cvds . however , the present study aimed to investigate pathobiological associations by stringent exclusion of potentially confounding comorbid conditions .
nevertheless , it has to be admitted that the exclusion of coronary artery disease was based on patient surveys and medical history alone , as coronary angiography was not performed in this asymptomatic population .
finally , due to the observational nature of the study further data are needed to characterize the role of adma within the observed associations between intima - media thickness and cardiovascular risk in patients with copd .
in conclusion , the present study reveals b - imt as a promising and easily accessible tool for stratification of future cardiovascular risk in patients with copd . confirming previous observations , a significant association was found between subclinical atherosclerosis and systemic inflammation .
additionally , adma was characterized as a potential cofactor in the pathogenesis of copd related cardiovascular comorbidity .
these findings help in understanding the complex mechanisms linking copd to the associated excess cardiovascular risk . | backgroundchronic obstructive pulmonary disease ( copd ) is associated with an increased cardiovascular risk .
however , the mechanisms for this association are yet unclear .
the aim of this study was to investigate the relationship between brachial intima - media thickness ( b - imt ) , an independent predictor of cardiovascular risk , systemic inflammation , and asymmetric dimethylarginine ( adma ) , an endogenous inhibitor of nitric oxide synthase , in patients with copd and respective controls.methodsthe study sample consisted of 60 patients with stable copd , free from overt cardiovascular disorders , as well as 20 smoking and 20 nonsmoking controls .
ultrasound assessment of b - imt , spirometry , venous blood sampling for quantification of inflammatory markers and adma levels were carried out , and individual cardiovascular risk was calculated via the framingham risk score.resultspatients with copd showed significantly higher b - imt compared to smoking ( p=0.007 ) and nonsmoking controls ( p=0.033 ) .
copd patients with elevated b - imt had a twofold increased calculated 10-year risk for cardiovascular events compared to those below the recommended cutoff ( p=0.002 ) .
b - imt was significantly associated with systemic inflammation ( interleukin-6 [ il-6 ] ; r=0.365 , p=0.006 ) and adma ( r=0.331 , p=0.013 ) in copd .
multivariate linear regression revealed male sex and adma as independent predictors of b - imt in this study sample.conclusionb-imt is significantly increased in patients with copd and is associated with systemic inflammation and adma levels . |
place the aluminum heat sink inside the 22.96 cm ( 9 " ) pie pan approximately 2 cm from the side of the pan , as shown in figure 1c . using a black marker pen , mark holes for the aluminum heat sink .
note : if the aluminum block ( purchased at a local scrap metal shop or online at http://www.onlinemetals.com ) does not come with pre - drilled holes , you will need to arrange to have holes drilled and countersunk prior to step 1 to secure the aluminum block to the pie pan .
we used 5 holes to secure the block to the platform and 4 extra holes to allow nitrogen gas bubbles to escape from under the aluminum .
place the cryo - grid box near the location of the aluminum heat sink and mark the notch and each side .
drill pilot holes for each marked position using a # 17 drill bit for the aluminum heat sink holes and a # 35 drill bit for the cryo - grid box holes . mount the aluminum heat sink using 5 - # 10 , 1.9 cm ( 3/4 " ) flat head slotted bolts and corresponding nuts as well as 15 - # 10 washers .
place two washers beneath the aluminum block and the third on the backside of the pie pan for each hole . note : unsecured overhangs of the aluminum block near the viewing area can result in vibrations that limit imaging capabilities of the stage .
insert 3 - # 4 , 0.95 cm ( 3/8 " ) round slotted bolts and corresponding nuts from the backside of pie pan to act as the cryo - grid box mount .
wet the top and bottom surface of the cake and pie pans respectively with ddh2o .
flip the pans upside down and press on the cake pan until the spacers contact the pie pan .
place any weighted object atop the cake pan and let sit overnight to cure . with a serrated knife , cut away the excess dried insulating spray foam from the edge of the pans and remove the chopsticks . remove the cake pan from the pie pan . the pie pan with aluminum heat sink
is now insulated and will be referred to as the " cryogenic stage " ( fig 1a ) .
place a transparent plastic clipboard ( any color and greater than 3 mm thick ) over the top of the cryogenic stage .
mark with a black marker the location of the cryo - grid box mount by drawing a circle approximately 1.5 times the diameter of a single round cryo - grid box .
this clipboard will be referred to as the " loading screen " ( fig 1b ) . put a new transparent clipboard atop of the cryogenic stage and place on the microscope with the heat sink directly under the objective lenses . with a black marker ,
cut along the marked line removing a half circle from the edge of the clipboard .
this can be accomplished with a jigsaw or using a 7.62 cm ( 3 " ) hole saw multiple times as shown in the video . finally cut a 1.9 cm ( 3/4 " ) hole away from the half circle but still within the area of the dish
. this will be the port for refilling liquid nitrogen ( ln2 ) if levels drop while imaging .
this clipboard will be referred to as the " viewing screen " ( fig 1c ) .
dilute log phase yeast cells grown in synthetic complete ( sc ) media to an appropriate concentration of 1x10 cells / ml in water .
2 ml of the diluted yeast are pipetted onto a r2/1 400 mesh holey carbon coated copper cryo - em grid ( spi supplies , west chester , pa ) and allowed to adsorb for 15 seconds .
blot away excess liquid from the grid surface by touching the back of the grid to a torn piece of soft cellulose tissue ( kimwipe ) for 2 seconds . if necessary , the grid can be washed with 3 l drops of water ( 1 - 3 times ) , and wicked away as in step 3 by blotting from the back . before the final wash , the sample
is loaded into the pneumatic plunge freezer and the hanging grid is washed as in step 2.4 .
after blotting the grid with torn tissue paper ( kimwipe ) to remove the majority of the water from the surface , the grid is plunged into ln2 cooled liquid ethane and transferred to a cryo - grid box for storage .
note : it is important to leave a layer of liquid as thin as possible on the surface to keep the sample hydrated .
improper blotting will either dry out the sample or leave ice that is opaque to the electron beam .
fill the cryogenic stage with ln2 and quickly cover with the loading screen ( plastic clipboard with single 1.9 cm ( 3/4 " ) hole ) .
once the metal reaches ln2 temperature , transfer the cryo - grid box through the 1.9 cm ( 3/4 " ) hole of the loading screen and into the transfer mount created by the 3 screws described in part a5 . unscrew the cryo - grid box from its holder and remove the holder for improved access . keep the cryo - grid box holder under ln2 in a separate dewar until step 3.10 .
the cryo - grid box should also be kept under ln2 to prevent sample grid warming .
refill ln2 in the cryogenic stage to just below the top of the aluminum heat sink .
note : ln2 levels must be periodically checked and refilled during the imaging process to ensure ln2 is continuously in contact with the heat sink . in general , the refilling occurs every 10 minutes through the fill port in the viewing screen . pre -
cool the tweezer tip in ln2 , then transfer your grid(s ) onto the flat viewing surface of the aluminum heat sink with tweezers , using the 1.9 cm ( 3/4 " ) hole of the loading screen . carefully move the cryo - stage to beneath the reflected light microscope s objective apertures .
all air currents around the microscope should be minimized , including : breathing , a nearby door opening , people walking past , etc .
we suggest wearing a facemask or hanging a transparent face shield below the microscope eyepieces as a precautionary measure .
rotate the objective lenses into the cold nitrogen gas environment of the cryo - stage and scan for the sample on the flat heat sink viewing area . using standard bright field light microscopy techniques
focus on the grid with a low magnification objective to find the center and take an overview image .
specifications regarding the light microscopy lenses used for this experiment are listed in the experimental materials section .
note : ln2 does not come in contact with the objective lenses and we have yet to see degradation of images or damage to the lenses from the effects of cooling .
focus in high magnification on an area of interest and acquire data with bright field , dark field , polarized light or fluorescence imaging .
be sure to record the location of the area of interest on the low magnification bright field image for future correlation . if all precautions listed above for refilling the ln2 are followed , then the positive pressure from the evaporating nitrogen is sufficient to maintain a contamination free environment ( independent of room humidity ) for the duration of imaging .
once finished , replace the loading screen by sliding it over the top of the viewing screen .
remove the cryo stage from the microscope and with pre - cooled tweezers , transfer the grid back to the cryo - grid box .
screw the cryo - grid box holder into cryo - grid box to seal against the environment and transfer the holder to a ln2 dewar for storage and future imaging . following standard and established techniques ,
load the sample grid into a cryo - em transfer holder while keeping the specimen at liquid nitrogen temperature at all times .
insert the cryo - holder with sample grid into a transmission electron microscope . in a suitable low magnification view ( 50 - 500x nominal magnification ) , find the center of the sample grid . use the previously collected low magnification cryo - lm data from step 3.7 to determine the relative orientation of the grid s central copper tabs ( as described in figure 2 ) and
identify exact areas of interest for correlation . proceed with microscope alignment , low - dose cryo - em imaging and data collection . the cryogenic stage ( fig 1a )
is an effective way to gather cryo - lm data for cryo - fluorescence microscopy and correlative cryo - lm / cryo - em analysis .
figure 2 shows how the combination of low and high magnification cryo - lm images allows you to build reference maps that direct you to specific areas in cryo - em . the resulting cryo - lm reference map ( fig 2b ) was utilized during cryo - em data acquisition to locate exact regions shown in figure 3 .
a ) the layout of the cryogenic stage consists of a cryo - grid box transfer mount indicated with a white arrow and an aluminum heat sink .
grids are transferred under ln2 from the cryo - grid box and placed directly on the heat sink s viewing area as indicated by the black arrow .
the hole in the loading screen is placed directly over the cryo - grid box mount and acts as a port to transfer samples and for moving samples from the cryo - grid box to the sample viewing area on the heat sink with tweezers .
c ) the cryogenic stage in position under the objective lenses with the viewing screen in place .
the special cutout on the viewing screen allows the objective lenses to easily swing into position without moving the cryogenic stage .
the hole in the viewing screen away from the sample area acts as a ln2 fill port to replenish ln2 levels if necessary .
b ) the same image in ( a ) overlaid with a high magnification fluorescence image of an area of interest and with a filled orange polygon marking the center of the sample grid .
the center consists of a group of four squares , three having an extra metal tab and the forth open .
for the three squares with an extra metal tab , two pairs share the tab about the long and short axes forming an asymmetric center .
this asymmetric center can be seen in the upper left corner and was used to indicate the rotation angle and handedness of the grid between cryo - lm and cryo - em .
from one low magnification image many areas of interest can be marked and used as a reference map to locate identical areas in cryo - em .
c ) a magnified fluorescence cryo - lm image of the area of interest in ( b ) .
hta1-cfp , a c - terminal cfp histone marker , can be seen as a green punctate structure labeling the location of the nucleus .
d ) a cryo - em image of the corresponding area in ( c ) .
two fields of view depicting identical yeast cells correlated with cryo - bright field ( a , d ) , cryo - fluorescence ( b , e ) , and cryo - em ( c , f ) .
place the aluminum heat sink inside the 22.96 cm ( 9 " ) pie pan approximately 2 cm from the side of the pan , as shown in figure 1c . using a black marker pen , mark holes for the aluminum heat sink .
note : if the aluminum block ( purchased at a local scrap metal shop or online at http://www.onlinemetals.com ) does not come with pre - drilled holes , you will need to arrange to have holes drilled and countersunk prior to step 1 to secure the aluminum block to the pie pan .
we used 5 holes to secure the block to the platform and 4 extra holes to allow nitrogen gas bubbles to escape from under the aluminum .
place the cryo - grid box near the location of the aluminum heat sink and mark the notch and each side .
drill pilot holes for each marked position using a # 17 drill bit for the aluminum heat sink holes and a # 35 drill bit for the cryo - grid box holes . mount the aluminum heat sink using 5 - # 10 , 1.9 cm ( 3/4 " ) flat head slotted bolts and corresponding nuts as well as 15 - # 10 washers .
place two washers beneath the aluminum block and the third on the backside of the pie pan for each hole . note : unsecured overhangs of the aluminum block near the viewing area can result in vibrations that limit imaging capabilities of the stage .
insert 3 - # 4 , 0.95 cm ( 3/8 " ) round slotted bolts and corresponding nuts from the backside of pie pan to act as the cryo - grid box mount .
wet the top and bottom surface of the cake and pie pans respectively with ddh2o .
flip the pans upside down and press on the cake pan until the spacers contact the pie pan .
place any weighted object atop the cake pan and let sit overnight to cure . with a serrated knife , cut away the excess dried insulating spray foam from the edge of the pans and remove the chopsticks . remove the cake pan from the pie pan . the pie pan with aluminum heat sink
is now insulated and will be referred to as the " cryogenic stage " ( fig 1a ) .
place a transparent plastic clipboard ( any color and greater than 3 mm thick ) over the top of the cryogenic stage .
mark with a black marker the location of the cryo - grid box mount by drawing a circle approximately 1.5 times the diameter of a single round cryo - grid box .
this clipboard will be referred to as the " loading screen " ( fig 1b ) . put a new transparent clipboard atop of the cryogenic stage and place on the microscope with the heat sink directly under the objective lenses . with a black marker ,
cut along the marked line removing a half circle from the edge of the clipboard .
this can be accomplished with a jigsaw or using a 7.62 cm ( 3 " ) hole saw multiple times as shown in the video . finally cut a 1.9 cm ( 3/4 " ) hole away from the half circle but still within the area of the dish
. this will be the port for refilling liquid nitrogen ( ln2 ) if levels drop while imaging .
this clipboard will be referred to as the " viewing screen " ( fig 1c ) .
dilute log phase yeast cells grown in synthetic complete ( sc ) media to an appropriate concentration of 1x10 cells / ml in water
. 2 ml of the diluted yeast are pipetted onto a r2/1 400 mesh holey carbon coated copper cryo - em grid ( spi supplies , west chester , pa ) and allowed to adsorb for 15 seconds .
blot away excess liquid from the grid surface by touching the back of the grid to a torn piece of soft cellulose tissue ( kimwipe ) for 2 seconds . if necessary , the grid can be washed with 3 l drops of water ( 1 - 3 times ) , and wicked away as in step 3 by blotting from the back . before the final wash
, the sample is loaded into the pneumatic plunge freezer and the hanging grid is washed as in step 2.4 .
after blotting the grid with torn tissue paper ( kimwipe ) to remove the majority of the water from the surface , the grid is plunged into ln2 cooled liquid ethane and transferred to a cryo - grid box for storage .
note : it is important to leave a layer of liquid as thin as possible on the surface to keep the sample hydrated .
improper blotting will either dry out the sample or leave ice that is opaque to the electron beam .
fill the cryogenic stage with ln2 and quickly cover with the loading screen ( plastic clipboard with single 1.9 cm ( 3/4 " ) hole ) .
once the metal reaches ln2 temperature , transfer the cryo - grid box through the 1.9 cm ( 3/4 " ) hole of the loading screen and into the transfer mount created by the 3 screws described in part a5 .
unscrew the cryo - grid box from its holder and remove the holder for improved access . keep the cryo - grid box holder under ln2 in a separate dewar until step 3.10 .
the cryo - grid box should also be kept under ln2 to prevent sample grid warming .
refill ln2 in the cryogenic stage to just below the top of the aluminum heat sink .
note : ln2 levels must be periodically checked and refilled during the imaging process to ensure ln2 is continuously in contact with the heat sink . in general , the refilling occurs every 10 minutes through the fill port in the viewing screen . pre -
cool the tweezer tip in ln2 , then transfer your grid(s ) onto the flat viewing surface of the aluminum heat sink with tweezers , using the 1.9 cm ( 3/4 " ) hole of the loading screen . carefully move the cryo - stage to beneath the reflected light microscope s objective apertures .
all air currents around the microscope should be minimized , including : breathing , a nearby door opening , people walking past , etc .
we suggest wearing a facemask or hanging a transparent face shield below the microscope eyepieces as a precautionary measure .
rotate the objective lenses into the cold nitrogen gas environment of the cryo - stage and scan for the sample on the flat heat sink viewing area . using standard bright field light microscopy techniques
focus on the grid with a low magnification objective to find the center and take an overview image .
specifications regarding the light microscopy lenses used for this experiment are listed in the experimental materials section .
note : ln2 does not come in contact with the objective lenses and we have yet to see degradation of images or damage to the lenses from the effects of cooling .
focus in high magnification on an area of interest and acquire data with bright field , dark field , polarized light or fluorescence imaging .
be sure to record the location of the area of interest on the low magnification bright field image for future correlation .
if all precautions listed above for refilling the ln2 are followed , then the positive pressure from the evaporating nitrogen is sufficient to maintain a contamination free environment ( independent of room humidity ) for the duration of imaging .
once finished , replace the loading screen by sliding it over the top of the viewing screen . remove the viewing screen by slowing sliding it beneath the loading screen .
remove the cryo stage from the microscope and with pre - cooled tweezers , transfer the grid back to the cryo - grid box .
screw the cryo - grid box holder into cryo - grid box to seal against the environment and transfer the holder to a ln2 dewar for storage and future imaging .
following standard and established techniques , load the sample grid into a cryo - em transfer holder while keeping the specimen at liquid nitrogen temperature at all times .
insert the cryo - holder with sample grid into a transmission electron microscope . in a suitable low magnification view ( 50 - 500x nominal magnification ) , find the center of the sample grid . use the previously collected low magnification cryo - lm data from step 3.7 to determine the relative orientation of the grid s central copper tabs ( as described in figure 2 ) and identify exact areas of interest for correlation . proceed with microscope alignment , low - dose cryo - em imaging and data collection .
the cryogenic stage ( fig 1a ) is an effective way to gather cryo - lm data for cryo - fluorescence microscopy and correlative cryo - lm / cryo - em analysis .
figure 2 shows how the combination of low and high magnification cryo - lm images allows you to build reference maps that direct you to specific areas in cryo - em . the resulting cryo - lm reference map ( fig 2b ) was utilized during cryo - em data acquisition to locate exact regions shown in figure 3 .
a ) the layout of the cryogenic stage consists of a cryo - grid box transfer mount indicated with a white arrow and an aluminum heat sink .
grids are transferred under ln2 from the cryo - grid box and placed directly on the heat sink s viewing area as indicated by the black arrow .
the hole in the loading screen is placed directly over the cryo - grid box mount and acts as a port to transfer samples and for moving samples from the cryo - grid box to the sample viewing area on the heat sink with tweezers .
c ) the cryogenic stage in position under the objective lenses with the viewing screen in place . the special cutout on the viewing screen allows the objective lenses to easily swing into position without moving the cryogenic stage .
the hole in the viewing screen away from the sample area acts as a ln2 fill port to replenish ln2 levels if necessary .
b ) the same image in ( a ) overlaid with a high magnification fluorescence image of an area of interest and with a filled orange polygon marking the center of the sample grid .
the center consists of a group of four squares , three having an extra metal tab and the forth open .
for the three squares with an extra metal tab , two pairs share the tab about the long and short axes forming an asymmetric center .
this asymmetric center can be seen in the upper left corner and was used to indicate the rotation angle and handedness of the grid between cryo - lm and cryo - em .
from one low magnification image many areas of interest can be marked and used as a reference map to locate identical areas in cryo - em .
c ) a magnified fluorescence cryo - lm image of the area of interest in ( b ) .
hta1-cfp , a c - terminal cfp histone marker , can be seen as a green punctate structure labeling the location of the nucleus .
d ) a cryo - em image of the corresponding area in ( c ) .
two fields of view depicting identical yeast cells correlated with cryo - bright field ( a , d ) , cryo - fluorescence ( b , e ) , and cryo - em ( c , f ) .
using our cryogenic stage and sample preparation techniques , correlative studies between cryo - lm and cryo - em exhibit several benefits over traditional room temperature approaches including , but not limited to : rapid fixation , reduced photobleaching , and scanning of sample integrity prior to cryo - em or chemical fixation / embedding
. one of the bottlenecks for cryo - em data collection is the time required for both transferring the sample into a tem and scanning the grid to find suitable regions to image .
with cryo - lm s rapid data acquisition , time spent finding good cells can be greatly reduced .
thus , we can save both time and money and mitigate this bottleneck by pre - scanning and mapping areas of interest in cryo - lm . more expensive or complex
if cryo - lm imaging and sample grid transfers are performed with caution as described in the text and video , fully contamination free imaging can be accomplished .
this method allows direct correlation of fluorescent and electron microscopy data of the same cell , organelle or macromolecular complex dispersed on the carbon support or contained within a thin tissue section .
it should be noted that the value of this cryogenic stage extends beyond cryo - lm / cryo - em correlative studies to the field of light microscopy as a whole .
this cryogenic stage is well suited for both delicate samples and fluorophore dyes / stains , quantum dots , or fluorescently tagged proteins that may be unstable during room temperature chemical fixation and embedding with glutaraldehyde and paraformaldehyde . as a result
, we hope that this cryogenic stage will provide greater access to those interested in cryo - lm , who have been previously deterred by cost and insufficient access .
. you may find it necessary to use other types of support grids such as continuous carbon , holey carbon , or formvar coated grids for sample support .
additionally , if the sample is binding to the copper bars of the grid and not the carbon surface , it may be necessary to adjust the carbon surface chemistry by incubating the grid with a wetting agent or by glow discharging prior to sample addition .
stage stability : if you notice vibration , it is likely due to the sample stage being overloaded with weight rather than the bubbling of ln2 .
the added weight of the cryogenic stage , can sometimes cause low frequency vibrations to transmit along the standard 3-axis travel microscope stage , and negatively affect imaging via blurring .
this can easily be corrected by supporting the microscope s travel stage from underneath with either an adjustable mini - lift or an adjustable adapter with dual - screw arms , as shown in the video .
both of these adjustable support mechanisms interact with a non - moveable portion of the travel stage and therefore still permits x and y - axis translation as required for imaging .
| the coupling of cryo - light microscopy ( cryo - lm ) and cryo - electron microscopy ( cryo - em ) poses a number of advantages for understanding cellular dynamics and ultrastructure .
first , cells can be imaged in a near native environment for both techniques .
second , due to the vitrification process , samples are preserved by rapid physical immobilization rather than slow chemical fixation .
third , imaging the same sample with both cryo - lm and cryo - em provides correlation of data from a single cell , rather than a comparison of " representative samples " .
while these benefits are well known from prior studies , the widespread use of correlative cryo - lm and cryo - em remains limited due to the expense and complexity of buying or building a suitable cryogenic light microscopy stage .
here we demonstrate the assembly , and use of an inexpensive cryogenic stage that can be fabricated in any lab for less than $ 40 with parts found at local hardware and grocery stores .
this cryo - lm stage is designed for use with reflected light microscopes that are fitted with long working distance air objectives . for correlative cryo - lm and cryo - em studies ,
we adapt the use of carbon coated standard 3-mm cryo - em grids as specimen supports .
after adsorbing the sample to the grid , previously established protocols for vitrifying the sample and transferring / handling the grid are followed to permit multi - technique imaging . as a result , this setup allows any laboratory with a reflected light microscope to have access to direct correlative imaging of frozen hydrated samples . |
erythromelanosis follicularis faciei ( eff ) is a rare sporadic condition of unknown etiology characterized by erythematous hyperpigmented patches and follicular papules on the face .
it was first described in japanese patients in 1960 by kitamura and collaborators . when the neck is affected , the condition is called erythromelanosis follicularis faciei et colli ( effc ) .
however , a combination of vasodilation and hyperpigmentation has been found in the affected areas .
eff is characterized clinically by the presence of red - brown patches on the lateral aspects of the cheeks , and rarely lateral aspects of the neck .
numerous pinhead - sized follicular papules are present within the involved areas that may sometimes appear relatively hypopigmented .
histopathologically , there are hyperkeratosis , slight follicular hyperkeratosis ( follicular plugging ) , increased basal layer pigmentation , dilatation of superficial dermal blood vessels , and periadnexal lymphocytic infiltrate .
a 16-year - old male presented with asymptomatic facial skin lesions which he had since early childhood .
skin examination revealed diffuse nonscaly reddish - brownish patches and multiple skin - colored , hypopigmented follicular papules on both cheeks ( fig .
erythromelanosis follicularis faciei ( eff ) is a pigmentary disease associated with erythema and follicular papules on the face .
the cause is unknown , but the hereditary component ( autosomal recessive ) seems to play a role in the pathogenesis . table 1 summarizes the previous reports of erythromelanosis follicularis faciei ( eff ) in the literature .
however , it has been reported in children as young as 2 years old and in adults as old as 46 years old .
similarly , the onset of the disease shows a wide range , starting from birth to as old as 43 years old .
differential diagnoses include keratosis pilaris rubra , poikiloderma of civatte , riehl 's melanosis , and pigmented peribuccal erythrosis of brocq . in skin type
i patients , there may be only erythema , leading to a significant overlap with keratosis pilaris rubra , and it remains to be answered whether effc and keratosis pilaris rubra are two spectrums of the same condition .
poikiloderma of civatte is observed in middle - aged women as reticulated dyschromia with atrophy and erythema affecting preferably photoexposed areas and sparing the submental region .
topical agents have been used , including , ammonium lactate , retinoids , hydroquinone , vitamin c , salicylic acid peels ( 20 - 30% ) , glycolic acid peels , tacalcitol ointment , and metronidazole gel .
limited courses of isotretinoin ( 0.1 - 1 mg / kg / day ) have been tried in severe cases . a combination of laser treatment ( pulsed dye laser ) for erythema and q - switched nd : yag laser for hyperpigmentation have been tried but they require multiple sessions .
consent has been obtained from the parents of the patient for the purpose of using patient 's photographs for print or online publication .
the authors have no conflicts of interest that are directly relevant to the content of this paper . | erythromelanosis follicularis faciei is a rare sporadic condition of unknown etiology characterized by reddish - brownish patches and follicular papules that appear commonly on the face and rarely on the neck .
herein , we report a 16-year - old male who had asymptomatic facial skin lesions since early childhood . his family history revealed a similar case in his younger brother .
his parents are not consanguineous .
skin examination revealed diffuse nonscaly brownish patches with erythematous background and multiple skin - colored , hypopigmented follicular papules on both cheeks .
a summary of previous reports of erythromelanosis follicularis faciei in the literature is presented in this report . |
total swine numbers in 2011 reached 39.3 million units in brazil , up 0.9% from 2010 according to the brazilian institute of geography and statistics ( ibge ) .
the intensification of feedlot swine production is responsible for producing large amounts of liquid waste , which once released without treatment into nature can pollute water springs , affect air quality from gas emissions , and cause insect proliferation .
feedlot conditions result in high prevalence of pathogenic microorganisms on floor surfaces , as the digestive and urinary systems of pigs are their main routes of waste disposal .
it is important to take into account that waste allows pathogen survival and dissemination for days to months .
the public health aspect , as one of the most relevant aspects of using effluents for productive purposes , is still object of controversy in the international technical - scientific community .
there are still controversies with regard to admissible risks , and by extension , the necessary and sufficient quality of effluents in order to guarantee health protection .
the consensus extends only to the acknowledgment that irrigation using untreated wastewater offers real risks of transmitting diseases , and that any irrigation practice using sewage involves public health risks .
nevertheless , there are still controversies with regard to admissible risk levels , and by extension , the level of treatment and the necessary and sufficient quality of effluents in order to guarantee health safety [ 46 ] . in brazil , there are no specific rules establishing parasitological parameters for the reuse of low - quality water . therefore , the guidelines set by the world health organization are followed [ 7 , 8 ] . for microbiological parameters , resolutions 357/2005 and 375/2006 by brazil 's national environmental council ( conama )
conama resolution 357/2005 establishes standards for water quality and uses and consequently for effluent release in water bodies . and conama resolution 375/2006 deals specifically with sewage sludge .
there is no specific legislation for farming waste or similar [ 9 , 10 ] .
conama resolution 375 from 2006 uses microbiological and parasitological parameters to classify sludge for use as fertilizer in agriculture , into type a ( or derived product ) or type b. sludge is classified as type a when the concentration of thermotolerant coliforms is below 10 mpn g ts , and viable helminth eggs are below 0.25 egg g ts . for sludge
to be classified as type b , the concentration of thermotolerant coliforms must be over 10 and below 10 mpn g ts , and helminth eggs should be over 0.25 g ts and below 10 eggs g ts . according to van haandel and marais ,
the guidelines recommended by the world health organization are based on theoretical models , epidemiological evidence , and information available on the efficiency of pathogen removal , particularly through the use of stabilization ponds .
the bacteriological and parasitological standards recommended by the who forum restricted irrigation are 10 mpn ( 100 ml ) and 1 helminth egg l , respectively .
american standards require the absence of pathogenic indicators ( including viruses and protozoa ) for unrestricted irrigation [ 5 , 12 ] .
therefore , to use the treated effluent for irrigation and/or fertilization and reactor sludge fed with wastewater , it is essential to know its physical - chemical characteristics and microbiological contamination indicators , in order to establish adequate environmental protection measures and the appropriate choice of technologies for treatment and final disposal .
moreover , according to chernicharo , some of the advantages of anaerobic treatment are low energy consumption , very low operational costs , small space requirements , methane production , and tolerance against high organic loads . among anaerobic treatment systems , the upflow anaerobic sludge blanket ( uasb ) reactor stands out .
in the uasb reactor , a significant portion of suspended solids present in raw sewage ( including helminth eggs ) are retained , which are retained in the bed of thick biological sludge given their density and due to hydraulic upflow .
in addition to this retention of solids in the bottom of the reactor , there is also sedimentation of biological sludge that eventually seeps out from the sludge digestion compartment , but this requires installation of a solids separator in the upper part of the tank . despite the advantages attributed to anaerobic reactors , the effluent produced usually does not meet quality standards set by environmental legislation , with regard to the number of helminth eggs , total , and thermotolerant coliforms , thus requiring the addition of a posttreatment system .
one alternative for posttreatment is the trickling filter ( tf ) , which works with continuous feeding and without unit flooding .
it is an aerobic reactor , permanently subject to air replacement , which naturally circulates in the empty spaces of the support medium , providing the necessary oxygen for microorganism respiration . according to van haandel and marais , the combined anaerobic / aerobic system has great potential in reducing construction and operational costs .
several works have been carried out using this combination to treat swine production wastewater , aiming to remove coliforms , among others .
duda and oliveira used a system consisting of anaerobic reactors ( uasb and anaerobic filter ) and aerobic reactors ( trickling filter ) . oliveira and
santana used two uasb reactors followed by an aerobic sequencing batch reactor ( sbr ) , and santos , who also worked with an anaerobic / aerobic / anoxic treatment system , obtained significant coliform removal efficiency .
this work evaluated two treatment systems : one with two uasb reactors in series and another consisting of uasb reactors , anaerobic filter , trickling filter , and decanter , placed in series , in the removal of coliforms and helminth eggs from swine production wastewater .
the experimental facilities consisted of two treatment systems . system i consisted of two uasb reactors , with volumes of 510 and 209 l , placed in series ( figure 1 ) , as described by oliveira and santana .
system ii consisted of a uasb reactor , anaerobic filter , trickling filter , and decanter , placed in series , with volumes of 300 , 190 , 250 , 150 l , respectively ( figure 2 ) , as described by duda and oliveira . in the anaerobic and aerobic biological filters ,
polypropylene rings were used as support medium , with specific surface area of 101 m / m .
the swine production wastewaters utilized to feed the treatment systems were collected daily in a feedlot for growing and finishing swine , at a commercial property located in the city of jaboticabal , sp , which uses shallow water channels to transport the waste .
the collected wastewater was first sieved ( 3 mm mesh ) to separate rough solids ; next , the water was stored in boxes and pumped to the first - stage reactors .
the other reactors were gravity fed . the operating conditions applied on the systems are described in table 1 .
the anaerobic reactors were regarded as stable when the coefficient of variation ( cv ) values of the removal efficiencies of total cod and volatile suspended solids ( vss ) , concentration of volatile acids ( tva ) , and methane production ( ch4 ) were lower than 20% ; in the trickling filter , whenever average cod and vss values in the effluent and their efficiencies had cv below 20% . inflow and
outflow samplings were carried out at the end of the assays , after 60 days of operation in assay 1 , 30 days in assay 2 , 60 days in assay 3 , and 75 days in assay 4 .
the laboratory exams performed were total and thermotolerant coliform counts and number of helminth egg in inflows , effluents , and reactor sludge and decanter . to determine coliforms , the multiple - tube technique was used in accordance with cetesb norm l.5 202 and in conformity with the standard methods for the examination of water and wastewater .
the results were expressed in mpn ( most probable number ) per 100 ml of sample .
samples of the inflows were collected in the incoming pipes of the anaerobic reactors and from outflows in the outgoing pipes of the anaerobic reactors , trickling filter , and decanter .
the collections were performed at the end of each assay , with two replications per assay .
sludge samples were collected at all sampling points . for processing , sample preparation , and counting of helminth eggs ,
the study used the sedimentation method developed by bailenger and modified by ayres and mara .
this method was chosen due to its simplicity and the low cost of the reagents used , in addition to the fact that it allows recovery of a wide range of helminths usually found in wastewaters , particularly nematode eggs ( ascaris sp .
, trichuris sp . , and hookworms ) which are the specific parasitological indicators found in the world health organization guide for reuse in agriculture .
the samples from inflows and outflows ( 10 l of each ) were collected and placed in 15 l polyethylene drums and processed after two hours of sedimentation .
the sampling site for the inflows was in the incoming piping of the anaerobic reactors .
outflows were sampled in the outgoing pipes of the anaerobic reactors , trickling filter , and decanter .
the sludge samples were collected at two collection points along the reaction chamber of the reactors : ( 1 ) uasb reactors in system i , sludge bed and blanket , at points 400 and 1200 mm from the inflow entrance ( figure 1 ) ; ( 2 ) uasb reactor in system ii , sludge bed and blanket , at points 400 and 1180 mm from the inflow entrance ; ( 3 ) anaerobic filter in system ii , at points 380 and 940 mm from the inflow entrance ; ( 4 ) decanter in system ii , 1100 mm from the inflow entrance ( figure 2 ) .
at each point , a 1-l sample of sludge was collected and placed in polyethylene bottles .
the mean values of the numbers of total and thermotolerant coliforms in the inflows of systems i and ii ranged between 1.40e + 07 and 2.40e + 08 mpn ( 100 ml ) in assays 1 to 4 . in the effluents of uasb reactors ( r1 ) , they decreased to mean values of 1.50e + 06 to 4.40e + 07 mpn ( 100 ml ) as shown in tables 2 and 3 . in the effluent of the uasb reactor ( r2 ) of treatment system i ,
the reduction was maintained to mean values of total and thermotolerant coliforms of 1.90e + 05 to 1.70e + 07 mpn ( 100 ml ) in assays 1 to 4 ( table 2 ) . in the anaerobic filter of treatment system
ii there were decreases as well , down to mean values of 4.30e + 05 to 2.00e + 07 mpn ( 100 ml ) of total and thermotolerant coliforms , in assays 1 to 4 ( table 3 ) . with the addition of tf , a decrease was obtained to values of 2.00e + 04 to 2.20e + 06 for assays 1 to 4 . in the decanter ,
the reduction was maintained to mean values of total and thermotolerant coliforms of 2.40e + 04 to 1.20e + 06 in assays 1 to 4 . in treatment system
i , with two uasb reactors in series , an effluent with superior microbiological quality for the evaluated coliform indicators , except in assay 4 , when the values were identical for total coliforms . in both treatment systems , in the anaerobic reactors , the effect of hrt reduction became evident , especially in assay 4 , hindering the microbiological quality of the effluent by raising the count of total and thermotolerant coliforms .
neto obtained higher values of total thermotolerant coliforms in swine production wastewater of 1.00e + 07 mpn ( 100 ml ) similar values as those found in the present work .
santos et al . obtained higher values of total coliforms , totaling 1,00e + 08 to 1,00e + 10 mpn ( 100 ml ) and thermotolerant coliforms values of 1,00e + 08 to 1,00e + 09 mpn ( 100 ml ) . oliveira and
santana obtained similar or slightly higher results when evaluating coliform concentrations in swine production wastewater .
after treatment in both uasb reactors of system i , the authors also obtained a marked reduction in the concentrations of thermotolerant coliforms in the effluent of r1 to average values of 4.30e + 06 to 4.30e + 07 mpn ( 100 ml ) and of r2 , which decreased to average values of 2.40e + 06 to 4.30e + 07 mpn ( 100 ml ) .
therefore , the evaluated anaerobic treatment systems revealed a reduction potential of two logarithmic units for the removal of total and thermotolerant coliforms , with relatively small variations among assays 1 to 3 , in which the hrt was 59 to 28 h. with the decrease of hrt to the range of 15 to 16 h in assay 4 , the removals were in the order of one logarithm .
the average removal efficiencies of total and thermotolerant coliforms were 92.92% to 99.93% in the anaerobic reactors of treatment systems i and ii in assays 1 to 4 ( figures 3 , 4 , 5 , and 6 ) .
the highest efficiencies for removal of coliforms occurred in assays 1 , 2 , and 3 .
the lower hrt and temperature in assay 4 resulted in lower coliform removal and were caused principally by the reduced efficiency in the uasb reactor ( r2 ) and anaerobic filter of treatment systems i and ii , in which the hrts were 4.5 and 5.2 h , respectively . even while achieving 99.93% removal efficiency of thermotolerant coliforms in the effluents of anaerobic reactors of treatment systems i and ii
, the coliform concentrations still exceeded standards established for use in plant irrigation according to brazilian legislation conama 357/2005 and for treated outflows according to the guidelines set by the world health organization [ 7 , 8 ] . analyzing swine production wastewater from uasb reactor and anaerobic filter with hrt 12.0 and of 8.5 h , respectively , pereira - ramirez et al .
obtained concentrations of thermotolerant coliforms in the final effluent of 2.51e + 07 mpn ( 100 ml ) .
the anaerobic filter ( af ) is removed between 80 and 96% of thermotolerant coliforms , similar and higher values than those obtained in this work .
buzato , assessing the performance of an upflow anaerobic filter in the treatment of domestic sewage using a uasb reactor , obtained an average removal efficiency of total and thermotolerant coliforms of 81 and 78% , respectively .
average removal efficiency in the uasb reactor was 71% for total coliforms and 69% for thermotolerant coliforms .
the anaerobic filter showed average removal efficiencies of total and thermotolerant coliforms of 41% and 33% , respectively , lower values than that found in this work .
duda worked with system ii in the treatment of swine production wastewater ; the highest efficiencies obtained in the removal of thermotolerant coliforms were 99.86% in the uasb reactor and anaerobic filter by themselves . after adding the trickling filter ( tf ) as posttreatment ,
the efficiencies were 99.94 and 99.99% in the assays with hrt of 44.7 and 66.6 h for the system of anaerobic treatment and posttreatment higher values than that obtained in this work , which demonstrates that greater hrt results in more significant removal efficiency .
system ii resulted in higher removal efficiency values than system i , consisting only of the uasb anaerobic reactors in series , confirming the importance of posttreatment , as shown in figures 5 and 6 .
the adequacy of bacteriological quality in the final effluent , in order to meet the standards of environmental legislation , will depend essentially on the characteristics of the receiving water body . in that sense , in order to meet quality standards of a class 2 river at most 1.00e + 03 mpn ( 100 ml ) , the dilution and concentration of coliforms upstream from the discharge points will be preponderant factors in the analysis [ 9 , 15 , 16 , 28 ] .
in uasb ( r1 ) and uasb ( r2 ) reactors of system i , a higher concentration of coliforms was observed in the bed of biological sludge , point 1 , which is located at the bottom of the reactor .
the average concentrations of total coliforms at point 2 were 1.50e + 08 to 9.10e + 08 mpn
( 100 ml ) and thermotolerant coliforms concentrations ranged between 1.10e + 08 and 6.50e + 08 mpn ( 100 ml ) in all assays . at the points 4 and 5 ( figure 1 ) , in the biological sludge blanket , which is located at the top of the reaction chamber from the uasb reactor ( r1 ) , the concentrations of coliforms decreased one or two logarithmic units , as shown in table 4 .
these numbers of coliforms remained in the bed of biological sludge from the second uasb reactor ( r2 ) , in which it also there was reduction of one more logarithmic unit in the sludge blanket . with regard to the sludge in system
ii , at point 1 of the uasb reactor and af , the concentration of coliforms was also higher compared to the other points in all assays and decreased as the distance from the reactor bed increased , as shown in table 5 . in the treatment of domestic sewage using uasb reactors , backes evaluated sludge and obtained thermotolerant coliform values of 2.10e + 03 mpn g ts , classifying it as type - b sludge , giving the possibility of reuse , similar to the values found in this work .
santos et al . , working at the sewage treatment plant of rios das antas , using uasb reactors , operated by the paran state sanitation utility , found concentrations of thermotolerant coliforms below 10 mpn gts ; as such , that residue could be used as fertilizer in crop soils .
it is worth reminding that there is no specific legislation for sludge from the swine treatment wastewaters .
conama resolution 375 defines criteria and procedures for the agricultural use of sewage sludge created in sewage treatment plants and their byproducts . to reuse sludge in agriculture
( type a ) , the concentrations of total and thermotolerant coliforms must stay below 1.00e + 03 mpn g ts and below 1.00e + 06 mpn g ts for type b. only sludge produced in the uasb reactor ( r2 ) of system i ( assays 1 , 2 , 3 , and 4 ) showed values that are in accordance with the standards set by conama resolution 375 for reuse in agriculture as type - b sludge .
parasitological analysis
table 6 shows the results of the identification and count of the average number of helminth eggs obtained in the samples of inflow and outflow of uasb reactors ( r1 and r2 ) placed in series , at pilot scale , of treatment system i , in assays 1 , 2 , 3 and 4
, while comparing swine farms in slotted or cement floors , described greater occurrence of ascaris suum on cement .
facilities with shallow pools are conducive to the dissemination of parasite agents when inadequately used , which explains the presence of ascaris suum eggs in the inflow .
it is important to assess water flow , so that waste is constantly discharged from the area .
the concentration of parasite forms in swine production wastewater is associated with handling practices and facilities .
changes in the raising system reduce infection rates , but the agents can persist even in properties with good handling practices .
the use of ivermectin injections in pregnant sows prevents vertical transmission from sows to piglets and consequently reduce local contamination .
treatment with anthelminthics is done using oral fenbendazole , and all animals are kept in a cemented area without access to soul , receiving only commercial feed .
therefore , helminth resistance in herds is associated with contamination and environment resistance by the eggs of these helminths . in the inflow ,
the number of ascaris suum eggs found in system i ranged from 2.3 to 3.0 eggs l , averaging 2.5 eggs l overall for system i. in the effluent of the two stage uasb reactors of system i , lower counts were obtained , averaging 0.027 to 0.107 eggs l , with removal efficiency between 96.44 and 99.11% in assays 1 to 4 , as shown in figure 7 .
table 7 presents the results of the average numbers of ascaris suum eggs obtained in the samples of inflow , effluents of the uasb reactor , anaerobic filter , trickling filter , and decanter of treatment system ii . in the inflow ,
the number of ascaris suum eggs found varied between 2.3 and 3.6 eggs l , averaging 2.7 eggs l overall for system ii . in the uasb reactor and anaerobic filter ,
no ascaris suum eggs were found , showing high efficiency of that combination in the removal of these organisms , as shown in figure 8 .
cavalcante , working with anaerobic filters treating domestic sewage , obtained 99% removal efficiency for helminth eggs , resulting in a final effluent with values lower than 1 egg l. in the treatment of domestic sewage , passamani et al .
obtained an efficiency of 87.5% in uasb reactor ( effluent with 24 eggs l ) , whereas no helminth eggs were detected in the effluent from biological filter placed in series , therefore achieving 100% removal efficiency , similar to those obtained in this work .
the variation in the number of eggs found in uasb effluents compared to other authors is quite significant .
zerbini et al . and souza presented , respectively , a total of 195 and 229.9 eggs l , values much higher than those obtained in this study . with regard to the mean values obtained , the observed results are within the range presented in works of cavalcante and passamani , averaging 0.65 and zero helminth eggs l respectively . in the anaerobic reactors of treatment systems i and ii , the highest helminth removal efficiencies occurred with higher hrt in assays 1 , 2 , and 3 . with the marked decrease in hrt in assay 4 ,
the lowest helminth removals were caused principally by the reduction in the uasb reactor ( r2 ) and in the af of treatment systems i and ii , in which hrts were 4.5 and 5.2 h , respectively , as shown in figures 7 and 8 .
leopoldino et al . , working with anaerobic filters to treat domestic sewage , observed a final effluent with means below 1 egg l , with 83.3% removal of helminth eggs .
egg size and density favour the removal by physical processes such as filtration and sedimentation , which are phenomena observed in anaerobic filters .
the obtained efficiency results of 99.11% and 100% for treatment systems i and ii , respectively , were considered excellent in ascaris suum eggs removal , meeting the health recommendations of the who for unrestricted use of the effluent for irrigation .
a large number of ascaris suum eggs were found in the sludge blanket in the uasb reactors from treatment systems i and ii a like 0.94 to 7.55 g ts ; in the bed , the egg count was higher , reaching values of 1.74 to 9.55 g ts . of the analyzed samples ,
the highest concentrations were detected in the bed of the uasb in all assays and in the interstitial sludge from fixed bed of af in assays 1 and 2 .
the results obtained both in treatment system i and in treatment system ii were above 0.25 egg g ts in all assays , and consequently the sludge must be classified as type b according to conama 375 , for which the threshold must be below 10 eggs g ts and use is restricted , as shown in table 8 .
this study indicates that there is a tendency for eggs to be retained or settle onto the bed of the uasb reactor and be retained by adsorption in the biofilm formed in the support medium and the interstitial sludge from fixed bed of the af and tf reactors , as they were found in low amounts or were not detected in the samples from the effluents . in biological sludge
we can find several different pathogenic microorganisms ; however , the mere presence of an infectious agent in the sludge used in agriculture does not necessarily imply immediate transmission of diseases ; it only characterizes a potential risk .
the real risk of infection for any individual actually depends on the combination of a series of factors , including resistance by pathogenic organisms against wastewater treatment and environmental conditions , infectious dose , pathogenicity , susceptibility and degree of immunity of the host , and degree of human exposure to outbreaks .
thus , in order for a microorganism present in an effluent used in agriculture to cause disease , it has to resist against the treatment processes employed and survive against the environment in sufficient numbers to infect a susceptible individual .
the results obtained in this research are of great importance for health and environmental engineering , as they evidence the importance of combined systems ( anaerobic and aerobic ) , as a technology is capable of having a significant beneficial impact on publish health , by removing helminth eggs .
the removal of helminth eggs by the treatment systems was excellent , with 99.11% removal efficiency for system i and 100% for system ii , showing values below 1 egg l and meeting the health recommendations set by the who for unrestricted use of effluent in irrigation .
coliform counts in the effluents of the treatment systems revealed a high potential of coliform removal , reaching percentage values of 99.51% for system i and 99,91% for system ii , which resulted in final effluents with concentrations in the range of 1.00e + 04 to 1.00e + 07 mpn ( 100 ml ) .
the high concentrations of this parameter make the agricultural reuse possible only for restricted irrigation ( grains , industrial crops , forage species , pastures , and trees ) .
when evaluated separately , the reactors showed lower removal efficiency for coliforms and helminth eggs than when analyzed as a system of reactors placed in series , evidencing the advantage of anaerobic reactor placed in series and the combination of anaerobic and aerobic reactors . | the present work evaluated the performance of two treatment systems in reducing indicators of biological contamination in swine production wastewater .
system i consisted of two upflow anaerobic sludge blanket ( uasb ) reactors , with 510 and 209 l in volume , being serially arranged .
system ii consisted of a uasb reactor , anaerobic filter , trickling filter , and decanter , being also organized in series , with volumes of 300 , 190 , 250 , and 150 l , respectively .
hydraulic retention times ( hrt ) applied in the first uasb reactors were 40 , 30 , 20 , and 11 h in systems i and ii .
the average removal efficiencies of total and thermotolerant coliforms in system i were 92.92% to 99.50% and 94.29% to 99.56% , respectively , and increased in system ii to 99.45% to 99.91% and 99.52% to 99.93% , respectively .
average removal rates of helminth eggs in system i were 96.44% to 99.11% , reaching 100% as in system ii . in reactor sludge ,
the counts of total and thermotolerant coliforms ranged between 105 and 109 mpn ( 100 ml)1 , while helminth eggs ranged from 0.86 to 9.27 eggs g1 ts . |
anti - mllerian hormone ( amh ) , also known as mller inhibiting factor or mller inhibiting substance , is a glycoprotein formed from two identical subunits , each with a molecular weight of 72 kda .
the hormone is part of the growth factor family , which includes 35 different peptide structures , including inhibin , activin , growth differentiation factor , and bone morphogenic protein.1 up until a few years ago , amh was known mainly for its role in the differentiation of male sexual characteristics.2,3 amh is not secreted in the female embryo , allowing development of the female sexual organs , starting from the mller ducts which do not regress , although they differ in the uterus , fallopian tube , and upper part of the vagina .
expression of the hormone in women is different at various stages of life , and starts to be detected at week 36 of gestation .
its concentration reaches a maximum during puberty , begins to decrease in adulthood , and disappears completely following the menopause .
amh , produced from the granulosa cells of the primary follicles , reaches maximum expression in the preantral follicles , with lesser secretion by the greater antral follicles . at this point , growth starts to become dependent on follicle - stimulating hormone ( fsh ) .
the data suggest that amh is a factor in regulation during the initial recruitment and cyclical recruitment phases leading to selection of the dominant follicle , and that it has a potential autocrine and paracrine role in follicular development in the female ovaries . after a period of optimal fertility at age 1830 years , oocyte quality diminishes in parallel with a progressive loss of follicles . in women with normal ovulation , serum levels of amh slowly increase , reaching a peak during puberty and then progressively diminishing with the passage of time .
moreover , recent studies have shown that amh is correlated with the number of small antral follicles .
this observation supports the hypothesis that serum levels of amh can reflect the state of the ovarian follicles better ( given its relative stability during the entire cycle ) than the more usual hormonal markers ( fsh , luteinizing hormone [ lh ] , estradiol , and inhibin b ) , and demonstrates how amh can be a favorable candidate as a marker of the ovarian reservoir.46
reproductive behavior has changed dramatically in the last century , and it is important to be able to identify loss of fertility in a woman as early as possible .
more and more women are now delaying pregnancy to a more advanced age , when the quality and amount of ovarian follicles begins to decrease .
the first sign of aging is increased levels of fsh at the age of 3540 years , when the menstrual periods tend to shorten .
therefore , determining ovarian age is important for patients in whom treatment with in vitro fertilization is proposed , keeping in mind that the probability of pregnancy and subsequent birth of a child gradually diminishes from the age of 3738 years onwards . from this point of view , amh has been identified and proposed for evaluation of responses in patients undergoing assisted reproductive technology .
it is now a potential candidate for inclusion in the clinical report , in order to be able to construct a strategy which is targeted and personalized to the characteristics of the patient , and able to increase the benefits of treatment from the physiological , psychological , and economic points of view.79 numerous studies have advocated the use of amh in assisted reproductive technology as a noninvasive test in order to estimate the antral follicle count.10,11 amh is now proposed as a hormonal test in the study of feminine infertility and in the diagnosis of pcos .
the diagnosis depends on two of the following criteria : clinical and/or biochemical evidence of hyperandrogenism ( with exclusion of other causes of excess androgen ) , oligo or anovulation , and polycystic ovaries ( european society of human reproduction and american society for reproductive medicine , consensus conference , rotterdam , 2003).12,13 such data lead us to conclude that inclusion of serum amh levels in routine tests for patients undergoing assisted reproductive technology is useful , both quantitatively and qualitatively , not only in the study of patient responses to clinical treatment for infertility , but also in clinical assessment.1420
numerous tests and markers are used in order to identify pathologies involving the ovaries . amongst these
are exclusion serum markers of other endocrinopathies ( prolactin , thyroid stimulating hormone , 17-hydroxyprogesterone ) , conf irmation of serum markers of ovarian pathology ( fsh , lh , estradiol , inhibin b ) , invasive scan markers ( transvaginal or laparoscopic ultrasound for antral follicle count ) and , over the last few years , amh levels .
there are also other confirmation and monitoring serum tests for pcos ( androstenedione , testosterone , free testosterone , dehydroepiandrosterone ) .
this diagnosis will not only render possible a targeted and personalized therapy in order to achieve a greater probability of a positive outcome of treatment , but will also avoid potential harmful effects of treatment , that could eventually preclude assisted reproduction altogether .
in this study , we evaluated the value of serum analysis of amh as a diagnostic test in patients undergoing assisted fertility , in order to diagnose pcos prior to treatment .
the purpose was to identify a cost - effective , noninvasive clinical method for assessing ovarian pathology , which would also reduce psychological stress for the patient .
amh can be measured on any day of the cycle , because there are no fluctuations and it has low cyclical interindividual or intraindividual variability .
the study was carried out on 236 serum samples taken from women aged 2646 years and scheduled for exogenous gonadotrophin treatment for infertility at the institute for maternal and child health , burlo garofolo , trieste , between september 2010 and june 2011 .
all patients signed an informed consent form before entering the study , which was approved by the ethics committee at our institution .
the sample centrifugation for 5 , as described in the manufacturer s instructions , was done to remove residual fibrin and cellular matter , prior to storage .
the serum was stored at 2c8c for up to 24 hours and was then frozen at 20c .
the confidence limits for amh controls were printed on the control vial labels and intra- and inter - test precision was within two standard deviations ( 2 sd ) .
measurement of amh levels was carried out on the third day of the ovarian cycle using an enzyme - linked immunosorbent assay ( beckman coulter , immunotech , dsl diagnostic system laboratories , marseille , france ) .
this quantitative , specific , and sensitive technique allows measurement of small amounts of molecules present in biological samples .
moreover , it is possible to analyze a high number of samples in a short space of time , as a result of being able to use microplates .
it is based on a colorimetric system , with the intensity of color being directly proportional to the concentration of the antigen , which is measured by spectrophotometry .
the field of measurement comprises concentration of the analyte sensitivity to the concentration of the highest calibrator standard , from 0.14 ng / ml to 21 ng / ml . the precision is given by an intratest and an intertest , with respective variation coefficients of 12.3% and 14.2% , respectively .
the instrument used for analysis in the enzyme - linked immunosorbent assay was a semiautomatic spectrophotometer ( pantech , new york , ny ) .
the enzyme - linked immunosorbent assay used was a typical sandwich test , the peculiarity of which concerns a second biotinylated monoclonal antibody directed against the antigen and conjugated with the enzyme streptavidin and horseradish peroxidase .
streptavidin is a purified tetrameric protein of bacterial origin ( streptomyces avidinii ) . in order to estimate the amh concentration in the study samples , a calibration curve for interpolation
was constructed , using standard amh samples with diverse absorbance concentrations ( pasquinelli and porta , 1994 ) , according to instructions supplied in the analysis kit .
fsh levels for all the patients was measured , as well as lh ( only in six patients with very elevated amh levels ) using an automated colorimetric method ( modular p , elecsys ) .
in this study , we analyzed 236 serum samples from patients aged 2646 years who had been referred to our institution for medically assisted fertility in september 2010 to june 2011 .
we identified 57 patients who were starting in vitro fertilization or embryo transfer with amh values within the normal range ( 3.64 1.51 ng / ml ) , 77 with values below normal ( 1.38 0.32 ng / ml ) , and 96 cases with undetectable values of amh .
six patients had very high amh levels ( 10.0 2.28 ng / ml ) and , of these , five were found to have pcos on pelvic ultrasound examination ( p < 0.05 ; table 1 ) .
the published studies have reported the average values for patients who were part of control groups or had pcos . comparing the values that we obtained with those of other laboratories
, it can be seen that the average values of controls are lower than those in patients with pcos , confirming the validity of the test as an indicator of this syndrome ( table 2 ) .
moreover , numerous studies have identified an inverse correlation between amh levels , fsh levels , and patient age .
therefore , we attempted to confirm these correlations in our group of patients and fsh levels were also measured in serum samples , showing an average value of 8.53 miu / ml ( follicular phase normal range 3.512.5 miu / ml ) ( figures 13 ) .
the cost - effective dosage of amh is similar to that of other hormones , such as fsh and lh .
many studies published in recent years have demonstrated that the concentration of amh is 34 times higher in patients affected by pcos than in patients without the disease .
one is that the follicles are transformed into cysts when they are at the preantral or antral stage , and remain at this stage and continue to secrete the hormone , and the other is that granulosa cells secrete a greater concentration of amh , detectable at the follicular level . in our case histories , the changes in reproductive state and amh levels
this inverse correlation has been found in many studies in the literature , and is confirmed by the present study.2125 our data emphasize that amh can be used to identify pcos and is a reliable marker of infertility associated with patient age and other hormonal tests , such as fsh , because it is influenced by the menstrual cycle , or identification by means of invasive tests such as transvaginal or laparoscopic ultrasound for follicular count and residual ovarian capacity . in conclusion ,
amh is confirmed as a useful test to study folliculogenesis and ovarian potential in various situations of infertility and for identification of pcos , to avoid the possibility of subjecting patients at risk to ineffective assisted reproductive technology , and using in vitro fertilization or in vitro embryo transfer only after careful clinical assessment.2635 | backgroundthe anti - mllerian hormone ( amh ) is a dimeric protein secreted by the female ovaries and has two fundamental roles in follicle genesis .
it delays the entrance of the primordial follicle into the pool of follicles in growth and diminishes the sensitivity of the ovarian follicle towards follicle - stimulating hormone ( fsh ) .
the purpose of this work was to study the amh ( nv 2.06.8 ng / ml ) as a marker during assisted reproductive technology ( art ) , in order to identify cases of infertility due to polycystic ovarian syndrome ( pcos ) .
this syndrome affects 10% of women with infertility problems , and a new biological marker could be useful to general practitioners of internal medicine to help generate the suspicion of pcos so that they can refer the patient to the gynecologist for confirmation.methodsthis study enrolled 236 patients aged 2646 years undergoing assisted reproductive technology at the institute for maternal and child health , trieste , italy . on the third day of the ovarian cycle ,
the patients were given doses of amh , fsh , and luteinizing hormone ( lh , in cases of amh < 2.06.8 ng / ml ) .
a control pelvic ultrasound was also carried out.resultswe identified 57 patients who were starting in vitro fertilization or embryo transfer with amh values within the normal range ( 3.64 1.51 ng / ml ) , 77 with values below normal ( 1.38 0.32 ng / ml ) , and 96 cases with undetectable values of amh .
six patients had very high amh levels ( 10.0 2.28 ng / ml ) and , of these , five were found to have pcos on pelvic ultrasound examination ( p < 0.05 ) .
we also found inverse correlations between amh levels and age ( r = 0.52 ) and between amh and fsh levels ( r = 0.32).conclusionin clinical practice it is common to encounter patients who turn to medicine in search of a cure for female infertility . in our experience , amh two or three times the normal amount ( 10 2.28 ng / ml ) , is a good indication of pcos and infertility . |
osteogenesis imperfecta ( oi ) is a hereditary connective tissue disorder due to a qualitative or quantitative defect of type i collagen .
oi is a rare disease , occurring in 1 case per 15,000 to 20,000 births and affecting 1 in every 200,000 individuals ; however , there are no citations in the literature about the predominance of race or gender . the main features of oi are ligamentous laxity , osteopenia , short stature , fractures caused by mild trauma , progressive skeletal deformities , and additional clinical manifestations including blue sclera , dentinogenesis imperfecta , and deafness . bone fragility in the spine usually leads to serious consequences .
the vertebrae can easily break , either in an acute or in a chronic form , and they commonly present deformed and with a biconcave shape due to the pressure exerted by the intervertebral discs at the endplate of the vertebrae ( fig .
the prevalence of scoliosis in oi patients ranges from 39% to 100% according to the literature , very high when compared to the same ratio in the general population ( idiopathic scoliosis ) , which is close to 2% according to the classic study of ref .
source : irmandade da santa casa de misericordia de so paulo ( same iscmsp ) .
axial skeleton changes can lead to substantial functional disability associated with a painful clinical condition and , in severe cases ( fig .
2 ) , even signs of radicular spinal neurological impairment . in addition , patients with considerable deformities of the thoracic cage still show decreased lung ventilatory capacity , and the cardio - respiratory complications are the major cause of late morbidity and mortality .
source : irmandade da santa casa de misericordia de so paulo ( same - iscmsp ) .
the aim of this study was to find patterns and risk factors in spinal deformities in patients with oi .
this study was conducted at the osteometabolic diseases group of pediatric orthopedics and traumatology group , department of orthopaedics and traumatology from irmandade da santa casa de misericordia de so paulo
this study was approved by the ethics and research committee and when necessary , data were collected from medical records of the department of medical records of the irmandade da santa casa de misericordia de so paulo .
inclusion criteria : to be a patient with oi diagnosis with panoramic x - rays in frontal and lateral views ( coronal and sagittal ) of the spine , and agree to sign the consent form ( or responsible person in case of minors ) .
patients with any other metabolic bone disease except oi were excluded , as were those who underwent surgery for correction of spinal deformity and did not have preoperative radiographs , or those who did not agree to sign the consent .
radiographs of the spine were evaluated in the coronal ( anterior posterior ) and sagittal ( lateral ) views , in the standing position , of all patients included in the study , except in the cases of the nonambulating patients , in which the radiographs were obtained in the sitting position .
angles were measured according to the cobb method for scoliosis , lumbar lordosis , and thoracic kyphosis , which consists of measuring the angle between the line perpendicular to the upper terminal plates of the first vertebra and the lower vertebra that belongs to the curve .
we observed the presence or absence of the following changes : biconcave vertebrae ( fig .
the greater curve was considered the primary one , and the secondary curve considered compensatory .
the thoracolumbar transition , defined as a neutral zone , was limited proximally by the eleventh thoracic vertebra and the second lumbar vertebra distally ( ie , included the t11 , t12 , l1 , and l2 vertebrae ) .
source : irmandade da santa casa de misericordia de so paulo ( same - iscmsp ) .
( cobb t10-l2 : 40 ) source : irmandade da santa casa de misericordia de so paulo ( same iscmsp ) . for descriptive analysis ,
categorical measures were presented on a gross basis and percentage ; regarding continuous measures , means , and standard deviations were presented .
inferentially , to test the association between severity of thoracic kyphosis and lumbar lordosis and angular deformity severity , spearman correlation was used since violation of the assumption of normal distribution ( assessed by kolmogov
smirnov test ) in the angles , level of measurement did not have intervals between categories of severity ( ie , increased , decreased , and physiological ) . to interpret the magnitude of the correlations
to evaluate the association between 2 dichotomous measures ( ie , presence / absence , as in the case of the association between the presence of thoracolumbar kyphosis and scoliosis ) , we used the chi - square test .
if values less than 5 were observed in the blanks , we used the fisher exact test . a p - value lower than 0.05 was considered statistically significant .
radiographs of the spine were evaluated in the coronal ( anterior posterior ) and sagittal ( lateral ) views , in the standing position , of all patients included in the study , except in the cases of the nonambulating patients , in which the radiographs were obtained in the sitting position .
angles were measured according to the cobb method for scoliosis , lumbar lordosis , and thoracic kyphosis , which consists of measuring the angle between the line perpendicular to the upper terminal plates of the first vertebra and the lower vertebra that belongs to the curve . we observed the presence or absence of the following changes : biconcave vertebrae ( fig .
the greater curve was considered the primary one , and the secondary curve considered compensatory .
the thoracolumbar transition , defined as a neutral zone , was limited proximally by the eleventh thoracic vertebra and the second lumbar vertebra distally ( ie , included the t11 , t12 , l1 , and l2 vertebrae ) .
source : irmandade da santa casa de misericordia de so paulo ( same - iscmsp ) .
( cobb t10-l2 : 40 ) source : irmandade da santa casa de misericordia de so paulo ( same iscmsp ) .
for descriptive analysis , categorical measures were presented on a gross basis and percentage ; regarding continuous measures , means , and standard deviations were presented .
inferentially , to test the association between severity of thoracic kyphosis and lumbar lordosis and angular deformity severity , spearman correlation was used since violation of the assumption of normal distribution ( assessed by kolmogov
smirnov test ) in the angles , level of measurement did not have intervals between categories of severity ( ie , increased , decreased , and physiological ) . to interpret the magnitude of the correlations
, we consider the study of cohen . to evaluate the association between 2 dichotomous measures ( ie , presence / absence , as in the case of the association between the presence of thoracolumbar kyphosis and scoliosis )
if values less than 5 were observed in the blanks , we used the fisher exact test . a p - value lower than 0.05 was considered statistically significant .
eight patients were excluded because they underwent surgery to correct deformities of the spine and lacked adequate preoperative radiographs . of the total 62 patients included in the study , 34 were female ( 54.83% ) and 28 male . in the study sample ( 62 patients ) , we observed that the patients ages ranged between 7 and 50 years , with a mean equal to 13 years , and 76% had scoliosis .
scoliosis rate and age in the radiographic variables ( table 2 ) , we note that 52% had right thoracic curve and 13% a secondary or compensatory lumbar curve .
the vertebral deformity ( figs . 2 and 3 ) was present in 61% of cases .
thirty - five percent had deformity of the chest and ribs , and 15% showed the presence of unilateral rib .
radiographic variables in table 3 , we note that the greater the severity of thoracic kyphosis , the greater the average intensity of angular deformity ; the magnitude of this correlation was statistically significant and strong ( r = 0.785 , p < 0:01 ) .
after the physiological thoracic kyphosis , we note that the decreased thoracic kyphosis was the most frequent ( 31% ) .
for the 17 patients with thoracolumbar kyphosis ( figure 6 ) , the lordosis angle ranged between 10 and 90 , with an average equal to 25. thoracic and thoracolumbar kyphosis main measures it is noteworthy that one can not infer causality in such associations , that is , one can not infer the direction of causality between the 2 pairs of measurements .
considering the associations between 2 dichotomous measurements , we observed that thoracolumbar kyphosis is associated with : scoliosis ( fisher exact test p - value = 0.048 ) , biconcave vertebrae ( fisher exact test p - value = 0.004 ) , deformity of the vertebra ( fisher exact test p - value = 0.001 ) , and deformity of the chest ( ( 1 ) = 5.543 , p = 0.018 ) .
the prevalence of scoliosis in patients with oi varies between 25% and 100% according to the literature ( watanabe et al , 2007 ) . in our study , 47 patients ( 76% of cases ) had a deformity . in 68% of cases , the main curve in the thoracic region was observed with the convexity to the right , similar to the pattern that is most commonly found in idiopathic scoliosis .
ishikawa et al identified the presence of biconcave vertebrae as a risk factor for developing severe spinal deformity .
yet our evaluation showed that the vertebral deformity is present in 61% of cases , the deformation of the chest in 35% , and the presence of unilateral rib in 15% of cases .
renshaw et al had also identified these radiographic risk factors for negative outcomes ( fig .
hanscom et al evaluated 43 patients with oi and spinal deformity , which were placed in 6 well - defined groups based on a set of radiological alterations .
the radiographic criteria used for classification include the shape , dimensions , and appearance of long bones , pelvis in the presence of clover and acetabular protrusion , and the shape of the vertebrae .
this study , however , considers the pelvis and long bones , not only the spine .
patients could be classified more accurately when the dynamic nature of radiographic changes were recorded . furthermore , the authors observed a difficulty in that progressive x - rays are needed to facilitate classification . because of that it is only effective in cases where periodic radiographic records for some years are present , then in those cases it would be possible to distinguish the groups more efficiently , otherwise it is poorly reproducible .
abelin et al evaluated the appearance of deformities of the spine and changes of physiological sagittal plane curves that can be explained by multiple fractures of the spine compression , reducing the height of the bodies .
however , only 18 patients with oi participated in that study . in these patients ,
this statistically significant difference between the displacements in the sagittal plane of the groups indicated that patients with oi have a center of gravity that allows them to balance the trunk displaced anteriorly , when compared with the normal population .
our radiographic thoracic kyphosis followed the recommendation of the scoliosis research society ( srs ) , who consider normal values for thoracic kyphosis as a range between 20 and 50 , with the curve measured by the method of cobb modified between the vertebrae t3 to t12 .
furthermore , the srs defines a normal absolute value of 40 in thoracic kyphosis . even in 37 patients who had thoracic kyphosis within the normal range ( between 20 and 50 ) , the average was 29 below the normal absolute value of 40. this drew attention to the high number of cases with hypokyphosis , 19 , in relation to cases with kyphosis , 6 . however , as opposed to the study of abelin et al , a tendency toward decreased thoracic kyphosis was observed in the normal population .
koerber et al introduced a new classification of spinal abnormalities in patients with oi , but used only lateral view x - rays .
as in our study , they identified the high incidence of thoracolumbar kyphosis as a risk factor .
the srs itself also defined the region as a neutral zone without angulation in the coronal and sagittal planes .
we observed that the presence of thoracolumbar kyphosis showed a statistically significant relationship with the presence of decreased thoracic kyphosis .
the thoracolumbar region is burdened by the rib cage and the trend is to increase the kyphosis , as in normal people , where the fracture of the thoracolumbar spine usually defaults to segmental kyphosis . with the thoracolumbar kyphosis acquired chronically leads us to suspect that the thoracic hypokyphosis is a consequence of the need to equalize the overall sagittal balance , which rectifies the segment in order to offset the deformity of the adjacent distal segment .
these factors were found in patients with oi : scoliosis , biconcave vertebrae , vertebral and chest deformity , unilateral rib , and thoracolumbar kyphosis . | abstractosteogenesis imperfecta ( oi ) is a hereditary connective tissue disorder that leads to bone weakness and deformities , especially in the spine , which can lead to poor outcomes.the aim of this study was to find patterns and risk factors in spinal deformities in patients with oi.in a retrospective study , 70 patients with oi were selected .
radiographs of the spine were evaluated .
we observed the presence or absence of the following changes : biconcave vertebrae , chest and vertebral deformities , unilateral rib , and thoracolumbar kyphosis .
the greater curve was considered the primary one , and the secondary curve considered compensatory.in the study sample , we observed that the patients ages ranged between 7 and 50 years , with a mean equal to 13 years , and 76% had scoliosis . in 68% of cases the main curve in the thoracic region
was observed with the convexity to the right.the following was found in patients with oi : scoliosis , biconcave vertebrae , vertebral and chest deformity , unilateral rib , and thoracolumbar kyphosis .
the thoracolumbar kyphosis is highly associated with thoracic hypokyphosis in patients with oi . |
although many theories have been proposed , the mechanism of ovarian carcinogenesis is still unclarified .
several risk factors for epithelial ovarian cancer ( eoc ) are identified . however , by far the most significant risk factor for eoc is a family history of this disease ; a woman with one first - degree relative with ovarian cancer has a three - fold increased risk of developing eoc herself .
at least two hereditary syndromes predispose to familial ovarian cancer : the hereditary breast - ovarian cancer ( hboc ) syndrome and the lynch syndrome .
mutations in the brca1 and brca2 tumor suppressor genes account for 6585% of all hereditary ovarian cancers . a recent population - based study showed a combined brca1 and brca2 mutation frequency of 13.3% among 1,342 women with ovarian cancer .
the lifetime risk of ovarian cancer in brca1 and brca2 mutation carriers is approximately 4060 and 1025% , respectively [ 7 , 8 ] . mutations in mismatch repair genes mlh1 , msh2 , msh6 , pms1 , and pms2 in the lynch syndrome account for 1015% of hereditary ovarian cancers , with a lifetime risk of 810% of developing ovarian cancer [ 2 , 8 , 9 ] . to date , reliable screening methods for ovarian cancer are not available and screening for ovarian cancer in the general population does not reduce mortality . even in high risk populations screening
the only proven method to dramatically reduce the incidence of ovarian cancer in high - risk patients is a prophylactic bilateral salpingo - oophorectomy ( bso ) [ 12 , 13 ] .
it not only reduces the risk of ovarian cancer by up to 96% but also halves the risk of breast cancer ( bc ) in pre - menopausal women [ 1215 ] .
it has several advantages over genetic tests including lower costs , greater acceptability and a reflection of shared genetic and environmental factors .
moreover , criteria for genetic testing rely almost exclusively on family history information . in various studies
however , the question is raised how accurate family history is to predict mutation status [ 3 , 4 , 6 ] .
several reasons are given for a low validity of family history taking as diagnostic test for hereditary cancer , i.e. small families or families with few women , changeable penetrance , sporadic cancers , new mutations or inadequate family history taking .
there is no literature available on the adequacy of family history taking in eoc patients .
the purpose of this population - based study was to describe adequacy of family history taking in eoc patients and to identify factors that determine this adequacy .
secondly , we aimed to acquire insight in the reliability of presence or absence of written notifications of family history in medical records by comparing data in medical records with data collected thru self - administered questionnaires .
to evaluate adequacy of family history taking in eoc patients and factors that determine this adequacy , we used population - based data from a retrospective study in 11 hospitals in the eastern part of the netherlands : one university clinic and ten community hospitals . the population - based netherlands cancer registry ( ncr ) registered 1,178 patients with primary eoc in these hospitals between 1996 and 2006
hospital records of the patients were studied by trained registrars using a standard case record form .
data on patient characteristics , tumor characteristics , therapy and recurrence were collected . after excluding 66 patients without histological confirmed eoc , data of a total number of 1,112 patients were available .
data on family history taking included degree and age at diagnosis of all relatives diagnosed with eoc , bc , or colorectal cancer ( crc ) .
for this study adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian cancer .
factors that may be correlated with family history taking were tested using univariable logistic regression analysis .
factors tested were ; age of the patient at diagnosis ( < 40 , 4060 , > 60 year ) , hospital type ( general , teaching , university hospital ) , year of diagnosis ( 19961999 , 20002003 , 20042006 ) , menstrual state ( pre- or postmenopausal ) , cancer in patient s history ( yes or no ) , bc in patient
s history ( yes or no ) , cervical cancer in patient s history ( yes or no ) , endometrial cancer in patient s history ( yes or no ) , colon cancer in patient s history ( yes or no ) , ca125 at diagnosis ( 35 or > 35 ) , risk of malignancy index ( 200 or > 200 ) , karnofsky score ( 70 or > 70 ) , stage of disease ( early = figo < iib or advanced = figo iib ) , surgery ( yes or no ) , chemotherapy ( yes or no ) , histology ( serous , endometrioid , mucinous , adenocarcinoma not otherwise specified or other ) , grade of differentiation ( grade i or ii or iii ) , number of recurrences ( 0 , 1 , 2 , 3 or 4 ) and inclusion in a trial ( yes or no ) .
all p values presented are two - sided , and associations were considered significant if the p value < 0.05 . since correlation between certain factors
was expected all significant indicators ( p < 0.05 ) were entered in a multivariable model using a stepwise forward approach .
statistical analyses were performed using statistical package for social sciences 16.0 for microsoft windows ( spss inc . ) . to measure the reliability of presence or absence of written notifications on family history in medical records , we compared data in the medical files with data collected by self - administered questionnaires . in 2008
, these questionnaires were sent to all living patients diagnosed with ovarian cancer between 1989 and 2008 in seven of the 11 hospitals .
the questionnaire database included 308 patients of whom 150 were also included in the above described eoc database .
the other 158 cases were diagnosed before 1996 or after 2006 , or were non - eoc cases ( fig . 1 ) .
another three cases were excluded since data on family history were missing in both the eoc database and the questionnaires .
data on family history taking included type of malignancy and age at diagnosis of first - degree relatives .
a comparison was made based on the number of relatives with a malignancy , the type of malignancy ( being bc , eoc or crc ) , and age at diagnosis . cancer cases among family members mentioned in the self - questionnaire but diagnosed after the last follow - up date of the patient were excluded .
agreement between the databases on number of relatives with a malignancy , type of malignancy , and age at diagnosis with an acceptable margin of error of 5 years , was defined as total agreement .
partial agreement was defined as agreement on number of relatives with a malignancy and type of malignancy.fig .
eoc epithelial ovarian cancer , oc ovarian cancer , bc breast cancer overview of databases used in this study .
figure 1 shows an overview of this database and the other databases used in this study . for 41% ( 456/1,112 ) of the cases ,
documentation on family history of breast and ovarian cancer was found in the medical records .
table 1 shows characteristics of patients with or without an adequate documentation on family history .
univariable logistic regression analysis showed age , hospital type , year of diagnosis , menstrual state , bc in the past , karnofsky score , histology , having surgery or chemotherapy , recurrence , and inclusion in a trial , to be significantly correlated with adequacy of family history taking .
multivariable logistic regression analysis identified age , hospital type , and having surgery or chemotherapy , as significant independent prognostic factors ( table 2 ) .
patients who were younger , diagnosed in a university hospital , or who underwent chemotherapy and/or surgery , were more likely to have an adequate documentation on family history.table 1associations between patient , tumor and treatment characteristics and adequacy of family history taking in univariable logistic regression analysis ( n = 1,112)characteristicsadequate n(%)inadequate n(%)p valueage ( years)<0.01 > 60200 ( 32%)429 ( 68% ) 4060216 ( 52%)202 ( 48% ) < 4039 ( 66%)20 ( 34%)hospital type<0.01 general hospital182 ( 33%)371 ( 67% ) teaching hospital188 ( 42%)264 ( 58% ) university hospital86 ( 81%)20 ( 19%)year of diagnosis0.019 19961999166 ( 38%)274 ( 62% ) 20002003181 ( 41%)265 ( 59% ) 20042006109 ( 49%)113 ( 51%)menstrual state<0.01 premenopausal113 ( 57%)86 ( 43% ) postmenopausal311 ( 37%)527 ( 63%)cancer in patients history0.230 no372 ( 41%)536 ( 59% ) yes82 ( 46%)97 ( 54%)breast cancer in patients history<0.01 no410 ( 41%)599 ( 59% ) yes44 ( 56%)34 ( 44%)colon cancer in patients history0.464 no448 ( 42%)621 ( 58% ) yes6 ( 33%)12 ( 67%)endometrial cancer in history0.131 no443 ( 42%)607 ( 58% ) yes11 ( 30%)26 ( 70%)cervical cancer in patients history0.593 no448 ( 42%)628 ( 58% ) yes5 ( 50%)5 ( 50%)ca-125 at diagnosis0.174 3560 ( 49%)63 ( 51% ) > 35360 ( 42%)491 ( 58%)risk of malignancy index ( rmi)0.984 20056 ( 44%)71 ( 56% ) > 200286 ( 44%)364 ( 56%)karnofsky score<0.01 < 7051 ( 24%)159 ( 76% ) 70395 ( 46%)459 ( 54%)stage0.602 early ( < iib)113 ( 43%)152 ( 57% ) advanced ( iib)316 ( 44%)394 ( 56%)chemotherapy<0.01 no98 ( 25%)297 ( 75% ) yes357 ( 50%)359 ( 50%)surgery<0.01 no40 ( 19%)166 ( 81% ) yes416 ( 46%)488 ( 54%)histology<0.01 serous205 ( 48%)221 ( 52% ) mucinous37 ( 42%)52 ( 58% ) endometrioid78 ( 47%)89 ( 53% ) adenocarcinoma nos84 ( 33%)169 ( 67% ) other45 ( 40%)67 ( 60%)grade of differentiation0.297 156 ( 41%)81 ( 59% ) 2100 ( 42%)140 ( 58% ) 3225 ( 47%)257 ( 53%)number of recurrence<0.01 0229 ( 35%)426 ( 65% ) 1145 ( 47%)163 ( 53% ) 258 ( 53%)51 ( 47% ) 314 ( 61%)9 ( 39% ) 410 ( 59%)7 ( 41%)inclusion in trial0.034 no421 ( 40%)623 ( 60% ) yes33 ( 54%)28 ( 46%)adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian canceradenocarcinoma not otherwise specifiedclear cell , brenner , mixed , undifferentiated and other rare epithelial typestable 2associations between patient , tumor and treatment characteristics and adequacy of family history taking in multivariable logistic regression analysis ( n = 1,112)characteristicsadequateinadequateodds ratio95% cilowerupperage > 60200 ( 32%)429 ( 68%)1.00 4060216 ( 52%)202 ( 48%)1.651.232.22 < 4039 ( 66%)20 ( 34%)3.271.706.26hospital type general hospital182 ( 33%)371 ( 67%)1.00 teaching hospital188 ( 42%)264 ( 58%)1.631.222.19 university hospital86 ( 81%)20 ( 19%)8.744.8415.79surgery no40 ( 19%)166 ( 81%)1.00 yes416 ( 46%)488 ( 54%)1.681.022.76chemotherapy no98 ( 25%)297 ( 75%)1.00 yes357 ( 50%)359 ( 50%)2.251.633.12adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian cancer associations between patient , tumor and treatment characteristics and adequacy of family history taking in univariable logistic regression analysis ( n = 1,112 ) adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian cancer adenocarcinoma not otherwise specified clear cell , brenner , mixed , undifferentiated and other rare epithelial types associations between patient , tumor and treatment characteristics and adequacy of family history taking in multivariable logistic regression analysis ( n = 1,112 ) adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian cancer 147 cases in the eoc database also completed a questionnaire . in 36% ( 53/147 ) of the cases , full agreement was found regarding the number and types of malignancy , as well as ages at diagnoses within 5 years . another five per cent ( 8/147 ) agreement was found for the number and type of malignancy in relatives . in 59% ( 86/147 ) of the cases , the information on family cancer history was discordant . in those 86 cases , medical records reported more malignancies than self - administered questionnaires in 11% ( 9/86 ) , self - administered questionnaires reported more malignancies in 23% ( 20/86 ) , and data were missing in the medical records where the self - administered questionnaires reported a negative family history in 66% ( 57/86 ) .
our population - based study shows that , adequate documentation on family history was present in only 41% of all medical records of eoc patients .
this percentage is in agreement with ranges found in literature regarding patients with crc and data required in primary care settings [ 1720 ] . in univariable analysis a slight improvement over time was seen which is encouraging however family history is still poorly recorded .
this is especially true when taking into account our limited definition of an adequate history covering the majority of hereditary ovarian cancers , namely the brca mutation carriers , but leaving others unattended .
previous studies on crc defined adequate family history taking by presence of a notification of relatives with crc only [ 18 , 20 ] . therefore , we feel that we used an appropriate definition for adequate family history taking in this study , but encourage clinicians to apply a much broader definition .
we believe a comprehensive adequate family history should include information on first and second degree relatives , the type of tumor they developed ( especially colorectal or endometrial carcinoma ) and the age at onset .
since families are getting smaller one should also note the total number of first and second - degree relatives to put it in perspective .
an additional problem is that with the decreasing number of relatives family history taking is expected to be less accurate in the future .
it is important to ask about second degree relatives since 50% of the mutations are paternally derived and the fathers are likely to be unaffected . though it is known that information on second degree relatives is less reliable than information on first degree relatives .
also the absence of malignancies should be noted . in case of suspicion of hereditary cancer
having chemotherapy or surgery often requires involvement of more specialists , longer therapeutic relationships and hospitalization , leading to more opportunities to ask about family history .
regarding age , in younger patients family history taking is probably more accurate because physicians are aware of an earlier age at onset in the majority of mutation carriers .
we urge specialists to keep in mind the possibility of a hereditary malignancy , even in the elderly patients .
with respect to hospital type , specialized gynecologists in academic hospitals more often recorded family history .
since it is shown that treatment by a gynecologic oncologist improves outcome , more and more eoc patients will be treated by specialized gynecologists and discussed in multidisciplinary tumor boards , which eventually may improve adequacy of history taking . with the result of the multivariable analysis
the question raised if gynecologists perform worse in family history taking compared to other physicians . to answer this question
family history data of all 4,858 bc and all 342 eoc patients diagnosed between 2005 and 2008 were compared .
data , extracted from medical records , included number of first - degree relatives with the same malignancy ( being bc or eoc ) , age of the youngest relative with the same malignancy and number of first - degree relatives with another malignancy . in 30% ( 104/342 ) of all eoc patients , compared with 64% ( 3,103/4,858 ) of all bc patients , documentation on presence or absence of first - degree relatives with the same malignancy was found .
24% ( 81/342 ) of eoc patients and 20% ( 989/4,858 ) of bc patients had any documentation in their medical record about first - degree relatives with other malignancies .
so family history regarding first - degree relatives with the same malignancy was taken twice more frequently in bc patients .
, patients can be more aware of bc in their family and both patient and physician can be more forthcoming towards this subject
. the clinician and patient can also be more aware of bc as a hereditary cancer , since there has been a lot of attention for this subject .
family history taking on first - degree relatives with another malignancy is as likely to be forgotten by surgeons in bc patients as by gynecologists in eoc patients .
although the large sample size is an apparent strength of this study , we are aware of some limitations .
it is possible that specialists did not register anything in the absence of relatives with a malignancy . in that case
the family history was considered to be absent although it in fact was examined correctly . in order to determine this possible bias , we compared the data with self - administered questionnaires .
. showed that reliability of self - reported family history taking varies by cancer site and by degree of relative . for first - degree relatives ,
supported the first statement but also states that negative family history reports for ovarian cancer are less useful .
especially abdominal malignancies are reported inaccurately probably because many organs are within the abdominal cavity and it is often referred to as abdominal cancer . in the current study
, we were unable to assess the reliability of family history taking by verifying it with a population - based registration and therefore chose a comparison with self - administered questionnaires .
data of 147 eoc cases of mainly long - term ovarian cancer survivors were studied . in nearly 60% of the cases
no agreement was found which was largely due to missing data in the eoc database in absence of any relatives with a malignancy in the questionnaires .
data from medical records were gathered in 2007 and the questionnaires were filled out by patients in 2008 .
it is likely that if gynecologists asked about family history , they did so in the early stages of treatment and never pursued it over time
. patients may also have developed more awareness on cancer in their family during the years since their diagnoses . as mentioned previously ,
these 147 cases were mainly long - term survivors . while analyzing data of these cases , 58% of these patients showed an adequate documentation in their medical records , compared to 41% in the whole eoc group .
an unselected patient group with respect to survival may worsen the results in our study even more .
it is of upmost importance to have an accurate tool for the identification of hereditary cancer .
the risk of eoc can currently not be reduced by screening but a prophylactic bso offered to high - risk patients can reduce the risk significantly .
brca mutation carriers also have an improved sensitivity to platinum chemotherapy and novel therapeutic agents such as poly ( adp - ribose ) polymerase inhibitors have increased activity in these patients .
our study shows that family history taking over the last 10 years was inadequate in the majority of eoc patients .
moreover , a recent study shows that family histories change significantly over time and updates on family history every 510 years are recommended .
data on sensitivity of family history as a predictor of mutation carrier status are conflicting . in various studies
the proportion of brca gene mutation carriers having a first or second degree relative with ovarian or bc varied from 92% to 6269% [ 4 , 5 ] .
it appears reasonable to offer genetic testing to all non - mucinous eoc patients in order to fully benefit from preventive measures like a bso .
but since genetic testing is not routinely offered in many countries and even when it is offered it is not performed in all cases , there is still a place for family history taking .
family history taking also plays an important role in the counseling of patients with a possible hereditary tumor .
moreover , patients with familial ovarian cancer but without mutation can be offered a bso .
the upcoming of electronic health record systems can be helpful by turning family history taking into a fixed item in consultations with cancer patients .
further education is needed for the physician to increase awareness of hereditary cancer since taking an adequate family history is still essential to provide high - standard care to patients with cancer and their families even in the era of genetic testing . | the aim of this study was to evaluate the adequacy of family history taking in epithelial ovarian cancer ( eoc ) patients and to identify factors that determine adequacy .
furthermore , the validity of family history taking was assessed by comparison with self - administered questionnaires .
medical records of all 1,112 eoc patients registered by the nation - wide cancer registry and diagnosed in eleven dutch hospitals between 1996 and 2006 were reviewed .
adequate family history taking was defined as a written notification of the presence or absence of relatives with breast or ovarian cancer .
factors that were correlated with family history taking were identified using univariable and multivariable logistic regression .
147 patients filled in a postal questionnaire .
an adequate family history was taken in 41% of all cases .
younger age , an academic hospital and having undergone surgery and/or chemotherapy were associated with adequate family history taking .
the comparison with self - administered questionnaires showed a disagreement in 64% mainly due to missing data in medical records .
documentation on family history is either absent or inadequate in the medical records in the majority of eoc patients .
these data urge for better uptake of hereditary cancer risk assessment .
different strategies for this assessment like improved family history taking and genetic testing in eoc patients should be explored . |
trigeminal neuralgia ( tn ) is defined by the international headache society ( ihs ) as unilateral disorder characterized by brief electric shock - like pains , abrupt in onset and termination .
the pain is limited to the distribution of one or more divisions of the trigeminal nerve.1 the ihs classifies tn as either classic ( essential or idiopathic ) type ( ctn ) or symptomatic tn type with pain indistinguishable from that of ctn but caused by a demonstrable structural lesion other than vascular compression .
ctn starts in the second or third divisions , affecting the cheek or the chin.1 tn may involve one or more branches of the trigeminal nerve with the maxillary branch involved mostly , and the ophthalmic branch is the least affected.23 the right side of the face is affected more commonly than the left ( ratio of 1.5:1 ) , which may be because of the narrower foramen rotundum and foramen ovale on the right side.234 tn has been described among the most painful conditions known to mankind.5 it is characterized by lancinating , unilateral , and paroxysmal pain occurring in the distribution of the fifth cranial ( trigeminal ) nerve .
usually , there is a trigger zone.678 the annual incidence of tn has been reported as 4.3/100,000 populations , with a slight female predominance.2 the initial treatment of choice for tn is medical therapy , and most patients have at least temporary relief with the use of selected agents.9 patients who have no response to or who relapse with medical therapy should be considered for surgical treatment.10 surgery may also be considered for patients who are intolerant of medical treatment . the general recommendation is to start with medical therapy and consider surgical procedures in patients who are refractory to medical treatment.1112 first - line therapy should be carbamazepine ( cbz ; 2001200 mg / day ) and oxcarbazepine ( oxc ; 6001800 mg / day ) according to current evidence - based treatment guidelines.1314 other medications may be tried if carbamazepine is unsuccessful or provides only partial relief .
baclofen ( lioresal ) in dosages of 1080 mg daily has been shown to be useful.15 additional medications with reported success in smaller studies or case reports include phenytoin ( dilantin ) , lamotrigine ( lamictal ) , gabapentin ( neurontin ) , topiramate ( topamax ) , clonazepam ( klonopin ) , pimozide ( orap ) , and valproic acid ( depakene).9161718192021 most patients will respond , at least temporarily , to single or combination therapy with these agents . since medical treatment is the most frequent treatment approach for tn reported worldwide,9101112 it may be the most effective treatment option for tn in nigerians .
there is dearth of literature that evaluates the medical treatment of tn in nigeria ; this study , therefore , evaluates the clinical profile of patients suffering from tn and correlates the findings with early response of the patients to medical treatment of this condition in a nigerian population .
this was a 4-year prospective study between may 2008 and april 2012 in which patients diagnosed of tn were treated medically and followed up weekly for 8 weeks ; to determine early treatment outcome , in the department of oral pathology and oral medicine , university of benin teaching hospital , benin city , nigeria .
demographic data , information concerning history , and treatment outcome were obtained from patients ' medical records .
treatment outcomes were analyzed in terms of immediate response of patients to medical treatment within 8 weeks of management .
data obtained from the study were analyzed using the ibm statistical package for social sciences ( ibm spss ; version 16.0 , chicago , usa ) .
a number of patients ' characteristics were analyzed for a possible correlation with treatment outcome .
of the 287 patients seen within the study period , a total of 14 ( 4.9% ) patients were diagnosed of tn .
thirteen ( 4.5% ) of the cases were selected for this study based on compliance to the 8-week follow - up visits , consisting of 8(61.5% ) males and 5 ( 38.5% ) females , giving a ratio of 1.6:1 .
the age range of the patients was 2773 years , with a mean age of 501.5 years and the peak age group were the 5 7 decades ( n = 9 , 69.2% ) .
the mandibular ( n = 6 , 46.2% ) and maxillary ( n = 5 , 38.5% ) divisions of the trigeminal nerve were mostly affected .
the lesion was slightly more common on the right side of the face ( n = 7 , 53.8% ) than the left side ( n = 6 , 46.2% ) .
most of the patients ( n = 8 , 61.5% ) had no known trigger zone . talking ( n = 4 , 30.8% ) and chewing ( n = 3 , 23.1% ) were the most frequent trigger factors [ table 1 ] .
summary of patients clinical profile the patients mostly described the pain as severe , spontaneous and sharp ( n = 5 , 38.2% ) , and the duration was between 2 weeks and 5 years .
there was no history of previous medical ( n = 8 , 61.5% ) or dental ( n = 6 , 46.2% ) problems in most of the patients .
the most common clinical differential diagnosis was atypical odontalgia ( n = 3 , 23.1% ) .
most patients became stable on tablet carbamazepine 200 mg 12 hourly and tablet folic acid 5 mg daily .
about 92.3% of patients responded well to medical treatment within the 8 weeks follow - up period [ table 2 ] .
treatment regimen and outcome good response was observed in most patients within 2 week ( n = 646.2% ) of medical treatment , especially in patients at the seventh decade of age ( n = 3 , 23.1% ) and those with lesions involving the mandibular division of the trigeminal nerve ( n = 3 , 23.1%)(p = 0.001 ) .
the patients with severe , sharp , and spontaneous pain were significantly associated with good response to treatment within 2 weeks ( p = 0.016 ) [ table 3 ] .
this study showed that 92.3% of the patients with tn responded to medical treatment , which affirms the previous report that states the initial treatment of choice for tn is medical therapy.9 carbamazepine is considered first - line therapy for tn.22 carbamazepine acts by inhibiting the neuronal sodium channel activity thereby reducing the excitability of neurons .
hence , predictable and powerful is the relief that if the patient does not respond at least partially to carbamazepine , reconsider the diagnosis of idiopathic tn.2223 in this study , all the patients were given carbamazepine with a starting dose of 100200 mg daily and tablet folic acid 5 mg to prevent the anemic effect of carbamazepine .
the dose of carbamazepine was adjusted according to the degree of pain . on the whole
, most patients became stable on tablet carbamazepine 200 mg 12 hourly and tablet folic acid 5 mg daily .
dosages used from literature have ranged from 100 to 2400 mg / day , with most patients responding to 200800 mg / day in two or three divided doses . a patient in this study , who failed to achieve maximum relief with carbamazepine , had sodium phenytoin 100 mg 12 hourly added to it .
phenytoin has the same mechanism of action as carbamazepine and poses a similar risk panel , except for the risk of aplastic anemia .
it has been reported that for those patients who fail to attain relief with carbamazepine alone , an additional 820% of the patients may have an adequate response if phenytoin is added to the treatment regimen.24 a study reported that the right side of the face is affected more commonly than the left.9 the symptoms of tn are confined to the trigeminal nerve distribution , and most cases involve the second or third division , or both.9 similarly , this study observed that the lesion was slightly commoner on the right with the mandibular ( v3 ) and maxillary ( v2 ) divisions of the trigeminal nerve mainly affected .
in addition , early response was observed in this study in most patients within the 2 week of medical treatment , especially in elderly patients and those with lesions involving the mandibular division of the trigeminal nerve .
talking , smiling , chewing , teeth brushing , and shaving have all been implicated as triggers for the pain .
even breeze touching the face may cause a paroxysm of pain in some patients.3 in this study , talking and chewing were the most frequent trigger factors . in trigger zones ( small areas near the nose or mouth in patients with tn )
patients with tn can pinpoint these areas and will assiduously avoid any stimulation of them .
not all patients with tn have trigger zones , but trigger zones are nearly pathognomonic for this disorder.39 about 38.5% of patients in this study had known trigger zones and avoided touching those areas .
this study supports previous reports that medical treatment is effective in the treatment of tn .
we recommend combination therapy of carbamazepine and folic acid in the treatment of patients with tn , especially elderly patients with lesions involving the mandibular division of the trigeminal nerve .
| background : this study evaluates the clinical profile of patients suffering from trigeminal neuralgia ( tn ) and correlates the findings with early response of the patients to medical treatment.patients and methods : a 4-year prospective study in which patients diagnosed of tn were treated medically and followed up weekly for 8 weeks to determine early treatment outcome , in the university of benin teaching hospital , benin city , nigeria.results:of the 287 patients seen during the study period , a total of 14 ( 4.9% ) patients were diagnosed of tn .
thirteen ( 4.5% ) of the cases were selected based on compliance to the 8-week follow - up visits , consisting of 8 ( 61.5% ) males and 5 ( 38.5% ) females , giving a ratio of 1.6:1 .
the mean age of the patients was 501.5 years .
the mandibular ( n = 6 , 46.2% ) and maxillary ( n = 5 , 38.5% ) divisions of the trigeminal nerve were mostly affected .
the lesion was slightly more common on the right side of the face ( n = 7 , 53.8% ) than the left side ( n = 6 , 46.2% ) .
talking ( n=4 , 30.8% ) and chewing ( n = 3 , 23.1% ) were the most frequent trigger factors .
the patients mostly described the pain as severe , spontaneous , and sharp ( n = 5 , 38.2% ) .
most patients became stable on tablets carbamazepine 200 mg 12 hourly , folic acid 5 mg daily , and phenytoin 100 mg daily .
good response was observed in most patients within 2 weeks ( n = 6 , 46.2% ) of medical treatment , especially in patients at the seventh decade of age ( n = 3 , 23.1% ) and those with lesions involving the mandibular division of the trigeminal nerve ( n = 3 , 23.1%).conclusion : this study shows early response of tn to medical treatment .
we recommend combination therapy of carbamazepine and folic acid in the treatment of patients , especially elderly patients with lesions involving the mandibular division of the trigeminal nerve . |
acute appendicitis ( aa ) is the most common abdominal emergency worldwide that requires surgical intervention in the daily clinical practice of general surgery .
the diagnosis of acute appendicitis has been primarily made with clinical symptoms and physical examination . since symptoms of aa overlap with other abdominal and gynecologic conditions , achieving an accurate diagnosis is still a clinical challenge for surgeons and
there is a lack of adequate specific biomarkers for aa . to support the diagnosis ,
preoperative scoring systems such as the alvarado score were developed ; however , these systems are rarely used . in clinical practice ,
the most commonly used laboratory tests for the diagnosis of aa are wbc and crp .
the nonspecific presentation and limited diagnostic accuracy of laboratory results often lead to an inadequate diagnosis , necessitating radiological imaging of the abdomen .
ultrasonography ( us ) and computed tomography ( ct ) scanning can enhance diagnostic accuracy in patients with suspected aa . although the pathophysiology of aa has been described in detail , the factors involving the progression of aa are still being investigated .
recently , it was found that one of these factors of interest is oxidative stress .
the possible role of oxidative stress parameters in the progression of aa has been demonstrated in a few studies [ 46 ] .
some biochemical markers , such as those used to identify oxidative stress and inflammation , have been proposed as indicators of the presence and extent of acute appendicitis [ 5 , 7 ] .
it has been known that plasma thiols are physiological free radical scavengers and they may serve as an antioxidant function by several mechanisms .
it has been known that the measurement of plasma total thiol and determining thiol / disulphide homeostasis are a good reflection of excess free radical generation in several diseases [ 810 ] . in this study
, we hypothesized that oxidative stress plays a role in the pathogenesis of aa and we aimed to investigate a novel oxidative stress marker , thiol / disulphide homeostasis , in patients diagnosed with aa , as well as its correlation with other inflammatory markers such as crp and wbc .
this study was carried out in adana numune training and research hospital general surgery clinic between april 2015 and december 2015 .
a total of 142 participants , consisting of 71 patients who underwent operations with diagnosis of aa over the age of 18 years and 71 healthy volunteers for the control group were included in the study .
the control group consisted of healthy patients with similar demographic characteristics to the patient group and who have applied to our hospital with dyspeptic complaints but without a known chronic disease , smokers and alcohol users or drug users .
participants were also excluded from the study if they were pregnant or had a history of malignancy or abdominal trauma within 7 days of admission .
the diagnosis of acute appendicitis was made with clinical symptoms and physical examination as well as laboratory tests and imaging techniques such as ultrasonography and computed tomography .
this study has been designed in accordance with 2013 brazil version of helsinki declaration and was approved by the local ethics committee .
venous blood samples were taken to measure thiol / disulphide homeostasis parameters of all participants who were included in the study . in aa patients , blood samples were taken when they admitted to our clinic before surgical intervention . in healthy volunteers
after blood samples were quickly centrifuged at 1500 rpm for ten minutes , plasma and serum samples were separated .
then the plasma samples tested for thiol / disulphide levels were shipped to biochemical laboratory of ataturk training and research hospital , ankara , turkey , after all samples were collected .
hemogram , biochemistry , and crp levels of all participants were measured at the time they were enrolled in the study .
thiol / disulphide levels were analyzed with a newly developed method by erel and neselioglu . in summary ,
unused reductant sodium borohydride was consumed and removed with formaldehyde , and all thiol groups including reduced and native ones were detected after reaction with 5,5-dithiobis-(2-nitrobenzoic ) acid .
half of the difference between total and native thiols provided the dynamic disulphide amount ( -s - s ) .
after the determination of native thiol ( -sh ) and disulphide ( -s - s ) amount , native thiol / disulphide ratio ( -s - s-/-sh ) was calculated .
laboratory staff performing the plasma thiol / disulphide homeostasis measurement analysis were blinded to the patients ' clinical information and outcome ; and results were not available to the treating physicians , study staff , or investigators during study period .
statistical package for social sciences ( spss ) for windows 20 ( ibm spss inc .
continuous variables with normal distribution were given as mean standard deviation and continuous variables without normal distribution were given as median interquartile range [ iqr ] .
continuous variables were compared with independent sample t - test , anova , mann whitney u test , and kruskal - wallis h test where appropriate .
chi - square test and fisher 's exact chi - square test were used to compare categorical variables .
no significant difference was observed between the aa and control groups with respect to age , hb , and bmi ( p > 0.05 ) .
the native thiol , total thiol , and the native thiol / total thiol ratio levels were statistically significantly decreased ( p < 0.001 ) in the patients with aa compared with the control subjects . on the other hand ,
disulphide level and the ratios of disulphide / native thiol and disulphide / total thiol were higher in the aa group than in the control group ( p < 0.001 ) .
the demographics and the thiol / disulfide homeostasis parameters of the patients and healthy controls are summarized in table 1 . in the appendectomy group , patients were further divided into two categories : nonperforated appendicitis ( n = 54 ) and perforated appendicitis ( n = 17 ) . there was no significant difference between the two groups in terms of sex , bmi , and hb ( p > 0.05 ) .
the levels of native thiol and total thiol ( p = 0.003 and p = 0.005 , resp . ) as well as the native thiol / total thiol ratio ( p = 0.04 ) were lower in the perforated group when compared to those of the nonperforated group . on the other hand ,
disulphide level and the ratios of disulphide / native thiol and disulphide / total thiol were higher in the perforated group than in the nonperforated group ( p = 0.027 , p = 0.001 , and p = 0.001 , resp . ) .
the demographics and the thiol / disulfide homeostasis parameters of the patients in aa group are summarized in table 2 .
table 3 shows the correlation analysis between thiol / disulphide homeostasis parameters and other characteristic features with study population .
we determined a negative correlation of crp with native thiol , total thiol , and native thiol / total thiol ratio , while we determined a positive correlation of crp with disulphide / native thiol and disulphide / total thiol in the aa group .
there was a negative correlation of age with total thiol and native thiol / total thiol in the aa group .
there was a negative correlation of age with native thiol and total thiol in the control group . in the stepwise regression model formed with risk factors such as age , sex , bmi , wbc ,
hb , crp , native thiol , total thiol , disulphide , disulphide / native thiol , disulphide / total thiol , and native thiol / total thiol , risk factors as disulphide / native thiol ( or = 1.368 ; p = 0.018 ) and crp ( or = 1.635 ; p = 0.003 ) were determined as predictors of perforated appendicitis compared to the nonperforated group .
it was determined that 1-unit increase in disulphide / native thiol rate predicts 1.368 times the risk of having perforated appendicitis and 1-unit increase in crp level predicts 1.635 times the risk of having perforated appendicitis .
acute appendicitis is still a clinical challenge for physicians , as there is no single test that reliably differentiates aa from other causes of acute abdomen .
developing specific diagnostic tests for aa would both prevent unnecessary surgery and help to define the advanced stages of the disease requiring urgent intervention , such as perforated appendicitis , which is associated with increased morbidity and mortality .
in addition to inflammatory markers , oxidative stress markers have recently become an area of interest for investigators . in the literature ,
experimental and clinical studies addressing the association between aa and oxidative stress are limited [ 5 , 13 , 14 ] .
it has been reported that the serum levels of oxidative stress markers change in patients with aa , determining that the imbalance between oxidant and antioxidant defense systems may play a role in the pathogenesis of aa , which could be either etiologic or a result of inflammation [ 9 , 13 , 15 ] .
therefore , these serum markers may be used to aid the diagnosis of aa and to determine the extent of the disease .
as is known , thiols are a class of organic compounds that contain a sulfhydryl group ( -sh ) , which is composed of a hydrogen and a sulphur atom attached to a carbon atom .
those disulphide bonds can be reduced back to thiol groups ; therefore , thiol / disulphide homeostasis is maintained .
thiols contribute the major portion of the total antioxidants present in the body and play an important role in defense against reactive oxygen species and also play critical roles in programmed cell death , detoxification , antioxidant protection , and regulation of cellular enzymatic activity [ 11 , 19 ] .
recently , it is known that an abnormal thiol / disulfide homeostasis state is involved in the pathogenesis of various acute and chronic diseases [ 10 , 11 ] .
measuring thiols in serum provides an indirect reflection of the antioxidative defense [ 10 , 11 , 1820 ] .
the measurement of dynamic thiol / disulphide first started by a new automated method developed by erel and neselioglu .
this study aimed to determine the status of dynamic thiol / disulphide homeostasis by this new method in aa .
furthermore , we investigated the correlation between thiol / disulphide homeostasis parameters and other clinical features in aa patients . previously , yilmaz et al . and dumlu et al .
to the best of our knowledge , this is the first study that investigated thiol / disulphide homeostasis as a novel marker of oxidative stress in patients with aa and compared the results with healthy controls . in our study
, we demonstrated that the levels of native thiol and total thiol and the native thiol / total thiol ratio are lower in patients with aa as compared to healthy individuals .
besides , we also demonstrated for the first time that disulphide level and disulphide / native thiol and disulphide / total thiol ratios , all of which are formed as a result of thiol oxidation , are higher in patients with aa than in the healthy controls .
in other words , thiol / disulphide homeostasis was found to shift towards disulphide formation .
thiol / disulphide homeostasis parameters were similar as for the subgroup analysis of aa patients .
we assume that this situation shows the higher level of oxidative stress in perforated appendicitis patients compared to that of nonperforated appendicitis . in clinical practice ,
previous studies have shown that the greater the degree of appendicular inflammation , the greater the crp value , reaching maximum values in cases of perforation [ 5 , 7 ] .
similarly , our study has disclosed a significant increase in crp in appendicitis progressed to perforation .
furthermore , correlation analysis showed a negative correlation of crp with native thiol , total thiol , and native thiol / total thiol ratio , while a positive correlation of crp with disulphide / native thiol and disulphide / total thiol was noted . in the stepwise logistic regression analysis formed with risk factors
, it was determined that disulphide / native thiol and crp are independent predictors of perforated appendicitis .
therefore , with the results of this study , we can say that when the increase of disulphide / native thiol ratio due to severity of inflammation and its positive correlation are considered together , it is possible to conclude that disulphide / native thiol ratio could be related with progression and used as a marker of disease activity .
although plasma thiol / disulphide homeostasis parameters can not be used in the diagnosis of aa , a shifting towards disulphide in its value by time might be considered as a predictor of the progression of inflammation to the perforation in aa cases .
first , this was a pilot study representing an initial investigation into the relationship between aa and thiol / disulphide homeostasis parameters .
second is inclusion of relatively small number of patients who were admitted to a single center .
other diagnostic aids such as procalcitonin and imaging techniques such as ultrasonography and/or computed tomography and alvarado score have not been correlated with thiol / disulphide homeostasis parameters .
lastly , the plasma samples tested for the thiol / disulphide homeostasis were frozen and shipped to a single laboratory remote from our hospital rather than on - site using fresh plasma samples as would be done in clinical practice .
further longitudinal studies on a larger patient population are needed to determine whether alterations in thiol / disulphide homeostasis could be predictive risk factors for aa .
this study demonstrated that dynamic thiol / disulphide homeostasis shifted towards disulphide formation as a result of thiol oxidation in patients with aa .
prospective and randomized controlled trials are necessary to confirm the pathophysiologic role of thiol / disulphide homeostasis in aa .
further studies are required to optimize the use of this novel oxidative stress marker in conjunction with other established approaches . | aim . to investigate the role of a novel oxidative stress marker , thiol / disulphide homeostasis , in patients diagnosed with acute appendicitis ( aa )
. methods . in this study , seventy - one ( 43 male and 28 female ) patients diagnosed with aa and 71 ( 30 male and 41 female ) healthy volunteers were included .
age , gender , body mass index ( bmi ) , haemoglobin ( hb ) , white blood cell ( wbc ) , c - reactive protein ( crp ) , and thiol / disulphide homeostasis parameters ( native thiol , total thiol , disulphide , disulphide / native thiol , native thiol / total thiol , and disulphide / total thiol ratios ) were compared between the groups .
thiol / disulphide homeostasis was determined by a newly developed method by erel and neselioglu .
results .
the native thiol , total thiol , and the native thiol / total thiol ratio levels were statistically significantly decreased in the aa compared with the control group ( p < 0.001 ) .
disulphide level and the ratios of disulphide / native thiol and disulphide / total thiol were higher in the aa group than in the control group ( p < 0.001 ) .
there was a negative correlation of crp with native thiol , total thiol , and native thiol / total thiol ratio while there was a positive correlation of crp with disulphide / native thiol and disulphide / total thiol in the aa group .
in the stepwise regression model , risk factors as disulphide / native thiol ( or = 1.368 ; p = 0.018 ) and crp ( or = 1.635 ; p = 0.003 ) were determined as predictors of perforated appendicitis compared to the nonperforated group .
conclusion .
this is the first study examining the thiol / disulphide homeostasis as a diagnostic aid in aa and establishing thiol / disulphide homeostatis balance shifted towards the disulphide formation due to thiol oxidation .
further studies are needed to optimize the use of this novel oxidative stress marker in aa . |
diabetes is rising globally , with the prevalence of type 2 diabetes ( t2d ) especially starting to reach epidemic proportions . the metabolic abnormalities that characterize t2d
moreover , individuals with t2d have an increased risk of developing cardiovascular diseases and higher cardiovascular mortality rates compared with individuals without t2d . despite the advances in antidiabetic treatments ,
effective glycemic control is not always achieved in patients and cardiovascular benefits of treatments are not always demonstrated . to address the need for antidiabetic treatments that are effective against both underlying pathology in t2d and associated cardiovascular complications , studies testing novel drug candidates require a predictive and translational animal model which closely represents the disease pathology . in the pancreas , glucokinase ( gk )
determines the rate of glucose - stimulated insulin secretion ( gsis ) , whereas in the liver the rates of glucose utilization and glycogen synthesis are regulated by the gk activity .
thus , gk plays a critical role in the regulation of blood glucose by acting as the glucose sensor in both pancreas and liver [ 4 , 5 ] . in humans ,
heterozygous point mutations in the glucokinase ( gk ) gene result in reduced enzymatic activity and decreased insulin secretion , causing maturity onset diabetes of the young ( mody ) with early - onset and persistent hyperglycemia .
reduced gk activity has been suggested to contribute to impaired insulin secretion , as well as to the abnormalities in hepatic glucose balance in humans with t2d [ 710 ] .
animal models of gk depletion have been developed in the past , but with limited success .
-cell specific gk knockout is lethal ; therefore , a nonleptin dependent global heterozygous depletion of glucokinase gene was generated at astrazeneca : a model that has proven responsive to standard - of - care antidiabetic agents like metformin , sitagliptin , exendin , glipizide , and gk activators .
this heterozygous glucokinase knockout ( gk ) mouse model has a global disruption of one allele for the gk gene , causing decreased gk activity in both pancreas and liver and leading to reduced insulin secretion and elevated blood glucose levels .
the gk mice were recently shown to back - translate the effects of various standard - of - care antidiabetic agents with different mechanism of actions at clinically translatable free - drug exposure levels .
additionally , these authors also showed that , due to the stability of its diabetic phenotype , the gk mouse can be used for long - term safety studies of novel glucose - lowering agents .
these characteristics make the gk mouse an attractive model to be used in drug development programs for new antidiabetic agents . in order to develop a diabetic atherosclerotic mouse model with characteristics that closely resemble the human t2d driven cardiovascular disease ,
we cross - bred the above - mentioned mouse model ( gk ) into an apolipoprotein e ( apoe ) deficient background , to derive a heterozygous glucokinase and apolipoprotein e - knockout mouse ( gkapoe ) . in this study
, we describe the generation of the gkapoe mice and characterize their phenotypes , diabetic as well as lipid .
in addition , the progression and regression of the atherosclerotic disease process were compared with nondiabetic apoe mice .
the main goal was to accomplish a model that would be suitable for the evaluation of combined t2d and cardiovascular endpoints in drug development .
animal care and experiments conform to the directive 2010/63/eu of the european parliament on the guidelines for the protection of animals used for scientific purposes and were approved by the regional animal ethics committee for experimental animals , university of gothenburg .
mice deficient in apolipoprotein e ( apoe ) on the c57bl/6n background ( astrazeneca , sweden ) were crossed with c57bl/6j mice with a global deletion in one glucokinase allele ( gk ) .
detailed description of the generation of the gk was given in a previously published article .
gkapoe colony was maintained by backcrossing to apoe mice and thus the gkapoe mice gradually acquired a complete c57bl/6n genetic background .
apoe deficient ( apoe ) littermates with functional gk were used as controls in all experiments .
male mice were housed individually and female mice in groups of five in rooms with regulated temperature , humidity , and a 12 hours ' light - dark cycle ( lights off 19:00 ) .
they had free access to normal chow diet ( r3 ; lactamin ab , kimstad , sweden ) and water , unless stated otherwise in substudies .
mice were sacrificed during anesthesia with 5% isoflurane , following blood withdrawal from left ventricle .
the effect of high - fat western diet ( wd ) ( r638 ; lactamin ab , kimstad , sweden ) on the diabetic phenotype of the gkapoe mice was investigated in 10 male and 10 female gkapoe mice compared with the sex matched wild - type apoe mice ( n = 20 ) .
basal levels of blood glucose and insulin were measured in the mice which were fed normal chow diet before starting the wd ( figure 1(a ) ) .
blood glucose was measured after 4-hour fasting at 4 , 8 , and 14 and 21 weeks after starting wd , using a hand - held accu - chek glucose monitor glucometer ( accu - chek , roche diagnostics , mannheim , germany ) in the awake mice . at the same time points , a blood sample of ~20 l
were examined by performing a tolerance test in the gkapoe mice and the apoe mice for comparison after 14 weeks on wd .
oral glucose tolerance tests ( ogtt ) were performed at 13:00 hour after 4-hour fasting by an oral administration of glucose ( 2 g / kg ) and 1520 l blood was drawn from the tail vein at 0 ( right before the dosing ) , 15 , 30 , 60 , and 120 min for the measurement of glucose ( 2 l , accu - chek , roche diagnostics , mannheim , germany ) and insulin ( 2 5 l , ultra - sensitive mouse insulin elisa kit , crystal chemical , downers grove , il ) levels . area under the curve ( auc ) values were calculated for glucose and insulin as total area under the curve and corrected for differences in baseline values .
plasma insulin levels were measured with a radioimmunoassay ( sri-13k , millipore corporation , usa ) on a 1470 automatic gamma counter ( perkinelmer , usa ) .
whole blood insulin was measured with an elisa kit ( ultra - sensitive mouse insulin elisa kit ; crystal chem , downers grove , il ) . to investigate atherosclerosis progression on different high - fat diets , gkapoe mice and apoe males and females ( n = 10/gender / genotype )
were switched from normal chow diet to lard diet ( 821424 ; 21% fat from pork lard , 0.15% cholesterol ; special diets services , essex , uk ) for 14 weeks , or western diet ( wd ) ( r638 ; 21% fat / cocoa butter , 0.15% cholesterol ; lantmnnen , kimstad , sweden ) for 23 weeks ( figure 1(b ) ) .
cholesterol was measured at 3 and 7 weeks after diet commenced and at termination ( 14 weeks in the lard diet group and 23 weeks in the wd group ) .
in addition , to investigate atherosclerosis regression , 18-week - old gkapoe and apoe males and females ( n = 10/gender / genotype ) were first transferred from chow to lard diet ( 821424 ; 21% fat from pork lard , 0.15% cholesterol ; special diets services , essex , uk ) for 9 weeks to establish atherosclerotic lesions and then split into two groups ( 1 ) chow diet and ( 2 ) wd for 14 weeks ( figure 1(c ) ) .
animals were allocated to the different diet intervention groups by randomization based on plaque size in the brachiocephalic artery ( bca ) measured by noninvasive ultrasound imaging .
blood samples during the study were drawn from the saphenous vein and by cardiac puncture at termination , placed into minicollect k3e edta tubes ( greiner bio - one gmbh , kremsmnster , austria ) on ice , and centrifuged ( 2800 rpm , 4c , 10 min ) .
plasma lipid concentrations were measured using enzymatic colorimetric methods ( total cholesterol : kit number a11a01634 , horiba abx , france ; triglycerides : kit number 12146029 , roche diagnostics gmbh , germany ; nonesterified fatty acids : nefa - hr ( 2 ) assay , 434 - 91795 and 436 - 91995 , wako chemicals gmbh , germany ) .
heart , bca , and thoracic aorta were dissected out and fixed in 4% phosphate - buffered formaldehyde ( number 02176 , histolab products , gothenburg , sweden ) .
thoracic aortas were cleaned from the adventitia and opened longitudinally and macroscopic lesions were quantified en face and photographed and images were imported into biopix iq 2.1.8 image analysis system ( biopix ab , gothenburg , sweden ) which was used for quantification .
samples of aortic sinus , ascending aorta , and bca were embedded in paraffin and serial 4 m sections were cut ( histocenter , gothenburg , sweden ) .
sections were either stained with conventional stains ( hematoxylin - eosin , miller 's elastin , or picrosirius red ; histocenter , gothenburg , sweden ) or immunostained for smooth muscle cells ( -actin , 1 : 100 , clone 1a4 , dako , m0851 ) or macrophages ( mac-2 , 1 : 10000 , clone m3/38 , cl8942ap , cedarlane ) using dab ( bc - bdb2004 , biocare ) as the chromogen .
immunostaining was performed as single or dual stain using an automated stainer ( intellipath , biocare ) .
slides were then scanned in an automated slide scanner ( mirax scan , zeiss ) and images were analyzed with biopix iq 2.1.8 image analysis system ( biopix ab , gothenburg , sweden ) . plaque area and area of positive staining were measured .
transthoracic echocardiography was performed using noninvasive high - frequency ultrasound imaging in the atherosclerosis regression study on 18-week - old gkapoe and apoe female mice to characterize coronary vascular function .
england ) in a closed chamber with 3% isoflurane in oxygen for 2 to 5 minutes until immobile and 1.01.5% isoflurane in oxygen during the examination .
each mouse was placed supine on a heated procedure board with isoflurane initially at 1.5% supplied by a nose cone connected to the anesthesia vaporizer .
chest hair was removed with chemical cream ( veet , reckitt benckiser , uk ) .
imaging was done with a high - resolution ultrasound scanner ( vevo 770 , visualsonics inc . ,
toronto , canada ) using a 40 mhz mechanical transducer with a focal depth of 6 mm .
isoflurane was reduced to 1% to lower coronary flow to a baseline level and velocity profile in the left coronary artery was measured in a modified long - axis view , recorded with a pulsed - wave doppler for 3 minutes to ensure stable signal was achieved , after which signals were collected and stored .
isoflurane level was then increased to 2.5% to increase the coronary flow , and velocity profile was monitored for up to 4 minutes during which time signals were stored for offline analysis of maximum hyperemic response .
plaque size and cfvr analysis were measured offline ( vevo770 software , visualsonics inc . ,
cfvr was calculated as the ratio of peak diastolic flow velocities at baseline obtained using 1% isoflurane and during hyperemia obtained using 2.5% isoflurane ( cfvr = hyperemic coronary flow velocity / basal coronary flow velocity ) . to detect a 20% difference in blood glucose at p < 0.05 with 80% power
however , since detecting differences in atherosclerosis requires bigger group sizes due to expected larger variation , group sizes were n = 10 .
statistical significance was evaluated using 1-sided ( blood glucose , plaque size , en face lesion area ) or 2-sided ( body weight , insulin , cholesterol , and triglyceride ( tg ) ) student 's t - test .
significant statistical difference was considered at p < 0.05 . for the ogtt , anova of repeated measures and tukey 's correction for multiple comparisons
all statistical analyses were performed using graphpad prism version 6.01 ( graphpad prism version 6.01 for windows , graphpad software , la jolla , california , usa ) .
there were gender differences in the genotypes , where gkapoe males have a higher body weight compared with the apoe males after 21 weeks on wd .
conversely , apoe females have a higher body weight from baseline on chow diet and maintained the weight difference on wd compared with gkapoe female mice ( figure 2 ) . on chow diet ,
the gkapoe mice displayed significantly higher fasting blood glucose levels ( 15.2 0.6 mmol / l in males and 12.2 0.6 mmol / l in females ) , compared to the normoglycemic apoe controls ( 8.3 0.3 mmol / l and 8.1 0.4 mmol / l in males and females , resp . ) ( figure 3 ) .
when challenged with wd , the glucose levels increased steadily to a 30% higher level in the gkapoe mice ( 19.8 0.4 mmol / l , p < 0.0001 , in males and 15.9 0.6 mmol / l , p = 0.0001 , in females ) .
in apoe controls a significant 18% increase was seen in male mice ( 9.8 0.6 mmol / l , p < 0.05 ) , whereas in females the change was smaller and not statistically significant ( 15% , 9.3 0.5 mmol / l , p = 0.1266 ) . in an oral glucose tolerance test performed after 14 weeks on wd ( figure 4 ) , gkapoe mice showed significant glucose intolerance with 2.3-fold increased aucglucose ( figure 4(b ) ) and impaired gsis with aucinsulin reduced by 49% and 27% ( in males and females , resp . )
defective gsis was reflected also in basal insulin values , which in general tended to be lower in the gkapoe than apoe mice ( figure 4(c ) ) . in the atheroprogression and atheroregression studies ,
hyperglycemia was very stable and more profound in gkapoe mice compared to apoe mice ( data not presented ) .
reduction in the gk function did not affect total plasma cholesterol or triglyceride levels ( table 1 ) .
in general , cholesterol levels were higher on lard diet compared with wd in both genotypes already after 3 weeks .
gkapoe male mice have a trend for lower cholesterol from study start and show a declining tendency with time .
the triglyceride levels were stable in gkapoe mice despite different diets , and there was a trend for lower values in gkapoe mice compared to apoe mice ( table 1 ) . priming with lard diet for 9 weeks in
the atherosclerosis regression study induced a 3-fold increase in total cholesterol and these levels remained the same after changing to wd with a similar cholesterol content ( 0.15% ) . on the contrary , after switching from lard to chow diet , the total cholesterol levels decreased significantly ( 4355% ) in all groups .
on wd , in the bca the female gkapoe had the largest plaques ( 230112 20124 ) versus female apoe ( 188057 15816 ) p = 0.0587 ( figure 5(a ) ) . in the ascending aorta
, there was a trend for gkapoe mice to have larger lesions with less variability compared with apoe ( figure 5(b ) ) .
however , statistically significant difference was seen only with female mice on lard diet ( gkapoe versus apoe , 2602000 403800 versus 1355000 297600 , p = 0.0115 ) ( males on lard : gkapoe versus apoe 4284000 615660 versus 3201000 465241 , p = 0.0858 ) . on lard diet , there was also a trend in bca for female gkapoe to have the largest plaque ( 228298 22675 ) versus female apoe ( 190804 16158 ) , p = 0.0974 .
there were no statistically significant differences in plaque size in the brachiocephalic artery ( wd 220188 12279 versus 199578 9759 , lard 264854 28916 versus 286013 23494 ) on either high - fat diets for the male group ( gkapoe versus apoe ) .
lesion was equally advanced in the brachiocephalic artery in the two strains illustrated in figure 6 . despite lower plasma cholesterol levels in both males and females
gkapoe and apoe mice after dietary change ( lard to chow diet ) compared with the lard to wd ( figure 7(a ) ) , plaque size in the brachiocephalic artery ( figure 7(b ) ) and in the aortic sinus ( figure 7(c ) ) remained comparable .
in other vascular sites , there was also impaired lesion regression ( en face lesion area in thoracic aorta , ascending aorta , and left coronary artery ) ( data not presented ) .
basal flow velocity and hyperemic flow velocity ( cm / s ) were not significantly different in either genotype .
furthermore , cfvr was not significantly different between apoe and gkapoe at 18 weeks of age ( table 2 ) .
the present study characterized heterozygous glucokinase knockout apolipoprotein e deficient mice ( gkapoe ) , a novel mouse model of diabetes and atherosclerosis . we demonstrate that this mouse model has very stable hyperglycemia , indications of increased atherosclerosis development on high - fat diet , and impaired lesion regression after lipid lowering .
the atherosclerosis is stable on wd and the gkapoe knockout shows comparable coronary vascular function to the apolipoprotein e ( apoe ) deficient mice at 18 weeks of age . for a rodent model to be considered t2d model , fasting blood glucose levels of around 150300
our model has glucose levels which exceed the minimum threshold and should therefore be considered as a diabetic model .
there are other commonly used animal models of t2d ( leptin - mutated ob / ob , leptin - receptor deficient db / db mice , and male missense mutated leptin - receptor zucker diabetic fatty ( zdf ) rats ) ; however , they have a wide but unstable hyperglycemic range [ 12 , 17 ] . in the fasted state ,
insulin levels were similar between the gkapoe knockout mice and the apoe mice despite higher glucose levels in the gkapoe .
higher glucose levels in the gkapoe would be expected to result in even higher insulin levels .
this however was not the case , indicating that the hyperglycemia in the gkapoe knockout mice is predominantly due to inadequate compensatory insulin secretory response , possibly as a result of impaired -cell function , an important determinant of type 2 diabetes [ 18 , 19 ] .
insulin level measurement is an acceptable measure to indicate -cell function in rodent models ; our findings are consistent with insulin response pattern in humans with advanced type 2 diabetes , where there is an insufficient insulin secretion to meet demand .
the gk mouse model has been suggested to be a representative model of type 2 diabetes , which encompasses both the hepatic and the -cell gk deficiencies found to occur in the disease . on a high - fat diet
, the gk mouse has reduced islet gk activity and defects in glucose - stimulated insulin secretion [ 11 , 21 ] ; our current diabetic phenotype data on gkapoe knockout mice are comparable to those previously published on the gk by above - mentioned authors .
this indicates that the hepatic and the -cell gk deficiencies in the parent gk mice when cross - breed with the apoe were transferred to the offspring gkapoe knockout mice .
plasma lipid levels were comparable between the gkapoe and the apoe mice , but nevertheless the gkapoe mice showed slightly higher plaque burden in line with atherosclerotic progression in human t2d , as well as impaired lesion regression at different vascular sites . even though the plaque burden is slightly higher in the gkapoe compared to the apoe
there are only few detectable macrophages and thin protecting caps , if any . on the other hand ,
both genotypes have necrotic cores , cholesterol clefts , buried caps , and layered phenotype , hallmarks of complicated mice lesions .
several clinical studies have shown in populations with atherosclerosis that dietary intervention may reduce the progression of the atherosclerotic plaque development [ 25 , 26 ] and regression mediated by weight loss may even occur . furthermore , there are also data suggesting that coronary atherosclerosis may be regressed by diet and comprehensive lifestyle changes [ 28 , 29 ] . for studies using animal models to investigate treatments targeting cardiovascular disease in diabetes ,
this mouse model showed comparable coronary vascular function to the apolipoprotein e ( apoe ) deficient mice at 18 weeks of age .
although there were no significant differences between the gkapoe and the apoe mice for coronary vascular function , values presented here for basal flow velocity and cfvr measured in both genotypes are higher and lower , respectively , when compared to published data for c57bl/6j - lep and age matched lean litter mates ( + / ? ) of comparable age .
furthermore , in a study by hartley et al . , they showed that old apoe ( 2 years of age ) mice have a higher baseline flow velocity and lower cfvr when compared to the apoe wild - type mice of similar age , which is in agreement with our findings .
baseline coronary flow is based on cardiac metabolic demand ( hemoglobin content , oxygen saturation , and baseline hemodynamics ) [ 31 , 32 ] , and it is reasonable to assume that the high blood glucose and cholesterol in the gkapoe and the apoe mice will negatively influence their hemoglobin content , thereby increasing metabolic demand reflected by higher basal flow velocity .
correlation between cfvr and coronary atherosclerosis has been shown in mice ; furthermore , cfvr is reduced in atherosclerotic mice [ 32 , 33 ] . in agreement , we observed low cfvr values in our mice model at 18 weeks of age and comparable plaque burden in the gkapoe and the apoe mice , supporting the lack of difference in the cfvr between the strains and emphasizing macrovascular burden to underlie the coronary vascular dysfunction . in man , cfvr is used to evaluate the severity of different cardiac pathologies and values ranging from 2.5 to 5.0 have been reported , with > 3.0 used as the lower limit of normal .
validation studies on the gkapoe are currently ongoing within our lab to characterize changes in coronary vascular function over time ( mice from 6 weeks of age ) using ultrasonography and to investigate effect of lipid lowering and standard - of - care treatments for diabetes .
the strength of the gkapoe mice lies in that it has stable hyperglycemia , and diabetes is not progressive .
this makes it possible to use either young or old mice to carry out short or long studies without the disease phenotype changing with age .
the zdf rats and ob / ob or db / db mice have limited age window for treatments due to rapid disease progression and large variability , which requires large group sizes . these other rodent models of t2d ( zdf rats and ob / ob or db / db mice ) are monogenic models of obesity which induces hyperglycemia , which weakens their translational value as obesity is seldom caused by a monogenic mutation [ 17 , 20 ] .
diabetes induced by streptozotocin ( stz ) provides a nonphysiological model , with variation dependent on stz dose and sometimes severe adverse effect on rodents . in the relatively long period of monitoring the gkapoe ( up to 21 weeks ) ,
this makes the gkapoe model suitable for investigations related to the combination of diabetes and atherosclerosis . for decades
however , after observations of increased cardiovascular risk with some medications , the regulatory agencies now demand studies showing that novel antidiabetic agents are at least neutral in their cardiovascular effects .
although these new regulatory requirements as such apply only for clinical trials , they affect also preclinical research , as more accurate prediction of the cardiovascular effects is warranted . secondly , instead of aiming just for cardiovascular neutrality , the future medical treatments will favor compounds that have beneficial cardiovascular effects in addition to their antidiabetic action ( multifunctional compounds with hypolipidemic and antidiabetic action ) .
therefore , we need pharmacokinetic : pharmacodynamics ( pk / pd ) models , where both metabolic and cardiovascular endpoints can be studied in one and the same animal .
the animal model has a stable hyperglycemic phenotype that is very reproducible from batch to batch , and there is little variation so that relatively small group sizes can be used .
diabetes does not cause increases in lipid levels , which is unlike most of the other used diabetes models .
the etiology is rather relevant , since individuals with t2d exhibit high rates of hepatic glucose output and have reduced gk activity in liver and pancreas .
these mice do not have any special health problems , so they are easy to breed and use in short- or long - term studies .
the lipid profile is a negative against this model , since the apoe mice are a remnant model and thus do not resemble much the human lipoprotein profile and lack also all the other functions of apoe . reviewing the lipid levels
moreover , the diabetic gkapoe mice have a bit lower cholesterol and tg levels , which can be due to reduced gk activity in the liver and thus reduced lipogenesis .
this is an important feature , since normally when diabetes is induced in mice , for example , with stz or by crossing db / db mice with dyslipidemic strains , the lipid levels increase significantly and as a result supraphysiological lipid levels that easily overrun all other factors .
we conclude that , compared to normoglycemic apoe mice , the gkapoe mice showed a stable and reproducible hyperglycemia , which induced accelerated atherosclerotic lesion progression as well as impaired lesion regression after lipid lowering .
this novel model provides a promising tool for drug discovery , enabling the evaluation of compound effects against both diabetic and cardiovascular endpoints simultaneously in one animal model . | aim . models combining diabetes and atherosclerosis are important in evaluating the cardiovascular ( cv ) effects and safety of antidiabetes drugs in the development of treatments targeting cv complications .
our aim was to evaluate if crossing the heterozygous glucokinase knockout mouse ( gk+/ ) and hyperlipidemic mouse deficient in apolipoprotein e ( apoe/ ) will generate a disease model exhibiting a diabetic and macrovascular phenotype .
methods .
the effects of defective glucokinase on the glucose metabolism and on the progression and regression of atherosclerosis on high - fat diets were studied in both genders of gk+/apoe/ and apoe/ mice .
coronary vascular function of the female gk+/apoe/ and apoe/ mice was also investigated .
results .
gk+/apoe/ mice show a stable hyperglycemia which was increased on western diet . in oral glucose tolerance test
, gk+/apoe/ mice showed significant glucose intolerance and impaired glucose - stimulated insulin secretion .
plasma lipids were comparable with apoe/ mice ; nevertheless the gk+/apoe/ mice showed slightly increased atherosclerosis development .
conclusions .
the gk+/apoe/ mice showed a stable and reproducible hyperglycemia , accelerated atherosclerotic lesion progression , and no lesion regression after lipid lowering .
this novel model provides a promising tool for drug discovery , enabling the evaluation of compound effects against both diabetic and cardiovascular endpoints simultaneously in one animal model . |
cervical total disc replacement ( ctdr ) was first introduced in europe in the late 1990s .
subsequently , three prospective , randomized food and drug administration ( fda ) regulated investigational device exemption ( ide ) trials were initiated in the us dating back to 2000 .
these initial ide studies ultimately led to the first three fda approvals for ctdr devices in the us , prestige st ( medtronic- 541 patients , 32 sites ) ( 2007 ) , prodisc - c ( depuy synthes- 209 patients , 13 sites ) ( 2008 ) and bryan disc ( medtronic- 463 patients , 30 sites ) ( 2009 ) , for the treatment of 1-level cervical spondylosis from c3 - 7 .
there have been an additional three fda approvals , secure - c ( globus medical- 380 patients , 18 sites ) , pcm ( nuvasive- 342 patients , 24 sites ) ( 2012 ) and mobi - c ( ldr- 1level : 260 patients , 24 sites ; 2 level : 339 patients ) ( 2013 ) .
there has also been a new indication as mobi - c was also approved for treatment of two - level cervical spondylosis c3 - 7 . all the us fda ide trials compared ctdr devices to standard anterior discectomy and fusion ( acdf ) in prospective and randomized studies producing level 1 data .
as with all industry - sponsored studies , bias , both investigator and patient related , is a concern .
this concern was somewhat mitigated by the fact that these ide studies have cumulatively involved over 2,500 patients at over 100 study sites ( table 1 ) .
furthermore , these studies utilized similar validated outcome measures including neck disability index ( ndi ) , visual analog scale ( vas ) and sf-36 .
acdf is an established surgical procedure with a well - documented safety and efficacy dating back 60 years .
cervical arthroplasty offers some theoretical advantages over acdf .. acdf results in loss of motion at the index level(s ) , placing increased stress on adjacent levels above and below the fusion .
there is a documented incidence of clinically symptomatic adjacent - level disc disease following acdf ranging from 0.5 - 3% annually .
hilibrand et al . reported a rate of symptomatic adjacent - level degeneration following acdf of 2.9% annually , although the rate of adjacent level re- operation was only 0.7% per year .
similarly , robertson and associates reported a symptomatic adjacent - segment degenerative disc disease rate of 7% in the anterior fusion series . by preserving motion at the operated level , ctdr has the potential to positively affect the occurrence of adjacent segment degeneration . fda - approved ctdr devices with number of patients enrolled in pivotal ide study . in order to establish an evidence based rationale for ctdr as a viable therapeutic modality in the treatment of cervical radiculopathy
they must show clinical efficacy and safety through the regulatory ide process and receive the appropriate regulatory approval .
additionally , cervical arthroplasty must validate that the technique maintains segmental motion with concomitant decreased adjacent level stresses compared to acdf .
furthermore , the results of multi - center controlled studies should be replicated at individual centers .
intermediate term data should reaffirm safety and efficacy beyond the two year follow - up mandated by fda ide process . once accepted as reasonable treatment option
, long - term data should be utilized to refine ideal indications for that procedure .
the results of seven different prospective , randomized studies have been published in peer - reviewed literature .
these studies , comparing ctdr to standard anterior cervical discectomy and fusion ( acdf ) , have shown positive results for ctdr leading to six different fda approvals . although the statistical design of these studies was non - inferiority . on numerous clinical end - points , artificial discs were found to be statistically superior to fusion .
mummaneni and colleagues showed statistically significant higher neurological success for the prestige st artificial disc .
heller et al and coric et al documented statistically significant greater overall composite success rates for bryan and kineflexc , respectively .
davis and associates reported statistically superior overall success for 2-level surgery with mobi - c .
murrey and associates reported statistically significant decrease in secondary surgeries following prodisc - c placement .
vaccarro et al showed statistically superiority in favor of secure - c in terms of overall success , secondary surgery as well as patient satisfaction .
phillips et al reported statistically significant lower ndi scores and dysphagia rates as well as higher patient satisfaction for pcm .
the following ctdr devices showed greater composite overall success ( prestige st 79% vs 68% ; prodisc - c 72% vs 68% ; bryan 83% vs 73% ; kineflexc 85% vs 71% ; secure - c 84% vs 73% ; pcm 75% vs 65% ; mobi - c 1-level 74% vs 65% , 2-level 70% vs 37%)(table 2 ) .
range of motion data from the ide studies confirm that cervical arthroplasty devices maintain segmental motion ( in degrees ) at the treated level : prestige st ( 7.7 ) , bryan ( 6.5 ) , prodisc - c ( 8.4 ) , kineflexc ( 9.8 ) , secure - c ( 9.7 ) , pcm ( 5.7 ) , mobi - c 1-level ( 10.8 ) and 2-level ( 10.1 , 8.3 ) ( table 3 ) .
the results of these multi - center studies have been replicated with single center results .
coric demonstrated statistically higher overall success rates from a single institution utilizing three different ctdr devices .
jawahar also combined data from three separate ctdr devices and reported clinical equivalence between arthroplasty and fusion , but no change in adjacent level disease at two years .
garrido reported long - term outcomes for the bryan disc from a single site which favored ctdr on ndi , vas and fewer additional surgeries .
level 2 and 3 data from single sites outside the united states ( ous ) have also shown positive clinical results .
goffin and kim reported safety and efficacy with 1- and 2-level cervical arthroplasty using the bryan disc .
bertagnoli and beuurain also showed good results with prodisc - c and mobi - c , respectively , at two year follow - up .
intermediate and long - term follow - up studies , ranging from 4- to10-years , have also been published .
burkus and associates reported statistically higher rate of disability ( ndi ) improvement at 3- and 5-years for ctdr with prestige st .
they also showed a statistically lower rate of index level surgery for ctdr at 5-years .
similarly , delamarter et al reported a statistically higher rate of vas satisfaction at all time points out to 4-year follow - up for prodisc - c ctdr over acdf .
they also reported a statistically lower rate of index level surgery for ctdr at four years .
quan reported eight - year outcomes on the bryan disc using odom criteria and showed good / excellent results in 90% of patients .
coric et al reported that in both ctdr and acdf groups , the mean ndi and vas scores improved significantly by 6 weeks and remained significantly improved from 4- to 8-year follow - up .
there is considerably less literature examining the use of cervical arthroplasty for multi- level cervical spondylosis .
several studies have reported positive results for ctdr in patients with 2-level disease . as previously discussed , davis et al reported level 1 data from the prospective , randomized ide study comparing 2-level ctdr with mobi- c compared to 2-level acdf .
these authors reported dramatically improved overall success with arthroplasty ( 70% versus 37% ) over fusion .
bartels et al published a meta - analysis of six peer - reviewed articles and three meeting abstracts .
these authors reported statistically superior results for ctdr in pain ( vas ) and function ( sf-36 ) at 12 months and disability ( ndi ) at 24 months , yet concluded that there was no proven clinical benefit for arthroplasty .
mcafee and associates combined the results of four separate ide studies and reported statistical superiority for overall success , neurologic success and survivorship success for ctdr .
upadhyaya and co - authors combined the completed data sets from the first 3 fda - approved ctdr devices and reported statistically significantly lower reoperation rate for adjacent level disease as well as superior neurological success .
it is well understood that fusion sacrifices motion at the index level and places stresses on adjacent levels .
adjacent level disease is likely a multifactorial process involving several disparate factors including natural history of the underlying disease process ( spondylosis ) , surgical technique , patient selection and type of instrumentation employed .
it is also well established that arthroplasty maintains motion decreases adjacent level stress compared to fusion .
it is important to differentiate between adjacent level degeneration ( deterioration above or below the operative level evident on radiographic imaging ) and adjacent level disease ( clinically symptoms attributable to a level above or below the operative level ) . the only level 1 studies to document statistically significant decrease in adjacent level disease for cervical arthroplasty are the previously discussed meta - analysis papers by mcafee and upadhyaya
. a decreased rate of adjacent deterioration from the ide studies in favor of arthroplasty devices was reported by coric ( 9% vs 25% ) , davis(11% vs 23% ) and vaccarro .
kim and associates also reported decreased degenerative change in patients treated with the bryan artificial disc .
there are several unique complications associated with ctdr devices including subsidence / dislocation , wear debris / osteolysis and heterotopic ossification .
the published results of ide studies generally show low rates of reoperation with the majority of these related to persistent neck pain without device failure .
the rate of bridging heterotopic bone across these studies was also low , ranging from 0 - 3% .
the safety and efficacy of cervical arthroplasty has been established with a growing body of level 1 evidence that is compelling enough to no longer consider ctdr investigational .
this evidence is bolstered by experience with multiple devices , at multiple sites , in and out of the investigational setting and with short- , intermediate- and long - term follow - up .
ctdr is a viable alternative to acdf in select patients with symptomatic 1- and 2-level cervical radiculopathy or myelopathy ( table 4 ) .
clinically symptomatic cervical radiculopathy and/or myelopathy due to neural compression c3-c7 at one - level or two contiguous levels failed at least 6 weeks of nonsurgical treatment or shows signs of progressively clinical deterioration intractable radiculopathy ( arm pain and/or a neurological deficit ) with or without associated neck pain myelopathy ( due to abnormality localized to the level of the disc space )
dr . coric is a consultant to pioneer surgical , medtronic , globus medical , spine motion , & spine wave . | morgan lorio , md , facs , chair , isass task force on coding & reimbursementthe isass task force reached out to domagoj coric , md to provide a timely summation on cervical disc arthroplasty given his special interest and recent iasp championship of this innovative technology to insure enhanced spine patient access .
the isass task force is pleased with this step towards published isass societal policy and applauds dr .
coric 's effort ; if isass is to continue to succeed we must continually harness the voluntary talents and energies of our members with gratitude . |
many deleterious mutations may then be harmless , because even if one gene suffers a mutation , the redundant gene copy can provide a back - up function .
put differently , after gene duplication - which can arise through polyploidization ( whole - genome duplication ) , non - homologous recombination , or through the action of retrotransposons - one or both duplicates should experience relaxed selective constraints that result in elevated rates of evolution .
this hypothesis originated as least as early as ohno 's seminal book , which emphasized the importance of gene duplications in organismal evolution .
but for decades any test of the hypothesis had to rely on small numbers of gene duplicates ; doubts thus remained over whether conclusions derived from such case studies were representative of all genes in a genome .
such sequence information can address not only this question but also many others related to the influence of selection on gene families .
for instance , does one duplicate evolve faster and thus acquire new functions more rapidly than the other ?
? and how frequent is gene conversion of duplicate genes , in which recombination and dna repair between very similar genes convert the sequence of one to that of the other ?
to address such questions , one can use nucleotide alignments of duplicates to calculate two key parameters of molecular evolution : the fractions per nucleotide site , first , of synonymous ( silent ) nucleotide substitutions , and ks , second , of non - synonymous nucleotide substitutions ( which change the encoded amino acid ) , ka ( see box 1 ) . the ratio ka / ks provides a measure of the selection pressure to which a gene pair is subject .
if a duplicate gene pair shows a ka / ks ratio of about 1 , that is , if amino - acid replacement substitutions occur at the same rate as synonymous substitutions , then few or no amino - acid replacement substitutions have been eliminated since the gene duplication . in other words ,
the gene pair is said to be under ' purifying selection ' if ka / ks <
1 : some replacement substitutions have been purged by natural selection , presumably because of their deleterious ratio is , the greater the effects .
the smaller the ka / ks number of eliminated substitutions and the greater the selective constraint under which the two genes have evolved .
the converse case , ka / ks > 1 , indicates that replacement substitutions occur at a rate higher than expected by chance alone , so advantageous mutations have occurred in the evolution of the two duplicates .
two recent studies analyzed these ratios in multiple fully sequenced and several partially sequenced genomes .
even very closely related gene duplicates , no older than a few million years , experience selective constraints - the ratio ka / ks is smaller than one even in these cases .
recent duplicates appear to tolerate more replacement amino - acid substitutions than older duplicates , however . for duplicates that differ at less than 5% of synonymous sites , between one in two and one in three substitutions are amino - acid replacement substitutions . for old duplicates
, this number falls to between one in ten and one in twenty replacement substitutions .
even a fine - grained statistical model that allows for differences in ka / ks among young and old duplicates may explain only 50% of the variance in evolutionary rates .
in addition , there may be species - specific differences in ka / ks , but detection of such differences is sensitive to how information on gene duplicates is extracted from genomes and on how ka and ks are estimated .
for example , one of the above studies suggests that recent mammalian duplicates ( ka / ks = 0.45 for genes with ks between 0.05 and 0.5 ) appear to be under lower selective constraints than recent duplicates of drosophila melanogaster , caenorhabditis elegans , or arabidopsis thaliana , where ka / ks < 0.3 , whereas the other study suggests no such differences . to determine whether one duplicate evolves faster than the other , one can compare the sequences of both duplicates with that of a related but distant ' outgroup ' gene and determine whether one duplicate has diverged to a greater extent than the other .
for example , in bacteria and mammals fewer than 10% of duplicates seem to evolve at different rates .
in contrast , a recent study focusing on ancient zebrafish duplicates - most of them developmental genes - found that about 50% of duplicates differ in their rates of evolution . despite such differences ,
these results show that it is not generally the case that one duplicate ' holds down the fort ' , and retains the original function while the other can evolve freely .
tandemly duplicated genes are known to be subject to gene conversion events that homogenize their sequences . if rampant , gene conversion could substantially distort inferences of selection pressures after gene duplication .
one group of genes with extremely slow rates of evolution , the histone h3 genes , has received recent attention in this regard . with only three amino - acid differences between animal and plant histone h3 proteins , for example ,
if so , one would expect that values of ks between histone gene duplicates would be small - reflecting recent gene conversion - and not dramatically greater than values of ka . but in organisms ranging from fungi to mammals , ka and ks differ by as much as a factor of 60 between non - tandemly clustered histone h3 genes , so evolution by gene conversion is unlikely to be frequent in this family .
another study asked whether yeast ( saccharomyces cerevisiae ) gene duplicates show evidence of gene conversion .
part of the assay in this study was based on the observation that measures of codon - usage bias are strongly correlated with the rate of synonymous divergence of yeast genes ( because mutations in a highly expressed gene to a synonymous codon for which the respective transfer rna is rare are deleterious ) .
only 4 out of 160 yeast duplicates had a synonymous divergence ( ks ) less than expected on the basis of their codon - usage bias , showing that gene conversion is rare . in summary , although gene conversion is potentially rampant for some genes , it is most likely to be rare for the vast majority of genes
. perhaps the most difficult questions about the influence of selection after gene duplication is how frequently beneficial mutations occur .
large amounts of genome sequence information lend themselves to the establishment of databases that document the gene families that have elevated ka / ksratios .
mere sequence analysis will probably have a limited impact on answering this question , however , because finding genes with ka / ks > 1 is usually not quite enough to make a case for positive selection .
although a particular genome may contain many duplicates with ka / ks apparently above one , the observed difference from unity often does not withstand statistical scrutiny .
it does not , because positively selected amino - acid substitutions often occur only in a small region of the coding region , too small to be detectable by an elevated ka / ks ratio .
and several case studies suggest the existence of positive selection for individual gene families , including the opsin visual pigments , primate ribonuclease genes , and triosephosphate isomerases .
these studies also show that a strong case for positive selection generally requires integration of information on gene divergence , phylogeny , and protein structure and function . in summary ,
genome - scale surveys of gene duplication have the great merit of answering questions about molecular evolution without lingering doubts of statistical bias caused by small samples .
they can assess to what extent selection is relaxed after gene duplication , to what extent gene duplicates diverge at different rates , and how abundant gene conversion events are . but their biggest strength - providing summary information about thousands of gene pairs - is also their biggest weakness .
some questions , such as the abundance of beneficial mutations , generally require more information than a crude view of the whole genome can provide .
genome - scale surveys thus draw our attention to their own limitations , which call for an integration of a variety of approaches to understand genome evolution .
| immediately after a gene duplication event , the duplicate genes have redundant functions .
is natural selection therefore completely relaxed after duplication ?
does one gene evolve more rapidly than the other ?
several recent genome - wide studies have suggested that duplicate genes are always under purifying selection and do not always evolve at the same rate . |
pelvic organ prolapse ( pop ) is a major health concern that affects a number of women , especially the elderly female .
patients with severe pop usually have a combination of anatomic abnormalities , involving the anterior , posterior , apical vagina , and the uterus .
the incidence of women undergoing surgery becomes higher . over the past decades , the prevalence of recurrent rate 1 year after
facing the high recurrence rates and hoping to reduce the rates of reoperation , surgeons have increasingly used mesh to correct pop , especially meshes made of synthetic materials .
we placed mesh into the vesicovaginal and rectovaginal spaces , restoring levels i and ii vaginal support .
however , the complications associated with the synthetic mesh materials ( e.g. , mesh erosion , vaginal infection , dyspareunia and chronic pain ) seriously affect the women 's quality of life ( qol ) .
the use of porcine small intestine submucosa ( sis ; cook medical ) mesh has recently been reported , but no large - scale prospective study has been published .
our study aimed to analyze the anatomic outcomes and qol in a population of pop patients who underwent sis surgical repair .
this prospective study included forty consecutive patients undergoing pelvic reconstructive surgery with sis between march 2012 and december 2013 at a tertiary teaching hospital in beijing , china .
the margin of error is 12% , taking the lost follow - up and the accidental death into consideration .
ethical approval for this study was granted by the ethics committee of peking university people 's hospital and the reference number was 2013-ethic-05 . written informed consent was obtained before sample collection .
the inclusion criteria were the presence of stage 2 pop confirmed by pop quantification ( pop - q ) and the presence of more than one symptom associated with prolapse ( sense of vaginal bulging , lower urinary tract symptoms [ luts ] , fecal incontinence , vaginal pain , and dyspareunia ) .
we excluded patients with age < 18 years , body mass index > 40 kg / m , infection , prior pelvic mesh surgery , collagen disease , and cancer .
the patients who were unable to tolerate the anesthesia were also excluded from the study .
baseline demographics consisted of age , sexual activity , childbearing history , comorbidities , surgical history , and the surgical procedure .
preoperative assessment included an interview and prolapse quantification by the pop - q system , 1-h pad test , and urodynamic examination .
we focused on luts , including abnormal frequency of micturition , urgent urination , cough ( or sneezing ) leakage , dysuria , and urinary incontinence .
we defined the abnormal frequency of micturition as urinating more than six times in the daytime or two times at night .
the sis mesh augmented surgery was performed under general or spinal anesthesia , with patients in the lithotomy position and with an indwelling urinary catheter .
the specific operative steps were as follows : first , 40 ml epinephrine in saline ( 1:200,000 ) was injected into the vesicovaginal space , and a midline vaginal incision was made from the bladder neck to the anterior fornix .
the tendinous arch of the pelvic fascia ( white line ) was touched by sharp and blunt separation of the vesicovaginal space .
being guided by the left index finger in the rectum , the surgeon took hold of the bilateral uterosacral ligament through the anterior fornix and marked it with a suture .
next , a 7 cm 20 cm four - layered sis mesh was divided into two parts to repair the anterior and posterior walls . for the anterior compartment
, one 7 cm 8 cm four - layered sis mesh was cut into a trapezoidal shape with two arms ( each arm length was 2 cm ) which were fixed to the bilateral uterosacral ligaments .
the up middle point of the mesh was sutured to the anterior cervix with 1 - 0 coated vicryl plus antibacterial sutures .
the distal part of the mesh was sutured to the bladder neck , and the mesh was attached to the tendinous arch of the pelvic fascia by absorbable sutures bilaterally .
finally , the anterior wall incision was closed using continuous hemstitch sutures . for the posterior compartment ,
the repair began with injecting 60 ml epinephrine in saline ( 1:200,000 ) into the rectovaginal space .
we then made a longitudinal posterior wall incision , beginning below the posterior fornix and ending at the hymen .
blunt and sharp dissections were continued to expose the ischial spine and sacral spine ligament .
the shape of the posterior mesh was similar to that of the anterior mesh , except for the longer length of the two arms ( 3 cm ) .
the up middle point of the mesh was fixed onto the posterior wall of cervix or the apical posterior wall ( in case of hysterectomy ) and the bilateral uterosacral ligament , the two arms were sutured to bilateral sacrospinous ligaments . the distal portion was then trimmed and attached snugly to the anal levator muscle , which was close to the perineal body fascia .
the operative details had been described in a previously published article and in the product instruction manual .
transvaginal hysterectomy ( tvh ) was conducted if patients had uterine diseases ( e.g. , hysteromyoma and uterine adenomyosis ) . stress urinary incontinence ( sui ) , diagnosed by 1-h pad test and urodynamic evaluation , was treated with tension - free vaginal tape - obturator ( tvt - o ) .
the foley catheter was removed 72 h after the operation , using ultrasonography to measure the residual urine volume .
the women were asked to visit the gynecological clinic at 3 , 6 , and 12 months postoperatively .
the follow - up included the subjective feeling , the status of surgical wound healing , the presence of infection or erosion , bowel movements , the luts status , and the pop - q score results .
in addition , the patients completed the pre- and post - operative qol questionnaires ( pelvic floor distress inventory [ pfdi]-20 and pelvic floor impact questionnaire [ pfiq]-7 ) by face - to - face interview , which were previously validated for using in pop patients .
moreover , participants were required to answer a sexual function questionnaire ( pelvic organ prolapse / urinary incontinence sexual function questionnaire [ pisq-12 ] ) .
objective success was defined as pop - q stage 0 or 1 in all compartments .
thus , objective recurrence meant postoperative stage 2 ( pop - q ) in any compartment .
subjective success was defined as having no more than an asymptomatic bulge protruding beyond the hymen and has no recurrence of symptoms .
subjective recurrence implied there was a symptomatic bulge beyond the hymen and recurrence of symptoms .
spss software ( version 17.0 ; ibm , armonk , ny , usa ) was used for statistical analyses .
all data were tested for normality of distribution , median ( p25 , p75 ) were used to analyze the abnormal distribution .
pre- and post - operative pop - q and qol scores were compared using repeated measures data of anova .
the postoperative recurrence rates were compared by linear - by - linear association of chi - square test .
a total of 40 patients met the inclusion criteria , and none of them were lost to follow - up .
the median parity was 2 . among them , one patient had a history of precipitate delivery , one received midwifery forceps , and four experienced perineal laceration during delivery .
thirty - nine patients had stage 3 prolapse . in terms of luts , 14 patients ( 35% )
were diagnosed with sui , four patients had the symptoms of mixed urinary incontinence ( mui ) , and two patients had urge urinary incontinence ( uui ) .
one patient underwent sis anterior wall repair surgery with sis and two underwent posterior wall repairs .
five patients with prolonged cervix underwent manchester operation and 14 patients diagnosed with severe urinary incontinence had tvt - o .
surgical baseline data of the patients tvh : transvaginal hysterectomy ; tvt - o : transvaginal tension - free vaginal tape - obturator ; sd : standard deviation ; sis : small intestinal submucosa .
the average time of foley indwelling catheter after the surgery was 4.71 1.29 days .
one patient still suffered from dysuria after 14 days catheter indwelling and she underwent a second procedure of graft release .
six patients suffered from postoperative fever with the temperature above 38.5c , which was defined as postoperative pyrexia .
the mean points in the pop - q system including aa , ba , c , total vaginal length ( tvl ) , ap , bp , and d were shown in table 2 . it should be noted that 26 patients had no point d because of hysterectomy . when comparing the pre- and post - operative ( 3 , 6 , and 12 months ) points , the statistical differences were significant , except for tvl .
pre- and post - operative pop - q of the patients all data were shown as median ( p25 , p75 ) .
of the thirty patients who suffered from luts preoperatively , ten sui and four mui patients underwent tvt - o surgery simultaneously . among them , nine patients announced that the symptoms were completely relieved , and two patients proved improvement .
moreover , four patients with mild sui did not undergo tvt - o surgery because the symptom did not affect their daily life .
ten patients who experienced abnormal frequency of micturition or dysuria had no concomitant procedure , and six patients symptoms were diminished postoperatively .
postoperatively , no one developed new symptoms including the ten patients who had no luts preoperatively .
flow chart of changes in the lower urinary tract symptoms after different treatments : no concomitant procedure or medicine , concomitant tvt - o , and tolterodine tartrate .
sui : stress urinary continence ; mui : mixed urinary incontinence ; uui : urge urinary incontinence ; tvt - o : transvaginal tension - free vaginal tape - obturator . during the first 3 months postoperatively , the objective recurrence rate was 9/40 .
postoperatively , the recurrences all occurred in the anterior layer . at 6 months , however , 15 patients ( 37.5% ) experienced recurrences mostly in the anterior compartment .
however , the subjective recurrence rate was only 3/40 ( n = 3 ) . at the 12-month follow - up , 16 patients had anterior wall prolapse , but only two of them had a posterior wall prolapse , and one had an apical prolapse .
the objective recurrence rate was 16/40 , while the subjective recurrence rate was only 3/40 .
there is no statistically significant difference in both objective and subjective recurrence rates between 3-month , 6-month , and 12-month follow - ups ( p > 0.001 ) . during the 1 month postoperatively
, one patient was diagnosed with ulcerative colitis because of hematochezia and was cured by drug therapy .
one patient had anus sphincter reconstruction surgery because of defecation urgency after 1 month postoperatively .
one patient experienced moderate vaginal pain 15 days after surgery and infection was detected in the posterior vaginal wall where the mesh had been implanted .
the symptom disappeared after using estrogen - containing vaginal suppository and estrogen cream to accelerate the repair of the vaginal mucosa , combining with the oral antibiotics . at the 12-month follow - up ,
one patient received a secondary surgery with a bard mesh ( tvm , avaulta ; c.r .
bard , murray hill , nj , usa ) because of stage 3 anterior prolapse and dysuria .
all patients filled the pre- and post - operative scoring questionnaires ( pisq 12 , pfdi-20 , and pfiq-7 ) . based on data from the pisq-12 scores , 15 patients had no sexual activity for more than 1 year preoperatively because of lowered sexual desire and the prolapse . among them , two patients recovered sexual activity after surgery . in the 25 patients with sexual activity , four patients claimed that their sexual qol had decreased , largely because of the luts , there was no physical findings that can explain their symptoms .
five patients believed that their sexual qol had improved , and the others felt no significant change .
thus , there was no significant difference between pre- and post - operative data in sexual qol ( p 0.001 ) ( i.e. , their postoperative sex lives had not improved ) . when compared with the preoperative data ,
the 3- , 6- , and 12-month pfdi-20 scores were significantly decreased [ table 3 ] , as showed with the pfiq-7 scores .
the changes of pisq-12 , pfdi-20 , and pfiq-7 scores between baseline and after pelvic reconstructive surgery with sis ( n = 40 ) * p0.001 means no significance .
pisq-12 : pelvic organ prolapse / urinary incontinence sexual function questionnaire-12 ; pfdi-20 : pelvic floor distress inventory-20 ; pfiq-7 : pelvic floor impact questionnaire-7 ; sis : small intestinal submucosa .
in 2003 , cosson et al . suggested that the ideal pelvic mesh should include the following characteristics : better tissue compatibility , greater chemical inertness , decent elasticity and tension , low possibility of infection , low rate of rejection , and morphologic plasticity .
the pelvic meshes consisted of prosthetic materials and biologic grafts . during the past decades , prosthetic materials had been widely used to correct pop , but they were associated with a high rate of complications , seriously affecting the qol .
gynecologists have long used biologic grafts from other species ( xenografts ) to repair hernias and reconstruct the pelvis .
it was thought that these tissues could reduce the complications of erosion , granulomas , and infection with permanent prosthetic materials .
sis , derived from the submucosa of porcine small intestine , is an acellular , three - dimensional lattice of collagen and extracellular matrix , not cross - linked
. the extracellular matrix can carry biologic signals , which encourages host angiogenesis as well as connective tissue and epithelial differentiation and growth , finally replacing the graft with constructive connective tissue remodeling instead of scar tissue .
sis , being freed from cellular components , has a low rate of rejection because it is incorporated into the host tissue with no significant immunologic reaction .
the findings were confirmed by a comparative study in an animal model that evaluated the incorporation of four biologic sling materials , including cadaveric fascia lata , cadaveric dermis , porcine dermis , and sis .
a case control study consisting of 14 women who underwent traditional anterior repair and 14 women who underwent anterior repair with an sis graft ( sg ) were reported by chaliha et al . at their 6-month follow - up , sg repair
had significantly improved all pop - q measurements except tvl , whereas traditional repair improved some measurements ( aa , ba , c , ap , and bp ) but not others ( d , tvl , gh , and pb ) . the study did not distinguish the anterior wall from the posterior wall and lacked randomization .
feldner et al . reported a randomized controlled trial that compared sgs with the traditional colporrhaphy ( tc ) for the treatment of anterior vaginal prolapse .
patients were randomly assigned to sis ( n = 29 ) or to tc ( n = 27 ) preoperatively , and outcomes were analyzed at 12 months postoperatively .
the sis group had 86.2% anatomic cure compared with 59.3% for tc ( p = 0.03 ) .
sis repair improved point ba significantly , and there were no differences between the techniques in regard to qol .
we defined anatomic cure as objective success , whereas subjective success was defined as no symptoms and no bulge beyond the hymen .
points aa , ba , c , ap , bp , and d ( but not tvl ) were significantly different , which was similar to the results of the chaliha et al .
the results showed that the objective recurrence rate was much higher than the subjective recurrence rate .
most of the recurrent patients had no related symptoms and these patients did not require repeat treatment .
the anterior recurrence rate was higher than the posterior recurrence rate , similar to the study of armitage et al .
nevertheless , previous studies reported that the recurrence rate of synthetic mesh repair was 4%15% , which was much lower than that after sis repair .
the reason for the variance might be the better stability of synthetic mesh . the sis repair , however , had no erosion because of the better biocompatibility and patients subjective degree of satisfaction was much higher
. in our results , one patient underwent the graft release surgery because of urinary retention 10 days after sis repair .
one patient had anus sphincter reconstruction surgery because of defecation urgency and the symptom was not relevant to the sis surgery .
in addition , one woman experienced infection in the posterior vaginal wall where mesh had been implanted and had severe vaginal pain , the pain disappeared after being treated with a vaginal suppository containing estrogen and with estrogen cream . at the 1-year follow - up
only one patient underwent secondary surgery with bard mesh ( tvm , avaulta ) because of stage 3 anterior prolapse and dysuria .
the other patients with recurrences required long - term follow - up to determine if they would need another operation .
sis repair benefited the patients by improving their qol , but it did not bring significantly improved sexual function according to pisq evaluation .
two patients recovered sexual activity after surgery and four patients believed that their sexual qol had decreased .
this may be due to the older age of our patients , who may believe sex life quality is not as important as in younger patients .
however , the study has certain limitations , including the limited number of samples and the lack of randomized control group . perhaps , we need long - term follow - up data , but the statistics show our results and conclusions to be solid . in conclusion , sis has better biocompatibility with human tissues than synthetic mesh .
our subjective recurrence rate was 5.0%7.5% , which was much lower than the objective recurrence rate ( 22.5%40.0% ) .
the results show that qol can be improved , with a much higher degree of subjective satisfaction .
thus , sis can be used in young women , but care must be exercised when performing an anterior repair . based on our results , we believe that monitoring the long - term clinical effect on patients is warranted .
this work was supported by a grant from the national sci - tech support plan ( no .
this work was supported by a grant from the national sci - tech support plan ( no .
| background : pelvic organ prolapse ( pop ) is a major health concern that affects women .
surgeons have increasingly used prosthetic meshes to correct pop .
however , the most common used is synthetic mesh , and absorbable mesh is less reported .
this research aimed to evaluate the clinical effectiveness of porcine small intestinal submucosa ( sis).methods : consecutive forty pop patients who met the inclusion criteria underwent pelvic reconstruction surgery with sis between march 2012 and december 2013 .
the patients clinical characteristics were recorded preoperatively .
surgical outcomes , measured by objective and subjective success rates , were investigated .
we evaluated the quality of life ( qol ) using the pelvic floor distress inventory-20
( pfdi-20 ) and the pelvic floor impact questionnaire-7 ( pfiq-7 ) . sexual qol was assessed by the pelvic organ prolapse / urinary incontinence sexual function questionnaire-12 ( pisq-12).results : at postoperative 12 months , the subjective recurrence rate ( 7.5% ) was much lower than the objective recurrence rate ( 40.0% ) .
postoperatively , no erosion was identified .
one underwent a graft release procedure because of urinary retention , and one had anus sphincter reconstruction surgery due to defecation urgency .
another experienced posterior vaginal wall infection where the mesh was implanted , accompanied by severe vaginal pain .
estrogen cream relieved the pain .
one patient with recurrence underwent a secondary surgery with bard mesh because of stage 3 anterior vaginal wall prolapse .
scoring system of pfdi-20 was from 59.150 13.143 preoperatively to 8.400 4.749 postoperatively and pfiq-7 was from 73.350 32.281 to 7.150 3.110 , while pisq-12 was from 15.825 4.050 to 12.725 3.471.conclusions:qol and the degree of subjective satisfaction were significantly improved postoperatively .
anterior repair deserves more attention because of the higher recurrence rate .
the long - term follow - up of the patient is warranted to draw firm conclusion . |
all operations were carried out in a moisture- and oxygen - free argon atmosphere using standard schlenk techniques . ti(oipr)4 and
the solvents for nmr spectroscopy ( eurisotop ) were degassed prior to use and stored over molecular sieve .
h and c solution nmr spectra were recorded on a bruker avance 250 ( 250.13 mhz for h , 62.86 mhz for c ) equipped with a 5 mm inverse - broadband probe head and a z - gradient unit .
ti(oipr)4 ( 1 cm , 3.45 mmol ) was added to a solution of 291 mm methacrylic acid ( 3.45 mmol ) in 3 cm of water - free isopropanol at 0 c .
a white precipitate formed immediately , which was dissolved by adding 1 cm of ch2cl2 .
crystals of 1 were obtained from the clear solution at 10 c after 2 days .
yield 500 mg ( 43 % ) ; h nmr ( c6d6 , 250 mhz ) : = 0.941.82 ( m , 42h , chch3 ) , 1.952.29 ( m , 6h , cch3 ) , 4.51 ( br , 2h , och ) , 4.885.33 ( m , 5h , och ) , 5.42 ( br , 2h , c = ch2 ) , 6.47 ppm ( br , 2h , c = ch2 ) ppm ; c nmr ( c6d6 , 62.90 mhz ) : = 18.22 ( br , cch3 ) , 24.98 ( chch3 ) , 25.37 ( br , chch3 ) , 77.90 ( och ) ,
methacrylic acid ( 2 : 582 mm , 6.90 mmol ; 4 : 1.75 cm , 20.69 mmol ; 5 : 2.33 cm , 27.58 mmol ) was added to 1 cm of ti(oipr)4 ( 3.45 mmol ) and the solution was stirred for 5 min .
crystals were obtained after 26 months at room temperature . 2 : yield 350 mg ( 40 % ) ; h nmr ( cdcl3 , 200 mhz ) : = 1.001.44 ( m , 48h , chch3 ) , 1.681.96 ( m , 24h , cch3 ) , 3.97 ( m , j = 6.16 hz , 1h , ch ) , 4.30 ( m , j = 6.06 hz , 1h , ch ) , 4.584.85 ( m , 4h , ch ) , 4.935.12 ( m , 2h , ch ) , 5.245.56 ( m , 8h
, ch2 ) , 5.906.27 ppm ( m , 8h , ch2 ) ppm ; c nmr ( cdcl3 , 50.3 mhz ) : = 18.17 , 18.26 , 18.48 , 18.58 , 18.64 , 18.74 , 18.81 ( cch3 ) , 24.41 , 24.52 , 24.90 , 25.25 , 25.33 , 25.40 , 25.47 , 77.20 , 78.13 , 78.40 , 78.85 , 80.27 , 81.62 , 81.75 ( chch3 ) , 125.81 , 126.96 , 127.90 ( ch2 ) , 137.45 , 137.61 , 138.12 , 138.55 , 138.75 , 139.19 , 139.29 , 139.40 ( c = ch2 ) , 172.77 , 173.14 , 174.31 , 174.71 , 175.12 , 175.81 ( coo ) ppm .
4 : yield 330 mg ( 39 % ) ; h nmr ( cdcl3 , 250 mhz ) : = 0.881.11 ( m , 3h , chch3 ) , 1.14 ( d , j = 6.12 hz , 6h , chch3 ) , 1.171.60 ( m , 15h , chch3 ) , 1.641.96 ( m , 48h , cch3 ) , 3.97 ( m , j = 6.11 hz , 1h , ch ) , 4.935.04 ( m , 1h , ch ) , 5.205.58 ( m , 16h , ch2 ) , 5.61 ( m , 3h , ch ) , 5.956.31 ppm ( m , 16h , ch2 ) ppm .
5 : yield 80 mg ( 12 % ) ; h nmr ( cdcl3 , 250 mhz ) : = 1.851.93 ( m , 48h , ch3 ) , 5.295.69 ( m , 16h , ch2 ) , 6.176.22 ppm ( m , 16h , ch2 ) ppm ; c nmr ( cdcl3 , 62.90 mhz ) : = 17.918.4 ( ch3 ) , 126.0128.3 ( ch2 ) , 136.2138.4 ( c ) , 176.7 ppm ( coo ) .
methacrylic acid ( 580 mm , 6.87 mmol ) was added to 1 cm of ti(oipr)4 ( 3.45 mmol ) at room temperature .
after 5 min of stirring , the reaction vessel was stored at 4 c .
after 6 months , no crystals were obtained ; therefore , the mixture was warmed to room temperature .
all measurements were performed at 100 k using mok ( = 71.073 pm ) radiation .
data were collected on a bruker axs smart apex ii four - circle diffractometer with -geometry , with and scans and different frame widths .
the data were corrected for polarization and lorentz effects , and an empirical absorption correction ( sadabs ) was employed .
saint plus software ( bruker analytical x - ray instruments , 2007 ) was used to integrate the frames.table 2crystal data and structure refinement details for 1 , 2 , 4 , and 5
1
2
4
5
emp .
formulac29h60o11ti2
c56h96o28ti6
c85.50h123o48.50ti9
c64h80o40ti8
m
r
680.571504.732357.941872.48crystal systemmonoclinicmonoclinictriclinicmonoclinicspace group
p21/n
p21/c
p
\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \overline{1 } $ $ \end{document}1
c2/c
a / pm1065.27(5)1155.03(4)1182.0(3)2401.7(2 )
b / pm1819.00(8)1895.81(5)1626.7(3)1662.8(2 )
c / pm1961.76(8)1702.46(5)3060.3(7)2430.8(2 )
/deg909087.652(5)90
/deg100.688(2)105.181(1)88.160(6)90.459(6 )
/deg909072.026(5)90
v / pm 10
3735.4(3)3597.8(2)5591(2)9707(1 )
z
4224
d
x / g cm
1.211.391.401.28
/mm
0.4760.7100.6930.699crystal size / mm0.5 0.5 0.50.4 0.25 0.20.2 0.15 0.050.65 0.64 0.33no .
2(i)]20,68510,63861907847
max / deg44.8933.5020.0226.38
r [ f
> 2(f ) ] , wr ( f
) , s
0.0540 , 0.0960 , 1.1080 . 0361 , 0 . 0605 , 1.0320.0824 , 0.1509 , 1.0870.1195 , 0.2594 , 3.502weighting scheme
w = 1/[
( f
02 ) + ( 0.0447p ) + 1.7418p ]
w = 1/[
( f
02 ) + ( 0.0459p ) + 1.6781p ]
w = 1/[
( f
02 ) + ( 0.1135p ) + 28.5259p ]
w = 1/[
( f
02 ) + ( 0.0275p ) + 11.5003p]
max , min / e10 pm
1.08 , 0.520.96 , 0.590.87 , 0.911.45 , 1.00
p = ( f
02 + 2f
c2)/3 crystal data and structure refinement details for 1 , 2 , 4 , and 5
p = ( f
02 + 2f
c2)/3 the structures were solved by the patterson method ( shelxs97 ) .
refinement was performed by the full - matrix least - squares method based on f ( shelxl97 ) with anisotropic thermal parameters for all non - hydrogen atoms .
three oipr groups in 1 are disordered and were refined with around 80 % occupancy of the carbon atoms marked as a ( e.g. c12a )
. one molecule of 2-propanol and two of methacrylic acid were found in the asymmetric unit of 4 , of which the 2-propanol was refined with 50 % occupancy .
the electron density in the void opened by the ring of 5 could not be refined and was removed using the squeeze function in platon .
ccdc-1024252 ( 1 ) , -1024253 ( 2 ) , -1024254 ( 4 ) , and -1024255 ( 5 ) contain the supplementary crystallographic data for this paper .
these data can be obtained free of charge from the cambridge crystallographic data center via www.ccdc.cam.ac.uk/data_request/cif .
ti(oipr)4 ( 1 cm , 3.45 mmol ) was added to a solution of 291 mm methacrylic acid ( 3.45 mmol ) in 3 cm of water - free isopropanol at 0 c .
a white precipitate formed immediately , which was dissolved by adding 1 cm of ch2cl2 .
crystals of 1 were obtained from the clear solution at 10 c after 2 days .
yield 500 mg ( 43 % ) ; h nmr ( c6d6 , 250 mhz ) : = 0.941.82 ( m , 42h , chch3 ) , 1.952.29 ( m , 6h , cch3 ) , 4.51 ( br , 2h , och ) , 4.885.33 ( m , 5h , och ) , 5.42 ( br , 2h , c = ch2 ) , 6.47 ppm ( br , 2h , c = ch2 ) ppm ; c nmr ( c6d6 , 62.90 mhz ) : = 18.22 ( br , cch3 ) , 24.98 ( chch3 ) , 25.37 ( br , chch3 ) , 77.90 ( och ) , 72.379.36 ( br , och ) , 125.1126.8 ( br , cch2 ) ppm .
methacrylic acid ( 2 : 582 mm , 6.90 mmol ; 4 : 1.75 cm , 20.69 mmol ; 5 : 2.33 cm , 27.58 mmol ) was added to 1 cm of ti(oipr)4 ( 3.45 mmol ) and the solution was stirred for 5 min .
crystals were obtained after 26 months at room temperature . 2 : yield 350 mg ( 40 % ) ; h nmr ( cdcl3 , 200 mhz ) : = 1.001.44 ( m , 48h , chch3 ) , 1.681.96 ( m , 24h , cch3 ) , 3.97 ( m , j = 6.16 hz , 1h , ch ) , 4.30 ( m , j = 6.06 hz , 1h , ch ) , 4.584.85 ( m , 4h , ch ) , 4.935.12 ( m
, 2h , ch ) , 5.245.56 ( m , 8h , ch2 ) , 5.906.27 ppm ( m , 8h , ch2 ) ppm ; c nmr ( cdcl3 , 50.3 mhz ) : = 18.17 , 18.26 , 18.48 , 18.58 , 18.64 , 18.74 , 18.81 ( cch3 ) , 24.41 , 24.52 , 24.90 , 25.25 , 25.33 , 25.40 , 25.47 , 77.20 , 78.13 , 78.40 , 78.85 , 80.27 , 81.62 , 81.75 ( chch3 ) , 125.81 , 126.96 , 127.90 ( ch2 ) , 137.45 , 137.61 , 138.12 , 138.55 , 138.75 , 139.19 , 139.29 , 139.40 ( c = ch2 ) , 172.77 , 173.14 , 174.31 , 174.71 , 175.12 , 175.81 ( coo ) ppm .
4 : yield 330 mg ( 39 % ) ; h nmr ( cdcl3 , 250 mhz ) : = 0.881.11 ( m , 3h , chch3 ) , 1.14 ( d , j = 6.12 hz , 6h , chch3 ) , 1.171.60 ( m , 15h , chch3 ) , 1.641.96 ( m , 48h , cch3 ) , 3.97 ( m , j = 6.11 hz , 1h , ch ) , 4.935.04 ( m , 1h , ch ) , 5.205.58 ( m , 16h , ch2 ) , 5.61 ( m , 3h , ch ) , 5.956.31 ppm ( m , 16h , ch2 ) ppm . 5 : yield 80 mg ( 12 % ) ; h nmr ( cdcl3 , 250 mhz ) : = 1.851.93 ( m , 48h , ch3 ) , 5.295.69 ( m , 16h , ch2 ) , 6.176.22 ppm ( m , 16h , ch2 ) ppm ; c
nmr ( cdcl3 , 62.90 mhz ) : = 17.918.4 ( ch3 ) , 126.0128.3 ( ch2 ) , 136.2138.4 ( c ) , 176.7 ppm ( coo ) .
methacrylic acid ( 580 mm , 6.87 mmol ) was added to 1 cm of ti(oipr)4 ( 3.45 mmol ) at room temperature . after 5 min of stirring ,
after 6 months , no crystals were obtained ; therefore , the mixture was warmed to room temperature .
all measurements were performed at 100 k using mok ( = 71.073 pm ) radiation .
data were collected on a bruker axs smart apex ii four - circle diffractometer with -geometry , with and scans and different frame widths .
the data were corrected for polarization and lorentz effects , and an empirical absorption correction ( sadabs ) was employed .
the cell dimensions were refined with all unique reflections ( table 2 ) . saint plus software ( bruker analytical x - ray instruments , 2007 ) was used to integrate the frames.table 2crystal data and structure refinement details for 1 , 2 , 4 , and 5
1
2
4
5
emp .
c56h96o28ti6
c85.50h123o48.50ti9
c64h80o40ti8
m
r
680.571504.732357.941872.48crystal systemmonoclinicmonoclinictriclinicmonoclinicspace group
p21/n
p21/c
p
\documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ \overline{1 } $ $ \end{document}1
c2/c
a / pm1065.27(5)1155.03(4)1182.0(3)2401.7(2 )
b / pm1819.00(8)1895.81(5)1626.7(3)1662.8(2 )
c / pm1961.76(8)1702.46(5)3060.3(7)2430.8(2 )
/deg909087.652(5)90
/deg100.688(2)105.181(1)88.160(6)90.459(6 )
/deg909072.026(5)90
v / pm 10
3735.4(3)3597.8(2)5591(2)9707(1 )
z
4224
d
x / g cm
1.211.391.401.28
/mm
0.4760.7100.6930.699crystal
size / mm0.5 0.5 0.50.4 0.25 0.20.2 0.15 0.050.65 0.64 0.33no . msd . refl.244,599103,239108,9329827obs .
2(i)]20,68510,63861907847
max / deg44.8933.5020.0226.38
r [ f
> 2(f ) ] , wr ( f
) , s
0.0540 , 0.0960 , 1.1080 . 0361 , 0 .
0605 , 1.0320.0824 , 0.1509 , 1.0870.1195 , 0.2594 , 3.502weighting scheme
w = 1/[
( f
02 ) + ( 0.0447p ) + 1.7418p ]
w = 1/[
( f
02 ) + ( 0.0459p ) + 1.6781p ]
w = 1/[
( f
02 ) + ( 0.1135p ) + 28.5259p ]
w = 1/[
( f
02 ) + ( 0.0275p ) + 11.5003p]
max , min / e10 pm
1.08 , 0.520.96 , 0.590.87 , 0.911.45 , 1.00
p = ( f
02 + 2f
c2)/3 crystal data and structure refinement details for 1 , 2 , 4 , and 5
p = ( f
02 + 2f
c2)/3 the structures were solved by the patterson method ( shelxs97 ) .
refinement was performed by the full - matrix least - squares method based on f ( shelxl97 ) with anisotropic thermal parameters for all non - hydrogen atoms .
three oipr groups in 1 are disordered and were refined with around 80 % occupancy of the carbon atoms marked as a ( e.g. c12a )
. one molecule of 2-propanol and two of methacrylic acid were found in the asymmetric unit of 4 , of which the 2-propanol was refined with 50 % occupancy .
the electron density in the void opened by the ring of 5 could not be refined and was removed using the squeeze function in platon .
ccdc-1024252 ( 1 ) , -1024253 ( 2 ) , -1024254 ( 4 ) , and -1024255 ( 5 ) contain the supplementary crystallographic data for this paper .
these data can be obtained free of charge from the cambridge crystallographic data center via www.ccdc.cam.ac.uk/data_request/cif . | abstractwhen ti(oipr)4 was reacted with increasing proportions of methacrylic acid ( mcoh ) , the compounds ti2(oipr)6(omc)2(iproh ) , ti6o4(oipr)8(omc)8 , ti9o8(oipr)4(omc)16 , and ti8o8(omc)16 were obtained in sequence .
this allowed conclusions on the relative ratio of substitution and hydrolysis reactions , the latter being due to ester formation between the acid and cleaved alcohol .
this ratio is also influenced by the reaction temperature , since ti4o2(oipr)6(omc)6 was formed instead of ti6o4(oipr)8(omc)8 at lower temperature with the same precursor ratio.graphical abstract |
mesothelial inclusion cyst is a rare tumour attached to the serosal surface of the visceral organs .
it was initially thought to be cystic lymphangioma ; however , electron microscopic examinations showed they originated from mesothelial cells .
immunohistochemical markers such as calretinin also distinguish mesotheliomas from lymphangiomas . whilst most mesothelial cyst reports are single cases , one study examining 37 cases found 84% presented in women of reproductive age with the remainder of either sex and of all ages .
the same report also noted that cysts were more frequently detected in patients who had previously had abdominal surgery or pelvic inflammation .
we present an unusual case of a male patient who presented with acute appendicitis and an incidental mesothelial inclusion cyst .
he complained of right - sided , colicky abdominal pain without other constitutional symptoms . on examination he was stable and afebrile , with right iliac fossa tenderness but no guarding or signs of generalized peritonitis .
a computed tomography ( ct ) abdomen revealed a large cystic mass initially thought to be an appendiceal mucocele ( fig .
1 ) .
figure 1:ct abdomen showing the cystic mass ( coronal view ) .
a laparotomy was performed to avoid rupturing the cyst due to the suspicion of the cystic mass being an appendiceal mucocele .
findings were of a very large ( 25 10 10 cm ) clear fluid filled sac associated with the ascending colon , a necrotic lymph node in the mesentery and acute appendicitis ( fig .
3 ) was performed with a 3.5 mm depth linear stapler and continuity established by side to side single layer hand sewn 3/0 polydioxanone ileocolic anastomosis .
histology revealed an inclusion mesothelial cyst lined by a single flattened layer of cells with bland ovoid to flattened nuclei and the cyst wall consisted of fibrous connective tissue .
the cyst was confirmed as mesothelial by positive immunohistochemical reactions using cytokeratin- , ae1/3- , wt1- and calretinin - specific antibodies .
four months postoperatively he complained of mild per rectal bleeding , but subsequent colonoscopy was normal with a well - healed anastomosis .
on the annual follow - up , he is asymptomatic with no recurrent cystic tumour at 2 years .
patients with mesothelial inclusion cysts usually present with a wide range of symptoms , including increasing abdominal girth , unspecific abdominal pain , nausea and vomiting .
differential diagnoses to consider include : appendicitis , diverticulitis , meckel 's diverticulum , duplication cyst or cystic neoplasms .
ct scans and ultrasound visualize the lesion but do not differentiate from other intra - abdominal pathologies . a paper by lee in 2012 suggested that a laparoscopic approach proved to be superior to laparotomy and reduced length of stay , blood loss and complication rate .
however , generally the risk of cyst rupture is higher in a laparoscopic approach than in an open approach .
as cystadenocarcinoma is a differential for cystic neoplasms of the appendix , rupture of any undifferentiated cyst associated with the appendix may place a patient at risk of pseudomyxoma peritonei .
therefore , whilst laparoscopy may reduce early morbidity , a low threshold for conversion to open to facilitate safe dissection and avoid cyst rupture should be employed .
however , there is a high rate of recurrence , with an average of 32 months , and reports of neoplastic changes in this tumour .
whilst surgical intervention is considered the best approach for complete removal of cysts , recent studies advocate additional intraperitoneal chemotherapy to reduce recurrence but these remain preliminary , involving only a few patients .
if a cyst suggestive of a mesothelial cyst is found incidentally on imaging in an asymptomatic patient , suggested management would be for complete surgical excision and removal due to the small risk of malignancy as well as to exclude other differential diagnosis .
we suggest that a safe approach is total en bloc resection , keeping the cyst intact whether this is performed laparoscopically or through open approach , and lifelong follow - up to check for recurrence and/or neoplastic transformation .
we would like to declare that there are no conflict of interest and no funding bodies for this study . | mesothelial inclusion cyst is a rare benign tumour that has only 130 cases reported in the literature .
accurate diagnosis and optimal management of this condition remains uncertain .
we report a 51-year - old african gentleman , whom presents with abdominal pain and constipation .
a computed tomography scan was performed and revealed a large cystic lesion in the right paracolic gutter .
the differential diagnosis included appendiceal mucinous neoplasm , cystic tuberculosis and duplication cyst .
a laparotomy was performed due to his symptoms and size of the cyst .
macroscopically , the tumour had a size of 25 10 10 cm and revealed a necrotic lymph node .
it was resected en bloc with the appendix and an ileocolic anastomosis performed .
histology revealed a diagnosis of mesothelial inclusion cyst and acute appendicitis .
the patient recovered well and had no recurrence at 2-year follow - up . |
fortunately , we are now able to test for an increasing number of antibodies that offer a definitive diagnosis for cases that would have been previously categorized as viral or idiopathic encephalitis .
the california encephalitis project found that the frequency of autoimmune encephalitis was greater than any single viral etiology .
anti - n - methyl d - aspartate receptor ( nmdar ) encephalitis was , in fact , the most frequent cause of immune mediated encephalitis in the pediatric population . any child who presents with memory deficits , aphasia
, seizures , movement disorders , or behavioral changes of a subacute nature should have autoimmune encephalitis in the differential diagnosis .
the initial presentation of these patients can vary depending on the receptor being targeted , but it is crucial to always consider immune - mediated encephalitis because of the potential for a successful outcome with prompt treatment .
the case we present is of a young man with an elevated titer of n - type voltage - gated calcium channel antibody and a relatively acute change in mental status including memory deficits , mood changes , and transient fever .
our initial instinct was to look for a bacterial or viral etiology . when the lumbar puncture was benign , however , an autoimmune etiology became the leading consideration in our differential diagnosis .
entities such as fever - induced refractory epileptic encephalopathy in school - aged children ( fires ) or rasmussen encephalitis were also considered .
fever - induced refractory epileptic encephalopathy in school - aged children is triggered by fever and an underlying inflammatory response in the suspected culprit .
although our patient 's clinical history was preceded by fever , his clinical course and prompt positive response to steroids and ivig are different from patient with fires because those patients present with drug - resistant status epilepticus , csf pleocytosis , and perisylvian / mesial temporal lobe abnormalities .
rasmussen encephalitis is a presumed inflammatory encephalopathy and a recognized cause of an intractable focal epilepsy or epilepsia partialis continua ( epc ) . in most cases ,
only one hemisphere is involved , and patients progress to have weakness on the contralateral side .
our young man 's initial mri scan was reminiscent of this type of unilateral hemispheric dysfunction , although his lack of epc or clinically evident focal seizures or weakness led us away from this diagnosis .
the etiology of rasmussen encephalitis remains largely unknown , although it is considered a prototype of immune - inflammatory epilepsy syndrome , and multiple mechanisms have been proposed .
patient 's with rasmussen encephalitis also do not typically respond readily to immunotherapies , often requiring hemispherectomy to afford seizure freedom .
treatment for encephalitis often needs to be initiated before the results of confirmatory tests are available .
typically , intravenous immunoglobulin and high - dose steroids are used in tandem as initial therapy .
supportive care and treatment of seizures also play a crucial role in a favorable outcome .
finding an underlying malignancy in an adult is more likely than in the pediatric population , but children should still be screened because a dramatic response can be seen after tumor removal .
our case demonstrates that an autoimmune etiology must always be considered in patients who present with acute behavioral change because of the potential for improved outcome with early administration of immunotherapy .
a previously healthy and normally developing 14-year - old boy presented with one week history of intermittent confusion , memory deficit , emotional liability , inactivity , and transient fever and complained of headaches , dizziness , and inability to talk .
his brother had a febrile illness earlier in the week , and the patient experienced one day of fever , with a maximum temperature of 101.7 f a day before the acute change in his mental state .
examination on admission was remarkable for an ill - appearing , tearful boy with significant deficits in memory , attention , language , and orientation .
he was oriented to person and place but not time and had difficulty naming simple objects ( bone
his digit span was only 2 forward , and he could not follow the directions for backward digit span .
head computed tomography ( ct ) was unremarkable , and a lumbar puncture ( lp ) was performed to rule out meningoencephalitis , which showed only 5 white blood cells ( wbcs ) with normal glucose and protein ( table 1 ) .
overnight video electroencephalogram ( veeg ) showed marked left hemisphere dysfunction , a lack of a posterior dominant rhythm on the left and epileptogenicity with temporal and occipital maximum .
electroencephalogram captured multiple , 20- to 30-second - long , subtle / stuttering electrographic seizures emanating from the left hemisphere ( fig . 1 ) .
magnetic resonance imaging ( mri ) revealed cortical thickening involving the left hippocampal and parahippocampal gyri and temporal lobes with associated abnormal flair signal and restriction .
the imaging pattern was most suggestive of an underlying inflammatory process such as encephalitis or prolonged seizure activity ( fig . 2 ) .
one gram of intravenous ( iv ) methylprednisolone ( solumedrol ) was started soon after mri and eeg and within 24 h of admission .
the patient was also loaded with fos - phenytoin and started on maintenance fos - phenytoin and topiramate .
intravenous solumedrol was continued for a total of 3 days followed by dexamethasone ( 6 mg tid 5 days , 6 mg bid 5 days , 6 mg daily 5 days , 3 mg daily 5 days ) .
he continued to demonstrate waxing and waning mental status after a high - dose solumedrol burst .
repeat video - eeg monitoring on day 9 no longer detected seizures but continued to show absence of a posterior dominant rhythm on the left .
single photon emission computed tomography scan was performed on day 9 to address continued concern for ongoing subclinical seizure activity that was not being captured on eeg .
it demonstrated an asymmetric hyperperfusion throughout the left cerebral hemisphere with posterior predominance , corresponding to the findings seen on mri , which may have reflected ongoing seizure activity ( fig .
repeated doses of lorazepam were given at times of aphasia , confusion , and sleepiness and produced a transient clinical improvement .
repeat mri of the brain ( with and without contrast ) on day 10 of the hospital stay displayed marked improvement ; only subtle t2 hyperintensity , with minimal cortical thickening in the left occipital and inferior temporal lobes , was noted .
the repeat lumbar puncture on day 10 was again unremarkable ( table 1 ) .
the patient was given 2 doses of 1-g / kg intravenous immunoglobulin ( ivig ) on days 11 and 12 of hospitalization .
on day 18 , he was transferred to inpatient rehabilitation with a plan for clobazam monotherapy ( 10 mg bid ) .
one month after initial presentation , the paraneoplastic panel came back positive for n - type calcium channel binding antibody ( 0.26
testicular ultrasound showed 1-cm hypoechogenicity in the upper pole of the right testis and bilateral microlithiasis .
the most recent mri of the brain , completed four months after the initial mri , demonstrated complete / near - complete resolution of abnormal t2 hyperintense signal and cortical thickening .
our patient has been able to go back to school and has not had any notable residual deficits .
one gram of intravenous ( iv ) methylprednisolone ( solumedrol ) was started soon after mri and eeg and within 24 h of admission .
the patient was also loaded with fos - phenytoin and started on maintenance fos - phenytoin and topiramate .
intravenous solumedrol was continued for a total of 3 days followed by dexamethasone ( 6 mg tid 5 days , 6 mg bid 5 days , 6 mg daily 5 days , 3 mg daily 5 days ) .
he continued to demonstrate waxing and waning mental status after a high - dose solumedrol burst .
repeat video - eeg monitoring on day 9 no longer detected seizures but continued to show absence of a posterior dominant rhythm on the left .
single photon emission computed tomography scan was performed on day 9 to address continued concern for ongoing subclinical seizure activity that was not being captured on eeg .
it demonstrated an asymmetric hyperperfusion throughout the left cerebral hemisphere with posterior predominance , corresponding to the findings seen on mri , which may have reflected ongoing seizure activity ( fig .
repeated doses of lorazepam were given at times of aphasia , confusion , and sleepiness and produced a transient clinical improvement .
repeat mri of the brain ( with and without contrast ) on day 10 of the hospital stay displayed marked improvement ; only subtle t2 hyperintensity , with minimal cortical thickening in the left occipital and inferior temporal lobes , was noted .
the repeat lumbar puncture on day 10 was again unremarkable ( table 1 ) .
the patient was given 2 doses of 1-g / kg intravenous immunoglobulin ( ivig ) on days 11 and 12 of hospitalization .
on day 18 , he was transferred to inpatient rehabilitation with a plan for clobazam monotherapy ( 10 mg bid ) .
one month after initial presentation , the paraneoplastic panel came back positive for n - type calcium channel binding antibody ( 0.26 nmol / l [ 0.03 nmol / l ] ) .
testicular ultrasound showed 1-cm hypoechogenicity in the upper pole of the right testis and bilateral microlithiasis .
the most recent mri of the brain , completed four months after the initial mri , demonstrated complete / near - complete resolution of abnormal t2 hyperintense signal and cortical thickening .
our patient has been able to go back to school and has not had any notable residual deficits .
early recognition of encephalopathy being related to an underlying autoimmune mechanism in our patient led to expedited immune - modulatory therapy and subsequent favorable outcome .
detection of elevated antibody titer of n - type vgcc in his serum and his positive response to steroids and ivig point towards an autoimmunity as the cause of his symptoms .
a case report of two boys with encephalitis of unknown etiology demonstrated the positive effect of immunotherapy even in the absence of a known antibody as the cause .
patients with immune - mediated encephalitis can present with the wide spectrum of symptoms including psychosis , catatonia , alterations of behavior and memory , seizures , abnormal movements , and autonomic dysregulation .
a high degree of suspicion for an autoimmune etiology may , therefore , lead to an early administration of immune - modulatory therapy and a better outcome . in cases of underlying malignancy , it is important to also treat and remove the malignant tumor for successful outcome . as noted in the literature on anti - nmdar encephalitis , over 75% of patients have significant recovery of neurologic issues when treated early with immunotherapy and tumor removal whenever applicable . at the time of initial presentation ,
also , we have no reason , at this point , to suspect an underlying malignancy .
close follow - up is necessary as encephalitis often develops prior to the diagnosis of cancer .
the adult guidelines recommend repeating the screening in 36 months if primary screening is negative and then every 6 months for 4 years , except in lambert
eaton myasthenia syndrome ( lems ) . for lems , follow - up for 2 years is recommended .
we are unaware of another case report of a child with encephalitis secondary to n - type calcium channel receptor antibody .
a case report was found of a 65-year - old woman with small cell lung cancer who presented with seizure , confusion , dizziness , and lethargy and was subsequently found to have anti - n - type voltage - gated calcium channel titer elevation ( 0.42 nmol / l [ < 0.03 nmol / l ] ) .
n - type voltage - gated calcium channel antibody does not have a well - described association with a specific paraneoplastic syndrome or underlying malignancy , whereas in other antibodies associated with characteristic cns syndromes , the presence of various tumors has been found as the underlying source of the antibody production .
n - methyl d - aspartate receptor encephalitis , for example , is often found in association with ovarian teratoma .
easton myasthenic syndrome ( lems ) and paraneoplastic cerebellar degeneration are commonly associated with small cell lung cancer ( sclc ) .
easton myasthenic syndrome is associated with voltage - gated calcium channels ( most of the p / q type with n - type found in about 35% ) .
other synaptic proteins targeted in limbic encephalitis or autoimmune epilepsies include -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor ( ampar ) , -aminobutyric acid ( gaba ) receptor , voltage - gated potassium channel complex ( vgkc ) , glutamic acid decarboxylase ( gad ) 65 , collapsin response - mediated protein 5 ( crmp5 ) , and ganglionic acetylcholine receptor .
limbic encephalitis is more often a paraneoplastic syndrome in adults , while children are far less likely to have an underlying malignancy . in summary , we present this unique case of a young man with encephalitis and high antibody titers of n - type voltage - gated calcium channel .
our case underscores the importance of early immune - modulatory therapy when an underlying autoimmune process is suspected .
patients presenting with new onset memory deficits , behavioral changes , and seizures of unknown etiology should have autoimmune encephalitis at the top of their differential diagnosis .
immunotherapy can be started prior to confirmation , and the timely treatment of these patients can facilitate improved outcome .
| we report , to our knowledge , the only known pediatric case with encephalopathy and significantly elevated titers of n - type voltage - gated calcium channel antibody ( n - type vgcc ) .
the patient , an 8th grader , was previously healthy and presented with a one - week history of confusion , aphasia , transient fever , headaches , and dizziness .
an underlying autoimmune process was suspected because of inflammatory changes in the brain mri and multiple focal electrographic seizures captured in the eeg in the absence of csf pleocytosis . within 24 h of presentation , the patient was empirically started on immune - modulatory therapy , and a full recovery was achieved within 3 months of the initial presentation .
immune therapy included high - dose intravenous ( iv ) methylprednisolone followed by a 2-week course of dexamethasone and 2 monthly courses of iv immunoglobulin ( ivig ) .
he was also treated with anticonvulsants for one month .
no tumor has been found to date .
there is a paucity of reports on autoimmune epilepsy or encephalopathy associated with n - type vgcc .
complete resolution of brain lesion , seizure freedom , and full recovery of function following early and aggressive immunotherapy demonstrate that a high index of suspicion is crucial for early recognition and treatment of autoimmune encephalitis . |
supplementary figure 1 validation of a complex indel . supplementary figure 2 read depth filtering for de novo events .
supplementary table 2 the list of all structural variants and the frequency of these variants among 11 samples . | we report an algorithm to detect structural variation and indels from 1 base pair to 1 megabase pair within exome sequence datasets .
splitread uses one - end anchored placements to cluster the mappings of subsequences of unanchored ends to identify the size , content and location of variants with good specificity and high sensitivity .
the algorithm discovers indels , structural variants , de novo events and copy - number polymorphic processed pseudogenes missed by other methods . |
obesity is considered a low - grade chronic inflammatory disease that may contribute to the development of insulin resistance .
obese adolescents and adults are at higher risk for developing type 2 diabetes ( t2d ) , cardiovascular disease , nonalcoholic fatty liver disease ( nafld ) , osteoarticular diseases , and several forms of cancer .
recent clinical studies have suggested that mediators of low - grade chronic inflammation , such as adipokines , cytokines , ghrelin , and acute phase reactants , are involved in the development of these comorbid conditions [ 3 , 4 ] .
tumor necrosis factor- ( tnf- ) is one of the main mediators of the inflammatory response in obesity and is expressed by infiltrating macrophages and adipocytes in the hypertrophic adipose tissue .
tnf- receptors 1 ( tnfr1 ) and 2 ( tnfr2 ) are the two main transducers of the tnf- signals in most cells and tissues , including peripheral leukocytes .
adiponectin , an adipose tissue secreted protein , has been well recognized to exhibit insulin - sensitizing , anti - inflammatory , and antiatherosclerotic properties , which are mediated through its receptors , adipor1 and adipor2 [ 7 , 8 ] .
these receptors are ubiquitously expressed in most organs as well as in peripheral monocytes and in monocyte - derived macrophages [ 915 ] .
adiponectin levels are known to be decreased in patients with obesity , t2d , and coronary artery disease ( cad ) , promoting the establishment of an inflammatory state in these conditions [ 1619 ] .
leptin is another adipocyte - secreted hormone that centrally regulates food intake and body weight .
obese subjects may become resistant to leptin resulting in greater production and secretion of this peptide .
leptin is correlated with insulin resistance and is considered a key mediator linking insulin resistance with metabolic syndrome and nafld .
the leptin receptor is expressed not only in the central nervous system , but also in peripheral tissues , such as haematopoietic and immune systems contributing to the obesity - related inflammatory state .
the leptin receptor ( obr ) is present in several alternative splice variants , of which only the long isoform ( obrl ) is fully functional [ 24 , 25 ] .
ghrelin is a stomach - derived hormone that , differently from leptin , stimulates food intake and growth hormone ( gh ) release .
circulating levels of ghrelin are reduced in obesity and metabolic syndrome , and , among obese subjects , ghrelin has been reported to be lower in insulin - resistant patients .
the effects of ghrelin are mediated via specific receptors , named the gh secretagogue receptors ( ghsr ) .
two distinct ghrelin receptor transcripts are known : ghsr type 1a acts as ghrelin receptor , whereas type 1b is a truncated form .
the ghsr1a is mainly expressed in the hypothalamus and pituitary gland , but it has also been found in many peripheral organs , including immune cells , in which ghrelin inhibits different proinflammatory functions [ 3335 ] .
nafld , which frequently occurs in obesity , is the consequence of excessive accumulation of triglycerides by hepatocytes .
acute phase reactants produced in the liver , such as c - reactive protein ( crp ) and fibrinogen , are elevated in obese adults and are implicated in the development of cardiovascular disease and t2d [ 3638 ] .
obese adults , who have a long - term duration of the disease , frequently exhibit a low - grade inflammation and insulin resistance , which have been hypothesized to be dissociated in childhood . however , there is not complete consensus on this matter in the paediatric literature [ 40 , 41 ] .
we hypothesized that the relationship between key biomarkers of obesity and inflammation in adolescents may be established in an initial ( and hopefully reversible ) phase . to test this hypothesis ,
we have assessed clinical and metabolic parameters , pro- and anti - inflammatory adipokines ( tnf- , adiponectin , and leptin ) and ghrelin together with their receptors ( tnfr1 , adipor2 , obrl , and ghsr1a ) and acute phase reactants ( crp and white blood cells ) , in a group of lean and obese adolescents compared with the adult counterparts .
obese male adolescents ( age : 15.0 0.5 yrs ; body mass index ( bmi ) : 40.3 2.2 kg / m ) and adults ( age : 36.5 1.9 yrs ; bmi : 45.4 1.3 kg / m ) were recruited from the istituto auxologico italiano , irccs , verbania , italy , where they were admitted for a multidisciplinary body weight - reduction intervention .
exclusion criteria included previous diagnosis of any disease affecting the endocrine system and metabolism such as t2d , chronic use of medications affecting metabolism and/or appetite , and 5.0 kg weight change during the 3 months preceding the study participation .
healthy lean male adolescents ( age : 14.3 0.1 yrs ; bmi : 20.5 0.5 kg / m ) and adults ( age : 32.1 2.7 yrs ; bmi : 24.1 0.8 kg / m ) were recruited among friends / colleagues and their sons .
tanner stage was evaluated in all ( lean and obese ) adolescents with no intergroup difference .
the four experimental groups ( obese and lean adolescents and adults ) were socioeconomically homogenous when evaluated by a specific questionnaire .
all subjects participated in this study after providing their free and informed consent . for subjects aged less than 18 yrs
, the informed consent was provided by their parents . before blood sampling , height and weight
standard blood tests , such as white blood cell ( wbc ) count with differential , comprehensive metabolic profile including glucose , cholesterol , triglycerides , and insulin levels and crp , were performed at the clinical laboratories of the istituto auxologico italiano , irccs , verbania , italy .
in addition to the blood samples used for the above - reported standard blood tests , a blood sample ( about 40 ml ) was drawn and placed immediately on ice .
( precisely tnf- , leptin , adiponectin , and ghrelin ) , while mononuclear cells were isolated by using a vacutainer cpttm ( becton dickinson , nj , usa ) , a sterile cell preparation tube with sodium citrate .
cells recovered from the layer just under the plasma layer were washed twice with pbs ph 7.4 and , after a last centrifugation , the pellet was suspended again by using an adapted amount of a specific buffer , which stabilizes cellular rna ( ambion united kingdom , distributed in italy by celbio , milan ) .
this cellular suspension was then stored at 80c until rna extraction ( see below ) .
circulating levels of adipokines and ghrelin and leukocyte expression of the related receptors were evaluated at the neuroendocrinology labs , department of clinical sciences and community health , university of milan , milan , italy . as an estimate of insulin resistance , fasting glucose and insulin levels
were used to compute the homeostatic model assessment of insulin resistance ( homa - ir ) , which was calculated in accordance with the following formula : ( insulin ( iu / ml ) glucose ( mg / dl))/405 .
total rna was isolated from the mononuclear cells using the trizol reagent ( life technologies , carlsbad , ca , usa ) according to the manufacturer 's instructions .
after purification rna was treated with dnase ( dna - free - ambion ) to avoid false - positive results due to amplification of contaminating genomic dna .
concentrations of total rna were determined from the absorbance value of the sample at 260 nm .
first - strand cdna was synthesized from 1 g of total rna in a final volume of 40 l using a high - capacity cdna archive kit ( applied biosystems , forster city , ca , usa ) .
the reaction conditions were 25c for 10 min and 37c for 2 h. cdna ( 2 l ) was subjected to real - time quantitative pcr using abi prism 7000 ( applied biosystems , forster city , ca , usa ) .
taqman pcr was performed in 25 l volumes using taqman universal pcr master mix ( applied biosystems , forster city , ca , usa ) .
taqman probe / primers specific for gapdh ( code no . ax-004253 - 00 - 0400 ) , human tnfr1 ( code no . ax-003934 - 00 - 0200 ) , human adipor2 ( code no . ax-007801 - 00 - 0200 ) , human obrl ( code no . ax-008015 - 00 - 0200 ) , and human gsr1a ( code no . ax-005513 - 00 - 0200 ) were purchased from euroclone , pero , italy .
all pcr assays were performed in triplicate and the data were pooled . before using the ct method for relative quantification , we performed a validation experiment to demonstrate that the efficiencies of target and reference were approximately equal .
the reaction conditions were as follows : 50c for 2 min , 95c for 10 min , followed by 40 cycles at 95c for 15 s ( denaturation ) and 60c for 1 min ( annealing and elongation ) . as controls ,
threshold cycle numbers ( ct ) were determined with an abi prism 7000 sequence detection system ( version 1.1 software ) and transformed using the ct ( 2 ) comparative method .
gene - specific expression values were normalized to expression values of gapdh ( endogenous control ) within each sample .
the levels of mrna of each receptor were expressed relative to the calibrator value of the same receptor in the corresponding lean ( adolescent or adult ) group ( controls ) .
the amount of target , normalized to an endogenous reference and relative to a calibrator , is given by 2 .
briefly , the ct value is determined by subtracting the average gapdh ct value from the average receptor ct value in the same sample ; the calculation of ct involves subtraction of the ct calibrator value .
plasma concentrations of adiponectin and leptin were measured by two commercially available radioimmunoassay ( ria ) kits ( millipore , st .
for adiponectin the sensitivity of the method was 1 ng / ml ; intra- and interassay coefficients of variation ( cv ) were 1.783.59% and 6.909.25% , respectively ; for leptin the sensitivity of the method was 0.44 ng / ml ; intra- and interassay cv were 3.48.3% and 3.06.2% , respectively .
plasma tnf- concentrations were measured by an enzyme - linked immunoabsorbent assay ( elisa ) kit ( ibl international gmbh , hamburg , germany ) .
the limit of detection of the method was determined to be 5.0 pg / ml .
total immunoreactive ghrelin concentration was determined with a commercial ria kit ( millipore , research park drive , st .
the lower and upper detection limits were 93 pg / ml and 6000 pg / ml , respectively , whereas intra- and interassay cv ( at 1500 pg / ml ) were 3.3% and 17.8% , respectively .
igf-1 concentrations were determined by the commercially available immunometric chemiluminescence assay immulite 2000 ( dpc ; los angeles , usa ) .
the sensitivity of the assay was 20 ng / ml . plasma glucose , ( total ) cholesterol , and triglycerides were determined by commercial colorimetric methods ( sigma diagnostics , st .
serum concentrations of insulin were measured by immunometric chemiluminescence ( immulite 2500 , dpc ; los angeles , usa ) ; the sensitivity of the method was 2 iu / ml ; intra - assay and interassay cv were < 5.5% and < 7.3% , respectively . a high - sensitivity immunochemiluminescent method was used to measure serum levels of crp ( immulite 2500 , dpc ; los angeles , usa ) , the analytical sensitivity being 0.01 mg / dl .
for each biochemical parameter , all of a single subject 's samples were run in the same assay and the order of tubes in the assay was randomized .
data were presented as mean sem ( standard mean error ) . as conventionally established
, the sample size was determined for giving 80% power at the 0.05 level of significance ( two - sided ) .
the expected mean difference of one adipokine ( precisely , fasting leptin levels , i.d .
, ~20 ng / ml ) between lean and obese groups and the estimated standard deviation of the same variable ( i.d . , ~3.0 ng / ml ) were deducted from the results reported in and on the basis of our personal previous experiences .
one - way anova , followed by bonferroni 's test , was used to investigate group differences in demographic , clinical , inflammatory , metabolic , and endocrine parameters .
exploratory analyses of all data were conducted by using pearson 's correlation to investigate whether tnf- , adiponectin , leptin , and ghrelin , their related receptors ( tnfr1 , adipor2 , obrl , and ghsr1a ) acute phase reactants ( crp and white blood cells ) , and homa - ir were associated with all other parameters . to formally test whether levels of the adipokines , ghrelin , their receptors , and inflammatory markers accounted for the degree of insulin resistance , backward stepwise linear regressions were calculated with homa - ir as dependent variable and tnf- , adiponectin , leptin , and ghrelin , their related receptors ( tnfr1 , adipor2 , obrl , and ghsr1a ) , acute phase reactants ( crp and neutrophil granulocytes ) , bmi , and age as independent variables in the entire population ( lean and obese adolescents and adults ) and in the two groups of ( lean or obese ) adolescents and adults .
demographic , clinical , inflammatory , metabolic , and endocrine data of the whole population recruited in the study are reported in table 1 . as expected , obese adults had significantly higher homa - ir and fasting insulin and triglycerides values compared to the corresponding lean group .
although not statistically significant , higher homa - ir , fasting insulin , and triglycerides values were also found in obese adolescents when compared to those of the corresponding lean group ( table 1 ) .
an inflammatory state was present in obese subjects , both adolescents and adults , as demonstrated by the significant higher values of crp and neutrophil granulocytes ( only absolute number ) ( table 1 ) .
there were no group differences in circulating levels of tnf- and leukocyte expression of tnfr1 ( figures 1 and 2 ) .
adiponectin concentrations were significantly higher in the lean groups than in the corresponding obese counterparts ; interestingly , obese adolescents had higher levels of this adipokine than obese adults ( figure 1 ) . also leukocyte expression of adipor2 was significantly higher in the lean groups than in the corresponding obese counterparts ; irrespective of bmi , adolescents had higher leukocyte mrna levels of adipor2 than adults ( figure 2 ) .
as expected , leptin concentrations were significantly higher in obese ( adolescent and adult ) groups than in the lean counterparts , whereas there was a lower leukocyte expression of obrl in obese adolescents or adults than in the corresponding lean groups ( figures 1 and 2 ) .
opposed to these results , circulating levels of ghrelin were significantly higher in lean adolescents and adults than in the related obese groups , while there was a higher leukocyte expression of ghsr1a in ( only ) lean adults than in obese adults ( figures 1 and 2 ) .
tables 24 summarize all significant correlations of tnf- , adiponectin , leptin , and ghrelin , their related receptors ( tnfr1 , adipor2 , obrl , and ghsr1a ) , acute phase reactants ( crp and white blood cells ) , and homa - ir with all other parameters . among these results
there were the correlations of adiponectin with neutrophil granulocytes , ghrelin , and leptin , of ghrelin with insulin , lymphocytes , monocytes , and leptin , of leptin with crp , insulin , and all leukocyte subpopulations , and of tnf- with igf-1 , neutrophil granulocytes , lymphocytes , and leptin ( table 2 ) .
leukocyte expression of tnfr1 was positively and negatively correlated , respectively , with those of adipor2 and ghsr1a , while circulating levels of leptin were negatively correlated with mrna levels of obrl in leukocytes ( table 3 ) .
finally , homa - ir was correlated positively with neutrophil granulocytes but negatively with leukocyte expression of adipo - r2 ( table 4 ) .
findings from the above ( bivariate ) correlation analysis were further explored using the stepwise multiple linear regression analysis with homa - ir as a dependent variable .
when all data ( i.e. , lean and obese adolescents and adults ) were considered , tnf- ( = 0.27 , p < 0.01 ) and neutrophil granulocytes ( absolute number ) ( = 0.36 , p < 0.01 ) were the only significant predictors of homa - ir . when the analysis was performed in ( lean or obese ) adults , in addition to tnf- ( = 0.34 , p < 0.01 ) and neutrophil granulocytes ( absolute number ) ( = 0.43 , p < 0.01 ) , also leptin ( = 0.51 , p < 0.01 ) and ghsr1a ( = 0.41 , p < 0.01 ) were significant predictors of homa - ir .
interestingly , none of the considered independent variables ( i.e. , adipokines , ghrelin , their receptors , inflammatory markers , bmi , and age ) accounted for the degree of insulin resistance in the adolescent group .
over the last two decades , our view of adipose tissue has been changed from that of an inert storage tissue to an active endocrine organ able to secrete a number of adipokines , such as adiponectin , tnf- , and leptin , which are reported to exert potent neuroimmunoendocrine effects [ 4345 ] .
reportedly , obesity promotes a state of chronic low - grade inflammation , which is reflected not only by an increased production of pro - inflammatory cytokines and adipokines by adipose tissue but also by a cellular component , which is represented by macrophages whose number is dramatically increased in obesity .
thus , local synthesis and release of chemoattractants that enhance the homing of monocytes to adipose tissue depots are thought to induce adipose tissue inflammation .
the development of t2d is characterised by two processes : ( 1 ) insulin resistance , resulting from impaired insulin signalling and leading to an increased demand for insulin , which must be met by increased insulin production by pancreatic cells ( compensatory -cell function ) ; ( 2 ) -cell dysfunction , with t2d developing when the amount of insulin that is produced is insufficient to meet the demand .
the low - grade inflammation found in overweight and obesity , especially in case of abdominal fat accumulation , has been implicated in -cell dysfunction and induction of insulin resistance [ 1 , 48 ] . differently from the situation in obese adults ,
the pathophysiology of inflammation has not been fully studied in obese adolescents and also no clear - cut consensus exists on the temporal establishment of insulin resistance [ 3941 ] .
the population recruited in the present study was composed of lean and obese adolescents and adults .
it is noteworthy that only obese adults had significantly higher insulin levels and homa - ir values than the corresponding lean group , while in obese adolescents the statistical significance was not reached because of a widespread variability of the same metabolic parameters , which is well known in paediatric literature [ 49 , 50 ] .
most studies in obese paediatric population show consistent increases in crp , but not in tnf- , which is frequently reported to be elevated in obese adults [ 5 , 39 , 51 ] . in the present study , irrespective of crp , which was higher in obese adolescents and adults compared to the lean counterparts ,
there were no group differences in circulating levels of tnf- and leukocyte expression of tnfr1 , which is one of the receptors to which this cytokine binds .
these findings are not surprising because other works found similar circulating levels of tnf- in lean and obese subjects [ 53 , 54 ] , one reason being the combination of extremely low concentrations of this cytokine and the sensitivity of the analytical method .
anyway , the lack of any group difference in tnf- does not damper the potential pathophysiological role of this cytokine .
in fact , when all data ( i.e. , lean and obese adolescents and adults ) were pooled in the analysis of stepwise linear regression , tnf- and neutrophil granulocytes were significant predictors of homa - ir . interestingly , tnf- and
neutrophil granulocytes still accounted for the degree of insulin resistance in the adult but not in the adolescent group .
based on these findings , one might argue that tnf- plays a key role in low - grade inflammation - induced -cell dysfunction that precedes the overt insulin resistance in obese adults [ 5 , 56 ] .
the adolescents recruited in the present study may have been obese for a relatively short time ( which corresponds to their young age , i.e. , 1015 years ) .
if inflammatory cytokines are the result of macrophage infiltration into the adipose tissue , it is possible that more time is required for this infiltration and the deleterious effects of tnf- to occur .
thus , a dissociation between low - grade inflammation and insulin resistance appears to be present in obese adolescents .
this study has confirmed that the long leptin receptor splice variant ( obrl ) is expressed in blood mononuclear cells from lean and obese subjects .
obese adolescents and adults had lower relative expression levels of obrl mrna transcripts compared with lean counterparts .
interestingly , there was an overall significant inverse correlation of leptin receptor transcript with the bmi and the circulating leptin levels , suggesting that the degree of adiposity and/or the elevation in leptin levels might influence the gene expression of obrl . assuming that the downregulation of obrl reflects a similar reduction in leptin receptor numbers on the cell surface ( i.e. , mrna versus protein levels )
in support of this intriguing hypothesis , there is experimental evidence to suggest that the expression of leptin receptor(s ) is sensitive to both genetic and physiologic interventions that cause a change in circulating leptin levels [ 57 , 58 ] . in this context , ob / ob mice that lack leptin have elevated levels of total leptin receptor expression . in the present study , there was no difference in leukocyte expression of obrl between obese adolescents and adults , this finding being expected because of the similar high leptin levels in both obese groups . while homa - ir was not associated with obrl , leptin was a predictor of homa - ir only in obese adults
. therefore , the downregulation of obrl in obese subjects seems to be only a consequence of the high leptin levels , whereas leptin should be considered a determinant factor in worsening of insulin resistance in obese adults .
the correlations of leptin with crp and white blood cells , which were found also in the present study , confirm the implication of this peptide in sustaining the low - grade inflammation and , ultimately , -cell dysfunction in obesity .
anyway , these correlations could also be due to any other metabolic factors related to hyperleptinemia actually present in obesity .
furthermore , ghrelin may play a role in energy balance , glucose and lipid metabolism , and blood pressure regulation .
these physiological functions can explain the associations of low serum ghrelin levels with insulin resistance , t2d , and blood hypertension in general population as well as carotid atherosclerosis in older people with metabolic syndrome [ 6365 ] .
although there are few studies in animal models and humans to indicate that ghrelin has any anti - inflammatory effect , progression of the low - grade inflammation in obesity might be accelerated by decrease in circulating levels of ghrelin and/or ghsr1a - mediated signalling in immune cells . in the present study ,
as expected , obese subjects had significantly lower levels of ghrelin than the corresponding lean groups ; anyway , only obese adults exhibited an upregulation of ghsr1a in leukocytes .
while ghrelin was negatively correlated with insulin , leukocyte expressions of ghsr1a and tnfr1 were inversely correlated .
importantly , ghsr1a was a predictive factor of homa - ir in obese adults , but not in obese adolescents .
these findings would suggest the establishment of a ( deleterious ? ) compensatory mechanism mediated by ghsr1a in obese adults to overcome the reduced levels of ghrelin , an allegedly diabetogenic peptide .
adiponectin is a versatile cardiovascular protective factor , which plays an important role in regulating insulin sensitivity and energy homeostasis , with antiinflammatory and anti - atherosclerotic properties .
including obesity and t2d , hypoxia , oxidative stress , and inflammation suppress adiponectin secretion from adipose tissue [ 70 , 71 ] .
interestingly , exogenous supplementation of recombinant adiponectin attenuates insulin resistance , improving metabolic disorders . in the present study , circulating levels of adiponectin were lower in obese subjects compared to the lean groups ; furthermore , obese ( but not lean ) adolescents had higher adiponectin levels than the corresponding adult group .
as no age - dependence of adiponectin levels was found , a persistent obese state might be involved in the reduced secretion of this adipokine in the adult age or , alternatively , the markedly low adiponectin levels might explain the hyperinsulinemia and the higher homa - ir values in obese adults when compared to the obese adolescents .
leukocyte expressions of adipor2 were significantly higher in the lean groups than in the corresponding obese counterparts , indicating an obesity - related downregulation of this receptor , which , combined with the hypoadiponectinemia , might explain the establishment of insulin resistance in obese adults .
along this view , the findings that adiponectin and adipor2 were negatively correlated , respectively , with white blood cells and homa - ir would suggest the existence of a link among adiponectin signalling , low - grade inflammation , and insulin resistance . in accordance with the negative correlation of adipor2 with age , ( lean or obese ) adolescents had higher leukocyte mrna levels of this receptor than ( lean or obese ) adults .
furthermore , the correlations of adipor2 with leptin , and tnfr1 or of adiponectin with ghrelin and leptin would indicate a crosstalk among adipokines and the related receptors , although other metabolic factors might be decisive for altered secretion of ghrelin , leptin and adiponectin as well as for the altered expression of adipor2 and tnfr1 .
alterations of a single component of the adipokine system would provoke deleterious effects at systemic levels , particularly on glucose metabolism . in the present study ,
many correlations of adipokines , ghrelin , and the related receptors with anthropometric and metabolic parameters were found . with these associations being
anyway , some correlations , including those of ghsr1a with height or of igf-1 with tnf- , appear to be of great interest , but their discussion is beyond the aims of the present study . before closing , some limitations of the present research need to be mentioned .
first of all , only a limited number of adipokines / cytokines / peptides and related receptors were investigated ; anyway , the adipokine profiling that was defined in the present study is sufficient to suppose the existence of a dissociation between insulin resistance and low - grade inflammation in obese adolescents and of an unbalance of pro- and anti - inflammatory factors in obese adults , who are at high risk to develop insulin resistance and t2d .
second , receptor expression was evaluated in leukocytes , which are easily isolated from whole blood ; anyway , biopsy specimens from adipose tissue or hypothalamus , which would have provided more information , represent an invasive or impracticable approach ; the notion that leukocytes include monocytes from which adipose macrophages are derived should be recalled .
third , the results should be cautiously interpreted because they are only based on statistical considerations , which do not actually imply any form of causation .
finally , the present study is cross - sectional and only two distinctive obese ( not - diabetic ) groups ( i.e. , adolescents and adults ) were recruited .
a long - term prospective study , including obese adolescents with at least 20-year followup , would allow us to better evaluate the role of the single adipokines and the receptor changes in the pathophysiology of insulin resistance and t2d , but this is , obviously , difficult to conduct not only for economic reasons .
in conclusion , this study demonstrates that obese adults exhibit alterations in circulating levels of some adipokines ( particularly , adiponectin and leptin ) and ghrelin and in leukocyte expressions of the related receptors ( i.e. , adipor2 , obrl , and ghsr1a ) , which sustain a low - grade chronic inflammation as demonstrated by their associations with some acute phase reactants , including crp and white blood cells . in the same group tnf- , leptin , ghsr1a , and
since none of the adipokines tested , ghrelin , the related receptors , and acute phase reactants are associated with homa - ir in obese adolescents , a dissociation between the low - grade inflammation and insulin resistance is supposed to exist in the early phases of obesity . based on these remarks , any effort , including diet , exercise , and pharmacological intervention , should be made in paediatric obese population to early contrast the low - grade inflammation and to avoid the occurring of an overt insulin resistance .
novel pharmacological strategies , including adipokine agonist / antagonists or anti - inflammatory drugs , might be of valuable interest in this context [ 72 , 74 ] . | obese adults frequently exhibit a low - grade inflammation and insulin resistance , which have been hypothesized to be established early in childhood .
aim of this study was to evaluate the age - dependent relationships between inflammatory state and insulin resistance in obese adolescents and adults .
clinical and metabolic parameters , circulating adipokines ( tnf- , adiponectin , and leptin ) , ghrelin , their leukocyte receptors ( tnfr1 , adipor2 , obrl and ghsr1a ) , and acute phase reactants ( crp and white blood cells ) were assessed in lean and obese adolescents compared with the adult counterparts .
only obese adults had higher homa - ir , insulin , and triglycerides compared to the lean group .
an inflammatory state was present in obese adolescents and adults , as demonstrated by the higher values of crp and neutrophils .
there were no group differences in circulating levels of tnf- and leukocyte expression of tnfr1 .
adiponectin concentrations and leukocyte expression of adipor2 were higher in the lean groups than in the corresponding obese counterparts . for leptin and leukocyte expression of obrl , the results were opposed .
circulating levels of ghrelin were higher in lean adolescents and adults than the related lean groups , while there was a higher leukocyte expression of ghsr1a in ( only ) lean adults than obese adults . when the analysis was performed in ( lean or obese ) adults , tnf- , neutrophils , leptin , and ghsr1a were predictors of homa - ir .
none of the considered independent variables accounted for the degree of insulin resistance in the adolescent group . in conclusion ,
a dissociation between the low - grade inflammation and insulin resistance is supposed to exist in the early phases of obesity . |
adolescents constitute 20% of the world population and are estimated to be 1.13 billion by the year 2025 .
adolescence is a period of rapid growth and development by which up to 45% of skeletal growth takes place and 15 to 25% of adult height is achieved [ 1 , 3 ] .
in addition to the increased nutritional requirements during adolescence period , poor dietary diversity and dietary inadequacies are more likely threats among adolescents due to their erratic eating pattern and having specific psychosocial factors [ 1 , 4 , 5 ] .
malnutrition passes from generation to generation , because adolescent girls that enter pregnancy with poor nutrient store are more likely to give birth to low birth weight or intrauterine growth restricted baby that is more vulnerable to metabolic disorders later in life .
so adolescence period is a unique opportunity to break a range of vicious cycles of structural problems that are passed from one generation to the next , such as poverty , gender discrimination , violence , poor health , and nutrition [ 1 , 4 ] .
study done in khagrachari district , bangladesh , shows that 13.67% of adolescent girls were severely stunted and 20.33% were moderately stunted .
another study done in rural areas of bangladesh shows that 32% of the adolescent girls were stunted .
according to different studies done in india the prevalence of stunting ranges from 11.7% to 34.2% [ 912 ] .
studies done in asembo and mumias , kenya , and tunisia reported that the prevalence of thinness was 15.6% and 1.3% , respectively [ 13 , 14 ] . according to the study done on the rural communities of tigray , ethiopia ,
age , family size , mother education status , wealth index , lack of latrine were the commonly mentioned factors that influence the nutritional status of the adolescents .
despite the fact that adolescents are future mothers and need critical attention , they are the most neglected age groups [ 1 , 4 ] .
the intergenerational cycle of malnutrition has to be broken by strategies to improve nutrition of adolescents .
there is limited information about the nutritional status and associated factors in adolescent girls in ethiopia especially including pubertal landmarks which is critical for creating strategies and interventions on these target groups .
therefore , this study will address the gap by assessing the nutritional status and associated factors of adolescent school girls in adwa town .
this study was conducted from march to april 2015 to assess prevalence of thinness , stunting , and associated factors among adolescent school girls in adwa town , ethiopia .
adwa town is in central tigray zone , northern ethiopia , which is 935 km from addis ababa , ethiopia . in the academic year 2014/2015
the total number of adolescent girls from grade 4 to grade 12 was 5974 of which 5603 were from government schools and the remaining 371 are from nongovernment schools ( adwa town education office ) .
the study utilized institution - based cross - sectional study design with quantitative data collection method and anthropometric measurements .
the study population included all regular adolescent girls attending grades 412 who were randomly selected by computer generated method in the randomly selected schools .
adolescent school girls who were seriously ill and unable to stand by themselves were excluded from the study .
the sample size was calculated using single population proportion formula with the assumptions of prevalence of thinness 58.3% , which was obtained from research conducted among rural adolescent girls of rural community of tigray , ethiopia . using 5% margin of error , 95% confidence level , 10% nonresponse rate , and the design effect of two the calculated sample size was 823 , but due to the 1.09% nonresponse rate information was collected from 814 students , by which 732 were from government schools and 82 from private schools . the sample was obtained using multistage sampling technique . during the first stage , schools were stratified into government and private schools . in the second stage from government schools
2 primary schools , 1 high school , and one preparatory school were selected by using lottery method out of 10 primary schools , 3 high schools , 2 preparatory schools , and 1 private school , which was included purposively since it was the only school from grade 4 to grade 12 .
finally , the total sample size was distributed proportionally to the selected schools based on the total number of students in each school .
individual students from each school were selected by using simple random sampling technique using computer generated random numbers .
the questionnaire was pretested on 5% ( 41 ) adolescent girls in a school other than those included in the sample .
data collectors and supervisors were trained for one day to have consensus and same understanding of what is intended to be measured by each question in the questionnaire .
all the interviewers and supervisors were able to communicate in the local language , tigrigna .
the study was reviewed and approved by institution research review boards , institute of public health at the university of gondar .
individual assent was obtained by explaining the purpose and the importance of the study to the adolescent girls .
parental consent from the parents was obtained by sending consent form with the students the day prior to the data collection .
moreover , confidentiality of the information was assured by using anonymous questionnaires and by keeping the data in a secured place .
family income of the adolescent girls was assessed by using wealth index which is a good method of assessing economic status of a family .
stadiometers with a sliding headpiece attached to digital weight scale were used to measure height and weight , respectively .
height was measured to the nearest 0.1 cm and weight to the nearest 0.1 kg in standing position .
the scales were carefully handled and periodically calibrated by placing standard calibration weights of 2 kg iron bars on the scale .
if the scale weight did not match the calibration weight , the scale was calibrated by adjusting its calibration screw while the calibration weight was on the scale . to avoid variability among the data collectors ,
anthropometric measurements were converted to height - for - age and bmi - for - age z scores by using antro plus software .
girls with height - for - age below 2z scores and bmi - for - age below 2z scores of the 2007 who reference population were classified as stunted and thin , respectively .
the definitions of terms are as follows : thinness : bmi - for - age < 2z scores of the 2007 who reference ; stunting : height - for - age < 2z scores of the 2007 who reference ; adolescents : individuals in the age group of 1019 years of age : early adolescents : adolescents in the age group of 1013 years of age ; middle adolescents : adolescents in the age group of 1416 years of age ; late adolescents : adolescents in the age group of 1719 years of age ; poor dietary diversity : adolescent girls with dietary diversity score below the median value ( < 4 food groups ) ; good dietary diversity : adolescent girls with dietary diversity score of the median and above the median values ( 4 food groups ) ; high mass media exposure : adolescent girls who had listened to radio or watched television or read newspaper / magazines at least once a week ; low mass media exposure : adolescent girls who had not listened to radio or watched television or read newspaper / magazines at least once a week ; improved source of water : including tap water , public tap , and protected well ; nonimproved source of water : including unprotected spring and unprotected well.the dependent variables were thinness and stunting while the following factors were included in the model as independent variables : sociodemographic characteristics ( age , wealth index , family size , mother education , father education , place of residence , and type of school ) , menstruation status , physical activity , meal pattern , dietary diversity , source of drinking water , availability of home latrine , and mass media exposure .
thinness : bmi - for - age < 2z scores of the 2007 who reference ; stunting : height - for - age < 2z scores of the 2007 who reference ; adolescents : individuals in the age group of 1019 years of age : early adolescents : adolescents in the age group of 1013 years of age ; middle adolescents : adolescents in the age group of 1416 years of age ; late adolescents : adolescents in the age group of 1719 years of age ; early adolescents : adolescents in the age group of 1013 years of age ; middle adolescents : adolescents in the age group of 1416 years of age ; late adolescents : adolescents in the age group of 1719 years of age ; poor dietary diversity : adolescent girls with dietary diversity score below the median value ( < 4 food groups ) ; good dietary diversity : adolescent girls with dietary diversity score of the median and above the median values ( 4 food groups ) ; high mass media exposure : adolescent girls who had listened to radio or watched television or read newspaper / magazines at least once a week ; low mass media exposure : adolescent girls who had not listened to radio or watched television or read newspaper / magazines at least once a week ; improved source of water : including tap water , public tap , and protected well ; nonimproved source of water : including unprotected spring and unprotected well .
bivariate analysis was done and variables with p value less than 0.2 were included in the multiple logistic regression analysis .
odds ratio and 95% confidence intervals were also computed along with the corresponding p value .
from the total of 823 adolescent girls , 814 responded to the questionnaire making the response rate 98.9% .
the mean age of the study participants was 15.27 years ( 15.27 2.05 sd ) .
seven hundred thirty - two ( 89.9% ) of the respondents were from government schools and the remaining 82 ( 10.1% ) were from private schools .
three hundred thirty - three ( 40.9% ) of the mothers of the study subjects had no formal education followed by secondary level of education , 181 ( 22.3% ) .
nearly one - quarter , 210 ( 25.8% ) , of respondents were found in the first quintile range of wealth index ( table 1 ) . from the total of 814 respondents , 543 ( 66.7% ) of them usually ate 3 or more meals per day .
four hundred twenty - three ( 52.0% ) of the respondents had good dietary diversity and the remaining 391 ( 48.0% ) had poor dietary diversity score .
from the total respondents , 97 ( 11.9% ) had history of illness in the past two weeks prior to the data collection . regarding physical activity of the respondents , 800 ( 98.3% ) and 561 ( 68.9% ) were involved continuously in walking for > 30 minute per day and moderate intensity sport activities for 10 minutes continuously per day , respectively .
seven hundred fifteen ( 87.8% ) of the respondents used drinking water from improved source .
four hundred fifty ( 55.3% ) and 661 ( 81.2% ) of the study subjects reported that home gardening and home latrine were available in their home , respectively . of the total 814 respondents , 671 ( 82.4% )
had high mass media exposure and the remaining 143 ( 17.6% ) had low mass media exposure .
five hundred sixty - five ( 69.4% ) of the respondents had information about adolescent nutrition and 249 ( 30.6% ) did not have information about adolescent nutrition .
the overall prevalence of thinness and stunting among adolescent school girls of adwa town was 21.4% ( 95% ci = 18.5% , 24.2% ) and 12.2% ( 95% ci = 9.9% , 14.4% ) , respectively .
the odds of thinness were 2.15 times higher among adolescent girls in the early adolescent stage as compared to adolescent girls in the late adolescent stage [ aor ( 95% ci ) = 2.15 ( 1.14,4.03 ) ] .
adolescent girls in government schools were 2.89 times more likely to be thin as compared to adolescent girls from private schools [ aor ( 95% ci ) = 2.89 ( 1.20,6.91 ) ] .
the odds of thinness were 3.27 [ aor ( 95% ci ) = 3.27 ( 1.98,5.40 ) ] times higher among adolescent girls who use water from unimproved source as compared to adolescent girls who use water from improved source ( table 2 ) .
adolescent girls who were from family size of greater than five were 2.05 times more likely to be stunted as compared to adolescent girls from family size of less than or equal to five [ aor ( 95% ci ) = 2.05 ( 1.31,3.23 ) ] .
adolescent girls who did not start menstruation were 2.80 [ aor ( 95% ci ) = 2.80 ( 1.75,4.48 ) ] times more likely to be stunted as compared to adolescent girls who started menstruation ( table 3 ) .
this prevalence is higher when compared to studies done in asembo and mumias , kenya ( 15.6% ) , tunisia ( 1.3% ) , and 10% of tamale metropolis , ghana [ 13 , 14 , 17 ] .
the possible explanation for this difference could be due to difference in the study group since unlike this study which assessed the early , middle , and late stages of adolescent , study done in tunisia considered adolescents in the middle and late stages which are less likely to be thin because of less possibility of height growth than early adolescents .
the variation could also be due to socioeconomic and cultural difference in dietary habit and care practices .
the prevalence in this study is lower than the findings of studies done in bangladesh , tamil nadu and west bengal , india , and tigray , ethiopia , where 26% , 28.2 , 40.94% , and 58.3% of the adolescent girls were thin , respectively [ 8 , 10 , 12 , 15 ] .
this difference might be due to urban rural difference since , unlike this study which included adolescent school girls from both urban and rural setting , the above studies included adolescent girls only from rural settings which are more likely to be involved in activities which need more energy expenditure .
this finding is lower than the findings of studies done in west bengal and tamil nadu , india , urban area of umuahia , nigeria , and tigray , ethiopia , by which 34.2% , 19.2% , 57.8% , and 26.5% of the adolescents were stunted , respectively [ 10 , 12 , 15 , 18 ] .
this difference might be due to the difference in the study setting by which , unlike this study which included urban and rural adolescent girls , the above studies were done in rural areas by which unhealthy household environmental factors are more likely to be common than the urban setting
. the difference could also be due to time gap variation as nowadays knowledge of parents under nutrition and its consequence is improving .
the likelihood of being thin was higher among adolescents in the early and middle stage of adolescence than late stage of adolescence .
adolescent girls in the early stage of adolescence were 2.15 times more likely to be thin as compared to adolescent girls in the late stage of adolescence .
this finding is similar with findings from belgaum and karnataka , india , and tigray , ethiopia [ 15 , 19 ] .
this might be due to the increased growth spurt during the early and middle adolescent stage compared to late adolescent with sudden increase of height in the early and middle adolescents than late adolescents .
adolescent girls enrolled in government school were 2.89 times more likely to be thin as compared to adolescent girls from private school .
this finding is in line with findings from delhi , india , and jimma , ethiopia [ 20 , 21 ] .
this might be due to differing school environment by which government schools environment is less hygienic than the private school predisposing students to infection that leads to poor nutritional status .
other reasons could be that government schools include students who came from rural areas involved in higher energy expenditure activities but private school students are mainly from urban areas .
this finding also could be due to poor economic status of government school adolescent girls ' parents .
adolescent girls who usually eat less than 3 meals per day are 1.66 times more likely to be thin as compared to adolescent girls who usually eat 3 or more meals per day .
this finding is in line with the finding from islamabad city , pakistan , and tamale metropolis , ghana [ 17 , 22 ] .
adolescence period has the fastest growth and the nutritional requirements are increased to promote this growth .
so , in addition to the increased nutritional demand during adolescent period , skipping of meals leads to being thin .
adolescent girls who were from family size of greater than five were about 2.53 times more likely to be thin as compared to adolescent girls from family size of less than or equal to five .
this finding is in line with findings from tamil nadu , delhi , and assam , india , and jimma , ethiopia [ 10 , 11 , 20 , 21 ] .
this might be due to having more family members which could lead to sharing of the available food for the large household members causing inadequate consumption of food leading to being thin .
this finding also could be due to increased family size mostly occurring in uneducated parents who are more likely to accept and practice food taboos affecting mostly females .
adolescent girls whose mothers did not have formal education were 2.34 times more likely to be thin as compared to those whose mothers have completed college and higher education .
this is due to the fact that if the level of education of the mother is low , her decision making and her contribution to the total family income will be low .
adolescents who use drinking water from unimproved source are 3.27 times more likely to be thin as compared to adolescent girls who use drinking water from improved source
. this might be due to the fact that impure water is vehicle for intestinal parasites which leads to loss of appetite leading to poor nutritional status .
adolescent girls who were from family of greater than five individuals were 2.05 times more likely to be stunted as compared to adolescent girls from family of less than or equal to five individuals .
this finding is in line with the findings from tamil nadu and assam , india , and jimma , ethiopia [ 10 , 11 , 21 ]
. this might be due to sharing of the available food for the large household members causing inadequate consumption of food leading to be stunted .
adolescent girls who did not start menstruation were 2.80 times more likely to be stunted as compared to adolescent girls who started menstruation .
this is in line with the findings of studies done in mumias and asembo , kenya , and wannune benue state , nigeria [ 13 , 23 ] .
this might be explained by the fact that starting menstruation coincides with the adolescent growth spurt .
delay in menstruation in stunted adolescents shows the opportunity for catch - up growth as stunting delay menarche .
the odds of stunting were 3.82 times higher among adolescent girls who use water from unimproved source as compared to adolescent girls who use water from improved source .
this might be due to repeated infection causing depressed immunity and making the severity and duration of disease more sever contributing to poor nutritional status of the adolescents .
thinness and stunting are prevalent problems in the study area . age of the respondent , type of school enrolled , meals eaten per day , education status of mother , source of drinking water , and family size were significantly associated with thinness among the respondents .
menstruation status , family size , and source of drinking water were significantly associated with stunting among respondents .
the result of this study helps in understanding of the magnitude of the problem in the area .
as results from different study show micronutrient supplementation for adolescent girls should be provided to improve their nutritional status .
a major strength of this study was the random selection of the schools and adolescents .
generalization may be made to adolescent girls in the study areas as an attempt was made to identify randomized schools and adolescents from the study area .
another strength of this study was the use of dietary diversity as a proxy measure of micronutrient adequacy .
the major limitation of this study was the failure to collect information on variables like food taboos and carrying food to schools .
another limitation of the study was the use of cross - sectional study design which makes any inference of growth pattern over time difficult .
the cross - sectional nature of the study could only generate a hypothesis about the possible role of certain independent variables on the nutritional status of these adolescent girls but not their causal relationships . | introduction . despite the fact that adolescence is a window of opportunity to break the intergenerational cycle of malnutrition , adolescents are the neglected age groups .
hence information regarding the nutritional status of adolescents is lacking making creating and implementing intervention programs difficult .
objective . to assess the prevalence of thinness , stunting , and associated factors among adolescent school girls in adwa town , northern ethiopia
. methods . data on 814 adolescent female students were collected from march to april 2015 using interviewer administered pretested semistructured questionnaire and anthropometric measurements .
data were entered using epi info version 3.5.3 and analyzed using spss version 20 and who anthroplus software .
results .
the prevalence of thinness and stunting was 21.4% and 12.2% , respectively .
age of adolescent [ aor = 2.15 ( 1.14,4.03 ) ] , mother 's educational status [ aor = 2.34 ( 1.14,4.80 ) ] , eating less than 3 meals per day [ aor = 1.66 ( 1.12,2.46 ) ] , having family size > 5 [ aor = 2.53 ( 1.66,3.86 ) ] were significantly associated with thinness among the adolescent girls .
family size > 5 [ aor = 2.05 ( 1.31,3.23 ) ] and unimproved source of drinking water [ aor = 3.82 ( 2.20,6.62 ) ] were significantly associated with stunting .
conclusion and recommendation .
thinness and stunting are prevalent problems in the study area . strategies to improve the nutritional status of girls should be given much attention . |
we present a case of bilateral extensive peripapillary myelinated retinal nerve fibers ( mrnf ) in an individual with crouzon syndrome , an inherited form of craniosynostosis caused by overactivation of fibroblast growth factor receptor 2 . as a secondary aim
, we examine the utility of optical coherence tomography ( oct ) angiography for visualization of peripapillary vasculature obscured by myelination on other imaging modalities .
a 24-year - old woman with crouzon syndrome was evaluated for suspected optic neuritis in the right eye .
oct angiography provided excellent visualization of peripapillary retinal vessels , which were partially obscured by myelination on other imaging modalities .
this association of crouzon syndrome with bilateral peripapillary mrnf may lend insight into the developmental control of optic nerve myelination , the pathogenesis of mrnf , and the potential role of growth factors in these processes .
further , oct angiography allowed for excellent blood vessel visualization in this case of mrnf .
myelinated retinal nerve fibers ( mrnf ) appear as grey or white striated patches with feathered borders , and are estimated to occur in 1% of the population .
mrnf are typically congenital , and therefore likely represent anomalies of myelination control in utero .
they are most commonly unilateral , with only 7.7% of cases estimated to occur bilaterally .
we present a case of bilateral extensive peripapillary mrnf surrounding the majority of the optic disc circumference in a patient with crouzon syndrome , an autosomal dominant craniosynostosis disorder with high penetrance and variable expressivity .
crouzon syndrome is caused by mutation of the fibroblast growth factor receptor 2 ( fgfr2 ) gene , leading to overactivation that promotes premature fusion of cranial sutures .
this can result in craniofacial and orbital structural anomalies , and has been associated with various ophthalmic manifestations including myopia , proptosis , hypertelorism , exotropia , globe subluxation , coloboma , and optic atrophy . to our knowledge , mrnf have not been previously described in association with crouzon syndrome .
we examine the potential common pathogenic mechanism for both the mrnf and craniosynostosis in crouzon syndrome , and the role of fgfr2 in the developmental control of optic nerve myelination .
mrnf are typically asymptomatic and found incidentally on ophthalmic examination . however , because they are located superficially , mrnf can obstruct the view of underlying retinal vessels .
adequate visualization of retinal vasculature in cases of mrnf is important , as the abnormal structure and thickening of the nerve fiber layer may play a role in the development of significant retinal vascular disorders.5 , 6 , 7 , 8 as a secondary aim of this report , we evaluate the use of optical coherence tomography ( oct ) angiography for visualization of peripapillary vessels obscured by myelination on other imaging modalities .
a 24-year - old caucasian woman was referred to neuro - ophthalmology clinic by her general ophthalmologist for suspicion of optic neuritis in the right eye .
she had become aware of a scotoma in the superonasal visual field of her right eye over the prior six months . additionally , she reported restricted ocular motility with binocular horizontal diplopia on left lateral gaze .
she denied pain with eye movement , but described mild right - sided retrobulbar pain .
the scotoma disappeared and the retrobulbar pain subsided while she was on a prior 5-day course of intravenous steroids .
the patient was diagnosed with crouzon syndrome as a child by genetic testing , which revealed mutation of the fgfr2 gene .
she previously had multiple facial and nasal corrective surgeries but no prior ocular or orbital surgeries .
past medical history also included depression and anxiety , and her only medication was escitalopram .
laboratory studies , including complete blood count , erythrocyte sedimentation rate , lupus anticoagulant panel , vitamin b12 , folate , aquaporin-4 antibody , rheumatoid factor , and lyme antibody titers performed 4 months prior were within normal limits .
an outside report of a gadolinium - enhanced mri of the brain and orbits revealed no significant abnormality of the optic nerves or other orbital structures .
the patient was adopted and her family history was unknown . on examination , the patient had craniofacial structural abnormalities consistent with crouzon syndrome .
uncorrected distance visual acuity was 20/25 in the right eye , with pinhole improvement to 20/20 , and 20/20 in the left eye .
ishihara color vision testing showed correct identification of 14 out of 14 plates in both eyes .
pupils were reactive to light , with a trace afferent pupillary defect in the right eye .
1 ) revealed a superonasal visual field defect with mean deviation ( md ) of 4.64 db and foveal threshold of 35 db in the right eye .
hvf testing of the left eye was normal with md of 1.56 db and foveal threshold of 39 db .
dilated funduscopic examination revealed extensive whitish peripapillary mrnf with irregular , feathered borders in both eyes .
this finding was further visualized with color and red - free fundus photography ( fig . 2 , fig .
myelinated fibers spanned roughly three - quarters of the circumference of the optic disc ( 9/12 clock hours ) in both eyes .
the inferotemporal sector of each disc was largely unaffected , and these visible disc margins appeared crisp and with normal contour . however , most portions of the peripapillary retinal vasculature and optic disc margins underlying the myelinated fibers were not readily visible .
swept - source oct of both optic nerve heads demonstrated a substantially thickened retinal nerve fiber layer ( fig .
tokyo , japan ) of the optic discs revealed normal blood vessel anatomy , with no tortuosity or other structural anomalies in either eye ( fig . 3 ) .
upon review of the previous gadolinium - enhanced mri of the orbits , enhancement of the right posterior orbit was evident involving the medial and lateral rectus muscles and posterior intraorbital optic nerve .
a diagnosis of idiopathic orbital inflammatory syndrome ( iois ) was made , in accordance with the patient 's mild limitation in ocular motility and non - specific orbital inflammation on mri .
the patient 's recent - onset visual field defect , while not typical of iois , was nonetheless determined to have occurred as a consequence of optic nerve inflammation .
the bilateral extensive mrnf were determined to be an incidental finding associated with the patient 's crouzon syndrome , though not contributory to the patient 's visual symptoms .
the precise etiology of mrnf is not known , however the pathogenesis is believed to involve defects of the lamina cribrosa,9 , 10 , 11 or the presence of intraretinal oligodendrocytes irrespective of lamina cribrosa function .
rarely , mrnf may be acquired in childhood in association with optic nerve structural abnormalities that can cause changes to the lamina cribrosa , such as optic nerve gliomas or optic nerve sheath fenestration .
elbaz et al have demonstrated an association between mrnf and a history of stroke , and suggest that such cases of acquired mrnf may result from stroke - related structural changes in the lamina cribrosa , or from upregulation of growth factors and production of new myelin by oligodendrocytes after an ischemic event . of note ,
proper proliferation , migration , and differentiation of oligodendrocytes and their progenitor cells depend on signaling from multiple growth factors between neurons and glia , including platelet derived growth factor , insulin - like growth factor 1 , and fibroblast growth factors , among others
. disruptions to the precise and coordinated temporal and spatial expression of signaling molecules or their receptors can result in aberrant patterns of myelination . that the pattern of myelination in this case was bilateral serves as an initial suggestion of a non - coincidental association between the patient 's developmental anomalies and intraretinal myelination .
further , the extensive peripapillary distribution of mrnf surrounding the majority of the optic disc in this case is striking , as most cases of mrnf are localized to an individual sector adjacent to the disc and typically involve less than half the disc circumference .
the findings in this case may lend insight into the developmental control of optic nerve myelination , and the potential role of fgfr2 in this process .
several mutations in the fgfr2 gene have been reported to cause crouzon syndrome ; these mutations appear to overactivate signaling by the fgfr2 protein , which promotes premature fusion of bones in the skull .
fgfr2-iiic , for example , is one of the isoforms involved in crouzon syndrome and is also expressed by astrocytes in humans , though its potential role in cns myelination in humans has not been elucidated . in mice ,
however , cns myelination by oligodendrocytes requires fgfr2 , and in vitro analysis has demonstrated that fgfr2 helps regulate oligodendrocyte process growth .
expression of fgfr2 and its ligands has also been detected in the human and mouse optic nerve and retina.22 , 23 , 24 this molecular link between developmental anomalies in crouzon syndrome and myelination in animal and in vitro models may indicate that an overactivation of fgfr2 signaling might be associated with abnormal regulation of myelination .
the development of mrnf in this case of crouzon syndrome may also be structural in origin .
in humans , myelination of retinal ganglion cell axons begins at the lateral geniculate nucleus in the fetus and ends at the lamina cribrosa at birth or shortly thereafter .
the lamina cribrosa a complex network of astrocyte processes , neurons , and connective tissue is believed to block migration of oligodendrocytes and/or their precursors into the retina.10 , 11 structural abnormalities of the lc may therefore permit oligodendrocyte access to the retina , leading to intraretinal myelination .
khan et al postulate that fgfr2 overactivity in crouzon syndrome may be associated with accumulation of abnormal fibrous tissue at the lc .
this might lend a further explanation for the potential link between crouzon syndrome and mrnf .
abnormal fibrous tissue may alter the integrity of the lc , thereby allowing oligodendrocytes and/or their precursors to enter the retina .
additionally , such structural compromise of the lc may further disrupt signaling that is necessary for cessation of myelination at the lc . a developmental link between crouzon syndrome and mrnf
dysregulation of fgfr2 might lead to perturbations in oligodendrocyte signaling pathways and altered integrity of the lamina cribrosa .
however , as this is , to our knowledge , the only documented case of mrnf in crouzon syndrome , this potential developmental link remains hypothetical .
nonetheless , the association between mrnf and crouzon syndrome in this case may provide insight into the regulation of myelination of visual pathways and the potential role of fgfr2 in this process , and lends credence to existing theories on the pathogenesis of mrnf .
oct angiography is a new imaging modality that provides non - invasive high resolution images of the optic nerve and retinal vessels .
the influence of mrnf on retinal vessel density measurement with oct angiography has been previously reported in two cases of focal mrnf .
visualization of retinal vasculature is essential in all comprehensive ophthalmologic examinations , and may be of particular importance in cases of mrnf .
the opaque appearance of mrnf can obscure underlying retinal vessels , and therefore can present diagnostic and monitoring difficulties for clinicians . in addition , although mrnf are typically a benign finding , they have been associated with and may be involved in the development of various retinal vascular disorders including telangiectatic vessels , branch artery and vein occlusion , microaneurysms , neovascularization , and recurrent vitreous hemorrhage.5 , 6 , 7 , 8 this is hypothesized to be a consequence of the abnormal structure and increased thickness of the overlying retinal nerve fiber layer , which may promote retinal ischemia,6 , 8 mechanical disturbance of retinal vessels , or disordered glial regulation of vascular tight junctions .
additionally , vascular abnormalities may develop independently in regions of mrnf , unrelated to the overlying myelination and structural anomalies of the retinal nerve fiber layer .
monitoring of underlying vasculature is therefore critical in patients with mrnf . in the present case ,
obscuration of peripapillary vessels was apparent on color and red - free fundus photography . however , oct angiography provided extensive visualization of the underlying vasculature , revealing a dense peripapillary capillary network without signs of structural anomalies .
oct angiography may be a useful imaging modality in cases of mrnf for evaluation of retinal vessels . | purposewe present a case of bilateral extensive peripapillary myelinated retinal nerve fibers ( mrnf ) in an individual with crouzon syndrome , an inherited form of craniosynostosis caused by overactivation of fibroblast growth factor receptor 2 . as a secondary aim ,
we examine the utility of optical coherence tomography ( oct ) angiography for visualization of peripapillary vasculature obscured by myelination on other imaging modalities.methodsa 24-year - old woman with crouzon syndrome was evaluated for suspected optic neuritis in the right eye.resultsfunduscopic examination and photography revealed the incidental finding of bilateral extensive peripapillary mrnf .
oct angiography provided excellent visualization of peripapillary retinal vessels , which were partially obscured by myelination on other imaging modalities.conclusionsthis association of crouzon syndrome with bilateral peripapillary mrnf may lend insight into the developmental control of optic nerve myelination , the pathogenesis of mrnf , and the potential role of growth factors in these processes .
further , oct angiography allowed for excellent blood vessel visualization in this case of mrnf . |
coronary aneurysms are identified in 0.15 - 4.9% of patients undergoing coronary angiography.1 ) recently , with the development of non - invasive imaging modalities , including echocardiography , multi - detector computer tomography ( mdct ) and magnetic resonance image , the detection of incidental coronary aneurysm is not rare . however , a huge coronary aneurysm , associated with coronary artery fistula , is still uncommon.2 - 4 ) most patients with coronary artery aneurysm are asymptomatic , but occasionally lead to life - threatening conditions , including thrombosis , distal embolization , infection and rupture
. nonetheless , there are still no uniform guidelines for therapeuticmanagement.1)5 ) we here report a patient who has a huge saccular coronary artery aneurysm with organized thrombi and coronary artery fistulae that was treated by a surgical correction .
a 48-year - old woman , who had no history of specific conditions , such as kawasaki 's disease or chest trauma , connective tissue disorder was referred to our hospital for the evaluation of an abnormal shadow on the left cardiac border on a chest x - ray film ( fig .
her blood pressure was 120/78 mm hg and pulse rate was 78 beats / min . on physical examination ,
continuous murmur of a grade ii / vi was audible at 4th left intercostal space .
transthoracic echocardiography demonstrated a 4.14.0 cm round cystic mass with internal echogenecity in the wall , located in contact with upper anterolateral wall of the left ventricle and coronary artery fistula opening to main pulmonary trunk ( fig .
chest mdct showed a 5 cm saccular aneurysm of proximal left anterior descending artery ( lad ) with organized thrombi and multiple fistulae from the conus artery , lad and aneurysmal sac to the main pulmonary trunk ( fig .
3 ) . coronary angiography revealed a huge saccular aneurysm at proximal lad , which was filled with contrast medium in a swirling fashion with slow opacification of distal lad ( thrombolysis in myocardial infarction grade ii ) .
moreover , there were several fistulae from the conus artery of right coronary artery ( rca ) , proximal lad , and aneurysmal sac to the pulmonary artery ( fig .
one of them , a fistula from the conus branch to pulmonary artery , were clamped and ligated .
when coronary aneurysmal sac was opened , the sac was filled with organized thrombi , which were removed ( fig .
then , the inlet and outlet of aneurysmal sac were ligated and the left internal mammary artery was grafted to the distal lad .
after total bypass , the main pulmonary artery was opened and closed the fistula 's opening site , which was observed ( fig .
6b ) , which was performed after 5 days and 7 days , respectively , showed patent bypass graft and successful ligation of aneurysm .
however , an abnormal flow at the main pulmonary trunk regarded as a remnant fistula was still visible , although the amount of the abnormal flow was reduced . the patient was discharged , and we have planned regular check - up because the patient was free of symptoms , and the size of fistula was small .
coronary artery aneurysm is defined as a localized dilatation , exceeding the diameter of adjacent normal segment by 1.5 times .
giant coronary artery aneurysms are those with more than 4 cm in diameter.6 ) markis et al.7 ) proposed a classification of aneurysms , according to the morphological feature and the number of affected arteries : type 1 was defined as dilations in all 3 epicardial coronary arteries ; type 2 , as dilation in 1 blood vessel , only with accompanying stenosis in another coronary artery ; and type 3 , as the dilation limited only to 1 artery .
coronary aneurysm is most commonly located in the rca , and then in decreasing order in the left descending artery , the left circumflex artery , and only exceptionally in the left main coronary artery.8 ) coronary - to - pulmonary artery fistula is a congenital heart malformation , and the combination of coronary artery aneurysm and pulmonary artery fistula is very rare .
yu et al.9 ) reported that coronary artery aneurysm was found in 5.9% of patients with congenital coronary artery fistula , which was found in only 0.2% of patients who had undergone heart surgery .
the majority of the patients with coronary artery aneurysms are asymptomatic , but they may present with angina pectoris , myocardial infarction , sudden death or complications , such as thrombus formation , embolization , fistula formation , rupture , hemopericardium , tamponade , compression of surrounding structure , or congestive heart failure.6 ) so far there is no optimal management strategy for patients with giant coronary artery aneurysm . however , depending on the symptoms , etiology and associated lesions , there are a few optional treatments , including medical treatment with anti - platelet agents or anti - coagulation drugs , stent implantation , and surgical exclusion of the aneurysm , using resection or ligation technique.6)10 ) in our case , 4.14.0 cm giant saccular coronary artery aneurysm was located at the proximal left anterior descending coronary artery , and was suspected to be filled with thrombus on transthoracic echocardiography
. that could be at high risk of the occlusion of distal lad and finally myocardial infarction . also , there is a risk of rupture and tamponade of the giant aneurysm.11)12 ) therefore , we decided surgical therapy .
on echocardiogram , after postoperative 7 days , a remnant small fistula from proximal lad ( above aneurysmal sac ) across aneurysmal sac to main pulmonary trunk was detected .
it is mostly recommended that symptomatic patients ( heart failure or ischemia ) or patients with large shunts ( qp / qs>1.5 ) should be referred for surgery.13)14 ) on a follow - up echocardiogram , after 3 months , the remnant fistula did n't grow and the value of the shunt ( qp / qs ) was 1.05 .
we are planning to follow up , on a regular basis , on the patient by echocardiography , even though there is still a remnant small fistula .
a 48-year - old woman has a huge saccular aneurysm with organized thrombi in proximal lad and coronary artery fistulae from lad , in addition to the conus branch of rca to the pulmonary artery .
she received surgical treatment , including thrombectomy of aneurysm , ligation of the inlet and outlet of aneurysmal sac , coronary artery bypass graft , and ligation of fistulae .
a small remnant fistula , from proximal lad across aneurysmal sac to pulmonary artery , was observed and will be followed up by echocardiography . | saccular coronary artery aneurysm , associated with coronary artery fistula , is a very rare condition .
a 48-year - old woman was referred to our hospital for the evaluation of an abnormal shadow on the left cardiac border from a chest x - ray film during regular medical health examination .
a huge saccular aneurysm with organized thrombi in the proximal left anterior descending artery ( lad ) and coronary artery fistulae from lad and conus branch of the right coronary artery to pulmonary artery was diagnosed by transthoracic echocardiography , multi - detector computer tomography ( mdct ) , and coronary angiography .
the patient received surgical treatment , including thrombectomy of aneurysm , ligation of the inlet and outlet of aneurysmal sac , coronary artery bypass graft ( left internal mammary artery - to - distal lad ) , and ligation of fistulae .
the postoperative course was uneventful , and postoperative echocardiography and mdct revealed patent bypass graft ; however , a small fistula from proximal lad across aneurysmal sac to pulmonary artery was observed . |
preeclampsia is an important cause of maternal morbidity and mortality which complicates approximately 3% of all pregnancies .
although several theories including abnormal placentation , cardiovascular maladaptation to pregnancy , genetic and immune mechanisms , increased systemic inflammatory response , and nutritional , hormonal , and angiogenic factors have been suggested to cause preeclampsia , the etiology of this serious disorder is still unclear.[37 ] compared to women with normal pregnancy , preeclamptic women have a significantly greater systemic inflammatory response .
infection is considered as an important source of inflammation that may play a role in many adverse pregnancy outcomes including preeclampsia.[911 ] infection can either increase the risk of acute uteroplacental atherosis , and therefore initiate preeclampsia , or amplify the maternal systemic inflammatory response , and consequently potentiate preeclampsia . according to the suggested association between infection and preeclampsia , periodontal infection , which is one of the most common chronic infectious disorders in humans ,
might be linked to preeclampsia.[101416 ] depending on the definition of periodontal disorders and the population , the prevalence of periodontal disorders is reported to be between 10% and 60% .
therefore , some studies suggest an association between preeclampsia and periodontitis , and some believe that periodontal pathogens may be present in the placenta of women with preeclampsia.[81720 ] however , it is still controversial due to some claims that deny such association . given the above evidence and the controversy on this topic , this study was aimed to investigate the presence of periopathogenic bacteria in the placental tissue of preeclamptic women , and compare it with women with normal pregnancy .
after approval for the study by the ethics committee of isfahan university of medical sciences ( research project number 390058 ) and informed consent were obtained , this case control study was performed on 46 women ( 23 preeclamptic women and 23 age - matched healthy women with normal pregnancy ) between june 2011 and february 2012 in beheshti and al - zahra hospitals , isfahan , iran .
we obtained the placental samples only from those who underwent cesarean section in order to avoid possible vaginal and cervical contamination .
preeclamptic women who underwent cesarean section formed the case group . according to the american college of obstetricians and gynecologists ( acog ) guideline ,
preeclampsia was considered when a woman had hypertension ( diastolic blood pressure of at least 90 mm hg or a systolic pressure of at least 140 mm hg ) after 20 week of gestation plus proteinuria ( urinary excretion of > 300 mg protein/24 h , or two random urine specimens obtained at least 4 h apart demonstrating 1+by dipstick testing or measured as > 30 mg protein per desyliter ) .
women who underwent cesarean section for reasons other than preeclampsia were assigned to the control group .
the excluding criteria were multiple gestation , diabetes mellitus , urinary tract infection , rupture of membrane , chronic hypertension , and having other medical disorders .
in addition , women who had received antibiotics over the 5 months before the study , or had been treated with calcium channel blockers , phenytoin , or cyclosporine a for more than 3 months before the investigation were excluded from this study .
after qualifying patients according to the aforementioned criteria , demographic and clinical features of patients including age , parity , gravidity , and gestational age at delivery were recorded . besides these , the labor phase at the time of delivery and the status of membranes were registered . after the cesarean section ,
four placental samples were taken from both central and marginal areas of each placenta by a single physician under sterile condition .
two samples were obtained from the maternal side and two samples from the fetal side . to make the study blind ,
then , the samples were sent to the laboratory for evaluation by qualitative polymerase chain reaction ( pcr ) regarding the presence of five periopathogenic bacteria ( actinomycetemcomitans , prevotella intermedia , porphyromonas gingivalis , treponema denticula , and tannerella forsythensis ) .
data were analyzed by spss 16.5 , and chi - square test and independent t - test were used when appropriate .
there was no significant difference between the two groups in the mean of age , gestational age , gravidity , and parity [ table 1 ] .
indications of cesarean section in each group the two groups were compared regarding the number of cases with positive periopathogenic bacterial infection of the placenta , and no significant difference was observed [ table 3 ] .
frequency of women with different types of periopathogenic bacterial infection of the placenta in each group surprisingly , the number of women with placental periopathogenic bacterial infection was higher in the control group ; however , this difference was not statistically significant .
data are presented as the number ( % ) of patients infected with different types of periopathogenic bacteria in each group moreover , we compared the number of mothers who had positive placental infection ( regardless of the type of periopathogenic bacteria ) and found no significant difference between the two groups [ 14 ( 61% ) mothers with placental infection in the case group vs. 18 ( 78% ) mothers in the control group , p value = 0.16 ] .
there was no significant difference between the two groups in the mean of age , gestational age , gravidity , and parity [ table 1 ] .
the two groups were compared regarding the number of cases with positive periopathogenic bacterial infection of the placenta , and no significant difference was observed [ table 3 ] .
frequency of women with different types of periopathogenic bacterial infection of the placenta in each group surprisingly , the number of women with placental periopathogenic bacterial infection was higher in the control group ; however , this difference was not statistically significant .
data are presented as the number ( % ) of patients infected with different types of periopathogenic bacteria in each group moreover , we compared the number of mothers who had positive placental infection ( regardless of the type of periopathogenic bacteria ) and found no significant difference between the two groups [ 14 ( 61% ) mothers with placental infection in the case group vs. 18 ( 78% ) mothers in the control group , p value = 0.16 ] .
the present study demonstrated no significant difference between preeclamptic women and healthy women with normal pregnancy regarding the relative frequency of placental infection with periopathogenic bacteria .
surprisingly , we found a non - significantly higher frequency of placental infection with periopathogenic bacteria in healthy women , which is inconsistent with the findings reported by previous studies .
the study design of barak et al . that was performed earlier was almost similar to this study .
they found significantly higher frequency of infected placental samples in the preeclampsia group compared with healthy women .
gingivalis , a. actinomycetemcomitans , pr . intermedia and fusobacterium nucleatum in placenta , barak et al . suggested that these pathogens may have transmitted hematogenously and played a role in the formation of placental atherosis .
they also reported significantly higher bacterial count in the preeclamptic women ; however , we do not have data about bacterial count detected by qualitative pcr . while all the five investigated types of periopathogenic bacteria were found in both case and control groups of our study , barak et al
. found all types in the case group and only three types in the control group .
these dissimilarities between what we found and the findings of barak et al . could be attributed to some factors , including racial and socioeconomic differences .
for instance , the difference could be caused by different levels of oral hygiene of the studied women .
in other words , it could be supposed that women who were investigated in the barak , et al .
study had better average level of oral hygiene than ours , so the difference between women with good oral hygiene and those with poor oral hygiene has been more prominent and has led to significant differences between the two groups .
however , it is just a hypothesis , not a definite reason , because we do not have any idea about the baseline level of oral hygiene of patients , either from our study or from the barak , et al .
the important finding which could be helpful in interpretation of what we found is that swati et al .
had detected periopathogenic bacteria in the placenta of two cases who did not have periodontal diseases .
this finding shows that having infected placenta with periopathogenic bacteria does not necessarily mean having periodontitis . it was suggested that these pathogens might have gained access to the placenta through the genital tract as an ascending infection , or they might have been translocated retrogradely from the peritoneal cavity through the fallopian tubes .
based on this condition , general hygiene could also play an important role in this regard , and can affect the probability of having placental infection with periopathogenic bacteria in the absence of periodontitis .
this emphasizes the role of socioeconomic status in the presence of periopathogenic bacteria in the placenta .
they defined the clinical criteria for periodontitis , and then assessed the relationship between periodontitis and preeclampsia after controlling the confounders .
they believe that maternal infections such as periodontitis accelerate cytokine release and endothelial dysfunction , which increase the risk of preeclampsia.[182325 ] the main difference between our study and the study of siqueira , et al .
is that we investigated the local effects of periodontitis on the placenta of preeclamptic women , while they investigated the systemic effects of periodontitis on preeclampsia .
therefore , although we did not find any evidence that supports the role of placental infection with periopathogenic bacteria , we are not able to rule out the suggested association between preeclampsia and periodontitis at this stage .
another study on a relatively large number of jordanian women investigated the association between periodontal parameters and preeclampsia , and reported no association between them .
suggested that differences in study design , sample size , periodontal disease definition , and adjustment criteria may be the reasons of their findings .
in summary , our study did not show any significant difference between preeclamptic women and healthy women with normal pregnancy regarding the periopathogenic bacterial profile of the placenta .
we suggest further investigations on larger sample size with better control of confounding factors such as socioeconomic status , accompanied by simultaneous assessment of periodontal parameters to achieve more accurate results . | background : preeclampsia is an important cause of maternal morbidity and mortality with unclear cause . it is believed that inflammation plays an important role in the pathogenesis of preeclampsia .
periodontal disease is a chronic inflammatory infectious condition which commonly involves humans .
recently , chronic infection was linked to atherosclerosis .
atherosclerosis shares some histopathologic features with uteroplacental atherosis of preeclamptic women .
this study was aimed to investigate the presence of periopathogenic bacteria in the placental tissue of preeclamptic women , and compare it with women with normal pregnancy.methods:samples were obtained from 23 placentas of preeclamptic women and from 23 age - matched healthy pregnant women .
qualitative polymerase chain reaction was performed to detect the presence of five periopathogenic bacteria.results:there was no significant difference between the two groups regarding the relative frequency of women with different types of periopathogenic bacterial infection of the placenta .
in addition , there was no significant difference in the number of women with any type of infection of the placenta ( regardless of the type of periopathogenic bacteria ) [ 14 ( 61% ) mothers with placental infection in the case group vs. 18 ( 78% ) mothers in the control group , p value = 0.16].conclusions : this study did not show any significant difference between preeclamptic women and healthy women with normal pregnancy regarding the periopathogenic bacterial profile of the placenta . |
single semiconductor nanostructures , such as quantum dots ( qds ) and quantum rings ( qrs ) , have attracted much attention due not only to their fundamental interest , but also to their potential applications in the prospective quantum information technology [ 1 - 8 ] . in semiconductor nanostructures ,
excitonic effects play a central role in their optical properties [ 9 - 15 ] .
electrons and holes form a variety of exciton complexes in qds and qrs due to the enhanced coulomb interactions by the spatial confinements .
the spatial extents of excitonic wave functions thus reflect the both the combined effects of spatial confinements and the inter - particle coulomb interactions among constituent charged carriers . applying a magnetic field b
is an efficient way to probe the spatial extent of excitonic wave functions . in a magnetic field
b , the exciton emission energy increases quadratically with b , i.e. , the diamagnetic shift e = b , with a diamagnetic coefficient proportional to the area of the excitonic wave function .
depending on the confinement regime of the nanostructures , the measured could have different physical meanings . in the strong confinement regime , where the single - particle energy dominates over the coulomb energies , is a measure of the spatial confinement of the qds , while the magnetic responses of inter - particle coulomb energies only appear as correction terms to the overall diamagnetism . on the other hand ,
when confined excitons are in the weak confinement regime , the coulomb energies become prominent , such that will be mainly determined by the magnetic response of the inter - particle coulomb interactions . for exciton complexes confined in nanostructures ,
the diamagnetic behaviors are more complicated because of the more elaborate coulomb interactions among the constituent charged carriers .
therefore , a systematic investigation is essential into further understanding the magnetic responses of different exciton complexes in qds or qrs . in this work
, we report on the diamagnetic response of different exciton complexes , including neutral excitons ( x ) , biexcitons ( xx ) , positive and negative trions ( x and x ) confined in single inas / gaas self - assembled qds and qrs . in qds , the influences of imbalanced magnetic responses of coulomb energies on the overall diamagnetisms of x , xx , and x are observed and discussed . as for the magnetic response of x in qds
, we observe an anomalous diamagnetic behavior , which can not be described by the conventional quadratic energy shift with the applied b. such anomalous behaviors for x can be attributed to the apparent change in the electron wave function extent after photon emission due to the strong coulomb attraction by the hole in its initial state . in qrs , the diamagnetic responses of x and xx also show different behavior . the impacts of inherent structural asymmetry of the self - assembled qrs , as well as the inter - particle coulomb interactions , on the distribution of x and xx wave functions are discussed .
our results suggest that the phase coherence of xx in qrs may survive from the wave function localization due to the structural asymmetry or imperfections .
the investigated samples were grown on gaas ( 100 ) substrates by a molecular beam epitaxy system . for the qd sample ,
a layer of inas self - assembled qds ( 2.0 mls ) was grown on gaas at 480c without substrate rotations , yielding a gradient in area dot density ranging from 10 to 10 cm .
atomic force microscopy ( afm ) of uncapped samples reveals that the dots are lens shaped , with an average height and diameter of 2(0.5 ) and 15 nm , respectively .
the qds were finally capped by a 100-nm undoped gaas layer . for the qr sample ,
a low - density inas qd layer was first grown by depositing 2-ml inas at 520c as qr precursors .
the substrate temperature was then lowered to 500c for depositing a thin gaas layer ( 1.7 nm ) to cover the qd sidewalls , followed by a 50-s growth interruption for expelling the indium atoms from the qd center for the qr formation .
typical surface qrs have a rim diameter of 35 nm , a height of 1.3 nm , and a center dip of about 2 nm . the realistic dimension of the embedded qrs is expected to be much smaller .
we also found that the qr is anisotropic ; the rim of the surface qr is higher along [ ] . to isolate individual qds or qrs for optical measurements , a 100-nm - thick al metal mask was fabricated on the sample surface with arrays of 0.3-m apertures using electron - beam lithography .
single qd spectroscopes were carried out at 58 k in a specially designed micro - photoluminescence ( -pl ) setup ( see fig .
1 ) , where the sample was mounted in a low - temperature stage and inserted into the bore of 6-t superconducting magnet for magneto - pl measurements .
a he ne laser beam or a cw ti : sapphire laser was focused onto the aperture through a microscope objective ( na = 0.5 ) .
the pl signals were collected by the same objective , analyzed by a 0.75-m grating monochromator , and detected by a liquid - nitrogen - cooled charged - coupled device ( ccd ) camera , which yield a resolution - limited spectral linewidth of about 60 ev .
several apertures containing only one qd have been investigated , and all of which showed similar spectral features .
typical single qd spectra consists of four dominant emission lines associated with the recombination of neutral excitons ( x ) , biexcitons ( xx ) , positive and negative trions ( x and x ) .
these excitonic spectra have been unambiguously identified according to power - dependent and polarization - resolved pl measurements .
magneto - pl measurements have been taken on a total of seven qds with x energy distributed over the range of 1,3491,385 mev .
2 . when a magnetic field , b , was applied along the qd growth direction ( faraday geometry ) , each line splits into a doublet through the zeeman effect .
in addition , the average energy of each zeeman doublet increases with the increasing b , known as the diamagnetic shift . in fig .
3 , the measured diamagnetic shifts for the four excitonic emission lines are plotted as a function of b. for xx , and xx , the measured diamagnetic shifts show a quadratic dependence e = b , with a clear trend of .
this trend holds for all investigated dots and is a consequence of different magnetic responses of inter - particle coulomb energies .
magneto - pl spectra for a typical qd measured under an applied b = 06 t a the energy shifts of x , x , and xx in a qd as a function of b. b the energy shifts of x as a function of b. a clear non - quadratic b dependence can be seen to explain this behavior , we consider here a 2d parabolic potential as the effective lateral confinement for both electrons and holes in the qds , with a quantization energy of and a wave function extent of , where denotes eor hand m are the effective masses .
the use of parabolic model simplifies the problem considerably , because of the availability of analytical formula for all coulomb interactions being parameterized by . the inter - particle direct coulomb energy is given by [ 20 - 22 ] where . in a magnetic field b can be replaced by the b - dependent hybridize frequency . in the weak - field limit , the b - dependent single - particle energy (b ) and the coulomb energies v(b ) can be expanded analytically as , where is the single - particle diamagnetic coefficient , and accounts for the magnetic response of v(b ) , with a constant k defined as .
if we take the coulomb energies as perturbations to the single - particle energy in the strong confinement regime , the diamagnetic shift of x should be corrected as . on the other hand ,
the diamagnetic shift of xx will deviate from that of x by an amount of . because varies as , a slight difference between e and h can lead to very different values for and . since h < e and hence , we have that leads to .
the same arguments can be applied to the x case , where is also reduced by a similar amount , in agreement with our experimental observations .
the reason for can also be understood from the fact that the emission energies of xx and x are usually correlated even in different qds , because their energy difference equals roughly to veeveh , which is value less sensitive to the magnetic field .
it is worth to emphasize that the systematic differences among x,xx , andcould be observed only when e and h exhibit a large difference . for small inas qds ,
electron gradually lose confinement as the dot size reduces , which in turn push the electron level toward the wetting - layer continuum , resulting in a more extended electron wave function penetrating into the barrier material . on the other hand , the hole wave function remains well localized in the qds , leading to a large difference between e and h . for larger
in(ga ) as qds , since e and h are expected to be similar , the diamagnetic response of all exciton complexes will be nearly identical , so that the magnetic response of interparticle coulomb energies of such strongly confined few - particle systems becomes unable to resolve experimentally . for the case of x in qds , its magnetic response shows an anomalous behavior , which does not follow the conventional b - dependence energy shift , as can be seen from fig .
our measurements show that the x diamagnetic shifts in most qds investigated are smaller and non - quadratic .
to understand the peculiar behavior , the charge configurations of the initial and the final states of x should be considered . as depicted in fig .
4 , the initial state of x consists of two electrons and one hole , which will leave one electron in its final state after recombination .
the x diamagnetic shift thus reflects the diamagnetic responses of both the initial and final states .
we have performed numerical model simulations using single - band hamiltonian of cone - shape qds including hartree approximations to calculate the lateral extents of the initial - state e , i and the final - state e , f electron wave functions of x. we found that the e , f is always more extended than e , i .
this can be realized from the presence of hole in its initial state , which contracts the electron wave function by the coulomb attraction .
as the qd sizes reduces , e , f increases rapidly , due to the penetration of electron wave function into the barrier material .
the very extended electron becomes sensitive to the long - range coulomb attractive potential produced by the hole in the initial state , by which e , i will be contracted and become apparently smaller than e , f . as a result , the final - state diamagnetic shift increases , so that the overall diamagnetic shift in x is reduced .
this phenomenon is not expected for x in qds , since the wave function extents of the initial- and final - state holes are almost identical due to the fact that hole has a larger effective mass , such that the hole wave function remains well confined even in small qds .
therefore , the coulomb attractive potential produced by the weakly confined electron becomes less important .
a schematic for the charge configurations of x in qds before and after photon emissions .
the final - state electron is more extended due the coulomb attraction of the hole in its initial state now , we explain why the x diamagnetic shift exhibits a non - quadratic b dependence .
to illustrate this behavior , we consider the diamagnetic shift in the carrier s single - particle energy and expand it in powers of b as , , where the quartic coefficientis negative and is given by . by taking into account the difference between e , i and e , f , a simple algebraic analysis for the x diamagnetic shift , , gives the following expression : whereand . because of h < e and ,
equation ( 3 ) makes clear how the difference in e , i and e , f can lead to anomalous diamagnetic shifts for x. for a normal case of e , i e , f = e , we haveand .
that is , the x diamagnetic shift behaves as the usual b dependence with a coefficient similar to that of x. a very interesting case occurs when , which leads to 2e , i = e , f and cancels out the b term , resulting in a dominant b - dependent energy shift . the energy shift shown in fig .
therefore , the measured curvature can also be a sensitive probe to the change in wave function extents between the initial and the final - state electrons of x. figure 5a and 5b show the surface topography and line scans along and [ ] directions of uncapped qrs .
the same measurement has been performed on a total of seven qrs with x emission energies ranging from 1,320 to 1,328 mev .
apart from the zeeman splitting , both x and xx show clear diamagnetic shifts with the increasing b. the average diamagnetic coefficient of x for all the investigated qrs is .
interestingly , we found that xx shows a considerably larger diamagnetic coefficient with an average value of , which is more than the double of the x value . a surface topography and b line scans along and [ ] directions of uncapped qrs .
c typical single - qr magneto - pl spectra taken under different applied b. d the b - dependent energy shifts of the x and xx .
solid and dashed lines are fitting curves using quadratic b dependence the larger xx indicates a more extended xx wave function in qrs .
this is different from the case of qds , where xx is usually similar to , or somewhat smaller than , x due to the different spatial extents of the electron and hole wave functions and their responses to the applied b. here , we argue that the larger xx is a consequence of the fact that self - assembled qrs do not have perfect azimuthal symmetry . it has been reported that buried self - assembled qrs exhibit an asymmetric craterlike shape , with a diameter substantially smaller than the ring - shaped islands on the surface of uncapped qr structures . in addition , due to the preferential out diffusion of dot material along the [ ] direction , the embedded rim height is higher along the direction , resulting in two separate potential valleys along the direction , resembling a pair of connected qds .
, we have performed theoretical calculations for the wave function distributions of x and xx in qrs , which are shown in fig .
although the actual shape of embedded qrs is not known exactly , the numerical model used here is still a good illustration when qrs have any structural imperfection .
using selective chemical etching to remove the gaas capping layer may be an efficient way to reveal the structure of buried qrs .
a a schematic for the qr geometry with a structural anisotropy used in model calculations .
b and c are the calculated electron wave functions of the lowest x and xx states .
the dash circle represents the rim diameter of 14 nm the lack of rotational symmetry in the potential of embedded qrs has significant impacts on the diamagnetic responses of x and xx . for x
confined in qrs , the height variation strongly localizes the hole in one of the potential valleys due to the large effective mass . consequently , the electron will be bound to the same valley by the electron - hole coulomb attraction .
this means that the wave function extent of x is determined mainly by the confinement of the potential valley and the coulomb interaction .
therefore , the diamagnetic response of x is similar to an elliptic qd . for xx confined in qrs
, the two holes may be separately localized in different valleys due to the strong hole
hole coulomb repulsion . due to the coulomb attractions of the two separately localized holes , the electron wave functions of xx
are more likely to spread over the two valleys and become more extended than that of x. unlike x , the wave function extent of xx is determined mainly by the diameter of the embedded qrs .
, we would like to comment on the implications of the larger diamagnetic shift of xx in qrs .
charged particles confined to a qr are expected to show the well - known aharanov
bohm ( ab ) effect due to the quantum interference of the carrier s wave function in the ring - shaped geometry [ 6 - 8 ] . however , for an exciton confined in ring - like nanostructures , the ab effect is not expected to occur for such a charge - neutral composite unless the electron and hole can propagate coherently in different trajectories with a non - zero electric dipole moment .
this can occur naturally in type - ii qd systems , where the electron and hole are spatially separated .
however , for ingaas self - assembled qrs where both the electron and hole are confined , it is still an open question whether the excitonic ab effect can be observed .
in fact , this issue is further complicated by the inherent structural asymmetry and/or imperfections presented inevitably in self - assembled qrs .
our results suggest that the inherent structural asymmetry combined with the inter - particle coulomb interactions tends to localize the x wave function and hence may smear out its phase coherence . on the other hand , due to hole
hole repulsion , the xx wave function is more extended and spread over the entire ring
. therefore , the phase coherence of xx may be more likely to survive from such wave function localizations at lower magnetic field .
several apertures containing only one qd have been investigated , and all of which showed similar spectral features .
typical single qd spectra consists of four dominant emission lines associated with the recombination of neutral excitons ( x ) , biexcitons ( xx ) , positive and negative trions ( x and x ) .
these excitonic spectra have been unambiguously identified according to power - dependent and polarization - resolved pl measurements .
magneto - pl measurements have been taken on a total of seven qds with x energy distributed over the range of 1,3491,385 mev .
2 . when a magnetic field , b , was applied along the qd growth direction ( faraday geometry ) , each line splits into a doublet through the zeeman effect .
in addition , the average energy of each zeeman doublet increases with the increasing b , known as the diamagnetic shift . in fig .
3 , the measured diamagnetic shifts for the four excitonic emission lines are plotted as a function of b. for xx , and xx , the measured diamagnetic shifts show a quadratic dependence e = b , with a clear trend of .
this trend holds for all investigated dots and is a consequence of different magnetic responses of inter - particle coulomb energies .
magneto - pl spectra for a typical qd measured under an applied b = 06 t a the energy shifts of x , x , and xx in a qd as a function of b. b the energy shifts of x as a function of b. a clear non - quadratic b dependence can be seen to explain this behavior , we consider here a 2d parabolic potential as the effective lateral confinement for both electrons and holes in the qds , with a quantization energy of and a wave function extent of , where denotes eor hand m are the effective masses .
the use of parabolic model simplifies the problem considerably , because of the availability of analytical formula for all coulomb interactions being parameterized by . the inter - particle direct coulomb energy is given by [ 20 - 22 ] where . in a magnetic field b can be replaced by the b - dependent hybridize frequency . in the weak - field limit , the b - dependent single - particle energy (b ) and the coulomb energies v(b ) can be expanded analytically as , where is the single - particle diamagnetic coefficient , and accounts for the magnetic response of v(b ) , with a constant k defined as .
if we take the coulomb energies as perturbations to the single - particle energy in the strong confinement regime , the diamagnetic shift of x should be corrected as . on the other hand ,
the diamagnetic shift of xx will deviate from that of x by an amount of . because varies as , a slight difference between e and h can lead to very different values for and . since h < e and hence , we have that leads to .
the same arguments can be applied to the x case , where is also reduced by a similar amount , in agreement with our experimental observations .
the reason for can also be understood from the fact that the emission energies of xx and x are usually correlated even in different qds , because their energy difference equals roughly to veeveh , which is value less sensitive to the magnetic field .
it is worth to emphasize that the systematic differences among x,xx , andcould be observed only when e and h exhibit a large difference . for small inas qds ,
electron gradually lose confinement as the dot size reduces , which in turn push the electron level toward the wetting - layer continuum , resulting in a more extended electron wave function penetrating into the barrier material . on the other hand , the hole wave function remains well localized in the qds , leading to a large difference between e and h . for larger
in(ga ) as qds , since e and h are expected to be similar , the diamagnetic response of all exciton complexes will be nearly identical , so that the magnetic response of interparticle coulomb energies of such strongly confined few - particle systems becomes unable to resolve experimentally . for the case of x in qds , its magnetic response shows an anomalous behavior , which does not follow the conventional b - dependence energy shift , as can be seen from fig .
our measurements show that the x diamagnetic shifts in most qds investigated are smaller and non - quadratic .
to understand the peculiar behavior , the charge configurations of the initial and the final states of x should be considered . as depicted in fig .
4 , the initial state of x consists of two electrons and one hole , which will leave one electron in its final state after recombination .
the x diamagnetic shift thus reflects the diamagnetic responses of both the initial and final states .
we have performed numerical model simulations using single - band hamiltonian of cone - shape qds including hartree approximations to calculate the lateral extents of the initial - state e , i and the final - state e , f electron wave functions of x. we found that the e , f is always more extended than e , i .
this can be realized from the presence of hole in its initial state , which contracts the electron wave function by the coulomb attraction .
as the qd sizes reduces , e , f increases rapidly , due to the penetration of electron wave function into the barrier material .
the very extended electron becomes sensitive to the long - range coulomb attractive potential produced by the hole in the initial state , by which e , i will be contracted and become apparently smaller than e , f . as a result , the final - state diamagnetic shift increases , so that the overall diamagnetic shift in x is reduced .
this phenomenon is not expected for x in qds , since the wave function extents of the initial- and final - state holes are almost identical due to the fact that hole has a larger effective mass , such that the hole wave function remains well confined even in small qds .
therefore , the coulomb attractive potential produced by the weakly confined electron becomes less important .
a schematic for the charge configurations of x in qds before and after photon emissions .
the final - state electron is more extended due the coulomb attraction of the hole in its initial state now , we explain why the x diamagnetic shift exhibits a non - quadratic b dependence .
to illustrate this behavior , we consider the diamagnetic shift in the carrier s single - particle energy and expand it in powers of b as , , where the quartic coefficientis negative and is given by . by taking into account the difference between e , i and e , f , a simple algebraic analysis for the x diamagnetic shift , , gives the following expression : whereand . because of h < e and ,
equation ( 3 ) makes clear how the difference in e , i and e , f can lead to anomalous diamagnetic shifts for x. for a normal case of e , i e , f = e , we haveand .
that is , the x diamagnetic shift behaves as the usual b dependence with a coefficient similar to that of x. a very interesting case occurs when , which leads to 2e , i = e , f and cancels out the b term , resulting in a dominant b - dependent energy shift . the energy shift shown in fig .
therefore , the measured curvature can also be a sensitive probe to the change in wave function extents between the initial and the final - state electrons of x.
figure 5a and 5b show the surface topography and line scans along and [ ] directions of uncapped qrs .
the same measurement has been performed on a total of seven qrs with x emission energies ranging from 1,320 to 1,328 mev .
apart from the zeeman splitting , both x and xx show clear diamagnetic shifts with the increasing b. the average diamagnetic coefficient of x for all the investigated qrs is .
interestingly , we found that xx shows a considerably larger diamagnetic coefficient with an average value of , which is more than the double of the x value . a surface topography and b line scans along and [ ] directions of uncapped qrs .
c typical single - qr magneto - pl spectra taken under different applied b. d the b - dependent energy shifts of the x and xx .
solid and dashed lines are fitting curves using quadratic b dependence the larger xx indicates a more extended xx wave function in qrs .
this is different from the case of qds , where xx is usually similar to , or somewhat smaller than , x due to the different spatial extents of the electron and hole wave functions and their responses to the applied b. here , we argue that the larger xx is a consequence of the fact that self - assembled qrs do not have perfect azimuthal symmetry . it has been reported that buried self - assembled qrs exhibit an asymmetric craterlike shape , with a diameter substantially smaller than the ring - shaped islands on the surface of uncapped qr structures .
in addition , due to the preferential out diffusion of dot material along the [ ] direction , the embedded rim height is higher along the direction , resulting in two separate potential valleys along the direction , resembling a pair of connected qds .
, we have performed theoretical calculations for the wave function distributions of x and xx in qrs , which are shown in fig .
although the actual shape of embedded qrs is not known exactly , the numerical model used here is still a good illustration when qrs have any structural imperfection .
using selective chemical etching to remove the gaas capping layer may be an efficient way to reveal the structure of buried qrs .
a a schematic for the qr geometry with a structural anisotropy used in model calculations .
b and c are the calculated electron wave functions of the lowest x and xx states .
the dash circle represents the rim diameter of 14 nm the lack of rotational symmetry in the potential of embedded qrs has significant impacts on the diamagnetic responses of x and xx . for x confined in qrs , the height variation strongly localizes the hole in one of the potential valleys due to the large effective mass .
consequently , the electron will be bound to the same valley by the electron - hole coulomb attraction .
this means that the wave function extent of x is determined mainly by the confinement of the potential valley and the coulomb interaction .
therefore , the diamagnetic response of x is similar to an elliptic qd . for xx confined in qrs
, the two holes may be separately localized in different valleys due to the strong hole
hole coulomb repulsion . due to the coulomb attractions of the two separately localized holes , the electron wave functions of xx
are more likely to spread over the two valleys and become more extended than that of x. unlike x , the wave function extent of xx is determined mainly by the diameter of the embedded qrs .
, we would like to comment on the implications of the larger diamagnetic shift of xx in qrs .
charged particles confined to a qr are expected to show the well - known aharanov
bohm ( ab ) effect due to the quantum interference of the carrier s wave function in the ring - shaped geometry [ 6 - 8 ] .
however , for an exciton confined in ring - like nanostructures , the ab effect is not expected to occur for such a charge - neutral composite unless the electron and hole can propagate coherently in different trajectories with a non - zero electric dipole moment .
this can occur naturally in type - ii qd systems , where the electron and hole are spatially separated . however , for ingaas self - assembled qrs where both the electron and hole are confined , it is still an open question whether the excitonic ab effect can be observed .
in fact , this issue is further complicated by the inherent structural asymmetry and/or imperfections presented inevitably in self - assembled qrs .
our results suggest that the inherent structural asymmetry combined with the inter - particle coulomb interactions tends to localize the x wave function and hence may smear out its phase coherence . on the other hand , due to hole
hole repulsion , the xx wave function is more extended and spread over the entire ring
. therefore , the phase coherence of xx may be more likely to survive from such wave function localizations at lower magnetic field .
in conclusion , the diamagnetic response of different exciton complexes , including neutral excitons ( x ) , biexcitons ( xx ) , positive and negative trions ( x and x ) confined in single inas / gaas self - assembled qds and qrs has been investigated . in qds
, we found a systematic trend ofcaused by the imbalanced magnetic responses of inter - particle coulomb interactions , which could be observed only when the confined electron and hole wave functions exhibit a large difference in their lateral extents .
furthermore , the differencewas found to scale as the cube of its single - particle wave function extent and therefore can be a sensitive probe to the electron - hole wave function asymmetry .
on the other hand , the magnetic response of x in qds fell into a special regime where the conventional quadratic diamagnetic shift failed to describe its magnetic response .
our measurements show that the x diamagnetic shifts in most qds investigated are even smaller and non - quadratic .
such anomalous behaviors for x were explained by the apparent change in the electron wave function extent after photon emission due to the strong coulomb attraction induced by the hole in its initial state . in qrs , the diamagnetic responses of x and xx also show different behavior . unlike single qds , xx in qrs shows a considerably larger diamagnetic coefficient than the x. numerical model calculations indicate that the inherent structural asymmetry and imperfection of the self - assembled qrs , combined with the inter - particle coulomb interactions , play a crucial role in the distribution of x and xx wave functions .
our results suggest that the phase coherence of xx in qrs may survive from the wave function localization due to the structural asymmetry or imperfections .
this work was supported in part by the program of moe - atu and the national science council of taiwan under grant nos . :
nsc-97 - 2112-m-009 - 015-my2 , nsc-97 - 2120-m009 - 004 and nsc-97 - 2221-e009 - 161 .
we also acknowledge the center for nanoscience and technology ( cnst ) at national chiao tung university .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited .
this article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and source are credited . | we report on the diamagnetic responses of different exciton complexes in single inas / gaas self - assembled quantum dots ( qds ) and quantum rings ( qrs ) . for qds
, the imbalanced magnetic responses of inter - particle coulomb interactions play a crucial role in the diamagnetic shifts of excitons ( x ) , biexcitons ( xx ) , and positive trions ( x ) . for negative trions ( x ) in qds , anomalous magnetic responses
are observed , which can not be described by the conventional quadratic energy shift with the magnetic field .
the anomalous behavior is attributed to the apparent change in the electron wave function extent after photon emission due to the strong coulomb attraction by the hole in its initial state . in qrs
, the diamagnetic responses of x and xx also show different behaviors .
unlike qds , the diamagnetic shift of xx in qrs is considerably larger than that of x. the inherent structural asymmetry combined with the inter - particle coulomb interactions makes the wave function distribution of xx very different from that of x in qrs .
our results suggest that the phase coherence of xx in qrs may survive from the wave function localization due to the structural asymmetry or imperfections . |
the knee joint is stabilised by passive restraints , such as the capsule and ligaments , as well as active restraints .
it has been suggested that the ligaments of the knee may contribute to active stability by providing proprioceptive input to the nervous system , which in turn would adjust muscle contraction accordingly .
the anatomy of the meniscofemoral ligament ( mfl ) has previously been described ; the femoral origins of the anterior mfl are distal to the pcl , close to the articular cartilage , whereas the posterior mfl arises proximal to the pcl .
it has been shown that the mechanical role of the meniscofemoral ligament ( mfl ) is to resist anteroposterior and rotatory laxity in the knee .
this is the most important when the primary stabiliser of posterior laxity , the posterior cruciate ligament , is deficient .
proprioceptive nerve endings were initially thought to be located in muscles ( as muscle spindles ) .
more recently , mechanoreceptors have been found in the cruciate ligaments of both animals and humans [ 1 , 57 ] .
kennedy et al . found mechanoreceptors within multiple clefts at the tibial attachment of the anterior cruciate ligament ( acl ) , within the vascular synovial covering .
schultz et al . reported the presence of mechanoreceptors at the surface of human cruciate ligaments , just beneath the synovial covering .
the mechanoreceptors were 200 um long and 75 um wide and resembled golgi tendon organs .
schutte et al . also demonstrated mechanoreceptors that morphologically resembled ruffini endings , golgi tendon organs , and pacinian corpuscles , which were predominantly present near the tibial attachment .
more recently pacinian corpuscles and free nerve ending type mechanoreceptors have been found in the posterior septum of the knee . despite studies demonstrating mechanoreceptors in the posterior cruciate ligament ( pcl ) of the human knee [ 1 , 7 , 10 , 11 ] , there are no accounts investigating the presence of mechanoreceptors in human mfls .
o'connor demonstrated the presence of mechanoreceptors in the meniscofemoral and meniscotibial portions of the canine lateral meniscus .
he described type ii and type iii endings , according to the freeman and wyke classification ( 1967 ) , which were present mainly in the meniscal ( distal ) portion of the mfl .
the presence of mechanoreceptors in the mfl lends weight to the hypothesis that these structures may provide sensory information from the knee which may form part of a protective reflex loop . noting the presence of mechanoreceptors in the cruciate ligaments and that the mfls act in synergy with the pcl to stabilise the knee , it was hypothesised that the mfls would also contain mechanoreceptors .
the purpose of this study was to ascertain whether there are any neural structures in the mfl of the adult human knee .
eight cadaveric knees were harvested from four donors after informed consent and ratification from the local hospital ethics board .
after removal of the patellar tendon , acl , collateral ligaments , and posterior capsule , the anterior and posterior surfaces of the pcl were inspected for the presence of the mfls .
the distal attachment of the mfl was removed by detaching the lateral meniscus from the tibia .
the distal attachment of the pcl was removed from each specimen by detaching the pcl close to the bone . as both structures attach proximally into the lateral aspect of the medial femoral condyle
the specimens were debrided of all extraneous material , such as fat , but no attempt was made to remove the adherent synovial tissue .
longitudinal sections were obtained from the tibial and femoral ends of the pcl and the meniscal attachment and femoral end of the mfls .
so that it was possible to identify approximately the location of any neural structures present .
all samples were dehydrated in a series of ethanols and were then processed to paraffin wax .
antibody staining was performed on paraffin sections using the standard avidin - biotin complex ( abc ) method . before the abc method could be applied , all slides required blocking to prevent background staining . in this process
, a solution of hydrogen peroxide was used to remove any endogenous peroxidase enzyme present in the sample , which can be associated with erythrocytes and leucocytes . in the present study the primary antibody was rabbit anti - human polyclonal antibody ( dako as , denmark ) and the secondary antibody was swine anti - rabbit antibody .
the sections were then washed in tris buffered saline ( tbs ) and the biotinylated secondary antibody was applied for 35 minutes .
these slides were rinsed in tbs and exposed to the abc complex for 5 minutes .
the use of swine antibody on human tissue can result in immune cross - reactivity of the secondary antibody with endogenous immunoglobulins ; a 10% concentration of nonimmune swine serum was applied in order to minimise cross - reactivity .
standard positive and negative controls were used in the study . the positive control consisted of standard schwannoma neural tissue . in the negative controls
tissue from an area adjacent to that used for light microscopy was processed from paraffin wax for transmission electron microscopy ( tem ) .
semithin sections ( approximately 1 m thick ) were stained with toluidine blue for light microscopic examination to determine the area of the sample under examination .
ultrathin sections ( 6080 nm ) were cut and stained with uranyl acetate and reynold 's lead citrate for examination by tem .
quantification of the different types of end - organs found in the specimens was beyond the scope of this study .
tissue from live human sural nerve was used as a standard control for the tem study .
of the 6 specimens suitable for the study , both mfls coexisted in 3 . in 2 specimens ,
only the anterior meniscofemoral ligament ( amfl ) was present and in 1 specimen only the posterior meniscofemoral ligament ( pmfl ) was present .
four of 6 pcl specimens demonstrated structures that were morphologically consistent with nerve fibres ( figure 1(a ) ) , whilst 4 of the 9 mfl specimens2 of the amfls and 2 of the pmfls demonstrated such structures ( figure 1(b ) ) .
these structures showed degenerative changes consistent with postmortem autolysis , that is , indistinct nuclei and blurring of the tissues .
perineurium was identified , together with the wavy ( serpiginous ) morphology associated with neural structures .
the standard negative controls showed no staining with the s100 stain , whilst the standard positive controls stained strongly positively with s100 stain .
the s100 stain was positive ( as evidenced by brown staining ) in 4 of the 6 pcl specimens ( figure 2 ) and 4 of the 9 mfl specimens ( figure 3 ) .
in general , those neural structures within the mfls were identified at the meniscal ( distal ) end of these ligaments , whilst those in the pcl were identified near its tibial attachment .
tem of the control neural tissue confirmed the presence of structures morphologically consistent with encapsulated nerve fibres on low magnification .
electron microscopy confirmed the presence of structures morphologically consistent with nerves in the pcl and both mfls of those ligaments that stained positively with the s100 stain ( figure 4 ) .
although there were structures morphologically similar to nerves , features such as schwann cells and external laminae were not seen ( see discussion ) .
ultrastructurally , encapsulated nerve endings were found in both the anterior and posterior mfls ( amfl and pmfl ) ( figures 5 and 6 ) , as well as in the pcl .
it was not possible to characterise the type of nerve ending present from the sections available . in those pcl and mfl specimens that were positive for neural structures
it was qualitatively noted that these structures existed in close proximity to blood vessels , possibly in keeping with neurovascular bundles on the macroscopic scale .
this study confirmed the presence of neural structures suggestive of mechanoreceptors in the pcl , amfl , and pmfl of cadaveric knees .
of the 6 pcls examined , 4 were positive for s100 staining , and 4 of the 9 mfls were positive . the tem studies further confirmed the presence of structures morphologically consistent with nerves .
the findings of this study were limited because the quality of the samples had been affected .
the cadaveric , frozen nature of the specimens is likely to have resulted in degeneration and neurolysis , so affecting the histological analysis and hampering detection and accurate characterisation of the nerve endings .
other histological methods have been used to examine mechanoreceptors , including gold chloride staining [ 5 , 11 ] and neurofilament protein antibody , and could be considered in future studies .
the tem specimens were processed directly from paraffin wax , which would have resulted in poor ultrastructural preservation of the neural structures present .
this was demonstrated by the absence of characteristic ultrastructural features , such as intact schwann cells with external laminae or myelin .
thus it was not possible to characterise the neural structures as specific types of mechanoreceptors .
however , the study suggests that such structures exist in the mfls . in their immunohistochemical study of the pcl , del valle et al .
found types i and iii endings according to the freeman and wyke classification [ 10 , 12 ] .
further studies are required on ex vivo mfls ( obtained from procedures such as knee arthroplasty ) that are processed immediately after being harvested with glutaraldehyde fixation , postfixed with osmium tetroxide and araldite embedding for ultrathin sections , to assess whether similar structures are present .
schultz et al . reported that most of the mechanoreceptors were present near the surfaces of the cruciate ligaments .
they suggested that such a location allows greater sensitivity of the receptors to ligament deformation .
the concentration of the neural structures near the meniscal end of the mfls is consistent with the canine study of o'connor .
previous studies have suggested that such receptors are present in the meniscofemoral part of the canine lateral meniscus and that they are situated to respond to extension of the knee in this species .
the current study confirmed the presence of structures morphologically consistent with neural tissue , which stained positively to s100 monoclonal antibody .
further studies could characterise the type of mechanoreceptor or neural tissue present , their relative density , and their functional significance .
palmer demonstrated the reflex contraction of the medial hamstrings and vastus medialis in response to stimulation of the deep capsular portion of the medial collateral ligament .
the demonstration of mechanoreceptors , together with the significance of proprioception during rehabilitation , has renewed interest in the neurological function of knee ligaments .
several animal studies have shown that mechanoreceptors in joints initiate a reflex contraction of muscle that is thought to be protective to the knee .
the presence of neural structures suggestive of mechanoreceptors in the human mfls demonstrated in this study may have a bearing on the prognosis and management of pcl injuries .
showed that patients with pcl rupture have a reduced posterior drawer if their mfls had remained intact .
ahn et al . also noted the significance of preserving the pcl remnant and mfls during pcl reconstruction .
this may be due to a role for the mfls as passive secondary restraints to posterior drawer but may also be due to an active role through a neurosensory feedback loop .
o'connor suggested that , in the canine stifle , which has a posterior meniscofemoral attachment , it is taut in extension and such a position would trigger the mfl mechanoreceptor to fire , thus performing a proprioceptive function . in the human ,
amis et al . noted that the amfl is tense in flexion , whilst the pmfl is tense in extension ( figure 7 ) , and so they might have a proprioceptive role in the human knee .
it may be that a tight pmfl causes the meniscus to be pulled up towards the femur in hyperextension and therefore be more liable to injury in sudden flexion with internal rotation .
this would lead to the posterior horn of the meniscus being squeezed ' and prone to tearing .
this may form part of a sensorimotor feedback loop leading to external rotation of the tibia . in the human ,
adachi et al . have shown that the number of mechanoreceptors present in acl remnants of patients undergoing acl reconstruction correlated well with their preoperative joint position sense .
the authors suggested that it might be of value to retain the acl remnant during reconstruction in order to optimise postoperative proprioception and thereby aid rehabilitation .
other authors have recommended the retention of the pcl during knee arthroplasty , as the proprioceptive function provided by the mechanoreceptors in the pcl may be of value during rehabilitation .
several authors have proposed that the isolated rupture of the pcl can be managed nonoperatively with rehabilitation without the need for surgical reconstruction [ 1719 ] .
the proprioceptive feedback provided by the intact mfls may contribute to the success of such management . at present , the mfls are sacrificed during surgical reconstruction of the pcl when the femoral tunnel is drilled for graft insertion . if the mfls do provide a proprioceptive role in rehabilitation , it may be of value to develop techniques of preserving the mfls during pcl reconstruction .
this is the first study to demonstrate the presence of structures suggestive of neural tissue in the human mfls .
these neural structures were present predominantly in the meniscal ( distal ) attachments of the mfls . | aim . to investigate the existence of neural structures within the meniscofemoral ligaments ( mfls ) of the human knee
. methods .
the mfls from 8 human cadaveric knees were harvested .
5 m sections were h&e - stained and examined under light microscopy .
the harvested ligaments were then stained using an s100 monoclonal antibody utilising the abc technique to detect neural components .
further examination was performed on 6080 nm sections under electron microscopy .
results . of the 8 knees ,
6 were suitable for examination .
from these both mfls existed in 3 , only anterior mfls were present in 2 , and an isolated posterior mfl existed in 1 .
out of the 9 mfls , 4 demonstrated neural structures on light and electron microscopy and this was confirmed with s100 staining .
the ultrastructure of these neural components was morphologically similar to mechanoreceptors .
conclusion .
neural structures are present in mfls near to their meniscal attachments .
it is likely that the meniscofemoral ligaments contribute not only as passive secondary restraints to posterior draw but more importantly to proprioception and may therefore play an active role in providing a neurosensory feedback loop
. this may be particularly important when the primary restraint has reduced function as in the posterior cruciate ligament deficient human knee . |
jefferson fractures of c1 constitutes 25% of all craniocervical injuries , 2 - 13% of all cervical spine injuries , and approximately 1.3% of all spinal fractures.12 there is a high prevalence of concomitant fractures of the axis , especially odontoid fractures.34 the unstable jefferson fracture of c1 is characterized by outward displacement of the lateral masses ( lmd ) in response to axial load.56 treatment algorithms in determining surgical versus nonsurgical treatment of unstable jefferson fractures have not reached a consensus , but treatment decisions are often based on the integrity of the transverse ligament and on the fact whether fractures occur in combination with other unstable spinal injuries .
conservative treatment of unstable jefferson injuries includes immobilization and traction while surgical procedures typically involve posterior fusion of either c1-c2 or occiput - c2 .
fusion procedures lead to loss of range of motion , particularly elimination of c1-c2 rotation and c0-c1 flexion / extension.7 there are few reports describing treatment of unstable jefferson fractures with osteosynthesis of c1 via a transoral approach without c1-c2 fusion.8 the purpose of this study is to introduce a motion - preserving surgical technique of reduction and stabilization for unstable jefferson fracture and to evaluate clinical outcomes .
a retrospective review of 12 patients with unstable jefferson fractures treated with a transoral osteosynthesis of c1 between july 2008 and december 2011 was performed .
eight males and four females with an average age of 33 years ( range 23 - 62 years ) were evaluated .
all patients underwent radiologic evaluation via plain cervical spine radiographs , computed tomography ( ct ) and magnetic resonance imaging ( mri ) .
the mode of injury was road traffic injuries ( n=4 ) , falls ( n=5 ) and diving injuries ( n=3 ) .
all patients complained of neck pain , stiffness and decreased range of motion without neurologic deficit .
three patients had bilateral fractures of the anterior arch ( anterior 1/2 jefferson fractures , landells and van petegghem type i ) [ figure 1a f ] .
five patients had anterior arch fractures with an associated posterior arch fracture ( semi - ring jefferson fracture , landells and van petegghem type ii ) [ figure 2a ] .
two patients had bilateral fractures of the anterior arch associated with a posterior arch fracture ( anterior 3/4 jefferson fracture , landells and van petegghem type ii ) , one patient presented with a comminuted anterior arch fracture associated with a c6 burst fracture [ figure 3a ] .
seven patients had an intact transverse ligament and five patients had avulsion of the insertion of the transverse ligament ( dickman type ii ) .
raney - crutchfield tong was applied after admission to stabilize the fracture using weights between 2 and 3 kg . a line diagram showing anterior
1/2 jefferson fractures ( a ) and posterior 1/2 jefferson fractures ( b ) are both landells and van peteghem type i with isolated arch fractures . semi - ring jefferson fracture ( c and d ) are landells and van peteghem type ii , which also includes anterior 3/4 jefferson fracture ( e ) and posterior 3/4 jefferson fracture ( f ) ( a - c ) preoperative axial computed tomography ( ct ) scan and three - dimensional reconstruction ct shows anterior arch fracture associated with posterior arch fracture in the atlas , both of lateral mass displacement are about 7.0 mm transoral intraoperative view with the axis plate system , and bone grafting of autologous ilium were planted to anterior arch defect ( a and b ) axial and coronal plane computed tomography at 2 years followup showing satisfactory osseous fusion , the good position of the screws and good reduction of the fracture . the lateral displacement of the lateral masses was improved to 2.0 mm ( c and d ) dynamic flexion / extension lateral radiographs of cervical spine showing no c1-c2 instability the clinical photograph of the same patient at 2 years followup showing full range of motion of the cervical spine including more than 60 of rotation in each direction ( a - e ) preoperative axial plane , coronal plane , sagittal plane computed tomography ( ct ) scan and three dimensional reconstruction ct shows anterior arc comminution fractures on the right side associated with c6 burst fracture , the height of c6 vertebrae lost half , both of lateral mass displacement are about 6.0 mm ( f ) t2-weighted images in the sagittal plane show the gap and the signal intensity changes between c1 and c3 level .
prevertebral hematoma is indicated by solid white arrows , the width of prevertebral hematoma is about 9.8 mm in c1-c3 level , dural sac was partly compressed in c6 level , no abnormal spine cord signals ( a - c ) at 6 months followup , axial computed tomography and roentgenograph manifested satisfactory osseous fusion and cervical alignment .
the patient underwent a corpectomy of c6 and an anterior interbody fusion with a titanium mesh cage spacer and bone grafting of autologous c6 vertebrae patients were positioned supine on a radiolucent frame under general anesthesia .
the patient 's head was secured using gardner - wells tongs and 2 kg of traction was applied .
somatosensory - evoked potential monitoring was established to monitor spinal cord function through out the surgery .
the transoral approach was used as described by yin et al . and ai et al.910
after a codman transoral retractor was placed for exposure of the posterior pharynx , the posterior pharyngeal wall was incised vertically approximately 25 - 30 mm in the midline . after splitting the soft palate ,
the anterior arch of c1 and the anterior aspect of the lateral masses were exposed . to define the entry point for the screws , the lower margin and the medial edge of the lateral mass of c1 are palpated to determine the center of the lateral mass.11 any soft tissue in the fracture line
was removed . in order to achieve the reduction , plier was used during the surgery to approximate the c1 lateral masses by compressing at the outer walls bilateral [ figure 4 ] .
osteosynthesis of c1 was performed using reconstruction plates ; iliac crest bone grafting was necessary to reconstruct anterior arch defects in patients with burst fractures [ figure 2b ] . in five cases ,
c1 specific plate was applied on axis ( medtronic spine , memphis , tn , usa ) , while in seven cases treatment ao reconstruction plates were applied ( ao plate ; synthes spine , usa ) . in all cases , we used 3-hole , 40-mm - length , 5-mm - width , 2-mm - thick plates .
the length and diameter of screws used were 20 - 24 mm and 3.5 mm , respectively .
closure of the plier leads to approximation of the c1 lateral masses retrospective data included operative time ( measured from the incision of the posterior pharyngeal wall to complete suture closure of the pharyngeal wall ) , clinicoradiological assessment and associated complications
. lateral , dynamic flexion / extension , anterior - posterior and open mouth odontoid radiographs of the upper cervical level were obtained at 3 , 6 and 12 months postoperatively to assess union and alignment of c1-c2 .
1 mm thin - slice ct scans with multiplanar reconstruction were used to assess bone healing and accuracy of screw placement and fracture reduction .
the rotational capacity of the c1-c2 joints was measured by functional ct scans in the supine position as described by koller et al.12 and patients were treated with therapy focusing on restoring rotation .
the patient 's head was secured using gardner - wells tongs and 2 kg of traction was applied .
somatosensory - evoked potential monitoring was established to monitor spinal cord function through out the surgery .
the transoral approach was used as described by yin et al . and ai et al.910
after a codman transoral retractor was placed for exposure of the posterior pharynx , the posterior pharyngeal wall was incised vertically approximately 25 - 30 mm in the midline . after splitting the soft palate ,
the anterior arch of c1 and the anterior aspect of the lateral masses were exposed . to define the entry point for the screws , the lower margin and the medial edge of the lateral mass of c1 are palpated to determine the center of the lateral mass.11 any soft tissue in the fracture line
was removed . in order to achieve the reduction , plier was used during the surgery to approximate the c1 lateral masses by compressing at the outer walls bilateral [ figure 4 ] .
osteosynthesis of c1 was performed using reconstruction plates ; iliac crest bone grafting was necessary to reconstruct anterior arch defects in patients with burst fractures [ figure 2b ] . in five cases ,
c1 specific plate was applied on axis ( medtronic spine , memphis , tn , usa ) , while in seven cases treatment ao reconstruction plates were applied ( ao plate ; synthes spine , usa ) . in all cases , we used 3-hole , 40-mm - length , 5-mm - width , 2-mm - thick plates .
the length and diameter of screws used were 20 - 24 mm and 3.5 mm , respectively . a line diagram showing plier
closure of the plier leads to approximation of the c1 lateral masses retrospective data included operative time ( measured from the incision of the posterior pharyngeal wall to complete suture closure of the pharyngeal wall ) , clinicoradiological assessment and associated complications .
lateral , dynamic flexion / extension , anterior - posterior and open mouth odontoid radiographs of the upper cervical level were obtained at 3 , 6 and 12 months postoperatively to assess union and alignment of c1-c2 .
1 mm thin - slice ct scans with multiplanar reconstruction were used to assess bone healing and accuracy of screw placement and fracture reduction .
the rotational capacity of the c1-c2 joints was measured by functional ct scans in the supine position as described by koller et al.12 and patients were treated with therapy focusing on restoring rotation .
the patients were followed for average 16 months ( range 12 - 28 months ) .
average flexion 35 ( range 28 - 40 ) , average extension 42 ( range 30 - 48 ) .
lateral bending to the right and left averaged 30 and 28 , respectively ( range 12 - 36 and 14 - 32 respectively ) [ figure 2d ] .
the average postoperative rotation through the atlantoaxial joint , ( evaluated by functional ct scan ) , was an arc of 60 ( range 35 - 72 ) .
the average composite lateral lmd was 7.0 mm before surgery ( range 5 - 12 mm ) and improved to 3.5 mm after surgery ( range 1 - 6.5 mm ) [ figure 2c ] .
the total average difference of the atlanto - dens interval in flexion extension after surgery was 1.0 mm ( range 1 - 3 mm ) [ table 1 ] .
the average intraoperative blood loss was 300 ml ( range 100 - 500 ml ) and the average fluoroscopic time was 60 s. no patient developed neurological deficit , arterial injury or other postoperative complication . at 6 months followup , roentgenograph and ct scan demonstrated satisfactory cervical alignment and osseous fusion in all the 12 patients [ figure 3b ] .
all screws were in a good position and no screws developed evidence of loosening or breakage .
no c1-c2 instability was observed on flexion extension radiographs in any case [ figure 2c ] .
fractures of the atlas were originally described in the 1800s and further characterized through the classification systems given by jefferson,13 segal et al.,14 and levine and edwards.15 however , no single classification system can accurately describe the spectrum of atlas fractures seen in clinical practice .
most recent biomechanical studies of atlas fractures have concluded that these fractures are usually caused by axial loading through the occiput.161718 although there is agreement regarding treatment of stable jefferson fractures , the optimal management of unstable jefferson fractures remains controversial.619 the integrity of the transverse atlantal ligament ( tal ) is the single most important factor in determining the method of treatment.20 spence et al . reported a lateral mass spread > 6.9 mm implied a disruption of the tal.21 more recently , it has been proposed that mri is a more sensitive indicator of tal disruption than the rule of spence .
based on a series of 39 patients with atlas and/or axis fractures who were evaluated with mri , the authors reported that the use of standard cervical radiographs and the rule of spence would have failed to identify 60% of fractures with associated disruption of the tal.21 a recent report suggests that partial avulsion of the tal can be sufficiently stabilized by surgical immobilization to allow union of the atlas fracture and healing of the avulsion.22 an unstable burst fracture of the atlas may result in atlantoaxial instability , even if properly treated.23 patients on conservative management are often treated with initial reduction of the fracture with skeletal traction , followed by halo - vest immobilization .
advocates of surgical treatment cite high rates of nonunion and persistent neck pain as reasons to perform surgical stabilization.162425 neck pain is present in 20 - 80% of patients after external immobilization.14 segal et al.14 reported 18 patients with atlas fractures were treated using the external immobilization .
of the five patients with isolated c1 fractures , nonunion of the fracture and poor clinical results were seen in three patients leading to conclusion that isolated anterior arch fractures often go onto nonunion with nonoperative treatment .
nonunion of isolated fractures of the atlas may occur in association with disruption of the transverse ligament , inadequate fracture reduction or absence of adequate cervical immobilization.26 surgical immobilization has classically involved fusion from either the occiput to c2 or between c1 and c2 and posterior approaches offer the advantage of being a commonly performed approach with relatively low morbidity.2728 however , the major disadvantage of c1 - 2 or c0 - 2 fusion is the loss of motion of the c1 - 2 and c0 - 1 joints and potentially accelerated degeneration of the subaxial cervical spine.8 ideally , unstable atlas fractures would be treated with both stabilization of the atlas and maintenance of motion at the occipitocervical junction .
treatment strategies would involve limited fixation of the fracture to preserve the function of the atlantoaxial and atlanto - occipital joints while maintaining cervical alignment , possibly using either transoral limited internal fixation or limited posterior lateral mass fixation.816222529 c1 posterior osteosynthesis does expose the patient to the risks of vertebral artery and greater occipital nerve injury .
the greater occipital nerve is at risk with a more cranial starting point for c1 lateral mass screws and the vertebral artery can be injured near the c1 - 2 joint,2728 reduction via a posterior approach can be difficult to perform.8 ruf et al.8 presented an innovative technique for function - preserving c1 osteosynthesis via a transoral approach , which was used successfully to treat six patients with high - grade c1 lmd using either compression plating or a screw - rod construct .
this technique however , is unsuitable for mounting a screw - rod instrumentation of more than 2 mm in thickness as the posterior pharyngeal soft tissue can not completely cover the instrumentation , thus increasing the risk of wound infection.1030 the transoral approach has some disadvantages , including the high rate of postoperative infection and the technical difficulty , which increases the postoperative complication rate to as high as 75%.31 wound infection and dehiscence are common problems and observed in 9 - 22% of cases.3233 cerebrospinal fluid leaks , meningitis , neurological deficits and pseudomeningocele have also been reported .
breathing , swallowing and speech dysfunction may require gastrostomy and tracheostomy in 4% of patients.33 velopharyngeal insufficiency is noted in about 40% of patients.3233 although commonly reported , we have yet to experience any of the aforementioned complications in our patients . thorough preoperative oral cavity cleansing , establishing an ex - oral airway ( tracheotomy ) , sterilization of the oral cavity , careful postoperative oral cavity nursing care , prophylactic antibiotics and maintenance of optimal nutritional support are all likely contributing factors.911 we consider anterior 1/4 , posterior 1/4 or posterior 1/2 simple jefferson fracture which are not combined with transverse ligament rupture to be stable fractures ; injuries combined with transverse ligament ruptures should be treated as unstable fractures . during the surgery ,
skull traction via gardner - wells tongs contributes to achieving a partial reduction , which is of great importance during the surgery ; complete reduction is rare during surgery . in our series ,
12 patients underwent transoral limited internal fixation of the atlas using a pre bent steel plate and lateral mass screws to achieve a direct reduction of the lateral mass . a nearly anatomic reduction of the bony fragments
fracture reduction restored the congruence of the atlanto - occipital and atlantoaxial joints , preventing the development of early arthrosis of these joints .
reduction through an anterior approach is facilitated by the fact that the center of the lateral masses is close to the anterior aspect of the atlas ; the lever arm for reduction from an anterior approach is much shorter than it is from a posterior approach .
all patients achieved fracture reduction , good cervical alignment and successful healing of the fracture ; flexion / extension views demonstrated no loosening or breakage of screws and no c1-c2 instability .
patients improved clinically and cervical range of motion was adequately preserved as demonstrated by functional ct scan as described by koller et al.12 indications for this surgical approach include isolated atlas anterior 3/4 jefferson fracture , anterior 1/2 jefferson fracture and semi - ring jefferson fracture .
abeloos et al.7 pointed out that patients with isolated atlas fractures without ligament injury , which do not heal after conservative treatment , isolated atlas fractures associated with c1 lmd and type ii transverse ligament injury are also candidates for surgical intervention .
a contraindication to this treatment approach is atlantoaxial or atlanto - occipital joint instability , such as seen in an isolated atlas fracture combined with type i ligament injury , which should be treated with c1-c2 or c0-c2 fusion .
special attention must be paid to the importance of characterizing the type of transverse ligament injury when making treatment decisions.220 moreover , the technical nature of this procedure provides an additional challenge to the treating surgeon . to conclude , transoral osteosynthesis using an anterior arch plate and lateral mass screws for treating unstable jefferson fractures , which allows maintenance of rotatory mobility in the c1-c2 joint and restoration of congruency in the atlanto - occipital and atlantoaxial joints is a viable option .
the procedure is able to achieve an anatomic reconstruction of the atlas and a reliable bony fusion of the fragments with a low morbidity rate . | background : majority of c1 fractures can be effectively treated conservatively by immobilization or traction unless there is an injury to the transverse ligament .
conservative treatment usually involves a long period of immobilization in a halo - vest .
surgical intervention generally involves fusion , eliminating the motion of the upper cervical spine .
we describe the treatment of unstable jefferson fractures designed to avoid these problems of both conservative and invasive methods.materials and methods : a retrospective review of 12 patients with unstable jefferson fractures treated with transoral osteosynthesis of c1 between july 2008 and december 2011 was performed .
a steel plate and c1 lateral mass screw fixation were used to repair the unstable jefferson fractures .
our study group included eight males and four females with an average age of 33 years ( range 23 - 62 years).results : patients were followed up for an average of 16 months after surgery .
range of motion of the cervical spine was by and large physiologic : average flexion 35 ( range 28 - 40 ) , average extension 42 ( range 30 - 48 ) .
lateral bending to the right and left averaged 30 and 28 respectively ( range 12 - 36 and 14 - 32 respectively ) .
the average postoperative rotation of the atlantoaxial joint , evaluated by functional computed tomography scan was 60 ( range 35 - 72 ) .
total average lateral displacement of the lateral masses was 7.0 mm before surgery ( range 5 - 12 mm ) , which improved to 3.5 mm after surgery ( range 1 - 6.5 mm ) .
the total average difference of the atlanto - dens interval in flexion and extension after surgery was 1.0 mm ( range 1 - 3 mm).conclusions : transoral osteosynthesis of the anterior ring using c1 lateral mass screws is a viable option for treating unstable jefferson fractures , which allows maintenance of rotation at the c1-c2 joint and restoration of congruency of the atlanto - occipital and atlantoaxial joints . |
local anesthetic injection is the most anxiety - provoking procedure for children.1 injection also produces the greatest negative response in children.2 pain and anxiety can reduce the efficacy of anesthesia in pediatric patients.3 inferior mandibular nerve block is the technique of choice for treatment of mandibular primary molars.2 however , the mandibular nerve block technique has some disadvantages for children such as a higher percentage of post - operative trauma ( lip and tongue biting)4 - 6 and increased risk of trismus7 and positive aspiration that occurs in 10 - 15% cases.8 facial nerve palsy is a complication of inferior alveolar nerve block anesthesia.9 considering the side effects of the mandibular nerve block technique , periodontal ligament ( pdl ) injection can be considered as an alternative.10,11 this technique is simple and seems to provide adequate pain control without an extended period of post - operative anesthesia .
this technique also requires very small quantities of anesthetic solution.2 results of study showed 91/5% effectiveness for restorative procedures when pdl injection was used .
the success rate of this technique was 66/6% for crown preparation and 50% for endodontic procedures.9 another study also reported a 92% success rate for pulpal anesthesia with this technique.12 results of a study showed that the success rate of pdl injection for restorative treatment , pulpotomy and extraction is 91/46%.13 because mandibular block has some side effects , and pdl injection has some advantages , it makes sense to evaluate the effectiveness of pdl injection in anesthetizing of mandibular primary molars .
the purpose of this study was to compare the effectiveness of pdl injection in the anesthesia of primary molar pulpotomy with mandibular block .
this study was conducted at the dental clinic of shahed university from september to december 2011 .
the study was performed using sequential double - blind randomized trial . based on a pilot study and a previous study
80 children aged between 3 and 7 years who required pulpotomy ( based on pre - operative radiograph and clinical signs ) on symmetrical mandibular primary molars were selected and entered in the study sequentially .
these children were healthy and did not have any contra indications for local anesthesia and were cooperative ( 3,4 frankle classification ) .
all children participating in the study were treated by the same operator . in each child who did not have any disease and contra indication for local anesthesia and was not uncooperative ( 1,2 frankle classification ) .
a primary molar on one side randomly received a nerve block injection and its symmetrical tooth received pdl injection randomly .
random allocation ( using a coin ) was done by the dental assistant who was instructed for this duty and was not informed about the study design .
topical anesthetic was applied before injection in both techniques . in the mandibular nerve block technique approximately 1/3 and 0/5 ml of an esthetic solution2 ( persocain e , lidocain hcl darupakhsh pharmaceutical mfa co. , iran )
was placed near the inferior alveolar nerve and in the muco buccal fold ( aesculap syringe , made in usa , niddle : nik rahnama karco , made in iran , 27g- short ( 0.4 - 25 mm ) , respectively . in the pdl technique ,
0.2 ml of anesthetic solution was placed in the bottom of the middle part of the buccal gingival sulcus until blanching of the buccal tissue was observed . at the time of injection ,
signs of discomfort included eye movement , hand and body tension , the verbal complaint and crying ( sem scale).13 these were evaluated after 3 min in the pdl injection group ( because onset of anesthesia after pdl injection is faster than mandibular block ) and after 5 min in the block group by a single rater who was not the surgeon and was blinded to group allocation .
finally , the data were analyzed using the exact fisher test and pearson chi - square exact test .
the results of this investigation were derived from a sample population comprising 41 female ( the samples were selected randomly ) and 39 males .
in the inferior alveolar nerve block group , two patients ( one 4-year - old and one 6-year - old ; both of the teeth were e ) exhibited hand and body tension . verbal complaint was seen in four cases ( one 7-year - old , two 4-year - olds , and
one 5-year - old ; 1 of the teeth was d and three were e ) and crying was seen in one patient ( 4-year - old ; the tooth was an e ) . in the pdl injection group ,
two patients ( one 3-year - old and one 4-year - old ; one tooth was d , and one was e ) exhibited hand and body tension .
verbal complaint was seen in six patients ( three 5-year - olds , one 3-year - old and two 4-year - olds ; the teeth were two d and four e ) and crying was observed in one case ( a 3-year - old ; the tooth was e ) .
based on the results of this study success rate was 88/75 and 91/25 in the pdl injection and nerve block groups , respectively .
there was no statistically significant difference between the two techniques ( p = 0.250 ) .
the pearson chi - square exact test showed that there was not a significant difference in pain based on the patient s age and gender between the two groups ( p = 0.250 ) .
the fisher exact test showed that there was not a significant difference in pain between the first and second primary molar ( p=0.250 ) .
when anesthesia is not successful , pain during dental treatment is tormenting.14,15 unfortunately approximately 11.6% of children aged 26 - 155 months experience insufficient levels of anesthesia during dental procedures.16 this may be due to the child s age and gender17 - 19 anxiety about injection15,20 the kind of anesthetic agent administered21,22 the operative procedure performed16,17 the use of nitrous oxide / oxygen analgesia and oral sedation23 whether they are arch treated16 - 18 and method of local anesthetic administration.5 when the tooth is clinically normal , the success rate of inferior nerve block has been reported to be approximately 75 - 90% or more.24 furthermore , deeper penetration of the needle causes more discomfort and access to the injection area can be difficult.5 pdl injection is an easy technique that probably produces adequate anesthesia for primary molar pulpotomy.25 in this study , we evaluated the effectiveness of pdl injection as primary injection not as adjunctive compared with mandibular block in the pulpotomy of primary molars . in pdl technique
, we injected an anesthetic agent into the middle of the sulcus on the buccal surface and observed gingival blanching and high success rate of this technique in the present study can be related to this point .
these results indicate that the pdl injection is an effective technique for performing pulpotomy on a primary molar . according to results of this study , pdl injection was effective in 88/75% of all cases .
the results of malamed s study showed that pdl injection is 50% effective for endodontic treatment , and these results do not agree with our results .
he used this technique on eight teeth and pointed out that the sample size he used was small for endodontic procedures and that additional research must be done.9 in this study injection of an anesthetic agent was done into the middle of the sulcus on the buccal surface , and gingival blanching was observed .
it is probable that the differences between the results of our study and malamed s stem from this key difference .
furthermore , anatomical position of primary molars and bone density in the primary dentition can affect on the success rate of pdl injection in the present study .
walton and abbott reported a 92% success rate for this technique.12 the results of his study are in accordance with those of our study .
however , walton evaluated the effectiveness of pdl injection in all teeth ( anterior and posterior ) in both the maxilla and mandible and found that the technique is least effective in mandibular molars.12 we compared the effectiveness of anesthetizing mandibular primary molars with mandibular block and pdl injection in pulpotomy procedures and believe that our study is more accurate than walton s study .
a study by haghgoo found that the success rate of periodontal injection for the pulpotomy of mandibular primary molars ( 30 cases ) was 83/4%.13 the results of our study are similar to hers .
however , the sample size in our study was more than in haghgoo s and the age range in our study was smaller .
another study by naidu et al . compared the effectiveness of the mandibular block / long buccal with infiltration / intra papillary for pulpotomy and stainless steel crown placement in lower primary molars.26 results of this study showed that there was no difference in the effectiveness of pain control between infiltration / intra papillary injection and inferior alveolar nerve block / long buccal infiltration .
however , naidu et al . compared infiltration / intra papillary injection and inferior alveolar nerve block / long buccal infiltration for pulpotomy and stainless steel crown placement in lower primary molars and in present study effectiveness of pdl injection and block injection have been compared .
oztas et al . compared children s reactions to inferior alveolar nerve injection with a traditional syringe and pdl injection with a computerized device ( wand ) and found that immediately after injection the traditional syringe was more painful than injections and pain scores with the wand were significantly higher than those with traditional inferior alveolar nerve injections at the end of the recovery.27 the results of oztas et al .
study contra lateral primary mandibular second molars were treated in two separate visits , and the differences in the results of these two studies may be a result of differences in methods and materials .
the results of the present study indicate that there was no significant difference in pain between first and second primary molars .
studies generally compared effectiveness of pdl injection in mandibular first and second primary molars . in pdl injection
, an anesthetic agent is injected into the bottom of the gingival sulcus and this area is similar to the mandibular first and second primary molars .
this technique provides reliable pain control rapidly and only requires very small quantities of anesthetic solution.2 in the present studied we investigated the effectiveness of pdl injection in the anesthesia of primary molar pulpotomy with mandibular block .
it is recommend that the effectiveness of pdl injection will be studied in dental treatment including pulp treatment and restoration and extraction of maxillary molars and incisors .
based on the results of this study , pdl injection can be used for pulpotomy of mandibular primary molars . | background : inferior alveolar nerve block is a common technique for anesthesia of the primary mandibular molars . a number of disadvantages have been shown to be associated with this technique .
periodontal ligament ( pdl ) injection could be considered as an alternative to inferior alveolar nerve block .
the aim of this study was to evaluate the effectiveness of pdl injection in the anesthesia of primary molar pulpotomy with mandibular block.methods:this study was performed using a sequential double - blind randomized trial design .
80 children aged 3 - 7 years old who required pulpotomy in symmetrical mandibular primary molars were selected .
the teeth of these children were anesthetized with periodontal injection on one side of the mandible and block on the other .
pulpotomy was performed on each patient during the same appointment .
signs of discomfort , including hand and body tension and eye movement , the verbal complaint and crying ( sem scale ) , were evaluated by a dental assistant who was blinded to the treatment allocation of the patients .
finally , the data were analyzed using the exact fisher test and pearson chi - squared exact test.results:success rate was 88/75 and 91/25 in the pdl injection and nerve block groups , respectively .
there was no statistically significant difference between the two techniques ( p = 0.250).conclusion : results showed that pdl injection can be used as an alternative to nerve block in pulpotomy of the mandibular primary molars . |
we collected adult and immature arthropods on december 513 , 2000 , using carbon dioxide baited cdc miniature light traps and by sampling potential larval habitats with dippers .
adult specimens were frozen in liquid nitrogen for later virus testing in fort collins , colorado . to investigate potential vertical transmission of rvfv , mosquito larvae were reared to adults in the malaria control laboratory in abha , asir region , for later virus testing in the united states .
all collection sites were in very arid habitats ; the soil is dry and rocky , and acacia species are the only trees present .
livestock , including goats ( the predominant animal ) , sheep , camels , and cattle , were present at every site .
light traps were hung in and near the residences of recent patients , and the area was examined for larval habitats .
typical larval habitats included wastewater catchments from houses that yielded mainly culex pipiens complex mosquitoes ; pools at the edge of wadis ; and small , walled , passively or actively flooded cultivated plots that yielded aedes vexans arabiensis and ae .
( stegomyia ) unilineatus , a mosquito species previously recorded from africa , india , and pakistan , was found in light trap collections from several sites ( godsey ms , submitted for publication ) .
the low species diversity and small numbers collected in light traps may have reflected that rainfall was light to nonexistent 2 weeks before our collection efforts .
we did examine one walled farming plot , which contained water to a depth of approximately 5 cm ; it held enormous numbers of ae .
collected arthropod specimens were identified and placed into pools of up to 50 individual mosquitoes by collection site .
a total of 161 pools were triturated , clarified by centrifugation , and spread onto confluent sheets of vero cells in six - well plates ( 4 ) . a single pool ( sa01 # 1322 ) yielded a virus isolate .
the virus was identified as rvfv by sequencing a dna fragment amplified from the m segment by reverse transcription - polymerase chain reaction using the primers rvf3082 5actttgtgggagcagccgtatctt3 and rvf3400 5cctgcttcccgcctatcatcaaat3. rvfv was isolated from a pool of 37 ae .
vexans arabiensis female mosquitoes collected by light trap at site 3 ( n18 45.089 min ; e41 56.373 min ) near the city of muhayil . a human infection was recorded from this site ( " agida " ) ; we also witnessed aborted bovine fetuses on the property .
rvfv is a member of the virus family , bunyaviridae ; the genomes of these viruses exist in three pieces or segments : small ( s ) , medium ( m ) , and large ( l ) .
we sequenced a portion of each of the genome segments and analyzed them by the maximum likelihood algorithm in paup ( 5 ) in relation to the published sequences of other geographic isolates to determine the possible origin of the mosquito isolate and whether the isolate was a possible reassortant between two existing virus strains ( 5,6 ) .
maximum likelihood trees for each genomic segment shared identical topologies ( data not shown ) .
the congruence of placement of the saudi virus strain in the three trees indicated that this virus was not a reassortant .
the phylogram for segment m ( figure ; table 2 ) demonstrates that the most closely related rvfv isolates were from kenya ( 1997 ) and madagascar ( 1991 ) .
reasonable hypotheses to explain how rvfv was introduced into the kingdom of saudi arabia ( and/or yemen ) from east africa are that an infected mosquito was carried over the narrow waterway between the red sea and the gulf of aden by air currents or that infected livestock were imported from east africa .
how long the virus was in the arabian peninsula before the epidemic occurred is unknown .
maximum likelihood phylogram of african rift valley fever virus strains ( see table 2 ) and mosquito isolate from the kingdom of saudi arabia based on a 655-bp dna fragment from the m segment ( 4 ) .
all three species should be considered important epidemic and epizootic vectors of rvfv in saudi arabia .
vexans arabiensis , has the potential to be an important epidemic and epizootic vector because of the tremendous numbers of individual mosquitoes that are produced after a flooding rain .
whether or not rvfv is able to persist on the arabian peninsula is unknown . clearly , vertical transmission of the virus in the epidemic mosquito vector would be an important factor to consider . | an outbreak of rift valley fever in the kingdom of saudi arabia and yemen in 2000 was the first recognized occurrence of the illness outside of africa and madagascar .
an assessment of potential mosquito vectors in the region yielded an isolate from aedes vexans arabiensis , most closely related to strains from madagascar ( 1991 ) and kenya ( 1997 ) . |
a 52-year - old woman sought treatment for decreased visual acuity of 1 month in the right eye .
the patient was previously treated with radial mastectomy and chemotherapy 5 years ago for an invasive ductal carcinoma of the right breast .
lung , liver , bone and brain metastases were found 1 year previously . on initial examination , visual acuity with correction
was 0.63/0.8 ( od / os ) and intraocular pressure ( iop ) was 15/16 mmhg .
right fundoscopy revealed an elevated mass - like lesion at temporal to the macule with serous retinal detachment .
no choroidal lesions were observed in the left fundus.a right fluorescein angiogram revealed hypofluorescence during the prearterial and arteriovenous phase and hyperfluorescence during the venous phase .
the venous phase showed nearly complete masking of background choroidal fluorescence at the elevated lesion due to leakage and neovascularization ( fig .
treatment was started with diode lasers while the patient was undergoing chemotherapy in hematology ( gemzar - navelvin 4th , taxotere - cis 3rd ) .
the typical settings were as follows : intensity , 300 - 400 milliwatts ; duration , 0.2 seconds ; size , 200 - 500 microns ; 250 - 300 shot per serial .
the patient underwent treatment with a diode laser once a week for a total of 4 weeks .
after 50 days , right funduscopy revealed mass regression in size and height and resolved retinal detachment .
right fluorescein angiogram revealed a flat devascularized choroid , the venous phase showed some leakages from the old lesion that affected the fovea ( fig .
the various methods for treatment of choroidal metastasis areas follows : observation , radiotherapy , laser photocoagulation , transpupillary thermotherapy , chemotherapy , and enucleation.3 radiotherapy is the preferred modality for local treatment of an ocular tumor .
although shown to be very effective , 3 to 4 weeks of daily radiation treatment is necessary , which many patients with metastasis find daunting , considering the serious condition of their health.4 radiotherapy presents a risk for local complications such as cataracts , dry eye syndrome , and radiation retinopathy.3,5 according to halpern and colleagues,6 chemotherapy alone is effective in approximately one third of the cases .
however , systemic therapy has side effects such as gastrointestinal manifestation , fatigue , generalized weakness , neutropenia , or cardiotoxic effects.7 laser photocoagulation yields a rapid response , is easy to perform on an outpatient basis , and is an effective therapy .
levinger and colleagues,5 treated 10 eyes of 7 patients with krypton red or argon green laser applications for small choroidal breast carcinoma metastasis with serous detachment of the retina . in all eyes ,
the tumor decreased , the subretinal serous detachment was absorbed , the retina flattened , and the visual acuity improved without complications .
the method by which the laser is effective in eradicating choroidal metastases is not clear . according to levinger and
colleagues,5 the effectiveness of the laser treatment was not a result of occlusion of the retinal or choroidal blood circulation .
a possible explanation for the mode of laser action is the destruction of the vasculature of the tumor . in other words ,
the laser closes all the blood vessels of the tumor , causing the tumor cells to die .
glaser and colleagues8,9 suggested that laser treatment may effect the retina and choroid through the release of extracellular modulating factors by laser - induced chorioretinal scars including neovascularization inhibiting factors .
if this theory is correct , the laser may induce destruction of the metastatic tumor by inhibition of the tumor angiogenesis , and formation of ischemia.5 in this study , diode laser photocoagulation was selected because the patient 's physical condition was poor and the laser procedure was short .
consequently , the mass regressed , subretinal serous detachment was absorbed , and the visual acuity improved .
laser photocoagulation does not appear to cause complications for the patient and may be an effective treatment for patients with choroidal metastasis of breast carcinoma . | to report a single case of improvement on choroidal metastasis of breast cancer after laser photocoagulation . a 52-year - old female patient who complained of visual disturbance of the right eye with multiple states of metastasis of breast carcinoma . on initial examination ,
the right best - corrected visual acuity was 0.63 .
right fundoscopy revealed an elevated mass - like lesion temporal to the macule with serous retinal detachment .
the mass had a 3.5-disc diameter . a right fluorescein angiogram revealed hypofluorescence during the prearterial and arteriovenous phase and hyperfluorescence during the venous phase .
the venous phase showed almost total masking of background choroidal fluorescence at the elevated lesion because of leakage and neovascularization .
the patient was treated 4 times by diode laser photocoagulation in addition to chemotherapy .
fifty days after the diode laser treatments , the funduscopy examination and fluorescein angiogram revealed that the serous retinal detachment had been absorbed , the choroid had become flat , the lesion had been reduced in size and hyperfluorescence .
the right best - corrected visual acuity was improved to 0.8 .
laser photocoagulation appears not to cause any problems for the patient and may be an efficient treatment for patients with choroidal breast carcinoma . |
the bacterium escherichia coli is widely used as indicator of the bacteriological condition of food and environments due to its almost exclusively fecal origin .
the presence of e. coli in fresh - marketed seafood indicates recent contamination and is usually attributed to infected handlers or storage on contaminated ice .
the intensification of production and the consequent increase in stocking density have made fish farming more vulnerable to disease [ 3 , 4 ] .
the indiscriminate use of antibiotics to treat infections and promote growth has been shown to be inefficient in the long run and to put selective pressure on bacterial populations favoring the development of resistant strains potentially hazardous to public health [ 57 ] .
in fact , bacterial strains resistant to different families of antibiotics have been isolated from environmental samples by a number of researchers [ 810 ] .
foodborne strains resistant to antibiotics pose a risk to consumers ' health and favor the transference of the phenotype to humans through the food chain [ 1113 ] .
there are no reports of illnesses caused by e. coli in farmed fish , but resistant strains may be selected due to the presence of antibiotics in the culture environment , leading to the dissemination by mobile genetic elements of resistance to potentially pathogenic bacteria [ 1417 ] . due to the importance of tilapia farming in northeastern brazil ,
the aim of the present study was to ( a ) investigate the presence of e. coli in fresh - marketed nile tilapia obtained from supermarkets in fortaleza , brazil , ( b ) establish the antibiotic susceptibility profile of e. coli strains isolated from nile tilapia samples , ( c ) determine whether resistance was potentially chromosomal or plasmidial , and ( d ) determine the multiple antibiotic resistance index of strains isolated from gills , muscle , and body surface .
thirty - six specimens of nile tilapia ( oreochromis niloticus ) were collected from twelve supermarkets in fortaleza ( cear , brazil ) .
the specimens were wrapped individually in plastic film and transported in ice - cooled isothermal boxes to the laboratory of seafood and environmental microbiology of the marine sciences institute ( federal university of cear ) for immediate bacteriological analysis .
the e. coli investigation followed the guidelines of the fourth edition of the compendium of methods for the microbiological examination of foods released by the american public health association .
presumptive tests were performed separately for gills , muscle , and body surface . to sample the body surface , an area measuring 10 10 cm
was stroked with a sterile cotton swab previously soaked in difco brain heart infusion ( bhi ) broth and subsequently immersed in 9 ml 0.85% nacl solution ( vetec ) diluted serially to 10 . to sample the gills
, a 25 g aliquot was homogenized in 225 ml 0.85% nacl solution , shaken in a magnetic stirrer for 30 min , and diluted serially to 10 . to sample the muscle , a 25 g aliquot was ground and homogenized in 225 ml 0.85% nacl solution and diluted serially to 10 .
a 1 ml aliquot was retrieved from each saline dilution and seeded with three repetitions in a test tube containing 10 ml lauryl sulfate tryptose ( lst , difco ) .
aliquots from positive lst tubes were seeded in 4 ml tubes containing ec broth and incubated in a water bath at 45c for 48 hours .
e. coli was isolated using eosin - methylene blue agar plates ( difco ) , from which 35 colonies suspected of e. coli were selectedand submitted to imvic testing .
colonies were considered to be e. coli when positive in the indole and methyl - red test , negative in the voges - proskauer and citrate test , and gram - negative with short rods in the gram staining test .
the antibiogram was done with the disk diffusion method using mueller - hinton agar ( difco ) .
initially , an emulsion of sample in saline solution was prepared by adjustment to the 0.5 mcfarland turbidity standard , equivalent to 1 10 cfuml ( clsi 2010 )
. the susceptibility of the e. coli strains was tested in relation to several families of antibiotics , including the aminoglycoside family : amikacin ( ami ; 30 g ) and gentamicin ( gen ; 10 g ) ; the carbapenem family : imipenem ( imp ; 30 g ) ; the cephalosporin family : cephalothin ( cet ; 30 g ) and cefotaxime ( ctx ; 30 g ) ; the fluoroquinolone family : ciprofloxacin ( cip ; 5 g ) ; the monobactam family : aztreonam ( atm ; 30 g ) ; the penicillin family : ampicillin ( amp ; 30 g ) ; the quinolone family : nalidixic acid ( nal ; 30 g ) ; the sulfonamide family : sulfametoxazol - trimetoprim ( sut ; 25 g ) ; and the tetracycline family : tetracycline ( tc ; 30 g ) . using sterile tweezers , commercially available antibiotic disks ( laborclin ) were placed individually on the surface of mueller - hinton agar . after 24 hours of incubation at 35c , the strains were scored as susceptible , intermediate , or
resistant to each antibiotic based on the measurement of the inhibition halo , as recommended by clsi .
the multiple antibiotic resistance ( mar ) index was determined for the total number of e. coli strains from each type of tissue sampled ( gills , muscle , and body surface ) using the formula a/(b c ) , where a is the total resistance score of the strains , b is the total number of families of antibiotics tested , and c is the number of strains from each type of tissue sampled .
resistant e. coli strains were submitted to plasmid curing using acridine orange dye at 100 gml ( sigma ) .
following exposure to the mutagen , the strains were rechallenged with the antibiotics to which they were initially resistant .
forty - four of the isolates were confirmed to be e. coli , 25 ( 56.82% ) of which were isolated from gills , 15 ( 34.09% ) from the body surface , and 4 ( 9.09% ) from muscle .
eleven e. coli strains isolated from gills and body surface were resistant to amp , sut , and tc , especially to last of these ( gills n = 4 ; surface n = 3 ) . on the other hand , strains isolated from muscle samples were susceptible to all the antibiotics tested ( table 1 ) .
all strains isolated from gills , muscle , and body surface were susceptible to ami , atm , cet , ctx , cip , gen , and imp .
according to some authors , the gills have a more diversified microbiota , qualitatively and quantitatively , due to their direct contact with the water , especially in plankton feeders such as the nile tilapia [ 2326 ] .
also detected e. coli in nile tilapia muscle samples , but many authors believe that the muscle is a relatively innocuous tissue [ 2830 ] .
nevertheless , the muscle may be contaminated during harvesting , a stressful process which often causes injury to the body surface , and/or during storage on contaminated ice [ 31 , 32 ] .
molinari et al . add that e. coli is commonly found in the gut of the tilapia ; thus , to these authors , its presence in the muscle is an indication of poor handling practices .
four resistance profiles were observed in this study : resistance to tc ( n = 5 ) , resistance to amp ( n = 4 ) , resistance to sut+tc ( n = 1 ) , and resistance to amp+sut+tc ( n = 1 ) ( table 2 ) .
the profiles sut+tc and amp+sut+tc involved more than one family of drugs and were therefore considered profiles of multiple antibiotic resistance .
the mar indexes for strains isolated from body surface and gills were 0.037 and 0.026 , respectively . in a study by jiao et al . on the occurrence of e. coli in the gut of farmed nile tilapia ,
the isolated strains were susceptible to ami , atm , ctx , and gen , matching our own findings and supporting the notion that these antibiotics are little used in aquaculture .
e. coli strains resistant to amp , sut , and tc were also reported by ryu et al . .
likewise , resistant strains of e. coli to tc were found by wang et al . .
the authors suggest that improperly handled seafood is a critical reservoir for the dissemination of bacterial genes of multiple resistance .
acridine orange curing of the 11 e. coli strains resistant to amp , sut , and tc revealed resistance to be plasmid - mediated in 4 cases and potentially chromosomal in 7 .
thus , residues may be detected up to 10 days after administration , suggesting the possibility of detecting bacteria resistant to sut for a relatively long period .
the presence of mobile genetic elements of resistance , especially plasmids and integrons , poses a risk to public health , as evidenced by koo and woo .
not surprisingly , tendencia and dela pea observed that the indiscriminate use of antibiotics in aquaculture has been paralleled by a significant increase in the number of reports of resistant bacteria isolated from aquaculture stock .
the overall high antibiotic susceptibility of e. coli strains isolated from fresh - marketed nile tilapia was satisfactory , although the occasional finding of plasmid - mediated resistance points to the need for close microbiological surveillance of the farming , handling , and marketing conditions of aquaculture products .
nevertheless , it is necessary to note the origin of marketed fish in order to evaluate the potential risk to the consumer . | the contamination of seafood by bacteria of fecal origin , especially escherichia coli , is a widely documented sanitary problem .
the objective of the present study was to isolate e. coli strains from the gills , muscle , and body surface of farmed nile tilapias ( oreochromis niloticus ) fresh - marketed in supermarkets in fortaleza ( cear , brazil ) , to determine their susceptibility to antibiotics of different families ( amikacin , gentamicin , imipenem , cephalothin , cefotaxime , ciprofloxacin , aztreonam , ampicillin , nalidixic acid , tetracycline , and sulfametoxazol - trimetoprim ) , and to determine the nature of resistance by plasmid curing .
forty - four strains ( body surface = 25 , gills = 15 , muscle = 4 ) were isolated , all of which were susceptible to amikacin , aztreonam , cefotaxime , ciprofloxacin , gentamicin , and imipenem .
gill and body surface samples yielded 11 isolates resistant to ampicillin , tetracycline , and sulfametoxazol - trimetoprim , 4 of which of plasmidial nature .
the multiple antibiotic resistance index was higher for strains isolated from body surface than from gills .
the overall high antibiotic susceptibility of e. coli strains isolated from fresh - marketed tilapia was satisfactory , although the occasional finding of plasmidial resistance points to the need for close microbiological surveillance of the farming , handling , and marketing conditions of aquaculture products . |
a number of patients with marfan syndrome eventually undergo surgical correction of cardiovascular systemic involvement of the disease with not infrequent and various unexpected post - operative complications .
we herein report a case of newly developed aortic dissection after aorta cannulation during mitral valve surgery in a patient with marfan syndrome .
1a , b and c ) underwent a planned mitral valve surgical procedure due to symptomatic severe mitral regurgitation { new york heart association ( nyha ) class iii / iv } ( fig .
an electrocardiogram revealed a sinus rhythm with non - specific st - segment and t wave changes . for surgical treatment of mitral valve disease
, an ascending aorta cannulation was performed for cerebral protection during cardiopulmonary bypass ( cpb ) . pre -
operatively , the patient had no evidence of aortic dissection on transthoracic echocardiography ( tte ) and computed tomography ( ct ) ( fig .
the cardiac surgery was completed successfully and the patient was stable during the immediate post - operative period .
the aorta was screened with intraoperative transesophageal echocardiography before and after cpb , which revealed no significant aortic disease . however ,
routine tte carried out for evaluation of cardiac performance 1 day post - operatively revealed a dissecting flap at the ascending portion of the thoracic aorta ( fig .
therefore , ct was performed for full evaluation of aorta pathology , which revealed a newly developed aortic dissection involving the entire aorta ( stanford type a ) ( fig .
the patient underwent a second operation for the unexpected aortic dissection ( hemiarch replacement and the bentall procedure ) 1 day after the mitral valve surgery for stabilization , which was successful ( fig .
the dissecting flap and entry site of the aortic dissection at previous cannulation site on the ascending aorta was observed during the operation ( fig .
three weeks later , the patient was discharged from our hospital in good general condition .
marfan syndrome is an autosomal dominant inherited connective tissue disorder caused by a fibrillin-1 gene mutation with a prevalence of 1 in 5000 - 10000 individuals.1 ) the condition is associated with involvement of the cardiovascular system , along with the skeletal , ocular , and respiratory systems , in addition to other tissues such as skin , integument , and dura mater.2 ) approximately 77% of patients with marfan syndrome have major cardiovascular involvement such as valve disease and aortic pathology,2 ) a considerable number of whom eventually need surgical correction .
our patient had severe mitral regurgitation and underwent a mitral valve repair , where the mitral valve operation itself was successful .
the main pathophysiology of marfan syndrome is the disordered incorporation of fibrillin into connective tissue , while media of the vascular wall is prone to cystic medial necrosis and vacuolization.3 ) aortic involvement in marfan syndrome can cause aortic dissection and/or rupture , which are common causes of premature death.4 ) there was no evidence of aortic disease in our patient based on pre - operative imaging studies .
however , aortic cannulation during cbp could have injured the aortic wall , which may have been an initiating factor for the newly developed aortic dissection .
aortic dissection is a probable complication after aorta cannulation during cbp and the threatening condition associated with aortic injury during percutaneous interventional procedure has been reported in patients who underwent supra - aortic debranching and endovascular stenting of the aortic arch and the descending aorta.5 ) moreover , kumar et al.6 ) reported an interesting case of an iatrogenic acute dissection of marfanoid aorta after cardiac surgery .
the case was notable because the location of the intimal tear was not the directly manipulated site .
therefore , it can be said that patients with marfan syndrome have existing subclinically disordered aorta wall tissue , even without significant findings on currently available cardiovascular imaging modalities . at the same time , fluctuating cardiac performances during the post - operative period and cardiotonic agent use after cardiac surgery may be contributing factors for disastrous conditions in patients with marfan syndrome in whom the aortic wall is weak and friable .
our case strongly suggests that aorta cannulation should be carried out with caution during cardiac surgery in patients with marfan syndrome and appropriate imaging studies , including echocardiography to survey probable complications of aorta cannulation , should be performed after surgery .
concurrently , strict hemodynamic monitoring and appropriate cardiac performance control must be applied in the post - operative period until the cannulation site is completely healed . | we report a case of newly developed aortic dissection after aorta cannulation during mitral valve surgery in a patient with marfan syndrome .
an unexpected fatal complication of cardiac surgery detected on postoperative imaging survey in marfan syndrome patient and its surgical finding are described . |
nanoparticle assemblies have gained significant attention recently with the intention of comprehending the true potential applications of their unique physical , optical , and electronic properties .
the ultimate aim is to interface these assemblies to microscale and subsequently to macroscale by organizing them into higher - level structures , devices , and systems with well - defined functionality .
gold platinum ( au pt ) bimetallic nanoparticles as alloy or core shell structure , in particular , has attracted increased interest due to its superior performance as fuel cell catalyst over conventional platinum ( pt ) based catalyst [ 4 - 6 ] .
the major problem for pt - based catalyst is their poisoning by co - like intermediates .
the unexpected finding of catalytic activity of gold at the nanoscale has opened up various new possibilities of catalyst development and it is well - known today that presence of au in aupt system enhances the catalytic activity for electrochemical methanol oxidation reaction ( mor ) as a result of electronic interaction between au and pt or from the lattice parameter contraction .
currently , these catalysts are mostly synthesized through direct deposition of pt on the preformed gold nanoparticle ( au np ) seeds in solution [ 3,10 - 13 ] or on solid supports
. however , problem arises from their tendency of coagulation , which occurs due to the unusual high surface energy . while different capping agents such as thiols , amines , phosphines , polymers etc
are normally used in synthesis methods to stabilize and disperse these nanoparticles , interaction with these stabilizing agents may profoundly alter the catalytic properties of these systems .
although assemblies of monometallic nanoparticles are reported extensively [ 16 - 19 ] , alloy or core
therefore , new methods of assembling these bimetallic nanoparticles on appropriate surfaces are necessary to integrate them as possible components for future nanodevices or as novel catalysts for fuel cell applications .
shell nanoparticle ( au pt np ) employs the deposition of pt layer onto preformed self - assembled seed au nps on silicon surfaces through the reduction of ptcl6 in presence of nh2oh as the mild reducing agent . in another recent approach , au np film at the air
water interface was transferred to a solid surface to build a three dimensional nanoporous structure and finally coated with a pt layer to form the desired core
shell nanoparticles , stabilization against coagulation and fabrication over a large surface area still remains a challenge . as an alternative strategy , nanoparticle assemblies can be generated in situ inside a suitable template on a solid surface to avoid number of sequential steps involved in the methods discussed before .
moreover , the template will essentially act as a reaction chamber that provides scaffold for immobilization of specific metal ions , prevent aggregation , and further act as capping agent to control the growth of the desired nanoparticle structure .
it is also possible to create lithographically defined structures of a suitable template to generate nanoparticle patterns without the multiple steps of synthesis and absorption of the corresponding nanoparticles from solution . in this paper
pt np assemblies on silicon and indium tin oxide ( ito ) coated glass surfaces and also demonstrate that these nanoparticle assemblies are catalytically active towards methanol electro - oxidation which is one of the key electrode reactions in direct methanol fuel cells ( dmfcs ) .
water used in these experiments was purified though a millipore system with a resistivity of 18 m cm .
boron doped p - type silicon wafers polished on one side ( resistivity 1030 ohm cm ) were purchased from virginia semiconductor ( fredericksburg , va ) . indium tin oxide ( ito ) coated glass substrates were obtained from delta technologies , ltd .
( stillwater , mn ) with a resistance of 48 . gold ( iii ) chloride trihydrate ( haucl43h2o ) , chloroplatinic acid hexahydrate ( h2ptcl66h2o ) , silver nitrate , 200 proof ( absolute ) ethanol , absolute methanol , and sodium citrate tribasic dihydrate were purchased from sigma
trimethoxysilylpropyl modified polyethylenimine ( tspei ) as 50% solution in isopropanol was obtained from gelest , inc .
( morrisville , pa ) and used without further purification . concentrated sulfuric acid , 70% nitric acid , and concentrated hydrochloric acids were obtained from fisher scientific ( pittsburgh , pa ) .
silicon and ito surfaces were cleaned before proceeding to surface modification with tspei and subsequent nanoparticle formation .
silicon surfaces , cut into required sizes for different characterization , were placed in aqua regia solution ( 3:1 v / v hcl : hno3 ) ( caution ! aqua regia is a strong oxidizing agent and should be handled with extreme care ) for at least 4 h , rinsed with millipore water , dried under a stream of argon , and then heated briefly on a hot plate to evaporate any residual water .
ito surfaces were sequentially rinsed in acetone , ethanol , and water , followed by 1.0 m hcl for 10 min and then treated with 1:1:5 ( v / v ) h2o2:nh4oh : h2o for an hour .
finally , these surfaces were thoroughly rinsed with millipore water and dried under flow of argon . for surface modification ,
the cleaned samples were immersed in a 2% solution ( v / v ) of tspei in 95% ethanol for 6 min .
surfaces were then rinsed with absolute ethanol , dried under a flow of argon , and left overnight for curing of the silane layer . in a subsequent step , [ aucl4 ]
ion adsorption was done by exposing the surfaces in a 1 10 m solution of haucl43h2o for 8 h followed by rinsing with water and finally drying the surfaces under a flow of argon . in situ reduction to generate au nps on the surface was achieved by exposing the above surfaces to a freshly prepared 1% ( w / v ) aqueous sodium citrate solution for an additional 8 h. for au pt bimetallic core
shell np generation , 1 10 m haucl4 and 1 10 m h2ptcl6 solutions were made separately and mixed in different volumes to create the desired au : pt mole ratio in the final solution , ranging from 1:0,1:0.25 , 1:0.75 to 1:1 .
after incubating the surface for 8 h , rinsing with water and drying under flow of argon , surfaces with adsorbed ions were placed in a freshly prepared 1% ( w / v ) aqueous solution of sodium citrate for 8 h to generate the au pt nps .
( paul n. gardner company inc . , pompano beach , fl ) , which is a battery - operated instrument for manual measurements of static contact angles at equilibrium .
the plunger was filled with millipore water , which was slowly pressed out until it formed a droplet on the surface ( 1.5 cm wide 2.53.0 cm long ) .
at least five different spots were chosen for measuring the contact angle for each surface and an average of the values was reported .
uv visible spectra of gold nanoparticles on ito surfaces were collected using usb4000-uv - vis spectrophotometer from ocean optics ( dunedin , fl ) .
surfaces with nanoparticles were directly introduced into the cuvette holder ( 1 cm path length ) and spectra were recorded with corresponding clean unmodified surface as the reference .
atomic force microscopy ( afm ) imaging was performed using veeco ( santa barbara , ca ) multimode system , equipped with a nanoscope iiia controller , in tapping mode .
the local root - mean - square ( rms ) surface roughness was determined using height data from at least four representative 2 m 2 m scan areas through roughness analysis program included in the afm analysis software .
surface coverage of different nanoparticles was estimated by analyzing the mean grain area and number of grains present in a typical 2 m 2 m ( total area = 4 m ) afm image of the respective nanoparticle .
cyclic voltammetric ( cv ) measurements were performed in a teflon electrochemical cell ( 3 ml maximum volume ) using standard three - electrode configuration , which was controlled by a chi660c electrochemical workstation ( ch instruments , inc .
a coiled platinum wire was used as the counter electrode , aqueous ag / agcl was used as the reference electrode , and ito surfaces were used as the working electrodes .
water used in these experiments was purified though a millipore system with a resistivity of 18 m cm .
boron doped p - type silicon wafers polished on one side ( resistivity 1030 ohm cm ) were purchased from virginia semiconductor ( fredericksburg , va ) . indium tin oxide ( ito ) coated glass substrates were obtained from delta technologies , ltd .
( stillwater , mn ) with a resistance of 48 . gold ( iii ) chloride trihydrate ( haucl43h2o ) , chloroplatinic acid hexahydrate ( h2ptcl66h2o ) , silver nitrate , 200 proof ( absolute ) ethanol , absolute methanol , and sodium citrate tribasic dihydrate were purchased from sigma
trimethoxysilylpropyl modified polyethylenimine ( tspei ) as 50% solution in isopropanol was obtained from gelest , inc .
( morrisville , pa ) and used without further purification . concentrated sulfuric acid , 70% nitric acid , and concentrated hydrochloric acids were obtained from fisher scientific ( pittsburgh , pa ) .
silicon and ito surfaces were cleaned before proceeding to surface modification with tspei and subsequent nanoparticle formation .
silicon surfaces , cut into required sizes for different characterization , were placed in aqua regia solution ( 3:1 v / v hcl : hno3 ) ( caution !
aqua regia is a strong oxidizing agent and should be handled with extreme care ) for at least 4 h , rinsed with millipore water , dried under a stream of argon , and then heated briefly on a hot plate to evaporate any residual water .
ito surfaces were sequentially rinsed in acetone , ethanol , and water , followed by 1.0 m hcl for 10 min and then treated with 1:1:5 ( v / v ) h2o2:nh4oh : h2o for an hour .
finally , these surfaces were thoroughly rinsed with millipore water and dried under flow of argon . for surface modification ,
the cleaned samples were immersed in a 2% solution ( v / v ) of tspei in 95% ethanol for 6 min .
surfaces were then rinsed with absolute ethanol , dried under a flow of argon , and left overnight for curing of the silane layer . in a subsequent step , [ aucl4 ]
ion adsorption was done by exposing the surfaces in a 1 10 m solution of haucl43h2o for 8 h followed by rinsing with water and finally drying the surfaces under a flow of argon . in situ reduction to generate au nps on the surface was achieved by exposing the above surfaces to a freshly prepared 1% ( w / v ) aqueous sodium citrate solution for an additional 8 h. for au pt bimetallic core
shell np generation , 1 10 m haucl4 and 1 10 m h2ptcl6 solutions were made separately and mixed in different volumes to create the desired au : pt mole ratio in the final solution , ranging from 1:0,1:0.25 , 1:0.75 to 1:1 .
after incubating the surface for 8 h , rinsing with water and drying under flow of argon , surfaces with adsorbed ions were placed in a freshly prepared 1% ( w / v ) aqueous solution of sodium citrate for 8 h to generate the au pt nps .
contact angle was measured by pocket goniometer , pg-1 model ( paul n. gardner company inc . , pompano beach , fl ) , which is a battery - operated instrument for manual measurements of static contact angles at equilibrium .
the plunger was filled with millipore water , which was slowly pressed out until it formed a droplet on the surface ( 1.5 cm wide 2.53.0 cm long ) .
at least five different spots were chosen for measuring the contact angle for each surface and an average of the values was reported .
visible spectra of gold nanoparticles on ito surfaces were collected using usb4000-uv - vis spectrophotometer from ocean optics ( dunedin , fl ) .
surfaces with nanoparticles were directly introduced into the cuvette holder ( 1 cm path length ) and spectra were recorded with corresponding clean unmodified surface as the reference .
atomic force microscopy ( afm ) imaging was performed using veeco ( santa barbara , ca ) multimode system , equipped with a nanoscope iiia controller , in tapping mode .
the local root - mean - square ( rms ) surface roughness was determined using height data from at least four representative 2 m 2 m scan areas through roughness analysis program included in the afm analysis software .
surface coverage of different nanoparticles was estimated by analyzing the mean grain area and number of grains present in a typical 2 m 2 m ( total area = 4 m ) afm image of the respective nanoparticle .
cyclic voltammetric ( cv ) measurements were performed in a teflon electrochemical cell ( 3 ml maximum volume ) using standard three - electrode configuration , which was controlled by a chi660c electrochemical workstation ( ch instruments , inc .
a coiled platinum wire was used as the counter electrode , aqueous ag / agcl was used as the reference electrode , and ito surfaces were used as the working electrodes .
pt nps by simultaneous in situ reduction of [ aucl4 ] and [ ptcl6 ] ions bound to the tspei functionalized surface .
the multiple amine functionalities present at the polyethyleneimine ( pei ) backbone of tspei can entrap both [ aucl4 ] and [ ptcl6 ] ions from solution through electrostatic interaction at a lower ph .
the surface functionalization with tspei is achieved through the well - known silane coupling chemistry of the trimethoxysilane groups present at one end of the molecule .
two different kinds of surfaces are used in our experiments with an idea that atomically smooth silicon is ideal for structural characterization of the surface bound nanoparticles by afm , while the conducting ito surfaces are suitable to assess the optical and electro - catalytic activity of the formed nanostructures .
pt nps on silicon surface after the final reduction step with the au : pt mole ratio of 1:1 in the final solution
an average height of 7.4 1.3 nm is obtained for the au pt nps from the analysis of a number of afm images of different samples which is evident from the histogram in the inset of fig .
1a . comparison of monometallic au nps generated by the same procedure shows an average height of 6.3 1.2 nm with a more densely packed structure ( fig .
it is known that colloidal metal nanoparticles in solution are generated through consecutive steps of nucleation and growth .
the balance between the rate of nucleation and growth can affect the final particle size .
it is observed that fast nucleation step leads to smaller particles and slow nucleation results in larger particles .
the growth step can occur mainly by consuming molecular precursors from the surrounding solution or by ostwald ripening when large particles grow at the expense of dissolving a smaller one . for colloidal metal nanoparticle growth in solution
, ostwald ripening is mostly absent and the growth usually happens due to consumption of dissolved metal precursors from solution .
in addition , the fast nucleation event and following growth step must be completely separate in order to achieve narrow size distribution of the final nanoparticles while multiple nucleation events may lead to wide size distribution . the current situation of in situ nanoparticle generation is different from solution synthesis since the molecular precursor ( [ aucl4 ] ) is attached to the template on the surface and no free precursor is essentially present during nucleation and growth step ( during citrate reduction ) . the observed gaussian distribution of particle size for both au and au pt systems indicates a single and fast nucleation event followed by the growth step through consumption of the surface bound molecular precursor . the increase in size during bimetallic np formation compared to its monometallic
shell structure formation in solution and the increase is expected from the relation where v is the corresponding mole volumes , c is the overall concentration of the specific metal involved , and d is the diameter .
pt nps is possibly due to the reduction in the number of surface adsorbed ions during bimetallic np formation , considering the difference in ionic charges of the respective ions and electrostatic interactions working in the process .
structure of trimethoxysilylpropyl modified polyethylenimine ( tspei ) is also shown a 2m 2m and b 5m 5m tapping mode afm height image of in situ generated bimetallic au
pt nps ( au : pt mole ratio = 1:1 ) on tspei modified surface .
c 2m 2m afm height image of monometallic au nps generated on tspei modified surface .
inset of ( a ) and ( c ) show the respective histogram of the au pt and au nanoparticle height distribution with a fit ( solid line ) using gaussian distribution function after analyzing a number of afm images .
pt np formation water contact angle measurements are used to follow the change in surface character during different steps of au
figure 1d shows the overall trend in the contact angle change from bare silicon surface to the nanoparticle formation on the surface for au : pt mole ratio of 1:1 in the final solution .
contact angle increased from 25 2.1 for bare silicon to 54 0.5 with adsorbed [ aucl4 ] and [ ptcl6 ] on the surface and eventually decreased to 34 0.57 due to formation of au
a similar trend in change of hydrophilic / hydrophobic character has been observed for au np formation on the surface by the present method and also reported in the literature for ag np formation .
controlling the hydrophilic and hydrophobic properties of a surface is significant due to different potential application areas like self - cleaning surfaces and sensors .
pt nps on the surface from the observed increase in nanoparticle size going from pure au nps to au
pt nps . however , it is not obvious which metal constitute the core and which one the shell and further experimental evidence is required to elucidate the actual structure of these bimetallic au pt nps generated on the surface .
visible spectroscopy has proven to be a versatile technique to understand the structure of core
pt nps on transparent ito surfaces to assess their optical property , using the same methodology as discussed above .
figure 2 shows the comparison of the uv visible response of pure au nps to that of au
it is evident that au nps show a characteristic plasmon absorption band at 558 nm .
interestingly , the au surface plasmon peak for au pt nps shifted to lower wavelength ( at 548 nm ) for a mole ratio of au : pt = 1:0.25 and further blue shifted ( a broad peak centered at 538 nm ) with increased pt content at a ratio of au : pt = 1 : 0.75 .
finally , the surface plasmon peak for au completely disappears for au : pt = 1:1 .
pt np formation in solution [ 3,5,10,25 - 27 ] substantiate that the deposition of a pt shell on top of an au core is responsible for the disappearance of the au surface plasmon peak in the uv visible absorption spectrum . in order to confirm the presence of the pt shell , au
pt nanoparticles ( au : pt = 1:1 ) are generated on quartz surface ( transparent to uv ) which shows a surface plasmon peak ~222 nm ( fig .
shell nps on the solid surface and are particularly significant since the core and the shell are generated in situ unlike the previous reports in solution where core particles were initially synthesized and the shell was deposited subsequently .
pt bimetallic nps generated on ito surface with varying mole ratio of au : pt .
pt bimetallic nps generated on quartz surface with 1:1 mole ratio of au : pt in order to further confirm the core
shell structure of these au pt nps , electrochemical measurements are done with au
pt np assemblies generated on ito surfaces in aqueous koh solution and compared to au np assemblies generated on ito surfaces .
detection of gold oxide ( auox ) from oxidation / reduction waves in basic ( 0.5 m koh ) medium during cyclic voltammetry measurements can provide information about the chemical nature of the shell .
figure 3a shows superimposed cyclic voltammograms for au nps and au pt nps generated on ito surface in 0.5 m koh solution .
the presence of oxidation / reduction waves of auox at ~0.24 v for au nps , in contrast to the absence of such peak for au
pt nps suggests that the oxidation / reduction of au is suppressed by the pt shell in the latter , which again validate the core
pt nps . to explore the catalytic properties of these au pt np bound ito surfaces towards methanol oxidation reaction ( mor ) , cyclic voltammetric responses ( fig .
a strong anodic peak at ~+0.65 v ( relative to aqueous ag / agcl reference electrode ) is observed , corresponding to methanol electro oxidation .
it is to be noted that these au pt np - bound ito surfaces were not thermally activated before assessing their catalytic property . a cyclic voltammetric response of au np and au
b electro - catalytic oxidation of methanol at the au pt np assembly on ito surface in 0.5 m koh with and without 5.0 m methanol .
scan rate = 50 mv / s and electrode area = 0.5 cm generation of au
pt core shell structure from simultaneous reduction of surface bound [ aucl4 ] and [ ptcl6 ] ions , evident from the uv visible and electrochemical results presented above and the preferred elemental distribution of the core and shell materials warrant further discussion .
since the formation of nanoparticles in solution essentially proceeds through nucleation and growth steps , it is expected that the metal ion which is easier to reduce will nucleate first and serve as the nucleation site for the second one during simultaneous reduction of the two metal ions in solution . in this case
, platinum will have to be first reduced to pt from pt and then to pt with a standard redox potential of 0.775 v for [ ptcl6]/[ptcl4 ] and 0.68 v for [ ptcl4]/pt compared to a single step reduction for gold from au to au with a standard reduction potential of 1.002 v for [ aucl4]/au , reported at room temperature .
considering the reduction potentials , it is obvious that au will preferably nucleate first to form the core followed by pt to form the shell .
however , the situation for surface bound ions is rather different as the respective ions are pinned down to the surface through electrostatic attraction of the template and will have limited mobility . the underlying mechanism of in situ core
shell structure formation on the surface is a subject of our on - going investigation .
in summary , we have reported an elegant method for in situ generation of two - dimensional au
pt np assemblies on silicon surface without much long range ordering and also show an increase in size of these bimetallic nanoparticles compared to their monometallic au equivalents .
moreover , these au pt np assemblies are active towards methanol oxidation , demonstrating their potential as catalyst for dmfcs .
this in situ synthetic approach relies on self - assembly employing wet chemical technique at an ambient condition and can also be extended to create other bimetallic np assemblies .
shell nps for site selective deposition , nanoparticle patterning for nanoelectronic applications and can also be combined with the conventional lithographic techniques .
we thank the american chemical society , petroleum research fund ( acs - prf ) and national science foundation ( nsf ) for financial support .
office of the vice president for research ( ovpr ) , um - ann arbor and the office of research and sponsored programs , um - dearborn are also gratefully acknowledged for additional funding . | two - dimensional assemblies of au
pt bimetallic nanoparticles are generated in situ on polyethyleneimmine ( pei ) silane functionalized silicon and indium tin oxide ( ito ) coated glass surfaces .
atomic force microscopy ( afm ) , uv visible spectroscopy , and electrochemical measurements reveal the formation of core shell structure with au as core and pt as shell . the core shell structure is further supported by comparing with the corresponding data of au nanoparticle assemblies .
static contact angle measurements with water show an increase in hydrophilic character due to bimetallic nanoparticle generation on different surfaces . it is further observed that these au pt core shell bimetallic nanoparticle assemblies are catalytically active towards methanol electro - oxidation , which is the key reaction for direct methanol fuel cells ( dmfcs ) . |
chronic obstructive pulmonary disease ( copd ) is a respiratory condition with clinical manifestations that affect not only the quality of life and prognosis but also the overall health of the patient.1 consequently , care of copd patients should comply with the clinical guidelines to ensure optimal clinical care.2 in this context , clinical audits have emerged as a tool to measure clinical activity and benchmark it against known clinical standards.3 previous clinical audits in copd care have shown variability in clinical practices across hospitals and countries after adjusting for different confounders.4 interestingly , weather changes considerably affect chronic respiratory diseases.5 various respiratory conditions , including asthma6 and cystic fibrosis,7 are known to exacerbate during winter . in copd , especially , the number of exacerbations rises during winter months,8 with an increase in the number of admissions and readmissions,9 and the corresponding implications on treatment selection.10 additionally , respiratory virus infection is more common in the winter and virus - associated exacerbations take longer to recover from.11 consequently , clinical practice in copd care can be influenced by weather variability throughout the year .
unfortunately , the effect of different seasons on clinical practice in copd care has not been evaluated thus far , and previous clinical audits have not taken into account the climatic changes and their potential effect on clinical care . in spain , the weather varies from very high temperatures and high pressures during the summer to considerably cold winter months with temperatures reaching < 0 in some areas , warranting an investigation on the influence of climatic changes on clinical care for copd . during the period 20132014 ,
a clinical audit was conducted on copd outpatients of hospitals in andalusia , spain ( more than 8 million inhabitants).12 the present study analyzes the results of this andalusian copd audit with regard to potential seasonal changes in clinical practice , in order to explore the hypothesis of seasonal variability in copd clinical care throughout the year .
the andalusian copd audit was a pilot clinical audit conducted from october 2013 to september 2014 in outpatient respiratory clinics of hospitals in andalusia , spain ( 8 provinces with more than 8 million inhabitants ) .
the methodology used has been extensively reported previously.12 in brief , 20% of the centers in the area were invited to participate in this audit .
the selection of centers was based on participation in previous audits and was voluntary . as it was a pilot study ,
randomization was not performed , and therefore , we did not aim to achieve representative sampling .
patients with an established copd diagnosis based on risk factors , clinical symptoms , and a post - bronchodilator forced expiratory volume in 1 second / forced vital capacity ( fev1/fvc ) ratio < 0.70 were deemed to be eligible.13 as our goal was to assess the usefulness of formally scheduled regular follow - up visits , only cases with at least 1 year of follow - up were included in the audit .
patients who underwent their first diagnostic visit or presented with an exacerbation were not eligible .
similarly , subjects with significant respiratory comorbidities that could influence copd treatment approach were excluded according to the local investigator s discretion . based on our previous experience
, we estimated that 80 cases per center would be required for this pilot study .
recruitment for the 1-year audit was performed in 4 quarters ( october december 2013 , january march 2014 , april
september 2014 ) . at the beginning of each trimester , investigators were instructed to identify consecutive copd cases until the desired sample size of 20 per trimester was reached .
the clinical practice of outpatient clinics was bench - marked against the clinical guidelines available at the time of the audit . during the study period ,
the gold 201313 and the spanish national guideline for copd ( gesepoc)14 were widely and uniformly used in spain .
we , therefore , carefully reviewed these 2 guidelines to extract relevant clinical recommendations for benchmarking the clinical practices audited .
we also considered the guidelines of the 2009 spain health - care quality standards in copd , which were applicable at the time of the audit.15 the final database included 55 variables for the resources and 182 variables for the clinical database . among the items
evaluated , it was verified whether doctors assessed the patient satisfaction with the inhaler . for this purpose , investigators were asked whether the degree of satisfaction with the inhalation device was recorded during the clinical visit with 2 possible answers : yes or no . for the present analysis ,
thus , december 21 to march 20 was considered winter , march 21 to june 20 was spring , june 21 to september 20 was summer , and september 21 to december 20 was autumn .
the audit was approved by the ethics committee of the hospital universitario virgen del roco ( code : 2013pi/201 ) .
clinical records were anonymized in the database by assigning a numerical code through an algorithm .
no personal information that could be used directly or indirectly to identify an individual was registered .
the relationship between the audit code and the clinical history number was kept local and was the local investigator s responsibility .
because of the retrospective nature of the study , the anonymization of data , and the lack of active diagnostic or therapeutic interventions , informed consents were not required according to the ethics committee of the hospital universitario virgen del roco .
all computations were performed using the statistical package for social sciences , version 23.0 ( spss ; ibm corporation , armonk , ny , usa ) . before performing any analysis , the database was evaluated for quality .
the values that were extreme from a clinical point of view , missing , or inconsistent were returned to the investigators for correction .
clinical variables are presented as the mean and standard deviations or absolute and relative frequencies , as appropriate for displaying the results of the entire cohort and dividing them by seasons .
the variability was expressed by using the interhospital range , which represents the highest and lowest mean value from the participant centers .
the significance of this variability was explored using the chi - square test or analysis of variance ( anova ) between the different participant centers .
crude differences between seasons were evaluated using anova or the chi - square test , depending on the nature of the variable .
we then explored the relationship between the doctor s adherence to the different guideline recommendations and season - related changes by performing a binomial multivariate logistic regression analysis using the enter method adjusted for age , sex , charlson comorbidity index , type of hospital , and copd severity by fev1 .
the results were expressed as odds ratio ( or ) with 95% confidence intervals ( cis ) .
all computations were performed using the statistical package for social sciences , version 23.0 ( spss ; ibm corporation , armonk , ny , usa ) . before performing any analysis , the database was evaluated for quality .
the values that were extreme from a clinical point of view , missing , or inconsistent were returned to the investigators for correction .
clinical variables are presented as the mean and standard deviations or absolute and relative frequencies , as appropriate for displaying the results of the entire cohort and dividing them by seasons .
the variability was expressed by using the interhospital range , which represents the highest and lowest mean value from the participant centers .
the significance of this variability was explored using the chi - square test or analysis of variance ( anova ) between the different participant centers .
crude differences between seasons were evaluated using anova or the chi - square test , depending on the nature of the variable .
we then explored the relationship between the doctor s adherence to the different guideline recommendations and season - related changes by performing a binomial multivariate logistic regression analysis using the enter method adjusted for age , sex , charlson comorbidity index , type of hospital , and copd severity by fev1 .
the results were expressed as odds ratio ( or ) with 95% confidence intervals ( cis ) .
most patients were men in the seventh decade of life , and a considerable proportion of patients were current smokers ; in addition , homogeneous distribution of comorbidities and moderate - to - severe lung function impairment were noted .
the distribution of the information obtained during the clinical interview over the 4 seasons is presented in table 2 .
the occurrence of dyspnea recorded using the modified medical research council ( mmrc ) scale and the copd assessment test increased in winter ; sputum color and hospitalizations were recorded less frequently in autumn and increased in summer . during autumn ,
the recording of previous exacerbations , smoking status , inhaler device satisfaction , and adverse effects decreased , whereas the recording of the current pharmacological strategy increased .
the different complementary diagnostic evaluations requested during the 4 seasons are presented in table 3 .
only the measurement of serum 1-antitrypsin level was found to be influenced by the seasons , with a decrease in spring .
the final treatment - related recommendations after the follow - up visit during the 4 seasons are presented in table 4 .
only the decision as to whether to discharge the patient from the clinic was influenced by the season , with an increase during the summertime .
after adjusting for covariates , only the assessment of inhaler device satisfaction was found to significantly differ according to seasons with an increase in winter ( or , 3.460 ; 95% ci , 1.4698.151 ) , spring ( or , 4.215 ; 95% ci , 1.8149.793 ) , and summer ( or , 3.371 ; 95% ci , 1.3918.169 ) compared to autumn .
notably , inhaler device satisfaction was low in the majority of centers ( table 2 ) , peaking at 60.5% in 1 center .
in fact , those seasons with device satisfaction more frequently recorded reached an average maximum of 21.5% .
the rest of the observed differences were not significant when adjusted for covariates ( data not shown ) .
the andalusian copd audit was the first to evaluate the quality of care in copd treatment in specialized respiratory outpatient clinics .
the results of the study showed that after controlling for confounders , there is no relationship between seasons and clinical practice .
the analysis of clinical performance against the recommended care has provided relevant information on how care is provided to copd patients.16 clinical audits are conceived as a tool to summarize the clinical performance of health care over a specified period of time and are aimed at providing information to health care professionals to allow them to assess and adjust their performance.17 although clinical performance has been extensively studied during copd admissions,18,19 the situation in outpatient clinics has been mainly evaluated in the andalusian copd audit,12 providing information on clinicians adherence to guidelines16 and pharmacological treatment performance.20 previous studies have evaluated the rates of adherence to gold guidelines for copd treatment among pulmonologists ; however , these studies focus exclusively on pharmacological treatments.2123 in the present study , we evaluated a typical follow - up clinical visit , and thus , in turn , determined the degree to which the doctor in - charge follows and records the recommended information , highlighting the variability of performance throughout the different seasons . in order to interpret our results correctly , some considerations need to be made .
this implies that there was no randomization of centers , and that the variables included were not all possible .
accordingly , randomization of a center in wider geographical areas and a comprehensive evaluation of different variables and clinical outcomes would improve the representativeness of the sample .
after this first experience , we identify the need to confirm our findings in a nationally representative audit , expanding the area studied and increasing the number of variables .
2 ) it is important to evaluate the effect of guideline adherence on clinically relevant outcomes . accordingly , a follow - up of patients is needed to evaluate the effect of guideline adherence on exacerbation rates and survival .
3 ) there are potential intrinsic limitations resulting from different auditors evaluating different medical records . to avoid this
, we analyzed the database looking for missing , extreme , or inconsistent values , and such values were returned to the investigators for correction .
4 ) finally , although global climate change has already had observable effects on the environment , resulting in a significant increase in the morbidity and mortality of patients with chronic lung disease24 and increased prevalence of certain respiratory diseases;25 due to the slow progression of climate change and global warming , 1 year is probably insufficient to evaluate the effect of climate change on clinical practice . therefore , the present study does not aim to evaluate the effect of global warming on clinical practice but only studies possible variations in copd care in a year .
significant year - to - year variations in climate conditions within a particular geographical area might affect our results .
in addition , climate differences among the different areas in the country might also have an effect .
although andalusia has extreme temperatures ranging from very high temperatures and high pressures during the summer to considerably cold winter months with temperatures reaching < 0 , other parts of spain may get colder during the year .
therefore , the results might have been different if the study would have been carried out in a region with more extreme climate changes throughout the year .
we are currently analyzing the results of a nationwide clinical audit that will allow us to analyze seasonal variation in the country .
the results of the present analysis indicate that clinicians do not alter their clinical practice according to the seasons .
a recent body of evidence has shown the variation in symptom perception by patients during the 24 hours of a day.26,27 however , although there is information on the distribution of exacerbation during the seasons,28 very little information is available regarding the variability of symptoms during a year .
although 1 study has focused on the effect of seasons on physical activity,29 the majority of the evidence shows that exacerbations increase during the cold months.30 however , in a stable state , there is little evidence of an association between the seasons and the symptoms perceived by patients .
should this association exist , it would result in an expected change in clinical performance across seasons .
however , the differences found here are explained by the severity of the disease , indicating that this is the main driver of clinical decisions rather than the seasons .
a recent analysis of the same database indicated that exacerbations and symptoms were the main factors for stepping up treatment , and fev1 and previous treatment with long - term antibiotics or inhaled steroids were the key determinants for stepping down treatment.20 thus , our data suggest that clinicians adapt their performance in accordance with clinical manifestations rather than the time of the year .
the association of inhaler device satisfaction with respect to the seasons has not been described previously .
because of the pilot nature of the study , the number of variables was limited .
accordingly , a detailed evaluation of inhaler satisfaction was not included in the audit , and investigators were only asked to check whether the degree of satisfaction with the inhalation device was recorded during the clinical visit . clearly , adherence evaluation and inhaler device satisfaction are crucial for a chronic respiratory condition .
many studies have highlighted the importance of treatment adherence and a correct inhaler technique in copd.31 patients satisfaction with the inhaler has been associated with compliance and health status in copd,32 where the role of the doctor in - charge is also crucial.33 it follows that patient satisfaction with the inhaler should be routinely evaluated .
recently , patient preference and acceptability of inhaler devices have been evaluated using the handling questionnaire,19 a validated questionnaire specifically designed to identify and compare the features for choice and acceptability of different inhalation devices in patients with persistent airway obstruction.34
in summary , the analysis of the andalusian copd audit data on seasonal variability of clinical practice indicates a lack of association between seasons and clinical copd care , after controlling for confounders , except for recording inhaler device satisfaction , which decreased in autumn in our region , but with a low compliance of this clinically relevant evaluation .
the present data should encourage clinicians to increase awareness of the importance of evaluating inhaler satisfaction to improve clinical care for copd patients . | objectivesclinical practice in chronic obstructive pulmonary disease ( copd ) can be influenced by weather variability throughout the year . to explore the hypothesis of seasonal variability in clinical practice
, the present study analyzes the results of the 20132014 andalusian copd audit with regard to changes in clinical practice according to the different seasons.methodsthe andalusian copd audit was a pilot clinical project conducted from october 2013 to september 2014 in outpatient respiratory clinics of hospitals in andalusia , spain ( 8 provinces with more than 8 million inhabitants ) with retrospective data gathering . for the present analysis ,
astronomical seasons in the northern hemisphere were used as reference .
bivariate associations between the different copd guidelines and the clinical practice changes over the seasons were explored by using binomial multivariate logistic regression analysis with age , sex , charlson comorbidity index , type of hospital , and copd severity by forced expiratory volume in 1 second as covariates , and were expressed as odds ratio ( or ) with 95% confidence intervals ( cis).resultsthe andalusian copd audit included 621 clinical records from 9 hospitals . after adjusting for covariates ,
only inhaler device satisfaction evaluation was found to significantly differ according to the seasons with an increase in winter ( or , 3.460 ; 95% ci , 1.4698.151 ) , spring ( or , 4.215 ; 95% ci , 1.8149.793 ) , and summer ( or , 3.371 ; 95% ci , 1.3918.169 ) compared to that in autumn .
the rest of the observed differences were not significant after adjusting for covariates .
however , compliance with evaluating inhaler satisfaction was low.conclusionthe various aspects of clinical practice for copd care were found to be quite homogeneous throughout the year for the variables evaluated .
inhaler satisfaction evaluation , however , presented some significant variation during the year .
inhaler device satisfaction should be evaluated during all clinical visits throughout the year for improved copd management . |
dentin pulp complex injuries are often induced by invasion of microorganisms and their components via dentinal tubules towards the pulp .
caries , cracks , fractures , and leakage from restorations provide pathways for microorganisms and their toxins to enter the pulp .
the inflammation can spread to the surrounding alveolar bone and cause periapical pathosis . in this process ,
bacterial lipopolysaccharides ( lpss ) play a potential role in several responses to pulpal infection .
lipopolysaccharide ( lps ) can induce the expression of proinflammatory cytokines and chemokines such as tnf- and il-6 and elicit the innate immune response in dental pulp cells ( dpcs ) .
signaling pathways initiated by engagement of toll - like receptors ( tlrs ) , such as tlr2 and tlr4 , by bacterial products lead to enhanced transcription of genes responsible for the expression of cytokines , chemokines , adhesion molecules , and other mediators of the inflammatory response associated with bacterial infection .
of note , the activation of mitogen - activated protein kinases ( mapks ) is important in the production of inflammatory cytokines by lps stimulation .
the mapk family includes extracellular - signal - related protein kinase ( erk ) , c - jun n - terminal kinase / stress - activated protein kinases ( jnk / sap ) and p38mapk .
the mapk signaling pathway is involved in various kinds of cellular processes including differentiation , development , proliferation , and survival , as well as cell death , depending on cell type and stimulus [ 5 , 6 ] .
pulpal p38mapk signaling is activated by lps stimulation during the induction of local proinflammatory response [ 79 ] .
telomeres are specialized structures at the ends of chromosomes that have a role in protecting the chromosome ends from dna repair and degradation .
telomerase is a cellular reverse transcriptase ( tert , telomerase reverse transcriptase ) which prevents premature telomere attrition and maintains normal length and function .
human reverse transcriptase subunit of telomerase ( htert ) has become an attractive target for cancer vaccines due to it being expressed in 8590% of human cancer tissues , whereas it is almost never expressed in normal tissues .
gv1001 peptide , which is a peptide corresponding to amino acids 611626 of htert ( earpalltsrlrfipk ) , has been developed as a vaccine against various cancers and has been reported to have the ability to penetrate into various cells , including cancer cell lines and primary blood cells .
gv1001 was found to localize predominantly in the cytoplasm and could successfully deliver macromolecules such as proteins , dna , and sirna into cells . because of this novel pharmaceutical potential and cell - penetrating ability , as well as its own anticancer activity , gv1001 peptide is very promising for use in the medical field . here
, we observed that this peptide could also penetrate into human dental pulp stem cells and , furthermore , that it had a self - anti - inflammatory effect without affecting cell viability .
the purpose of this study was to evaluate the cell - penetrating function of gv1001 peptide in human dental pulp cells ( hdpc ) and to investigate the anti - inflammatory effect of gv1001 and its related mechanism in p. gingivalis lps - induced inflammation through regression of inflammatory cytokine production .
all of the peptides used in this study were synthesized by the fmoc- ( 9-fluorenylmethoxycarbonyl- ) based solid - phase method and characterized by peptron inc .
the purities of all peptides used in this study were greater than 95% , as determined by high - performance liquid chromatography .
the impacted third molars of human adults were collected from 18- to 22-year - old patients after obtaining informed consent .
the isolated dental pulp was cut into small pieces and digested in a solution of 3 mg ml type i collagenase and 4 mg ml dispase for 3060 min at 37c ( sigma aldrich , st .
subsequently , the solution was filtered through a 70 mm cell strainer ( becton / dickinson , franklin lakes , nj , usa ) .
the single - cell suspensions were seeded in 35 or 60 mm culture dishes and maintained in a culture media consisting of -minimum essential medium ( -mem ; invitrogen , carlsbad , ca , usa ) supplemented with 15% fetal bovine serum ( fbs ; gibco - brl , life technologies inc . ,
gaithersburg , md , usa ) , 0.292 mg ml glutamine ( invitrogen ) , 100 units ml penicillin g , 100 mg ml streptomycin , and 50 mg ml ascorbic acid ( sigma ) .
the cells were incubated in a humidified atmosphere containing 5% co2 at 37c and cells between 3 and 4 passages were used in the following experiments .
porphyromonas gingivalis atcc 33277 was purchased from the american type culture collection ( atcc ; manassas , va ) and cultured with brain heart infusion broth ( bhi ; bd bioscience , sparks , md , usa ) supplemented with hemin ( 1 g ml ) and vitamin k ( 0.2 g ml ) in anaerobic conditions at 37c .
lipopolysaccharide was extracted from p. gingivalis cultured according to the method described by lee et al . .
hdpcs were seeded and cultivated in 2-chamber glass slides ( nunc , roskilde , denmark ) for 12 h. after washing with pbs , cells were incubated in serum - free opti - mem for an hour .
fluorescein isothiocyanate- ( fitc- ) labeled 1 , 10 , and 50 m of gv1001 peptides were added to cells and incubated for 2 h. the cells were fixed with 4% paraformaldehyde solution for 20 min at room temperature .
cells were stained with to - pro-3 iodide 642/661 nm ( invitrogen , grand island , ny , usa ) to visualize nuclei and were subjected to confocal microscopy .
colocalization of the peptides and nuclei was assessed using an fv1000 lager scanning confocal microscope ( olympus ) .
after addition of 0.75 m10 m gv1001 to lps - treated cells , the samples were prepared for electrophoresis and were separated using a 10% sodium dodecyl sulfate - polyacrylamide ( sds - page ) gel with a previously established buffer system .
after electrophoresis , the proteins were transferred onto a nitrocellulose membrane and blocked by tris - buffered saline ( tbst , 0.05% tween-20 ) containing 5% nonfat dried milk .
the membranes were then incubated with anti - p - erk and anti - p - p38 ( cell signaling technology , beverly , ma , usa ) antibodies and subsequently washed with tbst .
antigen - antibody complexes were visualized using an enhanced chemiluminescent detection system ( west - zol , intron , seoul , korea ) by incubating membranes with goat anti - rabbit igg or goat anti - mouse igg antibody coupled to horseradish peroxidase ( santa cruz biotechnology , inc .
, santa cruz , ca , usa ) , diluted at 1 : 2000 .
the blots were stripped and reprobed with an anti--actin polyclonal antibody to ensure that equal amounts of protein were used .
after treatment with 0.7520 g ml lps for 2 , 4 , 6 , and 8 h , total rna was isolated from the cells using trizol reagent ( life technologies inc . , gaithersburg , md , usa ) according to the manufacturer 's suggested protocol and treated with dnase i ( rnase - free , rq1 ; promega , madison , wi , usa ) .
one microgram of total rna was used as a template to create first - strand cdna with oligo - dt priming using an omniscript rt kit ( qiagen inc . ,
the quantitative real - time pcr analyses were performed using an abi prism 7500 real - time pcr system ( applied biosystems , foster city , ca , usa ) with a sybr premix ex taq ii kit ( takara , otsu , japan ) and 35 cycles of pcr .
the denaturing , annealing , and extension conditions of each pcr cycle were 95c for 10 s , 60c for 15 s , and 72c for 10 s , respectively .
the relative amount or fold change of the target gene was normalized relative to the level of the control ( untreated cells ) .
the following primer sequences were used in the real - time pcr reactions : 5-cga aag tca act cca tct gcc-3 and 5-ggc aac tgg ctg gaa gtc tct-3 for il-6 gene ; 5-cca gga gaa agt cag cct cct-3 and 5-tca tac cag ggc ttg agc tca-3 for tnf- gene ; 5-gtg gtg gac ctg acc tgc-3 and 5-tga gct tga caa agt ggt cg-3 for gapdh gene . to evaluate the cytotoxicity of gv1001 on hdpcs , cells ( 2 10/well ) were treated with several concentrations of gv1001 ( 0 , 1 , 5 , 10 , and 50 m / well ) for 48 hours .
mol l of mtt solution for 4 h in a tissue - culture incubator .
a 200-ll quantity of dimethyl sulfoxide solution was then added to the cell - culture wells , and the plates were shaken for 10 min at room temperature to dissolve the precipitated formazan crystals .
the solution was centrifuged for 10 min , and the optical density of the supernatant was measured at wavelength of 540 nm using an elisa plate reader ( powerwave x 340 ; biotek instruments , vt ) .
the data are expressed as the mean standard deviation ( sd ) of at least 3 separate experiments .
to confirm the cell - penetrating activity of gv1001 , fitc was conjugated to the c - terminus of 1 , 10 , and 50 m gv1001 peptides ( gv1001-f ) and subjected to an internalization assay using confocal microscopy .
as shown in figure 1 , gv1001-f showed mostly cytoplasmic distribution in hdpcs in various levels of peptide concentration . to verify the effects of various doses of lps on inflammatory cytokine expression in hdpcs
, the levels of tnf- and il-6 expression were evaluated using real - time pcr after exposing hdpc cells to lps of p. gingivalis or 1 g ml of e. coli at concentrations of 1 , 5 , 10 , or 20 g ml for 10 hrs .
the results showed that il-6 transcript was profoundly induced in the presence of 1 , 5 , 10 , or 20 g ml of p. gingivalis lps or 1 g ml of e. coli lps ( p < 0.05 ) , and tnf- transcript was profoundly induced in the presence of 10 or 20 g ml of p. gingivalis or 1 g ml of e. coli lps ( p < 0.05 ) ( figure 2(a ) ) . to evaluate the effects of lps on inflammatory cytokine expression in hdpcs over a period of time
, the levels of tnf- and il-6 expression were evaluated using real - time pcr after exposing hdpcs to 20 g ml of p. gingivalis lps or 1 g ml of e. coli lps for 2 , 4 , 6 , or 8 hrs .
upregulation was found in hdpcs after 4 to 8 hrs of exposure to 20 g ml of p. gingivalis lps or 1 g ml of e. coli lps ( p < 0.05 ) ( figure 2(b ) ) .
the expression of tnf- and il-6 in hdpcs were upregulated by lps in a time- and dose - dependent manner .
we measured tnf- and il-6 expression after lps stimulation to determine the anti - inflammatory activity of gv1001 peptide by real - time pcr .
lps - stimulated tnf- and il-6 production was significantly inhibited ( p < 0.05 ) ( figures 3(a ) and 4(a ) ) . to investigate whether the anti - inflammatory effect of gv1001 is mediated by the suppression of erk and p38mapk activation , regulation of phosphorylated erk and phosphorylated p38mapk
was evaluated by western blot analysis . as shown in figures 3(b ) and 4(b ) , gv1001 decreased lps - induced phosphorylation of erk and p38mapk .
incubating gv1001 peptide with hdpcs for 48 h did not affect cell viability in all concentrations tested ( 050 m ) , which showed a pattern similar to that seen with 0.9% nacl ( p < 0.05 ) ( figure 5 ) .
although endodontically treated teeth can maintain their function for a prolonged period of time , there are many advantages to maintaining pulp vitality . in immature permanent teeth with incomplete apical and dentinal wall development , reparative dentin formation is critical for further development of the teeth . maintaining
the vital pulp also has the benefit of reducing the occurrence of apical periodontitis by blocking bacterial infections . based on these advantages , it is preferable to maintain or renew pulp vitality rather than use current endodontic therapies . recently , successful pulp regeneration and revascularization techniques have been developed and are gaining popularity .
p. gingivalis is an obligately anaerobic , gram - negative bacterium that has been positively associated with destructive periodontal disease [ 17 , 18 ] .
it is one of the most pathogenic species among black - pigmented gram - negative anaerobes ; it is frequently present in root canal infections and other odontogenic abscesses of patients not suffering from periodontal disease , which confirms its pathogenic role .
p. gingivalis may also play a role in symptomatic infections , such as acute apical abscess [ 21 , 22 ] .
furthermore , there is a positive association between porphyromonas spp . and pain , mechanical allodynia , swelling , and purulent exudates in root canals [ 22 , 23 ] .
pathogens are generally detected by specific receptors , one of which is the toll - like receptor ( tlr ) family .
tlr stimulation initiates host defense through the activation of several intracellular signaling pathways , including activation of the mitogen - activated protein ( map ) kinases .
exposure of cells to inflammatory stimuli , including lps and proinflammatory cytokines , results in phosphorylation of p38mapk .
once the tlr is stimulated by a pathogen , proinflammatory cytokines and chemokines are produced by the odontoblast , resulting in recruitment and stimulation of immune effector cells and also direct bacterial killing .
although these biological responses protect the host against invading pathogens , the inflammatory response also leads to host tissue damage .
the extra - telomeric functions of htert are suggested regarding cellular proliferation , stem cell mobilization , and antiapoptotic , antiaging , and antioxidant effects through mitochondrial stabilization , transcriptional regulation [ 26 , 27 ] .
if htert peptide treatment that mimics the extra - telomeric functions of htert could be developed , it could be used in the treatment of pulpal diseases . in this study
, the potential use of a small peptide of human origin to control pulpal inflammation as a therapeutic agent was investigated .
the anti - inflammatory effect of gv1001 is achieved by modulating the suppression of the activation of erk and p38 mapk and the subsequent cytokine production induced by p. gingivalis lps stimulation .
p. gingivalis and e. coli lpss induced tnf- and il-6 expression in hdpc in a time- and dose - dependent manner , while gv1001 peptide downregulated inflammatory cytokines , il-6 and tnf-. hdpcs expressed tlr2 ( data are not shown ) and upregulated phosphorylated erk and p38 mapk in response to stimulation by lps . from the similar suppression patterns of the two , it could be assumed that the downregulation of inflammatory il-6 and tnf- by gv1001 was dependent on p38 mapk and erk - signaling , respectively , thus indicating that mapk signaling was required in downregulation of inflammatory cytokines in dental pulp stem cells by gv1001 peptide .
as shown in figure 3 , higher dose of gv1001 exhibited a lower effect on tnf induced by p. gingivalis lps .
one of the possible reasons is that gv1001 can partially aggregate in the high concentration in cell culture medium because cell culture medium does not include carrier protein .
thus , the lower concentration of gv1001 except aggregating gv1001 penetrates into the cells and reacts with signaling molecules related with inflammation . in another previous study ,
gv1001 peptide was reported to have the ability to penetrate into various cells , including cancer cell lines and primary blood cells , without affecting cell viability .
gv1001 was predominantly located in the cytoplasm and was used to successfully deliver macromolecules such as proteins , dna , and sirna into cells .
these cell - penetrating peptides ( cpps ) have become one of the most popular and efficient tools for delivering various molecules into cells owing to the fact that they have the ability to enter cells independently of a membrane receptor , and they show no cell - type specificity .
this study is significant in that it is the first to demonstrate gv1001 peptide as a cpp of human origin with a self - anti - inflammatory effect and without affecting cell viability .
the use of gv1001 peptide can be a potential therapeutic approach for treating pulpal inflammation and the peptide can also be used as an intracellular delivery tool for bioactive molecules . using gv1001 peptide as a pulp - capping agent on reversibly inflamed pulp or an alternative to antibiotics in regeneration therapy may be effective .
conjugating growth factors such as tgf-s and bmps with gv1001 can facilitate induction of hdpcs to differentiate effectively into odontoblast - like cells .
moreover , gene therapy can be implemented using gv1001 to fuse a growth / differentiation factor for application in vital pulp therapy , regenerative endodontic fields and tissue engineering .
the results from this study may support further research on the gv1001 peptide and its various clinical applications .
the downregulation of lps - induced tnf- and il-6 expression was mediated through erk and p38 map kinase pathways .
these findings provide mechanistic insight into the ability of gv1001 peptide to cause anti - inflammatory actions in lps - stimulated pulpal inflammation without significantly affecting cell viability . | porphyromonas gingivalis is considered with inducing pulpal inflammation and has lipopolysaccharide ( lps ) as an inflammatory stimulator .
gv1001 peptide has anticancer and anti - inflammation activity due to inhibiting activation of signaling molecules after penetration into the various types of cells .
therefore , this study examined inhibitory effect of gv1001 on dental pulp cells ( hdpcs ) stimulated by p. gingivalis lps .
the intracellular distribution of gv1001 was analyzed by confocal microscopy .
real - time rt - pcr was performed to determine the expression levels of tnf- and il-6 cytokines .
the role of signaling by map kinases ( erk and p38 ) was explored using western blot analysis .
the effect of gv1001 peptide on hdpcs viability was measured by mtt assay .
gv1001 was predominantly located in hdpc cytoplasm .
the peptide inhibited p. gingivalis lps - induced tnf- and il-6 production in hdpcs without significant cytotoxicity .
furthermore , gv1001 treatment markedly inhibited the phosphorylation of map kinases ( erk and p38 ) in lps - stimulated hdpcs .
gv1001 may prevent p. gingivalis lps - induced inflammation of apical tissue .
also , these findings provide mechanistic insight into how gv1001 peptide causes anti - inflammatory actions in lps - stimulated pulpitis without significantly affecting cell viability . |
eyelid tremor or blepharoclonus is a rare or underdiagnosed involuntary movement that has been found in patients with infarction in the thalamus or drug - induced or idiopathic parkinsonism , suggesting dysfunction of the basal ganglia .
anti - voltage - gated potassium channel antibody - associated encephalitis is now attributed to autoantibodies against leucine - rich glioma inactivated 1 ( lgi1 ) and less frequently against contactin - associated protein - like 2 ( caspr2 ) [ 2 , 3 , 4 , 5 ] .
we describe the first case of a patient with eyelid tremor associated with anti - caspr2 antibody .
a 63-year - old man was admitted to the hospital because he had become mute and akinetic .
no specific family or personal history was noted . starting about 1 year before admission his daily activities progressively decreased , and he confined himself to his house .
one month before admission he was not eating adequately , and 3 weeks later he was completely bedridden and refused to eat . on admission ,
the patient 's height was 160 cm and his body weight was 51.8 kg ( 8% of the ideal weight ) .
the body temperature was 36.8c , and his consciousness was e1 , v1 , and m1 on the glasgow coma scale ( gcs ) . with his eyes closed , he had a 12-hz eyelid tremor without nystagmus ( online suppl .
constipation and urinary retention were present but other autonomic regulations , including those of the cardiovascular systems or sweat glands , were not apparently affected .
his blood contained an increased wbc count ( 18,700/l ) with normal counts of rbc and platelets .
blood chemistry showed an increased crp level ( 16.8 mg / dl , normal 00.3 ) .
these findings were consistent with bladder infection secondary to urine retention and were resolved by drip infusion of an antibiotic ( 2 g / day ceftriaxone sodium for 3 days ) .
serum autoantibody against thyroid peroxidase , tsh ( thyroid stimulating hormone ) receptor , ssa ( sjgren syndrome type a antigen ) , ssb ( sjgren syndrome type b antigen ) , gad ( glutamic acid decarboxylase ) , hu , yo , ri , ma , ta , cv2 ( crossveinless-2 ) , amphisin , or vgcc ( voltage - gated calcium channel ) was negative .
cerebrospinal fluid ( csf ) analysis revealed a normal cell count ( 3 cells/l ) and a normal protein level ( 27 mg / dl ) without oligoclonal igg band .
mri only showed mild diffuse atrophy and punctate increased signals of the frontal white matter ( fig .
1 ) . electroencephalogram ( eeg ) showed 78-hz background waves without apparent epileptic discharges .
further investigation , including the examination of autoantibodies against neuronal cell surface antigens , revealed that anti - caspr2 antibody was positive in csf . since anti - caspr2 antibody
is occasionally associated with thymoma , we performed whole - body pet and ct , the result of which failed to identify tumors .
after six cycles of methylprednisolone pulse therapy ( 1 g for 3 days ) and two cycles of plasmapheresis ( 7 times / cycle ) , the patient 's consciousness improved to e3 , v1 , and m5 on the gcs .
he did not follow verbal orders , but could walk without a cane when manually guided . however , he did not eat voluntarily , which resulted in nasogastric tube feeding .
eyelid tremor was not obvious , but frequent blinking was observed ( see online suppl .
one and a half years after having been discharged from our hospital , his medical condition remained essentially unchanged .
we describe the first case of a patient who had eyelid tremor with anti - caspr2 antibody - related encephalitis .
recently , the clinical spectrum of anti - caspr2 antibody - related encephalitis has been broadened considerably from limbic encephalitis ; 10% of patients with idiopathic cerebellar ataxia were positive for this antibody .
moreover , a case report described a patient with ataxia , myoclonus , and dyskinesia in addition to symptoms of limbic encephalitis .
despite such a broadened clinical spectrum , a recent large clinicoserologic study demonstrated that extrapyramidal signs , including tremor , parkinsonism , and chorea , were not common in this disease as they were observed in only 1 patient ( about 3% ) . nonetheless , the eyelid tremor , masked face , and rigidity found in our patient may support the extrapyramidal involvement , which may be further supported by a very recent case report describing hemichorea in a patient with anti - caspr2 antibody . since clinical details of this disease
have been reported infrequently , their accumulation might identify susceptible central nervous system regions and help the correct diagnosis . in conclusion , we reported on a patient with anti - caspr2 antibody who had rare and common symptoms and partially responded to immunotherapy when the antibody disappeared .
notably , the tremor frequency of eyelid tremor in our patient ( 12 hz ) was lower than that in previously reported patients ( 57 hz ) . whether this discrepancy can be attributed to the antibody | we describe the first case of a patient with eyelid tremor probably associated with anti - contactin - associated protein - like 2 ( caspr2 ) antibody . encephalitis associated with anti - voltage - gated potassium channel antibody
is now attributed to autoantibodies against leucine - rich glioma inactivated 1 ( lgi1 ) and less frequently against caspr2 . eyelid tremor or blepharoclonus
is a rare or underdiagnosed involuntary movement that has been found in patients with infarction in the thalamus or drug - induced or idiopathic parkinsonism .
since patients with anti - caspr2 antibody - related encephalitis occasionally have extrapyramidal signs , we speculate that the eyelid tremor was also caused by anti - caspr2 antibody in our patient . partial resolution of his symptoms by plasmapheresis also supported the involvement in immunological processes . |
since the first introduction of endoscopic endocrine neck surgery in 1996 [ 1 , 2 ] , many different techniques of remote access thyroidectomy without a conventional cervical incision have been developed [ 3 , 4 ] .
although the pursuit on cosmetic superiority can be achieved , remote access thyroidectomy by the endoscopic approach is inevitably associated with the disadvantages of narrow working space , two - dimensional operative view , and restricted instrument manipulation .
these have largely limited the applicability of endoscopic thyroidectomy on thyroid neoplasia . until early 2000s when the da vinci robotic system ( intuitive surgical , inc . ,
sunnyvale , ca , usa ) was launched , many minimally invasive thyroid surgeons have shifted their enthusiasm towards robotic thyroid surgery [ 510 ] .
the robotic surgical system provides surgeons with the benefits of improved surgical dexterity by multiarticulated instrumentation , stable operative view by hand - tremor filtration technology , and excellent visualization by three - dimensional magnification .
these have remarkably extended the indications of the technique onto differentiated thyroid cancers . despite the vast abundance of literature reports supporting the safety and effectiveness of robotic thyroidectomy ( rt ) [ 1118 ] , many thyroid surgeons are not convinced on the merits of the procedure in treating thyroid cancers .
substantial controversies over the role of rt have emerged with respect to its safety , perioperative outcomes , and oncological completeness . in october 2011 , the food and drug administration had revoked approval for the use of the robot in thyroid surgery in the united states . while excellent outcomes can be confidently achieved by conventional open thyroidectomy ( ot ) in thyroid cancers , many surgeons who used to be advocates of the robot
had stopped practicing rt due to its off - label usage , higher costs , steep learning curve , and unclear patient benefits [ 1921 ] . in this review , we aim to analyze the current literature evidence in comparing rt to ot for the management of differentiated thyroid cancers .
they are gasless transaxillary approach ( ta ) , bilateral axillobreast approach ( baba ) , and gasless unilateral axillobreast approach ( guab ) . at present ,
rt is almost exclusively applied on differentiated thyroid cancers ( dtc ) alone [ 2249 ] .
most reports have no gender restriction but many centers limit their surgery to adults younger than 55 to 70 years [ 27 , 39 , 45 , 47 ] .
the size limit is commonly set at 24 cm for low - risk dtc and 5 cm for benign or indeterminate nodules [ 2249 ] .
locally advanced tumors with extrathyroidal invasion to larynx , trachea , esophagus , or recurrent laryngeal nerves , distant metastases , and posteriorly located tumors are considered unsuitable for rt .
minimal anterior strap muscle invasion is often not regarded as a contraindication because en bloc resection of strap muscles can be safely achieved by the robot [ 26 , 2931 ] .
presence of multiple metastatic lymph nodes at lateral compartment is no longer a contraindication because concomitant robotic modified radical neck dissection ( mrnd ) can be performed [ 22 , 26 , 31 ] . as for patient factor , prior surgery or irradiation at the neck , breast ( for baba or guab ) , and axilla ( for ta or guab )
obesity and thyroiditis are relative contraindications in the north american population as a result of perceived operative difficulties [ 33 , 40 ] . in the literature
, more than 25 studies had been published comparing the outcomes between rt and ot for differentiated thyroid cancers [ 2249 ] . except for three american studies [ 33 , 40 , 43 ]
, almost all reports are originated from south korea which represents the main body of worldwide experiences and literature evidences . to date , no randomized controlled trial is available in comparing rt to ot .
in addition to five meta - analyses comparing the outcomes between rt and ot in general [ 1115 ] , three more meta - analyses had specifically summarized the differences between rt and ot for thyroid cancer [ 1618 ] .
these literature evidences are to be discussed here with respect to the comparisons on the perioperative and oncological outcomes . as consistently shown in 19 comparative studies [ 2235 , 38 , 40 , 41 , 4347 ] and 7 meta - analyses [ 1117 ] comparing rt to ot , the operative time of rt was significantly longer than that of ot for pooled mean differences of 3954 minutes irrespective of the operative approaches . although the operative time of rt could be reduced with accumulation of experiences , it was hardly possible for rt to achieve comparable operative time with that of ot [ 5052 ] .
this was mainly attributed to the need of extra time for skin flap dissection and robotic docking .
the length of hospital stay was analyzed in 15 comparative studies [ 2234 , 40 , 41 ] and 4 meta - analyses [ 1316 ] . except for three studies [ 26 , 30 , 33 ] , all available data did not find a significant difference between rt and ot for the length of hospital stay .
in addition to pain in the neck , pain at remote wound sites and skin flaps are inherently associated with rt .
using different assessment scales , postoperative pain had been compared in 8 studies [ 2224 , 27 , 28 , 40 , 44 , 48 ] . except for two studies reporting significantly less pain in rt than in ot on the first two postoperative days [ 23 , 44 ] , no difference was observed between rt and ot for postoperative pain scores [ 27 , 40 , 48 ] and analgesic requirement [ 23 , 27 , 40 ] in all studies .
chronic pain after 36 months was also similar between the two procedures [ 22 , 24 , 28 ] . due to the adoption of different measurement scales ,
overall evidence suggested that rt and ot were comparable for postoperative pain . in the literature
, there was no universal consensus in defining transient and permanent recurrent laryngeal nerve ( rln ) injuries .
their quoted incidences in rt varied between 17% for transient injury and 02% for permanent injury ( table 1 ) . despite the discrepancies in their definitions ,
no significant difference was observed between rt and ot for the rates of transient and permanent rln injuries in 18 studies [ 2239 ] . except for one meta - analysis by lang et al . , all 6 available meta - analyses consistently found no difference between rt and ot for the rates of transient and permanent rln injuries [ 1217 ] .
the current evidence still supported that the risk of rln injuries was not increased by rt .
the definitions of postoperative transient and permanent hypoparathyroidism also varied among different studies ( table 2 ) .
the reported rates of transient and permanent hypoparathyroidism in rt ranged from 053% and 03% , respectively . in 18 studies comparing rt to ot ,
all except three studies [ 24 , 30 , 38 ] reported no significant difference between the two groups for the rates of transient hypoparathyroidism while the rates of permanent hypoparathyroidism were comparable among all studies [ 2238 , 40 ] . despite the slight variation in the definitions
, all available meta - analyses consistently showed that the rates of permanent hypoparathyroidism were comparable between rt and ot [ 1117 ] .
as for transient hypoparathyroidism , except for the studies by jackson et al . and kandil et al .
[ 12 , 15 ] , the pooled results from all other meta - analyses revealed no significant difference between rt and ot [ 11 , 13 , 14 , 16 , 17 ] .
hence , the current evidence also supported that the risk of hypoparathyroidism was not increased by rt .
although bleeding and hematoma are the major lethal complications of thyroidectomy , the reported incidences in rt remained below 2 - 3% and were comparable with those of ot in 16 studies [ 2233 , 35 , 37 , 38 , 40 ] .
as reflected by 6 meta - analyses , the rates of bleeding and hematoma were similar between rt and ot [ 1115 , 17 ] . according to the results from the latest meta - analyses ,
the outcomes of rt and ot were comparable for the rates of seroma formation [ 1215 , 17 ] , chyle leak [ 1217 ] , and tracheal injury .
one study also reported a significantly lower degree of postoperative nausea and vomiting in rt .
wound infection rates were similar between rt and ot in 3 other studies [ 22 , 23 , 29 ] .
postoperative voice change independent of rln injury had been compared in 5 studies [ 22 , 27 , 39 , 45 , 47 ] . using subjective symptom questionnaires , tae et al .
found that the subjective postoperative voice functions at 1 day , 1 month , and 3 months were significantly better in rt ( guab ) than in ot .
when they extended their study duration to 2-year follow - up , rt was found to have advantages of better recovery of voice symptoms and acoustic parameters over ot . in three other studies using ta in rt [ 22 , 27 , 39 ] ,
subjective and objective voice dysfunctions were contrarily found to be comparable between rt and ot . more prospective studies are needed before convincing conclusion can be drawn on the differences in voice dysfunction between rt and ot . in three studies evaluating the subjective swallowing dysfunction ,
rt was shown to have significantly less dysfunction than ot in two studies [ 22 , 27 ] but was similar to ot in another study .
due to more extensive skin flap dissection , chest paresthesia was significantly more common after rt than ot in both ta and baba techniques [ 22 , 27 , 38 ] . in a prospective study by kim et al , anterior chest paresthesia after baba thyroidectomy was found to be completely normalized by 3 months . while lee et al .
reported significantly more neck paresthesia in ot than in rt using ta [ 22 , 27 ] , song et al . found no such difference in ot and rt using baba
cosmetic superiority was considered to be the most concerned advantage of rt . in all 6 studies comparing cosmetic satisfaction between rt and ot at different time - points from postoperative 1 day to 6 months
, rt was associated with significantly higher cosmetic satisfaction scores irrespective of the operative approaches [ 22 , 24 , 27 , 28 , 32 , 34 ] . in a prospective study evaluating the postoperative body image by lee et al
, significantly better self - body image scores were found in rt than in ot from postoperative 3 months till 9 months . in another study analyzing the postoperative cosmetic concerns by koo
do et al . , the degree of scarring and psychological distress were also significantly better after rt than ot .
based on a cost model consisting of operating room charges , anesthesia fee , consumable cost , equipment depreciation , and maintenance cost , cabot et al .
found that rt was 1.5 times more expensive than ot ( usd 13670 1384 versus 9028 891 , p < 0.001 ) .
even when the annual case load was increased to reduce the equipment depreciation cost per case , such cost difference between rt and ot could hardly be resolved .
in another study analyzing the relative costs , broome et al . also found that the cost of rt was 2.1 times higher than that of ot ( usd 5797 versus 2668 ) .
in two recent comparative studies on thyroid cancer , the cost of rt was again shown to be significantly higher than that of ot [ 31 , 32 ] . radical central compartment nodal dissection ( ccd ) often represents the hallmark of favorable oncological control . in 15 studies comparing the number of ln retrieved during ccd [ 2232 , 3537 , 41 ]
, 6 reported a significantly lower number of ln retrieved in rt than in ot but 9 other studies found comparable results between the two procedures ( table 3 ) . in three meta - analyses , the number of central ln retrieved was consistently lower in rt than in ot though the reported absolute differences were small ( number < 1 ) [ 1618 ] .
as for the number of ln retrieved during mrnd for more advanced disease stages , only three studies compared rt to ot and no significant difference was found [ 22 , 26 , 31 ] . based on the evidence from pooled analyses , rt might be inferior to ot in terms of the number of central ln retrieved . in thyroid cancer , surgical completeness of resection
is commonly estimated by the serum thyroglobulin ( tg ) levels and the rai uptake levels on posttherapy whole - body scan ( rxwbs ) at radioiodine ( rai ) ablation .
the thyrotropin- ( tsh- ) stimulated tg ( stg ) level is a reliable surrogate marker for the amount of remnant thyroid tissue after total thyroidectomy .
it is measured upon tsh stimulation by either thyroid hormone withdrawal or human recombinant tsh stimulation .
ablation stg is measured at the time of rai ablation while control stg is measured at 612 months after rai . in the literature ,
ablation stg levels were reported to be significantly higher in rt than in ot in 4 studies [ 24 , 30 , 34 , 35 ] but were similar between the two groups in 5 other studies [ 29 , 31 , 36 , 37 , 42 ] .
found no difference between rt and ot for stg levels [ 16 , 17 ] , another meta - analysis consisting of the highest number of individual studies ( n = 6 ) by lang et al .
as for control stg , its levels were compared in three studies and no significant difference was observed between rt and ot [ 24 , 30 , 35 ] .
overall evidence suggested that the amount of remnant thyroid tissue ( as reflected by ablation stg levels ) might be higher in rt than in ot but such difference was resolved after rai ablation . using abnormal rai uptake at rxwbs to represent the amount of remnant thyroid tissues , 6 studies reported comparable results between rt and ot [ 25 , 26 , 34 , 35 , 40 , 42 ] but one study found a significantly higher result in rt .
the available evidence was considered inadequate for drawing a definite conclusion on the surgical completeness of resection by the two procedures .
short - term locoregional recurrence within the first two postoperative years was comparable between rt and ot in 7 studies [ 2226 , 35 , 40 ] . in the only long - term follow - up study by lee et al , the rates of locoregional recurrence at 5 years were similar between rt and ot ( 1.2% versus 1.2% ) . in the literature , the survival outcomes between rt and ot were only compared in one study . at 5-year follow - up , lee et al
. observed no significant difference between rt and ot for the disease - free survival ( 99.7% versus 98.7% , p = 0.89 ) .
longer time is needed to wait for more long - term follow - up data before comparison on survival outcomes can be made . as stated before , almost all the available evidences about the use of rt on thyroid cancer
the generalizability of these results to the north american or european populations is questionable because of the differences in body habitus , incidence of subcentimeter nodules , prevalence of obesity , and occurrence of thyroiditis in different ethnic groups .
despite the established advantages on cosmesis , current data suggests that rt compares less favorably than ot for longer operative time , higher cost , and possibly inferior oncological control with lower number of central ln retrieved . in terms of morbidity and quality of life outcomes , rt and ot
while conventional ot continues to be appropriate for most thyroid cancer patients , rt should better be continued by expert surgeons on selected patients who have low - risk thyroid cancers and have high expectations on cosmetic outcomes .
more prospective long - term follow - up studies are needed to define the oncological safety of rt . | while open thyroidectomy ( ot ) is advocated as the gold standard treatment for differentiated thyroid cancer , the contemporary use of robotic thyroidectomy ( rt ) is often controversial .
although rt combines the unique benefits of the surgical robot and remote access thyroidectomy , its applicability on cancer patients is challenged by the questionable oncological benefits and safety .
this review aims to analyze the current literature evidence in comparing rt to ot on thyroid cancers for their perioperative and oncological outcomes . to date
, no randomized controlled trial is available in comparing rt to ot .
all published studies are nonrandomized or retrospective comparisons .
current data suggests that rt compares less favorably than ot for longer operative time , higher cost , and possibly inferior oncological control with lower number of central lymph nodes retrieved . in terms of morbidity ,
quality of life outcomes , and short - term recurrence rates , rt and ot are comparable .
while conventional ot continues to be appropriate for most thyroid cancers , rt should better be continued by expert surgeons on selected patients who have low - risk thyroid cancers and have high expectations on cosmetic outcomes .
future research should embark on prospective randomized studies for unbiased comparisons .
long - term follow - up studies are also needed to evaluate outcomes on recurrence and survival . |
changes in healthcare delivery have influenced all aspects of medical practice , including the field of congenital cardiac surgery .
fast - tracking in cardiac surgery refers to the concept of early extubation , mobilization and hospital discharge in an effort to reduce the cost and perioperative morbidity .
economic concerns such as significant increases in overall medical expenses and the accumulating data that patient 's care is not jeopardized , have made the concept of fast - tracking attractive for practitioners involved in the care of children with congenital heart disease ( chd ) .
potential advantages of fast - tracking following surgery for chd are : reduced ventilator associated complications , reduced requirements of sedatives ( and associated hemodynamic compromise ) , more rapid patient mobilization , earlier intensive care unit ( icu ) discharges , decreased length of hospital stay and reduced patient or parental stress .
patient and parent satisfaction is increased in children who are extubated in the operating room ( or ) or soon after icu arrival .
early extubation allows earlier mobilization and verbal communication between the child , parents and hospital staff involved .
prolonged mechanical ventilation in children can be one of the most distressing experiences for the patient and parents .
the reported rate of reintubation following early extubation in patients undergoing chd corrective or palliative surgery is typically very low , and rates < 2 - 3% are usually reported . at our hospital before the institution of an early extubation protocol , patient extubation after chd surgery was determined by factors other than objective patient - focused parameters .
the current study was done to record the data to validate the importance and safety of fast - track extubation ( fte ) with evidence . in the current study ,
our aim was to determine the success rate of fte in chd surgery patients at our set up to analyze the reasons for delayed extubation and also the rate of reintubation within 24 h in patients extubated on fast - track mode .
after taking informed consent from the patients or their parents and approval from ethical review committee ( approval no : 2523-ane - erc-12 pi ) , the study was conducted in the cardiac ors and cardiac intensive care of a tertiary care hospital on the pediatric chd surgery patients fulfilling the inclusion criteria , for the period of 8 months from january 2013 to august 2013 .
fast - track extubation was defined as extubation within 6 h after arrival at cardiac icu . on table extubation
both male and female patients aged 6 months to 18 years undergoing elective chd surgical procedures under risk adjustment for congenital heart surgery ( rachs)-1 category 1 , 2 and 3 on cardiopulmonary bypass ( cpb ) or off pump were included in the study .
rachs-1 risk category ( 4 , 5 and 6 ) , emergency procedures , redo cases , and preoperative intubated patients were excluded from the study .
extubation criteria were fully awake normothermic patients ( core temperature 36c ) with regular breathing and tidal volume of 5 - 7 ml / kg , normal pre - extubation arterial blood gas ( abg ) analysis on fio2 of 0.4 , optimal hemoglobin with no metabolic acidosis , stable hemodynamics with minimal inotropic support , minimal chest tube drainage and normal per - operative postrepair transesophageal echocardiogram .
a total of 71 patients were included in this study on the basis of previous study in which the success rate of fte in chd pediatric surgical patients was 65 - 88% .
success rate of fte in chd pediatric patients ( p = 76% ) was estimated with 10% of the true proportion ( error ) with 95% confidence interval .
inhalational induction with sevoflurane 8% in 100% o2 was done in patients with no intravenous ( i / v ) line . for those with i
/ v access , midazolam 0.1 mg / kg plus fentanyl 2 - 3 g / kg were used for induction .
for those with allergic asthma , rocuronium 0.9 mg / kg i / v was used .
maintenance anesthesia consisted of isoflurane titrated to the patient 's response ( minimum alveolar concentration [ mac ] of 1 ) .
invasive blood pressure ( radial or femoral ) and central venous pressure monitoring through internal jugular vein or femoral vein was done apart from standard american society of anesthesiologists(asa ) recommended monitoring ( pulse rate , electrocardiogram , noninvasive blood pressure , spo2 , etco2 , nasopharyngeal temperature and urine output ) .
arterial blood gases with hemoglobin , electrolytes ( baseline , after cpb and preextubation ) , blood sugar ( baseline , during cpb half hourly ) and activated clotting time ( act ) ( baseline and postprotamine reversal ) were also monitored .
monitoring during cpb included mean arterial pressure ( map ) , urine output , systemic venous o2 saturation , half hourly abgs and act . during cpb , fentanyl infusion at 5 g / kg / h plus 1% isoflurane through cpb fitted vapourizer were administered .
patients with off pump surgery were maintained with 2 - 3 g / kg / h of fentanyl infusion with 1 mac of isoflurane in 50% oxygen and air .
atracurium was the primary muscle relaxant being run in infusion at 0.4 mg / kg / h until the start of sternal wiring . in patients with history of allergic asthma , 0.25
mg / kg i / v boluses of rocuronium were used . for analgesia adjuvants ,
paracetamol 15 mg / kg i / v and ketorolac 0.5 mg / kg i / v were administered before chest closure . at skin closure ,
bupivacaine 2.5 mg / kg diluted in saline was infiltrated at the wound and drain sites .
neostigmine ( 40 g / kg ) and glycopyrolate ( 10 g / kg ) was administered as a reversal after assessment with the train of four stimulus response ( tof ratio > 0.9 ) .
the patients undergoing atrial septal defect ( asd ) , ventricular septal defect ( vsd ) , blalock - taussig ( bt ) shunt , glenn shunt and patent ductus arteriosus closure were assessed to be extubated on ultra - fast track mode .
the patients undergoing other procedures mentioned under rachs-1 category 1 , 2 and 3 were assessed for extubation and extubated within 6 h of arrival in the cardiovascular intensive care unit ( cicu ) .
all statistical analyses were performed using statistical packages for social science version 19 ( spss inc . ,
age , weight , gender , success rate of fte , reasons for delayed extubation and reintubation were analyzed .
frequency and percentage were computed for categorical variables and mean and standard deviation estimated for quantitative observations .
chi - square test was applied to compare the success rate between gender and age groups .
in the current study , there were 49 ( 69% ) males and 22 ( 31% ) females .
surgical procedures included 25 vsd closures ( 35.2% ) , 17 tetralogy of fallot ( tof ) total corrections ( 23.9% ) , 14 ( 19.7% ) asd closures , 4 glenn shunts ( 5.6% ) and 4 bt shunts ( 5.6% ) .
other procedures ( including pulmonary artery banding , pulmonary valve replacement / repair , coarctation of aorta repair , aortic valve , and mitral valve replacement ) were 7 ( 9.9% ) as shown in table 1 .
demographic and clinical characteristic of patients of the total 71 patients included in the study , 26 patients ( 36.62% ) were extubated in the or , 29 ( 40.85% ) were extubated within 6 h of arrival in cicu and 16 ( 22.54% ) failed to get extubated within 6 h demonstrated in bar graph .
the reasons for delayed extubation were significant bleeding in 5 ( 31.3% ) cases , hemodynamic instability ( low cardiac output syndrome [ lcos ] in 4 ( 25% ) cases , respiratory complication in 2 ( 12.5% ) , bleeding plus hemodynamic instability in 2 ( 12.5 ) cases , hemodynamic instability and respiratory complication in 2 ( 12.5% ) cases and triad of hemodynamic instability , bleeding and respiratory complication in 1 ( 6.5% ) case as shown in table 2 .
reasons for delayed extubation in the selected patients ( n = 16 ) success rate of fast - track extubation in congenital heart disease pediatric surgery patients . ( or = operating room , cicu = cardiac intensive care unit ) success rate and delayed extubation according to age , weight and sex were also noted as shown in table 3 . in the age group < 1 year , patients extubated on the table were 21.4% , those extubated within 6 h were 28.6% and delayed extubation was noted in 50% of the cases . in the age group 1 - 5 years , on table extubation , extubation within 6 h and delayed extubation was 47% , 15% and 11% respectively . in the age group > 5 years it was 28.6 , 47.6 , and 23% , respectively .
the results of fast - track and delayed extubation calculated as percentages with respect to sex and weight were not clinically significant .
the results of the study validated the safety of fte in pediatric chd surgery patients at our pediatric cardiac surgery setup .
success rate of fast - track extubation according to age of the patients , weight and gender
fast - tracking strategy is being followed all over the world in the cardiac surgery centers .
the current study was carried out at cardiac ors and icu of a tertiary care hospital to assess the safety profile of this fast - tracking strategy in pediatric chd surgical patients .
a study was done in adult cardiac surgery patients to see the success and failure of fte .
a total of 614 patients underwent cabg surgery and 388 ( 63.19% ) patients were planned for fte .
a total of 196 ( 49.5% ) patients could be extubated within 6 h of arrival in the cardiac icu .
common reasons for delayed extubation included deep sedation in 80 patients ( 46.5% ) , confusion in 44 ( 25% ) cases , excessive bleeding in 20 ( 11.3% ) and high inotropic support in 10 ( 5.68% ) patients .
the concept of fast - tracking is popular due to its associated better patient outcome and resource saving advantages .
it plays an important role in reducing the patient elective ventilation time , icu and hospital stay and above all provides psychological relief to the patient and the parents .
on the basis of experience from the current study , all the mentioned advantages were achieved including better patient outcome and best possible resource utilization .
there was an improvement in patient turn over from pediatric cicu and improved ability to treat more chd patients . despite increasing evidence that fast - tracking in surgery for chd can be achieved safely , there still remains significant individual as well as institutional concerns about the safety of such an approach .
large series in adult cardiac surgery have shown that fast - tracking can be accomplished safely and may actually benefit the patient .
in addition , early extubation can clearly benefit some patients , and it was demonstrated that early extubation ( within 6 h ) in children undergoing surgery for chd had no negative affect on cardiac function .
the rate of reintubation following early extubation with modern anesthetics is low and mostly unrelated to fast - tracking .
we attribute this to improved surgical techniques , cpb refinements such as minimal priming volumes , the use of modified and conventional ultrafiltration technique and the availability of drugs with favorable pharmacokinetics ( short plasma half - life ) and pharmacodynamics .
our study had shown no incidence of reintubation in patients being extubated on fast - track or ultra - fast - track mode validating the safety profile of fte in pediatric chd surgical patients .
settings in surgery for chd where fast - tracking can not be considered safe include all patients who are hemodynamically unstable , coagulopathic patients or patients that do not meet generally accepted extubation criteria . in our study , the major factors that resulted in delayed extubation were age < 1 year , bleeding , hemodynamic instability and lcos . with the help of modern short acting opioids ,
the use of nonopioids in the postoperative period has been advocated . the use of acetaminophen and ketorolac for supplementary postoperative pain control has been reported . in our study
, we also used opioid based technique with high - dose fentanyl ( 20 - 40 g / kg ) . in the current study , i / v paracetamol , ketorolac and local infiltration of the wound and chest tube sites with bupivacaine were used to facilitate fast or ultra - fast - track pain free extubation .
on the basis of the current study , it is recommended to use fte in pediatric chd surgical patients safely with multidisciplinary approach involving the pediatric cardiac anesthesiologist , surgeon and intensivist . | background and aims : early extubation after cardiac operations is an important aspect of fast - track cardiac anesthesia . in order to reduce or eliminate the adverse effects of prolonged ventilation in pediatric congenital heart disease ( chd ) surgical patients , the concept of early extubation has been analyzed at our tertiary care hospital .
the current study was carried out to record the data to validate the importance and safety of fast - track extubation ( fte ) with evidence.materials and methods : a total of 71 patients , including male and female aged 6 months to 18 years belonging to risk adjustment for congenital heart surgery-1 category 1 , 2 , and 3 were included in this study .
all patients were anesthetized with a standardized technique and surgery performed by the same surgeon . at the end of operation ,
the included patients were assessed for fte and standard extubation criteria were used for decision making.results:of the total 71 patients included in the study , 26 patients ( 36.62% ) were extubated in the operating room , 29 ( 40.85% ) were extubated within 6 h of arrival in cardiovascular intensive care unit and 16 ( 22.54% ) were unable to get extubated within 6 h due to multiple reasons .
hence , overall success rate was 77.47% .
the reasons for delayed extubation were significant bleeding in 5 ( 31.3% ) cases , hemodynamic instability ( low cardiac output syndrome ) in 4 ( 25% ) cases , respiratory complication in 2 ( 12.5% ) , bleeding plus hemodynamic instability in 2 ( 12.5 ) cases , hemodynamic instability , and respiratory complication in 2 ( 12.5% ) cases and triad of hemodynamic instability , bleeding and respiratory complication in 1 ( 6.5% ) case .
there was no reintubation in the fte cases.conclusion:on the basis of the current study results , it is recommended to use fte in pediatric chd surgical patients safely with multidisciplinary approach . |
postoperative imaging after cochlear implantation usually is performed by conventional cochlear view ( x - ray ) or by multislice computed tomography ( msct ) .
conventional cochlear view is routinely used mainly in children due to short investigation time and low radiation dose .
this technique only gives projective information on the fact that insertion into the cochlea has been successful , but analysis of exact electrode position with regard to the topography of the cochlea is impossible [ 1 , 2 ] .
msct after cochlear implantation allows for three - dimensional imaging ; however , it unfortunately provides metal artefacts ; thus , a more detailed view of the electrodes with regard to the given anatomical structures is desirable [ 35 ] .
this is not only of major importance for quality control as far as surgical insertion methods are concerned but also with regard to special anatomic situations ( e.g. , mondini dysplasia , ossification of cochlea due to meningitis or otosclerosis ) and fitting conditions dependent on electrode array position and results of neural response telemetry in rehabilitation . in order to gain
more information on perfect design and function of electrodes , an exact way of imaging also is mandatory from researchers ' and developers ' point of view .
the experimental use of flat - panel high - resolution ct in temporal bone specimens was evaluated with regard to position of electrode array and with special concern on documentation of the highest possible accuracy in cranial base navigation [ 3 , 6 , 7 ] .
the aim of our study was to evaluate the clinical use of flat - panel ct as far as feasibility , artefacts , position within the cochlea and the temporal bone , and visualization of electrodes of different implant types are concerned .
between december 2009 and september 2010 31 subsequently implanted adult patients ( female = 11 , male = 20 ; mean age 52 years ) without inner ear malformations were included in this study one day after surgery .
3 different cochlear implant devices were applied : cochlear nucleus ci 512 ( n = 24 ) with 22 electrodes distributed over 15 mm , advanced bionics implant hi res 90 ( n = 4 ) with 16 electrodes distributed over 16.5 mm , and medel sonata ti ( n = 3 ) with 12 pairs of electrodes with a distance of 2.4 mm each .
cochlear implantation was performed by the same surgeon ; full insertion according to provided insertion depth was possible without complications in all cases .
flat - panel ct examinations were performed on a philips allura c - arc angiographic unit ( philips medical systems , best , the netherlands ) connected to a 3dra workstation ( philips medical systems ) . with patients temporal bone in system isocenter , the scan was performed with a propeller movement covering 207 of the circular trajectory .
622 frames were exposed during the 20.7 s scan ( 30 frames / s ) , utilizing a detector format of 33 40 cm .
total examination time including bedding of the patient on the examination table demanded less than 2 minutes .
source images were transferred to the workstation during and after the rotational acquisition , and a volume data set was created .
multiplanar mip reconstructions parallel to the cochlea were performed with a slice thickness of 1.5 mm and orthogonal to the cochlea with a slice thickness of 0.41 mm .
artefacts were characterised between very low (= 1 ) and very high (= 6 ) .
identification of scala tympani , scala vestibule , and osseous spiral lamina as well as tip fold over , full insertion , identification of distance between electrode array and modiolus ( next to ( n ) and far from ( f ) ) , and possibility of identification of single electrodes within the electrode array was of further interest .
an overview on all subjects is illustrated in table 1 . in all cases , full insertion of all electrodes
the level of artefacts was calculated as 2.41 ( 16 ) in the mean for investigator i and 2.64 ( 16 ) for investigator ii .
osseous spiral lamina could be identified in all subjects ; scalae tympani and vestibuli were obviously visible in 6 of 31 cases ( figure 4 ) . differentiation of different types of implants was clearly feasible ( figures 2(a)2(c ) ) .
additional identification of single electrodes was possible in all implants of medel and advanced bionics companies .
identification was not always possible in cochlear nucleus implants due to artefacts produced by narrower distances between electrodes .
dependening on implant type , electrode array insertion could apparently be identified as next to modiolus ( figures 3(a ) and 3(b ) ) in 25 cases or far from modiolus ( figures 3(c ) and 3(d ) ) in 6 cases .
radiological examinations after cochlea implantation are mostly performed by conventional x - ray ( figure 1(a ) ) .
conventional msct scans offer additional information of the electrode positioning within the cochlea ( figure 1(b ) ) .
nevertheless , conventional ct scans are often affected by artefacts due to electrode and generator [ 35 ] .
the technique of cone beam computed tomography as a low - dose imaging technique for postoperative assessment of cochlear implantation , which was tested in postoperative patients , seems to be promising with fewer artefacts and higher resolution than multislice ct . but
therefore , we evaluated the clinical impact of flat - panel ct in a c - arm angiography unit .
several publications deal with image quality of isolated temporal bone specimens in flat - panel ct .
rotational computed tomography ( rt ) is based on three - dimensional digital subtraction angiography .
blooming artefacts are also less comprehensive , and spatial resolution is superior in comparison to msct [ 11 , 12 ] . due to higher spatial resolution , additional information of the position of the electrode in relation to the modiolus is offered .
this has impact on the adjustment of the generator and the estimated life time of the battery . of course
otherwise , in case of positioning within the scala vestibuli , avoidable side effects like high impedances , reduced speech reception , and vertigo might occur due to damage of the intracochlear structures .
as far as the literature is concerned , the assessment of positioning within the scala tympani most often could only be demonstrated in ex vivo specimens .
[ 9 , 10 ] reported feasibility of assessing exact electrode position within the scala tympani or vestibuli in vivo by means of flat - panel ct .
scala media could not be visualized directly , and the position was concluded indirectly from curved reformatted images of the cochlea . in spite of similar examination techniques , the difference in the results might be based on different postprocessing .
there is no possibility to perform curved reformations techniques which is impossible on our system .
some examinations have been performed to adjust radiation dose of fd ct in comparison to multislice ct .
the main weak point of our study is the lack of direct comparison of msct and flat - panel ct . due to the high level of artefacts known from own experience ,
our results indicate that flat - panel ct is a fast and accurate examination in the postoperative imaging of cochlear implants .
it is of course superior to conventional x - ray , but it is also superior to msct mainly due to fewer artefacts . | background . postoperative imaging after cochlear implantation is usually performed by conventional cochlear view ( x - ray ) or by multislice computed tomography ( msct ) .
msct after cochlear implantation often provides multiple metal artefacts ; thus , a more detailed view of the implant considering the given anatomy is desirable .
a quite new method is flat panel volume computed tomography .
the aim of the study was to evaluate the method 's clinical use .
material and methods . after cochlear implantation with different implant types , flat panel ct scan ( philips allura ) was performed in 31 adult patients .
anatomical details , positioning , and resolution of the different electrode types ( medel , advanced bionics , and cochlear ) were evaluated interdisciplinary ( ent / neuroradiology ) .
results . in all
31 patients cochlear implant electrode array and topographical position could be distinguished exactly .
spatial resolution and the high degree of accuracy were superior to reported results of msct .
differentiation of cochlear scalae by identification of the osseous spiral lamina was possible in some cases .
scanning artefacts were low .
conclusion .
flat panel ct scan allows exact imaging independent of implant type .
this is mandatory for detailed information on cochlear electrode position .
it enables us to perform optimal auditory nerve stimulation and allows feed back on surgical quality concerning the method of electrode insertion . |
tuberculosis ( tb ) has been declared a global health emergency by the world health organization ( who ) .
it is estimated that about one third of the worlds population is currently infected with the responsible actinobacteria mycobacterium tuberculosis ( mtb).1 resistance of mtb to available antibiotics has increased drastically , and multidrug - resistant ( mdr ) strains of mtb as well as extensively drug - resistant ( xdr ) strains are becoming a major health problem worldwide.1 furthermore , cases have recently been reported where no available first- and second - line drugs are effective , and this has led to the term totally drug - resistant ( tdr ) tb.2 resistant strains of mtb require longer treatment , which may lead to interruption of therapy and , in turn , lead to further drug resistance . the usual drug regimen for tb at present consists of antibiotics discovered more than 60 years ago , and includes isoniazid , rifampicin , pyrazinamide , and ethambutol.3 these antibiotics act by disruption of cell wall synthesis4 and inhibition of rna synthesis.4c-5 it was quickly discovered that monotherapy led to resistance in the bacteria , and therefore the recommended tb treatment today utilizes a combination of the four first - line drugs for two months , and thereafter a pharmacotherapy with rifampicin and isoniazid for an additional four months.3 considering the long treatment time , the adverse effects associated with the drugs , and the problems with resistant strains , it is clear that there is a great need for novel antibiotics that possess new antitubercular modes of action and that can be used in combination with existing drugs .
proteasomes are responsible for degrading proteins , and so help maintain intracellular protein homeostasis.6 the human proteasome consists of a cylindrical 26s particle composed of a 20s core catalytic component capped at one or both ends with a 19s regulatory subunit , which recognizes and binds the substrate protein . in eukaryotic proteasomes , the 20s core particle is composed of four heptameric rings , of which the two inner rings are made up of seven different -subunits , with only three of them responsible for the proteolytic activity ( 1 , 2 , 5 , with peptidyl - glutamyl - peptide - hydrolyzing , trypsin - like and chymotrypsin - like activities , respectively).7 the mtb proteasome displays the same overall structure as the proteasomes of eukaryotic systems.8 however , prokaryotic 20s proteasomes , including those from mtb , have been shown to have open cylindrical ends , in contrast to the tighter ends of eukaryotic proteasomes , and possess only one type of -subunit , usually resembling the eukaryotic 5 chymotrypsin - like structure.8,9 proteolytic activity involves the -hydroxyl group of the n - terminal threonine , which is present in the active site of proteasome subunits.7a7d in many diseases , such as cancer , auto - immune diseases , and neurodegenerative diseases , cells accumulate various proteins , and the human proteasome has thus emerged as a promising therapeutic target.6a,7a the first human proteasome inhibitor , bortezomib ( velcade ) , was approved for clinical use in the usa in 2003 and in europe in 2004 for the treatment of multiple myeloma ( figure 1 ) .
the x - ray structure of the yeast proteasome in complex with the compound was reported in 2006 , giving valuable insights into its binding interactions.10 serious toxicity associated with peptidyl boronates , such as bortezomib , is mainly due to the inhibition of the 5 subunit of the human proteasome,11 precluding the use for treatment of , for example , infectious diseases .
therefore , the search for alternative classes of inhibitors with greater selectivity towards prokaryotic proteasomes is ongoing .
proteasomes have been shown to be of great importance to mtb ; they help the bacteria survive the nitrosative stress caused by the hosts immune response12 and increase their ability to persist in infected mice.13 furthermore , the actinobacteria are unusual among prokaryotes in that they express proteasomes , meaning that selective action against bacteria of this phylum should be possible.6b,14 it is particularly interesting that proteasome inhibitors have been shown to be active on nonreplicating mtb .
this is important since nonreplicating mtb ( which to a large extent underlie the need for long treatment times ) , display reduced protein synthesis , and are left unaffected by most antitranscription or antitranslation agents currently used for treatment.15 only a few classes of compounds have proven to be active on nonreplicating mtb , for example , oxathiazol-2-ones , quinolones , and allylic thiocyanates.7c,16 mtb proteasome inhibitors displaying species selectivity , thus low associated toxicity , are promising candidates for the development of new antitubercular drugs .
have previously reported that the 1,3,4-oxathiazol-2-one compounds ht1171 and gl5 ( figure 1 ) act as suicide - substrate inhibitors of the mtb proteasome displaying high selectivity over the human proteasome and other proteases , including trypsin , cathepsin b , and matrix metalloproteases.7c they demonstrated that the oxathiazol-2-one moiety acts as an electrophilic warhead , such that the active - site nucleophile , the n - terminal threonine residue , is effectively cyclocarbonylated by an irreversible covalent attack on the heterocycle.7c,8b moreover , oxathiazolones have been reported to have antimycobacterial activity when they were exploited as carboxylic acid bioisosteres in substituted pyridines and pyrazines.17 in an attempt to identify a new generation of species - selective proteasome inhibitors , gryder et al . investigated the effect of replacing the boronate group on the dipeptide backbone of bortezomib with an oxathiazol-2-one moiety .
unfortunately , the resulting compound was not active on the mtb proteasome and only slightly active on the human 20s proteasome.18 more recently , yang et al
. assessed the antitubercular activity of a series of gl5-type oxathiazol-2-ones , together with their dithiazol-3-one analogues , on the virulent mtb h37rv strain , achieving a lowest minimum inhibitory concentration ( mic ) value of 4 g ml ( 15 m ) for ht1171.16 g these compounds also possessed mycobacterial cell wall permeation properties , and were active against nonreplicating mtb .
they have therefore been proposed as highly interesting antitubercular agents for the synergistic combination treatment of tb.7c in the present study , we further investigate the structure activity relationships of 1,3,4-oxathiazol-2-one derivatives with respect to both their potency as mtb proteasome inhibitors and their selectivity over the chymotrypsin - like catalytic activity of the human proteasome as an early assessment of potential toxicity .
furthermore , the compounds were optimized with regard to solubility and stability . finally , activity against replicating and nonreplicating mtb and cytotoxicity to mammalian cells
in a first effort to investigate the chemical space , a wide variety of oxathiazol-2-ones were prepared from the corresponding commercially available amides by treatment with chlorocarbonyl sulfenyl chloride at 100 c for 15 min with microwave ( mw ) heating ( method a ) or at room temperature overnight ( method b ) .
isolated products were thereafter evaluated for proteasome inhibition based on the assay procedures described by lin et al.7c ( table 1 , entries 123 ) .
compounds were tested for chymotrypsin - like peptidase activity against both the mtb 20s open - gate proteasome ( in which the alpha subunit has an 8-residue deletion at the n - terminus , as described by lin et al.8a ) and the human 20s proteasome , tracked by cleavage of the fluorogenic substrate suc - llvy-7-amino-4-methylcoumarin .
method a reagents and conditions : amide ( 1.0 equiv ) , chlorocarbonyl sulfenyl chloride ( 1.5 equiv ) , 1,4-dioxane ( 4.0 ml mmol ) , 100 c mw , 15 min .
method b : amide ( 1.0 equiv ) , chlorocarbonyl sulfenyl chloride ( 2.0 equiv ) , thf ( 4.0 ml mmol ) , rt , o / n . [ a ] chemical stability in pbs ph 7.4 at 25 c as % remaining after 24 h. [ b ] the amide was prepared , and
[ c ] reagents and conditions : 14 ( 1.0 mmol ) , dess
martin periodinane ( 1.1 mmol ) , ch2cl2 ( 5 ml ) , 0 c , 2 h. [ d ] general method for the synthesis of 3-substituted dioxazolones .
reagents and conditions : starting hydroxamic acid ( 1.0 equiv ) , 1,1-carbonyldiimidazole ( 1.1 equiv ) , ch3cn ( 4.0 ml mmol ) , 0 c , 1 h. [ e ] the hydroxamic acid was prepared and used as starting material for the dioxazolone synthesis without further purification .
the 5-aryl - substituted 1,3,4-oxathiazol-2-ones in entries 14 ( table 1 , 14 ) have previously been reported as inhibitors of the mtb proteasome.19 to further develop the core structure , we decided to find out if elongated compounds with different spacers could have a positive impact on the activity . for this purpose ,
various tethers between the aryl and the heterocyclic warhead were introduced in the 5-position , for example , alkene , alkyne , and methylene linkers .
we found that an sp - hybridized carbon directly coupled to the oxathiazol-2-one ring in the 5-postion was crucial for the compounds activity .
additionally , the introduction of the ( e)-alkene linker ( entries 1718 ) gave inhibitors equally or more potent ( 17 and 18 ; ic50=420 and 640 nm , respectively ) toward the mtb proteasome compared to when the aryl was substituted directly onto the oxathiazol-2-one ( 14 ) .
more importantly , this type of compound was not active on the human proteasome ( ic50>100 000 nm ) . for compounds with an alkyne- or carbonyl - containing spacer ( 19 and 20 ) ,
the activities on the mtb proteasome were slightly lower compared to olefinic inhibitors 17 and 18 .
moreover , these linkers provided less selective inhibitors . when an sp - hybridized carbon was used as a linker atom , no activity
was obtained against the mtb proteasome , and little or no inhibition was seen towards the human proteasome ( entries 916 ) .
interestingly , when an ethyl bridge was introduced instead of the double bond between the phenyl and oxathiazol-2-one ( compare moieties 15 and 17 ) , no inhibition was observed for the mtb proteasome , but the saturated compound instead gained some activity toward the human proteasome .
this suggests that the ( e)-double bond is important both for the mycobacterial inhibition and the selectivity over the human proteasome .
however , the allowed substitution pattern of the ( e)-alkene linker seems to be slightly constrained ; when an additional phenyl group was introduced onto the ethylene linker , no activity was detected against the mtb proteasome ( entry 23 ) . instead , compound 23 became a more potent inhibitor of the human proteasome .
the aryl group of the styryl moiety also seems to be important for the interaction with the mtb protein . when a vinyl group was substituted onto the oxathiazol-2-one , the activity decreased from 420 nm for 17 to 27 000 nm for 21 .
the effect is probably due to the lack of an aryl group as well as the effect of the hybridization of the carbon directly attached to the oxathiazol-2-one . to summarize the results depicted in table 1
, it appears that an aryl group conjugated with the oxathiazolone scaffold is highly beneficial for the inhibition of the mtb proteasome ( see products 14 and 1722 ) , and in particular high selectivity over the human proteasome is caused by the presence of the ( e)-alkene linker ( 17 and 18 ) .
this may also be coupled to the loss of activity for the unconjugated 15 . to increase the scope of the investigation
, we wished to evaluate other heterocyclic warheads such as the dioxazolones ( table 1 , entries 2425 ) , but these compounds suffered from poor stability due to rapid hydrolysis .
the oxathiazol-2-one was also replaced with a boronic acid functionality ( table 1 , entries 2627 ) in an attempt to mimic the reversible covalently - bonded warhead used in bortezomib . however , the simple boronic acid analogues were completely inactive on both the mtb and human proteasomes , suggesting that the oxathiazol-2-one moiety is a more useful electrophile for the inactivation of the target .
a series of 5-styryl - oxathiazol-2-ones was synthesized to further investigate the effect of the phenyl substitution on the structure activity relationship of proteasome inhibitors . for this , we developed a synthetic route where aryl iodides or bromides were used as starting material in a microwave - assisted mizoroki heck cross - coupling reaction with acrylamide to yield the corresponding 3-substituted acrylamides.20 , 21 the final 5-substituted - oxathiazolones were obtained by treating the corresponding amides with chlorocarbonyl sulfenyl chloride ( scheme 1 ) .
a diverse set of para - substituted 5-styryl - oxathiazolones were chosen to explore the structural requirements of the active site ( table 2 , entries 112 ) .
the majority of the compounds displayed the same range of inhibiting activity against the mtb proteasome as 17 and 18 ( ic50 values between 4151700 nm ) .
the results showed no clear trend in activity for electron - rich and electron - poor aryl substituents , although electron - poor phenyl groups gave slightly better inhibition of the mtb proteasome compared to electron - rich phenyls .
the inhibition of the human proteasome was unfortunately also affected , giving a poorer selectivity profile . however , based on the relative activities for nonstyryl containing 21 and 22 ( table 1 , entries 2122 ) , it is evident that the phenyl group is important for inhibition of the mtb proteasome .
structure activity relationship of 5-styryl - oxathiazolone inhibitors with the mtb and human proteasome .
method c reagents and conditions : starting aryl iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) , pd(oac)2 ( 0.05 equiv ) , tri - tert - butylphosphonium tetrafluoroborate ( 0.10 equiv ) , et3n ( 3.0 equiv ) , ch3cn ( 4.0 ml mmol ) , 120 c mw , 15 min . method d reagents and conditions : .
starting aryl iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) and pd(oac)2 ( 0.05 equiv ) , et3n ( 3.0 equiv ) , ch3cn ( 4.0 ml mmol ) , 120 c mw , 15 min .
method e reagents and conditions : starting aryl bromide ( 1.0 equiv ) , acrylamide ( 1.5 equiv ) and trans - bis(acetato)bis[o-(di - o - tolylphosphino)benzyl]dipalladium(ii ) ( 0.05 equiv ) , naoac ( 3.0 equiv ) , dmf ( 4.0 ml mmol ) , 140 c mw , 15 min .
[ a ] chemical stability in pbs ph 7.4 at 25 c ; as % remaining after 24 h. [ b ] isolated yield over two steps .
four of the compounds with the best inhibition and selectivity profiles ( table 2 , 3033 ) were chosen for further investigation .
for these compounds , the corresponding ortho- and meta - analogues were synthesized and evaluated in the enzyme activity assay ( table 2 , entries 1421 ) .
the para - substituted analogues ( table 2 , entries 36 ) were more active than ortho- and meta - substituted analogues on the mtb proteasome , with ic50 values in the range of 4751080 nm .
furthermore , no inhibition of the human proteasome was detected for these compounds . when substituents were introduced in the meta - position ( table 2 , entries 1417 ) , inhibitory activity of the mtb proteasome decreased ( ic50 14509900 nm ) and poorer selectivity was observed .
the ortho - substituted analogues ( entries 1821 ) , despite the same mesomeric contribution as the para - analogues on the styryl moiety , showed almost no inhibition of the mtb proteasome ( ic50 22 000 > 100 000 nm ) .
the same trend was observed for chloro - functionalized 39 and disubstituted 40 ( table 2 , entries 1213 ) ; the para - substituted compound was more active on the mtb proteasome and had superior selectivity with regard to the human proteasome .
overall , the styryl - analogues 2848 in table 2 displayed good stability but poor solubility ( 0.17.1 m ) . to hopefully improve the solubility of the compounds , a small series of nitrogen- , oxygen- and sulfur - containing heterocyclic derivatives were prepared ( table 3 ) .
the introduction of five - membered , six - membered , and bicyclic heterocycles into the scaffold generally improved the solubility with retained chemical stability .
furthermore , the heterocyclic analogues were active on the mtb proteasome , although slightly higher ic50 values were obtained compared to the compounds in table 2 .
however , for the five - membered heterocycle - substituted oxathiazolones , the compounds were not as selective with regard to the human proteasome ( table 3 , entries 35 and 9 ) .
method c reagents and conditions : starting aryl iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) , pd(oac)2 ( 0.05 equiv ) , tri - tert - butylphosphonium tetrafluoroborate ( 0.10 equiv ) , et3n ( 3.0 equiv ) , ch3cn ( 4.0 ml mmol ) , 120 c mw , 15 min . method d reagents and conditions : .
starting aryl iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) and pd(oac)2 ( 0.05 equiv ) , et3n ( 3.0 equiv ) , ch3cn ( 4.0 ml mmol ) , 120 c mw , 15 min .
method e reagents and conditions : starting aryl bromide ( 1.0 equiv ) , acrylamide ( 1.5 equiv ) and trans - bis(acetato)bis[o-(di - o - tolylphosphino)benzyl]dipalladium(ii ) ( 0.05 equiv ) , naoac ( 3.0 equiv ) , dmf ( 4.0 ml mmol ) , 140 c mw , 15 min .
[ a ] chemical stability in pbs ph 7.4 at 25 c ; as % remaining after 24 h. [ b ] isolated yield over two steps .
[ c ] the compound interferes with the assay at 10 m , therefore it was not possible to measure human proteasome inhibition .
[ d ] reagents and conditions : 1 ) ( 2e)-3-(1h - indolyl-3-yl)acrylic acid ( 2.0 mmol ) , 1,1-carbonyldiimidazole ( 2.0 mmol ) , dmf ( 10 ml ) , rt , 30 min , 2 ) nh4hco3 ( 4.0 mmol ) , rt , o / n . based on these promising results for both inhibition and selectivity of the 5-styryl - oxathiazol-2-ones ,
active mtb proteasome inhibitors displaying full to moderate selectivity were tested against a virulent strain of mtb ( h37rv ) .
four 5-aryl - oxathiazol-2-ones ( table 4 , entries 14 ) were also tested for comparison , as well as three known antitubercular agents as a reference ( entries 30 - 32 ) .
cytotoxicity for mammalian cells was investigated using the vero cell line ( african green monkey kidney cells ) ; the results are reported in table 4 .
the minimum inhibitory concentration ( mic ) was determined against aerobically - grown mtb h37rv using a 10-point serial dilution by optical density ( od ) and relative fluorescence units ( rfu ) measurement .
the highest concentration of compound tested was 20 m . the % growth was plotted , and a curve was fitted using the gompertz fit .
the mic was defined as the minimum concentration at which growth was completely inhibited and was calculated from the inflection point of the fitted curve to the lower asymptote ( zero growth ) .
cytotoxicity was measured against the vero cell line ; the tc50 is the concentration required to inhibit growth by 50 % over 48 h. n.d.=not determined . [
a ] known antitubercular agents were used as reference compounds.3 the oxathiazolones had little or no activity against replicating bacteria when compared to the known antitubercular agents used as reference ( entries 30 - 32 in table 4 ) .
a few compounds showed > 20 % inhibition of growth at the maximum concentration tested ( 20 m ) , but none had an mic20 m . there was no clear difference between the 5-styryl - oxathiazol-2-ones ( entries 529 ) and the previously reported 5-aryl - analogues ( entries 14 ) or with respect to the electronic nature and/or position of the ring substitution .
this finding is consistent with the mic values ( 15299 m ) for a series of 5-aryl - oxathiazol-2-ones recently tested on the same mtb strain.16 g compounds demonstrated some cytotoxicity against the vero cell line , with tc50 values ( concentration required to inhibit growth by 50 % over 48 h ) in the range of 1141 m ( when tested ) .
however , these results indicate that our new inhibitors are generally 1000/4000-fold less toxic than the approved human proteasome inhibitor bortezomib ( tc50 less than 10 nm).7c the observed cytotoxicity might be related to the inhibition of the trypsin - like and caspase - like activity of the mammalian proteasome.22 alternatively , it might be due to the non - proteasome - related activity of the styryl oxathiazolone compounds towards other cellular enzymes that catalyze bond cleavage via the same mechanism as the mtb - proteasome ( i.e. nucleophilic attack ) .
on the other hand , a previous report from lin et al . demonstrated generally reduced inhibition potency for the parent aryl - oxathiazolone inhibitors ( e.g. compounds 14 included in our study ) toward 1 and 2 non - chymotrypsin - like active sites of the proteasome.7c additionally high selectivity towards other human proteases , including trypsin , cathepsin b , and matrix metalloproteases was reported for the same proteasome inhibitors.7c however , recent research by bassett et al . has revealed cytotoxicity towards vero cells for a number of proteasome inhibitors reported as antitubercular agents.23 previous work suggested that the proteasome plays a key role during oxidative and nitrosative stress,12 and that proteasome inhibitors are bactericidal against nonreplicating mtb subjected to nitrosative stress.7c we therefore determined whether the 5-styryl - oxathiazolone class of compounds had activity against mtb under nonreplicating conditions . for this we used a starvation model , in which bacteria are nutrientdeprived for 14 days,24 to induce the nonreplicating state , after which they are exposed to compounds over 21 days in this state ( figure 2 ) .
mtb was grown aerobically , washed , and resuspended in pbs - tyloxapol for 14 d. compounds were added with the indicated concentrations .
all four 5-styryl - oxathiazol-2-ones tested ( 17 , 33 , 37 , and 39 ) were bactericidal against nonreplicating mtb , displaying a very rapid kill ( > 4 logs in 714 days ) .
all compounds gave complete sterilization of cultures within 14 days at the lowest concentration tested ( 20 m ) .
the 5-(4-chloro)styryl - oxathiazol-2-one inhibitor ( 39 ) was most effective , reducing the colony - forming units ( cfu)/ml below the detection limit in only seven days at all concentrations .
our results demonstrate that 5-styryl - oxathiazol-2-ones provide a promising scaffold for mtb proteasome inhibitors . in the current study
we found that conjugated 5-styryl - oxathiazolones are equally or more potent inhibitors of the mtb proteasome compared to the previously reported 5-aryl - oxathiazolones .
as part of this investigation we prepared a series of novel 5-styryl - oxathiazolones from the corresponding aryl iodides or bromides by a microwave - assisted mizoroki heck coupling with acrylamide .
our enzyme activity results showed that para - substituted 5-styryl - oxathiazol-2-ones were superior to ortho- and meta - substitution with regard to mtb proteasome ic50 values , as well as their relative lack of effects against the chymotrypsin - like peptidase activity of human proteasomes .
we also produced a small series of oxathiazolones in which solubility - enhancing heterocyclic groups were introduced .
however , we gained solubility at the expense of selectivity regarding the human proteasome . finally , a selection of the synthesized inhibitors showed rapid bactericidal activity against nonreplicating mtb , although they were not very active against actively replicating cells .
the present results suggest that this new class of mtb proteasome inhibitors can be used as the basis for development of novel antitubercular drugs that are effective when protein synthesis of the mycobacteria is drastically reduced , such as in the nonreplicative state or during antibiotic treatment .
further development will include the improvement of the safety profile of this class of mtb proteasome inhibitors.30
general chemistry . analytical thin - layer chromatography ( tlc ) was performed on silica gel 60 f-254 plates ( merck ) and visualized with uv light .
flash column chromatography was performed on columns prepacked with pharma - sil ( 5 g/10 g , hydrophilic high surface activity silica , uct , inc . ,
h and c nmr spectra were recorded on varian mercury plus instruments ( palo alto , usa ) ; h nmr spectra at 399.9 mhz and c nmr spectra at 100.5 mhz .
the chemical shifts for h nmr and c nmr were referenced to tetramethylsilane ( tms ) via residual solvent signals ( h , cdcl3 at 7.26 ppm and [ d6]-dimethylsulfoxide ( dmso ) at 2.50 ppm ; c , cdcl3 at 77.0 ppm and [ d6]dmso at 39.5 ppm ) , while chemical shifts for f nmr were referenced to cfcl3 used as internal standard ( 0.0 ppm ) .
the microwave reactions were performed in a biotage initiator ( uppsala , sweden ) producing controlled irradiation at 2450 mhz with a power of 0300 w. the reaction temperature was determined using the built - in on - line infrared ( ir ) sensor .
all reactions were performed in sealed microwave - transparent process vials designed for 0.52 , 25 , or 1020 ml reaction volumes .
gas chromatography / electron ionization mass spectrometry ( gc / ei - ms ) was performed on a varian saturn 3900/2100 system equipped with a cp - sil 8 cb capillary column ( 30 m0.25 mm , 0.25 m ) operating at an ei potential of 70 ev .
analytical high - performance liquid chromatography / electrospray ionization mass spectrometry ( hplc / esi - ms ) was performed on a gilson hplc system ( middleton , usa ) with a finnigan aqa esi quadropole mass spectrometer with electrospray ionization ( thermo fisher scientific , waltham , usa ) and using an onyx monolithic c18 column 4.650 mm ( phenomenex , torrance , usa ) with ch3cn / h2o in 0.05 % hcooh as mobile phase at a flow rate of 4 ml min or on a dionex ultimate 3000 hplc system ( sunnyvale , usa ) with a bruker amazon sl ion trap mass spectrometer ( billerica , usa ) , using a phenomenex kinetex c18 column ( 503.0 mm , 2.6 m particle size , 100 pore size ) with ch3cn / h2o in 0.05 % hcooh as mobile phase at a flow rate of 1.5 ml min .
detection was by uv ( diode array detector ) and ms ( esi+ mode ) .
preparative hplc purification was performed by uv - triggered ( 254 nm ) fraction collection with a dionex ultimate 3000 hplc system , using an agilent prepht zorbax sb - c8 column ( 21.2150 mm , 5 m particle size ) ( santa clara , usa ) with ch3cn / h2o in 0.05 % trifluoroacetic acid ( tfa ) as mobile phase .
high - resolution mass spectrometry ( hrms ) was performed on a micromass q - tof2 mass spectrometer ( waters , milford , usa ) equipped with an electrospray ion source .
hrms data are provided for all novel compounds , unless low ionization level , intrinsic to the physicochemical properties of the specific molecules , did not permit the measurement of the corresponding molecular mass data . however , in some cases , it was possible to determine the low resolution molecular mass by the varian saturn 3900/2100 gc / ms system and/or by the bruker amazon sl ion trap mass spectrometer during the lc / ms analysis .
general method for the synthesis of 5-substituted oxathiazol-2-one. method a : a mixture of starting amide ( 1.0 equiv ) and chlorocarbonyl sulfenyl chloride ( 1.5 equiv ) in 1,4-dioxane ( 4.0 ml mmol ) was irradiated with microwaves at 100 c for 15 min .
the mixture was allowed to cool down to rt , and the solvent evaporated at reduced pressure .
the crude material was purified by silica gel column chromatography and/or preparative hplc to give the final compound with purity>95 % by hplc analysis ( =254 nm ) .
method b : a mixture of starting amide ( 1.0 equiv ) and chlorocarbonyl sulfenyl chloride ( 2.0 equiv ) in freshly distilled thf ( 4.0 ml mmol ) was stirred o / n at rt .
the solvent was evaporated at reduced pressure , and the crude material was purified by silica gel column chromatography and/or preparative hplc to give the final compound with purity>95 % by hplc analysis ( =254 nm ) .
5-phenyl-1,3,4-oxathiazol-2-one ( 1).7c according to method a , benzamide ( 121 mg , 1.0 mmol ) was used to give , after preparative hplc purification , 77 mg ( 43 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.53 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =7.997.96 ( m , 2 h ) , 7.607.55 ( m , 1 h ) , 7.527.47 ( m , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.8 , 157.4 , 132.6 , 129.0 , 127.4 , 125.8 ; hrms m / z for c8h5no2s as [ m+h ] adduct not found due to low ionization level .
5-(pyrazin-2-yl)-1,3,4-oxathiazol-2-one ( 2).17 according to method b , pyrazinamide ( 123 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after preparative hplc purification , 42 mg ( 23 % isolated yield ) of the title compound as white crystals .
tlc : rf=0.29 ( pentane / etoac 1:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =9.29 ( s , 1 h ) , 8.79 ( s , 1 h ) , 8.75 ppm ( s , 1 h ) ; c nmr ( 100 mhz , cdcl3 ) : =172.2 , 154.6 , 147.2 , 144.7 , 144.3 , 140.2 ppm ; esi - ms m / z : 182 [ m+h ] ; hrms m / z calcd for c6h3n3o2s [ m+h ] 182.0024 , found 182.0031 .
5-(3-methoxyphenyl)-1,3,4-oxathiazol-2-one ( 3).7c according to method b , 3-methoxybenzamide ( 151 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 80 mg ( 38 % isolated yield ) of the title compound as a white powder .
lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.537.49 ( m , 2 h ) , 7.417.39 ( m , 1 h ) , 7.277.20 ( m , 1 h ) , 3.84 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.7 , 159.5 , 156.6 , 130.6 , 126.8 , 119.5 , 118.9 , 111.7 , 55.5 ppm ; esi - ms m / z : 210 [ m+h ] ; hrms m / z for c9h7no3s as [ m+h ] adduct not found due to low ionization level .
3-fluorobenzamide ( 139 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:1 ) , 163 mg ( 83 % isolated yield ) of the title compound as a white solid .
tlc : rf=0.79 ( pentane/ etoac 100:3 ) ; lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.78 ( dt , j=7.6 , 1.2 hz , 1 h ) , 7.70 ( ddd , j=9.2 , 2.8 , 1.6 hz , 1 h ) , 7.65 ( td , j=8.0 , 5.9 hz , 1 h ) , 7.53 ppm ( tdd , j=8.8 , 2.8 , 0.8 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.5 , 162.1 ( d , j=244.0 hz ) , 155.6 ( d , j=3.1 hz ) , 131.7 ( d , j=8.4 hz ) , 127.6 ( d , j=9.2 hz ) , 123.4 ( d , j=3.0 hz ) , 119.7 ( d , j=21.4 hz ) , 113.8 ppm ( d , j=23.7 hz ) ; f nmr ( 376 mhz , [ d6]dmso ) : =111.4 ppm ( td , j=9.3 , 5.3 hz ) ; ei - ms m / z : 197 [ m ] ; hrms m / z for c8h4fno2s as [ m+h ] adduct not found due to low ionization level .
according to method a , 3-chloropropionamide ( 81 mg , 0.75 mmol ) was used to give , after silica column purification ( pentane / etoac 100:2 ) , 75 mg ( 60 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.31 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm):99 % ; h nmr ( 400 mhz , cdcl3 ) : =3.84 ( t , j=6.4 hz , 2 h ) , 3.11 ppm ( t , j=6.4 hz , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.5 , 157.9 , 38.4 , 33.7 ppm ; ei - ms m / z : 166/168 [ m+1 ] ; esi - ms m / z : 166/168 [ m+h ] ; hrms m / z for c4h4clno2s as [ m+h ] adduct not found due to low ionization level
according to method a , cyclopropanecarboxamide ( 85 mg , 1.0 mmol ) was reacted to give , after silica column purification ( pentane / etoac 100:1 ) , 38 mg ( 27 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.51 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) 99 % ; h nmr ( 400 mhz , cdcl3 ) : =1.981.90 ( m , 1 h ) , 1.181.12 ( m , 2 h ) , 1.111.04 ppm ( m , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =174.2 , 162.7 , 11.2 , 8.4 ppm ; ei - ms m / z : 143 [ m ] ; hrms m / z for c5h5no2s as [ m+h ] adduct not found due to low ionization level . 5-pentyl-1,3,4-oxathiazol-2-one ( 7 ) . according to method a , hexanamide ( 86 mg , 0.75 mmol ) was used to give , after silica column purification ( pentane / etoac 100:1 ) , 73 mg ( 56 % isolated yield ) of the title compound as colorless oil .
tlc : rf=0.65 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =2.61 ( t , j=7.0 hz , 2 h ) , 1.73 ( quin , j=7.0 hz , 2 h ) , 1.401.30 ( m , 4 h ) , 0.91 ppm ( t , j=7.0 hz , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =174.4 , 162.0 , 30.9 , 30.4 , 25.0 , 22.1 , 13.8 ppm ; ei - ms m / z : 174 [ m+1 ] ; esi - ms m / z : 174 [ m+h ] ; hrms m / z for c7h11no2s as [ m+h ] adduct not found due to low ionization level .
according to method b , fluoroacetamide ( 154 mg , 2.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:2 ) , 64 mg ( 24 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.55 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm)=96 % ; h nmr ( 400 mhz , [ d6]dmso ) : =5.39 ppm ( d , j=45.6 hz , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 155.7 ( d , j=21.5 hz ) , 76.9 ppm ( d , j=171.0 hz ) ; f nmr ( 376 mhz , [ d6]dmso ) : =0.96 ppm ( t , j=45.5 hz ) ; ei - ms m / z : 135 [ m ] , 196 ; hrms m / z for c3h2fno2s as [ m+h ] adduct not found due to low ionization level . 5-benzyl-1,3,4-oxathiazol-2-one ( 9).25 according to method a , 2-phenylacetamide ( 135 mg , 1.0 mmol ) was reacted to yield , after preparative hplc purification , the title compound as a white powder ( 83 mg , 43 % ) .
tlc : rf=0.39 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , cdcl3 ) : =7.407.28 ( m , 5 h ) , 3.93 ppm ( s , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =174.0 , 160.0 , 132.3 , 129,1 , 129.0 , 127.9 , 37.0 ppm ; hrms m / z for c9h7no2s as [ m+h ] adduct not found due to low ionization level .
according to method a , 4-methoxyphenylacetamide ( 83 mg , 0.50 mmol ) was used to yield , after preparative hplc purification , 30 mg ( 27 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.35 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , cdcl3 ) : =7.28 ( t , j=7.8 hz , 1 h ) , 6.906.82 ( m , 3 h ) , 3.90 ( s , 2 h ) , 3.81 ppm ( s , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =174.0 , 160.0 , 133.7 , 130.0 , 121.3 , 114.9 , 113.2 , 55.3 , 37.0 ppm ; ei - ms m / z : 184 , 147 ; esi - ms m / z : 224 [ m+h ] ; hrms m / z calcd for c10h9no3s [ m+h ] 224.0381 , found 224.0380 .
according to method a , 2-(4-formylphenoxy)acetamide ( 90 mg , 0.50 mmol ) was used to yield , after preparative hplc purification , 47 mg ( 39 % isolated yield ) of the title compound as white powder .
tlc : rf=0.10 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =9.92 ( s , 1 h ) , 7.89 ( d , j=8.8 hz , 2 h ) , 7.09 ( d , j=8.8 hz , 2 h ) , 5.05 ppm ( s , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =190.5 , 172.6 , 161.9 , 155.8 , 132.1 , 131.3 , 115.0 , 63.2 ppm ; ei - ms m / z : 238 [ m+1 ] ; esi - ms m / z : 238 [ m+h ] ; hrms m / z calcd for c10h7no4s [ m+h ] 238.0174 , found 238.0175 .
according to method a , 1-naphthylacetamide ( 93 mg , 0.50 mmol ) was used to yield , after preparative hplc purification , 62 mg ( 51 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.48 ( isohexane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =8.03 ( d , j=7.8 hz , 1 h ) , 7.927.83 ( m , 2 h ) ,
7.617.51 ( m , 2 h ) , 7.507.45 ( m , 2 h ) , 4.38 ppm ( s , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.9 , 159.9 , 133.9 , 131.6 , 129.0 , 128.5 , 128.3 , 126.9 , 126.1 , 125.5 , 123.2 , 34.6 ppm ; ei - ms m / z : 228 , 167 ; esi - ms m / z : 244 [ m+h ] ; hrms m / z calcd for c13h9no2s [ m+h ] 244.0432 , found 244.0427 .
according to method b , 2-(trifluoromethyl)phenylacetamide ( 152 mg , 0.75 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after two silica column purification ( 1 : pentane / etoac 100:0 10:1 , 2 : pentane / etoac 100:0 100:2 ) , 110 mg ( 56 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.53 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =7.72 ( d , j=7.8 hz , 1 h ) , 7.58 ( t , j=7.8 hz , 1 h ) , 7.497.41 ppm ( m , 2 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.7 , 158.9 , 132.3 , 132.0 , 130.5 ( q , j=1.5 hz ) , 129.1 ( q , j=30.7 hz ) , 128.3 , 126.6 ( q , j=5.4 hz ) , 124.0 ( q , j=273.7 hz ) , 33.8 ppm ( q , j=2.3 hz ) ; f nmr ( 376 mhz , cdcl3 ) : 59.8 ppm ; esi - ms m / z : 262 [ m+h ] ; hrms m / z calcd for c10h6f3no2s [ m+h ] 262.0150 , found 262.0154 .
according to method b , 2-hydroxy-2-phenylacetamide ( 151 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column ( pentane / etoac 100:0 1:1 ) and preparative hplc purification , 84 mg ( 40 % isolated yield ) of the title compound as a pale yellow oil .
tlc : rf=0.17 ( pentane / etoac 5:1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.487.32 ( m , 5 h ) , 6.73 ( d , j=5.5 hz , 1 h ) , 5.65 ppm ( d , j=5.5 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =174.0 , 161.9 , 138.3 , 128.5 , 128.4 , 126.7 , 69.9 ppm ; esi - ms m / z : 232 [ m+na ] ; hrms m / z for c9h7no3s as [ m+h ] adduct not found due to low ionization level .
3-phenylpropionic acid ( 150 mg , 1.0 mmol ) and 1,1-carbonyldiimidazole ( 357 mg , 2.2 mmol ) were dissolved in dmf ( 5 ml ) , and the mixture was stirred at rt .
after 30 min , nh4hco3 ( 316 mg , 4.0 mmol ) was added , and the resulting suspension was stirred at rt for 3 d. etoac ( 50 ml ) was added , and the organic phase was washed with h2o ( 220 ml ) and brine ( 20 ml ) .
evaporation of solvent gave 171 mg of the crude corresponding amide , purified by precipitation from etoac / pentane to afford 92 mg ( 62 % isolated yield ) of 3-phenylpropionamide as a white solid .
tlc : rf=0.28 ( pentane / etoac 1:1 ) ; gc / ms purity : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.356.98 ( m , 6 h ) , 6.76 ( bs , 1 h ) , 2.81 ( t , j=8.0 hz , 2 h ) , 2.36 ppm ( t , j=8.0 hz , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 141.5 , 128.2 , 128.1 , 125.8 , 36.7 , 30.9 ppm ; ei - ms m / z : 149 [ m ] . according to method b , 3-phenylpropionamide ( 150 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:1 ) , 147 mg ( 71 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.79 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.357.20 ( m , 5 h ) , 2.98 ppm ( s , 4 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =174.3 , 161.2 , 139.6 , 128.4 , 128.3 , 126.4 , 31.2 , 30.4 ppm ; esi - ms m / z : 208 [ m+h ] ; hrms m / z for c10h9no2s as [ m+h ] adduct not found due to low ionization level .
( r)-()-2-methoxyphenylacetic acid ( 332 mg , 2.0 mmol ) and 1,1-carbonyldiimidazole ( 649 mg , 4.0 mmol ) were dissolved in dmf ( 10 ml ) , and the mixture was stirred at rt .
after 30 min , nh4hco3 ( 632 mg , 8.0 mmol ) was added and the resulting suspension was stirred at rt for 3 d. etoac ( 50 ml ) was added , and the organic phase was washed with h2o ( 230 ml ) and brine ( 30 ml ) .
evaporation of solvent gave 180 mg ( 55 % yield ) of the crude ( r)-2-methoxy-2-phenylacetamide as a white powder , used for the next step without further purification .
gc / ms purity : 99 % ; ei - ms m / z : 166 [ m+1 ] .
according to method b , ( r)-2-methoxy-2-phenylacetamide ( 180 mg , 1.1 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:1 ) , 140 mg ( 58 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.64 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.487.38 ( m , 5 h ) , 5.44 ( s , 1 h ) , 3.43 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.7 , 159.4 , 135.4 , 129.0 , 128.7 , 127.2 , 78.8 , 57.3 ppm ; esi - ms m / z : 164 ; hrms m / z calcd for c10h9no3s [ m+h ] 224.0381 , found 224.0379 .
( e)-5-styryl-1,3,4-oxathiazol-2-one ( 17).26 according to method b , trans - cinnamamide ( 147 mg , 1.0 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 10:1 ) and trituration in pentane / etoac / meoh 10:1:1 drop , 82 mg ( 40 % isolated yield ) of the title compound as a pale yellow powder .
tlc : rf=0.76 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =7.567.49 ( m , 2 h ) , 7.50 ( d , j=16.4 hz , 1 h ) , 7.447.39 ( m , 3 h ) , 6.64 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.4 , 157.6 , 142.0 , 134.1 , 130.6 , 129.1 , 127.8 , 112.8 ppm ; ei - ms m / z : 191 , 161 , 129 ; esi - ms m / z : 206 [ m+h ] ; hrms m / z calcd for c10h7no2s [ m+h ] 262.0276 , found 262.0273 .
b , 4-(trifluoromethyl)cinnamamide ( 183 mg , 0.85 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 97 mg ( 42 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.57 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.01 ( d , j=8.2 hz , 2 h ) , 7.79 ( d , j=8.2 hz , 2 h ) , 7.63 ( d , j=16.4 hz , 1 h ) , 7.17 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 157.0 , 139.5 , 138.2 ppm ( q , j=1.5 hz ) , 129.9 ( q , j=32.2 hz ) , 128.8 , 125.7 ( q , j=3.8 hz ) , 124.0 ( q , j=272.2 hz ) , 116.0 ; f nmr ( 376 mhz , [ d6]dmso ) : =61.3 ppm ; esi - ms m / z : 274 [ m+h ] ; hrms m / z for c11h6f3no2s as [ m+h ] adduct not found due to low ionization level .
martin periodinane ( 467 mg , 1.1 mmol ) was added to a precooled solution ( t=0 c ) of 5-(hydroxy(phenyl)methyl)-1,3,4-oxathiazol-2-one ( 14 ) ( 209 mg , 1.0 mmol ) in anhydrous ch2cl2 ( 5 ml ) .
the resulting reaction mixture was stirred 2 h at 0 c and then filtered to remove the formed solid .
the mother liquor was washed with h2o ( 10 ml ) and dried on anhydrous na2so4 .
evaporation of the solvent under reduced pressure gave 347 mg of the crude material that was triturated with etoac for 30 min at rt .
filtration of the formed solid and evaporation of the solvent gave 117 mg of a colorless oil that was purified by silica column purification ( pentane / etoac 100:0 10:1 ) to give 118 mg ( 57 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.48 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.188.13 ( m , 2 h ) , 7.787.72 ( m , 1 h ) , 7.637.57 ppm ( m , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =177.4 , 172.3 , 153.3 , 134.5 , 133.5 , 130.6 , 128.6 ppm ; ei - ms m / z : 208 [ m+1 ] ; esi - ms m / z : 208 [ m+h ] ; hrms m / z calcd for c9h5no3s [ m+h ] 208.0068 , found 208.0070 .
5-(phenylethynyl)-1,3,4-oxathiazol-2-one ( 20 ) . in a round - bottom flask , socl2 ( 714 mg , 6.0 mmol )
was added to a solution of phenylpropiolic acid ( 730 mg , 5.0 mmol ) in chcl3 ( 10 ml ) at rt after addition of dmf ( 1 drop ) , the reaction mixture was stirred 1 h at rt to the resulting solution was then added 25 % aq nh4oh ( 2.5 ml ) at 10 c .
the reaction mixture was allowed to return to rt and stirred 30 min at this temperature .
chcl3 ( 10 ml ) and h2o ( 10 ml ) where added , the aqueous layer was extracted with chcl3 ( 220 ml ) and the combined organic phases were dried over na2so4 .
evaporation of the solvent under reduced pressure gave 377 mg ( 52 % isolated yield ) of the crude 3-phenylpropiolamide as a white solid , which was used for the next step without further purification .
tlc : rf=0.72 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.14 ( bs , 1 h ) , 7.66 ( bs , 1 h ) , 7.617.52 ( m , 2 h ) , 7.517.42 ppm ( m , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =153.9 , 132.0 , 130.2 , 128.9 , 119.9 , 84.2 , 82.9 ppm ; esi - ms m / z : 146 [ m+h ] , 291 [ 2 m+h ] . according to method b , 3-phenylpropiolamide ( 150 mg , 1.03 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by silica column ( pentane / etoac 100:1 10:1 ) followed by preparative hplc purification , 51 mg ( 24 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.80 ( pentane / etoac 9 : 1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.757.71 ( m , 2 h ) , 7.647.58 ( m , 1 h ) , 7.567.50 ppm ( m , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =172.3 , 141.5 , 132.6 , 131.6 , 129.2 , 118.1 , 92.3 , 75.7 ppm ; esi - ms m / z : 204 [ m+h ] ; hrms m / z for c10h5no2s as [ m+h ] adduct not found due to low ionization level .
5-vinyl-1,3,4-oxathiazol-2-one ( 21).27 according to method b , acrylamide ( 107 mg , 1.5 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after two silica column purification ( 1 : pentane / etoac 100:0 10:1 , 2 : pentane / etoac 100:0 100:2 ) , 15 mg ( 8 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.73 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , cdcl3 ) : =6.32 ( dd , j=17.6 , 10.9 hz , 1 h ) , 6.23 ( d , j=17.6 hz , 1 h ) , 5.92 ppm ( d , j=10.5 hz , 1 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.1 , 157.0 , 127.9 , 122.9 ppm ; ei - ms m / z : 129 [ m ] ; hrms m / z for c4h3no2s as [ m+h ] adduct not found due to low ionization level .
according to method b , 4,4,4-trifluorocrotonamide ( 306 mg , 2.2 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:2 ) , 350 mg ( 81 % isolated yield ) of the title compound as a colorless oil .
tlc : rf=0.69 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.127.01 ppm ( m , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =172.7 , 154.2 , 127.1 ( q , j=34.3 hz ) , 124.0 ( q , j=6.9 hz ) , 122.5 ppm ( q , j=268.4 hz ) ; f nmr ( 376 mhz , [ d6]dmso ) : =63.5 ppm ( d , j=5.6 hz ) ; hrms m / z for c5h2f3no2s as [ m+h ] adduct not found due to low ionization level .
2-phenyl - trans - cinnamic acid ( 224 mg , 1.0 mmol ) and 1,1-carbonyldiimidazole ( 357 mg , 2.2 mmol ) were dissolved in dmf ( 5 ml ) and the mixture was stirred at rt .
after 30 min , nh4hco3 ( 316 mg , 4.0 mmol ) was added and the resulting suspension was stirred at rt for 3 d. etoac ( 50 ml ) was added , and the organic phase was washed with h2o ( 220 ml ) and brine ( 20 ml ) .
evaporation of solvent gave 212 mg of the crude corresponding amide , purified by silica column chromatography ( pentane / etoac 1:1 3:1 ) to afford 150 mg ( 67 % isolated yield ) of 2-phenyl - trans - cinnamamide as white crystals .
tlc : rf=0.63 ( pentane / etoac=1:1 ) ; gc / ms purity : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.467.35 ( m , 4 h ) , 7.30 ( bs , 1 h ) , 7.247.15 ( m , 5 h ) , 7.036.97 ( m , 2 h ) , 6.90 ppm ( bs , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =170.0 , 136.7 , 136.6 , 135.0 , 133.9 , 129.7 , 129.3 , 128.8 , 128.2 , 128.1 , 127.8 ppm ; ei - ms m / z : 223 [ m ] .
according to method b , 2-phenyl - trans - cinnamamide ( 256 mg , 1.1 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after silica column purification ( pentane / etoac 100:0 100:1 ) , 290 mg ( 90 % isolated yield ) of the title compound as a white solid .
tlc : rf=0.77 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.65 ( s , 1 h ) , 7.507.43 ( m , 3 h ) ,
7.357.29 ( m , 2 h ) , 7.287.20 ( m , 3 h ) , 7.137.08 ppm ( m , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.6 , 158.5 , 137.6 , 134.1 , 134.0 , 130.3 , 129.9 , 129.4 , 128.9 , 128.6 , 128.4 , 127.8 ppm ; esi - ms m / z : 282 [ m+h ] ; hrms m / z calcd for c16h11no2s [ m+h ] 282.0589 , found 282.0587 .
benzhydroxamic acid ( 137 mg , 1.0 mmol ) was reacted with 1,1-carbonyldiimidazole to give , after silica column purification ( pentane / etoac 100:0 100:5 ) , 86 mg of the crude dioxazolone which was purified by precipitation from etoac / pentane to give 80 mg ( 49 % isolated yield ) of the title compound as a white solid .
tlc : rf=0.87 ( pentane / etoac=9:1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.877.83 ( m , 2 h ) , 7.767.71 ( m , 1 h ) , 7.677.61 ppm ( m , 2 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =163.0 , 153.9 , 133.7 , 129.6 , 126.4 , 120.3 ppm ; hrms m / z for c8h5no3 as [ m+h ] adduct not found due to low ionization level .
( e)-3-styryl-1,4,2-dioxazol-5-one ( 25). trans - cinnamic acid ( 296 mg , 2.0 mmol ) and 1,1-carbonyldiimidazole ( 486 mg , 3.0 mmol ) were dissolved in thf ( 8 ml ) , and the mixture was stirred at rt .
after 1 h , hydroxylamine hydrochloride ( 278 mg , 4.0 mmol ) was added , and the resulting suspension was stirred at rt for 2 d. 5 % aq khso4 ( 30 ml ) was added , and the mixture was extracted with etoac ( 230 ml ) . the collected organic phases were washed with brine ( 30 ml ) and dried over na2so4 .
evaporation of solvent gave 280 mg ( 86 % isolated yield ) of the corresponding n - hydroxycinnamamide as a pale pink solid , used in the next step without further purification .
lc purity ( 254 nm)=95 % ; esi - ms : m / z 164 [ m+h ] .
the obtained n - hydroxycinnamamide ( 140 mg , 0.86 mmol ) was reacted with 1,1-carbonyldiimidazole to give , after silica column purification ( ch3cn ) and evaporation of the solvent by freeze - drying , 123 mg of the crude dioxazolone which was purified by preparative hplc to give 83 mg ( 51 % isolated yield ) of the title compound as a white solid .
tlc : rf=0.64 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.847.78 ( m , 2 h ) , 7.56 ( d , j=16.4 hz , 1 h ) , 7.497.43 ( m , 3 h ) , 7.15 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =163.2 , 153.6 , 142.2 , 133.8 , 130.8 , 129.0 , 128.4 , 106.9 ppm ; esi - ms m / z : 190 [ m+h ] ; hrms m / z for c10h7no3 as [ m+h ] adduct not found due to low ionization level .
general method for the synthesis of 2-substituted acrylamide. method c ( mizoroki heck reaction , electron - rich iodide ) a suitable microwave vial was loaded with solid reactants and reagents : starting iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) , palladium(ii ) acetate ( 0.05 equiv ) , and tri - tert - butylphosphonium tetrafluoroborate ( 0.10 equiv ) .
ch3cn ( 4.0 ml mmol ) was added , followed by liquid reactants : starting iodide ( 1.0 equiv , in case ) .
oxygen was removed by bubbling gaseous nitrogen into the resulting mixture for 15 min , then triethylamine ( 3.0 equiv ) was added , the vial was capped , and the reaction mixture was irradiated with microwaves at 120 c for 15 min .
the mixture was allowed to cool down to rt , and the collected crude material was purified by silica gel column chromatography to give the desired 3-substituted acrylamide .
method d ( mizoroki heck reaction , electron - poor iodide ) a suitable microwave vial was loaded with solid reactants and reagents : starting iodide ( 1.0 equiv ) , acrylamide ( 2.0 equiv ) , and palladium(ii ) acetate ( 0.05 equiv ) .
ch3cn ( 4.0 ml mmol ) was added , followed by liquid reactants : starting iodide ( 1.0 equiv , in case ) .
oxygen was removed by bubbling gaseous nitrogen into the resulting mixture for 15 min , then triethylamine ( 3.0 equiv ) was added , the vial was capped , and the reaction mixture was irradiated with microwaves at 120 c for 15 min .
the mixture was allowed to cool down to rt , and the collected crude material was purified by silica gel column chromatography to give the desired 3-substituted acrylamide .
method e ( mizoroki heck reaction , electron - poor bromide ) a suitable microwave vial was loaded with solid reactants and reagents : starting bromide ( 1.0 equiv ) , acrylamide ( 1.5 equiv ) , trans - bis(acetato)bis[o-(di - o - tolylphosphino)benzyl]dipalladium(ii ) ( 0.05 equiv ) , and naoac ( 3.0 equiv ) .
dry dmf ( 4.0 ml mmol ) was added , followed by liquid reactants : starting bromide ( 1.0 equiv , in case ) .
the vial was capped , and the reaction mixture was irradiated with microwaves at 140 c for 15 min .
the mixture was allowed to cool down to rt , and the collected crude material was purified by silica gel column chromatography to give the desired 3-substituted acrylamide .
4-iodoanisole ( 234 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum to give 139 mg of the crude corresponding acrylate , that was purified by silica column chromatography ( etoac / meoh 100:5 100:10 ) to afford 133 mg ( 75 % isolated yield ) of ( e)-3-(4-methoxyphenyl)acrylamide as a white powder .
tlc : rf=0.34 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.52 ( dm , j=8.6 hz , 2 h ) , 7.45 ( bs , 1 h ) , 7.38 ( d , j=16.0 hz , 1 h ) , 7.036.97 ( m , 3 h ) , 6.47 ( d , j=15.6 hz , 1 h ) , 3.80 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.9 , 160.3 , 138.8 , 129.1 , 127.4 , 119.8 , 114.4 , 55.2 ppm ; esi - ms m / z : 178 [ m+h ] .
according to method b , ( e)-3-(4-methoxyphenyl)acrylamide ( 256 mg , 1.4 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 240 mg ( 71 % isolated yield ) of the title compound as a pale yellow powder . lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.73 ( dm , j=8.6 hz , 2 h ) , 7.49 ( d , j=16.0 hz , 1 h ) , 6.99 ( dm , j=8.6 hz , 2 h ) , 6.83 ( d , j=16.4 hz , 1 h ) , 3.81 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.6 , 161.1 , 157.7 , 141.2 , 130.0 , 126.8 , 114.4 , 110.6 , 55.4 ppm ; esi - ms m / z : 236 [ m+h ] ; hrms m / z calcd for c11h9no3s [ m+h ] 236.0381 , found 236.0383 .
1-iodo-4-isopropylbenzene ( 246 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum to give 150 mg of the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / meoh 100:0 100:10 ) to afford 118 mg ( 62 % isolated yield ) of ( e)-3-(4-isopropylphenyl)acrylamide as an off - white powder .
tlc : rf=0.42 ( etoac ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.49 ( bs , 1 h ) , 7.47 ( d , j=8.0 hz , 2 h ) , 7.37 ( d , j=16.0 hz , 1 h ) , 7.28 ( d , j=8.0 hz , 2 h ) , 7.05 ( bs , 1 h ) , 6.55 ( d , j=16.0 hz , 1 h ) , 2.90 ( sep , j=7.0 hz , 1 h ) , 1.20 ppm ( d , j=7.0 hz , 6 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.8 , 150.0 , 139.1 , 132.5 , 127.6 , 126.9 , 121.3 , 33.3 , 23.7 ppm ; esi - ms m / z : 190 [ m+h ] , 231 [ m+ch3cn+h ] , 379 [ 2 m+h ] . according to method b , ( e)-3-(4-isopropylphenyl)acrylamide ( 118 mg , 0.62 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by silica column chromatography ( pentane / etoac 100:0 100:2 ) and preparative hplc purification , 102 mg ( 66 % isolated yield ) of the title compound as a white solid .
tlc : rf=0.60 ( pentane / etoac 10 : 1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.69 ( d , j=8.1 hz , 2 h ) , 7.50 ( d , j=16.3 hz , 1 h ) , 7.31 ( d , j=8.1 hz , 2 h ) , 6.93 ( d , j=16.3 hz , 1 h ) , 2.92 ( sep , j=6.8 hz , 1 h ) , 1.21 ppm ( d , j=6.8 hz , 6 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.5 , 157.5 , 151.2 , 141.4 , 131.9 , 128.3 , 126.9 , 112.2 , 33.4 , 23.6 ppm ; esi - ms m / z : 248 [ m+h ] , 289 [ m+ch3cn+h ] ; hrms m / z for c13h13no2s as [ m+h ] adduct not found due to low ionization level .
1-iodo-4-methylbenzene ( 218 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum to give 126 mg of the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / meoh 100:0 100:10 ) to afford 95 mg ( 59 % isolated yield ) of ( e)-3-(p - tolyl)acrylamide as a white powder .
tlc : rf=0.36 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.48 ( bs , 1 h ) , 7.44 ( d , j=8.0 hz , 2 h ) , 7.37 ( d , j=16.0 hz , 1 h ) , 7.22 ( d , j=8.0 hz , 2 h ) , 7.04 ( bs , 1 h ) , 6.55 ( d , j=16.0 hz , 1 h ) , 2.32 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.8 , 150.8 , 139.1 , 132.1 , 129.5 , 127.5 , 121.3 , 20.9 ppm ; esi - ms m / z : 162 [ m+h ] , 203 [ m+ch3cn+h ] , 323 [ 2 m+h ] . according to method b , ( e)-3-(p - tolyl)acrylamide ( 95 mg , 0.59 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 41 mg ( 32 % isolated yield ) of the title compound as white crystals .
lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.66 ( d , j=8.1 hz , 2 h ) , 7.49 ( d , j=16.4 hz , 1 h ) , 7.25 ( d , j=8.1 hz , 2 h ) , 6.92 ( d , j=16.4 hz , 1 h ) , 2.34 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.5 , 157.5 , 141.4 , 140.5 , 131.4 , 129.6 , 128.2 , 112.2 , 21.0 ppm ; esi - ms m / z : 220 [ m+h ] , 261 [ m+ch3cn+h ] ; hrms m / z for c11h9no2s as [ m+h ] adduct not found due to low ionization level .
( e)-5-(4-ethylstyryl)-1,3,4-oxathiazol-2-one ( 31 ) . according to method c , 1-ethyl-4-iodobenzene ( 232 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum to give 170 mg of the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / meoh 100:0 100:10 ) to afford 88 mg ( 50 % isolated yield ) of ( e)-3-(4-ethylphenyl)acrylamide as a white powder .
tlc : rf=0.40 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.49 ( bs , 1 h ) , 7.47 ( d , j=8.0 hz , 2 h ) , 7.38 ( d , j=16.0 hz , 1 h ) , 7.25 ( d , j=8.0 hz , 2 h ) , 7.04 ( bs , 1 h ) , 6.55 ( d , j=16.0 hz , 1 h ) , 2.62 ( q , j=7.6 hz , 2 h ) , 1.18 ppm ( t , j=7.6 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.8 , 145.4 , 139.1 , 132.4 , 128.3 , 127.6 , 121.3 , 28.1 , 15.4 ppm ; esi - ms m / z : 176 [ m+h ] , 217 [ m+ch3cn+h ] , 351 [ 2 m+h ] . according to method b , ( e)-3-(4-ethylphenyl)acrylamide ( 88 mg , 0.50 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 50 mg ( 43 % isolated yield ) of the title compound as yellow crystals . lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.68 ( d , j=8.1 hz , 2 h ) , 7.50 ( d , j=16.4 hz , 1 h ) , 7.28 ( d , j=8.1 hz , 2 h ) , 6.93 ( d , j=16.4 hz , 1 h ) , 2.63 ( q , j=7.7 hz , 2 h ) , 1.18 ppm ( t , j=7.7 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.5 , 157.5 , 146.7 , 141.4 , 131.7 , 128.4 , 128.3 , 112.2 , 28.1 , 15.3 ppm ; esi - ms m / z : 234 [ m+h ] , 275 [ m+ch3cn+h ] ; hrms m / z for c12h11no2s as [ m+h ] adduct not found due to low ionization level .
1-iodo-4-trifluoromethoxy - benzene ( 288 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( double purification : 1 etoac ; 2 pentane / etoac 1:1 0:1 ) to afford 221 mg of a 1:1 mixture of ( e)-3-(4-(trifluoromethoxy)phenyl)acrylamide and starting acrylamide as a white powder .
tlc : mizoroki heck product rf=0.48 , acrylamide rf=0.31 ( etoac ) ; esi - ms m / z : 232 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 221 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.25 ml ) to give , after purification by silica column chromatography ( pentane / etoac 100:0 100:2 ) , 185 mg ( 64 % isolated yield after two steps ) of the title compound as a white powder .
tlc : rf=0.55 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 94 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.93 ( dm , j=9.0 hz , 2 h ) , 7.58 ( d , j=16.4 hz , 1 h ) , 7.43 ( dm , j=8.0 hz , 2 h ) , 7.05 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 157.2 , 149.4 , 139.7 , 133.5 , 130.2 , 121.3 , 120.0 ( q , j=256.9 hz ) , 114.4 ppm ; esi - ms m / z : 290 [ m+h ] ; hrms m / z for c11h6f3no3s as [ m+h ] adduct not found due to low ionization level .
d , ethyl 4-iodobenzoate ( 276 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum .
the crude corresponding acrylate was purified by silica column chromatography ( etoac / meoh 1:0 10:1 ) to afford 147 mg ( 67 % isolated yield ) of ( e)-ethyl 4-(3-amino-3-oxoprop-1-en-1-yl)benzoate as an off - white powder .
tlc : rf=0.53 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.98 ( dm , j=8.3 hz , 2 h ) , 7.69 ( dm , j=8.3 hz , 2 h ) , 7.61 ( bs , 1 h ) , 7.46 ( d , j=16.0 hz , 1 h ) , 7.20 ( bs , 1 h ) , 6.73 ( d , j=16.0 hz , 1 h ) , 4.31 ( q , j=6.9 hz , 2 h ) , 1.33 ppm ( t , j=6.9 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.2 , 165.3 , 139.4 , 137.8 , 130.2 , 129.7 , 127.7 , 124.9 , 60.8 , 14.1 ppm ; esi - ms m / z : 220 [ m+h ] , 439 [ 2 m+h ] . according to method b , ( e)-ethyl 4-(3-amino-3-oxoprop-1-en-1-yl)benzoate ( 147 mg , 0.67 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 129 mg ( 69 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.39 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.98 ( bd , j=8.6 hz , 2 h ) , 7.92 ( bd , j=8.6 hz , 2 h ) , 7.59 ( d , j=16.4 hz , 1 h ) , 7.13 ( d , j=16.4 hz , 1 h ) , 4.33 ( q , j=7.1 hz , 2 h ) , 1.33 ppm ( t , j=7.1 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 165.2 , 157.0 , 139.9 , 138.6 , 130.9 , 129.5 , 128.4 , 115.7 , 60.9 , 14.1 ppm ; esi - ms m / z : 278 [ m+h ] ; hrms m / z calcd for c13h11no4s [ m+h ] 278.0487 , found 278.0482 .
4-iodobenzophenone ( 308 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum .
the crude corresponding acrylate was purified by silica column chromatography ( etoac / meoh 1:0 10:1 ) to afford 158 mg ( 63 % isolated yield ) of ( e)-3-(4-benzoylphenyl)acrylamide as an off - white powder .
tlc : rf=0.47 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.807.66 ( m , 7 h ) , 7.63 ( bs , 1 h ) , 7.617.55 ( m , 2 h ) , 7.50 ( d , j=15.8 hz , 1 h ) , 7.21 ( bs , 1 h ) , 6.75 ppm ( d , j=15.8 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =156.0 , 127.1 , 99.8 , 98.8 , 98.1 , 97.8 , 93.6 , 91.1 , 90.4 , 89.5 , 88.5 , 85.8 ppm ; esi - ms m / z : 252 [ m+h ] , 503 [ 2 m+h ] . according to method b , ( e)-3-(4-benzoylphenyl)acrylamide ( 158 mg , 0.63 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 157 mg ( 80 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.26 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.96 ( dm , j=8.8 hz , 2 h ) , 7.807.74 ( m , 4 h ) , 7.737.67 ( m , 1 h ) , 7.64 ( d , j=16.4 hz , 1 h ) , 7.617.55 ( m , 2 h ) , 7.16 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =195.1 , 173.4 , 157.1 , 140.0 , 138.1 , 138.0 , 136.8 , 132.9 , 130.1 , 129.6 , 128.6 , 128.2 , 115.6 ppm ; esi - ms m / z : 310 [ m+h ] ; hrms m / z calcd for c17h11no3s [ m+h ] 310.0538 , found 310.0535 .
d , methyl 4-iodobenzoate ( 262 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum .
the crude corresponding acrylate was purified by silica column chromatography ( etoac / meoh 1:0 10:1 ) to afford 124 mg ( 60 % isolated yield ) of ( e)-methyl 4-(3-amino-3-oxoprop-1-en-1-yl)benzoate as an off - white powder .
tlc : rf=0.47 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.98 ( bd , j=8.3 hz , 2 h ) , 7.70 ( bd , j=8.3 hz , 2 h ) , 7.61 ( bs , 1 h ) , 7.46 ( d , j=15.9 hz , 1 h ) , 7.20 ( bs , 1 h ) , 6.73 ( d , j=15.9 hz , 1 h ) , 3.86 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.2 , 165.8 , 139.5 , 137.8 , 129.9 , 129.7 , 127.8 , 125.0 , 52.2 ppm ; esi - ms m / z : 206 [ m+h ] , 411 [ 2 m+h ] . according to method b , ( e)-methyl 4-(3-amino-3-oxoprop-1-en-1-yl)benzoate ( 124 mg , 0.60 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 108 mg ( 68 % isolated yield ) of the title compound as white powder .
tlc : rf=0.32 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.98 ( bd , j=8.6 hz , 2 h ) , 7.92 ( bd , j=8.6 hz , 2 h ) , 7.60 ( d , j=16.4 hz , 1 h ) , 7.13 ( d , j=16.4 hz , 1 h ) , 3.87 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 165.7 , 157.0 , 139.8 , 138.7 , 130.6 , 129.6 , 128.4 , 115.7 , 52.3 ppm ; esi - ms m / z : 264 [ m+h ] ; hrms m / z calcd for c12h9no4s [ m+h ] 264.0331 , found 264.0336 .
1-iodo-4-nitrobenzene ( 249 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum .
the crude corresponding acrylate was purified by silica column chromatography ( etoac / meoh 1:0 10:1 ) to afford 95 mg ( 49 % isolated yield ) of ( e)-3-(4-nitrophenyl)acrylamide as a yellow powder .
tlc : rf=0.53 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.26 ( bd , j=9.0 hz , 2 h ) , 7.83 ( bd , j=9.0 hz , 2 h ) , 7.66 ( bs , 1 h ) , 7.52 ( d , j=15.9 hz , 1 h ) , 7.27 ( bs , 1 h ) , 6.80 ppm ( d , j=15.9 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.9 , 147.5 , 141.5 , 136.8 , 128.6 , 126.7 , 124.1 ppm ; esi - ms m / z : 193 [ m+h ] .
according to method b , ( e)-3-(4-nitrophenyl)acrylamide ( 95 mg , 0.49 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 99 mg ( 80 % isolated yield ) of the title compound as a pale yellow powder .
tlc : rf=0.24 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.26 ( bd , j=8.9 hz , 2 h ) , 8.07 ( bd , j=8.9 hz , 2 h ) , 7.67 ( d , j=16.4 hz , 1 h ) , 7.24 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 156.8 , 147.9 , 140.7 , 138.7 , 129.2 , 124.0 , 117.3 ppm ; esi - ms m / z : 251 [ m+h ] ; hrms m / z for c10h6n2o4s as [ m+h ] adduct not found due to low ionization level .
4-iodobenzonitrile ( 229 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( double purification : 1 etoac , 2 pentane / etoac 1:1 0:1 ) to afford 123 mg of a 1:2 mixture of ( e)-3-(4-cyanophenyl)acrylamide and starting acrylamide as white a powder .
tlc : mizoroki heck product rf=0.37 , acrylamide rf=0.31 ( etoac ) ; esi - ms : m / z 173 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 123 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.21 ml ) to give , after purification by precipitation from etoac / pentane , 47 mg ( 20 % isolated yield after two steps ) of the title compound as an off - white powder .
tlc : rf=0.21 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.98 ( bd , j=8.4 hz , 2 h ) , 7.90 ( bd , j=8.4 hz , 2 h ) , 7.61 ( d , j=16.4 hz , 1 h ) , 7.20 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 156.9 , 139.3 , 138.8 , 132.8 , 128.8 , 118.6 , 116.6 , 112.2 ppm ; esi - ms m / z : 231 [ m+h ] ; hrms m / z calcd for c11h6n2o2s [ m+h ] 231.0228 , found 231.0226 .
( e)-4-(2-(2-oxo-1,3,4-oxathiazol-5-yl)vinyl)benzaldehyde ( 38 ) . according to method d , 4-iodobenzaldehyde ( 232 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction . after microwave irradiation ,
the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( double purification : 1 etoac , 2 pentane / etoac 1:1 0:1 ) to afford 100 mg of a 2:3 mixture of ( e)-3-(4-formylphenyl)acrylamide and starting acrylamide as a white powder .
tlc : mizoroki heck product rf=0.37 , acrylamide rf=0.31 ( etoac ) ; esi - ms m / z : 176 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 100 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.10 ml ) to give , after purification by precipitation from etoac / pentane , 36 mg ( 15 % isolated yield after two steps ) of the title compound as a pale yellow powder .
tlc : rf=0.18 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =10.03 ( s , 1 h ) , 8.01 ( bd , j=8.4 hz , 2 h ) , 7.95 ( bd , j=8.4 hz , 2 h ) , 7.62 ( d , j=16.4 hz , 1 h ) , 7.19 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =192.6 , 173.3 , 157.0 , 139.9 , 139.8 , 136.8 , 129.9 , 128.8 , 116.2 ppm ; esi - ms m / z : 234 [ m+h ] ; hrms m / z for c11h7no3s as [ m+h ] adduct not found due to low ionization level .
1-chloro-4-iodobenzene ( 238 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to 0 c , and the collected precipitate was washed with cold ch3cn ( 3 ml ) and dried by vacuum .
the crude corresponding acrylate was purified by silica column chromatography ( etoac / meoh 1:0 10:1 ) to afford 123 mg ( 68 % isolated yield ) of ( e)-3-(4-chlorophenyl)acrylamide as a yellow powder .
tlc : rf=0.60 ( etoac ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.58 ( dm , j=8.4 hz , 2 h ) , 7.54 ( bs , 1 h ) , 7.47 ( dm , j=8.4 hz , 2 h ) , 7.40 ( d , j=15.9 hz , 1 h ) , 7.13 ( bs , 1 h ) , 6.61 ppm ( d , j=15.9 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =166.4 , 137.8 , 133.9 , 133.8 , 129.2 , 128.9 , 123.2 ppm ; esi - ms m / z : 182/184 [ m+h ] , 363/365 [ 2 m+h ] . according to method b , ( e)-3-(4-chlorophenyl)acrylamide ( 123 mg , 0.68 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after purification by precipitation from etoac / pentane , 118 mg ( 73 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.68 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.81 ( dm , j=8.4 hz , 2 h ) , 7.54 ( d , j=16.3 hz , 1 h ) , 7.50 ( dm , j=8.4 hz , 2 h ) , 7.03 ppm ( d , j=16.3 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 157.2 , 140.0 , 134.9 , 133.2 , 129.9 , 129.0 , 114.0 ppm ; esi - ms m / z : 240/242 [ m+h ] ; hrms m / z for c10h6clno2s as [ m+h ] adduct not found due to low ionization level .
1,4-dichloro-2-iodobenzene ( 273 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( double purification : 1 etoac ; 2 pentane / etoac 1:1 0:1 ) to afford 184 mg of a 1:1 mixture of ( e)-3-(2,5-dichlorophenyl)acrylamide and starting acrylamide as a white powder .
tlc : mizoroki heck product rf=0.69 , acrylamide rf=0.31 ( etoac ) ; esi - ms m / z : 216/217 [ m+h ] . according to method b ,
the obtained mizoroki heck reaction mixture ( 184 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.24 ml ) to give , after purification by precipitation from etoac / pentane , 31 mg ( 11 % isolated yield after two steps ) of the title compound as an off - white powder .
tlc : rf=0.79 ( pentane / etoac 10:1 ) ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.18 ( d , j=2.5 hz , 1 h ) , 7.63 ( d , j=16.2 hz , 1 h ) , 7.61 ( d , j=8.7 hz , 1 h ) , 7.53 ( dd , j=8.7 , 2.5 hz , 1 h ) , 7.25 ppm ( d , j=16.2 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.2 , 156.6 , 134.4 , 133.5 , 132.7 , 132.1 , 131.6 , 131.4 , 127.5 , 117.6 ppm ; esi - ms m / z : 274/276 [ m+h ] ; hrms m / z for c10h5cl2no2s as [ m+h ] adduct not found due to low ionization level .
1-iodo-3-methylbenzene ( 218 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude to ( e)-3-(m - tolyl)acrylamide , esi - ms m / z : 162 [ m+h ] .
according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.34 ml ) to give , after silica column chromatography ( ch2cl2/isohexane 1:9 ) and recrystallization in ch3cn , 76 mg ( 35 % isolated yield after step two ) as a white solid .
esi - ms m / z : 220 [ m+h ] ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =7.47 ( d , j=16.2 hz , 1 h ) , 7.347.20 ( m , 4 h ) , 6.63 ( d , j=16.2 hz , 1 h ) , 2.39 ppm ( m , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.4 , 157.7 , 142.1 , 138.8 , 134.0 , 131.4 , 129.0 , 128.5 , 125.0 , 112.6 , 21.3 ppm ; hrms m / z calcd for c11h9no2s [ m+h ] 220.0432 , found 220.0437 .
( e)-5-(3-ethylstyryl)-1,3,4-oxathiazol-2-one ( 42 ) . according to method e , 1-bromo-3-ethylbenzene ( 370 mg , 2.0 mmol ) was used as starting bromide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , filtered through a plug of cotton , and concentrated under reduced pressure .
the residue was dissolved in etoac ( 25 ml ) and washed with h2o ( 25 ml ) , and the organic phase was dried over mgso4 and evaporated to yield the crude ( e)-3-(3-ethylphenyl)acrylamide as a pale yellow solid .
according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.67 ml ) to give , after silica column chromatography ( etoac / isohexane 2:100 5:100 ) and recrystallization in ch3cn , 77 mg ( 17 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 234 [ m+h ] ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , cdcl3 ) : =7.48 ( d , j=16.2 hz , 1 h ) , 7.367.23 ( m , 4 h ) , 6.63 ( d , j=16.2 hz , 1 h ) , 2.68 ( q , j=7.6 hz , 2 h ) , 1.27 ppm ( t , j=7.6 hz , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.4 , 157.8 , 145.1 , 142.2 , 134.1 , 130.3 , 129.1 , 127.4 , 125.3 , 112.6 , 28.7 , 15.5 ppm ; hrms m / z calcd for c12h11no2s [ m+h ] 234.0589 , found 234.0591 .
1-iodo-3-(trifluoromethoxy)benzene ( 288 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / isohexane 50:50 75:25 ) to ( e)-3-(3-(trifluoromethoxy)phenyl)acrylamide as a pale yellow solid .
tlc : rf=0.47 ( etoac : iso - hexane , 75:25 ) ; esi - ms m / z : 232 [ m+h ] .
according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.22 ml ) to give , after silica column chromatography ( etylacetate / isohexane 1:100 ) , 176 mg ( 61 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 299 [ m+h ] ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.81 ( m , 1 h ) , 7.78 , ( dm , j=8.0 hz , 1 h ) , 7.55 ( d , j=16.4 hz , 1 h ) , 7.54 ( m , 1 h ) , 7.38 ( m , 1 h ) , 7.01 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.8 , 157.5 , 149.3 , 140.0 , 137.1 , 131.3 , 127.7 , 122.9 , 121.0 , 120.5 ( q , j=257 hz ) , 115.6 ppm ; hrms m / z calcd for c11h6f3no3s [ m+h ] 299.0099 , found 299.0103 .
( e)-ethyl 3-(2-(2-oxo-1,3,4-oxathiazol-5-yl)vinyl)benzoate ( 44 ) . according to method d , ethyl-3-iodobenzoate ( 276 mg , 1.0 mmol )
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / isohexane 50:50 75:25 ) to afford 206 mg of ( e)-3-(3- ethoxycarbonyl)acrylamide as pale yellow solid .
tlc : rf=0.58 , ( etoac ) ; esi - ms m / z : 220 [ m+h ] .
according to method a , the crude 3-substituted acrylamide ( 206 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.17 ml ) to give , after recrystallization in ethylacetate / isohexane , 118 mg ( 43 % isolated yield after two steps ) as a white solid , 43 % yield .
esi - ms m / z : 278 [ m+h ] ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.24 ( m , 1 h ) , 8.05 , ( dm , j=7.7 hz , 1 h ) , 7.97 ( dm , j=7.8 hz , 1 h ) , 7.60 ( d , j=16.4 hz , 1 h ) , 7.58 ( dd , j=7.7 , 7.8 hz , 1 h ) , 7.05 ( d , j=16.4 hz , 1 h ) , 4.32 ppm ( q , j=7.2 hz , 2 h ) , 1.32 ( t ,
j=7.2 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.9 , 165.8 , 157.6 , 140.7 , 135.2 , 132.6 , 131.2 , 131.1 , 129.9 , 129.4 , 114.9 , 61.5 , 14.6 ppm ; hrms m / z calcd for c13h11no4s [ m+h ] 278.0487 , found 278.0486 .
1-iodo-2-methylbenzene ( 218 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / isohexane 50:50 75:25 ) to ( e)-3-(o - tolyl)acrylamide as a pale yellow solid , 149 mg .
tlc : rf=0.48 ( etoac ) ; esi - ms m / z : 162 [ m+h ] .
according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.26 ml ) to give , after silica column chromatography ( etoac / isohexane 1:100 ) , 70 mg ( 32 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 220 [ m+h ] ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , cdcl3 ) : =7.69 ( d , j=16.2 hz , 1 h ) , 7.48 ( dm , j=7.8 hz , 1 h ) , 7.257.13 ( m , 3 h ) , 6.49 ( d , j=16.2 hz , 1 h ) , 2.37 ppm ( m , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.5 , 157.8 , 139.5 , 137.6 , 133.0 , 131.0 , 130.3 , 126.5 , 125.9 , 113.8 , 19.8 ppm ; hrms m / z calcd for c11h9no2s [ m+h ] 220.0432 , found 220.0436 .
1-bromo-2-ethylbenzene ( 218 mg , 1.0 mmol ) was used as starting bromide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and filtered through a plug of cotton .
the reaction mixture was then extracted between etoac ( 25 ml ) and h2o ( 25 ml ) , and the organic phase was dried over mgso4 and evaporated to yield the crude ( e)-3-(2-ethylphenyl)acrylamide as a pale yellow solid , 117 mg .
according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.23 ml ) to give , after silica column chromatography ( etoac / isohexane 2:100 ) , 90 mg ( 19 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 234 [ m+h ] ; lc purity ( 254 nm ) : 98 % ; h nmr ( 400 mhz , cdcl3 ) : =7.80 ( d , j=16.2 hz , 1 h ) , 7.57 ( m , 1 h ) , 7.35 ( m , 1 h ) , 7.287.22 ( m , 2 h ) , 6.58 ( d , j=16.2 hz , 1 h ) , 2.79 ( q , j=7.5 hz , 2 h ) , 1.24 ppm ( t , j=7.5 hz , 3 h ) ; c nmr ( 100 mhz , cdcl3 ) : =173.5 , 157.8 , 143.8 , 139.3 , 132.3 , 130.6 , 129.4 , 126.5 , 126.1 , 113.9 , 26.4 , 15.9 ppm ; hrms m / z calcd for c12h11no2s [ m+h ] 234.0589 , found 234.0584 .
1-iodo-2-(trifluoromethoxy)benzene ( 288 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( etoac / isohexane 50:50 75:25 ) to ( e)-3-(2-(trifluoromethoxy)phenyl)acrylamide as a pale yellow solid , 229 mg .
tlc : rf=0.49 ( etoac / iso - hexane 75:25 ) ; esi - ms m / z : 232 [ m+h ] . according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.20 ml ) to give , after precipitation from etoac / isohexane , 110 mg ( 38 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 299 [ m+h ] ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.04 ( d , j=7.8 hz , 1 h ) , 7.54 ( m , 1 h ) , 7.47 ( d , j=16.4 hz , 1 h ) , 7.457.38 ( m , 2 h ) , 7.08 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.7 , 157.1 , 146.7 , 132.9 , 132.6 , 128.7 , 128.6 , 127.5 , 122.1 , 120.6 ( q , j=258 hz ) , 110.0 ppm ; hrms m / z calcd for c11h6f3no3s [ m+h ] 299.0099 , found 299.0096 .
ethyl 2-bromobenzoate ( 506 mg , 2.2 mmol ) was used as starting bromide in the mizoroki heck reaction .
after microwave irradiation , the product was filtered and washed with etoac ( 20 ml ) give ( e)-ethyl 2-(3-amino-3-oxoprop-1-en-1-yl)benzoate as a pale white solid , 391 mg . according to method a , the crude 3-substituted acrylamide was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.60 ml ) to give , after filtration and washing with etoac ( 10 ml ) , 198 mg ( 32 % isolated yield after two steps ) as a white solid .
esi - ms m / z : 278 [ m+h ] ; lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.18 ( d , j=16.2 hz , 1 h ) , 7.95 ( dm , j=8.0 hz , 1 h ) , 7.90 ( dd , j=7.8 , 1.6 hz , 1 h ) , 7.65 ( ddd , j=8.0 , 7.6 , 1.6 hz , 1 h ) , 7.54 ( ddm , j=7.8 , 7.6 hz , 1 h ) , 6.92 ( d , j=16.2 hz , 1 h ) , 4.33 ( q , j=7.2 hz , 2 h ) , 1.33 ppm ( t , j=7.2 hz , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.8 , 166.7 , 157.6 , 139.7 , 125.1 , 133.0 , 130.9 , 130.5 , 130.3 , 128.1 , 116.0 , 61.7 , 14.5 ppm ; hrms m / z calcd for c13h11no4s [ m+h ] 278.0487 , found 278.0485 .
4-iodopyridine ( 205 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through silica gel ( ch3cn ) .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( pentane / etoac 1:1 0:1 , then etoac / meoh 9:1 ) to afford 120 mg of a 1:1 mixture of ( e)-3-(pyridin-4-yl)acrylamide and starting acrylamide as a pale yellow solid .
tlc : mizoroki heck product rf=0.25 , acrylamide rf=0.72 ( etoac / meoh 9:1 ) ; esi - ms m / z : 149 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 120 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.34 ml ) to give , after purification by preparative hplc , 15 mg ( 7 % isolated yield after two steps ) of the title compound as an off - white powder .
tlc : rf=0.32 ( pentane / etoac=1:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.668.63 ( m , 2 h ) , 7.757.72 ( m , 2 h ) , 7.53 ( d , j=16.3 hz , 1 h ) , 7.27 ppm ( d , j=16.3 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.2 , 156.8 , 150.4 , 141.3 , 138.7 , 121.9 , 117.6 ppm ; esi - ms m / z : 207 [ m+h ] ; hrms m / z calcd for c9h6n2o2s [ m+h ] 207.0228 , found 207.0255 .
3-iodo-2-methoxy - pyridine ( 235 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after microwave irradiation , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through silica gel ( ch3cn ) .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by silica column chromatography ( pentane / etoac 1:1 0:1 , then etoac / meoh 9:1 ) to afford 184 mg of a 1:1 mixture of ( e)-3-(2-methoxypyridin-3-yl)acrylamide and starting acrylamide as a pale yellow oil .
tlc : mizoroki heck product rf=0.68 , acrylamide rf=0.60 ( etoac / meoh 9:1 ) ; esi - ms m / z : 179 [ m+h ] .
according to method a , the obtained mizoroki heck reaction mixture ( 184 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.34 ml ) to give , after purification by trituration with et2o followed by precipitation from ch3cn / h2o , 91 mg ( 39 % isolated yield after two steps ) of the title compound as a pale yellow solid .
tlc : rf=0.80 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.23 ( dd , j=4.9 , 1.8 hz , 1 h ) , 8.17 ( dd , j=7.4 , 1.8 hz , 1 h ) , 7.56 ( d , j=16.5 hz , 1 h ) , 7.09 ( dd , j=7.4 , 4.9 hz , 1 h ) , 7.06 ( d , j=16.5 hz , 1 h ) , 3.98 ppm ( s , 3 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.6 , 161.1 , 157.4 , 148.7 , 138.2 , 135.1 , 117.8 , 117.1 , 115.4 , 53.9 ppm ; esi - ms m / z : 237 [ m+h ] ; hrms m / z calcd for c10h8n2o3s [ m+h ] 237.0334 , found 237.0338 .
2-iodothiophene ( 210 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=120 c ) , the reaction mixture was irradiated for additional 30 min at the same temperature to afford full conversion .
the resulting reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through silica gel ( ch3cnetoacetoac / meoh 10:1 ) .
evaporation of the solvent gave the crude corresponding acrylate , which was purified by precipitation from ch3oh / h2o to afford 70 mg ( 46 % isolated yield ) of ( e)-3-(thiophen-2-yl)acrylamide as an off - white solid .
tlc : rf=0.52 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , cdcl3 ) : =7.71 ( d , j=15.3 hz , 1 h ) , 7.28 ( bd , j=5.1 hz , 1 h ) , 7.17 ( bd , j=3.5 hz , 1 h ) , 6.98 ( dd , j=5.1 , 3.5 hz , 1 h ) , 6.19 ( d , j=15.3 hz , 1 h ) , 5.36 ppm ( bs , 2 h ) ; esi - ms m / z : 154 [ m+h ] . according to method b , ( e)-3-(thiophen-2-yl)acrylamide ( 70 mg , 0,46 mmol ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.40 ml ) to give , after purification by silica column ( pentane / etoac 100:0 1:1 ) followed by preparative hplc purification , 46 mg ( 45 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.63 ( pentane / etoac 20:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =7.76 ( bd , j=5.1 hz , 1 h ) , 7.72 ( d , j=16.1 hz , 1 h ) , 7.59 ( bd , j=3.7 hz , 1 h ) , 7.17 ( dd , j=5.1 , 3.7 hz , 1 h ) , 6.61 ppm ( d , j=16.1 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 157.0 , 138.9 , 134.3 , 131.8 , 130.2 , 128.7 , 111.3 ppm ; esi - ms m / z : 212 [ m+h ] ; hrms m / z calcd for c8h5no2s2 [ m+h ] 211.9840 , found 211.9837 .
3-iodothiophene ( 210 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=120 c ) , the reaction mixture was irradiated for additional 30 min at the same temperature to afford full conversion .
the resulting reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through silica gel ( ch3cnetoacetoac / meoh 10:1 ) .
evaporation of the solvent gave the crude corresponding acrylate , that was purified by precipitation from etoac / pentane followed by silica column purification ( pentane / etoac 1:1 0:1 ) to afford 115 mg ( 75 % isolated yield ) of ( e)-3-(thiophen-3-yl)acrylamide as a white solid .
tlc : rf=0.46 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , cdcl3 ) : =7.64 ( d , j=15.4 hz , 1 h ) , 7.47 ( bd , j=2.9 hz , 1 h ) , 7.33 ( dd , j=5.1 , 2.9 hz , 1 h ) , 7.28 ( bd , j=5.1 hz , 1 h ) , 6.30 ppm ( d , j=15.4 hz , 1 h ) , 5.53 ( bs , 2 h ) ; esi - ms m / z : 154 [ m+h ] .
according to method b , ( e)-3-(thiophen-3-yl)acrylamide ( 115 mg , 0,75 mmol ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.40 ml ) to give , after purification by silica column ( pentane / etoac 100:0 1:1 ) followed by preparative hplc purification , 84 mg ( 53 % isolated yield ) of the title compound as a white powder .
tlc : rf=0.55 ( pentane / etoac=20:1 ) ; lc purity ( 254 nm ) : 95 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.028.00 ( m , 1 h ) , 7.667.61 ( m , 2 h ) , 7.55 ( d , j=16.2 hz , 1 h ) , 6.82 ppm ( d , j=16.2 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.5 , 157.6 , 137.5 , 135.4 , 129.6 , 127.9 , 125.7 , 112.6 ppm ; esi - ms : m / z 212 [ m+h ] ; hrms m / z calcd for c8h5no2s2 [ m+h ] 211.9840 , found 211.9841 .
5-iodo-2-furaldehyde ( 222 mg , 1.0 mmol ) was used as starting iodide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=120 c ) , the reaction mixture was irradiated for additional 30 min at the same temperature to afford full conversion .
the resulting reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through silica gel ( ch3cnetoacetoac / meoh 10:1 ) .
evaporation of the solvent gave a crude mixture that was taken in ch3oh / h2o and then filtered to remove the precipitated homocoupling byproduct .
evaporation of the solvent gave 262 mg of a crude mixture , which was purified by flash silica column ( pentane / etoac 1:1 0:1 ) to give 88 mg of a mixture containing the desired ( e)-3-(5-formylfuran-2-yl)acrylamide as a yellow solid .
tlc : mizoroki heck compound rf=0.44 ( etoac ) ; lc purity ( 254 nm ) : 30 % ; esi - ms m / z : 166 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 88 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.40 ml ) to give , after purification by silica column ( pentane / etoac 100:0 1:1 ) followed by preparative hplc purification , 10 mg ( 5 % isolated yield after two steps ) of the title compound as a white powder .
tlc : rf=0.70 ( pentane / etoac=20 : 1 ) ; lc purity ( 254 nm ) : 90 % ; h nmr ( 400 mhz , [ d6]dmso ) : =9.66 ( s , 1 h ) , 7.63 ( d , j=3.7 hz , 1 h ) , 7.47 ( d , j=16.2 hz , 1 h ) , 7.24 ( d , j=3.7 hz , 1 h ) , 6.83 ppm ( d , j=16.2 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =178.7 , 173.1 , 156.4 , 154.5 , 152.8 , 127.1 , 124.3 , 116.8 , 115.0 ppm ; esi - ms m / z : 224 [ m+h ] ; hrms m / z calcd for c9h5no4s [ m+h ] 224.0018 , found 224.0015 .
( e)-5-(2-(pyridin-2-yl)vinyl)-1,3,4-oxathiazol-2-one ( 54 ) . according to method e , 2-bromopyridine ( 237 mg , 1.5 mmol ) was used as starting bromide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=140 c ) , the reaction mixture was irradiated for additional 60 min at 160 c to afford full conversion .
the resulting reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite ( etoac / meoh 1:1 ) .
evaporation of the solvent under reduced pressure gave a crude mixture containing dmf , which was taken in etoac ( 20 ml ) .
the organic phase was washed with h2o ( 240 ml ) , the h2o phases were extracted with etoac ( 2100 ml ) , and the collected organic phases were dried over na2so4 .
evaporation of solvent gave 126 mg of a mixture containing the desired ( e)-3-(pyridin-2-yl)acrylamide as a yellow oil .
tlc : mizoroki heck compound rf=0.07 ( etoac / meoh 10:1 ) ; lc purity ( 254 nm)=70 % ; esi - ms m / z : 149 [ m+h ] .
according to method a , the obtained mizoroki heck reaction mixture ( 126 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.50 ml ) to give , after purification by preparative hplc , 8 mg ( 3 % isolated yield after two steps ) of the title compound as a brown powder .
lc purity ( 254 nm ) : 92 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.698.65 ( m , 1 h ) , 7.89 ( td , j=7.8 , 2.0 hz , 1 h ) , 7.78 ( dm , j=8.0 hz , 1 h ) , 7.58 ( d , j=16.0 hz , 1 h ) , 7.43 ( ddd , j=7.8 , 4.7 , 1.2 hz , 1 h ) , 7.20 ppm ( d , j=16.0 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.3 , 156.9 , 152.0 , 150.1 , 140.3 , 137.4 , 125.0 , 124.8 , 116.0 ppm ; esi - ms m / z : 207 [ m+h ] ; hrms m / z calcd for c9h6n2o2s [ m+h ] 207.0228 , found 207.0234 .
( e)-5-(2-(pyridin-3-yl)vinyl)-1,3,4-oxathiazol-2-one ( 55 ) . according to method e , 3-bromopyridine ( 237 mg , 1.5 mmol ) was used as starting bromide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=140 c ) , the reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite ( etoac / meoh 1:1 ) .
evaporation of the solvent under reduced pressure gave a crude mixture containing dmf , which was taken in etoac ( 20 ml ) .
the organic phase was washed with h2o ( 240 ml ) , the h2o phases were extracted with etoac ( 2100 ml ) , and the collected organic phases were dried over na2so4 .
evaporation of solvent gave 102 mg of a mixture containing the desired ( e)-3-(pyridin-3-yl)acrylamide as a white solid .
tlc : mizoroki heck compound rf=0.26 ( etoac / meoh 10:1 ) ; lc purity ( 254 nm ) : 90 % ; esi - ms m / z : 149 [ m+h ] . according to method a , the obtained mizoroki heck reaction mixture ( 102 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.50 ml ) by microwave irradiation , followed by thermal heating at 70 c for 2 d to give , after purification by preparative hplc , 45 mg ( 15 % isolated yield after two steps ) of the title compound as a white powder .
lc purity ( 254 nm ) : 99 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.92 ( bd , j=2.1 hz , 1 h ) , 8.59 ( dd , j=4.9 , 1.8 hz , 1 h ) , 8.24 ( dm , j=8.0 hz , 1 h ) , 7.58 ( d , j=16.4 hz , 1 h ) , 7.47 ( bdd , j=7.5 , 4.3 hz , 1 h ) , 7.16 ppm ( d , j=16.4 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =173.4 , 157.0 , 150.9 , 149.8 , 138.1 , 134.4 , 130.1 , 123.9 , 115.1 ppm ; esi - ms m / z : 207 [ m+h ] ; hrms m / z calcd for c9h6n2o2s [ m+h ] 207.0228 , found 207.0229 .
( e)-5-(2-(2-oxo-2 h - thiadiazolo[2,3-a]pyridin-8-yl)vinyl)-1,3,4-oxathiazol-2-one ( 56 ) . according to method e , 2-amino-3-bromopyridine ( 260 mg , 1.5 mmol ) was used as starting bromide in the mizoroki heck reaction .
after 15 min of microwave irradiation ( t=140 c ) , the reaction mixture was irradiated for additional 15 min at 160 c to afford full conversion .
the resulting reaction mixture was cooled down to rt , and the formed pd black was removed by filtration through celite ( etoac / meoh 1:1 ) .
evaporation of the solvent under reduced pressure gave a crude mixture containing dmf , which was taken in etoac ( 20 ml ) .
the organic phase was washed with h2o ( 240 ml ) , the h2o phases were extracted with etoac ( 2100 ml ) , and the collected organic phases were dried over na2so4 .
evaporation of solvent gave 94 mg of a mixture containing the desired ( e)-3-(2-aminopyridin-3-yl)acrylamide as a yellow solid .
tlc : mizoroki heck compound rf=0.22 ( etoac / meoh 10:1 ) ; lc purity ( 254 nm)=90 % ; esi - ms m / z : 164 [ m+h ] .
according to method b , the obtained mizoroki heck reaction mixture ( 94 mg ) was reacted with an excess of chlorocarbonyl sulfenyl chloride ( 0.50 ml ) , to give , after purification by trituration in ch3cn / h2o , 16 mg ( 4 % isolated yield after two steps ) of the title compound as a pale yellow solid .
lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , [ d6]dmso ) : =8.02 ( dd , j=7.0 , 1.3 hz , 1 h ) , 7.95 ( dm , j=7.0 hz , 1 h ) , 7.72 ( d , j=16.0 hz , 1 h ) , 7.62 ( dd , j=16.2 , 0.6 hz , 1 h ) , 6.89 ppm ( t , j=7.0 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =174.3 , 173.3 , 157.1 , 148.0 , 137.1 , 134.8 , 126.1 , 125.0 , 117.4 , 111.6 ppm ; esi - ms m / z : 280 [ m+h ] ; hrms m / z calcd for c10h5n3o3s2 [ m+h ] 279.9851 , found 279.9843 .
ghsqc and ghmqc experiments showed no correlations between proton he and carbon c , suggesting the following structure ( figure 3 ) as the most probable one .
( 2e)-3-(1h - indol-3-yl)acrylic acid ( 378 mg , 2.0 mmol ) and 1,1-carbonyldiimidazole ( 656 mg , 2.0 mmol ) were dissolved in anhydrous dmf ( 10 ml ) , and the mixture was stirred at rt .
after 30 min , nh4hco3 ( 639 mg , 4.0 mmol ) was added , and the resulting suspension was stirred at rt o / n .
etoac ( 100 ml ) was added , and the organic phase was washed with h2o ( 250 ml ) and brine ( 50 ml ) .
evaporation of solvent gave 397 mg of the crude corresponding amide , purified by silica column chromatography ( pentane / etoac 1:1 0:1 ) to afford 116 mg ( 31 % isolated yield ) of ( e)-3-(1h - indol-3-yl)acrylamide as a yellow sticky oil .
tlc : rf=0.24 ( etoac ) ; lc purity ( 254 nm ) : 95 % ; esi - ms m / z : 187 [ m+h ] .
according to method b , ( e)-3-(1h - indol-3-yl)acrylamide ( 58 mg , 0.31 mmol ) was reacted with chlorocarbonyl sulfenyl chloride to give , after preparative hplc purification , 9 mg ( 12 % isolated yield ) of the title compound as a pale yellow powder .
lc purity ( 254 nm ) : 97 % ; h nmr ( 400 mhz , [ d6]dmso ) : =11.84 ( bs , 1 h ) , 8.00 ( s , 1 h ) , 7.94 ( dm , j=7.2 hz , 1 h ) , 7.75 ( d , j=16.2 hz , 1 h ) , 7.48 ( dm , j=8.1 hz , 1 h ) , 7.267.15 ( m , 2 h ) , 6.66 ppm ( d , j=16.2 hz , 1 h ) ; c nmr ( 100 mhz , [ d6]dmso ) : =174.7 , 159.3 , 138.1 , 136.7 , 132.4 , 125.4 , 123.4 , 121.8 , 120.5 , 113.1 , 112.5 , 107.0 ppm ; esi - ms m / z : 245 [ m+h ] ; hrms m / z calcd for c12h8n2o2s [ m+h ] 245.0385 , found 245.0384 .
the sequences for the open - gate alpha8a ( rv2109c residues 9240 ) and a slightly truncated beta ( rv2110c ) ( residues 1285 ) subunits of the m. tuberculosis proteasome were amplified by pcr from total dna of mtb strain h37rv28 using the polymerase pfu ultra ( agilent technologies , la jolla , usa ) .
the c - terminus of the beta subunit was modified to incorporate a 6-histidine tag after the terminal glycine residue.8a the genes were inserted into the vector prsf duet-1 , which is a vector for coexpressing two proteins , both controlled by t7 promoters , from novagen ( merckmillipore , darmstadt , germany ) , and cloned in e. coli top10 cells ( invitrogen , carlsbad , usa ) . expression and purification
were performed as previously described.8a briefly , 6 l cultures of e. coli bl21(de3 ) cells in luria bertani broth with 30 g / ml kanamycin were grown for 2022 h at 37 c after induction with 0.4 mm isopropyl beta - d1 thiogalactopyranoside .
the cells were harvested by centrifugation , resuspended in lysis buffer ( 50 mm na3po4 , ph 8 , 300 mm nacl , 10 mm imidazole with 0.25 mg ml lysozyme , 0.02 mg ml rnase , and 0.01 mg ml dnase ) , incubated 30 min at rt and lysed by passage through a constant cell disruption system ( constant systems ltd , daventry , uk ) at 2 kbar .
full proteasome molecules were isolated from the cleared lysate with 1 ml ni - sepharose ( ge - healthcare , uppsala , sweden ) , and eluted with 250 mm imidazole .
the buffer was exchanged on an econo - pac 10dg desalting column ( bio - rad , hercules , usa ) to 10 mm tris ph 7.5 , 100 mm nacl before a final purification step by size - exclusion chromatography on a hiload 16/60 superdex 200 column ( ge healthcare , little chalfront , uk ) equilibrated with the same buffer .
the fractions containing the proteasome as analyzed by sds - page were pooled and concentrated to 1 mg ml ( measured by a280 , extinction coefficient 33 810 m cm ) in a vivaspin 20 , molecular weight cut - off 100 kda ( sartorius stedin biotech , goettingen , germany ) .
the protein production and assay were based on that of lin et al.8b both mtb and human proteasomes were assayed in 20 mm hepes , 0.5 mm edta ph 7.5 , with 25 m suc - llvy - amc ( bachem ag , switzerland ) as substrate , in a final volume of 100 l on a white 96-well assay plate ( cliniplate , thermo fisher scientific oy , finland ) . the increase in fluorescence caused by cleavage of amc ( 7-amino-4-methylcoumarin ) was measured using a fluoroskan ascent fluorescent plate reader ( thermo fisher scientific oy , finland ) equipped with a 390 nm filter for excitation and 460 nm filter for emission .
human 20s proteasome ( boston biochemicals , usa ) was assayed at 1 nm concentration in the presence of a tenfold excess of human pa28 activator ( boston biochemicals ) , as recommended by the manufacturer .
threefold dilutions of inhibitor ( 10 mm stock solution in dmso ) from an initial concentration of 100 m were performed on the assay plate in buffer containing the above concentrations of enzyme ; the final volume in the well after dilution was 96 l .
the plate was sealed and preincubated at rt for 3 h for mtb proteasome or 1 h for human proteasome .
next , substrate ( 5 l of 500 m in a buffer made from a 10 mm stock solution in dmso ) was added , and the fluorescence read in the plate reader immediately ( t=0 ) , then after 3 h for the mtb proteasome and after 1 h for the human proteasome .
the t=0 value was subtracted from the final value , and plotted against the logarithm of the inhibitor concentration ; the data were fitted to the standard ic50 equation using graphpad prism 5 ( graphpad software inc .
the mic were determined as previously described29 in middlebrook 7h9 medium containing 10 % v / v oadc ( oleic acid , bovine serum albumin , d - glucose , catalase ; becton dickinson , usa ) and 0.05 % w / v tween 80 .
briefly , compounds were tested in 10-point , two - fold serial dilutions with the highest concentration of 20 m against mtb h37rv expressing a fluorescent protein ( dsred ) .
growth was measured using od590 and rfu after 5 d. curves were fitted using the gompertz function , with mic defined as the minimum concentration required to inhibit growth .
data are reported for optical density at 590 nm ( od590 ) and relative fluorescence units ( rfu ) .
mtb was grown aerobically in middlebrook 7h9 medium containing 10 % v / v oadc and 0.05 % w / v tween 80 , washed , and resuspended in pbs with 0.05 % w / v tyloxapol for 14 d. compounds were added , and viability was determined by plating serial dilutions to determine colony forming units ( cfu ) on middlebrook 7h10 agar plus 10 % v / v oadc .
cytotoxicity was monitored against vero african green monkey kidney epithelial cells ( atcc ccl-81 ) grown in dmem , high glucose , glutamax ( invitrogen ) , supplemented with 10 % fbs , and penicillin streptomycin solution ( gibco ) .
cell viability was measured after 48 h using cell titer glo ( promega ) , and growth inhibition curves were fitted using the levenberg marquardt algorithm .
the tc50 was defined as the compound concentration that gave 50 % inhibition of growth .
hplc analyses were performed using a shimadzu 10 a system with a scl-10avp controller , 2 lc-10ad pumps with a 0.5 ml gradient mixer at the high pressure side , a sil-10 a ( rebuilt to also run 96-well plates ) , a cma 260 degasser , and a waters pda 996 photodiode array detector . a zorbax eclipse xdb - c8 , 5 m ,
2.150 mm column was utilized from dalco chromtech ab ( sollentuna , sweden ) with ch3cn / h2o in 0.05 % tfa as mobile phase and 1 ml min .
the chromatograms were registered at the wavelengths 230 , 254 , and 280 nm . all solutions containing the sample compound were prepared from 10 mm dmso stock solutions stored in glass vials at ambient temperature .
high standards ( hs ) were made by diluting the dmso stock solution 200 times with ch3cn+pbs ph 7.4 ( 1 + 1 ) , obtaining a 50 m solution .
low standards ( ls ) were prepared by diluting hs 20 times with ch3cn+pbs ph 7.4 ( 1 + 1 ) , obtaining a 2.5 m solution .
the hs solution was chromatographed a second time after 24 h to determine the chemical stability .
it was very important to exchange the septa after the first injection to avoid evaporation of the ch3cn .
the solubility solutions were prepared by diluting the dmso stock solution 100 times with pbs ph 7.4 , obtaining a nominal concentration of 100 m .
the solutions were left for 18 h at ambient temperature before filtration . when filtering the sample solution , the first 0.1 ml was discarded , and the rest was collected .
the solubility was determined using a two - point calibration curve forced through the origin . to evaluate the quality of the standard curve
the optimal quotient should equal the value of the concentration ratio , that is , 20.0 . when evaluating the solubility ,
the wavelength used was that which gives the area quotient closest to 20 . the stability ( given in percent remaining )
was obtained by multiplying the area after the 24 h run by 100 and dividing it by the area of the first hs injection .
mw , microwaves ; mtb , mycobacterium tuberculosis ; mdr , multidrug resistant ; xdr , extensively drug resistant ; tdr , totally drug resistant ; mic , minimum inhibitory concentration ; cfu , colony forming units notes . | this is the first report of 5-styryl - oxathiazol-2-ones as inhibitors of the mycobacterium tuberculosis ( mtb ) proteasome . as part of the study , the structure activity relationship of oxathiazolones as mtb proteasome inhibitors has been investigated .
furthermore , the prepared compounds displayed a good selectivity profile for mtb compared to the human proteasome .
the 5-styryl - oxathiazol-2-one inhibitors identified showed little activity against replicating mtb , but were rapidly bactericidal against nonreplicating bacteria .
( e)-5-(4-chlorostyryl)-1,3,4-oxathiazol-2-one ) was most effective , reducing the colony - forming units ( cfu)/ml below the detection limit in only seven days at all concentrations tested .
the results suggest that this new class of mtb proteasome inhibitors has the potential to be further developed into novel antitubercular agents for synergistic combination therapies with existing drugs . |
urolithiasis is a major health problem with a worldwide prevalence of between 2% and 20% .
it is estimated that almost 50% of stone formers will experience recurrence within 10 years .
more specifically , high fructose consumption , which promotes obesity ; reduced fluid intake ; and increased calcium , oxalate , sodium , and animal protein intake have all been identified as risk factors for kidney stones .
the risk of urolithiasis is greater in individuals with a family history of stone disease .
the risk in those individuals is estimated to be more than 2.5 times that in persons without a family history of stone disease .
different theories as to the pathophysiological mechanisms of lithogenesis have been proposed , including free and fixed particle theories and randal 's plaque hypothesis .
the main types of renal stones are calcium oxalate ( 59% ) , calcium phosphate ( 10% ) , uric acid ( 17% ) , struvite ( 12% ) , and cystine ( 2% ) .
the overall incidence of calcium - containing stones , that is , those containing calcium oxalate and calcium phosphate , is 70% to 80% .
more specifically , urine contains inorganic and organic molecules that may inhibit or promote lithogenesis .
hypocitraturia is a common physiologic disturbance in urolithiasis that affects from 19% to 63% of patients with stones . in stone patients with idiopathic hypocitraturia ,
the hypocitraturia occurs as either a sole disturbance or in association with other physiologic disturbances , which is termed complicated hypocitraturia .
we report the results of a 3.160.08-year clinical trial with potassium magnesium citrate and vitamin b-6 prophylaxis ( urikind - km6 , gena pharmaceutical ltd . , kolkata , india ) in patients with hypocitraturia- and hyperuricosuria - induced recurrent calcium oxalate and calcium phosphate urolithiasis .
between january 2005 and december 2010 , a total of 247 patients ( 193 men [ 78.2% ] and 54 women [ 21.8% ] aged 26 - 68 years with a mean age of 37 years ) , who were either first - time , recurrent , or multiple stone formers constituted the subjects of this study .
our study was a prospective , randomized case - control study that was approved by an institutional ethics committee .
we used urikind - km6 solution ( potassium magnesium citrate and vitamin b-6 ) , which is manufactured by gena pharmaceuticals limited .
urinary estimation of promoters and inhibitors ( calcium , magnesium , sodium , potassium , uric acid , citrate , oxalate , and phosphorus ) of stone formation was done before and 24 hours after treatment .
serum analysis was done for calcium , phosphorus , uric acid , albumin - globulin ratio , sodium , potassium , and bicarbonate .
the first 24-hour urinary collection for analysis of urinary calcium and oxalate was done in a container with 10 ml of 6 mmol of hydrochloric acid to prevent precipitation of calcium and oxalate salts and also to prevent oxidation of ascorbic acid to oxalate . the collection on the second day for urinary ph , uric acid , citrate , magnesium , and creatinine was done in a container with 10 ml of 0.3 mmol of sodium azide to prevent bacterial growth .
urinary volume was calculated , and the urinary volume collected on the 2 consecutive days was averaged .
there were no dietary restrictions and 24-hour urine samples were collected while the patients consumed their regular diets at home .
all stones or fragments that were retrieved after use of the available institutional modalities of treatment ( e.g. , extracorporeal shock wave lithotripsy , percutaneous cutaneous nephro lithotomy , ureterorenoscopy , incision surgery , or spontaneous passage of calculi ) were analyzed chemically and crystallographically by using a polarizing microscope .
61 patients ( 24.7% ) who had moderate to severe hypocitraturia or hyperuricosuria or both and who were known multiple or recurrent stone formers discontinued prophylaxis because of drug intolerance within 1 month of therapy .
these patients were given placebo and were followed at 6-month intervals and formed the untreated control group 1 .
control group 2 constituted 53 patients ( 21.5% ) who were first - time stone formers with mild hypocitraturia with or without hyperuricosuria who were not put on prophylactic therapy and were followed with conservative treatment with placebo at 6-month intervals for the same period of 3.160.08 years .
group 3 constituted 133 patients ( 54.8% ) who were known multiple or recurrent stone formers who were treated ( urikind - km6 ) with 1,100-mg potassium citrate , 375-mg magnesium citrate , and 20-mg pyridoxine hydrochloride/5 ml every 8 hours and were followed at 6-month intervals for 3.160.08 years .
patients with addison 's disease , uncontrolled diabetes , or severe heart disease were excluded from the study .
patients on antispasmodics , angiotensin - converting enzyme inhibitors like lisinopril , angiotensin blockers like losartan , corticosteroids , and nasal decongestants ( e.g. , amphetamine , pseudoephedrine ) were also excluded from the study .
new stone formation represented spontaneous passage of stones in the absence of preexisting stones , stone passage occurring without a change in the number of stones , appearance of new stones on roentgenograms , or surgical removal or other therapies for newly formed stones .
metabolic evaluation was postponed in surgically active stone formers with renal colic , obstruction , or infection for at least 4 weeks after surgical therapy . among the 247 patients , 201 patients ( 81.4% ) were in the idiopathic hypocitraturia group , and 46 patients ( 18.6% ) were in the hypocitraturia and hyperuricosuria group .
all patients were encouraged to increase their fluid intake ( > 3 l / d ) to ensure an equal amount of output .
only patients with calcium oxalate , calcium phosphate , or mixed calcium oxalate and phosphate stones were included in this study .
a total of 133 patients ( 54.8% ) received liquid potassium magnesium citrate and vitamin b-6 prophylaxis ( urikind - km6 ) in a dosage of 1,100-mg potassium citrate , 375-mg magnesium citrate , and 20-mg pyridoxine hydrochloride/5 ml dose every 8 hours .
twenty - four - hour urinary estimation of promoters and inhibitors ( calcium , magnesium , sodium , potassium , uric acid , citrate , oxalate , and phosphorus ) , urinary ph , and volume was also performed .
serum analysis was done for calcium , phosphorus , uric acid , albumin - globulin ratio , sodium , potassium , and bicarbonate during each visit at 6 months , 12 months , 18 months , 24 months , 36 months , and 38 months and the values were compared with baseline data .
the results are represented as least square meanstandard error . to test the mean difference between the three groups and to test the covariation between the three groups , analysis of variance test and analysis of covariance with post hoc tests
( ibm co. , armonk , ny , usa ) . a p - value of less than 0.05 was considered statistically significant .
in all patients who received potassium magnesium citrate and vitamin b-6 prophylaxis therapy , there were significant and sustained rises in urinary ph and citrate and potassium levels ( table 2 ) .
there was a sustained rise of ph from 5.620.2 to 6.870.01 , which was at the high normal range and was a statistically significant change ( p<0.0001 ) ( fig .
the urine citrate level increased from 221.7913.39 to 604.045.00 mg , which was also a statistically significant change ( p<0.0001 ) ( fig .
the urinary uric acid level decreased from 793.2722.65 to 748.917.05 mg for males and from 750.146.99 to 721.778.74 mg for females , both of which were statistically significant ( p<0.0001 ) ( fig .
urinary magnesium increased from 2.600.29 to 3.210.01 mg , which was statistically significant ( p<0.0001 ) ( fig .
1 ) . there was a significant difference in the incidence of stone formation from 3.231.04 per patient per year in control group 1 to 0.350.48 per patient per year in group 3 , which was statistically significant ( p<0.0001 ) ( table 3 ) .
comparative analysis between the groups was done , and group 3 and control group 1 varied significantly in 24-hour urinary values like ph , citrate , uric acid in males , and magnesium ; these results are shown in table 2 .
other urinary parameters were not altered and hence were not statistically significant . in the conservatively treated group ( control group 1 ) of 61 patients ( 24.7% )
, there was no significant rise in ph or the citrate level and the stone formation rate remained the same as before ( table 3 ) . in control group 2 , 53 patients ( 21.5% ) who were first - time stone formers and were not put on potassium magnesium citrate and vitamin b-6 prophylaxis therapy had a stone formation rate of 1.550.64 per patient per year with a mean follow - up of 3.160.08 years ( table 3 ) .
our findings suggest that hypocitraturia with or without hyperuricosuria was pathogenetically important in the formation of calcium nephrolithiasis in these patients .
systemic acidosis , distal renal tubular acidosis , hypocalciuria , and hypomagnesemia are common acid - base disturbances that can cause calcium oxalate urolithiasis .
furthermore , electrolyte disorders , drugs , changes in diet , and other disorders can be associated with low urine citrate .
pak showed that adequate citrate excretion inhibits calcium oxalate stone formation , because it retards the crystallization of stone - forming calcium salts .
lee and moon demonstrated that correction of complicated hypocitraturia ( coexistence with other metabolic abnormalities ) with potassium citrate had no clinical significance against prevention of recurrent nephrolithiasis .
kok et al . claimed that induced hypercitraturia with potassium magnesium citrate and vitamin b-6 prophylaxis enhances the inhibitor activity against calcium oxalate crystallization by providing an alkali load and reduces tubular reabsorption of citrate and increases citrate excretion .
there is clinical and biochemical evidence to prove the utility of potassium magnesium citrate and vitamin b-6 prophylaxis therapy in these patients .
the therapy restores normal urinary citrate excretion and increases urinary ph to the range optimal for the control of calcium stone formation .
tiselius claimed that urinary ph was kept below 7 to obviate hydroxyl apatite stone formation but greater than 6 to maximize inhibitor activity and the formation of anionic calcium complexes .
the close association between clinical and biochemical or physicochemical responses suggests that inhibition of stone formation was the result of potassium magnesium citrate therapy and vitamin b-6 prophylaxis therapy rather than conservative care ( stone clinic effect ) .
the rate of recurrence in first - time stone formers ( control group 2 ) was almost equivalent to that in the patients selected for potassium magnesium citrate and vitamin b-6 prophylaxis therapy ; hence , our policy of not prescribing to first - time stone formers is justified .
pak and peterson showed that potassium magnesium citrate and vitamin b-6 prophylaxis may be an alternative to allopurinol in the management of hypeuricosuric calcium oxalate nephrolithiasis .
ettinger et al . in their study showed that potassium magnesium citrate and vitamin b-6 prophylaxis is superior to potassium citrate in raising urinary ph and that undissociated uric acid decreases ; consequently , urinary saturation of calcium oxalate decreases , which was marginal with potassium citrate alone .
the major causes of discontinuation of therapy in the 61 patients ( 24.7% ) in our series were nonpalatability , nausea , and vomiting .
the minor side effects reported in the literature are diarrhea , nausea , and vomiting .
major side effects are due to overdose and include severe abdominal pain due to peptic ulceration ; confusion ; breathing difficulty ; irregular heartbeat ; nervousness ; numbness or tingling in the hands , feet , or lips ; weakness or heaviness of the legs due to hyperkalemia ; and serious allergic reaction such as rash or itching or swelling of the face , tongue , and throat . in our study ,
potassium magnesium citrate and vitamin b-6 ( urikind - km6 ) prophylaxis was relatively free of side effects except for occasional minor gastrointestinal complaints , which were addressed by adding sweet flavoring and by increasing the dilution of the compound in drinking water for each dose .
these problems can be minimized by use of slow - release tablet or capsule preparations .
the favorable results of potassium magnesium citrate and vitamin b-6 prophylaxis therapy as reflected in the treated patient series reinforce our conclusion that this additional prophylactic measure rather than the stone clinic effect alone was largely responsible for the clinical efficacy observed .
clinical efficacy after spontaneous passage or compelled procedural clearance of symptomatic stones was better in the treated patients than in the controls who underwent similar procedures for their stones but in whom potassium magnesium citrate and vitamin b-6 prophylaxis was either discontinued or deliberately avoided . | purposeto study the effects of long - term treatment with potassium magnesium citrate and vitamin b-6 prophylaxis ( urikind - km6 ; 1,100-mg potassium citrate , 375-mg magnesium citrate , and 20-mg pyridoxine hydrochloride/5 ml ) every 8 hours over 3 years.materials and methodsa total of 247 patients with recurrent idiopathic hypocitraturia with or without hyperuricosuria and randomized controls were studied prospectively for 3 years .
the total patients were divided into three groups .
control group 1 consisted of 61 patients ( 24.7% ) who had moderate to severe hypocitraturia with or without hyperuricosuria and were recurrent stone formers but discontinued prophylaxis because of drug intolerance within 1 month of therapy .
control group 2 constituted 53 patients ( 21.5% ) who were first - time stone formers and who had mild hypocitraturia with or without hyperuricosuria and were not put on prophylactic therapy and were followed for 3.160.08 years .
control group 3 constituted 133 patients ( 54.8% ) who were recurrent stone formers who had moderate to severe hypocitraturia with or without hyperuricosuria and were put on prophylaxis therapy and were followed for 3.160.08 years .
all patients were followed up at 6-month intervals.resultspotassium magnesium citrate prophylaxis produced a sustained increase in 24-hour urinary citrate excretion from initially low values ( 221.7913.39 mg / dl ) to within normal to high limits ( 604.045.00 mg / dl ) at the 6-month follow - up .
urinary ph rose significantly from 5.620.2 to 6.870.01 and was maintained at 6.870.01 .
the stone recurrence rate declined from 3.231.04 per patient per year to 0.350.47 per patient per year.conclusionspotassium magnesium citrate prophylaxis was effective in reducing the recurrence of calcium oxalate and phosphate urolithiasis . |
the choice of correct surgical treatment of adult low - grade isthmic spondylolisthesis remains a topic of debate .
many studies in the literature analyze clinical and radiological outcome of different fusion techniques by various approaches , including posterolateral fusion ( plf ) and lumbar interbody fusion , but considerable controversies regarding what is the gold standard
do more adult patients affected by low grade isthmic spondylolisthesis have significant clinical and radiological improvement following posterior lumbar interbody fusion ( plif ) than those who receive posterolateral fusion ( plf ) ?
inclusion criteria : all adult patients who had undergone posterior lumbar interbody fusion ( plif ) ( figs . 2 , 3 ) or posterolateral fusion ( plf ) ( fig .
4 ) for low grade isthmic spondylolisthesis ( meyerding grade 1 or 2 ) between february 2003 and april 2005 , and who had a minimum of 4 years of follow - up . exclusion criteria : previous spine surgery , age less than 40 years , etiology other than isthmic , high - grade spondylolisthesis , concomitant conditions which could compromise outcomes . patient population and interventions compared ( fig .
1 ) : one - hundred - and - fourteen consecutive patients met the inclusion criteria , and were divided into two groups , according to the surgical treatment they received : plif group ( posterior lumbar interbody fusion ) and plf group ( posterolateral fusion ) ( table 1 ) .
patients were evaluated preoperatively , postoperatively and at final follow - up . at the time of surgery
posterior pedicle screw instrumentation alone was used as support to fusion in the plf group .
outcome and analysis :
demographic , preoperative , perioperative and postoperative data were collected .
clinical outcome was assessed by means of the oswestry disability index ( odi ) , roland morris disability questionnaire ( rmdq ) and visual analogue scale ( vas ) , for back and leg pain respectively , filled in by patients preoperatively and at last follow - up .
radiographic evaluation included preoperative ct ( performed to assess the isthmic nature of the lesion ) and mri of the lumbar spine , as well as standing plain and functional films with flexion and extension views before and after surgery and during the follow - up , when requested .
fusion was defined as radiographic evidence of bone bridging , the absence of lucency around the implant , and no motion during functional films .
results are expressed as the mean ( range ) , with a p - value of < 0.5 considered as being statistically significant .
patient sampling and selection posterior lumbar interbody fusion for low grade isthmic spondylolisthesis , 3 and 15 months after surgery . note the segmental sagittal alignement ( kyphosis ) that could compromise long term clinical and radiographic outcome ( risk of negative effect on adjacent disc ) .
the two groups were similar with respect to demographic and surgical characteristics ( table 1 ) . at an average follow - up of 62.1 months ( range 5178 ) , 71 patients ( 62.3% ) , 28 ( 59.6% ) of the plif group and 43 ( 64.2% ) of the plf group ,
were completely reviewed . clinical outcome . both techniques ensured improvement of clinical outcome , without statistically significant differences between the two groups ( p > .05 ) .
unsatisfactory clinical results were achieved in four patients ( 14.3% ) in the plif group and in eight patients in the plf group ( 18.6% ) ( table 2 ) .
the x - rays performed at final follow - up showed a fusion rate of 97% in the plif group , 95% in the plf group , without statistically significant differences ( p > .05 ) . complications .
complications requiring revision surgery occurred in 5 of 71 patients reviewed ( 7% ) , one in the plif group ( 3.6% ) and four in the plf group ( 9.3% ) .
pseudarthrosis occurred in one case in the plif group , in two cases in the plf group ( table 3 ) .
p - value associated with change from baseline to follow - up in each treatment group p - value comparing change in baseline to follow - up between plif and plf groups revision due to pseudarthrosis two revisions due to pseudarthrosis
in our series , there does not appear to be a clear advantage of posterior lumbar interbody fusion over posterolateral fusion in terms of clinical and radiological outcome . a higher incidence of complications requiring surgical revision ( 9.3% versus 3.6% ) was found in the plf group .
pseudarthrosis occurred in one case in the plif group ( 3.6% ) and in two cases in the plf group ( 4.6% ) . despite nerve root manipulation required to insert the cages into the intervertebral space , in our series we found only one case of sciatica at last follow - up in the plif group .
the present series should be interpreted in the context of its limitations , including the retrospective nature of the review , the fact that patients were not randomized between posterior lumbar interbody fusion and posterolateral fusion , the low follow - up rate and the small sample size .
in case of adult low grade isthmic spondylolisthesis , posterior lumbar interbody fusion does n't seem to provide advantages in terms of mechanical stability and fusion rate ( pseudarthrosis incidence : 3.6% verses 4.6% ) . in our series , both treatments ensured good clinical results , without statistically significant differences between the two techniques .
comparing outcomes from patients treated with plif with those treated with plf is a commendable goal and important in the debate about the best treatment options for low - grade adult spondylolisthesis . in order to improve the quality of evidence available to settle the debate , future studies need to address a number of key factors .
patient selection : methodologically , selecting patients based on the completeness of follow - up at a specific time or studies where > 85% are lost to follow - up creates the possibility of selection bias . by selecting patients with a minimum of 4-years follow - up ,
it is possible that those with less complete follow - up may have different clinical or other characteristics ( and outcomes ! ) that could influence the evaluation of the study outcome and thus bias results .
for example , if those who are lost to follow - up are more likely to have a good outcome for a one of the treatments , the analysis would not potentially include as many patients with a good outcome for that treatment and the results may be biased to show that it is less effective than its comparator .
treatment allocation : how treatment was allocated was not well described in this paper , ie , what factors determined whether a patient received plif versus plf aside from what appears to be institutional preference ( see web appendix ) .
ideally , patients would be randomized to treatment groups using an appropriate method of concealed allocation .
it is common for studies to describe treatment allocation based on surgeon preference or patient presentation .
for example if patients with more severe disease are more likely to receive one treatment over the other and also have the potential for worse outcomes , the results may not be an accurate reflection of either treatment in patients with the same disease severity .
allocation based on the institution 's preference may also bias results as other factors may also differ across institutions .
factors such bmi and previous surgery may influence choice of procedure and therefore outcomes and need to be described .
retrospective versus prospective approaches : in this study ( and most retrospective studies ) , it is n't clear that a consistent perioperative protocol ( for clinical care or outcomes measurement ) was used in both study groups . with prospective study design , there is the potential to decrease study bias compared with retrospective designs .
protocols for patient selection and treatment allocation , perioperative care , collection of data and follow - up that are specified prospectively help assure less biased allocation of patients to treatment and similarity of care and measurement for both groups .
outcomes : definition and evaluation of fusion status is long - held area of controversy . in this study , it is unclear how fusion was determined and if its assessment was independent .
factors such as use of bmp or grafts which may influence fusion and functional outcomes need to be detailed and evaluated for their potential to influence the outcomes .
in addition factors such as reduction of deformity , disc height and restoration of lordosis should be evaluated .
final comments : this study 's use of validated outcomes measures and length of follow - up are two primary strengths .
the authors ' acknowledgement of the significant loss to followup and limitations imposed by retrospective , nonrandomized studies is commendable . | study design : retrospective cohort study.clinical question : do more adult patients affected by low grade isthmic spondylolisthesis have significant clinical and radiological improvement following posterior lumbar interbody fusion ( plif ) than those who receive posterolateral fusion ( plf)?methods : one hundred and fourteen patients affected by adult low grade isthmic spondylolisthesis , treated with posterior lumbar interbody fusion or posterolateral fusion , were reviewed .
clinical outcome was assessed by means of the questionnaires odi , rmdq and vas .
radiographic evaluation included ct , mri , and x - rays . the results were analyzed using the student t-test.results : the two groups were similar with respect to demographic and surgical characteristics . at an average follow - up of 62.1 months , 71 patients were completely reviewed .
mean odi , rmdq and vas scores did n't show statistically significant differences .
fusion rate was similar between the two groups ( 97% in plif group , 95% in plf group ) .
major complications occurred in 5 of 71 patients reviewed ( 7% ) : one in the plif group ( 3.6% ) , four in the plf group ( 9.3% ) .
pseudarthrosis occurred in one case in the plif group ( 3,6% ) and in two cases in plf group ( 4.6%).conclusions : in our series , there does not appear to be a clear advantage of posterior lumbar interbody fusion ( plif ) over posterolateral fusion ( plf ) in terms of clinical and radiological outcome for treatment of adult low grade isthmic spondylolisthesis . |
lymphomas are among the most common cancers and the most common hematologic malignancy in adolescents and young adults ( ayas , defined by the national cancer institute ( nci ) as individuals aged 1539 at diagnosis ) . in california ,
non - hodgkin 's lymphoma ( nhl ) represents approximately 7% of cancers diagnosed in ayas ( unpublished data ) .
mortality in aya nhl patients has been found to be higher than in younger children [ 3 , 4 ] , attributed in part to a lack of understanding of how best to treat nhl in ayas .
recent attention has been given to investigating socioeconomic disparities in survival among cancer patient populations with diverse ethno - racial or socioeconomic backgrounds or with differential access to healthcare [ 510 ] .
concurrently , nci as well as several other cancer advocacy agencies such as the lance armstrong foundation has begun to address the gaps in cancer research for ayas [ 1 , 11 ] .
this study sought to examine whether socioeconomic factors beyond race / ethnicity and treatment differences influence survival in ayas with nhl .
the following research questions were investigated : does neighborhood - level socioeconomic status ( nses ) at diagnosis predict all - cause and lymphoma - specific mortality in ayas diagnosed with nhl , after adjustment for race / ethnicity , gender , insurance status at diagnosis , marital status , stage at diagnosis , nodality , and first - course treatment ?
is there a linear trend between decreasing nses and shorter survival ? is the relationship between nses and mortality modified by race / ethnicity ?
a retrospective case - only analysis was performed of nhl cases diagnosed in california between 1996 and 2005 among individuals aged 15 to 39 years old using the california cancer registry ( ccr ) ( n = 3,762 ) .
the ccr , has been part of the nci 's surveillance , epidemiology and end results ( seer ) program since 1988 [ 1215 ] with annual patient follow - up .
data were abstracted from medical and laboratory records , with tumor site and histology coded using the world health organization ( who ) criteria in the international classification of diseases for oncology ( icd - o , 3rd edition ) .
patient cases were selected according to icd - o-3 coding standards and based on histologic types for nodal and extranodal nhl : seer primary site codes 33041 and 33042 .
histologic types included burkitt 's ( n = 228 ) , diffuse large b - cell ( n = 1,746 ) , follicular ( n = 480 ) , lymphoblastic , ( n = 201 ) , anaplastic large cell ( n = 148 ) , and other types ( n = 950 ) .
seventy - eight cases were identified only through death certificate , obituary , or the social security death index , and an additional two were lost to follow - up .
the remaining cases were identified through hospitals , inpatient / outpatient centers , oncology treatment centers , laboratories , or private practitioners . recorded
variables in the ccr include age at diagnosis , demographic information , histology , first - course therapy ( radiation , chemotherapy , and surgery status ) , neighborhood ses ( nses ) , vital status , treatment hospital type ( pediatric or otherwise ) , and insurance status . for this analysis , health insurance status at diagnosis
was categorized in one of the four following ways : ( 1 ) private insurance ( including managed care , military and veterans administration , or other private ) ; ( 2 ) government - funded insurance ( including medicare , medicaid , or other state assistance programs ) ; ( 3 ) no insurance ; or ( 4 ) unknown insurance status .
individuals with government - provided insurance were not grouped with those who had private insurance because preliminary kaplan - meier analyses indicated that individuals with government - provided insurance had shorter survival than individuals without health insurance at diagnosis , corroborating previously published reports [ 1820 ] .
the following four categories were used in the analysis : non - hispanic white ( nhw ) , non - hispanic black ( nhb ) , hispanic / latino ( hl ) , and asian / pacific islander ( api ) .
the nses variable used in the ccr is a single index created from a principle component analysis of census block group - level measures of education , income , occupation , and an adjustment for cost of living , previously described .
a subgroup analysis was performed on individuals aged 18 and over at diagnosis to examine the additional predictor of marital status at diagnosis , after all other variables were included in the model .
cause of death was recorded according to the icd criteria in effect at the time of death , using icd-9 codes for deaths prior to 2000 and icd-10 codes for deaths in 2000 and later .
hospital registrars contact cases annually and ccr staff review state death certificates on an annual basis to identify deceased patient cases .
the last date of follow - up was the date of death or last date of contact .
kaplan - meier curves were generated for age group , race / ethnicity , nses categories , and insurance status and were compared with the log - rank test .
cox proportional hazard regression was performed to generate adjusted hazard ratios ( hrs ) for all - cause mortality ( acm ) and lymphoma - specific mortality ( lsm ) using sas 9.1 ( sas institute , inc .
, cary , nc ) , controlling for age at diagnosis , race / ethnicity , histology , stage at diagnosis , nses , insurance status , gender , and diagnostic year .
a total of 2,432 males and 1,330 females in california aged 1539 at diagnosis with nhl between 1996 and 2005 comprised the study group .
table 1 presents distributions of demographic , clinical , and socioeconomic characteristics by race / ethnicity .
there was significant variation in age , tumor staging , nodality , first - course chemotherapy , radiation , nses , and health insurance .
the majority of the cases ( all histologic types ) were diagnosed at a late stage , but significantly more ( p < .01 ) non - hispanic black ( 52% ) than asian / pacific islander ( 34.7% ) patients were diagnosed at a distant stage .
figure 1 presents the frequencies of nses at diagnosis by race / ethnicity and shows that for nhws and apis , more individuals resided in higher ses areas , while for nhbs and hls , the opposite trend was true . for the remaining survival analyses , individuals with unknown race / ethnicity , stage , or chemotherapy status were excluded ( n = 183 ) . during the follow - up period through december 2005
the majority of deaths were due to lymphoma - related causes ( n = 593 ; icd-9 codes : 2008 , 2019 , 2028 , icd-10 codes : c819 , c829 , c833 - 5 , c837 , c844 - 5 , c851 , c859 ) .
the second most common cause of death was human immunodeficiency virus ( hiv ) disease resulting in nhl ( n = 204 ; icd-9 code : 042 , icd-10 codes : b21.0 - 3 , b21.7 - 8 ) ; an additional 43 died due to hiv complications that led to noncancerous diseases ( icd-10 code : b227 ) .
twenty - four others died of lymphoid leukemia ( icd-9 code : 204.0 , icd-10 codes : c91.0 - 5 ) , and the remaining deaths were due to other causes ( n = 217 ) .
table 2 displays the unadjusted and adjusted hazard ratios for both all - cause mortality ( acm ) and lymphoma - specific mortality ( lsm ) for this analysis .
the estimated average hr increased by 2% ( 95% ci : 1.011.03 ) for every increasing year of age at diagnosis after adjustment for all other variables : gender , race / ethnicity , diagnostic year , histological subtype , nodality , stage at diagnosis , nses , insurance status at diagnosis , and first - course treatment with chemotherapy and/or radiation . in the univariate model , nhbs and hls appeared to have increased acm and lsm compared to nhws . however , after adjustment no significant differences in mortality remained between nhws and either nhbs or hls .
conversely , adjustment increased rather than decreased the magnitude of difference in lsm for apis compared to nhws .
compared to earlier stages , later stage at diagnosis appeared to have a slightly stronger effect on acm after adjustment ( adj hr : 3.16 , 95% ci : 2.633.81 ) and the adjusted hr for later stage at diagnosis remained high for lsm ( adj hr : 3.14 , 95% ci : 2.424.06 ) .
extranodal involvement appeared to increase risk of overall death , but only after adjustment ( adj hr : 1.29 , 95% ci : 1.111.50 ) .
for lsm , extranodal involvement appeared to have a protective effect ( hr : 0.71 , 95% ci : 0.590.86 ) , but there was almost no effect after adjustment ( adj hr : 0.99 , 95% ci : 0.811.22 ) .
not having received chemotherapy as a first - course treatment appeared protective in the unadjusted acm analysis ( hr : 0.75 , 95% ci : 0.620.91 ) , but in the full model conferred shorter acm ( adj hr : 1.27 , 95% ci : 1.021.57 ) . on the contrary ,
not having first - course chemotherapy yielded protective lsm effects for both the unadjusted ( hr : 0.24 , 95% ci : 0.160.36 ) and adjusted hr ( adj hr : 0.37 , 95% ci 0.240.57 ) .
results were stratified by stage at diagnosis , and it appears that only in patients with distant - staged nhl was adjusted acm significantly higher than in patients that did not receive first - course chemotherapy ( adj hr : 1.69 , 95% ci 1.282.24 ) . for patients who did not receive first - course chemotherapy , lsm
was improved both in those with localized disease ( adj hr : 0.16 , 95% ci 0.070.38 ) and those with regional disease ( adj hr : 0.11 , 95% ci 0.010.76 ) .
not receiving first - course radiation therapy yielded significantly worse hazard ratios for the unadjusted acm ( hr : 1.31 , 95% ci 1.151.50 ) and lsm ( hr : 1.43 , 95% ci : 1.191.71 ) estimates , but did not have a significant effect after adjustment .
the effects of decreasing nses on acm and lsm significantly worsened with every decreasing quintile both before and after adjustment , with the strongest effects evident at the lowest quintile ( p < .05 ) ( see figure 2 for overall unadjusted kaplan - meier survival curves ) . the adjusted hazard ratio for acm for those residing in the poorest ses quintile at diagnosis compared to the wealthiest was 1.40 ( 95% ci : 1.131.75 ) .
all - cause mortality was higher for individuals with government - provided insurance as compared to having no insurance ( hr : 1.41 , 95% ci : 1.071.87 ) , but after adjustment the effect was only marginally significant ( adj hr : 1.32 , 95% ci : 1.001.75 ) . for individuals with private insurance , unadjusted
survival was longer ( hr : 0.62 , 95% ci : 0.470.82 ) compared to those without insurance , although the difference was not significant after adjustment .
a subgroup analysis was conducted to examine whether marital status , as a means of social support , conferred longer survival among individuals aged 18 and over at diagnosis .
after adjustment for the other demographic and clinical parameters in the full model , individuals who were married at diagnosis had 23% lower acm ( adj hr : 0.67 , 95% ci : 0.580.78 ) as compared to those who were single , separated , divorced , or widowed at diagnosis .
there was no significant difference in lymphoma - specific survival for individuals who were married at diagnosis , as compared to other marital statuses ( adj hr : 1.00 , 95% ci : 0.831.20 ) .
overall survival analysis was next stratified by the four racial / ethnic groups : nhw , nhb , hl , and api ( table 3 ) . in the stratified analysis ,
a one - year difference in age conferred a significant survival effect only in nhws ( adj hr : 1.02 , 95% ci : 1.011.04 ) and hls ( adj hr : 1.02 , 95% ci : 1.011.04 ) ; however , the analyses may have been underpowered for nhbs and apis .
later stage at diagnosis continued to be the strongest predictor of mortality across all age groups .
extranodal involvement was a significant adverse risk factor only for nhws ( adj hr : 1.51 , 95% ci : 1.211.87 ) .
not receiving first - course chemotherapy was a significant adverse risk factor in nhbs ( adj hr : 2.02 , 95% ci : 1.093.71 ) and hls ( adj hr : 1.71 , 95% ci : 1.192.46 ) , but interestingly , a significant protective factor in apis ( adj hr : 0.25 , 95% ci : 0.080.74 ) .
not receiving first - course radiation therapy was not a significant hazard for any of the racial / ethnic groups .
after stratification by race / ethnicity , decreasing nses was associated with worse acm in nhws , with the middle ( adj hr : 1.33 , 95% ci : 1.011.75 ) , low ( adj hr : 1.62 , 95% ci : 1.222.14 ) , and lowest ( adj hr : 2.25 , 95% ci : 1.643.08 ) quintiles having significantly higher hazard of overall death than the highest .
having private insurance imparted a protective effect only for hls ( adj hr : 0.64 , 95% ci : 0.430.95 ) , and having government - provided insurance predicted worse acm in nhbs ( adj hr : 5.97 , 95% ci : 1.4125.24 ) .
this study is one of the first to examine the impact of socioeconomic status on survival in adolescents and young adults with non - hodgkin 's lymphoma .
our analyses indicate that nses and treatment variables attenuate much of the racial / ethnic - specific differences in survival and that , after adjustment for demographic and clinical variables , both nhbs and hls tend to show similar survival patterns to nhws .
asian / pacific islanders , however , showed significantly poorer lymphoma - specific survival than nhws .
being married at diagnosis , a possible indicator of social support , as compared to being single , separated , widowed , or divorced , conferred strong protection against all - cause mortality , but not lymphoma - specific mortality .
furthermore , when examined across racial / ethnic groups , a significant gradient in survival by nses was only evident in nhws . although not significant , there was a suggestion of lower survival in apis as nses decreased , but the low numbers of apis in the study likely contributed to wide confidence intervals . for hls , having private insurance contributed to better survival , but for nhb , having government - provided insurance was associated with worse survival .
similar findings were reported in a cohort of elderly nhl patients ( age at diagnosis 65 ) in a study examining the association of mortality risk and ses . over three times as many black patients resided in the lowest ses quartile than whites ( p < .001 ) .
the authors found increasing hazard ratios by decreasing ses quartile after adjusting for race / ethnicity , sex , age , marital status , stage , comorbidity , and therapy , and for both all - cause and nhl - specific mortality .
interestingly , individuals in the lowest ses quartile and diagnosed at stages i - ii had a higher adjusted hazard ratio ( adj hr : 1.31 , 95% ci : 1.191.44 ) than individuals diagnosed at stages iii - iv ( adj hr : 1.22 , 95% ci : 1.121.33 ) .
finally , after controlling for disparities in stage at diagnosis and treatment , the authors failed to find significant differences in all - cause or nhl - specific mortality between black and white patients .
a brazilian study of hodgkin 's lymphoma patients also found higher mortality associated with lower ses that was unexplained by treatment regimen .
a scandinavian study investigated ses influences on incidence and survival in adult nhl cases and found decreasing rates of both one- and five - year relative survival by decreasing level of education , dwelling size , and disposable income .
however , two other studies of ses impacts on lymphoma survival failed to find a significant association . a hospital - based study in austria that investigated relapse - free survival ( rfs ) in a cohort of 218 hodgkin 's lymphoma patients ( average age at diagnosis = 35.9 15.0 years ) found that after adjustment for age survival rates actually decreased with corresponding increases in educational level and income .
the authors commented that the findings seemed to be specific only to hodgkin 's patients and may partly be specific to austria 's equal - access healthcare system or to possible underlying immunological differences related to life - course exposures , such as epstein - barr virus positivity . a study on teenaged and young adult cancer patients ( aged 1324 ) in england reported no gradient between survival and a composite measure of area - level poverty among nhl patients .
the lack of an association may be partly due to the age range included in this study ; another study that examined nses impacts on survival in leukemia patients aged 039 only found a significant gradient in survival among 3039 year - olds . an investigation on survival in nhl patients in scotland and wales found 10% and 19% shorter survival in intermediate and most deprived areas , respectively , .
the study used an area - level deprivation score based on four census variables ( car ownership , male unemployment , overcrowding , and social class ) .
race and ethnicity were not reported in the scottish study , perhaps because health research on racial / ethnic differences in survival is less widely conducted in the uk . if the study sample was fairly homogenously caucasian , the results would be consistent with our findings of an nses gradient in survival among non - hispanic whites . not finding an ses - mortality gradient in the non - white patients in our study raises several questions about the cancer experience in these populations .
first , it is important to reiterate that for nhbs and hls , although the unadjusted hazard ratios for both acm and lsm were significantly higher than for nhws , adjustment for the other factors in the model including nses , stage at diagnosis , and first - course treatment attenuated these risks . as evident in figure 1 , there were far more nhbs and hls residing in poorer nses areas , which often have lower access to resources .
thus , it is possible the differences in survival by race / ethnicity commonly reported may be due more to confounding by later initiation of and poorer access to care , a phenomenon noted in hispanic populations .
measuring access to care is quite difficult , particularly in a registry - based analysis , and further studies should be done to examine why a gradient exists for nhws but not other racial / ethnic groups .
differential access to the most effective treatment regimens may still persist for lower ses groups .
the lack of a consistent association between health insurance status and survival after adjustment was surprising , given the widely - documented increased vulnerability of patients lacking health insurance .
finding higher all - cause mortality among those with government - provided insurance compared to those without insurance suggests that there may be important disparities in access to care among medicaid recipients . approximately double the percentage ( 17.8% ) of those without health insurance
compared to those with government - provided health insurance ( 9.4% ) resided in the highest nses quintile at diagnosis .
a paper analyzing the relationship of health insurance status and cancer outcomes across us demographic groups found striking disparities in cancer screening , stage at diagnosis , and survival for those uninsured or insured by medicare or medicaid .
individuals in the general population aged 1824 were also found to have the highest probability of lacking insurance or being insufficiently insured .
access to adequate healthcare coverage can affect cancer care , including challenges of covering premiums , deductibles , and co - payments , and difficulty remaining employed and eligible for insurance benefits [ 19 , 29 ] .
one study found an average increase of 13.1 weeks in wait time between diagnosis and initiation of treatment for non- or government - insured patients as compared to private health insurance , although no associations between wait times and ses , gender , age , race / ethnicity , or marital status were found .
one of the strengths of this study is the use of ccr data with a large , heterogeneous , and population - based cohort with almost complete patient ascertainment and follow - up .
registry - based explorations of factors that contribute to longer survival are important to help identify groups that are particularly vulnerable to premature cancer mortality . because social determinants affect health outcomes along several pathways , it is important to document the existence of persistent health disparities , particularly for understudied groups such as ayas . the limitations of this study include the estimation of ses based on the residence at diagnosis , which may not accurately capture some factors that contribute to healthy living environments and adequate medical care .
transitioning through developmental life stages can make ayas a heterogeneous group ; some are dependent on parents and relatives while others provide for families of their own . as such , measuring ses as a one - time neighborhood composite variable may inadequately summarize an individual patient 's social and financial circumstances .
the way that first course of treatment is measured in the registry is also somewhat limited ; it is not possible to know the type of therapy , the dose - intensity administered , and other factors related to the treatment regiment that may have significant influence on survival .
furthermore , knowing a patient 's health insurance status only at diagnosis does not reveal whether the insurance was sufficient in covering the costs associated with cancer treatment , nor does it reveal whether there were any subsequent lapses in insurance coverage .
these findings do not appear to be limited to the us ; however , comparability across borders may be limited due to differing national health systems .
patient contact studies that address individual socioeconomic barriers to treatment and recovery and that can better guide potential interventions are warranted , as is the development and evaluation of programs specifically designed to meet the needs of the diverse and unique aya population .
our study is one of the first to examine socioeconomic impacts on survival in ayas with nhl .
we determined that as neighborhood ses at diagnosis increases , overall- and lymphoma - specific survival improves , after adjustment for demographic and treatment variables , and a linear trend persists .
the impact of ses on mortality appeared to be independent of health insurance status at diagnosis .
however , when stratified by race / ethnicity , the effects of nses on mortality were only significant in non - hispanic whites . | shorter survival has been associated with low socioeconomic status ( ses ) among elderly non - hodgkin 's lymphoma ( nhl ) patients ; however it remains unknown whether the same relationship holds for younger patients .
we explored the california cancer registry ( ccr ) , to investigate this relationship in adolescent and young adult ( aya ) nhl patients diagnosed from 1996 to 2005 .
a case - only survival analysis was conducted to examine demographic and clinical variables hypothesized to be related to survival .
included in the final analysis were 3,489 incident nhl cases . in the multivariate analyses ,
all - cause mortality ( acm ) was higher in individuals who had later stage at diagnosis ( p < .05 ) or did not receive first - course chemotherapy ( p < .05 ) .
there was also a significant gradient decrease in survival , with higher acm at each decreasing quintile of ses ( p < .001 ) .
overall results were similar for lymphoma - specific mortality . in the race / ethnicity stratified analyses , only non - hispanic whites ( nhws ) had a significant ses - acm trend ( p < .001 ) . reduced overall and lymphoma - specific survival was associated with lower ses in ayas with nhl , although a significant trend was only observed for nhws . |
cleft lip / palate are the most common craniofacial anomalies in children , with an incidence of 1:800 live births .
it occurs due to the failure of fusion or break in fusion of nasal and maxillary processes with the palatine shelves , which form during 8 week of the embryonic period .
the most well - known are the pierre robin 's , treacher collins and goldenhar syndrome . congenital heart disease ( chd )
. surgical repair of cleft lip is usually done at 1 - 3 months of age for cosmetic purpose and cleft palate at 6 months to 1 year of age to promote facial growth and the speech . the successful outcome following cleft repair depends on the age of the patient , associated morbidities , anaesthetic expertise and post - operative care .
infants with facial deformities are usually associated with abnormal dentition / hearing defect , recurrent ear / upper respiratory tract infection ( urti ) , pulmonary aspiration and poor nutrition . until recently criteria for cleft repair in infants was 10 pounds of weight , 10 weeks of age and haemoglobin of 10 g% .
recent concepts of early repair in neonates are based on improvements in parent - infant bonding , feeding , growth and speech development .
anaesthesia for cleft surgery in infant and children carries a higher risk with general anaesthesia and airway complications due to associated respiratory problems .
review of literature mentions higher incidence of perioperative respiratory complications when associated with the common cold symptoms in children for cleft repairs .
morbidity during general anaesthesia is associated with the difficult airway , endotracheal ( et ) tube compression / disconnection and post - operative airway obstruction .
this audit aims to present the frequency of associated congenital defects , other conditions and the perioperative airway related morbidity with the anaesthetic management of 1000 cleft lip / palate surgeries , conducted at our institution during 2003 - 2007 .
the smile train ( march 2005 ) guidelines , which are designed to promote the safety of children undergoing general anaesthesia for cleft lip and palate repairs were strictly followed .
surgeries in children with urti having symptoms of nasal discharge , sneezing , sore throat , cough and with lower respiratory tract infection ( lrti ) were postponed for 2 weeks and 4 weeks respectively .
they were examined for head size , neck movement , extent of oral defect , type of dentition and tongue size .
informed consent was obtained following explanation to the parents about the potential complications of the procedure .
routine blood investigations ( complete blood count , platelets , prothrombin time / partial thromboplastin time for cleft palate repair ) and urine examination ( routine , microscopic ) was done .
pre - operative fasting was observed for 4 h for milk , 6 h for solid food and 2 h for clear fluid .
baseline vital parameters like heart rate ( hr ) , non - invasive blood pressure ( nibp ) , ( ecg ) , pulse oximetry ( spo2 ) were noted inside the o.t . all the anaesthetic equipments and drugs were checked .
the et tubes ( ring , adair and elwyn ( rae ) south polar tube for cleft lip , oxford / armoured for cleft palate ) and lmas of appropriate sizes were kept ready .
emla cream ( 1:1 eutectic mixture of prilocaine and lidocaine ) was applied with occlusive dressing at the proposed venepuncture site 60 min prior to the surgery .
following pre - oxygenation for 3 min , intravenous ( iv ) line was secured with 22g/24 g cannula .
in uncooperative children , cannula was secured following inhalational induction with halothane ( 0.5 - 2.5% ) in o2 with jackson rees modification of ayre 's t piece .
patients were premedicated with iv glycopyrrolate 0.004 mg / kg , midazolam 0.05 mg / kg and tramadol 1 mg / kg and induced with iv thiopentone 5 mg / kg or propofol 1.5 mg / kg . after ensuring mask ventilation , intubation was carried out using rocuronium 0.8 mg / kg .
suxamethonium 1.5 mg / kg was used in infants and in children with syndromic / wide cleft deformity / anticipated difficult intubation having easy mask ventilation . bilateral equal air entry was confirmed and the tube fixed in the centre of the lower lip .
anaesthesia was maintained with 50% n2o in o2 with halothane / isoflurane 0.4 - 1% and intermittent positive pressure ventilation .
top up doses with 0.15 mg / kg of rocuronium were administered at the recovery of train of four ( tof 20% ) with tof watch ( organon teknika ) following ulnar nerve stimulation .
ringers lactate was infused ( considering 4 - 2 - 1 rule ) , 8 - 12 ml / kg / h throughout the procedure and 4 - 6 ml / kg / h for 4 - 6 h post - operative period .
intra - operative continuous monitoring included hr , nibp , ecg , spo2 , end tidal carbon dioxide ( etco2 ) , tof response at the thumb , temperature and blood loss .
blood loss up to 20% of total blood volume was corrected with crystalloids ( in 1:3 ratio ) and if > 20% with blood transfusion ( in 1:1 ratio ) .
surgical site was infiltrated with 2 - 4 ml of lignocaine ( 1 - 1.5% ) with adrenaline ( 1:100,000 ) . at the end of palate repairs tongue
reversal was achieved with 0.05 mg / kg of neostigmine with 0.01 mg / kg of glycopyrrolate and extubated following satisfactory clinical recovery and tof ( t4/t1 ratio > 90% and with no fade on double burst stimulation ) .
o2 was supplemented in the recovery room for 1 h and child shifted to paediatric intensive care unit ( picu ) for observation and vital monitoring for 8 - 12 h and later shifted to the paediatric ward .
post- operative pain control was provided with tramadol 1 mg / kg iv 4 hourly for 8 h , later orally with paracetamol or ibuprofen syrup .
older children > 1 year received diclofenac suppositories after 12 h. any adverse event during the course of anaesthesia and surgery was noted . for
the study purposes , fall in spo2 < 90% was considered as desaturation , laryngospasm as partial or complete airway obstruction with fall in spo2 < 90% with no relief after jaw thrust , chin lift , use of the airway and 100% o2 support by face mask .
requirement of more than three attempts at intubation by an anaesthesiologist having expertise in dealing with paediatric airway was considered as difficult intubation and failure to intubate after three attempts as failed intubation .
bradycardia was defined as hr < 20% of baseline , tachycardia if hr > 30% of baseline , hypotension when mean arterial blood pressure ( mbp ) < 20% and hypertension if mbp > 30% of the baseline value .
the data was analysed as mean ( standard deviation [ sd ] ) , frequency and percentage as appropriate for the study .
basic statistics was assessed by using ms excel office 2007 data analysis tool pack . for preparation of tables of frequency distribution and percentages , spss software ( version 20 ) was used . for comparison of percentage in two groups ,
pre - operative fasting was observed for 4 h for milk , 6 h for solid food and 2 h for clear fluid .
baseline vital parameters like heart rate ( hr ) , non - invasive blood pressure ( nibp ) , ( ecg ) , pulse oximetry ( spo2 ) were noted inside the o.t .
the et tubes ( ring , adair and elwyn ( rae ) south polar tube for cleft lip , oxford / armoured for cleft palate ) and lmas of appropriate sizes were kept ready . emla cream ( 1:1 eutectic mixture of prilocaine and lidocaine ) was applied with occlusive dressing at the proposed venepuncture site 60 min prior to the surgery . following pre - oxygenation for 3 min , intravenous ( iv ) line was secured with 22g/24 g cannula . in uncooperative children ,
cannula was secured following inhalational induction with halothane ( 0.5 - 2.5% ) in o2 with jackson rees modification of ayre 's t piece .
patients were premedicated with iv glycopyrrolate 0.004 mg / kg , midazolam 0.05 mg / kg and tramadol 1 mg / kg and induced with iv thiopentone 5 mg / kg or propofol 1.5 mg / kg . after ensuring mask ventilation , intubation was carried out using rocuronium 0.8 mg / kg .
suxamethonium 1.5 mg / kg was used in infants and in children with syndromic / wide cleft deformity / anticipated difficult intubation having easy mask ventilation . bilateral equal air entry was confirmed and the tube fixed in the centre of the lower lip .
anaesthesia was maintained with 50% n2o in o2 with halothane / isoflurane 0.4 - 1% and intermittent positive pressure ventilation .
top up doses with 0.15 mg / kg of rocuronium were administered at the recovery of train of four ( tof 20% ) with tof watch ( organon teknika ) following ulnar nerve stimulation .
ringers lactate was infused ( considering 4 - 2 - 1 rule ) , 8 - 12 ml / kg / h throughout the procedure and 4 - 6 ml / kg / h for 4 - 6 h post - operative period .
intra - operative continuous monitoring included hr , nibp , ecg , spo2 , end tidal carbon dioxide ( etco2 ) , tof response at the thumb , temperature and blood loss .
blood loss up to 20% of total blood volume was corrected with crystalloids ( in 1:3 ratio ) and if > 20% with blood transfusion ( in 1:1 ratio ) .
surgical site was infiltrated with 2 - 4 ml of lignocaine ( 1 - 1.5% ) with adrenaline ( 1:100,000 ) . at the end of palate repairs tongue
reversal was achieved with 0.05 mg / kg of neostigmine with 0.01 mg / kg of glycopyrrolate and extubated following satisfactory clinical recovery and tof ( t4/t1 ratio > 90% and with no fade on double burst stimulation ) .
o2 was supplemented in the recovery room for 1 h and child shifted to paediatric intensive care unit ( picu ) for observation and vital monitoring for 8 - 12 h and later shifted to the paediatric ward .
post- operative pain control was provided with tramadol 1 mg / kg iv 4 hourly for 8 h , later orally with paracetamol or ibuprofen syrup .
older children > 1 year received diclofenac suppositories after 12 h. any adverse event during the course of anaesthesia and surgery was noted . for
the study purposes , fall in spo2 < 90% was considered as desaturation , laryngospasm as partial or complete airway obstruction with fall in spo2 < 90% with no relief after jaw thrust , chin lift , use of the airway and 100% o2 support by face mask .
requirement of more than three attempts at intubation by an anaesthesiologist having expertise in dealing with paediatric airway was considered as difficult intubation and failure to intubate after three attempts as failed intubation .
bradycardia was defined as hr < 20% of baseline , tachycardia if hr > 30% of baseline , hypotension when mean arterial blood pressure ( mbp ) < 20% and hypertension if mbp > 30% of the baseline value .
the data was analysed as mean ( standard deviation [ sd ] ) , frequency and percentage as appropriate for the study .
basic statistics was assessed by using ms excel office 2007 data analysis tool pack . for preparation of tables of frequency distribution and percentages , spss software ( version 20 ) was used . for comparison of percentage in two groups ,
the demographic profile is shown in table 1 as distribution of patients in the three age groups with their mean ( sd ) of height and weight .
a total of 723 patients were screened and were operated for cleft lip and palate repairs for a total of 1000 surgeries .
the incidence of isolated lip was 263 ( 36.4% ) , isolated palate 183(25.3% ) and the combined defect was present in 277 ( 38.3% ) of the cases .
approximate surgical time for lip repair was 1 h and for palate repair was 2 h. figure 1 depicts the incidence of associated congenital anomalies .
associated congenital defects ( pr syndrome : pierre robin syndrome , sg stenosis : subglottic stenosis , asd : atrial septal defect , vsd : ventricular septal defect , pad : patent ductus arteriosus ) table 2 demonstrates the incidence of pre - operative associated problems .
24.9% patients had upper and lower rtis , anaemia ( hb < 10 g% ) was present in 6.1% , under nutrition ( weight < 50 percentile ) in 3.9% and feeding problems in 11.2% of the children .
preoperatively , 43.5% of patients had associated problems / complications , of which 29.6% were associated with cleft lip and 59.8% with palate repairs
( t = 9.6 , p = 0.0000 , p < 0.05 ) . the frequency of intraoperative respiratory complications in 1000 cleft repair surgeries are shown in figure 2 .
laryngospam occurred during induction in 0.2% of patients and could be relieved with routine airway manoeuvres , oxygenation or subsequent injection of muscle relaxant for intubation .
bronchospasm developed during induction in 0.5% of patients , which was relieved with deepening the plane of anaesthesia with inhalational agent , iv hydrocortisone 1 mg / kg and/or deriphyllin ( theophylline and etophylline ) 2 mg / kg .
pre - operative associated conditions frequency of intra - operative airway complications ( t = 4.433 , p 0.0000 < 0.05 [ significant ] ) difficult laryngoscopy due to wide cleft palate requiring more than one attempt for intubation was associated in 1.6% of patients .
failure of intubation after three attempts , due to poor visualisation of the larynx occurred in 0.3% cases ( cormack lehane [ cl ] grade iii / iv in two cases of pierre robin syndrome and in a case of retrognathia with wide cleft palate ) in which surgery was postponed and performed after 3 - 6 months when intubation was possible on the first attempt ( cl grade ii ) .
incidence of partial tube compression was observed in 1.3% ( palate repair ) , endobronchial intubation in 1% and accidental extubation occurred in 0.4% of patients ( palate repair 23 , lip repair 4 ) .
the frequency of intraoperative respiratory complications was 2.4% in cleft lip and 8.7% in cleft palate repairs ( t = 4.43 , p = 0.0000 , p < 0.05 ) .
bradycardia was observed in 0.3% patients at the time of intubation that responded to injection atropine 0.01 mg / kg iv .
tachycardia and hypertension were encountered in 3.3% and 1.7% of patients respectively , that was transient following local anaesthetic infiltration .
intraoperative bleeding 15 - 20% of the total blood volume occurred in 0.4% patients and they responded to the infusion of crystalloids .
intraoperative hyperthermia or hypothermia of 2 f change occurred in 0.4% and 0.3% cases , that was corrected with air cooling / sponging and warm drapings respectively .
laryngospasm occurred in 0.3% and bronchospasm in 0.5% of cases resulting in desaturation in the range of spo2 87 - 95% immediately after extubation that responded to oral suction , o2 by mask and iv steroids / bronchodilators respectively .
frequency of post - operative respiratory complications post - operative respiratory obstruction developed in 2.3% of cases requiring jaw manoeuvring / lateral positioning or insertion of nasopharyngeal airway .
one patient ( lip repair ) had epiglottic oedema following two attempts for difficult intubation and needed reintubation immediately after extubation .
post - operative respiratory complications occurred in 4.3% of cases , 1.7% with cleft lip and 7.4% with cleft palate repairs ( t = 4.41 , p = 0.0000 , p < 0.05 ) .
incidence of vomiting , shivering and moderate hyperthermia was 1% , 1.3% and 1.7% respectively .
post - operative bleeding occurred in two cases of palate repair and required re - exploration and blood transfusion at 6 - 8 h post - operative period .
wound dehiscence occurred in 0.4% cases of lip repair and palatal fistula in 2.8% requiring surgical correction at later dates .
one patient , aged one year , after lip repair , died 12 h post - operatively ; the child required two attempts for intubation for respiratory obstruction immediately after extubation that was associated with desaturation ( spo2 < 85% ) and bradycardia .
abg was suggestive of respiratory and metabolic acidosis with raised creatine phosphokinase levels , urine was positive for red blood cells and proteins .
another patient , an 8 years old girl with ventricular septal defect ( vsd ) had lip repair successfully at the age of two , also underwent palate repair uneventfully this time . on second post - operative day following bath she developed central cyanosis ( spo2 70% ) and , tachycardia .
echocardiography ( echo ) revealed large perimembranous vsd with 50% overriding of aorta with shunt from the right ventricle to the aorta .
immediate transfer to cardiac centre was advised by paediatrician but the child succumbed to thromboembolic episode at 72 h.
heredity plays a significant role in cleft deformity besides parents age , nutrition , radiation and certain drug therapies .
we aimed to present an audit of 1000 cleft surgeries , evaluated on the basis of medical records regarding perioperative complications . in our study , the incidence of urti was 7.01% and 15.9% in cleft lip and palate cases respectively .
acute urti is the leading cause of postponement of elective surgeries and there are no confirmatory laboratory tests or x - ray findings to diagnose urti .
it increases the risk of laryngospasm from 1.7% to 9.6% and a threefold increase in bronchospasm in children .
reported incidence of anaesthesia related complications within 24 h in 4.3/1000 infants and 0.5/1000 in children with 0.01% death .
reported higher peri - anaesthesia morbidity in paediatric patients ( 35% ) compared to adults ( 17% ) .
majority of the anaesthetic morbidity in cleft repair is related to the airway such as difficult intubation , et tube compression , disconnection or accidental extubation .
any child with hypoplastic mandible or wide cleft palate increases the risk of tongue prolapse into the nasopharynx and pose a problem during induction of anaesthesia .
gunawardhana in his study of 800 cleft lip / palate repairs reported difficult intubation and need for external laryngeal pressure in 86% of cases with cormack and lehane grade iii and iv airway grades .
the incidence of difficult laryngoscopy was 2.95% in unilateral , 45.7% in bilateral cleft lip and 34.6% in retrognathia with significant association of the lower age with difficult laryngoscopy . in our study , intubation related problems occurred in 2.4% in cleft lip repair and 8.7% in palate repair .
failure of intubation occurred in three cases of which one had retrognathia and two had pierre robin syndrome ( prs ) with micrognathia .
lma can be used to facilitate intubation in such cases and have been used successfully in craniofacial anomalies undergoing reconstructive plastic surgeries .
reported major complications such as laryngospasm , arrhythmias , excessive bleeding , hyper / hypothermia in 45.2% of lip repairs and 29.8% in palate repairs respectively .
mcqueen et al . noted incidence of the anaesthetic complications in 31% of the overall reported complications in the data reviewed during 2005 - 2006 .
difficult intubation , bronchospasm and airway obstruction accounted for majority ( 76% ) of these reported studies . in the post - operative period , there is a higher chance of developing mucosal oedema in any part of the airway especially following pharyngeal flap with palate repair or after surgeries lasting longer than 2 h. patients with pierre robin syndrome present with severe airway problems intra / postoperatively such as difficult intubation , mucosal oedema of the oropharynx / larynx or tongue due to the prolonged pressure on these structures following extension of head and dissection / manipulation during repair operations . in our study ,
an 1-year - old child for lip repair needed two intubation attempts and had epiglottic oedema resulting in post extubation respiratory obstruction .
post - operative respiratory obstruction may result following the closure of wide cleft palate or syndromic cleft associated with hypoplasia of mandible , haematoma or due to accidental left - over packs .
aspiration of the secretions or blood collected in the nasopharynx is possible following removal of head extension ( that brings down the larynx ) and with the emergence of reflexes .
there is also change in oral / nasal airway dynamics especially in children with prs that may present with the problem of respiratory obstruction in the post - operative period .
use of nasopharyngeal airway or / and tongue suture to allow forward traction can help in such a situation .
fillies et al . observed average blood loss of around 15 ml and 45 ml during cleft lip and palate closure .
we observed average blood loss of 21 ml with cheiloplasty and 46 ml with palatoplasty ( 3 - 12% of expected blood volume ) .
doyle and hudson reported requirement of blood transfusion in 10% patients of cleft lip and 16% of palate repair in their series of 244 cleft surgeries .
they used post - operative opioids for pain - relief and noted respiratory depression in 3/97 patients and total respiratory arrest in one case . in our series ,
blood transfusion was needed in 0.2% patients of palate repair who required re - exploration .
there was no incidence of respiratory depression in our patients as we avoided the use of potent opioids intra and post- operatively .
incidence of post - operative bleeding was 4.3% in old literature , which has come down to 0.5% in recent studies due to improved techniques and use of cauterisation .
we observed incidence of wound dehiscence in 0.4% patients and palatal fistula in 2.8% patients .
association of hyperpyrexia with raised creatinine phosphokinase , subclinical myopathy of autosomal dominant inheritance resulting in malignant hyperpyrexia is known . in infants
it responds well to dantrolene sodium , and its use has resulted in the drop in mortality from 80% 30 years ago to less than 5% now . we had a case of hyperpyrexia with laboratory findings positive for mh ; however , due to non - availability , we could not administer dantrolene sodium .
mcqueen et al . reported one death ( 0.012% ) at 72 hours post - operatively probably due to chd in 8000 cases of repair .
small defect ( pulmonary to systemic systolic pressure ratio < 0.3 and qp : qs < 1.4 ) causes negligible haemodynamic changes . large defect ( systolic pressure ratio more than 0.3 and qp : qs more than 2.2 ) leads to the eventual development of pulmonary vascular obstructive disease
morbidity in these patients is due to chronic cyanosis , thromboembolic events , cerebrovascular complications and the hyperviscosity syndrome . in our study 0.2%
mortality is reported , in a case due to hyperpyrexia with convulsions within 24 h and in the other case at 72 h of the post - operative period due to reversal of shunt at vsd and subsequent episode of thromboembolism .
surgical repair of the cleft lip / palate in infants and children is a great challenge to the anaesthesiologist due to its peculiar site and association of variety of developmental anomalies and perioperative complications . in our study , we observed congenital defects in 2.9% and other associated diseases in 43.5% of the patients of cleft lip / palate .
intra and post - operative respiratory complications occurred in 5.3% and 4.3% of patients respectively with significantly higher incidence reported in cleft palate repairs .
anaesthetic management of cleft repair needs skilled personnel , meticulous monitoring and post - operative care in an intensive care unit setup to minimise the complications . | background and aim : anaesthesia for cleft surgery in children is associated with a variety of airway related problems .
this study aims to review the frequency of associated anomalies and other conditions as well as perioperative respiratory complications during the cleft lip / palate repair surgeries.methods:an audit of 1000 cleft surgeries in children enrolled under
smile train is presented .
following informed consent , general anaesthesia was induced with endotracheal ( et ) intubation using halothane in o2 and/or intravenous thiopentone 5 mg / kg or propofol 1.5 mg / kg , suxamethonium 1.5 mg / kg or rocuronium 0.8 mg / kg and maintained with halothane / isoflurane 0.4 - 1% in 50% n2o in o2 with rocuronium .
the observational data regarding the occurrence of perioperative complications in 1000 cleft surgeries are mentioned as mean ( standard deviation ) , number and percentage as appropriate .
two sample t - test between percentage is applied for significance.results:the frequency of isolated cleft lip was 263 ( 36.4% ) , cleft palate 183 ( 25.3% ) and combined defect 277 ( 38.3% ) of the operated cases .
other congenital anomalies were present in 21 ( 2.8% ) of the children .
the intraoperative airway complications occurred in 13 ( 2.4% ) of cleft lip and 40 ( 8.7% ) of cleft palate repairs ( p < 0.05 ) .
post - operative respiratory complications were observed in 9 ( 1.7% ) and 34 ( 7.4% ) patients of cleft lip and palate repairs respectively ( p < 0.05 ) .
mortality occurred post - operatively in 2 ( 0.2% ) of cleft repairs ( n = 1000).conclusion : cleft deformities in children when associated with other congenital anomalies or respiratory problems pre - dispose them to difficult airway and pulmonary complications . frequency of perioperative respiratory complications were significantly higher with cleft palate repair than with cleft lip repair .
anaesthetic expertise , optimum monitoring facility and specialised post - operative care is necessary to decrease the morbidity . |
why are bruises so perversely satisfying ? despite the aesthetically unpleasant discoloring of the skin that accompanies them , bruises serve as an externally visible signal that effectively communicates and legitimizes pain .
unfortunately , the majority of pain that people endure does not manifest itself through bruising , and subjective measures are frequently used to rate and quantify levels of discomfort .
consequently , there is often a disconnect between an individual 's perception of pain and an observer 's understanding of its degree or intensity .
neuroscience research has produced many significant findings over the past decades , including localizing specific functions to certain regions or circuits within the brain .
however , there is no unified neural area devoted to pain processing , as it involves a multifaceted
matrix distributed across many neural regions . while our comprehension of the phenomenon is constantly evolving , within the past two years
, functional magnetic resonance imaging ( fmri ) studies have greatly accelerated the field through identifying and modeling
these measures can detect the presence of acute and chronic pain and distinguish them from other sensations , such as reactions to non - painful heat as well as feelings of social rejection .
not only are these findings important in the domain of neuroscience , but they are also pertinent to the realm of tort law .
pain , especially of the chronic subtype , is considered an invisible harm , which includes physical or emotional injuries that can not readily be seen by an observer .
courts impose a high threshold of proof for these harms , in part due to the lack of objective measures available to identify or quantify them .
the recent advancements in pain neuroimaging have thus piqued the interest of legal scholars for their possible application to tort law , particularly with regard to their potential for demonstrating the presence of pain in plaintiffs .
the concept of employing neuroimaging as an objective measure in the courtroom is neither novel nor inconceivable . over the past few years
, neuroscientists , legal scholars , ethicists , and even judges have had to deal with the question of using neuroimaging for lie detection in trials .
the science is still in its infancy , but this topic has nevertheless garnered significant controversy and debate . furthermore , despite the overlap in proposed applications , a comparative analysis of fmri for pain versus deception detection is largely absent from the current literature .
this article will therefore briefly summarize recent studies in both pain and deception neuroimaging , explore commonalities between the two techniques and their respective applications to the legal system , and conclude with an analysis of several key differentiating factors .
contrasting fmri for pain versus deception detection is necessary to determine whether pain neuroimaging will find a place in the current tort system or fade into oblivion in spite of its potential promise .
recent advancements in pain neuroimaging have employed fmri technology , which provides an indirect measure of brain activity during various tasks .
the basic premise of this technique is that more engaged areas of the brain will require higher levels of oxygen , which is transported via the hemoglobin found in red blood cells .
fmri technology detects changes in the blood oxygen level - dependent ( bold ) signal , and researchers can subsequently display this information by superimposing a
the highlighted regions reflect the difference in activity during a task versus that during resting state . in analyzing imaging results
, researchers can use computer algorithms created with preliminary sets of data to predict activation patterns in subsequent datasets ( machine learning ) .
while a multitude of studies have made important contributions to the field , this paper will focus on recent findings that purport to show a pain signature , which allows for detection on an individual level . in 2011 ,
brown and colleagues applied thermal stimuli to the forearm of healthy participants in two different conditions : hot but not painful , and painful ( to an intense but not unbearable level ) . via machine learning techniques , the researchers utilized fmri data from a subset of subjects to create algorithms for these two conditions . when used to analyze activity patterns from the remaining subjects , the algorithm correctly differentiated between painful and non - painful stimuli with 81% accuracy .
moreover , the authors found increased activity during the painful conditions in areas commonly associated with the pain matrix , such as the primary and secondary somatosensory cortices as well as the insular cortex . using a similar paradigm ,
in two subsequent follow - up tasks , the researchers distinguished acute pain from social feelings of rejection , and demonstrated the reduction of prediction accuracy upon giving participants analgesic medications . furthermore , as a testament to the field 's increasingly complex understanding of pain , favilla and colleagues employed machine learning to analyze neural activation in patients receiving injections of ascorbic acid while gathering their self - reports of pain intensity .
interestingly , the researchers ranked brain areas according to their time course in contributing to the perception of pain , specifying regions most associated with perceived pain intensity . for example , whereas the mid - cingulate and posterior insula were active throughout the pain experience , the parietal operculum 's role seemed isolated to the beginning stages .
additionally , abnormalities in these regions might inform future research on patients exhibiting excess amounts of pain .
although the significance of these three experiments should not be overlooked , it is nevertheless important to note that they all involved temporary manifestations of acute pain in healthy patients .
in contrast , studies examining chronic pain have compared healthy populations to chronic pain patients in deriving their neurological signatures . in a machine learning experiment exploring chronic back pain , callan and associates administered painful electrical stimulations to the lower back of both chronic pain patients and healthy controls .
their algorithm correctly differentiated between pain perceptions in the two subject groups with 92.3% accuracy .
the authors speculated that the difference in pain processing observed in chronic pain patients was a result of functional reorganization in brain regions such as the primary somatosensory cortex and the inferior parietal cortex .
bagarinao and colleagues conducted a similar study in patients with chronic pelvic pain , but reported much lower accuracy rates ( 73% ) . while not machine learning - based , a study by kucyi and researchers used fmri technology to demonstrate that chronic pain patients with temporomandibular disorder show atypical resting state functional activity in the default mode network , a group of brain regions believed to impact pain rumination . although tremendous progress has been made over the last few years in pain neuroimaging , the field is still too nascent to be applied to real - world contexts .
future research should focus on improving accuracy rates and expanding studies to include greater varieties of pain intensities and locations .
additionally , since a standardized method of data interpretation would optimize consistency for settings such as the courtroom , researchers will need to determine which machine learning techniques work best . while current neuroimaging protocols might be sufficient for chronic pain patients ( given their differential neural activation patterns compared to healthy controls )
theoretically , if an individual suffering from acute pain in his left arm were to receive a non - painful stimulus to both arms , the resulting activation patterns from the stimulation of each arm should be predictably different , assuming that the pain threshold would be lower for the already sensitive left side . yet , studies would need to test this hypothesis .
overall , despite the shortcomings , the current pace of progress in this field suggests that pain neuroimaging holds substantial promise .
whereas studies involving neuroimaging of pain generally incorporate common protocols from one experiment to the next , those examining the use of fmri for lie detection are more heterogeneous .
part of this diversity can be explained by variations in study design for mock crime scenarios , as minor discrepancies among methodologies can lead to significant differences in accuracy rates .
even so , researchers have highlighted a relatively consistent set of neural regions ( particularly the dorsolateral and ventrolateral prefrontal cortices ) that become more active during conditions of deceit than honesty .
early studies of detection deception relied on group level findings by averaging results across multiple participants .
given the focus of this article on new developments as well as the importance of detection in individuals for legal applications , only studies which analyze deception on the individual level will be discussed .
one such study was conducted by davatzikos and colleagues , who used machine learning techniques to predict deception .
subjects were told to lie about having one of two possible playing cards , and the experimenters were not aware of which card the subjects chose . during the scanning portion of the test , participants clicked buttons to indicate whether they did or did not have the card presented on the screen .
only a small proportion of the trials thus included the lying condition since hundreds of images were displayed .
however , critics have noted the potentially confounding nature of the motor demands in this study , as the number of times the button was pressed for truthful conditions far surpassed that of the lying ones .
kozel and associates employed a different paradigm to examine deception on an individual participant level . using a mock crime scenario intricately designed to approximate the pressures and stress inherent in the real world
, participants in the crime condition were tasked with stealthily destroying evidence of previous infractions .
meanwhile , participants in the no - crime group were instructed to lie about an alibi during the time these evidence - tampering crimes were committed , but did not actually commit the crimes themselves .
all participants then answered both neutral and crime - related questions while in the fmri scanner . in a subsequent task ,
each participant was told to steal a ring or a watch and to lie about taking either when asked during scanning .
the researchers analyzed activation patterns in the ring - watch scenario in order to identify participants for whom they could accurately detect deception during this simple task .
when the researchers then tried to predict which of the individuals in this subgroup were in the mock crime condition , they correctly identified all members of the crime group , while incorrectly identifying 66% of participants in the no - crime condition . whereas this study exemplified issues of specificity without countermeasures , ganis and colleagues demonstrated the effects of using deliberate methods to beat the system .
accuracy rates during the normal paradigm were 100% , but when participants were instructed to make unnoticeable movements in certain fingers or toes , the rates declined to 33% .
the authors noted that cognitive countermeasures would be similarly effective for example , participants could think of specific memories in order to make answers to neutral questions seem more personally relevant .
although neuroimaging for lie detection has improved considerably over the past decade , there are a number of frequently cited concerns with the current state of the field .
in addition to vulnerabilities to countermeasures , critics question whether deception is what is actually being tested , as opposed to memory or attention .
moreover , deception in the real world often entails highly emotional and complex situations , which might never be replicable in the lab .
lastly , as evidenced by kozel and colleagues study , even if neuroimaging can accurately identify those who are telling lies , the risk of making false predictions remains precariously high .
before contrasting respective applications of pain and deception neuroimaging to the courtroom setting , it is necessary to explicate the importance of making this comparison in the first place .
the legal system is a conservative domain , relying on laws and jurisprudence that have evolved over centuries .
proposed sources of evidence must achieve acceptance not only among the scientific community but also among judges , who are responsible for determining relevancy and admissibility . despite the fact that using fmri for deception detection could one day be a valuable resource for the courts ,
its current state of reliability is remarkably far from what it would need to be .
nevertheless , in three recent trials , defendants and witnesses have tried to use the technology to confirm their credibility ; in each case , the judge ruled the evidence to be inadmissible .
attempts to introduce the technology well before it was established and reliable have significantly set back the prospect of applying deception neuroimaging to the courtroom , as many scholars , judges , and members of the public are now skeptical of the idea . while pain neuroimaging has distinct benefits and weaknesses , its inexorable association with fmri for lie detection can not be denied .
however , by learning from the mistakes with deception detection and analyzing the ways in which the two techniques overlap and diverge , we can form a better idea of the extent to which pain neuroimaging may be accepted in the courtroom as well as anticipate potential roadblocks that might arise .
the most practical connection between neuroimaging for pain versus deception is that both applications seek to provide objective measures for issues that are notoriously difficult to detect with the naked eye . while researchers have elucidated common activation patterns for the respective processes , some studies report activation in areas not found in other experiments .
the lack of exclusively confined networks might therefore elicit concerns with reliability for both phenomena .
an additional problem involves contrived laboratory settings that might not reflect real - world complexities .
for example , the type of deception that would be implicated in criminal trials would typically entail very high stakes and a slew of concurrent emotions .
moreover , people undergoing an fmri - based lie detection test would never be instructed to lie , which is a prominent feature of current deception studies .
similarly , the acute pain produced in the lab lasts for a matter of seconds .
it is unclear whether acute pain from a persistent injury would present the same activation patterns observed with temporarily induced pain .
although it has better spatial and temporal resolution than other brain imaging techniques , fmri still can not account for factors such as the actual speed at which neurons fire .
furthermore , since the technique relies on blood flow , it is an indirect measure of brain activity and does not tell us exactly what is occurring at the neuronal level .
other concerns involve vulnerabilities to misinterpretation of findings and spurious results due to multiple statistical comparisons . however , some scholars believe that these criticisms might be overemphasized .
in addition to issues with the protocols and techniques themselves , both uses of neuroimaging raise questions specific to the legal setting .
to start , how accurate does the technology need to be in order to be admitted in court ? deciding what threshold is acceptable for admissibility will most likely contain some degree of arbitrariness .
moreover , measurements of accuracy will need to consider levels of sensitivity ( correctly identifying those who are lying or in pain ) and specificity ( correctly identifying those who are not lying or are not in pain ) . as with many emerging technologies , factors of cost and distributive justice will also be present . if fmri evidence was considered admissible , whether for pain or deception , it would be inequitable for only those who could afford the technology to use it .
even though the current cost of fmri usage might drop if the demand increased , defendants represented by public defenders would still not have the resources to pay for the technology .
issues of access also elicit concerns with the csi effect , in which jurors might come to expect neuroscientific evidence and make negative assumptions in its absence .
inherent in this theory is the notion of seductive allure , whereby jurors put more stock in brain images than is merited . while there is doubt regarding the existence of these effects , the mere fact that many are worried about them foreshadows the difficulty of introducing new technologies into the courtroom
despite the shared problems faced by these two applications of fmri , pain neuroimaging might diverge in enough meaningful ways to yield more favorable chances of acceptance .
although both fields are still in their infancy , pain neuroimaging seems to offer more robust results , especially in regard to the detection signature .
as critics have noted , neural regions believed to be involved in deception overlap with other cognitive functions such as memory and attention .
a recent study by liang and colleagues demonstrated that painful stimuli produce activation patterns in the primary sensory cortex that are differentiable from those of other sensory processes .
this suggests that certain neurons within areas of the pain matrix are responsive specifically to pain even if the general regions are activated by other sensory modalities . with respect to questions of accuracy , sensitivity , and specificity ,
it is difficult to make a direct comparison since not all studies lend themselves to analysis of such factors .
however , at least in regard to overall accuracy , neuroimaging for deception detection faces clear challenges from countermeasures .
while pain neuroimaging studies have not explicitly tested measures to beat the system , the nature of pain itself might render it less vulnerable . with deception , cognitive strategies
can successfully be employed to trick the technology in a manner imperceptible to outside observers .
in contrast , simply imagining pain elicits noticeably reduced activation patterns in the pain matrix .
thus , successful attempts at countermeasures during pain neuroimaging would most likely involve self - infliction of pain .
hypothetically , an individual could bite his or her tongue to induce pain , but simple safeguards like requiring the person to use a mouth guard during scanning could circumvent such issues . apart from countermeasures
, scholars and judges will still need to determine what levels of accuracy , sensitivity , and specificity are sufficient to constitute acceptance in the courtroom .
it is important to remember that this discussion analyzes pain neuroimaging as applied to tort law only , whereas deception detection , due to its broader nature , is considered in both civil and criminal settings . as a result ,
the thresholds for pain versus deception neuroimaging might not need to be equivalent , given the different stakes involved in tort law compared to criminal law .
the burden of proof , for instance , is much weaker in torts , where juror decisions are based on the preponderance of evidence as opposed to the beyond a reasonable doubt standard .
while any objective measure would need to be reliable in order to serve its purpose , judges , juries , and the public might be more willing to accept a 90% accuracy rate in the tort context than the criminal one .
the nuances between various legal doctrines are also important in assessing the degree to which each application of neuroimaging challenges fundamental traditions . even though the science is not yet there , much of the hype regarding neuroimaging in court imagines using fmri to prove or discredit an individual 's claims .
this could take the form of demonstrating the defendant is lying about his innocence or intent , or showing that the plaintiff is clearly in pain .
our knowledge of the neuroscience behind these processes will likely never be definitive enough to conclusively meet such objectives , but for the sake of argument let us temporarily indulge this widely held concern and consider the relative impacts on legal traditions . in the case of criminal law ,
if actus reus and mens rea can both be determined by neuroimaging , the role of the jury becomes fairly negligible .
in contrast , if the presence of pain is shown to be undeniable , juries in tort law would still be tasked with assessing causation as well as awarding damages .
the point here is that deception detection is much more central to the role of the jury in criminal law . as legal scholar adam kolber articulates : according to [ justice clarence ] thomas , [ a ] fundamental premise of our criminal trial system is that the jury is the lie detector. his remarks admit the possibility that even perfectly accurate lie - detection evidence could be excluded from the courtroom on the ground that it would infringe the province of the jury .
neuroimaging for pain appears to be significantly less controversial due to the lower stakes of tort cases , the different standard used for the burden of proof , and the dual role that tort juries play in both determining responsibility and deciding the subsequent consequences .
much research still needs to be conducted to improve accuracy rates , test the techniques across various population groups , establish the efficacy in real - world settings , and determine safeguards against countermeasures . despite the current state of the field ,
the pace of progress is so rapid that conversations regarding fmri 's potential implications , especially when applied to the courtroom setting , are necessary well in advance of the technology reaching its prime .
at least one purpose of the legal system is to ascertain the truth , and the search for more objective measures is vital to achieving that goal .
neuroimaging has been proposed for ameliorating subjective issues in assessing pain and deception , and the two applications face common obstacles in entering the legal realm . however , when the nature of tort law , the lower susceptibility for countermeasures , and the fine distinction between pain and other sensory modalities are taken into account , the prospect of using neuroimaging in the courtroom to support claims of pain seems significantly more promising .
nevertheless , many judges and members of the public are skeptical of using neuroimaging as an objective measure due to premature excitement with fmri for lie detection . as a result ,
emphasizing the key differences between pain and deception , as well as learning from hasty mistakes with fmri for lie detection , will be essential for moving pain neuroimaging beyond academic and clinical settings and into actual legal practice . | from an observer 's perspective , pain is a fairly nebulous concept it is not externally visible , its cause is not obvious , and perceptions of its intensity are mainly subjective . if difficulties in understanding the source and degree of pain are troublesome in contexts requiring social empathy , they are especially problematic in the legal setting .
tort law applies to both acute and chronic pain cases , but the lack of objective measures demands high thresholds of proof .
however , recent developments in pain neuroimaging may clarify some of these inherent uncertainties , as studies purport detection of pain on an individual level . in analyzing the scientific and legal barriers of utilizing pain neuroimaging in court ,
it is prudent to discuss neuroimaging for deception , a topic that has garnered significant controversy due to premature attempts at introduction in the courtroom . through comparing and contrasting the two applications of neuroimaging to the legal setting
, this paper argues that the nature of tort law , the distinct features of pain , and the reduced vulnerability to countermeasures distinguish pain neuroimaging in a promising way .
this paper further contends that the mistakes and lessons involving deception detection are essential to consider for pain neuroimaging to have a meaningful future in court . |
cutaneous leishmaniasis ( cl ) caused by leishmania species represents a complex disease with wide spectrum of clinical features ( 1 ) .
it is endemic in over 88 countries , mainly in tropical and sub - tropical areas ( 2 ) , where over 90% of the cases occur in afghanistan , brazil , algeria , peru , iran , saudi arabia and syria ( 3 ) .
surveillance data indicate the number of cases has sharply increased in recent years , as documented in several countries ( 1 ) .
cutaneous leishmaniasis is endemic in over 50% of the provinces of iran ( 4 , 5 ) ; anthroponotic cl ( acl ) caused by l. tropica , exists mainly in urban areas of many large and medium size cities ( 69 ) .
the main host is human ( 2 , 5 , 10 ) . whereas , zoonotic cl ( zcl ) due to l. major presents in rural areas ( 11 ) where the major reservoir host is gerbil ( 1214 ) .
several factors which contribute to the spread of cl throughout the world are urbanization , migration , war situation , environmental modification and also to some extent improved diagnosis and case notification ( 15 ) . outbreaks of cl have currently occurred throughout iran , where a suitable environment is present for breeding of the vector , propagation of the organism and transmission of the causative agent ( 1618 ) .
the primary objective of this study was to assess the present status of cl in endemic areas of baft , currently orzoieh district .
first emergence was started as epidemic in 1998 and the disease became endemic , thereafter ( 17 ) .
after the massive earthquake , it seemed that the feature of cl has been changing in this area , mainly because of the recent expansion of villages and towns , as well as movement of the population for various occupational reasons . due to the spread of the cl cases to the neighboring regions and reports by the physicians and health authorities in the area , the cl lesions present different clinical and epidemiological characteristics
therefore , the aim of the present study was to assess the magnitude of the cl infection and to identify the causative agent by a molecular method for future control strategy and current therapeutic measures .
this study was carried out in orzoieh district , in south - west kerman province , south east of iran .
this district is recently segregated from baft and consists of 4 main regions including , vakilabad , soltanabad , dolatabad and shahmaran .
orzoieh surrounds 4600 km area , located 125 km south to the city of baft , adjacent to jiroft district and hormozgan province .
due to the productivity of soil in this region , 6000 hectares of the land is cultivated by all kinds of tropical crops including orchard of oranges , summer crops and various vegetables .
this region has recently been attracted by residents of isfahan , yazd and people from other provinces for agricultural purposes .
this study was carried out as descriptive and prospective census in house- to house visits during march 2011 to february 2012 for a period one year .
the entire population of the affected villages was screened and followed - up actively and passively .
a questionnaire was completed for each individual , recording demographic characteristics ( sex , age , location and residence ) and clinical status of cl ( location of lesions , number and type of lesions and time of contraction ) .
the entire body was clinically examined by two health personnel and those with suspected lesions were referred for further clinical examination by an experienced physician and parasitological examination .
skin scrapings were taken by a scalpel and blade from the edge of each active lesion , smeared on a glass slide , fixed with methanol and stained by giemsa .
direct skin smears obtained from the borders of lesions were used for nested - pcr .
all smears were transferred o the leishmaniasis research center at medical school in kerman for further molecular study .
dna was extracted by proteinase k ( roche , germany ) from the smear preparations following the method of noyes et al ( 19 ) .
first , two external general primers ; csb2xf 5-cgagcagcagaaactcccgttca-3 and csb1xr 5-atttttcgcgattttcgcagaacg-3 and second , two other internal specific primers ; 13z 5-actgggggttggtgtaaaatag-3 and lir5tcgcagaacgcccct-3 were used .
the pcr products were visualized by 1.5% agarose gel electrophoresis ( uvitech , cambridge , uk ) , using a dna size marker ( 100bp ) at 260 nm wavelength . the protocol was reviewed and subsequently approved by the ethic committee of kerman university of medical sciences .
the consent of patients was obtained and the confirmed cases were referred to a local physician for treatment of cl .
a spss software was used for data entry and x - test was performed for any significant differences at p<0.05 .
this study was carried out in orzoieh district , in south - west kerman province , south east of iran .
this district is recently segregated from baft and consists of 4 main regions including , vakilabad , soltanabad , dolatabad and shahmaran .
orzoieh surrounds 4600 km area , located 125 km south to the city of baft , adjacent to jiroft district and hormozgan province .
due to the productivity of soil in this region , 6000 hectares of the land is cultivated by all kinds of tropical crops including orchard of oranges , summer crops and various vegetables .
this region has recently been attracted by residents of isfahan , yazd and people from other provinces for agricultural purposes .
this study was carried out as descriptive and prospective census in house- to house visits during march 2011 to february 2012 for a period one year .
the entire population of the affected villages was screened and followed - up actively and passively .
a questionnaire was completed for each individual , recording demographic characteristics ( sex , age , location and residence ) and clinical status of cl ( location of lesions , number and type of lesions and time of contraction ) .
the entire body was clinically examined by two health personnel and those with suspected lesions were referred for further clinical examination by an experienced physician and parasitological examination .
skin scrapings were taken by a scalpel and blade from the edge of each active lesion , smeared on a glass slide , fixed with methanol and stained by giemsa .
direct skin smears obtained from the borders of lesions were used for nested - pcr .
all smears were transferred o the leishmaniasis research center at medical school in kerman for further molecular study .
dna was extracted by proteinase k ( roche , germany ) from the smear preparations following the method of noyes et al ( 19 ) .
first , two external general primers ; csb2xf 5-cgagcagcagaaactcccgttca-3 and csb1xr 5-atttttcgcgattttcgcagaacg-3 and second , two other internal specific primers ; 13z 5-actgggggttggtgtaaaatag-3 and lir5tcgcagaacgcccct-3 were used .
the pcr products were visualized by 1.5% agarose gel electrophoresis ( uvitech , cambridge , uk ) , using a dna size marker ( 100bp ) at 260 nm wavelength .
the protocol was reviewed and subsequently approved by the ethic committee of kerman university of medical sciences .
the consent of patients was obtained and the confirmed cases were referred to a local physician for treatment of cl .
a spss software was used for data entry and x - test was performed for any significant differences at p<0.05 .
a total of 18308 inhabitants , aged 173 years ( mean age ; 22.7 years ) including of 9011 males ( 49.2% ) and 9297 females ( 50.8% ) were examined for presence of active or chronic lesions ( table 1 ) .
most of the individuals were < 30 years ( 64.2% ) and the smallest age group was > 50 years ( 13.2% ) .
the overall prevalence rate was 4.7% including 30 cases of active lesions and 839 cases of scar , distributed among males ( 4.3% ) and females ( 5.2% ) with a significant difference ( p < 0.01 , table 2 ) .
all age groups were infected ( table 3 ) , however subjects < 10 years of age indicated the highest ( 6.3 % ) and > 50 years the lowest rate of cl infection ( 1.1% ) , respectively .
overall , there was a significant difference between < 10 years old children and other age groups ( p < 0.001 ) .
the proportion of infection was the highest in soltanabad ( 14.7% ) , followed by vakilabad ( 6.8% ) , dolatabad ( 3.2% ) and shahmaran ( 2.8% ) .
the majority of cases ( 38.2% ) had 2 lesions ( mean ; 2.1 ) .
the hands ( 35% ) were the most common place of involvement , followed by face(26% ) , hands and legs ( 21.7% ) , hands and face ( 10.9% ) , legs ( 5.7% ) and other parts of the body ( 0.7% , fig .
1 ) . dna extracted from direct smear preparations showed 29 cases consisting of fragments of 560 bp , while only one case displayed a fragment of 750 bp , corresponding to l. major ( 99.9% ) and l. tropica ( 0.1% ) , respectively ( fig .
leishmaniasis is still a significant cause of morbidity and mortality in numerous countries across the world , including iran ( 2 , 3 ) .
cl also affects a considerable portion of human beings with a major health impact in recent years ( 1 ) .
although , l. tropica is the main species in endemic foci of various districts in kerman province ( 8) , the district of orzoieh is determined to be purely of zcl nature .
the only case detected as l. tropica was a native resident who had history of travelling to jiroft , an area adjacent to this district with a known acl focus ( 20 ) .
the cl cases were commonly found in females more significantly than males . however , there is no definite explanation for such a sex difference .
it might be attributed to individual and behavioral risk factors which could play a role as previously reported by others ( 16 , 21 ) .
all age groups were infected , although there was a strong tendency for cases to be prevalent more significantly in children of < 10 years than other age groups .
this is likely expected because children in this age play outdoors and are more exposed to the source of infection than others .
the clinical manifestations of cl were in general that of multiple lesions , with a predominant location on hands , face , hands - legs or hands - face ( 11 , 12 ) .
these extrinsic factors are consistent with the molecular identification by nested pcr which showed that l. major was the only causative agent in the area as previously reported in other places ( 5 , 8 , 11 , 12 ) . in this study
nested pcr with high specificity and sensitivity was applied to identify the causative parasite species among the inhabitants .
this method is currently the most commonly used technique in discrimination of species ( 8 , 11 , 13 , 18 , 19 ) .
the present status of the cl cases indicates that the study area is designated a recently emerged focus occurred for the first time in 1998 ( 17 ) and sustained as endemic , thereafter ( 1213 ) .
it appeared that the source of infection was introduced by the new settlements that arrived in the area from endemic regions for agricultural purposes ( 17 ) .
in addition , the environmental and ecological changes favored an increase in the vector population and reservoir host , gerbils ( 1213 ) which might also have played some roles in propagation of the life cycle and transmission of the causative organisms .
the semi nested - pcr was positive for 0.05% of phlebotomus papatasi in the region , a further evidence for a zcl focus ( 13 ) . furthermore , another investigation indicated that p. papatasi was the predominant species and they reported prevalence of 1.1% for ulcers and 10.4% for scars among inhabitants in 2003
they concluded that this gerbil might have played a role as the reservoir host in the focus .
this kind of information clearly has therapeutic significance and helpful in selection of optimal therapy .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . | background : the objective of this study was to assess the magnitude of the cutaneous leishmaniasis ( cl ) disease and identification of the causative agent by nested - pcr for current control strategy.methods:this study was carried out as descriptive house - to - house visits in orzoieh district in kerman province , south east iran , during 20112012 .
a questionnaire was completed for each individual consisting of demographic and clinical data .
suspected individuals were examined by direct smear microscopy and subsequent identification by nested - pcr .
x2-test was used for any significance ( p<0.05).results : a total of 18308 inhabitants ( mean age ; 22.7 yr ) consisting of 9011 males ( 49.2% ) and 9297 females ( 50.8% ) were examined for the presence of active or chronic lesions .
the overall prevalence was 4.7% , including 30 cases of active and 839 cases of scar , distributed more significantly ( p<0.01 ) in females ( 5.2% ) than males ( 4.3% ) .
individuals < 10 years of age showed the highest ( 6.3% ) and > 50 years the lowest rate of cl disease , respectively ( p<0.001 ) .
the proportion of infection was the highest in soltanabad ( 14.7% ) , followed by vakilabad ( 6.8% ) , dolatabad ( 3.2% ) and shahmaran ( 2.8% ) .
the majority of cases had 2 lesions ( mean ; 2.1 lesions ) .
hand was the most common site of involvement ( 35% ) , and then face ( 26% ) , and multiple locations ( 39% ) .
nested - pcr displayed 29 isolates as leishmania major and one isolate l. tropica .
the cl disease first emerged in 1998 as epidemic in the area and appeared endemics , thereafter.conclusion:l .
major was the sole species caused zcl .
these findings are necessary for future control programs and strategic planning . |
2.7 million people are estimated to have diabetes in saudi arabia , with estimated prevalence of 16.2% .
modern insulin analogues are a convenient new approach or tool to glycaemic control , associated with low number of hypoglycaemia and favourable weight change .
a1chieve , a multinational , 24-week , non - interventional study , assessed the safety and effectiveness of insulin analogues in people with t2 dm ( n = 66,726 ) in routine clinical care .
please refer to editorial titled : the a1chieve study : mapping the ibn battuta trail .
the patient characteristics for the entire cohort divided as insulin - nave and insulin users is shown in the table 1 .
the majority of patients ( 47.02% ) started on or switched to biphasic insulin aspart .
other groups were insulin detemir ( n = 360 ) , insulin aspart ( n = 37 ) , basal insulin plus insulin aspart ( n = 96 ) and other insulin combinations ( n = 57 ) . overall demographic data after 24 weeks of treatment , overall hypoglycaemic events reduced from 10.1 events / patient - year to 3.9 events / patient - year in insulin user group whereas hypoglycaemia increased from 0.7 events / patient - year to 3.9 events / patient - year in insulin naive group . however , this hypoglycaemia incidence in insulin naive group at 24 weeks was still lower than that observed in insulin users at baseline .
blood pressure decreased and overall lipid profile improved at week 24 in complete cohort [ tables 2 and 3 ] .
all parameters of glycaemic control improved from baseline to study end in the total cohort [ table 4 ] .
overall efficacy data of the total cohort , 489 patients started on biphasic insulin aspart ogld , of which 238 ( 48.6% ) were insulin nave and 251 ( 51.4% ) were insulin users .
after 24 weeks of starting or switching to biphasic insulin aspart , hypoglycaemic events reduced from 8.2 events / patient - year to 5.7 events / patient - year in insulin user group while hypoglycaemia increased from 8.2 events / patient - year to 5.7 events / patient - year in insulin naive group .
body weight decreased in both insulin nave and insulin user groups [ tables 5 and 6 ] .
biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [ table 7 ] .
biphasic insulin aspartoral glucose - lowering drug efficacy data of the total cohort , 96 patients started on basal + insulin aspart ogld , of which 16 ( 16.7% ) were insulin nave and 80 ( 83.3% ) were insulin users .
after 24 weeks of starting or switching to basal + insulin aspart hypoglycaemic events reduced from 13.7 events / patient - year to 2.3 events / patient - year in insulin user group , whereas hypoglycaemia increased from 0.0 events / patient - year to 8.1 events / patient - year in insulin naive group . a decrease in body weight
basal+insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [ table 10 ] .
basal+insulin aspartoral glucose - lowering drug efficacy data of the total cohort , 360 of patients started on insulin detemir ogld , of which 282 ( 78.3% ) were insulin nave and 78 ( 21.7% ) were insulin users .
after 24 weeks of starting or switching to insulin detemir , hypoglycaemic events reduced from 6.2 events / patient - year to 2.9 events / patient - year in insulin user group , while hypoglycaemia increased from 0.5 events / patient - year to 3.3 events / patient - year in insulin naive group . a decrease in body weight
was observed in both insulin naive and insulin user groups [ tables 11 and 12 ] .
insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [ table 13 ] .
insulin detemiroral glucose - lowering drug efficacy data of the total cohort , 37 patients started on insulin aspart ogld , of which 17 ( 45.9% ) were insulin nave and 20 ( 54.1% ) were insulin users .
after 24 weeks of treatment starting or switching to insulin aspart , hypoglycaemic events reduced from 10.4 events / patient - year to 0.0 events / patient - year in insulin user group , whereas hypoglycaemia increased from 3.1 events / patient - year to 8.4 events / patient - year in insulin naive group .
a decrease in body weight was observed in insulin user group [ tables 14 and 15 ] .
insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin aspart oglds for both insulin nave and insulin user groups [ table 16 ] .
of the total cohort , 489 patients started on biphasic insulin aspart ogld , of which 238 ( 48.6% ) were insulin nave and 251 ( 51.4% ) were insulin users .
after 24 weeks of starting or switching to biphasic insulin aspart , hypoglycaemic events reduced from 8.2 events / patient - year to 5.7 events / patient - year in insulin user group while hypoglycaemia increased from 8.2 events / patient - year to 5.7 events / patient - year in insulin naive group . body weight decreased in both insulin nave and insulin user groups [ tables 5 and 6 ] .
biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [ table 7 ] .
of the total cohort , 96 patients started on basal + insulin aspart ogld , of which 16 ( 16.7% ) were insulin nave and 80 ( 83.3% ) were insulin users .
after 24 weeks of starting or switching to basal + insulin aspart hypoglycaemic events reduced from 13.7 events / patient - year to 2.3 events / patient - year in insulin user group , whereas hypoglycaemia increased from 0.0 events / patient - year to 8.1 events / patient - year in insulin naive group . a decrease in body weight
basal+insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to basal + insulin aspart oglds for both insulin nave and insulin user groups [ table 10 ] .
of the total cohort , 360 of patients started on insulin detemir ogld , of which 282 ( 78.3% ) were insulin nave and 78 ( 21.7% ) were insulin users .
after 24 weeks of starting or switching to insulin detemir , hypoglycaemic events reduced from 6.2 events / patient - year to 2.9 events / patient - year in insulin user group , while hypoglycaemia increased from 0.5 events / patient - year to 3.3 events / patient - year in insulin naive group . a decrease in body weight
was observed in both insulin naive and insulin user groups [ tables 11 and 12 ] .
insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for both insulin - nave and insulin user groups [ table 13 ] . insulin detemiroral glucose - lowering drug efficacy data
of the total cohort , 37 patients started on insulin aspart ogld , of which 17 ( 45.9% ) were insulin nave and 20 ( 54.1% ) were insulin users .
after 24 weeks of treatment starting or switching to insulin aspart , hypoglycaemic events reduced from 10.4 events / patient - year to 0.0 events / patient - year in insulin user group , whereas hypoglycaemia increased from 3.1 events / patient - year to 8.4 events / patient - year in insulin naive group .
a decrease in body weight was observed in insulin user group [ tables 14 and 15 ] .
insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin aspart oglds for both insulin nave and insulin user groups [ table 16 ] .
our study reports improved glycaemic control following 24 weeks of treatment with any of the insulin analogues ( biphasic insulin aspart ; basal + insulin aspart ; insulin detemir ; insulin aspart ) with or without ogld .
though the findings are limited by number of patients , still the trend indicates that insulin analogues can be considered effective and possess a safe profile for treating type 2 diabetes in eastern saudi arabia . | background : the a1chieve , a multicentric ( 28 countries ) , 24-week , non - interventional study evaluated the safety and effectiveness of insulin detemir , biphasic insulin aspart and insulin aspart in people with t2 dm ( n = 66,726 ) in routine clinical care across four continents.materials and methods : data was collected at baseline , at 12 weeks and at 24 weeks . this short communication presents the results for patients enrolled from eastern saudi arabia.results:a total of 1040 patients were enrolled in the study .
four different insulin analogue regimens were used in the study .
study patients had started on or were switched to biphasic insulin aspart ( n = 489 ) , insulin detemir ( n = 360 ) , insulin aspart ( n = 37 ) , basal insulin plus insulin aspart ( n = 96 ) and other insulin combinations ( n = 57 ) . at baseline glycaemic control was poor for both insulin nave ( mean hba1c : 10.0% ) and insulin user ( mean hba1c : 9.2% ) groups .
after 24 weeks of treatment , both the groups showed improvement in hba1c ( insulin nave : 2.7% , insulin users : 1.7% ) .
no major hypoglycaemic episodes were observed at 24 weeks .
sadr was reported in 0.6% of insulin users.conclusion:starting or switching to insulin analogues was associated with improvement in glycaemic control with a low rate of hypoglycaemia . |
inguinal hernia repair is one of the most common surgical procedures performed worldwide , with [ sim[20 million surgeries performed every year .
although controversies remain in the literature regarding the different techniques and surgical indications , there is a need to improve outcomes vis - - vis chronic pain , operative time , costs , and aesthetic benefits . in the field of minimally invasive techniques ,
several studies suggest advantages regarding less chronic postoperative pain and numbness , faster recovery , less complications ( such as infection and hematoma ) , and even costs , when compared to open access for hernia repair . in laparoscopic surgery
there are 2 main techniques for hernia repair : transabdominal preperitoneal ( tapp ) and totally extra peritoneal ( tep ) approaches , and both use a mesh in the preperitoneal space .
the search for better outcomes has led surgeons to look for alternatives for laparoscopic inguinal hernia repair .
minilaparoscopy ( mini ) , by the reduced diameter of the traditional laparoscopic instruments , is the natural advancement of endoscopic hernia repair , and may lead inguinal hernia surgery in a new direction . with the advent of low - friction trocars , longer and precisely engineered for low - friction forces between the trocar and the mini instruments ,
improvement has been found in surgical precision during dynamic tasks ( e.g. , dissection of hernia sac ) , causing less stress and higher efficiency resulting in ease of tasks .
trocar dislocation and skin reinsertions were significantly diminished , consequently reducing skin trauma , resulting in improved aesthetics . although advantageous in several ways , mainly because of doing away with mesh fixation , resulting in less postoperative pain and faster recovery , tep has not been widely adopted because of its complexity , especially in creating the preperitoneal space and understanding inguinal anatomy in a narrow space .
the hypothesis was that combining the established advantages of tep with the delicacy , precision , and increased visualization of the mini in narrow spaces , it would be possible to develop an operative technique that would be simultaneously attractive for the surgeon , because it is simpler and faster to execute and for the patient , it can also promote less abdominal wall trauma and improve the aesthetic outcome .
from may 2012 through september 2015 , 58 laparoscopic inguinal hernia repairs were performed by the tep technique in the surgery department of the hospital universitrio gaffree guinle ( hugg ) , federal university of the state of rio de janeiro ( unirio ) .
exclusion criteria were patients under 18 years of age , use of systemic corticosteroids , and complex cases , including recurrent hernia , inguinal bilateral hernia , active infection , inguinoscrotal hernia , and history of extraperitoneal procedures .
patients who agreed to participate were required to read and sign an informed written consent . in this study , 58 patients were included and were divided into the control group ( cg ) and minilaparoscopic group ( mlg ) . the surgical team , equipment , and patient positioning for both groups are summarized in figure 1 . operating room setup and trocar positions for a left inguinal hernioplasty . after inserting the camera ( c ) ,
if a good operative space is obtained , the best choice is to place the next trocar at the b position ; otherwise , the second trocar is inserted at b position .
a , b , and b can be either 6 mm ( cg ) or 3.5 mm ( mlg ) .
thirty - six surgeries were performed by the traditional tep technique in the cg . in both groups ,
patients were under general anesthesia , in a supine trendelenburg position , without bladder catheterization .
a single dose of cefazolin ( 1 g ) , was administered as a prophylactic antibiotic at anesthesia induction .
after dissection of the muscular fibers and visualization of the posterior sheath , an 11-mm reusable trocar was positioned with a u suture with a polypropylene 0 thread . through the 11-mm trocar
was progressively created by blunt telescopic dissection and co2 insufflation at a continuous pressure of 12 mm hg .
once enough space was created , two 6-mm reusable trocars were placed ( figure 1 ) : one in an infraumbilical position and the other in the iliac fossae , ipsilateral to the hernia . after the instruments were positioned , we started the dissection of frouchaud 's myopectineal orifice , along with the identification of all the following anatomical structures : pubic bone , inferior epigastric vessels , gonadal vessels , deferens duct ( male patients ) , round ligament ( female patients ) , cooper 's ligament , and the urinary bladder , followed by identification , dissection , and reduction , when present , of the indirect sacs , cord lipomas , and hernial contents .
after properly finishing dissection , we inserted a trimmed portion of polypropylene mesh ( measuring 16 11 cm ) with no folds into the cavity with the paraumbilical 11-mm trocar ( figure 2 ) .
( b ) intra abdominal view of the hernia site , showing final adjustments of the mesh .
when residual pneumoperitoneum was present , a veress needle puncture was used to evacuate the gas and the aponeurosis was sutured with polypropylene 0 .
the type of hernia ( indirect , direct , or mixed ) and operative timing were recorded in all cases .
another 22 procedures were performed by minilaparoscopic approach ( mlg ) , with karl storz new generation of minilaparoscopic instruments ( 3 mm low
surgery was performed with exactly the same steps as in the conventional technique ( cg ) except for simple substitution of the 2 working trocars of 6 mm for those of 3.5 mm and , consequently , the use of 3-mm low - friction instruments .
patients in both groups were medicated in the postoperative period in a standard manner : with nonsteroidal antiinflammatory drug and on - demand use of analgesics ( dipyrone 1 g iv ) .
the number of doses of dipyrone needed was also recorded , along with the value obtained on the visual analog pain scale at 6 hours after surgery and at hospital discharge ( 24 h after surgery ) . in this
prospective series , all procedures were performed by the same surgeon ; there was no patient selection for one or the other technique , and the type of surgery was chosen by instrument availability .
a minilaparoscopic set of instruments was received as a loan for a limited time . before and after this period , the standard 5-mm teps were performed and during the loan period , only the mini - tep was performed .
the operative time was also recorded in all cases . for statistical analysis , the data were stored in spss statistical software ( ibm , chicago , illinois , usa ) , and standard statistical tests were performed . to evaluate pain and operative time
, we performed the mann - whitney nonparametric test , whereas for the use of on - demand analgesia ( dipyrone ) , a test was performed .
the median age for cg was 55 ( 17 ) years , whereas for mlg was 53 ( 14 ) years .
for the cg the number of indirect , direct , and mixed hernias was 19 , 15 , and 2 , respectively .
on the other hand , for mlg , there were 13 cases of indirect and 9 cases of direct hernias .
the 2 parameters pain at 6 h after surgery and operative time were higher in the cg ( p = .035 and 0.007 ) than in the mlg .
there were no differences between groups regarding pain at discharge and the use of rescue analgesia .
in laparoscopic surgery , there are 2 main techniques for hernia repair , tapp and tep , with standard use of mesh . comparing both approaches , in tapp
there is the advantage of obtaining an intraperitoneal view of abdominal structures , whereas in tep , there is only the view of the space created extraperitoneally .
however , studies have suggested that tep may be a better option , because it eliminates the need of creating a peritoneal flap that subsequently must be closed .
mesh fixation is also not necessary for tep , resulting in less chronic pain and faster recovery . in this study
, we noticed low pain scores in both groups of tep repairs and lower in the mlg group .
the main reason not to operate in more complex cases recurrent , scrotal , and bilateral hernias in the present investigation was to avoid confounding factors , facilitating statistical analysis .
the authors have routinely used minis in operations for bilateral and recurrent hernias , but usually have not used them in repair of large scrotal hernias . in those cases , a hybrid procedure with 5-mm instruments has been the surgery of choice .
described in the early 1990s by dulucq et al , tep involves the use of a large mesh that covers the myopectineal orifice at the preperitoneal layer of the fascia transversalis .
endoscopic hernia repair has been considered to be slightly superior to open approaches , mainly because it is associated with an earlier recovery , less chronic pain , and a lower risk of infection . although mostly attractive and advantageous , endoscopic repair of inguinal hernias is still an unpopular procedure among surgeons .
tep is a complex procedure with a steep learning curve , being considered the most difficult among the laparoscopic procedures , and some have suggested that the learning curve may entail as many as 250 cases .
it also carries the risk of severe complications , not commonly seen in open procedures . to simplify the procedure and reduce costs , avoidance of dissecting balloons and
mesh fixation has been advocated , being the core technique of both groups in this study . with the advent of the reduced - port surgery era , minilaparoscopy regained attention as an attractive option for improving the cosmetic appearance , while preserving the most valuable laparoscopic principle of instrument triangulation .
in addition to its known advantages to surgeons who have been performing minilaparoscopy for years , minilaparoscopic instruments have been improved for better performance at lower cost , thus allowing mini procedures to be an even more attractive option .
these advantages now greatly surpass aesthetics , the only proven advantage of single - port and notes . the search for better outcomes has led surgeons to keep looking for new alternatives for hernia repair , and the minilaparoscopic technique is one that may guide hernia repair into a new direction .
minilaparoscopy was originally used for tep in the late 1990s , but previous use of minilaparoscopic instruments did not achieve the expected results , mostly because the older instruments were flimsy , fragile , and costly .
today , the instruments are more resistant and cost effective , and the new low - friction instruments are a real game changer .
the advent of the new low - friction trocars , engineered for low - friction forces between the trocar and the mini instruments , improves surgical precision during dynamic tasks ( e.g. , dissection of the hernia sac ) , resulting in less stress and higher effectiveness , especially in hernia surgery .
trocar dislocation and skin reinsertions were significantly diminished , consequently reducing abdominal trauma , resulting in less pain and improved aesthetics .
( figure 3 ) this technique of mini - tep without mesh fixation also entails a considerable reduction in cost , because it does not use expensive meshes , disposable instruments , the fragile 3-mm laparoscope , sutures , glue , or tackers , and hence it is possible to perform this type of repair on a larger number of patients to their advantage .
( b ) details of the new low - friction 3.5-mm trocar , precisely engineered for low - friction forces between the trocar and the mini - instruments , having no valve and no seal .
previous studies have evaluated operative time , pain , the aesthetic aspect of scars , and the results have brought optimism for the minilaparoscopic approach .
the evident aesthetic benefits are based on patient satisfaction regarding the scars of the procedure .
the difference in operative time favoring minilaparoscopy was apparently small ( 4.5 min ) , but it was not only statistically significant ( p < .05 ) , representing 14% shorter time , but also a possible unexpected result as many would expect the mini instruments to perform worse than the 5-mm ones . the most possible reasons for the better performance in time for minis are easier manipulation of mini - instruments with low - friction trocars increasing dexterity and precision and better visualization of the structures in the restricted visual field . an important feature of minilaparoscopic surgery , the decreased surgical trauma is achieved by the reduction in diameter of the laparoscopic instruments and trocars .
this improvement is obtained with the maintenance of range of motion in triangulation throughout surgery . along with the benefit of low - friction trocars
, minilaparoscopy has the potential of improving ergonomics and , therefore , provides the surgeon the precision that is needed .
clear visualization is mandatory in laparoscopic procedures , and especially in the ones performed in restricted surgical spaces like the preperitoneum .
one of mini 's unique features is the reduced optical shadow produced by the minilaparoscopic instrument .
enhanced visualization achieved with the mini is remarkable , allowing easier identification of the structures facilitating procedures such as tep inguinal hernia repair .
this gain in precision provided by better visibility and lower friction , becomes particularly important when it is necessary to work in a previously nonexistent space , such as the preperitoneal space .
the reduced size of mini - instruments can enhance the view to a range of up to 2.7 times in magnification .
our results support the benefits suggested in previous noncomparative studies regarding early postoperative pain and a small but significant reduction in operative time .
the mini - tep , combining features and advantages of the extraperitoneal approach with the delicacy and precision of the mini - instruments , appears simple , safe , and versatile .
reduced costs can be anticipated because this technique obviates the need for using balloon dissection and mesh fixation .
a reduced learning curve can also be anticipated , because minilaparoscopic preperitoneal dissection allows faster and easier creation of the preperitoneal space .
the results found in the present study suggest that patients and surgeons may benefit from gains in operative time and reduction in early postoperative pain with the use of minilaparoscopy for the tep technique .
the findings are in accordance with previous studies that have suggested the same findings along with the evident aesthetic gains that the use of such small instruments afford the patient .
although this study did not evaluate short - term complications and recurrences , none was registered . | background and objectives : inguinal hernia repair is among the most common procedures performed worldwide and the laparoscopic totally extraperitoneal ( tep ) approach is a recognized and effective surgical technique .
although technically advantageous because of the option of no mesh fixation and no need for creation of a peritoneal flap resulting , in less postoperative pain and faster recovery , tep has not achieved the popularity it deserves , mainly because of its complexity and steep learning curve .
minilaparoscopy was first described in the 1990s and has recently gained significantly from better instrumentation that may increase tep 's effectiveness and acceptance .
we performed a prospective study , to analyze the outcomes of minilaparoscopy in pain and operative time when compared to the conventional laparoscopic technique in hernia repair.methods:fifty-eight laparoscopic inguinal hernia repairs were performed : 36 by traditional laparoscopic technique and 22 by minilaparoscopic instruments ( mini ) .
a study protocol was applied prospectively for data collection .
variables analyzed were early postoperative pain ( at hour 6 after procedure ) , pain at discharge , use of on - demand analgesics , and operative time.results:the mini group presented reduced early postoperative pain and operative time .
the present study also suggests less postoperative pain at discharge with mini procedures , although this difference was not statistically significant .
no difference between the groups regarding on - demand use of analgesics was found.conclusions:this study corroborates findings in previously published papers that have shown the feasibility of minilaparoscopy in laparoscopic tep hernia repair and its benefits regarding postoperative pain , operative time , and aesthetic outcomes . |
meningiomas , unlike the case of the adult population , account for less than 5% of intradural extramedullary spinal cord tumors3,12 ) .
these rare lesions tend to occur in the cervical or thoracic region in children10 ) .
the recognition and complete excision of these tumors are very important in view of their benign nature and complete curability . with a review of the literature
, we present a rare case of a 14-year - old girl with cervical spinal meningioma .
a 14-year - old girl was admitted to our hospital in may 2012 due to right arm weakness and gait disturbance lasting for 2 weeks .
her neurological examination revealed right hemiparesis ( grade 2 - 3/4 ) that was more severe in the upper extremity than the lower and in the distal region than the proximal .
a magnetic resonance imaging ( mri ) revealed an intradural extramedullary mass that was an isointense lesion on t1- and a slightly hyperintense on t2-weighted images , dorsal to the spinal cord in the level of c1 .
a rigid head holder , such as the skeletal fixation device , was used to secure the head in a neutral position .
first , the central decompression of the tumor was done with the use of the ultrasonic surgical aspirator .
the well - circumscribed , encapsulated tumor was separated easily from the surrounding tissue , allowing total excision . during the dissection , a major intradural vessel did not adhere to the tumor .
after the tumor removal , hemostasis was obtained with warm saline irrigation and avitene hemostatic collagen .
her neurological function had completely returned to its normal level at the time of discharge , 3 weeks after the surgery .
individual tumor cells had indistinct cytoplasmic boundaries and nuclear clearing , cellular whorls , and psammoma body were noticed ( fig .
in children , tumors of the spinal canal constitute a smaller proportion ( 5 to 10% ) of tumors of the central nervous system than in adults .
the various types of tumors that occur in children also differ from those seen in adults11 ) . there has not been much study on the pediatric spinal meningioma series .
meningioma of the brain is also very rare in children younger than 16 years old , with an incidence as low as 2.19% of whole - brain tumors .
the ratio of intracranial to intraspinal tumors in children is approximately 20 : 1 ; thus , intraspinal meningioma in childhood is extremely rare9 ) .
spinal meningioma may occur not only in the intradural , extramedullary space ( 83% ) but also in the extradural space ( 14% ) and intradural , intramedullary space ( 3%)10 ) .
compared to children , adult spinal meningioma commonly occurs in middle aged women in the form of a benign lesion .
the most frequent location of spinal meningioma is the thoracic region in the intradural - extramedullary spaces2 ) .
the patient presented here is a 14-year - old girl with upper cervical intradural extramedullary meningioma .
dermoids , epidermoids , nerve sheath tumors , and diffuse leptomeningeal tumors were also considerated to be a diagnostic candidate for the intradural extramedullary tumors before surgery .
nonetheless , postlaminectomy deformities are most common in pediatric patients with an immature skeletal system , but are also more common in young adults ( < 25 years of age ) than older adults .
the risk of postlaminectomy kyphosis should be always considered before approaching tumors in the spinal canal for resection , especially in higher - risk patients such as children and young adults .
multiple risk factors are associated with cervical spine deformity after laminectomy , including age , the extent of laminectomy and facetectomy , the number of laminae removed , the location of laminectomy ( upper , middle , or lower cervical spine ) , the preoperative loss of lordosis , the pathological condition in the intramedullary spinal cord , and the radiation treatment in the spine1 ) . to decrease the risk of postlaminectomy kyphosis in our case
, efforts were made to leave the facets intact and preserve the facet capsules when performing the muscle detachment .
spinal meningioma arises from cap cells of the arachnoid membrane and originates in proximity to nerve root , accounting for its predominantly lateral location2,8 ) . in our case ,
reports on pediatric spinal meningioma that mention histology indicate psammomatous and meningotheliomatous patterns as well as malignant meningioma4,6,7 ) .
the hallmark of psammomatous meningioma is the presence of a cellular whorl growth pattern with central psammoma bodies .
meningotheliomatous meningiomas , also known as syncytial meningiomas , are characterized by large nucleoli surrounded by polygonal cytoplasmic borders .
intranuclear cytoplasmic inclusions or whorl formations may appear as well . increased cellularity and the presence of mitotic figures push the diagnosis to one of malignancies10 ) .
histologically , our patient 's tumor was a meningotheliomatous meningioma with increased cellularity and rare mitoses .
advances in radiological and surgical techniques such as computed tomography ( ct ) , mri , intraoperative ultrasound , evoked responses , ultrasonic aspirators , and lasers have contributed to better clinical results .
however , there is frequently significant spinal cord compression . when the tumor is ventral to the cord and calcified , surgery becomes more hazardous and may damage the cord7 ) .
usually the prognosis of these tumors is good when they are completely resected , showing the need for early diagnosis and timely intervention .
however , meningioma may recur , especially as a result of incomplete resection . in children
there are few long - term studies that examine the recurrence rate in both adult and children .
klekamp and samii5 ) demonstrated that partial tumor removal , arachnoid scarring , primary dural suture , surgery on a recurrent meningioma , and male sex are significant risk factors for a clinical recurrence .
because the tumor of our patient was diagnosed early and removed completely , the rapid recovery of neurologic deficit could be achieved .
since the recurrence rate in pediatric spinal meningioma is not low , we need to conduct a long - term follow - up study to determine whether a tumor recurs . | the incidence of spinal meningioma is very rare in children . a 14-year - old girl presented with right arm weakness , gait disturbance , and urinary incontinence .
cervical magnetic resonance imaging revealed an intradural extramedullary tumor dorsal to the spinal cord in the level of c1 .
the tumor was totally removed despite the severe cord compression .
meningotheliomatous meningioma was diagnosed after histological examination . |
cow 's milk protein allergy ( cmpa ) results from allergy to -lactoglobulin in cow 's milk .
children usually present during the weaning period with vomiting , abdominal distension , bleeding per rectum or dysentery due to allergic proctitis , proctocolitis and enterocolitis . failure to thrive , watery diarrhea and constipation are rarer manifestations .
there are isolated case reports of cmpa mimicking / co - existing with hirschsprung 's disease ( hd ) and malrotation in newborns .
we present , a neonate with cmpa who presented with features of peritonitis and recurrent segmental enteritis .
a 30-day - old boy baby was referred with abdominal distension , feculent vomiting and failure to thrive .
he was born at term to a surrogate mother and weighed 3.2 kg at birth .
he was started on cow 's milk 6 h after birth and was discharged on the 3 day .
he was readmitted on the 7 day of life with clinical features suggestive of sepsis and probable necrotizing enterocolitis ( nec ) .
he was managed conservatively and discharged 5 days later on infant formula and cow 's milk .
a few days later , he was brought back to the treating pediatrician with recurrent vomiting , abdominal distension and weight loss .
malrotation of the gut was suspected and a barium meal was done and found to be normal .
the c - reactive protein ( crp ) was high and he was treated with intravenous antibiotics and other supportive measures .
immunodeficiency was suspected and immunoglobulin g ( igg ) , immunoglobulin m ( igm ) and immunoglobulin a ( iga ) were found to be normal .
he was referred to our hospital to the pediatric surgery out - patient department on day 30 with gross abdominal distension and persistent vomiting .
his admission weight was 2.8 kg and he was sick , wasted and dehydrated . a clinical diagnosis of hd with enterocolitis was made .
the jejunum showed features of segmental enteritis with turbid fluid and flakes in the peritoneum [ figure 1 ] .
the peritoneal fluid culture showed growth of escherichia coli and enterococcus faecalis and he was started on appropriate antibiotics . the general condition improved , but the abdominal distension recurred when oral feeds were initiated .
igg , igm , and iga were normal for age , but the ige level was > 315 iu / ml ( n 1.5 ) .
cmpa was considered and the radioallergosorbent test ( rast ) assay was done and was found to be strongly positive 6.82 ( n 0.1 ) . operative picture showing dilated bowel with segmental enteritis a diagnosis of segmental enteritis with peritonitis due to cow 's milk allergy was made . baby was started on a hypoallergenic formula .
his review weight at 7 months was 6.5 kg and the serum ige had declined to normal levels .
cmpa is being increasingly recognized in india . a consensus report compiled by the indian pediatricians states that awareness
should be created about this entity among primary care physicians as this is a common cause for diarrhea .
poddar et al . have shown that cmpa is as prevalent in india as in the west . in their series ,
the mean age at diagnosis was 17.2 7.8 months ( range : 3 - 36 months ) and the mean duration of symptoms was 8.3 6.2 months ( range : 4 weeks to 21 months ) .
lactose intolerance , failure to thrive , persistent vomiting and abdominal pain are the other clinical features .
since these are non - specific symptoms , it may be mistaken for a surgical abdomen .
barium enema had shown dilated colon with narrowing of the rectum and there was an increase in acetyl cholinesterase e ( ach - e ) activity and eosinophils in the biopsy .
due to persistent symptoms , he underwent pull through , but the post - operative biopsy was negative for hd .
he developed eczema and rashes after cow 's milk and the rast , raised ige and lymphocyte stimulation test ( lst ) confirmed the diagnosis .
there are few other case reports of children with bloody diarrhea and narrowing of the colon suggestive of hd .
they have postulated that the false positive ach - e staining could be due to the dysmotility caused by the immunological change resulting in an increase in nerve fibers .
they had noted a peripheral eosinophilia and recurrence of symptoms after commencing oral feeds , which settled with a hypoallergenic formula .
an increased incidence of cow 's milk allergy after intestinal surgery in newborns has also been noted .
it is postulated to occur due to the immature intestinal mucosal barrier being breached early in life , resulting in an exaggerated immune response .
the ige mediated form can be diagnosed by raised ige levels , raised ige levels specific to cm antigens otherwise known as ige rast , stimulation index for cm by lst and clinical response to the elimination of cow 's milk . in our patient ,
the ige and rast were very high and there was dramatic response to the elimination of cow 's milk .
re - challenge with cow 's milk has not been carried out due to the baby 's clinical condition and the parents were unwilling .
this is the first case report from india of cow 's milk allergy causing recurrent segmental enteritis leading to peritonitis .
our patient has not been breast fed and has had exposure to cow 's milk soon after birth .
it is possible that the nec like a picture in the 1 week of life resulted in the intestinal mucosal barrier being breached , triggering allergy to cow 's milk .
cmpa should be considered in young infants on artificial feeds who present with a surgical abdomen and atypical clinical findings . | cow 's milk protein allergy ( cmpa ) typically presents with persistent diarrhea or dysentery , vomiting and bleeding per rectum in young infants .
cmpa is reported to mimic hirschsprung 's disease and malrotation .
we report , a neonate who presented with recurrent attacks of segmental enteritis due to cmpa and the last episode presented with signs of peritonitis .
he improved dramatically after elimination of cow 's milk from his diet .
cmpa should be considered in artificially fed babies with surgical abdomen and atypical clinical signs and symptoms . |
forty - one subjects participated in the study ( 8 lean subjects with normal glucose tolerance [ ngt ] , 9 obese with ngt , 12 with impaired glucose tolerance ( igt ) , and 12 with type 2 diabetes ) .
all subjects were in good general health based on medical history , physical examination , screening blood chemistry and hematologic tests , urinalysis , and electrocardiogram .
weight was stable in all subjects ( 2 lb ) for at least 3 months before the study .
none of the subjects participated in any heavy exercise , and they were instructed not to engage in any vigorous exercise for at least 3 days before the study .
none of the nondiabetic subjects were taking medications known to affect lipid and glucose metabolism .
each study volunteer received 1 ) an oral glucose tolerance test ( ogtt ) and 2 ) a hyperinsulinemic - euglycemic insulin clamp with 3-[h]glucose to examine both hepatic and peripheral ( primarily reflects muscle ) insulin sensitivity .
the purpose , nature , and potential risks of the study were explained to all subjects , and written voluntary consent was obtained before their participation .
all research procedures were approved by the institutional review board of the university of texas health science center at san antonio .
baseline blood samples for determination of plasma glucose , free fatty acids ( ffas ) , insulin , and c - peptide concentrations were drawn at 30 , 15 , and 0 min . at time zero , subjects ingested 75 g of glucose in 300 ml orange - flavored water , and plasma glucose , ffas , and insulin were measured at 15-min intervals for 2 h. all studies were conducted in the general clinical research center of the university of texas health science center at san antonio and began at 0700 h after a 12-h overnight fast . a prime ( 25 ci)-continuous ( 0.25 ci / min ) infusion of 3-[h]glucose was started , and 2 h ( 3 h for diabetic subjects ) were allowed for isotopic equilibration . in type 2 diabetes ,
the priming dose of tritiated glucose was increased in proportion to the increase in fasting plasma glucose concentration . at the end of the tracer equilibration period , a primed - continuous insulin infusion ( 80 mu / m per min )
was started , and plasma glucose was measured every 5 min . based on the negative feedback principle , a variable infusion of 20% glucose was adjusted to maintain plasma glucose concentration constant at each subject 's fasting glucose level in the control group ( 18 ) . in diabetic subjects ,
plasma glucose concentration was allowed to decrease to 100 mg / dl , at which level it was maintained .
plasma glucose was measured at bedside with the glucose oxidase method ( beckman instruments , fullerton , ca ) .
plasma insulin concentration was measured by radioimmunoassay ( diagnostic products , los angeles , ca ) . tritiated glucose specific activity was determined on deproteinized plasma samples as previously described ( 19 ) .
plasma ffa concentration was determined by an enzymatic calorimetric quantification method ( wako chemicals , nuess , germany ) .
plasma fgf-21 concentrations were measured by radioimmunoassay ( phoenix pharmaceuticals , burlingam , ca ) at baseline in duplicate from plasma collected prior to start of the euglycemic insulin clamp .
this assay has been reported to cross - react specifically with human fgf-21 ( 100% ) .
serum creatinine was measured with an automated enzymatic assay , and glomerular filtration rate was estimated with the cockcroft - gault formula ( 20 ) . under
steady - state postabsorptive conditions , the rate of endogenous glucose appearance ( ra ) was calculated as the 3-[h]glucose infusion rate ( dpm / min ) divided by the steady - state plasma 3-[h]glucose specific activity ( dpm / mg ) . during the euglycemic insulin clamp ,
the rate of whole - body glucose appearance ( ra ) was calculated with steele 's equation ( 21 ) , using a distribution volume of 250 ml / kg .
endogenous glucose production ( egp ) was calculated by subtracting the exogenous glucose infusion rate from ra .
the rate of insulin - mediated whole - body glucose disposal ( rd ) was determined by adding the rate of residual egp to the exogenous glucose infusion rate . in the postabsorptive state ,
the hepatic insulin resistance index was calculated as the product of egp and fasting plasma insulin concentration ( 23 ) .
similarly , since fasting insulin concentration is the most important regulator of fasting plasma ffa concentration , adipocyte insulin resistance was calculated as the product of fasting plasma ffas and fasting plasma insulin concentration ( 24 ) .
spss version 15 statistical package ( chicago , il ) was used for all calculations .
pearson 's or spearman 's correlations were used to examine the relationship between plasma fgf-21 levels and markers of insulin sensitivity , as well as with anthropometric parameters .
anova with post hoc analysis with bonferroni correction was used to compare significant differences between groups .
baseline blood samples for determination of plasma glucose , free fatty acids ( ffas ) , insulin , and c - peptide concentrations were drawn at 30 , 15 , and 0 min . at time zero , subjects ingested 75 g of glucose in 300 ml orange - flavored water , and plasma glucose , ffas , and insulin were measured at 15-min intervals for 2 h.
all studies were conducted in the general clinical research center of the university of texas health science center at san antonio and began at 0700 h after a 12-h overnight fast . a prime ( 25 ci)-continuous ( 0.25 ci / min ) infusion of 3-[h]glucose was started , and 2 h ( 3 h for diabetic subjects ) were allowed for isotopic equilibration . in type 2 diabetes ,
the priming dose of tritiated glucose was increased in proportion to the increase in fasting plasma glucose concentration . at the end of the tracer equilibration period , a primed - continuous insulin infusion ( 80 mu / m per min )
was started , and plasma glucose was measured every 5 min . based on the negative feedback principle , a variable infusion of 20% glucose was adjusted to maintain plasma glucose concentration constant at each subject 's fasting glucose level in the control group ( 18 ) . in diabetic subjects ,
plasma glucose concentration was allowed to decrease to 100 mg / dl , at which level it was maintained .
plasma glucose was measured at bedside with the glucose oxidase method ( beckman instruments , fullerton , ca ) .
plasma insulin concentration was measured by radioimmunoassay ( diagnostic products , los angeles , ca ) .
tritiated glucose specific activity was determined on deproteinized plasma samples as previously described ( 19 ) .
plasma ffa concentration was determined by an enzymatic calorimetric quantification method ( wako chemicals , nuess , germany ) .
plasma fgf-21 concentrations were measured by radioimmunoassay ( phoenix pharmaceuticals , burlingam , ca ) at baseline in duplicate from plasma collected prior to start of the euglycemic insulin clamp .
this assay has been reported to cross - react specifically with human fgf-21 ( 100% ) .
serum creatinine was measured with an automated enzymatic assay , and glomerular filtration rate was estimated with the cockcroft - gault formula ( 20 ) .
under steady - state postabsorptive conditions , the rate of endogenous glucose appearance ( ra ) was calculated as the 3-[h]glucose infusion rate ( dpm / min ) divided by the steady - state plasma 3-[h]glucose specific activity ( dpm / mg ) . during the euglycemic insulin clamp , the rate of whole - body glucose appearance ( ra ) was calculated with steele 's equation ( 21 ) , using a distribution volume of 250 ml / kg .
endogenous glucose production ( egp ) was calculated by subtracting the exogenous glucose infusion rate from ra .
the rate of insulin - mediated whole - body glucose disposal ( rd ) was determined by adding the rate of residual egp to the exogenous glucose infusion rate . in the postabsorptive state ,
the hepatic insulin resistance index was calculated as the product of egp and fasting plasma insulin concentration ( 23 ) .
similarly , since fasting insulin concentration is the most important regulator of fasting plasma ffa concentration , adipocyte insulin resistance was calculated as the product of fasting plasma ffas and fasting plasma insulin concentration ( 24 ) .
spss version 15 statistical package ( chicago , il ) was used for all calculations .
pearson 's or spearman 's correlations were used to examine the relationship between plasma fgf-21 levels and markers of insulin sensitivity , as well as with anthropometric parameters .
anova with post hoc analysis with bonferroni correction was used to compare significant differences between groups .
type 2 diabetic subjects were slightly , but not significantly , older than subjects with ngt .
bmi was similar in obese subjects with ngt , igt , and type 2 diabetes .
type 2 diabetic individuals had significantly higher fasting plasma glucose , plasma insulin and triglycerides , and a1c compared with lean subjects ; ngt ( table 1 ) .
subjects with igt and type 2 diabetes had significantly lower whole - body ( primarily muscle ) glucose uptake compared with lean subjects with ngt ( table 1 ) .
hepatic insulin resistance ( egp fasting insulin ) in obese subjects with ngt was slightly , but not significantly , elevated compared with ngt subjects .
however , subjects with ifg / igt and type 2 diabetes displayed significantly greater hepatic insulin resistance ( p < 0.05 ) .
similarly , the adipocyte insulin resistance ( ffa fasting insulin ) was significantly higher in subjects with ifg / igt and type 2 diabetes .
* p < 0.05 vs. lean subjects with ngt ; p < 0.05 vs. obese subjects with ngt .
plasma fgf-21 was higher in obese subjects with ngt versus lean subjects with ngt ( 4.92 0.17 vs. 3.88 0.30 ng / ml , p = 0.04 ) .
subjects with igt ( 5.22 0.23 ng / ml , p < 0.05 vs. lean subjects with ngt ) and type 2 diabetes ( 5.27 0.23 , p < 0.05 vs. lean subjects with ngt ) also had increased plasma fgf-21 levels ( fig .
plasma fgf-21 concentration correlated with a1c ( r = 0.325 , p = 0.04 ) , fasting plasma glucose ( r = 0.312 , p = 0.05 ) , and 2-h glucose ( r = 0.414 , p = 0.01 ) .
there was also a direct association between plasma fgf-21 and bmi ( r = 0.456 , p < 0.001 ) in the entire group .
a recent report ( 25 ) demonstrated elevated plasma fgf-21 levels in patients with chronic kidney disease .
we did not observe any correlation between plasma fgf-21 and either glomerular filtration rate ( r = 0.089 , p = ns ) or serum creatinine ( r = 0.277 , p = 0.08 ) .
plasma fgf-21 concentration in lean subjects with ngt and obese subjects with ngt , igt , and type 2 diabetes ( t2 dm ) .
* p < 0.05 vs. lean ngt . the insulin - stimulated rate of glucose disposal ( rd ) correlated inversely with plasma fgf-21 concentration ( 0.421 , p < 0.01 ) ( fig .
a positive correlation also was observed between fgf-21 level and hepatic insulin resistance index ( 0.344 , p = 0.034 ) ( fig .
3 ) and adipocyte insulin resistance index ( 0.318 , p = 0.045 ) . correlation between plasma fgf-21 concentration and insulin - stimulated glucose disposal during the hyperinsulinemic - euglycemic clamp .
type 2 diabetic subjects were slightly , but not significantly , older than subjects with ngt .
bmi was similar in obese subjects with ngt , igt , and type 2 diabetes .
type 2 diabetic individuals had significantly higher fasting plasma glucose , plasma insulin and triglycerides , and a1c compared with lean subjects ; ngt ( table 1 ) .
subjects with igt and type 2 diabetes had significantly lower whole - body ( primarily muscle ) glucose uptake compared with lean subjects with ngt ( table 1 ) .
hepatic insulin resistance ( egp fasting insulin ) in obese subjects with ngt was slightly , but not significantly , elevated compared with ngt subjects .
however , subjects with ifg / igt and type 2 diabetes displayed significantly greater hepatic insulin resistance ( p < 0.05 ) .
similarly , the adipocyte insulin resistance ( ffa fasting insulin ) was significantly higher in subjects with ifg / igt and type 2 diabetes .
* p < 0.05 vs. lean subjects with ngt ; p < 0.05 vs. obese subjects with ngt .
plasma fgf-21 was higher in obese subjects with ngt versus lean subjects with ngt ( 4.92 0.17 vs. 3.88 0.30 ng / ml , p = 0.04 ) .
subjects with igt ( 5.22 0.23 ng / ml , p < 0.05 vs. lean subjects with ngt ) and type 2 diabetes ( 5.27 0.23 , p < 0.05 vs. lean subjects with ngt ) also had increased plasma fgf-21 levels ( fig .
plasma fgf-21 concentration correlated with a1c ( r = 0.325 , p = 0.04 ) , fasting plasma glucose ( r = 0.312 , p = 0.05 ) , and 2-h glucose ( r = 0.414 , p = 0.01 ) .
there was also a direct association between plasma fgf-21 and bmi ( r = 0.456 , p < 0.001 ) in the entire group .
a recent report ( 25 ) demonstrated elevated plasma fgf-21 levels in patients with chronic kidney disease .
we did not observe any correlation between plasma fgf-21 and either glomerular filtration rate ( r = 0.089 , p = ns ) or serum creatinine ( r = 0.277 , p = 0.08 ) .
plasma fgf-21 concentration in lean subjects with ngt and obese subjects with ngt , igt , and type 2 diabetes ( t2 dm ) .
the insulin - stimulated rate of glucose disposal ( rd ) correlated inversely with plasma fgf-21 concentration ( 0.421 , p < 0.01 ) ( fig .
a positive correlation also was observed between fgf-21 level and hepatic insulin resistance index ( 0.344 , p = 0.034 ) ( fig .
3 ) and adipocyte insulin resistance index ( 0.318 , p = 0.045 ) . correlation between plasma fgf-21 concentration and insulin - stimulated glucose disposal during the hyperinsulinemic - euglycemic clamp .
fgf-21 was discovered during a high - throughput assay for secreted proteins that increased glucose uptake in 3t3l-1 adipocytes ( 9 ) .
subsequent studies ( 4,9,13 ) showed that administration of recombinant fgf-21 in rodent models of diabetes and in diabetic rhesus monkeys improved blood glucose and the lipid profile .
however , in none of these studies were the plasma levels of fgf-21 compared between diabetic and nondiabetic animals . in the present study
, we demonstrate that plasma fgf-21 levels are elevated in insulin - resistant states ( obesity , igt / ifg , type 2 diabetes ) and are inversely correlated with both peripheral and hepatic insulin sensitivity .
this is consistent with two other reports ( 15,16 ) in humans that demonstrated elevated plasma fgf-21 concentration in obesity , igt , and type 2 diabetes .
the novelty of our study is that we demonstrate for the first time in humans that the increase in plasma fgf-21 levels are strongly correlated with the severity of whole - body ( primarily reflects muscle ) and hepatic insulin resistance .
our study is in agreement with two previous studies in asians , in which increased plasma fgf-21 levels were observed in newly diagnosed , drug - nave diabetic subjects and in treated type 2 diabetic subjects ( 26 ) . in a chinese population , plasma fgf-21 levels correlated with markers of the insulin resistance ( metabolic ) syndrome ( 16 ) . however , this later study did not measure either hepatic or peripheral insulin sensitivity . in rodent models , fgf-21 stimulates glucose uptake in 3tl3 adipocytes and increases glut4 expression in adipocytes .
arner et al . ( 27 ) demonstrated that fgf-21 inhibits lipolysis in human adipocytes and suggested that this may contribute to the protein 's insulin - sensitizing effect in humans .
a synergistic interaction has been described between fgf-21 and rosiglitazone to stimulate glucose uptake ( 28 ) .
contrary to these observations , in the present study plasma fgf-21 concentrations were positively correlated with adipocyte insulin resistance . with regard to the liver , in animal models fgf-21
has been shown to be expressed primarily in liver , and its glucose - lowering effects of fgf-21 have been suggested to be mediated by its actions on liver ( 9,11 ) .
in contrast , in the present study , we demonstrate a positive correlation between elevated fgf-21 levels and hepatic insulin resistance .
the apparently divergent results of the current study in humans and previous studies in animals could reflect a true species difference in the metabolic effects of fgf-21 in humans versus animals or may be less contradictory than they appear .
thus , the elevated plasma fgf-21 levels in insulin - resistant states may simply reflect a compensatory response to offset the peripheral and/or hepatic insulin resistance and not be a cause of the insulin resistance . since our observations are cross - sectional in nature , it is not possible to establish a cause - and - effect relationship ( i.e. , what is primary and what is secondary ) .
it also is not possible to distinguish whether the increased plasma fgf-21 levels in obese subjects and subjects with igt / ifg and type 2 diabetes are related to insulin resistance or obesity , since all three groups had similarly elevated fgf-21 levels .
further studies will be required to further elucidate the role of fgf-21 in glucose homeostasis and whether fgf-21 will sensitize target issues ( liver , adipocytes , muscle ) to insulin , as has been reported in animal models of diabetes .
recent studies have suggested that plasma fgf-21 concentrations are affected by the glomerular filtration rate and therefore may be related to the level of renal function ( 25 ) .
patients undergoing dialysis have significantly increased plasma fgf-21 levels compared with control subjects , and this is independent of the glucose / lipid metabolic status ( 25 ) .
although none of the participants enrolled in our study had impaired renal function , glomerular filtration rate spanned a wide range .
nonetheless , we did not find a significant relationship between plasma fgf-21 concentration and estimated glomerular filtration rate .
thus , in our sample , fgf-21 concentrations are unlikely to be affected by this parameter . in summary ,
elevated plasma fgf-21 concentrations in humans appear to be related to the presence of hepatic and peripheral insulin resistance . whether the increase in plasma fgf-21 represents a compensatory effect to offset insulin resistance or is a causative factor in the development of insulin resistance is yet to be determined . | objectivefibroblast growth factor ( fgf)-21 is highly expressed in the liver and regulates hepatic glucose production and lipid metabolism in rodents . however , its role in the pathogenesis of type 2 diabetes in humans remains to be defined .
the aim of this study was to quantitate circulating plasma fgf-21 levels and examine their relationship with insulin sensitivity in subjects with varying degrees of obesity and glucose tolerance.research design and methodsforty - one subjects ( 8 lean with normal glucose tolerance [ ngt ] , 9 obese with ngt , 12 with impaired fasting glucose [ ifg]/impaired glucose tolerance [ igt ] , and 12 type 2 diabetic subjects ) received an oral glucose tolerance test ( ogtt ) and a hyperinsulinemic - euglycemic clamp ( 80 mu / m2 per min ) combined with 3-[3h ] glucose infusion.resultssubjects with type 2 diabetes , subjects with igt , and obese subjects with ngt were insulin resistant compared with lean subjects with ngt .
plasma fgf-21 levels progressively increased from 3.9 0.3 ng / ml in lean subjects with ngt to 4.9 0.2 in obese subjects with ngt to 5.2 0.2 in subjects with igt and to 5.3 0.2 in type 2 diabetic subjects .
fgf-21 levels correlated inversely with whole - body ( primarily reflects muscle ) insulin sensitivity ( r = 0.421 , p = 0.007 ) and directly with the hepatic insulin resistance index ( r = 0.344 , p = 0.034 ) .
fgf-21 levels also correlated with measures of glycemia ( fasting plasma glucose [ r = 0.312 , p = 0.05 ] , 2-h plasma glucose [ r = 0.414 , p = 0.01 ] , and a1c [ r = 0.325 , p = 0.04]).conclusionsplasma fgf-21 levels are increased in insulin - resistant states and correlate with hepatic and whole - body ( muscle ) insulin resistance .
fgf-21 may play a role in pathogenesis of hepatic and whole - body insulin resistance in type 2 diabetes . |
studies have shown that the early detection of breast cancer leads to better patient prognosis and a greater five - year survival rate .
diagnostic and prognostic markers play a key role in classifying tumors and determining the best treatment plan for a patient .
the most widely used and established prognostic markers for breast cancer recurrence are tumor size , tumor grade , lymph node involvement , and tumor hormone receptor status . these indicators , although well established , are all related to tumor aggressiveness .
recent evidence has shown that proliferation markers , such as ki-67 and proliferating cell nuclear antigen ( pcna ) , may have independent prognostic value [ 13 ] .
although these proliferation markers have potential , recent studies indicate that thymidine kinase 1 ( tk1 ) , another marker associated with proliferation , may be a better prognostic marker than either ki-67 or pcna [ 4 , 5 ] .
thymidine kinase 1 ( tk1 ) has been studied extensively , primarily as a diagnostic biomarker for a variety of cancer types .
tk1 is a nucleotide salvage pathway repair enzyme that is primarily responsible for the phosphorylation of thymidine to thymidine monophosphate .
tk1 is associated with proliferating cells and is primarily elevated during s phase [ 6 , 7 ] . as a biomarker , higher serum tk1 activity levels correlate with a more advanced cancer stage and grade [ 810 ] .
serum tk1 levels also show prognostic potential as their levels help predict future relapse at the time of primary diagnosis in breast and colorectal cancer patients [ 11 , 12 ] .
one study demonstrated that breast cancer patients who later showed recurrence initially had higher primary tumor tk1 levels when compared to those patients who did not show recurrence .
furthermore , breast cancer patients with either high or intermediate tk1 activity in their tumors showed rapid disease progression and poorer prognosis as compared to patients with low tk1 activity in their tumors .
tumor tk1 levels , similar to serum tk1 levels , also correlate with both stage and grade .
although there is a significant correlation between pcna and tk1 staining of breast cancer tissue , tk1 showed a significant correlation with stage and grade while pcna did not , indicating that tk1 might be a more accurate marker for diagnosis and prognosis .
similarly , there is a significant correlation between ki-67 and tk1 in breast cancer tissue when compared to normal tissue ; however , due to early upregulation of tk1 as compared with ki-67 , tk1 may be a more accurate prognostic marker [ 16 , 17 ] .
tk1 upregulation as an early event of cancer is a novel concept that has been addressed by only a few recent studies .
one such study involving a health screening of 8,135 people found that 89.2% of persons with elevated serum tk1 levels had diseases linked to risk for pre-/early cancerous progression , including one individual who developed liver carcinoma 13 months after the health screening .
similar studies have also shown that recurrence can be detected by elevated serum tk1 levels as early as 16 months before the clinical onset of relapse .
this study seeks to determine whether , similarly to serum tk1 , tumor tk1 upregulation is an early event in tumor development and may aid in the identification of precancerous tissue .
tissue arrays containing tissue from normal ( n = 56 ) , adenosis ( n = 22 ) , and breast carcinoma ( n = 97 ) patients as well as a progressive breast array ( cybrdi inc . , frederick md ) were analyzed for tk1 expression .
breast carcinoma tissue included simple carcinoma ( n = 30 ) , infiltrating duct carcinoma ( n = 41 ) , medullary carcinoma ( n = 12 ) , scirrhous carcinoma ( n = 11 ) , and infiltrating lobular carcinoma ( n = 3 ) .
tissue arrays were stained using an anti - tk1 mouse monoclonal antibody ( cb001 ) , which we previously demonstrated to be highly specific to tk1 . using this antibody ,
briefly , formalin - fixed paraffin - embedded specimens were prepared by deparaffinization and rehydration . to retrieve antigenicities of tk1 , specimens were boiled in 0.01 m sodium citrate buffer ( ph 6.0 ) for 12 minutes and allowed to cool at room temperature for 20 minutes .
the endogenous peroxidase activity was blocked by immersion in 3% h2o2 in methyl alcohol at room temperature for 20 minutes .
the slides were then washed in phosphate - buffered saline ( pbs ; ph 7.2 ) and blocked in 10% normal horse serum for 30 minutes . after blocking
, the slides were incubated at room temperature for 3 hours with either anti - tk1 mouse monoclonal antibody ( diluted 1 : 100 ) or isotype control ( 0.6 g/l , mouse igg , upstate company , 12 - 371 ) .
slides were washed with pbs and then incubated with a biotin - conjugated anti - mouse secondary antibody ( abc kit , vector lab inc . ) at room temperature for 30 minutes .
after pbs washing , slides were incubated for 30 minutes , at room temperature , with streptavidin - peroxidase ( abc kit , vector lab inc . ) and then washed again in pbs .
diaminobenzidine ( vector lab inc . ) was used as a chromagen , and the slides were counterstained with haematoxylin .
specimens were scored by three pathologists , and a consensus score of positive , weak positive , or negative was compiled .
a positive score indicated cytoplasmic staining of tk1 in 525% of tumor cells . if some signal was detected but was insignificant when compared to the isotype control , it was given a weak positive score .
a chi - square test of independence was applied to compare the scores of normal and malignant tissues . due to the limited number of cases in the progressive breast array , no statistical analysis on this array
differences with p < 0.05 ( two - sided ) were regarded as statistically significant .
tk1 expression was found to be significantly different ( p < 0.001 ) between normal breast and breast carcinoma tissue .
a total of 73 breast carcinoma tissues ( 79% ) were positive for tk1 expression while only 18 normal breast tissues ( 36% ) scored positive .
breast tissue was also stained using an isotype control ( mouse igg , upstate company ) , and all breast tissue was found to be negative . since these normal tissues were retrieved from the margins around a tumor and were considered pathologically normal , we sought to determine if tissue from noncancerous individuals yielded similar results .
interestingly , there was no tk1 staining in any breast tissue obtained from noncancerous individuals , called fda - approved true normal tissue ( data not shown ) .
therefore , these 18 tk1 positive normal tumor margins may not be false - positive results , but rather precarcinoma tissue , which is considered pathologically normal tissue by current standards .
tk1 expression was also found to be significantly different ( p = 0.013 ) between the different types of breast carcinoma tissue .
a chi - square test of independence was applied to compare the scores of the various types of breast carcinoma tissue .
the pearson chi - square value was 22.452 , using 10 degrees of freedom , and the two - sided p - value was 0.013 .
the results are summarized in table 1 and typical staining can been seen in figure 1 . in summary , infiltrating lobular carcinoma and scirrhous carcinoma tissues all stained positive for tk1 , while 6683% of simple , infiltrating duct , and medullary carcinoma tissues stained positive for tk1 .
further studies with larger sample sizes may further elucidate the differences between these tissue types .
in addition to the tk1 positive breast carcinoma tissues , 4 breast adenosis tissues ( 22% ) were also found to be positive for tk1 expression .
these 4 positive precancerous tissues were the first indication that tk1 expression may be an early event in tumor development . to pursue this hypothesis
, we obtained a progressive breast array . this progressive breast array included tissue from different tumor developmental stages , such as normal , adenosis , and atypical hyperplasia , moderate atypical hyperplasia , severe hyperplasia , nonspecific infiltrating duct carcinoma , infiltrating lobular carcinoma , and infiltrating duct carcinoma with lymph node metastasis .
the results are summarized in table 2 and typical staining can be seen in figure 2 .
the proliferating epithelial cells of some cases of breast adenosis were positive for tk1 expression as well as breast tissue with simple or atypical hyperplasia .
as previously seen , most breast carcinoma tissues were also positive for tk1 expression while no breast tissue stained positive with an isotype control .
it appears from this progressive array that since tk1 is found in precancerous tissue , tk1 upregulation is an early event in breast tumor development .
these results support the previous conclusion that in some cases , there may be a difference between true normal tissue from noncancerous patients and the pathologically normal tumor margins .
further studies are needed to elucidate the differences between both the normal tumor margins and precancerous tissues that were positive for tk1 and those that were negative .
perhaps , the prognostic value of tk1 may be of help in identifying those precancerous tissues which are of greatest risk to the patient .
therefore , tk1 expression is an early event in tumor development and may aid in the identification of precancerous tissue .
the aim of this study was to determine if tk1 upregulation is an early event in tumor development . from the progressive breast array
, it can be seen that in many cases of breast cancer , tk1 is upregulated in precancerous tissue and remains elevated in correlation to cancer stage .
although not elevated in all tumors , tk1 appears to be upregulated as an early event in most tumors and therefore can possibly be used in connection with other diagnostic and prognostic techniques to improve patient outcome .
these results also indicate that the tk1 positive pathologically normal tumor margins may in fact be tumor cells that have escaped pathological identification .
this preliminary research may indicate that tk1 can be used to identify possible malignant cells , which have evaded pathological detection during surgical removal . unfortunately due to the anonymity of these patient samples , we have been unable to determine if tk1 positive tumor margins are of clinical significance .
further research would be required to establish if these tk1 positive cells are in fact a result of the tumor tissue .
overall , it appears that tk1 has diagnostic and prognostic potential in identifying breast tumor tissue as well as precancerous tissues .
the ability to identify tumor tissue during the early stages of development is of significant value .
therefore , the histological identification of tumors utilizing tk1 suggests promising prognostic and diagnostic potential in breast cancer tissue . | prognostic markers play an important role in our understanding of tumors and how to treat them .
thymidine kinase 1 ( tk1 ) , a proliferation marker involved in dna repair , has been shown to have independent prognostic potential .
this prognostic potential includes the novel concept that upregulation of serum tk1 levels is an early event in cancer development .
this same effect may also be seen in tumor tissue . in order to demonstrate that tk1 upregulation is an early event in tumor tissue formation
, tissue arrays were obtained and stained for tk1 by immunohistochemistry . using a progressive breast tissue array , precancerous tissue including breast adenosis , simple hyperplasia , and atypical hyperplasia stained positive for tk1 expression .
different stages of breast carcinoma tissue also stained positive for tk1 including nonspecific infiltrating duct , infiltrating lobular , and infiltrating duct with lymph node metastasis carcinomas .
this indicates that tk1 upregulation is an early event in breast carcinoma development , and may be useful in identifying precancerous tissue .
further work is needed to better understand the differences seen between tk1 positive and negative tissues . |
a large body of the recent psychiatric literature is questioning the empirical value of current prescribing habits as well as the psychiatrists choice of medication selection as increasing amounts of polypharmacy and risk of medications creep into patients regimes.112 without better evidence - based research , often medication choices are made by trial and error , leading to significant delays to effective treatment .
there is little empirical evidence supporting the benefits of polypharmacy , and continuing a trial - and - error approach to the implementation of psychotropic medications .
this is discussed in a recently published paper1 in which polypharmacy is compared to washing patients out of their current medication as a possible next step in medication management . in the newly reported combining medication to enhance depression outcomes
study,13 a national institutes of health ( nih)-funded research to determine whether starting several antidepressants at the same time would be associated with increased efficacy , no significant difference between the response or remission rates were observed .
this large , well - designed study supports the contention that psychiatry is still in need of evidence - based tools to orient psychotropic treatment selection .
this same conclusion was highlighted by recent programmatic documents of the national institute of mental health ( nimh ) , which highlighted the need for objective evidence - based neuroscience1417 instruments in addition to diagnoses based on symptom clusters in selecting the most effective treatments .
additionally , reports from the large nih - funded sequence treatment alternatives to relieve depression ( star*d ) study,18 as well as other publications,19,20 have revealed the lack of biomarkers and the limitations of relying on symptom - based prescribing followed by
quantitative electroencephalography ( qeeg ) which involves computerized spectral analysis of electroencephalography ( eeg ) signals provides information that can not be extracted through visual inspection of eeg alone and has been previously used to predict the outcome of antidepressant treatment .
some studies suggest that baseline qeeg parameters may also serve to predict the total burden of treatment - emergent side effects or more specifically to predict treatment - emergent suicidal ideation.21,22 there is ample previous evidence for the qeeg - based treatment outcomes in the literature .
suffin and emory,23 through referenced - eeg ( now called psychiatric eeg evaluation registry or peer report ) , initially examined attentional and affective disorders and their successful association with pharmacotherapeutic outcomes .
other smaller preliminary studies have suggested a potential role in using this information for medication selection for depression,2426 eating disorders,27 and substance abuse25 with similar promising results .
another pilot study28 was conducted to compare this same methodology with the texas medication algorithm project ( tmap ) used for patients with treatment - resistant depression .
the data in that study resulted in statistically greater change from baseline outcome scores than those treated with tmap - guided therapy .
in a larger , multicenter , randomized trial , debattista29 compared the referenced - eeg database treatment group ( experimental ) with an optimized treatment based on the star*d study guidelines ( control ) in patients with treatment - refractory major depressive disorder.18 the experimental group s selection led to statistically better outcomes compared with the control group . a recent retrospective chart review in the treatment of depression in eating disorders30 reported on 22 patients with a 2-year history prior to using the peer report to guide treatment and followed them for 25 years .
patients demonstrated significant decrease in depressive symptoms hamilton depression rating scale , severity of illness clinical global impression severity ( cgi - s ) , and overall clinical global impression improvement ( cgi - i ) .
the peer report information utilizing the referenced - eeg database can assist clinicians treating nonpsychotic psychiatric patients with objective choices that offer ( 1 ) caution against medications potentially associated with adverse events for a given patient , while at the same time ( 2 ) giving evidence - based knowledge from other patients with similar brainwave patterns associated with positive responses to specific medications in the growing database .
the methodology for determining the medication ratings in the database has been previously published.30 an uncontrolled retrospective chart review of clinical cases having received a qeeg utilizing the referenced - eeg database ( now called peer report ) was performed .
the objective was to determine if peer information would improve overall global ratings and quality of life in nonpsychotic patients in a typical psychiatric outpatient clinical setting .
in addition , we hypothesized that the report might help caution the prescriber about the potential of severe adverse events and reduce the number of such negative outcomes .
an uncontrolled retrospective chart review of clinical cases having received a qeeg utilizing the referenced - eeg database ( now called peer report ) was performed .
the objective was to determine if peer information would improve overall global ratings and quality of life in nonpsychotic patients in a typical psychiatric outpatient clinical setting .
in addition , we hypothesized that the report might help caution the prescriber about the potential of severe adverse events and reduce the number of such negative outcomes .
we reviewed the charts of 435 patients who elected to undergo qeeg assessment between 2003 through mid-2011 in an outpatient psychiatric clinic with three prescribers .
the patient population consisted of any nonpsychotic diagnosis typically seen in a private outpatient clinical setting that agreed to follow the medication plan suggested by the referenced - eeg database and peer report , along with any comorbid conditions .
the option for using the report was given to patients who could safely washout of medication for at least 5 half - lives and desired to add evidenced - based data to their treatment decisions .
most of them were treatment - resistant ( having failed at least two previous medication trials ) .
the patients had to pay for the test , but a compassionate - use policy allowed for a sliding scale .
all patients receiving an eeg had signed two different informed consents stating that their data could be used for purposes of research or publication in the future and that all health insurance portability and accountability act standards and personal health information would not be included or divulged in any way .
they were also given choices of other treatments or allowed to cease testing at any time without affecting their treatment options , as per standard informed consent language .
abstracted data from the patient s chart included primary and secondary diagnoses , age , history of failed medication trials , adverse events to prior medications , severe adverse events ( eg , agitation , hostility , aggressiveness , suicidality , homicidality , mania , hypomania ) , severity of symptoms , and off - label use . in our clinic ( neuro - therapy clinic , inc , denver , co ) depression and anxiety rating scales are administered as part of the initial assessment for each new patient , regardless of diagnosis .
two different depression scales were used because the clinic changed assessment tools within the time period of the review . including all anxiety and depression scores for the population ( even on patients without an anxiety or depression diagnosis )
skews the group depression / anxiety statistics toward being less severe since many of the patients did not have depressive or anxious symptoms , thus causing lower scores than might be anticipated .
postdepression / anxiety scores were not available because outcomes were measured by global scores , such as cgi - i and quality of life enjoyment and satisfaction short form ( q - les - q - sf ) , in agreement with the diagnostic agnostic fundamentals of the peer data .
clinical chart data was analyzed from the point of medication implementation ( guided by the peer report ) to the point where the prescriber determined patients were at maximum medical improvement ( mmi ) the term traditionally used , in medical disability , for example , to define the point at which they were thought to be stable and at which no further medication changes would alter their outcome .
the outpatient clinic included three individual prescribers who rated patients at each session according to the cgi - i rating scale31,32 at all visits since january 2009 .
patients also filled out q - les - q - sf ratings.33 data pertaining to all known prior medications , along with known severe side effects , were also collected .
raw data was recorded on spreadsheets , and changes in scores were calculated by subtracting baseline scores from the mmi scores .
the cgi - i31 is a well - accepted seven - point likert scale used regularly in both clinical practice and research . a score of 4 means no change , compared to baseline .
very much improved , two is much improved , and three is improved .
similarly , scores of 57 represent worsening . a score of 2 or 1 ( much or very much improved ) is typically used as the definition of a good clinical response .
the q - les - q - sf33 is a quality - of - life questionnaire assessing 14 areas of a patient s life circumstances .
while the q - les - q - sf has never been normed into typical bands of mild , moderate , or severe , psychiatric patients in treatment who are considered responders tend to score in the mid-60s or above .
schechter et al , among others , have written that psychiatric patients successfully treated for depression and anxiety score in the mid- to upper-60s , while patients with moderate symptoms or who function with only some difficulty tend to score ~64%.3438 descriptive statistics ( mean , range , standard deviations , percentage change ) were used to characterize study subjects on demographic and clinical measures at baseline , including age , severity of illness , history of failed medication trials , and previous severe adverse events prior to medications prescribed after initiating the peer report . for the primary study outcomes
, we performed student s t - tests to compare the mean number of medications used by subjects , their mean improvement as measured by the cgi - i , and their mean quality of life scores as measured by the q - les - q - sf , before and after starting peer guided treatment . due to the relative rarity of events related to suicidality and the difficulty in determining exact pre - period time windows for specification of incidence rates per unit of time , we report suicidal occurrences as counts ( number of events observed ) before and after subjects started peer - guided treatment .
no statistical analyses were applied to the counts of suicide - related occurrences that were observed in this study .
rates of severe adverse events before and after subjects started peer - guided treatment and rates of pre - off - label medication use were also reported .
no statistical analyses were applied to the adverse event rates or off - label use rates that were measured in this study . where there were no statistical analyses applied , it was either due to the fact that some measures had uncertainty about equal measurement intervals or we erred on the side of caution by not making statistical comparisons of pre versus post data since the rates of some measurements were so low that we did not have much statistical power to make adequate comparisons .
statistical analyses were performed using sas version 10.0 ( sas institute inc , cary , nc ) .
all tests were two - sided , with an a priori alpha - level of 0.05 for all comparisons .
we reviewed the charts of 435 patients who elected to undergo qeeg assessment between 2003 through mid-2011 in an outpatient psychiatric clinic with three prescribers .
the patient population consisted of any nonpsychotic diagnosis typically seen in a private outpatient clinical setting that agreed to follow the medication plan suggested by the referenced - eeg database and peer report , along with any comorbid conditions .
the option for using the report was given to patients who could safely washout of medication for at least 5 half - lives and desired to add evidenced - based data to their treatment decisions .
most of them were treatment - resistant ( having failed at least two previous medication trials ) .
the patients had to pay for the test , but a compassionate - use policy allowed for a sliding scale .
all patients receiving an eeg had signed two different informed consents stating that their data could be used for purposes of research or publication in the future and that all health insurance portability and accountability act standards and personal health information would not be included or divulged in any way .
they were also given choices of other treatments or allowed to cease testing at any time without affecting their treatment options , as per standard informed consent language .
abstracted data from the patient s chart included primary and secondary diagnoses , age , history of failed medication trials , adverse events to prior medications , severe adverse events ( eg , agitation , hostility , aggressiveness , suicidality , homicidality , mania , hypomania ) , severity of symptoms , and off - label use .
in our clinic ( neuro - therapy clinic , inc , denver , co ) depression and anxiety rating scales are administered as part of the initial assessment for each new patient , regardless of diagnosis .
two different depression scales were used because the clinic changed assessment tools within the time period of the review . including all anxiety and depression scores for the population ( even on patients without an anxiety or depression diagnosis )
skews the group depression / anxiety statistics toward being less severe since many of the patients did not have depressive or anxious symptoms , thus causing lower scores than might be anticipated .
postdepression / anxiety scores were not available because outcomes were measured by global scores , such as cgi - i and quality of life enjoyment and satisfaction short form ( q - les - q - sf ) , in agreement with the diagnostic agnostic
clinical chart data was analyzed from the point of medication implementation ( guided by the peer report ) to the point where the prescriber determined patients were at maximum medical improvement ( mmi ) the term traditionally used , in medical disability , for example , to define the point at which they were thought to be stable and at which no further medication changes would alter their outcome .
the outpatient clinic included three individual prescribers who rated patients at each session according to the cgi - i rating scale31,32 at all visits since january 2009 .
patients also filled out q - les - q - sf ratings.33 data pertaining to all known prior medications , along with known severe side effects , were also collected .
raw data was recorded on spreadsheets , and changes in scores were calculated by subtracting baseline scores from the mmi scores .
the cgi - i31 is a well - accepted seven - point likert scale used regularly in both clinical practice and research . a score of 4 means no change , compared to baseline .
very much improved , two is much improved , and three is improved .
similarly , scores of 57 represent worsening . a score of 2 or 1 ( much or very much improved ) is typically used as the definition of a good clinical response .
the q - les - q - sf33 is a quality - of - life questionnaire assessing 14 areas of a patient s life circumstances .
while the q - les - q - sf has never been normed into typical bands of mild , moderate , or severe , psychiatric patients in treatment who are considered responders tend to score in the mid-60s or above .
schechter et al , among others , have written that psychiatric patients successfully treated for depression and anxiety score in the mid- to upper-60s , while patients with moderate symptoms or who function with only some difficulty tend to score ~64%.3438 descriptive statistics ( mean , range , standard deviations , percentage change ) were used to characterize study subjects on demographic and clinical measures at baseline , including age , severity of illness , history of failed medication trials , and previous severe adverse events prior to medications prescribed after initiating the peer report . for the primary study outcomes , we performed student s t - tests to compare the mean number of medications used by subjects , their mean improvement as measured by the cgi - i , and their mean quality of life scores as measured by the q - les - q - sf , before and after starting peer guided treatment .
due to the relative rarity of events related to suicidality and the difficulty in determining exact pre - period time windows for specification of incidence rates per unit of time , we report suicidal occurrences as counts ( number of events observed ) before and after subjects started peer - guided treatment .
no statistical analyses were applied to the counts of suicide - related occurrences that were observed in this study .
rates of severe adverse events before and after subjects started peer - guided treatment and rates of pre - off - label medication use were also reported .
no statistical analyses were applied to the adverse event rates or off - label use rates that were measured in this study . where there were no statistical analyses applied , it was either due to the fact that some measures had uncertainty about equal measurement intervals or we erred on the side of caution by not making statistical comparisons of pre versus post data since the rates of some measurements were so low that we did not have much statistical power to make adequate comparisons .
statistical analyses were performed using sas version 10.0 ( sas institute inc , cary , nc ) .
all tests were two - sided , with an a priori alpha - level of 0.05 for all comparisons .
clinical chart data was analyzed from the point of medication implementation ( guided by the peer report ) to the point where the prescriber determined patients were at maximum medical improvement ( mmi ) the term traditionally used , in medical disability , for example , to define the point at which they were thought to be stable and at which no further medication changes would alter their outcome .
the outpatient clinic included three individual prescribers who rated patients at each session according to the cgi - i rating scale31,32 at all visits since january 2009 .
patients also filled out q - les - q - sf ratings.33 data pertaining to all known prior medications , along with known severe side effects , were also collected .
raw data was recorded on spreadsheets , and changes in scores were calculated by subtracting baseline scores from the mmi scores .
the cgi - i31 is a well - accepted seven - point likert scale used regularly in both clinical practice and research .
very much improved , two is much improved , and three is improved .
similarly , scores of 57 represent worsening . a score of 2 or 1 ( much or very much improved ) is typically used as the definition of a good clinical response .
the q - les - q - sf33 is a quality - of - life questionnaire assessing 14 areas of a patient s life circumstances .
while the q - les - q - sf has never been normed into typical bands of mild , moderate , or severe , psychiatric patients in treatment who are considered responders tend to score in the mid-60s or above .
schechter et al , among others , have written that psychiatric patients successfully treated for depression and anxiety score in the mid- to upper-60s , while patients with moderate symptoms or who function with only some difficulty tend to score ~64%.3438
descriptive statistics ( mean , range , standard deviations , percentage change ) were used to characterize study subjects on demographic and clinical measures at baseline , including age , severity of illness , history of failed medication trials , and previous severe adverse events prior to medications prescribed after initiating the peer report . for the primary study outcomes
, we performed student s t - tests to compare the mean number of medications used by subjects , their mean improvement as measured by the cgi - i , and their mean quality of life scores as measured by the q - les - q - sf , before and after starting peer guided treatment . due to the relative rarity of events related to suicidality and the difficulty in determining exact pre - period time windows for specification of incidence rates per unit of time , we report suicidal occurrences as counts ( number of events observed ) before and after subjects started peer - guided treatment .
no statistical analyses were applied to the counts of suicide - related occurrences that were observed in this study .
rates of severe adverse events before and after subjects started peer - guided treatment and rates of pre - off - label medication use were also reported .
no statistical analyses were applied to the adverse event rates or off - label use rates that were measured in this study . where there were no statistical analyses applied , it was either due to the fact that some measures had uncertainty about equal measurement intervals or we erred on the side of caution by not making statistical comparisons of pre versus post data since the rates of some measurements were so low that we did not have much statistical power to make adequate comparisons .
statistical analyses were performed using sas version 10.0 ( sas institute inc , cary , nc ) .
all tests were two - sided , with an a priori alpha - level of 0.05 for all comparisons .
charts of 435 psychiatric patients who elected to undergo qeeg assessment between 2003 through mid-2011 were reviewed .
a total of 178 patients were excluded from the analysis for the following reasons : lost to follow - up , 127 ; noncompliance , 29 ; insufficient data , 16 ; other , 6 . there were an additional 27 patients who , after their peer assessment , did not need medication for their treatment . abstracted data from the patient s chart included primary and secondary diagnoses , age , history of failed medication trials , adverse events to prior medications , severe adverse events ( as mentioned previously ) , severity of symptoms , and off - label use .
the 230 patients who received and followed peer averaged 36.4 ( 767.1 ; standard deviation [ sd ] 13.9 ) years of age .
the average number of previous medication treatment failures was 5.9 , dropping to 2.4 after treatment guided by the peer report ( table 1 ) .
these included either medications prescribed at the same time or failed attempts in both pre- and post - peer guidance .
the percent of patients lost to follow - up was similar to different comparable control populations .
these included other patients seen in the clinic that did not get a qeeg , and published studies utilizing the referenced - eeg database for depression efficacy29 in treatment - resistant patients , and a retrospective chart review in the eating - disorder population30 ( table 2 ) .
also noted in table 2 is the additional benefit for 10.5% of those patients who required no pharmacological treatment after washout .
the first were statistics relating to average number of drugs used and time to mmi ( table 1 ) .
the second measurements were clinical global scores that would not be dependent on any diagnostic category but addressed overall functioning .
table 1 consists of the cgi - i and the q - les - q - sf .
eighty - seven percent of patients achieved significant improvement ( cgi - i of 1 or 2 ) , and this was achieved within four visits for 68.7% of patients .
previous suicidality was determined by reviewing the chart for patients suicidal thoughts , ideations , plans , or attempts discovered in the intake and past history .
if the same or different patient had any of these identical symptoms after starting the peer - guided treatment , it was recorded as an occurrence . for those patients
the review charting was followed throughout their association with the clinic , which averaged 721.9 ( 543591 ) days ( table 1 ) .
for comparison , 7% of subjects in star*d level 1 who experienced treatment - emergent suicidal ideation experienced a new onset of suicidal ideation .
39 also , between 11.1% and 34.8% of patients in the nimh star*d study who discontinued treatment in the second treatment level described severe adverse events as the reason.40 in the current version of the peer report , medication classes as well as specific medications are rated in three categories based on the historical use from other providers data in the registry for success ( similar to an antibiotic sensitivity report ) .
the three categories are s ( sensitive or > 85% chance of treatment success ) , i ( intermediate or 35%85% ) , and
( resistant or < 35% chance of success ) . reviewing all past medications and patient reported responses , severe adverse events (
eg , agitation , hostility , aggressiveness , suicidality , homicidality , mania , hypomania ) were noted and compared with the rating score of their current peer report .
medications rated r on the peer report were associated with rates of severe adverse effects 55% of the time .
r ratings of medications can be considered as a potential cautionary flag in that , had the information been available at the time of giving the medication , the adverse response may have been prevented .
the same analysis was performed in the dataset of a previously published multicenter depression efficacy study29 ( des ) testing peer efficacy in major depressive disorder . in that dataset ,
table 3 shows both studies along with the rating on the drug causing the significant adverse side effect .
one drug in the chart review had insufficient information in the database to be included .
the pooled results were statistically significant assuming an equal distribution across r / i / s categories as the null hypothesis .
this chart review revealed 7% serious adverse events from patients prior medications . for comparison ,
7% of subjects in star*d level 1 who experienced treatment - emergent suicidal ideation experienced a new onset of suicidal ideation .
39 also , between 11.1% and 34.8% of patients in the nimh star*d study who discontinued treatment in the second treatment level described severe adverse events as the reason.40 in the current version of the peer report , medication classes as well as specific medications are rated in three categories based on the historical use from other providers data in the registry for success ( similar to an antibiotic sensitivity report ) .
the three categories are s ( sensitive or > 85% chance of treatment success ) , i ( intermediate or 35%85% ) , and
( resistant or < 35% chance of success ) . reviewing all past medications and patient reported responses , severe adverse events (
eg , agitation , hostility , aggressiveness , suicidality , homicidality , mania , hypomania ) were noted and compared with the rating score of their current peer report .
r on the peer report were associated with rates of severe adverse effects 55% of the time .
r ratings of medications can be considered as a potential cautionary flag in that , had the information been available at the time of giving the medication , the adverse response may have been prevented .
the same analysis was performed in the dataset of a previously published multicenter depression efficacy study29 ( des ) testing peer efficacy in major depressive disorder . in that dataset
, r - rated medications were associated with severe adverse effects 50% of the time .
table 3 shows both studies along with the rating on the drug causing the significant adverse side effect .
one drug in the chart review had insufficient information in the database to be included .
the pooled results were statistically significant assuming an equal distribution across r / i / s categories as the null hypothesis .
the medications prescribed based on review of the qeeg data contained in the current version of the referenced - eeg database and peer report were from four different classes , ie , anticonvulsants , antidepressants , stimulants ( which included monoamine oxidase inhibitors due to their stimulating effect on the eeg and the way the database classifies them ) , and beta - blockers .
patients were treated with either monotherapy or combinations of medications guided by the four categories listed in the peer report . clinical judgment always superseded data from the report as the peer report offers more data to incorporate into the clinical decisionmaking process and is not meant as a stand - alone cookbook for psychotropic medications . since not all medications are part of the current version of the database , substitutions were allowed in the following instances : duloxetine for venlafaxine ; oxcarbazepine for carbamazepine ; and lisdexamphetamine for dextroamphetamine .
our chart review was not designed to define us food and drug administration ( fda ) labeling , nor was it intended to encourage such prescribing habits . due to this concern
we examined the amount of off - label prior drug - use in this population as well as the literature and found a paucity of evidence for most off - label prescribing . when having to decide on changing or adding a medication , factoring in polypharmacy risks and benefits unfortunately is done with inadequate information .
the large degree of off - label prescribing should be done with as much data as is available to the prescriber in order to optimize safety and outcome .
this secondary analysis was performed to help address this possible criticism of off - label prescribing since it is done with such frequency and insufficient evidence .
peer has the potential to enhance the information available to the prescriber when making these difficult decisions , thus offering some objectivity to off - label usage .
radley et al41 wrote about off - label medication - prescribing , placing psychiatric medications as one of the most frequently prescribed at 31% .
yury et al42 found that there is no published data for 40% of the most popular augmentation strategies and 55% of frequent combination of medications for augmentation .
additionally , an agency for healthcare research and quality ( ahrq ) report43 reviewing the top off - label use of medications according to such factors as risk , cost , side effects , and drug interactions , revealed 17 of them to be psychotropic . of those studied , 65% had inadequate evidence for off - label prescribing ( ie , quetapine , clonazepam , escitalopram , lorazepam , trazodone , zolpidem , sertraline , bupropion , venlafaxine , duloxetine , aripiprazole ) .
the remaining 35% ( ie , gabapentin , risperidone , amitriptyline , olanzapine , devalproex , lamotrigine ) averaged 12.5% adequate evidence , 33.2% uncertain evidence , and 54.3% inadequate evidence . in another ahrq report on off - label use of atypical antipsychotic medications , it concluded that , with few exceptions , there was not enough evidence to consider the off - label use of these drugs and that the increased risk of adverse events was concerning.44 we used our own data to perform a review of all the drugs labeling and dates of approval , using the fda s website for each medication and approval date for each diagnosis . the date used for the prescribing date of previous medications was
prior to 2003 , the beginning date of the review , since patient history of medications start / stop dates is frequently unreliable .
this analysis revealed that 62% of previously prescribed psychotropic medications were offlabel at the time of their prescription date .
this assessment leaves many variables not accounted for , such as what previous diagnosis the patient had received at the time the drug was prescribed , which might be different than the diagnosis determined in our clinic or what the patient reported .
we are not implying any relationship between off - label prescribing and the medications used by peer guidance .
rather , since there is an abundance of off - label psychotropic medication - prescribing , such prescribing , with more evidenced - based information , can decrease risks and increase success , according to the results of this review . despite the evidence of increased safety and efficacy in this and previous studies,2130
there are several limitations inherent in this retrospective chart review that may limit the conclusions one can draw from a case series .
first , the peer report was initially established as a predictor of future treatment success .
at this point we are not able to separate the role of peer in selecting the most efficacious treatments from the selection of better - tolerated treatments ( since , many times , poorly tolerated treatments are abandoned in clinical practice and ultimately not efficacious ) .
however , it is comforting to see that peer reports appear to be associated with effective and well - tolerated medication choices .
second , while this review did not systematically benefit from research - ready data , our analyses suggest overall improvement on both cgi - i and q - les - q - sf global scales after peer .
third , there was no comparison group in this study so it is not clear what the effects of treatment would have been in a parallel cohort of subjects not utilizing the peer analysis .
however , some information is provided by comparing our results with the patients pre - peer experience ( ie , treatment failure ) and historic data , making each patient s pre / post results their own control .
fourth , this is a cohort of persons who could afford the costs ( despite the compassionate sliding scale offered ) associated with the eeg test , and thus these patients may not be representative of all similar patients .
fifth , not all available medications are in the current version of the database , leading to potential limitations . however , this would reduce our ability to detect a benefit with peer reports compared to standard practice ( and increases our confidence in our positive results ) .
our chart review was not designed to define us food and drug administration ( fda ) labeling , nor was it intended to encourage such prescribing habits . due to this concern
we examined the amount of off - label prior drug - use in this population as well as the literature and found a paucity of evidence for most off - label prescribing . when having to decide on changing or adding a medication , factoring in polypharmacy risks and benefits unfortunately is done with inadequate information .
the large degree of off - label prescribing should be done with as much data as is available to the prescriber in order to optimize safety and outcome .
this secondary analysis was performed to help address this possible criticism of off - label prescribing since it is done with such frequency and insufficient evidence .
peer has the potential to enhance the information available to the prescriber when making these difficult decisions , thus offering some objectivity to off - label usage .
radley et al41 wrote about off - label medication - prescribing , placing psychiatric medications as one of the most frequently prescribed at 31% .
yury et al42 found that there is no published data for 40% of the most popular augmentation strategies and 55% of frequent combination of medications for augmentation . additionally , an agency for healthcare research and quality ( ahrq ) report43 reviewing the top off - label use of medications according to such factors as risk , cost , side effects , and drug interactions , revealed 17 of them to be psychotropic .
of those studied , 65% had inadequate evidence for off - label prescribing ( ie , quetapine , clonazepam , escitalopram , lorazepam , trazodone , zolpidem , sertraline , bupropion , venlafaxine , duloxetine , aripiprazole ) .
the remaining 35% ( ie , gabapentin , risperidone , amitriptyline , olanzapine , devalproex , lamotrigine ) averaged 12.5% adequate evidence , 33.2% uncertain evidence , and 54.3% inadequate evidence . in another ahrq report on off - label use of atypical antipsychotic medications , it concluded that , with few exceptions , there was not enough evidence to consider the off - label use of these drugs and that the increased risk of adverse events was concerning.44 we used our own data to perform a review of all the drugs labeling and dates of approval , using the fda s website for each medication and approval date for each diagnosis . the date used for the prescribing date of previous medications was
prior to 2003 , the beginning date of the review , since patient history of medications start / stop dates is frequently unreliable .
this analysis revealed that 62% of previously prescribed psychotropic medications were offlabel at the time of their prescription date .
this assessment leaves many variables not accounted for , such as what previous diagnosis the patient had received at the time the drug was prescribed , which might be different than the diagnosis determined in our clinic or what the patient reported .
we are not implying any relationship between off - label prescribing and the medications used by peer guidance . rather , since there is an abundance of off - label psychotropic medication - prescribing , such prescribing , with more evidenced - based information , can decrease risks and increase success , according to the results of this review .
despite the evidence of increased safety and efficacy in this and previous studies,2130 there are several limitations inherent in this retrospective chart review that may limit the conclusions one can draw from a case series .
first , the peer report was initially established as a predictor of future treatment success . at this point
we are not able to separate the role of peer in selecting the most efficacious treatments from the selection of better - tolerated treatments ( since , many times , poorly tolerated treatments are abandoned in clinical practice and ultimately not efficacious ) .
however , it is comforting to see that peer reports appear to be associated with effective and well - tolerated medication choices .
second , while this review did not systematically benefit from research - ready data , our analyses suggest overall improvement on both cgi - i and q - les - q - sf global scales after peer .
third , there was no comparison group in this study so it is not clear what the effects of treatment would have been in a parallel cohort of subjects not utilizing the peer analysis .
however , some information is provided by comparing our results with the patients pre - peer experience ( ie , treatment failure ) and historic data , making each patient s pre / post results their own control .
fourth , this is a cohort of persons who could afford the costs ( despite the compassionate sliding scale offered ) associated with the eeg test , and thus these patients may not be representative of all similar patients .
fifth , not all available medications are in the current version of the database , leading to potential limitations . however , this would reduce our ability to detect a benefit with peer reports compared to standard practice ( and increases our confidence in our positive results ) .
our retrospective chart analysis of clinical cases indicates that peer report using the referenced - eeg database may be a useful metric tool for clinicians making medication recommendations for refractory nonpsychotic patients .
as this data indicates , peer report may be useful as a negative marker to potentially avoid some risk of severe adverse events and in selecting more efficacious agents in treatmentresistant patients .
the results of this review are encouraging and indicate that treating patients with the additional information conveyed by the referenced - eeg database and peer report may result in better treatment responses in a group of patients who had not previously responded to trial - and - error medication selection ( currently considered standard practice ) .
for example , the use of stimulants in some patients with obsessive - compulsive disorder , anxiety , or eating disorders without the use of an antidepressant would not be a traditional medication choice , yet in these cases appeared to be what was needed for their particular neurophysiology ( given positive clinical outcomes ) .
the potential cost savings as a result of an effective medication regimen suggest that peer analysis may be cost - effective .
the durability of response with medications selected according to data provided by this tool and the broader options of medication combinations suggested by data in the report portends well for treatment compliance , number of medication trials , and treatment efficiency .
getting a patient on the correct medicine with improvement within a few sessions not only reduces the cost of trial - and - error prescribing , but , more importantly , reduces patient suffering .
it is also noted that at this point in the development of the database , almost all the medications are generic .
similarly , the use of atypical antipsychotics for the nonpsychotic patient in our clinic is estimated to be significantly lower than the use in practices treating similar patient populations .
future directions for the use of this technology include development of additional drugs and including comparisons with other neuroimaging techniques to address neuroanatomy in addition to clinical correlations .
more studies need to be done on the ability to prevent serious adverse events , suicidality , as well as targeting the best medication option for the individualized patient .
finally , a separate database is being completed for predicting outcomes of transcranial magnetic stimulation therapy as a way of deciding the probability of success when the decision to spend health care dollars needs to be considered .
further research in these areas need to confirm the value of qeeg as a simple , inexpensive , and noninvasive outpatient clinical tool for accuracy , safety , and cost savings . | we previously reported on an objective new tool that uses quantitative electroencephalography ( qeeg ) normative- and referenced - electroencephalography sampling databases ( currently called psychiatric eeg evaluation registry [ peer ] ) , which may assist physicians in determining medication selection for optimal efficacy to overcome trial - and - error prescribing .
the peer test compares drug - free qeeg features for individual patients to a database of patients with similar eeg patterns and known outcomes after pharmacological interventions .
based on specific eeg data elements and historical outcomes , the peer report may also serve as a marker of future severe adverse events ( eg , agitation , hostility , aggressiveness , suicidality , homicidality , mania , hypomania ) with specific medications . we used a retrospective chart review to investigate the clinical utility of such a registry in a naturalistic environment.resultsthis chart review demonstrated significant improvement on the global assessment scales clinical global impression improvement and quality of life enjoyment and satisfaction short form as well as time to maximum medical improvement and decreased suicidality occurrences .
the review also showed that 54.5% of previous medications causing a severe adverse event would have been raised as a caution had the peer report been available at the time the drug was prescribed . finally , due to the significant amount of off - label prescribing of psychotropic medications , additional , objective ,
evidence - based data aided the prescriber toward better choices.conclusionthe peer report may be useful , particularly in treatment - resistant patients , in helping to guide medication selection . based on the preliminary data obtained from this chart review , additional studies are warranted to establish the safety and efficacy of adding peer data when making medication decisions . |
it is estimated that there were 1,12,609 cases of cervical cancer in the year 2004 and the number will rise to 1,39,864 in the year 2015 .
this country has the largest burden of cervical cancer patients in the world and one of every five cervical cancer patients belongs to this country . however , diagnosed in the early stages and treated early , cervical cancer is a curable disease .
there are several methods for cervical cancer screening and several studies have established the importance of papanicolaou ( pap ) smear as one of the easy and important screening methods for cervical cancer .
routine cervical screening by pap smear resulted in decreasing the incidence of cervical cancer in many countries of the developed world . however in india , in spite of national recommendation , routine cervical screening program is not done and as a result , the prevalence of different epithelial lesions of the cervix is not known .
our study was initiated to detect the prevalence and spectrum of cervical epithelial abnormalities among female sex workers ( fsws ) by pap smear .
this study group was selected because many other studies done previously showed high rates of epithelial lesions among this population due to different risk factors .
this was a prospective study carried out during a period of 1 year ( from august 2011 to july 2012 ) .
all the fsws attending outpatient department during this time period with different clinical symptoms such as abdominal pain , bleeding per vagina , vaginal discharge , irregular menstruation etc .
samples were taken by brushes / ayre spatula , immediately fixed in alcohol and stained using pap technique by trained technicians .
reporting was done by two consultant cytopathologists according to the bethesda system ( tbs ) .
slides were reported as normal smear , inflammatory smear , specific infection , atypical squamous cell of undetermined significance ( ascus ) , low grade squamous intraepithelial lesion ( lsil ) , high grade squamous intraepithelial lesion ( hsil ) , squamous cell carcinoma ( scc ) and atypical glandular cell of undetermined significance ( agus ) .
a total of 60 cases were included in this study during the time period of 1 year .
total 16 ( 26.67% ) out of 60 patients were below the age of 30 years and 44 ( 73.33% ) were above 30 years of age .
out of 60 smears , 52 ( 86.67% ) smears showed pathologic findings [ figures 1 and 2 ] .
premalignant lesions were found in 37 ( 61.67% , n = 60 ) smears of which ascus was 2 ( 3.3% ) , lsil-9 ( 15% ) , hsil-23 ( 38.3% ) , scc-2 ( 3.3% ) and agus-1 ( 1.7% ) [ table 1 ] . among the patients of below 30 years
( n = 16 ) , premalignant lesions were found in 8 ( 50% ) patients of which ascus was 1 ( 6.3% ) , lsil-5 ( 31.2% ) and hsil-2 ( 12.5% ) [ table 1 ] .
total inflammatory smears were 36 ( 60% , n = 60 ) , of which 12 smears showed nonspecific inflammation , 10 smears were associated with hsil , 8 smears were associated with lsil , 2 smears were associated with ascus , 1 smear was associated with agus and 3 smears were associated with specific infections .
one smear showed features of both human papilloma virus ( hpv ) and herpes simplex virus ( hsv ) infections , 2 smears were associated with features of both hpv and trichomonas vaginalis infections .
( b ) photomicrograph showing low grade squamous intraepithelial lesion with koilocytic change in some of the cells ( pap , 400 ) .
the cells have mild increase in nucleocytoplasmic ratio and hyperchromatic nuclei ( a ) photomicrograph showing high grade squamous intraepithelial lesion having moderate increase in the nucleocytoplasmic ratio , anisonucleosis and hyperchromatic nuclei with irregular nuclear membrane ( pap , 400 ) .
( b ) photomicrograph showing squamous cell carcinoma having overlapping of the nuclei , severe increase in the nucleocytoplasmic ratio , hyperchromatic nuclei with conspicuous nucleoli ( pap , 400 ) spectrum of abnormalities in cervical pap smears among female sex workers
cervical cancer has a long latent phase with identifiable and treatable premalignant lesions which precede the invasive disease , and the benefit of conducting screening exceeds the cost involved .
firstly , the incidence of ascus and lsil was almost same for the below 30 and above 30 years age group , but the incidence of hsil and scc was greatly increased in the above 30 years age group indicating the gradually increasing incidence of malignancy with age .
these results are in accordance with the studies of bal et al . , and elhakeem et al . secondly ,
in the age group of below 30 years , 9 out of 16 ( 56.25% ) patients were candidates for follow - up ( due to the presence of hsv infection , ascus , lsil / hsil ) , emphasizing the need for screening even in the below 30 years age group .
thirdly , 24 out of 36 ( 66.67% ) inflammatory smears were associated with epithelial lesions , indicating the importance of proper hygiene maintenance in prevention of cervical epithelial lesions .
we compared the results obtained in this study with some studies made on the general population . in comparison to these studies ,
a very high incidence of epithelial lesions was found in this study [ table 2 ] .
the probable causes for the discrepancy observed , include the fact that our study population ( fsws ) are exposed to all the risk factors for cervical epithelial lesions in contrast to the general population .
comparison of results with other studies carried out among general population we also compared the results obtained in this study with few studies done on sex workers . in comparison ,
our study showed a higher incidence of epithelial lesions , particularly hsil [ table 3 ] .
the main reason for this discrepancy is because this study includes only the symptomatic patients who came to the out patient 's department for medical advice .
other possible causes for the discrepancy may be a small denominator population in this study , and a poorer standard of living and lack of awareness in our study population in contrast to that of other developed countries .
comparison of results with other studies carried out among sex workers there were a few limitations in our study .
first of all , we could not include a control population in our study and secondly , we could not find the true incidence because the asymptomatic cases could not be included in the study population .
despite the small study population , several important deductions can be made from this study .
firstly , considering the higher incidence of epithelial lesions in the below 30 years age group , it is recommended that the age of routine cervical cancer screening should be much earlier than the national recommendation .
secondly , as the incidence of epithelial lesions is quite high in our study population ( 61.67% ) , close follow - up of this target population ( i.e. , fsws ) and histological examination , is necessary to avoid unnecessary spread of neoplastic disease and untimely death of the patients .
furthermore , awareness about the disease and diagnostic utility of pap test , among fsws is also a must . | background : papanicolaou ( pap ) test is an important and easy diagnostic tool to detect any abnormalities on vaginal cytology .
pap test is routinely done in women of reproductive age group in many countries.aim:the aim of this study was to detect spectrum of abnormalities in female sex workers ( fsws ) on vaginal cytology.materials and methods : a total of 60 cases were included over a period of 1 year ( july , 2011-june , 2012 ) .
the age range of the patients was 14 - 61 years .
pap stained slides were evaluated by two consultant cytopathologists and reported as normal smear , inflammatory smear , specific infection , low grade squamous intraepithelial lesion ( lsil ) , high grade squamous intraepithelial lesion ( hsil ) , atypical squamous cell of undetermined significance ( ascus ) , squamous cell carcinoma ( scc ) and atypical glandular cell of undetermined significance ( agus).results : most of the smears were abnormal accounting for 86.7% of total cases ( 52/60 ) .
incidence of hsil was very high in fsws .
out of 60 cases , 8 normal smears ( 13.3% ) , 12 inflammatory smears ( 20% ) , 3 cases of infections ( 5% ) , 9 cases of lsil ( 15% ) , 23 cases of hsil ( 38.3% ) , 2 cases ( 3.3% ) each of ascus and scc and 1 case ( 1.3% ) agus were encountered.conclusions:close follow - up and histologic examinations are necessary to avoid unnecessary spread of the neoplastic disease and untimely death of the patients .
awareness about diseases in fsws and diagnostic utility of pap test are also a must . |
linking functional traits to bacterial phylogeny remains a fundamental but elusive goal of microbial ecology ( hunt et al 2008 ) . without this information , it becomes difficult to resolve meaningful units of diversity and the mechanisms by which bacteria interact with each other and adapt to environmental change .
most bacterial diversity is delineated among clusters of sequences that share > 99% 16s rrna gene sequence identity ( acinas et al 2004 ) .
these sequence clusters are believed to represent fundamental units of diversity , while intra - cluster microdiversity is thought to persist due to weak selective pressures ( acinas et al 2004 ) suggesting little ecological or taxonomic relevance .
recently , progress has been made in terms of delineating units of diversity that possess the fundamental properties of species by linking genetic diversity with ecology and evolutionary theory ( achtman and wagner 2008 , fraser et al 2009 ) . despite these advances , there remains no widely accepted species concept for prokaryotes ( gevers et al 2005 ) , and sequence - based analyses reveal widely varied levels of diversity within assigned species boundaries .
the comparative analysis of bacterial genome sequences has revealed considerable differences among closely related strains ( joyce et al 2002 , thompson et al 2005 , welch et al 2002 ) and provides a new perspective on genome evolution and prokaryotic species concepts .
genomic differences among closely related strains are concentrated in islands , strain - specific regions of the chromosome that are generally acquired by horizontal gene transfer ( hgt ) and harbor functionally adaptive traits ( dobrindt et al 2004 ) that can be linked to niche adaptation .
the pelagic cyanobacterium prochlorococcus is an important model for the study of island genes , which in this case are differentially expressed under low nutrient and high light stress in ecologically distinct populations ( coleman et al 2006 ) . despite convincing evidence for the adaptive significance of island genes among environmental bacteria , the precise functions of their products
have seldom been characterized and their potential role in the evolution of independent bacterial lineages remains poorly understood .
the marine sediment inhabiting genus salinispora belongs to the order actinomycetales , a group of actinobacteria commonly referred to as actinomycetes .
actinomycetes are a rich source of structurally diverse secondary metabolites and account for the majority of antibiotics discovered as of 2002 ( berdy 2005 ) .
have likewise proven to be a rich source of secondary metabolites ( fenical and jensen 2006 ) including salinosporamide a , which is currently in clinical trials for the treatment of cancer ( fenical et al 2009 ) . at present ,
the genus is comprised of three species that collectively constitute a microdiverse sequence cluster ( sensu ( acinas et al 2004 ) , i.e. , they share 99% 16s rrna gene sequence identity ( jensen and mafnas 2006 ) .
although the microdiversity within this cluster has been formally delineated into species - level taxa ( maldonado et al 2005 ) , it remains to be determined if these taxa represent ecologically or functionally distinct lineages .
here we report the comparative analysis of the complete genome sequences of s. tropica ( strain cnb-440 , the type strain for the species and thus a contribution to the genomic encyclopedia of bacteria and archaea project ) , hereafter referred to as st , and s. arenicola ( strain cns-205 ) , hereafter referred to as sa , the first obligately marine actinobacteria to be obtained in culture ( mincer et al 2002 ) .
the aims of this study were to describe , compare , and contrast the gene content and organization of the two genomes in the context of prevailing species concepts , identify the functional attributes that differentiate the two species , assess the processes that have driven genome evolution , and search for evidence of marine adaptation in this unusual group of gram - positive marine bacteria .
the sequencing and annotation of the sa genome was as previously reported for st ( udwary et al 2007 ) .
both genomes were sequenced as part of the department of energy , joint genome institute , community sequencing program .
orthologs within the two genomes were predicted using the reciprocal smallest distance ( rsd ) method ( wall et al 2003 ) , which includes a maximum likelihood estimate of amino acid substitutions .
a linear alignment of positional orthologs was created and the positions of rearranged orthologs and species - specific genes identified .
genomic islands were defined as regions > 20 kb that are flanked by regions of conservation and within which < 40% of the island genes possess a positional ortholog in the reciprocal genome .
paralogs within each genome were identified using the blastclust algorithm ( dondoshansky and wolf 2000 ) with a cut - off of 30% identity over 40% of the sequence length . the automated phylogenetic inference system ( apis )
all genes were assessed for evidence of hgt based on abnormal dna composition , phylogenetic , taxonomic , and sequence - based relationships , and comparisons to known mobile genetic elements ( mges ) .
genes identified by 2 different methodologies were counted as positive for hgt . to reflect confidence in the assignments , genes displaying positive evidence of hgt were color coded from yellow to red corresponding to total scores from 2 to 6 .
the results were mapped onto the genome to reveal hgt clustering patterns and adjacent clusters were merged ( figure 1a ) .
four dna compositional analyses included g+c content ( obtained from the jgi annotation ) , codon adaptive index , calculated with the cai calculator ( wu et al 2005 ) using a suite of housekeeping genes as reference , dinucleotide frequency differences ( * ) , calculated using islandpath ( hsiao et al 2003 ) , and dna composition , calculated using alien_hunter ( vernikos and parkhill 2006 ) .
g+c content or codon usage values > 1.5 standard deviations from the genomic mean and dinucleotide frequency differences > 1 standard deviation from the mean were scored positive for hgt .
taxonomic relationships in the form of lineage probability index ( lpi ) values for all protein coding genes were assigned using the darkhorse algorithm ( podell and gaasterland 2007 ) .
genes with an lpi of < 0.5 , indicating the orthologs are not in closely related genomes , were scored positive for hgt . a reciprocal darkhorse analysis (
podell et al 2008 ) was then performed on the orthologs of all positives , and if these genes had an lpi score > 0.5 , indicating the match sequence is phylogenetically typical within its own lineage , they were assigned an additional positive score . a phylogenetic approach using the apis program ( badger et al 2005 )
using this program , bootstrapped neighbor - joining trees of all predicted protein coding genes within each genome were created .
all genes cladding with non - actinobacterial homologs were binned into their respective taxonomic groups and given a positive hgt score .
evidence of hgt was also inferred from rsd analyses of each genome against a compiled set of 27 finished actinobacterial genomes that included at least two representatives of each genus for which sequences were available .
genes present in sa and/or st and not observed among the 27 actinobacterial genomes were assigned a positive hgt score .
bacteriophage were identified using prophage ( bose 2006 ) and phage finder ( fouts 2006 ) .
other insertion elements were identified as prophage or transposon in origin through blastx homology searches .
gene annotation based on searches for identity across pfam , sptr , kegg and cog databases was also used to help identify mobile genetic elements ( mges ) . each gene associated with an mge
test scores were amalgamated and those genes showing evidence of hgt in two or more tests ( maximum score 6 ) were classified as horizontally acquired .
the results were mapped onto the genome and genes identified by only one test but associated with clusters of genes that scored in two or more tests were added to the total hgt pool .
crisprs were identified using crispr finder ( http://crispr.u-psud.fr/server/crisprfinder.php ) while repeats larger than 35 bases were identified using reputer ( kurtz et al 2001 ) .
secondary metabolite gene clusters were manually annotated as in ( udwary et al 2007 ) .
cluster boundaries were predicted using previously reported gene clusters when available as in the case of rifamycin . for unknown clusters ,
loss of gene conservation across the actinobacteria was used to aid boundary predictions . in the future ,
programs such as clustscan may prove useful for pathway annotation and product prediction ( starcevic et al 2008 ) . however , many biosynthetic genes are large ( 5 - 10 kb ) and highly repetitive creating challenges associated with gene calling and assembly , eg . , ( udwary et al 2007 ) and the interpretation of operon structure .
the ratio of non - synonymous to synonymous mutations ( dn / ds ) for all orthologs was calculated using the perl progam snap ( http://www.hiv.lanl.gov ) with the alignments for all values > 1 checked manually .
the sequencing and annotation of the sa genome was as previously reported for st ( udwary et al 2007 ) .
both genomes were sequenced as part of the department of energy , joint genome institute , community sequencing program .
orthologs within the two genomes were predicted using the reciprocal smallest distance ( rsd ) method ( wall et al 2003 ) , which includes a maximum likelihood estimate of amino acid substitutions .
a linear alignment of positional orthologs was created and the positions of rearranged orthologs and species - specific genes identified .
genomic islands were defined as regions > 20 kb that are flanked by regions of conservation and within which < 40% of the island genes possess a positional ortholog in the reciprocal genome .
paralogs within each genome were identified using the blastclust algorithm ( dondoshansky and wolf 2000 ) with a cut - off of 30% identity over 40% of the sequence length . the automated phylogenetic inference system ( apis )
all genes were assessed for evidence of hgt based on abnormal dna composition , phylogenetic , taxonomic , and sequence - based relationships , and comparisons to known mobile genetic elements ( mges ) .
genes identified by 2 different methodologies were counted as positive for hgt . to reflect confidence in the assignments , genes displaying positive evidence of hgt were color coded from yellow to red corresponding to total scores from 2 to 6 .
the results were mapped onto the genome to reveal hgt clustering patterns and adjacent clusters were merged ( figure 1a ) .
four dna compositional analyses included g+c content ( obtained from the jgi annotation ) , codon adaptive index , calculated with the cai calculator ( wu et al 2005 ) using a suite of housekeeping genes as reference , dinucleotide frequency differences ( * ) , calculated using islandpath ( hsiao et al 2003 ) , and dna composition , calculated using alien_hunter ( vernikos and parkhill 2006 ) .
g+c content or codon usage values > 1.5 standard deviations from the genomic mean and dinucleotide frequency differences > 1 standard deviation from the mean were scored positive for hgt .
taxonomic relationships in the form of lineage probability index ( lpi ) values for all protein coding genes were assigned using the darkhorse algorithm ( podell and gaasterland 2007 ) .
genes with an lpi of < 0.5 , indicating the orthologs are not in closely related genomes , were scored positive for hgt . a reciprocal darkhorse analysis (
podell et al 2008 ) was then performed on the orthologs of all positives , and if these genes had an lpi score > 0.5 , indicating the match sequence is phylogenetically typical within its own lineage , they were assigned an additional positive score . a phylogenetic approach using the apis program ( badger et al 2005 )
was also employed to assess hgt . using this program , bootstrapped neighbor - joining trees of all predicted protein coding genes within each genome were created .
all genes cladding with non - actinobacterial homologs were binned into their respective taxonomic groups and given a positive hgt score .
evidence of hgt was also inferred from rsd analyses of each genome against a compiled set of 27 finished actinobacterial genomes that included at least two representatives of each genus for which sequences were available .
genes present in sa and/or st and not observed among the 27 actinobacterial genomes were assigned a positive hgt score .
bacteriophage were identified using prophage ( bose 2006 ) and phage finder ( fouts 2006 ) .
other insertion elements were identified as prophage or transposon in origin through blastx homology searches .
gene annotation based on searches for identity across pfam , sptr , kegg and cog databases was also used to help identify mobile genetic elements ( mges ) . each gene associated with an mge
test scores were amalgamated and those genes showing evidence of hgt in two or more tests ( maximum score 6 ) were classified as horizontally acquired .
the results were mapped onto the genome and genes identified by only one test but associated with clusters of genes that scored in two or more tests were added to the total hgt pool .
crisprs were identified using crispr finder ( http://crispr.u-psud.fr/server/crisprfinder.php ) while repeats larger than 35 bases were identified using reputer ( kurtz et al 2001 ) .
secondary metabolite gene clusters were manually annotated as in ( udwary et al 2007 ) .
cluster boundaries were predicted using previously reported gene clusters when available as in the case of rifamycin . for unknown clusters ,
loss of gene conservation across the actinobacteria was used to aid boundary predictions . in the future ,
programs such as clustscan may prove useful for pathway annotation and product prediction ( starcevic et al 2008 ) . however , many biosynthetic genes are large ( 5 - 10 kb ) and highly repetitive creating challenges associated with gene calling and assembly , eg . , ( udwary et al 2007 ) and the interpretation of operon structure .
the ratio of non - synonymous to synonymous mutations ( dn / ds ) for all orthologs was calculated using the perl progam snap ( http://www.hiv.lanl.gov ) with the alignments for all values > 1 checked manually .
the st and sa genomes share 3606 orthologs , representing 79.4% and 73.2% of the respective genomes ( table 1 ) .
the average nucleotide identity among these orthologs is 87.2% , well below the 94% cut - off that has been suggested to delineate bacterial species ( konstantinidis and tiedje 2005 ) . despite differing by only seven nucleotides ( 99.7% identity ) in the 16s rrna gene , the genome of sa is 603 kb ( 11.6% ) larger and possesses 1505 species - specific genes compared to 987 in st .
seventy - five percent of these species - specific genes are located in 21 genomic islands ( tables 1 , s1 ) , none of which are comprised of genes originating entirely from one genome ( figure 1 ) .
the presence of genomic islands in the same location on the chromosomes of closely related bacteria is well recognized ( coleman et al 2006 ) and facilitated by the presence of trnas ( tuanyok et al 2008 ) .
twelve islands in the salinispora alignment share at least one trna between both genomes and of those , four share two or more trnas within a single island indicating multiple insertion sites .
in addition to trnas , direct repeats detected in the same location in both genomes could also act as insertion sites to help create islands .
these islands are enriched with large clusters of genes devoted to the biosynthesis of secondary metabolites ( figure 1 ) .
they house all 25 of the species - specific secondary metabolic pathways , while eight of the 12 shared pathways occur in the genus - specific core ( tables 2 , 3 ) . we have isolated and identified the products of eight of these pathways , which include the highly selective proteasome inhibitor salinosporamide a ( feling et al 2003 ) as well as sporolide a ( buchanan et al 2005 ) , which is derived from an enediyne polyketide precursor ( udwary et al 2007 ) , one of the most potent classes of biologically active agents discovered to date .
a previous analysis of 46 salinispora strains revealed that secondary metabolite production is the major phenotypic difference among the three species ( jensen et al 2007 ) , an observation supported by the analysis of the s. tropica genome ( udwary et al 2007 ) .
of the eight secondary metabolites that have been isolated from the two strains , all but salinosporamide a , sporolide a , and salinilactam have been reported from unrelated taxa ( figure 1 ) , providing strong evidence of hgt .
further evidence for hgt comes from a phylogenetic analysis of the polyketide synthase ( pks ) genes associated with the rifamycin biosynthetic gene cluster ( rif ) in sa and amycolatopsis mediterranei , the original source of this antibiotic ( yu 1999 ) .
this analysis confirms prior observations of hgt in this pathway ( kim et al 2006 ) and reveals that all 10 of the ketosynthase domains are perfectly interleaved , as would be predicted if the entire pks gene cluster had been exchanged between the two strains ( figure s1 ) .
evidence of hgt coupled with prior evidence for the fixation of specific pathways such as rif among globally distributed sa populations ( jensen et al 2007 ) supports vertical inheritance following pathway acquisition ( ochman 2005 ) .
this evolutionary history is what might be expected if pathway acquisition fostered ecotype diversification or a selective sweep ( cohan 2002 ) resulting from strong selection for the acquired pathway , either of which provide compelling evidence that secondary metabolites represent functional traits with important ecological roles .
the concept that gene acquisition provides a mechanism for ecological diversification that may ultimately drive the formation of independent bacterial lineages has been previously proposed ( ochman et al 2000 ) .
the inclusion of secondary metabolism among the functional categories of acquired genes that may have this effect sheds new light on the functional importance and evolutionary significance of this class of genes .
although the ecological functions of secondary metabolites remain largely unknown , and thus it is not clear how these molecules might facilitate ecological diversification , there is mounting evidence that they play important roles in chemical defense ( haeder et al 2009 ) or as signaling molecules involved in population or community communication ( yim et al 2007 ) .
differences between the two species also occur in crispr sequences , which are non - continuous direct repeats separated by variable ( spacer ) sequences that have been shown to confer immunity to phage ( barrangou et al 2007 ) .
the st genome carries three intact prophage and three crisprs ( 35 spacers ) , while only one prophage has been identified in the genome of sa , which possesses eight different crisprs ( 140 spacers ) .
the sa prophage is unprecedented among bacterial genomes in that it occurs in two adjacent copies that share 100% sequence identity .
these copies are flanked by trna att sites and separated by an identical 45 bp att site , suggesting double integration as opposed to duplication ( te poele et al 2008 ) .
remarkably , four of the sa crisprs possess a spacer that shares 100% identity with portions of three different genes found in st prophage 1 ( figure 2 ) .
these spacer sequences have no similar matches to genes in the sa prophage or in any prophage sequences deposited in the ncbi , camera , or the sdsu center for universal microbial sequencing databases .
the detection of these spacer sequences provides evidence that sa has been exposed to a phage related to one that currently infects st and that sa now maintains acquired immunity to this phage genotype as has been previously reported in other bacteria ( barrangou et al 2007 ) .
this is a rare example in which evidence has been obtained for crispr - mediated acquired immunity to a prophage that resides in the genome of a closely related environmental bacterium . given that sa strain cns-205 was isolated from palau while st strain cnb-440 was recovered 15 years earlier from the bahamas , it appears that actinophage have broad temporal - spatial distributions or that resistance is maintained on temporal scales sufficient for the global distribution of a bacterial species .
enhanced phage immunity , as evidenced by 140 relative to 35 crispr spacer sequences , coupled with a larger genome size and a greater number of species - specific secondary metabolic pathways may account for the cosmopolitan distribution of sa relative to st , which to date has only been recovered from the caribbean ( jensen and mafnas 2006 ) . also included among the sa - specific gene pool is a complete phospho - transferase system ( pts , sare4844 - 4850 ) .
ptss are centrally involved in carbon source uptake and regulation ( parche et al 2000 ) and may provide growth advantages that also factor into the relatively broad distribution of sa .
however , additional strains will need to be studied before any of these differences can be firmly linked to species distributions .
the 21 genomic islands are not contiguous regions of species - specific dna but were instead created by a complex process of gene acquisition , loss , duplication , and inactivation ( figure 3 ) .
the overall composition , evolutionary history , and function of the island genes are similar in both strains , with duplication and hgt accounting for the majority of genes and secondary metabolism representing the largest functionally annotated category .
remarkably , 42% of the rearranged island orthologs fall within other islands indicating that inter - island movement or
island hopping is common , thus providing support for the hypothesis that islands undergo continual rearrangement ( coleman et al 2006 ) .
there is dramatic , operon - scale evidence of this process in the shared yersiniabactin pathways ( st sid2 and sa sid1 ) , which occur in islands 15 and 10 , respectively , and in the unknown dipeptide pathways ( st nrps1 and sa nrps3 ) , which occur in islands 4 and 15 , respectively . in both cases , these pathways remain intact yet are located in different islands in the two strains ( figure 1 , table 2 , 3 ) .
there is also evidence of cluster fragmentation in the 10-membered enediyne gene set sa pks3 , which contains the core set of genes associated with calicheamicin biosynthesis ( figure s2 ) ( ahlert et al 2002 ) , yet is split by the introduction of 145 kb of dna from three different biosynthetic loci ( island 10 , figure 1 ) .
the conserved fragments appear to encode the biosynthesis of a calicheamicin anolog , while flanking genes display a high level of gene duplication and rearrangement indicative of active pathway evolution .
cluster fragmentation is also observed in the 9-membered enediyne pks cluster sa pks1(a - c ) , which is scattered across the genome in islands 4 , 10 , and 21 ( figure 1 , table 3 ) .
the genomic islands are also enriched in mobile genetic elements including prophage , integrases , and actinobacterial integrative and conjugative elements ( aices ) ( burrus et al 2002 ) ( tables s2 , s3 ) , the later of which are known to play a role in gene acquisition and rearrangement .
the salinispora aices possess trab homologs , which promote conjugal plasmid transfer in mycelial streptomycetes ( reuther 2006 ) , suggesting that hyphal tip fusion is a prominent mechanism driving gene exchange in these bacteria .
aices have been linked to the acquisition of secondary metabolite gene clusters ( te poele et al 2007 ) and their occurrence in island 7 ( sa aice1 ) , which includes the entire 90 kb rif cluster , and island 10 ( sa aice3 ) , which contains biosynthetic gene clusters for enediyne , siderophore , and amino acid - derived secondary metabolites , provides a mechanism for the acquisition of these pathways ( figure 1 ) .
six additional secondary metabolite gene clusters ( st nrps1 , st spo , sa nrps3 , sa pks5 , sa cym , and sa pks2 ) are flanked by direct repeats , providing further support for hgt . in the case of cym
( schultz 2008 ) , which is clearly inserted into a trna , the pseudogenes preceding and following it are all related to transposases or integrases providing a mechanism for chromosomal integration . despite exhaustive analyses of hgt , only 22% of the 127 genes in the five biosynthetic pathways ( rif , sta , des , lym , cym ) whose products
have also been observed in other bacteria ( figure 1 , table 3 ) scored positive for hgt .
this observation suggests that the pathways either originated in salinispora or that the exchange of these biosynthetic genes has occurred largely among closely related bacteria and therefore gone undetected with the hgt methods applied in this study .
the latter scenario is supported by the observation that all five of the shared biosynthetic pathways were previously reported in other actinomycetes .
the acquisition of genes from closely related bacteria likely accounts for many of the species - specific island genes for which no evidence of evolutionary history could be determined ( figure 3b ) .
these genes were poorly conserved among 27 actinobacterial genomes ( figure 3d ) providing additional support that they were acquired , most likely from environmental actinobacteria that are not well represented among sequenced genomes .
although gene loss was not quantified , this process is also a likely contributor to island formation . in support of an adaptive role for island genes , 7.6% ( 44/573 ) of the orthologs
show evidence of positive selection ( dn / ds > 1 ) compared to 1.6% ( 49/3027 ) of the non - island pairs .
given that the majority of island genes display evidence of hgt , the increased dn / ds ratio is in agreement with the observation that acquired genes experience relaxed functional constraints ( hao and golding , 2006 ) .
functional differences between related organisms can be obscured when orthologs are taken out of the context of the gene clusters in which they reside .
for example , the pks genes sare1250 and stro2768 are orthologous and likely perform similar functions , yet they reside in the rif and slm pathways , respectively , and thus contribute to the biosynthesis of dramatically different secondary metabolites .
likewise , intra - cluster pks gene duplication ( sare3151 and sare3152 , figure 1 ) has an immediate effect on the product of the pathway by the introduction of an additional acyl group into the carbon skeleton of the macrolide , as opposed to the more traditional concept of parology facilitating mutation - driven functional divergence ( prince 2002 ) .
sub - genic , modular duplications are also observed ( sare3156 modules 4 and 5 , figure 1 ) , which likewise have an immediate effect on the structure of the secondary metabolite produced by the pathway .
while hgt is considered a rapid method for ecological adaptation in bacteria ( ochman et al 2000 ) , pks gene duplication provides a complementary evolutionary strategy ( fischbach et al 2008 ) that could lead to the rapid production of new secondary metabolites that subsequently drive the creation of new adaptive radiations .
salinispora species are the first marine actinobacteria reported to require seawater for growth ( maldonado et al 2005 ) .
unlike gram - negative marine bacteria , in which seawater requirements are linked to a specific sodium ion requirement ( kogure 1998 ) , salinispora strains are capable of growth in osmotically adjusted , sodium - free media ( tsueng and lam 2008 ) .
an analysis of the salinispora core for evidence of genes associated with this unusual osmotic requirement reveals a highly duplicated family of 29 polymorphic membrane proteins ( pmps ) that include homologs associated with polymorphic outer membrane proteins ( pomps ) .
pomps remain functionally uncharacterized however there is strong evidence that they are type v secretory systems ( henderson 2001 ) , making this the first report of type v autotransporters outside of the proteobacteria ( henderson 2004 ) .
phylogenetic analyses provide evidence that the salinispora pmps were acquired from aquatic , gram - negative bacteria and that they have continued to undergo considerable duplication subsequent to divergence of the two species ( figure s3 ) .
the occurrence of this large family of pmp autotransporters in marine actinobacteria may represent a low nutrient adaptation that renders cells susceptible to lysis in low osmotic environments .
in conclusion , the comparative analysis of two closely related marine actinobacterial genomes provides new insight into the functional traits associated with genomic islands .
it has been possible to assign precise , physiological functions to island genes and link differences in secondary metabolism to fine - scale phylogenetic architecture in two distinct bacterial lineages , which by all available metrics maintain the fundamental characteristics of species - level units of diversity .
it is clear that gene clusters devoted to secondary metabolite biosynthesis are dynamic entities that are readily acquired , rearranged , and fragmented in the context of genomic islands , and that the results of these processes create natural product diversity that can have an immediate effect on fitness or niche utilization .
the high level of species specificity associated with secondary metabolism suggests that this functional trait may represent a previously unrecognized force driving ecological diversification among closely related , sediment inhabiting bacteria .
| genomic islands have been shown to harbor functional traits that differentiate ecologically distinct populations of environmental bacteria .
a comparative analysis of the complete genome sequences of the marine actinobacteria salinispora tropica and s. arenicola reveals that 75% of the species - specific genes are located in 21 genomic islands .
these islands are enriched in genes associated with secondary metabolite biosynthesis providing evidence that secondary metabolism is linked to functional adaptation .
secondary metabolism accounts for 8.8% and 10.9% of the genes in the s. tropica and s. arenicola genomes , respectively , and represents the major functional category of annotated genes that differentiates the two species .
genomic islands harbor all 25 of the species - specific biosynthetic pathways , the majority of which occur in s. arenicola and may contribute to the cosmopolitan distribution of this species .
genome evolution is dominated by gene duplication and acquisition , which in the case of secondary metabolism provide immediate opportunities for the production of new bioactive products .
evidence that secondary metabolic pathways are exchanged horizontally , coupled with prior evidence for fixation among globally distributed populations , supports a functional role and suggests that the acquisition of natural product biosynthetic gene clusters represents a previously unrecognized force driving bacterial diversification .
species - specific differences observed in crispr ( clustered regularly interspaced short palindromic repeat ) sequences suggest that s. arenicola may possess a higher level of phage immunity , while a highly duplicated family of polymorphic membrane proteins provides evidence of a new mechanism of marine adaptation in gram - positive bacteria . |
Subsets and Splits