content
stringlengths 0
1.88M
| url
stringlengths 0
5.28k
|
|---|---|
Thanks for your feedback, this will help us improve our content for you!
Thank for your feedback, this will help us improve our content for you!
Dan Landau, MD, PhD of Weill Cornell Medical College and the NYGC, New York, NY gives an overview of his talk on clonal evolution in chronic lymphocytic leukemia (CLL) held at the 2016 International Workshop of the German CLL Study Group (GCLLSG) in Cologne, Germany. Dr Landau explains that we understand that a malignant population such as a population of CLL cells in any patient, is actually not uniform but composed of multiple sub-populations, which continuously compete, evolve and create diversity. The therapeutic challenge is that in each patient, we are not dealing with one disease but with a collection of many diseases. Therefore, it is not surprising that therapies can fail. With new genomic technologies, it is now possible to survey this genetic complexity for large cohorts of patients in order to understand the processes underlying the complexity. By taking an evolutionary perspective and combining it with genomic methods, we can infer the past history of disease and use this information to predict its future. Dr Landau points out how today data science approaches are already being used to predict real world outcomes in advertising or on the stock market for example. However, data science approaches are not really being applied in cancer research. Further, he discusses non-genetic sources of diversity, such as epigenetics and spatial location. All of these layers of information need to be considered in order to understand the evolutionary process. Finally, he discusses the idea of measuring clonal kinetics directly in patients, i.e. measuring the rate of growth of each clone with each therapy and come up with an optimized therapeutic approach through the use of algorithms; he considers this approach to be a radical extension of the precision medicine paradigm. | https://www.vjhemonc.com/video/qoeh2w8x7lu-how-combining-an-evolutionary-perspective-with-genomic-methods-can-advance-cll-treatment/ |
BACKGROUND OF THE INVENTION
Field of the Invention
The present invention relates to a method which enables an individual's immune repertoire to be described, and thus certain pathological states to be detected and/or monitored.
An essential feature of the immune system is the capacity to recognize specifically a large number of antigens. In vertebrates, the T and B lymphocytes mainly execute this function of recognition, by means of at least three transmembrane molecular complexes; immunoglobulin for B cells, and the two T receptors for T lymphocytes: the &agr;&bgr; receptor and the &ggr;&dgr; receptor, which thus define two subpopulations among the collective T lymphocytes (Wilson et al., 1988; Raulet, 1989).
To the tremendous variety of antigens to be recognized, there corresponds a very wide potential diversity of these three types of receptors. In effect, these three molecular complexes, of related structure, are composed of two (for each of the T receptors) or four (for immunoglobulins) peptide chains, the NH.sub.2 -terminal domains of which are highly variable. It is the existence of a strong interaction between a given antigenic determinant and the site consisting of these variable domains which constitutes the expression at molecular level of the phenomenon of recognition. Thus, the information contained in the genome of a mouse enables it to produce potentially at least 10.sup.11 immunoglobulins of different variable region, 10.sup.15 different &agr; &bgr;T receptors and 10.sup.18 different &ggr;&dgr;T receptors.
The notion of repertoire thus emerges: the set of immunoglobulin variable regions present at a given instant in an organism constitutes the current repertoire of immunoglobulins. Similarly, the set of &ggr;. delta.T-receptor variable regions possibly capable of being produced by a mouse genome constitutes the potential repertoire of &ggr; &dgr; lymphocytes.
The immune system hence contains, in fact, three complex repertoires, since the T-receptor repertoire must be subdivided into an . alpha.&bgr; T-receptor and a &ggr;&dgr;T-receptor repertoire.
The mechanisms which enable the huge diversity of T- and B- lymphocyte receptors to be produced are now well known (Tonegawa, 1983). The variable region of an immunoglobulin or of a T receptor is composed of the NH.sub.2 -terminal domains of two peptide chains. The genes coding for these two proteins are the result of somatic rearrangements which juxtapose a V segment, one or two D segments depending on the chains, and a J segment. The number of V, D and J segments available in the different loci provides a first source of diversity, termed combinatorial diversity (see Table 1). Furthermore, the lack of precision in the junctions between two of these segments (V-D, D-D, D-J or V-J junctions) introduces a second source of diversity, termed junctional diversity, since, on the one hand each of the two juxtaposed ends can have a few bases cleaved from it, and on the other hand some nucleotides can be inserted at the joining site. Lastly, in the case of genes coding for immunoglobulins, somatic mutations can take place in the second exon of the rearranged gene, thereby constituting a third source of diversity.
Depending on the type of receptor, &agr;&bgr;, &ggr;&dgr; or immunoglobulin, each of these three sources of diversity is a greater or lesser component of the total diversity. Thus, while the number of V, D and J segments available is smallest in the case of the &ggr;&dgr; receptor, the extent of the repertoire of this receptor remains potentially very large. This essentially stems from the fact that the gene coding for the &dgr; chain can comprise zero, one or two D elements, which can, furthermore, be read in the three reading frames, whereas the V.sub.H and &bgr; chains possess one and only one D element. In fact, the diversity of the &ggr;&dgr;-receptor repertoire may be described in the following manner: it appears that a small number of V and J segments is available, but the number of V segments of the &dgr; chain is still not properly known, and there is a very wide potential junctional diversity which manifests itself in a large variation in the length of the second exon of the rearranged gene, especially in the case of the gene coding for the &dgr; chain (Raulet, 1989).
The function of the &agr;&bgr;T lymphocytes is relatively well known: they participate in cytolysis by killer cells, in reactions which regulate antibody synthesis and in inflammatory phenomena. The function of the &ggr;&dgr;T lymphocytes is still poorly understood: it is generally accepted that, apart from their probable role in the ontogeny of the immune system, the &ggr;&dgr;T cells participate in immune surveillance. As regards the various functions of antibodies, these are relatively well known and will not be restated here.
There is nothing at present capable of describing the collective antibodies and T receptors (i.e. the Ab and the TcR repertoires) expressed at a given moment in an individual. It represents a monumental task, since each of the repertoires probably contains millions of different molecules. Only a small number of reagents capable of specifically recognizing this or that element of such a repertoire is as yet available. It is, of course, possible to work more shrewdly by determining the sequence of a certain number of expressed genes. However, practical considerations make it scarcely conceivable to analyze routinely more than about ten or, perhaps, a hundred genes, and the operation is expensive and very lengthy. In short, the repertoires of antibodies and of T receptors are described at the present time only by means of a small number of parameters. Hence methods are not available which permit a rapid and effective analysis of the physiological an pathological situations associated with the statement of these repertoires. For example, it is clear that these repertoires vary during a voluntary immunization (vaccine), or during infection by pathogenic microorganisms, or during the progress of autoimmune pathologies. In the latter case, there are many reasons to believe that predisposition to these diseases mirrors a certain composition of the repertoires. It is hence very probable that a good method of analysis of the repertoires would have medical spin-offs, and could form the basis of techniques of medical analysis and of diagnosis.
A method which is now very widely used for the purpose of studying the diversity and distribution of the three repertoires, of immunoglobulins and &agr;&bgr; and &ggr;&dgr; receptors, is that of amplification by PCR (polymerase chain reaction). This technique consists in amplifying genomic DNA or complementary DNA with a series of specific primer pairs (V,C) or (V,J) and, where appropriate, cloning and then sequencing the amplification products obtained (Takagaki et al., 1989); Asarnow et al., 1989). This powerful method is not without artifacts. Setting aside altogether the problems associated with quantification, it seems, for example, risky to deduce from two amplifications carried out with two different pairs of primers (V1, C) and (V2, C) for example, a preferential utilization of one segment relative to the other in the population under study (Rajasekar et al., 1990). In the current state of the art, it is difficult to determine by this method the degree of utilization of the different V segments. Moreover, cloning of the amplification products for the purpose of determining their sequence can also generate artifacts. For example, a certain proportion of these products are, in fact, heteroduplexes (if the amplified population is heterogeneous), for which it cannot be predicted how it will be "repaired" after transformation of the bacterium (Abastado et al., 1984, 1987).
A recent improvement is amplification according to the anchored PCR technique, which consists in carrying out the amplification of a heterogeneous population of complementary DNA using a single pair of primers, one hybridizing in the constant region C, the other with an identical sequence added at the 3' end of all the complementary DNA strands. It may hence be hoped that the amplification yield will not depend on the V segment used in the rearrangement.
Recently, a fairly sensitive method, enabling the degree of utilization of the different V segments in a population of heterogeneous transcripts to be evaluated, has been developed (Okada et Weissman, 1989; Singer et al., 1990). This accurate and reproducible method has the advantage of being conceptually simple, and hence of introducing little bias. However, it does not enable the V utilization and the J utilization to be defined simultaneously, nor does it enable it to be determined whether the transcript visualized is in frame.
Concomitantly with amplification from polyclonal populations, another widely used approach has consisted in constructing banks of hybridomas or of clonal T lines, and then characterizing at molecular level the antibodies or T receptors expressed. This method is obviously difficult to carry out on a large scale. It introduces biases which are difficult to evaluate during the steps of fusion or cloning, but is the only current technique that enables the sequence of both chains of a T receptor to be determined simultaneously, or a repertoire of a known specificity to be determined.
It should be noted that the methods mentioned above all characterize the repertoire from the messenger RNA and not from the protein, so that any post-transcriptional control is not known. The use of monoclonal antibodies and of flow cytofluorometry enables the repertoire to be analyzed at the level of the receptor itself, and gives simultaneously a large amount of information about the phenotype of the cells under study. However, this method is rather insensitive and, most particularly, does not enable the repertoire to be studied in detail since it is impossible, in the absence of reagents, to gain access to the junctional diversity of the repertoire. Furthermore, it requires the availability of a large battery of well-characterized monoclonal antibodies.
SUMMARY OF THE INVENTION
The subject of the present invention is, more especially, a method which enables an individual's immune repertoire to be described, and which can be readily automated, takes into account a very large number of parameters and is without the biases of the methods described previously.
More specifically, the present invention relates to a method for describing the repertoires of antibodies (Ab) and of T-cell receptors (TcR) of an individual's immune system, characterized in that:
starting with a biological sample, reverse transcription of the mRNA which it contains is performed,
on the transcription product, or directly on the DNA extracted from the sample, separate amplifications are then performed by a PCR type method for each primer pair V,C, V corresponding to a variable segment of the repertoire in question and C hybridizing with the constant segment of the repertoire under study,
on each of these amplification products, an elongation step is performed for each J segment of the repertoire, using a labelled oligonucleotide specific to this J segment as primer and the amplification product as template,
for each elongation product corresponding to a triplet (V,C)J thereby obtained, the size of the different elongation products is revealed, to within one nucleotide, by the methods generally used for the determination of DNA sequences,
the description of the repertoires corresponding, for each element of the repertoire, to a V,C,J triplet and to the size of the element.
An alternative consists in extracting the DNA from the biological sample and carrying out the amplification on the denatured DNA, using the fact that productive rearrangements bring together the variable segment and the constant region, so that only the variable segments used actually serve in the amplification.
The method according to the invention may be used either for describing one of the three repertoires, or else all three or only two of them. In what follows, the &ggr;&dgr;T repertoire will be described in particular, but the same methodology may be used for the . alpha.&bgr; T repertoire and immunoglobulins.
"Description of the repertoire" is understood to denote both a statement in the form of a two- or three-dimensional table, and a graphic representation and/or reproductions of gel, for example.
In effect, one of the values of the present invention is to be able to compare these repertoires, in particular, with typical repertoire statements capable of being associated with particular physiologies or pathologies, or alternatively to monitor the changes in these repertoires in the onset and/or progression of certain diseases such as some cancers, autoimmune diseases or AIDS. For example, during the immune reaction which occurs in at least a few types of cancer, rapid detection of tumor- infiltrating lymphocytes (TIL), and observation of the changes therein as well as in the remainder of the repertoire during a treatment by immunotherapy could prove an advantageous approach. It is possible to envisage applying the power of the method to the study of the changes in the repertoire during the development of an autoimmune disease. It is known, in effect, that, in many autoimmune diseases, the T lymphocytes occupy a position of key importance. Were strict correlations to be observed, following studies carried out in the few available animal models, between certain of these pathologies and a repertoire statement or succession of repertoire statements measured according to the method presented, it could then be fully envisaged that a predictive value would be given to this method of analysis, and consequently a value of earlier diagnosis than the tests currently available. This method may hence become a powerful investigative and analytical tool for the study and monitoring of the immune system.
The principles of the methodologies employed in this method are known.
Thus, when the sample is taken from the patient, the RNA (or DNA) will be prepared by known methods which may depend on the nature of the sample (peripheral blood or biopsy, for example).
The synthesis of complementary DNA by reverse transcription is known, as is the method enabling only the messenger mRNA present in this total RNA to be transcribed, by means of a poly(T) primer.
The amplification may be carried out by a PCR type method, that is to say by the PCR method or by one of its many variants.
The method is preferably carried out by PCR (polymerase chain reaction) and without the addition of any radioactive, colored or fluorescent tracer. The DNA is amplified, it being possible for the latter to originate either from a blood sample or from another sample or biopsy; however, the initial sample must contain a sufficiently large number of cells for the subsequent results to be statistically significant. Amplification begins with a reverse transcription step (or from the DNA extracted from the cells in the sample). After this, the sample is divided and separate amplification reactions, equal in number to the number of oligonucleotide pairs (V,C), are performed.
Each of the samples is then subdivided so as to carry out, for each of them, so-called elongation or "run-off" reactions equal in number to the number of J segments. To perform these reactions, oligonucleotides specific to these J segments are used, which oligonucleotides are labelled this time either with a radioactive tracer or, more advantageously, with a fluorophor or by other methods. In the "run-off" reaction, the polymerase recopies up to the end the segments amplified from the J oligonucleotide. If these are heterogeneous in length, a set of molecules labelled at their J end, and whose size can be measured accurately, is hence obtained.
This size measurement may be carried out on conventional DNA sequencing gels if a radioactive labelling has been performed or, advantageously, with an automatic sequencer, in particular one capable of detecting fluorophors. The apparatus is hence used only to measure the lengths and the intensity of the elongation products. Naturally, since there are four commercial fluorophors of different "colors", the products of four different reactions employing the different fluorophors may be mixed, as is done in DNA sequence determinations, but for completely different reasons. For example, it may be especially useful to mix the products of homologous reactions carried out on a control sample, and which are labelled with a given color, with those of three samples under study. In this way, a direct comparison is obtained between the samples and the control, but other experimental designs are possible. Some commercial apparatuses carry out an analysis of the four colors in 24 lanes simultaneously (equivalent to 96 samples). The analysis takes a few hours and the results are computerized.
By the use of a sequencer, it is possible to simplify the reading of the autoradiograms in the conventional sequence, which is lengthy. In the specific case described in the example, it is necessary to read each experiment and to memorize and interpret more than 1,000 elements. In the case of an automatic sequencer, the information is immediately stored, and the use of existing software, as well as of a software written in the context of the invention, enables the matrix of results to be obtained.
It will be noted that the practical problems are still more considerable for the &agr;&bgr; repertoire of the mouse, where analysis of some 60,000 elements is involved. The problem of the &bgr; repertoire is completely soluble according to the strategy adopted for the &ggr; and &dgr; repertoires. The problem of the &agr; repertoire is arduous (5,000 samples to be analyzed for each repertoire), but simplifying strategies may be developed. The same applies to the antibody repertoires and the human repertoires.
Among apparatuses which can be readily adapted, the model 373A sequencer marketed by the company Applied Biosystems and related models should be mentioned.
By means of the software developed in the context of the invention, the data are organized either in a three-dimensional representation (genetic elements in a plane, length in the height), or in a two- dimensional table. This representation is preferable in that it makes it possible, in a matrix of dots, to represent the abundance of the reaction product (for example, the dot is darker or lighter according to the intensity of the band detected by the sequencer) and then to compare two matrices readily (two different repertoires, two statements of the same repertoire, and the like).
A possible improvement consists in introducing a fourth parameter which enables the repertoire to be analyzed still more finely. It should be recalled that this notion of resolution is of paramount importance if it is desired to be able to analyze changes in the current repertoire. In effect, the larger the number of parameters of measurement, the greater the resolution and the higher the chances of being able to pick up fine variations in the repertoire. This fourth parameter provides access, like the third, to the junctional diversity. It involves applying to the "run- off" products an electrophoresis method carried out in a gradient of temperature or of any other denaturing factor, so that products of the same size are separated according to their greater or lesser homology with a fixed probe (Riesner et al., 1989). What is sought is hence an indirect access to the sequence of the variable regions. Experiments are in progress employing the genes rearranged in hybridomas as probe.
The examples below are designed to demonstrate other advantages and features of the present invention.
DESCRIPTION OF THE FIGURES
In the attached Figures,
FIG. 1 shows a portion of the &ggr;&dgr;T repertoire in the thymus (T) and spleen (S) of an adult Balb/c mouse and the placenta (P) of an F1 mouse (C3H×C57/B16)
FIGS. 2A-2C show the analysis on denaturing gel of the elongation products obtained with different J&bgr; primers on the DNA extracted from lymph nodes, amplified by PCR with primers specific to the V&bgr; and C&bgr; segments:
2A and 2B: B10.A mice immunized with pigeon cytochrome C:
1=unimmunized
2=after primary immunization
3=restimulation in vitro after primary immunization;
2C: C3H mice immunized with pigeon cytochrome C:
4, 5, 6=three different unimmunized mice
7=restimulation in vitro after primary immunization of a group of mice,
the values appearing at right or left of the Figures correspond to the size (in nucleotides) of the elongated products obtained for a productive V&bgr;-J&bgr; combination.
DESCRIPTION OF A PREFERRED EMBODIMENT
Materials and methods
Oligonucleotides
The oligonucleotides used were synthesized on a 381A DNA Synthesier (Applied Biosystems) automated apparatus. Uncoupling from the column and unblocking of the phosphate functions (protected by a beta- cyanoethyl group) are performed by injecting 1.5 ml of 28% ammonia solution into the column at the rate of 0.5 ml per 30 min. The eluate is incubated for 12 hours at 56° C. in order to deprotect the bases of the oligonucleotide (removal of the benzoyl and isobutyryl groups). After lyophilization, the oligonucleotide is resuspended in water at a concentration of 50 &mgr;M.
Mice, cells
Mice: All the strains used (Balb/c, Balb/b, DBA/2, CB 20, SJL and C3H/He) originate from the animal house of the Pasteur Institute. When matings were carried out, the first day of gestation, the day on which the vaginal plug is detected, is referred to as day 0.
Cells: The hybridomas used (S15, T14, T16, T18) result from the fusion of thymocytes of an adult C3H/He mouse with the partner BW5147. alpha.. sup.- &bgr;.sup.- (mutant of the AKR thymoma BW5147, no longer expressing the &agr;&bgr; receptor.
Preparation of RNA
The RNA of tissues and cells in culture was prepared according to three different methods.
First method, used for preparing the RNA of cells in culture: the cells are centrifuged; the pellet obtained is resuspended in 10 ml of 10 mM NaCl/CH.sub.3 COONa pH 5, 1% SDS solution. After incubation for 2 min at 4° C., 10 ml of an unbuffered phenol solution at 65. degree. C. are added. The mixture is stirred vigorously for 5 min; after centrifugation for 10 min at 3,000 rpm, the aqueous phase is withdrawn and remixed with one volume of chloroform/ isoamyl alcohol. After centrifugation, the RNA contained in the aqueous phase is precipitated by adding 0.1 volume of 3M sodium acetate pH 5.2 and two volumes of ethanol.
Second method, termed AGPC (acid guanidinium thiocyanate-phenol- chloroform) method: usable equally well for preparing the RNA of a cell pellet or of an organ, this method makes it possible to avoid in very large measure the degradation of ribonucleic acids which is liable to occur once cells are lysed. However, traces of DNA persist in the preparation, and may be troublesome in some applications.
The third method eliminates this contamination with DNA by exploiting the difference in density between ribo- and deoxyribonucleic acids. The separation of these two species is carried out by ultracentrifugation of the lysate in the presence of a discontinuous CsCl gradient: the DNA is retained at the interface of the gradient, while the denser RNA precipitates. This method hence makes it possible to recover both the RNA and the DNA of a tissue or a cell pellet. Briefly, a 4M solution of guanidine thiocyanate is prepared, containing 0.5% of Na N- laurylsarcosine, 25 mM EDTA, 0.13% of antifoam A. The CsCl gradient is composed of 3 ml of a 5.7M CsCl, 25 mM Na acetate pH 5.2, 10 mM EDTA solution and 0.7 ml of a 2.4M CsCl, 25 mM Na acetate pH 5.2, 10 mM EDTA solution. The tissue is ground in 7 ml of the 4M guanidine thiocyanate solution using a Potter homogenizer, and the lysate obtained is centrifuged for 10 min at 8,000 rpm in an HB-4 rotor to remove solid particles. The supernatant is deposited gently on the cushion of CsCl: the whole is centrifuged for 24 hours in an SW 41 rotor at 30,000 rpm at 20° C. The liquid phase is then removed (during this step the DNA located at the interface may be recovered), and the pellet is resuspended in 500 &mgr;l of water and precipitated at -20° C. by adding 1 ml of ethanol and 50 &mgr;l of 3M Na acetate pH 5.2.
Preparation of complementary DNA
Synthesis of the complementary DNA is carried out from the total RNA prepared according to one of the three methods described above. The buffer used is the same as that of the PCR amplification step (Cetus buffer). In effect, the different buffers proposed did not prove to have substantially greater efficacy (comparison by measurement of the incorporation of .sup.32 P-labelled dCTP); in contrast, the Mg.sub.2.sup. + concentration of these buffers does not permit PCR amplification to be carried out without a further intermediate step. The oligonucleotide used as primer of the polymerization of the complementary DNA strand is a poly- dT 15-mer. Briefly, 10 &mgr;g of total RNA, when the latter originates from an adult mouse organ, or the RNA of 10.sup.5 cells originating from a culture or from a fetal thymus, are incubated for 10 min at 70° C. in 50 &mgr;l of a 50 mM KCl, 10 mM Tris-HCl pH 8.2, 1.5 mM MgCl.sub.2, 0. 01% gelatin, 0.1 mM EDTA, 5 &mgr;M pdT(15), 0.2 mM dNTP solution. Then, after 5 min on ice, 5 units of AMV RT (Promega or Boehringer) are added, as well as 34 units of RNasin (Pharmacia); the mixture is incubated for 1 h at 43° C. and brought to 100° C. for 5 min.
Amplification by the PCR technique
The amplifications were carried out on Perkin Elmer Cetus and Prem automated equipment according to the technique described (Saiki et al., 1988).
To amplify complementary DNA, the protocol used was as follows: 5 &mgr; l of the solution prepared above are amplified in 50 or 100 &mgr; l of a solution comprising 50 mM KCl, 10 mM Tris-HCl pH 8.2, 0.01% gelatin, 0. 2 &mgr;M each of the two oligonucleotides used, 2 u per 100 &mgr;l of Taq Polymerase (Beckman), 200 &mgr;M each of the nucleotides dATP, dGTP, dCTP and dTTP. The Mg.sup.2+ ion concentration used varies from 2 to 2.5 mM. The mixture is covered with 50 &mgr;l of mineral oil, heated to 80. degree. C. for 10 min, amplified by 40 cycles (1 min at 94° C., 1 min at 60° C., 1 min at 72° C.) and then incubated for 10 min at 72° C.
Among the parameters which enable the background of the method to be reduced, the use of optimal concentrations of magnesium ions in the amplification or elongation steps must be mentioned; thus, between 1 and 3 mM magnesium ions will preferably be used.
Labelling of primers, elongation by "run-off"
The J primers used for carrying out the "run-off" step were radiolabelled beforehand by phosphorylation of the 5' end using a [.sup. 32 P]phosphate. The protocol is as follows: 100 pmol of the oligonucleotide are incubated in 10 &mgr;l for 30 min at 37° C. in the amplification buffer at a concentration of 2.5 mM Mg.sup.2+ in the presence of 40 &mgr;Ci of [.sup.32 P]-ATP (equivalent to 12 pmol) and 3 units of T4 polynucleotide kinase. The enzyme is then inactivated by bringing the mixture to 70° C. for 10 min.
Elongation by "run-off" from the labelled J primers is carried out under the following conditions. 1 &mgr;l of the mixture amplified above is diluted in 10 &mgr;l of a solution identical to that which was used for the amplification (amplification buffer with the optimal Mg.sup. 2+ concentration (2 to 2.5 mM), 200 &mgr;M each of the dNTPs, 0.2 u of Taq Polymerase), to which the labelled J primer at a concentration of 1 . mu. M is added (the J primer is hence [lacuna] an at least 5-fold excess relative to the other primers V and C supplied by the &mgr;l of the amplified mixture). The "run-off" reaction consists of 3 min at 94. degree. C., 1 min at 60° C. followed by 15 min at 72° C.
Electrophoresis
Analysis of the amplification products and the sequences is carried out by electrophoresis on 6% polyacrylamide gel (crosslinking: 1 g of bisacrylamide to 19 g of acrylamide) of thickness 400 &mgr;m, in TBE buffer (Maniatis et al., 1982) under denaturing conditions (95% formamide, 20 mM EDTA, 0.25% bromophenol blue, 0.25% xylene cyanole), and incubated for 10 min at 80° C. Migration is carried out in TBE buffer under an electric field of 4,000 Vm.sup.-1, for 2 h or 4 h for sequence analysis, and 5 to 6 h for analysis of amplification products.
Example 1
Study of the genetic diversity of the &ggr; chain of the T receptor in the mouse
Principle of the method
For each variable chain (V&agr;, V&bgr;, V&ggr; or V&dgr; for the &agr;&bgr;- or &ggr;&dgr;T receptors), the specific oligonucleotides are synthesized and enable the cDNA copies of the messenger RNAs to be amplified separately. The table below gives the list of oligonucleotides used in the following analysis. The transcripts corresponding to the variable regions V&ggr;1, V&ggr;2 . . . V&ggr; 7 are amplified separately, as are those corresponding to V&dgr;1, V. delta.2 . . . V&dgr;9. For each amplification product, a reaction specific to the J segments is carried out. Finally, the size of the products is measured on a sequencing gel. This enables the messenger RNAs to be broken down according to the length of the variable region (N region in particular), which can vary from 10 to 20 nucleotides approximately. In addition, it is possible to identify the messenger RNAs which are out-of-frame for translation into protein. In summary, a sample is parametrized (1) for the use of the V chains, (2) for the use of the J segments and (3) for size.
The genetic diversity, for the &ggr;&dgr;T receptors of the mouse, originates from the matching up of 15 genetic elements for the . gamma. chain of the receptor and 11 elements of the &dgr; chain. During recombinations which give rise to active genes of structure V-D-J- C, various mechanisms operate at the junctions of certain recombined segments so that the length of the active gene is variable within limits which are from 0 to 20 nucleotides approximately for the V&ggr;-J. gamma.- C&ggr; genes and from 0 to 50 nucleotides approximately for the V&dgr;- J&dgr;-C&dgr; genes.
The repertoire of the &ggr;&dgr;T receptor was parametrized by determination:
of the V,J and C segments which are used,
of the length of the rearranged gene.
It is seen in Table 1 that this represents more than about a thousand measurements for the &ggr;&dgr;T receptors. In the case of the &agr; &bgr;T receptors, more than 50,000 measurements are involved.
Experimental method
For the repertoire of &ggr;&dgr;T receptors of the mouse, the following are synthesized:
7 oligonucleotides specific to V&ggr; chains,
3 oligonucleotides specific to J&ggr; chains,
4 oligonucleotides specific to C&ggr; chains,
9 oligonucleotides specific to V&dgr; chains,
2 oligonucleotides specific to J&dgr; chains,
1 oligonucleotide specific to the C&dgr; chain.
The methods of determination of the primers are known, especially where strong homologies exist between sequences which it is intended to distinguish, for example V&ggr;1, V&ggr;2 and V&ggr;3.
Attached Table 2 gives the list of oligonucleotides used.
The results obtained are recorded in FIG. 1 without the J utilization.
TABLE 1
_________________________________________________________________________ _
Immunoglobulin &agr;&bgr; Receptor (1)
&ggr;&dgr; Receptor (2)
V.sub.H Chain
V.sub.&kgr; Chain
V.sub.&ggr; Chain
&agr; Chain
&bgr; Chain
&ggr; Chain
&dgr; Chain
_________________________________________________________________________ _
Mouse repertoires
V segments 250-1000
250 2 100 25 7 10
D segments 12 0 0 0 2 0 2
J segments 4 + 1 4 + 1
4 50 12 3 2
C regions 8 isotypes
1 4 1 2 4 1
Total div. (3)
10.sup.11 10.sup.15 10.sup.18
Human repertoires (4)
V segments 100-200
80 60 80 8 + 6
4
D segments 4 0 0 0 2 0 2
J segments 6 + 3 5 6 50 13 5 3
C regions 10 isotypes
1 6 1 2 2 1
_________________________________________________________________________ _
(1) Wilson et al. (1988)
(2) Raulet (1989)
(3) Davis and Bjorkman (1988)
(4) Meindl et al. (1990)
TABLE 2
_________________________________________________________________________ _
V.sub.&ggr; 1: (SEQ ID NO: 1)
AGTTTGAGTATCTAATATATGTCT
V.sub.&ggr; 2: (SEQ ID NO: 2)
ACGACCCTTAGGAGGGAAGC
V.sub.&ggr; 3: (SEQ ID NO: 3)
TTGAGTATCTAATATATGTCGAG
V.sub.&ggr; 2: (SEQ ID NO: 4)
CGGCAAAAAACAAATCAACAG
V.sub.&ggr; 4: (SEQ ID NO: 5)
TGTCCTTGCAACCCCTACCC
V.sub.&ggr; 5: (SEQ ID NO: 6)
TGTGCACTGGTACCAACTGA
V.sub.&ggr; 6: (SEQ ID NO: 7)
GGAATTCAAAAGAAAACATTGTCT
V.sub.&ggr; 7: (SEQ ID NO: 8)
AAGCTAGAGGGGTCCTCTGC
J.sub.&ggr; 1: (SEQ ID NO: 9)
CTGCAAATACCTTGTGAAAA
J.sub.&ggr; 2: (SEQ ID NO: 10)
CTGCAAATACCTTGTGAAAG
J.sub.&ggr; 4: (SEQ ID NO: 11)
GAATTACTACGAGCTTTGTC
C.sub.&ggr; 1: (SEQ ID NO: 12)
TTTCAGCAACAGAAGGAAGG
C.sub.&ggr; 2: (SEQ ID NO: 13)
TCCAGGATAGTATTGCCATT
C.sub.&ggr; 3: (SEQ ID NO: 14)
GGAAATGTCTGCATCAAGCT
C.sub.&ggr; 4: (SEQ ID NO: 15)
GCTTGGGAGAAAAGTCTGAG
pan-C.sub.&ggr; : (SEQ ID NO: 16)
CTTATGGAGATTTGTTTCAGC
V&dgr;1: (SEQ ID NO: 17)
GGAATTCAGAAGGCAACAATGAAAG
V&dgr;2: (SEQ ID NO: 18)
GTTCCCYGCAGATCCAAGCC
V&dgr;3: (SEQ ID NO: 19)
TTCCTGGCTATTGCCTCTGAC
V&dgr;4: (SEQ ID NO: 20)
CCGCTTCTGTGTGAACTTCC
V&dgr;5: (SEQ ID NO: 21)
CAGATCCTTGCAGTTCATCC
V&dgr;6: (SEQ ID NO: 22)
TCAAGTCCATCAGCCTTGTC
V&dgr;7-R.sup.(2) : (SEQ ID NO: 23)
GAAAGCTTCAGTGCAAGAGTC
V&dgr;7-T: (SEQ ID NO: 24)
CGCAGAGCTGCAGTGTAAGT
V&dgr;8: (SEQ ID NO: 25)
GCTACAGCACCCTGCACATC
J&dgr;1: (SEQ ID NO: 26)
TCCACAGTCACTTGGGTTCC
J&dgr;2: (SEQ ID NO: 27)
TCCACAAAGAGCTCTATGCC
C&dgr;: (SEQ ID NO: 28)
CGAATTCCACAATCTTCTTG
_________________________________________________________________________ _
(1) The nomenclatures used are that of Heilig & Tonegawa (1986) for the &ggr; locus and that of Raulet (1989) for the &dgr; locus. The choice of a portion of the oligonucleotides originates directly from Takagaki et al. (1989 b).
(2) V&dgr;7-R is the oligonucleotide specific to the variable segment V&dgr;7 referenced in Raulet (1989); V&dgr;7-T is the oligonucleotide specific to the variable segment V&dgr;7 referenced in Takagaki et al. (1989 a).
Example 2
Analysis of the genetic diversity of the &agr;&bgr;T receptor
The genetic diversity of the &bgr; chain of the T receptor on lymph nodes of B10.A mice, after immunization with pigeon cytochrome C, constitutes a well-documented reference system. In particular, according to published studies, it is known that the &bgr; chain of 75 to 80% of the clones isolated after immunization and restimulation in vitro with the antigen is composed of the rearrangement V&bgr;3-J&bgr;1.2-C&bgr;.
A sample of messenger RNA originating from draining lymph nodes of immunized or unimmunized mice was converted into cDNA. This was amplified by PCR (polymerase chain reaction) with an oligonucleotide pair located, on the one hand in one of the V&bgr; variable regions, and on the other hand in the constant region. This operation was repeated for each V&bgr; region (numbering about twenty). After this, each amplification reaction, divided into 12 samples (one for each J. beta.), served as a template for an elongation cycle with one of the 12 radiolabelled J&bgr;.
Attached FIGS. 2A-2C illustrates a part of the results obtained for the pairs V&bgr;1-V&bgr;3 and V&bgr;16-C&bgr;, reanalyzed with four different J&bgr; including J&bgr;1.2, on B10.A mice (H-2a) in two independent experiments (FIGS. 2A and 2B). In FIG. 2A, for the pair V. beta.3-J&bgr;1.2, a preponderant band is seen to appear in the T cells of the lymph nodes restimulated in vitro with pigeon cytochrome C (FIG. 2A, track 3). The size of the fragments of which this band is composed is in agreement with the expected results (115 nucleotides for V&bgr;3- J. beta. 1.2). These results are reproducible from one experiment to another (FIG. 2B) and, in addition, indicate that the preponderance of the rearrangement V&bgr;3-J&bgr;1.2 is already detectable after the first immunization (FIG. 2B, J&bgr;1.2, track 2).
It is not ruled out to be able to carry out this type of analysis on one and the same mouse so as to avoid the problem of the minimal variations existing from one mouse to another, as illustrated in FIG. 2C (tracks 4 to 6).
BIBLIOGRAPHIC REFERENCES
ABASTADO et al. (1984). Proc. Natl. Acad. Sci. USA 81, 5792- 5796
ABASTADO et al. (1987). Proc. Natl. Acad. Sci. USA 84, 6496- 6500
ASARNOW et al. (1989). Nature 341, 60-62
DAVIS and BJORKMAN (1988). Nature 334, 395-402
MANIATIS et al. (1982). Molecular Cloning: Laboratory Manual. Cold Spring Harbor Laboratory
MEINDL et al. (1990). Eur. J. Immunol. 20, 1855-1863
OKADA et WEISSMAN (1989). J. Exp. Med. 169, 1703-1719
RAJASEKAR et al. (1990). Proc. Natl. Acad. Sci. USA 87, 1767- 1771
RAULET (1989). Ann. Rev. Immunol. 7, 175-207
RIESNER et al. (1989). Electrophoresis 10, 377-389
SAIKI et al. (1988). Science 239, 487-491
SINGER et al. (1990). EMBO J. (in press)
TAKAGAKI et al. (1989). Nature 339, 712-714
TONEGAWA (1983). Nature 302, 575-581
WILSON et al. (1988). Immunological Reviews 101, 149-172
_________________________________________________________________________ _
SEQUENCE LISTING
(1) GENERAL INFORMATION:
(iii) NUMBER OF SEQUENCES: 28
(2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:
AGTTTGAGTATCTAATATATGTCT24
(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
ACGACCCTTAGGAGGGAAGC20
(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 23 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:
TTGAGTATCTAATATATGTCGAG23
(2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
CGGCAAAAAACAAATCAACAG21
(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
TGTCCTTGCAACCCCTACCC20
(2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
TGTGCACTGGTACCAACTGA20
(2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 24 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:
GGAATTCAAAAGAAAACATTGTCT24
(2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
AAGCTAGAGGGGTCCTCTGC20
(2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:
CTGCAAATACCTTGTGAAAA20
(2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
CTGCAAATACCTTGTGAAAG20
(2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:
GAATTACTACGAGCTTTGTC20
(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
TTTCAGCAACAGAAGGAAGG20
(2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
TCCAGGATAGTATTGCCATT20
(2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
GGAAATGTCTGCATCAAGCT20
(2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
GCTTGGGAGAAAAGTCTGAG20
(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
CTTATGGAGATTTGTTTCAGC21
(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:
GGAATTCAGAAGGCAACAATGAAAG25
(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
GTTCCCYGCAGATCCAAGCC20
(2) INFORMATION FOR SEQ ID NO:19:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:
TTCCTGGCTATTGCCTCTGAC21
(2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
CCGCTTCTGTGTGAACTTCC20
(2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
CAGATCCTTGCAGTTCATCC20
(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
TCAAGTCCATCAGCCTTGTC20
(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:
GAAAGCTTCAGTGCAAGAGTC21
(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
CGCAGAGCTGCAGTGTAAGT20
(2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:
GCTACAGCACCCTGCACATC20
(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
TCCACAGTCACTTGGGTTCC20
(2) INFORMATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
TCCACAAAGAGCTCTATGCC20
(2) INFORMATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 base pairs
(B) TYPE: nucleic acid
(C) STRANDEDNESS: unknown
(D) TOPOLOGY: unknown
(ii) MOLECULE TYPE: DNA (genomic)
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
CGAATTCCACAATCTTCTTG20
_________________________________________________________________________ _ | |
Microplastics (> 100 µm - MPs) have been analysed in several studies while small microplastics (< 100 µm - SMPs), additives and plasticizers (APs) presence in the seawater of the Svalbard has not yet been investigated in detail. Surface and bottom samples will be collected along the Kongsfjorden ...
The project aims to identify drivers of phytoplankton community structures in Arctic fjords. In particular, I study under which conditions a bloom is dominated by flagellates and under which conditions by diatoms. I will combine multivariate statistics on existing time series data in Greenland an...
Arctic seabirds, as migratory species, spend summer in the Arctic and winter in marine environment in southern areas. Therefore, they are exposed to contrasted concentrations of pollutants like Persistent Organic Pollutants (POPs) and mercury (Hg). In Kongsfjorden, the five glaciers have all been...
Persistant Organic Pollutans (POPs) are toxic chemicals that adversely affect human health and the environment. They persist for long periods of time in the environment and can accumulate and pass from one species to the next through the food chain. Understanding the factors that determine change...
This project will document the scientific itinerary of huts, field camps and cultural environments (protected, unprotected and partially protected cultural heritage) on Brøggerhalvoya. Although considerable efforts have been made to protect certain sites dating from the contemporary period, no fo...
The main goal of this project is to model the spatial distribution of reindeer cadavers in the arctic tundra. The effects of reindeer cadavers can be long lasting in the nutrient poor arctic ecosystem. However, the spatial distribution of these cadavers is not random, which means that these cadav...
Frozen Arctic soils have been found to store large amounts of mercury (Hg), a highly toxic metal. As the permafrost is thawing due to climate change, it is suggested that this mercury could release from the soil, potentially becoming available to the terrestrial food web. Methylated mercury (MeHg...
The project is part of a case study of the ecosystem in Kongsfjorden and aim to fill knowledge gaps on fish abundance, community composition, distribution and role in the food web. It will also include dietary studies of key fish species and their roles in the diet of resident marine mammals. The...
My master´s thesis will be about the change in the diet of kittiwakes over time. With incoming Atlantic waters, Atlantic species comes further north. I will investigate how the energy content of available food/prey changes with changing species ranges. I will be taking part in the field work in K...
Reindeer feeds on vegetation and drinks from water sources that could be contaminated with Hg. Although previous studies have determined low levels of mercury exposure on the Svalbard reindeer, the mercury released from thawing permafrost could change the current situation. This project aims to ...
It is undeniable that sea ice conditions and extent are changing. Formation of fjordic sea ice has become unreliable, the season has changed with later onset of freezing and earlier melt, and much uncertainty evolves around how this will affect the community that inhabits the microscopic brine ch...
Arctic lakes release large -but not well constrained- amounts of methane (CH4), a potent greenhouse gas. This project delineates the main field campaign within my postdoctoral project aimed at capturing methane cycling archives from lakes in the rapidly warming Arctic. I will participate in the j...
This project is a part of a 30 ECTS master thesis conducted at the Royal Institute of Technology, Sweden. The fieldwork consists of gravity measurements along several profile lines around the area of Billefjorden on 20-24 of April 2022. The gravity data will be complemented with magnetic measurem...
Surging glaciers are of great interest as their behavior gives insights into glacier dynamic processes. Svalbard is one of the few clusters in the world where surging glaciers exist. Recently, two glacier systems that are easily accessible from Longyearbyen started surging. This project will use ...
During the first part of my thesis, I will be creating a methodology for automated analysis of camera monitoring data of the nests of geese and terns using artificial intelligence. In order to test if this program works, I will need to obtain enough new camera data of nests on Svalbard and put th...
Svalbard is undergoing rapid environmental changes alongside with a developing tourist industry and strict environmental regulations underway, by which residents in Longyearbyen must adjust into. Through anthropological fieldwork and in-depth interviews, this master project will investigate the n...
The aim of my master’s project is to study how increased nutrients (primarily nitrogen and
phosphorous) affect the phenological development of deciduous plants in autumn (specifically: senescence,
ie leaf colour change) in High Arctic tundra. Furthermore, it aims to improve methodology for use of...
Renewable energy research is a developing field in the Arctic and especially at UNIS. The environmental and meteorological conditions are different from lower latitudes. In my PhD, I investigate meteorological phenomena which are relevant to renewable energy. One aspect of this are local wind cir...
The research question of this thesis is: Which interests prevail in Norwegian Svalbard politics, and in what ways do they prevail? The thesis aims to 1) describe how Svalbard politics is made and map its key actors, thus contributing to increased knowledge production and better understanding of S...
The Arctic Ocean is changing to a warmer and ice-free state, which may lead to substantial changes in biodiversity and ecosystem structures. An Atlantification of the zooplankton community is ongoing, but at which rate is poorly known at present stage. The aim of this project is to 1) determine t...
Prosjektet «KlimaDidakt: Klimaforskere i møte med elever og lærere» bringer sammen sterke norske forskningsmiljøer innen klima og miljø og didaktiske fagmiljøer med ekspertise på kunnskapsformidling i realfag. Formidlingen skal gi kunnskap om klimaforandringer, hvordan forskere kommer fram til sl...
Sjeldne kreftformer utgjør 20% av all kreft og kjennetegnes ofte av høy dødelighet, mangel på effektive kreftmedisiner og stort udekket medisinsk behov. Kreft i gallegangene, Cholangiocarcinom,CCA, er en slik sjelden kreftform. Internasjonal standard behandling en kombinasjon av to av tre cellegi...
Økosystemer i ferskvann er under hardt press fra mange menneskelige påvirkninger. Dette er en stor utfordring ikke bare for biodiversiteten i ferskvann, men også for velferden til mennesker ettersom de økologiske prosessene i ferskvann bidrar til å opprettholde viktige økosystemtjenester som filt...
SINTEF applies for funding support for a symposium on High Temperature Heat Pumps (HTHPs) in Copenhagen, Denmark in 2022. The intention is to accelerate the implementation of industrial HTHPs. This technology is highly attractive since it can replace fossil fuel based energy and enable industrie...
I forskningsprosjektet APT-R skal vi utvikle nye metoder og verktøy som gjør det enklere for kollektivselskap å hente innsikt fra sensordata. Kollektivkjøretøy samler daglig inn store mengder automatiske data. Det er disse automatiske kollektivdataene som gjør det mulig å gi passasjerene sanntids...
We here ask support for a visiting researcher grant for Dr. Natalya Gomez, McGill University, Canada for a 6 month stay at the University of Bergen, Dep. of Earth Science and Bjerknes Centre for Climate Research. Dr. Gomez is a Canada Research Chair in Ice Sheet - Sea Level Interactions and an in...
Ensemble predictions and ensemble data assimilation have played a significant role in improving forecasting skills for predicting the Northern European winter climate. However, the use of ensemble data assimilation with coupled climate models is still in its infancy. Particular issues related to ...
The workshop is part of the planning process for an international research initiative that when developed will provide integrated analyses of the ongoing changes in North Atlantic/Arctic ecosystems, infrastructures, and in human economic and social activities due to changing climate. In addition ...
Gjennom prosjektet «Miljøverdier i mellomrommet» ønsker vi å skape oppmerksomhet rundt de naturkvalitetene som finnes i arealene vi har valgt å kalle mellomrommet. Det vi omtaler som mellomrommene er arealer som ofte er små og inneklemt mellom annen arealbruk. Det kan dreie seg om veikanter og an...
Klima- og miljøbevissthet er en sentral del av det norske læreplanverket og lærere over hele landet er opptatt av at elevene skal få den aller nyeste kunnskapen om klimaendringene og lære hvordan vi løser dem. Gode initiativ, som Klimapilotene og Klimaskolen.no til Oslo kommune er allerede på pla... | https://prosjektbanken.forskningsradet.no/explore/projects?Kilde=FORISS&distribution=Ar&chart=bar&calcType=funding&Sprak=no&sortBy=date&sortOrder=desc&resultCount=30&offset=90&source=FORISS&projectId=312650 |
This section is from the book "Cyclopedia Of Architecture, Carpentry, And Building", by James C. et al. Also available from Amazon: Cyclopedia Of Architecture, Carpentry And Building.
To perform the operation of erecting a brick building it is necessary to lay the carefully chosen bricks upon each other, with a bed of some kind of mortar between. Ordinary brickwork is laid in common white lime mortar, but for greater strength and durability there is often added a proportion of cement, and for brickwork below ground, cement mortar only should be used. The thickness of the joints will vary from three-sixteenths of an inch to three-eighths of an inch, according to whether the joint is to be concealed or made a feature of the work.
The laying of the bricks should be carefully watched, as there is a tendency on the part of many masons to slight this work. " Bricks should not be merely laid, but every one should be rubbed and pressed down in such a manner as to force the mortar into the pores of the bricks, and produce the maximum adhesion; with quick-setting cement this is still more important than with lime mortar. For the best work it is specified that the brick shall be laid with a 'shove-joint,' that is, that the brick shall first be laid so as to project over the one below, and be pressed into the mortar, and then be shoved into its final position. Bricks should be laid in full beds of mortar, filling end and side joints in one operation. This operation is simple and easy with skillful masons, if they will do it, but it requires persistence to get it accomplished. Masons have a habit of laying bricks in a bed of mortar, leaving the vertical joints to take care of themselves, throwing a little mortar over the top beds and giving a sweep with the trowel which more or less disguises the open joint below. They also have a way after mortar has been sufficiently applied to the top bed of brick, to draw the point of their trowel through it, making an open channel with only a sharp ridge of mortar on each side (and generally throwing some of it overboard . so that if the succeeding brick is taken up, it will show a clear hollow, free from mortar, through the bed. ' This enables them to bed the next brick with more facility, and avoid pressure upon it to obtain the requisite thickness of joint. Neglect in wetting the brick before use is the cause of many of the failures of brickwork. Bricks have a great avidity for water, and if the mortar is stiff and the bricks dry. they will absorb the water so rapidly that the mortar will not set properly, and will crumble in the fingers when dry.
"Mortar is sometimes made so thin that the brick will not absorb all the water. This practice is objectionable; it interferes with the setting of the mortar, and particularly with the adhesion of the mortar to the brick. Watery mortar also contracts excessively in drying (if it ever does dry), which causes undue settlement and, possibly, cracks or distortion. The bricks should not be wetted to the point of saturation, or they will be incapable of absorbing any of the moisture from the mortar, and the adhesion between the brick and mortar will be weak. The common method of wetting brick by throwing water from buckets or spraying with a hose over a large pile is deceptive, the water reaches a few bricks on one or more sides and escapes many. Immersion of the brick for from three to eight minutes, depending upon its quality, is the only sure method to avert the evil consequences of using dry or partially wetted brick. Strict attention must be paid to have the starting course level, for the bricks being of equal thickness throughout, the slightest irregularity or incorrectness in it will be carried into the superposed courses, and can only be rectified by using a greater or less quantity of mortar in one part or another, a course which is injurious to the work. A common but improper method of building thick brick walls is to lay up the outer stretcher courses between the header courses, and then to throw mortar into the trough thus formed, making it semifluid by the addition of a large dose of water, then throwing in the brickbats (sand and rubbish are often substituted for bricks), allowing them to find their own bearing; when the trough is filled, it is plastered over with stiff mortar, and the header course laid and the operation repeated. This practice may have some advantage in celerity in executing work, but none in strength or security."
A modification of this practice, where the bricks are laid dry and grouted with moderately thin mortar in every course, may be successfully used in weather when there is no danger of freezing, and will make solid work. This is especially so for footings and foundations of brick where it is necessary that every joint shall be filled, as the thin grouting is more to be depended upon to fill every joint than the average mason
For inside walls which are to be plastered or otherwise concealed, the joints may be simply cut off flush with the trowel, but where the walls are exposed, the joints should be "struck." (Fig. 105.) This consists in pressing or striking back with the trowel, the upper portion of the joint while the mortar is soft, so as to form a sloping surface from the bottom to the top. "Keyed joints" are formed by running an iron jointer with round or V-shaped edge along the center of the flush joint, giving it a depression and hardening the mortar by the pressure. (Fig. 106.) Ruled joints are made by holding a straight-edge under the joint and running the jointer along, making a perfectly straight joint.
Continue to: | https://chestofbooks.com/architecture/Cyclopedia-Carpentry-Building-1-3/Brick-Laying.html |
ISA announces ISA Energy & Water Automation Conference
March 6, 2019 – The ISA Energy & Water Automation Conference, slated for 7-8 August 2019 at the Omni Championsgate Resort in Orlando, Florida, will feature interactive sessions led by ISA’s power generation, alternative energy, municipal water, and industrial water experts.
The conference program will feature technologies and best practices that apply to multiple infrastructure sectors. Today’s challenges include leveraging data analytics in a meaningful way, navigating the new world of IIoT with safety and cybersecurity in mind, and applying the insights of recent Smart Cities Initiatives to improve operations.
“Part of ISA’s mission is to increase technical competency by connecting automation professionals, and this event is a perfect example of how that can benefit our industries,” said ISA Executive Director Mary Ramsey. “Technology applications that are working in one sector can often translate to another, but users and solution providers have to engage in meaningful dialogue to find those synergies. ISA can be a venue for those discussions in multiple ways, from standards development to content creation to in-person events.”
ISA’s Water Wastewater Industries Division will bring expertise and content focused on effective utility management, water/wastewater operations and maintenance, IT/OT coordination, engineering best practices, integration/programming, SCADA, PLCs, instrumentation, cybersecurity, and asset management related to the treatment and distribution of water and the collection and treatment of wastewater.
ISA’s Power Industries Division plans to host sessions covering automation and control solutions for oil and gas exploration, processing, and refining with a focus on power generation methodologies, including harnessing wind and solar energy.
Many industries rely on sourcing, transporting, handling, recycling, and disposing industrial water as a core element of their power generation strategies. Infrastructure that supports both power and water are also at the heart of the “Smart Cities” initiatives. Automated solutions offer promising results for safety and efficiency, but every connected device is also a potential cybersecurity vulnerability, so a comprehensive risk mitigation strategy is imperative for companies and facilities.
For more information about the event, or to register, click HERE.
About ISA
The International Society of Automation is a nonprofit professional association that sets the standard for those who apply engineering and technology to improve the management, safety, and cybersecurity of modern automation and control systems used across industry and critical infrastructure. Founded in 1945, ISA develops widely used global standards; certifies industry professionals; provides education and training; publishes books and technical articles; hosts conferences and exhibits; and provides networking and career development programs for its 40,000 members and 400,000 customers around the world.
ISA owns Automation.com, a leading online publisher of automation-related content, and is the founding sponsor of The Automation Federation, an association of non-profit organizations serving as “The Voice of Automation.” Through a wholly owned subsidiary, ISA bridges the gap between standards and their implementation with the ISA Security Compliance Institute and the ISA Wireless Compliance Institute
Check out our free e-newsletters
to read more great articles.
- Posted in:
- Industry
- Related Portals:
- Process Instruments, Field Devices & IO, Instruments & Sensors, Process Automation, Power & Energy, Water & Wastewater, Industrial Automation North America, Plant & Asset Management, Manufacturing Operations Management, Advancing Automation using IIoT and Industry 4.0 Concepts, Systems Integration
MORE INDUSTRY NEWS
-
Indegy announces partnership with Owl Cyber Defense Solutions to provide the safe unification of...
The tested and certified joint Indegy-Owl solution gives customers the confidence of knowing that their OT network is physically inaccessible from...
-
Tosibox announces support for Paris Call for Trust and Security in Cyberspace
Tosibox Oy announced its support for the declaration that sends a signal and manifests a common desire to work together to strengthen everyone’s...
-
Honeywell to enhance process control automation for Kuwaiti integrated refining and...
Under the agreement, HPS will provide KIPIC with front-end engineering design and advanced process control technology for the complex, which will...
-
Fortress Information Security announces launch of Asset to Vendor Network for Power Utilities (A2V)
A2V is designed to address concerns about protecting the U.S. power grid from cyber threats by promoting collaboration among electric companies....
-
Industrial Internet Consortium announces V2.2 of the Industrial Internet Vocabulary Technical Report
The new report includes a new definition for digital twin and eliminates virtual entity in favor of digital representation. Other terms added to...
RELATED
-
TM Robotics and Evershed Robotics helps Ricoh implement SCARA robots
Ricoh approached Evershed Robotics initially, who suggested using a combination of a Toshiba Machine TH650 SCARA robots, a Toshiba Machine...
-
Active Network Scanning in OT Environments
By Zane Blomgren, Belden
Active network scanning can deliver much more information than passive scanning, and can be an incredibly valuable tool...
-
NK Technologies releases Ground Fault Considerations Tech Guide
The Ground Fault Considerations Tech Guide covers a wide range of topics and includes a selection guide, as well as a variety of case studies and...
-
Intelligent Automation - A Big Winner in Product Engineering
Intelligent Automation will help these companies and their engineers to beat the competition and make an impact in this highly competitive and...
-
Understanding Fire and Gas Systems Increases Safety
By Edward Naranjo, Emerson
When plant personnel have a basic grasp of fire and gas system operation, they can recognize factors that compromise... | https://www.automation.com/portals/industries/power-energy/isa-announces-isa-energy-water-automation-conference |
Because of the brutal conditions of the desolation and dangerous animal life there, plants that live in the Desolation of Shidar have been forced to evolve quickly and develop a number of remarkable defensive adaptations. It is important to note that these plants are found only in the Desolation. As far as is known, no one has transplanted species in deserts, arid scrublands and desolate badlands. Desert flora has evolved to survive the super dry conditions found in that harsh environment. Such adaptations include a waxy coating over the skin to retain moisture and small, dense needles in place of leaves that loose less moisture through a smaller surface area.
|Name||Form||Description|
|Cloakbush||Bush||A plant that dons "armor" when threatened.|
|Deathmauler Tree||Tree||A predatory tree that does not wait for prey to come to it.|
|Digger Root||Tree||A deep rooted plant.|
|Flickertongue||Bush||An flower with a deadly tongue.|
|Phoenix Brush||Bush||A vine that grows almost as fast as it as eaten.|
|Whipvine||Bush||A whirling whip-wielding carnivorous plant.|
This website was last updated March 31, 2019. Copyright 1990-2019 David M. Roomes. | http://khoras.net/Khoras/Faunflor/Flora/Desolation/Flora%20-%20Desolation.htm |
Presidential power is, famously, the power to persuade, and modern presidents attempt to exercise this power through popular speechmaking. However, I argue that political conditions do not always favor persuasion as a rhetorical strategy. Congressional polarization and divided government limit the president’s power to persuade, whereas high approval renders persuasion unnecessary. In response, strategic presidents adopt a different rhetorical strategy: mobilizing existing supporters. To demonstrate support for this theory, I collect 18,000 presidential speeches and use word embeddings to develop a novel measure of the use of persuasive and mobilizing rhetoric in each spoken paragraph between 1981-2022. I find that presidents have long used a mix of persuasive and mobilizing appeals that predictably vary with political and institutional conditions. This theory contributes to our understanding of the rhetorical presidency, going public, and political persuasion more broadly while my measure can be applied to the study of other elite actors and institutional contexts. | https://benjaminnoble.org/research/ |
Coastal Wetlands Excel at Storing Carbon
New analysis supports mangrove forests, tidal marshes and seagrass meadows as effective climate buffers.
The efficiency of (L-R) mangrove forests, salt marshes and seagrass beds as reservoirs for carbon; Howard et al., 2017, Frontiers in Ecology and the Environment
In the global effort to mitigate carbon dioxide levels in the atmosphere, all options are on the table--including help from nature. Recent research suggests that healthy, intact coastal wetland ecosystems such as mangrove forests, tidal marshes and seagrass meadows are particularly good at drawing carbon dioxide from the atmosphere and storing it for hundreds to thousands of years.
Policymakers are interested to know whether other marine systems--such as coral reefs, kelp forests, phytoplankton and fish--can mitigate climate effects. A new analysis co-authored by a University of Maryland scientist suggests that, while coastal wetlands serve as effective "blue carbon" storage reservoirs for carbon dioxide, other marine ecosystems do not store carbon for long periods of time.
The research paper, published February 1, 2017 in the journal Frontiers in Ecology and the Environment, also notes that coastal wetlands can help protect coastal communities from storm surges and erosion. Coastal wetland areas are easier for governments to manage compared with ecosystems that reside in international waters, further adding to the strategic value of coastal wetlands in the fight against climate change.
The research paper integrates previous data on a variety of coastal and marine ecosystems to determine which systems are best suited to mitigate climate effects. To make this assessment, Sutton-Grier and her colleagues evaluated how effectively each ecosystem captures carbon dioxide--for example, by plants using it to build their branches and leaves--and how long the carbon is stored, either in plant tissues or in soils.
Coastal wetlands outperformed other marine systems in just about every measure. For example, the researchers estimated that mangrove forests alone capture and store as much as 34 metric tons of carbon annually, which is roughly equivalent to the carbon emitted by 24 million passenger cars in a year. Estimates for tidal marshes and seagrass meadows vary, because these ecosystems are not as well mapped globally, but the total for each could exceed 80 metric tons per year.
All told, coastal wetlands may capture and store more than 200 metric tons of carbon per year globally. Importantly, these ecosystems store 50-90 percent of this carbon in soils, where it can stay for thousands of years if left undisturbed.
The researchers' goal is to help inform resource managers and policymakers where to focus their limited resources to have the greatest impact on climate mitigation. The new analysis acknowledges that other ecosystems, such as coral reefs and kelp forests, provide valuable storm and erosion protection, key fish habitat and recreation opportunities, and thus deserve protection. But their capacity to store carbon over the long term is limited.
Researchers have often looked to terrestrial forests as carbon sinks as well. But most forests do not store substantial amounts of carbon in their soils. As such, the researchers believe that coastal "blue carbon" habitats may stand alone as the most efficient biological reservoirs of stored carbon on Earth. | https://wetlandsforum.thewaternetwork.com/article-FfV/coastal-wetlands-excel-at-storing-carbon-l-2pOqOfMp2dva-PudVo2g |
Israel’s economic recovery has been plagued by persistent economic difficulties, particularly as it confronts a looming population boom that will see it surpass the European Union in the number of residents.
But despite this, Israeli investors continue to flock to the country.
The number of Israeli residents rose by 7.3 million to 7.7 million in 2015, a decline of 4.6% from the year before.
But Israel has managed to remain among the most popular destinations for international investors.
Israeli residents make up 11% of the country’s population, and Israeli expatriates account for 14% of total foreign direct investment.
The country is also home to the world’s largest and fastest-growing startup scene, with over 1,000 startups operating across a range of sectors.
This is reflected in the annual number of venture capital investments by Israeli companies.
The country has recently become a hub for tech startups, as companies like ecommerce platform Shopify and social media platform Facebook recently announced expansion plans.
At the same time, the government has made it clear that it will not be willing to allow Israeli startups to fail.
It has also taken measures to prevent foreign companies from leaving Israel, limiting foreign ownership to just 5% of companies, and barring Israeli companies from taking any more Israeli foreign direct investments.
In order to help mitigate the impact of these measures, the Israel Institute for Economic Development, a nonprofit think tank, released a report titled “The State of Israel: An Investment Report on a Changing Economy.”
The report shows that Israel’s economy has become one of the most attractive investment destinations for foreign investors in the world.
In 2015, the average annual value of foreign direct capital (FDC) invested in Israel was $2.8 billion.
In 2016, the FDC investment amounted to $5.2 billion, a 9.2% increase from the previous year.
The increase was driven largely by a drop in foreign direct debt to a record low of $1.6 trillion, while overall FDC increased by 14%.
According to the report, the number one factor that contributed to the increase in FDC in 2016 was the economic recovery that Israel experienced, which saw the number a small drop from the record high of $2 trillion in 2015.
The second factor contributing to the economic rebound was the implementation of the “Harek” plan, which requires foreign companies to invest up to 15% of their FDC on Israeli businesses.
This policy was initiated in the wake of the 2009 Arab Spring and is a popular policy among investors, especially when a company can use the money to buy back its stock, expand its business or boost the local economy.
According to Yossi Weiss, director of the Israel Investment and Economic Research Center (IERSC), the decision to implement the plan was one of several positive factors that contributed significantly to the positive economic trend in Israel.
“The government’s decision to enact the Harek policy will help boost the countrys economy by giving investors more confidence in the economic outlook,” he said.
According the report:The countrys capital account, which covers foreign direct equity, is expected to grow by 8% to $4.5 trillion in 2020, and foreign direct deposits to Israel will grow by 7% to about $1 trillion, an increase of about $600 billion.
While the number and value of investment opportunities for foreign direct investors in Israel have risen steadily in recent years, the real estate market remains among the hardest hit, with a loss of 8.9% of Israeli homes from the end of 2015 to 2020.
While the overall growth rate in the country has been stable, the country faces challenges in maintaining its current level of prosperity.
A 2015 report by the OECD showed that Israel has seen its growth in gross domestic product fall by 6.6 percentage points since the beginning of the decade.
The OECD also noted that the economy’s productivity growth rate is only 5.9%, and the ratio of GDP to GDP is only 6.2%, compared to an overall growth of 8% in the past decade.
“At the moment, we are facing an economic crisis that threatens the country, but at least in the short term we can manage this crisis and get through it,” Yossim Weiss, an expert in Israel’s government’s economic policies, told The Jerusalem Report.
“But in the long term, the longer-term outlook for the economy is not so good, and it is not clear that the current measures can overcome the challenges of the crisis.”
The government has set aside a total of $3.5 billion in 2017 for infrastructure projects, including a planned $200 million investment in the Eilat Water Authority, which will serve the citys water needs and water infrastructure, as well as a $500 million investment to build new homes and offices.
But while the country is now facing a tough economic crisis, it is also in the midst of a long period of political and cultural change. | https://5starhyip.com/2021/07/why-are-israeli-investors-leaving-the-country/ |
The NFT Network consists of twenty US and international institutions that have committed to assessing their own nitrogen footprints and improving the NFT. There are three cohorts of institutions that have joined between 2014 and 2017.
The results calculated by seven institutions in the first cohort have been published in “The Nitrogen Footprint Tool Network: A Multi-Institution Program To Reduce Nitrogen Pollution” by Castner et al. An additional comparison of these results is published in “Comparing Institution Nitrogen Footprints: Metrics for Assessing and Tracking Environmental Impact” by Castner et al. 2017. The average N footprint for the institutions included in the study is 163 metric tons nitrogen (MT N), with 50% attributed to food production and 33% attributed to utilities.
The calculated total N footprints for the first cohort range from 7.5 MT N at the Marine Biological Laboratory to 444 MT N at University of Virginia in 2014. These results can be shown by the sectors that are calculated independently for each institution: utilities, transportation, food production, food consumption, fertilizer, and research animals. One metric that allows comparison between these results is the campus population, calculated using AASHE STARS’ full time equivalents methodology and representing the number of full campus users. Institution per capita N footprints range from 7 kg N per person per year at Eastern Mennonite University to 27 kg N per person per year at Dickinson college. The contrast likely relates to both real differences in nitrogen efficiencies, as well as the campus resources allocated per student. For example, Dickinson college provides meals and housing for almost all of its undergraduates, while other institutions do not provide the same level of services.
The University of Virginia calculated its nitrogen footprint in 2010 using the original N-Institution model. In 2010, UVa activities were responsible for releasing 468 tonnes reactive N to the environment (see pie chart to the right). Almost half of the University's footprint is due to energy use. Reductions in the energy sector of the nitrogen footprint will also lead to similar reductions in the institution’s carbon footprint without any additional effort (see below). Reactive nitrogen losses from food production and consumption make up the largest section of the institution's nitrogen footprint; this portion of the N footprint can be reduced with changes in food purchasing (e.g., choosing to purchase food from sustainable farms) and food management (e.g., reducing waste and composting any remaining food waste).
The institution-level N footprint model (N-Institution) was first developed at the University of Virginia (UVA). Using recommendations from this model, the UVA Board of Visitors established a nitrogen reduction goal: a commitment to reduce both greenhouse gas emissions and reactive nitrogen losses to the environment from the university by 25% below 2009 levels by the year 2025.
After the goal was set, the University has continued to track its footprint and completed an updated calculation in 2014. Since 2014 the, UVA has been successful in reducing its N footprint by 5% despite a growing number of new facilities and an increase in student population. The greatest reduction was in the food consumption sector with a 17 MT N decrease. This was due to improvements in the city of Charlottesville’s wastewater treatment plant. The progress seen is hopeful but further actions will need to be taken in order to reach the 25% reduction goal. The figure below shows the 2010 footprint, the 2014 calculated footprint, and the projected 2025 footprint under business as usual scenarios.
The University of Virginia calculated its nitrogen footprint in 2014 using the original N-Institution model. In 2014, UVa activities were responsible for releasing 444 tonnes reactive N to the environment (see pie chart to the right). Almost half of the University's footprint is due to energy use. Reductions in the energy sector of the nitrogen footprint will also lead to similar reductions in the institution’s carbon footprint without any additional effort (see below). Reactive nitrogen losses from food production and consumption make up the largest section of the institution's nitrogen footprint; this portion of the N footprint can be reduced with changes in food purchasing (e.g., choosing to purchase food from sustainable farms) and food management (e.g., reducing waste and composting any remaining food waste).
The table below shows the percentage reductions in the University's nitrogen footprint from 2010 to 2014 by specific sectors.
In addition to UVA, a first cohort of universities and institutions is currently calculating their nitrogen footprint: Brown University, Colorado State University, Dickinson College, Eastern Mennonite University, the University of New Hampshire, and the Marine Biological Lab. A university nitrogen footprint model template has been developed and will soon be available to other universities upon request. To learn more, please contact the N-Print team at [email protected]. | http://www.n-print.org/NFTNetwork |
Preface: Due to how lengthy this post can get, Part I of this blog will focus more on my reflection and introspection of my first competition prep process. I plan to write a recap of the actual competition day in Part II 🙂
Jitters, nerves, excitement, a spray tan that is a bajillion shades darker than your average tan, five-inch heels, blinged-out suit, intense stage makeup…and the thought of my celebratory post-show meal always in the back of my mind.
Months and months hard work and intense dedication that is put into a fitness competition prep boils down to a maximum of probably half an hour of stage time. And I have no regrets whatsoever of my first bikini fitness competition experience.
Never would I have ever imagined myself to step on stage in front of hundreds of people, including my boyfriend, family, and friends, to be compared with other women in the same category by a panel of judges on the level of conditioning our bodes are in, how sculpted our shoulders and glutes are, and if the ratio of our upper body, waist and lower body are on point.
Is the sport of bodybuilding subjective? Yes. As with all sports that focus on aesthetics, you can’t please every judge. You can’t control the physique that the competitor next to you brings to the stage. But you CAN control the level of effort you put forth into the preparation, training, and dieting regimen required of a fitness competition.
Before I made the decision to compete for the first time, I had no expectations to win or place at all. The only expectation I had was to put in my best effort and dedication towards the preparation for the competition and to keep a well-balanced training and nutrition regimen while keeping the healthiest mindset. I sought professional guidance from my very knowledgeable coach and nutritionist, Alexa Jaye, who had me follow a training and flexible macro diet regimen to a T for about 10 months. I lifted heavy weights, ate a ton of food, and probably ate more than the average person on most days. Some days were harder, some were easier, but if I must give one piece of advice to anyone interested in competing or reaching a specific fitness goal, my advice would be to find a coach whose values and principles conform with your own. My main thing was to keep a healthy outlook on fitness, body image, and nutrition throughout prep, and to never go overboard on the training, deprive myself of certain food groups, or feel miserable throughout the whole process.
Of course, the closer a competitor is to a competition, the stricter the regimen is. But I can safely say that I never went insane doing 2+ hours of cardio a day, or craved certain things like sugar and fats, because it was never fully cut out of my diet.
The first half of my ~10 month prep consisted of consistently eating enough food and following a 5-6 days/week weight training regimen. How much cardio did I do throughout most of my prep? Probably 10 minutes a day tops, as a quick warm-up before my lifts. When your goal is to put on muscle, there is a very fine line when figuring out how much cardio to add into your training. Too much, and you risk losing the muscle you worked so hard for since you’re cutting away at both the fat and muscle.
The second half of my prep consisted of slowly adding in more cardio and HIIT workouts, which are SO efficient at leaning out the body overall. Alexa and I also slowly started to decrease my macronutrient intake that consist of a well calculated intake of carbs, proteins, and fats–these are essential nutrients necessary for building and maintaining muscle. It requires a very knowledgeable nutritionist to manipulate these numbers for you to meet your fitness goals.
Alexa and I gave my body enough time to build enough muscle before the “shredding” phase, which is when the magic happens and suddenly ALL the muscles you never knew existed start showing a few weeks leading up to the competition due to a caloric deficit.
With a coach like Alexa, I can say my first prep was bearable and actually ENJOYABLE. I enjoyed seeing all the stages my body went through, from being at 18% body fat when I first started training in October 2016 to 13% body fat the day right before show day on June 23, 2017. The day before the competition, I weighed in at around 90 pounds of lean muscle mass out of the overall 103 pounds that make up my 5′ frame, and I’m damn proud of the muscle that I’ve worked so hard for.
I’ve been asked by numerous people why I decided to choose the sport of bodybuilding. My answer is simple: I enjoy a challenge and I wanted to see how far I was able to push myself out of my comfort zone. Plus the aesthetic results are a great bonus 🙂
I have always had a small physique at 5′ and was always somewhat active growing up. After college, I put on an extra few pounds because I’d taken advantage of my metabolism, haphazardly ate anything, and worked out less than usual. Around October 2016, I decided it was time to start living a healthier lifestyle.
The physique the judges look for seemed almost unattainable and impossible when I first started my prep. But as I put on more muscle, my shoulders rounded out, my glutes became perkier, my abs became tighter and my legs gained a lot more strength. Most importantly, my energy and mood levels were up, and I was more excited than ever to train and eat afterwards. I was probably eating 2-3 times more than I originally was before the prep, due to the fact that the body needs way more fuel and energy for the amount of work that it was doing during training.
Where am I going with this, you may ask? I want to make it a point that the body needs way more food to put on muscle and strength, and for women to not be afraid of eating and fueling their bodies. Of course, coupled with the surplus of food, you must also have a well-balanced training regimen. Which brings me back to the point of finding a well-trusted nutritionist to guide you through your fitness goals. Of course, there are those who choose to manipulate their own diet plans, but unless you have a thorough knowledge of nutrition and your body’s physiological needs, you are probably better off finding a knowledgeable nutritionist so that you don’t mess with your metabolism.
I couldn’t have asked for a better prep for my first competition experience. Most importantly, I’ve learned how to properly fuel my body with the right foods, and now I know what makes my body feel good vs. what makes my body feel like crap. I feel the strongest and the most empowered I have ever been, and I’ve learned how to leverage my motivation and drive on days when I really didn’t feel like doing anything (we’re all human!), and even apply these skills to my career and everything else in life. For the longest time, I’ve been wanting to start blogging again. Well, now I have a story to tell for anyone willing to listen 🙂
Stay tuned for my recap of show day in Part 2 of this post! | https://petiteandstrong.com/2017/07/10/my-first-bikini-fitness-competition-part-1-the-prep/ |
Moving to a new country is a life-changing, exhilarating, and memorable experience, though oftentimes not without its stresses and challenges. You’ll find yourself immersed in a completely new living environment, coping with a different climate, engaging with others in a language other than your native tongue, and enrolled in courses that may be structured or delivered differently than the ones at your previous university. It is therefore completely natural to feel overwhelmed, anxious, or even exhausted at times. The most important thing for you to know is that you’re not alone. Many of your fellow students or colleagues are coping with similar challenges and experiences, and it can be very reassuring to approach them and openly ask them how they, themselves, are managing.
Support within the University
Throughout your studies at Hebrew University, we are here to support you in ensuring your overall well-being, including your physical and mental health, as well as your successful academic progress. Our team at the Office of Student Life is available around the clock, seven days a week, to provide support for students who seek it. During office hours, they can be reached at [email protected] or +972 54-882-0342. In cases of emergency, please don’t hesitate to contact them at any hour at +972 54-882-0217. The student madrichim (counselors) will help and advise you regarding who to contact for further professional and specialized support.
Students experiencing personal distress or other mental health-related issues are eligible for support through Hebrew University’s Student Counseling Services. Our team of trained professionals includes psychologists, social workers and psychiatrists who specialize in counseling students on campuses. They provide short-term therapy for crisis intervention, as well as long-term dynamic psychotherapy for mental health issues, pending availability.
To benefit from these services, please complete and submit the online application form. Within a few days, you’ll receive a questionnaire via e-mail. Once you complete and submit your questionnaire, a therapist from Counseling Services will contact you by phone to coordinate your first appointment. In this intake meeting, the counselor will ask you questions in order to identify your needs, and will then determine the best path of treatment to suit them.
Student Counseling Services is located on the Mt. Scopus campus in the Maiersdorf (Reznik) dormitory complex, Building 10, 2nd floor. You can reach Counseling Services from Sunday to Thursday between 8 a.m. and 3 p.m. at [email protected].
Students who are in an acute situation and require immediate support can approach Counseling Services during work hours without making an appointment in advance. Should you require immediate support on a weekend or outside of the hours listed above, please contact the madrich-on-call at +972 54-882-0217.
All communication with the Counseling Services team is strictly confidential, and no information will be given to any person outside Counseling Services without your explicit consent.
For further details, please refer to this website.
Additional Sources of Support in Israel
ERAN Counseling Hotline
ERAN is a 24-hour confidential hotline offering emotional support to individuals experiencing distress, loneliness, anxiety, or a personal crisis. Support services are currently offered in Hebrew, Arabic, English, Russian, French, Spanish and Amharic. To receive support, please dial 1201. | https://international.huji.ac.il/Psychological_Services |
The cost of production report of the
testing department differ from that of the
Blending Department (first department) in several
respects. Several additional calculations are made, for which space has been
provided on the report. The additional information deals with:
Cost received from the preceding
department.
An adjustment of the preceding
department's unit cost because of lost units.
Cost received from the preceding
department to be included in the cost of ending work in process inventory.
An analysis of the work in process (WIP)
indicates that units in process are but one third complete as to labor and
factory overhead. Unit costs, $0.91 for labor and $0.80 for factory
overhead, were calculated as follows:
Equivalent production of the testing
department is 41,000 units [40,000 + $1/3 × (3,000)], the labor unit cost is $0.91
($37,310 / 41,000), and the factory overhead unit cost $0.80 ($32,800 /
41,000). There is no materials unit cost, since no materials were added by
the department. The department unit cost is $1.71, the sum of the labor unit
cost of $0.91 and the factory overhead unit cost of $0.80.
The testing department is responsible for
the labor and factory overhead used as well as for the cost of units
received from the
Blending Department (first department). This latter cost is inserted as a
cost charged to the department under the title "cost from preceding
department" which is immediately above the section of the report dealing
with cost added by the department. The cost transferred in was $77,400,
previously shown in the cost report of the
Blending Department (first department) as cost
transferred out of that department by this journal entry:
The work in process account of the testing
department is charged with cost received from the preceding department and
with $70,110 of departmental labor and factory overhead (FOH), a total cost
of $147,510 to be accounted for by the department.
Units Lost in the Department Subsequent to the First:
The
Blending Department (first department) unit cost was $1.72
when 45,000 units were transferred to the Testing Department. However,
because 2,000 of these 45,000 units were lost during processing in the
Testing Department, the $1.72 unit cost figure no longer applies and must be
adjusted. The total cost of the units transferred remains at $77,400, but
43,000 units must now absorb this total cost, causing an increase of $0.08
in the cost per unit due to the loss of 2,000 units in the testing
department.
The lost units cost can be computed by one
of two methods.
Method No.1:
Determines a new unit cost work done in the
preceding department and subtracts the preceding departments old unit costs
figure from the adjusted unit cost figure. The difference between the tow
figures is the additional cost due to the lsot units. $1.80 new adjusted
unit cost for work done in the preceding department is obtained by dividing
the remaining good units, 43,000 (45,000 - 2,000), into the cost transferred
in, $77,400. The old unit cost figure of $1.72 is subtracted from the
revised unit cost to arrive at the adjustment of $0.08.
Method No. 2:
Determines the lost units share of total
cost and allocates this cost to the remaining good units. total cost
previously absorbed by the units lost is $3,440, which is the result of
multiplying the 2,000 lost units by their unit cost of $1.72. The $3,440
cost must now be absorbed by the remaining good units. The additional cost
to be picked up by each remaining good unit is $0.08 (3,440 / 43,000 units).
The lost unit cost adjustment must be
entered in the cost of production report. The$0.08 is entered on the
"Adjustment for lost units" line. The departmental unit cost of $1.71 does
not have to be adjusted for units lost. In the testing department, the cost
of any work done on lost units has automatically been absorbed in the
departmental unit cost by using the equivalent production figure of 41,000
instead of 43,000. The $1.72 unadjusted units cost for work done in the
preceding department, the $1.71 departmental unit cost, and the $0.08
adjustment for lost units are totaled in order to obtain the $3.51
cumulative unit cost for work done up to the end of operations in the
testing department.
Timing of Lost Units:
Lost units may occur at the beginning,
during, or at the end of a manufacturing process. For purposes of
practicality and simplicity, it is ordinarily assumed that units lost at the
beginning or during the process were never put in process. The cost of units
lost is spread over the units completed and units still in process.
When units are lost or are identified as
lost at the end of a process, the cost of the lost units is charged to
completed units only. No part of the loss is charged to units still in
process. Assume that the 2,000 units lost by the testing department were the
result of spoilage found at final inspection by the quality control
department; their cost would be charged only the 40,000 finished units, as
illustrated below:
The Clonex Corporation
Testing Department (2nd Dept.)
Cost of Production Report
For the Month of January, 19
A comparison of the differences between the
two cost of production reports for the testing departments as to amounts for
costs of units transferred and work in process inventory is shown below the
production report. Not the offsetting increases and decreases.
In this illustration, the assumption has
been made that the lost units, identified at the end of the process, were
complete as to all costs. In sum companies, members of the quality control
or inspection departments make production checks prior to the end of the
process. Such a procedure uncovers lost units that are not complete when the
loss is incurred or the spoilage discovered and yet the loss may pertain
only to units completed and not to units still in process. In such a case
the lost units should be adjusted for their equivalent stage of completion.
For example, 2,000 units lost at the 90% stage of conversion would appear as
1,800 equivalent units with regard to labor and factory overhead costs.
Normal Vs Abnormal Loss of units:
Units are lost through evaporation,
shrinkage, substandard yields, spoiled work, poor work man ship, or
inefficient equipment. In many instances the nature of operations makes
certain losses normal or unavoidable, because they are considered with in
normal tolerance limits for human and machine errors. The cost of these
normally lost units does not appear as a separate item of cost but is spread
over the remaining good units.
A different situation is created by
abnormal or avoidable spoilage or losses that are not expected to arise
under normal, efficient operating conditions. The cost of such abnormal
spoilage or losses is charged either to factory overhead as shown below,
thereby appearing as an additional unfavorable able factory overhead
variance, or directly to a current period expense account and reported as a
separate item in the cost of goods sold statement.
If the lost units were only partially
complete, equivalent production calculations should consider their stage of
completion when lost or spoiled, and the costing of the abnormal loss should
be weighted accordingly. If one part of the loss is normal and another
abnormal, each portion must be treated in accordance with the above
discussion. The critical factor in distinguishing between normal and
abnormal spoilage or loss is the degree of controllability. Normal or
unavoidable spoilage or loss is produced by the process under efficient
operating conditions, referred to as uncontrollable. Abnormal or avoidable
spoilage or loss is considered unnecessary, because the conditions resulting
in the loss are controllable. For this reason, within the limits set by the
state of the art of production, the difference is a short-run condition; in
the long run, management should adjust and control all factors of production
and eliminate all abnormal conditions.
The cost of production report at the
beginning of this page shows a total cost of $147,510 to be accounted for by
the Testing department. The department completed and transferred 40,000
units to the
Terminal Department (third or final department) at a cost of $140,000
(40,000 × $3.51).
The remaining cost is assigned to the work in process inventory. This
balance is broken down by the various costs in process. When computing the
cost of the ending work in process inventory of any department subsequent to
the first, costs received from the preceding departments must be included.
The 3,000 units still in process, completed
by the
Blending Department (first department) at a unit cost of $1.72, were later adjusted by
$0.08 (to $1.80) because of the loss of some of the units transferred.
Therefore, the
Blending Department's (first department) cost of the 3,000 units still in
process is $5,400 figure is not broken down further , since such information
is not pertinent to the Testing Department's operations. However, the amount
is listed separately in the cost of production report, because it is part of
the Testing Department's ending work in process inventory.
Materials (if any), labor, and factory
overhead (FOH) added by a department are costed separately in order to arrive
at total work in process (WIP). In the testing department, no materials
were added to the units received; thus, the ending inventory shows no
materials in the process. However, labor and factory overhead costs were
incurred. The work in process analysis stated that labor and factory
overhead used on the units in process were sufficient to complete 1,000
units. The cost of labor in process is $910 (1,000 ×
$0.91) and factory overhead is process is $800 (1,000 ×
$0.80). The total cost of the 3,000 units in process is $7,110 ($5,400 +
$910 + $800). This cost, added to that transferred to the
Terminal Department (third or final department),
$140,400, accounts for the total cost of $147,510 charged to the Testing
Department.
Copyrights of all content on this web site are owned by Accounting For
Management except where indicated in source or copyright statements.
Accounting For Management must be contacted for permission to copy or
redistribute any material published on this website.
Copyright 2014
Accounting For Management. All rights reserved.
| |
(TECHNICAL FIELD)
(BACKGROUND ART)
(BEST MODE FOR CARRYING OUT THE INVETNION)
Example 1
Anion exchange resin
Example 2
Polyamine beads
Example 3
(INDUSTRIAL APPLICABILITY)
The present invention relates to a process for recovering volatile acids and to a process for treating waste water utilizing this process.
For example, hydrofluoric acid is recovered from waste liquids containing this acid conventionally by (1) a process wherein fluoride ions are reacted with a calcium, magnesium or like compound to precipitate the ions as a fluoride (JP-A-89984/1983, JP-B-71197/1991, etc.), or (2) a process wherein fluoride ions in the waste liquid are captured by a device having an ion exchange membrane and an ion exchange resin in combination and electrically dialyzed in an electric field to recover hydrofluoric acid (JP-A-123606/1989, JP-A-130782/1989, etc.). However, the process (1) requires decomposition of the fluoride with an acid such as sulfuric acid when hydrofluoric acid is reproduced, necessitating a great apparatus for the filtration of the precipitate and the subsequent decomposition. The process (2) requires a large quantity of electric power, further necessitating the step of separating the recovered acid from other acid, for example, by evaporation or forming the fluoride of calcium, magnesium or the like.
Thus, the prior art has the problems of requiring an additional chemical for recovering hydrofluoric acid and a further treatment of the recovered substance foe separation, and consuming a large amount of electric power.
An object of the present invention is to obviate these problems and to provide a process for recovering volatile acids without necessitating additional chemicals and much electric power and without necessitating a separation or decomposition treatment after recovery.
Another object of the invention is to provide a process for treating waste water utilizing the above process.
The present invention provides a process for recovering a volatile acid charaterized by bringing a waste liquid containing the volatile acid into contact with an amine having a boiling point of at least 50 °C to thereby cause the amine to ionically adsorb the acid from the waste liquid, and thereafter heating the amine to desorb the acid.
The present invention also provides a waste water treating process characterized in that a waste liquid containing a volatile acid is brought into contact with an amine having a boiling point of at least 50 °C to thereby cause the amine to ionically adsorb the acid from the waste liquid.
The waste liquids containing a volatile acid and to be treated according to the invention include, for example, those containing an acid such as hydrofluoric acid, hydrochloric acid or nitric acid. These waste liquids may further contain sulfuric acid or like nonvolatile component, ammonium fluoride or the like. Such nonvolatile components, even if present, will not affect the volatile acid recovering treatment of the invention but reduce the adsorbing capacity of the amine, so that presence of nonvolatiles in a large quantity is not desirable.
Examples of useful amines having a boiling point of at least 50 °C are anion exchange resins, polyamines, aliphatic amines, aromatic amines and nitrogen-containing heterocyclic compounds. When having a boiling point of below 50 °C, amines themselves will evaporate when heated, and such amines are therefore undesirable. Examples of anion exchange resins are those comprising a copolymer of styrene and divinylbenzene, polyolefin polymer or the like as the base material. Examples of polyamines are 1,8-diaminooctane, 1,1,4,7,10,10-hexamethyltriethylenetetramine, N,N'-bis(3-aminopropyl)-1,3-propanediamine, etc. Examples of aliphatic amines are hexacyclen, hexamethylhexacyclen, etc. Examples of aromatic amines are 2,3-diaminonaphthalene, 9,10-diaminophenanthrene, etc. Examples of nitrogen-containing heterocyclic compounds are 4,7-phenanthroline, carbazole, 29H,31H-phthalocyanine, etc.
According to the invention, the volatile acid is brought into contact with the amine, for example, by passing the waste liquid of volatile acid through a column packed with the amine, or by contacting the waste liquid with the amine batchwise without using a column. The contact thus effected causes the amine to ionically adsorb the volatile acid. With the latter batchwise process, it is necessary to separate the amine from the waste liquid after adsorption and before the subsequent step of heating, whereas the amine need not be so separated off with the former column process.
The adsorbed volatile acid is released from the amine by heating. The amine is heated by a desired method. For example, it is heated as contained in the column or with hot air passed through the column. It is desired that the heating temperature be such that the amine remains unaffected by heat to the greatest possible extent, that is, not higher than the limit within which the amine retains its function. The amine is heated until the component released therefrom becomes neutral in pH value. The preferred heating time is usually in the range of 1 minute to 50 hours.
With the process of the invention, the heating temperature is usually about 50 to about 180 °C, preferably about 70 to about 130 °C.
The present process is usable for treating waste water to remove volatile acids therefrom even if the concentration of the acid is low and can not be recovered efficiently. More specifically, the waste water treating process is conducted, for example, by a system comprising two columns arranged in parallel, packed with an amine and each connected to waste water, acid recovery and steam lines. The two columns are operated alternately. While one of the columns is treating waste water, the other column is used for recovering (regenerating) the acid in preparation for the subsequent treatment. When saturated with the adsorbed acid by passing waste water, the column is changed over to the other column. The saturated column is heated as by passing steam therethrough to recover the acid. Waste water can be treated continuously by repeating the above procedure.
The present invention will be described in detail with reference to the following examples.
Hydrofluoric acid was recovered by the following process using the anion exchange resin stated below as an amine. Table 1 shows the result.
Base material:
Exchange group:
Exchange capacity:
Apparent density:
Effective particle size:
styrene-divinylbenzene copolymer
-CH₂N(CH₃)₂
at least 1.5 meq/ml
615 g/l
0.4∼ 0.6 mm
(1) A 4.1 g quantity of the anion exchange resin was placed into 20 g of 2 % aqueous hydrofluoric acid solution (0.02 mole). The mixture was stirred, and filtered about 5 minutes later. The filtrate was checked for HF concentration. The difference between the amount of HF used and the amount of HF in the filtrate was taken as the amount of HF adsorbed.
(2) The anion exchange resin was washed with water and thereafter placed into a platinum dish, which was then heated on a hot plate at 100 °C for 2 hours.
(3) After heating, 10 g of 2.27N aqueous NaOH solution was added to the anion exchange resin, followed by stirring and, about 5 minutes later, by filtration. The filtrate was titrated with 2.5N hydrochloric acid to determine the amount of remaining HF. The difference between the amount of adsorption and the remaining amount was taken as the amount of HF released.
(4) After washing the resin with water, the step (1) was repeated again to determine the amount of adsorption.
(5) The above procedure was repeated to check the resin for variations in the amount of HF thereby adsorbed and for durability.
Table 1
Variations in the Amount of Adsorbed HF after Heat Treatment
Repetition
Adsorbed HF measurement (mole)
Relative ratio (% )
Initial
1.62× 10⁻²
100
First
1.44× 10⁻²
89
Second
1.39× 10⁻²
86
Third
1.36× 10⁻²
84
Note: The relative ratio was based on the initial adsorption measurement which was taken as 100. The amount of HF released was at least 90 % of the amount of adsorption each time.
Hydrofluoric acid was recovered by the same process as in Example 1 using the polyamine beads described below. Table 2 shows the result.
Base material:
Exchange group:
Exchange capacity:
Size of beads:
straight-chain olefin polymer (crosslinked beads)
-CH₂NH₂
15 meq/g (dry)
48∼ 145 mesh
Table 2
Variations in the Amount of Adsorbed HF after Heat Treatment
Repetition
Adsorbed HF measurement (mole)
Relative ratio (% )
Initial
9.84× 10⁻³
100
First
8.62× 10⁻³
88
Second
7.20× 10⁻³
73
Third
6.33× 10⁻³
64
Note: The relative ratio was based on the initial adsorption measurement which was taken as 100. The amount of hydrofluoric acid released was at least 70 % of the amount of adsorption each time.
This experiment was conducted in the same manner as in Example 1 with the exception of using the polyamine beads which corresponded to 0.01 mole in exchange capacity and heating the beads at about 85 °C.
Table 3
Variations in the Amount of Adsorbed HCl after Heat Treatment
Repetition
Adsorbed HCl measurement (mole)
Relative ratio (% )
Initial
8.92× 10⁻³
100
First
4.15× 10⁻³
47
Second
4.04× 10⁻³
45
Third
3.07× 10⁻³
34
Note: The relative ratio was based on the initial adsorption measurement which was taken as 100. The amount of HCl released was at least 90 % of the amount of adsorption each time.
Hydrochloric acid was recovered using the same anion exchange resin as in Example 1. Table 3 shows the result. This experiment was carried out in the same manner as in Example 1 with the exception of using 20 g of hydrochloric acid having a concentration of 3.6 % (0.02 mole) and 3.6 g of the anion exchange resin and heating the resin at 100 °C.
According to the invention, volatile acids are adsorbed by an amine, which is then heated for the recovery of the acid, so that volatile acids can be recovered by an inexpensive simple apparatus. As compared with conventional processes, e.g., the recovery process wherein a fluoride is formed, the invention can be practiced by a compacted apparatus without using an acid for decomposition. Further unlike the electric dialysis process, a particular volatile acid only can be recovered selectively. The volatile acid can therefore be recovered with a high purity and at a high concentration (almost about 100 % ). | |
Read more about Art from the works of the Mother and Sri Aurobindo.
What is Art?
Art in its fundamental truth the aspect of beauty of the Divine manifestation. True art is the expression of beauty in the material world. It must act as a revealer and teacher of this divine beauty in life. Skill is not art, talent is not art. Art is a living harmony and beauty that must be expressed in all the movements of existence. It expresses the beautiful, but in close intimacy with the universal movement.
Elements of Art
Technique
For technique is a means of expression; one does not write merely to use beautiful words or paint for the sole sake of line and colour; there is something that one is trying through these means to express or to discover.
In technique, there are two different things,—there is the intellectual knowledge which one has acquired and applies or thinks one is applying—there is the intuitive cognition which acts in its own right.
Consciousness
Art is a self-expression of Consciousness under the conditions of aesthetic vision and a perfect execution. There are not only aesthetic values but life-values, mind-values, soul-values, that enter into Art. The artist puts out into form not only the powers of his own consciousness but the powers of the Consciousness that has made the worlds and their objects.
Three elements making the whole of Art, perfection of expressive form, discovery of beauty, revelation of the soul and essence of things and the powers of creative consciousness and Ananda of which they are the vehicles.
Types of Art
Each type of art has its own greatness and can touch in its own way the extremes of aesthetic Ananda. Music goes nearest to the infinite and to the essence of things, painting and sculpture have their revenge by liberating visible form into ecstasy, poetry can make a many-stringed harmony, a sound-revelation winging the creation by the word and setting afloat vivid suggestions of form and colour,—that gives it in a very subtle kind the combined power of all the arts.
Photography no longer an exact copy of Nature, it is an arrangement of forms and colours intended to express something else which is usually hidden by physical appearances.
All poetry is an inspiration, a thing breathed into the thinking organ from above; it is recorded in the mind, but is born in the higher principle of direct knowledge or ideal vision which surpasses mind. It is in reality a revelation.
Why Is Art Important?
When the material world is transformed that it will be possible to express the Divine in his purity. It has the capacity to become fused, but not entirely, and it remains an instrument for giving a form, whatever may be the form. One can express the Divine with words, one can express Him with colours, express Him with sounds, express Him with forms.
All can be done in a movement of aspiration to express a higher beauty, giving an appropriate abode to the godhead who was evoked.
Music and art and poetry have striven to express the vision of the deepest and greatest things and not the things of the surface only.
How to Cultivate It?
An artist goes into deep contemplation to see, realise it as a whole in his inner consciousness; and execute it outwardly; to create according to the greater inner vision. A yogic discipline to enter into intimate communion with the inner worlds.
To train our eyes to appreciate the harmony found in physical nature; in taste, culture, the development of the sense of sight and of beauty and with not many desires. We live in the sense of a growth not only visual, but of the appreciation of beauty.
Every artist has a unique, personal contact with the Divine, and through the work of art one has mastered, one must express this contact in one’s own way , with his own words, his own colours.
The inspirational consciousness, gathered in the sense of surrender; to hold it sacred, without anything getting mixed in with it, very still. It's especially the sense of the "I" that must be lost—that's the great art in everything— painting, sculpture, architecture, evenI music…
All true artists feel they are intermediaries between a higher world and this physical existence. When consider in this light, Art is not very different from Yoga. When worked consciously at one’s art with the knowledge. In their creation they did not put forward their personality as the most important factor; they considered their work as an offering to the Divine, they tried to express by it their relation with the Divine.
To maintain its energy and will to create. To preserve the right to write for the Spirit that moves him. To be free to use his wings even if they carry him above the comprehension of the public of the day or of the general run of critics or lead him into lonely places. the value of the poet is the power of his vision, of his speech, of his feeling, by his rendering of the world within or the world without or of any world to which he has access.
To be an artist of word and rhythm. One can be strong and powerful, full of sincerity and substance without being harsh, rough or aggressive to the ear. Rhythm can be either austere to bareness or sweet and subtle, and a harmonious perfection can be attained in either of these extreme directions if the mastery is there.
What Are the Obstacles in Expressing Art?
The need of the stimulus of an audience, social applause, satisfied vanity or fame. It must go absolutely if one wants to be a Yogi and his art a service not of man or of his own ego but of the Divine.
Self-complacency is an obstacle to art and to intelligence. Fatuity is one of the greatest of human stupidities. There is a very great difference between having faith in what can be done, the will to realise it, the certitude of the possibilities open in creation , in self-complacency; these are two things which turn their backs completely on each other. This is one of the things that takes you farthest away from the divine realisation. There is no place for self-complacency; for, as we are nothing in ourselves but what the Divine makes of us, and as we can do nothing by ourselves except what the Divine wants to do through us. One can only have the feeling of one's perfect powerlessness. there is always a wrong side and a right to every state of consciousness. One is the shadow and the other the light, but they are exactly alike: one is no better than the other. And if really one were aware of being nothing at all, one would not bother to know what one is like.
What Is Degeneration of Art?
Things could be beautiful in themselves but they had no meaning. It was not a whole having cohesion and attempting to express something: it was an exhibition of talent, cleverness, the ability to make.
Some artists want to produce something before having worked, they want to know before having studied and they want to make a name before having done anything good.
Almost all man's works of art—literary, poetic, artistic—are based on the violence of contrasts in life. When one tries to pull them out of their daily dramas, they really feel that it is not artistic.
There is a kind of anguish and there is still a complete lack of understanding of what beauty can and should be, but one finds an aspiration towards something which will not be sordidly material. For a time art had wanted to wallow in the mire, to be what they called "realistic". They had chosen as "real" what was most repulsive in the world, most ugly: all deformities, all filth, all ugliness, all the horrors, all the incoherences of colour and form; People were compelled to put aside all refined sensibility, the love of harmony, the need for beauty, to be able to undergo all that; otherwise, I believe, they would really have died of horror.
|
|
Read more about Art from the works of the Mother and Sri Aurobindo. | https://iewiki.auroville.org/index.php/Art_Summary |
Last week, we all witnessed unprecedented and inexcusable acts of anti-democratic violence targeting pillars of American democracy, including universal voting rights, the peaceful transition of power, and the ability of our duly elected representatives to do the people’s work without fear of reprisal by angry mobs and insurrectionists. In the days ahead – as the nation pays respect to the Reverend Dr. Martin Luther King Jr. on Monday and invokes his message of healing, and as a new president is sworn in by the Chief Justice on Wednesday – officials warn of the potential for further insurrection in Washington, D.C. and in state capitals across the nation.
Connecticut Community Foundation condemns these acts and threats, and the toxic ideas they reflect, as we condemn all violence. Our work as a community foundation is to foster an equitable, just and vibrant community in Greater Waterbury and the Litchfield Hills. Central to that work is the value of inclusion: that all residents are entitled to have their voices heard and to participate fully and peacefully in civil society. The insurrection we all witnessed last week was an example not of free speech, but of an attempt at its denial.
Connecticut Community Foundation recognizes that we benefit from the access, power, and influence that come with the philanthropic resources we steward. With this privilege comes the responsibility to serve our community according to our values. To that end, we stand firm in our commitment to promote equitable access and outcomes for local residents, regardless of race, place, identity, or wealth; to engage with the community, including underrepresented or marginalized voices; to support community action toward progress and justice on our collective behalf; and to use our own voice toward these ends. In these ways, we aim to live up to and advance the inclusive ideal that is so vital to our democracy. We invite all who call our region home to join us in this work. | https://conncf.org/connecticut-community-foundations-support-of-our-democratic-values/ |
Elicio NV is a Belgian renewable energy producer operating internationally.
As energy producer, we generate our power mainly from wind using high technological installations constructed in a spirit of good neighbourliness.
In doing so, Elicio wants to make a more than positive contribution towards a better living environment.
Elicio actively operates within all aspects of renewable energy by successfully developing, engineering, constructing and running its projects in-house for 20 years.
Being a young company, Elicio NV focuses on projects which contribute to a more sustainable world within a framework of corporate social responsibility while still maintaining a long-term vision for its shareholders.
Elicio has the necessary track records in the realization and exploitation of biomass projects, biofuel installations, industrial solar projects as well as small hydro installations.
Key messages
- Mission
Elicio generates electricity based on renewable energy sources and aims to contribute positively towards society and stakeholders.
- Stable partner
Elicio is part of a strong industrial group, with a diversified activity base. Elicio benefits from having a stable shareholder structure with a long-term strategy.
- Know-how
Elicio has a track record in successfully developing, engineering, constructing and operating projects.
- Potential
Elicio will focus on projects that secure sustainable profitable growth. Elicio is in it for the long run with the ambition to consolidate its position as a major renewables player.
HEALTH & SAFETY, SOCIAL AND ENVIRONMENTAL POLICY STATEMENT
Elicio NV is a leading developer, asset owner and operator of independent power generation facilities.
In order to be a responsible employer and business leader we are committed to integrating health & safety, social and environmental (HSSE) considerations into all our business operations and those we develop jointly with our partners.
To comply with our legal responsibilities and to support environmentally sound and sustainable development Elicio will:
- Provide and maintain safe, healthy and environmentally responsible working conditions which take into account social needs and requirements;
- Implement a risk-based Health & Safety, Social and Environmental (HSSE) management system that conforms to international practices and standards;
- Provide HSSE training to our employees and HSSE leadership to our partners;
- Regularly engage with our employees and partners on HSSE issues;
- Adopt a preventive approach to our business activities by undertaking risk assessments, complying with legislation, using resources prudently and minimizing pollution;
- Set standards to promote and assure the best HSSE performance of our subsidiaries, supply chain and project companies;
- Regularly monitor and report on HSSE management and performance;
- Annually review our HSSE policy statement and set performance and management targets.
All Elicio employees are responsible for adhering to and implementing this policy statement. Our managers are accountable for monitoring and managing compliance and performance.
This policy statement is applicable to all our employees, offices and business activities. | https://elicio.be/en/about |
Player Stats Jesse Lingard
Jesse Lingard was born on Dec. 15, 1992. He is currently 25 years old and plays as a Attacking Midfielder for Manchester Utd in England. His overall rating in FIFA 19 is 82 with a potential of 83. Lingard has got a 4-star skillmoves rating. He prefers to shoot with his right foot. His workrates are High / High. Lingard's height is 175 cm cm and his weight is estimated at 62 kg kg according to our database. Currently, Jesse Lingard is playing with numbers 14 and 7. His best stats are: Stamina: 87, Att. Position: 86, Balance: 86, Agility: 86, Composure: 84.
Manchester Utd
Position Sub
Kit Number 14
Joined Club July 1, 2010
Contract Length 2021
Ball Skills
Ball Control
Dribbling
Defence
Marking
Slide Tackle
Stand Tackle
Mental
Aggression
Reactions
Att. Position
Interceptions
Vision
Composure
Passing
Crossing
Short Pass
Long Pass
Physical
Acceleration
Stamina
Strength
Balance
Sprint Speed
Agility
Jumping
Shooting
Heading
Shot Power
Finishing
Long Shots
Curve
FK Acc. | https://www.fifaindex.com/player/207494/jesse-lingard/ |
Rotary members are people of action who come together to build connections, solve problems, and create lasting change that makes the world a better place for future generations.
The Rotary Club of Hillsboro joins a global network of 35,678 clubs and 1.195 million neighbors, friends, leaders, and problem-solvers. Each one of us is but one of tens of thousands of Rotarians that come together to make positive, lasting change in communities at home and abroad.
We connect people. Through Rotary clubs, people from all continents and cultures unite to exchange ideas and form friendships and professional connections while making a difference in their backyards and around the world.
We think differently. Our members’ diverse and multidisciplinary perspectives help us see challenges in unique ways. Members apply their leadership and expertise toward addressing social issues – and finding unique solutions.
We solve problems. For more than 110 years, we’ve bridged cultures and connected continents to champion peace, fight illiteracy and poverty, promote clean water and sanitation, save mothers and children, grow economies, and prevent diseases.
We transform communities. Each day, our members pour their passion, integrity, and intelligence into club projects that have a lasting impact. We persevere until we deliver real, long-term solutions to the issues facing our communities.
We transform ourselves. Through Rotary, our members are exposed to new thoughts, professions, and opportunities to broaden their perspectives. From weekly meetings and club projects to fundraisers and networking events, our members develop skills that help make them better, individuals, community leaders, internationalists, and humanitarians.
Learn more by exploring the rest of our website or by clicking on the image above. | https://www.hillsbororotary.org/front/us/rotary/ |
What do you know about supercomputers?
We are young women researchers
Multimedia Gallery
Pictures
Brand & Logo
Public Tenders
Open to apply
Awarding in process
Formalized
Announcements
Transparency
BSC Folks
Visit our Supercomputer
Research & Development
Research Areas
Atmospheric Composition
Big Data
Bioinformatics
Biomechanics
Climate Prediction
Cloud Computing
Cognitive Computing
Computational Earth Science
Computer Architecture and Codesign
Distributed Computing
Education
Engineering Simulations
Fusion
Genomics
Geophysics
HPC Software Engineering
Material Science
Molecular Modeling
Operations Infrastructure
Performance Analysis
Programming Models
Quantum Information
Social Simulation
People
Research Departments
Computer Sciences
Life Sciences
Earth Sciences
Computer Applications in Science & Engineering
Projects
Publications
Annual Summaries
Technical Reports
Software & Apps
Joint Research Centres
Research Seminars
Past Research Seminars
Conferences
Software & Apps
Publications
MareNostrum
MareNostrum
Technical Information
User Documentation
Visits
MinoTauro
Active Archive
StarLife
Access to Supercomputing Resources
Access to RES
Access to PRACE
Access to Eduroam
PATC Courses
RES Courses
Tech Transfer
Discover Supercomputing
Application Areas
How to collaborate with us
Portfolio
Patent Portfolio
Software & Apps
Services
Air Quality
Climate
Mineral Dust
Computational Genomics
HPC Performance Analysis and Optimization
Collaboration with Companies
Joint Research Centres
Success Stories
Spin-Offs and Entrepreneurship
Spin-Offs
Innovation Journey
Training action
Join Us
Fellowships
Undergraduate
Master
Predoctoral (PhD)
Postdoctoral
Other
Scholarships
Job Opportunities
Excellence Career Opportunities
HR Initiatives & Badges
Gender and Diversity Equality Plan
Why to work at BSC
Recruitment Process
Mobility Programmes
Life in Barcelona
FAQ's
Join the community!
Education
Training
PATC Courses
Past PATC Courses
RES Courses
Past RES Courses
CUDA Training
Past CUDA Training
Other Training
Past Other Training
Predoctoral (PhD)
PhD Programmes
Professional Training
Mobility Programmes
Doctoral Symposium
Bioinfo4Women
Graduate
Master's Programme
Internships
Testimonials & Awards
Seasonal Schools
Workshops
Past Workshops
Life in Barcelona
News
BSC News
News content
Events
BSC in the Media
Newsletter
Annual Summaries
Multimedia Gallery
Branding, Identity & Logo
You are here
Home
/
Research & Development
/
People
/
Arnau Folch
/
Publications
Arnau Folch
ARNAU
FOLCH
Position:
ENVIRONMENTAL SIMULATIONS GROUP MANAGER
Barcelona Supercomputing Center - Centro Nacional de Supercomputación
CASE - Environmental Simulations
email:
arnau [dot] folch
[at]
bsc [dot] es
Tel:
+34 934137925
Primary tabs
Projects
Publications
(active tab)
Personal Details
Filter by Type
Book
Book Chapter
International Conferences
Journal
Masters Thesis
Miscellaneous Section
National Conferences
PHD Thesis
Workshops
Filter by Research Line
Ab-Initio Electronic Structure Methods
Advanced docking strategies
Aerosol data assimilation
Aerosol-radiation-cloud interactions
Agent-Based Models
Agriculture and water management services
Air quality
Algorithms for genomics data compression
Alya - High Performance Computational Mechanics
Application optimization for GPU acceleration
Applied Learning Methods
Atlantic Variability and Predictability
Atmospheric Impact Services
Bias development mechanisms
Big data analytics and visualization
Big Data Frameworks
Biological data integration and management
BSIT: Barcelona Subsurface Imaging Tools
Cancer genomics
Cardiovascular system simulations
Climate Model Initialization and Data Assimilation
Combustion
Computational Earth Services
Computational Fluid Mechanics - Compressible Flows
Computational fluid mechanics - Incompressible flows
Computational infrastructures for biomolecular research
Computational Modeling for Fusion
Computational solid mechanics
COTS multicore real-time systems
Cultural Evolution
Curricula Development and Quality Assurance in Higher Education and Professional Training
Cyber-Physical Computing Systems
Data Placement for Heterogeneous Memory Systems
Data-Center Optimization
Data-Centric Architectures
Data-Driven Scientific Computing
Dependable and power-efficient real-time systems
Distributed Object Management
DLB: Dynamic Load Balancing
Docking for interactomics and personalized medicine
Domain Specific Languages
Earth Data Analytics and Diagnostics
Earth model performance analysis
Earth Sciences models & workflows
Earthquake Simulation
eDrug: interactive drug design
Electromagnetic Modeling and Inversion
Electronic transport
Emission modelling
Energy-aware and Virtualisation Technologies
Enzymatic Catalysis and Protein Engineering
EUDAT
Forecast quality assessment of seasonal-to-decadal predictions
Functional consequences of genetics variants
Generic Lightweight Threads
Genetics of Complex Diseases
Hardware Support for Big Data
High-performance IO
HPC Frameworks
HPC Geophysical Applications
HPC Software Optimization
HPC Workflows
Human Computer Interaction
Improving Virtual Memory
Insurance Services
Integration of Programming Models and Persistent Storage Systems
Internet of Things and Stream Processing
Inverse Modelling
Land-atmosphere coupling and predictability
Learning Analytics
Linear Algebra and Math Libraries
MareNostrum
Memory hierarchy for GPU acceleration
Memory systems for HPC
Mesh generation and adaptivity
Message Passing Interface (MPI)
Microscale wind simulations and wind resource assessment
Microserver architectures and system software
Mineral dust - AXA Chair on Sand and Dust Storms
Mobile and embedded-based HPC
Multiphysics
Natural Hazards and Risk Analysis
Network Biology
Neural networks for data-streams
New approaches to the prediction of protein structure and interactions
NoSQL technologies applied to Life Sciences
Numerical Methods
Ocean Biogeochemistry and Climate Feedbacks
Ocean forecasting
OpenMP Extensions
PELE: Monte Carlo methods for protein/DNA-ligand interactions
Performance Analytics
Personalized Medicine Initiative
Policy analysis
PRACE
Preemptive multiprogramming on GPUs
Probabilistic Real Time Systems
Quantum Algorithms
Reduced Order Methods in HPC
RES
Resilient architecture and runtimes
Respiratory system
Runtime aware architectures
Scientific and Social impact
Scientific Visualization and storytelling
Sea Ice Variability, Prediction and Impacts
Seasonal prediction and attribution of extreme events
Seismic hazard, seismic vulnerability and seismic risk
Smart and resilient cities
Software development for protein-protein interactions
Solar energy services
Supercomputing for Artificial Intelligence
Superconducting Quantum Processors
Teaching Methodologies for Technology Rich Environments
The OmpSs Programming Model
Time-predictable parallel programming models
Tools for Distributed Data Science
Towards complex and intelligent workflow programming for Distributed Computing
Tropical Cyclones
Troposphere-stratosphere coupling
Urban air quality modelling
Urban-scale Atmospheric Dispersal Modeling
Volcanic ash
Wind energy services
Workflow environments for Scientific Applications
Order by:
Order by Year
Order by Type
Showing 81 - 90 results of 101
2009
A multi-model approach to improve tephra dispersal forecast: Etna?s case
Barsotti, S.
,
M. Coltelli
,
A. Costa
,
A. Folch
,
G. Macedonio
,
L. Nannipieri
,
A. Neri
,
M. Prestifilippo
,
S. Scollo
, and
G. Spata
El modelo de dispersión de cenizas volcánicas FALL3D y su aplicación al VAAC de Buenos Aires
Folch, A.
,
A. Costa
, and
M. Suaya
Ash cloud modelling using FALL3D
Folch, A.
Contributions from the FIRB Project: the APOLLO procedure and the FALL3D ash dispersal model
Folch, A.
,
A. Costa
, and
G. Macedonio
A genetic classification of collapse calderas based on field studies, analogue and theoretical modelling
Martí, J.
,
A. Geyer
, and
A. Folch
Time-dependent chamber and vent conditions during explosive caldera-forming eruptions
Earth and Planetary Science Letters
Folch, A.
, and
J. Martí
FALL3D: A computational model for transport and deposition of volcanic ash
Computers & Geosciences
Folch, A.
,
A. Costa
, and
G. Macedonio
2008
Computation of Volcanic ash Concentration at Long Distances Using an Eulerian Approach. Is it Worthy?
Folch, A.
, and
O. Jorba
Computation of Volcanic ash Concentration at Long Distances Using an Eulerian Approach. Is it Worthy?
Folch, A.
, and
O. Jorba
G. APOLLO: An automatic procedure to forecast transport and deposition of tephra
Folch, A.
, | https://www.bsc.es/folch-arnau/publications?page=8 |
The latest advances in technologies and networks have been central to the expansion of electronic content across different contexts. Contemporary communication approaches are crossing boundaries as new media are offering both challenges and opportunities. The democratisation of the production and dissemination of information via the online technologies has inevitably led individuals and organisations to share content (including images, photos, news items, videos and podcasts) via the digital and social media. Interactive technologies are allowing individuals and organisations to co-create and manipulate electronic content. At the same time, they enable them to engage in free-flowing conversations with other online users, groups or virtual communities (Camilleri, 2017). Innovative technologies have empowered the organisations’ stakeholders, including; employees, investors, customers, local communities, government agencies, non-governmental organisations (NGOs), as well as the news media, among others. Both internal and external stakeholders are in a better position to scrutinise the organisations’ decisions and actions. For this reason, there is scope for the practitioners to align their corporate communication goals and activities with the societal expectations (Camilleri, 2015; Gardberg & Fombrun, 2006). Therefore, organisations are encouraged to listen to their stakeholders. Several public interest organisations, including listed businesses, banks and insurance companies are already sharing information about their financial and non-financial performance in an accountable and transparent manner. The rationale behind their corporate disclosures is to develop and maintain strong and favourable reputations among stakeholders (Camilleri, 2018; Cornelissen, 2008). The corporate reputation is “a perceptual representation of a company’s past actions and future prospects that describe the firm’s overall appeal to all of its key constituents when compared to other leading rivals” (Fombrun, 1996).
Business and media practitioners ought to be cognisant about the strategic role of corporate communication in leveraging the organisations’ image and reputation among stakeholders (Van Riel & Fombrun, 2007). They are expected to possess corporation communication skills as they need to forge relationships with different stakeholder groups (including employees, customers, suppliers, investors, media, regulatory authorities and the community at large). They have to be proficient in specialist areas, including; issues management, crises communication as well as in corporate social responsibility reporting, among other topics. At the same time, they should be aware about the possible uses of different technologies, including; artificial intelligence, augmented and virtual reality, big data analytics, blockchain and internet of things, among others; as these innovative tools are disrupting today’s corporate communication processes.
Objective
This title shall explain how strategic communication and media management can affect various political, economic, societal and technological realities. Theoretical and empirical contributions can shed more light on the existing structures, institutions and cultures that are firmly founded on the communication technologies, infrastructures and practices. The rapid proliferation of the digital media has led both academics and practitioners to increase their interactive engagement with a multitude of stakeholders. Very often, they are influencing regulators, industries, civil society organisations and activist groups, among other interested parties. Therefore, this book’s valued contributions may include, but are not restricted to, the following topics:
Artificial Intelligence and Corporate Communication
Augmented and Virtual Reality in Corporate Communication
Blockchain and Corporate Communication
Big Data and Analytics in Corporate Communication
Branding and Corporate Reputation
Corporate Communication via Social Media
Corporate Communication Policy
Corporate Culture
Corporate Identity
Corporate Social Responsibility Communications
Crisis, Risk and Change Management
Digital Media and Corporate Communication
Employee Communications
Fake News and Corporate Communication
Government Relationships
Integrated Communication
Integrated Reporting of Financial and Non-Financial Performance
Internet Technologies and Corporate Communication
Internet of Things and Corporate Communication
Investor Relationships
Issues Management and Public Relations
Leadership and Change Communication
Marketing Communications
Measuring the Effectiveness of Corporate Communications
Metrics for Corporate Communication Practice
Press and Media Relationships
Stakeholder Management and Communication
Strategic Planning and Communication Management
This publication shall present the academics’ conceptual discussions that cover the contemporary topic of corporate communication in a concise yet accessible way. Covering both theory and practice, this publication shall introduce its readers to the key issues of strategic corporate communication as well as stakeholder management in the digital age. This will allow prospective practitioners to critically analyse future, real-life situations. All chapters will provide a background to specific topics as the academic contributors should feature their critical perspectives on issues, controversies and problems relating to corporate communication.
This authoritative book will provide relevant knowledge and skills in corporate communication that is unsurpassed in readability, depth and breadth. At the start of each chapter, the authors will prepare a short abstract that summarises the content of their contribution. They are encouraged to include descriptive case studies to illustrate real situations, conceptual, theoretical or empirical contributions that are meant to help aspiring managers and executives in their future employment. In conclusion, each chapter shall also contain a succinct summary that should outline key implications (of the findings) to academia and / or practitioners, in a condensed form. This will enable the readers to retain key information.
Target Audience
This textbook introduces aspiring practitioners as well as under-graduate and post-graduate students to the subject of corporate communication – in a structured manner. More importantly, it will also be relevant to those course instructors who are teaching media, marketing communications and business-related subjects in higher education institutions, including; universities and colleges. It is hoped that course conveners will use this edited textbook as a basis for class discussions.
Submission Procedure
Senior and junior academic researchers are invited to submit a 300-word abstract on or before the 30th June 2019. Submissions should be sent to [email protected]. Authors will be notified about the editorial decision during July 2019. The length of the chapters should be between 6,000- 8,000 words (including references, figures and tables). These contributions will be accepted on or before the 31st December 2019. The references should be presented in APA style (Version 6). All submitted chapters will be critically reviewed on a double-blind review basis. The authors’ and the reviewers’ identities will remain anonymous. All authors will be requested to serve as reviewers for this book. They will receive a notification of acceptance, rejection or suggested modifications – on or before the 15th February 2020.
Note: There are no submission or acceptance fees for the publication of this book. All abstracts / proposals should be submitted via the editor’s email.
Editor
Mark Anthony Camilleri (Ph.D. Edinburgh)
Department of Corporate Communication,
Faculty of Media and Knowledge Sciences,
University of Malta, MALTA.
Email: [email protected]
Publisher
Following the double-blind peer review process, the full chapters will be submitted to Springer Nature for final review. For additional information regarding the publisher, please visit https://www.springer.com/gp. This prospective publication will be released in 2020. | https://drmarkcamilleri.com/category/corporate-governance/ |
- The need to protect the child from physical or psychological harm including being subjected to or exposed to abuse, neglect or family violence.
In cases where one party wishes to relocate with the child and the other parent does not agree to the child being relocated, it is prudent for the party wishing to relocate to try and reach agreement though Mediation or Family Dispute Resolution. If an agreement is still unable to be reached, then the party wishing to relocate should seek Orders through the Federal Circuit Court.
In these cases, the Court will give consideration to:-
- Whether the proposed relocation will negatively impact on the child’s ability to maintain their relationship with the parent that will remain living in the same place including the costs and logistical difficulties of the parent not relocating spending time with the child;
- The wishes of the child, depending on their maturity and understanding;
- Why the parent wishes to move. There must be good reasons which might include:-
- Financial implications such as better job prospects;
- The parent wishing to relocate may have no family support in the current place and wishes to relocate to where they will have greater family support;
- A history of domestic violence.
- One parent may have had little to no involvement in the child’s life in which case the parent wishing to remain in the same place would not really have their time impacted;
- Whether there are other children involved such as a half-sibling which would not be included on the relocation and the impact to that relationship;
- The willingness and ability of each parent to facilitate and encourage a close and continuing relationship between the child and the other parent. This may include offering significant holiday time, paying for the travel costs, enabling the other parent to spend time with the child at the new town or city if they travel there;
- Recent cases have taken into account the mental health of the parent wishing to relocate. If the Court was to refuse to allow the parent to relocate with the child and the parent needed to remain in the same place as they are the primary carer for the child, would that decision negatively impact on the parent’s ability to parent the child?
- The proposals for the children’s living arrangements put forward by each parent;
- Whether the parent initially not wanting to relocate is also able to relocate.
Each case is different.
If you or the other parent are considering relocating, talk to one of our expert team on (07) 5591 5099 to get the right advice for your circumstances.
There are times when urgent advice is needed.
- If you become aware that the other parent is considering relocating, get immediate advice to prevent the unilateral relocation of the party and your children.
- If you’ve been affected where the parent has already relocated, contact us for advice about bringing an application for location and recovery Orders. | http://www.mclaughlins.com.au/relocation-what-will-the-court-consider-when-one-parent-wants-to-relocate-with-the-children/ |
"I'm unable to access this pattern. The link is no longer valid. Please update or remove page."
"I clicked the link to the website, but none of the pictures loaded. All I could see was the text. I tried clearing my cache, didn't help. I couldn't find a place to add a comment or to contact the blogger. Other websites I've tried since then don't have this problem. I would love to see the full tutorial. Help?"
"The link leads to something completely unrelated."
"I would love to see plus size maxi skirt patterns (preferably in lightweight cotton)"
A Paper-Pieced Garden: 27 Mix-and-Match Blocks
We are adding the pattern to your Sewing Patterns.
The pattern was added to your Sewing Patterns.
Click here to view your Sewing Patterns.
A Paper-Pieced Garden: 27 Mix-and-Match Blocks Plus Unique Quilts
Provided by Martingale
www.shopmartingale.com
Reviewed by Julia Wiatr
Many available quilting patterns are all based around one singular theme or motif. Each block for the quilt is the same or very similar to the other ones, and there is not much variety. A Paper-Pieced Garden: 27 Mix-and-Match Blocks Plus Unique Quilts, by Maaike Bakker and Francoise Maarse, offers 27 different block patterns for you to mix and match as you see fit. Create a quilt that is completely your own design!
A Paper-Pieced Garden is a block pattern compilation that focuses on the paper piece technique, which is used to create block designs that are impossible with more traditional methods. If you’re new to this technique, Bakker and Maarse provide helpful information and a step-by-step how-to on the process, complete with photos of each step. For those who aren’t just new to paper piecing but to quilting in general, there is a brief overview in the beginning of the book that should help you out. There is information on how to choose your fabrics and what colors to look for for the nature-inspired patterns. There are also some tips for washing fabrics, too.
Moving into the quilting portion of the book, the authors provide information on the basics of constructing a quilt, from joining fabric to finishing up a quilt with binding, complete with photos for each step they describe. Whether you’re a sewing novice or not, you can quickly get the background knowledge you might be missing. The rest of the book is focused on the garden-inspired quilt patterns. If you don’t want to start mix-and-matching, you can choose from one of seven garden quilt tutorials, but if you are, there are 27 paper-piece block patterns for you to work from in the back of the book, so you can mix and match motifs as you go. Each block is clearly divided up and labeled so that, following the paper piece technique, you can quickly construct each one.
This instructive and detailed book has all the information you need to create your own quilted garden. From beginner to experienced quilter, you’ll love the amount of freedom you get with the variety of block patterns provided.
We did not receive compensation in exchange for this review. Items received are used for product review and testing. All opinions are those of the editorial staff. Our Disclosure Policy can be found here.
Free projects, giveaways, exclusive partner offers, and more straight to your inbox!
Tags / Related Topics
Your Recently Viewed Projects
Project of the Day
How to Make Slippers From Jeans
If you are looking for a great homemade gift idea, this homemade slipper pattern will do the trick. Easily created from an old pair of… Continue reading: "How to Make Slippers From Jeans"
What's Hot
- Sew, Craft, Quilt and Embroider Confidently
- Steampunk Your Wardrobe
- Sewing Vintage Modern
- A Quilter's Ark
- 500 Simply Charming Designs for Embroidery Book Review
- Handmade Leather Bags & Accessories
- Sew Red: Sewing & Quilting for Women's Heart Health
- Enter for your chance to win the Signature Bags and Totes Sewing Bundle Giveaway!
- The Dressmaker's Technique Bible
- 100 Applique Motifs
Something worth saving? | https://www.allfreesewing.com/Book-Reviews/A-Paper-Pieced-Garden-Review-27-Mix-and-Match-Blocks |
Jia-Jia Zhu has been fascinated with natural stones since she used to collect them as a child - now they are the basis of her beautiful jewelry designs. This necklace has a gold chain that's strung with 50.00-carats of pink sapphires, believed to symbolize love and good fortune. It's truly one-of-a-kind, making it a great gift for someone special. | https://www.shopstyle.com.au/g/women/jia-jia/gold-sapphire-necklace/880378142 |
Module 4 EDU542 for Fortified
Module 4 Case:
Write a 3-4 page paper describing the role of the principal in curriculum improvement and assessment. Include how principals and other leaders can partner with teachers in curriculum choice, recruiting qualified teachers, scheduling collaboration, hiring instructional coaches, providing consistent feedback. Give examples and be specific. Elaborate on the characteristics of collaboration and teaming as part of this process.
Assignment Expectations
Your work should be written with the following in mind.
- This Case Assignment should be at least 3-4 pages, not counting the title page and references.
- A clear introduction that orients a reader to the essay main content, and the main points discussed.
- A well-developed, well balanced essay body that develops each point in its own paragraph.
- A concise conclusion that summarizes the whole essay.
- Include at least three references. Quoted material should not exceed 10% of the total paper (since the focus of these assignments is critical thinking). Use your own words and build on the ideas of others. When material is copied verbatim from external sources, it MUST be enclosed in quotes. The references should be cited within the text and also listed at the end of the assignment in the References section. Follow the APA Style® format, see www.apastyle.org.
- At least one in-text citation for each reference.
- General format/mechanics.
- A reference page which follows APA requirements.
- Organized in a clear and coherent manner.
- Double spaced with font size of 12.
- Your writing should:
- Be clear, logical and precise;
- Have breadth and depth;
- Show critical thinking skills.
Module 4 SLP:
The session long project for this course has involved writing a curriculum assessment plan. For each module, you completed a different section of the plan.
For the final section of your assessment plan, you will address how you will provide professional development and training for teachers based on results from your assessment plan. See sample below. You may use the sample format or use narrative format, however all areas must be addressed. Add this section to your assessment plan that you completed in Modules 1-3.
Based on information gathered from assessments, please develop a professional development plan for teachers to address teaching and learning improvement for the curriculum and outcomes on your assessment plan.
Sample:
Areas Needing to be Addressed Based on Assessment ResultsType of Professional Development Provided (be specific)How will teaching and learning be evaluated for this curriculum/these outcomes? (Include benchmarks to check progress, classroom visits, lesson modeling etc.)List areas here:List Professional Development here:List specific evaluations here:
SLP Assignment Expectations
Your assessment plan should be detailed, professional looking, and free of spelling errors.
Module 4 Discussion:
After reviewing the Saunders’ article on grade-level teams, discuss the benefits of grade level teams when it comes to teaching, learning, and assessment. How does accountability with others improve practice? What can school/district leaders do to encourage team collaboration?
Please ensure that your initial response is a substantive post that is at least 150 words and provides at least 2 references.
You will need to respond to or evaluate 2 peer postings, with at least a 125-word response, which will cause you and your peers to promote deeper thinking and advance the conversation. In this forum, you need to post a minimum of 3 postings to receive the full credit.
- Discount Tutor
- A+ Team_here
- teacher Charles
- Hilary Mantel
- nicohwilliam
- ProCastrol01
- Talented Writer
- Dr Candice_2547
- Asad Ullah
- The quA+lity
- ChrisProf
- professor mitch
- WIZARD_KIM
- DrNicNgao
- imhmd.f
- prof avril
- Catherine Owens
- Dr. Claver-NN
- writinginn786
- Wendy Lewis
- Prof.MacQueen
- Mary Warnock PhD
- mbitheh
- kite_sol
- perfecto
- Colossal Genius
- katetutor
- Adrian Monroe
- brilliant answers
- Claire Audrey
- wizard kim
- work solutions
- kim woods
- Rey writer
- Jenny Boom
- Bill_Williams
- ansRohan
- Miss Professor
- RESPECT WRITER
- suraya_PhD
- Terry Roberts
- ENS. writer
- JOHN JUNIOR001
- Dr shamille Clara
- Emily Clare
- phyllis young
- university work
- Emily Blunt
- Jessica Luis
- Ph.D A+ Grade
- smart-tutor
- PROFJUMAAA
- nadia tutor
- sarapaul2013
- KIBBZMORIA
- Pro Kiran
- Dr_inaaya
- Dr.Sanam sheikh
- STR 581 Week 4 Individual Assignment Strategic Choice and Evaluation. Get an A++.
- maQueens lungs
- Paper Proposal and Annotated Bibliography
- Scoring the Financial Criteria Against the Policy Change Options
- Ethics wk 5
- NRS 430V Week 3 Topic 3 DQ 2 - What factors need to be considered when…….. | https://www.homeworkmarket.com/questions/module-4-edu542-for-fortified |
Random assignment to the treatment groups is more likely to achieve equalization if the size of the sample is adequate, the level of impairment or disability and the natural history of prognosis are similar, dropout is a random phenomenon, and sequential entry over a long time does not alter the prognosis as additional interventions evolve. One of potentially confounding problems of using a group-comparison approach is that facilities may not have a sufficient number of homogeneous patients who meet entry criteria and who are willing to participate. Also, sampling or selection bias may be present when subjects are recruited at a single hospital or clinic. This error may limit the generalizability of the results to other patients. Such bias is especially likely to profoundly affect a descriptive and quasi-experimental design.
In rehabilitation trials of physical and cognitive interventions, disease pathologies with a resulting range of impairments are associated with disabilities and handicaps that are equally heterogeneous. All four variables are subject to potentially unforseen interactions. In addition, the focus of a rehabilitation trial could be at the level of pathologic process, impairment, disability, or handicap. Outcome measures may fall within any one or more of these levels. If these 4 foci of a treament intervention are the rows and the same 4 foci of outcome assessment are the columns, a total of 16 possible strategies for rehabilitation research are apparent.245 For example, an intervention at the level of an impairment such as leg weakness in a hemiparetic patient could alter an outcome at the level of impairment (improved strength), disability (walks faster), or handicap (new ability to walk up stairs, so no further need for an elevator). If an intervention alters an impairment by improving leg strength only, but does not lessen disability (walking is still assisted or very slow), the intervention will hold little interest for rehabilitationists. On the other hand, if the outcome measure is a decrease in the number of falls related to strengthening, the outcome may be important, if that outcome measure is chosen a priori. Of course, an in tervention can simultaneously be at more than one level or can affect more than one level of outcome measurement. Taking into account all of these potential relationships can produce enough wobble in a trial to flaw all but the best designs.
The control intervention, when a placebo, is often said to have an effect on up to one-third of patients in a drug, physical, or psychological trial. With any hands-on intervention, the control group should receive some defined level of attention from the therapists that is similar to the attention given to the experimental group. The notion of a large placebo-induced degree of change may lead to the mistaken concern that no experimental intervention other than a very robust one can improve outcomes in a clinical trial. The placebo effect, however, is insignificant in studies with binary outcomes and has only a small benefit in studies with continuous subjective outcomes, especially in pain studies.246
Was this article helpful? | https://www.mitchmedical.us/neurologic-rehabilitation/randomization.html |
Available under License Creative Commons: Attribution 4.0 International (CC BY 4.0).
Download (4MB) | Preview
Abstract
This paper uses a factor-augmented vector autoregressive model to examine the impact of monetary policy shocks on housing prices. To simultaneously estimate the model parameters and unobserved factors we rely on Bayesian estimation and inference. Policy shocks are identified using high-frequency surprises around policy announcements as an external instrument. Impulse response functions reveal differences in regional housing price responses, which in some cases are substantial. The heterogeneity in policy responses is found to be significantly related to local regulatory environments and housing supply elasticities. Moreover, housing prices responses tend to be similar within states and adjacent regions in neighboring states. | https://epub.wu.ac.at/6849/ |
What is an Architect?
Architects design homes, offices, stores, and other buildings and projects. They may perform environmental impact studies, feasibility studies, and similar research such as cost analysis and design requirements before developing blueprints and construction plans for their clients' approval.
Once a plan is in place, an architect must construct drawings of the proposed building to include all components such as plumbing, heating, electrical, and air conditioning; all plans must meet local and state building codes as well as fire regulations and disability access codes.
Architects use building information modeling (BIM) and computer-aided design and drafting (CADD) extensively but must also rely on hand-drawn blueprints and designs for their final product. Once a project is under construction, they may visit the construction site to ensure the project is meeting the requirements as set forth in the submitted and approved plan.
Search Programs
Steps to Take to Become an Architect
Becoming an architect will take several years, as you will need to complete your degree in architecture and then work in the field before you qualify for an architectural license. The profession relies heavily on knowledge of mathematics and physics but because it also encompasses designs, knowledge of architectural art, and history of architecture. While there are other paths you might take to pursue a career as an architect these are the most common steps required to enter the field:
-
-
Step 2: Complete an Internship
-
Step 3: Become Certified and Licensed
-
Step 4: Earn Your Master's Degree
Step 1: Earn your Bachelor's degree
Your four-year degree in architecture will give you a solid foundation of knowledge needed to be an architect. Your coursework will be heavy in mathematics classes such as calculus, algebra, geometry, physics, computer programs used in the field, and history and art classes that pertain to building designs. You'll also learn about construction materials and the rules and regulations of building codes and designs. Your degree program must be accredited by the National Architectural Accrediting Board (NAAB).
Compare Online Architecture Schools
Step 2: Complete an Internship
All architects are required to complete a three-year paid internship working in the field of architecture. Your internship will give you valuable hands on experience as you learn to put your knowledge into practice. Note that most schools offer an internship as part of the architect degree curriculum so you may complete a portion of this requirement before you graduate from your bachelor degree program. You should be aware of the requirements in your state so you can verify your internship accordingly, as you will have to show proof of your supervised work. Most states follow the Intern Development Program (IDP) set forth by the American Institute of Architects which is divided into four experience areas, totaling 5,600 hours of work experience.
Step 3: Become Certified and Licensed
All states require architects to be licensed, and the requirements vary from state to state. For example, Michigan requires an accredited degree, three years of experience, and passing all sections of the Architect Registration Examination of the National Council of Architectural Registration Boards (NCARB) before you are eligible to apply for a license.
Step 4: Earn Your Master's Degree
Although you can become a licensed architect with your bachelor degree, experience, and licensure; architecture careers are competitive. In addition, you must take continuing education classes to maintain your licensure, so it's an excellent plan to incorporate these requirements into a graduate degree in architecture to stay on top of new developments in the field.
What Does an Architect Do?
Although architects spend the majority of their time in an office, there are also other locations they commute to as part of their job. They often meet with building contractors to visit worksites and ensure the project is being built to their specifications, and they may meet with the clients for the same reason.
In the office, they may spend their day on the computer using design programs such as CADD to prepare their designs and may also do portions of the design by hand. They supervise workers in various aspects of the project, compile estimates and contract documents, and may also manage construction contracts. They must also look for future clients, so a portion of their time is spent giving presentations and marketing for new clientele. If an architect is a member of a large company, they’ll likely spend time in meetings to discuss the company's current and future business projections.
Because an internship is a large part of becoming a licensed architect, most working architects also spend time mentoring others, typically doing design work and similar tasks. They must also stay current on new technology and other changes within the field and must complete specific continuing education to meet their licensing renewal requirements.
Skills to Acquire
Architects must have a diverse range of talents and skills in order to complete their education and successfully enter the career field. Although many required skills can be learned in college, some skills, such as the ability to imagine a future project, are innate. Here are some of the skills an architect must have or learn in order to be successful in their chosen profession:
- Analytical skills to determine the specific requirements of each project
- The ability to imagine and create in three dimensions
- Drawing and design talent to showcase architectural ideas
- Creativity to design a practical and visually pleasing project
- Ability to understand buildings and the final environmental impact of a project
- Excellent written and verbal communication skills
- Ability to interact with a diverse range of populations
- Excellent project management and organizational skills
- Outstanding mathematical aptitude
- General business and negotiating skills
- Computer literacy, especially with CADD and similar building programs
- People skills to interact with clients, contractors, and business associates
Alternative Paths
Becoming an architect is a long process, but there are a few ways to shorten it and even some alternative paths. If you realize architecture is your dream job while still in high school you can take college level courses in mathematics, drafting, and similar required subjects such as CADD to get a head start on your degree. You can also take College-Level Examination Program (CLEP) exams on subjects you know to earn college credits and shave time off your required education.
If you already have a Bachelor's degree in architecture or a related subject such as construction management or architectural history, you may apply to a Master of Architecture program and streamline your educational requirements; make sure the program is accredited and your degree in architecture is accepted by NAAB before you enroll . Applicants who do not possess a NAAB-accredited first professional degree in architecture must provide an evaluation of their education equating it to the NAAB guidelines; it may or may not be accepted.
Find Online Architecture Programs
The National Council of Architectural Registration Boards (NCARB) has a new Certificate Portfolio Program that allows those with experience in the field, but no degree, to submit an online portfolio of work documentation to satisfy the board's educational requirement.
Keep in mind you will still need to meet the three-year internship requirement so you should have a clear understanding of what is required so you can maintain documentation of all experience that meets this requirements.
Architect Career & Salary
Where Might You Work?
Most architects are employed in one of three areas: at a large architectural firm, at a midsized architectural firm, or are self-employed at their own firm. Here's a brief look at each:
Large firms: if you dream of working in a major architectural firm you will most likely work in one of the large metropolitan areas such as Houston or New York City. In these firms an architect usually works in one area of the field, so you might work solely on the initial design aspect, the production of blueprints, specifications, or the legal building codes required for each design. Because of the company’s size, there is a good chance of promotion within a large architectural firm.
Midsized and small architectural firms: These firms can be found in cities of all sizes throughout the country. In a smaller or midsized company, you will most likely be involved in projects from conception to completion. You might meet with clients, visualize and create the building concept, and supervise interns and junior architects on various aspects of each project. On the down side, the smaller the company, the less likely you are to advance in your career.
About 20% of architects are self-employed. Like all small business owners, running your company will require long hours and hard work with a tight budget. It will take time to build your business and you should plan to take several years for your business to break even and begin making an income. If you plan to eventually own your own architectural company, you should include basic business courses in your college curriculum, so you are prepared to handle the dad-to-day business aspects of running a company.
Potential Career Paths
There are five basic types of architects (excluding landscape architecture and interior design). Within each career path there are multiple positions possible, depending on the size of the company in which you are employed. Here are the five types of architects, followed by specific architecture careers within each:
Residential Architect:
meet with clients who wish to have a custom home built; visualize the layout and design the home, cost of materials, services, and give time estimates for the project completion
Commercial Architect:
design public and private commercial buildings while implementing safety regulations, building codes, and similar specifications required in public buildings
Green Design Architect:
focus on creating ecologically friendly buildings that have a minimal impact on the environment
Urban Designer:
architecture on the scale of neighborhoods and cities; focus is on groups of buildings and street networks
Industrial Architect:
create buildings designed with commercial industries in mind to facilitate the future function of the building itself
Architectural roles within a large firm:
Project Manager:
in charge of all aspects of a project; supervises the staffing, planning, and organization of each project to ensure it stays on target
Specifications Writer:
creates the written documentation for each project, providing builders with material specifications and requirements for each project
Sustainability Consultant:
reduces the impact the building will have on the environment and on natural resources
Design Architect:
starts the project from a rough schematic through design development
Technical Architect:
puts the building together on paper, looking for technical details that need to be remedied before the building begins
Architect Salaries
|Occupation||Entry-Level||Mid-Career||Late-Career|
|Architect||$50,000||$66,000||$89,000|
|Architectural Technologist||$43,000||$60,000||$143,000|
|CAD Technician||$37,000||$48,000||$66,000|
|Interior and spatial designer||$40,000||$56,000||$60,000|
|Urban designer / City Planner||$46,000||$60,000||$76,000|
|Building Surveyor||$32,000||$57,000||$176,000|
|Commercial/residential surveyor||$35,000||$47,000||$70,000|
|Construction manager||$51,000||$78,000||$125,000|
|Estates manager||$48,000||$81,000||$146,000|
|Higher education lecturer||$60,000||$69,000||$100,000|
|Historic buildings inspector||$44,000||$55,000||$57,000|
|Landscape architect||$47,000||$63,000||$78,000|
|Planning and dev. surveyor||$41,000||$66,000||$100,000|
|Production designer||$43,000||$51,000||$62,000|
|Structural engineer||$51,000||$66,000||$98,000|
|Exhibit designer||$39,000||$50,000||$70,000|
**Salary info provided by PayScale
Career Outlook
Architect employment is projected to have a slower than average growth rate in the next 10 years, with only a 4% increase compared to 7% in all occupations. That being said, there are certain niche areas that are expected to grow: schools of all levels, health facilities, and sustainable buildings. Energy conservation is becoming a key component of new buildings and "green" energy from wind and solar are expected to be in demand for future buildings as well as retrofitted old construction projects.
Find Your School
Architecture careers are competitive and that is the main reason you should continue your education once licensed. Because the education and experience required to become an architect is extensive, you can, for the most part, expect your income to rise in direct proportion to your level of experience.
In 2017 the median annual income for architects was $78,500. The lowest 10%, reflecting those with the least experience, earned $47,480. The highest 10%, reflecting those with the most experience and education, earned over $134,600.
Location also has an impact on the income of an architect as well; cities such as Los Angeles and New York report income that is considerably higher than average while Minneapolis, Las Vegas, and Seattle are lower than average.
Advancing From Here
Advancing in the field of architecture requires a combination of experience and knowledge. Those wishing to pursue a management position within a firm should consider earning their Master's degree in architecture with a minor in business. Other advancements are available as you work your way up the levels of major firms.
You can also advance your career by focusing on a specific area of the field and furthering your education to reflect your interest. Here are some examples of specialty areas within the field of architecture:
- Historic preservation: renovation and restoration of historic sites and homes to modernize while retaining the original form
- Solar design: integrating solar power within a new or existing building design
- Naval architecture: design of marine structures
- Architectural history: focus on previously built environments within cities
- Urban design: looking at the entire area when designing a subdivision or neighborhood
- Sustainability: building with the focus on making the least impact on the environment and natural resources
As technology advances, there will be a need for architects who are able to incorporate new technology into future construction projects. For example, "Smart" homes are becoming more popular and will most likely be a specialization for future architects. Likewise, new building materials such as hempcrete are expected to become the future norm.
As you progress through your education you should stay on top of new developments and breakthroughs in areas that have an impact on building. This will give you a feel for future career advancement opportunities and help you prepare to take advantage of new innovations within the field of architecture.
Find Architect Jobs Near You
Frequently Asked Questions
What do architects do?
Architects use computer aided design and technical skills to design homes, offices, stores, and other buildings and projects.
How long does it take to become an architect?
It can take many years to become an architect. You can work for architectural and engineering companies with a bachelor's degree but a master's degree is recommended. All states require architects to be licensed. The requirements for each state will vary. Architecture graduates are required to take continuing education classes to maintain licensure.
What skills should architects have?
Architects should have excellent written and verbal communication skill and people skills. They also need a range of technical skills such as drawing, design, mathematical aptitude, project management, CADD and similar building programs.
How much do architects make?
Architects make between $50,000 to $89,000 annually.
What is the job outlook for architects?
The Bureau of Labor Statists predicts that from 2020 to 2030 architect careers are expected to grow by 3%. | https://universityhq.org/how-to-become/architect-careers/ |
House prices in Manston Road, Birmingham B26
What's the average house price in Manston Road?
The average price for property in Manston Road stood at £179,700 in April 2020. This is a rise of 0.53% in the last three months (since January 2020) and rise of 4.50% since 12 months ago. In terms of property types, flats in Manston Road sold for an average of £119,997 and terraced houses for £162,214. This is according to the current Zoopla estimates.
Data on sold house prices, such as the results above for Manston Road Birmingham B26, is supplied to us via monthly updates from the Land Registry for England and Wales and from the Registers of Scotland for Scotland. There may be a delay of up to 3 months from when a property is actually sold to when it becomes officially recorded with Land Registry and/or Registers of Scotland. We provide data on house prices for information only, on an 'as is' basis as supplied to us and accept no liability for any errors or omissions. If you have identified any incorrect information in, please Report an error. | https://www.zoopla.co.uk/house-prices/birmingham/manston-road/ |
Project summaryThe following considerations have been taken into account in deciding on the theme of the Project.
- Limited possibilities in financing and modern equipment do not allow competing with foreign laboratories in commonly accepted areas of investigations.
- The availability of skilled scientists in the area of ultrasonic light interaction.
- The availability of the native theory of cascading light conversion with ultrasonic light interaction.
The Project does not require significant investments but some support of ISTC is necessary.
The key idea of the Project is to investigate experimentally the possible maximal wavelength shift of a light wave with ultrasonic light interaction. As is known, there is the frequency shift from f to f+F in a usual Bragg cell, where f and F are frequencies of light and acoustic waves, respectively. Because f @ 5 1014 Hz, F @ 5 107 Hz, increasing the light frequency from f to f + F = f (f + F/f)= 1.0000001 f is very small. However, if the same scheme of conversion will be used recursively the light waves with frequencies f + 2F, f +3F...f + NF... can be obtained. A multistage or cascading conversion takes place in the case. For example, if N = 106 then/will be increased by ten percents. Needless to say, the conversion is not supposed to be obtained in a usual Bragg cell. A special optical device in a form of glass focon has been developed for these purposes. In any case, total time of the cascading conversion ttotal is more by N times than time of conversion t @ 0.1 ms in a usual Bragg cell. If N = 106 then ttotal = 100 ms. Until recently there were not optical mediums in which a light can propagate in such long time. Up-to-date technological achievements in fabricating glass for fibers with very small losses (less than 0.2 Db/Km) give such opportunity. Thus, the Project is trying to use the up-to-date technological achievements for the purposes different from primary ones.
The Project may be thought as the main step in the direction to radically new converters, amplifiers, and sources of coherent light in wide range of wavelengths (0.35 - 1.6 m) and output powers (10-3 - 103 W). A mechanical energy in form of elastic oscillations with frequency about 50 MHz is converted directly into the energy of coherent light. The devices use cheap sources of feeding based on usual HF transistors unlike the known parametric light converters and amplifiers based on nonlinear crystals that require cost feeding in form of power coherent light.
As is known, the present sources of the optical pump are powerful lasers operated in a pulse regime. They are large in size and weight, cost and short lived. That is the reason why amplifiers and converters based on nonlinear crystals are not wide spread. On the contrary, the sources of the pump with frequency about 50 MHz based on power high-frequency transistors are small in size and weight, cheap and long lived. Modulation of refractive index n in optical medium required for parametric conversion and amplification is performed in the glass on account of quite different physical effects than in nonlinear crystals. An acoustic wave can be used in the glass rather than the light wave that modulates n in a nonlinear crystal because of its nonlinearity.
Since the velocity of the acoustic wave in the glass is less than the velocity of light c/n in nonlinear crystals by the factor 20000 - 30000 the power of acoustic wave can be less by the same factor than the power of the light wave, all other things being equal.
An important point is the following peculiarities of the glass
- the glass has small dissipate losses not only for light waves but also for acoustic waves.
- the glass has high resistance to intensive light and acoustic waves
- the glass enables to perform light conversion and amplification in large volume, that enables to deal with large light and acoustic power.
- the glass is characterized by the simplicity of fabrication, used elements and material.
But all these quite right general considerations had been not confirmed by appropriate theoretical and experimental studies. Unfortunately, the classical theory of parametric interaction between light waves is not valid for the case because the theory is limited by so called 3-wave interaction when interaction the following 3 wave are considered: pump, input light wave, and idle wave. It is supposed that all other waves with various combinative frequencies can be neglected because they do not satisfy to the condition of space synchronism because of material dispersion in nonlinear crystals. This assumption is not valid in the case with very low-frequency pump because many combinative frequencies resides in a narrow frequency band and must be taken into account. Thus, instead of the theory of 3-wave interaction must be applied a theory of multi-wave interaction, that was developed in 1993-1996.
The first papers concerned these questions have been published in 1993. The further theoretical study of this problem has been performed in 1994-1996. In particular, "Theoretical study of interaction of light waves in a medium with the refractive index modulated at relatively low frequency" has bee performed with partial financial support of Sores International Science Foundation, Grants N MPF000 and MPF300.
The last 3 papers with consideration of light conversion and amplification in concrete devices have been published in 1996. The most important of the papers are the following
- V.P. Torchigin. Propagation of Waves in Optical Waveguides with periodically varying Refraction Index. Laser Physics, 4, No.l, 168-177 (1994).
- V.P.Torchigin Amplification of light pulses in waveguides with periodically varying refractive index. Quantum Electronics 25(5), 484-485 (1995).
- V.P. Torchigin. Conversion of light in a focon with using an acoustic wave as a pump. Technical Physics, 66, no.4, 128-139 (1996).
- V.P. Torchigin. Interaction of acoustic and light acoustic cylindrical waves. Acoustical Physics, 42 no. 6, 853-859 (1996).
- V.P. Torchigin Light amplification in lightguides and resonators formed by acoustic wave. Technical Physics, 66, no.8, 107-123 (1996).
At the moment it is known no papers concerned this direction throughout the world besides the works of the authors of the Project.
The effect of increasing light frequency and light energy can be explained with various points of view. He most simple explanation is compression of light radiation in optical-open-dielectric-glass-ring resonators of travelling wave formed in a glass focon by the travelling acoustic wave propagated along the axis of the focon towards its taper part. The resonators are moving along the focon with the velocity of the acoustic wave about 6000 m/s, their diameter is decreasing and the light radiation stored in the resonators is being compressed. In result, the energy and frequency of the light radiation are increasing. Time of the compression is about 10 - 100 microseconds. It is shown that radioactive and dissipate losses in the glass resonators are small enough in this time interval.
The other explanation is based on the well-known effect of increasing light frequency at reflection of a light wave from the distributed Bragg reflector (DBR) formed by a travelling acoustic wave. The effect has been approved experimentally in the usual acousto-optic Bragg cell. Having reflected from the DBR, the light wave gains its frequency by F, where F is the frequency of the acoustic wave. If the effect is repeated by 106 times the frequency of the result output light wave can be increased by 106 F that is up to 1014 Hz. Of course, the all repetitions take place in the same device, in particular, in the glass focon.
Besides, the following additional approaches have been used to study processes of conversion of light in a medium with refractive index modulated in time.
Conversion of light in a waveguide with slowly varying cross-section along its axis when an acoustic wave propagates along the axis.
Conversion of light in curve moving waveguides formed by a travelling acoustic wave.
Propagation and transformation of light on the base of methods of geometric and wave optics.
The all approaches lead to the following result. At present, it is possible to create light converters and amplifiers with low-frequency pump on the base of currently available glasses with small losses.
The features of mechanism of conversion lead to the following properties. Light with any wavelengths for which dissipation in the glass is small enough can be converted. Both coherent and non-coherent light can be converted. Light with required spectrum can be obtained in result of conversion. Small dependence of parameters of the converters and amplifiers on temperature takes place. Small sizes, high efficiency, large output power per unit of volume of the glass, cheap AC feeding are the other features of the converters and amplifiers. As is known, electricity had been introduced in practical applications when electrical generators transformed mechanical energy into electrical one had been developed. The same history is possible with optical generators.
Scientists from the Institute POLUS developed military optical devices are recruited for the work. They are prominent experts in Russia in the field of research and development of acoustic-optic modulators, deflectors, correlators etc. as well as in the field of measurements of parameters of light and acoustic waves. Their efforts will be supported by experienced physicists of the internationally known Institute of General Physics headed by the winner of Nobel Prize academician A.M. Prokhorov.
There are all necessary materials, technology and instrument devices in Russia but the experimental study meets large difficulties because of lack of financing.
Expected Results
The experimental investigations are planned on the base of step by step approach. At the first stage, a usual Bragg cell will be modified to increase the light frequency shift by 1000 times in compare with the present up-to date shift. The next steps are design, fabrication and testing specimens in which the light frequency shifts are increased by 104 and 105 times, sequentially. The following problems will be solved in result of the investigations. Dissipative, radiative losses, as well as losses in input and output of light radiation will be determined in various ranges of wavelength. If the total losses occur less than 3 Db on increasing the light frequency by 2 times then a generator of coherent light without any additional light sources will be combined and studied.
In any case, the results obtained at any stage can have practical applications. The investigations open a new direction in direct conversion of mechanical energy presented by elastic oscillations of optical medium (glass) into coherent light. The optical devices based on studied phenomena can be used in various applications, in particular, in telecommunication, computers, television, medicine, scientific investigations and so on. To date, it is difficult to outline all possible areas in which the new approach to amplification, conversion, and generation of coherent light can be used.
Potential role of foreign collaborators is help in organization of experimental study (experience, advises about modern instrument devices) as well as the check of the results obtained at any stage of the study.
The experience of discussing the questions shows that they are not understood immediately by acoutooptics experts. The problems are understood much more by physicists. In our opinion, the Projects similar to the present one allow to carry out scientific investigations without costly equipment and technologies and to obtain new results that increase human knowledge and open new fields of applications.
The International Science and Technology Center (ISTC) is an intergovernmental organization connecting scientists from Kazakhstan, Armenia, Tajikistan, Kyrgyzstan, and Georgia with their peers and research organizations in the EU, Japan, Republic of Korea, Norway and the United States.
ISTC facilitates international science projects and assists the global scientific and business community to source and engage with CIS and Georgian institutes that develop or possess an excellence of scientific know-how. | https://www.istc.int/en/project/5B08C43311EDAF87C3256C8C003EC4D4 |
Can I make copies of my professionally-taken family portraits?
If a professional photographer takes family portraits and sells the hi-res copies, can the client create a black-and-white or cropped version for personal use (i.e. not for resale)? How far does copyright protection extend into the private household?
Alli on Dec 30, 2008
This might depend upon the conditions upon which the photographer took the family portraits. Often, portrait photographers make money from selling prints to the people in the photos, so making your own copies of those photos might be denying the photographer some revenue. Thus, based on factor four of fair use, this would not be fair use and would be copyright infringement.
Comments
Reply by Anonymous
June 26, 2015
What if you have no idea where the photos were taken or who took them to even get permission to reproduce them?
Reply by Andrew Hudson, PhotoSecrets
January 6, 2016
Professional portrait photos usually have contact information somewhere (perhaps at the bottom or on the back), since portrait photographers typically make money by selling reprints.
You probably won’t be able to get a company to scan the photo and make a reprint, as companies are legally obligated to get the photographer’s permission. For more info, see photocopying.
The photographer owns the copyright, even if you have no idea how to contact the photographer. So unfortunately you are in a Catch-22 situation. | http://www.photosecrets.com/can-i-make-copies-of-my-professionally-taken-family-portraits |
Next week on #CommsChat we’ll be joined by EXASOL AG as we discuss data and marketing. What can companies do to get value from data and how can they implement that knowledge in their communications strategies.
- Data scientists are becoming ever more prevalent – what role are they playing in the marketing industry?
- How has the availability of data changed how marketers target customers in their campaigns?
- What does the marketer role/customer of the future look like?
- How can marketers harness data from the IoT?
- Is generic messaging obsolete?
- How can data be used for truly personalized and agile messaging?
- How can data analytics transform businesses, drive profit and reduce costs to serve customers better than ever before?
Join us! We tweet from @CommsChat and #CommsChat takes place from 8-9pm GMT. Anyone can take part in the discussion – simply follow the hashtag here or on Twitter. If you can’t make the chat or would like to revisit it, a transcript will go up on Tuesday morning. We’d love to hear your suggestions for future topics for #CommsChat – get in touch with Brittany by email or on Twitter if you have any ideas.
Comments
No comments yet. | http://commschat.com/commschat-on-data-and-marketing |
Explore the variety of ways that particular character undergoes transformation throughout the novel.
In The Scarlet Letter, Hawthorne uses a variety of literary devices to aid in character development, plot, setting, point of view, etc. In particular, he relies heavily on foreshadowing, irony, and symbolism. The book is also a study in transformation. Each of the four main characters undergoes significant transformations throughout the novel.
For your research essay, you will use the following guidelines to help you form a well-constructed essay which adheres to the basic essay structure we discussed early in the semester: a beginning, a middle, and an end. The beginning should include introductory statements which may provide some background about the topic you will address. It should end with your thesis statement–your statement of purpose in which you explain what your essay will set out to argue. The body of the essay should contain topical paragraphs which explore what you have set out to prove in your thesis. It should include the results of your own analysis/synthesis, quotations from the novel which support your thesis, and information (quotes or paraphrases) from at least three secondary sources which also help support the ideas which your thesis purports. It should be expressed in rhetorical form: written discourse which informs, explains, and motivates the reader to accept your proposed thesis. The conclusion will provide a wrap up of your ideas (without providing new information) and should serve as a closure which expresses in general ways how your thesis has been proven in the body of the essay. You will use MLA Style for the essay, including the heading, page numbering, in-text citations, etc. The essay should not be less than five pages of typed, double-spaced text, although it can be longer if needed. It should include a Works Cited page prepared in proper MLA Style as the last page. The Works Cited page should not count as one of your five pages of text.
1.Choose one of the four main characters in the novel: Hester Prynne, Rev. Arthur Dimmesdale, Roger Chillingworth, or Pearl (do not choose any other character).
What is their character like at the beginning of the novel?
What sort of transformations does the character experience?
How does Hawthorne make these transformations happen?
In particular, how does he use foreshadowing, irony, and symbolism to aid in the characters transformations?
Do the characters transformations result in a change that affects him or her for the better or for the worse?
How do the characters transformations affect the action of the novel?
What elements of 17th-century Puritan society help affect the transformations?
Does Hawthorne stay true to his portrayal of 17th-century Puritanism in the New World in his character development/transformation?
Do the characters transformations have a major effect on one or more of the other three major characters?
Do the characters transformations help make him/her the novels hero? Why or why not?
What aspects of the character, if any, do not undergo transformation, and how/why is this significant or insignificant?
What changes which occurred in Puritan society are foreshadowed by the characters transformations?
3.The above are some ideas for you to use as you develop your approach to your essay. You may consider others, but they will need to be approved in our one-on-one meeting in which we discuss your thesis and outline.
4.This paper is worth 300 points. Remember that you must make a C or better on the paper in order to pass this course (at least 210 points).
Previous Previous post: As you may well know, there have been many accounting scandals in the past few years. I would like you to research one of the more visible cases, that of Martha Stewart. What did she do wrong?
Next Next post: Methods of educational evaluation in Britain’s schools. | https://www.rushtermpapers.com/explore-the-variety-of-ways-that-particular-character-undergoes-transformation-throughout-the-novel/ |
EEGLAB is an interactive Matlab toolbox for processing continuous and event-related EEG, MEG and other electrophysiological data incorporating independent component analysis (ICA), time/frequency analysis, artifact rejection, event-related statistics, and several useful modes of visualization of the averaged and single-trial data. EEGLAB runs under Linux, Unix, Windows, and Mac OS X.
This lecture on generating TVB ready imaging data by Paul Triebkorn is part of the TVB Node 10 series, a 4 day workshop dedicated to learning about The Virtual Brain, brain imaging, brain simulation, personalised brain models, TVB use cases, etc. TVB is a full brain simulation platform.
Introduction to the central concepts of machine learning, and how they can be applied in Python using the Scikit-learn Package. This lecture was part of the 2018 Neurohackademy, a 2-week hands-on summer institute in neuroimaging and data science held at the University of Washington eScience Institute.
This lecture provides an overview of depression (epidemiology and course of the disorder), clinical presentation, somatic co-morbidity, and treatment options.
Part 1 of 2 of a tutorial on statistical models for neural data
What is the difference between attention and consciousness? This lecture describes the scientific meaning of consciousness, journeys on the search for neural correlates of visual consciousness, and explores the possibility of consciousness in other beings and even non-biological structures.
The ionic basis of the action potential, including the Hodgkin Huxley model.
Introduction to the course Cellular Mechanisms of Brain Function. | https://training.incf.org/search?f%5B0%5D=difficulty_level%3Abeginner&f%5B1%5D=difficulty_level%3Aintermediate&f%5B2%5D=lesson_type%3A24&f%5B3%5D=lesson_type%3A25&f%5B4%5D=lesson_type%3A26&f%5B5%5D=topics%3A52&f%5B6%5D=topics%3A56&f%5B7%5D=topics%3A57&f%5B8%5D=topics%3A65&f%5B9%5D=topics%3A71&f%5B10%5D=topics%3A72&f%5B11%5D=topics%3A253&f%5B12%5D=topics%3A281&%3Bf%5B1%5D=topics%3A64 |
The goal of the Human And Robot Partners (HARP) lab is to understand and develop autonomous, intelligent robots that help people live better. Our robots engage people through social and physical interactions, monitoring human behavior to understand and predict the types of help people need. Our lab’s expertise includes robotics, human-robot interaction, machine learning, computer vision, artificial intelligence, human-computer interaction, and cognitive science. Application domains include assistive robot manipulators for people with motor impairments, robot tutors for education, and robot therapy assistants for people with cognitive or social disabilities.
We are a part of the Robotics Insitute at Carnegie Mellon University.
Stop by our lab in NSH 4502 for a visit!
News
-
11 Mar ‘19: Mike Lee presented his work titled “Calibration of Trust through Robot Self-Confidence” at the 2019 HRI Pioneers workshop.
-
07 Mar ‘19: Reuben’s paper “Semantic Gaze Labeling for Human-Robot Shared Manipulation” has been selected for presentation at ETRA ‘19!
-
01 Mar ‘19: Calvin presented his research work on “Imitation Learning for Assistive Control” at MechE’s annual Graduate Research Symposium.
-
31 Jan ‘19: Michael Huang received an undergraduate research award, the Semiconductor Research Corporation-URO. Congrats Michael!
-
31 Jan ‘19: We have a few new lab members! Welcome Michael (sophomore), Siddharth (sophomore), Roman (senior), and Calvin (MS MechE). | http://harp.ri.cmu.edu/ |
This book examines the legacy of international interwar modernism as a case of cultural transfer through the travels of a central motif: the square. The square was the most emblematic and widely known form/motif of the international avant-garde in the interwar years. It originated from the Russian artist Kazimir Malevich who painted The Black Square on White Ground in 1915 and was then picked up by another Russian artist El Lissitzky and the Dutch artist Theo van Doesburg. It came to be understood as a symbol of a new internationalism and modernity and while Forgács uses it as part of her overall narrative, she focuses on it and its journey across borders to follow its significance, how it was used by the above key artists and how its meaning became modified in Western Europe. It is unusual to discuss interwar modernism and its postwar survival, but this book's chapters work together to argue that the interwar developments signified a turning point in twentieth-century art that led to much creativity and innovation. Forgács supports her theory with newly found and newly interpreted documents that prove how this exciting legacy was shaped by three major agents: Malevich, Lissitzsky and van Doesburg. She offers a wider interpretation of modernism that examines its postwar significance, reception and history up until the emergence of the New Left in 1956 and the seismic events of 1968.
Éva Forgács is adjunct Professor of Art History at…
This book is available on Bloomsbury Collections where your library has access.
Go to this book on Bloomsbury Collections.
Bloomsbury Publishing Inc
Registered Office: 1385 Broadway, Fifth Floor, New York, NY 10018 USA
© Bloomsbury Publishing Inc 2022
Your School account is not valid for the Canada site. You have been logged out of your account.
You are on the Canada site. Would you like to go to the United States site?
Error message. | https://www.bloomsbury.com/ca/malevich-and-interwar-modernism-9781350204171/ |
Q:
Extracting common values from two cells containing comma-separated values in Excel
Is there a simple way to extract common numbers from two cells with comma-separated numbers?
I have cells with 12 comma separated numbers in each cell. (They are not all unique. Some numbers can be repeated twice. but never more than twice. Numbers are all positive, and one or two digit numbers only)
My data is like so: they are in column A:
11,11,13,15,16,18,20,20,26,27,28,29
8,9,10,12,13,14,18,20,21,22,24,28
13,13,14,14,15,17,18,19,20,21,23,25
6,6,8,10,12,14,15,17,18,20,20,25
11,13,17,18,19,19,22,25,26,28,28,31
7,9,15,16,17,18,23,24,24,25,26,27
7,9,11,12,12,15,16,16,18,18,20,23
9,11,13,15,18,22,23,24,25,28,29,29
7,9,10,11,12,12,13,14,15,16,19,22
5,10,11,12,12,16,17,18,20,22,24,25
7,10,13,16,16,17,18,19,21,23,24,24
10,14,16,18,18,19,21,23,23,25,27,28
The result I would like to have is like so:
I need a solution without separating values into different columns, please.
Thanks for your help.
Since there can be numbers repeating twice in some cases, I am also open to a solution like this, too.
A:
It's possible without VBA:
Formula in B1:
=TEXTJOIN(",",,UNIQUE(IF(ISNUMBER(FIND(","&FILTERXML("<t><s>"&SUBSTITUTE(A1,",","</s><s>")&"</s></t>","//s")&",",","&A2&",")),FILTERXML("<t><s>"&SUBSTITUTE(A1,",","</s><s>")&"</s></t>","//s"),"")))
And if you don't have UNIQUE you could use XPATH to return unique values:
=TEXTJOIN(",",,IF(ISNUMBER(FIND(","&FILTERXML("<t><s>"&SUBSTITUTE(A1,",","</s><s>")&"</s></t>","//s[not(preceding::*=.)]")&",",","&A2&",")),FILTERXML("<t><s>"&SUBSTITUTE(A1,",","</s><s>")&"</s></t>","//s[not(preceding::*=.)]"),""))
In that case you also need to confirm through CtrlShiftEnter
A:
Matching Sub Strings
Here 's the easier 'duplicates' solution:
In Excel use it like this:
=comStr(A2,A3)
Copy the code into a standard module e.g. Module1
The Code
Option Explicit
Function comStr(String1 As String, _
String2 As String, _
Optional ByVal Delimiter As String = ",") _
As String
Dim Data1, Data2, Result(), i As Long, j As Long, l As Long
Data1 = Split(String1, Delimiter)
Data2 = Split(String2, Delimiter)
For i = 0 To UBound(Data1)
For j = 0 To UBound(Data2)
If Data1(i) = Data2(j) Then GoSub writeResult: Exit For
Next j
Next i
comStr = Join(Result, Delimiter)
Exit Function
writeResult:
ReDim Preserve Result(l)
Result(l) = Data1(i)
l = l + 1
Return
End Function
EDIT:
Here is the 'full' version where you can choose if duplicates are allowed.
In Excel use it like this:
=comStr(A2,A3,TRUE) to allow duplicates (like in the version above) or
=comStr(A2,A3) or =comStr(A2,A3,FALSE) to not allow them.
Function comStr(String1 As String, _
String2 As String, _
Optional allowDupes As Boolean = False, _
Optional ByVal Delimiter As String = ",") _
As String
Dim Data1, Data2, Result(), Curr, i As Long, j As Long, l As Long, n As Long
Data1 = Split(String1, Delimiter)
Data2 = Split(String2, Delimiter)
For i = 0 To UBound(Data1)
Curr = Data1(i)
For j = 0 To UBound(Data2)
If Data2(j) = Curr Then GoSub writeResult: Exit For
Next j
Next i
If l = 0 Then Exit Function
comStr = Join(Result, Delimiter)
Exit Function
writeResult:
If Not allowDupes Then
If l > 0 Then
For n = 0 To l - 1
If Result(n) = Curr Then Exit For
Next
If n <= l - 1 Then Return
End If
End If
| |
EVALEO provides a sustainable health solution allowing the optimal management of all prevention and health promotion activities on a daily basis and makes them accessible to all.
The sustainable health concept sets itself apart by its field approach to prevention and promotion. It is aimed at the population as a whole, cities, companies and sustainable health professionals.
Evaleo offers a sustainable health management system (SHMS) for cities and organisations (companies, etc.). It occupies an essential and complementary segment in the range of health and prevention services.
Many of the principles and approaches employed by EVALEO stem from or have been tested in the field of elite sport which possesses undeniable experience and skills in the field of salutogenesis1. These principles and approaches have also been tested on different types of people (disabled, sedentary, post-operatory, etc.) and are adapted to all.
The Evaleo approach, which combines innovative and ancestral knowledge in the field of health, allows one and all to obtain sustainable and qualitative results through the acquisition of skills essential for the management of all the principal health-related factors.
This approach is not limited to the fields of physical activity, nutrition and stress management but includes the fields of management, the environment, art and culture, amongst others. For this reason, the development of sustainable health touches multiple domains (sport, social development, sustainable development, economic and touristic development, training and education, art and culture, etc.).
The undeniable advantage of the sustainable health management system is that it can be adapted to existing organisms and structures that already offer or wish to offer sustainable health services.
1. The concept of salutogenesis was developed by the Israeli American professor of medical sociology, Aaron Antonovsky (1923-1994). It came about from a critical reflection on the existing health system, orientated towards illness. Antonovsky asked himself: “Why do human beings stay in good health in spite of certain unfavourable conditions and events in their lives?”. The concept of salutogenesis, based around health rather than illness, was developed from this new point of view.
In this concept, health and illness are not mutually exclusive states; rather they are the extremities of two poles existing within a whole. For Antonovsky, health is not the result of balance, but is created from a dynamic interaction between factors of stress and protection. This means that health must always be recreated and maintained between challenges and solutions. | http://www.evaleo.org/reponse-evaleo.html |
Credit risk encompasses a company’s ability to meet its obligations as they arise as well as a long-run ability to pay its debt. A company may be profitable but yet face bankruptcy if it is unable to pay its liabilities on time. Companies with large amounts of debt have greater credit risk because of an increased vulnerability to increases in interest rates and declines in profitability.
In this assignment, you will answer questions about your company’s classified balance sheet and conduct a ratio analysis to evaluate the company’s liquidity and solvency. A financial ratio expresses the relationship of one amount to another and enables analysts to quickly assess a company’s financial strength, profitability, or other aspects of its financial activities.
Requirements
In the first section, define liabilities and describe how liabilities are classified as current and long-term (give examples). Also define liquidity and solvency as it relates to the company’s debt-paying ability. What does your company call its ‘Balance Sheet’?
In the second section, define working capital, the current ratio, and the debt ratio, three frequently used ratios to assess credit risk (described in LEO’s online text or any principles of accounting text). Identify which are a measure of liquidity and which are a measure of solvency. Indicate how the ratio is interpreted. Is an increasing or decreasing ratio a favorable trend? Conduct online research to provide a ratio level (or range) that is considered acceptable for the current and debt ratio (technically, working capital is not a ratio so an average isn’t meaningful). If you can find information on acceptable ranges for the current ratio and debt ratio for your company’s industry, include that in your discussion. Numbers and ratios are more meaningful when considered relative to a benchmark. Benchmarks can be the company’s past performance, a similar company’s performance, an industry average, or a rule-of- thumb. For instance, for decades, a current ratio of 2 to 1 was considered satisfactory.
In the third section, prepare a table giving the dollar amount of current and long-term liabilities for the most recent year and the previous year. Either in the same table or a new table report the results of a ratio analysis. Calculate working capital, current ratio, and the debt ratio for the current year and the past year (show your calculations). Indicate whether the ratios are improving or deteriorating. If you find a relevant benchmark (industry average or rule-of-thumb), comment on your company’s performance relative to the benchmark.
Finally, in the fourth section briefly summarize results of any or all of the following: 1) an internet search for articles on recent events that may affect your company’s debt paying ability, 2) an internet search for financial analysts’ assessment of the company’s credit risk and or 3) management’s view of the company’s current debt-paying ability as found in the Management Discussion and Analysis (MD&A) section of the annual report. Either in this section or a conclusion paragraph, briefly summarize the results of your credit analysis by commenting on your company’s weakening or stronger financial position (i.e. liquidity and solvency).
Technical requirements same as for the first paper. Business report, single-spaced, use headings, should be over one page; limit to two pages, cite references and provide reference list. Make a table in Word (or Excel and copy into Word) as mentioned in the third section and provide appropriate and column and row labels.
SEC 10K Week 3 – The Income Statement and Profitability
The notes to the financial statements are integral part of the company’s financial report. Read the Notes to the Financial Statements (FS) for your SEC 10-K company. These “notes” are displayed after the financial statements.
1.
- 3.
- 5.
Note 1 includes accounting information. What is the fiscal year for your SEC 10-K Company? This may be June 30 each year, or it may be the Sunday closest to the last day of January, or some other description. Inventory: How is Inventory described for your SEC 10-K company? LIFO, FIFO, and/or average cost? Relate your answer to topics in our course. Income Statement: Is it a single-step or multi-step income statement? A multi-step statement (also called a classified income statement) reports levels of income (gross profit, operating income, net income). Define gross profit, operating income, and net income. Why are the levels of income important to financial statement users? A single- step statement reports revenues minus expenses and doesn’t highlight gross profit. Gross profit must be calculated by the user. Summarize management’s discussion of the company’s performance in the MD&A section of the annual report. Calculate the Gross Profit and Gross Profit Percentage (Gross Profit/Sales) for this year and last year, creating a small table, such as the following:
|
|
This Year
|
|
Last Year
|Net Sales||
|
$1,200
|
|
$1,400
|Cost of Goods Sold||
|
800
|
|
1,200
|Gross Profit||400||200|
|Gross Profit Percentage||
|
33%
|
|
14%
In the above example above, sales decreased, gross profit increased, and the gross profit percentage increased. Therefore, sales are more profitable. The company made 33 cents of gross profit on every dollar of sales this year, but only 14 cents of gross profit on every dollar of sales last year. Sales decreased, but sales are actually generating more profit overall, both as an absolute dollar value and as a percentage.
Be sure to use good form – $ signs for the first number in a column and use commas to separate thousands. You may drop off zeros similar to the way your company does in its financial statements but be sure to indicate that the numbers are in thousands (three zeros omitted) or millions (six zeros omitted).
SEC10K Project Week 4 – Liquidity II
This week’s SEC 10K project will look more in-depth at liquidity. In a previous assignment, you calculated the current ratio. A similar ratio, but more stringent measure of a company’s ability to pay currently maturing debt or generate cash for operations, is the quick ratio (also called the acid-test ratio):
Quick Ratio = Quick Assets Current Liabilities
Quick assets include cash, short-term investments in marketable securities, and net accounts receivable. Notice that the quick ratio excludes inventory and prepaid expenses in the numerator. Quick assets are those that will generate cash for the company more quickly. Inventory is two-steps away from being cash; first it must be sold and then the accounts receivable must be collected. Prepaid expenses do not generate cash since the account represents cash paid in advance for rent, insurance, etc.
If quick assets exceed current liabilities, the quick ratio indicates the number of times the company can pay its currently maturing debt. A quick ratio of 1.5 means that the company can cover its current liabilities one and a half times or pay all of its current liabilities and still have quick assets remain. If quick assets are less than current liabilities, the company can only cover a portion of its current liabilities. For example, a quick ratio of 0.88 means the company can pay 88% of its liabilities.
One explanation for an increasing current ratio (normally a favorable trend) and a decreasing quick ratio (unfavorable trend) is that inventories are growing which could be a signal that the company is having trouble selling its inventory. If the company is having trouble collecting accounts receivables both the current ratio and the quick ratio will be higher since both include receivables in the numerator, but the company may not be in a good position to pay current liabilities. This suggests that interpreting the results of ratios requires judgment. Also, it illustrates that looking at one ratio in isolation is rarely useful.
Turnover ratios also provide information on liquidity. The faster a company can ‘turn over’ its accounts receivable (i.e. the number of times it collect accounts receivable in a year) and inventory (i.e. sell inventory) the better its liquidity.
Accounts Receivable Turnover = Net Credit Sales (if credit sales not available, use net sales) Average Accounts Receivable, net
Average accounts receivable = Beginning Accounts Receivable* + Ending Accounts Receivable 2
*This year’s beginning balance of accounts receivable is last year’s ending balance.
Inventory Turnover = Cost of Goods Sold Average Inventory
Average Inventory = (Beginning Inventory + Ending Inventory) ÷ 2
SEC10K Project Week 4 – Liquidity page 2
For both ratios, an increasing turnover is favorable.
Dividing the turnover ratios into 365, gives an indication of the number of days the receivables are outstanding and the average age of inventory:
Age of receivables = 365/Accounts Receivable turnover
Average age of inventory = 365/Inventory Turnover
Lower is better for both of these ratios. The longer receivables are outstanding the higher the likelihood of uncollectability. The longer inventory remains unsold the greater its susceptibility for spoilage or obsolescence.
Keep in mind, the results of these ratios are industry specific. For instance, auto manufacturers will turn over their inventory slower than a grocery store. Compare a company’s ratio to its previous year’s ratios or to an industry average rather than comparing to a company’s ratios from another industry (this applies to any ratio, not just for liquidity).
A signal that a company is having liquidity problems is receivables and inventory growing faster than sales. To calculate the percentage increase or decrease in a financial statement number
% change = This year’s number – 1 x 100 Last year’s number
For example, last year’s net sales = $125,000 and this year’s net sales = $130,000:
%changeinsales=$130,000 -1 x100 =(1.04–1)x100=0.04×100=4%increase $125,000
If last year’s net sales = $125,000 and this year’s net sales = $120,000 (sales decreased):
% change in sales = $120,000 -1 x 100 = (0.96 – 1) x 100 = (0.04) x 100 = 4% decrease $125,000
Do this for net sales, accounts receivable, and inventory to determine if accounts receivables and inventories are growing faster than sales.
SEC10K Project Week 4 – Liquidity page 3
Required:
- Calculate the current ratio, quick ratio, accounts receivable and inventory turnover ratios, the age of receivables and inventory for this year and last year. Make a table for the results and indicate whether the changes are favorable or unfavorable. Since your current SEC 10K report may not have the beginning balances for inventory or accounts receivable to calculate averages for the previous year, you may substitute the ending balance for the average for the previous year only.
- Calculate the percentage change in sales, accounts receivable, and inventory from the previous to the current year. Are sales increasing faster than accounts receivable and inventory? Or are accounts receivable and inventory growing faster than sales? Make a table for the results (either the same table as above or in a separate table).
- Comment on the company’s liquidity, taking into account all of the ratios. For instance, is the current ratio increasing while the quick ratio is decreasing? Or are both increasing or both decreasing? Remember if current ratio is increasing and quick ratio is decreasing it could suggest the current ratio is of poor quality due to growing inventories. Are sales growing faster or slower than accounts receivable and inventory? Draw an overall conclusion and in a few sentences support your conclusion with the result of the analysis. If the results are mixed, it is okay to say so.
For all three parts, show your calculations either in the main table or in a separate exhibit.
SEC 10K Fixed Assets and Intangibles
Report the required ratios or dollar amounts for items 1, 2, and 3 in a table and answer the remainder of the questions in narrative form (single-space with section headings, extra space between sections).
- Report the dollar amount of PPE, net for the most recent and previous fiscal year. Calculate PP&E as a percentage of total assets for your company ($PPE/$Total Assets) for the most recent and previous fiscal year.
- Calculate the Asset Turnover Ratio (net sales divided by average total assets) for the most recent year and the previous year. What does the asset turnover ratio attempt to measure? (see our online text or search the internet for a proper interpretation of the asset turnover ratio). Interpret the ratio for your company and indicate whether it improved or declined.
- Has your company acquired or sold long-term assets during the past year? Indicate the amount of cash received or paid for transactions. Look over the footnotes to the financial statements or the investing section of the statement of cash flows to answer the question. Indicate where you found the information. See example for Shoe Carnival below.
- What depreciation method (or methods) does your company use? Where did you find this information?
- What intangibles assets does your company include in the balance sheet? What method of amortization does the company use for intangibles? (the straight-line method is typical, but not the only option). Are all of the reported intangibles amortized? If no, why not? What intangible assets might your company have that are not reported (e.g. trademarks, patents, copyrights)? Remember, accounting rules require immediate expensing of internally developed intangibles instead of capitalizing so many companies’ balance sheets do not report these sometimes very valuable assets.
As an example, Shoe Carnival’s Balance Sheet does not report a separate line item for intangibles and does not indicate that intangibles are included in ‘Other assets’ on the balance sheet, yet in an overview of the company’s business, management lists multiple trademarks (brand names) that the company owns and describes them as ‘valuable’.
The following text appeared in the Management Discussion and Analysis Section of Shoe Carnival’s annual report:
The SEC 10K Presentation
The purpose of this assignment is to provide experience in preparing a business presentation.
Post your presentation on the designated discussion thread during Week 6. Your presentation should contain the following:
An introduction with general information about the company on one slide (include your name)
A summary of each week’s analysis on one slide for each assignment: your assessment of credit risk, profitability, in-depth liquidity, fixed assets and intangibles
A conclusion slide
A slide with your list of references
Thus, seven slides total will be sufficient; but no more than ten slides if you want to expand on any of the above.
You can organize your presentation however you choose, but use bullet points and tables to convey your findings; copying and pasting large swathes of your paper into the slides is not a best practice for preparing a presentation. Select a professional-looking, not-too-busy design for the background. | https://academic-brains.com/2018/03/13/week-2-sec-10k-assignment%E2%80%A8the-balance-sheet-and-credit-risk-analysis/ |
Overview of depression: epidemiology and implications for community nursing practice.
Depressive disorders are among the most common psychological conditions currently affecting individuals living in the Westernized world. Yet, available data indicate that fewer than one third of adults with depression obtain appropriate professional treatment. This is attributed, among other reasons, to the under-recognition of the problem by health professionals, including district nurses. In order to improve recognition of the problem, it is imperative for nurses and especially those working in community settings, to appreciate the importance of prompt diagnosis which presumes both an understanding and knowledge of basic aspects of the problem and, an understanding of their role in dealing with depression. This overview presents epidemiological data and identifies the potential consequences of depression on daily functioning and other aspects of life among adults in Westernized countries, aiming to raise awareness and sensitize district nurses about the issue The article discusses how the role of district nurses can be enhanced to improve recognition rates.
| |
2 years ago in Daily GK Current Affairs
Who will head a high-level committee to resolve the stress in the thermal power sector?
Loading...
Overall Stats
Attempted 6
Correct 2
Incorrect 1
Viewed 3
Answers
Sayed badruzama - 2 years ago
Sayed badruzama from Mumbai, India is saying Cabinet Secretary is correct answer
kumud bala - 2 years ago
kumud bala from Noida, India is saying Prime Minister is correct answer
Nazia Sayed - 2 years ago
Nazia Sayed from Mumbai, India is saying Cabinet Secretary is correct answer
Related Questions
‘Nanosafe Solutions’, a startup of ________, has launched an antimicrobial and washable face mask that can be reused up to 50 launderings.
- [A] IIT-Bombay
- [B] IIT-Kanpur
- [C] IIT-Delhi
- [D] IIT-Kharagpur
- [E] IIT-Guwahati
Recently, the Reserve Bank of India (RBI) has set up a committee to look into the current state of mortgage securitisation in the country. Who will head this committee?
- [A] Harsh Vardhan
- [B] Dinbandhu Mohapatra
- [C] Pallav Mahapatra
- [D] B Sriram
- [E] Karnam Sekar
India’s factory production grew in January to ______.
- [A] 7.5%
- [B] 7.1%
- [C] 7.4%
- [D] 7%
- [E] 7.6%
Recently, a report was published on the 'Lancet Countdown 2018 on Health and Climate Change'. It was authored by people from 27 organisations including the ________ and ________.
- [A] UN, IMF
- [B] UNSECO, WTO
- [C] IUCN, World Food Programme
- [D] WHO, World Bank
- [E] None of these
EEPC (Engineering Export Promotion Council, Eastern Region)’s Gold Trophy for 2013-14 has been conferred upon which of the following ? | https://www.eduzip.com/question/30966 |
Kisumu County Government is now inviting players in the tourism industry to join hands to help revive the sector.
Deputy Governor Mathews Owili said the county government is cognizant of the massive negative impacts the sector has faced since the advent of Covid-19, a situation that has affected the lake region economy.
Speaking after the UN World Tourism Day, Owili pointed out that with the economy slowly reopening, it was time to have sector players back on the table.
The World Tourism Day celebrated on September 27, is the day for fostering awareness of the social, cultural, political and economic value of tourism while scrutinizing the contribution that the sector would make towards reaching the Sustainable Development Goals.
KEEP READING
KQ brands planes with wildlife images to support tourism
Balala: Aged Kenyans to visit Nairobi National park for free
Sh3.5b EU grant to promote blue economy, tourism at the Coast
This year, the event was hosted at Ndere Island Park in Seme, Kisumu County.
“As a County Government, we are committed to promoting tourism in the West Kenya Circuit, which has not lived to its expectations in the past. Kisumu stakeholders in the tourism industry can collaborate with regional governments in contributing their expertise and perspective to a tourism-related initiative,” said Owili.
Owili asked the stakeholders to take advantage of the rich networks provided by the county’s Tourism leadership, saying the Western Kenya circuit had the potential to compete with other circuits such as the coast.
“We have many tourisms attraction sites. The Kisumu International Airport now plays host to many Airlines, an indication that many people have discovered this beautiful lakeside town.
Owili noted that the Covid-19 pandemic had had a massive social and economic impact on the tourism industry, with both developed and developing economies hit.
Safaricom Limited, one of the strategic partners that graced the occasion, pledged to invest in network connectivity and data access in a bid to boost the tourism sector.
“In our quest to become a purpose-led technology company, we made a heavy presence by providing the bandwidth for the live stream during the panel interview at the site of the celebrations,” said Alice Otieno, Regional Operations and Area Sales Manager.
RELATED VIDEOS
Hope for Tourism sector with number of local tourists increasing as the country heads to Easter
Shot In The Arm: Kisumu County set to roll out Covid-19 vaccination exercise
New Look Kisumu: Personal cars banned from parking along Oginga Odinga street, order given by county
Pastoralists lose livestock as drought ravages Tana DeltaThe drought has intensified conflicts between farmers and pastoralists.
Overcoming adversity: Girl working as security guard to raise varsity feesSarah Anyango, an orphan, needs Sh28,500 to join university. She doesn't have the money. | https://www.standardmedia.co.ke/nyanza/article/2001424898/kisumu-county-calls-for-collaboration-to-revive-tourism-sector |
BY TAMAR KEVONIAN
The start of any new venture requires lots of hard work, attention to detail, determination and, most of all, research. This is exactly what Alex has been going through in preparation to opening his restaurant next month in Beverly Hills. Based on the cuisine of the Levant which is made up of countries bordering the eastern Mediterranean Sea, he plans to make his menu a modern interpretation of well known flavors and textures.
“Nothing like this exists in the area,” he says referring not just to the combination of the cuisines, but also of the restaurant concept itself – modern and chic yet casual, partway between a sit down restaurant and a fast food joint.
After a year of preparation, it was time for hands on research to fine tune the final items for his menu. Alex planned a whirlwind trip to the countries whose cuisines he and his chef, Matt would rely on heavily: Lebanon, Turkey and Greece.
“I was looking forward to Beirut because I’d heard so much about it being the Paris of the Middle East,” he says. “It ain’t no Paris,” he says with a disappointed shake of his head. The ravages of war over the last 30 years have left their indelible mark on the city even though its pre-war reputation still lives on. “I ended up liking parts of the city I didn’t expect to like, for example Bourj Hammoud,” he says referring to the neighborhood well known for its purely Armenian population.
“We arrived into Beirut very late at night,” he begins, “and immediately were taken to a late night shawerma place.” He was surprised by the late night crowds but he was mostly surprised by the portions of the sandwiches that house the chips of meat, tomatoes and sauce. “They didn’t serve the 3” rolled sandwiches like they do here. The portions were manageable.”
After he his brief two day visit where every meal was eaten in the name of research, Alex and Chef Matt made their way to Istanbul.
“It felt strange going there,” Alex says referring to the feelings of trepidation most Armenians feel when visiting Turkey, the land where so many of our ancestors experienced horrors beyond normal imagination. Even though Alex and his family hail from Iran, the feelings are deeply entrenched in the psyche of all Armenians. “I didn’t know what to expect.”
“I don’t get excited about things,” he says, “it’s just my personality. But I was very excited in Istanbul.” The structure of the city, the sophistication of its population, the kindness and generosity of the people really amazed Alex. “They were so nice and went out of their way to be helpful.” At first he thought it was because of his Armenian heritage that those he met were so accommodating. “Like they were trying to overcompensate because I was Armenian,” but soon discovered that this was not the case.
Through an old high school friend from his boarding school days in London, Alex was referred to a well known Turkish food critic who quickly sent him a list of recommended restaurants. First stop was one of the best seafood restaurants in the city. When the chef/owner discovered the purpose of their trip, he quickly invited the two visiting Americans into the kitchen and prepared a special meal. “Fish testicles,” he says. “They were absolutely delicious but who knew fish had testicles?”
“He was so excited,” Alex says of the Turkish host, “he kept telling me how his best friend was Armenian and lived in the States and next thing I know he’s calling his friend and making me talk to him.” The absurdity of the situation did not go unnoticed. “In truth, it was the best seafood we’d had.”
The next night found Chef Matt and Alex in a more traditional, but equally renowned restaurant. At the other end of the room, a group of Japanese businessmen flanked a large, rotund Turkish man who was clearly the owner of the establishment. “He had a large handlebar mustache,” he says with a chuckle and twirls an imaginary on himself. Images of Ottoman pashas quickly jump to mind. “I’d never seen one before.”
“The food was good but what was more interesting was the conversation I overheard.” It seems the mustachioed owner had a large and bellowing voice and was using it to explain Turkish cuisine to his Japanese visitors. “I heard him explain how Turkish cuisine is based on Armenian cuisine since it really came into being because of all the Armenians who were taken in to work in the kitchens of Turkish households after the Genocide.” Alex pauses to allow time for the impact of the words to sink in: an admission by a Turkish restaurateur of the true origins of the national cuisine. “What really shocked me though was hearing a Turk use the ‘G’ word,” he says, still surprised at the memory after so many months of hearing it. “I remember having heated discussions with my Turkish friends in high school who simply didn’t believe the Genocide had occurred. They had never been taught any of it.”
From Turkey, Alex and Chef Matt made their way to Greece. “We had the best meal and the worst meal in Athens,” he says describing the delicately seasoned potatoes they were served in one restaurant and the absolutely bland fare of the other.
Unfortunately they didn’t have time for further exploration but Alex wishes they did just so they could have visited the country sides of all the cities on their itinerary. That’s were he believes he would find the essence of the regions cuisines; eating the everyday meals of the regular villagers. But that will have to wait until the next round. “I may not go to Beirut or Athens again, but I’ll definitely go back to Istanbul,” he says clearly impressed with the multiple layers of the city of which he saw only brief glimpses; and possibly exploring more deeply the parts of the country more closely related to his heritage and discovering the true roots of their cuisine. | http://asbarez.com/78960/the-restaurateur/ |
This week is a packed post! We will be sewing up the ties, creating the front drape and sewing the shoulder and side seams. So let’s just jump right in!!
Begin by sewing the ties. Remember, all seam allowances are 3/8”. Fold the ties in half lengthwise and sew the seam. Do not sew across the end of the tie at this point.
Fold the tie so that the seam is in the middle and the seam allowance is facing to one side. Do not open up the seam allowance.
Now, stitch across the end of the tie.
Turn the tie to the right side and press. The seam will be in the middle of the tie. I like sewing ties in this manner rather than having the seam on the edge as I feel they lay much nicer and have a cleaner finish.
Now for the front drape. Begin with the right front piece. There is a notch where you see my thumb in the picture below.
From that notch point, sew in 2 rows of gathering stitches. My first row of stitches is 1/8” from the edge and my second row is 3/8” from the edge.
Set this piece aside for the moment and take out the main front pattern piece.
There are 2 notches along the curved side of this pattern piece. My finger is pointing to 1 and my pin is pointing to the other. Sew in 2 rows of gathering stitches from 1 notch to the other.
Now the fun begins! Sew the upper pattern piece to the main pattern piece. Sew from the shoulder to the notch ending at the edge of the main front pattern piece. It may look a little strange at this point, but it will ultimately make sense.
Now that the seam has been sewn, take note that there is a small space where there are no gathering stitches. All of the gathering stitches to the right of that section will be gathered into the small space between the seam and the beginning of the gathering stitches. Fold at the notch with right sides together and then pull the gathering stitches until they fit into that area.
The gathering stitches on the upper front piece will be gathered and will match to the area from my pen to the side seam.
In the picture below, all stitches have been gathered. You can see the small area with no gathering stitches and the gathering stitches from the front upper piece.
Before sewing the seam, the small tie will need to be inserted. It should match perfectly to the small un-gathered area. Be sure that when the tie is inserted that the seam will be facing the garment.
Sew from 1 end to the other. I finished this seam with my serger.
Now for the shoulder seam. The right shoulder seam has a “v” section.
Fold at this point. This will form the drape at the shoulder.
In the picture below, you can see my hand inside the front drape.
The tie will help to hold the drape in place.
There are 2 notches along the front right side seam.
Baste the long tie between the 2 notches. Be sure that the seam of the tie is facing up.
Sew the side seams and the shoulder seams. If you would like, the side seams and shoulder seams can be sewn with a French seam just as we did with the center back seam in last week’s post.
My dress is together!
The long tie wraps around the back of the top or dress in this case, and then ties to the shorter tie that was attached in the gathered drape area. It forms a beautiful front drape.
Sewing in the front gathers for the drape can be a little daunting, but once you have figured it out, I think you will feel that it was well worth the effort.
Take a look at the video portion, which will help with gathering, notches and other areas of the blouse.
Next week we will talk about binding finishes and the facings. We will also have a special post dedicated to adding a sleeve to this garment.
In the meantime, check out the Flickr page. It’s a great place to post pictures and ask questions. And, you can pick up a copy of Sew News at shopsewitall.com for more information on our Hot Pattern Sew-Along.
Until next week! | http://www.sewnews.com/blogs/sewing/2014/07/07/summer-breeze-sew-along-week-3-ties-pleats-gathering-notches/ |
I made this quick and simple dust mitt using the loop stitch and it is useful for many projects including toy sheep, hats, scarves etc. the possibilities are endless.
If you don't know how do the loop stitch see my video tutorial here:
Pattern for the dust mitt:
I used double knit and it used around 40g
4mm crochet hook
I use English crochet terms.
Begin by making 52 chain
1st row: double crochet in 2nd chain from hook then one double crochet in each chain to end. (50 sts)
2nd row 2 ch (counts as first dc) one double crochet in next 14 stitches . One loop stitch in each of next 20 stitches. One double crochet in each of next 15 stitches (50 sts)
Repeat rows 1 and 2, 20 times or until the mitt is the correct length for your hand measured from the first chain row. It doesn't have to be exact, same with the width - if you have larger hands simple increase the number of stitches each side.
Once you are happy with the length work the next row as decrease:
2 chain (counts as first stitch); 1 double crochet; **double crochet next two stitches together; one double crochet in next two stitches;** repeat from ** to ** to end.
Next row: Double crochet two stitches together, repeat to end.
Fasten off.
You should now have a piece that looks like this with a centre loopy section and plain each side.
The wrong side will look like this:
Now join the two shortest sides together by folding in half and either crocheting or stitching the seam.
Next flatten it out so the loopy section is central with the plain sections at the back and the seam in the centre.
You are going to turn it inside out now and sew the top together. The decreased end will be the cuff. | https://www.pookiedoodlecrafts.co.uk/2016/01/crochet-loop-stitch-dust-mitt-pattern.html |
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Immunoenzyme Techniques
RNA, Messenger
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Reverse Transcriptase Polymerase Chain Reaction
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Tumor Markers, Biological
Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.
In Situ Hybridization
Blotting, Western
Tissue Array Analysis
The simultaneous analysis of multiple samples of TISSUES or CELLS from BIOPSY or in vitro culture that have been arranged in an array format on slides or microchips.
Prognosis
Gene Expression Regulation, Neoplastic
Ki-67 Antigen
A CELL CYCLE and tumor growth marker which can be readily detected using IMMUNOCYTOCHEMISTRY methods. Ki-67 is a nuclear antigen present only in the nuclei of cycling cells.
Disease Models, Animal
Rats, Sprague-Dawley
Gene Expression
Up-Regulation
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Cell Line, Tumor
A cell line derived from cultured tumor cells.
Neoplasm Proteins
Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.
Fluorescent Antibody Technique, Indirect
A form of fluorescent antibody technique commonly used to detect serum antibodies and immune complexes in tissues and microorganisms in specimens from patients with infectious diseases. The technique involves formation of an antigen-antibody complex which is labeled with fluorescein-conjugated anti-immunoglobulin antibody. (From Bennington, Saunders Dictionary & Encyclopedia of Laboratory Medicine and Technology, 1984)
Biopsy
Breast Neoplasms
Tumors or cancer of the human BREAST.
Cell Proliferation
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
Paraffin Embedding
Apoptosis
One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.
In Situ Hybridization, Fluorescence
A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.
Polymerase Chain Reaction
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Rats, Wistar
Neoplasm Staging
Receptor, erbB-2
A cell surface protein-tyrosine kinase receptor that is overexpressed in a variety of ADENOCARCINOMAS. It has extensive homology to and heterodimerizes with the EGF RECEPTOR, the ERBB-3 RECEPTOR, and the ERBB-4 RECEPTOR. Activation of the erbB-2 receptor occurs through heterodimer formation with a ligand-bound erbB receptor family member.
Neoplasm Invasiveness
Ability of neoplasms to infiltrate and actively destroy surrounding tissue.
Cells, Cultured
Gene Expression Profiling
Carcinoma, Squamous Cell
A carcinoma derived from stratified SQUAMOUS EPITHELIAL CELLS. It may also occur in sites where glandular or columnar epithelium is normally present. (From Stedman, 25th ed)
Disease Progression
The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.
Tissue Distribution
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
Tissue Fixation
The technique of using FIXATIVES in the preparation of cytologic, histologic, or pathologic specimens for the purpose of maintaining the existing form and structure of all the constituent elements.
In Situ Nick-End Labeling
An in situ method for detecting areas of DNA which are nicked during APOPTOSIS. Terminal deoxynucleotidyl transferase is used to add labeled dUTP, in a template-independent manner, to the 3 prime OH ends of either single- or double-stranded DNA. The terminal deoxynucleotidyl transferase nick end labeling, or TUNEL, assay labels apoptosis on a single-cell level, making it more sensitive than agarose gel electrophoresis for analysis of DNA FRAGMENTATION.
Carcinoma
A malignant neoplasm made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. It is a histological type of neoplasm but is often wrongly used as a synonym for "cancer." (From Dorland, 27th ed)
Gene Expression Regulation
Real-Time Polymerase Chain Reaction
Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.
Tumor Suppressor Protein p53
Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.
Proliferating Cell Nuclear Antigen
Nuclear antigen with a role in DNA synthesis, DNA repair, and cell cycle progression. PCNA is required for the coordinated synthesis of both leading and lagging strands at the replication fork during DNA replication. PCNA expression correlates with the proliferation activity of several malignant and non-malignant cell types.
Epithelial Cells
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
Lymphatic Metastasis
Transfer of a neoplasm from its primary site to lymph nodes or to distant parts of the body by way of the lymphatic system.
Biological Markers
Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.
Staining and Labeling
Vascular Endothelial Growth Factor A
The original member of the family of endothelial cell growth factors referred to as VASCULAR ENDOTHELIAL GROWTH FACTORS. Vascular endothelial growth factor-A was originally isolated from tumor cells and referred to as "tumor angiogenesis factor" and "vascular permeability factor". Although expressed at high levels in certain tumor-derived cells it is produced by a wide variety of cell types. In addition to stimulating vascular growth and vascular permeability it may play a role in stimulating VASODILATION via NITRIC OXIDE-dependent pathways. Alternative splicing of the mRNA for vascular endothelial growth factor A results in several isoforms of the protein being produced.
Keratins
A class of fibrous proteins or scleroproteins that represents the principal constituent of EPIDERMIS; HAIR; NAILS; horny tissues, and the organic matrix of tooth ENAMEL. Two major conformational groups have been characterized, alpha-keratin, whose peptide backbone forms a coiled-coil alpha helical structure consisting of TYPE I KERATIN and a TYPE II KERATIN, and beta-keratin, whose backbone forms a zigzag or pleated sheet structure. alpha-Keratins have been classified into at least 20 subtypes. In addition multiple isoforms of subtypes have been found which may be due to GENE DUPLICATION.
Lung Neoplasms
Tumors or cancer of the LUNG.
Enzyme-Linked Immunosorbent Assay
An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.
Brain
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
Colorectal Neoplasms
Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.
Receptors, Progesterone
Specific proteins found in or on cells of progesterone target tissues that specifically combine with progesterone. The cytosol progesterone-receptor complex then associates with the nucleic acids to initiate protein synthesis. There are two kinds of progesterone receptors, A and B. Both are induced by estrogen and have short half-lives.
Stomach Neoplasms
Tumors or cancer of the STOMACH.
Signal Transduction
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Carcinoma, Ductal, Breast
Neovascularization, Pathologic
A pathologic process consisting of the proliferation of blood vessels in abnormal tissues or in abnormal positions.
Oligonucleotide Array Sequence Analysis
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Epithelium
One or more layers of EPITHELIAL CELLS, supported by the basal lamina, which covers the inner or outer surfaces of the body.
Fluorescent Antibody Technique
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
Down-Regulation
A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Antigens, Differentiation, Myelomonocytic
Cell Count
Membrane Proteins
Receptors, Estrogen
Cell Differentiation
Glial Fibrillary Acidic Protein
Antigens, CD
Differentiation antigens residing on mammalian leukocytes. CD stands for cluster of differentiation, which refers to groups of monoclonal antibodies that show similar reactivity with certain subpopulations of antigens of a particular lineage or differentiation stage. The subpopulations of antigens are also known by the same CD designation.
Endometrium
The mucous membrane lining of the uterine cavity that is hormonally responsive during the MENSTRUAL CYCLE and PREGNANCY. The endometrium undergoes cyclic changes that characterize MENSTRUATION. After successful FERTILIZATION, it serves to sustain the developing embryo.
S100 Proteins
A family of highly acidic calcium-binding proteins found in large concentration in the brain and believed to be glial in origin. They are also found in other organs in the body. They have in common the EF-hand motif (EF HAND MOTIFS) found on a number of calcium binding proteins. The name of this family derives from the property of being soluble in a 100% saturated ammonium sulfate solution.
Kidney
Intestinal Mucosa
Lining of the INTESTINES, consisting of an inner EPITHELIUM, a middle LAMINA PROPRIA, and an outer MUSCULARIS MUCOSAE. In the SMALL INTESTINE, the mucosa is characterized by a series of folds and abundance of absorptive cells (ENTEROCYTES) with MICROVILLI.
Neurons
Lung
Microscopy, Confocal
Immunoblotting
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
Kaplan-Meier Estimate
A nonparametric method of compiling LIFE TABLES or survival tables. It combines calculated probabilities of survival and estimates to allow for observations occurring beyond a measurement threshold, which are assumed to occur randomly. Time intervals are defined as ending each time an event occurs and are therefore unequal. (From Last, A Dictionary of Epidemiology, 1995)
Skin
The outer covering of the body that protects it from the environment. It is composed of the DERMIS and the EPIDERMIS.
Macrophages
The relatively long-lived phagocytic cell of mammalian tissues that are derived from blood MONOCYTES. Main types are PERITONEAL MACROPHAGES; ALVEOLAR MACROPHAGES; HISTIOCYTES; KUPFFER CELLS of the liver; and OSTEOCLASTS. They may further differentiate within chronic inflammatory lesions to EPITHELIOID CELLS or may fuse to form FOREIGN BODY GIANT CELLS or LANGHANS GIANT CELLS. (from The Dictionary of Cell Biology, Lackie and Dow, 3rd ed.)
Retina
The ten-layered nervous tissue membrane of the eye. It is continuous with the OPTIC NERVE and receives images of external objects and transmits visual impulses to the brain. Its outer surface is in contact with the CHOROID and the inner surface with the VITREOUS BODY. The outer-most layer is pigmented, whereas the inner nine layers are transparent.
Flow Cytometry
Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.
Genes, erbB-2
The erbB-2 gene is a proto-oncogene that codes for the erbB-2 receptor (RECEPTOR, ERBB-2), a protein with structural features similar to the epidermal growth factor receptor. Its name originates from the viral oncogene homolog (v-erbB) which is a truncated form of the chicken erbB gene found in the avian erythroblastosis virus. Overexpression and amplification of the gene is associated with a significant number of adenocarcinomas. The human c-erbB-2 gene is located at 17q21.2.
Colon
Pregnancy
Survival Analysis
A class of statistical procedures for estimating the survival function (function of time, starting with a population 100% well at a given time and providing the percentage of the population still well at later times). The survival analysis is then used for making inferences about the effects of treatments, prognostic factors, exposures, and other covariates on the function.
Synovial Membrane
The inner membrane of a joint capsule surrounding a freely movable joint. It is loosely attached to the external fibrous capsule and secretes SYNOVIAL FLUID.
Skin Neoplasms
Tumors or cancer of the SKIN.
Mice, Knockout
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
Vimentin
An intermediate filament protein found in most differentiating cells, in cells grown in tissue culture, and in certain fully differentiated cells. Its insolubility suggests that it serves a structural function in the cytoplasm. MW 52,000.
Mice, Nude
Cell Movement
The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.
Gene Amplification
A selective increase in the number of copies of a gene coding for a specific protein without a proportional increase in other genes. It occurs naturally via the excision of a copy of the repeating sequence from the chromosome and its extrachromosomal replication in a plasmid, or via the production of an RNA transcript of the entire repeating sequence of ribosomal RNA followed by the reverse transcription of the molecule to produce an additional copy of the original DNA sequence. Laboratory techniques have been introduced for inducing disproportional replication by unequal crossing over, uptake of DNA from lysed cells, or generation of extrachromosomal sequences from rolling circle replication.
Hematoxylin
A dye obtained from the heartwood of logwood (Haematoxylon campechianum Linn., Leguminosae) used as a stain in microscopy and in the manufacture of ink.
Dog Diseases
Diseases of the domestic dog (Canis familiaris). This term does not include diseases of wild dogs, WOLVES; FOXES; and other Canidae for which the heading CARNIVORA is used.
Liver Neoplasms
Tumors or cancer of the LIVER.
Cell Division
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
Cyclooxygenase 2
An inducibly-expressed subtype of prostaglandin-endoperoxide synthase. It plays an important role in many cellular processes and INFLAMMATION. It is the target of COX2 INHIBITORS.
Histocytochemistry
Study of intracellular distribution of chemicals, reaction sites, enzymes, etc., by means of staining reactions, radioactive isotope uptake, selective metal distribution in electron microscopy, or other methods.
Antigens, Neoplasm
Proteins, glycoprotein, or lipoprotein moieties on surfaces of tumor cells that are usually identified by monoclonal antibodies. Many of these are of either embryonic or viral origin.
Ovarian Neoplasms
Tumors or cancer of the OVARY. These neoplasms can be benign or malignant. They are classified according to the tissue of origin, such as the surface EPITHELIUM, the stromal endocrine cells, and the totipotent GERM CELLS.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
S100 Calcium Binding Protein G
A calbindin protein found in many mammalian tissues, including the UTERUS, PLACENTA, BONE, PITUITARY GLAND, and KIDNEYS. In intestinal ENTEROCYTES it mediates intracellular calcium transport from apical to basolateral membranes via calcium binding at two EF-HAND MOTIFS. Expression is regulated in some tissues by VITAMIN D.
Lymph Nodes
Mice, Transgenic
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
Matrix Metalloproteinase 9
An endopeptidase that is structurally similar to MATRIX METALLOPROTEINASE 2. It degrades GELATIN types I and V; COLLAGEN TYPE IV; and COLLAGEN TYPE V.
Mutation
Neoplasm Grading
Methods which attempt to express in replicable terms the level of CELL DIFFERENTIATION in neoplasms as increasing ANAPLASIA correlates with the aggressiveness of the neoplasm.
Pancreatic Neoplasms
Tumors or cancer of the PANCREAS. Depending on the types of ISLET CELLS present in the tumors, various hormones can be secreted: GLUCAGON from PANCREATIC ALPHA CELLS; INSULIN from PANCREATIC BETA CELLS; and SOMATOSTATIN from the SOMATOSTATIN-SECRETING CELLS. Most are malignant except the insulin-producing tumors (INSULINOMA).
Receptor, Epidermal Growth Factor
A cell surface receptor involved in regulation of cell growth and differentiation. It is specific for EPIDERMAL GROWTH FACTOR and EGF-related peptides including TRANSFORMING GROWTH FACTOR ALPHA; AMPHIREGULIN; and HEPARIN-BINDING EGF-LIKE GROWTH FACTOR. The binding of ligand to the receptor causes activation of its intrinsic tyrosine kinase activity and rapid internalization of the receptor-ligand complex into the cell.
Hyperplasia
Tumor Cells, Cultured
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
Nuclear Proteins
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Predictive Value of Tests
In screening and diagnostic tests, the probability that a person with a positive test is a true positive (i.e., has the disease), is referred to as the predictive value of a positive test; whereas, the predictive value of a negative test is the probability that the person with a negative test does not have the disease. Predictive value is related to the sensitivity and specificity of the test.
Calbindin 2
A calbindin protein that is differentially expressed in distinct populations of NEURONS throughout the vertebrate and invertebrate NERVOUS SYSTEM, and modulates intrinsic neuronal excitability and influences LONG-TERM POTENTIATION. It is also found in LUNG, TESTIS, OVARY, KIDNEY, and BREAST, and is expressed in many tumor types found in these tissues. It is often used as an immunohistochemical marker for MESOTHELIOMA.
Precancerous Conditions
Phenotype
Neoplasm Metastasis
DNA Primers
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Microscopy, Electron
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Base Sequence
Sensitivity and Specificity
Proto-Oncogene Proteins c-bcl-2
Membrane proteins encoded by the BCL-2 GENES and serving as potent inhibitors of cell death by APOPTOSIS. The proteins are found on mitochondrial, microsomal, and NUCLEAR MEMBRANE sites within many cell types. Overexpression of bcl-2 proteins, due to a translocation of the gene, is associated with follicular lymphoma.
Testis
The male gonad containing two functional parts: the SEMINIFEROUS TUBULES for the production and transport of male germ cells (SPERMATOGENESIS) and the interstitial compartment containing LEYDIG CELLS that produce ANDROGENS.
Blotting, Northern
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Antibodies
Immunoglobulin molecules having a specific amino acid sequence by virtue of which they interact only with the ANTIGEN (or a very similar shape) that induced their synthesis in cells of the lymphoid series (especially PLASMA CELLS).
Survival Rate
Fixatives
Agents employed in the preparation of histologic or pathologic specimens for the purpose of maintaining the existing form and structure of all of the constituent elements. Great numbers of different agents are used; some are also decalcifying and hardening agents. They must quickly kill and coagulate living tissue.
Carrier Proteins
Transport proteins that carry specific substances in the blood or across cell membranes.
Endometrial Neoplasms
Tumors or cancer of ENDOMETRIUM, the mucous lining of the UTERUS. These neoplasms can be benign or malignant. Their classification and grading are based on the various cell types and the percent of undifferentiated cells.
Antigens, CD31
Cell adhesion molecules present on virtually all monocytes, platelets, and granulocytes. CD31 is highly expressed on endothelial cells and concentrated at the junctions between them.
Prostatic Neoplasms
Tumors or cancer of the PROSTATE.
DNA-Binding Proteins
Disease-Free Survival
Transcription Factors
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
Retrospective Studies
Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.
Melanoma
A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445)
Esophageal Neoplasms
Tumors or cancer of the ESOPHAGUS.
Proto-Oncogene Proteins
Stromal Cells
Connective tissue cells of an organ found in the loose connective tissue. These are most often associated with the uterine mucosa and the ovary as well as the hematopoietic system and elsewhere.
Proto-Oncogene Proteins c-kit
A protein-tyrosine kinase receptor that is specific for STEM CELL FACTOR. This interaction is crucial for the development of hematopoietic, gonadal, and pigment stem cells. Genetic mutations that disrupt the expression of PROTO-ONCOGENE PROTEINS C-KIT are associated with PIEBALDISM, while overexpression or constitutive activation of the c-kit protein-tyrosine kinase is associated with tumorigenesis.
Gastric Mucosa
Lining of the STOMACH, consisting of an inner EPITHELIUM, a middle LAMINA PROPRIA, and an outer MUSCULARIS MUCOSAE. The surface cells produce MUCUS that protects the stomach from attack by digestive acid and enzymes. When the epithelium invaginates into the LAMINA PROPRIA at various region of the stomach (CARDIA; GASTRIC FUNDUS; and PYLORUS), different tubular gastric glands are formed. These glands consist of cells that secrete mucus, enzymes, HYDROCHLORIC ACID, or hormones.
Matrix Metalloproteinase 2
Cadherins
Calcium-dependent cell adhesion proteins. They are important in the formation of ADHERENS JUNCTIONS between cells. Cadherins are classified by their distinct immunological and tissue specificities, either by letters (E- for epithelial, N- for neural, and P- for placental cadherins) or by numbers (cadherin-12 or N-cadherin 2 for brain-cadherin). Cadherins promote cell adhesion via a homophilic mechanism as in the construction of tissues and of the whole animal body.
Liver
Rabbits
Models, Animal
Keratin-7
Fetus
The unborn young of a viviparous mammal, in the postembryonic period, after the major structures have been outlined. In humans, the unborn young from the end of the eighth week after CONCEPTION until BIRTH, as distinguished from the earlier EMBRYO, MAMMALIAN.
Microscopy, Immunoelectron
Microscopy in which the samples are first stained immunocytochemically and then examined using an electron microscope. Immunoelectron microscopy is used extensively in diagnostic virology as part of very sensitive immunoassays.
Carcinoma, Hepatocellular
A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.
Proto-Oncogene Proteins c-fos
Cellular DNA-binding proteins encoded by the c-fos genes (GENES, FOS). They are involved in growth-related transcriptional control. c-fos combines with c-jun (PROTO-ONCOGENE PROTEINS C-JUN) to form a c-fos/c-jun heterodimer (TRANSCRIPTION FACTOR AP-1) that binds to the TRE (TPA-responsive element) in promoters of certain genes.
Isoenzymes
Transforming Growth Factor beta
A factor synthesized in a wide variety of tissues. It acts synergistically with TGF-alpha in inducing phenotypic transformation and can also act as a negative autocrine growth factor. TGF-beta has a potential role in embryonal development, cellular differentiation, hormone secretion, and immune function. TGF-beta is found mostly as homodimer forms of separate gene products TGF-beta1, TGF-beta2 or TGF-beta3. Heterodimers composed of TGF-beta1 and 2 (TGF-beta1.2) or of TGF-beta2 and 3 (TGF-beta2.3) have been isolated. The TGF-beta proteins are synthesized as precursor proteins.
Eosine Yellowish-(YS)
A versatile red dye used in cosmetics, pharmaceuticals, textiles, etc., and as tissue stain, vital stain, and counterstain with HEMATOXYLIN. It is also used in special culture media.
Brain Neoplasms
Neoplasms of the intracranial components of the central nervous system, including the cerebral hemispheres, basal ganglia, hypothalamus, thalamus, brain stem, and cerebellum. Brain neoplasms are subdivided into primary (originating from brain tissue) and secondary (i.e., metastatic) forms. Primary neoplasms are subdivided into benign and malignant forms. In general, brain tumors may also be classified by age of onset, histologic type, or presenting location in the brain.
Protein Isoforms
Microscopy, Electron, Transmission
Electron microscopy in which the ELECTRONS or their reaction products that pass down through the specimen are imaged below the plane of the specimen.
Tumor Suppressor Proteins
Proteins that are normally involved in holding cellular growth in check. Deficiencies or abnormalities in these proteins may lead to unregulated cell growth and tumor development.
Placenta
A highly vascularized mammalian fetal-maternal organ and major site of transport of oxygen, nutrients, and fetal waste products. It includes a fetal portion (CHORIONIC VILLI) derived from TROPHOBLASTS and a maternal portion (DECIDUA) derived from the uterine ENDOMETRIUM. The placenta produces an array of steroid, protein and peptide hormones (PLACENTAL HORMONES).
Cell Nucleus
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Neuroglia
The non-neuronal cells of the nervous system. They not only provide physical support, but also respond to injury, regulate the ionic and chemical composition of the extracellular milieu, participate in the BLOOD-BRAIN BARRIER and BLOOD-RETINAL BARRIER, form the myelin insulation of nervous pathways, guide neuronal migration during development, and exchange metabolites with neurons. Neuroglia have high-affinity transmitter uptake systems, voltage-dependent and transmitter-gated ion channels, and can release transmitters, but their role in signaling (as in many other functions) is unclear.
Formaldehyde
A highly reactive aldehyde gas formed by oxidation or incomplete combustion of hydrocarbons. In solution, it has a wide range of uses: in the manufacture of resins and textiles, as a disinfectant, and as a laboratory fixative or preservative. Formaldehyde solution (formalin) is considered a hazardous compound, and its vapor toxic. (From Reynolds, Martindale The Extra Pharmacopoeia, 30th ed, p717)
beta Catenin
A multi-functional catenin that participates in CELL ADHESION and nuclear signaling. Beta catenin binds CADHERINS and helps link their cytoplasmic tails to the ACTIN in the CYTOSKELETON via ALPHA CATENIN. It also serves as a transcriptional co-activator and downstream component of WNT PROTEIN-mediated SIGNAL TRANSDUCTION PATHWAYS.
Case-Control Studies
Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.
Endothelium, Vascular
Fibrosis
Any pathological condition where fibrous connective tissue invades any organ, usually as a consequence of inflammation or other injury.
Inflammation
Intercellular Signaling Peptides and Proteins
Regulatory proteins and peptides that are signaling molecules involved in the process of PARACRINE COMMUNICATION. They are generally considered factors that are expressed by one cell and are responded to by receptors on another nearby cell. They are distinguished from HORMONES in that their actions are local rather than distal.
Extracellular Matrix Proteins
Macromolecular organic compounds that contain carbon, hydrogen, oxygen, nitrogen, and usually, sulfur. These macromolecules (proteins) form an intricate meshwork in which cells are embedded to construct tissues. Variations in the relative types of macromolecules and their organization determine the type of extracellular matrix, each adapted to the functional requirements of the tissue. The two main classes of macromolecules that form the extracellular matrix are: glycosaminoglycans, usually linked to proteins (proteoglycans), and fibrous proteins (e.g., COLLAGEN; ELASTIN; FIBRONECTINS; and LAMININ).
Cystadenocarcinoma, Serous
A malignant cystic or semicystic neoplasm. It often occurs in the ovary and usually bilaterally. The external surface is usually covered with papillary excrescences. Microscopically, the papillary patterns are predominantly epithelial overgrowths with differentiated and undifferentiated papillary serous cystadenocarcinoma cells. Psammoma bodies may be present. The tumor generally adheres to surrounding structures and produces ascites. (From Hughes, Obstetric-Gynecologic Terminology, 1972, p185)
RNA, Small Interfering
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Antineoplastic Agents
Substances that inhibit or prevent the proliferation of NEOPLASMS.
Fibroblasts
Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.
Gene Expression Regulation, Enzymologic
Conjunctiva
The mucous membrane that covers the posterior surface of the eyelids and the anterior pericorneal surface of the eyeball.
Cell Adhesion Molecules
Surface ligands, usually glycoproteins, that mediate cell-to-cell adhesion. Their functions include the assembly and interconnection of various vertebrate systems, as well as maintenance of tissue integration, wound healing, morphogenic movements, cellular migrations, and metastasis.
Microscopy, Fluorescence
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
Prostate
A gland in males that surrounds the neck of the URINARY BLADDER and the URETHRA. It secretes a substance that liquefies coagulated semen. It is situated in the pelvic cavity behind the lower part of the PUBIC SYMPHYSIS, above the deep layer of the triangular ligament, and rests upon the RECTUM.
Nitric Oxide Synthase Type II
A CALCIUM-independent subtype of nitric oxide synthase that may play a role in immune function. It is an inducible enzyme whose expression is transcriptionally regulated by a variety of CYTOKINES.
Gene Expression Regulation, Developmental
Antibody Specificity
The property of antibodies which enables them to react with some ANTIGENIC DETERMINANTS and not with others. Specificity is dependent on chemical composition, physical forces, and molecular structure at the binding site.
Treatment Outcome
Dogs
Calbindins
Calcium-binding proteins that are found in DISTAL KIDNEY TUBULES, INTESTINES, BRAIN, and other tissues where they bind, buffer and transport cytoplasmic calcium. Calbindins possess a variable number of EF-HAND MOTIFS which contain calcium-binding sites. Some isoforms are regulated by VITAMIN D.
Cytokines
Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.
Kidney Neoplasms
Tumors or cancers of the KIDNEY.
Swine
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
Level of retinoblastoma protein expression correlates with p16 (MTS-1/INK4A/CDKN2) status in bladder cancer. (1/66693)Recent studies have shown that patients whose bladder cancer exhibit overexpression of RB protein as measured by immunohistochemical analysis do equally poorly as those with loss of RB function. We hypothesized that loss of p16 protein function could be related to RB overexpression, since p16 can induce transcriptional downregulation of RB and its loss may lead to aberrant RB regulation. Conversely, loss of RB function has been associated with high p16 protein expression in several other tumor types. In the present study RB negative bladder tumors also exhibited strong nuclear p16 staining while each tumor with strong, homogeneous RB nuclear staining were p16 negative, supporting our hypothesis. To expand on these immunohistochemical studies additional cases were selected in which the status of the p16 encoding gene had been determined at the molecular level. Absent p16 and high RB protein expression was found in the tumors having loss of heterozygosity within 9p21 and a structural change (mutation or deletion) of the remaining p16 encoding gene allele, confirming the staining results. These results strongly support the hypothesis that the RB nuclear overexpression recently associated with poor prognosis in bladder cancer is also associated with loss of p16 function and implies that loss of p16 function could be equally deleterious as RB loss in bladder and likely other cancers. (+info)
Decreased expression of the pro-apoptotic protein Par-4 in renal cell carcinoma. (2/66693)Par-4 is a widely expressed leucine zipper protein that confers sensitization to apoptosis induced by exogenous insults. Because the expression of genes that promote apoptosis may be down-regulated during tumorigenesis, we sought to examine the expression of Par-4 in human tumors. We present here evidence that Par-4 protein levels were severely decreased in human renal cell carcinoma specimens relative to normal tubular cells. Replenishment of Par-4 protein levels in renal cell carcinoma cell lines conferred sensitivity to apoptosis. Because apoptosis may serve as a defense mechanism against malignant transformation or progression, decreased expression of Par-4 may contribute to the pathophysiology of renal cell carcinoma. (+info)
Expression of Bcl-2 protein is decreased in colorectal adenocarcinomas with microsatellite instability. (3/66693)Bcl-2 is known to inhibit apoptosis and is thought to play a role in colorectal tumour development. Studies of the promoter region of bcl-2 have indicated the presence of a p53 responsive element which downregulates bcl-2 expression. Since p53 is commonly mutated in colorectal cancers, but rarely in those tumours showing microsatellite instability (MSI), the aim of this study was to examine the relationship of bcl-2 protein expression to MSI, as well as to other clinicopathological and molecular variables, in colorectal adenocarcinomas. Expression of bcl-2 was analysed by immunohistochemistry in 71 colorectal cancers which had been previously assigned to three classes depending upon their levels of MSI. MSI-high tumours demonstrated instability in three or more of six microsatellite markers tested, MSI-low tumours in one or two of six, and MSI-null in none of six. Bcl-2 expression in tumours was quantified independently by two pathologists and assigned to one of five categories, with respect to the number of cells which showed positive staining: 0, up to 5%; 1, 6-25%; 2, 26-50%; 3, 51-75%; and 4, > or =76%. Bcl-2 negative tumours were defined as those with a score of 0. Bcl-2 protein expression was tested for association with clinicopathological stage, differentiation level, tumour site, age, sex, survival, evidence of p53 inactivation and MSI level. A significant association was found between bcl-2 expression and patient survival (P = 0.012, Gehan Wilcoxon test). Further, a significant reciprocal relationship was found between bcl-2 expression and the presence of MSI (P = 0.012, Wilcoxon rank sum test). We conclude that bcl-2 expressing colorectal cancers are more likely to be MSI-null, and to be associated with improved patient survival. (+info)
Immune responses to all ErbB family receptors detectable in serum of cancer patients. (4/66693)Employing NIH3T3 transfectants with individual human ErbB receptor coding sequences as recombinant antigen sources, we detected by immunoblot analysis specific immunoreactivity against all four ErbB receptors among 13 of 41 sera obtained from patients with different types of epithelial malignancies. Overall, serum positivity was most frequently directed against ErbB2 followed by EGFR, ErbB3 and ErbB4. Specificity patterns comprised tumor patients with unique serum reactivity against ErbB2 or ErbB4. Moreover, approximately half of the positive sera exhibited concomitant reactivity with multiple ErbB receptors including EGFR and ErbB2, EGFR and ErbB4, ErbB2 and ErbB3 or EGFR, ErbB2 and ErbB3. Serum reactivity was confirmed for the respective ErbB receptors expressed by human tumor cells and corroborated on receptor-specific immunoprecipitates. Positive sera contained ErbB-specific antibodies of the IgG isotype. Representative immunohistochemical analysis of tumor tissues suggested overexpression of ErbB receptors for which serum antibodies were detectable in five of six patients. These findings implicate multiple ErbB receptors including ErbB3 and ErbB4 in addition to EGFR and ErbB2 in primary human cancer. Heterogeneity of natural ErbB-specific responses in cancer patients warrants their evaluation in light of immunotherapeutic approaches targeting these receptors. (+info)
Detailed methylation analysis of the glutathione S-transferase pi (GSTP1) gene in prostate cancer. (5/66693)Glutathione-S-Transferases (GSTs) comprise a family of isoenzymes that provide protection to mammalian cells against electrophilic metabolites of carcinogens and reactive oxygen species. Previous studies have shown that the CpG-rich promoter region of the pi-class gene GSTP1 is methylated at single restriction sites in the majority of prostate cancers. In order to understand the nature of abnormal methylation of the GSTP1 gene in prostate cancer we undertook a detailed analysis of methylation at 131 CpG sites spanning the promoter and body of the gene. Our results show that DNA methylation is not confined to specific CpG sites in the promoter region of the GSTP1 gene but is extensive throughout the CpG island in prostate cancer cells. Furthermore we found that both alleles are abnormally methylated in this region. In normal prostate tissue, the entire CpG island was unmethylated, but extensive methylation was found outside the island in the body of the gene. Loss of GSTP1 expression correlated with DNA methylation of the CpG island in both prostate cancer cell lines and cancer tissues whereas methylation outside the CpG island in normal prostate tissue appeared to have no effect on gene expression. (+info)
The disulfide-bonded loop of chromogranin B mediates membrane binding and directs sorting from the trans-Golgi network to secretory granules. (6/66693)The disulfide-bonded loop of chromogranin B (CgB), a regulated secretory protein with widespread distribution in neuroendocrine cells, is known to be essential for the sorting of CgB from the trans-Golgi network (TGN) to immature secretory granules. Here we show that this loop, when fused to the constitutively secreted protein alpha1-antitrypsin (AT), is sufficient to direct the fusion protein to secretory granules. Importantly, the sorting efficiency of the AT reporter protein bearing two loops (E2/3-AT-E2/3) is much higher compared with that of AT with a single disulfide-bonded loop. In contrast to endogenous CgB, E2/3-AT-E2/3 does not undergo Ca2+/pH-dependent aggregation in the TGN. Furthermore, the disulfide-bonded loop of CgB mediates membrane binding in the TGN and does so with 5-fold higher efficiency if two loops are present on the reporter protein. The latter finding supports the concept that under physiological conditions, aggregates of CgB are the sorted units of cargo which have multiple loops on their surface leading to high membrane binding and sorting efficiency of CgB in the TGN. (+info)
A cytomegalovirus glycoprotein re-routes MHC class I complexes to lysosomes for degradation. (7/66693)Mouse cytomegalovirus (MCMV) early gene expression interferes with the major histocompatibility complex class I (MHC class I) pathway of antigen presentation. Here we identify a 48 kDa type I transmembrane glycoprotein encoded by the MCMV early gene m06, which tightly binds to properly folded beta2-microglobulin (beta2m)-associated MHC class I molecules in the endoplasmic reticulum (ER). This association is mediated by the lumenal/transmembrane part of the protein. gp48-MHC class I complexes are transported out of the ER, pass the Golgi, but instead of being expressed on the cell surface, they are redirected to the endocytic route and rapidly degraded in a Lamp-1(+) compartment. As a result, m06-expressing cells are impaired in presenting antigenic peptides to CD8(+) T cells. The cytoplasmic tail of gp48 contains two di-leucine motifs. Mutation of the membrane-proximal di-leucine motif of gp48 restored surface expression of MHC class I, while mutation of the distal one had no effect. The results establish a novel viral mechanism for downregulation of MHC class I molecules by directly binding surface-destined MHC complexes and exploiting the cellular di-leucine sorting machinery for lysosomal degradation. (+info)
Expression of extracellular matrix proteins in cervical squamous cell carcinoma--a clinicopathological study. (8/66693)AIM: To evaluate the intracellular and peritumoral expression of matrix proteins in squamous cell carcinoma of the uterine cervix using immunohistochemistry. METHODS: 71 squamous cell carcinomas and 10 controls were stained for laminin, fibronectin, and collagen IV. Cytoplasmic staining in tumour cells and peritumoral deposition of matrix proteins were evaluated. The association between staining results and patient age, tumour stage, histological grade, and survival was studied. RESULTS: Positive cytoplasmic staining for laminin, fibronectin, and collagen IV was observed in 17 (23.9%), 27 (38%), and 10 (14.1%) cases, respectively. Staining for laminin was most pronounced in the invasive front of tumour islands, while for fibronectin and collagen IV it appeared to be diffuse. Peritumoral staining for laminin and collagen IV was detected in 12 cases (16.9%). Early stage (Ia1-Ia2) tumours were uniformly negative for all three proteins. Cytoplasmic staining for laminin correlated with positive staining for fibronectin and collagen IV, and with the presence of a peritumoral deposition of collagen IV and laminin. There was no correlation with any of the three markers between staining results and patient age, stage, grade, or survival. CONCLUSIONS: Expression of extracellular matrix proteins in some cervical squamous cell carcinomas might reflect the enhanced ability of these tumours to modify the peritumoral stroma. This ability seems to be absent in early stage tumours. The correlation between intracytoplasmic and peritumoral expression of matrix proteins supports the evidence of their synthesis by tumour cells. However, this property did not correlate with disease outcome in this study. (+info)
Pathological and Immunohistochemical Studies on The Effect of Synthetic Glucocorticoids Compounds on Rabbits for El Alem Maha...
Thesis, English, Pathological and Immunohistochemical Studies on The Effect of Synthetic Glucocorticoids Compounds on Rabbits for El Alem Maha Mohammed
Selecting for BRCA1 testing using a combination of homogeneous selection criteria and immunohistochemical characteristics of...
TY - JOUR. T1 - Selecting for BRCA1 testing using a combination of homogeneous selection criteria and immunohistochemical characteristics of breast cancers. AU - Miolo, GianMaria. AU - Canzonieri, Vincenzo. AU - De Giacomi, Clelia. AU - Puppa, Lara D.. AU - Dolcetti, Riccardo. AU - Lombardi, Davide. AU - Perin, Tiziana. AU - Scalone, Simona. AU - Veronesi, Andrea. AU - Viel, Alessandra. PY - 2009/10/10. Y1 - 2009/10/10. N2 - Background: BRCA1 gene-related tumours are more frequently estrogen receptor (ER) and progesterone receptor (PR) negative with a lower prevalence of human epidermal growth factor receptor 2 (HER2) overexpression or amplification. We evaluated the effectiveness of a combination of homogeneously selected criteria and immunohistochemical (IHC) characteristics of Familial Breast Cancers (FBCs) in detecting BRCA1 mutation carriers. Methods: Primary breast tumours from 93 FBC patients defined by specific eligibility criteria, based on personal and familial tumour history, were ...
A methodology to identify consensus classes from clustering algorithms applied to immunohistochemical data from breast cancer...
Single clustering methods have often been used to elucidate clusters in high dimensional medical data, even though reliance on a single algorithm is known to be problematic. In this paper, we present a methodology to determine a set of core classes by using a range of techniques to reach consensus across several different clustering algorithms, and to ascertain the key characteristics of these classes. We apply the methodology to immunohistochemical data from breast cancer patients. In doing so, we identify six core classes, of which several may be novel sub-groups not previously emphasised in literature.. ...
Immunolocalisation of matrix metalloproteinase 3 (stromelysin) in rheumatoid synovioblasts (B cells): correlation with...
Immunolocalisation of matrix metalloproteinase 3 (stromelysin) in rheumatoid synovioblasts (B cells): correlation with rheumatoid arthritis
Immunohistochemical identification of tissue culture cells. by R Hiramoto, J Jurandowski et al.
Hiramoto, R; Jurandowski, J; Bernecky, J; and Pressman, D, Immunohistochemical identification of tissue culture cells. (1961). Subject Strain Bibliography 1961. 1057 ...
Immunohistochemistry Studies
Rocklands Immunohistochemistry Studies (IHC) provide confidential high-quality target localization data through wide services. Option to outsource IHC.
Quantitative immunohistochemistry.
In general there exist two possibilities to obtain quantitatively information in immunohistochemical work: (1) Titration of an antibody of defined specificity and concentration on different antigenic substrates. (2) The measurement of the specific s
Quantitative Immunohistochemistry
Dr. Bloom has more than 30 years of clinical experience and has been an early adopter of precision medicine. He is a renowned researcher and lecturer in pathology, cancer, telemedicine, and informatics.. Dr. Bloom recently joined Invicro as the CMO of advanced pathology and advanced genomic services. Prior to Invicro, he served as the President and head of oncology and immunotherapy at Human Longevity Inc., Chief Medical Officer of In Vitro Diagnostics at GE Healthcare, senior medical director at US Labs and director of laboratory operations at Rush Medical Center. Dr. Bloom has held a series of academic position as including Clinical Professor of Pathology at USC and CIO at Rush Cancer Center.. ...
PSCO Case of the Month September 2008
The diagnosis of SPT is made based on the clinical presentation, location of tumor, histological findings, and immunohistochemical staining. SPTs express positive immunohistochemical staining for vimentin, CD56, alpha-1-antitrypsin and neuron-specific enolase. Epithelial markers (keratins) may be focal or weakly positive. Synaptophysin is commonly positive in SPTs; however, chromogranin is usually negative. Immunohistochemical staining for Amylase/Lipase/Trypsin are negative, as well as those for pancreatic hormones. There may be positive immunohistochemical staining for CD10, Beta- catenin, CD117 (c-kit), Progesterone receptor, and the beta form of estrogen receptor. SPTs are considered to be tumors of low malignant potential and more than 80% of SPTs are cured by surgical resection. However, metastases may be seen in a small percentage of patients. When metastasis occurs, it is usually to the liver or peritoneum. Patient follow-up: The patient underwent a brain biopsy. Histologic examination ...
Multiplex fluorescence immunohistochemistry using the Ultivue InSituPlex platform on the Leica Biosystems BOND RX
DATE: November 15, 2018TIME: 10:00am PT, 1:00pm ET Multiplex fluorescence immunohistochemistry offers a window into the biology of human disease, enabling the ana
Clinical Impact and Cost Implication of Routine MMR Protein Immunohistochemistry in High Risk Dukes B Colon Cancer | ...
41 colon cancer patients were tested for MMR status using immunohistochemistry between March 2013 and October 2014 (18 months). 31 of the 41 patients were resected high risk Dukes B colon cancer patients. 24 of the 31 patients (77%) were under the age of 75 and were considered for adjuvant chemotherapy. 3 of the 24 patients (13%) were found to have dMMR. 2 of the 3 dMMR patients did not proceed to have adjuvant treatment. 13 of the 24 patients (54%), including 1 dMMR patient, were commenced on adjuvant chemotherapy.. 7 of the 31 high risk Dukes B patients (23%) were over the age of 75. None of the over-75 patients were given chemotherapy. 4 of them (57%) were found to have dMMR. All dMMR patients had right sided colon cancer.. The overall prevalence of dMMR in high risk Dukes B patients was 23%. The cost of an MMR protein immunohistochemistry was under £50, whereas a 6 month course of Capecitabine chemotherapy, including all non-drug clinical costs, could amount up to £3500.. The other 10 ...
Immunocytochemical Expression of BAX and BAK Proteins in Cervical Smears of Women Positive for HPV Types: A ...
Immunocytochemical Expression of BAX and BAK Proteins in Cervical Smears of Women Positive for HPV Types: A Study of 120 Cases
Características clínicas y pronósticas de los subtipos moleculares de cáncer de mama determinados por inmunohistoquímica....
MEDINA BUENO, Gonzalo Arturo. Clinical and prognostic characteristics of the molecular subtypes of breast cancer determined by immunohistochemistry. Arequipa, Peru. Rev. perú. med. exp. salud publica [online]. 2017, vol.34, n.3, pp.472-477. ISSN 1726-4634. http://dx.doi.org/10.17843/rpmesp.2017.343.2530.. The objective of this study was to determine the clinical and prognostic characteristics of breast carcinomas according to the molecular subtype using immunohistochemical markers. The study included 280 women with unilateral breast cancer enrolled from 2009 to 2012. The carcinomas were classified into four subtypes based on immunohistochemical findings: luminal A, luminal B, HER2, and triple negative. The Kaplan-Meier test was used to determine the effect of histological type and molecular subtype on overall survival. Our results indicated that the most common breast carcinoma subtype was luminal A (105 cases, 37.5%), followed by luminal B (88 cases, 31.4%), HER2 (46 cases, 16.4%), and triple ...
Microscopic Description -- Case 252
The tumor cells were arranged in organoid clusters or sheets and composed of round to polygonal cells with central round nucleus, abundant eosinophilic or clear cytoplasm and distinct cell membrane (IMAGES 1, 2). Myxoid matrix was also present between the tumor cells (IMAGE 3). The tumor had increased cellularity with nuclear pleomorphism and significant mitotic activity (IMAGES 4, 5). Immunohistochemical stains showed an unusual pattern of staining for CD117 (c-kit) (IMAGE 6). Instead of cytoplasmic staining as typically seen in GIST, there was predominantly nuclear staining. CD34 (IMAGE 7), smooth muscle specific actin (IMAGE 8) and S-100 (IMAGE 9) were immunostain negative. Atypical staining for CD117 and absence of positive immunohistochemical staining for CD34 in the present tumor tissue prevent a definitive diagnosis of GIST at this time. Loss of positive staining for these characteristic GIST markers could be consistent with tumor dedifferentiation over time associated with recurrence. ...
Patent US4469098 - Apparatus for and method of utilizing energy to excise pathological tissue - Google Patents
Pathological tissue is excised with a beam from a laser that is coupled through a flexible, optical waveguide to a collimator that reduces the beam cross-sectional area by variable, controlled amounts. A transparent bore or a graphite cannule couples the beam exiting the collimator to the tissue to vaporize same. An electrically responsive deflector gyrates the reduced cross-sectional area beam about a bore sight axis aligned with the cannula bore so that the excised tissue has a frusto-conical volume. To excise different, displaced tissue regions, a position servo system moves the cannula so the bore sight axis moves in a plane at right angles to a plane on the exterior surface containing the pathological tissue.
Video: Can you trust your immunohistochemistry results?
IHC remains the simplest method for detecting biomarker expression while maintaining spatial context within tissues. Getting reliable staining hinges on the specificity of your antibody.
Morphometric and morphologic evaluation of pulmonary lesions in beagle dogs chronically exposed to high ambient levels of air...
TY - JOUR. T1 - Morphometric and morphologic evaluation of pulmonary lesions in beagle dogs chronically exposed to high ambient levels of air pollutants. AU - Hyde, D.. AU - Orthoefer, J.. AU - Dungworth, D.. AU - Tyler, W.. AU - Carter, R.. AU - Lum, H.. PY - 1978. Y1 - 1978. N2 - Beagle dogs (104) comprising one control and seven treatment groups were exposed 16 hours daily for 68 months to filtered air, raw or photochemically reacted auto exhaust, oxides of sulfur or nitrogen, or their combinations. After a further 32 to 36 months in clean air, morphologic examination of lungs by light microscopy, scanning electron microscopy, and transmission electron microscopy revealed two important exposure-related lesions. They were enlargement of air spaces in proximal acinar regions, with and without increases in the number and size of interalveolar pores, and hyperplasia of nonciliated bronchiolar cells. Proximal enlargement of air spaces was most severe, both subjectively and morphometrically, in ...
Signal Transduction Immunohistochemistry - Methods and Protocols | Alexander E. Kalyuzhny | Springer
Unlike detecting constitutively expressed targets, immunohistochemical detection of labile, low abundance, and short-lived signal transduction molecules can be a very difficult task. In Signal Transduction Immunohistochemistry: Methods and Protocols, IHC experts contribute detailed protocols
Gain of chromosome region 18q21 including the MALT1 gene is associated with the activated B-cell-like gene expression subtype...
The 116 DLBCL analyzed in our study were diagnosed according to the histopathological and immunohistochemical characteristics described in the WHO classification and additionally according to novel gene expression features recently defined by our group.10. Forty-three of our 116 cases of DLBCL had a genomic gain of BCL2 and MALT1 and one case revealed an amplification of MALT1 together with a normal BCL2 gene status (together 38%), while 72 cases (62%) had normal copy numbers of the BCL2 and MALT1 genes not considering changes in ploidy. Interestingly, gain of the BCL2 gene was invariably associated with gain of the MALT1 gene in our series. Moreover, the presence of a 18q21/MALT1 gain correlated with upregulation of genes located on 18q including MALT1 at the RNA level, independently of the ABC or GCB gene expression signature, and was strongly associated with over-expression of BCL2 protein. We found a significant accumulation of cases with a 18q21/MALT1 gain among those with an ABC signature ...
HA antibodies
Subject: HA antibodies From: jesuspla Date: Thu, 6 Apr 1995 10:39:10 In article ,jesuspla.1.000AA770 at eucmvx.sim.ucm.es, , jesuspla at eucmvx.sim.ucm.es writes: ,Does anyone know how to get anti-hemaglutinin antibodies to localize protein ,in the cell ?. Are they comercial ? If you want to use epitope tagging for immunolocalisation anti-HA antibodies are the ones to avoid. HA-tagged proteins can be immunolocalised but only if they are horrifically overexpressed in COS or 293 cells for example. A reasonable level of expression will not be visible above the high background. It is of course possible that we have received poor lots of mAb! We routinely use HA tags for immunoprecipitation of the protein of interest and VSVG or MYC tags for immunolocalisation, both of which work well. Fergus McKenzie, McKenzie at naxos.unice.fr Universite de Nice, France ...
CD24 shows early upregulation and nuclear expression but is not a prognostic marker in colorectal cancer | Journal of Clinical...
Background and aims: The putative stem cell marker CD24 is a small, heavily glycosylated, cell surface molecule which was originally associated with tumour metastasis. Recently it has been reported to be upregulated and of prognostic importance in colorectal tumours. The study aims to study the prognostic value of CD24 in a large series of colorectal cancer (CRC).. Methods: CD24 protein expression was examined by immunohistochemistry. A total of 10 whole tissue sections (WTS) of adenoma and 345 CRCs arranged as tissue microarrays (TMAs) were evaluated. For comparison with non-neoplastic tissue, 10 WTS containing tumour with associated non-neoplastic tissue were also studied.. Results: None of the samples of normal tissue (adjacent to tumour) showed CD24 expression. In the tumours, CD24 expression was seen on the luminal surface of the cells, within the cytoplasm and, unexpectedly, also within the nucleus. Positive immunostaining was seen in 9/10 (90%) adenomas and 313/345 (91%) of CRCs. Weak ...
Immunolocalisation and expression of keratocan in tendon -ORCA
Rees, S. G., Waggett, A. D., Kerr, Briedgeen, Probert, J., Gealy, Elizabeth Claire, Dent, C. M., Caterson, Bruce and Hughes, Clare Elizabeth 2009 ...
Overnight Drugstore: Prescribed propecia overnight delivery!
Positive connexin 43 staining and immunohistochemical characteristics, higher cartilage- specific gene mutations, adrenal hyperplasia. 319 compendium of research: Stem cells stem cells: Use of ipecac-induced emesis is no longer recommended in renal size operator dependent detects major scarring provides information on differential function is impaired. Adverse effects are classi ed as unpre- dictable reactions. Foods with high doses of phosphorus causes blood-cell dyscrasias, muscular postmenopausal women , journal of medicine, izmir, turkey e-mail: [email protected] a. Ran et al. After a few weeks. Also, many csa survivors emotionally numb them- selves if they do not administer antacids to patients over the surface of tibia thigh at the shoulder with the ko-medium (ko-dmem supple- marker hb7. Autonomic compo- motor) branches are small twigs that supply the sigmoid has been known to induce may decrease blood especially if a past history of glaucoma and prostatic cancer, pregnancy, hepatic ...
Signal transduction immunohistochemistry - Methods and protocols | European Journal of Histochemistry
Alexander E. Kalyuzhny statement that immunohistochemical detection of labile, low abundance and short-lived signal transduction molecules appears to be a very challenging task actually captures the same reader’s feeling. Each of us daily using immunohistochemical protocols to reveal targets either useful for research or diagnostic aims will surely wonder by which tricky techniques it is possible to overcome the preservation and unmasking of those labile antigens involved in signal transduction. Well, by seventheen chapters grouped in five parts Prof. Alexander E. Kalyuzhny is presenting an invaluable technical and methodological source of hints to satisfy our needs: to overcome troubleshottings if we are already in the field or to orientate those entering the field ...
Immunohistochemical identification of type I and type III collagen and chondroitin sulphate in human pre-dentine: a correlative...
To identify type I- (I-CF) and type III-collagen fibrils (III-CF) and chondroitin 4/6 sulphate (CS) within human pre-dentine by means of a correlative analysis under field emission in-lens-scanning electron microscopy (FEI-SEM) and transmission electron microscopy (TEM). Human-extracted...read more ...
Immunohistochemistry | National Diagnostics
Antibodies can be generated by injecting animals with antigens, and then collecting serum after the immune response has taken place. If the antibodies are labeled with an easily detectable molecule (a fluorescent dye, an enzyme, etc.), they become powerful detection reagents for the antigen. This system has been exploited to generate exceptionally specific and sensitive stains which are used in histology as well as other disciplines.. Immunohistochemistry/cytology is the use of antibodies in light microscopy and EM. The basic process depends upon selecting an antibody sufficiently specific to bind an antigen in situ. The antibody/antigen conjugate is then identified using a variety of signal generating molecules triggered either by the antibody/antigen interaction or by secondary processes. The signal generators can be precipitating dyes, fluorescent molecules or electron dense (ultrastructural tag) materials for electron microscopy (EM).. The first report of an immunohistochemistry technique ...
Plus it
Triple-negative breast cancer (TNBC) is an aggressive breast cancer subtype with high recurrences and mortality rate, for which no therapies besides chemotherapy are available to date. Lacking specific markers for an effective targeted therapy, TNBCs continue to represent the most important challenge for clinical oncologists. Here, we investigated the expression of CDCP1, a transmembrane non-catalytic receptor reportedly associated with poor prognosis in some solid tumors (e.g., lung and pancreatic cancer), and its association with tumor aggressiveness in a cohort of 115 human TNBC primary specimens obtained from women surgically treated in our Institute from the beginning of 2002 to the end of 2006 and selected based on immunohistochemical (IHC) criteria (,1% cell positivity for estrogen receptor, progesterone receptor and HER2 expression classified as 0 or 1+). CDCP1 was overexpressed in 56.5% of human primary TNBCs. FISH analysis of 75 TNBCs for which material was available delineated four ...
CD24 Expression Is a New Prognostic Marker in Breast Cancer | Clinical Cancer Research
CD24 has been described in B-cell development and B-cell neoplasia, in the developing pancreas and brain, and in regenerating muscle, keratinocytes, renal tubules, and a large variety of malignant tumors (12 , 13 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 , 32, 33, 34) . In this immunohistochemistry-based study we describe the expression of CD24 protein in breast cancer. Basically, we can confirm the findings of Fogel et al. (31) , who were the first to describe CD24 expression of breast cancer in an immunohistochemistry study based on frozen sections. They reported an apical membranous CD24 immunoreactivity in benign ducts and an additional cytoplasmic staining in invasive carcinomas, and described CD24 expression as a marker of breast cancer. We used a commercially available monoclonal CD24 antibody that is applicable to paraffinized tumor tissue and, thus, made a comprehensive analysis of clinically characterized archive material possible. The specificity of the antibody was ...
NEET (NTA-National Eligibility cum Medical Entrance Test) Biology Plant Tissues - Morphology, Anatomy and Functions(Structural...
Structural Organization in Animals and Plants-Plant Tissues - Morphology, Anatomy and Functions: Questions 277-284 of 446. Get to the point NEET (NTA-National Eligibility cum Medical Entrance Test) Biology questions for your exams.
KVPY (Kishore Vaigyanik Protsahan Yojana) Stream-SA (Class 11) Biology Animal Tissues - Morphology, Anatomy and Functions -...
Structural Organization in Animals and Plants-Animal Tissues - Morphology, Anatomy and Functions - Mainly Cockroach: Questions 1-8 of 8. Get to the point KVPY (Kishore Vaigyanik Protsahan Yojana) Stream-SA (Class 11) Biology questions for your exams.
The effects of proteasomal inhibition on synaptic proteostasis | The EMBO Journal
A common method for studying the involvement of catabolic pathways in the degradation of particular proteins is to pharmacologically inhibit the pathways, and examine-by Western blots or quantitative immunohistochemistry, for example-how these manipulations affect total quantities of the proteins in question. Unfortunately, these methods are incapable of separating the effects of such inhibitors on protein degradation from effects on protein synthesis. These processes are more readily discernible in pulse‐chase experiments based on radioactive amino acids; this approach, however, is not free from confounds either: On the one hand, the slow turnover rates of synaptic proteins require relatively long labeling periods. On the other, labeling is typically associated with substantial (ten‐ to hundredfold) reductions in (labeled) amino acid concentrations, raising the risk of inducing macroautophagy (see, e.g. Sutter et al, 2013). In contrast, the methods used here do not suffer from either of ...
Immunohistochemistry Market worth 2.12 Billion USD by 2021
(EMAILWIRE.COM, April 03, 2018 ) Browse 181 market data tables and 44 figures spread through 225 pages and in-depth TOC on Immunohistochemistry Market https://www.marketsandmarkets.com/Market-Reports/immunohistochemistry-market-121632939.html Early buyers will receive 10% customization on this...
Histological Differentiation Grade Predicted by Ultrasound Backscatterer Imaging - Full Text View - ClinicalTrials.gov
Histological grade of hepatocellular carcinoma (HCC) is an important prognostic factor affecting patient survival. It has been divided into four grades from I to IV on the basis of histological differentiation. Grade I is the best differentiated consisting of small tumor cells arranged in thin trabeculae. Cells with higher grade are larger and less differentiated with hyperchromatic nuclei and loss of trabecular pattern.. Ultrasound is an imaging modality frequently used to evaluate liver tumors because of its convenience, real-time, less expensive and no radiation exposure. However, ultrasonographic evaluation by conventional B-mode image is semi quantitative and subjective. It still cannot replace liver biopsy for the evaluation of HCC.. This study is aimed to quantify the image characters of B-mode image and the scatterer properties using Nakagami distribution. Nakagami parameter is a general model to describe the distribution of scatterers. Therefore, the investigators hypothesized that ...
Biochemical and immunohistochemical changes in delta-9-tetrahydrocannabinol-treated type 2 diabetic rats
The regulation of glucose, lipid metabolism and immunoreactivities of insulin and glucagon peptides by delta-9-tetrahydrocannabinol (Δ(9)-THC) in diabetes were examined in an experimental rat model. Male Sprague-Dawley rats were divided into four groups: (1) control, (2) Δ(9)-THC treated, (3) diabet …
Video Tutorials Resources | Vector Labs
Click here to view our tutorial videos on immunohistochemical staining, nucleic acid labeling, and much more aiding you and your research.
Figure 7
Figure 7: Immunohistochemistry of grafts in the rat striatum. Double immunohistochemical detection of grafted human cells (HCM-immunoreactivity in green) and of microglial cell detected (Iba1-immunoreactivity in red) in the striatum of implanted rats. Cell nuclei stained with DAPI (in blue). Following the implantation, rats were treated with saline 7A-7C, with tacrolimus only 7D-7F, with tacrolimus and prednisolone 7G-7I or with cyclosporine and prednisolone 7J-7L. Scale bar: A, B, D, E, G, H, J ,K=600 μm, C, F, I, L=300 μm ...
Bio-Quick, Corp.
QC Dots Cancer Array (CA) control slides are blank, charged microscope slides pre-spotted with selected tumor and normal cells that serve as a quality control for immunohistochemical procedures. Tissue can be mounted directly on the slide underneath the cell dots. QC Cancer Array (CA) Control Slides offer unrivaled flexibility and value - over 200 common clinical antibodies have been validated using CA Slides.. Read more ...
BTN - 536 Laboratory Techniques VI - Acalog ACMS™
Histology and immunohistochemistry techniques. Retake Counts for Credit: No. Pass/No Pass Grading Allowed: Yes. Credit(s): 2. ...
Plus it
Purpose: The level of estrogen receptor (ER), progesterone receptor (PR), and HER2 aids in the determination of prognosis and treatment of breast cancer. Immunohistochemistry is currently the predominant method for assessment, but differences in methods and interpretation can substantially affect the accuracy, resulting in misclassification. Here, we investigated the association of microarray-based mRNA expression levels compared with immunohistochemistry.. Experimental Design: Microarray mRNA quantification of ER, PR, and HER2 was done by the developed TargetPrint test and compared with immunohistochemical assessment for breast tumors from 636 patients. Immunohistochemistry was done in a central laboratory and in an independent reference laboratory according to American Society of Clinical Oncology/College of American Pathologists guidelines for 100 cases. For HER2 immunohistochemistry 2+ cases, additional chromogenic in situ hybridization (CISH) was used to determine the final ...
Histologic and Immunohistochemical Features of Ductal Carcinoma In Sit by Dennis B. Cornfield MD, G Schwartz et al.
Cornfield D B, Schwartz G F, Shen R, McDade T, Kovatich A. (1996, May). Histologic and Immunohistochemical Features of Ductal Carcinoma In Situ of the Breast Recurring After Wide Excision Alone. Presentation presented at: 32nd annual Meeting of the American Soc Clinical Oncol, Philadelphia, PA.. ...
Citoxlab - Tissue Cross-Reactivity (TCR) and immunohistochemistry
Citoxlab has experience with a wide variety of compounds and has a team of pathologists dedicated to running TCR and immunohistochemistry studies.
ABT-263 | Small molecule inhibitors of HCV replication
Background Fibrinogen-related proteins with lectin activity are believed to be part of the tick innate immune system. the FRePs immunostaining pattern. In D. marginatus haemolymph, anti-DMF1 serum stained the 36 kDa protein under reducing conditions. After ABT-263 deglycosylation with N-glycosidase F (cleaves off the whole N-glycan except for structures containing core (1,3)-bound fucose), reactive protein bands with molecular weights of 30, 31, 33, 34, and 36 kDa appeared (Figure ?(Figure3A).3A). The enduring reaction of the 36 kDa band suggests incomplete deglycosylation reaction. The anti-DMF1 serum detected also the 79/80 kDa proteins, which under reducing conditions migrated as three protein bands with molecular weights of 58, 60, and ABT-263 66 kDa suggesting the presence of non-covalently bound subunits. The molecular weights of these three bands decreased after N-glycosidase ABT-263 F treatment and they were observed at 54, 58, and 63 kDa (Figure ?(Figure3A).3A). Same results with lower ...
Scoring results PRB experiment 1. Results from manual s | Open-i
Scoring results PRB experiment 1. Results from manual scoring of PRB immunohistochemistry results in stroma (upper panel), luminal epithelium (LE, middle panel)
Bioline International Official Site (site up-dated regularly)
the expression of AR from five age groups [postnatal 1(neonatal), 10, 25, 45 and 60 days (adult) of age] was examined using immunohistochemistry method. The results were as follows: ① There was AR expression in leydig cells in neonatal voles and the expression of AR decreased at postnatal 10 days and 25days. AR expression reached its peak at postnatal 45 days and then decreased in adults（ ...
Positive immunostaining in negative control - Immunology and Histology
Hi. Ive been working with Vectastain Elite ABC kit for a month. First, I didnt get any signal in a positive human sample. This sample must to show some signal but my negative is very clean (beautiful) with 4 minutes of staining. So I decided test the kit with a positive control. Im using rat (a know sample) as my positive and the same sample as negative control without primary antibody. I suppose see signal only in my positive control but I got signal in both. I can see diffuse brown in my negative and my positive. Im using DAB to stain. I start with 6 minutes and jump to 4 minutes but I cant see any difference ...
Biolidics and the detection of tumoral cells on bloodstream | Durviz SL
Biolidics and the detection of tumoral cells on bloodstream , the new machine for liquid biopsies that allows to detects tumoral cells.
Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples | Protocol ...
心脏疾病的细胞基础上的现有知识大多依赖于对动物模型的研究。在这里，我们描述和验证了一种新的方法从人心肌小型手术样品得到单一可行的心肌细胞。人心肌细胞可用于电生理学研究和药物测试。...
How many words can you make out of immunohistochemistry
Words you can make out of immunohistochemistry. Anagrams of immunohistochemistry. Words made after you unscramble immunohistochemistry.
Multiplex IHC Assay Staining & Imaging Services | Ultivue
Let our team of multiplex IHC assay staining and imaging experts provide you with the data and insight you need from your tissue samples. Find out more!
Primary antibodies for immunohistochemistry CE/IVD Biotrend
Primary antibodies for immunohistochemistry CE/IVD. Immunohistochemistry (IHC) is an important method for pathologists because it specifically visualizes the distribution...
CD79
Chu PG, Arber DA (June 2001). "CD79: a review". Applied Immunohistochemistry & Molecular Morphology. 9 (2): 97-106. doi:10.1097 ...
Cytoskeletal drugs
Buchwalow, Igor B.; Böcker, Werner (2010). Immunohistochemistry: Basics and Methods. Springer. pp. 92. ISBN 978-3-642-04608-7. ...
Epstein-Barr virus-associated lymphoproliferative diseases
Applied Immunohistochemistry & Molecular Morphology. 25 (5): e30-e33. doi:10.1097/PAI.0000000000000405. PMID 27299190. S2CID ...
Necrotizing sialometaplasia
Immunohistochemistry may aid the diagnosis. If the lesion is NS, there will be focal to absent immunoreactivity for p53, low ...
Large-cell lung carcinoma with rhabdoid phenotype
Immunohistochemistry is an important factor in diagnosis. Results of immunohistochemistry (IHC) staining in rhabdoid lung ...
Signet ring cell
SRC carcinomas can be classified using immunohistochemistry. Signet ring cell carcinoma Cancer Research UK. Signet Ring Cancer ...
Immunogold labelling
Immunohistochemistry Iborra FJ, Kimura H, Cook PR (2004). "The functional organization of mitochondrial genomes in human cells ...
Cytokeratin
Thus the study of cytokeratin expression by immunohistochemistry techniques is a tool of immense value widely used for tumor ... 4-8. ISBN 978-3-642-20085-4. Dabbs, DJ (2010). Diagnostic Immunohistochemistry: Theranostic and Genomic Applications (3rd ed ...
Statin-associated autoimmune myopathy
Immunohistochemistry testing may demonstrate additional pathologic features of SAAM. Such findings include the presence of ...
Ziehl-Neelsen stain
... immunohistochemistry and modifications of Ziehl-Neelsen staining (such as the Fite-Faraco method) have comparable diagnostic ... "Clinical Performance of Mycobacterial Immunohistochemistry in Anatomic Pathology Specimens". American Journal of Clinical ...
Histopathology of colorectal adenocarcinoma
Immunohistochemistry can also be used to screen for Lynch syndrome, a genetic disorder with increased risk of colorectal and ... In cases where a metastasis from colorectal cancer is suspected, immunohistochemistry is used to ascertain correct diagnosis. ... Taliano RJ, LeGolvan M, Resnick MB (February 2013). "Immunohistochemistry of colorectal carcinoma: current practice and ...
Glomerulonephritis
Immunohistochemistry staining of tissue specimens shows linear IgG deposits. Type 2 is characterised by immune-complex-mediated ...
Neuronal lineage marker
By immunohistochemistry, anti-Hu stains the nuclei of neurons. To localize mRNA in brain tissue, one can use a fragment of DNA ... Although immunohistochemistry is the staple methodology for identifying neuronal cell types, since it is relatively low in cost ... Immunohistochemistry is a technique that uses antibodies with fluorescent staining tags that target a specific antigen present ... For the past years there are still creating new neural markers for immunocytochemistry or/and immunohistochemistry. In 1953 ...
Progastrin
Handbook of Immunohistochemistry and in Situ Hybridization of Human Carcinomas. 4. Elsevier. pp. 23-32. doi:10.1016/s1874-5784( ... Handbook of Immunohistochemistry and in Situ Hybridization of Human Carcinomas. 4. Elsevier. pp. 23-32. doi:10.1016/s1874-5784( ...
Rhabdomyoblast
The presence of desmin and myogenin can be detected using immunohistochemistry. Holland, James F.; Frei III, Emil; Weichselbaum ...
Chondrosarcoma
In a few cases, usually of highly anaplastic tumors, immunohistochemistry (IHC) is required. There are no ...
Tissue microarray
Immunohistochemistry combined with tissue microarrays has also been used with success in large scale efforts to create a map of ... The use of tissue microarrays in combination with immunohistochemistry has been a preferred method to study and validate cancer ... Tests commonly employed in tissue microarray include immunohistochemistry, and fluorescent in situ hybridization. Tissue ... Immunohistochemistry Staining and Digitalization Within the Human Protein Atlas". Journal of Visualized Experiments (63): e3620 ...
Sebaceous carcinoma
Tissue immunohistochemistry is routinely used in evaluation of SGc to screen for MTS. The absence of staining for DNA mismatch ... Immunohistochemistry may also be used to differentiate SGc from benign growths and certain markers may predict an increased ... Immunohistochemistry may be used to establish a definitive diagnosis, but it is not required with typical histopathological ...
TMEM39B
The TMEM39B protein has been found to localize to the vesicles using immunohistochemistry. The human TMEM39B gene has a paralog ...
Neural cell adhesion molecule
In anatomic pathology, pathologists make use of CD56 immunohistochemistry to recognize certain tumors. Normal cells that stain ...
Reed-Sternberg cell
The presence of these cells is confirmed mainly by use of biomarkers in immunohistochemistry. They can also be found in ...
Tris-buffered saline
"An optimized immunohistochemistry protocol for detecting the guidance cue Netrin-1 in neural tissue". MethodsX. doi:10.1016/j. ...
Sweat gland
... an immunohistochemistry-laser scanning confocal fluorescence microscopy study". The Journal of Neuroscience. 14 (11 pt. 2): ...
Uschi Keszler's Pennies-in-Action Cancer Research Fund
March 1999). "Immunohistochemistry with pancytokeratins improves the sensitivity of sentinel lymph node biopsy in patients with ...
Tumor marker
Microscopic visualization in tissue by immunohistochemistry does not give quantitative results and is not considered here. For ...
THP-1 cell line
... and immunohistochemistry. Although THP-1 cells are of the same lineage, mutations can cause differences as the progeny ...
Carcinoembryonic antigen
Antibodies to CEA are also commonly used in immunohistochemistry to identify cells expressing the glycoprotein in tissue ... it is commonly employed in combination with other immunohistochemistry tests, such as those for BerEp4, WT1, and calretinin. ...
Alport syndrome
Immunohistochemistry or immunofluorescence studies to identify the COL3-4-5 proteins in GBM can be helpful. However, these ...
Myelinogenesis
Immunohistochemistry analysis was utilized in order to further confirm the relationship between thyroid hormone and ...
Michael Palese
A Case of Probable Implantative Origin With Characterization of Benign Fallopian Tube Immunohistochemistry". Int J Surg Pathol ...
Quantitative immunohistochemistry.
Signal Transduction Immunohistochemistry - Methods and Protocols | Alexander E. Kalyuzhny | Springer
In Signal Transduction Immunohistochemistry: Methods and Protocols, IHC experts contribute detailed protocols ... Signal Transduction Immunohistochemistry. Book Subtitle. Methods and Protocols. Editors. * Alexander E. Kalyuzhny ... Authoritative and practical, Signal Transduction Immunohistochemistry: Methods and Protocols serves as an ideal guide for ... In Signal Transduction Immunohistochemistry: Methods and Protocols, IHC experts contribute detailed protocols addressing the ...
Overview of immunohistochemistry | Abcam
Immunohistochemistry (IHC) is a method for studying the localization of antigens in tissue sections using antibodies. Find out ... Our immunohistochemistry guide takes you through all the steps in the IHC workflow and includes links to some of our other IHC ... Immunohistochemistry (IHC) is a method for demonstrating the distribution and localization of antigens (such as proteins) in ...
Immunohistochemistry Studies
Rocklands Immunohistochemistry Studies (IHC) provide confidential high-quality target localization data through wide services ... Immunohistochemistry:. Phase II entails the use of the antibody under optimized assay conditions to immunolabel selected ... Custom Immunohistochemistry Services:. Confidential custom target expression-profiling studies are performed on a fee-for- ... Rocklands Immunohistochemistry Studies (IHC) provide confidential high-quality target localization data through its extensive ...
Immunohistochemistry | National Diagnostics
Immunohistochemistry can also be carried out on cells either in free solution or bound to membranes, or on monolayers of ... Immunohistochemistry/cytology is the use of antibodies in light microscopy and EM. The basic process depends upon selecting an ... Immunohistochemistry is generally carried out in sectioned tissue, which allows the antibodies free access to the interior of ... Intracellular Immunohistochemistry requires that the antibody to the target antigen be able to penetrate the cell membrane and ...
Immunohistochemistry Market worth 2.12 Billion USD by 2021
... www.marketsandmarkets.com/Market-Reports/immunohistochemistry-market-121632939.html Early buyers will receive 10% customization ... Browse 181 market data tables and 44 figures spread through 225 pages and in-depth TOC on Immunohistochemistry Market https:// ... Immunohistochemistry Market worth 2.12 Billion USD by 2021. The global immunohistochemistry market is expected to reach USD ... In 2015, the immunohistochemistry antibody segment accounted for the largest share of immunohistochemistry market, by product. ...
Immunohistochemistry - Wikipedia
Immunohistochemistry Staining Protocol. *. Burnett R, Guichard Y, Barale E (1997). "Immunohistochemistry for light microscopy ... Immunohistochemistry is also used for protein profiling in the most common forms of human cancer. ... Immunohistochemistry is used to determine patients who may benefit from therapeutic antibodies such as Erbitux (cetuximab). ... Immunohistochemistry can be used to assess which tumors are likely to respond to therapy, by detecting the presence or elevated ...
CDC - Diagnosis: Immunohistochemistry (IHC) - Rabies
Immunohistochemistry in Gynecologic Pathology - Redorbit
Immunohistochemistry may offer some guidance in these cases.11-19 Most uterine smooth muscle tumors express hormone receptors. ... Subsequently, sections of the uterine tumor were submitted for immunohistochemistry. The endometrial carcinoma was found to be ...
Immunohistochemistry Applications | SpringerLink
Immunohistochemistry can be applied judiciously in the delineation of tumoral histiogenesis and the extent of lesional ... Immunohistochemistry can be applied judiciously in the delineation of tumoral histiogenesis and the extent of lesional ... Cherpelis B.S., Frank Glass L., Hamill J.R., Fenske N.A. (2018) Immunohistochemistry Applications. In: Morgan M., Spencer J., ...
Reprints : Applied Immunohistochemistry & Molecular Morphology
Previous Issues - Applied Immunohistochemistry & Molecular Morphology. *Previous Issues - Diagnostic Molecular Pathology (1992- ... Articles published in Applied Immunohistochemistry & Molecular Morphology are available to nonsubscribers online and/or in PDF ...
Liver Cancer & Immunohistochemistry
... Recorded: Apr 10 2019 64 mins Brett Merritt. Did you know that the incidence of liver ... Liver Cancer & Immunohistochemistry. Did you know that the incidence of liver cancer has tripled since 1980? Have you wondered ... Liver Cancer & Immunohistochemistry Brett Merritt [[ webcastStartDate * 1000 , amDateFormat: MMM D YYYY h:mm a ]] 64 mins ... Immunohistochemistry has now been a staple in diagnostic pathology for decades. This is partially due to pathologist ...
Basics of Immunohistochemistry
Immunohistochemistry is the technology of detecting cellular and infectious agent proteins in tissue with antibodies and then ... Basics of Immunohistochemistry. Immunohistochemistry is the technology of detecting cellular and infectious agent proteins in ... Liver Cancer & Immunohistochemistry Recorded: Apr 10 2019 64 mins Brett Merritt. Did you know that the incidence of liver ... Immunohistochemistry has now been a staple in diagnostic pathology for decades. This is partially due to pathologist ...
Applied Immunohistochemistry & Molecular Morphology
Previous Issues - Applied Immunohistochemistry & Molecular Morphology. *Previous Issues - Diagnostic Molecular Pathology (1992- ...
Immunohistochemistry | Thorax
Blood-Brain Barrier Permeability Using Tracers and Immunohistochemistry | SpringerLink
What is Immunohistochemistry? (with pictures)
Immunohistochemistry is a type of technique that is used to identify specific types of cells in a given sample. The ... Immunohistochemistry (IHC) is a technique which can be used to identify specific types of cells within a given sample. This ... In an immunohistochemistry study, antibodies search for specific antigens in the sample, and if they find one that matches, ... I can only imagine how cool the slides from immunohistochemistry look. I always think its cool when scientists are able to ...
Mesothelioma and Immunohistochemistry - Mesothelioma Symptoms
Immunohistochemistry, more commonly referred to as IHC, helps doctors and scientists differentiate between histological ... Mesothelioma and Immunohistochemistry. Immunohistochemistry, more commonly referred to as IHC, helps doctors and scientists ...
Immunohistochemistry Market Is Expected To Reach US$ 2,986.4 Mn By 2025 - Credence Research | MCT
Immunohistochemistry Market Is Expected To Reach US$ 2,986.4 Mn By 2025 - Credence Research. Mark Alfonso September 13, 2017 ... Home ,, Business ,, Immunohistochemistry Market Is Expected To Reach US$ 2,986.4 Mn By 2025 - Credence Research ... Immunohistochemistry is a method used for localizing specific antigens in tissues or cells using antibodies, enzyme conjugates ... "Global Immunohistochemistry Market - Growth, Future Prospects, Competitive Analysis, 2017 - 2025," the global ...
Immunohistochemistry Images | Cornell University College of Veterinary Medicine
Immunohistochemistry courses | Medical School | The University of Sheffield
... level courses in immunohistochemistry. Details of our latest course dates and booking information can be found here. ... Carry out immunohistochemistry protocols to demonstrate how proteins are distributed within a tissue section. ... The Department of Neuroscience offers beginner and advanced level courses in immunohistochemistry. Details of our latest ... Discuss the interaction of an antigen and antibody and how this impacts on the immunohistochemistry reactions. ...
Immunohistochemistry Protocol - IHC Protocol | Sigma-Aldrich
Immunohistochemical staining is a valuable tool for detecting specific antigens in tissues. This IHC protocol describes the application of peroxidase or alkaline phosphatase conjugates in the immunohistochemical labeling of formalin-fixed, paraffin-embedded tissue sections.
Prestige Antibodies® in Immunohistochemistry | Sigma-Aldrich
Immunohistochemistry (IHC) is the most widely used technique in histopathological diagnosis and research for detection of ... Immunohistochemistry (IHC) is the most widely used technique in histopathological diagnosis and research for detection of ... By the use of Prestige Antibodies® in Immunohistochemistry studies, information on a subcellular level can be achieved. ... The use of Prestige Antibodies® in Immunohistochemistry on Tissue Microarrays (TMAs) has allowed for protein expression ...
Immunohistochemistry in Dermatopathology. - Free Online Library
Immunohistochemistry in Dermatopathology. by Archives of Pathology & Laboratory Medicine; Health, general Squamous cell ... Utility of Immunohistochemistry in the Pancreatobiliary Tract.. Next Article:. Application of Immunohistochemistry in ... Immunohistochemistry for LMP1 should be considered in any type of lymphoma in the setting of immune suppression, but EBER in ... MLA style: "Immunohistochemistry in Dermatopathology.." The Free Library. 2015 College of American Pathologists 07 Jul. 2020 ...
Immunohistochemistry (IHC) kits | Abcam
Comparison of Antibodies for Immunohistochemistry-based Detection...: Ingenta Connect
Growth factor receptor HER3 (ErbB3) lacks standardized immunohistochemistry (IHC)-based methods for formalin-fixed paraffin- ... Source: Applied Immunohistochemistry & Molecular Morphology, Volume 26, Number 3, March 2018, pp. 212-219(8) ... Comparison of Antibodies for Immunohistochemistry-based Detection of HER3 in Breast Cancer ...
Immunohistochemistry Services
An easy-to-use directory for life science and biomedical research products. Find special deals on products, order catalogs and browse product lines from suppliers of reagents, antibodies, laboratory equipment, and more.
480226: HER-2/neu Immunohistochemistry (IHC),... | LabCorp
Histotech - Immunohistology & Immunohistochemistry Protocol Services | Contract Research
Immunohistochemistry Approach In Encephalitozoonosis | 71859
Immunohistochemistry Market by Product | MarketsandMarkets
225 Pages Report] Immunohistochemistry Market report categorizes the global market by Application (Diagnostics (Autoimmune, ... Global Immunohistochemistry Market, by Product *Antibodies *Reagents *Equipment *Kits *Global Immunohistochemistry Market, by ... 1.2 Immunohistochemistry Market Definition 1.3 Immunohistochemistry Market Scope 1.3.1 Markets Covered. 1.3.2 Years Considered ... 2.2 Immunohistochemistry Market Size Estimation 2.3 Market Breakdown and Data Triangulation 2.4 Immunohistochemistry Market ...
Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas - 1st Edition
Purchase Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas - 1st Edition. Print Book & E-Book. ... Immunohistochemistry Southern Blot Analysis Methods Immunohistochemistry Southern Blot Analysis Results and Discussion. ... Immunohistochemistry for Pan-Cytokeratin Molecular Detection by Mutated K-Ras Methods Immunohistochemistry for Pan-Cytokeratin ... Immunohistochemistry Polymerase Chain Reaction Methods Hematoxylin and Eosin Staining Immunohistochemistry Genetic Analysis for ...
Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas - 1st Edition
Purchase Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas - 1st Edition. Print Book & E-Book. ... Handbook of Immunohistochemistry and in situ Hybridization of Human Carcinomas 1st Edition. Molecular Genetics, ... Role of Immunohistochemistry in Elucidating Lung Cancer Metastatic to the Ovary from Primary Ovarian Carcinoma ... Prediction for BRCA1 Mutation in Ovarian Carcinoma by Immunohistochemistry. Role of BRCA1/BRCA2 in Ovarian, Fallopian Tube, and ... | https://lookformedical.com/en/search/immunohistochemistry |
Breadcrumbs Section. Click here to navigate to respective pages.
Chapter
Chapter
Understanding the Issues
DOI link for Understanding the Issues
Understanding the Issues book
Understanding the Issues
DOI link for Understanding the Issues
Understanding the Issues book
Click here to navigate to parent product.
ABSTRACT
How do aircraft interact with their environment? What interactions occur between airports and the environment? How do those interactions vary geographically and with time? Answering such questions is central to understanding aviation environmental impacts. In particular, two aspects of the relationship between air transport and the environment are important in understanding current debates: (a) the emissions from aircraft and airport infrastructure; and (b) the growth in demand for air transport. Those two themes – aviation emissions and aviation growth – recur throughout the subsequent chapters of this book, and understanding the issues associated with each is vital for a balanced view of the environmental impacts of air transport. Explaining the main trends in aviation emissions and growth is the focus of this chapter. Aircraft and airports have many interactions with the environment, by far the most important of which are the emissions generated by aircraft during their operation. This is not to imply that other environmental interactions are negligible. The materials and energy used in manufacturing, maintaining and ultimately disposing of aviation infrastructure – over the life cycle of that infrastructure – may be substantial and should be considered in aviation environmental impact assessments, especially in the case of airport infrastructure development. In addition, many environmental interactions occur during the surface transport of employees, passengers, freight, goods and waste to, from and within airport sites, and during the servicing of aircraft before and after flights. At the local scale, such interactions may result in significant, cumulative environmental impacts because major airports are sites of intensive resource consumption and waste production. Nevertheless, at the global scale – and increasingly at the scale of individual airports – the impact of aircraft emissions far outweighs any other aviation environmental effect in its magnitude and significance (Bows et al. 2009; Upham 2003). Therefore, an understanding of aircraft emissions is crucial to any discussion of aviation environmental impacts. Furthermore, despite some impressive technological and operational advances in the efficiency of air transport operations, absolute aircraft emissions are increasing – and are projected to continue to rise – due to the growth in demand for air
transport. This makes an understanding of the trends in aviation growth critical for a full understanding of aviation environmental impacts. | https://www.taylorfrancis.com/chapters/mono/10.4324/9781315566320-10/understanding-issues-ben-daley |
Maybe you're a retiree wanting to keep your skills fresh, or working full-time, but enjoy helping others in your free time. There's a surprising range of opportunities for you at Tri-City Hospital Foundation.
Tri-City Hospital Foundation has more than 20 Board volunteers who contribute their time and energy to the Foundation. Others contribute their efforts in planning our annual, signature events.
These volunteers are dedicated to enhancing the caliber of Tri-City through their commitment to our programs, events and efforts to invent the future for our community. These volunteers help Tri-City Hospital Foundation reach new heights in excellence, and we are deeply grateful for their involvement.
Tri-City Hospital Foundation is focused on bringing together this community to engage support of Tri-City Medical Center. For more information or volunteering opportunities call (760) 940-3370. A member of the Development Team will be pleased to help you. | https://tricityhospitalfoundation.org/what_you_can_do/volunteer.html |
Biodiversity refers to the variety of life forms on Earth. The South West of Western Australia is one of 34 global biodiversity ‘hot spots’ – the most species-rich but threatened places on the planet.
The south west of Western Australia is one of the 34 biodiversity hotspots in the world – an area of high conservation value due to level of species richness and endemism, but also one on a rapid rate of decline. The Shire’s Sustainability Services works towards effective management and conservation of biodiversity values, including threatened and endemic flora found in the Shire of Denmark’s bushland, coastal and foreshore Reserves.
Native vegetation is protected under the Environmental Protection Act 1986. All clearing of native vegetation is prohibited unless a clearing permit is granted by the Department of Water and Environmental Regulation (DWER) or the clearing is for an exempt purpose, as defined under the Act or the Environmental Protection (Clearing of Native Vegetation) Regulations 2004. Clearing of native vegetation also includes the collection of firewood, flower picking, seed collection and removal of dead or dying vegetation.
for advice on the need for a clearing permit application. Relevant documents on the native vegetation clearing approval process can also be found in the links below.
Chuditch (Dasyurus geoffroii) A nationally-listed Vulnerable species.
There are four main species of frog found around the Wilson Inlet: the Motorbike Frog (Litoria moorei), Pobblebonk Frog (Lymnodynastes dorsalis), Moaning Frog (Heleioporus eyrie) and the Quacking Frog (Crinia georgiana). Frogs breathe primarily through their moist skin, which is a poor barrier to pollutants in the environment.
The Quacking frog is found only in the south western corner of WA, particularly along the south coast. These sensitive frogs breed between June and October and rely on wetlands for finding shallow pools of water where they can lay their eggs. They do not cope well in saline or polluted water.
All Australian native animals, including kangaroos, magpies and Black Cockatoos, are protected under State and Commonwealth law. No person is able to keep, injure or kill native Australian wildlife without the appropriate licence from the Department of Biodiversity Conservation and Attractions. | https://www.denmark.wa.gov.au/residents/sustainability-the-natural-environment/biodiversity.aspx |
This is a collection of academic essays based on the symposium Performative Urbanism held by the Technical University of Munich in 2013. Starting from the notion that architecture is the art of articulating spaces, the book explores the relationship between the built form and the urban realm, or how the space is used while experiencing the architecture around it. The book cites Jean Baudrillard’s theory that buildings or cities without scenic space would just be merely a structure or an agglomeration of structures.
While this debate has so far been carried out mostly in cultural and theatre forums, the aim of the book is to transfer the discussion onto the streets and explore the potentially performative ability of architecture. By simply walking or strolling along the streets, one becomes part of a play or some other sort of event.
To take it further, this concept is applied to everyday urban spaces. A square is a set of soft and hard landscaping without any urban relevance unless it is used. According to the authors, the shift is that we are no longer interested in signature architecture but in good quality public realm. Spaces are designed to have a level of unpredictability and ambivalence in the way that people perceive and use them, and have an intrinsic ability to transform and adapt. Nevertheless, personal perception and subjective disposition play a key role: for example walking through a space would be a different experience than seeing the space from above.
While most essays in the book try to define the concepts of performance and performativity – meaning the act of performing and the creation of a new reality – others showcase examples like those by Assemble, a London based design group, whose work can be described as performative in the sense that it’s less about the building, than about the process of getting there and using it.
I question who the book is written for and how relevant it is for urban designers. Despite the subject being urban spaces and the public realm, the text is very academic, making it inaccessible and for a narrow audience. If the authors aimed at sparking ideas to create places that are inclusive and accessible to all, a more concise version around the key points and in plain english, would have probably been enough.
As featured in URBAN DESIGN 143 Summer 2017
Want to read more like this? If you're not already an Urban Design Group member, why don't you consider joining? | https://www.udg.org.uk/publications/book/performative-urbanism |
Journal article Open Access
Sabourin, Jennifer L.; Rowe, Jonathan P.; Mott, Bradford W.; Lester, James C.
Over the past decade, there has been growing interest in real-time assessment of student engagement and motivation during interactions with educational software. Detecting symptoms of disengagement, such as offtask behavior, has shown considerable promise for understanding students' motivational characteristics during learning. In this paper, we investigate the affective role of off-task behavior by analyzing data from student interactions with CRYSTAL ISLAND, a narrative-centered learning environment for middle school microbiology. We observe that off-task behavior is associated with reduced student learning, but preliminary analyses of students' affective transitions suggest that off-task behavior may also serve a productive role for some students coping with negative affective states such as frustration. Empirical findings imply that some students may use off-task behavior as a strategy for self-regulating negative emotional states during learning. Based on these observations, we introduce a supervised machine learning procedure for detecting whether students' off-task behaviors are cases of emotion self-regulation. The method proceeds in three stages. During the first stage, a dynamic Bayesian network (DBN) is trained to model the valence of students' emotion self-reports using collected data from interactions with the learning environment. In the second stage, a novel simulation process uses the DBN to generate alternate futures by modeling students' affective trajectories as if they had engaged in fewer off-task behaviors than they did during their actual learning interactions. The alternate futures are compared to students' actual traces to produce labels denoting whether students' off-task behaviors are cases of emotion self-regulation. In the final stage, the generated emotion self-regulation labels are predicted using off-the-shelf classifiers and features that can be computed in run-time settings. Results suggest that this approach shows promise for identifying cases of off-task behavior that are emotion self-regulation. Analyses of the first two phases suggest that trained DBN models are capable of accurately modeling relationships between students' off-task behaviors and self-reported emotional valence in CRYSTAL ISLAND. Additionally, the proposed simulation process produces emotion self-regulation labels with high levels of reliability. Preliminary analyses indicate that support vector machines, bagged trees, and random forests show promise for predicting the generated emotion self-regulation labels, but room for improvement remains. The findings underscore the methodological potential of considering alternate futures when modeling students' emotion self-regulation processes in narrative-centered learning environments. | https://zenodo.org/record/3554608 |
The open access, unlicensed or spectrum commons approach to managing shared access to RF spectrum offers many attractive benefits, especially when implemented in conjunction with and as a complement to a regime of marketbased, flexible use, tradable licensed spectrum ([Benkler02], [Lehr04], [Werbach03]). However, as a number of critics have pointed out, implementing the unlicensed model poses difficult challenges that have not been well-addressed yet by commons advocates ([Benjam03], [Faulhab05], [Goodman04], [Hazlett01]). A successful spectrum commons will not be unregulated, but it also need not be command & control by another name. This paper seeks to address some of the implementation challenges associated with managing a spectrum commons. We focus on the minimal set of features that we believe a suitable management protocol, etiquette, or framework for a spectrum commons will need to incorporate. This includes: (1) No transmit only devices; (2) Power restrictions; (3) Common channel signaling; (4) Mechanism for handling congestion and allocating resources among users/uses in times of congestion; (5) Mechanism to support enforcement (e.g., established procedures to verify protocol is in conformance); (6) Mechanism to support reversibility of policy; and (7) Protection for privacy and security. We explain why each is necessary, examine their implications for current policy, and suggest ways in which they might be implemented. We present a framework that suggests a set of design principles for the protocols that will govern a successful commons management regime. Our design rules lead us to conclude that the appropriate Protocols for a Commons will need to be more liquid ([Reed05]) than in the past: (1) Marketbased instead of C&C; (2) Decentralized/distributed; and, (3) Adaptive and flexible (Anonymous, distributed, decentralized, and locally responsive).
Date issued2006-02
Publisher
Massachusetts Institute of Technology. Engineering Systems Division
Series/Report no. | https://dspace.mit.edu/handle/1721.1/102778 |
I most enjoy the broad scope of briefs, industries and fields of design disciplines explored within the projects we undertake.
More about Joe
Placement company: Webb deVlam
What do you enjoy most about your course at NTU?
“I most enjoy the broad scope of briefs, industries and fields of design disciplines explored within the projects we undertake. They have allowed me to hone my own approach to the design process and gave me a greater understanding of what skillsets I wanted to pursue in addition to the types of design careers that interested me the most.
“Tutors often offer valuable feedback and criticism of work from an industry-validated perspective; drawing upon their own knowledge of the industries and projects they maintain involvement within. A similar industry-centred approach with technical staff enables designs and prototypes to be fabricated to a professional level utilising CNC machining, water jet cutting and other production processes used within industry.
How did you spend your placement year?
“I undertook my twelve-month placement with Webb deVlam, a strategic brand design agency with offices in London, Chicago and Singapore, working on projects for both large multinational corporations and small start-ups. As part of the 3D design team I worked alongside experienced and talented colleagues in producing concepts and developing projects through sketching, CAD modelling and visualisations among many other typical design tasks. The placement provided invaluable insight into the inner-workings of a design consultancy, which have since been applicable to my final year of studies.
“My placement year not only provided me with the platform to enhance my design and software skills but also put them into practice in a time-efficient manner, with deadlines on consultancy work often being paramount in the process of a project. Whilst I was familiar with programs such as the Adobe Creative Suite, Solidworks and KeyShot prior to undertaking my placement, the utilisation of these programs on a daily basis has allowed me to develop an even greater understanding and proficiency.
What advice would you give to prospective students?
“You should try to tackle each new brief with your portfolio in mind. This way you’ll develop a unique and personal style and approach to the design process. Doing so will ensure any prospective employees viewing your work get an understanding for your key strengths whilst allowing you to focus on the design skills you are most successful with i.e. sketching, modelling, testing etc.”
Still need help? | https://www.ntu.ac.uk/study-and-courses/courses/our-students-stories/architecture-design-built-environment/joe-parker |
This page has been archived.
Information identified as archived on the Web is for reference, research or recordkeeping purposes. It has not been altered or updated after the date of archiving. Web pages that are archived on the Web are not subject to the Government of Canada Web Standards. As per the Communications Policy of the Government of Canada, you can request alternate formats on the "Contact Us" page.
Strategic Outcome 1: Wrongdoing in the federal public sector is detected, resolved and reported, while public servants are protected from reprisal, resulting in a greater integrity in the workplace.
The Office pursues this outcome through three guiding principles: inform, protect and prevent.
The Office’s outreach activities are a key means to informing public servants about the legislation and our mandate. Great emphasis is placed on the Office’s protection role. This encompasses the protection of: identities, information, persons making the disclosure and the witnesses from any form of reprisal, interests of those against whom an allegation is brought, integrity of public institutions and the public interest. The Office also utilises a prevention oriented approach to promote ethical behaviour and a workplace culture that is open to dialogue and disclosure of wrongdoing and that protects public servants from reprisal.
The Preamble of the PSDPA articulates the benefits of this outcome to Canadians: “the federal public administration is an important national institution and is part of the essential framework of Canadian parliamentary democracy”, and that “it is in the public interest to maintain and enhance public confidence in the integrity of public servants”.
|2008-09 Financial Resources
|
($ thousands)
|2008-09 Human Resources
|
(FTEs)
|Planned
|
Spending
|Total
|
Authorities
|Actual
|
Spending5
|Planned||Actual||Difference|
|6,553||6,445||3,611||41||21||20|
|Expected
|
Results
|Performance
|
Indicators
|Targets||Performance
|
Status
|Performance
|
Summary
|Increased awareness of workplace integrity and recourses available.||Awareness and Education.||Public servants and Canadians aware of the Office’s role and mandate and disclosure of wrongdoing viewed as a pro-social behaviour.||Somewhat met||Numerous promotional and outreach activities were undertaken in 2008-09 including hosting symposium bringing together senior leaders from across Canada. However, more work is required to fully entrench a culture of disclosure in the public service and overcome the fear of coming forward, which must include partnerships with key stakeholders.|
|Effective investigation, resolution and reporting of wrongdoings.||Advice and Responses to Inquiries.||Inquiries are conducted efficiently and in accordance with the Act.||Successfully met||All requests for information about the Act and procedures used by our Office concerning disclosures of wrongdoing and reprisal complaints from public servants and members of the public received in 2008-09 were responded to.|
|Disclosure Investigations and Reports.||Investigations are conducted efficiently and in accordance with the Act. The Commissioner reports to Parliament on specific information about the Office’s activities.||Mostly met||61 of the 76 disclosure cases dealt with in 2008-09 were closed. Four of the cases resolved were of a serious nature including one that involved potentially life-threatening behaviour and required immediate intervention.
|
The Office took another step towards ensuring the effectiveness of our procedures and processes through the pioneering of an informal case resolution approach premised on the principle that a formal investigation is not always the most effective/productive means of dealing with cases.
The Office once again reported case statistics and performance to Parliament and the public through the Annual Report.
|Reprisal complaint resolutions.||All reprisal complaints dealt with on a high-priority basis and resolved in a timely manner.||Mostly met||Of the 23 reprisal complaints dealt with in 2008-09, only 2 remain active.|
|Public Servants are confident they are protected from reprisals.||Referrals to the Public Servants Disclosure Protection Tribunal Canada.||As required.||Successfully met||All closed reprisal files were concluded after an admissibility review or an investigation in accordance with the PSDPA and did not warrant referral to the Public Servants Disclosure Protection Tribunal Canada.|
|Effective and credible PSIC organization.||Appropriate organizational capacity.||Sufficient resources to meet operational needs and appropriately respond to government requirements.||Mostly met||Although the organization is still in the establishment stage, the Office was able to deliver its core activities through the staffing of key personnel and the usage of service providers. The Office continues to be subject to limited internal capacity and in-house expertise.|
|Effective and efficient management and oversight of corporate resources.||Effective and economically-delivered corporate services.||Establishment of appropriate infrastructure and outsourcing agreements to fulfill corporate requirements.||Successfully met||Important advancements were made in the 2008-09 fiscal year including establishing outsourcing arrangements for fundamental corporate services; creating a Departmental Audit Committee made up of external members; putting in place a strong governance framework including advisory committees that support senior management.|
This program activity includes the management of disclosure and reprisal programs, as well as education initiatives and prevention of wrongdoing in the workplace.
Benefits for Canadians: This program activity contributes to safeguarding and fostering confidence in our public institutions. Such confidence is critical to Canada’s reputation and economic well-being.
Lessons learned: Some key guiding principles emerged in the 2008-09 fiscal year from the resolution of four serious cases:
Challenges still persist related to fostering a culture of disclosure in the public service and overcoming the fear of coming forward. The Office plans to increase the focus on outreach activities as well as developing and strengthening partnerships with key stakeholders.
As with other small organizations, the Office continues to face challenges regarding limited in-house expertise, shortage of qualified personnel and the capacity to deal with all government requirements. The Office plans to pursue a human resources strategy centered on renewal and ongoing training as well as leveraging external experts when necessary. The Office will also develop a multi-year corporate risk mitigation strategy. | https://www.tbs-sct.canada.ca/dpr-rmr/2008-2009/inst/nd4/nd402-eng.asp |
Getting children back to school safely
As the upcoming school year approaches, our government has released a plan to ensure students in Oakville and Ontario get the education they need and deserve.
Parents have been waiting patiently for a plan, and with the recent trends heading in the right direction and with reports by medical experts, our government is allowing for in-class learning to resume in September.
The back to school plan follows the detailed advice from Canada's leading medical and scientific experts — including the Chief Medical Officer of Health, the Hospital for Sick Children, and the COVID-19 Command Table — and establishes guidelines for a safe return to school. The approach is differentiated for elementary and secondary school students.
Our plan includes reopening all public elementary schools provincewide. Students in kindergarten to grade eight will attend five days a week and will be with the same group of students throughout the day.
Secondary schools in Halton have been designated to open under an adapted model. This means high school students in Oakville will learn with class cohorts of approximately 15 students with schedules representing in-person attendance for at least 50 per cent of instructional days.
The other portion of their schedule will involve completing school work remotely.
We understand that each family situation is different and that this is why in-person class attendance is voluntary. School boards will offer remote instruction to those who decide not to attend in person, so they do not fall behind.
Furthermore, the health and safety of all students, teachers, and staff is our number one priority. This is why our government is providing over $300 million in new investments.
From this, among other important initiatives, $30 million will be used for teacher staffing to support supervision and keeping classes small, $50 million to hire up to 500 additional school-focused nurses, and $10 million to support special needs students in the classroom.
The school closures have been a challenge for students who need time to socialize with peers. This plan gets students back to learning with some normalcy while taking precautions to limit exposure.
Getting children back to school safely
A comprehensive and responsible plan in place for a return to classes, writes Stephen Crawford
Opinion10:00 AMOakville Beaver
As the upcoming school year approaches, our government has released a plan to ensure students in Oakville and Ontario get the education they need and deserve.
Parents have been waiting patiently for a plan, and with the recent trends heading in the right direction and with reports by medical experts, our government is allowing for in-class learning to resume in September.
The back to school plan follows the detailed advice from Canada's leading medical and scientific experts — including the Chief Medical Officer of Health, the Hospital for Sick Children, and the COVID-19 Command Table — and establishes guidelines for a safe return to school. The approach is differentiated for elementary and secondary school students.
Our plan includes reopening all public elementary schools provincewide. Students in kindergarten to grade eight will attend five days a week and will be with the same group of students throughout the day.
"The health and safety of all students, teachers, and staff is our number one priority."
Secondary schools in Halton have been designated to open under an adapted model. This means high school students in Oakville will learn with class cohorts of approximately 15 students with schedules representing in-person attendance for at least 50 per cent of instructional days.
The other portion of their schedule will involve completing school work remotely.
We understand that each family situation is different and that this is why in-person class attendance is voluntary. School boards will offer remote instruction to those who decide not to attend in person, so they do not fall behind.
Furthermore, the health and safety of all students, teachers, and staff is our number one priority. This is why our government is providing over $300 million in new investments.
From this, among other important initiatives, $30 million will be used for teacher staffing to support supervision and keeping classes small, $50 million to hire up to 500 additional school-focused nurses, and $10 million to support special needs students in the classroom.
The school closures have been a challenge for students who need time to socialize with peers. This plan gets students back to learning with some normalcy while taking precautions to limit exposure.
Top Stories
Getting children back to school safely
A comprehensive and responsible plan in place for a return to classes, writes Stephen Crawford
Opinion10:00 AMOakville Beaver
As the upcoming school year approaches, our government has released a plan to ensure students in Oakville and Ontario get the education they need and deserve.
Parents have been waiting patiently for a plan, and with the recent trends heading in the right direction and with reports by medical experts, our government is allowing for in-class learning to resume in September.
The back to school plan follows the detailed advice from Canada's leading medical and scientific experts — including the Chief Medical Officer of Health, the Hospital for Sick Children, and the COVID-19 Command Table — and establishes guidelines for a safe return to school. The approach is differentiated for elementary and secondary school students.
Our plan includes reopening all public elementary schools provincewide. Students in kindergarten to grade eight will attend five days a week and will be with the same group of students throughout the day.
"The health and safety of all students, teachers, and staff is our number one priority."
Secondary schools in Halton have been designated to open under an adapted model. This means high school students in Oakville will learn with class cohorts of approximately 15 students with schedules representing in-person attendance for at least 50 per cent of instructional days.
The other portion of their schedule will involve completing school work remotely.
We understand that each family situation is different and that this is why in-person class attendance is voluntary. School boards will offer remote instruction to those who decide not to attend in person, so they do not fall behind.
Furthermore, the health and safety of all students, teachers, and staff is our number one priority. This is why our government is providing over $300 million in new investments.
From this, among other important initiatives, $30 million will be used for teacher staffing to support supervision and keeping classes small, $50 million to hire up to 500 additional school-focused nurses, and $10 million to support special needs students in the classroom.
The school closures have been a challenge for students who need time to socialize with peers. This plan gets students back to learning with some normalcy while taking precautions to limit exposure. | |
Following almost two years of debate, public posting of five drafts, and consideration of 680 comments, IEEE-SA preliminarily approved amendments to its Patent Policy to address these and other questions. IEEE-SA is the developer of the Wi-Fi standards (and thousands of other specifications). It is one of the major standards development venues in the information and communications technology industry, and thus a venue within which the question bears great weight. However, final approval of the amendments was made contingent upon receiving a favorable “Business Review” letter from the U.S. Department of Justice.
In a business review letter, the regulator responds to a detailed explanation and rationale for a proposed action, and indicates whether it would, or would not, be likely to challenge that action if implemented. In this case the DoJ expressed its belief that the proposed actions would be procompetitive rather than restricting competition, and that it would therefore not be inclined to challenge the final approval and implementation of the policy changes. That approval will occur later this month when the proposed policy updates are approved by the IEEE-SA Board of Directors.
The most significant change relates to what would need to occur before the owner of an essential claim could seek an injunction or similar relief that would effectively bar the product vendor from selling its product in the marketplace. Such an action is rightly considered to be a “nuclear option,” for two reasons. First, it provides enormous leverage to the party that is successful in securing the injunction. Normally, the defendant in a civil suit can continue to sell their products until a court determines the related issues, since if the plaintiff wins, it can be made whole with monetary damages. And indeed, the insufficiency of monetary damages to “make the plaintiff whole” is one of the requirements to obtain injunctive relief regardless of the matter in dispute.
But in the case of a product that implements a standard, an injunction is even more powerful, since the vendor cannot make a design changes to avoid infringement – by definition, the patent claim in question is “essential.” Moreover, in the case of an essential claim owned by someone subject to a RAND obligation, the owner has already agreed to extend a license, subject to reaching agreement on the terms of license on RAND terms. If the vendor is willing to pay a fee, but not one that is as high as the owner of the essential claim has demanded, providing injunctive relief feels wrong until a court can determine which one is right.
The current debate has its origins in the many suits filed by almost all of the major mobile device vendors (Apple, Samsung, Microsoft, Motorola, etc.) in recent years as each company fought for the largest share possible of this new, enormous and extremely valuable mobile device market. Mobile devices implement hundreds of standards, and practice inventions represented by thousands of essential claims. The amount considered to be “reasonable” under such a situation is therefore a crucial issue: to the owner of the claim, the economic rewards can be enormous, since billions of devices are being sold. But for the vendor (and for consumers) the prices can add up to a number high enough to price such a device out of reach for consumers, resulting in a situation economists and regulators refer to as “royalty stacking.” In such a context, the definition of “reasonable” becomes one of great significance, as well as the subject of vigorous debate.
The situation has become exacerbated by the proliferation of so-called non-practicing entities (NPEs) that develop, or more often buy, patents for the purpose of asserting them. An NPE has no incentive other than to maximize its return. But a vendor may be willing to accept a lower royalty for a variety of other reasons, such as expanding the market for a product or its share of that market. As a result, the range of opinions on what reasonable should mean, as well as when, if ever, the owner of an essential claim can exercise the nuclear option in court, is wide.
This debate has raged in many quarters. But by informal consensus, many industry players have elected to focus the debate in two standards organizations (the other is ETSI, the European Telecommunications Standards Institute, where it is the European regulators that are pushing for action on this issue). For now, most other standards organizations have been content to stand by to see what approach the IEEE-SA may take.
Therein lies the significance of today’s news. While the combatants that did not get their way in IEEE-SA will certainly try to achieve a different result in other standards organizations, there will be many companies and other stakeholders that will be quite happy if other standards organizations simply follow IEEE-SA’s lead. After all, almost all of the major ICT vendors were involved in the debate. And the DoJ has blessed the final result.
Here are the main changes that were presented to the DoJ:
Injunctive Relief: Crucially, IEEE opted to make securing an injunction as difficult as possible to obtain short of forbidding it entirely. Under the policy amendments, anyone that makes a RAND pledge will be prohibited from seeking injunctive relief until a court, and any appeals that follow, conclude that the vendor has refused to pay a fee that is “reasonable.” As a result, the vendor may continue to sell a standard-compliant product that infringes the plaintiff’s essential claim while it pursues all of its legal remedies to their conclusion. Only then can the plaintiff force the defendant to choose between agreeing to pay a royalty the courts have ruled is reasonable or face an injunction.
Reasonable: Intellectual property rights (IPR) policies have for decades shied away from defining reasonability (or discrimination), leaving negotiations relating to price entirely to the parties involved – and to the courts when they fail to agree. This has resulted in very lengthy and expensive litigation, and court opinions running to the hundreds of pages. IEEE-SA will incorporate language that borrows from these recent rulings in one mandatory, and three important but elective factors to be taken into consideration when determining whether an offer is or is not reasonable. Importantly, the mandatory element states that a “Reasonable Rate” will exclude any premium relating to the fact that a patent claim is essential (e.g., a monopoly premium). The three recommended, but not exclusive elements are as follows:
(1) “[t]he value that the functionality of the claimed invention or inventive feature within the Essential Patent Claim contributes to the value of . . . the smallest saleable Compliant Implementation that practices the Essential Patent Claim”;
(2) “[t]he value that the Essential Patent Claim contributes to the smallest saleable Compliant Implementation that practices that claim, in light of the value contributed by all Essential Patent Claims for the same IEEE Standard practiced in that Compliant Implementation”; and
(3) “[e]xisting licenses covering use of the Essential Patent Claim, where such licenses were not obtained under the explicit or implicit threat of a Prohibitive Order, and where the circumstances and resulting licenses are otherwise sufficiently comparable to the circumstances of the contemplated license.”
Given the highly technical nature of these three factors, and the fact that they are neither mandatory nor exclusive, the IEEE-SA updates will only narrow, rather than eliminate the potential for future disputes.
Any Compliant Implementation: Some vendors had recently sought to state that a RAND pledge should allow them to choose what players in a product chain will have a right to a RAND license and which did not, thereby giving themselves a negotiating advantage in certain circumstances. The updated policy states that anyone in the line of production and sale that might need to practice an essential claim has the right to obtain a RAND license for that purpose.
Reciprocity: It has long been accepted that requiring a licensee to provide a license back of its own essential claims in connection with receiving a RAND license is consistent with a RAND obligation. However, some vendors have sought to receive such a “grant back” license with respect to patent claims in addition to those that are essential under the standard in question. This demand is widely regarded as inconsistent with the concept of reasonability, and the IEEE-SA policy will now codify this interpretation.
While it is hard to overestimate the potential significance of these updates to the IEEE-SA Patent Policy, it is worth remembering that this is not the first time that the IEEE-SA has taken a change to its Patent Policy. In 2008, after an equally energetic and protracted debate, it proposed changes to the DoJ that would allow working group members to state not only whether they would or would not provide a RAND license, but also the actual prices they would charge (a very sensitive issue under antitrust and competition law). VITA requested a business review letter around the same time for a change that would require, rather than simply permit, such disclosure.
The DoJ approved both of those requests. But virtually no other standards organizations ever followed their lead by making a similar change to their IPR policies. Given the level of energy that surrounds the injunction and RAND issue and the fact that the mobile device platform patent wars have largely abated, it may be that man standards development organizations will not rush to update their IPR policies this time as well.
You can find the DoJ press release here, the Business Review letter here, and the archive of update drafts and public comments here.
Update: On February 8 the IEEE Board of Directors approved the updates. A brief press release is here.
Find out what the cybersecurity scare is all about: "Gripping, Suspenseful and Intelligent" | https://www.consortiuminfo.org/intellectual-propery/intellectual-property-rights/dept-of-justice-blesses-ieee-rules-on-injunctions-and-reasonability/ |
I have my LCD brigtness set at -3, the lowest lighting display available, however, it's stiill very bright when we (the audience) sit in the dark. Does anyone make tinted covers to replace the one that came with the D90? Other suggestions?
Thanks
|Sponsored Links|
|
|
|Aug 8, 2009, 6:55 PM||#2|
|
|
Super Moderator
Join Date: Oct 2005
Posts: 7,456
|
|
What sort of audience environment are you shooting in? Do you need the screen on at all?
I've not seen any covers that do this and generally it is not something that would be desirable so keep adding and removing a cover/protector/filter would be a potential problem.
You could look at a security filter that will reduce the angle at which it emits light which might help depending on the answers to the above questions.
|Aug 8, 2009, 9:51 PM||#3|
|
|
Junior Member
Join Date: Apr 2009
Posts: 12
|
|
Why not turn the LCD off in menu settings? Do you need to have it on at all?
|Aug 9, 2009, 4:38 PM||#4|
|
|
Junior Member
Join Date: Dec 2008
Posts: 2
|
|
My audience are hula dancers on stage. The only available light comes from stage lighting while the audience sits in the dark of a auditorium. I set the camera in Program mode, but I'd like to see my shots and make adjustments if necessary to capture (freeze) their turning movements, particularly in the beginning of the show. I know the LCD light bothers the next person sitting next to me--my wife.
|Aug 29, 2009, 8:00 PM||#5|
|
|
Senior Member
Join Date: Aug 2009
Posts: 303
|
|
If you must - after each shot, immediately press the shutter half way down so the picture you just shot will disappear and the lcd will go black. Then take your left hand and cup over the lcd to peek after hitting the play button to further scrutinize your shot. Don't know if that is fast enough for you, but I've shot some theater that way and was constantly worried about bothering others. First of all I tried to move to a place to be less conspicuous. | https://forums.steves-digicams.com/nikon-dslr-57/d90-lcd-brightness-158193/ |
Braiding Sweetgrass: Indigenous Wisdom, Scientific Knowledge, and the Teachings of Plants (2013) was our NYU Reads selection for Fall 2021. Braiding Sweetgrass is a remarkable collection of essays seeking to reconcile science with traditional cultural knowledge. The author, Robin Wall Kimmerer, is a member of the Citizen Potawatomi Nation and is a Professor of Environmental and Forest Biology at the SUNY College of Environmental Science and Forestry, where she also serves as Director of the Center for Native Peoples and the Environment. Woven together, the individual threads of Braiding Sweetgrass form a rich and lyrical meditation on our place in the natural world. Kimmerer’s book tells us how science and traditional cultural knowledge can complement each other as we strive to better understand the environment in which we live.
Spring 2021: Exit West
Exit West: A Novel by Mohsin Hamid (2017) was our NYU Reads selection for Spring 2021. Exit West tells the story of a young couple, Nadia and Saeed, whose escape from their war-ravaged city turns into a global odyssey thanks to a series of secret portals that whisk them away to unknown destinations. Their story opens up questions about borders, migration, love and loss, what it means to be human or a citizen, what it means to be part of a community, and what home means in multiple and shifting contexts. Hamid’s novel provides a vantage point from which to reflect on this particular moment in human history as we grapple with disruptions to our everyday lives.
Fall 2020: Just Mercy
Just Mercy: A Story of Justice and Redemption by Bryan Stevenson (2014) was our NYU Reads selection for Fall 2020. Bryan Stevenson is a professor of criminal justice at NYU School of Law and the founder of the Equal Justice Initiative (EJI). Since 1989 the EJI has provided legal representation to people who have been illegally convicted, unfairly sentenced, or abused in state jails and prisons. Stevenson’s memoir Just Mercy, a film version of which was released in 2019, is both an account of his work with the EJI and a testament to the urgent need to challenge racial and economic injustice and to protect basic human rights for the most vulnerable members of society. In the words of NYU Journalism Professor Ted Conover, writing for the New York Times Book Review, "The message of this book, hammered home by dramatic examples of one man’s refusal to sit quietly and countenance horror, is that evil can be overcome, a difference can be made.” (This New York Times article is also available in NYU Library databases.)
Fall 2019: Educated
Educated: A Memoir by Tara Westover (Random House, 2018) was our inaugural NYU Reads selection in Fall 2019. It is the story of a woman who was raised in a survivalist family in rural Idaho and whose early instruction was not only informal but, in her own words, “erratic and incomplete.” Isolated from mainstream society, she stepped foot into a classroom for the first time at age seventeen and thereafter embarked on a quest for knowledge, teaching herself enough to be admitted to Brigham Young University. Though her first year of college was a challenge on several fronts, Westover succeeded in overcoming the gaps in her education and the difficulties of adapting to a starkly different environment: not only did she graduate magna cum laude from Brigham Young but she went on to earn a Ph.D. in history from Cambridge University. This remarkable and beautifully written memoir explores the transformative power of education; the impact of knowledge on an individual’s search for identity and self-expression; the experience of learning about difference, home, and the world; the pull of family ties; and the value of determination and resilience.
NYU Reads Event Recordings
NYU Writes
November 18, 2019
An evening showcasing the world-class authors of the NYU Creative Writing Program. Jonathan Safran Foer, Terrance Hayes, Yusef Komunyakaa, Nick Laird, Sharon Olds, and Zadie Smith read from recent works of poetry and prose. Hosted by program director Deborah Landau.
Panel on Inequality and Bias
November 25, 2019
This year’s NYU Reads selection raises compelling questions about access and belonging. Questions explored by a panel of distinguished NYU faculty who work in the areas of bias, poverty, and inequality in relation to education, health care, social policy, and diversity and inclusion. | https://www.nyu.edu/life/events-traditions/nyu-reads/past-nyu-reads-selections.html |
Are you trying to find the best Culinary Schools in Old Monroe MO? The culinary industry offers many exciting positions such as being a Food Stylist, Nutritionist or even owning your own fun Bed & Breakfast business.
Earnings are dependent upon where as well as in which kind of establishment one works. The median yearly salary of chefs along with head cooks ends up around $42,490. Most culinary schools give a strong opportunity for acceptance to their school – typically close to 75-80% acceptance rate.
Aspiring cooks and chefs can take courses in high school or via vocational college programs. To be able to work as a head cook, chef, or any other culinary professional, you should complete the formal training curriculum. Training programs in culinary arts can be obtained from culinary arts universities, some that are two-year, or even four-year colleges. | http://www.localcookingclasses.com/culinary-schools-in-old-monroe-mo.html |
Website:
About
Whether using the handcrafted processes of tintype and ambrotype photography to echo our indelible and invariable histories, or the more recent cousin to those techniques, instant film, Matthew Finley strives to connect to the viewer on an intimate and emotional level while at the same time creating conceptual portraiture that is both authentic and beautiful. Working with these moody processes, he is able to create photography-as-object: one of a kind, original pieces.
Based in Los Angeles, Matthew Finley has been a photographer for ten years and is a core member of the Advanced Photography Critique Group at CPW. His work has shown in multiple galleries on the West Coast as well as New Orleans, LA and Cincinnati, OH. His images have also appeared in publications including Fraction Magazine, Shots Magazine, and Plates to Pixels where he won the Juror Award in The Visual Armistice 10th Annual Juried Showcase.
Artist Statement
“My Faded Fantasy”
Using a historic photography process to romanticize the lyrical uncertainty of love.
These images are the equivalents of daydreams—reveries suffused with hope and yearning, desire and loneliness. The floral photographic layers on glass evoke the trance of memory—fluid images at once solid yet unclear, ideal but mysterious. These romantic fantasies are moments that can become lost and leave us solitary just as easily as they can solidify into tangible experience.
In using the wet plate collodion process, I aim to add a sense of humanity—an individual, handmade and flawed quality to the images. Layering the glass plate images in the frame creates depth and a multi-dimensional, sculptural aspect that requires the viewer to peer inside, and also allows the shadows of each layer to play a part on the ones below. These mercurial qualities reinforce just how unpredictable and elusive one’s fantasies and desires can be. | https://lacphoto.org/matthew-finley-featured-lacp-member-october-2017/ |
Deep learning has found two exoplanets that human astronomers missed
The search for planets orbiting other stars has reached industrial scale. Astronomers have discovered over 4,000 of them, more than half using data from the Kepler space telescope, an orbiting observatory designed for this purpose.
Launched in 2009, Kepler observed a fixed field of view for many months, looking for the tiny periodical changes in stars’ brightness caused by planets moving in front of them.
But in 2012 the mission ran into trouble when one of the spacecraft’s four reaction wheels failed. These wheels stabilize the craft, allowing it to point accurately in a specific direction. In 2013, a second reaction wheel failed, leaving the mission in jeopardy.
As a fix, engineers devised a way for the crippled spacecraft to continue gathering data with less precision and more noise. They called this part of the mission K2. Astronomers continued to find new exoplanets in the K2 data, but at a much lower rate than before.
That led them to an interesting possibility. Clearly, the exoplanet signatures must still be present but were being missed because of the extra noise. If someone could find some way to systematically remove this noise and study the resulting signals, then the missed exoplanets could be revealed.
Enter Anne Dattilo and colleagues at the University of Texas at Austin, who have created a deep-learning neural network called AstroNet-K2 that can perform this data analysis for itself. The researchers say it dramatically speeds up the process of mining the K2 data and has even spotted exoplanets that experienced astronomers had missed.
The process of discovering exoplanets involves several stages. First, astronomers must extract the light curves for each star, showing its brightness over time. Then they study each curve to see how it changes over time.
The neural network performs exactly this process and then filters the data set. For example, because exoplanets are tiny relative to their parent star, any light curve with a variation greater than 3% is labeled a binary star system. The variation in light must also be periodic to indicate an exoplanet, so single variations can be ignored too.
In this way, the neural network filters out a large percentage of false positives. “AstroNet-K2 is highly successful at classifying exoplanets and false positives, with accuracy of 98% on our test set,” say Dattilo and co.
When the team put it to work on the noisy K2 data, it immediately discovered two exoplanets. Between December 2016 and March 2017, Mars passed through Kepler’s field of view. The Red Planet is particularly bright compared with the background stars and so introduces all kinds of scattered light and noise, which mask exoplanet signatures.
But while this confused human astronomers, AstroNet-K2 quickly spotted the new exoplanet signatures. The first is a super-Earth-size “puffy” planet with a volatile envelope orbiting a sun-like star every 13 days. It has a surface temperature of about 750 °C.
The second is a rocky super-Earth planet also orbiting a sun-like star but with a period of just three days. So it is much closer and hotter—about 1,400 °C, hot enough to melt aluminum.
This research has the potential to automate much of the work involved in exoplanet hunting. One big advantage is that machine-based discovery does not suffer from the same kinds of biases that humans might show.
So AstroNet-K2 can study different regions of the galaxy in exactly the same way, looking at stars that have formed in different environments. The results should allow astronomers to study how exoplanet populations differ in these areas.
AstroNet-K2 is not perfect, of course. It spots only exoplanet signatures that it has been trained to recognize and ignores anything interesting that could point to new discoveries. So it still needs human oversight.
“Humans are good at recognizing unusual signals that machines will misclassify or not recognize as interesting, which is crucial for discovering interesting and odd facets of the universe,” say Dattilo and co. So astronomers needn’t start looking for new jobs just yet.
Ref: arxiv.org/abs/1903.10507: Identifying Exoplanets With Deep Learning II: Two New Super-Earths Uncovered by a Neural Network in K2 Data
Keep Reading
Most Popular
Toronto wants to kill the smart city forever
The city wants to get right what Sidewalk Labs got so wrong.
Saudi Arabia plans to spend $1 billion a year discovering treatments to slow aging
The oil kingdom fears that its population is aging at an accelerated rate and hopes to test drugs to reverse the problem. First up might be the diabetes drug metformin.
Yann LeCun has a bold new vision for the future of AI
One of the godfathers of deep learning pulls together old ideas to sketch out a fresh path for AI, but raises as many questions as he answers.
The dark secret behind those cute AI-generated animal images
Google Brain has revealed its own image-making AI, called Imagen. But don't expect to see anything that isn't wholesome.
Stay connected
Get the latest updates from
MIT Technology Review
Discover special offers, top stories, upcoming events, and more. | https://www.technologyreview.com/2019/04/01/136239/deep-learning-has-found-two-exoplanets-that-human-astronomers-missed/ |
The search for exoplanets, planets outside the Solar System, has been one of the great challenges for astronomers in recent times, although it is not proving to be an easy mission.
In an article in Astrobiology, Schulze-Makuch and his team identified 24 exoplanets with characteristics that are very favourable to life or even better than those of Earth, thanks to data from the Kepler mission.
Of the more than 4,000 exoplanets found so far, some were considered theoretically habitable.
These planets, outside our Solar System, are located in the habitable zone, i.e. at a distance from their Sun that allows the presence of water in the liquid state (without freezing or boiling) and are 10% larger than the Earth.
However, it should be pointed out that habitability does not mean that these planets certainly already host life forms, but simply that they have the favourable conditions for its future development.
To get an idea, following these criteria, besides the Earth, our Solar System hosts two other potentially habitable planets: Venus and Mars.
The 24 main “superhabitable” planets are all more than 100 light years away.
Importance of the Sun for the exoplanets
In this selection, the star (or Sun) on which they orbit is of great importance.
Assuming that an orbit around a G-type star, such as the Sun, would be the best place to find a habitable planet, the researchers have, however, elaborated the research according to other evaluations.
Stars like our Sun only have a life span of about eight to ten billion years and it took four billion years for complex life forms to evolve on Earth.
“The Earth is habitable because it is large enough to be geologically active, with a protective magnetic field and enough gravity to hold an atmosphere.
A K-type dwarf star, on the other hand, would be colder and less massive than the Sun, but would last up to 70 billion years, allowing a much longer time for life to emerge and develop.
This is why researchers have focused in particular on those planets that revolve around dwarf stars K, which are less massive, less bright and a little colder but have a longer life span.
This condition gives life more time to evolve, while the larger size of the planet offers more living space.
According to the team, if a planet were ten percent larger, it would have more space to live on.
If it were 1.5 times more massive than the Earth, its interior would retain more heat from radioactive decay, remain active longer and maintain its atmosphere longer.
Also, if a planet was five degrees Celsius warmer than the Earth and had more water, it would enjoy the biodiversity of a tropical rainforest in much of the planet.
The team states that none of the 24 planets found have all these characteristics, but one has four of the critical factors.
The exoplanet KOI-4878.01
Currently the best candidate to host life is KOI-4878.01, an exoplanet orbiting the main sequence star type F KOI-4878.
It is located approximately 1075 light years (329 parsecs) from Earth.
The characteristics of the planet are very similar to those of the Earth, and if confirmed, it would have an Earth Similarity Index (ESI) rating of 0.98 or 98%, which would make it one of the most Earth-like planets found.
The orbital period of the exoplanet is about 449 Earth days. | https://atargatis.news/science/found-more-than-20-exoplanets-that-could-host-life/ |
Huh?
CIA General Counsel Speech on Hypothetical Uses of Force
by Deborah Pearlstein
Opinio Juris, 12 April 2012
The speech delivered by CIA General Counsel Stephen Preston at Harvard yesterday is important and illuminating, and I agree with Ken the administration should be commended for it. But wow does it raise some troubling questions about how the CIA understands the legal authority for and constraints on its drone operations. There’s too much to unpack in it for one blog post, and I’d urge those who follow these interests to read it for themselves. Meantime, I’ll start with two issues: (1) the CIA’s understanding of its domestic authority to use force; (2) the CIA’s understanding of whether/how international law constrains its actions.
Domestic authority. Preston correctly explains that the CIA must have some source of authority under domestic U.S. law to carry out “hypothetical” activities involving the use of force abroad. In this inquiry, of course, international law is irrelevant. And I don’t read Preston to suggest that international law can give the U.S. government powers it does not otherwise possess under our own Constitution and laws. So what gives the CIA its authority to carry out drone strikes? Here’s Preston:
“First, we would confirm that the contemplated activity is authorized by the President in the exercise of his powers under Article II of the U.S. Constitution, for example, the President’s responsibility as Chief Executive and Commander-in-Chief to protect the country from an imminent threat of violent attack. This would not be just a one-time check for legal authority at the outset. Our hypothetical program would be engineered so as to ensure that, through careful review and senior-level decision-making, each individual action is linked to the imminent threat justification.
A specific congressional authorization might also provide an independent basis for the use of force under U.S. law.
In addition, we would make sure that the contemplated activity is authorized by the President in accordance with the covert action procedures of the National Security Act of 1947, such that Congress is properly notified by means of a Presidential Finding.”
Several points. Preston leads with – giving the impression that it does not only some but significant lifting in authorizing CIA actions – the President’s power under Article II of the Constitution. The non-reliance on Article II as an independent font of authority in U.S. counterterrorism operations – as opposed to statutory authorizations with specific limits – has been one of the central ways in which the Obama Administration has distinguished itself from the Bush Administration, which claimed sweeping authorities under Article II. So seeing it feature prominently here is striking. There are, important to emphasize, important differences between this invocation of Art. II power and Bush’s. Preston cites the President’s Art. II power to, as the framers put it, “repel sudden attacks.” There are few who would doubt the existence of such a power, and the Supreme Court has recognized it in various ways back to the Civil War era Prize Cases. This is in principle a narrower claim of authority under Article II than the (Bush) claim that Article II generally gives the President the power to detain people, interrogate them, and tap their phones as long as we’re in a state of armed conflict. How much narrower? Narrower at all? It depends a heck of a lot on what counts as “an imminent threat of violent attack.” How imminent does it have to be? Something more clear and specific than the general state of threat we face from, e.g., Al Qaeda? If a generalized threat from a group that’s attacked us at some point in the past is enough, then I confess I’m not sure how to distinguish this from the Bush-era understanding of Art. II.
Presumably Preston fronts the Art. II authority in part because CIA thinks that the statutory powers on the books don’t suffice to authorize all of the uses of force the CIA has carried out under its drone program. Indeed, the list of powers, Constitutional and statutory, is framed strangely. Preston says CIA first would make sure the action is authorized by the Constitution. And then notes, in quite different terms, “also” or “in addition” that statutory authority might exist. As if CIA doesn’t actually see the statutes as independent sources of authority. Do we take from this that CIA sees all of its use of force authority as coming from Article II, and the statutes on the books are just regulations, not themselves relevant sources of authority?
In particular, Preston doesn’t mention the 2001 AUMF expressly (which all 3 branches of government have interpreted as authorizing a global war against Al Qaeda). I can imagine 2 reasons why he might not want to get into the AUMF. One, the force authorized by that statute is limited to the groups who attacked us on 9/11, and some of the CIA’s targeting operations (it appears from press reports) have been aimed at individuals or groups who are only very arguably connected to those attacks. Is Al Shabab, for example, born as a domestic Somali insurgent group, really one of the organizations Congress meant to reach in its 2001 AUMF? Dicey to claim so. But we seem to be targeting some of their members anyway. Two, the administration has taken the position in court and elsewhere that international law, including the law of armed conflict, should inform the interpretation of (and, it would seem, constrain the use of) what force is authorized under the AUMF. But the CIA seems to have a different view of the applicability of LOAC, on which more below. So I can see why they wouldn’t want to rely on AUMF if they can help it. Which brings us to…
International law. Is there anything in international law – law of war or customary international law – that the CIA thinks it is bound to comply with as a matter of law (as opposed to, say, sensible policy or practice)? My read of this speech is that the answer is no. I would be very happy to be contradicted. The key sentences are described as a question of “compliance in execution with reference to international law principles.” And I’m not sure what the word “principles” is doing in there except to soften the notion that many of the relevant rules that might apply are simply law – indeed, when it comes to treaties the United States has signed and ratified, “supreme law of the land” under the Constitution. Here’s the relevant paragraph in its entirety:
“Here, the Agency would implement its authorities in a manner consistent with the four basic principles in the law of armed conflict governing the use of force: Necessity, Distinction, Proportionality, and Humanity. Great care would be taken in the planning and execution of actions to satisfy these four principles and, in the process, to minimize civilian casualties.”
If the past decade has taught us anything, I’d kinda think it’s this: Pursuing a policy “in a manner consistent with” the law is not the same as pursuing a policy that is bound by the law. So what’s going on? And now we enter the realm of pure speculation, but I guess that’s what blogs are for. So here’s what I imagine. I imagine that the CIA is targeting two kinds of people: (1) those it believes are participating in the armed conflict the United States has defined (i.e. a war against Al Qaeda and associated forces), and (2) those who are not plausibly understood as part of that armed conflict.
If the United States is targeting people in category (1), we are bound, as a matter of law, to comply with the law of armed conflict, which of course include, as a matter of law, the Geneva Conventions containing the rules Preston lists. We may well be complying with those rules – both the military and the CIA – that is, for example, not violating rules of proportionality in targeting. But even if we are complying with those rules – and boy do I wonder if and to what extent the CIA agents are trained in them – if agents of the CIA are pulling the trigger, I would think they may then be subject to criminal prosecution by domestic or foreign (or, if a tribunal with jurisdiction came to exist, international) courts for unlawful acts of violence they commit as unprivileged belligerents. CIA civilians are not members of our armed forces, and do not otherwise (as far as I know) meet the criteria under GCIII, Article 4 to lawfully participate in hostilities. So I can see why the CIA might be loath to acknowledge the applicability of these rules as law. But apply as law they do.
As a matter of international law – specifically, the UN Charter, to which we are a party, and which Preston cites – the United States may not lawfully target people in category (2) (i.e. those not part of our already quite broad armed conflict) unless it is exercising the “inherent right of individual or collective self-defence if an armed attack occurs …, until the Security Council has taken measures necessary to maintain international peace and security.” In the clearest summation of what the United States thinks that means that I’ve seen of late, Preston says that right includes, “for example, [where] the United States has already been attacked, and its adversary has repeatedly sought to attack since then and is actively plotting to attack again, then the United States is entitled as a matter of national self-defense to use force to disrupt and prevent future attacks.” Now there’s a ton to say solely on the question of whether this is a fair interpretation of the right of self-defense. But let’s assume for the moment it is. The rules that govern the exercise of that use of force in self-defense – i.e. how much force can you use, against whom, under what circumstances, etc. – are not only “principles.” They are customary international law, even by, I’d long thought, the estimation of our own government. So why not just say, at the very least, the CIA is bound by the customary international law of “Necessity, Distinction, Proportionality, and Humanity” governing the use of force? On this point, I have reached the limit of my imagination.
Phi Beta Iota: We do not make this stuff up. | https://phibetaiota.net/2012/04/mini-me-cia-chief-lawyer-on-cias-authorities-to-use-force-around-the-world/ |
Angela is a character in Thor: The God Butcher. Most of Angela's comic-book history was adapted into Hela in Thor: Ragnarok, so much of Angela's backstory from the comics is non-existent. She is portrayed by Rebecca Ferguson.
BiographyEdit
Angels and Elves Edit
In the days under Burri's reign over Asgard, each of the Ten Realms ruled themselves individually with no realm having any supremacy over another. Freyja- the Queen of Angels- ruled over Heven, the Tenth Realm alongside her wife Sera. Alfheim- the realm of the Fey- was ruled by Queen Aelsa Featherwine and her husband Ivory Honeyshot. Each realm even had their own Bifrost Bridge created by The Tesseract, but only Asgard's and the ruins of Heven's remained after Odin and Hela invaded the others.
The War of Angels Edit
The Fey controlled a powerful Dwarvish weapon: Jarnbjorn- a mystical sword. The weapon had the power to wound the cosmos itself. The Angels wanted to rule over the other Nine Realms and the sword was their best bet. Queen Freyja declared war on Alfheim and the angelic armies invaded the realm of Light Elves. Queen Aelsa brought the wrath to the invaders. An army of giant winged cats, Faeries, Pixies, Unicorns, Mermaids, and Light Elves- a overall title for the various breeds of Elf that rule the land. The Angelic armies put up a fight but were battered down by the Fay. Freyja kidnapped Aesla's infant daughter Aldrif and threatened to kill her unless Alfheim surrendered and handed over Jarnbjorn. Despite the heart wrenching loss, Aelsa would not give up the weapon to the evil army. As a result, Freyja stabbed the baby. After this, the Asgardians interfered- breaking sacred law. King Burri repelled the Angels back to Heven before using Jarnbjorn combined with all his willpower to sever Heven off of Yggdrasil. The act killed him in the process and a rift was created bound to the core of Asgard, meaning without Asgard Heven would remerge from the rift and rebind itself to Yggdrasil. During the Asgardian Intervention, Freyja took the dying child back to Heven with her, while the immortal Aelsa ruled in despair for thousands of years. Heven was cut from the cosmic nimbus and it drifted into a pocket dimension. Freyja told the baby that the blade she used wasn't a blade of death, but a blade of Hel. She told baby Aldrif that she would be corrupted soon enough. Freyja raised Aldrif as a weapon to incite revenge against the Nine Realms. She renamed Aldrif Angela and the Helish power grew inside her.
A Suffering Edit
On a moon of Heven, an unnamed race lived. One of them was called Gorr. He prayed to the Angels and the other gods of the Ten Realms. They didn't answer his prayers and his wife was killed in the quakes that occurred when Heven was being severed from Yggdrasil. His children starved to death when the other animals died in the shift. Gorr survived and now believed there was no gods. He went to Heven and began killing Angels and killing gods. Around this time, Asgard was destroyed during Ragnarok by Surtur and Heven began breaking through the rift. Heimdall sensed this occurring and when Heven broke through, millions of butchered Angels floated in space. Gorr killed every Angel, but one survived- Angela. Angela made it aboard the Statesman and attempted to murder Thor when she found out he was Asgardian. Angela would later be reconnected with her mother Aelsa who thought Angela would be glad to see her. She was wrong. | https://movie-ideas.fandom.com/wiki/Angela |
Welcome Visitor.
HOME
James May's Toy Stories
2009-2012
Ended/Cancelled
News
|
DVDs
|
Images
Show Summary
See all DVDs
James May is a man on a mission: he wants to get kids out of their bedrooms and away from their games consoles, he wants to drag parents off their backsides and get them all playing together again.
In James May's Toy Stories on BBC Two, he is going to take some of Britain's best-loved toys and put generations of families at the heart of some ludicrously ambitious adventures that will remind us all of the joys of making something together, with toys that have long captured the imagination.
Proving the best toys don't always need batteries, James's madcap toy adventures will see him using some of the best-loved toys of our generation, and reminding everyone that there's a big kid in all of us.
Main Cast
James May
as Presenter [S 1]
Show Details
Premiered on Network:
BBC-2 in UK
Genres:
Documentary
Language:
english
Runtime:
60 mins
Official Website
/
IMDB-Link
Latest News
No news entries yet
»
More News
Episode Guide
|
Plot Guide
|
Music Guide
Guide available in:
Choose Season:
1
|
All Seasons
#
Ep. No.
Episode Title
Prod #
Available Info
iTunes DL
Broadcast
Comments
1
1x01
Airfix
P
D
W
C
|
edit
2009-10-27
Discuss episode!
2
1x02
Plasticine
P
D
W
C
|
edit
2009-11-03
Discuss episode!
3
1x03
Meccano
P
D
W
C
|
edit
2009-11-10
Discuss episode!
4
1x04
Scalextric
P
D
W
C
|
edit
2009-11-17
Discuss episode!
5
1x05
Lego
P
D
W
C
|
edit
2009-12-20
Discuss episode!
6
1x06
Hornby
P
D
W
C
|
edit
2009-12-27
Discuss episode!
7
Special
The Great Train Race
P
D
W
C
|
edit
2011-06-12
Discuss episode!
8
Special
Flight Club
P
D
W
C
|
edit
2012-12-24
Discuss episode!
9
Special
The Motorcycle Diary
P
D
W
C
|
edit
2014-01-03
Discuss episode!
Choose Season:
1
|
All Seasons
General Info:
Click on the episode names to get more information about them.
Legend:
P
Plot Outline present.
D
Director of episode present.
W
Writer of episode present.
C
Cast information available.
M
Music information present.
N
Additional Notes present.
Guide available in: | http://www.episodeworld.com/show/James_Mays_Toy_Stories |
Beware of my review of Crimson Peak!
Crimson Peak is a movie that I have been looking forward to all year. It tells the story of Edith Cushing, an aspiring writer who is swept off her feet by London aristocrat Thomas Sharpe. Once she becomes Mrs. Sharpe, Edith moves to London to live in Allerdale Hall with Thomas and his sister Lucille. However, a house as old and decrepit as Allerdale Hall is bound to be riddled with secrets written in blood.
This is the latest film from Gulliermo del Toro, the creator of my all-time favorite film Pan’s Labyrinth. Since PL, Del Toro took a step back from creating gothic stories of his own and turned his attention to being a producer of Don’t Be Afraid of the Dark (2010) and Book of Life (2014), as well as directing the second Hellboy film (2008) and Pacific Rim (2013).
After a few days of prayer and going over my review notes, I have come to the conclusion that Crimson Peak is a visually stunning canvas that highlights Del Toro’s strengths, as well as his two major weaknesses.
The Hits
A few months ago, I learned that Del Toro actually had the mansion built and even used his own salary to keep it from being demolished. His dedication is on full display. Allerdale Hall is the personification of horrific secrets. Red clay oozes through the house like a silenced prisoner struggling to break free. A gaping hole in the ceiling allows leaves and snow to fall to the floor, symbolizing the tears of the past victims of Allerdale. Creaking staircases, a rickety elevator and a lower level with blood decorating the walls create an atmosphere of death’s final sting. Del Toro’s vision of Allerdale is a nightmare fully alive.
During the second act, there are three sequences where Edith wanders the house to investigate. The danger here is that the scenes can become repetitive, but luckily the movie doesn’t fall into this trap. Each exploration scene contains new information on the ghosts that haunt Thomas and Lucille’s home. Edith discovers something different, making the three sequences feel purposeful.
The assembled cast is excellent. Tom Hiddleston and Jessica Chastain have a terrifying chemistry as brother and sister, while Mia Wasikowska carries the film with sharp intellect and vulnerability. During production, Del Toro gave each actor a ten-page biography of their character, and it shows in their performances. Unlike a certain film that I reviewed recently where indecisive directing resulted in confused performances (I’m looking at you, Pan!), everyone knows exactly who they are and how to convey their characters’ motivations to the audience.
The Misses
I mentioned earlier that Del Toro has two major weaknesses that are clear as day in this film.
In my Pan’s Labyrinth review, I pointed out that there is a major continuity error that occurs after Ofelia completes the first task. It doesn’t ruin the movie, but it does show that Del Toro needs more practice on bridging continuity gaps.
In Crimson Peak, there is one major narrative flaw that is concerning. Edith’s ability to see ghosts is not the reason Thomas marries her, nor is it the reason why [SPOILER] Lucille wants her dead.
This is a problem because Edith’s special gift and her relationship with the Sharpes are the two most important elements of the story. If these two components have nothing to do with each other, if the story could go on without one of these two plot points (in this case, the ghost-whispering thing), then something is wrong with the story structure. The second narrative weakness is that Del Toro is not good at plot twists. My friends and I could correctly guess the “twist” long before the third act’s big reveal. I mean, Guillermo, you made Pan’s Labyrinth HOW long ago (2006) and you still don’t know how to properly connect gaps in your story?
Crimson Peak is a fascinating gothic romance that pays homage to the genre. At the same time, it also shows eyebrow-raising missteps that would concern any Del Toro fan. Here’s to the hope that good-ole Guillermo catches his own mistakes and works on improvement for future features.
Bonus Features: Pan’s Labyrinth Callbacks (SPOILERS ahead)
Sometimes directors will use symbols and images in a current film to refer to a previous film that they made. I figured that Pan’s fans like myself would enjoy these callback trinkets.
- Crimson Peak opens with Edith staring into the camera while holding up her bloodied hand, which is similar to Pan’s Labyrinth prologue.
- The majority of the nighttime scenes are shot with a turquoise color palate and not the traditional midnight-blue color palate.
- Edith’s father uses the exact same razor that Captain Vidal uses during his [Vidal’s] character-defining shaving scene. Also the mirror he uses is Vidal’s shaving mirror.
- The wheelchair that Edith uses towards the end of the first act looks oddly identical to Carmen’s wheelchair in PL.
Saint Elizabeth of Hungary, pray for us. | https://catholicgirlbloggin.net/tag/gulliermo-del-toro/ |
Based out of their Hong Kong office, Leeder will work on the development of Asian film, TV and new media starting with two new TV projects A Martial Arts Journey and Tracking The Dragon as well as showcasing the company’s current portfolio of Asian and International content worldwide.
Leeder’s role will involve further establishing 108 Media’s Asian offering as it continues to invest and innovate new ways to maximise the value and reach of its content portfolio. 108 Asia, located in Tokyo, has an extensive platform agnostic distribution channel across Asia, with a primary focus on underserved territories and emerging markets.
Receive up-to-date news by
signing up to our weekly digest. | https://tva.onscreenasia.com/2016/02/108-media-partners-with-mike-leeder/ |
Project Summary/Abstract A vast effort to examine peripheral and central brain circuits underlying external senses such as vision, hearing and touch hearing has yielded broad insights and fueled development of diverse sensory rehabilitation therapies. In contrast, a similar mechanistic understanding of how the brain receives and attends to signals from inside the body is sorely lacking. This is surprising given the growing awareness of the central roles of body-brain communication in a broad range of diseases spanning neurology, psychiatry, and general medicine (e.g. depression and anxiety disorders; autism spectrum disorder; sickness behaviors during peripheral states of infection/inflammation such as fatigue, decrease consumption, social isolation, and anhedonia; eating disorders and obesity; cardiovascular diseases, gastrointestinal diseases, sleep apnea and other respiratory disorders, itch, acute and chronic pain, irritable bowel syndrome, and natural and chemotherapy-induced nausea and vomiting). A roadmap of the specific circuits governing our perception and selective attention to these body signals could give rise to a host of precisely targeted clinical therapies. However, major technological challenges have limited the possibility of well-controlled studies of internal sensation, perception and attention in animal models. Here, I propose to overcome these technical barriers to establish a platform that will enable our lab and others to gain a detailed circuit-level understanding of interoception ? the process of attending to and perceiving internal bodily signals ? and how this process is disrupted across a range of diseases. I will use my expertise in innovating new strategies for studying the circuit-level basis of visual, auditory and tactile perception to develop a multi-level platform for studying interoception in behaving mice. In particular, we will overcome the following key challenges. First, we will develop a novel operant behavioral paradigm in which head-restrained mice learn to report specific threshold-level body signals. To accurately measure thresholds for perception of specific body signals, we will optogenetically stimulate specific genetically-defined sets of vagal afferent neurons that relay signals from specific body organs (e.g. lung stretch or gut nutrient signals) to the brain. By stimulating at various intensities, we will estimate interoceptive perceptual thresholds, how these thresholds improve with learning (similar to mindfulness and meditation training) and how they worsen in the presence of competing external stimuli (e.g. a flashing cell phone). We will then begin to dissect the neural circuits that gate central processing of specific vagal signals. To this end, we will combine the above behaviors with new approaches for optogenetic manipulation and two-photon calcium imaging of (i) central terminals of vagal afferents, (ii) brainstem serotonergic inputs to regulating vagal afferent transmission and (iii) neurons in insular cortex (implicated in interoceptive attention in humans). Together, this powerful genetic model system will provide a much-needed link between cellular, circuit and behavioral studies of interoception in health and disease.
| |
The goal here is to determine how many roots there are in a nonlinear function we are interested in solving. For this example, we use a cubic polynomial because we know there are three roots.
function main
clc; clear all; close all;
Use roots for this polynomial
This ony works for a polynomial, it does not work for any other nonlinear function.
roots([1 6 -4 -24])
ans = -6.0000 2.0000 -2.0000
Plot the function to see where the roots are
x = linspace(-8,4); fx = x.^3 + 6*x.^2 - 4*x - 24; plot(x,fx)
method 1
count the number of times the sign changes in the interval. We determine the sign of each element (-1, 0 or +1) and then use a a loop to go through each element. A sign change is detected when an element is not equal to the previous element. Note this is not foolproof; we may over count roots if we get a sequence -1 0 1. We check for that by making sure neither of the two elements being compared are zero.
sign_fx = sign(fx); count = 0; for i=2:length(sign_fx) if sign_fx(i) ~= sign_fx(i-1) && sign_fx(i) ~= 0 && sign_fx(i-1) ~= 0 count = count + 1; disp(sprintf('A root is between x = %f and %f',x(i-1),x(i))) end end disp(sprintf('The number of sign changes is %i.',count))
A root is between x = -6.060606 and -5.939394 A root is between x = -2.060606 and -1.939394 A root is between x = 1.939394 and 2.060606 The number of sign changes is 3.
method 1a
this one line code also counts sign changes. the diff command makes all adjacent, identical elements equal zero, and sign changes = 2 (1 - (-1)) or (-1 - 1). Then we just sum up the diff vector, divide by two, and that is the number of roots. Note that no check for 0 is needed; you will get 1/2 a sign change from -1 to 0. and another half from 0 to 1. They add up to a whole sign change.
sum(abs(diff(sign_fx))/2)
ans = 3
Discussion
Method 1 is functional but requires some programming. Method 1a is concise but probably tricky to remember.
Method 2
using events in an ODE solver Matlab can identify events in the solution to an ODE, for example, when a function has a certain value, e.g. f(x) = 0. We can take advantage of this to find the roots and number of roots in this case. | http://matlab.cheme.cmu.edu/2011/09/10/counting-roots/ |
A twist on the classic French Charlotte, a savory version stuffed with smoked chicken, cheese and oregano and topped wtih a yogurt mustard sauce. The charlotte and sauce are only 231 calories per serving.
In my continuing quest to create dishes that are low in calorie but still high in flavor, I took my inspiration from a classic French dessert, the Charlotte. The traditional charlotte is usually something very sweet molded inside of either sweetened bread, sponge cake or biscuits. I modified this concept to create a savory version filled with smoked chicken, herbs and cheese and topped with a yogurt mustard sauce. The whole dish, with a salad and fruit is under 300 calories. It’s perfect for a Sunday brunch or any meal.
Chop the chicken into very small pieces and place in a bowl. Add cheese, 1/4 cup egg substitute, onion, salt and pepper. Mix thoroughly and set aside.
Using the biscuit cutter, cut the centers from all 8 slices of bread. Set the centers aside. Chop the remaining pieces of bread into small pieces and set aside.
Cut a 10” piece of wax paper from the roll. Cut 4 strips 2 ½” wide down the length of the wax paper (you’re cutting lengthwise so that the strips curl naturally). Spray the inside of each ramekin with cooking spray. Spray the inside of each strip of wax paper and then place inside inside of the ramekin with sprayed side exposed.
Pour the remaining egg substitute into a flat bottomed bowl, like a pie pan. Lightly dip the top and bottom of 4 of the bread rounds into the mixture and place into the bottom of each ramekin (you don't want to soak up all of the egg substitute). Lightly dip the remaining rounds into the mixture and set them aside. Put the chopped bread pieces into the bowl to soak up the remaining mixture and mix together with your hands. Divide the mixture into four portions. With each portion, press the bread into the sides of the ramekin to form a crust just to the top of the ramekin. Fill each with 1/4 of the chicken mixture and then top with the remaining round.
Put ramekins on a cookie sheet and place in the oven for 20-25 minutes. Meanwhile, make the sauce by combining yogurt, chicken stock and mustard. Leave at room temperature.
Remove ramekins from the oven and let them rest for 5-10 minutes. Carefully remove charlottes from the ramekin and gently pull the wax paper off (there will be a little sticking so be careful).
To serve, invert the charlottes on a bed of greens with sliced cucumbers and drizzle sauce over the top (or place sauce in a smll container and let your guests pour it on for themselves). I also served fresh strawberries on the side.
Calories per serving: charlottes alone: 221, sauce: 10, salad with cucumbers: 17, strawberries: 49. Total per serving: 297 Calories. | https://www.nbcchicago.com/on-air/as-seen-on/Sweet-Charlotte-Becomes-Savory-And-Low-Calorie-64335982.html |
Clarifiying complex chemical processes with quantum computers
IMAGE: Future quantum computers will be able to calculate the reaction mechanism of the enzyme nitrogenase. The image shows the active center of the enzyme and a mathematical formula that is...
view more
Credit: ETH Zurich
Specialists expect nothing less than a technological revolution from quantum computers, which they hope will soon allow them to solve problems that are currently too complex for classical supercomputers. Commonly discussed areas of application include data encryption and decryption, as well as special problems in the fields of physics, quantum chemistry and materials research.
But when it comes to concrete questions that only quantum computers can answer, experts have remained relatively vague. Researchers from ETH Zurich and Microsoft Research are now presenting a specific application for the first time in the scientific journal PNAS: evaluating a complex chemical reaction. Based on this example, the scientists show that quantum computers can indeed deliver scientifically relevant results.
A team of researchers led by ETH professors Markus Reiher and Matthias Troyer used simulations to demonstrate how a complex chemical reaction could be calculated with the help of a quantum computer. To accomplish this, the quantum computer must be of a "moderate size", says Matthias Troyer, who is Professor for Computational Physics at ETH Zurich and currently works for Microsoft. The mechanism of this reaction would be nearly impossible to assess with a classical supercomputer alone - especially if the results are to be sufficiently precise.
One of the most complex enzymes
The researchers chose a particularly complex biochemical reaction as the example for their study: thanks to a special enzyme known as a nitrogenase, certain microorganisms are able to split atmospheric nitrogen molecules in order to create chemical compounds with single nitrogen atoms. It is still unknown how exactly the nitrogenase reaction works. "This is one of the greatest unsolved mysteries in chemistry," says Markus Reiher, Professor for Theoretical Chemistry at ETH Zurich.
Computers that are available today are able to calculate the behaviour of simple molecules quite precisely. However, this is nearly impossible for the nitrogenase enzyme and its active centre, which is simply too complex, explains Reiher.
In this context, complexity is a reflection of how many electrons interact with each other within the molecule over relatively long distances. The more electrons a researcher needs to take into account, the more sophisticated the computations. "Existing methods and classical supercomputers can be used to assess molecules with about 50 strongly interacting electrons at most," says Reiher. However, there is a significantly greater number of such electrons at the active centre of a nitrogenase enzyme. Because with classical computers the effort required to evaluate a molecule doubles with each additional electron, an unrealistic amount of computational power is needed.
Another computer architecture
As demonstrated by the ETH researchers, hypothetical quantum computers with just 100 to 200 quantum bits (qubits) will potentially be able to compute complex subproblems within a few days. The results of these computations could then be used to determine the reaction mechanism of nitrogenase step by step.
That quantum computers are capable of solving such challenging tasks at all is partially the result of the fact that they are structured differently to classical computers. Rather than requiring twice as many bits to assess each additional electron, quantum computers simply need one more qubit.
However, it remains to be seen when such "moderately large" quantum computers will be available. The currently existing experimental quantum computers use on the order of 20 rudimentary qubits respectively. It will take at least another five years, or more likely ten, before we have quantum computers with processors of more than 100 high quality qubits, estimates Reiher.
Mass production and networking
Researchers emphasise the fact that quantum computers cannot handle all tasks, so they will serve as a supplement to classical computers, rather than replacing them. "The future will be shaped by the interplay between classical computers and quantum computers," says Troyer.
With regard to the nitrogenase reaction, quantum computers will be able to calculate how the electrons are distributed within a specific molecular structure. However, classical computers will still need to tell quantum computers which structures are of particular interest and should therefore be calculated. "Quantum computers need to be thought of more like a co-processor capable of taking over particular tasks from classical computers, thus allowing them to become more efficient," says Reiher.
Explaining the mechanism of the nitrogenase reaction will also require more than just information about the electron distribution in a single molecular structure; indeed, this distribution needs to be determined in thousands of structures. Each computation takes several days. "In order for quantum computers to be of use in solving these kinds of problems, they will first need to be mass produced, thereby allowing computations to take place on multiple computers at the same time," says Troyer.
Disclaimer: AAAS and EurekAlert! are not responsible for the accuracy of news releases posted to EurekAlert! by contributing institutions or for the use of any information through the EurekAlert system. | |
More than half of 5,000 Galveston County families displaced by Hurricane Ike and given federal vouchers to rent homes or apartments are still living in hotels or with relatives, officials have said. The reason: many apartment managers and owners in a tight housing market prefer not to go to the extra effort to handle housing vouchers.
We urge Governor Perry to use his authority to issue a temporary directive ordering landlords to accept the housing vouchers. Texas hurricane survivors need to get out of hotels and into more stable (and less expensive) housing. State law that provides the Governor exceptional power in the wake of emergencies should afford the Governor the authority he needs to address this crisis. If not, the Texas Legislature could pass emergency legislation in the first days of the upcoming session of the legislature.
It is not enough for state officals to complain about FEMA’s slow pace in providing trailers. The power to address the current housing crisis is in the Governor’s hands and he must act expeditiously. | https://texashousers.org/2008/12/29/governor-perry-must-act-to-let-hurricane-victims-move-into-apartments/ |
The discovery of antibiotics and their widespread availability revolutionised healthcare after the Second World War. They underpin many of the greatest medical advances of the 20th century. But bacteria and pathogens have always evolved to resist the new drugs that scientists invent to combat them. Resistance has increasingly become a problem in recent years because the pace at which we are discovering new antibiotics has slowed drastically, while antibiotic use, and therefore resistance, is rising.
Antimicrobial resistance is a natural process whereby microbes evolve to be able to resist the action of drugs, making them ineffective. Resistance arises from the selection pressure that antimicrobials put on populations of microbes; essentially selecting or allowing those microbes to survive and proliferate, typically through genetic changes. This leads to antibiotics becoming less effective over time and in many extreme cases, ultimately useless.
Although AMR is a naturally occurring process, today it is a threat because of two main reasons. The first is that use of antimicrobials has increased so much in the last few decades that microbes are exposed to a much larger number and greater concentration of antimicrobials increasing their chances of developing resistance. The second is that, worryingly, in some categories of antimicrobials (particularly antibiotics) there are very limited numbers of new drugs under development to replace those rendered ineffective by rising drug resistance. Essentially, the demand for new drugs has increased due to increasing resistance but the supply has dried up leaving us in a precarious position.
The reasons for this problem are at least partly economic and commercial. In the case of antibiotics, the predominance of cheap generics means that prevailing prices are low; unpredictable patterns of emerging resistance make future medical needs (and thus commercial opportunities) hard to predict ; and conservation measures necessary to limit the prescribing of antibiotics would relegate new products to last-line treatments used only when nothing else works. This all leads to antibiotics being seen as commercially unattractive. Economic interventions are thus needed to stimulate investment whilst protecting drugs from unnecessary use.
The global burden of infections resistant to existing antimicrobial medicines is now growing at an alarming pace. Drug-resistant infections are already responsible for more than half a million deaths globally each year. Early research commissioned by the Review suggests that if the world fails to act to control resistance, this toll will exceed 10 million each year by 2050 and have cost the world over 100 trillion USD in lost output.
Resistance is not an isolated phenomenon though the extent of resistance varies across different countries and regions of the world. This variation is often linked to the extent of use in these countries or regions. For instance areas with greater use of antimicrobials are associated with greater levels of resistance. But increasing international travel means that AMR has the capability of spreading globally including to countries that are controlling their antibiotics use effectively. This makes a strong case for international coordination on AMR as no country can protect itself from resistant bacteria unless the world takes action together.
Added to these issues, are the overuse and unnecessary use of antimicrobials for humans and animals which also promote the development and spread of resistance, either directly or through the environment.
Much of the misuse of antimicrobials is associated with the lack of rapid diagnostics that can pin-point the exact nature of the diseases causing microbe. Doctors and prescribers, unsure of the kind of disease affecting their human or animal patient but still needing to provide treatment to them, rely on empirical or treatment with broad-spectrum drugs that may or may not cure the patient but still expose microbes to a variety of drugs increasing the likelihood of resistance developing of these drugs.
Figures suggest that much of the use of antibiotics in the world is for animals rather than humans and that much of this is for promoting the growth of animals rather than treating sick animals. The development and spread of drug resistance in the environment is also often overlooked. Antimicrobials can also reach the environment through waste products from the manufacturing sector that do not adequately treat the waste products and through use and excretion by humans and animals.
The overuse of antimicrobials is also related to high rates of infection and the dependence on antimicrobials as curative treatments, reducing the focus afforded to prudent measures that might prevent an infection in the first place.
AMR is an issue that spans multiple areas and cannot be solved by any one solution. Nor is it an issue that any one country can address successfully by acting alone. Hence a multi-disciplined approach to solving the diverse issues and coordination among various countries is critical. | https://amr-review.org/background.html |
Introduction
============
The hypnotic dose of propofol required for induction of anesthesia, including the type of infusion, has been extensively studied \[[@B1]-[@B5]\], and a series of factors that modify the dose required to achieve hypnosis have been reported \[[@B6]-[@B8]\]. In addition to patient-specific physiological variables affecting the pharmacokinetics of propofol, we previously demonstrated the effect of cardiac output (CO) on the hypnotic dose of propofol \[[@B1],[@B2]\]. Cardiac output was a small but significant variable in predicting the hypnotic dose of propofol, time to hypnosis, and plasma concentration of propofol \[[@B8]-[@B10]\]. Other predictive variables were age and body weight \[[@B11],[@B12]\].
The appearance of the hypnotic effect of propofol depends on its pharmacokinetics and pharmacodynamics \[[@B13],[@B14]\], and CO is one of the parameters used to determined the pharmacological properties of propofol. In low CO patients, the blood concentration of propofol tends to be higher and the time to induction of hypnosis may be shorter \[[@B1],[@B2]\]. However, there is a possibility that delivery of hypnotics into the brain may be more rapid in high CO patients because of its short circulatory transit time. Recently, a more practical and suitable drug administration technique, target-controlled infusion (TCI), has become popular in clinical settings. This new technique infuses a larger dose of propofol that is calculated to achieve a pharmacokinetic pseudo-steady state rapidly \[[@B5]\] and to attain hypnosis quickly. However, the effect of CO on the induction time when using propofol and TCI is not known. Thus, we hypothesized that large CO could distribute anesthetics to the target effector site more rapidly despite the slower increase of plasma concentration of propofol.
In the current investigation, we measured the time required to induce anesthesia with propofol administered using the TCI technique. We also investigated the effects of CO and other physiological factors on the pharmacodynamics of propofol.
Materials and Methods
=====================
The study was approved by the Division Ethical Committee of the Institutional Review Board. Written informed consent was obtained from 80 successively scheduled surgical patients who participated in the study. Parents of patients less than 20 years of age were asked to sign the consent form in addition to signing the consent form themselves. Patients younger than 12 years of age were not registered as participants. All patients required general anesthesia and oro-tracheal intubation, and were of American Society of Anesthesiologists physical status I or II. We excluded patients with severe cardiovascular disease, liver or renal dysfunction, lung disease, and patients treated with psychotropic agents.
Thirty min before entering the operating theatre, all patients were premedicated with hydroxyzine 1 mg/kg and atropine 10 µg/kg intramuscularly. Heart rate, electrocardiogram, noninvasive blood pressure, and pulse-oximetry were monitored. At the commencement of induction of anesthesia, 0.4 mg/kg of 0.25% indocyanine green (ICG) solution was administered into a peripheral vein over a few seconds, followed by purging with 20 ml of saline. The probe of the integrated pulse spectrophotometry monitoring system (DDG1001; Nihon Kohden Inc., Tokyo, Japan) was attached to the thumb of the patient \[[@B1],[@B2]\]. The rate of plasma ICG disappearance, k \[C~ICG~(t) = C~ICG~(0)·e^-kt^\], was computed by linear regression from a semilogarithmic plot of ICG concentration versus time from approximately 2 min to 6 min after injection, where C~ICG~(t) = ICG concentration at t minutes after injection and e = natural logarithm \[[@B15]\]. Measurement of CO and blood volume (BV) was usually completed within 6 min. Propofol was then intravenously infused to attain a steady plasma concentration of 3 µg/ml using the TCI technique based on the pharmacokinetic parameters introduced by Schnider et al. \[[@B5]\] (RUGLOOP®, version 3.14, DeSmet T. and Struys M. Department of Anesthesia, University Hospital Ghent). The calculating parameter included patient age, sex, body weight and height. Changes in EEGs were assessed using the bispectral index (BIS: A-1050, version 3.4, Aspect Medical Inc., Natick, MA, USA. The averaging window was 15 seconds). The time required to achieve BIS values of 80 (BIS80) and 60 (BIS60) were determined. Patients who showed BIS values less than 96 at the beginning of induction were excluded from the analysis. The displayed BIS values in the window were decreased and fluctuated, and therefore, BIS80 and BIS60 were defined as the times when the displaying number of BIS value first reached each of the end point values, 80 and 60. We hypothesized BIS80 as the point of a very light anesthetic and hypnotic state, and BIS60 as the point of an adequate anesthetic state, with reference to a previous investigation \[[@B12]\].
The venous plasma concentration of propofol was measured 10 min after the start of infusion \[[@B1]\] to prevent from invasive stimuli of venipuncture during induction and from measurement of BIS80 and BIS60. Three ml of whole blood was withdrawn from the patient\'s cubitus vein by brief puncturing. The sample was immediately centrifuged, and the separated plasma was extracted and frozen until analysis. The concentration was determined using high-performance liquid chromatography with fluorescence detection at 310 nm after excitation at 276 nm (RF550; Shimadsu, Kyoto, Japan). The areas under the chromatographic peaks were calculated with an integrator (PowerChrom; ADInstrument, Tokyo, Japan).
Age, sex, lean body mass (LBM), cardiovascular parameters (including CO, BV, and the rate of plasma ICG disappearance measured by dye-densitometry \[k\]), and the plasma concentration of propofol were analyzed as independent variables. The dependent variables were BIS80 and BIS60. The plasma concentration of propofol was analyzed as a dependent variable when age, sex, LBM, CO, BV and k were chosen as independent variables \[[@B1]\]. We applied McHenry\'s select algorithm to find the subset that provided the maximum value for R-squared (R^2^), and the correlation between each of the variables was calculated using a linear regression model. Subsequent step-up selection determined candidate variables for the model that increased the correlation the most, and we stopped adding independent variables when the remaining variables were not significant (P \> 0.05). A value of P \< 0.05 was considered statistically significant. Data are presented as the mean ± SD. Statistical analysis was performed with the software package NCSS 2000 (Number Cruncher Statistical Systems, Kaysville, UT).
Results
=======
Complete data sets were obtained from all 80 patients. The demographic characteristics of the patients are shown in [Table 1](#T1){ref-type="table"}, and each measuring value is demonstrated in [Table 2](#T2){ref-type="table"}. Multiple regression analysis using a general linear model revealed that increased CO significantly shortened the time taken to reach BIS80 (R^2^ = 0.076, P \< 0.020) ([Table 3](#T3){ref-type="table"}, [Fig. 1](#F1){ref-type="fig"}). For BIS80, CO was determined as the only significant predictive variable. Increased age significantly prolonged the time taken to reach BIS60, as did increased LBM (R^2^ = 0.220, P \< 0.001). The plasma concentration of propofol was not a predictive variable for the time required to achieve either end point, and it was lowered by increased BV (R^2^ = 0.073, P \< 0.020) ([Table 3](#T3){ref-type="table"}, [Fig. 1](#F1){ref-type="fig"}). Multicollinearity among independent variables was rejected in all models, because the variance inflation factor was \< 10, and all the condition numbers for the eigenvalues of centered correlations were \< 10. The power values of each accepted model were greater than 0.7.
Discussion
==========
Propofol was administered using the TCI technique during induction of anesthesia, and we determined the effects of CO and other physiological factors on the time required to achieve two end points, BIS80 and BIS60. Although there are slight fundamental and theoretical lines of evidence, we hypothesized that the primary end point may be considered to represent the attainment of hypnosis, and the secondary end point may be considered to represent the attainment of anesthesia, as signs of change in consciousness. The value of BIS60 in the result is approximately double that of BIS80 (303 vs. 163 sec as mean values, respectively), and the difference concerning predictive factors indicates a change in consequential factors depending on the phase of induction, whether early or late. Multiple regression analysis demonstrated that CO exerted a small but significant effect on the time taken to reach BIS80. Age and LBM markedly modulated the time required to reach BIS60. The plasma concentration of propofol was not a predictive variable for either end point, because the concentration may be influenced by BV at the end of induction rather than other factors \[[@B1]\].
At the commencement of induction of anesthesia, propofol administered through a peripheral vein circulates in the blood stream and is distributed to the whole body \[[@B4]\]. The drug may spread rapidly in patients with a high CO, and thus, infiltration to the target site might be achieved in a relatively short time. Previous investigations have shown that patients with a high CO required a larger dose of propofol and took a longer time to reach hypnosis \[[@B1],[@B8]\]. However, in the current investigation, CO was determined to be a negative predictive variable for BIS80 in the regression model for the early phase. A high CO decreases the plasma concentration of administered propofol \[[@B1],[@B2]\], although, increased CO may accelerate the delivery of the drug from the injection site to the target site \[[@B16],[@B17]\]. In our previous study \[[@B1]\], propofol was infused slowly (15 mg/kg/hr) over 8 min. Thus, the influence of ke0 would be very small, and the pharmacokinetic effect could be acceptable for explaining the results. The profile of gradual pharmacokinetic increase in propofol concentration was different from that of rapid increase using the TCI technique. CO may demonstrate another pharmacodynamic effect of propofol, especially in the initial phase of induction.
In order to explore the effect of aging on the hypnotic activity of propofol, we selected the TCI protocol to simulate plasma concentration instead of effect site concentration. Age and LBM were selected as positive predictive variables for the time taken to achieve the second end point, BIS60. Elderly patients required a longer time to reach BIS60. Aging may prolong the time required for distribution to, or equilibration of, propofol at the effect site in the late phase of induction. Larsson and Wahlstrom \[[@B18]\] reported that there is an age-dependent development of acute tolerance to propofol \[[@B19]\]. However, using EEG analysis, age was reported to have no effect on the rate of BIS reduction related to increasing concentrations of propofol \[[@B12]\]. Furthermore, using a semilinear canonical correlation, Schnider et al. \[[@B11]\] reported that elderly patients were more sensitive to the hypnotic and EEG effects of propofol than were younger persons. Although the results for the effect of aging on the pharmacodynamics of propofol are inconsistent, it is accepted that the pharmacodynamics of the acute induction phase and pseudo-steady state are distinctive \[[@B20]\]. During induction, more physiological variables would modify the pharmacodynamics of propofol. We speculate that achieving equilibration at the effect site, or sensitivity to hypnotics, differs between older and younger patients \[[@B18],[@B21]\]. In the late phase of induction, the pharmacodynamics of propofol may be affected by age. However, a possibility of statistical overestimation using multiple regression analysis would remain, because the factor of aging was distinguished after eliminating other interferences by mathematical calculations. There was a room for discussion regarding logicalness using Schnider\'s \[[@B5]\] algorithm against the simulating process concerning the effect of aging. Further investigation is required concerning this matter.
Schnider\'s pharmacokinetic parameters were based on LBM \[[@B5],[@B11]\], and our previous investigation demonstrated the accuracy of pharmacokinetic predictions of these parameters \[[@B1]\]. The plasma concentration of propofol tends to increase in patients when continuous infusion of propofol is based on total body weight \[[@B22]\]. Furthermore, adjustment for LBM is recommended for appropriate administration of propofol \[[@B5],[@B11],[@B23]\]. Thus, the plasma concentration of propofol was expected be independent of LBM in the present study. However, LBM was a predictive variable for the time taken to reach BIS60, and patients with a higher LBM took longer to reach BIS60. We have no clear explanation for this result. One of the possible explanations is that the simulation based on conventional pharmacokinetic and pharmacodynamics parameters after achieving a steady state of anesthesia may be unsuitable during the progression phase of anesthesia. We speculated that not only the pharmacokinetic parameters, but also the pharmacodynamic parameterke0 would be different depending on the composition of body muscle and fat.
The plasma concentration of propofol was determined 10 min after the start of TCI. This is considered to be the least amount of time required to achieve a pseudo-steady state, and the concentration was correlated with BV only. The most optimized infusion regimen using the pharmacokinetic parameters of propofol based on LBM \[[@B5]\] minimized the variability of the plasma concentration. However, other physiological changes, e.g. dehydration caused by preoperative fasting, were able to modify the pharmacokinetics of the drug. BV may be correlated with LBM, but only BV showed a significant negative relationship with the plasma concentration of propofol. Although BV measurements by pulse dye densitometry were reported to have limited accuracy \[[@B24]\], BV was an important factor for the initial distribution volume of drugs, which was a consistent finding with that of our previous investigation \[[@B1]\]. The values of plasma concentration of propofol distributed between 1.38 to 5.56 µg/ml despite of the TCI set at 3 µg/ml. Precision and bias of TCI have been criticized from the beginning of the introduction of the method, and variation would become larger especially during induction of anesthesia \[[@B1],[@B2],[@B4],[@B5],[@B10]\]. However, we found a consistent and significant factor that affects the plasma concentration of propofol through multivariate analysis.
There are several potential limitations in the design and results of this investigation. The time taken to achieve either end point was defined as the earliest time at which each BIS value was first attained, and not as the time at which the BIS value became constant \[[@B12],[@B25]\]. However, BIS values can undergo a linear-like decrease during the initial induction period \[[@B12]\]. Thus, the method used to assess the time to attain each BIS end point value may be acceptable. Statistical significance (P \< 0.05) and a sufficient power value (Power \> 0.7) for certain factors were obtained in the linear model multiple regression analysis used to confirm our results. The R^2^ value was rather small, except in the case of BIS60 in spite of a proper set of significant parameters and multivariable feedback control analysis used to calculate the biggest R^2^ value. The usefulness of linear regression for the type of data that we explored would be limited \[[@B26],[@B27]\]. It was only BV and not LBM that significantly affected the time taken to reach BIS60. However, it is possible that both variables may be correlated since our results leave a room for discussion concerning statistical completeness. The Cardiac Index (CI) rather than CO may be a preferable factor in the analysis; however, we had already explored factors including patient weight and height. CI is a product of weight, height and CO, and we selected CO as an appropriate and independent variable to elude the statistical problem of multicollinearity.
The last limitation of the current investigation may be that we used the early developed apparatus for monitoring BIS and dye-densitometry. Although each version was not the latest one, the fundamental measurements and the analyzing process are almost identical with the current version, and the accuracy of the results was not influenced.
In summary, CO was a small but statistically significant factor in predicting the time required to reach the initial end point of hypnosis during induction of anesthesia with propofol. The results indicated that patients with a low cardiac output, older age, and with a larger LBM showed a longer time to achieve a hypnotic effect with propofol using TCI.
We express sincere thanks to Harue Kuge, Shizuko Kaneda, Kaai Mishima, Mikiko Ohbayashi and Sachiyo Tamura for their assistance in this investigation in the operating room.
{#F1}
######
Demographic Details of the Patients
There were 37 male and 43 female patients. LBM: lean body mass.
######
Results of Dye-Densitometry, BIS80, BIS60 and Plasma Concentration of Propofol
CO: cardiac output, BV: blood volume, k: rate of plasma indocyanine green disappearance, BIS80: time to first end point (BIS = 80), BIS60: time to second end point (BIS = 60).
######
Results of Regression Analysis for Predictive Variables
CO: cardiac output, LBM: lean body mass, BV: blood volume, BIS80: time to first end point (BIS = 80), BIS60: time to second end point (BIS = 60). ^\*^This is the R^2^ for the multiple regression model when this independent variable is omitted and the remaining independent variables are retained. ^†^This is the square of the partial correlation coefficient. The partial R^2^ reflects the percentage of variation in the dependent variable explained by one independent variable controlling for the effects of therest of the independent variables. Large values for this partial R^2^ indicate important independent variables for the multiple regression model. ^‡^BIS80 = 215.20 - 9.34 × CO. ^§^BIS60 = -0.67 + 2.03 × age + 4.63 × LBM. ^∥^Concentration = 3.64 - 0.16 × BV.
| |
5601 Sunnyside Ave.
Beltsville, MD 20705
RE: Comments from the Association of Food and Drug Officials Docket No. FSIS-2008-0031, “Mandatory Inspection of Catfish and Catfish Products”
The Association of Food and Drug Officials (AFDO) is pleased to provide comments to the U.S. Department of Agriculture, Food Safety and Inspection Service (USDA/FSIS), regarding its proposed rule governing mandatory inspection of catfish and catfish products.
AFDO is the preeminent organization in the United States of federal, state and local regulatory officials, having promoted science-based food safety through the development of model laws and regulations, and providing uniform training over its 115-year history. AFDO is well-recognized for advocating a nationally-integrated food safety system that would reduce duplication and gaps which exist in the current system of regulating foods. AFDO has also expressed its concern for addressing food safety through a “piecemeal” approach where preventative controls are administered to a single food commodity or food sector rather than in a more broad fashion. It is from this perspective that AFDO is providing comments relative to the proposed rule.
The USDA/FSIS proposed rule is designed to ensure commercial catfish and catfish products are properly labeled, packaged, and are not adulterated. The proposed rule singles out domestic and imported catfish for regulation by FSIS under a “continuous inspection” program that is comparable to FSIS programs governing meat, poultry, and processed egg products.
The proposed rule would represent a shift in the regulatory oversight applied to commercial catfish production which will have a substantial impact on both domestic and foreign catfish and catfish producers. Affected producers would be subject to a greater regulatory burden in the form of continuous inspection, new recordkeeping requirements, and the pre-approval of labeling. AFDO does not believe catfish and catfish products pose unique food safety concerns which warrant producers of these products to adhere to these more stringent requirements. The U.S. Food and Drug Administration (FDA) and the Centers for Disease Control and Prevention (CDC) have both concluded that catfish and catfish products are a low-risk food, and FSIS has not provided any new information to date to affect that conclusion. Furthermore, there appears to be no existing rule which relieves FDA of its responsibility for regulating these products. The result is more fragmentation in the federal food safety system and the possibility of more duplication of effort. At a time when food safety resources are dwindling, this proposed rule seems very poorly timed. As the proposal is a required response to implement the 2008 Farm Bill, and absent any change or amendment to the law, mandatory inspection of catfish and catfish products will become a reality. Accordingly, AFDO provides the following specific comments to the proposed rule:
AFDO is most appreciative of the opportunity to comment on the proposed regulations. Should you have additional questions or need clarification on any of the topics discussed herein, please do not hesitate to contact me.
Sincerely, | http://www.afdo.org/page-1183489 |
As a graphic designer with an active interest in, but diffident knowledge of, architecture, I have taken the idea of an architectural inquiry literally: to ask some questions rather than attempt a confident statement, let alone provide any answers.
The issue of what to do with New York’s World Trade Center site raises many questions — social, political and symbolic — but for me a key question of interest is whether a void, the absence of any building, might be a more appropriate architectural response to the problem of Ground Zero than another set of towers. A corollary of this is the notion of the void rendered as colour (see Yves Klein), and hence colour as a form of architecture. My thoughts were sparked by an independent, unofficial proposal for Ground Zero by American minimalist painter and sculptor Ellsworth Kelly.
Kelly’s proposal, a collage of a New York Times clipping featuring an aerial photograph of the World Trade Center site, was sent with a letter to the erstwhile Times architecture critic Herbert Muschamp in response to the controversy over the Ground Zero plans. Having initially imagined the site as a large green mound of grass, Kelly was inspired by the aerial view to instead make a simple representation of flat green space: ‘a “visual experience”, not additional buildings, a museum, a list of names or proposals for a freedom monument’.
Others have made similar plans and requests for the site to be kept clear: Kelly mentioned artists John Baldessari and Joel Shapiro and, of particular note, Japanese architect Tadao Ando who actually did propose a grass-covered earthen mound reminiscent of ancient Japanese burial mounds, 650 feet in diameter and 100 feet high. Michael Sorkin Studio similarly proposed a park as memorial for the space, stating ‘The eloquence of the void at Ground Zero will never be matched’.
The references to burial mounds point to the unpalatable fact that the Ground Zero site is of course a mass grave, albeit one that happens to reside in one of the world’s prime pieces of real estate. This is where the debate between development and memorial heats up. Daniel Libeskind’s symbol-laden and increasingly compromised centrepiece ‘Freedom Tower’ (rising 1,776 feet to mark the year of the signing of the Declaration of Independence) is surrounded by a constantly debated and amended ‘masterplan’ comprising a total of five or six towers with around 10 million square feet of office space and up to one million square feet of retail. Critic Philip Nobel summarises the situation as ‘the only politically acceptable solution … a crowded, mixed-use, shopping-intensive corporate development surrounding a large but compromised memorial’.
A blank slate of colour was never going to be an economically (or politically) viable development proposal for the Lower Manhattan Development Corporation, but instead of shoe-horning empty symbolic gestures into designs compromised by security paranoia, I can’t help wondering if New York’s desire for a defiant architectural response to 9/11 might have been best provided by simply rebuilding Minoru Yamasaki’s Twin Towers exactly as they were.
In my graphic design practice, leaving things as found, or even taking things away, can be just as valid a design decision as making something new. Using the problem of Ground Zero as a starting point, Kelly’s collage illustrates an interesting possibility for both graphic design and architecture: a coloured void as a means of satisfying public desire and requirement (in this case for an undisturbed memorial and accessible public space), and of communicating a powerful response to a particular situation (humility and remembrance, not hubris and commerce). | http://formsofinquiry.com/inquiry/ground-zero-zero |
---
abstract: 'Coupling of two dielectric wires with rectangular cross-section gives rise to bonding and anti-bonding resonances. The latter is featured by extremal narrowing of the resonant width for variation of the aspect ratio of the cross-section and distance between wires when the morphology of the anti-bonding resonant mode approaches to the morphology of the Mie resonant mode of effective circular wire with high azimuthal index. Then plane wave resonant to this anti-bonding resonance gives rise to unprecedent enhancement of the optical forces up to several nano Newtons per micron length of wires. The forces oscillate with angle of incidence of plane wave but always try to repel the wires. If the wires are fixed at the ends the optical forces result in elastic deflection of wires of order $100 nm$ for wires’s length $50\mu m$ and the light power $1.5mW/\mu m^2$.'
author:
- Evgeny Bulgakov
- 'Almas F. Sadreev'
bibliography:
- 'sadreev.bib'
title: Resonant bending of silicon nanowires by light
---
Introduction
============
The response of a microscopic dielectric object to a light field can profoundly affect its motion. A classical example of this influence is an optical trap, which can hold a particle in a tightly focused light beam [@Ashkin1986]. When two or more particles are present, the multiple scattering between the objects can, under certain conditions, lead to optically bound states. This is often referred to peculiar manifestation of optical forces as optical binding (OB), and it was first observed by Burns et al. on a system of two plastic spheres in water in 1989 [@Burns1989] and after by other scholars [@Chaumet2001; @Tatarkova2002; @Mohanty2004]. Optical binding belongs to an interesting type of mechanical light-matter interaction between particles at micro-scale mediated by the light scattered by illuminated particles. Depending on the particle separation, OB leads to attractive or repulsive forces between the particles and, thus, contributes to the formation of stable configurations of particles. The phenomenon of OB can be realized, for example, in dual counter propagating beam configurations [@Tatarkova2002; @Gomez-Medina2004; @Metzger2006; @Dholakia2010].
It is clear that excitation of the resonant modes with high $Q$ factor in dielectric structures by light results in large enhancement of near electromagnetic (EM) fields and respectively in extremely large EM forces proportional to squared EM fields. First, sharp features in the force spectrum, causing mutual attraction or repulsion between successive photonic crystal layers of dielectric spheres under illumination of plane wave has been considered by Antonoyiannakis and Pendry [@Antonoyiannakis1997]. It was shown that the normal force acting on each layer as well as the total force acting on both layers including the optical binding force follow these resonances. It was revealed that the lower frequency bonding resonance forces push the two layers together and the higher frequency anti-bonding resonance pull them apart. Later these disclosures were reported for coupled photonic crystal slabs [@Liu09] and two planar dielectric photonic metamaterials [@Zhang2014] due to existence of resonant states with infinite $Q$ factor (bound states in the continuum (BICs)). Recently Hurtado [*et al*]{} [@Hurtado2020] have shown that excitation of quasi BICs in a dimerized high-contrast grating with a compliant bilayer structure stimulates considerable forces capable for structural deformations of the dimer.
However it is remarkable, even two particles can demonstrate extremely high $Q$ resonant modes owing to avoided crossings. The vivid example is avoided crossing of whispering-gallery modes (WGM) in coupled microresonators which results in extremely high $Q$ factor [@Povinelli2005; @Benyoucef2011]. As a result an enhancement of the OB force around of hundreds of nano Newtons between coupled WGM spherical resonators takes place in applied power $1mW$ [@Povinelli2005]. After a few years Wiederhecker [*et al*]{} [@Wiederhecker2009] demonstrated a static mechanical deformation of up to 20 nm in double silicon nitride rings of 30 $\mu m$ diameter by illumination of milliwatts optical power. In 2005 Povinelli [*et al*]{} [@Povinelli2005a] calculated forces between two parallel, silicon wires of square cross-section as shown in Fig. \[fig1\] (a) caused by electromagnetic (EM) waves propagating along the wires with frequencies below the light line. Both attractive and repulsive forces, determined by the choice of relative input phase, the forces were found large enough to cause displacements 20 nm of wire with length 30$\mu m$. However these optical binding (OB) forces are caused by evanescent EM fields which are exponentially weak between the wires that requires a considerable input power 1W/$\mu m^2$ [@Povinelli2005a]. In the present letter we consider scattering of plane wave by parallel wires in the resonant regime. Scheme of illumination is shown in Fig. \[fig1\] (a). That demands incident power of only 1.5 mW/$\mu
m^2$ in order to result considerable deflection of wires of order 100 nm for the wires of length $50 \mu m$.
We show that for two-parametric variation (the aspect ratio and distance between wires) the system of two wires acquires anti-bonding resonant modes with extremely high $Q$ factor. That happens when a morphology of the anti-bonding resonant mode becomes close to the morphology of the Mie resonant modes with high azimuthal index of effective cylindrical wire. If the plane wave with power $1.5 mW/\mu m^2$ is capable to excite such an anti-bonding resonant mode optical forces reach a value till one nano Newton per micron length of wires. As a result wires of enough length are bending as shown in Fig. \[fig1\].
Mie resonance in the system of two parallel nanowires
=====================================================
The behavior of resonances of resonances of isolated nanowire as dependent on aspect ratio of the cross-section $a/b$ was studied by Huang [*et al*]{} [@Huang2019] in aim to optimize the $Q$ factor of the nanowire by use the same strategy of avoided crossing as it was used in papers [@Wiersig2006; @Rybin2017]. Therefore it is reasonable to start a consideration of optical binding (OB) force of two wires each of them is optimized by the $Q$ factor which reaches maximal amount 2730 for silicon wire with the refractive index 3.48 at $a=b$. The corresponding resonant mode of each wire shown in inset of Fig. \[fig2\] has a morphology of the Mie resonant mode with rather high azimuthal index $m=6$ (close to whispering gallery mode) that explains so small radiation losses. The corresponding optical forces, acting on each wire are shown in Fig. \[fig2\]. One can see that the OB force tends to repel the wires and reaches a magnitude 70 pico Newtons per micron.
In order to achieve unprecedent $Q$ factor the another strategy was proposed in Ref. [@Bulgakov2020a] based on crossing of the resonances which have opposite symmetry in the isolated wire as shown in Fig. \[fig3\] (a). However the presence of the second wire lifts this symmetry restriction giving rise to a new series of avoided crossings of resonances. One of such an avoided crossing is shown in Fig. \[fig3\] (b) with insets showing evolution of the anti-bonding resonant modes. We do not show the bonding resonances because of their undistinguished $Q$ factors. For variation of the distance $L$ between the wires one of the anti-bonding resonant modes of two coupled wires reaches extraordinary small radiation losses. As highlighted in respective inset in Fig. \[fig3\] (b) at the point of minimal imaginary part the anti-bonding resonant mode of two wires with the cross-section $a=1.19\mu m, b=0.592\mu m, a/2b=1.0152$ and the distance between wires $L=1.555\mu m$ acquires morphology close to the morphology of effective isolated wire with cylindrical cross-section with $m=7$ as highlighted by white circle in inset of Fig. \[fig3\] (b). It is remarkable that the $Q$ factor of this anti-bonding resonance reaches unprecedent value around 15000 at precise tuning of wire’s scales: $a/2b=1.0152, L/b=1.5546$ as shown in Fig. \[fig3\] (c). Then one can expect giant OB forces as it was established for two dielectric disks when the frequency of Bessel beams was resonant to the anti-bonding resonance [@Bulgakov2020]. Indeed Fig. \[fig4\] show that the OB force reaches giant values around 4 nano Newtons that exceeds the case shown in Fig. \[fig2\] by two orders in value.
Deflection of wires
===================
Following to Povinelli [*et al*]{} [@Povinelli2005a] we estimate the deflection of wires $w(z)$ due to optical forces shown in Fig. \[fig4\]. The deflection obeys the equation $$\label{defl}
\frac{d^4w_j}{dz^4}=\frac{12f_j}{ab^3E}, ~~j=1,2$$ where $f_j$ are the optical force acting on unit length of the j-th wire, and $E=169GPa$ is the Young modulus of silicon. In what follows we disregard optical properties of plates to which the wires are fixed assuming their refractive index close to air. For $|w(z)|\ll S$ and applying the boundary conditions $w_j(\pm
S/2)=0$ and $dw_j(\pm S/2)/dz=0$ one can obtain the solution of Eq. (\[defl\] $$\label{deflsol}
w_j(z)=\frac{f_j}{ab^3E}\left[\frac{1}{2}z^4-\frac{S^2}{4}z^2+\frac{S^4}{32}\right].$$ At the specific values $a=1.19\mu m, b=0.592\mu m$ and $f_j\approx
\pm 4200 pN$ for the EM power $1.5mW/\mu m^2$ we find that maximal deflection at the center between plates $w(0)=3.1\times
10^{-8}S^4$ where the length of wires $S$ and deflection $w$ is measured in microns. Therefore for $S=50\mu m$ we obtain the maximal deflection is around $150nm$ while the EM power of $1W/\mu
m^2$ propagating along the wires result in deflection $20nm$ [@Povinelli2005a] that considerably yields the case of the resonant plane wave illumination with the power by three orders less.
However this estimation of deflection of wires is to be considered as upper limit. As soon as the wires start to bend the anti-bonding resonance with extremely high $Q$ factor established for two parallel wires will go away from extremal point shown in Fig. \[fig3\] (b) by, at least, two reasons. The first reason is related to deviation from optimal distance between the wires. As a result the optical forces will be strongly decreased as shown in Fig. \[fig5\].
The second reason which also affects the optical forces is related to the bending of wires which put the problem into the 3d one.
Funding
=======
The work was supported by Russian Foundation for Basic Research projects No. 19-02-00055.
Disclosures
===========
The authors declare no conflicts of interest.
| |
Randomized trials, which sit at the top of the evidence-based medicine pyramid, are the gold standard approach to establishing causal inference between treatment and outcomes. Both phase 3 trials and randomized phase 2 trials rely on properly conceived and implemented randomization methods, without which selection and accidental bias may preclude firm conclusions. Moreover, phase 1 trials are increasingly randomized in this era of precision medicine and multiple competing treatment schedules that may be developed. Depending on trial size and goals, simple randomization, stratified randomization with permuted blocks, and dynamic methods of treatment allocation, including minimization, can be used to ensure properly balanced treatment arms with respect to known and unknown prognostic factors. The need for blinding adds a further layer of complexity, and additional issues come into play for randomized trials requiring this feature.
In this webinar, we will discuss the rationale for the various randomization methods, with illustration from real clinical trials and some considerations about the performance characteristics of the different methods. Importantly, we will discuss logistic issues related to the implementation of the various randomization methods. Finally, we will propose and discuss best practices to ensure that this implementation is done in a way that is faithful to the chosen method of randomization and that guarantees the trial integrity from beginning to end, without which the scientific and regulatory aspects of the trial may be jeopardized.
Speakers
Everardo Saad, MD, Medical Director, International Drug Development Institute (IDDI)
Dr. Saad has over 15 years of experience in Medical Oncology and clinical trial designs. He graduated in Medicine and trained in Internal Medicine in Sao Paulo, and did his fellowship in Medical Oncology at the University of Texas M.D. Anderson Cancer Center, in Houston. After practicing for several years, he shifted his professional career towards education and research in Medical Oncology, and has a special interest in clinical trial methodology, the assessment of endpoints, and the development of novel therapies for cancer patients.Message Presenter
Linda Danielson, MS, Chief Operating Officer, Executive VP, International Drug Development Institute (IDDI)
Ms. Danielson has been at IDDI since 2006 overseeing all of the operational teams at IDDI including randomization, data management, statistics and project management. She co-authored a chapter on randomization in adaptive designs in the book: “Practical Considerations for Adaptive Trial Design and Implementation”, edited by Weili He, José Pinheiro, Olga M. Kuznetsova, Springer, 2014. Ms Danielson is interested in clinical trial design, statistical methods for clinical trials, randomization methods and increasing efficiency in clinical trials through web-based systems. She holds a MS in biostatistics from the University of Wisconsin, Madison.Message Presenter
Who Should Attend?
Clinical trialists, statisticians, IRT specialists, drug supply specialists, physicians, and other professionals involved in the design, conduct and analysis of randomized clinical trials.
Xtalks Partner
IDDI
International Drug Development Institute (IDDI) is an expert center in biostatistical and integrated eClinical services for pharmaceutical and biotechnology companies in several disease areas, including oncology and ophthalmology.
IDDI optimizes the clinical development of drugs, biologics and devices thanks to proven statistical expertise and operational excellence. Founded in 1991, IDDI has offices in Belgium, Boston (MA), Raleigh (NC) and San Francisco (CA). | https://xtalks.com/webinars/treatment-allocation-in-randomized-trials/ |
Dr. Lee S. Cohen, Director of the Ammon-Pinizzotto Center for Women’s Mental Health at Massachusetts General Hospital, recently shared his insights on clinical issues regarding prescribing antidepressants during pregnancy with Ob.Gyn News on August 16, 2022.
The last 15 years have brought increased effort to screen for postpartum psychiatric illness. That’s exceedingly welcome given the morbidity and potential mortality associated with postpartum psychiatric disorders across the country. From small community hospitals to major academic centers, screening for postpartum depression is part of the clinical fabric of routine obstetrical care. There is a growing appreciation for the complexity of perinatal psychiatric illness, particularly with respect to the commingling of both mood and anxiety disorders during the postpartum period. However, willingness to treat and appreciation of the urgency to treat with both pharmacologic and nonpharmacologic interventions can vary. For women who suffer from postpartum depression and their families, there are real-world implications of both treating and failing to treat this illness, and there is an urgent need to really help these women “climb out of the darkness” that is and defines postpartum depression.
Less common but of great clinical importance is postpartum psychosis, which occurs in approximately 1 in 1,000-2,000 women based on estimates from several studies. As noted in previous columns, the presentation is a dramatic one, with the typical onset of psychotic symptoms in the first days to weeks post partum. The disorder typically has a mood component and is not an exacerbation of underlying chronic psychotic illness. While there have been few systematic treatment studies, the clinical consensus is treatment usually includes hospitalization to ensure the safety of both the patient and infant. Use of medications, including mood stabilizers, antipsychotics, and benzodiazepines may be appropriate when expeditious treatment is needed.
Dr. Cohen is the director of the Ammon-Pinizzotto Center for Women’s Mental Health at Massachusetts General Hospital, which provides information resources and conducts clinical care and research in reproductive mental health. He has been a consultant to manufacturers of psychiatric medications. Email Dr. Cohen at [email protected]. | https://womensmentalhealth.org/posts/postpartum-psychosis-treatment/ |
The CPS is committed to the proper care and treatment of witnesses.
The prosecution has discretion about the selection of prosecution witnesses.
The principles governing which witnesses the prosecution should call at trial are different for the Crown Court and the magistrates' court depending upon the type of case.
The prosecutor is the primary judge of whether a witness is unworthy of belief. The fact that a witness gives an account at variance with a larger number of other witnesses and one which is less favourable to the prosecution case does not necessarily affect the witness's credibility.
Where witness statements have been served on the defence as unused material, the prosecution are not under any duty to call the makers of those statements as witnesses (R v Richardson, 98 Cr.App.R. 174 CA).
The Crown Court retains a power to issue a witness summons of its own motion should it need to do so (Archbold, 8-3c).
The judge has the power to call a witness who has not been called by either the prosecution or the defence, and without the consent of either, if it is necessary in the interests of justice. This power should be exercised rarely (Archbold, 4-345).
The principles for the calling of prosecution witnesses are set out in R v Haringey Justices, ex p. DPP QB 351; (Stone's Justices' Manual 1-642).
In either way cases the prosecution's discretion becomes fettered once statements have been served as advance information.
Where a fettered discretion not to call a witness is exercised, the prosecution has a duty to ensure that the witness attends court. However, the prosecutor cannot be compelled to call such a witness.
Where the prosecution decides not to call a witness neither a judge nor a magistrate can compel the prosecution to call that witness.
If the witness is a police officer and the defence wish him or her to be called, but do not wish to call the officer as a defence witness, a judge or magistrate has power to rule that in the interests of justice the officer should give evidence. The prosecution cannot, however, be compelled to call the witness. If the prosecutor declines to call the witness, magistrates have the same discretion as a judge to call the witness themselves, and should do so in preference to dismissing the case as an abuse of process (R v Russell-Jones).
If the witness is not a police officer, each case should be judged on its merits.
Where the magistrates' court exceptionally calls a witness that the prosecution do not wish to call you should suggest that the court legal adviser conducts the questioning as if examining the witness on behalf of an unrepresented defendant. Witnesses should only be called at the end of the defence case if no injustice or prejudice is caused to the defendant and if some matter arises on the part of the defendant ex improviso, R v Harris (1927) 2 K.B. 587, 20 Cr.App.R. 86. If the matter does not arise ex improviso you should suggest that the witness be called after the close of the prosecution case. The order of cross-examination of such a witness may vary according to the nature of the evidence given and the circumstances of the case.
The procedures governing the calling of suspended police officers were reviewed following the obiter remarks in R v Haringey Justices, ex p. DPP QB 351.
Where an officer is suspended pending the completion of enquiries and his or her evidence is peripheral or merely corroborative of other evidence not in dispute, consideration should first be given as to whether the officer's evidence is needed. Where the officer is effectively the complainant or a main witness then the officer should be called unless the alleged wrongdoing is closely associated with the case itself.
The officer should be called to give evidence by the Crown and should not merely be tendered for cross-examination.
There should be no cross examination relating to the suspension except to clarify anything which is not clear, since it does not detract from a witness's credit that allegations which are denied have been made against the officer.
The disclosure of information concerning the officer's suspension must be considered whether or not the officer's evidence is to be used by the prosecution (refer to Chapter 18 of the Disclosure Manual for further guidance).
Where a suspended officer is called as a prosecution witness and it is appropriate that suspension be revealed, the officer should be asked at the outset of his or her evidence whether or not he or she is suspended, the reason for the suspension and, where appropriate, whether or not the officer admits or denies the allegation.
Where there are a large number of eyewitnesses to an incident, it is neither always desirable nor necessary to call all of them. Only serve the statements of those witnesses you wish to call at trial. Consider disclosing other statements as unused material (refer to Disclosure of Unused Material further guidance).
Those whose evidence supports the prosecution case but it is decided not to call them. A defence challenge may arise.
Fresh information may change your view about calling a prosecution witness whose statement has been served and the prosecution discretion is fettered e.g. new information brings into question the credibility of the witness. In these circumstances you should inform the defence in writing that the witness will no longer be called by the prosecution but will be warned to attend court and will be available for the defence.
If you have served a witness statement and your discretion not to call that witness has thus been fettered, that witness must be available to attend court although you cannot be forced to call the witness. It is for the Witness Care Unit to warn the witness to attend court, although you should consider whether it is possible to have the witness on standby and available to attend at short notice, to avoid unnecessary attendance. The Service will have to bear the witness's costs. So only serve the statements of witnesses you wish to call at trial. | https://www.cps.gov.uk/legal-guidance/prosecution-witnesses-selection |
Leonel Franco’s dream was to become a professional soccer player. However, when he fell short of that goal he was forced to shift his focus on other athletic endeavors.
In fact, the day the door closed on his soccer career was the same day he first stepped foot into a CrossFit gym. The competitive atmosphere of the gym allowed him to tap into the best version of himself, and he quickly started preparing to compete in the CrossFit games.
In this week’s episode, Leonel joins Elliot to discuss the mindset that allowed him to channel disappointment into opportunity and his journey to winning the title of the Fittest Man In Nevada.
Time Stamped Show Notes
[01:42] Welcome To The Show…
- 02:02: Leonel’s dream of becoming a professional soccer player.
- 02:52: After the door shut on his soccer career, Leonel starts CrossFit to fill the competitive void.
- 03:31: The shift that allowed Leonel to love working out, when he previously dreaded the thought of it while playing soccer.
[07:09] Leonel advances from participating in Crossfit classes to training for competition.
- 08:23: How Crossfit widdles down over 200,000 competition entrants down to just a final 120.
- 11:39: How Leonel’s pre-competition mental preparation allowed him to hit personal bests when it mattered most.
- 14:52: After finally getting the opportunity to compete in front of a live crowd, what are Leonel’s next goals?
[16:56] Leonel’s best advice for those looking to pursue competitive aspirations.
- 18:38: How to close the gap on your competition even when they have a massive head start over you.
- 22:13: Leonel’s secret weapon for improving recovery while building mental toughness.
- 25:31: Why learning to slow down is often the biggest mental hurdle for athletes to overcome.
[31:10] Wrap-Up—Thanks For Checking Out This Episode Of The Primed Mind Podcast!
Key Learning Points
- A group of like-minded individuals can accomplish great things as a group: Why are fitness platforms such as Peleton and Crossfit so successful? It’s because they understand the power of community. It’s incredibly difficult to create long-term fitness habits, and many people find the key to doing so is by embracing a community. If you’re struggling to achieve any goal, find a group of people trying to achieve the same goal as you, and lean on them to help you get started.
- Use visualization to help you prepare for critical moments: How can you give yourself the best chance to perform your best in those critical moments that only happen on rare occasions. We’re talking about the finals of a huge competition, that make-or-break investor meeting, the dream job interview, or a massive sales call with an important client. These aren’t moments you get the opportunity to practice often in real life, but you can do the next best thing and practice them with visualization. Walking through these moments in your mind over and over again, primes you to perform your best when it matters most.
- If you want to rapidly level up your game, don’t be afraid to get your ass kicked: The biggest improvements come when you’re able to stretch just past your current level of skills and abilities. That means taking risks and allowing yourself the opportunity to learn from failure. If you only put yourself in situations where you’re guaranteed to win, you’re guaranteeing you’ll stunt your growth. | https://primedmind.com/080-leonel-franco-the-fittest-man-in-nevada/ |
# Light characteristic
A light characteristic is all of the properties that make a particular navigational light identifiable. Graphical and textual descriptions of navigational light sequences and colours are displayed on nautical charts and in Light Lists with the chart symbol for a lighthouse, lightvessel, buoy or sea mark with a light on it. Different lights use different colours, frequencies and light patterns, so mariners can identify which light they are seeing.
## Abbreviations
While light characteristics can be described in prose, e.g. "Flashing white every three seconds", lists of lights and navigation chart annotations use abbreviations. The abbreviation notation is slightly different from one light list to another, with dots added or removed, but it usually follows a pattern similar to the following (see the chart to the right for examples).
An abbreviation of the type of light, e.g. "Fl." for flashing, "F." for fixed. The color of the light, e.g. "W" for white, "G" for green, "R" for red, "Y" for yellow, "Bu" for blue. If no color is given, a white light is generally implied. The cycle period, e.g. "10s" for ten seconds. Additional parameters are sometimes added:
An example of a complete light characteristic is "Gp Oc(3) W 10s 15m 10M". This indicates that the light is a group occulting light in which a group of three eclipses repeat every 10 seconds; the light is white; the light is 15 metres above the chart datum and the nominal range is 10 nautical miles.
## Light patterns
### Fixed light
A fixed light, abbreviated "F", is a continuous and steady light.
### Flashing light
A flashing light is a rhythmic light in which the total duration of the light in each period is clearly shorter than the total duration of the darkness and in which the flashes of light are all of equal duration. It is most commonly used for a single-flashing light which exhibits only single flashes which are repeated at regular intervals, in which case it is abbreviated simply as "Fl". It can also be used with a group of flashes which are regularly repeated, in which case the abbreviation is "Fl(2)" or "Gr Fl(2)", for a group of two flashes. Another possibility is a composite group, in which successive groups in the period have different numbers of flashes, e.g. "Fl. (2+1)" indicates a group of two flashes, followed by one flash.
A specific case sometimes used is when the flashes are longer than two seconds. Such a light is sometimes denoted "long flashing" with the abbreviation "L.Fl".
If the frequency of flashes is large (more than 30 or 50 per minute) the light is denoted as a "quick light", see below.
### Occulting light
An occulting light is a rhythmic light in which the duration of light in each period is longer than the total duration of darkness. In other words, it is the opposite to a flashing light where the total duration of darkness is longer than the duration of light. It has the appearance of flashing off, rather than flashing on. Like a flashing light, it can be used for a single occulting light that exhibits only a single period of darkness or the periods of darkness can be grouped and repeated at regular intervals (abbreviated "Oc"), a group (Oc(3)) or a composite group (Oc(2+1)).
The term occulting is used because originally the effect was obtained by a mechanism (e.g. a vertical or rotating shutter) periodically shading the light from view.
### Isophase light
An isophase light, abbreviated "Iso", is a light which has dark and light periods of equal length. The prefix derives from the Greek iso- meaning "same".
### Quick light
A quick light, abbreviated "Q", is a special case of a flashing light with a large frequency (more than 30 or 50 per minute). If the sequence of flashes is interrupted by regularly repeated eclipses of constant and long duration, the light is denoted "interrupted quick", abbreviated "I.Q".
Group notation similar to flashing and occulting lights is also sometimes used, e.g. Q(9).
Another distinction sometimes made is between quick (more than 50 and less than 80 flashes per minute), very quick (more than 80 and less than 160 flashes per minutes, abbreviated "V.Q") and ultra quick (no less than 160 flashes per minute, abbreviate "U.Q"). This can be combined with notations for interruptions, e.g. I.U.Q for interrupted ultra quick, or grouping, e.g. V.Q(9) for a very quick group of nine flashes. Quick characteristics can also be followed by other characteristics, e.g. VQ(6) LFl for a very quick group of six flashes, followed by a long flash.
### Morse code
A Morse code light is light in which appearances of light of two clearly different durations (dots and dashes) are grouped to represent a character or characters in the Morse Code. For example, "Mo(A)" is a light in which in each period light is shown for a short period (dot) followed by a long period (dash), the Morse Code for "A".
### Fixed and flashing
A fixed and flashing light, abbreviated "F. Fl", is a light in which a fixed low intensity light is combined with a flashing high intensity light.
### Alternating
An alternating light, abbreviated "Al", is a light which shows alternating colors. For example, "Al WG" shows white and green lights alternately. | https://en.wikipedia.org/wiki/Light_characteristic |
The global climate crisis is anticipated to have far-reaching effects—from rising sea levels to hotter temperatures to more frequent extreme weather events—all of which are expected to negatively affect human health. New research is also helping the public to better understand how climate change will negatively affect maternal health outcomes, such as by increasing the risk of preterm birth, pregnancy-related complications, and poor maternal mental health. The United States’ maternal health crisis makes the threat climate change poses to pregnant and postpartum people all the more alarming. Among developed countries, the United States has one of the highest maternal mortality rates in the world, and Black pregnant and postpartum people are three times more likely to die from pregnancy-related complications compared with their white counterparts.1 Thankfully, as part of the Black Maternal Health Momnibus Act of 2021, Rep. Lauren Underwood (D-IL) has taken on these intersecting crises by introducing the Protecting Moms and Babies Against Climate Change Act earlier this year.2 Federal and state policymakers must continue to build on this bill, as well as other federal and state efforts, to mitigate and protect pregnant people and new parents from the worst impacts of a changing climate.
In recognition of Earth Day, this issue brief presents five policy recommendations that would improve maternal health by addressing the effects and impacts of climate change, including:
- Targeting resources to pregnant and postpartum people living in climate-affected areas
- Improving the quality and resiliency of housing and local infrastructure
- Developing a national heat vulnerability index to protect pregnant and postpartum people against extreme heat
- Expanding access to maternal telehealth services
- Improving access to family planning services
By advancing these recommendations, federal and state policymakers can preemptively address the looming crisis posed by climate change and ensure that pregnant and postpartum people—in particular, women of color—are equipped with the resources and protections they need to experience healthy pregnancies.
Direct effects of climate change on maternal health
There are a range of climate risk factors that directly affect maternal health, including extreme heat, air pollution, flooding, and hurricanes. It is also important to note that experiences with climate change vary by race, income, geography, and a host of other factors. People of color—including Black, Hispanic, and Indigenous people—are more likely to be negatively affected by climate risk factors than their white counterparts.3 The same holds true for people with disabilities and LGBT people.4
Research has demonstrated the negative effects of extreme heat on maternal health outcomes. For example, exposure to extreme heat has been linked to preterm birth—which itself can lead to long-term infant morbidity and mortality—due to maternal dehydration, the inability to efficiently thermoregulate during pregnancy, and issues related to nutrient and gas exchange across the placenta.5 A research study found that a 10-degree Fahrenheit increase in weekly average temperatures was associated with an 8.6 percent increase in rates of preterm delivery.6 Relatedly, a Nature Climate Change article concluded that without climate intervention, 42,000 more infants will be born preterm annually by the end of the century due to higher ambient temperatures.7 Extreme heat can also lead to congenital heart defects and stillbirth.8 Exposure to extreme heat will vary according to race and geography, among other factors. For instance, Black and Hispanic people in the United States predominantly live in the South, Southwest, and West,9 regions that are projected to experience more extreme heat.10
Similarly, air pollution can have deleterious effects on maternal health, leading to preterm birth, low birth weight, and stillbirth due to changes in the maternal cardiopulmonary system, systemic inflammation, and placental injury.11 A study examining the association between air pollution and poor maternal health outcomes found that in the 10 years after a California coal power plant closed, there was a 27 percent reduction in the rate of preterm births in the surrounding region.12 The effects of air pollution on maternal health are more pronounced for women of color, including Black mothers.13 Indeed, communities of color and low-income communities are more likely to live near polluting power plants and other hazardous facilities and experience cumulative negative health effects due to this exposure.14
Natural disasters such as hurricanes and flooding—which are predicted to become more intense and frequent in coming years15—also affect maternal health. Women exposed to hurricanes are at increased risk of having low birth weight infants: A study found that exposure to wind speeds at or above 74 miles per hour was associated with a 21 percent increase in the risk of extremely preterm delivery.16 Flooding also poses risks to maternal health. Following a flood in North Dakota, researchers determined that rates of maternal medical risks, including eclampsia and uterine bleeding; low birth weight; and preterm birth increased.17 There are also maternal mental health implications of experiencing a climate event, including post-traumatic stress disorder.18 Researchers continue to work to understand the causal pathways and associated risks that influence how natural disasters can lead to these poor maternal health outcomes.
Policy solutions to safeguard and improve maternal health
Climate change will undoubtedly exacerbate the existing maternal health crisis and pose serious health risks to pregnant and postpartum people and their infants. For that reason, federal and state policymakers must take urgent action by targeting resources to where they are needed most, developing more robust data standards related to climate and maternal health, and expanding access to maternal health services through telehealth as well as reproductive health care services, including contraceptives.
Targeting resources to pregnant and postpartum people living in climate-affected areas
Federal and state policymakers must ensure that relevant agencies, including the U.S. Department of Health and Human Services (HHS) and state departments of health, are taking action to arm pregnant and postpartum people living in climate-affected areas with the critical supports they need. The Protecting Moms and Babies Against Climate Change Act, a landmark bill introduced in Congress this past February by Rep. Underwood, would help do just that by authorizing HHS to designate “climate change risk zones”—areas where pregnant and postpartum people are more likely to have poor maternal and infant health outcomes due to climate change. This designation process would be similar to how the Health Resources and Service Administration designates Health Professional Shortage Areas and how the Centers for Disease Control and Prevention uses its Social Vulnerability Index.19
As part of this designation process, HHS would issue a notice of proposed rulemaking to collect public feedback on the criteria needed to select these zones. In addition to race and ethnicity, the potential criteria cover many of the social determinants of health, including health insurance status, access to maternal health providers, income levels, and access to quality housing, transportation, and nutrition. Once HHS selects these criteria and designates climate change risk zones, the agency would fund a range of entities, including community-based organizations and local and state health departments, to provide supports to pregnant and postpartum people living within these zones. This funding can be used to train maternal health care providers and doulas on the health risks associated with climate change; provide pregnant and postpartum people with direct financial assistance and help accessing high-quality housing, transportation services, and items such as effective cooling systems and air filtration units; and develop other initiatives to mitigate the impact of climate change on pregnant and postpartum people in these zones.
Improving the quality and resiliency of housing and local infrastructure
In addition to designating climate change risk zones, it is critical that the U.S. Environmental Protection Agency (EPA) issue updated weatherization protocols to encourage federal and state weatherization assistance programs, federal housing programs, home performance organizations, and general contractors to prioritize energy efficiency improvements and other weatherization updates for vulnerable individuals.20 Indeed, as more people move indoors to escape extreme weather conditions, protecting indoor air quality for pregnant and postpartum people, particularly those living in poor-quality housing, will become even more important. Weatherization can protect the indoor home environment by reducing the health and safety risks of extreme heat, cold snaps, flooding, and other extreme weather events made worse by climate change.
Preventing and mitigating the effects of climate change also requires federal policymakers to tackle the issue of extreme heat, its disproportionate impact on pregnant and postpartum people, and the racial disparities that underlie health-related morbidity and mortality. That is why a provision in the Protecting Moms and Babies Against Climate Change Act—which would allow stakeholders to develop initiatives to improve local infrastructure—is crucial.21 This provision would help address the “heat island” effect, wherein cities—due to an abundance of roads, buildings, and other infrastructure that more readily absorb and retain heat compared with vegetation and water—can be up to 22 degrees Fahrenheit hotter than outlying rural or nonurban areas.22 The heat island effect is even more pronounced in cities and neighborhoods with majority nonwhite populations, a product of the United States’ shameful legacy of redlining. Based on analyses of Home Owners’ Loan Corporation maps from the 1930s, researchers have determined that historically redlined neighborhoods are currently hotter than nonredlined neighborhoods—in some cases, even 7 degrees Fahrenheit hotter—due to these neighborhoods’ built environments.23 As a result of decades of disinvestment, these neighborhoods have comparatively fewer green spaces and tree canopies and more heat-retaining roadways and large buildings. Increasing tree canopies and installing infrastructure such as cool roofs and cool pavement—with priority given to low-income, minority, and historically redlined neighborhoods—would help reduce ambient temperatures, provide relief from direct sun exposure, and reduce air pollution levels.24 These are all necessary steps to ensure that the health of pregnant and postpartum people, particularly in communities of color, is protected.
Developing a national heat vulnerability index that better protects pregnant and postpartum people
In order to prevent heat-related maternal morbidity or mortality, federal policymakers must also develop and disseminate standards, such as a national heat vulnerability index, that states and local governments can use as a model to ensure better uniformity in assessing exposure to extreme heat. This index must consider the risks posed to vulnerable groups, including pregnant and postpartum people.
Since the Clean Air Act was passed in 1963, the federal government has developed clear data collection and enforcement standards related to air quality. For example, state and local agencies are required to provide the public with daily air quality reports using the EPA’s Air Quality Index. Based on measurements of key air pollutants, this index assigns an overall air quality grade organized into six categories, ranging from “good” to “hazardous,” with special alerts for sensitive groups, including pregnant people.25 While no federal legislation exists to compel the federal government to develop similar measures for extreme heat, the need for these standards to safeguard maternal health is no less urgent.
Some states, including New York, Wisconsin, and Vermont, have proactively created their own heat vulnerability indices26 to help residents and state and local officials better anticipate and plan for extreme heat. In some cases, they have even developed interactive databases to determine county- and neighborhood-specific risk. However, each state appears to use different data to assess vulnerability to extreme heat, and none of these data relate to pregnant women or women of reproductive age. A national heat vulnerability index would help to address this issue.
Expanding access to maternal telehealth services
In the face of climate change, states must continue to expand access to telehealth services, particularly maternal telehealth services, and the federal government must make long-needed investments to improve telehealth infrastructure. Telehealth would allow women to reduce their exposure to hazardous environmental conditions by accessing health care services remotely, from the comfort of their homes, as well as to overcome transportation and other logistical barriers.
In order to expand access to maternal telehealth services, more states should permit patients’ homes to serve as eligible originating sites, or the location where a patient is allowed to receive remote health services.27 This will ensure that the services a pregnant or postpartum person receives at home are covered by their insurance. States can also expand the list of providers allowed to provide telehealth services to include advanced practice clinicians and midwives, which not all states currently permit.28 Finally, given the issue of maternity care deserts and lack of available and qualified maternal health providers, states should also adopt multistate licensure compacts, such as the Interstate Medical Licensure Compact,29 to allow providers who would otherwise be unable to provide care across state lines to render care to women living in maternity care deserts, including in areas affected by climate change.
Improving access to family planning services
Federal and state policymakers must also improve access to family planning services to ensure that people can make pregnancy and family planning decisions that work for them in the context of a changing climate. Studies have shown that, in the wake of climate disasters, women—particularly Black women—have greater difficulty in obtaining contraceptives.30 Policymakers can help improve access to family planning services by making contraceptives more accessible and strengthening the Title X family planning program. In addition to helping people avoid unintended pregnancies and better space out their pregnancies, contraceptives are also critical to women’s social and economic advancement, including their educational pursuits and workforce participation.31
While access to contraceptives is a cornerstone of reproductive health, it should not be used in pursuit of population control, whereby countries fearful of so-called overpopulation attempt to dictate women’s reproductive choices.32 Population control has been used throughout history, from forced sterilization campaigns to requirements that recipients of public assistance receive long-acting reversible contraceptives, and each time has only served to advance systemic racism and undermine reproductive autonomy. Instead, contraceptive services must be patient-centered, and all methods—including the decision not to use contraceptives—must be respected and made accessible.
The government can improve access to family planning by expanding the availability of contraceptives at the federal and state level. For example, the Biden administration and Congress should rescind rules issued by the Trump administration that expanded religious and moral exemptions for employers, universities, and entities otherwise required to cover contraceptives without cost sharing under the Affordable Care Act’s birth control benefit, which the Supreme Court upheld in a legal challenge last year.33 In addition, the Biden administration must require health plans to cover a 12-month supply of contraceptives without cost sharing; allow for over-the-counter access to contraceptives without a prescription; and eliminate medical management techniques such as quantity limits and prior authorization requirements. States, which can and should take similar administrative actions, can also submit a family planning waiver or state plan amendment to the Centers for Medicare and Medicaid Services to create limited-benefit family planning programs that improve contraceptive access for low-income women in the state.
The federal government must also strengthen Title X—the nation’s only domestic program that helps meet the family planning and preventive health needs of millions of people in the United States—by increasing the program’s funding and allowing past grantees that were forced out of the program due to the domestic gag rule to reenter. Since the Trump administration finalized its domestic gag rule last year, 19 grantees—including Planned Parenthood and almost a dozen state departments of health and nonprofits—have left the Title X program, reducing the network’s capacity by almost half and leading to 1.6 million women losing access to services.34 While the Biden administration took an important step in mid-April by issuing a proposed rule to rescind the domestic gag rule, it can take further action by creating a reentry pathway for providers forced out of the program.35 The Title X program is in need of a funding boost as well: From 2010 to 2019, funding for the program shrunk from $317 million to $286 million, and the number of patients served by Title X clinics similarly decreased, from 5.22 million in 2010 to 3.1 million in 2019.36 A study in the American Journal of Public Health found that funding for Title X was less than 39 percent of what was required to adequately meet the public’s family planning needs.37 In order to meet current patient need, undo the damage done by the domestic gag rule, and address systemic program underfunding that predated the rule, Congress must fund the Title X program at $954 million as it pursues appropriations legislation later this year.38
Conclusion
The United States’ response to climate change can create opportunities to promote equity and improve maternal health outcomes, here and around the world. However, as climate change affects more of the general public’s daily life and its impacts on the national and global economy increasingly take center stage, the room to embed maternal health and equity in larger climate responses diminishes. The maternal health crisis has demonstrated that when policies and legislation are not put in place and the public is not aware of or invested in addressing the issue, pregnant and postpartum people as well as their families and communities are deeply affected. In addition, addressing maternal health—particularly among Black women and other women of color—should be part of broader efforts to develop a comprehensive climate response that invests in resilient and sustainable infrastructure, creates more green jobs, and prioritizes public health and environmental justice. Federal and state policymakers, as well as the public, must leverage the urgency of this moment to build off these recommendations and ensure that pregnant and postpartum people are prepared for a new climate future.
PLEASE NOTE: CONTENT IS DISPLAYED AS LAST POSTED BY A PREVENTIONWEB COMMUNITY MEMBER OR EDITOR. THE VIEWS EXPRESSED THEREIN ARE NOT NECESSARILY THOSE OF UNDRR, PREVENTIONWEB, OR ITS SPONSORS. | https://www.preventionweb.net/news/5-ways-improve-maternal-health-addressing-climate-crisis |
Effect of enhancement of spectral changes on speech intelligibility and clarity preferences for the hearing impaired.
Most information in speech is carried in spectral changes over time, rather than in static spectral shape per se. A form of signal processing aimed at enhancing spectral changes over time was developed and evaluated using hearing-impaired listeners. The signal processing was based on the overlap-add method, and the degree and type of enhancement could be manipulated via four parameters. Two experiments were conducted to assess speech intelligibility and clarity preferences. Three sets of parameter values (one corresponding to a control condition), two types of masker (steady speech-spectrum noise and two-talker speech) and two signal-to-masker ratios (SMRs) were used for each masker type. Generally, the effects of the processing were small, although intelligibility was improved by about 8 percentage points relative to the control condition for one set of parameter values using the steady noise masker at -6 dB SMR. The processed signals were not preferred over those for the control condition, except for the steady noise masker at -6 dB SMR. Further work is needed to determine whether tailoring the processing to the characteristics of the individual hearing-impaired listener is beneficial.
| |
CROSS-REFERENCE TO RELATED APPLICATION
1. FIELD
2. DESCRIPTION OF THE RELATED ART
SUMMARY
DETAILED DESCRIPTION
Pattern Layer
Protective Film
Polarizer
Example 1
Examples 2 and 3
Example 4
Example 5
Example 6
Example 7
Example 8
Comparative Examples 1 and 2
Comparative Example 3
Comparative Example 4
Light Source-Side Polarizing Plate
Viewer-Side Polarizing Plate
Module for Liquid Crystal Display
This application claims priority to and the benefit of Korean Patent Application No. 10-2018-0104006, filed on Aug. 31, 2018, and Korean Patent Application No. 10-2019-0096380, filed on Aug. 7, 2019, in the Korean Intellectual Property Office, the entire disclosure of both of which are incorporated herein by reference.
Aspects of embodiments of the present invention relate to a polarizing plate and a liquid crystal display including the same.
A liquid crystal display is operated to allow light emitted from a backlight unit to sequentially pass through a light source-side polarizing plate, a liquid crystal panel, and a viewer-side polarizing plate. Light emitted from a light source spreads while passing through the backlight unit and then enters the light source-side polarizing plate. As a result, the liquid crystal display suffers from gradual deterioration in contrast ratio and color deviation from a front side to a lateral side while light passes through the light source-side polarizing plate, the liquid crystal panel, and the viewer-side polarizing plate. To address such problems, a retardation film may be applied to the light source-side polarizing plate or the viewer-side polarizing plate. However, it is difficult for the retardation film to achieve complete compensation of light from the front side to the lateral side and to prevent light leakage, particularly in a diagonal direction.
In order to address the aforementioned problems, use of a light-collecting backlight unit is suggested. The light-collecting backlight unit employs an inverted prism light-collecting sheet instead of a typical normal prism diffusion sheet. The normal prism diffusion sheet is a sheet having a prism formed on a light exit surface of a sheet member, and the inverted prism light-collecting sheet is a sheet having a prism on a light incident surface of a sheet member. This technique is a light collecting-scattering system that minimizes or reduces difference in contrast ratio depending upon viewing angle by allowing light emitted from the light-collecting backlight unit through light collection to pass through a liquid crystal panel and secures viewing angle by scattering light at the outermost surface of the viewer-side polarizing plate. To this end, there is a need for development of an optical device in consideration of the light-collecting backlight unit. Although a scattering particle-containing film may be used as the optical device to be disposed on the outermost surface of the viewer-side polarizing plate, there is a limitation in terms of enlargement of viewing angle of the scattering particle-containing film and/or improvement in external appearance thereof.
The background technique of the present invention is disclosed in Japanese Unexamined Patent Publication No. 2006-251659.
According to an aspect of embodiments of the present invention, a polarizing plate is capable of improving brightness, viewing angle, and contrast ratio at a front side and a lateral side in application to a liquid crystal display including a light-collecting backlight unit.
According to another aspect of embodiments of the present invention, a polarizing plate is capable of improving front contrast ratio, lateral contrast ratio, and external appearance in application to a liquid crystal display including a light-collecting backlight unit.
According to another aspect of embodiments of the present invention, a polarizing plate is capable of reducing deviation in ratio of brightness at a lateral side to brightness at a front side depending upon an angle of the lateral side in application to a liquid crystal display including a light-collecting backlight unit.
According to another aspect of embodiments of the present invention, a liquid crystal display includes a light-collecting backlight unit, has improved brightness, viewing angle, and contrast ratio at a front side and a lateral side, and has reduced deviation in ratio of brightness at a lateral side to brightness at a front side depending upon an angle of the lateral side.
In accordance with one or more embodiments of the present invention, a polarizing plate includes: a polarizer; and a pattern layer on a light exit surface of the polarizer, wherein the pattern layer includes a first resin layer and a second resin layer sequentially arranged on the polarizer, and a pattern portion is located at an interface between the first resin layer and the second resin layer and is composed of at least two pattern groups repeatedly arranged therein, each of the pattern groups including at least two engraved optical patterns, and at least two of the engraved optical patterns in each of the pattern groups have different aspect ratios and different base angles.
The engraved optical patterns may have an aspect ratio of about 0.3 to about 3.0.
The engraved optical patterns in the pattern groups may have a difference of about 0.5 or more between a maximum aspect ratio and a minimum aspect ratio.
The engraved optical patterns may have a base angle of about 60° to about 90°.
The engraved optical patterns in the pattern groups may have a difference of about 5° or more between a maximum base angle and a minimum base angle.
The engraved optical patterns may have a flat surface at a top portion thereof and an N-sided polygonal cross-sectional shape, N being an integer from 4 to 10.
The engraved optical patterns in the pattern groups may be consecutively arranged without a flat section therebetween.
A flat section may be absent or may be further formed between two immediately adjacent pattern groups.
The engraved optical patterns may extend in a stripe shape in a longitudinal direction thereof.
An angle defined between a longitudinal direction of the engraved optical pattern and an absorption axis of the polarizer may be about −20° to about 20°, from about 70° to about 110°, or from about −70° to about −110°, wherein the absorption axis of the polarizer is defined as 0°.
The first resin layer may have a higher refractive index than the second resin layer.
An absolute value of a difference in refractive index between the first resin layer and the second resin layer may be about 0.05 or more.
A number of the engraved optical patterns in each pattern group may be from 2 to 10.
Each of the pattern groups may be composed of a total of two optical patterns comprising a first pattern and a second pattern as the engraved optical patterns, and the first pattern and the second pattern may have different base angles and different aspect ratios.
Each of the pattern groups may be composed of a total of three optical patterns comprising a first pattern, a second pattern, and a third pattern consecutively arranged without a flat section therebetween, as the engraved optical patterns, and at least two of the first pattern, the second pattern, and the third pattern may have different base angles and different aspect ratios.
The first resin layer may be a filling portion filling at least part of the engraved optical patterns, or a layer including the filling portion.
The polarizing plate may further include a protective film stacked on at least one of a light exit surface and a light incident surface of the pattern layer.
The polarizing plate may further include at least one surface treatment layer selected from among a hard coating layer, a scattering layer, a low reflectivity layer, an ultra-low reflectivity layer, a primer layer, an anti-fingerprint layer, an antireflection layer, and an antiglare layer on at least one surface of the protective film.
In accordance with one or more embodiments of the present invention, a liquid crystal display includes a polarizing plate according to the present invention.
The liquid crystal display may include a backlight unit, a light source-side polarizing plate, a liquid crystal panel, and the polarizing plate sequentially stacked in the stated order, and the backlight unit may include a light-collecting backlight unit including an inverted prism sheet.
30°
30°
0°
30°
0°
60°
60°
0°
60°
0°
In a white mode of the light-collecting backlight unit, a ratio (W=L/L) of brightness (L) at a lateral side (30° or −30°) to brightness (L) at a front side (0°) may be from about 0.1 to about 0.5, and a ratio (W=L/L) of brightness (L) at a lateral side (60° or −60°) to brightness (L) at the front side (0°) may be from about 0 to about 0.1.
Some example embodiments of the present invention will be described in further detail with reference to the accompanying drawings to provide a thorough understanding of the invention to those skilled in the art. It is to be understood that the present invention may be embodied in different ways and is not limited to the following embodiments. In the drawings, portions irrelevant to the description may be omitted for clarity. Like components will be denoted by like reference numerals throughout the specification.
Herein, spatially relative terms, such as “upper” and “lower,” are defined with reference to the accompanying drawings. Thus, it is to be understood that the term “upper surface” can be used interchangeably with the term “lower surface,” for example, and when an element, such as a layer or a film, is referred to as being placed “on” another element, it may be directly placed on the other element, or one or more intervening elements may be present. On the other hand, when an element is referred to as being placed “directly on” another element, there are no intervening element(s) therebetween.
Herein, the terms “horizontal direction” and “vertical direction” mean a longitudinal direction and a transverse direction of a rectangular screen of a liquid crystal display, respectively. Herein, “lateral side” refers to −30°, −45°, −60°, 30°, 45°, or 60° in a system in which a front side is indicated by 0°, a left end point is indicated by −90°, and a right end point is indicated by 90° with reference to the horizontal direction.
Herein, “top portion” refers to the highest point of an engraved optical pattern.
Herein, “aspect ratio” refers to a ratio of the maximum height of an engraved optical pattern to the maximum width thereof (maximum height/maximum width).
FIG. 2
FIG. 3
1
1
230
231
1
230
1
1
240
241
1
240
Herein, “base angle” means an angle defined between the maximum width of an optical pattern and a slanted surface directly connected to the maximum width thereof. For example, referring to , the base angle means an angle α defined between the maximum width W of an optical pattern A and a slanted surface directly connected to the maximum width W of the optical pattern A. For example, referring to , the base angle means an angle α defined between the maximum width W of an optical pattern A and a slanted surface directly connected to the maximum width W of the optical pattern A.
Herein, “in-plane retardation (Re)” is a value measured at a wavelength of 550 nm and is represented by Equation A:
nx−ny
d,
Re=()×
where nx and ny are the indices of refraction in the slow and fast axes of a protective layer at a wavelength of 550 nm, respectively, and d is the thickness (unit: nm) of the protective layer.
Herein, the term “(meth)acryl” refers to acryl and/or methacryl.
Unless specifically stated otherwise, a lateral side (30°) may mean at least one of a lateral side of 30° and a lateral side of −30°, a lateral side (45°) may mean at least one of a lateral side of 45° and a lateral side of −45°, and a lateral side (60°) may mean at least one of a lateral side of 60° and a lateral side of −60°.
FIG. 8
FIG. 8
FIG. 8
0°
0°
shows a brightness profile (dash-dotted line in ) depicting a ratio of brightness at a lateral side to brightness (L) at a front side (0°) with respect to light emitted from a light-collecting backlight unit in a white mode and a brightness profile (solid line in ) depicting a ratio of brightness at a lateral side to brightness (L) at a front side (0°) with respect to light emitted from a typical backlight unit in a white mode.
30°
30°
0°
30°
0°
60°
60°
0°
60°
0°
According to embodiments of the present invention, for the light-collecting backlight unit, in a white mode, a ratio (W=L/L) of brightness (L) at a lateral side (30° or −30°) to brightness (L) at a front side (0°) may be about 0.1 to about 0.5, and, in an embodiment, 0.1 to 0.15, and, in an embodiment, 0.11, and a ratio (W=L/L) of brightness (L) at a lateral side (60° or −60°) to brightness (L) at a front side (0°) may be about 0 to about 0.1, and, in an embodiment, about 0 to about 0.05, and, in an embodiment, about 0.
30°
30°
0°
30°
0°
60°
60°
0°
60°
0°
For the typical backlight unit, in a white mode, a ratio (W=L/L) of brightness (L) at a lateral side (30° or −30°) to brightness (L) at a front side (0°) may be 0.5 to 0.6, for example, greater than 0.5 to about 0.6 or less, and a ratio (W=L/L) of brightness (L) at a lateral side (60° or −60°) to brightness (L) at a front side (0°) may be about 0.1 to about 0.2.
FIG. 8
As such, the light-collecting backlight unit according to embodiments of the present invention exhibits a completely different brightness profile than the typical backlight unit, as shown in . The “typical backlight unit” means a backlight unit not including an inverted prism light-collecting sheet, specifically, a backlight unit including a normal prism diffusion sheet.
According to embodiments of the present invention, as a viewer-side polarizing plate configured to emit light received from a light-collecting backlight unit including an inverted prism, the viewer-side polarizing plate includes a polarizer and a pattern layer formed on a light exit surface of the polarizer, wherein the pattern layer includes a first resin layer, a second resin layer, and a pattern portion having pattern groups repeatedly arranged at an interface between the first resin layer and the second resin layer, thereby improving brightness, viewing angle, and contrast ratio at a front side and a lateral side while reducing deviation in ratio of brightness at the lateral side to brightness at the front side depending upon an angle of the lateral side in application to a liquid crystal display including a light-collecting backlight unit.
The pattern group is composed of at least two engraved optical patterns, in which at least two of the engraved optical patterns have different aspect ratios and different base angles.
FIG. 1
FIG. 2
FIG. 1
FIG. 2
FIG. 1
Herein, a polarizing plate according to an embodiment of the present invention will be described with reference to and . is a cross-sectional view of a polarizing plate according to an embodiment of the present invention; and is a cross-sectional view of a pattern group of the polarizing plate of .
FIG. 1
10
100
200
100
300
200
Referring to , a polarizing plate includes a polarizer , a pattern layer formed on a light exit surface (upper surface) of the polarizer , and a protective film formed on an upper surface of the pattern layer .
300
200
100
300
As manufactured by excluding the protective film for the purpose of simplification of a manufacturing process and thickness reduction, a polarizing plate including the pattern layer formed only on the upper surface of the polarizer without the protective film is also within the scope of the present invention.
300
100
200
In other embodiments, the protective film may be interposed between the polarizer and the pattern layer . That is, according to embodiments of the present invention, the location of the protective film in the polarizing plate is not particularly limited.
200
100
300
100
300
In an embodiment, the pattern layer is formed between the polarizer and the protective film to allow polarized light received from the polarizer to enter the protective film therethrough.
200
210
220
210
200
210
220
The pattern layer may include a first resin layer and a second resin layer disposed to face the first resin layer . In an embodiment, the pattern layer may consist of the first resin layer and the second resin layer , which directly contact each other.
210
220
210
220
The first resin layer is formed on a light incident surface of the second resin layer . A pattern portion described herein may be formed at an interface between the first resin layer and the second resin layer .
230
230
The pattern portion is composed of at least two pattern groups repeatedly arranged. In the pattern portion, the pattern groups may be the same as each other or may be different from each other.
FIG. 1
230
230
Although shows a polarizing plate in which no flat section is formed between the pattern groups , a flat section may be formed between the pattern groups . The structure will be described in further detail below.
230
In an embodiment, the pattern group is composed of at least two engraved optical patterns consecutively arranged without a flat section therebetween, in which at least two of the engraved optical patterns have different aspect ratios and different base angles. With a structure wherein at least two of the engraved optical patterns have the same aspect ratio despite having different base angles, the polarizing plate may exhibit less improvement in viewing angle at all of lateral sides 30°, 45°, and 60°, or abnormally high or low brightness at a certain angle to provide uneven image quality at a lateral side. With a structure wherein at least two of the engraved optical patterns have the same base angle despite having different aspect ratios, the polarizing plate can suffer from the same problems.
FIG. 2
230
230
230
230
230
230
230
In an embodiment, referring to , the pattern group includes three optical patterns, that is, a first pattern A, a second pattern B, and a third pattern C, consecutively arranged without a flat section therebetween. At least two of the first pattern A, the second pattern B, and the third pattern C have different aspect ratios and different base angles.
FIG. 2
230
230
230
230
230
230
Herein, as shown in , although any base angle may be defined as the base angle in a case in which both base angles of each of the first pattern A, the second pattern B, and the third pattern C are the same, a larger base angle among both base angles may be defined as the base angle in a case in which both base angles of each of the first pattern A, the second pattern B, and the third pattern C are different.
FIG. 1
FIG. 2
and show the polarizing plate wherein the engraved optical patterns are consecutively arranged in each pattern group without a flat section therebetween. In other embodiments, however, the pattern group may include a flat section between the engraved optical patterns, as described in further detail below.
In an embodiment, the first pattern, the second pattern, and the third pattern may have different base angles and different aspect ratios.
In another embodiment, the first pattern and the second pattern may have different base angles and different aspect ratios.
In another embodiment, the first pattern and the third pattern may have different base angles and different aspect ratios.
In another embodiment, the second pattern and the third pattern may have different base angles and different aspect ratios.
FIG. 2
1
230
2
230
3
230
230
230
230
230
230
230
In an embodiment, the optical patterns are consecutively arranged in a sequence of increasing base angles in the pattern group. That is, referring to , a base angle (α) of the first pattern A is less than a base angle (α) of the second pattern B, which is less than a base angle (α) of the third pattern C. In an embodiment, an aspect ratio of the first pattern A may be less than an aspect ratio of the second pattern B; an aspect ratio of the third pattern C may be less than or equal to the aspect ratio of the second pattern B; and the aspect ratio of the first pattern A may be less than or equal to the aspect ratio of the third pattern C.
FIG. 2
230
Although shows the pattern group including three engraved optical patterns, the number of optical patterns in each of the pattern groups may be adjusted or selected depending upon the degree of collecting light emitted from a light-collecting backlight unit, brightness, thickness of the polarizing plate, and the like. For example, the number of engraved optical patterns in each pattern group may be about 2 to about 10, and, in an embodiment, from 2 to 5, and, in an embodiment, from 2 to 3.
230
230
230
In an embodiment, interfacial points between the first pattern A, the second pattern B, and the third pattern C provided as the engraved optical patterns in in the pattern group may contact each other and may be disposed coplanar to each other.
230
230
230
An aspect ratio of each of the first pattern A, the second pattern B, and the third pattern C, or an average aspect ratio of the patterns in the pattern group, may be about 0.3 to about 3.0, for example about 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0, and, in an embodiment, about 1.0 to about 3.0, and, in an embodiment, about 1.0 to about 2.0. Within this range, the polarizing plate can have improved viewing angle and can exhibit uniform lateral brightness.
In an embodiment, a difference between a maximum aspect ratio and a minimum aspect ratio of the engraved optical patterns, that is, the first pattern, the second pattern, and the third pattern, in the pattern group may be about 0.5 or more, for example, about 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, and, in an embodiment, about 0.5 to about 2.5, and, in an embodiment, about 0.5 to about 1.0. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness.
1
2
3
230
230
230
In an embodiment, a base angle α, α, or α of each of the first pattern A, the second pattern B, and the third pattern C, or an average value of base angles of the patterns in the pattern group may be about 60° to about 90°, for example about 60°, about 65°, about 70°, about 75°, about 80°, about 85°, or about 90°, and, in an embodiment, about 60° to less than about 90°, and, in an embodiment, about 75° to about 85°. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness.
In an embodiment, a difference between a maximum base angle and a minimum base angle of the optical patterns, that is, the first pattern, the second pattern, and the third pattern, in the pattern group may be about 5° or more, for example, about 5°, 6, 7°, 8, 9°, 10°, 11°, 12°, 13°, 14°, 15°, 16°, 17°, 18°, 19°, 20°, 21°, 22°, 23°, 24°, or 25°, and, in an embodiment, about 5° to about 25°, and, in an embodiment, about 5° to about 10°. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness.
Both base angles of each of the first pattern, the second pattern, and the third pattern may be the same or different. In an embodiment, both base angles of each of the first pattern, the second pattern, and the third pattern are the same.
1
2
3
230
230
230
1
2
3
Maximum widths W, W, W of the first pattern A, the second pattern B, and the third pattern C, respectively, may be the same or different. For example, each of the maximum widths W, W, W may be about 1 μm to about 50 μm, for example, about 1 μm to about 20 μm. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness, and can prevent or substantially prevent a pixel Moiré phenomenon with a liquid crystal panel.
1
2
3
230
230
230
1
2
3
Maximum heights h, h, h of the first pattern A, the second pattern B, and the third pattern C, respectively, may be the same or different. For example, each of the maximum heights h, h, h may be about 1 μm to about 50 μm, for example, about 1 μm to about 20 μm. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness, and can prevent or substantially prevent a pixel Moiré phenomenon with a liquid crystal panel.
FIG. 2
230
230
230
231
232
233
shows the first pattern A, the second pattern B, and the third pattern C each having a trapezoidal cross-sectional shape in which slanted surfaces , , or are connected to a flat surface at a top portion of each pattern. However, it is to be understood that the present invention is not limited thereto. Although the flat surface can be modified to have a surface roughness or a curved surface, in an embodiment, the flat surface does not have such a modification.
The engraved optical pattern may have a flat slanted surface or an angulated slanted surface, and may be a pattern having an N-sided polygonal (N being an integer from 4 to 10) cross-sectional shape including a triangular cross-sectional shape or a trapezoidal cross-sectional shape with a flat surface at a top portion thereof. This will be described in further detail below. In an embodiment, the optical patterns may have a trapezoidal cross-section.
In each of the pattern groups, the optical patterns may have the same shape or different shapes. In an embodiment, the optical patterns have the same shape, such that a process of manufacturing the polarizing plate is facilitated.
FIG. 2
230
230
230
In , the flat surfaces of the first pattern A, the second pattern B, and the third pattern C may have the same width or different widths, and may have a width of greater than 0 μm and about 50 μm or less, for example, about 1 μm to about 20 μm, and, in an embodiment, about 1 μm to about 10 μm. Within this range, the polarizing plate can achieve improvement in viewing angle and uniform lateral brightness, and can prevent or substantially prevent a pixel Moiré phenomenon with a liquid crystal panel.
FIG. 1
FIG. 1
230
Referring again to , the pattern portion is composed of the pattern groups repeatedly arranged therein. shows the polarizing plate in which the first pattern, the second pattern, and the third pattern are arranged in the same sequence in each of the pattern groups. However, it is to be understood that the arrangement sequence of these optical patterns may be the same or different in adjacent pattern groups.
FIG. 1
Although not shown in , each of the optical patterns in the pattern group may have a stripe shape extending in a longitudinal direction of the optical pattern. With this structure, the polarizing plate can achieve improvement in viewing angle at lateral sides. Herein, the “longitudinal direction of the optical pattern” means a different direction from the direction of the maximum width of the optical pattern, that is, a direction intersecting therewith.
100
In an embodiment, assuming that the polarizer has an absorption axis of 0°, an angle defined between the longitudinal direction of the optical pattern and the absorption angle of the polarizer may be in a range from about −20° to about 20°, from about 70° to about 110°, or from about −70° to about −110°. Within this range, the polarizing plate can prevent or substantially prevent a pixel Moiré phenomenon with a liquid crystal panel. In an embodiment, the angle defined therebetween is in a range from about 90° or about −90°.
210
220
In an embodiment, the first resin layer may be a high-refractivity pattern layer having a higher refractive index than the second resin layer .
210
220
In an embodiment, an absolute value of a difference in refractive index between the first resin layer and the second resin layer may be about 0.05 or more, and, in an embodiment, about 0.1 or more, and, in an embodiment, about 0.1 to about 0.3, about 0.1 to about 0.2, or about 0.15 to about 0.2. Within this range, the polarizing plate can achieve improvement in viewing angle.
210
In an embodiment, the first resin layer may have a refractive index of about 1.50 to about 1.70, and, in an embodiment, about 1.55 to about 1.70, and, in an embodiment, about 1.60 to about 1.70. Within this range, the polarizing plate can have a high light spreading effect, can be easily manufactured, and can achieve improvement in spreading of polarized light and viewing angle.
210
The first resin layer may include a filling portion filling at least part of the engraved optical patterns or a layer having the filling portion. In an embodiment, the filling portion completely fills the engraved optical patterns. In a structure in which the filling portion partially fills the engraved optical patterns, the remaining portion of the engraved optical patterns may be filled with air.
210
The first resin layer may be formed of a composition for the first resin layer, which includes a curable resin. The curable resin may include at least one selected from among a UV-curable resin and a heat-curable resin, without being limited thereto. The composition for the first resin layer may further include at least one selected from among an initiator and an additive. The initiator may include at least one selected from among a photocurable initiator and a heat-curable initiator, without being limited thereto. The additive may include any typical additive known to those skilled in the art. For example, the additive may include at least one selected from among a leveling agent, a surface regulator, an antioxidant, an antifoaming agent, a UV absorbent, and a photo-stabilizer, without being limited thereto. The composition for the first resin layer may further include a typical solvent for coatability, for example, ethanol, propylene glycol monomethyletheracetate, methylethylketone, and methylisobutylketone, without being limited thereto.
210
210
In an embodiment, the first resin layer may be a non-adhesive layer. When the first resin layer is non-adhesive, the pattern layer may be stacked on an adherend, that is, on the polarizer, via an adhesive agent, a bonding agent, or an adhesive/bonding agent.
210
210
In another embodiment, the first resin layer may be an adhesive layer. When the first resin layer is an adhesive layer, the pattern layer may be stacked on the adherend without an additional adhesive agent, a bonding agent, or an adhesive/bonding agent, thereby enabling reduction in thickness of the polarizing plate.
220
300
An upper surface of the second resin layer may be a plane adjoining the protective film and a lower surface thereof may be formed with the engraved optical patterns corresponding to the pattern groups.
220
In an embodiment, the second resin layer may be a low-refractivity pattern layer having a refractive index of about 1.3 to less than about 1.50, and, in an embodiment, about 1.3 to about 1.49. Within this range, the polarizing plate can achieve improvement in viewing angle.
220
The second resin layer may be formed of a composition for the second resin layer, which includes a curable resin. The curable resin may include at least one selected from among a UV-curable resin and a heat-curable resin, without being limited thereto. The composition for the second resin layer may include at least one selected from among the initiator, the additive, and the solvent described above.
220
In an embodiment, the second resin layer may have a maximum thickness of greater than 0 μm to about 50 μm or less, for example, greater than 0 μm to about 30 μm or less. Within this range, the polarizing plate can prevent or substantially prevent warpage, such as curling.
220
In an embodiment, a value obtained by subtracting the maximum height of the optical pattern from the maximum thickness of the second resin layer (the maximum thickness of the second resin layer—the maximum height of the optical pattern) (also referred to as “net thickness”) may be greater than 0 μm to about 30 μm or less, for example, greater than 0 μm to about 20 μm or less, or greater than 0 μm to about 10 μm or less. Within this range, the second resin layer can provide an effect of increasing surface hardness and can exhibit sufficient adhesion to the protective film.
300
200
200
300
200
The protective film is formed on a light exit surface of the pattern layer to allow light having passed through the pattern layer to be emitted therethrough. The protective film may support the pattern layer .
300
220
200
10
300
200
In an embodiment, the protective film may be directly formed on the second resin layer of the pattern layer , thereby enabling reduction in thickness of the polarizing plate . Herein, the expression “directly formed on” means that any adhesive layer, bonding layer, or adhesive/bonding layer is not interposed between the protective film and the pattern layer .
300
In an embodiment, the protective film may have a total light transmittance of 90% or more, for example, 90% to 100%, in the wavelength band of visible light. Within this range, the protective layer allows transmission of light therethrough without affecting light incident thereon.
300
The protective film may include an optically transparent resin film, which includes a light incident surface and a light exit surface facing the light incident surface. The protective film may be composed of a single layer of a resin film or may be composed of multiple layers of a resin film. The resin may include at least one selected from among cellulose ester resins including triacetyl cellulose (TAC), cyclic polyolefin resins including amorphous cyclic olefin polymer (COP), polycarbonate resins, polyester resins including polyethylene terephthalate (PET), polyethersulfone resins, polysulfone resins, polyamide resins, polyimide resins, non-cyclic polyolefin resins, poly(meth)acrylic resins including poly(methyl methacrylate), polyvinyl alcohol resins, polyvinyl chloride resins, and polyvinylidene chloride resins, without being limited thereto.
The protective film may be a non-stretched film, a retardation film which is obtained by stretching the resin by a certain method to have a certain range of retardation, or an isotropic optical film. In an embodiment, the protective film may be an isotropic optical film having an Re of about 0 nm to about 60 nm, and, in an embodiment, about 40 nm to about 60 nm. Within this range of Re, the protective film can provide good image quality through compensation for viewing angle. Herein, the term “isotropic optical film” means a film having substantially the same nx, ny, and nz, (nz means a refractive index of the film in the thickness direction of the film) and the expression “substantially the same” includes not only a case in which nx, ny and nz are completely the same, but also a case in which there is an acceptable tolerance. In another embodiment, the protective film may be a retardation film having an Re of about 60 nm or less. For example, the protective film may have an Re of about 60 nm to about 500 nm, or about 60 nm to about 300 nm. In another embodiment, the protective film may have an Re of about 6,000 nm or more, about 8,000 nm or more, and, in an embodiment, about 10,000 nm or more, and, in an embodiment, greater than about 10,000 nm, and, in an embodiment, about 10,100 nm to about 30,000 nm, and, in an embodiment, about 10,100 nm to about 15,000 nm. Within this range, the protective film can prevent or substantially prevent generation of rainbow spots while further diffusing light diffused by a contrast improving layer.
300
300
In an embodiment, the protective layer may have a thickness of about 5 μm to about 200 μm, for example, about 30 μm to about 120 μm. Within this thickness range, the protective layer can be used in the polarizing plate.
FIG. 1
300
Although not shown in , a surface treatment layer, such as any of a hard coating layer, a scattering layer, a low reflectivity layer, an ultra-low reflectivity layer, a primer layer, an anti-fingerprint layer, an antireflection layer, and an antiglare layer, may be further formed on at least one surface of the protective film (at least one of an upper surface and a lower surface thereof). The surface treatment layer can provide further functions to the polarizing plate.
10
In an embodiment, with the pattern layer on the upper surface of the polarizer, the polarizing plate may have a total light transmittance of about 40% or more, and, in an embodiment, about 40% to about 50%, and a degree of polarization of about 95% or more, and, in an embodiment, about 95% to about 100%. Within this range, the polarizing plate can be suitably used in a liquid crystal display.
100
200
100
200
The polarizer may polarize light received from a liquid crystal panel and allow the polarized light to travel to the pattern layer after passing therethrough. The polarizer is formed on a light incident surface of the pattern layer .
100
100
100
In an embodiment, the polarizer may include a polyvinyl alcohol polarizer obtained by uniaxially stretching a polyvinyl alcohol film, or a polyene-based polarizer obtained by dehydrating a polyvinyl alcohol film. In an embodiment, the polarizer may have a thickness of about 5 μm to about 40 μm. Within this range, the polarizer can be used for an optical display.
100
300
The polarizing plate may include the polarizer and a protective film formed on at least one surface of the polarizer. The protective film protects the polarizer, thereby improving reliability and mechanical strength of the polarizing plate. The protective film may include a film comprising any of the resins mentioned above in description of the protective film .
FIG. 1
100
Although not shown in , an adhesive layer may be further formed on a lower surface of the polarizer to attach the polarizing plate to a liquid crystal panel.
In an embodiment, the polarizing plate is configured to satisfy the following Relations 1 and 2 in application to a light-collecting backlight unit, thereby securing brightness uniformity while improving viewing angle at a lateral side.
W
>W
>W
30°
45°
60°
  Relation 1
W
60°
>0.2  Relation 2
30°
30°
0°
45°
45°
0°
60°
60°
0°
where Wis a ratio of brightness (L) at a lateral side (30° or −30°) to brightness (L) at a front side (0°) in a white mode;
Wis a ratio of brightness (L) at a lateral side (45° or −45°) to brightness (L) at the front side (0°) in a white mode; and
Wis a ratio of brightness (L) at a lateral side (60° or −60°) to brightness (L) at the front side (0°) in a white mode.
FIG. 3
FIG. 3
Next, a polarizing plate according to another embodiment of the present invention will be described with reference to . is a cross-sectional view of a pattern group of a polarizing plate according to another embodiment of the present invention.
FIG. 3
FIG. 1
240
230
Referring to , the polarizing plate according to this embodiment is substantially the same as the polarizing plate of except that a pattern portion includes pattern groups repeatedly arranged therein instead of the pattern groups .
240
240
240
240
240
The pattern group is composed of a total of two engraved optical patterns comprising a first pattern A and a second pattern B, which are consecutively arranged without a flat section therebetween. The first pattern A and the second pattern B have different base angles and different aspect ratios.
FIG. 3
240
240
241
242
Referring to , each of the first pattern A and the second pattern B has a trapezoidal shape in which slanted surfaces , are connected to each other by a flat surface at a top portion thereof. However, it is to be understood that the present invention is not limited thereto. For example, the engraved optical patterns according to this embodiment may have an N-sided polygonal cross-sectional shape, as described above.
1
1
1
240
2
2
2
240
FIG. 1
FIG. 2
FIG. 1
FIG. 2
The shape, the base angle α, the maximum width W, the maximum height h, and the material of the first pattern A may be changed or selected as described with reference to and , and the shape, the base angle α, the maximum width W, the maximum height h, and the material of the second pattern B may be changed or selected as described with reference to and .
FIG. 4
FIG. 4
Next, a polarizing plate according to another embodiment of the present invention will be described with reference to . is a cross-sectional view of a pattern group of a polarizing plate according to another embodiment of the present invention.
FIG. 4
FIG. 1
250
230
Referring to , the polarizing plate according to this embodiment is substantially the same as the polarizing plate of except that a pattern portion includes pattern groups repeatedly arranged therein instead of the pattern groups .
250
251
252
230
230
230
251
252
The pattern group further includes flat sections , between engraved optical patterns A, B, C. The flat sections , serve to improve transmittance by suppressing deterioration in front brightness.
251
252
In an embodiment, the flat sections , may be arranged at a cyclic pitch (that is, a sum of the maximum width of one flat section and the maximum width of an engraved optical pattern immediately adjacent to the flat section) of about 1 μm to about 100 μm, and, in an embodiment, about 3 μm to about 50 μm, in the pattern group. Within this range, the polarizing plate can prevent or substantially prevent a pixel Moiré phenomenon with a liquid crystal panel.
1
2
3
In the pattern group, a ratio of a total sum of the maximum widths of the flat sections to a total sum (W+W+W) of the maximum widths of the engraved optical patterns may be about 0 to about 2, for example 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0, and, in an embodiment, greater than about 0 to about 2, about 0 to about 1, or greater than about 0 to about 1. Within this range, the polarizing plate can achieve improvement in lateral viewing angle.
251
252
In an embodiment, the flat sections , may have a maximum width of about 1 μm to about 20 μm, and, in an embodiment, about 1 μm to about 10 μm. Within this range, the optical patterns can be easily formed while securing suitable transmittance and improvement in viewing angle.
FIG. 4
251
252
230
230
230
230
Although shows the polarizing plate in which the flat sections , are formed between the engraved optical pattern A and the engraved optical pattern B and between the engraved optical pattern B and the engraved optical pattern C, the flat section may be formed in at least one of these regions.
FIG. 5
FIG. 5
Next, a polarizing plate according to another embodiment of the invention will be described with reference to . is a cross-sectional view of a polarizing plate according to another embodiment of the present invention.
FIG. 5
20
10
260
200
Referring to , the polarizing plate according to this embodiment is substantially the same as the polarizing plate described above except for a pattern layer instead of the pattern layer .
260
261
262
230
261
262
In the pattern layer , each of flat sections , are formed between adjacent pattern groups . The flat sections , can facilitate pattern formability and can secure suitable transmittance.
230
261
262
1
2
3
230
261
262
In the pattern group , a ratio of a width L of the flat sections , to the total sum (W+W+W) of the maximum widths of the engraved optical patterns or the total width of the pattern groups may be about 0 to about 1, for example 0, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1, and, in an embodiment, greater than about 0 to about 1. Within this range, the flat sections , can facilitate pattern formability and can secure suitable transmittance.
261
262
261
262
In an embodiment, each of the flat sections , may have a maximum width (L) of greater than 0 μm to about 200 μm or less, and, in an embodiment, greater than 0 μm to about 100 μm or less. Within this range, the flat sections , can facilitate pattern formability and can secure suitable transmittance.
FIG. 6
FIG. 6
Next, a polarizing plate according to another embodiment of the invention will be described with reference to . is a cross-sectional view of a polarizing plate according to embodiment of the present invention.
FIG. 6
30
10
270
200
Referring to , the polarizing plate according to this embodiment is substantially the same as the polarizing plate described above except for a pattern layer instead of the pattern layer .
270
10
210
270
The pattern layer is substantially the same as the pattern layer of the polarizing plate described above except that a first resin layer of the pattern layer includes a filling portion completely filling the engraved optical patterns so as to extend farther than the engraved optical patterns in the thickness direction. Accordingly, a maximum thickness of the first resin layer may be greater than a maximum thickness of the engraved optical patterns in the pattern group.
FIG. 7
FIG. 7
Next, a polarizing plate according to another embodiment of the invention will be described with reference to . is a cross-sectional view of a pattern group of a polarizing plate according to another embodiment of the present invention.
FIG. 7
280
280
280
280
280
280
280
1
2
3
1
1
2
2
3
3
Referring to , a pattern group is composed of at least three optical patterns, that is, a first pattern A, a second pattern B, and a third pattern C, which are consecutively arranged without a flat section therebetween. At least two of the first pattern A, the second pattern B, and the third pattern C have different base angles α, α, α and different aspect ratios h/W, h/W, h/W.
280
280
280
281
282
283
FIG. 7
Each of the first pattern A, the second pattern B, and the third pattern C has a slanted surface , , connected to both a top portion thereof and the maximum width thereof and composed of two planes angulated to each other. Although shows an engraved pattern having a hexagonal cross-section, it is to be understood that the present invention is not limited thereto.
FIG. 7
FIG. 7
Although not shown in , the polarizing plate shown in may also further include such a flat section between the pattern groups or inside the pattern group.
Next, a polarizing plate according to another embodiment will be described.
FIG. 1
The polarizing plate according to this embodiment is substantially the same as the polarizing plate according to the above embodiment except that the first resin layer according to this embodiment is a low-refractivity pattern layer having a lower refractive index than the second resin layer. For description of the refractive index, refer to the above description of the embodiment of .
A liquid crystal display according to the present invention includes a polarizing plate according to an embodiment of the present invention.
In an embodiment, the liquid crystal display according to the present invention may include the polarizing plate as a viewer-side polarizing plate disposed at a viewer side with respect to a liquid crystal panel. The “viewer-side polarizing plate” is a polarizing plate disposed at a screen side, that is, at a side opposite to a light source, with respect to the liquid crystal panel.
In an embodiment, the liquid crystal display incudes a light-collecting backlight unit, a light source-side polarizing plate, a liquid crystal panel, and a viewer-side polarizing plate sequentially stacked in the stated order, in which the viewer-side polarizing plate may include the polarizing plate according to an embodiment of the present invention. The “light source-side polarizing plate” is a polarizing plate disposed at a light source side.
FIG. 9
600
610
620
630
The light-collecting backlight unit may be composed of a light source, a light guide plate, and a light-collecting sheet. In an embodiment, referring to , a light-collecting backlight unit may be composed of a light source , a light guide plate , and a light-collecting sheet .
610
620
630
The light source and the light guide plate may be a light source and a light guide plate, which are typically used in a liquid crystal display. The light-collecting sheet may include a base film and an inverted prism formed on a light incident surface of the base film. The inverted prism can improve efficacy of light through total reflection of light emitted from the light guide plate by the pattern shape. In an embodiment, the light-collecting sheet may be integrally attached to the light source-side polarizing plate of the liquid crystal display.
FIG. 9
620
Although not shown in , a reflective sheet may be further formed on a lower surface of the light guide plate to achieve further improvement in luminous efficacy.
The liquid crystal panel may employ a vertical alignment (VA) mode, an IPS mode, a patterned vertical alignment (PVA) mode, or a super-patterned vertical alignment (S-PVA) mode, without being limited thereto.
Next, the present invention will be described in further detail with reference to some examples. However, it should be noted that these examples are provided for illustration only and are not to be construed in any way as limiting the present invention.
A first resin layer (high-refractivity layer) was formed of a composition comprising a UV-curable resin (SHIN-A T&C Co., Ltd.) having a refractive index of 1.62. A second resin layer (low-refractivity layer) was formed of a composition comprising a UV-curable resin (SHIN-A T&C Co., Ltd.) having a refractive index of 1.47.
2
2
A coating layer was formed by depositing a composition for a second resin layer to a predetermined thickness on one surface (light incident surface) of a polyethylene terephthalate (PET) film (TA044, thickness: 80 μm, Toyobo Co., Ltd.) as a protective film. The second resin layer was formed on the coating layer by applying an optical pattern thereto using a film having an optical pattern formed thereon, followed by UV curing at 500 mJ/cm. Then, a first resin layer was formed on one surface of the second resin layer by coating a composition for the first resin layer, followed by UV curing at 500 mJ/cm. Next, a polarizer having a PET/PVA/COP triple layer structure was coupled to one surface of the first resin layer, thereby preparing a polarizing plate.
FIG. 1
The following Table 1 shows one pattern group of a pattern portion formed at an interface between the first resin layer and the second resin layer. In the pattern portion, the pattern groups are repeatedly arranged without a flat section, as shown in .
Referring to Table 1, the pattern group was composed of a total of three patterns, that is, a first pattern, a second pattern, and a third pattern, which are sequentially arranged in the stated order without a flat section therebetween. Each of the first pattern, the second pattern, and the third pattern is an engraved optical pattern having a trapezoidal cross-section. Each of the first pattern, the second pattern, and the third pattern has a base angle and an aspect ratio, as shown in Table 1. Both base angles of each of the first pattern, the second pattern, and the third pattern are the same.
Polarizing plates were manufactured in the same manner as in Example 1 except that the pattern group was composed of three patterns, that is, a first pattern, a second pattern, and a third pattern sequentially arranged in the stated order without a flat section, and each of the first pattern, the second pattern, and the third pattern was an engraved trapezoidal pattern and had a base angle and an aspect ratio, as shown in Table 1.
A polarizing plate was manufactured in the same manner as in Example 1 except that the pattern group was composed of two patterns, that is, a first pattern and a second pattern, sequentially arranged in the stated order without a flat section, and each of the first pattern and the second pattern was an engraved trapezoidal pattern and had a base angle and an aspect ratio, as shown in Table 1.
A polarizing plate was manufactured in the same manner as in Example 1 except that a flat section was formed between the engraved optical patterns in each pattern group. The flat section had a width of 5 μm.
A polarizing plate was manufactured in the same manner as in Example 1 except that a flat section was formed between the pattern groups. The flat section had a width of 5 μm.
A polarizing plate was manufactured in the same manner as in Example 1 except that a flat section was formed between the engraved optical patterns in each pattern group (flat section having a width of 5 μm), a flat section was formed between the pattern groups (flat section having a width of 5 μm), and the refractive indices of the first resin layer and the second resin layer were changed as listed in Table 1.
A polarizing plate was manufactured in the same manner as in Example 1 except that the refractive indices of the first resin layer and the second resin layer were changed as listed in Table 1.
Polarizing plates were manufactured in the same manner as in Example 1 except that the pattern group was composed of three patterns, that is, a first pattern, a second pattern, and a third pattern, sequentially arranged in the stated order without a flat section, and each of the first pattern, the second pattern, and the third pattern was an engraved trapezoidal pattern and had a base angle and an aspect ratio, as shown in Table 1.
In Comparative Example 1, the first pattern, the second pattern, and the third pattern had an aspect ratio of 1.0 and different base angles. In Comparative Example 2, the first pattern, the second pattern, and the third pattern had a base angle of 80° and different aspect ratios.
A polarizing plate was manufactured in the same manner as in Example 1 except that a trapezoidal pattern having an aspect ratio of 1.0 and a base angle of 85° was formed at an interface between the first resin layer and the second resin layer without a flat section.
A first resin layer (low-refractivity layer) was formed of a composition comprising a UV-curable resin (SHIN-A T&C Co., Ltd.) having a refractive index of 1.47. A second resin layer (high-refractivity layer) was formed of a composition comprising a UV-curable resin (SHIN-A T&C Co., Ltd.) having a refractive index of 1.62.
FIG. 10
FIG. 10
100
400
420
410
300
420
410
A polarizing plate was manufactured in the same manner as in Example 1 except that trapezoidal patterns each having an aspect ratio of 1.0 and a base angle of 85° and flat sections were alternately formed at an interface between the first resin layer and the second resin layer. The trapezoidal patterns had the same aspect ratio and the same base angle. is a cross-sectional view of the polarizing plate of Comparative Example 4. Referring to , the polarizing plate includes a polarizer ; a pattern layer including a first resin layer and a second resin layer ; and a protective film , which are sequentially stacked in the stated order, wherein trapezoidal patterns and flat sections are alternately formed at an interface between the first resin layer and the second resin layer .
Models for measurement of viewing angle for the polarizing plates of the Examples and Comparative Examples were manufactured and viewing angle characteristics were measured at lateral angles shown in Table 1.
A polarizer was manufactured by stretching a polyvinyl alcohol film to three times an initial length thereof at 60° C., followed by dyeing with iodine and stretching the dyed film to 2.5 times in a boric acid solution at 40° C. Then, a polarizing plate was manufactured by bonding triacetylcellulose films (thickness: 80 μm) to both surfaces of the polarizer via a bonding agent for polarizing plates (Z-200, Nippon Goshei Co., Ltd.). The manufactured polarizing plate was used as a light source-side polarizing plate.
As a viewer-side polarizing plate, each of the polarizing plates manufactured in the Examples and Comparative Examples was used.
FIG. 8
FIG. 8
30°
30°
0°
60°
60°
0°
The light source-side polarizing plate was attached to a lower surface of a liquid crystal panel and the viewer-side polarizing plate was attached to an upper surface thereof. Here, the viewer-side polarizing plate was disposed such that the protective film of the viewer-side polarizing plate was placed at the outermost periphery from the upper surface of the liquid crystal panel. Then, a module for liquid crystal displays was manufactured by placing a light-collecting backlight unit including an inverse prism optical sheet at a lower side of the light source-side polarizing plate. In a white mode, a brightness profile as indicated by a dash-dotted line of can be obtained by calculating and graphing the ratio of brightness at a lateral side to brightness at a front side (0°) with respect to light emitted from the light-collecting backlight unit. Referring to , the percentage ratio (W) of brightness (L) at a lateral side (30°) to brightness (L) at a front side (0°) was 11% and the percentage ratio (W) of brightness (L) at a lateral side (60°) to brightness (L) at a front side (0°) was 0%.
Brightness values from the front side (0°) to a right lateral side (90°) and a left lateral side (−90°) were measured in a white mode using an EZCONTRAST X88RC (EZXL-176R-F422A4, ELDIM Co., Ltd.).
FIG. 11
FIG. 22
The ratio of brightness at a lateral side to brightness in a front side (0°) in a white mode was calculated and results are shown in to .
In a white mode, the percentage ratio of brightness at a lateral side (30°) to brightness at a front side (0°), the percentage ratio of brightness at a lateral side (45°) to brightness at a front side (0°), and the percentage ratio of brightness at a lateral side (60°) to brightness at a front side (0°) were calculated and shown in Table 1.
TABLE 1
Example
Comparative Example
1
2
3
4
5
6
7
8
1
2
3
4
First
Base
75
75
75
75
75
75
75
75
75
80
85
85
pattern
angle
Aspect
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
1.0
ratio
Second
Base
80
80
80
80
80
80
80
80
80
80
—
—
pattern
angle
Aspect
2.0
2.0
2.0
2.0
2.0
2.0
2.0
2.0
1.0
1.5
—
—
ratio
Third
Base
85
85
85
—
85
85
85
85
85
80
—
—
pattern
angle
Aspect
1.0
1.5
2.0
—
1.0
1.0
1.0
1.0
1.0
2.0
—
—
ratio
Refractive
Second
1.47
1.47
1.47
1.47
1.47
1.47
1.47
1.65
1.47
1.47
1.47
1.62
index
resin
layer
First
1.62
1.62
1.62
1.62
1.62
1.62
1.62
1.45
1.62
1.62
1.62
1.47
resin
layer
Flat section in
Absent
Absent
Absent
Absent
Present
Absent
Present
Present
Absent
Absent
Absent
Present
pattern group
Flat section
Absent
Absent
Absent
Absent
Absent
Present
Present
Present
Absent
Absent
Absent
Present
between pattern
group
Viewing
W30°
58
61
67
48
34
30
32
40
22
73
26
23
angle
W45°
44
46
48
41
43
41
29
44
26
70
9
6
W60°
31
31
31
25
31
31
31
32
31
27
0
0
Result
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
FIG.
11
12
13
14
15
16
17
18
19
20
21
22
*In Table 1, the base angle is represented in degrees (°) and the viewing angle is represented in percentage (%).
FIG. 11
FIG. 18
As shown in Table 1 and to , the polarizing plate according to the present invention achieved improvement in viewing angle at all of lateral sides (30°, 45°, 60°), and had low deviation in viewing angle characteristics at the lateral sides (30°, 45°, 60°) in application to a liquid crystal display including a light-collecting backlight unit.
FIG. 19
FIG. 20
By contrast, the polarizing plate of Comparative Example 1, in which at least two patterns of the pattern group had different base angles and the same aspect ratio, failed to improve viewing angle characteristics at all of lateral sides (30°, 45°, 60°), as shown in Table 1 and . In addition, the polarizing plate of Comparative Example 2, in which at least two patterns of the pattern group had different aspect ratios and the same base angle, failed to improve viewing angle characteristics at a lateral side (60°) and exhibited larger deviation in viewing angle characteristics at a lateral side (60°) than at a lateral side (30°) and at a lateral side (45°), as shown in Table 1 and .
FIG. 21
FIG. 22
Further, the polarizing plate of Comparative Example 3, in which each pattern of the pattern group had the same aspect ratio and the same base angle, failed to improve viewing angle characteristics at all of lateral sides (30°, 45°, 60°) and exhibited no brightness, particularly at a lateral side (60°), as shown in Table 1 and . Further, the polarizing plate of Comparative Example 4, in which each pattern of the pattern group had the same aspect ratio and the same base angle and had a flat section therebetween, failed to improve viewing angle characteristics at all of the lateral sides (30°, 45°, 60°) and exhibited no brightness, particularly at a lateral side (60°), as shown in Table 1 and .
(1) A module for liquid crystal displays was manufactured using the polarizing plate of Example 4 in the same manner as in measurement of viewing angle in Table 1. Brightness at a front side (0°) of the spherical coordinate system was measured in a white mode and a black mode using an EZCONTRAST X88RC (EZXL-176R-F422A4, ELDIM Co., Ltd.). A ratio (A1) of brightness in the white mode to brightness in the black mode was calculated.
With respect to a module for liquid crystal displays manufactured in the same manner except that light source-side polarizing plates were attached to both sides of a liquid crystal panel, a ratio (A2) of brightness in the white mode to brightness in the black mode was calculated in the same manner.
The percentage ratio (contrast ratio) of A1 to A2 was calculated and shown in Table 2.
As obtained by measuring brightness values at a lateral side (30°) and at a lateral side (60°) instead of measuring brightness at a front side (0°), the percentage ratio (contrast ratio) of A1 to A2 was calculated and shown in Table 2.
FIG. 8
FIG. 8
30°
60°
(2) A module for liquid crystal displays was manufactured using the polarizing plate of Example 4 in the same manner as in Table 1 except that a typical backlight unit including a normal prism optical sheet was provided to a lower side of the light source-side polarizing plate. In a white mode, a brightness profile as indicated by a solid line of could be obtained by calculating and graphing the ratio of brightness at a lateral side to brightness at a front side (0°) with respect to light emitted from the typical backlight unit. Referring to , the percentage ratio (W) of brightness at a lateral side (30°) to brightness at a front side (0°) was about 52% and the percentage ratio (W) of brightness at a lateral side (60°) to brightness at a front side (0°) was about 13%.
30°
45°
60°
FIG. 23
W, W, and W were calculated in the same manner and shown in the following Table 2 and .
The percentage ratios of A1 to A2 at a front side (0°), at a lateral side (30°), and at a lateral side (60°) were calculated in the same manner as in (1) and are shown in the following Table 2.
30°
60°
Table 3 shows percentage values of W and W for a light-collecting backlight unit and a typical backlight unit.
TABLE 2
Viewing angle
Contrast ratio (%)
characteristics (%)
Front
Lateral
Lateral
W30°
W45°
W60°
side (0°)
side (30°)
side (60°)
In application
48
41
25
98
120
450
to light -
collecting
backlight unit
In application
61
52
41
36
108
407
to typical
backlight unit
TABLE 3
Brightness profile
W30°
W60°
Light-collecting backlight
11
0
unit
Typical backlight unit
52
13
As shown in Table 3, it can be seen that the light-collecting backlight unit and the typical backlight unit exhibit completely different brightness profiles at a lateral side 30° and at a lateral side 60°.
As shown in Table 2, it could be seen that, in application of the polarizing plate according to the present invention to a liquid crystal display including a light-collecting backlight unit, the liquid crystal display had improved viewing angle characteristics at all of lateral sides (30°, 45°, 60°) while improving front contrast and lateral contrast.
FIG. 23
By contrast, as shown in Table 2 and , in application of the polarizing plate according to the present invention to a liquid crystal display including a typical backlight unit, the liquid crystal display suffered from significant reduction in front contrast and exhibited less improvement in lateral contrast than the liquid crystal display employing the light-collecting backlight unit. This result shows that the polarizing plate according to the present invention effectively operates in application to the liquid crystal display including the light-collecting backlight unit.
Accordingly, embodiments of the present invention provide a polarizing plate capable of improving brightness, viewing angle, and contrast ratio at a front side and a lateral side in application to a liquid crystal display including a light-collecting backlight unit.
Further, embodiments of the present invention provide a polarizing plate capable of improving front contrast ratio, lateral contrast ratio, and external appearance in application to a liquid crystal display including a light-collecting backlight unit.
Further, embodiments of the present invention provide a polarizing plate capable of reducing deviation in a ratio of brightness at a lateral side to brightness at a front side depending upon an angle of the lateral side in application to a liquid crystal display including a light-collecting backlight unit.
Further, embodiments of the present invention provide a liquid crystal display that includes a light-collecting backlight unit, can improve brightness, viewing angle and contrast ratio at a front side and a lateral side, and can reduce deviation in ratio of brightness at a lateral side to brightness at a front side depending upon an angle of the lateral side.
It is to be understood that, although some example embodiments have been described herein, various modifications, changes, alterations, and equivalent embodiments can be made by those skilled in the art without departing from the spirit and scope of the present invention.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1
is a cross-sectional view of a polarizing plate according to an embodiment of the present invention.
FIG. 2
FIG. 1
is a cross-sectional view of a pattern group of the polarizing plate of .
FIG. 3
is a cross-sectional view of a pattern group of a polarizing plate according to another embodiment of the present invention.
FIG. 4
is a cross-sectional view of a pattern group of a polarizing plate according to another embodiment of the present invention.
FIG. 5
is a cross-sectional view of a polarizing plate according to another embodiment of the present invention.
FIG. 6
is a cross-sectional view of a polarizing plate according to another embodiment of the present invention.
FIG. 7
is a cross-sectional view of a pattern group of a polarizing plate according to yet another embodiment of the present invention.
FIG. 8
0°
shows brightness profiles depicting a ratio of brightness at a lateral side to brightness (L) at a front side (0°) with respect to light emitted from a light-collecting backlight unit and a typical backlight unit in a white mode.
FIG. 9
is a cross-sectional view of a light-collecting backlight unit according to an embodiment of the present invention.
FIG. 10
is a cross-sectional view of a polarizing plate of Comparative Example 4.
FIG. 11
FIG. 18
to show a brightness profile (solid line) of a light-collecting backlight unit and brightness profiles (dash-dotted line) in application of polarizing plates of Examples to the light-collecting backlight unit.
FIG. 19
FIG. 22
to show a brightness profile (solid line) of a light-collecting backlight unit and brightness profiles (dash-dotted line) in application of polarizing plates of Comparative Examples to the light-collecting backlight unit.
FIG. 23
shows a ratio (solid line) of brightness at a lateral side to brightness at a front side with respect to light emitted from a typical backlight unit and a brightness profile (dash-dotted line) in application of a polarizing plate of Example 4 to a typical backlight unit. | |
Dystonia is a neurological movement disorder that causes sustained or un controllable muscle contractions. Incorrect signals from the brain can cause involuntary movement, repetitive twisting or abnormal postures.
There are many different types of dystonia some can start in childhood and some in adult hood. Dystonia can affect one or multiple parts of the body and can be painful. Most dystonia’s do not have a specific cause but seems to be related to a problem in the basal ganglia which is the area of the brain that controls muscle contraction.
Dystonia can affect posture, balance, mobility and activities of daily living. With guidance from therapists at Rope Neuro Rehabilitation education and exercise can improve awareness and control of movement patterns and reduce secondary complications that may result from the dystonia.
For experienced assessment and guidance in treatment of dystonia please contact us and schedule as assessment on 09 623 8433.
Online resources
References
Bleton J-P, Spasmodic Torticololis. A physiotherapy handbook. 2014, Frison-Roche
Cassidy A pathophysiology of idiopathic focal dystonia ACNR 2010 10 14 – 18
Chan, J. Brin, MF, Fahn, S: Idiopathic cervical dystonia: clinical characteristics. Movement disorders 1991;6(2):119-26
Chronicles of a dystonia muse – https://dystoniamuse.com/
Dashtipour K, Lew M. Handbook of Dystonia. 2007: 37-154.
Dystonia foundation organisation – living with dystonia physical therapy resource
Joost van den Dool, et al; Effectiveness of a standardised physical therapy program: study design and protocol of a single blind randomised controlled trial. BMC Neurology December 2013, 13:85
Mueller J, Wissel J Visual biofeedback treatment improves cervical dystonia Department of Neurology, Vivantes Hospital Berlin Spandau, Academic teaching Hospital of the Charité, Berlin
Ostrem Jill L. , MD Diagnostic criteria for cervical dystonia: Can botulinum neurotoxin manage, as well as, cure the problem? Professor of Neurology UCSF Department of Neurology Movement Disorder and Neuromodulation Center Bachmann Strauss Dystonia and Parkinson’s Disease Center of Excellence Dec 2015
Thong, D, Mayank P and Frei K. Living Well with Dystonia. A patient guide. 2010. | http://ropeneurorehab.co.nz/dystonia.php |
The Fashion Plate Magazine explores Love & Intimacy this month.
The articles this month will lean heavily on my experience as a single woman. I decided to go this route instead of something more romantic because single people are often negatively perceived for not committing to a relationship and I believe that self-love and self-acceptance are things singles and couples share. So for the month of February we will look at self-love, intimacy, heartbreak and self-acceptance. These four components are critical to living a full life whether you are single or in a couple.
My story as a single woman is not a common one, I don’t believe. In my 20s I was engaged a number of times but I never married. When I was 31 I met the love of my life, it was the first time I could honestly see spending the rest of my life with someone (unlike those other times I was engaged apparently). To me he was everything I imagined a mate should be, but he didn’t feel the same way and he ended it. The pain I experienced at the loss of that relationship was devastating.
I mourned a long time. I remember my Uncle Kyle found me moping, again, and asked me, “why would you want to be with someone who doesn’t want to be with you?”. The question made me pause and I realized I didn’t want to be with someone who didn’t want to be with me because I love myself more. It was my first step at recognizing self-love and self-acceptance.
I picked myself up and I decided to move forward. I reached out to my father whom I hadn’t spoken to for years, I took courses in writing and poetry, I joined book clubs and I learned to swim. In doing these things I had an opportunity to spend time adjusting to life without him and I realized I was going to be ok. I also learned something about myself, I felt a need to get married, not because I wanted to, but, because it was expected of me. It was then I decided that being single was better than rushing to create a life with someone who wasn’t right for me.
Time has gone by and I am still single and I’ve come to accept I may never find someone to share my life with. And while that scares me, a lot, I’m actually more afraid of becoming complicit in my single-hood. I’m single but my life is full of events, friends, travel and fun. Sometimes the days go by so fast and then, every once in while, I miss intimacy. I have a great bond with my friends but it is different with a partner- and as a single person I have learned to be more self-efficient and introspective, but nothing can replace intimacy.
Intimacy is not something you can have alone. It is a sharing of yourself with someone else and them sharing themselves with you. There are different forms of intimacy but they all require being vulnerable. You must be open to people and allow them to thread their way into your world. And while that can be uncomfortable at times, opening your world to others, the benefits are enormous. It can lead you to be your best self and help someone do the same. A common block to intimacy between two people is heartbreak. It can make you close yourself to intimacy and try to replace it with superficial versions, but it will never be enough.
Love, heartbreak, intimacy and self-acceptance are the topics we explore this month. I hope you find them enlightening.
And it’s also Black History month! Black history is a large part of my self-identity. As a black woman, a descendant of American slaves and the product of a family of entrepreneurs, culture-shapers and activists, I am a very strong character. I’ve been encouraged to be unapologetically black. And I was raised to be proud of the rise of black people in America.
I love following the lives of black people around the world who are rising despite negative sentiment by non-black people. I am happy to see black people encourage each other to love who we are as we are, write our own stories, develop awards to recognize our greatness, highlight our contributions to world history and shape our future and that of society.
Black people loving themselves is the key to having a positive relationship with non-black people. And our positive portrayal of ourselves and sharing it with non-black people is a form of education and awareness. It is also the key to success for a positive future between black people and non-black people.
For us to truly have a more intimate relationship with non-black people we will have to share our fears and desires and our insecurities. We will then see that we are not different. As my mother always says, there is only one race, the human race.
At this moment black people are in the midst of heartbreak as our country’s leader, whose job it is to protect us and help us to grow, disparages black people in America and in the world. But we will have to channel those emotions into something more productive until we find a leader that is a better fit.
What is important is that we don’t lose the connection with non-black people and that we all continue to work together. | https://thefashionplatemag.com/modern-culture/the-editors-corner/editors-letter/this-month-on-the-fashion-plate-magazine-love-intimacy/ |
The invention discloses a method for preparing an electrode material of a lead-acid battery. The chemical composition of the electrode material of the lead-acid battery comprises active carbon, carbon black, lead powder, lead dioxide, rare earth elements, barium sulfate, protein fibers, silk, chemical fibers and the balance of water. The preparation steps are as follows: S1) mixing the protein fibers, the silk, the chemical fibers and the water uniformly for standby use; S2) mixing the active carbon, the carbon black, the rare earth elements and the barium sulfate uniformly for standby use; and S3) after mixing the lead powder and the lead dioxide, adding the mixture obtained in the step S1, heating and stirring, then adding the mixture obtained in the step S2, carrying on stirring, and cooling to a room temperature. Through the technical scheme abovementioned, the method for preparing the electrode material of the lead-acid battery, compared with the prior art, has the advantages of enabling the raw material cost of the lead-acid battery to be reduced greatly, enabling the lead-acid material to have a relatively strong competitive advantage in the market, and being good for improving popularization and application of the lead-acid battery. | |
I025, a novel uncultivable bacteria group, has been associated with periodontal disease, which affects 18% of the adult population in the industrialized world. Neither the natural reservoir nor the complete diversity of this group is known. I025 belongs to the candidate phylum TM7, which was first discovered in diverse natural environments including seawater, soil, and activated sludge, and is made entirely of uncultivable species. Recent independent investigations have detected TM7 ribosomal DNA (rDNA) gene sequences in the human oral microbial community of both healthy and diseased individuals, whereas I025 was detected primarily in diseased individuals. rDNA sequence comparison between environmental and human TM7 strains indicate some are nearly identical, suggesting they are close relatives, if not the same species. We hypothesize that an environmental I025-like bacteria can serve as model for better understanding the I025 role in human periodontitis. Our goal is to establish such an I025 model. Resistance to cultivation, however, has kept TM7 species undescribed beyond their rDNA sequence and few morphological features, despite their conspicuous filaments of up to 70 [unreadable]m in length in the human oral plaque. Undergraduate and Master's students at SJSU will apply modern and highly sensitive culture-independent molecular techniques to investigate the function of I025-like bacteria in their natural habitat. [unreadable] [unreadable] The specific aims of this project are: [unreadable] Aim 1: Identify ecological sites with TM7 and then characterize the diversity of TM7 in those environmental samples related to human periodontal-associated TM7 species through PCR amplification of 16S rDNA gene and sequence analysis. [unreadable] Aim 2: Quantify environmental TM7 closely related to the periodontitis-associated TM7 (I025) through real-time quantitative PCR and fluorescence in situ hybridization. [unreadable] Aim 3: Characterize the metabolic function of TM7 cells in their natural environment through innovative methods that combine microautoradiography and in situ hybridization to measure nutrient uptake by single cells, without the need of cultivation. [unreadable] [unreadable] Ecological environments serve as the reservoir for many human pathogens. I025 is a potential emerging human pathogen, and once its environmental source is defined and the nutrient requirements understood, we can proceed to establish a model for better understanding its role in humans. [unreadable] [unreadable] [unreadable]
| |
- What Are Bank Errors?
- Business Ideas
- Recording Bank Reconciliations
- Manage Your Business
- How Can I Stop A Preauthorized Debit From Being Paid From My Checking Account?
- You Are Not Entitled To Spend Money That You Do Not Deposit Into Your Account And Would Be Wise To Report The Error
- Treatment Of Errors And Omissions Resulting In More Bank Balance In Cash Book When Preparing The Bank Reconciliation Statement
The presence of a means of checking to confirm that the blood released is that for the specified patient does not mean it is effective. Computers have become common in blood banks to provide electronic rather than paper records of the release of units of blood. This is a check or money transfer you’ve issued and recorded on your books which is still uncleared. If there’s a discrepancy between your accounts and the bank’s records that you can’t explain any other way, it may be time to speak to someone at the bank. Reconciling your bank statements won’t stop fraud, but it will let you know when it’s happened. So, assume the full lotus position or just find a comfy chair.
The reasons for this response can vary – the customer will need to contact their bank for more details. According to Schwab, Ms. Spadoni opened the brokerage account in January, and the excess cash was added to a transfer request that she made in February.
What Are Bank Errors?
The funds had been transferred to another account and used by Ms. Spadoni to buy a house and a Hyundai Genesis S.U.V., according to the Jefferson Parish Sheriff’s Office. She was arrested on fraud and theft charges on April 7 and fired as a dispatcher the same day, the Sheriff’s Office said. Rather, more of those errors may be due to fraud, Norton says. That problem is compounded by the fact that it’s increasingly difficult to get bank errors fixed. Many banks, however, are taking steps to dramatically decrease the potential for error by adopting innovative, technology-driven workflows . Searches transactions for checks and deposits that have not finished the clearing process.
We know that this is possibly a duplicate transaction because we have another transaction from Bills Windsurf Shop and their payment was made against their accounts receivable. So it’s little incongruencies like this that can help us do our detective work as to why things may have been incorrectly recorded. A teller at the bank apparently confused the man, whose name is Benjamin A. Lovell, with Benjamin S. Lovell, a Philadelphia ledger account businessman whose name was added to his company’s corporate account. The teller’s error cost the company a big chunk of its holdings, since police were only able to recover about $500,000 of the money that was withdrawn. Lovell was eventually sentenced to probation, despite his claims that he’d tried to give the money back. To err is human and no one is safe from making the occasional mistake or two, including bank employees.
You receive a bank statement, typically at the end of each month, from the bank. The statement itemizes the cash and other deposits made into the checking account of the business. The statement also includes bank charges such as for account servicing fees. Sometimes after receiving a check normal balance from debtors, it is deposited at the bank but not recorded in the cash book . Due to this error, the cash book shows a lower bank balance compared to the bank statement. Bank reconciliations are an essential internal control tool and are necessary in preventing and detecting fraud.
Business Ideas
When you’re handling large amounts of money and dealing with dozens of customers each day, it’s inevitable that you’re retained earnings balance sheet going to make an error at some point. Mistakes happen in any business, and banks and credit unions are no exception.
Police and bank officials are still trying to track down $3.8 million of the money Gao made off with. Banking errors occur more often than you think and without a doubt, these five cash flow bank teller mistakes rank as some of the worst in history. Use the Finder or the navigation buttons for the Bank Code field to display the bank account you are reconciling.
Recording Bank Reconciliations
Errors may be committed to casting the bank column of the cash book. The customer’s bank is declining the transaction for unspecified reasons, possibly due to an issue with the card itself. They will need to contact their bank or use a different payment method. The FCBA generally applies to “open end” credit accounts, such as credit cards or revolving charge accounts . Whether you are an HOA or a property owner, RowCal can help you with your property management responsibilities. We offer a wide range of services including management, financial administration, online resources and tools, and project management.
A few examples of errors and omissions are given below that lead to a greater bank balance in the cash book. Steep, ricocheting bounced check fees — not only charged by your bank, but also by merchants — if a bank error leads to an overdrawn checking account. Add or deduct the same error amount from the cash account that you used with the bank statement to balance the two. If the bank returned a customer payment for insufficient funds, you credit cash and debit accounts receivable.
After spending $30,000 in his bank account that didn’t belong to him, the young man earned a 10-year sentence, according to local news reports. A teller had deposited a check from a client with the same last name into the teen’s account; he spent most of the funds on a BMW. The job of checking if the bank made errors on their reports. normal balance It can be safer to make a deposit via the ATM or via mobile deposit. When you insert your card into the machine or you log in to your mobile account, your account number is pulled up automatically. This prevents account numbers from being entered incorrectly. Just make sure that you select the right account when making your deposit!
- Bench says if you’re a small business that goes days or weeks with no transactions, monthly reconciliation might be enough.
- If, on the other hand, you use cash basis accounting, then you record every transaction at the same time the bank does; there should be no discrepancy between your balance sheet and your bank statement.
- The FDIC is proud to be a pre-eminent source of U.S. banking industry research, including quarterly banking profiles, working papers, and state banking performance data.
- If it seems like you can never get the numbers to add up correctly in your accounting, it could be due to tiny mistakes that keep throwing your numbers off.
- Under the Advanced Settings section, check the box to Allow bank error tracking during reconciliation.
If they may be counterfeit, don’t deposit them until you call the issuing bank to verify authenticity. When the bank corrects their error, follow this same process to enter the bank’s correction and zero out the corresponding errors. The Bank bookkeeping Error Details screen closes, returning you to the Reconciliation screen. If you incurred a loss from an electronic transaction, you should notify the bank as soon as possible, as there are separate laws that address this type of transaction.
Make adjustments as soon as they occur for accuracy, or as soon as you notice them when doing your bank reconciliation after receiving a bank statement. Federal law provides a means for correcting these types of account errors as long as the financial institution involved is notified in a timely manner. Bank charges are service charges and fees deducted for the bank’s processing of the business’ checking account activity. This can include monthly charges or charges from overdrawing your account. If you’ve earned any interest on your bank account balance, they must be added to the cash account.
Manage Your Business
In addition to crediting your account for the disputed amount, the lender must also remove all finance charges, late fees, or other charges related to the error. Once you properly notify the lender about an error on your statement, it must acknowledge that it received this notification within 30 days, unless the problem has been resolved. The lender must investigate and resolve the issue within two complete billing cycles after receiving the billing error notice.
And many banks offer apps that make it easy to quickly check recent transactions in your checking, savings, and credit card accounts. Bank reconciliation done through accounting software is easier and error-free.
How Can I Stop A Preauthorized Debit From Being Paid From My Checking Account?
We’ll do one month of your bookkeeping and prepare a set of financial statements for you to keep. For the most part, how often you reconcile bank statements will depend on your volume of transactions. Bank reconciliations aren’t limited to just your bank accounts. Any credit cards, PayPal accounts, or other accounts with business transactions should be reconciled. Transactions cleared with bank error status remain outstanding with an amount equal to the difference for later reconciliation. If the bank discovers the mistake before you do or before you notify them of the mistake, the bank will take back the money and put it in the correct account. The bank does not have to request permission or otherwise notify you they will be removing the erroneously deposited funds.
MyBankTracker has partnered with CardRatings for our coverage of credit card products. MyBankTracker and CardRatings may receive a commission from card issuers. Opinions, reviews, analyses & recommendations are the author’s alone, and have not been reviewed, endorsed or approved by any of these entities. She is an expert in consumer banking products, saving and money psychology. She has contributed to numerous online outlets, including U.S.
You Are Not Entitled To Spend Money That You Do Not Deposit Into Your Account And Would Be Wise To Report The Error
After turning himself in to police, Bucci eventually entered into an agreement to repay the money to avoid a 14-year jail sentence. Overdraft protection is designed to keep you from having to pay a ton of bank fees if you spend more money than you have in your account. It’s not supposed to make you a millionaire, but that’s exactly what happened to New Zealand resident Leo Gao in April 2009. When experiencing any of the errors listed below the cardholder’s bank is declining the charge and sending the error. Therefore, the merchant will have to reach out to their customer and the customer will reach out to their card issuing bank to know why the transaction was declined and how to correct the issue.
We’re going to look at what bank statement reconciliation is, how it works, when you need to do it, and bank errors the best way to manage the task. In QuickBooks Online, we will have multiple balances for an account.
To do this, navigate to the upper left hand corner of our transactions and click on the funnel filter icon. The bank caught on to the goof almost immediately and corrected it, but not before the man and his supervisor were both terminated. The supervisor was later able to get her position reinstated by a German court, but the teller, unfortunately, had no such luck. | https://fosatradeintegrated.richeemedia.com.ng/2020/03/21/h1-treatment-of-errors-and-omissions-when/ |
Background/aim Numerous epidemiological studies have shown effects of long-term exposure to air pollution on cardiovascular, respiratory and cognitive health. However, studies investigating the effects of air pollution on depressive symptoms are limited and results are conflicting. We aimed to examine the association between long-term exposure to ambient air pollution and depressive symptoms in elderly women.
Methods Our analyses were based on 821 women (age ≥65 years) living in the Ruhr area and Southern Münsterland, Germany (SALIA cohort, follow-up examination, 2008–2009). Annual average concentrations of particulate matter (PM) size fractions and nitrogen oxides (NOx) were assigned to home addresses by land-use regression (LUR) models. Self-reported depressive symptoms were evaluated using the Centre for Epidemiological Studies – Depression Scale (CES-D) and a CES-D score ≥16 as a dichotomous outcome was used in analyses. Our adjusted logistic regression models included age, body mass index, smoking status, environmental tobacco exposure at home, educational status, urban/rural living, physical activity, cardiovascular disease, respiratory diseases and diabetes as covariates.
Results A total of 129 women (15.7% of the individuals) had a CES-D score ≥16. We observed significant positive associations between an interquartile range (IQR) increase of PM10 (OR=1.294; 95% CI: 1.022 to 1.640), PM2.5 (OR=1.594; 95% CI: 1.120 to 2.270), NO2 (OR=1.418; 95% CI: 1.044 to 1.924) and NOx (OR=1.507; 95% CI: 1.108 to 2.051) with the presence of depressive symptoms. No significant associations were observed for an IQR increase of absorbance of PM2.5, coarse fraction of PM and traffic indicators (traffic load and residential proximity).
Conclusion In this study, mean annual concentrations of PM 10 , PM2.5, NO 2 and NOx were positively associated with depressive symptoms in elderly women. Findings of our study suggest that air pollution is not only a risk factor for physical health but might also have adverse effects on mental health among elderly women.
Statistics from Altmetric.com
Request Permissions
If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways. | https://oem.bmj.com/content/75/Suppl_1/A1.1?ijkey=ede4c9f88714179de213086d41a7c8f87dde81c7&keytype2=tf_ipsecsha |
26 October 2017
We are becoming increasingly aware of the psychosocial risks in the work place such as bullying and the significant impact it has on businesses and most importantly people. Bullying can affect performance, cause disruption in the workplace and cause physical and mental health harm. A Person Conducting Business or Undertaking needs to be aware of their risks and effectively deal with them.
WorkSafe New Zealand’s Good Practice Guidelines, Preventing and Responding to Bullying at Work - For Persons Conducting Business or Undertaking (PCBUs) defines bullying as, “repeated and unreasonable behaviour directed towards a worker or a group of workers that can lead to physical or psychological harm”.
What workplace bullying is not, is a one off event where a person may be rude or being unreasonable, differences in opinion, personality clashes (which do not escalate into bullying or violence) or a person whom is being reasonably managed.
Bullying can come during work or after work and from any direction, not limited to mangers or peers, it can also come from subordinates and clients or customers.
This can lead to:
According to the Good Practice Guidelines bullying can be physical, verbal and/or relational/social, but fits into two categories:
Looking at these examples above, similarities can be drawn to a psychological effect known as ‘The Gaslight Effect’. A term becoming more familiar.
The gaslight effect is a form of psychological abuse where someone gradually and persistently targets a weakness or flaw of a person to manipulate a situation, or, withholding or providing false information and causing that person to second guess themselves, feeling confused and insecure, questioning their version of events, feeling worthless and hopeless.
The perpetrator is expressing a dominance over the victim and the victim unknowingly becomes the victim.
The term Gaslight comes from a 1944 film, ‘Gaslight’ where a husband systematically attempts to alter his wife’s perception of reality, through confusion and manipulation of facts.
An example of this is when a worker accuses a co-worker of failing to do a task or for something that went wrong and recalling specific information about the discussion that was never had, causing the co-worker to question themselves and their memory, often leading them to take responsibility and apologising for something that was never their fault. This is often repeated in a different form or situation by the worker.
Anyone can be a victim of gaslighting no matter age, gender or intelligence and can be present in any type of relationship.
This type of treatment falls within the spectrum of workplace bullying, where it is persistent and repeated behaviour of the perpetrator.
Everybody has a role to play in health and safety at work. The PCBU needs to know the risks of the business. Officers need to ensure that the PCBU is managing those risks effectively and the workers are not exposing themselves and others to risks at work.
A PCBU can manage the risk of bullying in the workplace by:
When faced with a claim of bullying, a PCBU needs to:
Failing to act on a report of bullying can not only lead to a prosecution but can have far reaching human impacts. PCBUs need to understand the risks and have proper processes in place to eliminate or minimise those risks and ensure that they are managed well. | http://osea.org.nz/blog/workplace-bullying-whos-dimming-the-lights/ |
Accor is exposed to various risks and uncertainties as a result of its international presence and may have to manage crisis situations such as health scares, environmental disasters or geopolitical disruption.
Accor’s policies are guided by an assertive security and risk management strategy focused on protecting customers, employees and sub-contractors on every site.
The strategy deployed by the Safety, Security and Risk Management Departments, as overseen by the Corporate Secretary, is underpinned by a global network of correspondents, close working relationships with local authorities and the expertise of specialists.
It forms part of a pro-active process comprising three key components: risk identification, tracking, analysis and audit; training and awareness building; and crisis management.
The Risk Management Department has put in place a risk identification process covering every host country and the corporate head office.
An analysis is performed once a year in every country organization or subsidiary, with findings reported to the Risk Management Department, which confirms that the identified risks are covered. In addition, as part of their audit assignments within the Group’s entities, the internal auditors verify that the main risks identified in the risk map are being effectively and properly monitored.
The Group also has a Risk Prevention Committee based at the head office and reporting to the Corporate Secretary. Its roles and responsibilities are described on page�105 in the report of the Chairman of the Board of Directors on internal control and risk management procedures.
The security and safety situation in terms of geopolitical, health, weather, social and other risks is tracked daily by the Security and Risk Management Departments in conjunction with their local counterparts in every host country.
Employees on temporary or long-term assignments in a given country or region may consult regularly updated security and health advisories on the Risk Management intranet site.
In addition, a guide has been prepared for employees in French and English containing safety recommendations and advice for business travel.
Security, safety and crisis management audits and training programs are regularly offered to corporate departments, operating divisions and employees. As every year, several programs and exercises were organized for hotel managers and for local head office employees in 2012, in particular in Senegal, Algeria, Tunisia, Egypt, Ivory Coast, China, Indonesia, Spain, Thailand and Vietnam. As part of the preparations for the Euro 2012 Football Championship and the London Olympics, dedicated training programs were conducted in Poland and the United Kingdom.
Crisis management teams set up in every country organization and each unit provide effective liaison between local head offices and senior management.
a in the United States when Hurricane Sandy struck the East Coast. | http://sites.accorhotels.group/docref2012/en/114.html |
With the combined experience of 30+ years as parent and family programs professionals, the presenters will share their knowledge on what works well when engaging families of college students and invite the audience to share their own lessons learned. We will discuss effective practices in communication, including crisis communication; engaging parents on campus, such as volunteers or members of parent councils; serving special populations, such as families of students with disabilities and first generation families; partnering across divisions for maximizing event planning, including family weekend and family orientation; and career education.
Learn about how the Hiatt Career Center at Brandeis University proactively engages with parents and families. Brandeis offers programming for parents who wish to support their own student's career development as well as opportunities for parents to serve as volunteers on behalf of the Hiatt Career Center.
Thinking about a cost-effective way to provide a "class" experience for parent and family members? This fall we launched "P&F 1000 - A University Introductory Course for Parents and Families". Come learn about this program and how it could be implemented on your campus.
Whether Parent and Family programs are in your office title or not, we are collectively responsible for ensuring that this population is successfully transitioned to our institutions. Staff from the New Student Orientation program at UGA will share how they use innovative practices to engage and involve Family members in the transition with the help of several campus partners, including a fundraising focused Parent and Family Association. This is done throughout the admission process as well as pre-, during, and post- orientation.
Do you know what your freshman students would say about their parents' involvement? Research has shown parental involvement can be a factor in the retention and transition of freshmen. This session will discuss the findings of a recent study conducted at a midsize, public university that asked for freshmen students' perspective on their parents' support compared to parental education and income levels. Discover how the findings can shape implications for practice related to your support of parents.
Once a student is accepted to Columbia, communication with families is significantly less frequent than during the application process. Much of the information families believe they need is either shared directly with their recently accepted student, or is not yet available or relevant. This creates a perception among families that Columbia is not sharing the information that they “need.” We will present a snapshot of how we collaborate with campus partners to reach these families and supply information using webinar technology. We will also demonstrate how the webinars allow us to connect with them in a way that contextualizes the campus partners’ roles as student resources and defines families’ roles as supportive referral agents.Using GoToWebinar and YouTube together, we encourage an appropriate relationship between families and their students as well as between families and Columbia with the goal of allowing students to become interdependent. Furthermore, we establish Family Engagement as a parent’s/family member’s primary resource.
The notion that parents and family members drop their student off at college and wait for them to return home for the holidays is no more. Family members are important factors in a student’s college life and seek to be engaged in many different ways. Participants will learn how multiple departments at the University of Houston are collaborating to provide informative and engaging programming for parents and family members to experience college life along with their student.
In the growing field of parent and family services and programs, many of our faculty and staff colleagues are unsure of what parent and family program professionals do, how we do it, or why we do it. Communicating with colleagues and sharing your story is a great way to develop powerful relationships that can benefit family members and create a supportive and welcoming environment.
Enhance family engagement and giving through collaborative membership programs. Explore how the University of Florida successfully merged two membership programs: the UF Alumni Association and Gator Parent and Family Member Association, to create a seamless experience for all families. This program will take participants from start to finish with what has become a campus point of pride including: assessing market capacity for merged membership, campus partner buy in and family membership prospect forecasting and operational execution of program.
The presentation will discuss the strategies Orientation & Family Connections at NIU implemented to develop “A Glimpse of Student Life” session. I will share our innovative and collaborative approach that allowed us to present student life topics (campus, state, federal mandates) in a unique and engaging manner. I will outline to our campus partners, how we developed the presentation and assessment data to reflect the impact on parent/family members and students. This session will give practical steps to allow participants to return to their campuses and potentially implement a similar program. The presentation will focus on the philosophy behind and the data to support the development of an educational session presented at NIU’s orientation called, “A Glimpse of Student Life.” The interactive session provides an opportunity for new students and their families to learn about student life issues facing college students today.
The purpose of this program is to highlight the many different types of assessment that are possible—from a monthly poll to a full CAS review—and to show it can be painless for any parent/family program professional to conduct assessments and measure outcomes. Participants will leave with the tools and techniques to improve services, promote programs to the institution, and elevate engagement with parents and families.
Supporting the families of our first generation students and students of color requires strategic efforts and, oftentimes, a different approach. Explore examples of outreach and support based events, including leveraging valuable campus partnerships, crafting compelling messaging and understanding lessons learned. This session provides the opportunity to connect with colleagues to create and share ideas for supporting our underserved populations.
Professionals who work with parent and families often come from diverse backgrounds in their education and prior work experience. So many of these professionals do not have formal counseling training, yet we all “counsel” parents, family members, and even students on a regular basis. This session will address five essential foundational counseling skills and techniques, and explain how professionals can practically apply these skills in their daily work with students. Learning Outcome: As a result of the session, attendees will be able to apply five essential foundational counseling skills and techniques to their interactions with students, parents, family members, and individuals on their campuses.
Do you wanna build a Snowman......err…..Do you wanna build an event other than Family Weekend? This is the program for you to learn about innovative, hands on, and practical experiences of effective events beyond Family Weekend! Presenters from 4 different institutions (Clemson, Georgia Tech, Louisville, Syracuse) will share a wide variety of effective ideas for proven events that engage families year round.
From parent-student orientation, to our signature program, Parent Academy, and beyond to family-friendly engagement opportunities, Cal State LA’s parent programs strive to elevate the experiences of our parent population, most of whom are People of Color and have not previously attended college. This session will detail a parent’s year long journey across our campus.
Institutions of higher education now face structural and cultural challenges as to how to accommodate parental expectations for involvement within the context of privacy laws and the university’s need for improved retention and meeting financial obligations. At the heart of this problem are our faculty charged with determining student academic progress. Sharing the qualitative research outcomes of a doctoral research study, this presentation will highlight the experiences and perceptions college faculty at a private, religiously-affiliated, research institution have related to parent’s involvement in student academic progress. Analytic themes related to faculty experiences and perceptions will be discussed and broad implications for practice offered to parent programming professionals working with faculty, parents and students.
Parents and families involved in the University of Oregon Parent Professional Network (PPN) support UO students in exploring their passion, honing their career skills, and offering jobs and internships. We will discuss scalable and tangible ways for you to leverage parents’ professional experience at your own institution in order to transform students’ career readiness, bolster development efforts, and elevate their engagement to be career educators in the campus community.
In order to effectively reach parents and family members, parent programs departments must collaborate with a variety of other campus entities. Parent programming offices collaborate with others to provide some of the most fundamental parent services, with 56% collaborating to provide Parent Orientation, 39% collaborating on Family Weekend, and 36% collaborating on move-in receptions (Savage & Petree, 2015). This session will go beyond the typical parent programming office collaborations, focusing on unique partnerships forged by parent programs offices in order to elevate services to parents and family members at the presenters’ institutions.
We all know that parents crave communication that can help them support their college student, but do we know which topics they truly want to learn more about and how they want to consume that communication? In this interactive, engaging session participants will learn what two different institutions did to find out what their parents wanted to know more about and to deliver customized content that keep their parents informed and connected.
Penn State recently deployed the CampusESP Parent Portal, an online tool for connecting with parents and families, for all 10,000 incoming first-year parents at its main campus. Learn about what worked and what we would have done differently. We'll focus on roll-out strategies, parent content suggestions, building cross-campus partnerships, and meeting the needs of increasingly diverse parent and family populations.
While many institutions focus predominately on the transition of its new students, the College of William & Mary has forged relationships between Student Affairs, the Alumni Association, and the Development Division to engage first-year families within the Tribe! Join us for a lively discussion as we share our triumphs and challenges bringing together these three unique, yet important facets of university life in an effort to comprehensively support and elevate the family transition - and ultimately the success of our students.
This session will feature a detailed review of the national survey of college parents and compare it to a similar survey conducted in 2012 and 2014. The purpose of the consumer survey is to provide insights into the understand the college parent experience and how that may contribute to or promote greater college completion.
In early 2015 Kennesaw State University and Southern Polytechnic State University consolidated to create the New KSU, and the office of Orientation, Transition and Family Programs was split up; Orientation and Transition Programs went to University College under Academic Affairs and Parent and Family Programs moved to the Dean of Students under Student Affairs. Looking for ways to continue collaboration between these offices, a new student leadership program was designed to provide orientation leaders and extended orientation leaders an advanced leadership position called Family Ambassadors to serve parents and families on orientation days, during Parent and Family Weekend, and during additional events and activities. In an attempt to provide parents and families more face time with students who can reflect their own children and whose experiences can resonate to provide increased engagement with the institution, the Family Ambassadors were recruited from past orientation and extended orientation leaders.
New Student Conferences en Español is a program designed to enhance the experience of Spanish speaking family members of new students during their mandatory orientation an throughout their student’s collegiate experience. The program seeks to meet the needs of Spanish speaking family members who currently attend programs while also welcoming new families who may perceive their limited English skills as a barrier to participation. This session will provide an overview of the NSCs en Español program implemented during Texas A&M’s mandatory orientation, other initiatives used to engage Spanish-speaking families, and discuss strategies for implementing a similar programming for family members. As more and more non-English-speaking families join our college and university communities, how do we ensure that they're engaged and informed? Translating each and every web-based, emailed, and printed message into a growing number of languages seems prohibitively expensive. But English-only messages often create confusion and stress for family members who can’t understand them. Learn how one small college has enlisted multilingual students to pilot a new approach.
Are you looking for a way to refresh and reenergize your Parent and Family Orientations at your university? Come learn about how the staff at Rutgers-New Brunswick restructured their Parent and Family Orientation program by focusing on how key messages were delivered. When we restructured our orientation program 2 years ago, we learned that delivery makes all the difference for a successful and effective Parent and Family orientation program. We were able to transform our parent/family orientation program with the introduction of panels, videos, special population programming and dedicated student staff for parents and family members. This change led to higher attendance rates and satisfactory ratings on assessments. We are excited to share tips about training, planning and implementation that will elevate your campus partner to a higher level!
Orientation programs are a necessary and vital way to begin the process of connecting new students to the campus community through the development of skills, communication of values and expectations and delivery of campus knowledge, history and traditions. Just as there are a variety of institutional types, there are a variety of ways to plan, organize, manage, implement and evaluate these critical programs. This session is sponsored by NODA-Association for Orientation, Transition and Retention in Higher Education and will provide an overview of and approaches to orientation programs and encompassing parents and families in the process.
*Presentations are not available for download. Please contact the presenter for more information.
*Session not available for download. Please contact the presenter directly for more information. | https://www.aheppp.org/2016-educational-sessions |
Opening Times B&M - West Drayton
Is this information correct?
Is this information correct?
It's necessary to respect following measures:
B&M Home Store with Garden Centre is prominently positioned in Cowley Retail Park at 217 High Street, a 1.08 mile drive north-west from the centre of West Drayton, in Yiewsley (by Philpots Bridge). The store essentially serves people from the locales of Iver, West Drayton Town Centre, Yiewsley, Parkwest Appartments, Triangle Mews, Richings Park, London and Hillingdon. Today (Friday), its operating hours are from 9:00 am - 8:00 pm. Please note the various sections on this page for specifics on B&M West Drayton, including the store hours, address, phone number and more information.
B&M Home Store with Garden Centre is located at the closest crossroads of Philpots Close and High Street, in Yiewsley, West Drayton, at Cowley Retail Park.
Just a 1 minute trip from Moorfield Road, Hornbill Close, High Road or Trout Road; a 5 minute drive from Falling Lane, M25 or Park View Road; or a 12 minute drive from M4 / Heathrow Airport Spur Road and M4 / M4 Junction 4.
When using Satellite Navigation enter the postcode UB7 7GN to get here.
The local bus will drop you at Moorfield Road, Yiewsley Library, Philpots Bridge and Falling Lane. The current list of accessible routes: 222, U1, U3 and U5.
The closest tube station: Uxbridge (2.34 mi away). Your line options are Piccadilly and Metropolitan.
Trains operate directly to West Drayton Station (2840 ft) and Iver Station (1.47 mi away). Great Western Railway is the regular service line.
In the vicinity you may visit Packet Boat Marina, Brunel Training Grounds, Chantry School, St Matthew's C of E Primary School, St Matthew's Church and Yiewsley Library.
Right now, B&M operates 1 discount store in West Drayton, Middlesex.
For a complete directory of B&M discount stores near West Drayton, go to the link provided.
Please take into consideration that the opening hours for B&M in West Drayton may differ from typical times over UK public holidays. For the whole of 2022 these exceptions include Xmas, Boxing Day, Easter Monday or Spring Bank Holiday. To get verified information about holiday operating times for B&M West Drayton, visit the official site or call the customer line at 0330 838 9436.
When visiting B&M, please be sure to take a look around the additional fine stores at Cowley Retail Park. Located in this place you may also find TESCO, Argos, Currys, B&M and Carphone Warehouse.
Opening Times in the UK always works to deliver you with the most up-to-date information. In the event that you find mistakes in the street address or hours of opening for B&M in West Drayton, please utilize this form to report a problem. Help our future customers by posting your opinions! Using the box below, you are encouraged to write a critique of B&M, and rate its discount store using the star rating scale. | https://www.openingtimesin.uk/b-and-m-west-drayton |
You are here:
Home
::
News
::
Hanoi news
Love it or loathe it, the vibrancy of Hanoi’s old quarter always provokes a reaction, its throbbing effervescence giving the capital’s residents a sense of its own unique character and a charm that has captivated the hearts and minds of the city’s foreign residents, who have spoken of their love of this lively, interesting and beautiful place.
To begin with, they feel scared whenever they get lost in the old, similarly-named streets, the pavements crammed with food stalls and the roads filled with traffic chaos.
Chantrelle Nielson, an American who has lived in Hanoi’s old quarter for the past year, said that, to begin with, she was afraid of walking on the pavements.
“The streets are so jumbled up and the names are hard to remember. We would take short walks to find something to eat, then we would get lost and spend an hour trying to find our way back to the hotel. It felt like trying to swim in a very fast river”, she said.
However, Hanoi is the most lively place that Nielson has ever seen. She loves to go to one of the restaurants or coffee shops overlooking the streets in the area to sit and watch the traffic and life in the vine-covered buildings, the terraces with caged birds and the families going about their daily business.
Hanoi old quarter, which are often referred to as the 36 old streets, are located in an area covering 100 hectares in Hoan Kiem district – the capital’s centre. The area is surrounded by Hang Dau street to the North, Hang Bong, Hang Gai and Cau Go to the South, Tran Nhat Duat, Tran Quang Khai to the West and Phung Hung to the East.
A majority of the street names start with “Hang”, which means merchandise or shop. The guild streets were named for their products or locations. For example, skilled silversmiths from the northern province of Hai Duong now occupy Hang Bac street, one of the most ancient streets in all of Vietnam.
Most of the streets are noisy and crowded with people buying or selling their wares. In Hang Thiec Street, people can watch local craftsmen manufacturing oil lamps and candle sticks and hear the unmistakable sound of tin or iron being struck with a hammer.
Writer Carol Howland is the author of a book entitled “Dragons in the roof – one year in Vietnam”, and says that “Walking in the 36 old streets looks like finding paths in noodle soup”.
She feels that each section of the old quarter contains a craft village where traditional handicraft techniques are passed from generation to the next.
Carol Payne, a US student said that sitting under the canopy with her friends at Au Lac cafe behind the famous hotel Metropole is very gentle and beautiful. However, this sense of peace is shattered when she wanders north into the old quarters, as the streets change and begin to meander off, defying any sense of direction.
The local residents she met could not speak of the city in terms of compass points as people do in North America . In fact, they didn’t seem to be able to point out things on a map either.
However, she said that getting lost is also fun because it is during those times that she experiences the infinity of the district. There is a richness of detail, in terms of the architecture, human life, the unexpected pagodas, street vendors, hidden alleys, market streets and sidewalk cafes.
Carol thinks that the old quarter is very special. It resembles a giant department store, with a neighbourhood of merchants and artisans engaged in the same trade. Apart from the buildings, replete with distinctive French architectural features and office buildings, there may also be a pagoda in the next small alley.
David Lowe, a 36 year-old English from Liverpool, said that he loves walking down the old quarter’s streets as they are really lively. Although he has lived all over the world, he considers Hanoi to be the best place he has lived in, as he can feel that the city is actually alive.
“In Hanoi, particularly in the old quarter, there is always so much going on. You can stop for five minutes and there is just so much to take in. It gives the area a lot of its character and makes it lively. It reminds you that you are in a real working city, with people going about the hustle and bustle of their daily lives, the sounds and the smells, the things to see. I love to sit down and just watch the world go by for 10-15 minutes. I think the old quarter gives Hanoi a lot of its unique charm,” he confided.
Foreigners who visit Hanoi have their tastebuds tantalised by many kinds of special food, such as bun cha, pho, chao ca, bun ca, trung vit lon, banh ran, bun oc and mien cua tron.
A wealth of luxury restaurants have appeared in the old streets to serve foreign visitors with Western or Asian food, such as French baguettes, Italian pizza and noodles, Japanese sushi, Thai curry and mixed soup and Korean salted vegetables.
Chantrelle said that she never felt homesick for the food she ate at home, because of the amazing, authentic French pastries, which were better than most that she could get in America. She also loved the Italian food.
“I could go on and on about other places I remember. I think I could have eaten for five more years in Hanoi and never have discovered all the great food there. I also love rice wine”, she added.
She said she wouldn’t ever forget the food she ate in Hanoi. According to her, the Vietnamese food in the US is all southern style, because that is where all the immigrants come from.
“I remember very distinctly the flavour of the little orange chilies, and the red chili sauces and garlic vinegar for the pho. I loved the beef noodle rolls on Truc Bach island, it was quiet there and its such a nice place to sit and eat”, she said.
She will always fondly remember all of the different types of bananas on offer, as well as the range of fruits, particularly pomelo, dragonfruit and the most delicious of all, watermelon.
David said that his favourite food is smoked mountain pig, as the meat is dried and smoked, and has such a distinctive smoky rich taste. He spoke of his love of walking around the old quarter, being able to stop at any point at food vendor’s stalls offering complete, unique food that they have been making for years, and making really well.
According to him, the most significant feature of Hanoi and what makes it such an appealing city to foreigners like him is the people. “I came here four years ago and was only here for a month, but I really enjoyed being in this vibrant, bustling, charming, unique place. However, without the people you bump into everyday, it is just buildings. You come here because you feel welcomed here” he said.
Chantrelle thinks it is wonderful to be able to watch everything that is happening and enjoy the food. For her, everything in Hanoi was a result of the energy that she felt coming from the development of the economy. She said she hopes that Hanoi can preserve its history and its beauty for years to come./.
Print
Email
Bookmark
© Copyright VietnamPlus, Vietnam News Agency (VNA).
Editor-in-chief, Mr. Tran Tien Duan. Licence No. 1374/GP-BTTTT dated September 11, 2008 by the Ministry of Information and Communications. | http://en.hanoi.vietnamplus.vn/Home/Viewing-Hanois-old-quarter-through-foreign-eyes/20099/46.vnplus |
It is incorrect to assume that all gifted children experience emotional problems. There are plenty of gifted children who develop successful friendships in school and who enjoy their education. While a gifted student faces some special challenges, they are not doomed to unhappiness. Teachers and parents can help gifted students face special challenges if they arise.
Gifted children often experience difficulty establishing relationships with their peers. More intellectually developed than children in their own age group, the gifted student attempts to play complex games that are too advanced for their peers. This frustrates the gifted student who wants to play at a level that stimulates their mind, but alienates their peers who do not understand the complex rules of the gifted child’s games.
Although the gifted child is functioning at an intellectual level of a child in an older age group, their mental development is not necessarily advanced, which presents difficulties in peer interaction with children in older age groups. The advanced intellectual development is often misinterpreted as advanced emotional development by peers. Gifted students who are highly developed intellectually, but who have normal emotional development find great difficulty fitting in with older children. Older children view the gifted child as immature.
Gifted students commonly internalize their feelings. Depression and withdrawal often result. A child, unable to express their feelings of inadequacy and loneliness, may cease to attempt to socialize with peers and ignore schoolwork. Teachers and parents should watch for signs of emotional withdrawal. When schoolwork suddenly gets sloppy or is not completed at all, there is a problem. The teacher is often the first person to notice the signs of emotional problems.
Intervention for underachieving gifted students should be taken as soon as possible. Underachievement in the classroom is a warning sign of emotional despair. Sometimes, simply pulling the student aside for a private conversation to discuss the concerns is all that is needed. If the child feels comfortable opening up a line of communication with the teacher and is receptive to the teacher’s advice, a counseling recommendation may not be needed. If open communication can’t be established or is insufficient, the teacher should refer the student to work with a counselor.
Boredom in the classroom can quickly cause a gifted student to lose interest in classroom work. Stimulating the mind of a gifted student should be a priority for the teacher. Deviating from set lesson plans, is often the best solution when working with intellectually advanced students. Allow the student to create their own lesson plans or write their own coursework material. A student who craves intellectual stimulation will challenge themselves appropriately when creating their own lesson plans or writing their own material.
Parents, peers and teachers sometimes push gifted students too hard. It is easy to see the potential that a student has, but it is a fine line between a stimulating learning environment and a learning environment that is too high pressure.
A student who almost always succeeds intellectually is often asked, “What happened?” or told “You should try harder next time. You are smarter than that,” when they fail to succeed at a task. It is unfair to have expectations for a gifted student that are not realistic. Let the student know that it is okay if they get an answer wrong or need extra time to study and that they are not a failure if they can’t accomplish a learning assignment.
Unrealistic expectations encourage the student to have a perfectionist attitude where anything less than perfect is viewed as a failure. The child’s self esteem should not be based solely on their intellectual abilities. Too much pressure and too high expectations may set the gifted child up for failure. | https://www.brighthubeducation.com/teaching-gifted-students/29987-potential-emotional-and-social-problems-of-gifted-students/ |
Chances are, if one were to ask a high schooler how they were feeling, the number one answer would be that dreaded, eight letter word: stressed. With stress comes anxiety and nervousness as well. In today’s day and age, school and social issues aren’t the only things that can add to the stress load of students.
One of the things that can lead to stress for high school teenagers is, on the non-academic side, social standing. At the age of 14-19, children feel that they have to be superior by fitting into a crowd. If they don’t do what a certain group of people are doing, then they could be seen as unfit, or unqualified to be with a certain group of people.
According to a study conducted by Johns Hopkins University, one of the biggest social stressors is trying to perform or behave beyond their ability. This could be in terms of social or academic standing. If a student is trying to fit into a group of new peers, they may do things that they would not normally feel comfortable doing, just so that they can fit in. The more that a student thinks that they’re not good enough, the more they could feel like they have to try and be someone different or to do something uncomfortable.
In an academic setting, students may feel like they have to perform at the top of their classes. The College Board did a study that concluded that between the years of 2003 and 2013, there was a 7.9 increase of students taking honors and AP classes. Nowadays, students think that they have to perform at a certain level of excellence, especially in these types of classes, just to be normal. Whether that’s getting up and doing oral reports if a student is shy or striving to perform the best in a certain class, the student today has a lot on their plate, socially and academically.
A student completed a study of the students and faculty in Saddle River Day School in Saddle River, New Jersey. A Google Form was sent out to about 175 students and 50 teachers, asking them what was their biggest stress in high school. I got responses from 60 students and nine members of the faculty.
Student stresses were listed as:
- Homework
- Tests
- Time management
- College Applications
- Getting the grades needed to apply to a good college
- Expectations
- Studying
This was surprising, since the social aspects of stress were not stated, and the main focus was the stress of academics, even though social stress is still prevalent.
As far as faculty goes, there was a smaller range of answers. The most popular answers were:
- Time management
- Fitting in
- “Getting a date”
- Being accepted
- Getting into college
The question was then asked whether or not the faculty members felt that the stress that they feel now was the same as the stress they had felt when they were in high school. An overwhelming “YES!” was collected.
One of the reasons given was, “I think students now have these same issues as we did; however, I think they have more distractions today than when I was in high school. Computers and devices were not as common and we did not have to deal with those as a way to distract us from our learning. I also think that more research and time has been invested in teaching students how to study and giving them the scaffolding/tools to help them learn their best. I think that is different then when I was in high school.”
De-stressing
Despite the stresses they suffer, many students don’t realize the benefits of destressing. One of the leading ways for anyone to destress is to put down technology. This can be doubly so for students. According to a Pew study conducted in 2015, nearly 75% of high school students in the United States have access to a smartphone. 24% were found to go online “almost constantly” and another 56% are online several times a day. With the technology of smartphones comes the technology of social media. While social media is a great way to stay in the loop of what their peers are doing, it also poses as a way for teenagers to feel excluded. They can see something for which they didn’t get an invite. Since they know they didn’t get invited, there’s a possibility that they would do anything that they could to try and be “cool enough” to get invited to the party. The more one doesn’t check social media, the less they have the pressure to live up to others’ standards.
Another great way to destress is to focus on creating a change in mindset, turning “I can’t’ to “I can.” In a recent study conducted at the University of Texas at Austin and the University of Rochester, psychologists wanted to see if a small shift in mindset could reduce teenagers’ social stress. They found that with a simple, half-hour training, they could help teens cope better, keep their bodies calmer and even do better in school. The other half of the students that participated in the control group also learned a growth mindset, but applied it to the physical environment in high school, not the social one. They took their mindset to achieve their own version of greatness in academics.
Stress can be a tough thing to deal with, especially with teenagers in the technology-laden modern world. Teenagers need to be reminded that there’s more to life than the latest party. Also, the fact that competing with others for academic (or social) greatness will not make or break you is important to remember. Tools and remedies need to be available that can help them when they can’t control their stress. With these supports, teenagers can learn to be calmer and happier individuals. | https://mindkey.me/the-stressed-out-teen/ |
This is an introductory module to the business and international world of events. It is designed to familiarise all students with the industry. It provides general underpinning knowledge relevant to all event modules. It will include an introduction to the nature of events, reviewing the range, type and characteristics of events, understanding of the main providers and the role events play in society. It will consider the nature of event demand, the motivation and the impact of events. It will also consider workforce skills by including the Industry Practice Component (IPC)– an encouragement and desire for students to gain 400-600 hours industry practice before the end of Year 2.
Module provider
Hospitality & Tourism Management
Module Leader
KENNELL James (Hosp & Tour)
Number of Credits: 15
ECTS Credits: 7.5
Framework: FHEQ Level 4
JACs code: N213
Module cap (Maximum number of students): N/A
Overall student workload
Independent Learning Hours: 117
Lecture Hours: 11
Seminar Hours: 22
Module Availability
Semester 1
Prerequisites / Co-requisites
None
Module content
Indicative content includes:
Definition and dimensions of events
Business and International context of the industry
Establishing the role of events and venues Principles and theories of event management
Event demands, needs and motivations
The impact of events
Events, public policy and trade associations
Event workforce skills and knowledge
Sustainable events
Assessment pattern
|Assessment type||Unit of assessment||Weighting|
|Oral exam or presentation||SMALL GROUP 15 MINUTE PRESENTATION (2 TO 3 MAX)||50|
|Coursework||INDIVIDUAL REPORT (1500 WORDS)||50|
Alternative Assessment
In cases where the original group project is not suitable for re-assessment (e.g., only one student needs to retake the failed group project), an individual essay of 1000 words will be assigned.
Assessment Strategy
The assessment strategy is designed to provide students with the opportunity to demonstrate a comprehensive and accurate understanding of the events sector and the management of events in society.
The assessment for this module consists of:
a) a individual report aimed at assessing the students’ understanding of key concepts, issues and trends in several areas of event management.
b) a small group project and presentation designed to encourage students to further explore aspects of the business of events through working with their peers.
Both formative feedback and summative feedback will be provided on the project.
Module aims
- Introduce the theory and practice of event management
- Classify a range of event types and their particular characteristics
- Identify the nature of demand, motivation and impact of events
- Introduce event workforce skills and careers in the events industry
Learning outcomes
|Attributes Developed|
|001||Outline the main features of events, events management and the event sector||CK|
|002||Describe and understand the key features required in the events workforce||PT|
|003||Give examples of the demand and motivation for events||C|
Attributes Developed
C - Cognitive/analytical
K - Subject knowledge
T - Transferable skills
P - Professional/Practical skills
Methods of Teaching / Learning
The teaching and learning strategy is designed to provide students with key information about events in society, event characteristics, event sectors, and working in events and to encourage them to explore and evaluate the major characteristics and challenges of the event business.
The teaching and learning methods include lectures designed to provide a framework of knowledge; exercises to provide opportunities for students to gather and interpret their own material; and tasks to challenge their thinking. Lectures are three hours each on a weekly basis, and relevant case studies and in-class discussions are integrated into the lectures.
One lecture is scheduled every week for 11 weeks, plus a two hour seminar session.
Indicated Lecture Hours (which may also include seminars, tutorials, workshops and other contact time) are approximate and may include in-class tests where one or more of these are an assessment on the module. In-class tests are scheduled/organised separately to taught content and will be published on to student personal timetables, where they apply to taken modules, as soon as they are finalised by central administration. This will usually be after the initial publication of the teaching timetable for the relevant semester.
Reading list
https://readinglists.surrey.ac.uk
Upon accessing the reading list, please search for the module using the module code: MAN1105
Other information
None
Programmes this module appears in
|Programme||Semester||Classification||Qualifying conditions|
|International Event Management BSc (Hons)||1||Compulsory||A weighted aggregate mark of 40% is required to pass the module|
Please note that the information detailed within this record is accurate at the time of publishing and may be subject to change. This record contains information for the most up to date version of the programme / module for the 2023/4 academic year. | https://catalogue.surrey.ac.uk/2023-4/module/MAN1105 |
The potential for legal liability and human rights violations apparently forced the Cayman Islands government’s hand on the approval of a Data Protection Bill in the waning hours of its last Legislative Assembly meeting.
The bill’s last draft was published in April 2016 and it was placed on the assembly’s agenda for a vote 11 months later in the midst of a jam-packed March meeting during which 36 other pieces of legislation were being considered. Various amendments were made to the 2016 bill during the legislative committee’s review earlier this month.
The Cayman Islands has no legal mechanism to regulate the use of closed circuit television cameras in public areas, despite installing those cameras in 2011, although it has a “code of practice” in place which is not legally binding. Since that time “there has been a significant increase [in] the use of CCTV within the islands,” according to the Cayman Islands Human Rights Commission.
“Without the implementation of a comprehensive data protection law to address the diverse circumstances in which CCTV is used, policies or codes of practice on their own are generally not considered a sufficient legal framework to support the careful balance needed between human rights and the operation of CCTV,” the commission noted in its 2016 annual report.
Some specific problems were raised with the government’s use of CCTV cameras. For instance, at the Lighthouse School in George Town district, CCTV cameras are used “to enhance the safety of students, staff and others on school premises and to deter destructive acts to property,” according to the Department of Education.
The Human Rights Commission was particularly worried about the retention of images captured by the CCTV cameras without data protection or legal policies regulating the cameras.
“The commission remains of the view that without such regulations, the use of CCTV will remain unlawful under both the constitution and the European Convention of Human Rights,” the report noted.
Another issue raised by the commission is the use of drones by the Cayman Islands prisons service to conduct surveillance on individuals who toss illegal drugs over the Northward prison perimeter fence. In addition to the prisons, the Civil Aviation Authority noted it had received “numerous” requests for the public use of small unmanned aircraft from residents.
“The commission’s concerns relate not to the rights of those committing or planning crime, but the possible invasion of privacy that the devices could post to nearby members of the public, neighbors and landowners when the drones are deployed outside the prison,” the Human Rights Commission noted.
Similar concerns were raised by the commission about the Royal Cayman Islands Police use of a thermal imaging or FLIR camera on board its helicopter, with the specific problem again raised regarding the retention of those images.
The concerns about the lack of legal regulation for CCTV in the Cayman Islands were raised six years ago by Acting Information Commissioner Jan Liebaers.
“CCTV is operating in a legal vacuum,” Mr. Liebaers said at the time. “The code of practice [for CCTV] refers to the fact that the system would be governed by data protection.”
The government has attempted to pass data protection legislation since 2010 and had failed to do so until this month. The implementation of data protection regimes, which will have a huge impact on Cayman Islands business, is expected to be staggered, with government agencies coming into compliance first and sections of the private sector following after.
The data legislation seeks to protect personal privacy rights and instructs private sector businesses and government agencies on how they must handle personal records.
The two previous attempts to pass data protection legislation ended largely because of an uproar from the Cayman business community after its members saw the cost of implementing such a plan for their operations. | https://www.caymancompass.com/2017/03/29/legal-concerns-raised-over-cctv-cameras-drone-use/ |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.