content
stringlengths 0
1.88M
| url
stringlengths 0
5.28k
|
|---|---|
Tiny plastic particles from the ocean have now entered the food chain, making their way into our bodies through the gut, a groundbreaking study has found.
Scientists from the Medical University of Vienna tested stool samples from volunteers in eight countries, including Britain. Harmful levels of plastic were present in each and every one.
The plastic is thought to have been ingested by fish in our oceans, which then end up on our plates. Around 5% of plastics produced globally end up in the sea.
There are now concerns about the impact ingested plastic is having on our immune systems and gut health.
Lead researcher, Dr Philipp Schwabi said: "Of particular concern is what this means to us, and especially patients with gastrointestinal diseases.
"While the highest plastic concentrations in animal studies have been found in the gut, the smallest microplastic particles are capable of entering the blood stream, lymphatic system and may even reach the liver.
"Now that we have first evidence for microplastics inside humans, we need further research to understand what this means for human health."
The scientists found nine different types of plastic in the stool samples, including the most common polypropylene (PP) and polyethylene terephthalate (PET).
Six of the eight study participants – who came from Britain, Austria, Finland, Poland, Italy, Japan, the Netherlands and Russia – had recently eaten fish. All of the volunteers had eaten products wrapped in plastic packaging or drunk from plastic bottles, their food diaries revealed.
Scientists say the study's findings are not surprising, but more research is needed to understand whether ingesting plastic has long-term health implications. | https://www.countryliving.com/uk/wellbeing/a24097578/plastic-found-in-the-bodies-of-every-single-human-participant-in-new-study/ |
The Department of Criminology and Sociology of Law is hosting the 41st annual conference of the European Group for the Study of Deviance and Social Control.
The main theme of the conference is the ways in which those studying deviance and social control have traditionally responded to challenges in society and how and in which ways ‘criminology’ is challenged today.
- How should these challenges should be met in the development of new theoretical perspectives?
- What are the limits to critical criminology?
- What, if anything, defines critical analysis in criminology? | https://www.jus.uio.no/ikrs/english/research/news-and-events/events/conferences/2013/CCIACW/ |
The US Department of Energy (DOE) recently launched the Operational Technology (OT) Defender Fellowship. Another milestone step from the Department in enhancing the US’s critical infrastructure.
In collaboration with DOE’s Idaho National Laboratory (INL) and the Foundation for Defense of Democracies’ (FDD) Center for Cyber and Technology Innovation (CTTI), the OT Defender Fellowship hopes to expand the knowledge of primary US front-line critical infrastructure defenders.
“In support of the President’s Cybersecurity Workforce Executive Order, the Department of Energy is proud to support this elite training program to create opportunities to grow America’s cyber workforce,” says DOE Secretary Dan Brouillette.
Briolette also said that operation technology security managers play a vital role in keeping the core physical systems of the US’s energy infrastructure running smoothly, especially during natural disasters, physical sabotage, and even nation-state cyberattacks.
Sharing cybersecurity knowledge to the private sector
The OT Defender Fellowship is a 12-month program for operational technology security managers in the US energy sector. It will enable the program participants to engage with various cyber and national experts across the US government. The program aims to also equip them with a better understanding of the strategies and tactics of the country’s adversaries and how the US government cyber operations defend the nation.
“Understanding an adversary’s strategy and tactics is critical to effective defense,” explains CSC Commissioner Samantha Ravich, chair of FDD’s CCTI.
The Fellowship aligns with the bipartisan recommendations of the congressionally mandated Cyberspace Solarium Commission (CSC).
“Securing our energy infrastructure is not an abstract policy idea, it is an immediate need to protect our nation from the real threat of malign actors,” says Senator Angus King, CSC co-chair.
King also explains that the CSC report supports operationalizing cybersecurity partnership with the private sector and remolding how the government works with the private sector. King added that this DOE initiative will better protect the US from cyberattacks.
Tom Fanning, Chairman, President & CEO of Southern Company, says that national security greatly depends on the collaboration between private sector and the government.
“As a world leader in securing operational technology and industrial control systems from cyber threats, INL is looking forward to sharing our knowledge and experiences with the private sector through this important fellowship,” said Zach Tudor, INL associate laboratory director for National and Homeland Security programs. “This fellowship expands on many of the lab's successful research and development programs, our at-scale testing capabilities, and our comprehensive training and workforce development initiatives,” Fanning adds.
To qualify for the fellowship, participants must be in a middle or senior management role in a US energy sector, with decision-making authority and oversight responsibility of operational technology systems. They must also be nominated by their organization’s leadership and commit to the requirements imposed by the program. The participant must also be a US citizen and currently hold or be able to attain federal security clearance at the Secret or higher level, or be in a role that justifies application for Department of Homeland Security-sponsored private sector clearance. | https://www.trendmicro.com/us/iot-security/news/6466/US_Department_of_Energy_Launches_New_Program_for_Technology_Security_Managers |
The importance of measuring social factors – the ‘S’ in ESG – is rising up the sustainability agenda, Robeco’s recent experience shows.
Robeco routinely integrates environmental, social and governance factors in its investment processes, and votes on ESG issues that we feel are important at company shareholder meetings. In the past, the environmental and governance factors have been high profile, due to concerns over climate change and boardroom behavior respectively.
Now, the social factor is increasing in prominence. Looking at what kind of financially material ESG issues are addressed in investment cases of our financial analysts, we find that eight out of the 15 most mentioned issues are actually social factors, as shown in the graph below. These range from human capital management to occupational health and safety and privacy protection.
This forms part of a wider acceptance by companies and investors that ESG factors are financially material to performance. Virtually all companies already give a high priority to occupational health and safety, for example, as this topic routinely comes before profit; the safety of employees remains paramount. Aside from the human consequences of an unsafe working environment, the premise that good management of your staff leads to lower staff turnover and enables a company to attract better-qualified people is widely understood as also leading to lower costs, and thus higher margins.
Many of the other socially relevant topics like privacy and data security, product quality and food safety management often influence a company’s value through reputation. Having good policies and track records on these issues gives financial analysts the comfort that risks are lower when investing in these names, and is integrated into our investment processes.
Investors who take the time to do this may find they also then have more confidence in management quality. Quantifying it can be more difficult, however. To help investors with this topic, the UNPRI published a report in May 2017 entitled ‘ESG integration: How are social issues influencing investment decisions?’ using several case studies to strengthen their arguments.
The fact that social issues are very relevant for companies was also confirmed by the voting season this year. We voted on 195 socially related shareholder proposals, compared to 85 on the environment.
In fact, of the many ways in which shareholders can influence the strategic direction of the companies in which they invest, filing and co-filing shareholder proposals is perhaps the most impactful. We will therefore file and co-file shareholder proposals in a limited number of cases where we believe they will have strong material impact on long-term shareholder value creation. At the 2017 shareholder meeting of McDonald's Corporation, for example, we co-filed a proposal requesting the company to adopt a policy regarding use of antibiotics by its meat suppliers.
We also analyze all shareholder proposals on case-by-case basis, and assess the impact on the company’s business from a responsible shareholder perspective. As shareholder proposals on environmental issues tend to relate in some way or other to climate change, their materiality is immediately obvious.
However, the more fragmented nature of proposals on social issues makes their materiality less instantly clear. We tend to find that these proposals are often less well constructed, more difficult to quantify and assess the impact on value for the company, and more difficult to execute for the company than are proposals on the environment. That is why we vote in favor of them in about 55% of the cases (as opposed to 83% of cases on the environment).
So, to me, it is clear that social issues can be extremely relevant to investors, though we need to do more research into making the financial relevance and context clearer. So let’s not forget the S in ESG. | https://www.robeco.com/jp/insights/2017/07/social-factors-rise-in-prominence-for-sustainability-.html |
The Malibu community needs trustworthy reporting—but good journalism isn’t free. Please help keep us in print by making a contribution.
1 of 5
Lisa McKean submitted photos of her Malibu Park garden to The Malibu Times for Best Shot consideration this week. “I find my garden the most healing place to be in this time of isolation,” she wrote. “Spring is here.”
Stuck at home, many in Malibu are planting vegetable gardens during the coronavirus emergency—local garden supply stores can barely keep up with demand.
Lisa McKean submitted photos of her Malibu Park garden to The Malibu Times for Best Shot consideration this week. “I find my garden the most healing place to be in this time of isolation,” she wrote. “Spring is here.”
Photo courtesy Lisa McKean
Fresh eggs from a local farmer, available at Trancas Canyon Nursery
Julie Ellerton / TMT
Another garden photo provided by Lisa McKean (@malibufountains)
Photo courtesy Lisa McKean
Anawalt Malibu Hardware & Supply displays herbs, vegetables, flowers and other plants available for purchase as an “essential business.”
Julie Ellerton / TMT
Danielle Dagenais reaches for a garden sculpture during her day helping customers at Trancas Canyon Nursery.
Now that everyone is staying home around the clock except for the occasional foray to an “essential business” or to walk the dog, boredom is setting in. There are only so many hours a day anyone can spend looking at a screen or cleaning out the garage. As a result, many residents have come up with the same solution for doing something fun outside that doesn’t involve violating the social distance rules—planting an edible garden of vegetables, fruits and herbs.
Andy Lopez, Malibu’s “Invisible Gardener” said in a phone interview that, “Now is the time to get started—you can have vegetables in 30 days... and if you plant fruit trees, you can have a ton of fruit by next year.”
All of the garden supply companies in town have confirmed that sales of plants, potting soils and seeds are going through the roof since schools, businesses and beaches were closed.
At Cosentino’s Nursery at 25019 PCH, Manager Phil Campanella said, “It really helps people’s anxiety just to come here and walk around looking at the plants and the ocean view for a half-hour, even if they don’t buy anything.” He pointed out that the nursery seldom has more than a handful of customers at one time spread out over a large property, so social distancing is no problem.
“Usually, people in Malibu don’t start planting vegetables until April,” Campanella continued, “but this year, they’re starting early” because of the state’s Safer at Home order. “It’s mostly locals coming in, and they’re really taking their time planning out their gardens. There’s a real demand for anything edible, as well as succulents.”
At Anawalt Malibu Hardware & Supply, employee Matthew Gervais said raised beds, potting soils and vegetable plants were selling very well. The store had a variety of nursery plants to pick from, including eggplant, cucumbers, beans, spinach and beets.
Nearby, Whole Foods Market has a display of vegetable nursery plants out front, including tomatoes, herbs and bell peppers. Ana Arias, store flower and plant manager, said “People are buying up all the trays of plants and I’m having to work closely with the vendor to keep it full out front.”
At the west end of town, Trancas Canyon Nursery has also been experiencing a run on garden plants. Longtime employee Debbi Stone said, “Our customers are buying anything edible. I think they’re doing the Victory Garden thing.”
“We got a ton of vegetables in last week and everything was gone by that night,” she continued. “Right now, I’m out of seeds and most potting soil, but I’ll be getting more in, and I just got a shipment of fruit trees and blueberry bushes. My vendors are also getting overwhelmed.”
She confirmed that now is a good time to begin planting.
“The weather is still cool, but the ground is warming up and still moist from rain,” Stone said. “It’s a good time to plant tomatoes, peppers, zucchini and cucumbers—just about everything.”
Beginning gardeners can contact or join the Malibu Garden Club for advice or help. Vice president Linda Androlia said anyone can ask a question through their website or Facebook page. Although the monthly meetings are currently on hiatus, when they resume, the 70 members have access to a sharing table of plant cuttings and extra fruits, raffles, talks, snacks and field trips.
In addition, Lopez not only has a website and a book (“Don’t Panic, it’s Organic”), but also hundreds of YouTube videos, radio shows, podcasts and workshops. He said his book can be downloaded in a PDF format for free from his website, invisiblegardener.com/ebooks.
And remember, a garden doesn’t necessarily require a yard—experts say even a balcony, small patio or a sunny window sill are enough space to grow something.
Watch this discussion.Stop watching this discussion.
(0) comments
Welcome to the discussion.
Keep it Clean. Please avoid obscene, vulgar, lewd,
racist or sexually-oriented language. PLEASE TURN OFF YOUR CAPS LOCK. Don't Threaten. Threats of harming another
person will not be tolerated. Be Truthful. Don't knowingly lie about anyone
or anything. Be Nice. No racism, sexism or any sort of -ism
that is degrading to another person. Be Proactive. Use the 'Report' link on
each comment to let us know of abusive posts. Share with Us. We'd love to hear eyewitness
accounts, the history behind an article. | |
I appreciate your invitation to discuss the question of whether future beneficiaries will get a fair return on their contributions in terms of the benefits they will receive from Social Security. You also asked me to address the question of whether young workers should expect to receive their full benefits and what changes will be required to ensure that future retirees are treated fairly.
As we begin to discuss and analyze the changes that may be necessary to ensure that Social Security continues to serve the needs of America, it is absolutely essential to understand the role that Social Security has played in the past and recognize the positive impact it has had on the economic well-being of the country. Social Security allows almost 42 percent of the elderly-10 million people--to live out of poverty.
Unfortunately, many critics of the program judge its value from much too narrow a perspective. They view it from the perspective that Social Security is only a savings plan for retirement and that the return on investment is the sole criterion against which it should be assessed. Some people believe that if they were allowed to invest their Social Security taxes in private investments, such as stocks and bonds, they would receive a higher rate of return--in their view, a fairer return--on their Social Security taxes than Social Security currently provides. Thus, I would like to begin today with a brief look at the purpose of the program before I discuss some specific comparisons of contributions and benefits.
The success and popularity of Social Security is based on the fact that it strikes a balance between the complementary goals of individual equity--providing benefit protection which is related to an individual's contributions--and social adequacy--providing advantages to society as a whole by alleviating poverty and allowing as many citizens as possible to enjoy a reasonable standard of living. In other words, the social adequacy aspects of the program look beyond the individual to how Social Security can benefit society as a whole. These features, which I will describe later in my testimony, are designed to provide a measure of financial independence to all workers, including lower paid workers and their families. One of the key elements of Social Security is that because it is not means-tested, it maintains the collective nature inherent in this social insurance program.
As a social insurance program, Social Security spreads the cost of protection against the risk of lost income due to retirement, death, or disability over the entire working population, with more protection, per dollar earnings, for lower paid workers and for workers with dependents. Consequently, the value of benefits for any given worker depends on his or her individual circumstances--whether the individual has high or low earnings, is married, may have children, becomes disabled or dies at. a young age, or receives benefits beyond average life expectancy.
For example, in an extended family, retired beneficiaries·may be receiving benefits while their adult children, still in the workforce, and grandchildren have the assurance that Social Security benefits will be there if one of the working parents becomes disabled or dies. The security provided by Social Security is inter-generational.
Those who limit their analysis of the value of Social Security to the retirement program ignore the vitally important disability and survivor programs. Over 30 percent of our Nation's Social Security beneficiaries are receiving disability and survivors benefits, and those programs make up over 30 percent of the benefits Social Security pays. This protection can be extremely valuable, especially for young families that have not been able to sufficiently protect themselves against the risk of the worker's death or disability. In 1994, Social Security paid $15.2 billion in benefits to children. Without Social Security's protection, an increased burden would be placed on families, other government programs, and private charities to support those who would be left in financial need due to the unexpected death or disability of the worker.
One way to gauge the value of Social Security disability benefits is to express their value as insurance. The Social Security disability program provides the same value as a $203,000 disability insurance policy for a worker aged 27 with a spouse and two children and with average earnings. Last year, Social Security paid about $41 billion in benefits to about 6 million disabled workers and family members.
Similar value applies to the Social Security survivor program. Survivor benefits for a worker aged 27 with a family and with average earnings are equal to a $295,000 life insurance policy. Social Security also paid about $67 billion in benefits to more than 7 million survivors of deceased workers last year. Again, we tend not to focus on the fact that one in five of today's 20-year-old men and one in eight 20-year-old women will die before retirement.
Social Security has had another important beneficial impact that critics of the program often fail to acknowledge. By dramatically increasing the extent to which retired and disabled workers, their dependents, and survivors of deceased workers are financially independent, Social Security has relieved younger generations of the burden of providing for the financial needs of older relatives at the same time they are trying to raise their own families.
Finally, because the cost of administering the program is less than one percent of contributions paid, the public is receiving maximum value for their investment. More than 99 percent of the Social Security contributions paid by workers is returned in benefits paid to them or their survivors. That's better than anything you can get in the private market.
Because Social Security is designed to meet certain social adequacy goals, we should not measure its worth simply by comparing contributions paid and benefits received. Certain features of the program are geared toward meeting broad-based social needs in addition to providing retirees with a specific rate of return.
The basic benefit formula is designed to replace a higher proportion of earnings for low earners than for high earners. This is in part because higher income workers are more likely to have accumulated greater savings or investment income than lower income workers. Also, it assumes that lower earners need to have more of their earnings replaced because they spend a higher proportion of their earnings for basic needs. Such workers generally are not able to accumulate savings or generate investment income to the extent that higher earners can. Additionally, many low earners have worked in jobs that have not provided pension coverage. Thus, the benefit formula provides lower income workers with a measure of financial independence without the requirement to establish need.
Social Security is the major source of income (providing 50 percent or more of total income) for 63 percent of beneficiaries aged 65 and older, and contributes 90 percent or more of income for about 25 percent. As the program has matured, it has more effectively met its objectives. Only 1 in 8 elderly people are living below the poverty line today, compared to 1 in 3 in 1959. And about 42 percent of beneficiaries age 65 and over--more than 10 million people--are kept out of poverty by their monthly Social Security benefits.
Social Security was never intended to serve as the sole source of income to retirees. When combined with pensions, private savings, and investments, however, Social Security benefits were intended to give workers some measure of economic security. Benefits are based on the amount of earnings subject to Social Security contributions, rather than individual financial circumstances. Generally, the higher the lifetime earnings, the higher the monthly benefit.
Let me now discuss some specific comparisons of contributions and benefits. As stated earlier, the value of the Social Security program should not be measured solely on the basis of individual equity. Any analysis of the Social Security program shows· that past generations have benefited greatly from the program. This is because, until the program matured, benefits tended to be generous relative to contributions so that the program could begin to offer adequate protection to as many workers as possible, including those who did not have an opportunity to contribute to it during their entire careers.
As the program has matured, the return on contributions has decreased but remains generous. For example, to illustrate the return for persons now becoming beneficiaries, we may consider a person with average wages who retires at age 65 in 1996, who paid $21,518 in the employee's share of Social Security OASI contributions. When interest on those contributions is factored in, the resulting value is $73,703. This worker will receive a monthly benefit of $890, and will recover all contributions, with interest, in 8 and one-third years. This worker can be expected to live nearly 10 more years beyond the break-even point.
In the future, the rate of return, while declining, will continue to be fair, especially when viewed within the context of the broad social objectives of Social Security. For example, a "baby boom" worker with average wages who retires at 66 in 2015 will pay $59,562 in the employee's share of Social Security contributions ($258,824 with interest). This worker will receive $2,074 in monthly benefits or $1,006 in real terms, and recover those contributions in about 12 years, and can be expected to live 6 years beyond the break even point based on life expectancy projections for 2015.
For a worker born in 1968 with average earnings who retires in 2035 at age 67 it will take 10 years to recover the contributions he or she paid. This worker will receive a monthly benefit of $1,215 in today's dollars and can be expected to live an estimated 8 years after the break-even point.
Having given you these calculations for those individuals born in 1968, however, I must qualify their significance. As we all know, we cannot project what lifetime benefits for those retiring 20 to 40 years from now will be. We all recognize that changes to the program will be required to sustain Social Security in the long term.
As you know, the Congressionally mandated Advisory Council on Social Security is very close to completing its assessment of long-range solvency options. Once the Council's options and recommendations are made public, the Social Security Administration, Congress and the public will carefully evaluate them and assess their impact on current and future beneficiaries. Until the public discussion has progressed further, it would be 5 premature for me to take a position on specific options or ideas.
Mr. Chairman, for 60 years Social Security has been one of the most important and successful government programs. It was conceived not only to protect individuals, but also to protect America as a whole from the kind of economic uncertainty and need that existed during the Great Depression. The value of Social Security must be judged in terms of the protection it provides- not only for the individual but for society as a whole. Thus, those who seek to measure its value must consider the design of the program and the elements that support its design, rather than restrict their analysis to a simple measure of a rate of return on contributions.
According to the 1995 Trustees Report, beginning in 2013 Social Security expenditures will exceed revenues. The Trustees Report estimates that the Social Security Fund will be exhausted in 2030. Clearly, considering the crucial role that Social Security plays in our society, its future solvency is of critical importance to the nation.
As past successful efforts to reform Social Security have shown, changes to the program should occur only after bipartisan debate and public discussion. The Advisory Council is an important element in the development of this bipartisan consensus. I look forward to sharing the Council's work with Congress and the public, and to working with you and the American people to ensure that there is sufficient funding of the Social Security program for all future generations. | https://www.ssa.gov/legislation/testimony_031196.html |
Background {#Sec1}
==========
Lung cancer is one of the most common malignant tumors in the world \[[@CR1],[@CR2]\]. According to the etiologic and pathologic characteristics, lung cancer could be divided into two main forms, small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC) \[[@CR3]\]. The incidence of lung adenocarcinoma, a subtype of NSCLC, is by far the most prevalent lung cancer in China \[[@CR2],[@CR4]\]. Although novel surgical treatment can prolong the survival time of the patients, the long-term survival rate of lung adenocarcinoma after surgery remains low \[[@CR1],[@CR2]\]. Molecular prognostic factors of lung adenocarcinoma such as nuclear DNA mutations \[[@CR5],[@CR6]\] have been investigated extensively in clinical samples. However, whether mitochondrial DNA (mtDNA) alteration is associated with tumor properties has not been explored vigorously.
Mammalian mitochondria are usually depicted as elongated cylindrical particles originated in ancestral eukaryotic cells through endosymbiosis of free living bacteria capable of metabolizing oxygen \[[@CR7]-[@CR9]\]. It is well known that the core functions of mitochondria include oxidative phosphorylation, amino acid metabolism, fatty acid oxidation, and ion homeostasis \[[@CR7]-[@CR9]\]. In recent years, mounting data suggest that mitochondria are involved in crucial cell properties such as proliferation, differentiation and apoptosis \[[@CR10],[@CR11]\]. Most mammalian cells contain 10^3^ - 10^4^ copies of mtDNA and the mutation rate of mtDNA is much higher than that of nuclear DNA \[[@CR7],[@CR8]\]. Mitochondrial dysfunction as a result of mtDNA mutation is increasingly recognized as an important cause of human disease \[[@CR12]\]. MtDNA mutations have been identified in various types of tumors including lung adenocarcinoma \[[@CR13]\].
MitND6 gene encodes ND6 subunit, which is one of the 40 subunits of the NADH dehydrogenase (also known as complex I), in mammalian cells \[[@CR14]\]. In the past ten years, a variety of point mutations of ND6 gene were showed to affect NADH dehydrogenase activity \[[@CR15]-[@CR18]\] leading to NADH dehydrogenase deficiency, and were associated with maternally inherited diseases such as Leber's hereditary optic neuropathy (LHON) \[[@CR15],[@CR16]\] and mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS) \[[@CR17],[@CR18]\]. Using a cytoplasmic hybrid technology with several tumor cell lines, Ishikawa et al. \[[@CR19]\] reported that ND6 missense mutation contribute to tumor cell metastasis in mouse fibrosarcoma, lung carcinoma and colon cancer. However, the biological role of mitND6 gene mutation in human lung adenocarcinoma cells has not been documented.
Here we set out to evaluate the role of mitND6 gene nonsense and missense mutation in human lung adenocarcinoma by clinical investigation and cellular experiments. Clinical investigation showed that mitND6 gene nonsense and missense mutation in lung adenocarcinoma cells was closely correlated with poor differentiation, advanced stage, lymph node metastasis of the tumor, and survival rate. With cytoplasmic hybrid cell (nuclear removed primary lung adenocarcinoma cell as mitochondria donor and mtDNA depleted A549 cell as nuclear donor), we further demonstrate that cells with mitND6 gene nonsense and missense mutation produced more reactive oxygen species (ROS) and exhibited higher capacities of migration and invasion. Our results suggest that mitochondrial ND6 gene nonsense and missense mutation in lung generation.
Methods {#Sec2}
=======
Lung adenocarcinoma specimens {#Sec3}
-----------------------------
A total of 87 primary lung adenocarcinoma patients that underwent pulmonectomy were enrolled in this study. Tumor specimens and paired normal lung tissue specimens taken from a site distant from the cancerous lesion were obtained from the consenting patients, as approved by the Medical Ethics Committee of Changhai Hospital and Fuzhou General Hospital and all patients gave written consent for use of tissue specimens. None of the patients received radiotherapy or chemotherapy before surgery. Clinical and pathological data including age, gender, pathological grading, tumor stage and lymph node metastasis were acquired from the medical records.
Cell culture {#Sec4}
------------
Human lung adenocarcinoma cell line A549 was purchased from the Shanghai Institute of Biochemistry and Cell Biology (Shanghai, China). Cells were maintained in RPMI1640 (Invitrogen) supplemented with 10% fetal bovine serum (Invitrogen), 100 U/mL penicillin and 100 μg/mL streptomycin, within a humidified atmosphere containing 5% CO~2~ at 37°C.
Lung adenocarcinoma samples were mechanically dissociated and then digested in the medium containing 150 μg/mL Collagenase Type IV, 2 μg/mL DNase type I and 10 μg/mL hyaluronidase type V (Sigma) for 2 hr at 37°C. The resulting cell suspension was filtered through a 38-μm nylon mesh and single cells were harvested and subsequently seed in 25 cm^2^ flasks. At confluency, cells were subcultured following detachment by exposure to 0.25% trypsin for 2 min at 37°C. Cells were resuspended in fresh RPMI 1640 medium with 10% fetal bovine serum, within a humidified atmosphere containing 5% CO~2~ at 37°C.
Sequencing of the Mitochondrial ND6 gene {#Sec5}
----------------------------------------
The total cellular DNA of tissue samples were extracted using QIAamp genomic DNA kits (Qiagen). The DNA sample was kept at −20°C until use. The mitochondrial ND6 gene was PCR amplified (sence: ggcataattaaactttacttc; anti sence: catatcattggtcgtggttgtag) from the extracted DNA and then subjected to direct sequencing. The PCR conditions were set at 94°C for 2 minutes followed by 30 cycles of amplification at 94°C for 15 seconds, 58°C for 15 seconds, and 68°C for 40 seconds, and the final extension at 68°C for 6 minutes. PCR products were subject to electrophoresis on a 1.5% agarose gel to separate the DNA bands and visualized by ultraviolet light illumination after ethidium bromide staining. The DNA band of interest was then cut out of the gel and subject to direct sequencing. The results were compared in pairs with reference to the human mitochondrial genome database (<http://www.mitomap.org/MITOMAP>).
Construction of cytoplasmic hybrid {#Sec6}
----------------------------------
Cytoplasmic hybrids were constructed as previously described \[[@CR19]\]. Briefly, A549 cell subline without mitochondria (ρ0 A549 cells, nuclear donor) was constructed by 100 ng/mL ethidium bromide (EB) treating. Complete depletion of mtDNA was confirmed by PCR analysis. Cultured cells from primary lung adenocarcinoma (with and without ND6 gene mutations as mtDNA donor) were prepared by their pretreatment with cytochalasin B (10 μg/mL) at 37°C for 20 min and centrifugation at 9,000 × g at 37°C for 10 min. Resultant cytoplasts were fused with ρ0 cells by polyethylene glycol.
NADH dehydrogenase activity analysis {#Sec7}
------------------------------------
Cells in log-phase growth were harvested, and the mitochondrial NADH dehydrogenase activity was detected with NADH Assay Kit (Abcam). Briefly, NADH and cytochrome c (oxidized form) were used as substrates for estimation of NADH dehydrogenase activity, and the reduction of cytochrome c was monitored at 550 nm.
ROS production analysis {#Sec8}
-----------------------
ROS generation was detected with mitochondrial superoxide indicator MitoSOX-RED (Invitrogen). Cells were incubated with 5 μM MitoSOX-RED for 10 min at 37°C in serum-free DMEM, washed twice with phosphate-buffered saline (PBS), and then immediately analyzed with a FACScan flow cytometer (Becton Dickinson, Mountain View, CA, USA). Those cells incubated with MitoSOX-RED and exhibited red fluorescence were determined as ROS positive cells.
Wound healing assay {#Sec9}
-------------------
Lung adenocarcinoma cells were seeded on 6-well plates at a density of 5 × 10^5^ cells/well. After the cells reached sub-confluence, the mono-layer cells were wounded by scraping off the cells and then grown in medium for 72 hr. The migrated distance of cells was monitored and imaged under a microscope. The distances of cell migration were calculated by subtracting the distance between the lesion edges at 48 hr from the distance measured at 0 hr. The relative migrating distance of cells is measured by the distance of cell migration/the distance measured at 0 hr.
Transwell assay {#Sec10}
---------------
Cell migration and invasion were determined using a transwell (Costar) with a pore size of 0.8 μm. 5 × 10^3^ cells were seeded in serum-free medium in the upper chamber (normal chamber for migration assay and matrigel-coated chamber for invasion assay). The lower chamber was filled with medium containing 10% FBS. After incubating for 8 hr at 37°C, cells in the upper chamber were carefully removed with a cotton swab and the cells that had traversed to reverse face of the membrane were fixed in methanol, stained with Giemsa, and counted.
Statistical analysis {#Sec11}
--------------------
Statistical significance was tested using SPSS15.0 software. For comparison of clinical features (except for aging) between patients with and without ND6 gene mutations, chi-square test was performed. The average age between the patients with and without mitND6 gene mutations was compared with Cochran & Cox t' test. Other data are presented as mean ± SEM, using student t tests for 2-group comparison, and ANOVA for multi-groups comparison with Bonferroni's post-test. A P value less than 0.05 is considered as statistically significant.
Results {#Sec12}
=======
MitND6 gene nonsense and missense mutations are correlated with age, pathological grade, tumor stage and lymph node metastasis in lung adenocarcinoma specimens {#Sec13}
---------------------------------------------------------------------------------------------------------------------------------------------------------------
To determine the mitND6 gene mutations in lung adenocarcinoma specimens, we compared each of the mitND6 gene sequences of 87 patients to the Cambridge Reference Sequence. A total of 26 mitND6 gene mutations existed in 24 lung adenocarcinoma specimens (22 samples with one mitND6 gene mutation and 2 samples with two mitND6 gene mutations). As shown in Figure [1](#Fig1){ref-type="fig"}A-K, 8 mitND6 gene mutations were missense mutations that results in amino acid change of ND6 protein, 3 were nonsense mutations that results in premature termination of the translation of ND6 protein, and the other mutations were samesense mutations that render the ND6 protein sequence unaltered. In addition, the average age of the patients with mitND6 gene mutations was significantly higher than those without mitND6 gene mutations (Figure [1](#Fig1){ref-type="fig"}L). As shown in Table [1](#Tab1){ref-type="table"}, mutations were more common in patients over 60 years of age, but there was no significant gender difference in incidence of mitND6 mutations. We further analyzed the relationship of mitND6 gene mutation with the clinical features including pathological grade, tumor stage and lymph node metastasis. It was found that missense and nonsense, but not samesense, mitND6 gene mutations were significantly correlated with the pathological grade, tumor stage and lymph node metastasis (Table [1](#Tab1){ref-type="table"}). Moreover, ND6 gene missense and nonsense mutations were associated with shorter survival rate, whereas survival rate of patients with ND6 gene samesense mutations was not significantly different from those without ND6 gene mutations (Figure [1](#Fig1){ref-type="fig"}M). These results suggest that the mitND6 gene nonsense and missense mutation might be involved in the regulation of metastasis of lung adenocarcinoma.Figure 1Mitochondrial ND6 gene nonsense and missense mutations in lung adenocarcinoma patients. **(A**-**K)** DNA sequencing electropherograms showing point mutations of mitochondrial ND6 gene lead to the amino acid changes of the protein in 11 cases. **(A**-**H)** represent missense mutation and **(I**-**J)** represent nonsense mutation. **(L)** The average age of the patients with or without mitND6 gene mutation. Each dot represents the age of a patient (n = 24 for patients with mitND6 gene mutation, n = 63 for patients without mitND6 gene mutation) with the line indicating the mean level; \*, *P* \< 0.05. **(M)** The survival rate of the patients with or without mitND6 gene mutation. n = 11 for patients with missense and nonsense mitND6 gene mutation, n = 13 for patients with samesense mitND6 gene mutation, n = 63 for patients without mitND6 gene mutation.Table 1**Relationship between mitochondrial ND6 gene mutation and clinical features of lung adenocarcinoma**Clinical featuresLung adenocarcinoma samplesWith ND6 gene missense and nonsense mutationsWith ND6 gene samesense mutationsWithout ND6 gene mutationsTest*P***Total**111363**Age (year)** \<603/115/1341/637.4230.024 ≥608/118/1322/63**Gender** Male7/119/1343/630.1060.949 Female4/114/1320/63**Pathological grading** Well1/114/1325/6311.9930.017 Moderately4/117/1330/63 Poorly6/11c2/138/63**Tumor stage** T1/T22/118/1337/636.5470.038 T3/T49/115/1326/63**Lymph node metastasis** Negative2/119/1338/637.7940.020 Positive9/114/1325/63
MitND6 gene nonsense and missense mutations promote migration and invasion of lung adenocarcinoma cell line {#Sec14}
-----------------------------------------------------------------------------------------------------------
To study the effect of mitND6 gene nonsense and missense mutation on cell migration and invasion, we constructed A549 sublines expressing mitND6 gene with missense and nonsense mutations by cytoplasmic hybrid technology \[[@CR19]\]. Hybrid A549 cells containing normal mitochondrial, as well as normal A549 cells treated with rotenone, were used as controls.
Through wound healing assay, we found that the migrating distance of cells was significantly longer in cells with mitND6 gene nonsense and missense mutations and in cells treated with rotenone as compared to those with the wild type mitND6 gene (Figure [2](#Fig2){ref-type="fig"}A). Further, the mean migrating distance of cells with mitND6 gene nonsense mutation and cells treated with rotenone was similar and was significantly longer than cells with mitND6 gene missense mutation (Figure [2](#Fig2){ref-type="fig"}B).Figure 2Mitochondrial ND6 gene nonsense and missense mutation promotes the migration of lung adenocarcinoma cells. **(A)** Representative images of different groups of A549 cells taken immediately (0 hr) and 72 hr after lesion in the wound healing assay. **(B)** Histogram showing the relative migration distance of cells. Bars = 100 μm. Data represent mean ± SEM from 4 independent experiments; \*\*, *P* \< 0.01.
In matrigel-coated transwell assay, the percentages of cells invaded through the matrigel was significantly higher in cells with mitND6 gene missense mutation than cells with normal mitND6 gene, and was further higher in cells with mitND6 gene nonsense mutation and in cells treated with rotenone. Cell invasion was not significantly different between mitND6 nonsense mutation group and rotenone-treated group (Figure [3](#Fig3){ref-type="fig"}).Figure 3Mitochondrial ND6 gene nonsense and missense mutation promotes the invasion of lung adenocarcinoma cells. **(A)** Representative photographs showing invasion of different groups of A549 cells in the transwell assay. The invaded cells were stained with crystal violet. **(B)** Histogram showed the percentage of invasive cells. Bars = 50 μm. Data represent mean ± SEM from 4 independent experiments; \*\*, *P* \< 0.01.
These results suggest that nonsense and missense mutation of mitND6 gene, like inhibitor of NADH dehydrogenase, might promote migration and invasion of lung adenocarcinoma cells.
MitND6 gene nonsense and missense mutation inhibit the activity of NADH dehydrogenase, increase production of ROS, and increases the activity of AKT and ERK/MAPK in lung adenocarcinoma cell line {#Sec15}
--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Since ND6 is a subunit of the NADH dehydrogenase, we detected the effect of mitND6 gene nonsense and missense mutation on the activity of NADH dehydrogenase in lung adenocarcinoma cells. As shown in Figure [4](#Fig4){ref-type="fig"}, NADH dehydrogenase activity was reduced in A549 cells with mitND6 gene missense mutation (p \< 0.05 vs. cells with normal mitND6 gene), and further reduced in cells with mitND6 gene nonsense mutation and in cells treated with rotenone (p \< 0.01 and p \< 0.05, respectively, vs. cells with normal mitochondrial ND6 gene). In addition, NADH dehydrogenase activity was not significantly different between mitND6 nonsense mutation and rotenone-treated cell groups. Hence, mitND6 gene nonsense and missense mutation resulted in reduced NADH dehydrogenase activity in lung adenocarcinoma cells.Figure 4MitND6 gene nonsense and missense mutations inhibit the activity of NADH dehydrogenase. NADH dehydrogenase were analyzed by spectrophotometry. The histogram illustrates reduced NADH dehydrogenase activity in cells with nonsense and missense mutations of mitND6 gene and cells treated with rotenone compared to A549 cells with the wild type mND6 (normal). Data represent mean ± SEM from 4 independent experiments; \*\*, *P* \< 0.01.
To study the role of mitochondrial ND6 gene nonsense and missense mutation in the regulation of cell migration and invasion, we further investigated the cellular ROS level, since it was reported that defective activity of NADH dehydrogenase could induce the increase of ROS \[[@CR7]-[@CR9]\] and the level of ROS is relevant to tumor cell migration, invasion and metastasis \[[@CR11],[@CR19]\]. As shown in Figure [5](#Fig5){ref-type="fig"}A, the cellular ROS level was significantly higher in A549 cells with mitochondrial ND6 gene nonsense and missense mutations and cells treated with rotenone as compared to those with normal mitochondrial ND6 gene. Further, cells with mitochondrial ND6 gene nonsense mutation and cells treated with rotenone showed significantly higher cellular ROS level than cells with mitochondrial ND6 gene missense mutation, while there was no significantly difference between the last 2 groups (Figure [5](#Fig5){ref-type="fig"}B). These results suggest that the mitochondrial ND6 gene nonsense and missense mutation increase production of ROS in lung adenocarcinoma cells.Figure 5Mitochondrial ND6 gene nonsense and missense mutation over-produces the ROS. ROS level was analyzed by flow cytometry. **(A)** Representative flow cytometry graphs of A549 cells with the wild type mND6 (normal), cells with missense mutation and nonsense mutations of mitND6 gene and cells treated with rotenone. Histogram represented the ROS level in cells. **(B)** Histogram showed the relative ROS level of cells. Data represent mean ± SEM from 4 independent experiments; \*\*, *P* \< 0.01.
ROS was reported to regulate tumor cell metastasis through AKT and ERK/MAPK signal pathway \[[@CR20],[@CR21]\]. In the present study, our western blot results showed that cells containing mitND6 gene nonsense and missense mutation increased the expression level of phosphate AKT and ERK1/ERK2 (Figure [6](#Fig6){ref-type="fig"}A and B), but had no effect on total AKT and ERK1/ERK2 (Figure [6](#Fig6){ref-type="fig"}A and B). These results suggest that the mitochondrial ND6 gene nonsense and missense mutation increases the activity of AKT and ERK/MAPK in lung adenocarcinoma cell line.Figure 6Mitochondrial ND6 gene nonsense and missense mutation increases the activity of AKT and ERK/MAPK. AKT and ERK1/ERK2 expression level was determined by western blot. **(A)** Representative graphs of total and phosphate AKT and ERK1/ERK2 expression of A549 cells with the wild type mND6 (normal), cells with missense mutation and nonsense mutations of mitND6 gene and cells treated with rotenone. **(B)** Histogram showed the relative total and phosphate AKT and ERK1/ERK2 expression level of cells Data represent mean ± SEM from 4 independent experiments; \*, *P* \< 0.05; \*\*, *P* \< 0.01.
Discussion {#Sec16}
==========
The major finding of the present study is that nonsense and missense mutations of mitND6 gene are correlated with the clinical features of lung adenocarcinoma and that in adenocarcinoma cell lines (A549 cells) such mutations lead to reduced NADH dehydrogenase activity, increased ROS production and concomitantly promote cell migration and invasion.
As the only extranuclear source of DNA in animal cells, mitochondrial genome has unique characteristics different from nuclear genomic DNA \[[@CR7]-[@CR9]\]. MtDNA is not protected by histones, lacks nucleotide excision repair is located in an environment with high levels of potentially damaging ROS \[[@CR22],[@CR23]\], and hence may be more prone to mutations than nuclear DNA. Consistently, it was reported that the rate of human mtDNA mutation was approximately 17 times greater than that of nuclear DNA \[[@CR24]\]. mtDNA mutations have been detected in different types of tumors including lung adenocarcinoma. Ishigawa et al. have shown that mtDNA missense mutations might promote cell invasion and metastasis in several mice tumor cell lines \[[@CR19]\]. However, there still is a lack of investigation into the relationship between mitochondrial gene mutations and the clinical features of tumors.
In the present study, point mutations of mitND6 genes were detected in 27.5% lung adenocarcinoma samples with 45.8% of the mutations being nonsense and missense mutations that result in amino acid changes of the protein. Importantly, nonsense and missense mutations of mitND6 were associated with poor differentiation grading, advanced tumor stage, lymph node metastasis and shorter survival rate, suggesting that mitND6 gene mutation may play an important role in regulating the progression and metastasis of lung adenocarcinomas. However, whether the status of mitND6 mutations is an independent factor predicting metastasis in lung cancer warrants further analysis with more patients' samples. In addition, we found that mitND6 gene mutations were more common in lung adenocarcinoma patients over 60 years of age, and the average age was significantly higher in the patients with mitND6 gene mutations as compared to those without mitND6 gene mutations. It was reported that cells accumulate somatic mutations of mitochondrial DNA as part of normal ageing. These data are consistent with the previous reports that mtDNA mutations are accumulated during aging process \[[@CR25],[@CR26]\].
Tumor metastasis is the major cause of low survival rate of lung adenocarcinoma patients \[[@CR27],[@CR28]\]. Previous studies showed that the cybrid cells containing the missense mutant mitND6 gene derived from the highly metastatic mouse tumor cell lines conferred higher metastatic potential, regardless of the nuclear background \[[@CR19]\]. Consistently, here we demonstrated that mitND6 gene nonsense and missense mutation significantly promote the migration and invasion of human lung adenocarcinoma cell line A549. In addition, cells containing mitND6 nonsense mutation showed significantly higher migrate and invasive capacity than cells containing mitDN6 missense mutation. On the other hand, our clinical data indicated that the mitND6 gene nonsense and missense mutation was significantly correlated with lymph node metastasis of lung adenocarcinoma. These results suggest that mitochondrial ND6 gene nonsense and missense mutation may contribute to the metastasis of lung adenocarcinoma.
ROS could function as signaling molecule to stimulate tumor cell proliferation, promote genetic instability, and contribute to carcinogenesis by affecting the expression and activity of certain redox sensitive molecules. It is well known that mitochondria is the major site of ROS generation occurring mainly at NADH dehydrogenase of the respiratory chain \[[@CR7],[@CR9]\]. Recently, Ishikawa et al. reported that mitND6 gene missense mutation induced NADH dehydrogenase defects and in turn increased ROS production in some mice tumor cell lines \[[@CR19]\]. However, the effect of mitND6 gene nonsense and missense mutation on the ROS production in human lung adenocarcinoma cells has not been identified before. In the present study, we found that mitND6 gene nonsense and missense mutation resulted in inhibition of NADH dehydrogenase activity and significantly higher levels of ROS in A549 cells. In addition, cells containing mitND6 nonsense mutation exhibited significantly lower activity of NADH dehydrogenase and significantly higher level of ROS than cells containing mitDN6 missense mutation, and showed no significant differences to those treated with rotenone (an inhibitor of NADH dehydrogenase). It was reported that treated cancer cells with diphenyliodonium, a specific inhibitor of ROS generation, could reverse the promotion of migration and invasion by ROS, suggesting that ROS plays role in the regulation of cell migration and invasion in cancer cells \[[@CR20]\]. Combined with the results that mitND6 gene nonsense and missense mutation could inhibit of NADH dehydrogenase activity and increase the level of ROS in A549 cells, we suggest that mitochondrial ND6 gene nonsense and missense mutations may induce ROS over-production by reducing the activity of NADH dehydrogenase and further regulate cell migration and invasion in lung adenocarcinoma cells.
It was reported that increased generation of ROS could promote the cell invasion and tumor metastasis in some types of malignances including lung adenocarcinoma \[[@CR29]\]. Consistent with the previous findings in human breast cancer \[[@CR30]\], we found that rotenone caused dramatic increase in ROS production and concomitant increases in migration and invasion of A549 cells, suggesting that dysfunction of NADH dehydrogenase may enhance the metastatic potential of lung adenocarcinoma cells. Importantly, mitND6 gene nonsense and missense mutation resulted in inhibition of NADH dehydrogenase activity, significantly higher levels of ROS, and increasing the capacities of migrating and invasion in A549 cells. ROS have been shown to play a role in the AKT and ERK/MAPK activation, which plays essential roles in tumor cells, and activation of these kinases may increase the capacity of tumor cell migration, invasion and metastasis \[[@CR20],[@CR21]\]. Our results show that mitND6 gene nonsense and missense mutation could increase the expression level of phosphate AKT and ERK1/ERK2, but had no effect on total AKT and ERK1/ERK2. Based on these findings, we propose that mitochondrial ND6 gene nonsense and missense mutation may contribute to the metastasis of lung adenocarcinoma by reducing the activity of NADH dehydrogenase and in turn the over-production of ROS probably through AKT and ERK1/ERK2 signal pathway.
Conclusions {#Sec17}
===========
In summary, we show here high incidence of nonsense and missense point mutations of mitND6 gene in lung adenocarcinoma, especially in patients over 60 years of age. Such mutations were correlated with the pathological grade, stage and lymph node metastasis of tumors. In lung adenocarcinoma cell line (A549), nonsense and missense mitND6 gene mutations resulted in significant decrease in NADH dehydrogenase activity, increases in ROS production and promoted cell migration and invasion. These findings suggest that mitND6 gene nonsense and missense mutations may contribute to the metastasis of human lung adenocarcinoma.
Yang Yuan, Weixing Wang and Huizhong Li contributed equally to this work.
**Competing interests**
The authors declare that they have no competing interests.
**Authors' contributions**
SDH and ZYZ conceived the design of the study and were in charge of its coordination. YY and WXW participated in data analysis, performed data interpretation and drafted the manuscript. HZL carried out the invasion analysis and helped to draft the manuscript. YWY and JT performed Immunohistochemistry and pathologic analysis. All authors read and approved the final manuscript.
This work was supported by the National Natural Science Foundation of China (grant 81000932), the Shanghai Municipal Natural Science Foundation (grant 11ZR1447700), and Fujian Natural Science Foundation (grant 1200839).
| |
Environmental services have taken on a new urgency since the beginning of this decade. There has been widespread recognition of the seriousness of the environmental problems at various levels and one consequence of this is the greater importance being attached to Environmental Impact Assessment [EIA], the process of identifying the environmental consequences of human activities, even before begin. The idea of carrying out environmental impact assessment is becoming increasingly familiar to people all around the world, especially in developing countries.
Our environmental consultancy services are spread all over India and abroad.
The EIA organization of ULTRA TECH Environmental Consultancy Services is accredited by QCI-NABET.
ULTRA TECH, a leader in providing project & consultancy services on turnkey basis, has been well known for its quality, cost-effectiveness and well scheduled services.
We have a special cell for providing ‘Environmental Due Diligence Services’ one of the essential steps in modern real property transactions is evaluating candidate properties for potential environmental contamination and ...
Operation and Maintenance of STP services offered by ULTRATECH ensure optimum sewage/ Effluent / Water treatment support for industrial units as well as for commercial and residential establishments. | https://www.ultratech.in/ |
We Own This City Part 6 is the finale of an American true crime drama miniseries based on the nonfiction book of the same name by Baltimore Sun reporter Justin Fenton. The miniseries was developed and written by George Pelecanos and David Simon, who had previously collaborated on The Wire and Deuce. The premise involves the rise and fall of the Baltimore Police Department’s Gun Trace Task Force (GTTF) and the corruption surrounding it.
S P O I L E R S
We Own This City Part 6 is a mixed bag of a conclusion. Being a true life story, anyone could have googled the outcome of the events depicted and thus, there is no element of surprise that key players in the GTTF corruption reserved their just desserts, in a manner of speaking. However, what the series has attempted to do in this finale is to comment on the systemic nature of police corruption – not only in Baltimore but in the entire USA. But even that is inherently flawed.
READ OUR ANALYSES OF WE OWN THIS CITY.
Once again the non-linear storytelling in We Own This City Part 6 makes things too complicated for its own good and destroys all tension and conflict in the story being told. It has been impossible in the series to engage with most of the characters with the possible exception of the tragedy of Officer Sean Suitor – a former GTTF member who did not partake but kept silent on the corruption. Even then, his suicide at the end of the episode seems inexplicable – why would a good cop kill himself if his conscience was clear? A lost opportunity.
The message communicated in We Own This City Part 6 seems clear – nothing changes. Yes, you can get rid of all the dirty cops but closing the barn doors now is simply too late as all the crazy horses have long bolted. This would seem to be a common theme concerning the USA – a failed republic that is slowly but surely going the way of the Roman Empire.
In the final analysis, We Own This City is probably still essential viewing for the performances and scene executions – bearing our caveats about the writing overall.
Now streaming on HBO Max. | https://www.powerofpop.com/we-own-this-city-part-6-analysis/ |
Two Syrians arrested in connection with forged ID racket
Two Syrian nationals, aged 31 and 36, on Wednesday faced a prosecutor in the Cretan port of Iraklio charged with operating an illegal racket providing immigrants with forged documents to remain in Greece or travel on to Western Europe.
The arrests came after police raided a warehouse in the area of Kaminia, near Iraklio, and found 16 Syrian migrants – including two young boys – who had been awaiting transfer to Iraklio’s international airport to board flights to various European countries.
Police confiscated several laptops, forgery equipment and fake documents. | https://www.ekathimerini.com/news/151832/two-syrians-arrested-in-connection-with-forged-id-racket/ |
<p>An Academic Writing Style research essay has a lot of information in the document....
Scriptio Continua: Ancient Latin Writing Style to Modern Computer Language
<p>Archeologists and historians claim that the early Sumerians in ancient Mesopotamia invented some of...
The Writing Style of Hemingway
<p>For Whom the Bell Tolls portrays the typical Hemingway characters and addresses the issues...
Developing a Blog Writing Style
<p>Under the Blog writing style, I would categorically be presenting you some useful insights...
Technical Writing Trends: Substance vs. Style?
<p> As a technical writer, you strive for Accuracy, Clarity and Readability. ...
What Is The Best Style Of Writing For Online Content?
<p>If your website has poor online content it has little or no value to...
3 Obscure APA Writing Style Rules You Should Know
<p> Many students are required to submit essays, research papers, and other assignments...
Richard Lanham’s Official Style of Writing
<p>Richard Lanham, a well-known scholar and teacher of writing, gave a name to the... | https://giftwrapplus.org/tag/writing |
A theory that attempts to account for the fine tuning of the universe for life may be “deeply flawed,” we learn in Paul J. Steinhardt’s “The Inflation Debate.” Steinhardt is one of the theory’s creators, nevertheless asks, “Abstract: Is the theory at the heart of modern cosmology deeply flawed?
Cosmic inflation is so widely accepted that it is often taken as established fact. The idea is that the geometry and uniformity of the cosmos were established during an intense early growth spurt.
But some of the theory’s creators, including the author, are having second thoughts. As the original theory has developed, cracks have appeared in its logical foundations.
Highly improbable conditions are required to start inflation. Worse, inflation goes on eternally, producing infinitely many outcomes, so the theory makes no firm observational predictions.
Scientists debate among (and within) themselves whether these troubles are teething pains or signs of a deeper rot. Various proposals are circulating for ways to fix inflation or replace it.
– Scientific American (April 2011), 304, 36-43 | doi:10.1038/scientificamerican0411-36 (Paywall)
Rob Sheldon notes,
Inflation adds a whole bunch of really unlikely metaphysical assumptions — a new force field that has a never-before-observed particle called the “inflaton”, an expansion faster than the speed of light, an interaction with gravity waves which are themselves only inferred– just so that it can explain the unlikely contingency of a finely-tuned big bang.
But instead of these extra assumptions becoming more-and-more supported, the trend went the opposite direction, with more-and-more fine-tuning of the inflation assumptions until they look as fine-tuned as Big Bang theories. At some point, we have “begged the question”. Frankly, the moment we add an additional free variable, I think we have already begged the question. In a Bayesean comparison of theories, extra variables reduce the information content of the theory, (by the so-called Ockham factor), so these inflation theories are less, not more, explanatory than the theory they are supposed to replace.
On the other hand, no one expects the first formulation of a theory to be the best, or the most concise, or even the most informative, so we should cut some slack for novel theories. But after 20 years of work, if we haven’t made progress, but have instead retreated, it is time to cut bait. | https://uncommondescent.com/cosmology/cosmology-one-of-cosmic-inflation-theory%e2%80%99s-creators-now-questions-own-theory/ |
The Women for Water Partnership (WfWP) currently includes 26 women’s networks covering around 100 countries, predominantly in the developing world. This publication pays tribute to some of the work of women’s organisations involved in the WfWP, by qualitatively documenting some of the best practices displayed, and highlighting the specific contributions of women around the world toward the UN General Assembly mandated International Decade for Action ‘Water for Life 2005 - 2015.
The introduction explains the context the report in terms of the importance of studying the gender-water-sustainability nexus, Water for Life, and the status of water and sanitation as a human right. The majority of the report then examines examples of good practice from a number of case studies involving WfWP members. Each of the case studies provide background information on the contexts and organisations involved, and describes the role played by the primary women’s organisations in driving change. Also disucssed are their contributions to Water for Life, which together with the Dublin/Rio Principles for Integrated Water Resources Management (IWRM), underline the central role of women in the provision, management, and safeguarding of water. The case studies examined include women’s organisations cooperating in: efforts toward a transformative gender-water-sustainable development agenda in Tanzania; contributions toward the Protocol on Water and Health for the UNECE Water Convention in Armenia and Ukraine; the implementation of the human right to water and sanitation in Nepal; provision of social accountability for water access in Kenya; sustainable water governance at Lake Victoria in Uganda; and empowering women in Nigeria through water and sanitation interventions.
The role of women’s civil society organisations, and the value they add to sustainable development, is discussed next, before the report identifies a number of lessons learned through examination of the projects. In terms of barriers to the meaningful participation of women in the water sector, most stem from either the direct and indirect difficulties of working in large, remote areas with limited access to water, or where customary law is actively involved in water rights and the role of women in society. Cultural resistance to empowering women consumes time and effort to overcome, though drivers for change exist, including: the introduction of gender equality legislation; strong political leadership committed to gender equality, as evidence by the catalytic effect of a gender-sensitive water minister in Nigeria; support by local communities themselves, which can be highly effective in changing mind-sets; and the use of peer networks that can provide support, training, coaching, and backstopping. Small scale projects that account for cultural differences are often more successful than large scale projects, but scaling-up these projects is an intensive and difficult task due to geographical scale, and a perpetual challenge of under-funding for women’s organisations.
The report finishes with a section on conclusions and recommendations for women-inclusive water cooperation, including that:
- A human rights based approach is required to ensure effective cooperation between all stakeholders in the water sector.
- Institutional mechanisms guiding water cooperation need to be strengthened, including the establishment of clear definitions of roles and responsibilities, and the strengthening of complementary partnerships involving different skill-sets.
- Civil society groups can and should reach, empower, represent, and defend vulnerable groups through awareness raising, coordinating action, monitoring, increasing women’s capacities, and acting as a bridge between governments and citizens.
- In order to deliver on water-related SDGs, there is a need for targeted investments to scale-up the capacities of women’s civil society organisations.
- There are four prerequisites for meaningful engagement with women: governments willing to involve women in decision-making, backed by legislation, policies, and regulations; decision-making to be inclusive, and based on equality in terms of rights and responsibilities; an enabling environment that sets forth clear potential for results through women’s participation; and investment in the social capital of women’s organisations to facilitate community involvement, which makes the best use of women’s skills and leadership. | https://eldis.org/document/A75358 |
Critical thinkers have the ability to think on a higher level. A process for thinking critically is required that will bring about decisions and ideas that will provide for a better life for ourselves and those around us. Most of us take thinking for granted. However, we develop as critical thinkers when we open ourselves to recognizing the strengths and weakness’ of our own thinking. Higher order thinking comes into play when choosing a presidential candidate, or sitting on a jury for a murder trial, or deciding if we need nuclear power plants, or when determining the effects of global warming. As a critical thinker, one becomes a more responsible, contributing member of society. (Schafersman, S.D., 1991). To put us on the road to being critical thinkers, we need to acquire the attributes of a critical thinker and to learn to be fair minded and recognize our own ignorance.
In order to improve the thinking ability, one needs intellectual integrity, humility, sense of justice, perseverance, fair mindedness, a confidence in reason, intellectual courage, empathy, and autonomy. These traits allow one to use highly insightful thinking. Someone with a weak sense for critical thinking may become good at winning arguments but they do not develop a sense of fair mindedness. (Paul & Elder, 2006).
Being a fair minded thinker can be hard. It requires one to consider views other than one’s own. A person cannot look for his or her own advantage or the advantage of friends. We cannot always be fair minded because our egos get in the way. However, striving to develop a brain that is fair minded will let us find the truth of a matter. All of the traits described above go into developing a fair minded thinking ability. By examining and applying each trait, we will become critical thinkers of a higher level. (Paul & Elder, 2006).
To have intellectual humility requires us to first recognize our own ignorance. This is not to say that we are stupid, but that we lack “…intellectual arrogance, pretentiousness, boastfulness, or conceit” (Paul & Elder, 2006, pg. 10). Recognizing that we are ignorant about a subject lets us see “…the prejudices, false beliefs, and habits of mind that lead to flawed learning” (Paul & Elder, 2006, pg. 11). We cannot be fair-minded about a subject we do not know. This brings us to Intellectual courage.
Can Food Influence Creative And Critical Thinking Ability? | https://brightkite.com/essay-on/critical-thinking-the-ability-to-think-for-ones-self |
How to write cursive on paper
By NICHOLAS DUBNER CBS News/AP The cursive written on paper is one of the most difficult and demanding writing skills a person can learn.
For some people it’s difficult to get started and even harder to maintain.
For others, the process is even more difficult.
But it can be done.
We asked experts to tell us what you need to know.
How do I get started?
If you’re already doing it, you should start with cursive.
If you haven’t already, take a cursive lesson or a cursivate.
It’s the first thing you need.
How to get it right: If you can’t get started, try reading through some of the cursive books on the web.
Some of the best books on writing cursive are from the late 1930s, when there was a big demand for a style of writing for the masses.
These books tell you how to write in a cursivesque way and are easy to read.
But they’re not always the best way to get into the craft.
If that’s the case, you might want to do a cursital reading on the internet.
And if you do that, you’ll learn more about writing cursives, the different styles and techniques that make it so challenging.
What’s the difference between cursive and roman?
What you need: There are different styles of writing that are different from each other.
If it’s a book that tells you how a character should be written, you need a roman font.
It should be a full-size typeface and should be in the same size as the rest of the writing.
If a book is a book about the history of a particular country, you probably want a full Roman font.
Some authors and scholars have said that cursive is more in-your-face, with its “punctuation,” while roman is more casual.
But all of these are just styles of handwriting.
They all have different advantages and disadvantages.
For example, if you have a good set of cursive skills, you may find that you can get away with just using a cursiver in your everyday writing.
But if you’re not very good at it, a raster cursive will be much more effective at writing.
So if you want to learn how to use a rasters cursive, here’s what you should know.
Learn more about how to get the most out of writing: How do you get the writing to look right?
If your cursive style is more relaxed and casual, then you’ll want to use cursive to create a visual hierarchy.
That will help you find what’s important and what’s not important.
It will help with visual recognition, for example, so you can better recognize the characters on the page.
And it’ll help with the type of handwriting you use, so it’s easy to type and read.
If your writing style is relaxed, you will want to write on a page that looks natural.
A page that’s clean, even though you have cursive lettering on it, will make it easier to recognize the typefaces on the pages and find the right type.
Learn how to do that on a book: There’s another type of writing where the typeface will affect how you read the writing: the roman cursive handwriting.
This is the one you’ll use to make sure you have the right spacing and strokes for your characters.
The roman typeface looks different from cursive typeface, but it’s the same overall look.
So it should look good, but you’ll also want to be able to read the words well.
It can look a little more formal, but that’s because it’s also more stylized.
If the raster typeface is too formal, you won’t be able read the characters as well as the cursives do.
So the first rule is to find the best raster font you can use.
If there’s no raster fonts available, then it might be best to use something like a serif font.
If this font isn’t available, or if you can only use the serif typeface for your cursives you might need to use one of these.
You’ll need a good hand, though, so choose one that’s easy for you to use.
Learn to type with one hand.
You may need to work with it, but the best thing to do is to work in two or three hands.
This will allow you to concentrate on the letter and not worry about the rest.
You can do it on a computer, too, if it’s not too hard for you.
Learn about the different types of writing and how to learn them.
If any of the tips above are helpful, then go out and start practicing, because you’ll need all of them in order to master writing cursors. | https://rapidpens.com/2021/09/how-to-write-cursive-on-paper/ |
Over the past few decades, countries in the Organization for Islamic Cooperation (OIC) have achieved various levels of economic development, especially in the tourism sector. Tourism growth in OIC countries increases every year. This growth has tightened competition between countries in providing tourist facilities and destinations. This study aims to measure the level of efficiency and productivity of the tourism industry in OIC countries using the Data Envelopment Analysis (DEA) and Malmquist Productivity Index (MPI) methods. The results showed that the average efficiency value of the tourism industry in OIC countries as a whole was 0.357. The country with the highest efficiency score was Turkey with an efficiency value of 0.92 and the country with the lowest efficiency value of 0.007 was Libya. On the other hand, the country that had the highest productivity increase was Turkey with a TFP value of 1.656 and the country with the largest decrease in productivity was Nigeria with a TFP value of 0.610.
Collaborative Planning for the Environmental Sustainability of the Hajj
PDF
Abdullah Abonomi,Terry De Lacy,Joanne Pyke,
Journal Of Islamic Tourism |
Volume 2 |
Pages 23-54 |
|
Abstract
Every year over two million Muslim worshippers from around 183 different countries visit Mecca in Saudi Arabia to perform Hajj which is the fifth and last pillar of Islam. Tourism, especially a religious tourism attraction such as the Hajj, is expected to boost the economy and create new job opportunities for Saudi youth in the services sector. Yet, despite the many benefits, the Hajj itself has suffered adverse environmental impacts. The government of Saudi Arabia has set many strategies and policies in an effort reduce the significant impact of the Hajj activities on environmental sustainability. However, these environmental strategies have not achieved their goals due to the lack of stakeholder collaborations. The overarching aim of this research is to investigate how the environmental sustainability of the Hajj can be improved. With particular focus on how stakeholder collaborations in planning can be improved to achieve sustainable goals. This study applies Gray’s (1989) collaborative planning model to investigate the nature of the collaboration process between Hajj stakeholders. This model establishes a three-phase planning process necessary to successfully achieve stakeholder collaborations and the strategic goals. To achieve the aim, a qualitative approach was adopted as the appropriate strategy to understand why things occur, as opposed to what things occur in the social world. The specific methodologies used include unstructured and semi-structured interviews with representatives of public and private sector stakeholders. The results show that the level of collaboration between stakeholders in the Hajj is fragile and requires significant improvement. Thus, from an analysis of findings, ways to improve the collaborative network between Hajj stakeholders when planning for protecting the environmental sustainability of the destination are explored. Keywords: Hajj, environmental sustainability, stakeholders’ collaboration
An Analysis: How Quran (The Holy Book of Islam) Talks About Halal Tourism
PDF
Herman Supriadi,Irwan Rahadi,Mohamad Tamrin,Muh. Hilmi Pauzi
Journal Of Islamic Tourism |
Volume 2 |
Pages 55-65 |
|
Abstract
The purpose of this study is how to convince people that the holy book of Islam is not only discusses specific situation but also recommend its followers to travel. The holy book of Islam suggest its followers to travel to certain place as long as they follow the rule of Islam. This research is literature based, the data collection of this research was taken from the holy book of Quran (the primary data) then the secondary data was taken from hadith. The research question that was tried to answer is what the Quran perspective about halal tourism. Based on the research result of this research, Quran suggest its followers to do a journey. There are four reasons according to Quran why people should travel, firstly is to search for the omnipotence. Secondly is to elevate their knowledge and science so that by using their knowledge they can maintenance and explore the creatures of God wisely then address the values of Islam to another human (da’wah). Finally, the last one is most important for Muslim why God and His prophet had human being to have travelling is to worship Him.
Can Halal Tourism Village Boost The Economy in Lakbok District, Ciamis Regency, Indonesia?
PDF
Hisam Ahyani,Haris Maiza Putra,Muharir,Muntaha Mahfud,Naeli Mutmainah,Memet Slamet
Journal Of Islamic Tourism |
Volume 2 |
Pages 66-89 |
|
Abstract
The existence of Halal Tourism Villages in Indonesia, such as in Tambakreja Village, Lakbok District, Ciamis Regency, West Java Province needs to be developed, especially during the COVID-19 pandemic. The goal is to improve the community's economy through the Tourism Industry sector. Halal tourism village is a culture-based village that puts forward the values and norms of Islamic law as its basic foundation. This research is included in the type of field research, which was carried out in Tambakreja Village, Lakbok District, Ciamis Regency. Research data obtained from interviews and documentation studies. The results show that halal tourism villages are a type of tourism that is starting to develop in Indonesia at this time and is becoming a trend and can meet the lifestyle of the people of Tambakreja Village, Lakbok District. The uniqueness of this Halal Tourism Village is evidenced by the presence of halal food (halal food) in the village such as (cimplung, growol, tempe mendoan, brown sugar) which in other villages are not necessarily owned. Tambakreja village also owns land (rice fields, culinary and traditional arts). In addition, this halal tourism village is able to boost the economy of the local village community through various tourism sectors. | http://jistour.org/en-us/dergiler/volume-2/6-s |
1. Introduction {#s0005}
===============
The outbreak of novel coronavirus infection emerged on 2019 December in Wuhan, China and soon spread to involve all the world.
Now the health care systems worldwide are facing with pandemic of severe acute respiratory coronavirus 2 (SARS-COV-2) and its associated disease, named coronavirus disease 19 (COVID-19). The identified symptoms of infection first thought to be confined to the respiratory system, but as the time passed extrarespiratory manifestations became increasingly identified.
At first it seemed that the COVED-19 spares the nervous system and neurologic complications were among the manifestations later to be identified. Now we know that both central and peripheral nervous system may be affected by COVID-19([@bb0010])([@bb0045]). Involvement of central nervous system based on report by Helms et al. ranges from encephalopathy with agitation and confusion, and corticospinal tract signs to ischemic stroke([@bb0030]). Peripheral nervous system is also affected by COVID-19, and several cases of acute polyneuropathy had recently reported.
Here, the authors report the case of an acute and severe peripheral polyneuropathy associated with SARS-COV-2 infection.
2. Case presentation {#s0010}
====================
On April 15 (As of this date, 76,389 patients with COVID- 19 have been identified in Iran, of which 4777 deaths have been occurred by the virus, and according to statistics, Iran ranks sixth in the number of deaths due to COVID- 19) a 41-year-old male was referred to emergency department for acute onset of cough, dyspnea, and fever. Regarding symptom profile and chest CT scan findings (obtained same day) of multiple ground glass opacities and consolidations, typical of COVID-19 pneumonia ([Fig. 1](#f0005){ref-type="fig"} ) the patient diagnosed as COVID-19 and was admitted to hospital. At the time of admission, the patient was febrile with an oral temperature of 39 °C, the blood pressure was 110/70 mmHg, the pulse was 110 beats per minute and the respiratory rate was 22 breaths per minute. O~2~ saturation was 88% on room air. His medical history included type 2 diabetes mellitus under treatment with metformin and gliclazide. Laboratory data revealed lymphopenia (WBC:5.9 × 10^9^/L, PMN:85%, Lymphocyte:15%), elevated levels of C-reactive protein (CRP: ++) and erythrocyte sedimentation rate (ESR:69 mm/h), glucose (280 mg/dL) and HbA1c (8.7%).Fig. 1Chest CT scan revealed a peripheral ground-glass opacity.Fig. 1
The patient underwent treatment with antiviral agent lopinavir/ritonavir and hydroxychloroquine. Reverse transcription polymerase chain reaction (RT-PCR) assays of nasopharyngeal sample was positive for SARS-CoV-2.
Ten days after onset of pneumonia the patient experienced paresthesia in feet which later days progressed to involve more proximal parts and mild weakness added, but these symptoms unnoticed until patient discharged 14 days after the onset of COVID-19 symptoms, following improvement of respiratory symptoms (probably because of attributing these complaints by treating physician to diabetic neuropathy).
Seven days after onset of neurologic symptom regarding worsening of paresthesia and weakness the patient was referred for neurologic evaluation. In the first look at neurology office the patient was unable to stand and walk without assistance. The neurologic examination revealed normal mental status and speech. Motor examination showed absent muscle stretch reflexes in lower extremities and diminished reflexes in upper extremities. There was symmetric limb weakness (Medical Research Council score 4/5 at upper limbs and 3/5 at lower limbs), and symmetric and severe stocking-and-glove hypesthesia and reduced vibration and position sense at all 4 limbs (more pronounced at lower limbs). There was no cranial nerve deficit. Plantar responses were flexor. The patients complained of pain and an aching discomfort in the muscles, mainly those of the shoulder, hips, thighs, and back. There was no dyspnea, and cough if present was occasional. Electromyography and nerve conduction studies showed absence of right tibial and both peroneal nerves compound muscle action potentials (CMAP). F waves were unobtainable at lower limbs. Left tibial, Right and left median, and ulnar nerves distal latencies were markedly prolonged and velocities and amplitudes (with spatial and temporal dispersion) were decreased. All sensory nerve action potentials (SNAP) latencies were prolonged and amplitudes decreased ([Table.1](#t0005){ref-type="table"} ).Table 1Nerve conduction study parameters.Table 1NerveSNAP Onset Latency(ms)SNAP Peak Latency(ms)SCV (m/s)SNAP Amplitude (μV)Right Sural3.64.438.896.24Left Sural3.54.536.015.21Right Median3.835.536.64.48Left Median3.284.842.7510.19Right Ulnar3.54.5342.15.34Left Ulnar3.44.6542.285.21
NerveCMAP Distal Latency(ms)CMAP Amplitude(mV)Velocity(m/s)F wave latency(ms)Right TibialNRNRNRNRLeft Tibial12.430.131NRRight PeronalNRNRNRNRLeft PeronalNRNRNRNRRight median8.932.91[a](#tf0005){ref-type="table-fn"}4138Left median7.131.64[a](#tf0005){ref-type="table-fn"}4036Right ulnar7.144.2[a](#tf0005){ref-type="table-fn"}4135Left ulnar6.183.1[a](#tf0005){ref-type="table-fn"}3736[^1][^2]
On needle EMG examination, no spontaneous activity was seen. Motor unit action potential (MUAP) morphology was normal, but with reduced recruitment in weak muscles including tibialis anterior, vastus lateralis, and iliacus.
These findings were consistent with demyelination pattern polyneuropathy, so the patient diagnosed as Guillain-Barré syndrome (GBS) associated with COVID-19, and at the same day admitted in hospital and treatment with IV immunoglobulins (0.4 g/kg per day for 5 consecutive days) was initiated. There was a favorable response to IVIG so the patient was able to stand and walk a short distance without assistance in day 3 of therapy. On discharge patient was ambulate but with some residual weakness in lower extremities, so was referred for rehabilitation clinic.
Personal protective equipment was used during first examination and subsequent visits.
3. Discussion {#s0015}
=============
Guillain--Barré syndrome is considered an autoimmune process that affects peripheral nerves, and commonly manifests as demyelinating neuropathy with ascending paresthesia and weakness. Though the exact etiology and pathophysiology have poorly been identified, the syndrome is commonly preceded by a respiratory or gastrointestinal infection.
Although various microbial agents and antecedent events including various viral illnesses in adults and children have been associated with Guillain--Barré syndrome, *Campylobacter jejuni*, Epstein--Barr virus, cytomegalovirus, and Zika virus are among the most reported agents. There have been reports of an association between Guillain--Barré syndrome and *Coronaviridae* family viruses. For instance, during 2012 outbreak of Middle East respiratory syndrome (MERS) caused by MERS coronavirus (CoV) that shares many similar features with SARS-COV-2 a few cases of Guillain--Barré syndrome associated with infection had been reported([@bb0035]).
The occurrence of autoimmune polyneuropathy in patients with aforementioned viral and bacterial infections indicates that these agents have the potential of autoimmune response induction. In the case of *Campylobacter jejuni* for instance molecular mimicry between GM1 gangliosides expressed on nerve fibers and lipooligosaccharides present on bacteria may account for their association with GBS.
The same pathophysiology has been proposed for *Haemophilus influenzae, Cytomegalovirus,* and *Mycoplasma pneumoniae*([@bb0040])*.*
Considering these facts and based on prior knowledge of dealing with other viral epidemics we expected increasing number of reports on involvement of peripheral nervous system especially peripheral neuropathy in the era of COVID-19 pandemics.
The first case of Guillain-Barré syndrome associated with SARS-CoV-2 infection in the literature has probably been reported by Zhao et al. who reported the GBS as presenting syndrome in a 61 years old woman which later diagnosed as Covid-19([@bb0065]). Following this case other cases have been reported.
Remarkable fact in some reports including reports by Aberti([@bb0005]) and Sedaghat([@bb0050]) and in our case is that these cases share a common comorbidity, the diabetes.
The interval of 10 days between the onset of viral illness respiratory symptoms and the first manifestations of Guillain--Barré syndrome in our case, is similar to cases reported by Galan([@bb0020]) and Virani([@bb0060]). This interval was 5--10 days in case series by Toscano that is quiet the same as occurs during or after other infections([@bb0055]). Considering the temporal association, we hypothesize that there is causal relationship between GBS and SARS-CoV-2 infection, but there is no evidence of direct invasion of nerves or nerve roots by virus, as the CSF was negative for SARS-CoV-2 in patient reported by Alberti([@bb0005]).
COVID-19 associated neuropathies are not confined to peripheral nerves as cranial nerve involvement as Miller Fisher syndrome have been reported([@bb0025]).
The important clinical point about this patient is ignorance of patient\'s compliant in COVID-19 isolation ward. The treating physicians of patients affected with COVID-19 should be aware of neurological complications of infection, and pay attention to every single symptom and sing in patients; because the disease is a novel condition and not every feature of it identified.
We described this case as GBS but it should be kept in mind that our follow up period is short and acute-onset chronic inflammatory demyelinating polyneuropathy (A-CIDP) that accounts for 18% of CIDP cases([@bb0015]) should be in consideration as a differential diagnosis.
[^1]: Abbreviations: SNAP: sensory nerve action potential; CMAP: compound muscle action potential; NR = no response; SCV: sensory conduction velocity.
[^2]: Spatial and temporal dispersion.
| |
Controlling an epidemic, e.g. severe acute respiratory syndrome (SARS), H1N1 swine influenza, and Ebola, in the midst of frequent movements of infected persons via cars, trains, and aeroplanes poses a challenging problem. In network science, much effort and progress has been made on understanding epidemics in single-layered networks[@b1][@b2][@b3][@b4][@b5][@b6][@b7][@b8][@b9][@b10][@b11][@b12][@b13][@b14][@b15][@b16][@b17][@b18][@b19][@b20] and multi-layered networks[@b21][@b22][@b23][@b24][@b25][@b26][@b27][@b28]. In single-layered static networks with an immobile agent at each node, for example, no finite epidemic threshold exists for scale-free (SF) networks and a tiny initial infection eventually spreads[@b11]. A delicate balance between the number of high degree nodes and the topological distance between them[@b29] is shown to be crucial. The same result holds for reaction-diffusion models with random diffusion of agents among nodes with infections only among the agents momentarily on the same node[@b6]. Recently, how human dynamics affects an epidemic has become the focus of research[@b14][@b18][@b30][@b31][@b32][@b33], but the diversity of links and the time spending on journeys are largely ignored. Real-life networks, e.g. power grids and the internet, are often multi-layered networks[@b34][@b35], with their mutual influence and cascades being hot research topics[@b36][@b37]. Epidemics in two-layered networks also received much attention[@b21][@b22][@b23][@b24][@b25][@b26], and the layer for infection processes actually shares the same set of nodes with the layer for information exchanges.
For diseases spreading through human contacts, it is most important to understand the impact of frequent journeys. There exist many single and multi-layered transportation network models[@b38][@b39][@b40][@b41][@b42][@b43], with the layers representing networks of airports, railways, highways, etc. coupled together. To incorporate epidemics, however, random diffusion of people on such networks will be an oversimplification, as a journey involves a planned route to a destination using mixed modes of transportation. These directed movements should be incorporated in studying epidemics.
The ease and speed of inter-city travels offered by the growth in the airline and high-speed train[@b44] industries and better highways has contributed to making our Earth a global village. These inter-city travels readily spread a disease to different places. However, the big populations in major cities and densely packed travellers on multiple means of transportation of various speeds add further complications. A reliable framework for studying the effects of travelling on epidemics has yet to be constructed. Earlier works on epidemics in airport and railway networks often modelled journeys as random diffusion of agents[@b4][@b5][@b45]. The obvious shortcomings are: (i) real journeys typically involve multiple means of transportation instead of agents all travelling the same way; (ii) neighboring stations have different distances that affect the chance of infection instead of identical distance between adjacent nodes; (iii) real journeys are round-trip with an destination instead of random diffusion. It should be noted that intra-city travel is also inhomogeneous. It is, therefore, of fundamental importance to construct a framework incorporating the differences in travelling means and distances between cities. We propose here such a framework to incorporate inhomogeneity among the links and round-trip journeys with intended destination. It is found that infections at the links greatly affect the epidemic threshold, and the traveling speed and frequency are key factors in determining the extent of an epidemic.
Results
=======
An integrated travel network (ITN) model
----------------------------------------
Our integrated travel network (ITN) model accounts for different means of transportation by different kinds of links. [Figure 1(a)](#f1){ref-type="fig"} shows schematically an inter-city transportation network emphasizing its link inhomogeneity: Links of faster transportation (dashed lines), e.g. airlines and high-speed trains, connecting major cities and links of slower transportation (solid lines), e.g. highways, connecting to surrounding cities (blue nodes) via part of a highway network.
A journey starts from a city *i* to an intended destination *j* through intermediate places along the path that takes the shortest time, which necessarily invoke the actual distance between two cities and the mode of transportation. The return journey could follow the same path or an alternative path, as depicted in [Fig. 2(a,b)](#f2){ref-type="fig"}. The ITN aims to incorporate the key features of how human travel, namely round-trip journeys of shortest time through multiple means of transportation. Here, we invoke the *travel time*, which depends on the distance and the means of transportation, as the key factor, instead of the effective distance[@b43]. Instead of emphasizing the multi-layered network structure as in previous works, ITN takes a traveller's viewpoint that journeys take place in a single-layered undetachable network with a diversity of links connecting cities representing an inhomogeneous transportation network, see Methods for details. It aims to provide a step closer to a realistic description of human journeys and an alternative platform for studying epidemics on which finer and further details on local area transportation could be added.
Epidemic spreading on ITN
-------------------------
Contacts during journeys are important for epidemics. An example is the 2009 H1N1 cases in a Singapore's hospital that 116 of 152 patients in two months were classified as air travel-associated imported cases[@b46]. The time that travellers meet becomes a crucial factor. It is related to the length of a link and how fast agents travel on it. As a minimum model, we consider two speeds *v*~*s*~ and *v*~*f*~ with *v*~*s*~ \< *v*~*f*~ (see solid and dashed lines in [Fig. 1](#f1){ref-type="fig"}) representing slower and faster transportation. An agent starts a round-trip journey from a node (home) to a destination chosen randomly (upper [Fig. 3](#f3){ref-type="fig"}) through intermediate (middle) nodes along the path of shortest travel time[@b18]. Let *r*~*ij*~ be the distance between neighbouring nodes *i* and *j*. The time travelling on the link is
with *v* = *v*~*s*~ or *v*~*f*~ depending on the type of transportation. To account for travel time, a link from node *i* to node *j* is divided into *τ*~*ij*~ segments, with *τ*~*ij*~ = *t*~*ij*~ if *mod*(*r*~*ij*~,*v*) = 0 and *τ*~*ij*~ = *int*(*t*~*ij*~) + 1 if *mod*(*r*~*ij*~,*v*) ≠ 0 (lower [Fig. 3](#f3){ref-type="fig"}), where *mod*(*x,y*) represents the modulo operation and *int*(*x*) taking the integral part of *x*.
For epidemic on ITN, we invoke the susceptible-infected-susceptible (SIS) model[@b6][@b9][@b10][@b11][@b12][@b13][@b14][@b15][@b16][@b17]. A susceptible agent will be infected if it contacts an infected agent, with an infectious rate *β*. There are travelling and non-travelling agents in a population. Generally, people travelling are in closer contact and have a higher infectious rate *β*~2~ than the non-travelling agents with *β*~1~[@b47]. An infected agent recovers and becomes susceptible with a recovery rate *μ*. For travelling agents, we assume that infections take place only among agents in the same segment *k*~*r*~ (1 ≤ *k*~*r*~ ≤ *τ*~*ij*~) of a link. For non-travelling agents, the SIS process is confined to non-travelling agents at the same node. Explicitly, a non-travelling susceptible agent at node *i* has a probability 1−(1−*β*~1~)^*n*^~*i,I*~ to be infected at a time step, when there are *n*~*i,I*~ infected non-travelling agents at the node. Similarly, a susceptible agent at a segment of a link has a probability to be infected when there are infected agents at that section *k~r~*.
An example of ITN: China's big city network
-------------------------------------------
Buses on highways and high-speed trains in China together provide an example of ITN. To include a large population and to reduce the number of nodes, we consider 116 cities with population over one million (see [Table S1 in Supplementary Information (SI)](#S1){ref-type="supplementary-material"}). From high-speed train schedule, 61 cities are served by routes of high-speed trains. For the remaining 55 cities, we construct the highway links as follows. A highway link is added between two cities in the same province or two neighbouring provinces when there is a highway between them. Finally, highway links are added to connect neighboring highway and high-speed railway nodes in the same province. [Figure 4](#f4){ref-type="fig"} shows the resulting ITN of 116 cities with two types of links. We give the structural properties in SI. It has a mean degree 〈*k*〉 = 4.25 and a high clustering coefficient of *C* = 0.35. The degree distribution is shown in [Fig. S1(a) in SI](#S1){ref-type="supplementary-material"}. [Table S2 in SI](#S1){ref-type="supplementary-material"} gives the lengths of the links.
Typically, travels between major cities and/or nearby cities are more frequent. This was modelled by assigning weights to a link, where *N*~*i*~ denotes the population at node *i* and *r*~*ij*~ the distance between nodes *i* and *j*[@b48][@b49]. To incorporate factors including transportation infrastructure and convenience, we modified the weight in ITN to
where *S*~*ij*~ represents the daily services of high-speed trains between nodes *i* and *j* and thus an indication of how convenient it is, and *S*~*ij*~ = 0 for highway links. Values of *S*~*ij*~ as obtained by train schedules are listed in [Table S2 in SI](#S1){ref-type="supplementary-material"}. Summing *W*~*ij*~ for the *k*~*i*~ links give the weight *W*~*i*~ of node *i* as
To set up a model for simulations, we measure population in units of 5000 and distance *r*~*ij*~ in kilometers. Thus cities of *N*~*i*~ ≥ 200 are considered and *N*~*i*~ is of the real population. The corresponding weight distribution is shown in [Fig. S1(b) in SI](#S1){ref-type="supplementary-material"}. Sensitivity to the choice of measuring populations in lots of 5000 is tested in [Fig. S2](#S1){ref-type="supplementary-material"} in SI. In each time step, agents starts a round-trip journey from node *i*, where the parameter *p*~*T*~ is chosen so that , i.e., people travelling are fewer than a city's residents. It is related to the small fraction *f* of the total population starting a journey every time step by
An agent from node *i* picks a destination *j* according to the probability
and follows the path of shortest travel time. An agent typically travels on slower transportation in the local area before transferring to high-speed train followed by local transportation to the destination. ITN captures the inhomogeneous means of travelling better than multi-layered networks. An agent spends some time at the destination before the return trip begins, which is taken to be 5 time steps corresponding to 5 hours[@b50][@b51]. Returning to home city, an agent becomes a non-traveller until the next journey. [Figure 3](#f3){ref-type="fig"} shows a schematic journey. The travelling dynamics leads to a steady state in which residents among are non-travellers at node *i*. The number of all non-travellers depends on *f* (see [Fig. S2 in SI](#S1){ref-type="supplementary-material"}) linearly for *f* ≤ 0.01. We thus take *f* = 0.01. The values of *n*~*i*~ and for the 116 cities are shown in [Fig. S3 in SI](#S1){ref-type="supplementary-material"}.
Epidemic spreading on China's ITN network
-----------------------------------------
Let *v*~*s*~ = 100 (km/h) be the highway traffic speed and *v*~*f*~* *\> *v*~*s*~ be speed of high-speed train. The speeds and *r*~*ij*~ determine the time *τ*~*ij*~ of each link. After the travelling population reaches the steady state, the SIS process is initialized by assigning agents randomly as infected at *t* = 0. Practically, uniformly distributed initial infection speeds up the approach to the steady state. The recovery rate is fixed at *μ* = 0.1. Let *ρ*~*I*~ be the fraction of infected agents. [Figure 5(a)](#f5){ref-type="fig"} shows *ρ*~*I*~(*t*) for *β*~1~ = 2 × 10^−5^ and *β*~2~ = 0.004, for two values of *v*~*f*~ = 250 and 500. An epidemic steady state is reached quickly. As a higher shortens the time on the links that the infection rate is higher, *ρ*~*I*~ is smaller for higher *v*~*f*~. [Figure 5(b)](#f5){ref-type="fig"} shows the steady state *ρ*~*I*~ for *β*~1~ = *β*~2~. There exists a threshold *β*~1*c*~ ≈ 4 × 10^−5^ above which *ρ*~*I*~ ≠ 0.
As *β*~2~* *\> *β*~1~ generally, [Fig. 5(c)](#f5){ref-type="fig"} shows *ρ*~*I*~ (*β*~2~) after setting *β*~1~ = 2 × 10^−5^ \< *β*~1*c*~, for two values of *v~f~*. [Figure 5(d)](#f5){ref-type="fig"} shows *ρ*~*I*~(*β*~2~) for three different values of *β*~1~ \< *β*~1*c*~. It is found that *β*~2*c*~ remains unchanged for different *β*~1~ \< *β*~1*c*~. It is reasonable in that when the outbreaks come from infections in journeys, the infection rate *β*~1~ of non-travellers is irrelevant to the threshold *β*~2*c*~. However, for *β*~2~* *\> *β*~2*c*~, a higher *β*~1~ leads to a higher *ρ*~*I*~.
Next, we set *β*~1~ = 10^−4^* *\> *β*~1*c*~ and [Fig. 6(a)](#f6){ref-type="fig"} shows that *ρ*~*I*~(*β*~2~) increases monotonically with *β*~2~, for *v*~*f*~ = 250 and 500. Here, *ρ*~*I*~ ≠ 0 for all *β*~2~. There exists a value *β*~2*c*′~ (*β*~2*c*′~ = 0.0025 for the case in [Fig. 6(a)](#f6){ref-type="fig"} below (above) which *ρ*~*I*~ for *v*~*f*~ = 250 is lower (higher) than that for *v*~*f*~ = 500.
To summarize the findings in a physical picture, for *β*~2~ \< *β*~2*c*′~, infections among non-travellers at the nodes dominate the epidemic process. A higher *v*~*f*~ (e.g. *v*~*f*~ = 500) reduces the time that agents spent on journeys and thus promotes infection. For *β*~2~ \> *β*~2*c*′~, infections among travellers on journeys dominate the epidemic process. A higher *v*~*f*~ shortens the journey and suppresses infection.
For *β*~1~ = 2 × 10^−5^ \< *β*~1*c*~ and *β*~2~ = 0.006* *\> *β*~2*c*~, infections during journeys dominate. [Figure 6(b)](#f6){ref-type="fig"} shows that *ρ*~*I*~ increases monotonically with the fraction of travellers *f*, with *ρ*~*I*~ for *v*~*f*~ = 500 smaller than that for *v*~*f*~ = 250 due to the shorter journey time.
Discussion
==========
We stressed the necessity of establishing a new framework for modelling journeys in modern times and their effects on epidemics. We illustrated the key ideas by presenting an integrated travel network constructed by considering geographic data, population data and transportation infrastructures in China. An example using only the high-speed trains and highways among the 116 cities of over a million population suffices for stressing the points. An ITN should include: (i) diversity among the links due to different distances and different speeds of transportation; (ii) diversity among the cities due to different population sizes, and transportation services often reflecting their economic growth; (iii) round-trip journeys to targeted destination via paths of shortest time; and (iv) different infection rates for travellers and non-travellers. The ITN can readily be extended to include details on local area transportation, multiple means of transportation, and journeys among different countries. For example, [Fig. 1(b)](#f1){ref-type="fig"} shows schematically a local transportation network with stations (nodes) served by a subway network (dashed lines) and a bus network (solid lines). A journey includes generally travelling in both [Fig. 1(a,b)](#f1){ref-type="fig"}. Effects such as traffic congestion naturally emerge. As far as epidemics are concerned, faster and more convenient inter-city journeys would reduce the travel time during which passengers are crowded and thus suppress the chance of being infected, but they would also induce people to make more journeys and to farther places and thus spread a diseases more readily. Our ITN would serve as a good starting point for exploring the interplay of travelling and infection dynamics for many further work.
Methods
=======
Degree and weight distributions of ITN
--------------------------------------
Highway buses and high-speed trains are the major means of transportation in China. After constructing ITN (see [Fig. 4](#f4){ref-type="fig"}) based on high-speed trains and highways data, the number of links *k*~*i*~ is recorded for each node and the degree distribution *P*(*k*) is obtained ([Fig. S1(a) in SI](#S1){ref-type="supplementary-material"}). The average degree and the clustering coefficient are calculated, where *E*~*i*~ is the number of links connecting the *k*~*i*~ neighbors of node *i*[@b52].
For the weights in [Eq. (2)](#eq5){ref-type="disp-formula"}, we record the actual populations in each node and reduce them to *N*~*i*~ in units of 5000 and the distances *r*~*ij*~ between pairs of nodes in *km* according to the China official website. The frequency of high-speed trains *S*~*ij*~ is obtained based on the routes and schedules of all high-speed trains. For each route that originates from a city *A* and terminates at a city *B*, we record the cities, say *A*, *C*1, *C*2, *C*3, *B*, served along the route and the number of services *m*~*s*~ per day. Then, all *S*~*ij*~, i.e. *S*~*A*,*C*1~, *S*~*C*1,*C*2~, *C*~*C*2,*C*3~, and *S*~*C*3,\ *B*~, are augmented by *m*~*s*~. Data for all routes give the final *S*~*ij*~ that go into [Eq. (2)](#eq5){ref-type="disp-formula"} for the weights of the links *W*~*ij*~ and [Eq. (3)](#eq6){ref-type="disp-formula"} for the weights of the nodes *W*~*i*~ (see [Table S1 in SI](#S1){ref-type="supplementary-material"}).
Journeys on ITN
---------------
For a journey that starts from the home city, the path of the shortest travel time to the destination is chosen. For a single type of links, i.e., *v*~*s*~ = *v*~*f*~, the path of shortest travel time coincides with the shortest path. In ITN with *v*~*s*~ \< *v*~*f*~, the shortest paths are generally different from the paths of shortest time. As *v*~*f*~ \> *v*~*s*~, selected paths will involve railways as much as possible. It is convenient to discretize the journeys. The distance *r*~*ij*~ between two neighboring nodes *i* and *j* are divided into *τ*~*ij*~ time steps. At each time step, agents at node *i* become travellers. The destinations are chosen according to [Eq. (5)](#eq12){ref-type="disp-formula"}. The journeys are carried out as follows:
For every path between the home city *i* and destination *j*, the sum of *τ*~*ij*~ along the path is obtained. The path of shortest time is the one with the smallest sum.Paths originated from different cities to different destinations may partially overlap. Therefore, in the intermediate nodes (cities) in a journey, some travellers may come in and other travellers may leave.Upon arrival at the destination, an agent stays 5 time steps before the return journey begins.
Initially, the segments 1 ≤ *k*~*r*~ ≤ *τ*~*ij*~ on the links are empty and they will be occupied only when agents travel. For a node *i*, there are new travellers starting their journeys in the steady state, making a total new travellers. Each of them has the chance of choosing node *i* as the destination, giving a total agents arriving per time step in the steady state.
Epidemic spreading measurement on ITN
-------------------------------------
In the SIS dynamics, we distinguish infections among non-travellers in the cities and among travellers in the same segment of a link with infectious rates *β*~1~ and *β*~2~, respectively. As travellers on trains/buses are densely packed, *β*~2~* *\> *β*~1~[@b47]. An agent is a traveller and non-traveller at different times. When he is a non-traveller in a city, he is exposed to an infectious rate of *β*~1~. Once he is on a journey, he is exposed to an infectious rate of *β*~2~ during each segment of his journey, regardless of the segment being in the middle of a link or a passing-by city. Only travelling agents in the same segment *k*~*r*~ (1 ≤ *k*~*r*~ ≤ *τ*~*ij*~) towards the same direction can infect each other. Thus, SIS on ITN accounts for the continual exchanges of agents on trains and buses due to partial overlaps of agents' journeys and the spread of a diseases through journeys. A susceptible non-traveller at node *i* will be infected by the rate 1−(1−*β*~1~)^*n*^~*i,I*~ when he is in contact with *n*~*i,I*~ infected agents. A susceptible traveller at a segment *k*~*r*~ of a link will be infected by the rate when he is in contact with infected agents. Each infected agent recovers with a rate *μ*. The fraction *ρ*~*I*~ of infected agents is obtained by , where is over all the segments in all links in both travelling directions and *N*~*tot*~ is the total population.
An approximate theoretical analysis
-----------------------------------
We make a qualitative analysis of the key behavior and illustrate that the dependence of *ρ*~*I*~ on the model parameters in ITN can be captured by mean-field considerations. Let there be *M* cities. There are pairs of cities that the journey between which is all on high-speed trains. The mean number of sections 〈*τ*〉 in a link is *τ*~*s*~ = *int*(*s*/*v*~*s*~) + 1 for highway links and *τ*~*f*~ = *int*(*s*/*v*~*f*~) + 1 for railway links, where is the mean distance between neighbouring nodes. There are altogether
sections on the links, with *d* being the mean shortest path length between two nodes. It follows that *N*~*mid*~ decreases with *m*.
There are two processes in one time step: infection and motion. For the step *t *→ (*t* + 1), SIS processes take place in the time interval *t*^+^ → (*t* + 1)^−^ and the motion occurs at (*t* + 1). At a node , there are *n*~*i,s*~ susceptible and *n*~*i,I*~ infected agents and *n*~*i*~ = *n*~*i,S*~ + *n*~*i,I*~. Similarly, there are *n*~*α*,*S*~ susceptible and *n*~*α*,*I*~ infected agents at a section *α* of a link, with and . The dynamics of the infected agents can be described by
where *X*~*I*~ accounts for infected agents arriving at the destination or at home, *Y*~*I*~ represents infected agents starting a journey, *k*~*station*~ are nodes where agents switch means of transportation, and is over the *k*~*i*~ links to node *i*.
The time evolution of *ρ*~*I*~ is given by and thus
where *N*~*tot*~ is the total population. The set of equations can be iterated in time for the steady state. Further generalizations of ITN can be treated accordingly.
Based on [Eq. (8)](#eq39){ref-type="disp-formula"}, we make the following observations:
1\. *For β*~1~ = *β*~2~: As *n*~*i*~ \>\> *n*~*α*~, we readily have *n*~*i,I*~ \>\> *n*~*α,I*~ and the second term in [Eq. (8)](#eq39){ref-type="disp-formula"} dominates. Thus, *ρ*~*I*~ in [Fig. 5(b)](#f5){ref-type="fig"} comes mostly from infections at the nodes.
2\. *For β*~1~ ≠ *β*~2~ *and β*~1~ \> *β*~1*c*~: Infections at the nodes give *ρ* ≠ 0, but the third term in [Eq. (8)](#eq39){ref-type="disp-formula"} becomes important when *β*~2~ \> *β*~1~ and *β*~2~ \> *β*~2*c*~. This gives the behaviour in [Fig. 6(a)](#f6){ref-type="fig"}.
3\. *For β*~1~ ≠ *β*~2~ *with β*~1~ \< *β*~1*c*~: Infections at the nodes alone cannot sustain *ρ*~*I*~. Infections on journeys dominate and *ρ*~*I*~ becomes finite at *β*~2~ = *β*~2*c*~, independent of *β*~1~ (see [Fig. 5d](#f5){ref-type="fig"}). It follows from the equation for *n*~*α*,*I*~((t + 1)^−^) that
indicating that *β*~2*c*~ is inversely proportional to the mean number of agents travelling in a segment of a link *n*~*α*~.
4\. *For different m*: The third term in [Eq. (8)](#eq39){ref-type="disp-formula"} indicates that *ρ*~*I*~ ∝ *N*~*mid*~. As *N*~*mid*~ decreases with *m* (see Eq. 6), *ρ*~*I*~ also drops with increasing *m* and high-speed railways tend to prevent epidemics by shortening travel times. One should note that this captures one effect of having faster transportation. However, an opposite effect of inducing more travellers poses a risk.
Additional Information
======================
**How to cite this article**: Ruan, Z. *et al.* Integrated travel network model for studying epidemics: Interplay between journeys and epidemic. *Sci. Rep.* **5**, 11401; doi: 10.1038/srep11401 (2015).
Supplementary Material {#S1}
======================
###### Supplementary Information
This work was partially supported by the NNSF of China under Grant Nos. 11135001 and 11375066, and 973 Program under Grant No. 2013CB834100.
**Author Contributions** Z.L. and Z.R. conceived the research project. Z.R., Z.L. and C.W. performed research. Z.L., Z.R. and P.M.H. analyzed the results. Z.L. and P.M.H. wrote the paper. All authors reviewed and approved the manuscript.
{#f1}
{#f2}
{#f3}
{#f4}
{#f5}
{#f6}
| |
Most churches that are seeing significant growth and ministry effectiveness are also churches that practice regular innovation. They have a culture of looking for new and better ways of accomplishing their mission and pursue those opportunities regularly.
However, developing a culture of innovation is not as easy as it sounds. There are always significant hurdles to moving from a culture of status quo to a culture of innovation in a church. Obviously those churches who see regular growth have overcome these hurdles but understanding what they are is an important step in overcoming them.
Hurdle One: You have to want a culture of innovation
Do you embrace innovation, seek it and value it? If this is not a value at the leadership level it will not happen. If your leaders operate out of fear (what if something goes wrong? We've never done it before! Someone might object) innovation will not happen. Organizations that see regular innovation do so because they want it to happen and know how it helps them move forward and stay fresh.
Hurdle Two: You must be willing to fail and even celebrate failure
Truth be told, most leaders won't go toward innovation for the simple reason that it may fail. They would rather be safe than suffer the embarrassment of failure. Here is a simple truth: Innovation requires risk. That risk pays off in multiple ways but not all ideas work. Ministries that make innovation a part of their culture know this and will celebrate that people tried a new idea even if it failed. In fact, it is often after the learnings of a few failures that the right solution is found.
Hurdle Three: You must focus on the future rather than the present or past
If one wants to focus on the past or present, innovation is not for you. If your focus is on the future, innovation is the key to that future. Times change, opportunities around you change, generations change and unless we also change we become irrelevant and stale. If you are happy where you are, doing things differently will not be a value. If you live in fear of failure, innovation will not be a value. If you want to reach the next generation or new opportunities, innovation is your friend.
Hurdle Four: You must be willing to push through the naysayers
It is a sad reality that the majority of church leaders (staff and boards) live in fear of those that object when new ideas are suggested. Think about that: The most conservative and change unfriendly folks in your congregation hold the congregation hostage from moving forward because their voices are loud and intimidating and leaders are unwilling to challenge those voices. Lets be candid. New ideas face opposition. We have the choice of allowing naysayers to run our ministries or for us to lead well and push through the opposition. Every good idea that is different will face opposition.
Hurdle Five: You need to we willing to spend money when necessary
Innovation does not mean that it must be expensive but there are times when investments need to be made in order to try new things. If your leadership is unwilling to spend money to try something new you will never have a culture of innovation. No business prospers long term without making investments in R & D and nor do ministries. Such investments are investments in the future success of your ministry. Make no investments and you live with what is and not what could be.
Hurdle Six. You cannot be too proud to steal good ideas
Cultures of pride say, "I won't do what others are doing, it has to be my idea." Cultures of humility say, "I am willing to learn from others any time I can and keep my "dumb tax" to a minimum. Proud leaders don't value learnings from others but humble leaders do. Learn from others and rip off their ideas. This is not about you but about maximizing the impact of your ministry.
Hurdle Seven. You must have a leader who promotes innovation
If the senior leader does not value innovation and you are an idea person, you may be on the wrong team. A senior leader must champion innovation and new ways of doing things if there is going to be a culture of innovation. Otherwise you are pushing a boulder uphill and it is likely to come back down and flatten you.
Hurdle Eight. The church board must value innovation
It is unfortunate that church boards can be the largest impediment to innovation in the church. I have watched this happen time and time again. This is where the influence and skill of the senior leader is important. Can they convince the board to take the same risk for the future that the staff is willing to take?
Think about the level of innovation in your church or ministry. Which of these hurdles are keeping you from embracing a culture of innovation and what can you do about it? | https://addingtonconsulting.org/blogs/news/the-eight-hurdles-to-innovation-in-the-church |
In his second inaugural address on Monday, President Obama made it clear that the threat of climate change is real and vowed to take action during his final four years in office.
“We will respond to the threat of climate change, knowing that the failure to do so would betray our children and future generations,” Obama said. “Some may still deny the overwhelming judgment of science, but none can avoid the devastating impact of raging fires and crippling drought and more powerful storms.”
The president’s statements are not as controversial as they would have been four years ago. From droughts and extreme weather to health problems such as asthma, climate change is already affecting everyday Americans and the nation’s economy, according to a draft report recently released by a number of federal agencies under the Global Change Research Program. The report will take public comment before a final draft is issued, but the scientists and government advisers who put it together are confirming what many Americans already suspect:
Americans are noticing changes all around them. Summers are longer and hotter, and periods of extreme heat last longer than any living American has ever experienced. Winters are generally shorter and warmer. Rain comes in heavier downpours, though in many regions there are longer dry spells in between.
Sharp reductions in greenhouse gas emissions are necessary to avoid the worst symptoms of climate change, such as coastal flooding, extreme weather, drought and wildfires, according to the report. If global emissions continue to increase, average temperatures in the United States could rise by 5 to 10 degrees Fahrenheit by the end of the century.
So what can Obama do? During his first term, the initial push for a national cap on carbon emissions failed when Congress rejected cap-and-trade legislation. To avoid another showdown with lawmakers, the president and his Environmental Protection Agency (EPA) are expected to rely on administrative measures and regulation to encourage big polluters to embrace new technologies that reduce greenhouse gas emissions.
Under Obama, the EPA has already taken some steps toward regulating greenhouse gas pollution. In 2007, the Supreme Court upheld the EPA’s power to regulate greenhouse gas emissions under the Clean Air Act, and in 2009, the EPA officially acknowledged that greenhouse gas pollution threatens the health and welfare of Americans and can be regulated.
The EPA has since put several proposals on the table. Now, environmentalists want to the agency to seal the deal.
“Thankfully, we have the clean energy solutions at our fingertips to tackle [climate change], but we need our elected officials to do more to put these solutions to work,” said Nathan Willcox, global warming program director with Environment America, in a recent statement.
Curbing Power Plant Pollution
Power plants are the country’s largest source of greenhouse gas pollution and an obvious target for regulators. In 2010, power plants produced more than 2.2 billion tons of carbon dioxide and accounted for 40 percent of America’s total carbon dioxide emissions, according to the EPA.
In April 2012, the EPA proposed its first-ever rule to limit carbon dioxide pollution from new power plants. Existing power plants are exempt, so the rule would only apply to future power plants and would not cap emissions from plants that are currently polluting the atmosphere.
The EPA told Truthout that it has no specific timeline for implementing the rule and is currently reviewing 2 million comments on the proposal. A final rule will be issued after the review.
The proposed rule has met tough opposition from the coal and energy industries while rallying environmental groups, which are pushing the EPA to finalize the rule and then quickly move to cap emissions from existing power plants, as well.
By setting a carbon emissions limit at 1,000 pounds per megawatt hour for new power plants, the EPA’s proposed rule would require that new, carbon-reducing technologies be installed in America’s next fleet of power plants.
The proposed rule could push new facilities to rely more heavily on natural gas, which burns cleaner than coal and is available at historically low prices due to the ongoing gas rush made possible by the controversial drilling technique known as hydraulic fracturing, or fracking.
New power plants may also install what is known as carbon capture technology, which pumps carbon dioxide deep underground. The EPA and some environmental groups are touting the new technology, which is still under development, but some environmentalists and researchers worry that carbon capture could cause minor earthquakes and would be too costly to gain interest from the industry.
The proposed rule, along with other EPA greenhouse gas initiatives, has already survived legal challenges from a coalition of coal companies and industry groups, including the US Chamber of Commerce. The rule could face more challenges after being finalized.
Conservatives and industry groups have accused the Obama administration of waging a “war on coal” and have fought any attempt by EPA to regulate power plants. Rules limiting the amount of mercury and other potentially deadly toxins produced by coal-burning power plants, for example, were held up for years by industry lawsuits and regulatory challenges.
Regulating Fracking Emissions
Unconventional drilling techniques commonly called fracking have made new reserves of oil and natural gas available to a growing domestic oil and gas industry. Fracking has expanded in rural areas across the country and become one of the nation’s most high-profile environmental controversies.
Fracking faces widespread grassroots opposition, but the Obama administration has said it supports the growing industry as long as drilling is done safely. Concerns over water contamination and rural industrialization dominate the fracking debate, but recent studies have shown that fracking contributes to climate change by emitting a considerable amount of the greenhouse gas methane.
In an open letter to Obama, the Clean Air Task Force told the president that the EPA could reap “almost immediate climate benefits” by regulating methane emissions from fracking.
Pound for pound, methane warms the planet over 70 times more than carbon dioxide, according to the Clean Air Task Force. Methane also degrades from the atmosphere at a faster rate, so reducing methane emissions quickly would have the near-term benefit of reducing temperatures in coming decades.
The EPA issued regulations last year requiring the industry to capture some methane and dangerous pollutants such as benzene, but the rule does not address leaking and venting methane from oil and gas pipelines and infrastructure.
The leaking and venting of methane from the oil and gas production systems is the nation’s largest source of methane pollution, the task force said, and comprehensive methane emissions standards from the EPA would save money, reduce air pollution that causes health problems, and help slow climate change.
| |
In cyber space everyone is interconnected and defences are only as strong as the weakest link, says Antonio Missiroli, assistant secretary general for emerging security challenges at Nato.
“Nato also recognises the scale and severity of cyber threats, and at our most recent summit, allies stated that cyber threats to the security of the alliance are becoming more frequent, complex, destructive and coercive,” he told attendees of the CyberSec Brussels Leaders’ Foresight 2019 event.
Responding to a call for the development of common principles for a secure cyber space at the event, Missiroli said the concept of “one for all and all for one” as it relates to cyber space is a “fundamentally uncontroversial” idea at Nato.
The alliance, he said, is firmly committed to continuing to adapt to the cyber threat landscape and take actions to improve cyber defence capabilities, build trust and improve cooperation among allies, partners, industry and academia.
One of Nato’s key tools for enhancing cyber defence, said Missiroli is the cyber defence pledge made by allies at the 2016 summit to strengthen and enhance the cyber defences of their national networks and infrastructures as a matter of priority.
“We are now in the midst of our third cycle of assessment and reporting, and overall, the pledge has been a good news story because since 2016, almost every ally has upgraded their cyber defences,” he said.
Read more about Nato and cyber defence
- Nato to be fully operational in cyber space by 2023.
- Cyber attacks must avoid civilian targets, says Nato manual.
- Nato gears up for cyber warfare with latest exercise.
- Nato assembles cyber task force to bolster defence capabilities against online attacks.
According to Missiroli, the political impact of the pledge is also apparent through the fact that cyber security has attracted high-level political attention in allied nations, which has helped to elevate cyber defence from a technical to a strategic issue.
“It has also been useful in bringing together a variety of domestic national stakeholders that were operating separately from one another previously, and it has served as an important platform for allies to share best practices,” he said.
Throughout Nato, Missiroli said allies are working together, pooling their knowledge and experience to help each other.
“This demonstrates the pledge’s ‘multiplier effect’ across the alliance, with the results being far greater than the sum of their parts.”
In 2018, senior officials and cyber defence experts from Nato members met in Paris for the first annual conference on the pledge to discuss key elements of the pledge, with the second annual conference scheduled to take place in the UK later this year.
“These events demonstrate the ongoing commitment to this important tool, which is supported at the highest levels of government,” he said.
More work to be done
However, Missiroli said there is still more work to be done because the threat continues to grow and evolve, adding that the pledge has been a useful mechanism to galvanise and catalyse improvement.
In addition to the work by allies, he said Nato has undertaken “significant” policy and organisational adaptation in response to the recognition of cyber space as a domain of operations at the 2016 summit.
“Milestones include the setting up of the cyber space operations centre in Mons, Belgium, which will provide situational awareness and coordination of Nato activity in cyber space; the approval of a military vision and strategy for the cyber space domain; and the agreement on how to integrate cyber effects, provided voluntarily by allies, into alliance operations and missions,” said Missiroli.
However, he noted that the recognition of cyber space as a domain of operations does not change Nato’s defensive mandate, adding that Nato has explicitly affirmed the applicability of international law to cyber space.
“We support work to maintain international peace and security in cyber space and to promote stability and reduce the risk of conflict. We recognise that we all stand to benefit from a norms-based, predictable and secure cyber space.
“Our goal in recognising cyber space as a domain of operations is simply to ensure that we can operate as effectively as we do on land, at sea and in the air. In short, our goal is to make cyber space a daily and normal part of our business.”
Cyber defence a team sport
Although a cliché, Missiroli said it remains true that cyber defence is a team sport. “Nato cannot and should not go it alone. We are only made better by sharing more information and the more we can pool best practices and interoperate with partners,” he said, adding that Nato currently engages with more than 40 partner countries based on shared values and common approaches.
Nato also helps to foster dialogue and practical cooperation in partner countries through the Science for Peace and Security Programme, taking steps, for example, to intensify cooperation with the European Union, particularly in the areas of information exchange, training, research and exercises.
However, Missiroli said Nato must continue to look beyond Europe in light of the fact that partner nations such as Australia, New Zealand, Japan and South Korea have all invested heavily in cyber defence. “And it will serve us well to continue to build these relationships.”
Nato also recognises the importance of the private sector, he said. “It is the private sector, after all, that develops and operates the vast majority of networks worldwide and our continuous interactions with industry partners helps provide advance notice and rapid mitigation for many activities that have been detected against systems in allied nations and against Nato itself.
“Information sharing goes both ways. Industry shares with us and we also share with industry. In the WannaCry and NotPetya attacks, for example, we quickly reached out to our industry partners and the information exchange was critical for getting the most up-to-date picture of a rapidly-evolving and complex situation.”
Nato needs to do more
Moving forward, Missiroli said that given the cutting-edge developments in the cyber domain, such as artificial intelligence, Nato will need to do more to capitalise on the power of industry and academia.
“I hope it is clear that Nato has made significant progress in the cyber space domain as individual allies, as Nato and as partners,” he said.
“While affirming Nato’s defensive mandate, we have expressed our determination to employ the full range of capabilities, including cyber, to deter, to defend against and counter the full spectrum of cyber threats, including those conducted as part of a hybrid campaign.
“The threats of cyber space are real, and they are certainly not going away any time soon, so Nato will continue to adapt and evolve to meet these threats, and we do so not alone, but with all our partners,” concluded Missiroli. | https://www.computerweekly.com/news/252458161/Nato-supports-collaboration-on-cyber-security |
For stochastic time series modelling, an essential property is the underlying statistical model that is assumed to govern the number of defective parts of PCBs in a production process in the manufacturing industries in Ghana. The data points were assumed to exhibit Markov dependency with respective state transition probabilities matrices following the identified state space (i.e. increase, decrease or remain the same). We established a methodology for determining whether the daily number of defective parts increase, decrease or remained the same. A criterion for identifying the state(s) in which production of PCBs is cost effective based on least transition probabilities was also applied. The results showed that it was cost effective when productions are done in the first and second states since at these.
This paper presents improvement in the design of a gear drive bucket elevator by introducing a ratchet mechanism which holds the chain links and buckets in position when there is a failure in order to prevent them from damage and also addresses the difficulty in joining the chain links together. The main function of the ratchet mechanism is to ensure that the chain is prevented from dropping to the bottom when there is a failure. The ratchet, basically, is made up of toothed wheel (sprocket/spur gear), a pawl/lever, and a spring. The calculations involve the design of the beam, pawl and the spring. As the ratchet mechanism will help prevent the chain together with the bucket from dropping to the bottom whenever there is failure, it will help reduce downtime leading to an increase in production. The mechanism will also prevent damage to buckets and chain links leading to reduction in maintenance cost..
Here effects of variable viscosity and thermal conductivity and magnetic field effect on the free convection and mass transfer flow through porous medium with constant suction/heat flux is studied The boundary layer equations are transformed in to ordinary differential equations with similarity transformations. The effects of variable viscosity and thermal conductivity on velocity profile, temperature profile and concentration profiles are investigated by solving the governing transformed ordinary differential equations with the help of Runge- Kutta shooting method and plotted graphically.
Keyword: Areal parameters, GIS, linear parameters, Morphometry, Narmada river watershed, relief parameters.
Student Monitoring System is the latest approach to track the student's academic and college activities by their parents. It utilizes the RFID Readers and RFID Tags with an Arduino Ethernet Connectivity and Cloud Brokerage as a Mediator. RFID deployment in education is student monitoring system, by using IoT and Cloud technology; it will generate a real time monitoring system that can be retrieved by parents. Whenever a student enters the college campus it forwards and store the information in the college Database. The data can be accessed by every parent through an App or a Web-based Application. The parent has to get registered during the student admission in order to get touch with the College Administration. So, without the assistance of other the parent will know their child progress using a simple click on button. Using IoT and Cloud we can access it from anywhere and anytime which will impart us the better pliability..
Keyword: RFID Sensors, IoT, Ethernet, Network, Tags, Cloud.
Valuation of Waste Obtained from the Harvest of Cane, Processing of Sugar And Alcohol of the Agroindustrial Company Paramonga S.A.A. | http://ijera.com/pages/v9no2S2.html |
Shaking off a two-day delay that began with swirling winds on the coast of Florida, NASA launched its GRAIL mission to the moon Saturday, seeking a greater understanding of Earth's nearest neighbor through a promising dual-spacecraft technology.
The Delta II rocket carrying the paired washing-machine-sized craft that make up the Gravity Recovery and Interior Laboratory lifted off into a blue sky from Cape Canaveral, Fla., at 9:08 a.m. About 90 minutes later, NASA confirmed that GRAIL-A and GRAIL-B had separated from the rocket, unfurled their solar panels and begun a 31/2-month trip to the moon.
"Our GRAIL twins have Earth in their rear-view mirrors," said David Lehman, GRAIL project manager at the Jet Propulsion Laboratory in La Cañada Flintridge, which is managing the $496-million mission.
Maria Zuber, professor of geophysics at the Massachusetts Institute of Technology and GRAIL's principal investigator, said in an email that the launch, long in the making, was an emotional experience. It was akin, she said, to watching a child practice for years at music or sports, "then watching them perform in extraordinary fashion."
NASA had scrubbed planned launches Thursday and Friday, first as a result of foul weather and then because of a data glitch.
The spacecraft will spend three months making 12 polar orbits of the moon each day. Scientists predict that the mission will provide a map of the lunar gravitational field, data that will allow for the first comprehensive assessment of the moon's crust, mantle and core.
Considering that 12 humans have walked on its surface, there are still surprisingly significant questions about the moon. For instance, scientists do not know why lava flooded the plains on one face of the moon but does not appear to have reached the surface elsewhere. Understanding the moon's thermal history would add to the understanding of the evolution of rocky planets, including Earth.
The study of the moon has been hamstrung by a quirk of the solar system: Because the moon spins at the same rate that it orbits Earth, only half of the moon is visible to us. A single spacecraft studying the moon can send back data only when it has a direct line of communication to Earth, which can only happen on the side of the moon facing us, or the near side.
GRAIL marks the first time that a technique known as "precision formation flying" — studying the same object using multiple, coordinated spacecraft — will be used beyond Earth's orbit.
Two spacecraft will fly in locked formation and will speak to each other through a high-frequency signal rather than to scientists on Earth. As they orbit together, even minute changes in gravity will change the distance between the craft — allowing for the first true "map" of the moon's gravitational field, even on the far side of the moon.
Scientists predict enormous leaps in their understanding of the moon — even the resolution of a dispute over whether Earth once had two moons, which collided and fused together.
Some scientists say GRAIL is the beginning of a revolution in planetary science. Precision formation flying could allow for numerous spacecraft to create singular technology "platforms" that could see deeper into space and in far greater detail than ever before.
For example, 30 spacecraft could band together to form a single telescope — peering into unexplored pockets of space to continue the search for life. Scientists envision a day when they will send swarms of iPod-sized spacecraft into space, a technology that could replace satellites and offer other advances in communications.
"NASA is taking its next big leap into deep-space exploration," said NASA Administrator Charles Bolden. | https://www.latimes.com/world/la-xpm-2011-sep-11-la-na-grail-moon-20110911-story.html |
I’ve always enjoyed learning new skills but it was only when I was looking at what I was going to do following my retirement from procurement in the NHS, that I thought about setting up my own business making toys and ornaments for the Christmas market that the idea of running a business was first born. I employed a colleague who was skilled particularly on the IT side of things. Shortly after Adam arrived we invested in a laser machine. The difference in working on my own compared to working with others was noticeable. As a man I had also been conscious of the difficulties I had had with my own mental health. The fix I got by working with someone who had a shared objective was tremendous.
Wendover is a comparatively well off area! With my NHS experience and volunteering with both the Ambulance service and those people suffering from the effects of Dementia, I realised that the community could and should be doing a lot more to help those in need via self help methods. Men are useless sometimes at admitting to problems – especially health problems. My work in the community as a volunteer and as a previous Chair of the local Parish Council spurred me in to action and I became a member of Men’s sheds. There are Men’s sheds north of Aylesbury and at Amersham but nothing in Wendover.
Men’s Sheds (or Sheds) are similar to garden sheds – a place to pursue practical interests at leisure, to practice skills and enjoy making and mending. The difference is that garden sheds and their activities are often solitary in nature while Men’s Sheds are the opposite. They’re about social connections and friendship building, sharing skills and knowledge, and of course a lot of laughter.
Sheds are whatever the members (or Shedders as we call them) want them to be. Although labelled sheds, they often aren’t sheds at all. They can be empty offices, portable cabin’s, warehouses, garages, and in at least one case, a disused mortuary. Some Sheds are purpose built workshops, but they rarely start out that way. Many don’t have premises at all in the beginning and instead form a group that meets regularly for the social connection, company and camaraderie until they can find somewhere to kit out with tools. Many Sheds get involved in community projects too – restoring village features, helping maintain parks and green spaces, and building things for schools, libraries and individuals in need.
Activities in Sheds vary greatly, but you can usually find woodworking, metalworking, repairing and restoring, electronics, model buildings or even car building in a typical Shed. Sheds typically attract older men, but many have younger members and women too. Whatever the activity, the essence of a Shed is not a building, but the connections and relationships between its members.
For a long time research has shown the negative impact of loneliness and isolation on a person’s health and wellbeing. Recently we have seen more evidence come to light that shows loneliness and isolation can be as hazardous to our health as obesity and excessive smoking. Surveys from mental health charities are finding that millions of people report feeling lonely on a daily basis.
Men typically find it more difficult to build social connections than women, and unlike women of a similar age, fewer older men have networks of friends and rarely share personal concerns about health and personal worries. It is not the case for all men, but for some, when retirement comes, it can feel like personal identity and purpose is lost. Men’s Sheds can change all of that.
Sheds are about meeting like-minded people and having someone to share your worries with. They are about having fun, sharing skills and knowledge and gaining a renewed sense of purpose and belonging. As a by-product of all of that they reduce isolation and feelings of loneliness, they allow men to deal with mental health challenges more easily and remain independent, they rebuild communities and in many cases, they save men’s lives.
My mission is simple! To get a small group together – so far there is me, the Minister of the local Free Church, a local Countryside gentlemen’s group. We will meet in the New Year with a view to obtaining support from the local community, the organisation of Men’s Sheds itself to set up a Men’s Shed in Wendover
Men’s Sheds are vital. | https://wendovernews.co.uk/news/mens-sheds-in-wendover/ |
The recent stage of my EU ‘sojourn’ has been fascinating and enjoyable. I used my biographic narrative expertise to interpret a number of interviews from health professionals, working in GP Practices in the north of England, uncovering where informal learning takes place in their workplaces. The NHS changes, I discovered, are making big differences to working life – previous ‘spaces’ for sharing ideas and discussing practice are being slowly eroded, leaving a need for an alternative of some kind – perhaps our online EU ‘Help seeking’ tool! For those unfamiliar with biographic narrative, Tom Wengraf, author the best selling book Qualitative Research Interviewing (Sage 2001) has agreed to share a very short overview – available here: Quick Outline Sketch of BNIM-14. My work on the interviews gave me valuable insights now workshops are running with health professionals. The first one explored existing professional networks, the second one was about co-designing their own ‘ideal’ network, and the final one will run in the autumn, when a more developed tool will be available. Empirical work is really exciting!
Monthly Archives: May 2014
Biographic narrative approaches to Health
More about MOOCs
More about MOOC s @ALDinHE
I went to the talk by the innovative team at the University of Northampton who are working on a combination of a MOOC/SOOC (small online open access course!)! Launching for 13,500 potential students this summer so no pressure there then!…..and one iteration will link to a 10 credit module, be facilitated/ peer reviewed by student ambassadors- a study skills for academic success. Other talks re ‘things MOOC’ various snippets caught my attention –
the difference between “C” constructivist MOOCs and ‘X’ MOOCs which are more structured and directive. Suggested ways forward is a hybrid MOOC
Platforms – Coursera, Udacity, Futurelearn, EdX
Badges are of interest
Pilot MOOCs with sixth forms students
Ones people have tried and liked
http://octel.alt.ac.uk/ just started, on coursera and run by the ALT C crew
Sian Baynes digital cultures one starts again Nov 2014
And was fascinated by this Shakespeare one
http://www.shakespeare.org.uk/visit-the-houses/whats-on.html/mooc.html
already run but resources are there
some excellent links to MOOC papers here:
http://www.icde.org/en/icde_news/news_archive/2013/Recent+reports+and+papers+on+MOOCs+and+Online+education.b7C_wRfSYa.ip
And the UK policy document on MOOCs here: ‘maturing the MOOC’
https://www.gov.uk/government/uploads/system/uploads/attachment_data/file/240193/13-1173-maturing-of-the-mooc.pdf
Educause special editions on MOOCs:
www.educause.edu/discuss/teaching-and-learning/blended-and-online-learning-constituent-group/vol-9-no-3-merlot-journal-online-learning-and-tea
http://www.educause.edu/discuss/teaching-and-learning/blended-and-online-learning-constituent-group/vol-9-no-2-special-issue-moocs-merlot-journal-onl
And an excellent blog posting:
I recently added an extended blog post looking at the issues of MOOC pedagogy and the difficulties in defining and evaluating it. It is hopefully a thought provoking piece that challenges some of the orthodoxies and assumptions around the MOOC-steria that has enveloped the sector over the last few years.
As always, the opinions in my blog are my own J
Cheers Peter Peter Bryant
Head of Learning Technology and Innovation/Centre for Learning Technology
London School of Economics and Political Science
ALDinHE Conference 2014
ALDinHE Conference 2014
So busy Easter – went to the ever fantastic ALDinHE conference, warmly welcomed by University of Huddersfield – #aldcon for the conference tweets and all abstracts here: http://www.aldinhe.ac.uk/huddersfield14
My own talk (with the virtual Helen Webster (@schloristic_rat) was a workshop on how to put together a flipped classroom- the key principles, some theory, hands on ideas and what worked for me – the online resources and what we changed in the classroom. presentation here on slide-share:http://www.slideshare.net/debbieholley1/al-din-he-flipped-classroom
Then it was over to Bradford to work with colleagues from Leeds University: Leeds Medical School on the EU Learning Layers project…. | http://drdebbieholley.com/2014/05/ |
A large, nineteenth century, French copper skimmer. These were used for skimming jams and preserves. This example is made from a very heavy gauge of copper and it has a turned end to the handle, which is shaped like a shepherd’s crook, so that it can hang. It dates from c.1870 and it is in excellent condition.
Dimensions: Length 50.2cm. Width 11.2cm.
Price includes postage within the U.K. Shipping to the U.S.A. add £30. Most of Western Europe add £15. | https://www.applebyantiques.net/pages/shop/catalogue_detail_printerfriendly.php?nShopProd_ID=12910&nLang_ID=1&sLangAbbr=en-GB |
This software application is provided under license from Intelliquip, Inc. (LICENSOR) to the LICENSEE, who in turn provides access to you, the user (USER). We have a deep respect for your privacy. As such, we are committed to the security of the information you give us and have made steps to protect your data. The LICENSOR is an entity with clients and end users in the European Union. LICENSOR receives and processes a variety of data on behalf of LICENSEE, and adheres to the EU's General Data Protection Regulation (“GDPR”). LICENSOR’S processing and storage of Personal Data is for the limited purpose of providing LICENSEE, and its authorized USERS, with the ability to use these software applications.
Table of Contents
- What is Personal Data?
- The Information We Collect
- How we use the Information we collect
- Where we store your information
- How long do we store your information?
- You have rights
What is Personal Data? Back to top
For the purpose of this policy, personal data means any information relating to an identifiable natural person. That is, one who can be identified by reference to an identifier such as a name, an email, an identification number, location data; or to one or more bio-identifiable factors specific to the identity of that natural person (the “Personal Data”) – directly or indirectly.
Personal data will be collected and used in the following ways:
The Information We Collect Back to top
We collect the following types of data about you when you:
- register an account with us;
- visit our websites, where we collect usage data (e.g., Cookie data);
- communicate with us.
Information You Give Us
Registered Account
Information you give us when you register as a USER of this software via forms on our website comprises the minimum of a username but most of our LICENSEE’s also ask for:
- your company
- your first & last name
- your email address
To successfully use our software, we need a minimum of an email address to provide you a unique experience, to help recover your password, and association to “your” data.
Optional Data
Our LICENSEEs can tailor the software application to meet their specific needs. This can include, but is not limited to, asking their users to provide additional information that assists in providing a better user experience as it pertains to the LICENSEE. For example, we may ask for a postal code and possibly even “Market Segment” to provide local services.
You can opt out of providing some data that is optional, and merely forego the functionality that such information permits, but continue to use the remainder of the site functionality.
Contact us via Email
We also get information from you when you make a request or report a problem (by phone, email, or otherwise) or make a user support request.
Information We Collect About You
We use third-party service providers for certain technical analysis and services that meet high standards of data protection and security.
How we use the Information we collect Back to top
The information we collect from you or about you—whether personal or technical—may be used in the following ways:
- We will use it to fulfill requests to provide our LICENSEE with products, software and services.
- We may notify you of product news, new products, services and best practices to maximize your usage and efficiency of our products.
- If we change our policies, we will use your contact information to notify you.
- We share anonymous website usage information with analytics providers that assist us in the improvement and optimization of our site. Personal data is not shared.
- Select employees may analyze information to fulfill technical requests or improve our software.
Where we store your information Back to top
All data is stored on secure servers (e.g., Amazon Web Services servers). We take reasonable steps to protect your information, including (without being limited to):
- Using SSL for https transport
- Physically securing the data centers
- Using anti-virus detection software
- Conducting regular backups
Where you have a password that enables you to access certain parts of the Site, you are responsible for keeping this password confidential. We ask you not to share a password with anyone.
How long do we store your information? Back to top
LICENSOR stores Personal Data for no longer than necessary under the scope of its license with LICENSEE. The data needs to be stored as long as you are a registered user. As discussed below, you have the “Right to be Forgotten,” which means that if certain grounds apply, You have the right to have your Personal Data erased from our storage without undue delay. See below for how LICENSOR can be contacted should you desire to exercise Your Right to be Forgotten.
You have rights Back to top
- The right to know how your data is collected
- The right to know how your data is being used
- The right to opt out at any time
- The Right to be Forgotten
If you wish to exercise your “Right to be Forgotten”
Please contact us at [email protected]
Who to contact
What are cookies?
Cookies are small data files that websites place on your computer or mobile device. Cookies are used by virtually all online website service providers, as they help to facilitate a smooth interaction between the user and the website. Cookies often include an anonymous unique identifier.
The cookies that Intelliquip sets are known as “first party cookies.” Cookies set by affiliated services (such as Google Analytics) are known as “third party cookies.”
Some of our cookies are required (“strictly necessary”) for technical reasons so that we can provide the as-designed functionality to you via our web applications. Other third party cookies help us improve our web app performance and better understand usage via analytics.
Strictly Necessary
These are cookies that are required for the operation of the website. You cannot refuse to use these cookies; otherwise the site will not function. The cookies are described as follows:
|
|
Name
|
|
Expires
|
|
Info
|
|
_project_portal_session
|
|
When browser closes
|
|
Enables you to log into the website to gain access to your and your organization's data.
|
|
request_method
|
|
When browser closes
|
|
Improves functionality
|
|
JSESSIONID
|
|
When browser closes
|
|
Allows the various apps (to communicate critical info to deliver a seamless user experience. It also keeps the user from having to login when moving across each application boundary.
|
|
rdAllowRedo
reAllowUndo
rdPanelExpanded_Table
rdTablePanelMenuExpanded
rdPanelExpanded_AnalCrosstab_1
rdCrosstabPanelMenuExpanded_AnalCrosstab_1
|
|
When browser closes
|
|
Allows redoing of changes in reports
Allows undoing of changes in reports
Remembers whether panel expanded or not
Remembers whether menu expanded or not
Functionality
These cookies are used to help recognize a user when they return to the website.
These are non-essential to the core functionality behind our web applications and can be refused (see below). You will lose peripheral functionality such as “Help” and “Chat.”
|
|
Name
|
|
Expires
|
|
Info
|
|
intercom-lou-*
intercom-id-*
intercom-session-*
_mkra_ctxt
|
|
24 Hours
20 years
1 week
24 hours
|
|
Intercom is a popular provider of Customer Support, Chat, Messaging, and articles knowledge base.
See below to opt-out by setting your browser up to refuse these cookies.
|
|
uechat_*_mode
uechat_*_pages_count
uechat_*_first_time
uechat_*_disabled
|
|
24 Hours
|
|
User Echo is a customer support & help knowledge base.
You can refuse these cookies via your browser.
|
|
advancedModeNotifyOff
_iq2-batch_session
fileDownload
userClicked
|
|
When browser closes
|
|
|
|
CloudFront-Policy
CloudFront-Signature
CloudFront-Key-Pair-Id
|
|
When browser closes
|
|
Amazon CloudFront is a global content delivery network (CDN). CloudFront is integrated with the Amazon Web Server (AWS).
|
|
svid
muxData
|
|
100 years
20 years
|
|
Analytical / Performance
|
|
Name
|
|
Expires
|
|
Info
|
|
_ga
_gid
_gat_*
|
|
2 Years
24 hours
When browser closes
|
|
Google analytics is a very common tool used to track website traffic, anonymously collecting user behavior and website page speeds, etc. We use it to help improve the user experience and better understand how our users use our web apps.
|
|
_hjIncludedInSample
|
|
When browser closes
|
|
HotJar is similar to Google Analytics in that we use it to help improve the user experience and better understand how our users use our web apps. Hotjar also offers the ability to anonymously poll users.
|
|
request_method
|
|
When browser closes
|
|
Optimizes web navigation via turbolinks
Can I control my cookies?
You can decide whether to accept or reject cookies by clicking on the appropriate opt-out links provided in the cookie table above.
You can set or amend your web browser controls to accept or refuse some or all cookies. If you choose to reject non-essential cookies, you may still use our Websites and/or Web App – though access to some functionality and areas may be degraded or eliminated. You cannot reject necessary cookies and continue to use our Website. Check your browser's help menu for more information or search online for helpful tips.
This Policy is not Legal Advice
This policy is being provided to you as part of LICENSOR’S effort to ensure that You understand the scope and impact of the processing of Your Personal Data that takes place in conjunction with the utilization of LICENSOR’S services as well as Your rights associated with the use and storage of Your Personal Data. However, the information provided herein is not for the purpose of providing You legal advice. Should you need legal advice regarding Your Personal Data, you should seek counsel from an attorney. | https://bombasklassen.portal.intelliquip.com/privacy_and_cookie_policy.html |
Learning via online environments has diffused from universities to high schools today with state education boards taking the lead in promoting online learning. As increasing numbers of high school students engage in learning via online means, facilitating learning communities by maintaining a strong sense of virtual presence becomes a significant factor in fostering student engagement with the subject material. The author has been involved in teaching a variety of undergraduate and graduate Computer Science courses online for 3 years and shares her experience in strengthening social presence and facilitating learning communities. Teacher presence results in creating and sustaining learning communities, which have been proven to be a powerful indicator of student satisfaction and engagement. Strong virtual presence of teachers in an online environment creates learning communities that fosters student engagement with course content.
Citation
Bhagyavati, B. (2005). Strong Teacher Presence Fosters Student Engagement with Online Learning. In C. Crawford, R. Carlsen, I. Gibson, K. McFerrin, J. Price, R. Weber & D. Willis (Eds.), Proceedings of SITE 2005--Society for Information Technology & Teacher Education International Conference (pp. 286-289). Phoenix, AZ, USA: Association for the Advancement of Computing in Education (AACE). Retrieved July 18, 2019 from https://www.learntechlib.org/primary/p/19001/. | http://www.learntechlib.org/primary/p/19001/ |
The invention discloses a ground disaster early warning method and system based on real-time data monitoring, and belongs to the technical field of ground disaster early warning, and the method comprises the steps: firstly collecting ground disaster data of a to-be-early-warned region, determining a ground disaster early warning region, and generating an early warning level of the ground disaster early warning region; then acquiring a real-time image of the ground disaster early warning area by using an unmanned aerial vehicle, and performing personnel identification according to the real-time image; and finally, carrying out real-time early warning according to the personnel identification result and the early warning level in the ground disaster early warning area. According to the method, data and images are combined, the defect that an existing early warning method only focuses on data monitoring but neglects image processing is overcome, and early warning of ground disasters and evacuation of detained people are more comprehensive and timely. | |
Financial Stability Review – April 2018 2. Household and Business Finances
Macro-financial risks emanating from the household sector remain, given the high level of household debt and strong growth of riskier lending in previous years. However, the build-up of risks has abated somewhat of late, in part reflecting the Australian Prudential Regulation Authority's (APRA's) prudential measures in the residential mortgage market. Continuing a trend that has been evident for some time, standards for new lending to households have improved further, with a lower share of new loans having riskier characteristics, such as interest-only (IO) terms and/or high loan-to-valuation ratios (LVRs). Nationally, housing market conditions have eased, with prices notably falling in Sydney.
Overall, most indicators suggest that the incidence of household financial stress is not widespread, although some households could be tested were unemployment to increase. Existing housing loans, including those written under earlier weaker standards, continue to perform well given good economic conditions in most of the country. In addition, borrowers coming to the expiry of an IO payment period face a sizeable increase in their scheduled payments if they transition to principal and interest (P&I) payments. While most of these borrowers appear well placed to handle this change, liaison with banks suggests a small minority will face difficulty affording the higher scheduled payments.
In apartment markets, the peak of the large pipeline of new additions in Melbourne and Brisbane looks to have passed, and to date has been absorbed without significant disruption.
Indeed vacancy rates are currently declining and falls in apartment prices have been modest in these cities. Settlement failures have been concentrated in lower-quality developments and there have been some reports of settlement delays, predominantly in Brisbane. Where settlement failure has occurred, developers appear to have largely been able to resell the apartment to another buyer, although some developers may be delaying selling apartments where there is weak demand. While the growth of the total housing stock does not appear excessive relative to overall population growth, ongoing strong growth of the apartment stock over the next year or so, especially in Brisbane, could yet weigh further on apartment market conditions there.
In non-residential commercial property markets, prices continue to increase strongly. This is particularly evident in the Sydney and Melbourne office property markets. Price growth has been underpinned by strong demand and some demolitions and conversions of existing office buildings to apartments, and it continues to exceed the rate of growth in rents, thereby further lowering yields. One risk is that, if global bond yields were to rise further, these low yields may not be sustainable as investors seek more attractive returns. In contrast to Sydney and Melbourne, conditions in the Perth and Brisbane office markets remain relatively weak.
In other parts of the business sector, conditions are generally favourable. Corporate profitability remains high and gearing low relative to the past. Business failure rates in the mining states have stabilised after increasing, as the drag from mining investment has eased. The retail sector's corporate insolvency rate also remains low, notwithstanding some recent high-profile failures amid a challenging competitive environment for some segments.
Household Sector
Household financial position
The ratio of total household debt to income has increased by almost 30 percentage points over the past five years to almost 190 per cent, after having been broadly unchanged for close to a decade (Graph 2.1). Australia's household debt-to-income ratio is high relative to many other advanced economies, including some that have also continued to see strong growth in household lending in the post-crisis period, such as Canada, New Zealand and Sweden. Household debt in these economies is notably higher than in those that were more affected by the financial crisis and experienced deleveraging, including Spain, the United Kingdom and the United States. While Australia's high level of household indebtedness increases the risk that some households might experience financial stress in the event of a negative shock, most indicators of aggregate household financial stress currently remain fairly low (notwithstanding some areas of concern, particularly in mining regions). In addition, total household mortgage debt repayments as a share of income have been broadly steady for several years (Graph 2.2).
As outlined below, regulatory measures and improvements in lending standards have contributed to a significant improvement in the risk profile of new lending over the past couple of years, and so stemmed the deterioration in the resilience of household balance sheets. However, the risk from the stock of existing loans remains. Overall, while rising a bit recently, non-performing housing loans remain a low share of the outstanding stock of loans, indicating that the overall quality of outstanding housing debt remains generally high (Graph 2.3). However, non-performing loans in states with more mining activity have increased, reflecting increases in unemployment and weak income growth in these regions. In other states, the non-performing share of housing loans has been steady, indicating the potential risks associated with the quality of earlier lending have not materialised to date. Household net wealth also continues to rise, although the rate of increase has slowed more recently given the moderation in housing price growth.
Debt servicing ratios have increased, in part because of loan switching from IO to amortising products in response to the prudential measures in 2017. To date, households have partly accommodated these increases in payments by lowering their voluntary prepayments of principal and have been aided by the low interest rate environment. Consistent with this, comprehensive survey measures continue to suggest that, in aggregate, the incidence of household stress is relatively low by recent historical standards. Data from the Household Income and Labour Dynamics in Australia (HILDA) survey indicate that in 2016 fewer than 5 per cent of households had required mortgage payments greater than 50 per cent of their disposable income, with the majority of these households in the lowest income quintile.
The HILDA survey and the 2015/16 Household Expenditure Survey also indicate that the share of households experiencing financial stress has been the lowest since at least the early 2000s (Graph 2.4). While the overall level of stress among mortgaged households remains relatively low, there are some pockets of financial stress. In particular, the incidence of household financial stress is noticeably higher in Western Australia than in other parts of the country, with the rate of personal administrations rising further over 2017 and applications for property possessions increasing over recent years. Indeed, while there has been a rise in non-performing personal credit, this does not appear indicative of a broader deterioration in household finances (see ‘Box B: Recent Trends in Personal Credit’).
Prepayments enable households to build a financial buffer to cushion mortgage rate rises or income falls. Aggregate mortgage prepayments – balances in offset accounts and redraw facilities – are around 18 per cent of outstanding loan balances, or over 2½ years of scheduled repayments at current interest rates (Graph 2.5, left panel). These aggregates, however, mask substantial variation; about one-third of mortgages have less than one month's prepayments (Graph 2.5, right panel). Of these, not all are vulnerable given some borrowers may accumulate savings outside of their mortgage, including those with fixed-rate mortgages (which restrict the ability to make prepayments) and investors (who have incentives not to pay down tax-deductible debt). Some borrowers with new mortgages are yet to accumulate prepayments and so would be vulnerable to income falls. Liaison with the banks suggests that there is a small share of borrowers who have not accumulated prepayments despite having had their loan for some time and may have little margin for unexpected increases in living expenses or income falls.
One area of potential concern is for borrowers at the end of their current IO period. Much of the large stock of IO loans are due to convert to P&I loans between 2018 and 2021, with loans with expiring IO periods estimated to average around $120 billion per year or, in total, around 30 per cent of the current stock of outstanding mortgage credit. The step-up in mortgage payments when the IO period ends can be in the range of 30 to 40 per cent, even after factoring in the typically lower interest rates charged on P&I loans.
However, a number of factors suggest that any resulting increase in financial stress should not be widespread. Most borrowers should be able to afford the step-up in mortgage repayments because many have accumulated substantial prepayments, and the serviceability assessments used to write IO loans incorporate a range of buffers, including those that factor in potential future interest rate increases and those that directly account for the step-up in payments at the end of the IO period. Moreover, these buffers have increased in recent years. In addition to raising the interest rate buffer, APRA tightened its loan serviceability standards for IO loans in late 2014, requiring banks to conduct serviceability assessments for new loans based on the required repayments over the residual P&I period of the loan that follows the IO period. Prior to this, some banks were conducting these assessments assuming P&I repayments were made over the entire life of the loan (including the IO period), which in the Australian Securities and Investments Commission's (ASIC's) view was not consistent with responsible lending requirements. As a result, eight lenders have agreed to provide remediation to borrowers that face financial stress as a direct result of past poor IO lending practices. However, to date, only a small number of borrowers have been identified as being eligible for such remediation action. Some borrowers have voluntarily switched to P&I repayments early to avoid the new higher interest rates on IO loans, and these borrowers appear well placed to handle the higher repayments.
Some IO borrowers may be able to delay or reduce the step-up in repayments. Depending on personal circumstances some may be eligible to extend the IO period on their existing loan or refinance into a new IO loan or a new P&I loan with a longer residual loan term. The share of borrowers who cannot afford higher P&I repayments and are not eligible to alleviate their situation by refinancing is thought to be small. In addition, borrowers who are in this situation as a result of past poor lending practices may be eligible for remediation from lenders. Most would be expected to have positive equity given substantial housing price growth in many parts of the country over recent years and hence would at least have the option to sell the property if they experienced financial stress from the increase in repayments. The most vulnerable borrowers would likely be owner-occupiers that still have a high LVR and who might find it more difficult to refinance or resolve their situation by selling the property.
Housing and mortgage markets
A key contributor to the abatement of new risks in mortgage and housing markets has been the regulatory measures to improve the quality of new lending. For several years, APRA has also taken a number of steps to improve lending standards by authorised deposit-taking institutions (ADIs), while ASIC has stepped up its monitoring and enforcement of lender compliance with responsible lending requirements. The types of lending that potentially posed the greatest risk to the macro-financial system have been specifically targeted since the end of 2014, including a 10 per cent benchmark for the growth of ADIs' investor lending and a 30 per cent cap on the flow of their new IO loans.
Collectively these measures have worked to moderate the risks that had been emerging in household mortgage debt. The share of approvals that were for new IO loans fell to around 16 per cent in the December quarter, the lowest share in over 10 years and well below both the 30 per cent benchmark and its peak of 44 per cent in late 2014 (Graph 2.6).
These measures have contributed to a significant moderation in new investor lending across all states (Graph 2.7). However, given the very sharp fall in new IO and investor lending, some banks have indicated that they have room to grow this type of lending and there have been some targeted reductions in interest rates for particular segments. Lending at high LVRs (greater than 90 per cent) also remains at low levels by recent standards.
Lenders have used interest rate differentials to alter the composition of their lending in order to comply with APRA's expectations, in combination with some tightening of LVR restrictions. At present, new IO investment loans are priced at an average premium of around 85 basis points above new owner-occupier P&I loans. According to bank liaison, lenders are competing strongly for owner-occupier P&I borrowers that also have low LVRs, which has been reflected in lower interest rates for this group. There has also been a pick-up in lending to first home buyers as demand from investors has eased. The slowing in investor credit was initially partly offset by rising owner-occupier credit growth, although more recently this too has also slowed.
The easing in housing market conditions reflects a number of factors. In addition to APRA's regulatory measures, earlier increases in interest rates for some types of loans, increased housing supply, and some reduction in demand from foreign buyers have contributed. However, a number of other factors have continued to support the market, including the ongoing low interest rate environment and population growth, particularly in Melbourne.
The easing has been most evident in Sydney, where housing prices have started to decline, although price growth has also slowed noticeably in Melbourne (Graph 2.8). In both cities, the decline in price growth has been more pronounced for detached houses and more expensive properties. This suggests that the regulatory measures, which have had more impact on investors (who tend to purchase apartments and less expensive properties), were not the only drivers of the slowing housing market conditions. In a further sign of easing conditions, auction clearance rates are well below their decade average in Sydney and have also been declining in Melbourne, although auction volumes remain high. In Brisbane, apartment prices have been relatively stable following price falls in 2016 and 2017. Falls in rental income remain a risk for investors, particularly in Perth and inner-city areas of Brisbane. The housing market in Perth remains weak. While the pace of price and rent declines has slowed, the vacancy rate remains elevated (Graph 2.9).
Commercial Property
Residential development
The potential risks posed by the large pipeline of apartment construction in Sydney and pockets of inner-city Melbourne and Brisbane have not materialised in a significant manner, at least to date (Graph 2.10). In Melbourne and Brisbane, the flow of new additions has peaked and, so far, been absorbed with little disruption to apartment markets, with vacancy rates steady or declining, rents steady or rising, and apartment prices generally only falling modestly (Graph 2.11). However, risks remain, with a substantial number of new apartments yet to be completed and some pockets of inner-city Brisbane already experiencing more pronounced price declines. The increased share of new housing that is high density, and has a longer planning and development phase, raises the risk of amplified housing cycles as increased supply may not be well timed to match changes in demand.
According to liaison with industry, valuations at settlement in some locations have been below the purchase price, in particular for some lower-quality apartments in Brisbane. There have also been reports of increased settlement failure rates and longer settlement times for these types of developments, due mainly to tighter financing conditions for foreign buyers. Stricter lending standards for borrowers relying on foreign income have led to some buyers experiencing difficulties raising funds domestically, while tightened Chinese capital controls have made it harder for the many buyers from that country to expatriate funds. Liaison suggests that developers have generally been able to find other buyers at broadly similar prices to those previously contracted, although it is possible that some developers are holding excess stock on their books and so have increased their exposure to losses if prices fall materially. In contrast, for higher-quality apartments, which tend to mostly be marketed to owner-occupiers and have better locations and amenities, buyer demand has remained strong and settlement valuations are generally around the purchase price.
Developers' access to bank finance remains tighter than a few years ago, particularly for projects in areas where a large volume of new supply has already recently come on line. However, liaison suggests that non-banks have increased their lending to this sector significantly, including for lower-quality projects. Nevertheless, building approvals for new projects in Brisbane remain low. In Perth, liaison suggests that demand for new dwellings has stabilised, although developer margins are very thin. Several small-to-medium-sized builders have filed for bankruptcy in Perth and Brisbane and one large commercial builder in Perth has ceased operations. Property market analysts anticipate more failures in coming months as competition among builders leads to lower margins, partly to keep their workforce continuously employed.
Other commercial property
Ongoing strong demand for commercial property has seen further falls in yields as growth in prices continues to outpace rents (Graph 2.12). To some extent the low yields reflect the low global interest rate environment. However, in liaison, banks have expressed concern over the particularly modest returns implied by some recent transaction prices (Graph 2.13). If these valuations are not sustained, say because of a further increase in global interest rates leading to a reallocation of investor portfolios away from commercial property, highly leveraged borrowers could be vulnerable to breaching their LVR covenants on bank debt, which could potentially trigger property sales and large price declines.
Conditions in commercial property markets differ significantly by state and property type. Investor demand remains strongest in the Sydney and Melbourne office markets, where limited net increased supply over recent years and robust tenant demand have driven vacancy rates to near historic lows. Industry liaison suggests that smaller firms are becoming more important for tenant demand in offices. The recent strength in the prices of office buildings has elicited a strong supply response from developers, particularly in inner-city Melbourne, where additions to the stock of office floor space are expected to increase strongly over the coming years. If these new additions were to be completed in a deteriorating market, they may precipitate price declines, particularly for existing, lower-quality stock. In Brisbane, Perth and Adelaide, elevated office vacancy rates and falling rents have seen tenants relocate into better quality space in the commercial business district (CBD). This continues to place pressure on second-grade and non-CBD markets, where the outlook remains weak (Graph 2.14).
Conditions in retail property markets continue to be subdued. Rents have been flat amid headwinds to retailers' margins that are associated with strong competition from online and new entrants. Banks have nevertheless continued to fund projects which increase the entertainment and hospitality services provided by existing shopping centres (to differentiate these retail offerings from online shopping) (Graph 2.15). At the same time, they view the outlook for some older and less well-located retail properties as weak due to lower tenant demand.
Australian-owned banks have tightened their lending criteria for commercial property following APRA's thematic review of the industry in 2016 and they have slowed the growth in their exposures (Graph 2.16). Notably, their responses included a mix of lowering maximum LVRs, raising minimum interest coverage ratios and capping the percentage of foreign presales in residential developments. Deal flow data show a reduction in average LVRs, particularly for residential development deals, over 2017. Australian-owned banks' commercial property exposures are little changed over the past two years while the exposures of foreign banks, especially those headquartered in Asia, have continued to grow (Graph 2.16).
Other Business Sectors
Businesses' finances generally remain in good shape, supported by the ongoing improvement in overall economic conditions and low interest rates. Aggregate earnings of listed corporations continued to rise across most industries over the second half of 2017. The gearing ratio of listed corporations remains below its historical average and a market-based measure of default risk indicates that listed companies remain in generally good financial health (Graph 2.17). The business sector is well placed to service its debt; businesses' debt-servicing ratios declined over the second half of 2017, supported by a pick-up in profits (Graph 2.18).
Conditions in the resources sector have continued to improve. Earnings of resource-related corporations increased further over the second half of 2017, supported by higher commodity prices, increased exports and ongoing cost reductions. Many listed resource-related corporations have used their rising profits to reduce debt further, with the gearing ratio of resource-related corporations continuing to decline. However, the earnings of mining services companies have maintained their downward trend reflecting the focus on cost reductions by resource producers. In the mining states, business failure rates have stabilised, as the drag from declining mining investment has eased.
Despite an overall improvement in business conditions, the discretionary retail sector (including clothing, apparel and footwear and department stores) is facing challenges. These businesses are experiencing strong competition from online and international retailers and liaison indicates that retailers are investing in technology to increase efficiency. Although there have been some recent high-profile failures, the retail sector's corporate insolvency rate remains low. | https://www.rba.gov.au/publications/fsr/2018/apr/household-business-finances.html |
Vigilance of new and emerging risks in the financial system is important.
Getty
High asset values, elevated levels of corporate and public debt, and loosening lending standards globally confront the Group of 20 (G20) finance ministers and central bank governors when they meet this week in Washington D.C. I applaud Financial Stability Board Chairman Randal Quarles for stating that loosening lending standards and high levels of public and corporate debt are vulnerabilities in the global financial system. This is true, not only in developed markets, but also in emerging ones as well.
Randal Quarles
FSB
I have been writing about and commenting to the press about these important topics for over five years. Unfortunately, my warnings, as well as even those of former Federal Reserve and FDIC officials and rating agencies, have been largely ignored by banks and non-banks. According to Moody’s Investors, in the U.S, and Canada, the quality of covenants hit a new record worst level the third quarter of 2018 even as loan volumes continue to grow. Since investors have been chasing yields for almost a decade, covenant protections have been weakening for many years with very few interruptions.
North American Loan Covenant Quality Indicator
Moody's Investors Services
Just last week, in a report entitled “Borrowers push investment capacity to the brink and telegraph their intention to use it,” Moody’s Investors covenant officers Enam Hoque, Derek Gluckman, and Evan Friedman, pointed out that “Borrowers have gained unprecedented flexibility to make investments via the accumulated credit in their builder baskets without satisfying any leverage requirements.”
Borrowers push investment capacity to the brink and telegraph their intention to use it.
Moody's Investors Services
In his letter to the G20, Quarles also mentioned that since it is remains unknown whether the U.K. will leave the European Union without an agreed upon withdrawal agreement, the possibility of a disruptive Brexit remains a distinct possibility. According to Quarles, “Authorities and firms have taken steps to address possible financial stability risks, though some disruption to cross-border services remains possible. A disruptive Brexit could represent an adverse macroeconomic shock, which could be accompanied by significant market volatility. The FSB is monitoring developments, and if necessary, will advise G20 Ministers and Governors on risks, should they crystallize.” I am pleased that Quarles highlighted concerns about Brexit's effects on the financial system. As I wrote last fall, there are so many interconnections between U.K., European, and U.S. banks do to interbank lending and derivatives transactions, I remain unconvinced that they are fully prepared for a Brexit where the U.K. does not have a formal withdrawal agreement.
Fortunately, Quarles also mentioned that while “the growth in non-bank financing represents a welcome increase in the diversity of the sources of finance supporting economic activity, provided that such financing is resilient, the FSB continues to monitor closely the developments and risks in non-bank financial intermediation.” In my view, not enough has been done in the U.S. or Europe to better regulate non-banks, which now account for almost half of financial assets globally. Partly, this is because they are very heterogeneous due to their different size, risk appetite, and long-term objectives. However, part of the challenge with non-banks has also been the lack of political will to regulate them. In some countries, financial stability committees lack all the necessary tools to monitor non-banks. And in the U.S., unfortunately, much has been done to gut the Financial Stability Oversight Council, which would have the power to better regulate non-banks. Better supervision of non-banks is critical, particularly as they are very opaque, especially in terms of their participation in leveraged lending and collateralized lending obligation (CLO) markets.
Additionally, the FSB will continue working on enhancing cybersecurity resilience, “supporting the Japanese G20 Presidency’s focus on financial innovation. Building on its 2017 stock take of regulatory and supervisory cyber security practices and its 2018 cyber lexicon, during 2019 and 2020 the FSB will develop and report on effective practices relating to a financial institution’s response to, and recovery from, a cyber incident.” For the June G20 meeting, the FSB plans to deliver a progress on the development of effective practices for cyber incident response and recovery.
Finalizing and operationalizing post-crisis reforms– the FSB will work with standard-setting bodies to complete the few remaining reform items. The FSB will continue to support full, timely and consistent implementation of the agreed post-crisis reforms. Work on addressing structural vulnerabilities from asset management activities will continue.
Evaluating the effects of the reforms– the FSB is currently examining the effects on the financing of small and medium-sized enterprises, and has just started to evaluate the effects of too-big-to-fail reforms in the banking sector. The FSB, is exploring issues around market fragmentation, supporting the Japanese G20 Presidency’s priority to address this topic.
Reinforcing outreach to stakeholders– the FSB remains committed to improve communication and transparency with other external stakeholders, to increase understanding of the FSB’s work and facilitate greater input from a wide array of stakeholders.
I strongly encourage the G20 to add the current weakening of post-crisis reforms to emerging vulnerabilities in the financial system. For example, in continental Europe, French Finance Minister, Bruno Le Maire recommended this weekend that capital requirements be lowered for large banks in order that they merge. Not only do mergers often result in hundreds, if not thousands of employees being laid off, asking for capital to be lowered this late in the cycle is dangerous to tax payers. In the U.S., yesterday's proposals to ease requirements for large banks' Comprehensive Capital Analysis Review (CCAR), stress tests, and submission of bank resolution plans (living wills) are particularly worrisome. It is important to understand that some of these requirements have not even been in effect fully for all banks in the U.S., and they are already being rolled back. In his letter to the G20, Quarles stated that the FSB has just started to evaluate the effects of too-big-to-fail reforms.Easing financial regulations this late in the credit cycle is dangerous, not only to investors, but especially to taxpayers. The FSB can only be an effective international financial stability systemic standard setter if it continually reminds regulators and financial institutions not to succumb to collective amnesia. | |
Surrounded by volcanoes and ancient lava flows, Chalbi Desert is the hottest and most arid region in Kenya. Though it is a harse and sparsely populated desert, its known for its stunning natural beauty. It has towering sand dunes and volcanic mountains. The Kalacha oasis is an assured watering point – several days’ walk from the closest suitable grazing areas, and camels, cattle, donkeys and goats gather here in mass. With its traditional caravan routes, the region is also home to Kenya’s last nomadic tribes, such as the Turkana, Samburu, Marakwet, Pokot, El Molo, and the Gabbra tribes. The Gabbra people of this area are a hardy race, and adaptation to a nomadic way of life ensures their survival. | https://www.enchantingtravels.com/destinations/africa/kenya/chalbi-desert/ |
We used to do ‘DPS community workshops’ fairly regularly but it’s been a while – so lets recap on what they are.
See some previous ones on the topics of photographing funerals, travel, cricket, Grandma in hospital and Fashion Shows.
Got the idea? OK – lets do one.
This workshop’s question comes from a reader by the name of Brent who asks:
“I’ve just been approached to photograph a regional gymnastics finals event – next week! I’ve taken shots of my daughter at gymnastics before but this time I’m THE official photographer for the whole event. The previous Pro that they had lined up got sick and had to withdraw so it’s all very last minute.
OK – it is no Olympics trial or anything – it’s just a regional event for kids – but I want to do my best and need some help. Do you have any advice?”
Brent tells me that he’ll be shooting with a Canon 5D (Mark II) and a 70-200mm f/2.8 IS lens as his primary lens (he has a few others that he’ll take but that’s what he’s planning on using primarily.
What would you advise Brent?
Having a been a gymnast and a coach, and having photographed gymnastics for the past 3-years I can tell you that while you'll get great results from the 5D, the enhanced speed of the 7D will allow more creativity and some better shots. Shoot and burst mode, however use the single shot focusing. This will allow you to catch some of the best shots. Depending on the location the white balance and ISO requirements will change based on the event your shooting and time of day, just be aware of that. I've found that keeping the aperature as wide open as possible (I typically shoot the 70-200 f2.8) with a shutter speed of around 1/500 or greater you can get some great shots. Your best bet is to do some post shoot corrections so you can shoot a little faster with a lower ISO.
Finally, don't just shoot the competition, shoot the warm-ups as well. This will 1) give you some practice and help finalize some of your settings, and 2) there are also some key shots here of the coaches and gymnast interactions and you can typically get some decent group shots....
DON'T SHOOT IN BURST MODE!!!! If you're on a 5D than you only have 3fps, which isn't enough to rely on getting the shot. Have your finger on the trigger and wait for the gymnast to hit his/her peak in flight or the one "wow" moment and snap the picture. I'm on a 7D and I still try to avoid the temptation of burst mode.
One thing no one seems to be mentioning is make sure you have enough memory cards. If you are shooting in burst mode, and are planning on every single gymnast, plus the odd side line moment, you are going to go through memory like crazy. It would be a shame to get 1/2 way through the event and find you have no space left. You may want 2 or 3 memory cards or more. This isn't something I have done but maybe someone who has can say how many you will likely need
As a former international gymnast I'd suggest a few things:
1. Work out who the top 5 contendars are in each event and watch them practice - they'll have at least one 'spectacular' signature move in each routine which they love. Talk to the goupies if you don't know each person's signture moves.
2. Shoot from below, eye level and from above - makes for interest
3. Go for the anguish in the eyes and face
4. Get in close - don't worry, the gymnasts are concentrating so hard, plus they love to show off - a photographer is like a great crowd - it makes them feel special
5. Most complex moves have 3 parts, a) the start, b) the guts of the move, and c) the end or landing. From the warmups work out what is the most spectacular bit
6. Most aerial moves have a point of stopping - you go up, stop, and then decend. That stopping or hanging point has less motion than the other two sections. Practice during the warmups.
7. Shoot lots of frames on the key moves - one will stand out
8. The equipment doesn't have to be in focus - so drop that aperture way down. (also give the impression of flying)
9. Remember, gymnastics is a team sport. Get the coach, the judges, the team camerarderie, that fanatical parent in the crowd etc
10. Take the great shots to the gymnast - I'd love to have copies of me in my old competing days. Your carrer is so short.
Knowing routines and positioning yourself is primary. I was intimately involved with the former USGF back in the 80's and 90's and was fortunate to know Dave Black, now a Nikon photographer. I sat with him on the main floor of some events where he had 2 or 3 cameras with him and all we'd do is sit and rotate to cover different events. "sit' is important because you don't want to distract the gymnast by standing up. Keep out of their line of sight. I shot then with a Nikon FM2 with a Soligor 135mm, f2.0 monster..., but I got great shots.
Getting to the event early and watching practice is very important too. And don't stand in front of a judge!!!
You've gotten some very good tips so far. In case no one mentioned it, I'd add this. Getting low and shooting up is great, it makes the subject seem larger in the frame and can be very dramatic. Don't however discount the idea of getting up and shooting down, especially with gymnastics. Both techniques can be used to remove distractions from the background. Take whatever gear you want, but find a way to not have to carry it. Get an assistant to carry the bag with all the equipment. Typically, several events are taking place at the same time and you must be able to move around (the competitors aren't the only ones getting a workout). Most of all, plan your locations and the path you will take to reach them carefully. Pick your spots so that you will not be a distraction. Gymnastics is a sport of extreme focus on the part of the athletes. You will know you've done your job well when you make great pictures and people on the floor hardly noticed you were there.
It's very interesting to hear all of the different opinions. 5d good, 5d bad . Zoom good,zoom bad
Whether you rent a different body or lens, shoot raw for the versatility to underexpose a bit. Set your focusing to continuous servo, use a monopod, and just make sure you have a high enough shutter speed that they aren't blurry.
Anticpate the shot and don't kill yourself on the back end by shooting in burst mode. And I totally agree that the key to sales will be promotions-
Iso 3200 will be your friend. Definitely shoot in manual exposure and set yourself a custom white balance or shoot in Kelvin mode
Sorry for the typing errors- I'm typing this from my phone
Very good tips so far. You already know the sport, that's very good. My little girl used to practice gymnastics too. I would add for this kind of event (kids thing) more context, parent's reaction, the kids expectation, some behind the scene takes you're know the photography boss, so you can do anything you dreamed to do before. Good luck and please try to show the results to us.
Visual references: Search the web for photos with the same subject of yours, analyze and guess the problems involved in doing them.
Know the area: If you can go to explore the place in advance, find the best spot.
Talk to the organizer: try to understand how the events work for an aid in planning your photoshooting
Universal to particular: try to choose more than one tematics for your's photos. I mean you have to answer to the questions: who, where, when and why.
Best wishes!
Fast indoor sports are miserable to shoot. First thing I check for is light because guess what not all parts are lit the same. I will concentrate the majority of the photos in the area where there is light.
You can also use Ev compensation https://digital-photography-school.com/ev-compensation-explained
If you shoot in M mode then you can just adjust the camera so that the exposures are darker to get the right shutter speed.
Also take photos of the teams and individuals getting ready and the landings. Landings are good because they usually have a big grin and most important for you are standing still Try and take the fast pictures with them coming at you speeds appear slower then if taken from the side. If you can get on the floor take a faster shorter lens if you have one. I would also guess that you were asked because they have seen some of your photos and liked them, so think about what people like about the photos that you've taken and take shots of their kids that are similar. Sometimes for parents a slightly blurry shot of their kid doing something spectacular is better then all the clear shots of them standing still. Good Luck and have a great time.
Regionals IS a huge deal and it is usually a great chance to get known by other gyms quickly!! Bring tons of business cards or small flyers and put them everywhere....if you have a large screen you can play some of your images throughout the day to generate some excitement .... put your website info on the monitor....
Go to a local gymnastic club and ask to practice shooting during one of their practices - look for the higher levels 9/10 and you will get mostly action to practice... each state has a listing of clubs under USAG
You can't use ANY flash at a gymnastic meet it is too dangerous and not allowed.....the lighting usually stinks. Get a copy of the rotation sheets so you will be able to assign a number to each gymnast and keep each team seperate for your workflow after the meet.... they all look very similar when you are going through them afterward.
It is hard to do a gymnastics meet by yourself - there are 4 events going on at the same time ... if you can get someone to help you then you only need to focus on 2 events .....
If you can't find help ....then only shoot floor and beam ...for floor ... a monopod will come in VERY handy at this type of venue.....you can shoot right on the floor using it as a tripod ...get as close as you can to the action and fill the frame with action and poses.... for beam..... it is dramatic to shoot from one end but you will have more shots from the side...
watch the warm-ups and shoot those as well as awards at the end....
people will only buy shots that have FACES in them unless you catch a unique pose
Have fun and good luck!
Hi, I got here following the link provided by Gogle Alerts ... nice!
I have to buy a new camera , so this article goes to my favorites and I will find the time to read !!
I'm a great fan of gymnastics, with both photo and camcorder
Always want to improve the results , so I will check back here !
My advice on event photography >> also make some pictures "off the court " , so not only shoot the routines on the apparatus , but also participants away from the podium.
If there is not to much light in the hall, better a bit dark picture then less shutter time
Try and zoom in as far as you can, putting your camera on a tripod.
Thanks DPS for this item on gymnastics
with all of the above tips in mind, shoot in RAW, it will allow for slight under exposure if necessary, since you don't want to go slower than 1/500th. Later on you can lighten up the images and use some noise reduction program.
Good luck!
Hello, I am the autor of this image.
First sorry for my bag english, I will try to write an understandable message ;)
Gymnastics is a very hard sport : indoor, no light, very fast, and often much people or things around the subject.
These are my first impressions :
- Canon 5d ? I really don't like it's autofocus for sport. I prefer the 20D (used for this photo), or a 1D / 7D
- High ISO ? well OK in general, but this picture was taken at 400ISO.
- 70-200 : OK this lens is very good for sport, but be careful : the Sigma version has a very slower AF than the Canon version ! For my part, I use and love my 135mm for indoor sport and I often use it at f/2
- An important (perhaps the most important) point is that a good sport picture is "clear" : only a subject and the apparatus. No other parasite. And that's certainely the most difficult.
As Jeff Wilson says, the 85mm f/1.8 is a great lense for indoor sport.
When I shoot handball, I only use this one on my 450d.
http://www.flickr.com/photos/alienlebarge/tags/handball/
If noone else has said it:
Spend some time watching gymnastics (assuming you havn't - given your kids do it, chances are you have). KNOW the sport. I'd be useless photographing american football (or even normal football - oops "soccer"), as I've never really watched or played them - but Rugby or Rugby League, Basketball or Badminton - no problems. I know where the flow of the game is likely to go :)
Other than that: fast glass, get close, crop later. 5D has mucho megapixels, so you should be able to crop later to keep the f-stop wide open.
See if you can go to a few practices beforehand to learn the routines. I've found that knowing when the gymnast is in the most photogenic poses is better than leaning on the shutter and relying on burst mode. Also, you'll know where to stand for the best angles. In addition, get as close as is allowed so the background is as blurred as possible. This way the gymnasts will pop--makes a huge difference.
Rent the fastest prime lenses you can get. I shot an event last weekend with the 70-200 f/2.8 IS. I had to use ISO 2500 to get 1/100th. I really needed closer to 1/300th to get the action stopped. My 50 f/1.4 worked well, but wasn't long enough.
You cannot use a flash (can blind someone doing a flip and cause injury), so go for aperture and ISO until you get your shutter into a place where you can stop motion (if that is the desired outcome). I often find the motion blur to be interesting for some shots.
I had two similar situations recently. Fortunately, both were outside. The first was a children's (9-10 YO) soccer game and the second was the Blue Angels flying over San Francisco Bay. I have a Nikon D70 with a 18mm-70mm lens. I just set the camera to continuous (burst) and shot away. The soccer game was mostly short bursts, but the Blue Angels was a much longer burst. Many of the shots you won't want to use but you will get some spectacular action shots. I got one of the Blue Angels flying in formation right overhead and it is so clear you can read the inscription on the bottom of their wings. Adjust the camera for the correct exposure first and shoot away. Good luck.
I realize he said he's shooting with a 5Dmk2, but how about renting a 7D? The 7D would give him 8 frames/sec and give him more reach -- equivalent of 320mm -- with the 7D's smaller sensor.
If this is in the US and a USAG sactioned event, then I am assuming you have a USAG pass to get on the floor (requires safety course). If not, then the 70-200 IS is definitely needed. Hopefully the venue is not a black hole. Having shot many gymnastics meets, the venues generally are poorly lit - and you are not allowed to use a flash. If you are allowed on the floor, a 24-70/f2.8 would be my choice.
Shoot in full manual. You need to know what the kids are doing, that way you will know when they will be at a slow/stop point so that you can use a slower shutter speed. Shoot in JPEG - make sure you do white balance, otherwise shoot in RAW and take care of that in post (Small or med RAW if largest pic is 8x10).
In my experience, the 5DmkII is a poor sports camera - the AF is slow, inaccurate and poor in low light compared with the 7D, 1D series, or even the 40/50D. Borrow a different body if you can.
Are they expecting you got cover all pieces of equipment or one piece and every kid?
Good luck!
By Official photographer, do you mean that you have been retained by the event coordinator to capture promotional shots?
Or are you taking on the task of trying to capture images of every gymnast that competes in the event in the hopes of selling them online post event, or onsite printing?
I'm going to assume it's the latter, If it is, and you are the only shooter, concentrate on one event. As one shooter trying to capture images of all of the athletes, you can only do it effectively for one event. You can get a few grab shots here and there between competitors of other areas but each shooter should concentrate on one.
Again if you are the only shooter, choose beam or floor, they will offer the highest ratios and most ops.
The 70-200 is the lens to use, unless you have an 85 1.4 which is great for beam.
It's very tiring, I shoot handheld the whole time but bring a monopod for when I start to get too tired.
Keep the camera up after the event, athletes are on their way to a high-five or hug, if you are doing the event for speculative sales, these are good sellers.
High ISO, stop motion with noise is better than motion blur in gymnastics
Stay on single shot, especially with the 5D, but even with a faster camera, good timing will get a better shot than burst mode, and even when burst mode gets the great shot your left with a bunch that are not great. Which is OK for scenario one above, but not scenario two where you'll need to cull through these and get them on the web fast.
I will end with one more very important tip for a speculative sales event, (speculative sales meaning you are doing the event for no upfront cost, and pinning your hopes on making sales), Promotion is huge, getting everyone in attendace to know that you are there is the goal. Anouncements and flyers.
If you are uploading for online sales, shoot jpeg medium fine or whatever the 5DmkII has in the 6 or 7mp range because having them online fast, like next day is very important. Space isn't the issue, upload speed is. SmugMug is the best online sales fulfilment solution for this type of photography business. My email address will save you $5
Sorry for the long winded response.
Gymnastics is tough, partially because of the fast motion involved in many of the events and partially because so many gymnastics venues are poorly lit -- the lighting is generally far worse than for other indoor sports, such as volleyball or basketball.
Shoot in manual mode, use ISO 3200 (you'll need to apply some noise reduction to your shots) and open the aperture all the way. You'll need a shutter speed of at least 1/500 to effectively stop action. The 70/200 f/2.8L is a great lens, but it might just not be fast enough, depending upon the light available at the venue. If you can borrow/rent a 135mm f/2L and/or an 85mm f/1.8 it would help. If you start getting motion blur because you can't get a faster shutter speed, look for chances to shoot as the gymnasts hesitate and pause in their maneuvers.
Get as close as you can to the action, fill the frame, and watch for distracting backgrounds. You can get good results both from the floor looking up, or from above looking down. Again, see what's available at your venue. Choose angles that show faces.
Good luck!
You've got the right gear. A fast lens, and a camera capable of clean ISO.
Crank up the ISO as high as you can. You'll want a fast shutter speed to capture the action.
Above all, watch your white balance. Take a couple test shots, experiment with the white balance settings until you see something that looks like what your eye sees.
Pick a place where you can shoot all the events comfortably. If you're allowed floor access that's be great.
Most likely you won't be allowed to use any speedlights/strobes so it's fluorescent lighting against you.
If you have any faster glass, you may to bring them as well, although the 70-200 will serve you will.
First and foremost, no flash. As a former gymnastics parent and meet staffer, I can tell you that flashes are forbidden (I suspect you know that, but our fellow readers may not) by USA Gymnastics. I have had to ask parents to leave a meet because flash photography can be a distraction (and safety hazard) to the athlete.
Most meet photographers tend to photograph only the bars or beam because it will let them stay in one spot. If you are photographing the lower levels where all routines are compulsory, then you will know consistently what elements will be best and what precedes it. The same thing can apply to floor routines.
I strongly recommend working with the clients (anyone you are giving images to should be considered a client) to create a list of "must-have" shots. Having created that list I would help the clients to realize your experience level and the fact that even with such a list, due to the dynamic nature of sports, no shot is guaranteed.
Just like the picture in the post. Find the angles that not everyone will see when they're sitting in the stands. | https://digital-photography-school.com/how-do-i-photograph-a-gymnastics-event-dps-community-workshop/ |
Old Saigon has been remarkably well-preserved in today’s Ho Chi Minh City, and there is a resurgence of nostalgia for the (colonial) past that means more of the city’s French architecture is slated to be restored. If you block out the ubiquitous drone of the motorbikes, and look past the equally ubiquitous visage of Ho Chi Minh, the heart of Ho Chi Minh City – Old Saigon itself -makes for a delightful wander. Here are five essentials:
✑ A promenade down Rue Catinat, ancien Champs Elysées of Saigon, and the backdrop of many a memorable scene from the Vietnam War. This street has the city’s most important monuments, including the former Opera House, the Notre-Dame Cathedral, and the City Hall.
✑ Rue Catinat and its environs also plays host to all the city’s famous grand hotels. Stop for a cup of tea at the outdoor terrasse of Hotel Continental, to pay homage to Somerset Maugham, circa 1929. Head to the rooftop bar at Hotel Majestic for an aperitif to pay homage to Graham Greene, circa 1950 and to take in the spectacular views of the Saigon River.
✑ Pay a visit to the Ho Chi Minh City Museum, to soak in the delicious period atmosphere of the building – this was the former residence of the Governor of Cochinchina. The exhibitions and displays themselves are rather more propagandistic in nature, but also make for an educational experience.
✑ Have a meal at Quan An Ngon, a chain of Vietnamese street food restaurants that occupy French colonial buildings. These are immensely popular with the locals and the local fare served there, though pricey by local standards, is delicious.
✑ Visit Cholon – Saigon’s Chinatown, to luxuriate in the sensuous atmosphere described in Marguerite Duras’ novel, The Lover.
Old Saigon typifies the “ROMANCE” in Romance of the Grand Tour, particularly in the early mornings and late evenings, when the streets are devoid of those pesky motorbikes, and one is transported back a hundred years to L’Indochine Française. | https://romanceofthegrandtour.com/2015/09/05/5-essential-sights-for-the-grand-tourists-itinerary-old-saigon/ |
BACKGROUND OF THE INVENTION
This invention relates to corrosion of metals. More in particular the invention concerns the reduction of corrosion of metal members in systems containing both metallic and nonmetallic components.
Most metals, and especially those containing major amounts of iron, are known to corrode, or rust, when exposed to salt water or other environments capable of conducting an electric current and an electric potential. To retard corrosion of metals, various coatings and anodic or cathodic protection techniques have been developed. Such techniques are exemplified in U.S. Pat. Nos. 3,313,721 and 3,477,930; Morgan, Cathodic Protection 253-265 (1959); and Fontana et al., Corrosion Engineering 205- 214 (1967).
In certain equipment an electrically conductive liquid solution, i.e. an electrolyte, flows from electrically charged members through nonmetallic conduits and directly into, and through, metallic conduits attached to the nonmetallic conduit. The electrolyte can flow from the metallic conduit to a suitable receiving container for storage or disposal. Oftentimes stray electric current will flow through the electrolyte and cause the metallic conduit to corrode even though this conduit is not in physical contact with the electrically charged member. Corrosion of the metal portion of this system has previously been reduced by inserting a graphite electrode through the nonmetallic conduit, and into the electrolyte, and connecting this electrode to a ground. A portion of the stray current flowing through the electrolyte was removed, and corrosion of the metallic conduit reduced, by means of such an electrode, but corrosion resulting from stray electric current in such an electrode protected system is still excessive.
An apparatus and method is desired to minimize corrosion of metallic conduits in a system including a source of stray electric current, a nonmetallic conduit and an electrolyte.
SUMMARY OF THE INVENTION
It has been found that corrosion of a metal conduit in an aqueous electrolyte conduit system, which includes a nonmetallic conduit physically attached to the metal conduit, can be reduced. Such reduction in corrosion is achieved by impressing a predetermined electric potential (volts) between an electrode positioned at least partially within the nonmetallic conduit and a ground. The electric potential is at least about the difference between the electrochemical reaction potentials (volts), at the reaction temperature, of the reactions occurring at the electrode and at the metal conduit.
The present invention includes a system to reduce the corrosion of a metal conduit through which an aqueous electrolyte flows. The system comprises, in combination, a source of stray electric current with a conduit, having at least a nonmetallic inner surface, attached thereto. A metal conduit is attached to the nonmetallic conduit. The nonmetallic and metal conduits are adapted to contain the electrolyte as such electrolyte flows to, or from, the stray electric current source, such as an electrolytic cell, from a suitable feedstock container or to predetermined location for disposal. To remove stray electric current flowing through the electrolyte from, for example, the electrolytic cell, an electrode with a higher oxidation potential than the metal conduit is suitably attached to the nonmetallic conduit to be in electrical contact with the electrolyte within such conduit. A means to impress an electric potential between the electrode and an electrical ground is in combination with the electrode. Such potential impressing means is of sufficient size to provide an electric potential at least equal to about the difference between the electrochemical reaction potentials (volts), at the reaction temperature, of the reactions occuring at the electrode and at the metal conduit.
Removing stray electric current from the conduit system in the herein described manner reduces the corrosion rate of the metal conduit whether the exterior surface of the metal is buried in the earth, submerged in water or entirely exposed to air. Thus, the possibility of the metal conduit, such as a pipe, corroding sufficiently from stray electrical current to permit undesired leakage of the electrolyte is minimized.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
In one embodiment, a nonmetallic, electric nonconductive pipe is attached to an electrolytic cell for producing gaseous chlorine from an aqueous solution of sodium chloride. Suitable nonmetallic materials for the pipe are, for example, polytetrafluoroethylene, polyethylene, vinyl esters, acrylonitrile-butadiene-styrene copolymers and the like. The nonmetallic pipe is physically, axially, attached to a metal pipe, generally an iron alloy containing at least 50 weight percent iron, by well-known means to permit the sodium chloride solution, or brine, to flow through both the nonmetallic and iron pipes. The nonmetallic pipe is affixed directly to the electrolytic cell to electrically insulate the cell from metal bodies in close proximity thereto. Such insulation is, however, not completely effective in preventing stray electric current from flowing from the cell through the electrolyte and to metal bodies, such as the iron pipe. Stray electric current from the cell hastens the corrosion, or rusting of, for example, iron in the metal pipe.
An electrode is inserted through a wall portion of the nonmetallic pipe, at a location spaced apart from the metal pipe, and attached to such pipe by well-known means, such as bolting. At least a portion of the electrode is in physical contact with the sodium chloride solution passing through the pipe. When the electrode is electrically connected to an electrical ground, a portion of the stray current flowing from the cell through the sodium chloride solution will pass through the electrode and to the ground. However, the iron pipe will still corrode, since the remaining portion of the stray current will continue flowing through the nonmetallic pipe and will enter the iron pipe.
When the electrolyte is a solution of sodium chloride and water, the reaction occurring at the electrode positioned in the nonmetallic pipe, when an electric potential is applied thereto, is:
2Cl.sup.- = Cl.sub.2 (gas) + 2 electrons (e)
The electrochemical reaction potential for this reaction at 25. degree. C is about (-) 1.3 volts (V). An electrochemical reaction potential of about 0.4 V results when the reaction at the metal pipe is:
Fe → Fe.sup.++ + 2e
To remove substantially all of the stray electric current from the nonmetallic pipe before such current reaches an iron pipe in physical contact with an aqueous sodium chloride solution, a direct current "bias" of at least 1.7 V, i.e. the difference between 1.3 V and - 0.4 V, is applied to the electrode. The use of such a bias minimizes and preferably substantially eliminates corrosion of the iron pipe caused by stray electrical current. A bias within the range of from about 0.9 V to about 2.0 V will reduce corrosion of the iron exposed to the sodium chloride solution.
The specific bias applied to the electrode depends upon the compositions of the electrolyte and the metal pipe and the reactions which occur at the electrode and metal pipe. For example, following are representative of anode reactions occurring when various salts are dissolved in the electrolyte.
______________________________________
Approximate Poten-
Salt Reaction tial at 25° C (volts)
______________________________________
Na.sub.2 SO.sub.4
2H.sub.2 O→O.sub.2 + 4H.sup.+ + 4e
-0.8
Na.sub.2 Br
2Br.sup.- →Br.sub.2 +2e
-1.1
NaI 2I.sup.- →I.sub.2 + 2e
-0.5
______________________________________
An electric bias about equal to the difference between the potentials of the reactions occurring at the electrode and at the metal pipe is preferred.
Electrodes suitable for use in the present invention include, for example, graphite, titanium and platinum. Titanium electrodes can be coated with an electrode activating layer of ruthenium and titanium oxide or cobalt oxide.
The following examples will further illustrate the invention.
EXAMPLE 1
An aqueous sodium chloride solution containing a minor amount of impurities was passed to an electrolytic cell through a corrodable iron alloy pipe and thereafter through a substantially nonconductive, corrosion resistant organic plastic pipe. Electric current leakage of 0. 57 amperes from the cell through the solution in the pipe caused undesirable corrosion of the iron pipe. A corrosion resistant metal electrode with a greater oxidation potential than iron was inserted into the plastic pipe at a position spaced apart from both the iron pipe and the electrolytic cell. This electrode was suitably electrically attached to an electrical ground. A potential difference of -4.4 volts between the electrode and the ground was measured with a voltmeter.
Attachment of the grounded electrode to the plastic pipe resulted in removal of about 0.4 amperes of current, but did not eliminate corrosion of the iron pipe. At the approximate temperature at which the solution flows through the pipes (about 25° C), the electrochemical reaction potentials occurring at the electrode and iron pipe are about (-) 1.3 volts and 0.4 volts, respectively. When a potential of 1.7 volts was impressed between the electrode and the ground by means of a rectifier about 0.57 amperes, or substantially all, of the current leakage from the electrolytic cell was removed from the system. Corrosion of the iron pipe was minimized when such impressed potential was applied to the system.
EXAMPLE 2
Substantially as in Example 1, a potential of 2.0 volts was impressed between the electrode and the ground. About 0.58 amperes was removed from the system to satisfactorily reduce and minimize corrosion of the iron pipe.
EXAMPLE 3
Substantially as in Example 1, a potential of 1.5 volts was impressed between the electrode and the ground. About 0.54 amperes of the current leakage from the electrolytic cell was removed from the system. Corrosion of the metal pipe, through which the aqueous solution was passing, was reduced. | |
How do those words taste now, Dr. Evans?
August 5, 2014 | By: Joaquin Fernandez
Eleven years ago, Dennis L. Evans, Ed.D., then the director of doctoral programs in education leadership at the University of California, Irvine, wrote these words:
The isolation implicit in home teaching is anathema to socialization and citizenship. It is a rejection of community and makes the homeschooler the captive of the orthodoxies of the parents.
Dr. Evans’ argument was built mostly on teacher competence and the need for diversity and group dynamics. His theory was that home education doesn’t work because it cannot produce a socially-adept citizen who can think for him or herself. After all, Dr. Evans, was a member of the Board of Institutional Reviewers for the California Commission on Teacher Credentialing.
But what’s of special interest to me about this is the opening sentence of the USA Today article cited above. He writes, “The popularity of home schooling, while not significant in terms of the number of children involved, is attracting growing attention from the media, which create the impression that a ‘movement’ is underway.”
Well, homeschooling is not proving to be a flash in the pan, some sensational weird fringe thing to report on for the sake of ratings. There is indeed a movement underway. The National Home Education Research Institute has a wealth of research and resources that completely disprove Dr. Evans’ and the rest of the educational establishments’ rhetoric against parent-led education.
According to Brian Ray, Ph.D., director of NHERI, studies show quite the opposite of Dr, Evans’ predictions. He sites Professor Richard Medlin, writing in the Peabody Journal of Education, who reported the following:
This research paints a very favorable picture of homeschooled children. Compared to children attending conventional schools, they apparently have higher quality relationships both with close friends and with parents and other adults. They are happy, optimistic, satisfied with their lives, and have a positive attitude about themselves and about being homeschooled. As adolescents, they show a strong sense of social responsibility. They experience less stress and emotional turmoil and exhibit fewer problem behaviors than their peers.
Professor Medlin concludes:
Are homeschooled children acquiring the “skills, behavior patterns, values, and motivations” they need to function competently as members of society…? And the answer to that question, based on three decades of research on homeschooling, is clearly yes. Recent research, like that reviewed earlier…, gives every indication that the socialization experiences homeschooled children receive are more than adequate. In fact, some indicators-quality of friendships during childhood, infrequency of behavior problems during adolescence, openness to new experiences in college, civic involvement in adulthood-suggest that the kind of socialization experiences homeschooled children receive may be more advantageous than those of children who attend conventional schools.
Dr. Evans was wrong. The enemies of homeschooling are wrong. The enemies of God’s educational prescriptions will always be wrong. Parents are not only capable of educating their own children, they are divinely ordained and empowered by the Holy Spirit to do so.
Dr. Evans closed his article with these words: “Those contemplating home teaching might heed the words of the Roman educator, Quintilian (A.D. 95). In opposing home schooling, he wrote, “It is one thing to shun schools entirely, another to choose from them.” God-fearing Christians of the time did not heed Quintillian’s words, nor should we. We ought, rather, to heed the words of his contemporary and fellow Roman citizen, Paul the Apostle:
And you, fathers, do not provoke your children to wrath, but bring them up in the training and admonition of the Lord. (Ephesians 6:4)
Now those are words worth ingesting. | http://indoctrinationmovie.com/how-do-those-words-taste-now-dr-evans/ |
Breast Cancer has a massive impact on a woman’s physical, psychological, social-cultural economical well-being. This extends to their families and in some cases, to entire communities. Continuous research and development of materials and technologies include wearable technology, artificial intelligence, 3D scanning and 3D printing solutions forthe purpose of realizing external customized breast prosthesesthat provide comfort, functionality and their personal lifestyle. | https://clubofamsterdam.com/2020/10/12/wearable-technology-for-breast-cancer-patients/ |
Mario Cucinella is the founder of Mario Cucinella Architects. With more of 20 years of professional practice, MCA developed a great experience in sustainable practices ranging from individual residences to urban master plans. In 2017 the American Institute of Architects (AIA) confers Mario Cucinella the Honorary Fellowship Award. In 2016 the Royal Institute of British Architects (RIBA) bestowed upon him their prestigious International Fellowship (2016). Mario Cucinella is the curator of the Italian Pavilion at 2018 Venice Biennale.
In 2012, he founded Building Green Futures (BGF), a non-profit organization that promotes sustainable development through green architecture and urban regeneration.
In 2015, Cucinella founded SOS – the School of Sustainability – a multi-disciplinary post-graduate program in Bologna. SOS serves as a nexus for the exchange of knowledge for the building industry, the community and the profession. | https://www.floornature.com/nextlandmark/jury/mario-cucinella-14140/ |
I have written in the past about the need for change in an organisation being driven by strategic change outside. A recent article in the Harvard Business Review on Transient Advantage by Rita Gunther McGrath (one of my favourite management authors) shows that there are internal drivers for change which are just as powerful. This is particularly relevant for Fast Growing businesses.
McGrath identifies 5 stages of growth and decline that an entrepreneurial business goes through to seek and exploit a competitive advantage. She argues that a sustainable advantage (one that once secured is there for ever) is a fallacy and that competitive advantage comes and goes as markets and technology change. To continue to be successful a business should cycle through a number of competitive advantages by repeating her stages of growth and decline.
This entry was posted in Book Review, Change Capacity, Change Function, Change Management, Leadership, Portfolio Management, Strategy and tagged competitive advantage, fast growth, Fire Brigade, Harvard Business Review, portfolio management, Rita Gunther McGrath, strategy on 9th September 2013 by Robert Cole. | https://c4cm.co.uk/blog/?tag=fast-growth |
Rowe, Neil C.
Second Reader
Fulp, John D.
MetadataShow full item record
Abstract
A honeypot is a non-production system, design to interact with cyber-attackers to collect intelligence on attack techniques and behaviors. While the security community is reaping fruits of this collection tool, the hacker community is increasingly aware of this technology. In response, they develop anti-honeypot technology to detect and avoid honeypots. Prior to the discovery of newer intelligence collection tools, we need to maintain the relevancy of honeypot. Since the development of anti-honeypot technology indicates the deterrent effect of honeypot, we can capitalize on this deterrent effect to develop fake honeypot. Fake honeypot is real production system with deterring characteristics of honeypot that induces the avoidance behavior of cyber-attackers. Fake honeypots will provide operators with workable production systems under obfuscation of deterring honeypot when deployed in hostile information environment. Deployed in a midst of real honeynets, it will confuse and delay cyber-attackers. To understand the effects of honeypot on cyber-attackers to design fake honeypot, we exposed a tightly secured, self-contained virtual honeypot to the Internet over a period of 28 days. We conclude that it is able to withstand the duration of exposure without compromise. The metrics pertaining to the size of last packet suggested departure of cyber-attackers during reconnaissance.
Collections
Related items
Showing items related by title, author, creator and subject.
-
Defending Cyberspace with Fake Honeypots Rowe, Neil C.; Custy, E. John; Duong, Binh T. (Monterey, California. Naval Postgraduate School, 2007);Honeypots are computer systems designed for no purpose other than recording attacks on them. Cyber-attackers avoid them since honeypots jeopardize the secrecy of attack methods and it is hard to launch attacks from them. ...
-
Fake Honeypots: A Defensive Tactic for Cyberspace Rowe, Neil C.; Duong, Binh T.; Custy, E. John (Monterey, California. Naval Postgraduate School, 2006-06);Cyber-attackers are becoming more aware of honeypots. They generally want to avoid honeypots since it is hard to spread attacks from them, attacks are thoroughly monitored on them, and some honeypots contain planted false ...
-
Deception using an SSH honeypot McCaughey, Ryan J. (Monterey, California: Naval Postgraduate School, 2017-09);The number of devices vulnerable to unauthorized cyber access has been increasing at an alarming rate. A honeypot can deceive attackers trying to gain unauthorized access to a system; studying their interactions with ... | https://calhoun.nps.edu/handle/10945/2468 |
A collection of databases that are available for students and teachers to use.
If on-campus you won't need to sign in.
If off-campus, click on the link below to get the passwords for all of the databases.
NCW Library Databases
Search a wide array of resources including encyclopedias, newspapers, and databases for your school projects
You will need a library card in order to access these resources
Click on the link below to access all of the resources available through NCW Libraries
Check out the video to learn some new tricks on how to research on Google
Learn about how search engines work?
Plagiarism
What is plagiarism?
Merriam-Webster Dictionary states plagiarism means:
"To steal and pass off (the ideas or words of another) as one's own: to use (another's production) without crediting the source"
Click on the link below to learn about the different types of plagiarism: | https://www.wahluke.net/o/whs/page/research |
The present invention relates to new compositions for the treatment of psoriasis which are applied to the skin containing 10- substituted 1,8- dihydroxy-9-anthrone and to a process for the treatment of psoriasis. Preferred 10-substituted 1,8-dihydroxy-9-anthrones are the diacid in which the 10-substituent is of the formula --CH(COOH)--CH.sub. 2 --COOH, the methyl and the ethyl esters and the anhydride thereof.
Psoriasis is a particularly frequent dermatosis which may affect 2 to 3% of the population and represents 4 to 5% of the dematological conditions at this time.
Psoriasis manifests itself by the presence of erythematosquamous plaques which are rather limited. Histological examination shows a considerable thickening of the epidermis with focuses of polynuclear microabcesses which produce a pustular dermatosis.
Generally, the lesions produced by psoriasis are found in joints, on the posterior surface of the forearms, the knees, the legs, and in the sacro- lumbar regions. Psoriasis also manifests itself on hairy skin and the nails.
Treatment of psoriasis is particularly difficult in view of the different forms which it may take. It may consist of local or systemic treatment. In the case of local treatment, it is necessary to produce a cleansing of the squamous lesions followed by treatment of the erythematous plaques by local corticotherapy or by classic reduction, such as with ichtyol, tar, chrysarobin and its derivatives, or cade oil.
Systemic treatments are rather numerous and one can cite particularly vitamin therapy, especially the use of vitamin A, placental extracts, liver factors, sedatives, and synthetic antihistamines.
Among the treatments recently proposed are the utilization by topical route or by injection of a combination of cycloheximide or a derivative of cycloheximide with an anti-inflammatory glucocorticoid steroid.
Although these various treatments permit in certain cases an initial remission of symptoms, each of these treatments presents certain inconveniences, for instance a temporary and incomplete attenuation of the symptoms, a rapid reappearance of the psoriasis when the attenuation has ended, a serious alteration and sometimes an atrophy resulting from the topical application of glucocorticoids for prolonged periods.
According to the invention, one considers psoriasis attenuated when a psoriatic lesion is significantly reduced in thickness or notably but not completely removed or totally removed.
It has been noted, that by use of the present invention, psoriasis could be attenuated by treating the affected regions with the aid of a composition containing in an appropriate vehicle for topical application at least one compound of the formula ##STR3## wherein R is a radical of the group represented by ##STR4## wherein R.sub.1 and R'.sub. 1 are identical or different and represent H, methyl or ethyl or one of the isomers thereof.
Among the compounds of formula (I), which may be used in the compositions according to the invention for the treatment of psoriasis, are:
10-(1,8-dihydroxy-9-anthron)ylsuccinic anhydride,
10-(1,8-dihydroxy-9-anthron)ylsuccinic acid,
10-(1,8-dihydroxy-9-anthron)ylsuccinic acid dimethyl ester,
10-(1,8-dihydroxy-9-anthron)succinic acid diethyl ester,
methyl 3-carboxy-3 10-(1,8-dihydroxy-9-anthron)yl!propionate, and
ethyl 3-carboxy-3- 10-(1,8-dihydroxy-9-anthron)yl!propionate.
Topical application according to the invention can employ utilization of an active compound incorporated in a base or a pharmaceutical vehicle convenient for application on the place of the lesion so that a local effect can be produced. These compositions for topical administration can be, for example, solutions, lotions, suspensions, pastes, ointments, gels, aerosol compositions, etc.
The term ointment covers formulations, such as creams containing absorbable oil bases of the water soluble type or of the emulsion type, for example petrolatum, lanolin, polyethylene glycols, as well as mixtures thereof.
These ointments can be prepared by dispersion of the active principle in convenient bases such as petrolatum, lanolin, polyethylene glycols, and their mixtures. It is preferable that the active compound be finely divided by means of a colloid mill using for example light liquid petrolatum as levigating agent before dispersion in the ointment base. Creams which are of the oil-in- water or water-in-oil type are prepared by dispersing the active compound in the oily phase before preparing an emulsion of that phase with the aqueous phase.
The compositions according to this invention generally contain 0. 05 to 5% and preferably 0.1 to 3% by weight of the active principle of formula (I) relative to the total weight of the composition.
The compositions according to the invention may also contain additional active principles such as salicylic acid, hydrocortisone, etc.
The treatment of psoriasis consists of applying to the lesions, after they have been cleaned, a sufficient quantity of a composition according to the invention and protecting the place thus treated, advantageously by utilization of a protective bandage.
The treatment may be accompanied by ultraviolet radiation using repeated exposure and adopting a schedule of decreasing weekly exposures until the various lesions are attenuated or have totally disappeared.
The active compounds used in the compositions according to this invention are mostly known and are prepared by the Michael reaction in which 1,8-dihydroxy-9-anthrone (anthralin) is reacted in an inert atmosphere in an organic solvent, such as dimethylformamide, chloroform, or acetonitrile, optionally in the presence of a basic catalyst, with an unsaturated compound in which the double bond is conjugated and activated by an unsaturated electronegative group.
The reaction is generally conducted at the boiling temperature of the organic solvent and one utilizes preferably as a basic catalyst dimethylamino-4-pyridine or sodium methylate.
When the product crystallizes from the reaction mixture in the course of its formation or on cooling, it is separated by filtration, washed and dried under reduced pressure.
In other cases the reaction mixture is concentrated under reduced pressure and the residue is either crystallized in an appropriate solvent or purified by chromotography on silica gel.
The following examples which are given for purposes of illustration and not to limit the invention in scope. They show the preparation of the active compounds as well as several examples of compositions which can be used for topical application in treatment of psoriasis.
EXAMPLE I
Preparation of 10-(1,8-dihydroxy-9-anthron)ylsuccinic anhydride
A mixture of 28.6 g of anthralin (0.13 mol), 15 g of recrystallized maleic anhydride (0.15 mol) in 250 ml of dimethylformamide is placed in an inert atmosphere protected against air humidity and against light and is maintained for an hour at a temperature of 120° C. The reaction mixture is filtered at that temperature. To the filtrate, brought to ordinary temperature, one adds several ml of water until the product begins to crystallize. After several hours the solid is suction dried, and analysed. One isolates thus 26 g of 10-(1,8-dihydroxy-9- anthron) ylsuccinic anhydride of yellow color decomposing at 260° C.
Analysis: C.sub.18 H.sub.12 O.sub.6 ; Calc. C: 66.57, H: 3.73, O: 29. 60; Found: 66.53, 3.82, 229.54.
According to O. Schultz and G. Frey, Arch. Pharm. 310, pages 776- 780 (1977), this compound has a melting point with decomposition of 230. degree.-253° C.
EXAMPLE II
Preparation of 10-(1,8-dihydroxy-9-anthron)ylsuccinic acid
The anhydride prepared in Example I (10 g) is dissolved in a mixture of 350 ml of acetic acid and water (1:1) at 100° C. and the resulting solution is filtered while hot. The filtrate is permitted to stand at room temperature with exclusion of light. The crystalline diacid is suction filtered and then dried. One thus obtains 10 g of bright yellow crystals of a melting point of about 237° C.
Analysis: C.sub.18 H.sub.14 O.sub.7 ; Calc. C: 63.16, H: 4.12, O: 32. 72; Found 63.24, 4.16, 32.91.
According to O. Schultz and G. Frey (loc. cit.) this compound has a melting point of 232°-233° C.
EXAMPLE III
Preparation of 10-(1,8-dihydroxy-9-anthron)ylsuccinic acid dimethyl ester
To a solution of 6.78 g of anthralin (0.03 mol) and an excess of dimethyl maleate (0.06 mol) in 50 ml of chloroform placed in an inert atmosphere with exclusion of air humidity and light, one adds 0.5 ml of a 1% solution of sodium methylate. The reaction mixture is then kept at the boiling point for two hours. After cooling, it is applied directly on a silica gel chromotography column. The product obtained is eluted by chloroform. The chloroform phases are concentrated. The crystallized diester is collected on a filter and dried. One obtains thus 10 g of pale yellow crystals with a melting point of 137° C.
Analysis: C.sub.20 H.sub.18 O.sub.7 ; Calc. C: 64.86, H: 4.90, O: 30. 24; Found 64.72, 4.92, 30.05.
EXAMPLE IV
Preparation of methyl 3-carboxy-3- 10-(1,8-dihydroxy-9- anthron) yl!propionate
A mixture of 7 g of anthralin (0.031 mol) and 4.42 g of methyl monomaleate (0.034 mol) in 100 ml of acetonitrile is brought to the boiling point for two hours in an inert atmosphere under exclusion of light and humidity, at which time all of the anthralin is transformed. The solvent is then evaporated under reduced pressure.
The solid obtained is washed with a mixture of water and acetic acid and then dissolved in methanol. The solution is filtered and then concentrated. The yellow crystals obtained (10 g) are dried. They start to decompose beginning at 168° C.
Analysis: C.sub.19 H.sub.16 O.sub.7 ; Calc. C: 64.04, H: 4.52, O: 31. 43; Found 63.88, 4.53, 31.36.
EXAMPLE V
Ointments are prepared according to the invention for application on the lesions starting with the following ingredients:
EXAMPLE A ##TBL1##
EXAMPLE B ##TBL2##
EXAMPLE C ##TBL3##
EXAMPLE D ##TBL4##
EXAMPLE E ##TBL5##
EXAMPLE F ##TBL6##
EXAMPLE G ##TBL7## | |
‘It’s as if reality didn’t exist’
For a century quantum physics has been essential to medicine, engineering, computers, nuclear power and even our knowledge of deep space. But what is quantum?
For a century quantum physics has been essential to medicine, engineering, computers, nuclear power and even our knowledge of deep space. But what is quantum?
The word “quantum” has different associations for many people. To lovers of 1970s rock it evokes memoriesof Quantum Jump, a band whose main claim to fame is singing the Guinness Book of Records’ longest word – the 57-letter name of a New Zealand hill – on their only top 10 single, The Lone Ranger.
‘A hundred years ago it was discovered that the equations do not work for small things and they were replaced with quantum.’
To others, the word may contain a mere seven letters but it’s just as indecipherable as the name of that hill. This is despite Brian Cox, Salford University professor and TV personality, seeming to mention quantum almost every time he’s on the box. Professor Cox also wrote a book titled The Quantum Universe and once boiled the word’s meaning down to “everything that can happen, does happen”.
Still, that fails to explain why boffins around the globe get excited by the expression quantum jump, or quantum leap as it is now more commonly known. Yet even they often struggle to define it. For example, one sought to illustrate the magnetic resistance of spinning “quantum mechanically entangled electrons” by comparing it to the fight between John Cleese’s Black Knight and King Arthur in the film Monty Python and the Holy Grail. About half of the electrons won’t magnetise, he observed, and thus displayed the same against-the-odds tenacity as Cleese did while being hacked down to a limbless and insult-spouting torso by King Arthur’s sword.
So here comes another attempt at nailing the meaning and significance of the word quantum. Only this time it might just be possible to understand, even by those of us who failed our school physics exams. It is a book by Italian theoretical physicist Carlo Rovelli, whose fans include David Hockney, Lily Cole and Benedict Cumberbatch, but rather than writing a bloated tome comprehensible only to science graduates, Rovelli’s book reads almost like a thriller.
The action begins on the Hong Kong island of Lama. Two men are picking their way along a path through the coastal jungle that fringes the beach. One is Rovelli, the other a Serbian-Austrian expert on quantum physics, Caslav Brukner. They are taking an afternoon break from attending an international conference on scientific theory and find themselves discussing a complex thought experiment. By the time they sit down on the sand just a few steps from the sea they are reduced to silent contemplation of their unexpected agreement on the subject. Then Caslav whispers: “Can this be believed? It’s as if reality…didn’t exist…”
Rovelli knew just how challenging the quantum theory remained. After a century of scientists studying it – even with modern technology, he writes in his book – “the theory that is one of the greatest ever achievements of science fills us with astonishment, confusion and disbelief”.
So what is this theory?
For Big Issue North, from his home in Canada, Rovelli explains that physics provide a scientific description of how things move and interact with one another, and three centuries ago this was turned into mathematical formulae by Isaac Newton.
“For 200 years,” says Rovelli, “the equations of Newton worked very well and were used by engineers and scientists to build all sorts of things, from bridges to airplanes. But then a hundred years ago it was discovered the equations do not work for small things and they were replaced by the new scheme of quantum theory, the basis of modern physics.”
A hundred years ago, in fact, like one of those Agatha Christie mysteries awash with so many red herrings that readers inevitably point the finger at the wrong villain, something wasn’t quite right about the quantum theory. “Many facts didn’t fit,” according to Rovelli.
And so for his book he turned to the person who finally made them fit, Werner Heisenberg, the sort of Hercule Poirot of quantum. In May 1925, after leaving a research fellowship at Copenhagen University, Heisenberg had found himself suffering a severe attack of hay fever. He retreated to a treeless German island in the North Sea archipelago of Helgoland (Heligoland in English), where there was almost no pollen to trigger his allergy and he could find blessed relief. While there he conceived the basis of the quantum theory, and worked out if not whodunnit then certainly whatdunnit and whydunnit.
Rovelli says of Heisenberg’s stay on the island that, like Einstein and his theory of relativity, the young physicist was prepared to believe that even our most rooted convictions can be wrong, and that abandoning common assumptions could lead to greater understanding. Knowledge had to be based solely on observations and be freed from theory, he decided while on Helgoland. And so whilst there, according to Rovelli, Heisenberg had an idea about physics that would transform the science in its entirety. It is an idea, Rovelli believes, that even a century later humanity has not yet fully resolved.
For several weeks Heisenberg breathed big healthy lungfuls of the virtually pollen-free North Sea air and dared to think what was then considered to be the scientifically unthinkable. Once upon a time in the scientific world, at the root of everything were just particles of matter guided by a few forces. If no one had been able to find the mysterious force capable of causing bizarre behaviour in electrons – something which impacted everything – then maybe scientists should simply stop trying to identify this apparently new force. Maybe, reasoned Heisenberg, they should stick with the laws of motion they were familiar with. From now on, they should base their understanding only on what they could observe, such as the light emitted by electrons.
Into the early hours of 7 June, he was engaged in a marathon session of recalculating the frequency and amplitude of light emitted by electrons moving in orbits. He made one failed mathematical calculation after another based on Newton’s tables, until he decides to abandon orbital movement entirely. Instead, he applied the behaviour of a pendulum.
“As a consequence,” Heisenberg wrote, “it was around three o’clock in the morning when the result of my calculations lay before me. It was correct in all terms. Suddenly I no longer had any doubts about the consistency of the new ‘quantum’ mechanics that my calculation described.”
Two days later he returned to the German mainland and continued his research at the Georg-August University of Göttingen. He had sent an advance copy of the Helgoland findings to his professor, admitting in a covering note: “I have written a crazy paper and I do not have the courage to submit it anywhere for publication.”
But his professor did have the courage, and sent it to a respected German scientific journal.
The great Einstein himself was then moved to comment: “The ideas… have everyone in suspense, and are preoccupying everyone with the slightest interest in theory.” Einstein added that it was “a calculation of real witchery”.
The theory made Heisenberg famous and in 1932 he was awarded the Nobel Prize for Physics. But fame caused his life to take a dark turn. As one of the generation of young physicists who had learned how to use the new quantum theory to manipulate atoms, in September 1939, shortly after the outbreak of the Second World War, he was invited to join a team assembled by Adolf Hitler to develop an atomic bomb.
He travelled to Copenhagen to meet his former teacher, Niels Bohr, and “discuss the moral problem entailed by the prospect of a terrifying weapon”. A short time later Bohr was willingly kidnapped by British commandos, taken to meet Churchill in London and then to the United States where, writes Rovelli, he was “put to work with the generation of young physicists who have learned how to use the new quantum theory to manipulate atoms” and build the bombs that annihilated Hiroshima and Nagasaki.
Heisenberg continued his atomic weapons research in Germany until he was captured by Allied forces in May 1945 and eventually flown to England. He said later that he had never contemplated building a bomb, only producing atomic energy. Rovelli writes that there is so much more to quantum theory than weapons. The theory has advanced our knowledge of everything from medicines that have saved millions of lives to computers and the entire field of astronomy, including the formation of galaxies. | https://www.bigissuenorth.com/features/2021/06/its-as-if-reality-didnt-exist/ |
Q:
Why can't for_each modify its functor argument?
http://www.cplusplus.com/reference/algorithm/for_each/
Unary function taking an element in
the range as argument. This can either
be a pointer to a function or an
object whose class overloads
operator(). Its return value, if any,
is ignored.
According to this article, I expected that for_each actually modifies the object given as its third argument, but it seems like for_each operates on a temporary object, and doesn't even modify the object given to it.
So, why is it implemented in that way? It seems much less useful. Or did I misunderstand something and my code below contains errors?
#include <iostream>
#include <vector>
#include <algorithm>
template <class T> struct Multiplicator{
T mresult;
public:
const T& result() const{return mresult;}
Multiplicator(T init_result = 1){
mresult = init_result;
}
void operator()(T element){
mresult *= element;
std::cout << element << " "; // debug print
}
};
int main()
{
std::vector<double> vec;
vec.push_back(1);
vec.push_back(2);
vec.push_back(3);
Multiplicator<double> multiply;
std::for_each(vec.begin(),vec.end(),multiply);
std::cout << "\nResult: " << multiply.result() << std::endl;
return 0;
}
Expected output:
1 2 3 Result: 6
But got following output:
1 2 3 Result: 1
A:
The function object is taken by value. for_each returns the function object, so if you change it to:
multiply = std::for_each(vec.begin(),vec.end(),multiply);
you get the expected output.
A:
While James is correct, using std::accumulate with std::multiplies would be more correct, probably:
#include <iostream>
#include <functional>
#include <numeric>
#include <vector>
int main(void)
{
double result = std::accumulate(vec.begin(), vec.end(),
1.0, std::multiplies<double>());
std::cout << "\nResult: " << result << std::endl;
}
With your for_each version, you don't really need to copy the functor again, rather:
double result = std::for_each(vec.begin(), vec.end(), multiply).result();
Or C++0x, for fun:
double result = 1;
std::for_each(vec.begin(), vec.end(), [&](double pX){ result *= pX; });
| |
We are committed to delivering for our clients prompt, accurate, rigorous, innovative and independent advice and geotechnical engineering solutions for:
- Dams and tunnels for water, wastewater and hydropower projects.
- Foundations and earthworks for roads, bridges, infrastructure, industrial, commercial and residential buildings.
- Ground improvement for earthquake and liquefaction mitigation.
- Slope stability assessment and remedial stabilization.
- Ground retention systems, temporary works and deep excavation support.
- Independent peer review, geotechnical design & construction supervision and certification.
Geotechnical engineering expertise includes:
- Ground investigation and the assessment of
the geotechnical engineering implications of
the ground conditions
- Foundation & retaining wall design recommendations
- Slope stability assessment
- Earthworks and ground improvement
- Retaining wall design
- Independent checking and peer review of
geotechnical design
- Design certification.
Dam engineering experience includes:
- Advisory services to dam owners on the NZ Dam Safety Guidelines (2015)
- Classification of dam Potential Impact Category
- Comprehensive safety reviews
- Intermediate safety reviews
- Routine dam safety surveillance, instrumentation and monitoring
- Embankment design and construction supervision
- Advisory services for dam Building Consent applications and regulatory review. | http://grantmurrayassociates.co.nz/Services.php |
Sara joined Energy Cities in February 2018. Before, she worked 4 years for the European Commission, first in the Directorate General for the Environment, then in the Joint Research Centre, as a communication and events officer.
Passionate about sustainability issues, working for Energy Cities allows her to directly contribute to the transition to a greener world, powered by renewable energy! Inside the office she is a social media geek, communicating and raising awareness on the potential of #renewables and #local action.
Outside the office, she is still a social media geek (catch her on @Giovannini_S) but also a foodie, a traveller and a runner.
It happens to everyone: sometimes, we focus so much on projects, policy files and deadlines that we forget to breathe, look around, and talk with […]
Currently, Europe is using around half on its energy consumption for heating and cooling (H&C). The sector relies mostly on fossil fuels and it is […]
Energy transition in coal mining regions is not a new issue, but lately, it has come up often in my newsfeed. I am sure you […]
Community energy can encompass a number of different aspects and activities. Attempts to define the concept have been made. by various organisations, which defines it as “the economic and operational participation and/or ownership by citizens or members of a defined community in a renewable energy project.”. | https://energy-cities.eu/staff/s-giovannini/ |
Amrit Campus, formally named as Public Science College (PUSCOL) and later named as Amrit Science College (ASCOL), after late Mr. Amrit Prasad Pradhan. Mr pradhan was born in 1918 at Thamel, Kathmandu. He served as headmaster of Jooddha High School in Birgunj for two years and later joined at Tri-Chandra College as lecturer in Chemistry. In 1962, he became founder Principal of Public Science College (present Amrit Campus) and began teaching as professor of Chemistry.
Late Principal Amrit Prasad Pradhan established Amrit Campus with a view to promote the study of Science and Technology in Nepal. The campus has benefited greatly from his spirit or enterprise, dedication and enthusiasm. While on a mission to the United States of a cause connected with the college, he died in an air crash over Mt. Blanc on January 24, 1966. The death of this noble soul was mourned by the nation.
- To develop skilled and highly competent human resources in the field of Science and technology
- To improve the existing classroom facilities for quality education
- To upgrade the existing infrastructure facilities for implementation of new programs
- To enhance scientific research activities for human resource development
- To establish research oriented education system upto Ph.D. level and to promote all tech departments as the “Center for Excellence”
MISSION OF THE CAMPUS
To fulfill the vision of the campus following mission has been set
- To introduce Master level courses in some subjects like Botany, Chemistry, Zoology, Microbiology and CSIT.
- To construct new infrastructure for introducing the above mentioned Master level programs.
- To create healthy teaching/learning environment and develop students who can think critically, communicate effectively and marketable in global market.
- To renovate and upgrade the classroom and laboratory facilities with LCD projectors and internet facilities for update knowledge sharing.
VALUES OF THE CAMPUS
Amrit campus has been working in the field of science and technology for last five decades and believes in generation of competent human resources with following values:
- Quality: We strive for continuous quality improvement, individually and collectively, in all that we do.
- Creativity and Innovation: We apply new concepts, ideas and creative approaches to improve teaching, service, research and college operations.
- Commitment: Understanding the interdependence of our actions, we are therefore committed to the success of the college and each other.
- Teamwork: We acknowledge that everyone’s contribution is important. Working together we place the mission of the college first and align our contributions, whether individual or terms, toward that end.
- Compassion: Recognizing the role of science in society we will always strive to reach our goals with compassion for our students, clients and one another.
- Integrity: We conduct ourselves with honesty and integrity, recognizing that upholding the public trust requires the highest moral and ethical conduct.
- Diversity: We promote cultural and gender diversity and equality to strengthen all programs and service areas of the college to ensure maximum integration with the community and country we serve.
- Professionalism: We honor our role in teaching, service and research by valuing the principles and spirit of material science, natural science and human value ethics. | https://hamrocsit.com/csit/college/amrit-science-campus-ascol/ |
The Indeed Editorial Team comprises a diverse and talented team of writers, researchers and subject matter experts equipped with Indeed's data and insights to deliver useful tips to help guide your career journey.
The judicial system depends on several professionals performing different roles to function efficiently. Process servers belong to this group of legal professionals responsible for delivering legal documents and performing other essential roles. If you’re considering a career as a process server, understanding the role in more detail can help you make a more informed decision. In this article, we answer "What is a process server?" examine the duties of a process server, outline the skills required, and provide answers to some FAQ.
What is a process server?
Understanding the answer to "What is a process server?" is important if you want to pursue a career as a process server. A process server is an individual who works in the legal field to deliver or serve legal documents to people who are parties to court cases or their legal representatives. Also known as Service of Process, this process of serving documents has specified procedures, which each area of jurisprudence clearly states.
Process servers also provide many other functions to the court and the legal system. They file confidential court papers and transcripts and retrieve and deliver other official documents. Some servers also provide skip tracing services to help locate persons of interest whose location is unknown.
Related: Top 21 Jobs in the Legal Field (With Duties and Salaries)
What does a process server do?
Process servers are key to a wide array of legal tasks. While their primary function is to serve legal documents to defendants and other people involved in legal matters, they also file court papers, deliver legal documents, and retrieve other documents and legal items.
To legally serve someone is to officially deliver court documents that implement a person in a crime, debt, or lawsuit. Sometimes, in anticipation of service, a person may try to hide their whereabouts or relocate to avoid receiving the notice. In these instances, process servers use public and private databases, interviews, and other investigative tactics to locate the people they serve.
Essential process server skills
Considering acquiring the following skills if you want to succeed as a process server:
Problem solving
Like other professionals, process servers often encounter challenges while executing their tasks. These can range from procedural issues to locating recipients. Identifying the root causes and finding effective solutions can help you excel in this role.
Read more: Problem-Solving Skills: Definitions and Examples
Notary public
Possessing notary skills can be an advantage if you want to pursue a career as a process server. Notary publics are people who have the empowerment of the law to verify signatures and certify a document's validity. They can also prepare legal paperwork like affidavits, which they often use to verify the identity of recipients of notices.
Persistence
The job of a process server can sometimes be challenging, requiring long hours of focused effort to complete a task. People who can keep working on a difficult task without losing their composure can excel as process servers. They often succeed at delivering some papers only after many trials.
Skip tracing
People sometimes conceal their location to avoid responding to a court summons. Skip tracing is the ability to find people who have tried to disappear. Process servers with this skill stand a better chance of excelling at the job.
Investigative skills
Process servers work in the legal field, where data collection is fundamental to building a strong case. The ability to find and analyze data to reach valid conclusions can be an asset. Process servers can use this skill to reveal hidden locations and collect relevant evidence to support their legal documents.
Read more: Effective Investigative Skills to Develop Your Career
Communication
Good communication skills are an advantage to a process server as they work in the legal profession, which often requires a strong grasp of written and spoken language. Servers work with legal professionals, including lawyers and judges, and understanding legalese is essential to functioning well. With strong communication skills, a process server can convey information clearly, accurately, and professionally.
Read more: Communication Skills: Definitions and Examples
Court filing
Knowledge of the court filing system is important to succeeding as a process server. The service of process typically requires the submission of the relevant paperwork to the courts. Knowing where to submit which document is a necessary skill.
Legal research
Process servers require the ability to conduct legal research to function well in their role. Searching court records is a prerequisite to serving a summons or complaint and one of the functions of servers. This skill includes locating relevant legal documents, interpreting them, and managing citations and references.
Related: Research Skills: Definition and Examples
Organizational skills
Process servers often work with multiple files and documents simultaneously. They also keep records of important details of their tasks. Strong organizational skills help maintain these multiple records efficiently.
Read more: Developing Proficient Organizational Skills
Attention to detail
Attention to detail is the ability to efficiently allocate your cognitive resources and achieve thoroughness and accuracy when accomplishing tasks. Process servers require this skill to notice the minutest details while carrying out their duties. This ability to note details is essential because a seemingly harmless omission can have significant legal repercussions.
Related: How to Be More Detail-Oriented (With Definition and Resume Tips)
Process server FAQ
The following are some frequently asked questions about process servers:
How much research do process servers perform on a day-to-day basis?
Process servers regularly locate individuals to serve documents. Strong research skills help successfully track down the most up-to-date and accurate information on the individual receiving service. People in this job use public and private databases to research daily.
Do process servers write affidavits?
After serving someone with legal documents, process servers require proof that their delivery methods were successful. Known as an "affidavit of service," this proof requires notarization as protection for the served party, the processor and the individual or organization requesting the service. It's important to know that the regulations regarding serving legal documents, procuring service affidavits, and obtaining notarization vary by province.
What qualities do process servers need for success?
Process servers require various qualities to be successful in this career. It's important that they exhibit a calm disposition as they may encounter individuals who get upset or angry about receiving legal papers. In addition to being calm, the ability to deal with challenging and emotional situations may also be an advantage.
Attention to detail, ensuring that the people they serve with legal documents are the intended recipients, is another important aspect of the job. Paying attention means carefully reviewing confidential documents and records and accurately examining official forms of identification, including driver's licenses and passports. It's important that they also be able to navigate the public records system quickly and accurately.
Related: 12 Types of Careers in Law to Consider (With Salaries)
Can I become a process server without a valid driver's license?
A driver's license is a requirement to become a process server, given the core job function of delivering legal documentation to defendants and other participants in a legal case. Because these documents are legal and confidential, they require timely service and delivery. Travelling by car is a necessity.
Do process servers need a bachelor's degree to secure employment?
Process servers can secure employment without a bachelor's degree. Most employers provide their employees with on-the-job training for servers and offer information regarding proper procedures. There aren't any nationally recognized education requirements for this career. This means that people with a high school diploma or associate degree can apply for a job as a process server.
Do process servers testify in court?
Process servers occasionally present reports of their delivery in court. In certain rare cases, they appear in court to testify they delivered the court papers as directed. Keeping a record of their deliveries can be helpful in such instances.
What is the work environment of process servers?
Process servers work closely with legal professionals. They rarely work regular business hours due to the nature of the job. They often work weekends and weeknights since they’re most likely to find an individual at those times. Process servers often travel since they hand-deliver legal documents. Some individuals are more difficult to locate than others, which makes the job both exciting and challenging.
Explore more articles
- What Is a Personal Care Aide? (And How to Become One)
- 14 Early Morning Jobs (With Average Salaries and Duties)
- How To Become a Business Administrator: A Step-by-Step Guide
- What is an SQL Developer? (And How to Become One)
- What Do Automation Engineers Do and Why Do They Do It?
- What Is an Orthodontist? (With 7 Steps To Become One)
- What Is a Business Analyst? | https://ca.indeed.com/career-advice/finding-a-job/what-is-process-server |
Embracing God's Calling Through Mind,
Body, & Spirit
This book examines the notion that we are all made in the image of God with gifts and talents unique to our path, and destiny in this life. Throughout the book we will explore why so many of us are mentally riddled with self-doubt; trapped in the cycle of self-sabotage; and surrounded by people who only seem to want to damper your dreams and extinguish your imagination.
Physically; we address reasons why we are constantly fighting fatigue, exhaustion, and chronic ailments; and why spiritually we are constantly fighting the uphill battle of using our gifts to impact the world, and avoid being side-tracked along the way. Are we dreaming too little, and playing too safe?
Throughout the book we probe and discover how mental, physical, and social choices affect the trajectory of your life and how effectively we engage our gifts and calling. Can we use biblical principles, along with modern science, and best psychological practices to safeguard our dreams and passions, while also fully embracing the (Imago Dei) creative image and likeness of God within us all? | https://www.firelovewellness.com/media-shop |
Also See: Sugar Land, TX ZIP Codes & ZIP Code Maps | Local Area Photos
The City of Sugar Land had a population of 121,520 as of July 1, 2019. Sugar Land ranks in the upper quartile for Population Density and Diversity Index when compared to the other cities, towns and Census Designated Places (CDPs) in Texas. See peer rankings below.
The primary coordinate point for Sugar Land is located at latitude 29.6197 and longitude -95.6349 in Fort Bend County. The formal boundaries for the City of Sugar Land encompass a land area of 33.59 sq. miles and a water area of 2.1 sq. miles. Fort Bend County is in the Central time zone (GMT -6). The elevation is 75 feet.
The City of Sugar Land (GNIS ID: 2411994) has a C1 Census Class Code which indicates an active incorporated place that does not serve as a county subdivision equivalent. It also has a Functional Status Code of "A" which identifies an active government providing primary general-purpose functions.
Texas is one of 20 states where Census County Divisions (CCDs) are used for statistical tracking of subdivisions within each county. The City of Sugar Land is located within Sugar Land Division of Fort Bend County.
Also See: Nearby Photos | Nearby Hotels | Driving Directions
HOUSING AFFORDABILITY INDEX
|Sugar Land, TX Housing Affordability Index is 151
|
State of Texas Housing Affordability Index is 132
|The Housing Affordability Index base is 100 and represents a balance point where a resident with a median household income can normally qualify to purchase a median price home. Values above 100 indicate increased affordability, while values below 100 indicate decreased affordability.|
WEALTH INDEX
|Sugar Land, TX Wealth Index is 205
|
State of Texas Wealth Index is 94
|The Wealth Index is based on a number of indicators of affluence including average household income and average net worth, but it also includes the value of material possessions and resources. It represents the wealth of the area relative to the national level. Values above or below 100 represent above-average wealth or below-average wealth compared to the national level.|
These new demographic attributes are availiable for cities, Counties, ZIP Codes and even neighborhoods (Census Blocks) when you search by a specific Texas address.
See our:
POPULATION
|Total Population||121,520|
|Population in Households||120,726|
|Population in Familes||111,457|
|Population in Group Qrtrs||794|
|Population Density||3,002|
|Diversity Index1||71|
INCOME
|Median Household Income||$109,145|
|Average Household Income||$145,511|
|Per Capita Income||$49,029|
|Wealth Index3||205|
HOUSING
|Total Housing Units||41,975 (100%)|
|Owner Occupied HU||32,768 (78.1%)|
|Renter Occupied HU||8,024 (19.1%)|
|Vacant Housing Units||1,183 ( 2.8%)|
|Median Home Value||$316,959|
|Housing Affordability Index2||151|
HOUSEHOLDS
|Total Households||40,792|
|Average Household Size||2.96|
|Family Households||33,683|
|Average Family Size||3|
|
|
GROWTH RATE / YEAR
|2010-2019||2019-2024|
|Population||1.33%||2.05%|
|Households||1.44%||2.07%|
|Families||1.35%||2.06%|
|Median Household Income||0.79%|
|Per Capita Income||1.16%|
The table below compares Sugar Land to the other 1,746 incorporated cities, towns and CDPs in Texas by rank and percentile using July 1, 2019 data. The location Ranked # 1 has the highest value. A location that ranks higher than 75% of its peers would be in the 75th percentile of the peer group.
|Variable Description||Rank||Percentile|
|Total Population||# 29||98th|
|Population Density||# 166||91st|
|Diversity Index||# 266||85th|
|Median Household Income||# 76||96th|
|Per Capita Income||# 85||95th|
Additional comparisons and rankings can be made with a VERY EASY TO USE Texas Census Data Comparison Tool. | https://texas.hometownlocator.com/tx/fort-bend/sugar-land.cfm |
Call the non-emergency dispatch phone number (208-465-2257) to report your dog as lost. Give a description of the dog to dispatch. Post on Craigslist Boise in the Lost and found section, as well as on various forms of social media, such as Facebook lost and found pet pages, and NextDoor Neighbor. Make sure you leave a contact numbers and list the area that the dog was lost from. Contact the West Valley Humane Society (208-455-5920) to file a lost dog report, and go there to see if your dog has been brought in.
Property damaged by a pet is generally considered negligence, rather than criminal, and thus payment to repair damage is a civil matter. If you fear the neighbor’s dog(s) getting into your yard, try fortifying your side of the fence to prevent them from doing so. Animal Control can also discuss options with your neighbors on ways to keep their dog(s) on their property. Until a dog has actually left its yard or injured another animal or human, charges generally are not able to be brought against its owner, i.e. no criminal laws have been broken.
Nampa City Code 6-2-20A(h) states that only two dogs over the age of six months are permitted per house in the City of Nampa. If you desire to own more than two dogs, you will have to apply for a Kennel License at Nampa City Hall Planning and Zoning (411 3rd St S; 208-468-5484).
When Animal Control picks up a dog, we scan it for a microchip. If the dog has a chip and the information is current, we try to bring the dog home. If the dog has no form of identification on it, we bring it to the West Valley Humane Society (5801 Graye Ln, Caldwell). The shelter will hold on to the dog for a set number of days, giving the owners a chance to claim the dog, before putting it up for adoption.
No. It is the responsibility of the dog owner to take their dog to the Shelter and sign it over, i.e. owner surrender.
When you have located the address of the barking dogs, contact Nampa Animal Control and we can go out and talk to the dog owner to suggest ways to fix the problem. If it is an ongoing issue, the following is required in order for someone to sign a citation for nuisance noise (Nampa code 6-2-24):
There is no limit to how many cats a person may own in the City of Nampa. If you are having nuisance cat problems, refer to the West Valley Humane Society website regarding their Community Cat Program.
All dogs within Nampa city limits are required to have a Nampa City Dog License (per City Ordnance 6-2-20). There are discounts for Senior Citizens (over 65 years of age), if the dog is microchipped, and if the dog is spayed/neutered. Evidence is required to show proof that the discount option has been met. I.E., driver's license or legal I.D., veterenarian records showing spay/neuter, and rabies vaccination status. All dogs in Nampa are requiered to have a current rabies vaccination.
Note: underground electric fences do not qualify as an enclosure/fence under the definition of “enclosure” in Nampa Ordnance (Definitions: 6-2-1). | https://www.cityofnampa.us/FAQ.aspx?QID=128 |
Q:
How to separate and store hours and minutes from 3.875 hours
I'm trying to calculate time from distance and speed.
Ie 155 km traveled at 40 km/h. That makes 3.875 hours. But I need that displayed as HH:MM.
How do I convert 3.875 hours into HH and MM?
double kmNumber = [Input1.text doubleValue]; // 155
double kmHourNumber = [Input3.text doubleValue]; // 40
double hoursAndMinutes = number1 / number3; // 3,875
[display setText:@"If you travel %f at %f you would use %f.", kmNumber, kmHourNumber, hoursAndMinutes];
Any help would be appreciated!
A:
int hours = (int)hoursAndMinutes; // the integer part is the hours
int minutes = (hoursAndMinutes-hours)*60; // the fractional part of an hour
NSLog(@"HH:MM = %02d:%02d", hours, minutes);
| |
Q:
How can I verify that a contract on the blockchain matches the source code?
Given the (Solidity) source code of a smart contract, is there a way to deterministically compile the code and compare it with the code on the blockchain? I want to verify that the contract does what the source code claims to do and the author hasn't tampered with it.
A:
AFAIK the best way to do this at the moment is to compile the source code again with the exact same compiler version the author used (so this is something that needs to be disclosed) and to compare the bytecode.
So the match you should check is the compiled bytecode against the data of the contract creation tx.
A:
To add to @thomas-bertani's answer, today etherchain.org released a verification tool for Ethereum contracts
Here's the text from the page:
Source code verification provides transparency for users interacting
with smart contracts. By uploading the source code, Etherscan will
match the compiled code with that on the blockchain. Just like
contracts, a "smart contract" should provide end users with more
information on what they are "digitally signing" for and give users an
opportunity to audit the code to independently verify that it actually
does what it is supposed to do.
A:
Currently the workflow is quite annoying. You need to compile the contract with the same compiler version and the same setting (look out for the "optimization=true" flag).
Now please note that the resulting bytecode does NOT match with the bytecode that is stored on the address. The reason for that is that the compiled contract does contain an initialization part that is ran only once when the contract is submitted to the chain. So the byte code stored on the blockchain is the code without the initialization part.
To verify the code you have two options:
Submit the compiled code to a (virtual) blockchain and than check with the getCode command the resulting code.
Compare the compiled code with the payload of the transaction that created the contract.
Etherchain helps to do this process.
In principal pattern matching techniques could be applied to identify a contact even if not exactly the same compiler is used. A project that is doing this and in general linking high level contract (Serpent/Solidity) to Ethereum adresses is: Etherscrape
| |
Sapna is a partner in the firm’s Intellectual Property Practice covering patent, copyright and trademark matters. In the patent area, her practice focuses on an array of technologies, including pharmaceuticals, biotechnology, drug delivery systems and medical devices, with an emphasis on Hatch-Waxman patent infringement cases. She has over 15 years of experience in patent litigation and experience in various jurisdictions including the Federal Circuit and federal courts in Delaware, District of New Jersey, Eastern District of Virginia, Eastern District of Texas, Southern District of New York, Southern District of Florida, Northern District of California and the District of Maryland.
Sapna counsels a variety of US and international clients regarding US intellectual property law by providing them with infringement, validity, enforceability and clearance opinions, and by advising them in licensing and antitrust matters, conducting intellectual property due diligence investigations in connection with acquisitions and licensing deals and preparing responses and amendments to office actions, appeal briefs, and reexamination briefs for submission to the United States Patent Office. Sapna also counsels clients about Indian patent law.
Outside the patent area, Sapna is also experienced in trademark and copyright litigation as well as in counseling clients on trademark and copyright registration, strategy and licensing.
Sapna frequently writes and speaks on a range of topics including developments in pharmaceutical, biotechnology and medical devices patent law, patent reform, biosimilars regulations, intellectual property law in Asia, and developments in e-discovery. Her programs have been presented by Practicing Law Institute and WestLegal Ed and she has been published and quoted in Leading publications, including Forbes, Pharmaceutical Patent Analyst and Bloomberg/BNA.
Sapna teaches as an adjunct professor at Pace University School of Law addressing antitrust and patent topics. She clerked for the Honorable Judge Robert J. Hurley of the United States District Court for the Eastern District of New York.
Sapna is on the Board of Directors of the Asian American Bar Association of New York. Previously she was a Co-Chair of its Women’s Committee. Sapna is also a member of the New York Intellectual Property Law Association and a member of its Legislative Action Committee.
Sapna received her J.D. summa cum laude from Pace University School of Law. She was a member of the Pace Environmental Law Review (Notes and Comments Editor). She received her B.B.A. magna cum laude, in International Management with Pre-Medical Concentration from Pace University. She authored research papers entitled Carbohydrate Inactivation of Bacteriophages T1 and T7 (May 1993) and Hydrogen Peroxide and Ultraviolet Inactivation of T1 and T7 (May 1994) published by the American Society of Microbiology. She received the Medal for Distinction in University Honors Program and a Medal for Outstanding Scholarship in International Management.
Sapna has lived and studied in both India and Tanzania. She is fluent in Hindi and Marathi and conversant in French. | https://conference2017.aabany.org/speaker/sapna-palla/ |
NA61/SHINE efforts in support of the US Neutrino Physics Program
Since neutrinos are charge-less, they cannot be accelerated and steered with magnets as typically done at a particle accelerator. To create a neutrino beam, researchers accelerate charged protons and impinge them onto a fixed target of a few interaction lengths that are typically made of beryllium or carbon. The resulting particle interactions, both primary and tertiary, produce charged pions and kaons exiting the target. Physicists then focus these particles into beams, at which point they decay into daughters, including neutrinos, which roughly follow the direction of the parent. As neutrino research advances and more statistics are accumulated systematic errors become important and therefore it is essential to have a precise knowledge of parent properties to reduce the overall errors when extracting the fundamental properties of neutrinos from final data.
The NA61/SHINE experiment (offspring of NA49) was approved in October 2008. Prior to approval it took neutrino inspired data in a pilot run during September 2007, with 600,000 triggers on a thin carbon target and 200,000 triggers on the replica (long) T2K target in support of the neutrino program at JPARC (Japan). This was followed with extensive data-taking for the T2K neutrino physics program with thin (6 million triggers in 2009) and long targets (10 million triggers in 2010). The incorporation of these data into the T2K neutrino flux prediction significantly reduced the beam uncertainties and greatly enhanced the physics output of T2K. The SHINE detector was primarily designed to study strongly interacting matter, quark-gluon plasma and the production of composite particles. It can therefore reconstruct particles produced from interactions in a high track density environment with great precision (see Figure 1).
Figure 1: Typical Event 60 GeV pion on Be
Due to the success of the T2K experience a new partnership between scientists from US institutions and CERN was initiated to improve flux predictions for the US neutrino program at Fermilab. Researchers from Fermilab, Los Alamos National Lab, University of Colorado, and University of Pittsburgh wishing to improve the understanding of the interactions between the protons and the target recently joined the NA61/SHINE collaboration. The collection of these precise hadro-production measurements will support Fermilab experiments such as MINOS(+), MINERnA, NOnA, and DUNE.
A pilot run took place in 2012 with the first extensive data collection phase scheduled for Fall 2015. Unfortunately the vertex magnet suffered problems with its cryogenic system. Moreover it was recommended replacing the magnet safety system before any further operation of the magnets. Therefore the 2015 run was cut short and data was collected with the vertex magnets off precluding any differential cross-section measurements. However these data sets are presently being used for determining important total cross-sections. CERN made a major effort to repair the cryo-system and build a new safety system over the winter and the magnets were successfully powered on again in May 2016. The group took their first data with a completely operational detector starting with one week in late July, and a six-week period in September-October 2016. The beam-target configurations used were: 60 GeV/c pions on carbon and beryllium, 60 GeV/c protons on carbon, beryllium, and aluminum, and 120 GeV/c protons on carbon (see Figure 2) and beryllium. For each setting 2.2 - 4 million events were recorded, close to the groups goal of ~3 million in each mode.
Figure 2: Data collection time-line for proton on Carbon at 120 GeV mode. ~4 million triggers recorded over a 6 day period.
The team hopes for at least two more years of data-taking at CERN. The plan is to take additional statistics in some of the configurations we collected in 2016 as well as other beam/target/energy combinations, including possible long targets, to allow us to fill out the matrix of primary and secondary interaction hadro-production cross-sections applicable to Fermilab neutrino beams. The design of the DUNE target should be ready by the end of the long shutdown and we hope to take data with a replica target at that time. | https://ep-news.web.cern.ch/content/na61shine-efforts-support-us-neutrino-physics-program |
Click Here for Menu
Collectively changing the approach to extractive development and increasing the likelihood that communities see sustained positive outcomes.
NetPositive believes that our approach to extractive development needs to change: we need to prioritize social and environmental outcomes. We work with affected communities, companies, governments, and other stakeholders to collectively change the approach to extractive development and increase the likelihood that communities will see sustained positive outcomes from mining and oil and gas. We do this through collaborative research and problem solving that positions these groups to take collective action on priority social issues.
If extractive development is to bring sustained positive outcomes to local communities, the status quo won’t cut it and a systemic step change is needed. By building and sharing evidence about what an effective approach looks like, we are dedicated to supporting those incremental changes that will bring us toward collective, systemic change.
The extractive sector affects communities in Canada and around the world on a daily basis. More often than not, those communities are not left better off. NetPositive believes a new approach is needed, one that brings communities to the center of the extractive development system. We’re pushing for change based on real evidence of what works. | https://tidescanada.org/projects/netpositive/ |
Few empires throughout history have been as extensive and have bequeathed as many things to civilization as the Roman Empire. His footprints can be seen throughout Europe, North Africa, and the Asian area of Middle East. So today we are going to stop at an impressive Roman-era monument in Bulgaria. Specifically in the city of Plovdiv, the second in the country, and one of the oldest cities in the world, since it is estimated that there has been a population here for 8 millennia.
Plovdiv Roman Theatre
The Plovdiv Roman Theater was built during the rule of Emperor Trajan, back in the second century AD. And thanks to various restorations, it is one of the best preserved of its kind on the entire continent.
The truth is that it came back to light during the last third of the last century, since it had remained buried for centuries. But after several years of archaeological campaigns it re-emerged to the surface.
This is a venue that could have held up to 7,000 spectators in its best performances, and that is because the spectator area is larger than a semicircle, and has an amphitheater design. In it there were up to 28 rows of marble seats, divided into two different categories, separated by an aisle area. Although only 20 of those rows remain today, and therest was lost after the site was destroyed in the 4th century.
The truth is that the stands that are set on the ground have been preserved, taking advantage of the slope of the hill that houses the theater. And the rows that disappeared would be built and elevated by a structure of which only the foundations are known today.
Also at that same time (perhaps an earthquake) the area of the scene collapsed, but today it is perfectly rebuilt with its three stories high, in which various columns and pediments can be distinguished. Although, only what has been reconstructed from archaeological materials has been raised. And when new materials have been used, this is immediately visible, since the reconstruction and restoration was carried out following the anastylosis approach, thanks to which a coloration clearly marks what is new and old.
As a curiosity, it must be said that in many seats the registration of its user has been discovered. Names that correspond to local rulers, but also to friends of the emperor himself.
Anyway, today this Roman theatre is still a scenic space, and there are theater performances in it again. This puts it on a par with other buildings from the Roman era, such as the Verona Amphitheater in Italy or the Mérida Theater in Spain. | https://technology-news-hub.com/17124714-plovdiv-roman-theater |
U.S. military veterans were six times more likely to experience a sleep disorder in the year 2010 than they were in 2000, according to a new study of more than 9.7 million U.S. veterans published in the journal Sleep.
The largest increases were identified in patients with post-traumatic stress disorder (PTSD), other mental disorders, or combat experience. Veterans with cardiovascular disease, cancer, or other chronic diseases also experienced higher rates of sleep disorder diagnoses relative to those without comorbid conditions.
The findings also show that the prevalence of PTSD tripled during the 11-year study period.
“Veterans with PTSD had a very high sleep disorder prevalence of 16 percent, the highest among the various health conditions or other population characteristics that we examined,” said principal investigator and senior author James Burch, Ph.D., associate professor in the Department of Epidemiology and Biostatistics in the Arnold School of Public Health at the University of South Carolina.
“Because of the way this study was designed, this does not prove that PTSD caused the increase in sleep disorder diagnoses,” noted Burch, also a researcher at the WJB Dorn Department of Veterans Affairs Medical Center in Columbia, South Carolina.
“However, we recently completed a follow-up study, soon to be submitted for publication, that examined this issue in detail. In that study, a pre-existing history of PTSD was associated with an increased odds of sleep disorder onset.”
During the study period, the age-adjusted prevalence of sleep disorders increased from less than one percent in 2000 to nearly six percent in 2010. Sleep apnea was the most common sleep disorder diagnosis (47 percent) followed by insomnia (26 percent).
Sleep apnea is a sleep-related breathing disorder characterized by abnormalities of respiration during sleep, according to the American Academy of Sleep Medicine. The most common form of sleep apnea is obstructive sleep apnea, which involves repeated episodes of complete or partial upper airway obstruction occurring during sleep.
Insomnia is characterized by having frequent and persistent difficulty initiating or maintaining sleep that results in general sleep dissatisfaction and daytime impairment.
The study population consisted of all U.S. veterans seeking care in the Veterans Health Administration system between the years 2000 and 2010. Of the total sample of 9,786,778 veterans, 93 percent were men, and 751,502 were diagnosed with at least one sleep disorder. | https://psychcentral.com/news/2016/07/16/sleep-disorders-among-vets-on-the-rise/107244.html |
TGS Share Repurchase
Oslo, Norway (14 December 2021) – On period from 09 December 2021 to 13 December 2021, TGS ASA (TGS) purchased 45,000 own shares on the Oslo Stock Exchange at an average price of NOK 85.4300 per share. Following the purchase TGS owns 1,334,261 shares, representing 1.136% of the total outstanding shares.
The shares were purchased in connection with the share repurchase announced on 11 February 2021.
Overview of transactions
Date
Aggregated daily volume (number of shares)
Weighted average share price per day (NOK)
Total daily transaction value (NOK)
9-Dec-21
20,000
85.5933
1,711,866
10-Dec-21
20,000
85.4667
1,709,334
13-Dec-21
5,000
84.6300
423,150
Previously disclosed buy-backs under the program (accumulated)
1,274,261
103.4880
131,870,674
Accumulated under the buy-back program
1,319,261
102.8720
135,715,024
The issuer's holding of own shares:
Following the completion of the above transactions, TGS owns a total of 1,334,261 own shares, corresponding to 1.136% of TGS' share capital.
Appendix:
An overview of all transactions made under the buy-back programme that have been carried out during the above-mentioned time period is attached to this report and available at www.newsweb.no.
About TGS TGS provides scientific data and intelligence to companies active in the energy sector. In addition to a global, extensive and diverse energy data library, TGS offers specialized services such as advanced processing and analytics alongside cloud-based data applications and solutions.
Recommended Stories
Shares of semiconductor company Nvidia (NASDAQ: NVDA) dropped again on Monday -- down 4.2% as of noon ET -- its fourth straight down day in a row. There doesn't appear to be any particular news behind today's decline, at least not specific to Nvidia. Although high demand for high-end Nvidia graphics chips is generally good news for the company and its pricing power, the network notes that "semiconductors are beneath the hood of an increasing number of products," but "things made with chips don't just use one chip." Thus, even a PC manufacturer lucky enough to get hold of all the Nvidia chips it needs might not be able to sell its PC if it can't also get all the power control, memory, and other chips it also needs to build the product.
Heading into year’s end, the Street’s professional analysts are busy putting together their predictive models, working to give investors an idea just where the markets are heading. All in all, it would seem to be a positive picture; despite some recent volatility, the markets are still following the sustained upward trend they’ve been on since the spring of last year. Writing from Oppenheimer, chief investment strategist John Stoltzfus leads the bulls. He sees gains of 13% in store for the S&P 5
Shares of Chinese electric car manufacturer Nio (NYSE: NIO) crashed 4% in very early trading this morning before beginning to bounce around, first higher, then lower again. A confluence of negative macroeconomic news headlines out of China may be weighing on Nio shares. First and foremost, of course, is the worry that the United States Securities and Exchange Commission (SEC) may begin delisting Chinese shares because of China's failure to permit its companies to subject themselves to audit inspection by the U.S. Public Company Accounting Oversight Board. On top of that worry, though, last week Chinese property giant China Evergrande Group finally and officially placed itself in default when it missed a final deadline to pay interest due on about $1.2 billion worth of international loans.
Rags to riches is a common trope in our storytelling. Some people actually live it, and few more so than hedge fund billionaire Israel Englander. Using $35 million in seed money, Englander started Millennium Management – and by 2019 his firm was managing over $39 billion. As of this year, that number is up to $57 billion. In 2020, Millennium brought in a total of $10.2 billion for its investors, and Englander took home $3.8 billion in personal earnings – which made him the highest paid fund mana
In this article, we discuss 10 high dividend stocks with over 12% yield. If you want to skip our detailed analysis of dividend investing and these stocks, go directly to 5 High Dividend Stocks with Over 12% Yield. Dividend investing has always been an attractive option for investors who are looking for passive income, retired […]
Metaverse news has been flooding the headlines ever since Facebook changed its name to Meta Platforms. No one knows how successful, if at all, the metaverse will be. Two companies providing metaverse services are CrowdStrike (NASDAQ: CRWD) and Unity Software (NYSE: U). Crowdstrike provides endpoint security software to secure network access points.
In this article, we discuss Warren Buffett’s top 10 stock picks. If you want to skip our detailed analysis of these stocks, go directly to Warren Buffett’s Top 5 Stock Picks. Warren Buffett, the 91-year-old fund manager of Berkshire Hathaway, is one of the most-watched investors in the world. The legendary investor is the brain behind the […]
Stock futures were up on Monday following declines during the earlier trading session for all three major U.S. indexes as investors set their sights on a prolific week in Washington that includes the Fed's final policy-setting meeting of 2021.
Jack Dorsey's been busy. The tech visionary stepped down as CEO of Twitter on Nov. 29, and a day later, his other company announced it would soon change its name from Square to Block (NYSE: SQ), a move that's now official. This follows Meta Platforms' name change in October, from Facebook, in an effort to identify with the developing metaverse. Along the way, it's become a champion of cryptocurrency, specifically Bitcoin, as a native internet token. | |
WELCOME TO WORDSMITH PRESS LLC
Do you have a story to tell? Have you ever dreamt of being a published author? If so, then Wordsmith Press LLC is here to assist you in bringing your dreams to life.
Wordsmith Press LLC is a newly established publishing company that focuses on publishing material that will keep readers entertained. Our staff is committed to assisting new and existing wordsmiths in bringing their stories to publication. Our team of authors and writers are dedicated to creating bodies of work that will resonate with readers from all walks of life.
We are here for you. The author. The writer. The wordsmith. | http://www.wordsmithpress.org/ |
The ACCESS Leadership College – led by Dr. Saffron O’Neill (University of Exeter) is an opportunity for emerging leaders (based in the UK) who are using social science to tackle environmental problems to be part of a cohort of people from diverse sectors (academia, public sector, NGOs and charities, business) to work, learn and grow as leaders together: as they work to address the social science challenges associated with the transition to a sustainable and biodiverse environment and a net zero society. We are looking for environmental social scientists who can demonstrate emerging leadership, and who are enthusiastic about working in an interdisciplinary way to champion the use of social science to tackle environmental problems. Fellows will be working as catalysts for change within their own organisation, within their sector, or beyond.
The closing date for applications is Friday 16 December, 16:00 GMT
The ACCESS Leadership College is designed to build capacity in environmental social science throughout the UK, through fostering a community of emerging leaders who are well informed about the social science dimensions of environmental challenges.
ACCESS Leadership College fellows will come together for a 3-day residential retreat every year, over four years (2023-2026). Each retreat will focus on a topic of concern for environmental social scientists, with contributions from international experts. The retreats will provide opportunities for training, knowledge exchange, mentoring and career development; through a mix of formal and participant-led learning. The College will also provide opportunities for the group to get to know and learn from each other in an interdisciplinary setting. The same participant cohort will attend throughout the four years, to maximise opportunities for peer-to-peer learning, networking and collaboration. In addition, the College will provide opportunities for the group to work together on funding applications towards the ACCESS Flexible Fund.
Applicants will need to commit to attending a three-day, in-person retreat each year over the four years of the College (2023-2026 inclusive). The first College event will be held 26-28th April 2023 at Dartington Hall in Devon, with a focus on ‘Health, Wellbeing and the Environment’.
Applications should be made via the ACCESS Leadership College application form. If you have a query, it may be answered in the FAQs (scroll down the page). If your question is not answered in the FAQs, please get in touch: [email protected]. | https://masts.ac.uk/opportunities/access-leadership-college-call-for-applications-from-environmental-social-scientists-now-open/ |
Work permit rules revised
The Bureau of Immigration issued new guidelines for the issuance of Special Work Permit and Provisional Work Permit following the surge in the number of Chinese workers in the Philippines.
Immigration Commissioner Jaime Morente signed Operations Order No. JHM-2019-002, requiring foreign nationals intending to work in the Philippines to submit additional documents before they are issued an SWP or PWP, in a bid to discourage and minimize the number of foreign workers in the country.
The issuance of new guidelines for SWP and PWP was triggered by reports of mounting complaints from various labor groups, which claims that thousands of foreign workers, mostly Chinese, were working in the construction sites and other technical jobs which can be filled by Filipino workers.
Under the new guidelines, the BI will no longer issue SWP or PWP to construction workers, cashiers, waiters, janitors, household helps, carpenters, garbage collectors, security guards, warehouse caretakers, and other analogous labor.
However, the bureau may still issue SWP or PWP to highly technical positions provided that they first secure a Special Temporary Permit from the Professional Regulation Commission.
To acquire a SWP/PWP, foreign workers are required to submit the following:
At least 20 days validity of Temporary Visitors Visa (TVV) at the time of application; existence and capability of petitioning company; address of the company and applicant (residence); nature of business of the petitioning company as reflected in its SEC Certificate and; whether the company has a valid appropriate government license to operate.
The BI said that an applicant can only work for the position applied for and for the said company.
The Alien Control Officer (ACO), acting Alien Control Officer (AACO) or duly authorized personnel shall approve or disapprove SWP/PWP application filed within their area of jurisdiction. However, the BI satellite offices at SM Aura and Makati will not be allowed to issue SWP/PWP and all applicants are advised to secure their SWP/PWP at the main office in Intramuros, Manila.
Related stories:
More from this Category:
COMMENT DISCLAIMER: Reader comments posted on this Web site are not in any way endorsed by Manila Standard. Comments are views by manilastandard.net readers who exercise their right to free expression and they do not necessarily represent or reflect the position or viewpoint of manilastandard.net. While reserving this publication’s right to delete comments that are deemed offensive, indecent or inconsistent with Manila Standard editorial standards, Manila Standard may not be held liable for any false information posted by readers in this comments section. | |
We specialize in building, managing, and maintaining wealth through strategic, personalized investment approaches across individual time horizons and life-stages. Our Wealth Management and Creation approach focuses on our clients’ unique individual, family, and business needs.
For certain qualified clients, we consider and offer opportunities to access Structured Financial Products and Alternative Investments as a way of achieving targeted returns in an investment portfolio. Such products can offer a possibility of achieving significantly higher than market returns with increasing commensurate risk including loss of principal.
Access to our Structured Financial Products and Alternatives investments may be limited by Securities and Exchange Commission (“SEC”) and State of California and Nevada exemptions for Accredited Investors. Please contact us for additional information. | http://www.smrwealth.com/services-offered/ |
Because we deserve better. We deserve someone who will work for our community.
New York City Charter
The New York City Charter needs to be revised to reflect the needs of our city and communities. City Charter should empower and support New York City Residents By giving communities a voice into the changes they want in their districts.
- Rezoning: each district should have an active participation in the planning of land use within its borders.
- Invest in Community Land Trust.
- Allow the city council to have an input into who is appointed to executives offices such as boards, and as commissioner:
- Police Commissioner.
- HPD Commissioner.
- NYC Chancellor.
- Animal Care and Control Director.
- Create a non partisan board that will ensure that the city is complying with its ordinance and laws.
- Allow the Recall of all elected officials from judges, the mayor and district leaders. This will assure transparency and accountability from our elected officials.
Animal Rights and Advocacy
As a pet parent and animal lover I want to implement laws where our fur babies are protected and treated humanely. I will be their voice as they cannot speak for themselves.
- Allow Pet parents to have their pets living with them without fearing being evicted or harrasssed by their landlords. Create pet friendly housing.
- Teach Humane Education in our schools.
- End the unnecessary euthanization of healthy animals by declaring N YC a no Kill animal shelter. This will be accomplished by funding TNR Rescue Groups and increasing the Funding to Free/Low Cost Spay and Neuter programs.
- Ban the sale of Dogs at petstore to end Puppy mills.
- Ban horse carriage in New York City.
- Allow business to have “Working Pets” must be spayed/neutered and up to date with their immunization. Also need to be registered with the NYC Department of Health animal control unit.
Housing Insecurities
"Housing is a Human Right"
Unfortunately too many of our elected officials are deaf to the cries of our citizens. This is reflective in the policies and laws they implement. Since too many of our elected official's are in the pockets of developers and landlords. As your city council representative I will make housing a priority. *End Warehousing of Apartments. This will increase the market of available apartments.
*Preserve existing housing by having HPD inspectors inspect apartments and correctly classify violations. *Assuring that landlords make repairs and that HPD enforce the correction of violations.
*Permit HPD to make repairs in situations where the violations are hazardous and endanger the life of tenants
*Housing court fine and have city collect monies from landlords who fail to make repairs.
*Enforce and supervise the enactment of tenant harassment and discrimination laws. * Housing Lottery Program needs to be reflective of the income from each district in order to be effective as a program for low to moderate New Yorkers. *Reform the shelter system homeless New Yorkers should transition to permanent housing as soon as possible.
*Allow pets in shelters with their pet parent.
“Food Insecurities – EBT/SNAP”
2) I will advocate for all Supermarkets/Food Outlets/Farmers Markets to offer a specific discount at the check out registers when the EBT/SNAP card is presented as payment, and thus allowing the EBT/SNAP monies to last out a little longer. I will ask that the City offer financial incentives to the supermarket owners to allow such discounts to be in place.
4) I will advocate that many businesses offer to EBT/SNAP card recipients the ability to purchase other necessary items such as diapers, clothes/shoes/ school supplies for their children, pet food offering significant discounts for purchases. I will also ask that these businesses offer discounts and that the City offer financial incentives for this proposal to take place.
5) I will co-sponsor legislation that would allow EBT/SNAP cardholders and up to 3 family members to enter all city controlled cultural institutions for free.
Private cultural institutions will also be asked to offer free entry, or alternatively to offer a max of $3. per family unit (this policy exists in many cities across the US – Boston, Chicago, Philadelphia , Pittsburg, etc.). So then why not have this policy all across NYC so that the poor can take their children to the finest Science Museums, Fine Arts Museums, Botanical Gardens and Zoos..
Disabled Community
1) Assuring that all residential buildings in District 10 be fully accessible, along with all businesses and the MTA.
2) Have the City, State and Federal offer financial incentives to allow all residential buildings and businesses in district 10 to become fully accessible by 2030 and comply with the Federal ADA code.
4) Offer financial incentives to employers who hire disabled employees.
5) The disabled children in District 10 will be given the best education possible, with specialized schools and qualified special needs teachers.
New York City Government
In order for us to have a city that works for all of us we need to address and change systematic racism and inequalities in our agencies and in the operation of our government.
- We need to prioritize municipal budget to fund programs desperately needed in our communities like: Social service and mental health.
- Invest in Job Training for adults of all ages to better prepare our work force for decent paying jobs; IT, social media , nursing, green jobs.
- Create a peoples bank
New York City Employees
During this pandemic it became evident how essential we are to the city we serve. Because of systematic racism and bad decisions on behalf of our elected officials too many of our fellow city employees lost their lives. As the city starts to recover and rebuild we need to look at the failed policies which allowed the loss of hundreds of city employees. Such policies as:
- Time and leave regulations which need to be revised.
- Better health care system to include coverage and more public hospitals to care and treat every New Yorker needing medical attention.
- Our Hospital need to be equipped with the latest equipment and supplies.
- Unions need to be taken into account during crisis. As they are the voice of their members and the voice of the city employee.
New York City Green New Deal
New York City must create public Policy to address climate change.
- We need to expand our current composting and recycling programs.
- New york city needs to expand its GrowNYC Program.
- We need to end the practice of allowing corporations to throw away goods which can be donated.
- We need to continue planting trees.
- We need to build green buildings.
- We need to protect our parks and green space from developers. | https://castellanosfortheheights.com/ |
United States Court of Appeals
Fifth Circuit
F I L E D
IN THE UNITED STATES COURT OF APPEALS
FOR THE FIFTH CIRCUIT February 23, 2006
Charles R. Fulbruge III
Clerk
No. 05-40241
Conference Calendar
UNITED STATES OF AMERICA,
Plaintiff-Appellee,
versus
VLADIMIR SALGADO-BRITO, also known as Pablo Alvarez-Gutierrez,
Defendant-Appellant.
--------------------
Appeal from the United States District Court
for the Southern District of Texas
USDC No. 7:04-CR-551-ALL
--------------------
Before GARZA, DENNIS, and PRADO, Circuit Judges.
PER CURIAM:*
Pursuant to a written agreement, Vladimir Salgado-Brito
pleaded guilty to illegal reentry after removal from the United
States in violation of 8 U.S.C. § 1326(a), (b). He appeals his
conviction and sentence of 33 months of imprisonment.
Salgado-Brito argues for the first time on appeal that the
“felony” and “aggravated felony” provisions of § 1326(b) are
unconstitutional. We need not decide the applicability of the
*
Pursuant to 5TH CIR. R. 47.5, the court has determined that
this opinion should not be published and is not precedent except
under the limited circumstances set forth in 5TH CIR. R. 47.5.4.
No. 05-40241
-2-
waiver in this case because the issue that Salgado-Brito raises
is foreclosed.
Salgado-Brito’s constitutional challenge to § 1326(b) is
foreclosed by Almendarez-Torres v. United States, 523 U.S. 224,
235 (1998). Although Salgado-Brito contends that
Almendarez-Torres was incorrectly decided and that a majority of
the Supreme Court would overrule Almendarez-Torres in light of
Apprendi v. New Jersey, 530 U.S. 466 (2000), we have repeatedly
rejected such arguments on the basis that Almendarez-Torres
remains binding. See United States v. Garza-Lopez, 410 F.3d 268,
276 (5th Cir.), cert. denied, 126 S. Ct. 298 (2005). Salgado-
Brito properly concedes that his argument is foreclosed in light
of Almendarez-Torres and circuit precedent, but he raises it here
to preserve it for further review.
Accordingly, the conviction and sentence are AFFIRMED.
| |
ROSTELECOM PJSC (RKMD)
ROSTELECOM PJSC: Rostelecom Shareholders vote to place additional shares as
part of the transaction to consolidate 100% of Tele2 Russia
19-Dec-2019 / 13:01 MSK
Dissemination of a Regulatory Announcement that contains inside information
according to REGULATION (EU) No 596/2014 (MAR), transmitted by EQS Group.
The issuer is solely responsible for the content of this announcement.
Rostelecom Shareholders vote to place additional shares as part of the
transaction to consolidate 100% of Tele2 Russia
Moscow, Russia - December 19, 2019 - Rostelecom PJSC (MOEX - RTS: RTKM,
RTKMP; OTCQX: ROSYY), Russia's national telecommunications operator, today
announces that on December 18, 2019, its Extraordinary General Meeting (the
"EGM") has approved in favour of increasing Rostelecom's charter capital by
placing additional shares. The placement of additional shares is an integral
part of the complex transaction to consolidate 100% of Tele2 Russia [1][1].
The additional shares will be issued through a private placement offering to
VTB Bank (Public Joint-Stock Company). The issue price, including the price
of shares offered to holders of preemptive rights to acquire them, amounts
to RUB 93.21 per share.
The number of additionally issued ordinary shares will not exceed
1,200,000,000 (including the shares acquired in line with the preemptive
right).
Further information is available at
https://www.company.rt.ru/en/ir/news_calendar/ [2].
* * *
PJSC Rostelecom [3] is the largest digital service provider, operating in
all segments of the telecommunications market in Russia, it serves millions
of households, the state and private enterprises across the country.
Rostelecom is Russia's undisputed market leader, providing high-speed
Internet access to over 13.1 million users and pay-TV services to more than
10.3 million clients, over 5.5 million of which are subscribed to
Rostelecom's IPTV services on a national level.
In the nine months of 2019, the Group generated RUB 242.6 billion of
revenues, RUB 81.4 billion of OIBDA (33.6% of revenue) and RUB 16.4 billion
of net income.
The Group is the leading provider of telecommunications services to
government bodies and corporates of all levels.
Rostelecom is a key strategic innovator that provides solutions in the
following fields: E-Government, cybersecurity, data-centers and cloud
computing, biometry, healthcare, education and housing & utility services.
The Group's stable financial position is confirmed by its credit ratings.
Rostelecom has been assigned 'BBB-' and 'BB+' international credit ratings
by Fitch Ratings and Standard&Poor's respectively, and AA(RU) by ACRA.
* * *
Certain statements in this press release are forward-looking statements
within the meaning of the U.S. federal securities laws and intended to be
covered by the safe harbours created thereby.
Those forward-looking statements include, but are not limited to:
? Assessment of PAO Rostelecom's (the Company) future operating and
financial results as well as forecasts of the present value of future cash
flows and related factors;
? The Company's plans to take ownership stakes in other organisations;
? the Company's anticipated capital expenditures and plans to construct
and modernize its network;
? the Company's expectations as to the growth in demand for its services,
plans relating to the expansion of the range of its services and their
pricing;
? the Company's plans with respect to improving its corporate governance
practices;
? the Company's expectations as to its position in the telecommunications
market and forecasts on the development of the market segments within
which the Company operates;
? economic outlook and industry trends;
? the Company's expectations as to the regulation of the Russian
telecommunications industry and assessment of impact of regulatory
initiatives on the Company's activity;
? other statements regarding matters that are not historical facts.
Such forward-looking statements are subject to risks, uncertainties and
other factors, which could cause actual results to differ materially from
those expressed or implied by these forward-looking statements. These risks,
uncertainties and other factors include:
? risks relating to changes in political, economic and social conditions
in Russia as well as changes in global economic conditions;
? risks relating to Russian legislation, regulation and taxation,
including laws, regulations, decrees and decisions governing the Russian
telecommunications industry, securities industry as well as currency and
exchange controls relating to Russian entities and their official
interpretation by regulatory bodies;
? risks relating to the Company, including the achievement of the
anticipated results, levels of profitability and growth, ability to create
and meet demand for the Company's services including their promotions, and
the ability of the Company to remain competitive in a liberalized
telecommunications market;
? technological risks associated with the functioning and development of
the telecommunications infrastructure, technological innovations as well
as the convergence of technologies;
? other risks and uncertainties. For a more detailed discussion of these
and other factors, see the Company's Annual Report and the Company's other
public filings.
Many of these factors are beyond the Company's ability to control or
predict. Given these and other uncertainties, readers are cautioned not to
place undue reliance on any of the forward-looking statements contained
herein or otherwise. The Company does not undertake any obligation to
release publicly any revisions to these forward-looking statements (which
are made as of the date hereof) to reflect events or circumstances upon the
annual report publication or to reflect the occurrence of unanticipated
events, except as may be required under applicable laws.
=---------------------------------------------------------------------------
[1] In line with the Decree of the President of Russia #480 as of 03.10.2019
and the Board of Directors decision as of 13.11.2019, Minutes #6
ISIN: US7785291078
Category Code: ROM
TIDM: RKMD
LEI Code: 2534001D752JPNM0H170
Sequence No.: 36399
EQS News ID: 940179
End of Announcement EQS News Service
1: https://link.cockpit.eqs.com/cgi-bin/fncls.ssp?fn=redirect&url=1051555dbf94591b129cdb1d791d6f6e&application_id=940179&site_id=vwd&application_name=news
2: https://link.cockpit.eqs.com/cgi-bin/fncls.ssp?fn=redirect&url=6415b37abbeaba846e8e06da62607d4f&application_id=940179&site_id=vwd&application_name=news
3: https://link.cockpit.eqs.com/cgi-bin/fncls.ssp?fn=redirect&url=2191e3bd109978bbadf8617de6d24ca7&application_id=940179&site_id=vwd&application_name=news | |
09/01/2013 - The OECD today announced the winner of its first-ever global data visualisation challenge.
The challenge, conducted in concert with Visualizing.org, was launched in September 2012 to solicit visualisations based on the OECD’s data-rich Education at a Glance report. Entries from around the world focused on data related to the economic costs and return on investment in education — both for the individual and for society. Winners Krisztina Szucs and Mate Cziner from Hungary were chosen for successfully breaking down the complex interplay between costs and returns into a form that is easy to compare.[please see below]. Their entry takes a detailed look at public vs. private and men vs. women for selected countries, which can be changed.
The judges were particularly impressed by the angled slope format of the visualisation, which encourages comparison between the upper-secondary and tertiary benefits of education. Szucs and Cziner were also lauded for their striking visual design, which draws users into exploring their piece.
The winner will receive $2500 and will be invited to attend this year’s OECD Forum, taking place in Paris in the last week of May.
The judges also awarded an honorable mention to That’s Edu, by Carlo Zapponi, for its friendly design and intuitive interface.
The importance of education is little disputed, but really understanding the complex interplay between education and society is exceedingly difficult. As part of its commitment to promoting policies that will improve the economic and social well-being of people around the world, the OECD publishes a wide-range of statistics and indicators on educational systems and learning outcomes. By looking at data across the 34 OECD countries, as well as selected non-member countries, comparative analysis can reveal trends and insights crucial to shaping policy and improving well-being through education.
To read more on this, please visit the Insights blog and Education Today.
The OECD is the global economic policy forum. It provides analysis and advice to its 34 member governments and other countries worldwide, promoting better policies for better lives.
Visualizing.org helps make data visualisations more accessible to the general public; promotes information and literacy through the creation, sharing and discussion of data visualisations; and provides unique resources to help simplify complex issues through design.
Follow the OECD on Twitter and Facebook. | http://www.oecd.org/newsroom/oecdannounceswinnerofglobaldatavisualizationcompetition.htm |
It is interesting to note that for continental drift, the majority of the facts were collected from the continental areas in the form of allocation of flora and fauna or deposits like finite. A number of discoveries during the post-war era added the latest information to geological literature.
Particularly, the information collected from the ocean floor mapping provided new dimensions for the study of the distribution of oceans and continents.
Convectional Current Theory
Arthur Holmes in the 1930s discussed the chance of convection currents operating in the mantle portion. These currents are generated due to radioactive elements causing thermal differences in the mantle portion. Holmes tried to explain the force factor behind continental drift. Convectional Current Theory says that:
- Convectional current operating in the mantle portion. These currents are generated due to radioactive elements causing thermal differences in the mantle portion.
- Currents are nothing but molten rocks that move like cells in the mantle portion of the earth.
- Due to heat from radioactive elements present in the core of the Earth and also primordial energy left inside the earth.
Holmes argued that there exists a system of such currents in the entire mantle portion. This was an attempt to provide an explanation to the Issue of force. on the origin of which contemporary scientists discarded the continental drift theory.
Mapping of the Ocean Floor
Detailed research of the ocean configuration revealed that the ocean floor is not just a vast plain but it is full of relief. In the post-war period, a geologist was able to collect information from ocean floor. Expeditions to map the oceanic floor in the post-war period provided a detailed picture of the ocean relief and indicated the existence of submerged mountain ranges as well as deep trenches, mostly located close to the continental margins. Dating of rocks from oceanic crust reveals that they are much younger than continental areas. The mid-oceanic ridges were found to be most active in terms of volcanic eruptions. The dating of the rocks from the oceanic crust revealed the reality that the latter is much younger than the continental areas. Rocks on either side of the crest of oceanic ridges and having equidistant locations from the crest were found to have notable similarities both in terms of their constituents and their age.
Particularly, the mapping of the ocean floor and further studies of rocks from the oceanic region revealed the following facts:
(i) All along the mid-oceanic ridges, volcanic eruptions are scattered which bring out huge amounts of lava to the surface in this area.
(ii)The rocks central on either side of the ridge of mid-oceanic ridges have notable similarities in terms of a period of the structure, chemical compositions, and magnetic properties.
(iii)The ocean crust rocks are much younger than the continental rocks. The oldest rock of the ocean crust is no older than 200 million years, while some of the continental rocks are as old as 3,200 million years.
(iv)The deep trenches have deep-seated earthquake occurrences while in the mid-oceanic ridge areas, the quake foci have shallow depths. | https://qsstudy.com/post-drift-studies/ |
The present invention relates to a method for continuous casting of steel, and more particularly to a method for controlling a flow of molten steel fed from an immersion nozzle into a mold for continuous casting of steel by the use of magnetic force.
Fig.7 is a schematic illustration showing a flow of molten steel from an immersion nozzle into a mold in a slab continuous caster. Mold powder floats on the surface of the molten steel 8 inside the mold 1. The mold powder performs a prevention of the molten steel 8 from being oxidized, thermal insulation of the molten steel 8, lubrication between solidified shell 9 and the mold 1 and adsorption of non-metallic inclusions or the like. The mold powder on the side of molten steel surface is in the state of being melted by the heat of the molten steel 8. The mold powder on the side of the atmosphere covers the surface of the molten steel 8 in the form of powder 7. Molten powder 6 flows into between the solidified shell 9 and the mold 1 and plays a role of lubricant. The molten powder 6 is replenished at a rate of its consumtion since it is consumed as the libricant. The thickness of the mold powder layer is controlled to be a predetermined value. Immersion nozzle 2 is vertically positioned at the central portion of the mold 1. Exit ports 3 arranged at the end of the immersion nozzle 2 have an opening facing narrow side walls of the mold 1. The molten steel is poured from the exit port 3. Flow 4 of the poured molten steel moves downward obliquely toward the narrow side wall of the mold. The flow 4 of the poured molten steel strikes the narrow side wall of the mold and is divided into an upward flow and a downward flow, that is, turn-over flow 11 and penetration flow 12. The turn-over flow 11 rises along the narrow side wall of the mold and becomes a cause of a wavy motion of a molten steel surface near the narrow side wall of the mold. Fig.8 is a schematic illustration showing the wavy motion of molten steel surface inside the mold. The flow poured from the exit port 3 of the immersion nozzle 2 is divided into the turn-over flow 11 and the penetration flow 12. The turn-over flow 11 reaches the molten steel surface and causes the level of the molten steel surface to fluctuate. Fluctuation of the molten steel surface gives rise to the wavy motion of the molten steel surface. The wavy motion of the molten steel surface is measured by means of eddy current type distance measuring device 15. The voltage signal is filtered, by which high frequency elements are removed. The voltage signal, from which the high frequency elements have been removed, is measured by means of a millivoltmeter. The eddy current type distance measuring device 15 is arranged above the molten steel surface near the narrow side of the mold as shown in Fig.8. Fig.8 is a schematic illustration showing the wavy motion of the molten steel for about one minute. The molten steel surface continuously rises or falls. The level of the wavy motion of the molten steel for one minute is measured. The maximum value of the level of the wavy motion of the molten steel is regarded as the maximum height " h " of a wave of the molten steel surface and a data processing is carried out. In a high rate casting, wherein molten steel of 3 ton/min or more is poured, a flow rate of molten steel poured from the exit port 3 of the immersion nozzle 2 is large. The turn-over flow 11 of molten steel which is produced after the flow of poured molten steel has struck the solidified shell 9 also is large and causes a large wavy motion of molten steel to be formed. Fig.10 is a graphical representation designating the relationship between the maximum height of the wavy motion of molten steel surface and the index of surface defect of hot-rolled steel plate. As clearly seen from Fig.10, the ratio of occurrence of the surface defect of hot-rolled steel plate is small when the maximum height of wavy motion of molten steel surface is within a range of 4 to 8 mm. The range of 4 to 8 mm of the maximum height of wavy motion of molten steel surface is preferable. In case the wavy motion of molten steel surface is large, molten powder 6 is easily trapped by the molten steel by the wavy motion of molten steel surface and suspended in the molten steel. The molten powder 6 having been trapped by the molten steel rises on the surface of molten steel due to a difference in the specific weights of the molten steel and the molten powder 6, but some of the molten powder 6 is caught by the solidified shell 9. On the other hand, when the wavy motion of molten steel surface is small, a small amount of new molten steel is fed to the molten steel surface. In consequence, the mold powder 5 is hard to melt. Accordingly, it is hard for the inclusions to be melted and adsorbed into the molten powder 6. The inclusions are caught by the solidified shell 9 and are liable to be inner defect of a slab. The values of 4 to 8mm which are the preferable range of the maximum height of molten steel surface were obtained by experience in operations of continuous casting. The form and the pouring angle of the immersion nozzle 2, clogging in the immersion nozzle 2 and the width of the mold 1 are specified so that the maximum height of wavy motion of molten steel surface can be within said range.
(a) The multiple continuous casting of steel in which several charges of casting are continuously carried out by the use of one tundish and one immersion nozzle.
(b) The change of widths of mold during the continuous casting of steel.
(c) The change of casting rate from a low value to a high value.
Recently, however, the operations shown below have been carried out and operation conditions have changed to increase productivity in the continuous casting of steel.
As the result of the change of the aforementioned operation conditions, the form and the pouring angle of the immersion nozzle, set for the initial operation, does not fit to the successive operation conditions, which leads to the incapability of the control of the level of the molten steel to the most pertinent range.
Two methods are known as technologies of controlling the height of wavy motion of molten steel surface. The prior art method 1 is a method wherein a flow of molten steel poured from two exit ports is braked by a direct current magnetic field. Two pairs of direct current magnets are arranged inside a cooling box of a surface on the wide side of a mold and introduce a direct current magnetic field to the flow of molten steel poured from the immersion nozzle. The flow of molten steel is controlled by magnetic force produced in the direction opposite to the flow of molten steel under induced electric current and direct current magnetic field which are produced in flowing molten steel. The prior art method 2 is a method wherein direct current magnetic field is introduced to the position of the molten steel surface. The height of wavy motion of molten steel surface in the magnetic field is controlled by arranging a direct current magnet at the position of the molten steel surface and horizontally introducing the direct current magnetic field to the molten steel surface. The prior art method 1 is disclosed in " Iron and Steel " (1982), Nagai et al., 68, S 270, and " Iron and Steel " (1982), Suzuki et al., 68, S 920. The prior art method 2 is disclosed in " Iron and Steel " (1986), Ozuka et al., 72, S 718.
The flow of molten steel poured from the immersion nozzle strikes the solidified shell and is divided into an upward turn-over flow and a downward penetration flow. Since kinetic energy which the upward turn-over flow has oscillates the molten steel surface, a wavy motion of the molten steel surface is formed.
However, in the prior art method 1, a direct current magnetic field is introduced vertically to the flow of molten metal poured from the immersion nozzle in the portion between the immersion nozzle and the surface of the narrow side of the mold. The flow of molten metal is braked. In this method, since the flow disperses after it has been poured from the immersion nozzle, the direct current magnetic field should be introduced to a wide range of the flow of poured molten steel. Since the direct current magnetic field is introduced to the wide range of the flow poured molten steel, a large equipment is required, by which the production cost is increased. Moreover, since a circuit of the eddy current, formed by the mutual work of the flow of molten steel with the direct current magnetic field, is formed in the molten steel in this method, the current density cannot be increased. Accordingly, to generate a great braking force, the magnetic flux density should be increased. The cost of the equipment is increased to increase the magnetic flux density,
The wavy motion is most easily controlled in the prior art method 2 since the direct current magnetic field is directly introduced against the wavy motion of molten steel surface. However, the position where the wavy motion of the molten steel surface is most violent is situated within the range of 100 mm from the narrow side of the mold. Accordingly, the direct current magnetic field is introduced to the range of 100 mm from the narrow side of the mold. A device for generating a magnetic field is required to be placed on the reverse side of a wide side copper plate of the mold and in the position about 100 mm away from the upper end of the wide side of the mold. In case when the device for generating a magnetic field is placed in the above-mentioned position, a large scale revamp of the cooling box is necessary and the direction of cooling path on the copper plate of the mold is required to be made transverse. Then, the wide side copper plate of the mold is insufficiently cooled.
It is an object of the present invention to manufacture products having good surface properties by decreasing a wavy motion of molten steel surface inside a mold to prevent mold powder from being trapped by the molten steel and to make inclusions in molten steel rise to a molten steel surface by making a depth of penetration of the inclusions small.
To accomplish the foregoing object, the present invention provides a method for continuous casting of steel comprising:
charging molten steel from a tundish into a mold through exit ports of an immersion nozzle;
introducing a magnetic field vertically to a flow of the molten steel from said exit ports by the use of at least a pair of direct current magnets which are arranged on the outer side of copper plates on the wide side of the mold, the immersion nozzle being placed between said direct current magnets and polarities of magnetisms on the top side of said magnets being the same; and
casting the molten steel at a predetermined casting rate.
Fig.1 (a) is a vertical longitudinal sectional view illustrating a mold for continuous casting of steel used for execution of the present invention;
Fig.1 (b) is a transverse sectional view of the mold taken on line 1 - 1 in Fig.1 (a);
Fig.1 (c) is a perspective view schematically illustrating a magnet in Fig.1 (a);
Fig.2 is a graphical representation indicating the relationship between the casting rate or the withdrawal speed and the maximum height of the wavy motion of molten steel surface in Example-1;
Fig.3 is a graphical representation indicating the relationship between the withdrawal speed and the maximum height of the wavy motion of molten steel surface in Example-2;
Fig.4 is a graphical representation indicating the relationship between the casting rate and the index of surface defect of hot-rolled plate in cases of inroducing and not introducing direct current magnetic field to the flow of molten steel in Example-2;
Fig.5 is a graphical representation showing the relationship between the maximum casting rate and the magnetic flux density with the angle of the opening of the immersion nozzle as a parameter;
Fig.6 (a) and Fig.6 (b) are schematic illustrations of the state of flow of molten steel in the case of introducing an electromagnetic force on the molten steel in the mold of the present invention;
Fig.7 is a vertical sectional view schematically illustrating the flow of molten steel from the immersion nozzle into the mold in the prior art slab continuous caster;
Fig.8 is a schematic illustration showing the wavy motion of molten steel surface in the prior art mold;
Fig.9 is a schematic illustration showing the change of level of molten steel surface for about one minute according to the present invention; and
Fig.10 is a graphical representation showing the relationship between the maximum height of molten steel surface and index of surface defect of hot-rolled steel plate according to the present invention.
The above objects and other objects and advantages of the present invention will become apparent from the detailed description which follows, taken in conjunction with the appended drawings.
In the present invention, a direct current magnetic field is vertically introduced to the flow of molten steel poured from exit ports of the immersion nozzle in a mold of continuous casting. When an electroconductive fluid flows in electromagnetic field, an electromotive force is produced by Fleming's right-hand rule and eddy current is generated. The movement of the fluid is hindered by the electromagnetic force working in the direction opposite to that of the movement of the fluid on the basis of Fleming's right hand rule under a mutual work of the eddy current and the induced magnetic field. As a result, the rate of the flow of molten steel is decreased. When the rate of the flow of molten steel poured from the exit ports is decreased, a flow rate of a turn-over flow of molten steel after the flow of molten steel has struck a shell on the narrow side of the mold is decreased, by which the wavy motion of the molten steel surface becomes hard to occur. Moreover, when there occurs a single flow phenomenon in which molten steel flows out of mainly one of the two exit ports, a larger electromagnetic force works on the flow of molten steel having the larger flow rate. As a result, the single flow phenomenon is suppressed. When the direct current magnetic field is vertically introduced to the flow of molten steel, the eddy current forms a circuit around the immersion nozzle as shown in Fig.6 (b). Since electric current flows in a copper plate of the mold having the electric resistance of 2.5 x 10⁻⁸ Ω · m as a part of circuit of the eddy current, the electric resistance of the circuit is decreased and the current density can be increased. As a result, the produced electromagnetic force is increased and the electromagnetic force can be effectively produced. when the direct current magnetic force is introduced to the flow of molten steel horizontally in the same direction as that of the narrow side of the slab, the produced eddy current forms a circuit on the surface parallel with the copper plate of the mold. Since the molten steel has large electric resistance of 150 x 10⁻⁸ Ω · m, the electric resistance of the circuit is increased and the density of eddy current is decreased. Accordingly, thedirect current magnet is arranged so that the direct current magnetic field can be vertically introduced to the flow of molten steel. One magnetic pole is positioned at just above the upper end of the copper plate on the wide side of the mold and the other magnetic pole is positioned at lower than the exit port of immersion nozzle behind the copper plate on the wide side of the mold.
The present inventors' viewpoint on the flow of molten steel in the case of introducing the electromagnetic force on the molten steel will be described as follows. Fig.6 is a schematic illustration showing a state of flow of molten steel in the case of introducing an electromagnetic force on the molten steel in the mold. Fig.6 (a) is a vertical sectional view illustrating the inside of the mold. Fig.6 (b) is a transverse sectional view of the inside of the mold taken on line 1 - 1 of Fig.6 (a). In the drawing, reference numeral 21 denotes a copper plate of the wide side of the mold, 22, an immersion nozzle, 23, a magnet, 24, a magnetic core, 25, a magnet coil , 30, molten steel , 31, one magnetic pole of the magnet, 32, the other magnetic pole of the magnet and 33, an exit port of the immersion nozzle. Magnetic field 26 is shown with dotted lines having arrow symbol in Fig.6 (a) and with symbol ⊗ in Fig.6 (b). Flow 27 of molten steel poured from exit ports is shown with black arrow symbols in Fig.6 (b). Eddy current 28 is shown with solid lines having arrow symbol in Fig.6 (b). Braking force 29 is shown with white arrow symbols in Fig.6 (b).
Molten steel is poured from a tundish into the mold through the immersion nozzle 22. At least a pair of magnets 23 are arranged so that the immersion nozzle 22 can be positioned between the magnets 23. The magnet is constituted by the magnetic core 24 and the magnet coil 25. One magnetic pole of the magnet 24 is arranged just above the upper end of the wide side copper plate of the mold. The other magnetic pole 32 of the magnet is arranged at lower than the exit port 33 of the immersion nozzle behind the wide side 21 of the mold. For example, reference numerals 31a and 31b denote N poles and 32a, and 32b, S poles. The polarities of the magnetic poles facing each other are the same. The braking force 29 working in the direction opposite to the movement of the flow of molten steel poured from exit ports is produced in the flow 27 of molten steel by vertically introducing magnetic field 26 to the flow 27. The flowing rate of flow 27 is decreased by the braking force 29.
V :
B :
Y
V :
Z
B :
the flowing rate of molten steel (m/sec)
the magnetic flux density
element of the flowing rate in the direction of the width of the mold
element of the magnetic flux density in the vertical direction
α :
the electric resistance of fluid ( Ω·m)
When the direct current magnetic field is introduced to flowing molten steel 30, electromotive force E is produced according to the following formula:
Eddy current flows in the molten steel under the influence of the electromotive force and the braking force works in the direction opposite to the movement of the molten steel under the mutual work of the eddy current and the magnetic flux density.
Y
Z
The braking force depends on V and B² from the formula (2).
Y
Y
Since V is small in the case of continuous casting of steel at a low rate, the braking force working on the molten steel is small. However, since V becomes large with the increase of the rate of continuous casting, the braking force becomes large.
Relative to the flow 27 poured from the immersion nozzle 22, a single flow phenomenon, in which the molten steel flows out of mainly one exit port 33 in case there is no direct current magnetic field, is liable to occur. Since a greater braking force works on the flow of molten steel having a larger flow rate of molten steel under the direct current magnetic field introduced vertically to the flow of molten steel poured from the immersion nozzle according to the formula (2), the flow from both exit ports are equalized and the single flow of molten steel is decreased. As a result, the maximum height of wavy motion of molten steel surface can be controlled to be within a predetermined range.
The magnetic field can be controlled by measuring the wavy motion of molten steel surface in the mold by the use of an eddy current type distance measuring device arranged above the molten steel and controlling electric current in the coil of direct current magnet on the basis of the values obtained by the measurement. The height of wavy motion of molten steel surface is controlled within the predetermined range. The trapping of mold powder by the wavy motion of molten steel surface is decreased.
The magnetic field vertically introduced to the flow of molten steel is controlled depending on the casting rate. The magnetic field of about 1000 to 4000 gauss is desired when the casting rate is from 2.5 to 8 ton/min. When the magnetic field is less than 1000 gauss, it cannot effectively control the height of wavy motion of molten steel surface. When the magnetic field exceeds 4000 gauss, capacity of the direct current magnet is excessively large, which causes increase of the equipment.
Referring now specifically to the appended drawings, a mold for continuous casting of steel which was used for executing the method of the present invention will be described. Fig.1 (a) is a vertical longitudinal sectional view illustrating the mold for continuous casting of steel used for the execution of the present invention. Fig.1 (b) is a transverse sectional view of the mold taken on line 1 - 1 in Fig.1 (a). Fig.1 (c) is a perspective view schematically illustrating a magnet in Fig.1 (a). In the drawing, reference numeral 21 denotes a copper plate on the wide side of the mold, 22, an immersion nozzle, 23, a magnet, 24, a magnetic core,25, a direct current magnet coil, 30, molten steel, 31, one magnetic pole of the direct current magnet, 32, the other magnetic pole of the direct current magnet and 33, an exit port of the immersion nozzle, 41, a cooling water path, 42, a back plate constituting the cooling water path 41 between the back plate and the wide side copper plate 21 of the mold, 43, water box for supplying cooling water, and 44, a water box for discharging cooling water
A pair of the magnets 23 were arranged behind the wide side copper plate 21 of the mold, the immersion nozzle 22 being between the pair of magnets. The magnet 23 was constituted by the magnetic core 24 and direct current magnet coil 25. One magnetic pole 31 of the direct current magnet was arranged just above the upper end of the wide side copper plate 21 of the mold and the other magnetic pole 32 of the direct current magnet at the hight of about 300 mm below the exit port 33 of the immersion nozzle on the outer side of copper plate 21 of the mold. Dimensions of a section of the magnetic core 24 was determined so that the magnetic field could be introduced to the whole mold and so that the magnetic pole 31 arranged just above the upper end of the wide side copper plate of the mold could not hinder any casting operation inside the mold. That is, the magnetic pole 31 on the upper side had a height of 70 mm and a width of 1100 mm and an upper corner of the magnetic pole was cut off. The magnetic pole on the lower side had a height of 100 mm and a width of 1100 mm. The polarities of the direct current electromagnets 23 were selected so that the polarities of magnetic poles 31a and 31b were the same. In this way, a magnetic field in the vertical direction could be produced in the mold. The back plate is preferred to be made of stainless steel which is a non-magnetic metal. The magnetic field inside the mold can be effectively produced with no influence by the back plate. Moreover, the direct current electromagnet 23 together with the mold are mounted on an oscillation table ( not shown ) and oscilated in the up-and-down direction.
The height of wavy motion of molten steel surface near copper plate 34 on the narrow side of the mold was measured during casting of steel by the use of a continuous caster in which a pair of magnets 23 shown in Fig.1 were arranged. Molten steel was cast into a slab of sectional dimension of 220 mm in thickness and 1200 mm in width at a withdrawal speed of 0.7 to 2.7 m/min. A casting rate during casting was changed with the rate from 1.4 t to 2.7 ton/min. Fig.2 is a graphical representation indicating the relationship between the casting rate or the withdrawal speed and the maximum height of a wavy motion of molten steel surface in the case of introducing and not introducing the direct magnetic field to the flow of molten steel poured from the immersion nozzle. The abscissa in Fig.2 denotes the withdrawal speed and the casting rate. Symbol ○ means no application magnetic field. Symbol ● means the application of the magnetic fields. The magnetic flux density was controlled within a range of 2000 to 2500 gauss. The maximum height of wavy motion of molten steel surface in the case of introducing the magnetic field to the flow of molten steel became considerably small compared with the maximum height of wavy motion of molten steel in the case of not introducing the magnetic field to the flow of molten steel. When the casting rate was 2.5 ton/min, the maximum height of wavy motion of molten steel was limited to 4 mm or less. On the other hand, even when the maximum height of wavy motion of liquid steel was 2.5 ton/min or more, the maximum height of wave motion of molten steel could be limited to 8 mm or less.
A continuous casting was carried out by introducing the direct current magnetic field to the flow of molten steel poured from the immersion nozzle by the use of a mold of continuous caster in which a pair of magnets shown in Fig.1 were arranged. Conditions of introducing the direct current magnetic field were judged from the results in Example-1. That is, the magnetic flux density at a casting rate of 3.0 ton/min or more was determined at 2000 gauss. In this way, the molten steel was cast into a slab of sectional dimensions of 220 mm in thickness and 1200 mm in width. Fig.3 shows the timewise change of the withdrawal speed and the maximum height of wavy motion of molten steel. The magnetic field was not introduced to the flow of molten steel for 20 to 30 minutes after the start of casting. The magnetic field of 2000 gauss was introduced to the flow of molten steel for 20 to 33 minutes after the start of casting. The magnetic field was not introduced to the flow of molten steel for 33 to 40 minutes after the start of casting to change one ladle for the other. The magnetic field of 2000 gauss was introduced to the flow of molten steel 40 minutes later after the start of casting. It was necessary to set the eddy current type distance measuring device and to adjust it to measure the maximum height of wavy motion of molten steel after the start of continuous casting of steel. Therefore, the maximum height of wavy motion of molten steel surface could not be measured. When the maximum height of wavy motion of molten steel surface was enabled to be measured and the magnetic field was introduced to the flow of molten steel, the maximum height of wavy motion of molten steel surface could be controlled in the entire range of casting. The wavy motion of molten steel surface was small due to the decreased flow rate during the change of one ladle for the other. Therefore, it was not necessary to introduce the direct current magnetic field to the flow of molten steel to cause the magnetic field to work on the flow of molten steel.
Fig.4 is a graphical representation showing the relationship between the casting rate and the index of surface defect of hot-rolled steel plate. Symbol ○ denotes the case when the magnetic field was not introduced to the flow of molten steel and symbol● the case when the magnetic field was introduced to the flow of molten steel. The direct current magnetic field was introduced to the flow of molten steel at a casting rate of 3.0 ton/min. The index of surface defect of hot-rolled steel plate is the value which is obtained by dividing the number of spills by the observed area. As clearly seen from Fig.4, the index of surface defect of hot-rolled steel plate was greatly decreased in the high-speed continuous casting of steel.
Molten steel was cast into aluminium-killed low-carbon steel by the use of a mold of 220 mm in thickness and 1400 mm in width. The aluminium-killed low-carbon steel had a content of 0.04 to 0.05 wt.% C, 0.01 to 0.02 wt.% Si , 0.22 to 0.26 wt.% Mn, 0.012 to 0.018 wt.% P, 0.013 to 0.016 wt.% S and 0.028 to 0.036 wt.% sol. Al. The withdrawal speed was changed within a range of 1.8 to 2.7 m/min. The direct current magnetic field was introduced to the portion near the exit port of the immersion nozzle in the same way as that shown in Example-1. The eddy current type distance measuring device was mounted in the corner portion of the mold and the height of wavy motion of molten steel was measured. The corner portion was positioned 50 mm away from the wide side of the mold and 50 mm away from the narrow side of the mold. The nozzle used had two exit ports. Angles of discharge were 15 ° , 25° , 35° and 45° downwards relative to the horizontal plane. The immersion nozzle was immersed into molten steel constantly to the depth of 210 mm. The depth of immersion was a distance from the molten steel surface to the upper end of exit port of immersion nozzle.
The height of wavy motion of molten steel surface is desired to be 8 mm or less in order that any entanglement of powder with the molten steel is not produced. Accordingly, the magnetic flux densities necessary for limiting the height of wavy motion of molten steel surface were found with respect to the angles of the exit port of the immersion nozzle and the casting rate. The results obtained are shown in Fig.5. A portion shown with oblique lines in Fig.5 is a range where a good slab by which powder has not been trapped is produced.
The angle of exit port of the immersion nozzle is desired to be 15 to 45° . When the angle is less than 15° , it is difficult to control the height of molten steel surface in case the withdrawal speed is large. When the angle is over 45 ° , the flow of molten steel from the immersion nozzle is injected under the bottom of the mold.
Next, the same aluminium-killed low-carbon steel as described above was manufactured by the use of a mold of 220 mm in thickness and 1400 mm in width. Molten steel was cast into the steel at a withdrawal speed of 2.5 m/min. The withdrawal speed corresponds to a casting rate of 5.5 ton/min. The immersion nozzle used had two exit ports. An angle of the exit port of the immersion nozzle was 35° . A depth of immersion of the immersion nozzle was 210 mm. The ratio of occurrence of flaws of products in the case of casting in both of the states of the flows of molten steel, to which the direct current magnetic field was introduced and not introduced, was studied. The ratio of occurrence of flaws of products in the case of introducing the direct current magnetic field to the flow of molten steel was about one third of that of the case of not introducing the direct current magnetic field to the flow of molten steel. In consequence, the effect of introducing the direct current magnetic field was proved.
Reference signs in the claims are intended for better understanding and shall not limit the scope.
Example
Example-1
Example-2
Example-3 | |
By Ross B. Lampert
Almost since this series began, I’ve been writing about things that writers, especially new ones, have trouble with. This post is the last of that string. Next time I’ll begin a short series on how critiquers should respond to things a writer did well. Positive critiques are at least as important as corrective ones, so that’s a set of subjects we can’t and shouldn’t avoid.
Formatting a manuscript is a simple and almost purely mechanical process, yet it’s one new writers may not have had any training on, or they were trained on formats that aren’t appropriate for fiction manuscripts.
This might seem like a minor point, yet if an author intends to follow the traditional publishing route and submit their work to literary agents or directly to publishing house editors, an improperly formatted manuscript is almost sure to garner an immediate rejection, unread. Agents make no bones about this: If a manuscript isn’t formatted to industry standards, they immediately question whether the author really knows what he or she is doing. The work already has 2½ strikes against it, even before the agent or editor reads a single word—if they do.
So, here are the standards for the US (and, I presume, Canada, even though they use metric measures). European and Asian standards are different and I don’t have any idea what they are.
- Page size: 8½” by 11”
- Margins: 1” all around
- Justification: Use a “ragged” right margin, that is, one in which the last letters of each line do NOT align vertically, except by coincidence.
- Line spacing: Double
- Paragraph format:
- Fiction and memoir: First line indented by 0.25” to 0.3”, with NO additional spacing after the last line of the paragraph. DO NOT use tabs for these indents. Word processors have controls in their paragraph formatting function that will set this indent automatically every time a new paragraph starts.
- Non-fiction: First line NOT indented, with 6 points of spacing after the last line of the paragraph. (This blog post is formatted this way, except for the bulleted text.)
- Exceptions: At a scene break, insert one blank (double-spaced) line. At a chapter break, start a new page or insert about three blank lines.
- Page numbering: In the header of every page, include the work’s title or a shortened version of it, the author’s last name, and the page number. For example, the header for the manuscript of my WIP Chrysalis looks like this: Chrysalis / Lampert / 137.
- Font (type face): Twelve point Times New Roman (or its Apple counterpart) is the industry standard. “Sans serif” fonts like Arial, Calibri, or Verdana can be acceptable as well but scientists have found that fonts with serifs (those little angular tips at the ends and corners of letters) are actually easier to read. This post is in Times New Roman.
- Widow and Orphan control: Turned off. “Widows” and “orphans” are the first or last line of a paragraph left by themselves at the bottom or top of a page. A word processor’s “widows and orphans” control keeps these from happening. This is fine for book or article typesetting but unnecessary for a manuscript.
- Automatic hyphenation: Turned on. While automatic hyphenation software sometimes produces odd breaks in words, like the word scene being broken as sce-ne, this function prevents blanks at the ends of lines where a long last word was too big to fit.
Every word processing program has its own methods for controlling all of these settings, and trying to give instructions on how to set them is beyond the scope of this article. Writers need to learn how to set their manuscript up to follow these guidelines. Many, if not all, word processors allow users to create a default or standard collection of these settings—Microsoft calls them “styles”—which lets the writer set them and forget them. Knowing how to use “styles” or their equivalents can be extremely helpful if a writer wants to do their own formatting for ebooks or print-on-demand publishing.
Why should a reviewer even bother with this? Several reasons. First, it’s a matter of instilling a sense of professionalism in the writer. If the writer learns to do this right, it’ll become natural for them to do other things right as well. Second, it’s really easy to do right. Set it up once and it’s done from then on. Third, once it’s fixed, it’s a distraction that neither you nor the writer will have to deal with again.
Any thoughts on manuscript formatting? Share them in the comments below. | https://www.rossblampert.com/2014/06/28/critique-technique-part-55-manuscript-format/ |
Council leaders have warned new national bodies are not the best way to protect the UK from unsafe products.
In response to research published today by Which?, the Local Government Association (LGA) said councils are best placed to ensure unsafe products are removed from shops.
Research by Which? found that Safety Gate, a European rapid warning system, issued 34% more alerts in 2018 compared to a decade ago.
The watchdog said the UK could face a ‘rising tide’ of unsafe toys, cars and white goods unless the consumer enforcement system is not reformed.
It warned that the UK may have to rely on its own system for identifying unsafe products following Brexit, and that the Government is already too reliant on overstretched local authority trading standards services
Caroline Normand, Which? director of advocacy, said: ‘If it is to make people’s safety the number one priority, the Government must secure access to the European alert and information sharing systems after Brexit, as well as introduce major domestic reforms to ensure consumers are properly protected from unsafe products.’
It is calling for the Government to establish the Office for Product Safety and Standards (OPSS) as an independent body.
However, the LGA said this was not the best approach to reforming trading standards.
A spokesperson said: ‘The answer to this problem is not to take funding, resources and expertise from councils to create new national bodies or to expand existing organisations, as these will lack the intelligence - and currently the powers - to take effective action at a local level to ensure unsafe products are off supermarket shelves and out of people’s homes. | https://www.localgov.co.uk/Councils-call-for-extra-funding-to-stop-UK-being-flooded-with-unsafe-products/47249 |
To Cite: Arian M, Younesi S J, Khanjani M S. Explaining the Experiences and Consequences of Care Among Family Caregivers of Patients with Cancer in the Terminal Phase: A Qualitative Research, Int J Cancer Manag. 2017 ; 10(10):e10753. doi: 10.5812/ijcm.10753.
Background: Cancer is a disease which affects both the patient and family members. Family caregivers of these individuals have been recognized as the undercover patients, the problems and experiences of whom should be evaluated. The present research has been aimed to provide a deep understanding of the experiences and consequences of care in family caregivers of patients with cancer in the terminal phase.
Methods: The present research has been conducted by a qualitative content analysis method. The sampling method was purposeful and it was progressed until data saturation. The data were gathered through in-depth semi-structured interviews, and then, were analyzed via content analysis.
Results: From the total 18 interviews, 413 initial concepts (codes) were obtained. Finally, three main concepts (categories) were extracted after data analysis, including: 1, inhibition; 2, challenges and consequences of care; and 3, supportive-palliative factors.
Conclusions: According to the family caregivers’ condition in Iran, that is, caring overload, informational and emotional inhibition, and spirituality as a way of alleviation and adaptability, the emergent need for counseling and psychological-social-informational-spiritual support particular to this culture, seems to be necessary.
Cancer is of particular importance due to its prevalence, life threat, emotional and psychological effects and complications on the patient, family and caregivers (1). Family members of the patient play an important role as the caregivers of the moribund. These individuals have some needs which are often not recognized (2). Therefore, cancer is a familial disease which goes beyond the patient itself (3). The nature and severity of the problems affecting the caregivers are unknown in the developing countries, and such individuals have been called as the hidden patients (4). Hence, screening the needs and psychological pressures among family members of cancer patients is a vital and important matter in all the phases of this disease (5).
The terminal phase of the disease is recognized with deterioration of the patient’s health status and shifting the focus of treatment from medical treatment to palliative care; therefore, caregiving for the patient in the final phase is palliative, rather than being remedial, and this palliation means providing psychological-emotional-spiritual-interpersonal adjustments with the death process and accepting the death (6). Palliative care is also the most important part of the caregiving in the last stages of life (2) which is provided for the life-threatening diseases, and it is an inclusive approach which is focused on enhancing life in the last stages (6). Several researches from around the world have been conducted on family caregivers of cancer patients in the terminal phase, suggesting that their common problems include depression (7), financial pressure, low quality of life, cessation of work and running out of financial savings (8), grief and anxiety (9). There are certain ethnic, racial, value-related, cultural belief-based and family system characteristics, which might cause the caregivers of different countries to experience their role differently (10), and according to the knowledge of the researcher, up to now in Iran, no reliable research has been conducted on family caregivers of cancer patients in the terminal phase and in accordance with care conditions in the country. By considering the difference of psychological pressure sources according to treatment stages for cancer (11), the present qualitative research has been conducted by the aim of gaining a deep understanding of the experiences of family caregivers and consequences of taking care of cancer patients in terminal phase in Iran.
The present research has been conducted by content analysis method. The sample of the present research included all the main family caregivers of cancer patients in the terminal phase of the disease, whose patients were hospitalized in the palliative care ward of ALA cancer prevention and control center, Tehran, Iran. The sample was selected by purposeful sampling method, the data were saturated after the17th and 18th interviews, after which the sampling procedure was over. In sum, 15 participants were interviewed in the present research, so that three participants were interviewed for more than one time. The Sociodemographic Characteristics of them are presented in Table 1. The sample selection criteria were as follows: 1, the caregivers who are a member of the patient’s family and have been caregiving the patient for at least 6 months; 2, they should be aware of the terminal phase of the disease; 3, they should not be affected by any specific medical and psychiatric illnesses; and 4, they should be able to describe their experiences and have full and conscious consent for participating in the interviews. The study is reviewed and approved by ethics committee of University of Social Welfare and Rehabilitation Sciences.
For the purpose of respecting the participants’ rights, the researcher took written-informed consent letter from them. For gathering the data, the researcher took in-depth face to face semi-structured interviews from the participants. The interviews duration has been 40 - 65 minutes, which were recorded by participants’ notice. These interviews and the additional notes (which were written by the researcher during the interview) were transcribed on paper as soon as possible, and then, the text would be typed into a computer. After several reviews, the transcribed texts of the interviews were broken down into constituent semantic units, and then into smallest meaningful units, and a number would be assigned to them, as the initial concept. Afterwards, the codes were reviewed for several times, to be placed in main categories and sub-categories based on their semantic similarity. The initial texts and final categories were reviewed for several times until the researcher and participants reached a semantic agreement about the categories. For determining the data accuracy, four criteria were used: acceptability, reliability, verifiability, and transferability (12). For determining the data acceptability, a constant engagement existed with the research topic and data. The corrective comments of professors of the research team on interview procedure, analysis, and the extracted data were used. Interview contexts and their extracted codes and categories, were handed to some of the participants and two PhD students of rehabilitation counseling as researcher colleagues, and their comments were also considered. By using synthesis in the data gathering method (interview and in-field notes) and finally in selecting the sample, the necessary variety was provided. For determining data reliability, as mentioned in determining the acceptability, the synthesis method was used for data gathering and an external observer, familiar with qualitative research, was employed for examining the data, and there was an agreement on the process and results. For determining the verifiability of the results, all the activities including the work procedure and the finding results procedure were recorded with great detail and a report on research procedure was provided. Also, for determining the transferability of the data, the results were shared with two main family caregivers who were outside the study with a condition similar to research participants, and the results were confirmed by these caregivers, as well.
From a total of 18 interviews, 413 initial concepts were obtained, and three categories were extracted after the analysis, including: 1, inhibition; 2, care challenges and consequences; and 3, supportive-palliative factors. Each of these main categories are constituted by several sub-categories and initial categories.
1, full concealment of information from the patient: suggests that the caregivers have given no information about cancer development to the patient and they do not intend to inform the patient about his illness. 2, censoring the information on the disease phase: in the case of such caregivers, the patient knows about his illness, but he does not know about the terminal phase and the progress of his cancer. One of the caregivers says: “I don’t dare to tell him that his illness has progressed. I fear that he would lose his spirit”. One of the main reasons for such informational censorship is that they believe the patient would lose his spirit in case of knowing about the final phase. 3, informational inhibition from the family: some of these caregivers, conceal or censor information about the illness and its progress from their family members. Such caregivers, due to the important, heavy responsibility they have, are always worried about their family members, and they would not fully inform them about the illness because of being worried about the mental state of the older and younger members of the family.
1, emotional inhibition in front of the patient: suggests that the caregivers prevent themselves form expressing any emotions or affection such as crying, tiredness, worries, sympathies, and so on, in front of the patient. A caregiver’s quote: “the hard thing is that I am internally wrecked up, but I have to stay strong. But without any frowns or cries”. 2, emotional inhibition in front of the family: the main family caregivers have a burdensome role to play, and in addition to the patient, they are worried about other members of the family, as well. Thus, they try to present themselves as a strong person with high spirit in front of their family members. One of the caregivers says: “I had a lump in my throat in front of my mother and family, but I didn’t cry, because if I cry, they’d think I have lost hope”.
The second category obtained from the current research is care challenges and consequences, which has four sub-categories.
Including 1, financial and 2, career pressures. Financial pressures include running out of savings, financial and insurance problems, transportation (commuting), and for some caregivers, financial crisis. Career problems have also been considerable, so much that the self-employed caregivers have abandoned their jobs, and the government employed caregivers have faced certain career challenges. As one of them says, “I’m a government employee, but now I don’t know whether I’m still an employee or not. Because it has been about two weeks that I have left my job due to the severity of my father’s condition”.
1, weight change: weight gain/loss at the same time with the disease’s progress. One of the reasons for this upsetting change is the disturbance that occurs for the sleep cycle and appetite of such individuals. 2, fatigue and pain: because of the physical condition of the patient, the caregivers have to be always vigilant in order to help the patient with pains, medicine intake, hygienic issues, bandage change and so on. In this point, the patient has nearly a disturbed physical function, and he cannot take care of himself on his own. Additionally, the irregular sleep of the caregivers is also among the physical fatigue factors. One of the caregivers says: “Day and night, I just go back-and-forth between the hospital and pharmacy. I’m so tired. Sometimes that I can take a nap or sleep, my knee-pain and feet-pain disturb my sleep. My body is exhausted”.
1, disturbing the life routine: clearly, cancer and particularly its progress can lead to disturbance in the daily routine of the family life. These caregivers have reported that they have experienced reduced family relationships, interruption in their education, limitation in social relationships, suspension of the plans, and disturbance in long-term and short-term personal/family goals of theirs. 2, failing in the roles: due to the burdens of taking care of the patient, such caregivers would fail to play their role in the family. They have reported the following problems: stopping the sexual relationship with the patient or with the non-patient spouse, or failing to play their marital/parental role. Such failures from the family roles lead to certain problems and conflicts between the family members and the caregiver, particularly when the mother/wife of the family is the main caregiver. 3, conflict with family members: this sub-category is partly due to failing to play the family role. Anger and conflict feelings between the caregivers and patients have been reported, so much that one of them says, “I’m all at my husband’s (patient) service, but he doesn’t understand me”. The caregivers have also reported to have conflicts with their family members for the type of treatment.
This is the third concept of the present research which includes three sub-categories.
Associates means all the family, friends and relatives. Family caregivers have reported that family, relatives, friends of theirs or those of the patient’s, constitute their psychological and emotional support sources.
This category includes 4 sub-categories, as follows: 1, spiritual comfort: the caregivers reported the following factors as their spiritual and psychological comfort source: praying to God, Azadari (religious mourning rituals for Imam Hossein), reading Quran, and religious practices. 2, spiritual beliefs: this sub-category involves spiritually-based beliefs that the caregivers hold about their caregiving and the disease. They consider this tough condition as a divine test, which they must pass proudly. Some have a destiny-based attitude (Taghdir in Islamic terms) towards the disease. In fact, this sub-category suggests the meanings that the caregivers attribute to the disease and consequently to the caregiving. These adaptive spiritual beliefs lead to some calm and comfort for such individuals. 3, comforting beliefs about death and afterlife of the patient: this group of beliefs is also suggesting adaptive meanings that the caregivers attribute to death and particularly the patient’s death. One of them says, “I think at least after all this illness she would be in peace in heaven”. However, all the caregivers do not possess religious attitudes, such that one of them says, “The world is finite. One day we come, one day we go. We never perish. We’ll come back to nature again”. 4, religious practices for healing the patient: this group of caregivers are still hopeful about divine miracles and, as they say, they have still a high spirit; and they find the religious practices as a way of finding peace and hope.
This category includes two sub-categories: 1, transcendence: this term in this research is used to refer to the beneficial and valuable experience that caregivers have gained as a result of taking care of the patient. These experiences include: increased sense of responsibility towards family, valuing the moments of being with the patient and family, the feeling of getting close to God, getting in touch with death and the transient nature of life, recognizing the value of the parents very existence, spiritual growth and transcendence, and recognizing the love between the patient and self. 2, feeling satisfaction from caregiving: this sub-category refers to a positive and valuable feeling which the caregiver obtains by taking care of the patient.
In the present study, three main concepts (categories) were obtained from the experiences of family caregivers of cancer patients in the terminal phase. The inhibition concept indicates emotional and informational inhibition, by which the caregivers try to deny or censor the disease-related information from the patient and other family members. Emotional inhibition is partly derived from informational inhibition, that is, the caregivers try not to express their emotions by the purpose that the patient would not know about the condition, keep his spirit, and get hopeful. Such inhibition would lead to some psychological conflicts and problems for the caregiver. To the best of the author’s knowledge, this concept has not been referred to in the related research on the subject. Conversely, according the research conducted by Yun and colleagues (13), the majority of the patients (58%) and caregivers (83.4%) were aware of the disease’s final phase, and the patients (78.6%) preferred more, in comparison to caregivers (69.6%), that the patients would be informed about the final phase of the disease. The caregivers of the current research think that factors such as being young or educated are accountable for inhibition. They were also worried that in case of informing the patient about the condition, his condition would deteriorate, and this pressure would consequently turn back to the caregiver.
The second main concept in the present research has been negative challenges and outcomes of care, which has several sub-categories. Some categories of this concept, that is, patient-related stress, concern about future, stress, depression and grief, financial and physical problems, family challenges, sleep-related changes, psychological functional problems, loneliness and caregiving pressure are consistent with some research (4, 7, 8, 14-18). However, two sub-categories, namely, annoying and dysfunctional beliefs and resentment from the relatives are not seen in prior research. This concept suggests a high care burden among family caregivers of patients with cancer in terminal phase in Iran.
The medical staff, including physician, nurse, social worker, psychologist, counselor, psychiatrist, and so on, should pay attention to numerous problems of these individuals. They are hidden patients who experience high levels of psychological, physical, family, and social symptoms. They even experience spiritual/religious challenges, and they need spiritual-psychological support for the purpose of adapting with the imminent death of the patient and getting prepared to mourn for the loss, so that they would feel less severe consequences in the loss phase.
Overall, based on this concept, they have dysfunctional and insufficient information about cancer, they do not know how to take care of themselves and the patient appropriately, their coping strategies against stress and various problems are limited and insufficient, and they suffer from various psychological distress and physical problems in relation to the caregiving.
The third concept is related to supportive-palliative factors. This concept is comprised of three categories: associates, spirituality and positive outcomes of care. Associates suggests that caregivers who share caregiving responsibilities are less prone to negative consequences (19). Spirituality suggests that the caregivers in the Iranian culture are affected by spiritual/religious beliefs, and they use religion and spirituality for adapting to and coping with the crisis condition. The present results are consistent with research conducted by Hatamipour (20) and Lotfi Kashani and colleagues (21). Spirituality and religious beliefs are among the main factors for psychological comfort and healing among these caregivers. On the other hand, the annoying spiritual/religious beliefs indicate the attention and importance that such individuals assign to spirituality, and they also suggest cognitive distortions and distortion in God’s image. Also, the positive outcome or post-traumatic growth are among significant factors which reduce distress in caregivers and their patients (22).
According to the three obtained concepts, it can be said that for providing spiritual, psychological, financial, informational and physical support for the caregivers of cancer patients, it is better that some programs and actions be designed which are consistent with Iranian culture, so that a ground for healing and reducing negative care consequences would be provided for such individuals. Regarding clear exposure of the disease’s information, cultural and other issues should be considered, and we should have conversations and clarification sessions regarding the outcomes of inhibition -especially informational inhibition- with the caregivers. Also, the medical staff can increase the adaptability of such individuals by emphasizing the positive outcomes of caregiving. In addition, most participant caregivers of the present study stated that in the terminal phase (metastasis and disease progression), they feel more severe problems and conflicts, and some have referred to this phase as a kind of crisis. This means that these family caregivers need more therapeutic and supportive attention in this phase of the disease. In fact, they were satisfied with the presence of their patient in the palliative care ward, because they could not manage the patient’s symptoms at home, which means, they need medical information about taking care of both themselves and the patient in order to be able to manage the patient’s symptoms in case of patient discharge, and take care of themselves, too.
Having an interview with those caregivers who talked with just one local dialect was not possible. Due to the research method we used, comparing the experiences of caregivers in different phases of the disease was not possible. Therefore, these issues must be considered in future research.
According the results of the present study, it seems that more research should be conducted on the informational inhibition subject and its solution in Iranian culture. This is necessary that the patients’ experiences in this phase of the disease be evaluated.
We thank the ALA cancer prevention and control center, and their psychology unit. We greatly thank the dear and patient caregivers who agreed to cooperate in the present research, despite all the difficulties they had, and considered the researcher as a worthy person to talk about their experience with.
1. Gore M, Russell D. Cancer in primary care. London: London Martin Dunitz; 2003.
2. Sadock BJ, Sadock VA. Kaplan and Sadock's synopsis of psychiatry: Behavioral sciences/clinical psychiatry. Lippincott Williams & Wilkins; 2011.
3. Wen KY, Gustafson DH. Needs assessment for cancer patients and their families. Health Qual Life Outcomes. 2004;2:11. doi: 10.1186/1477-7525-2-11. [PubMed: 14987334].
4. Yusuf AJ, Adamu A, Nuhu FT. Caregiver burden among poor caregivers of patients with cancer in an urban African setting. Psychooncology. 2011;20(8):902-5. doi: 10.1002/pon.1814. [PubMed: 20680930].
5. Friethriksdottir N, Saevarsdottir T, Halfdanardottir SI, Jonsdottir A, Magnusdottir H, Olafsdottir KL, et al. Family members of cancer patients: Needs, quality of life and symptoms of anxiety and depression. Acta Oncol. 2011;50(2):252-8. doi: 10.3109/0284186X.2010.529821. [PubMed: 21231786].
6. Veach TA, Nicholas DR, Barton MA. Cancer and the family life cycle: A practitioner's guide. Routledge; 2013.
7. Song JI, Shin DW, Choi JY, Kang J, Baik YJ, Mo H, et al. Quality of life and mental health in family caregivers of patients with terminal cancer. Support Care Cancer. 2011;19(10):1519-26. doi: 10.1007/s00520-010-0977-8. [PubMed: 21479527].
8. G Nayak M, George A, Vidyasagar MS, Kamath A. Quality of life of family caregivers of patients with advanced cancer. IOSR J Nurs Health Sci. 2014;3(2):70-5. doi: 10.9790/1959-03217075.
9. Palos GR, Mendoza TR, Liao KP, Anderson KO, Garcia-Gonzalez A, Hahn K, et al. Caregiver symptom burden: the risk of caring for an underserved patient with advanced cancer. Cancer. 2011;117(5):1070-9. doi: 10.1002/cncr.25695. [PubMed: 20960510].
10. Romito F, Goldzweig G, Cormio C, Hagedoorn M, Andersen BL. Informal caregiving for cancer patients. Cancer. 2013;119 Suppl 11:2160-9. doi: 10.1002/cncr.28057. [PubMed: 23695928].
11. Northouse LL, Katapodi MC, Schafenacker AM, Weiss D, editors. The impact of caregiving on the psychological well-being of family caregivers and cancer patients. Seminars in oncology nursing. Elsevier; 2012.
12. Graneheim UH, Lundman B. Qualitative content analysis in nursing research: concepts, procedures and measures to achieve trustworthiness. Nurse Educ Today. 2004;24(2):105-12. doi: 10.1016/j.nedt.2003.10.001. [PubMed: 14769454].
13. Yun YH, Kwon YC, Lee MK, Lee WJ, Jung KH, Do YR, et al. Experiences and attitudes of patients with terminal cancer and their family caregivers toward the disclosure of terminal illness. J Clin Oncol. 2010;28(11):1950-7. doi: 10.1200/JCO.2009.22.9658. [PubMed: 20212258].
14. Ishii Y, Miyashita M, Sato K, Ozawa T. A family's difficulties in caring for a cancer patient at the end of life at home in Japan. J Pain Symptom Manage. 2012;44(4):552-62. doi: 10.1016/j.jpainsymman.2011.10.011. [PubMed: 22575721].
15. Hendriksen E, Williams E, Sporn N, Greer J, DeGrange A, Koopman C. Worried together: a qualitative study of shared anxiety in patients with metastatic non-small cell lung cancer and their family caregivers. Support Care Cancer. 2015;23(4):1035-41. doi: 10.1007/s00520-014-2431-9. [PubMed: 25277959].
16. Park B, Kim SY, Shin JY, Sanson-Fisher RW, Shin DW, Cho J, et al. Prevalence and predictors of anxiety and depression among family caregivers of cancer patients: a nationwide survey of patient-family caregiver dyads in Korea. Support Care Cancer. 2013;21(10):2799-807. doi: 10.1007/s00520-013-1852-1. [PubMed: 23729225].
17. Tsigaroppoulos T, Mazaris E, Chatzidarellis E, Skolarikos A, Varkarakis I, Deliveliotis C. Problems faced by relatives caring for cancer patients at home. Int J Nurs Pract. 2009;15(1):1-6. doi: 10.1111/j.1440-172X.2008.01725.x. [PubMed: 19187163].
18. Chang EW, Tsai YY, Chang TW, Tsao CJ. Quality of sleep and quality of life in caregivers of breast cancer patient. Psychooncology. 2007;16(10):950-5. doi: 10.1002/pon.1167. [PubMed: 17315285].
19. Park CH, Shin DW, Choi JY, Kang J, Baek YJ, Mo HN, et al. Determinants of the burden and positivity of family caregivers of terminally ill cancer patients in Korea. Psychooncology. 2012;21(3):282-90. doi: 10.1002/pon.1893. [PubMed: 22383270].
20. Hatamipour K, Rassouli M, Yaghmaie F, Zendedel K, Majd HA. Spiritual needs of cancer patients: a qualitative study. Indian J Palliat Care. 2015;21(1):61-7. doi: 10.4103/0973-1075.150190. [PubMed: 25709188].
21. Lotfi Kashani F, Vaziri S, Esmaeil Akbari M, Jamshidifar Z, Mousavi M, Shirvani F. Spiritual interventions and distress in mothers of children with cancer. Procedia Soc Behav Sci. 2014;159:224-7. doi: 10.1016/j.sbspro.2014.12.361.
22. Fallah R, Keshmir F, Lotfi Kashani F , Azargashb E, Akbari ME. Post-traumatic growth in breast cancer patients: A qualitative phenomenological study. Middle East J Cancer. 2012;3(2 & 3):35-44. | http://intjcancermanag.com/en/articles/10753.html |
Home
Facilities
Derived works
Statistics
Visits
528
Downloads
745
How to cite
MARC format
OAI DC format
Master's Dissertation
DOI
10.11606/D.42.2016.tde-12082016-094920
Document
Master's Dissertation
Author
Camargo, Marília de Paiva
(
Catálogo USP
)
Full name
Marília de Paiva Camargo
Institute/School/College
Instituto de Ciências Biomédicas
Knowledge Area
Cell and Tissue Biology
Date of Defense
2016-03-01
Published
São Paulo, 2016
Supervisor
Borella, Maria Ines
(
Catálogo USP
)
Committee
Borella, Maria Ines (President)
Nóbrega, Rafael Henrique
Oliveira, Sergio Ferreira de
Title in Portuguese
Caracterização das espermatogônias indiferenciadas e dos nichos espermatogoniais em
Astyanax altiparanae
Garutti e Britski, 2000 (Teleostei, Characidae).
Keywords in Portuguese
Astyanax altiparanae
BrdU
Espermatogônia indiferenciada
Morfologia
Morfometria
Abstract in Portuguese
Ao se observar ao microscópio de luz e eletrônico de transmissão as espermatogônias indiferenciadas de lambari (
Astyanax altiparanae
), espécie de grande valor econômico e comercial, as mesmas se subdividem em Aund* e Aund. A do tipo Aund* apresentou núcleo irregular, excêntrico, cromatina descondensada e
nuages
próximas ao envoltório nuclear e/ou ainda, associadas às mitocôndrias e, a do tipo Aund, apresentou núcleo esférico, central, com cromatina levemente condensada e
nuages
. Análise por meio de morfometria demonstrou que o nicho espermatogonial das espermatogônias indiferenciadas do tipo Aund* é próximo ao interstício, enquanto as do tipo Aund, próximas às regiões entre dois túbulos (intertúbulo). Adicionalmente, de acordo com a técnica de incorporação e retenção de BrdU foi possível analisar a existência de possíveis candidatas às espermatogônias-tronco, chamadas de labeling-retaining cells, visto que estas células retiveram BrdU ao longo de todo período avaliado, demonstrando um longo ciclo celular, característica esta de célula-tronco.
Title in English
Characterization of undifferentiated spermatogonia and spermatogonial niche in
Astyanax altiparanae
GARUTTI and Britski 2000 (Teleostei, Characidae).
Keywords in English
Astyanax altiparanae
BrdU
Morphology
Morphometry
Type A undifferentiated
Abstract in English
Observing by light and transmission electron microscope, undifferentiated spermatogonia of lambari (
Astyanax altiparanae
), species of great economic and commercial value, they are divided into Aund * and Aund. The type Aund* presents irregular nucleus, eccentric and decondensed chromatin, and
nuages
near the nuclear envelope and/or associated to mitochondria. The type Aund presents spherical central nucleus, with slightly condensed chromatin and
nuages
. Morphometric analysis showed that the niche of the type Aund* spermatogonia is near the interstitium, while the type Aund, next to the regions between two tubules (intertubule). Additionally, by the BrdU incorporation and retention technique, we found the possible candidates to spermatogonial stem cells, called "labeling-retaining cells", since these cells have retained BrdU over the entire study period (21 days), showing a long cell cycle, a stem cells characteristic.
This document is only for private use for research and teaching activities. Reproduction for commercial use is forbidden. This rights cover the whole data about this document as well as its contents. Any uses or copies of this document in whole or in part must include the author's name.
MariliaPaivaCamargo_Corrigida_Mestrado_I.pdf
(3.31 Mbytes)
MariliaPaivaCamargo_Corrigida_Mestrado_P.pdf
(331.35 Kbytes)
Release Date
2018-08-12
Publishing Date
2016-08-12
Derived works
WARNING
: Learn what derived works are
clicking here
.
All rights of the thesis/dissertation are from the authors
CeTI-SC/STI
Digital Library of Theses and Dissertations of USP. Copyright © 2001-2021. All rights reserved. | https://www.teses.usp.br/teses/disponiveis/42/42134/tde-12082016-094920/en.php |
The Iowa Legislature refused to generate additional revenue for government services this session. And their cuts to the state budget slashed funding for higher education. Again.
State appropriations for operations at the University of Iowa and Iowa State were reduced by 6.25 percent for the 2018 budget year. The University of Northern Iowa will receive about 3.2 percent less in public support.
That reduction has prompted the Iowa Board of Regents to consider a 3 percent tuition increase — in addition to the already-approved 2 percent increase for the fall. Iowans will struggle to come up with more money to cover the cost of college, which frequently means borrowing more.
Debate about student loan debt has historically focused on young people who begin their adult lives in a financial hole. But now debt for these students increasingly burdens their parents and grandparents.
In January, the Consumer Financial Protection Bureau reported the number of education loans taken out by older Americans has nearly quadrupled over the past decade. In 2014, 73 percent of borrowers age 60 and older said their debt was owed for a child and/or grandchild’s education.
Family members may feel obligated to help pay for college. They may feel guilty for not saving or believe they owe a child the opportunity for a better future. And students may simply not be able to come up with the money on their own.
Undergraduates can borrow a maximum of $5,500 to $7,500 each year from the federal government. Those loans may not cover the entire cost of tuition, fees, books, housing and meals. Gone are the days when students can secure private education loans on their own.
A tightening of the credit market and new federal requirements have resulted in students needing co-signers, frequently parents and grandparents who become equally responsible for repayment. The CFPB estimates nearly 60 percent of co-signers on one or more outstanding student loans are age 55 and older.
Parents also borrow through the U.S. Department of Education’s Parent Plus program. In the 2015-16 school year, Iowans took out $161 million in these federal loans. Borrowers must pay all the interest (the current rate is 6.3 percent), and the loans are virtually impossible to extinguish in bankruptcy.
About 11 percent of Parent Plus loans are in default. As of September 2015, more than 330,000 borrowers had not made a payment in at least a year, according to the Government Accountability Office. The agency reported about 114,000 borrowers age 50 and older had Social Security benefits withheld to repay student loans in fiscal year 2015, a four-fold increase from 2002.
Retirees with outstanding education loans are more likely to skip “necessary health care needs such as prescription medicines, doctors’ visits and dental care because they could not afford it,” according to the CFPB.
So many older Americans incurring college debt for loved ones should provide a wake-up call to everyone. States need to do a better job funding higher education. Schools must do everything possible to contain costs. And families may need to rethink what makes sense financially.
They should avoid expensive, for-profit schools, consider community colleges and encourage young people to take time to work and save money instead of rushing into school. Families should also be aware of statistics on college completion and persistence.
In Iowa, about 30 percent of students who enter a four-year public college do not graduate within six years.
Nationally, about one in three students who started college in the fall of 2013 did not return to any U.S. educational institution in the fall of 2014, according to data from the National Student Clearinghouse Research Center. Nearly one in three. They didn’t transfer to a different school or enroll anywhere else.
Many of these students may still have education loans to repay, but no college degree to secure a better job. Sadly, their parents and grandparents may be left to struggle with debt, too.
Early information reduces borrowing
Iowa Student Loan, a nonprofit organization based in West Des Moines, provides thousands of private loans for higher education each year. Only 2 percent of borrowers qualify without a co-signer, meaning 98 percent need one. The co-signer is frequently a parent, grandparent or other family member.
Steve McCullough, president and CEO, recognizes the burden debt can place on entire families. “We want people to succeed in college,” he said. “That includes helping them know how to reduce the amount they need to borrow.”
Iowa Student Loan requires all borrowers to complete an online “smart borrowing” tool as part of the application process. It provides information about projected salaries for specific degrees, manageable debt loads and ideas for cutting costs. Students may be able to save money by renting textbooks, graduating on time and cutting unnecessary expenses. Parents are given advice about helping their students stay on track and be successful after college.
“I wish the federal government would require its borrowers to do the same thing,” McCullough said about the online tool. He credits it with helping Iowa families reduce their borrowing by more than $5 million over the course of four years.
This tool, “Student Loan Game Plan” and other borrowing resources are available for public use at www.IowaStudentLoan.org. | https://www.desmoinesregister.com/story/opinion/editorials/2017/05/06/editorial-student-loan-debt-burdens-parents-and-grandparents/309290001/ |
Become a LEADER in your community.
Learn to work with policymakers to make a difference in the quality of life for people with intellectual disabilities and/or on the autism spectrum.
C2P2 is a free program for:
- Family members of a school age child with an intellectual disability and/or on the autism spectrum;
- People with an intellectual disability and/or on the autism spectrum.
2020 Session Dates
- January 31 - February 1, 2020
- February 21-22, 2020
- March 27-28, 2020
- April 17-18, 2020
- May 1-2, 2020
- June 5-6, 2020
- June 26-27, 2020
- September 11-12, 2020
Session Times
Fridays: 1 PM - 9 PM
Saturdays: 8 AM -3 PM
Location
Hyatt Place, Bethlehem
45 West North St.
Bethlehem, PA 18018
Participants Will Learn
- About local, state and national issues affecting people with disabilities;
- To foster a partnership between people who need supports and services and those who make policy and law;
- To advocate for themselves and others;
- To teach policymakers a new way of thinking about people with disabilities.
Topics
- History of the Self-Advocacy and Independent Living Movement
- History of the Family Movement
- Visioning for a Preferred Future
- Best Practices in:
- Early Intervention
- Inclusive Education
- Transition
- Employment
- Community Inclusion
- Federal, State and Local Laws and Regulations
- How to effectively educate Legislators
- How to run a meeting
- How to serve on a Board of Directors
- Effective Communication
- Conflict resolution
- Assistive Technology
- Waivers
- Community of Practice in Supporting Families and in Employment
- Community Engagement
- Community Organizing and Resource Development
Requirements
- Successful applicants MUST commit to attend ALL sessions in person at the Bethlehem location;
- Attendees must review all materials before and after each session;
- Homework will be assigned and must be completed;
More Information
Participants will be reimbursed for travel and provided lodging (if 40+ miles are traveled).
C2P2 is free but only a limited number of applications will be accepted.
Application period is extended to January 17, 2020. All applicants will be notified on or around January 20, 2020.
Apply for C2P2 2020
Contact Us
Cathy Roccia-Meier
[email protected]
215-204-1772
Funded by Pennsylvania's Office of Developmental Programs. | https://disabilities.temple.edu/programs/leadership/c2p2-2020.shtml |
Donnie Campbell, left, of Anna, receives his certificate from Theresa Manteuffel for his service as a helicopter mechanic in Chu Lai, Vietnam, from 1968-1969 during a dinner Monday night which honored all Vietnam War veterans.
A POW/MIA table was placed part of the program to honor Vietnam War veterans Monday night.
The large group of Vietnam and Vietnam Era Veterans display their Certificates of Appreciation that they received Monday night at the Sidney Veterans Service Center.
SIDNEY — “Chatter” was code and the phonetic alphabet for sharing locations and orders over field radios in a different country and in a different time was a ordinary occurrence.
Over 40 soldiers who benefited from that static gathered together on Monday evening at the former American Legion to fellowship with their comrades who fought in the Vietnam War. The chatter was friendly, without fear, as they shared their stories with one another about all those years ago.
Chris North, Veteran’s Service director for Shelby County, welcomed the crowd with the Pledge of Allegiance followed by a prayer led by Ron Leininger, Shelby County Veteran Service commissioner. North clarified the purpose of this evening’s gathering as a tribute to the county’s Vietnam veterans and an opportunity to say thank you to the brave men and women who served.
On March 28, 2017, President Donald Trump declared the Vietnam War Veterans Act of 2017, and designated every March 29 as National Vietnam War Veterans Day. In accordance with this declaration, Shelby County Commissioner Julie Ehemann officially announced that this date, from this day forward, be recognized as Shelby County Vietnam War Veterans Day.
All branches of the military were represented, with the veterans proudly wearing their hats and jackets of Army, Navy, Air Force, Marines and Coast Guard and which Division they served in and dressed with what insignias they had been awarded, earned and identified by. They were connected in their experiences in that land. They were connected by the frustrations of coming home to a country which was war weary and less than celebratory for their return.
Mayor Barhorst shared his experience with the display of the Traveling Wall Memorial as he met two Vietnam soldiers.
“I don’t get to Washington often, but when I do, I always take time to visit the wall. When the replica wall visited Sidney almost a decade ago, I stood watch one of the nights it was here. I remember it being chilly and damp and lonely duty. It was then that I thought to myself, imagine doing this for hours at a time, day after day, week after week.
Barhorst related the interruption of these soldiers’ lives mirrored in the life of another man who Shelby County was named after. Isaac Shelby had a dream for his life to be a successful farmer and grow fine cattle. He had been called to fight in three wars, serve in the House of Burgesses as well as the North Caroline House of Commons. He also held the Governorship of Kentucky and served as the first president of the Kentucky Agricultural Society. His country called and he answered.
Shelby had a hero’s welcome when he had returned to Kentucky after one war he fought in. Word spread of his route and as he traveled home, people lined the road to gather a glimpse of the battle’s hero, and to thank him as he returned home to be a successful farmer and grow fine cattle.
“I’m sharing this story because of Shelby County’s Bicentennial, and also because Gen. Shelby’s return home following the Battle of Thames was so different from what I am guessing most of you experienced,” said Barhorst. “As I dig through old photos, I’ve found images of Civil War veterans marching along Poplar Street, faded photographs of World War I veterans returning home and marching in parades in Sidney, and black and white photos of World War II veterans being welcomed home.
Of those 850,000 veterans there are many soldiers who are in need of help but are not aware of all the services offered to them. North explained the types of programs and compensation available and gave instructions on how these vets can get that extra support they are deserved.
North listed benefits from caregiver benefits to monthly monetary payments for diseases that are being added to the long list of military connected ailments and urged Vietnam Vets to come to the Shelby County Veterans Services for more information and signing up for their due compensation. A list of those diseases and a Veterans Resource Guide where handed out for home reference and an explanation of what the Vietnam Vets are eligible for.
As a final thank you to the men and women attending the event, Certificates of Recognition were awarded to each person who served during the Vietnam War. | https://www.sidneydailynews.com/news/138832/honoring-americas-heroes-2 |
Owning a property is very expensive and entails a cumbersome process that might waste your time. If you want to commence your commercial venture quickly, it is advisable to lease a property. However, some people are only interested in owning the property before starting any development. Whichever approach you use, it is important to understand the procedures that are applicable so that you avoid being conned. This article is devoted to offering landlords and tenants important information they must consider before leasing or selling their properties.
As a prospective tenant, it is advisable to thoroughly search and important information about the property in question and its ownership. This will help you determine whether the person you want to give money is the real owner of the property. The landlord also needs to verify whether the person who wants to lease the property is genuine or they have hidden motives. It is also advisable for the prospective tenant to request a copy of the lease so that they go through and acquaint themselves of their obligations if they become tenants of the property.
As a prospective tenant, you need to evaluate how important services are handled. For example you need to look at who will pay the electricity, and water bills. You need to evaluate whether these bills are paid as part of rent or you pay for yourself. If they are paid as part of rent, what happens when you consume extra services?
The lease agreement must state clearly who should carry out repair work and renovations. If for example, it is the tenant, the lease should state how the tenant will get back the money used for repair. On the other hand, if you are selling the property, improve it by painting it, replacing broken windows and even the roof. This will make the property more valuable.
It is important for a prospective property purchaser to ensure that the seller has a genuine title. It is advisable to visit relevant government agencies to verify the authenticity of the title and its current status. | https://propertymanagementkenya.com/leasing-property.html |
The Workshop: sensory & consumer behavior includes basic topics related to sensory science, consumer research and behavioral/ emotion research combined with various exercises/case studies covering practical, real-world scenarios.
The aim of this workshop is to familiarize participants with various, carefully selected, methods, techniques and tools used during the complete journey of new product development and product understanding. We name examples such as product labs, triangle tests, but also observational research and facial expression analysis. Each one of these methods can be helpful in its ‘own right in developing an adequate product business case. During the workshop these methods and much more will be introduced and explained. Furthermore, advices will be given where they could be potentially applied and what benefits they can bring during the product innovation process (product and packaging) covering from ideation phase through market implementation till product withdrawal phase.
This course is for all involved in product’s innovation process and research, particularly for R&D managers, food technologists, product managers/specialists, category managers/specialists, business unit managers, quality assurance departments, on-site laboratories who would like gain, refresh or broaden their knowledge about various product research tools.
Although Xandra didn’t envision a life as a scientist and moved away from academic life, she did not move away from the human psyche! From a degree in Psychology, specializing in Neuropsychology, she moved to dabbling in HR for a short period of time, and then revisited the study of human behavior.
Specifically, she found her niche studying consumer behavior. Xandra worked on international projects as a qualitative researcher at an international market research company. This experience allowed her to convey consumers’ stories to clients from a variety of consumer industries.
After spending time in Australia, a place she adores, Xandra returned to the Netherlands. She currently lives in Amsterdam with her husband and two sons. Her sons keep her busy these days, so Xandra often has to put her other interests (motorbike and horse riding, salsa dancing, cooking, and gardening) on hold for the time being.
Through Noldus, Xandra was able to return to her neuropsychology roots. Making use of Noldus technology, she aims to explore both ‘System 1’ and ‘System 2’ of the human motivational systems to explain consumer behavior to her clients as thoroughly as she can.
Agata is highly analytical and creative consumer insights and sensory specialist proficient in products’ research and research in consumers’ needs, skilled in quantitative and qualitative methodologies. Enhanced know-how about sensory and consumer sciences she gained from working in the FMCG sector for many years and on individual trainings organized in research units in Europe (Germany, the Netherlands, England, France).
Her extensive professional experience is related to work in the food industry for well-known international companies in the FMCG sector in the departments: Research and Development (R&D) and Marketing, for such companies as Unilever and Heinz. She worked on a wide range of products in the food industry: from fresh to frozen products such as soups, sauces, ketchups, ready meals, juices, tomato products, chilled products, salads, vegetables, powder products, desserts, ice-creams, teas.
Currently Agata lives in Poznań in Poland but is quite a regular visitor in the Netherlands where it feels like her second home. In her free time she loves biking, hiking, travelling, and making photos of spectacular buildings and landscapes.
I have always been fascinated by the biology of feelings & behavior. Through Noldus, I have been able to return to these roots. I helped clients in their research to better understand consumer behavior. | https://noldusconsulting.com/blog/consumer-insight-research-workshop |
PSST: Expand your Revelation 12 view on the role of womanhood, motherhood & daughterhood as well as of the Comforter!
Monday, January 27th, 2020
PSST: Expand your Revealtion 12 view even more on the role of womanhood, motherhood & daughterhood as well as of the Comforter! –Cobbey Crisler on Rev. 12 (B21):
“We find in investigating the Old Testament as well as the New, that the woman in travail is an image, a metaphor, used almost as often as Messiah in prophecy. For the epitome of that, look at the 12 chapter of Revelation where we find not a novel figure at all, simply a repetition of a symbol that has been seen throughout the Scriptures. Remember womanhood and comforter, and comfort and love and motherhood her all closely linked as well as Scriptural ideas. So the concept of womanhood and comfort and the Comforter perhaps having relation to womanhood’s fulfillment of prophecy and the Genesis 1 role of God-given dominion may all be linked up. At least it’s worthwhile investigating to see what the Bible says.
As a matter of fact, here is what the Anchor Bible says about the figure in Revelation 12. See if you have ever looked at it from this angle.
“In Revelation 12 there is a mysterious symbolic figure of a woman who has a key figure in the drama of salvation. There can be no doubt that Revelation is giving the Christian enactment of the drama foreshadowed in Revelation 3:15 where enmity is places between the serpent and the woman, between the serpent’s seed and her seed—and the seed of the woman enters into conflict with the serpent. However, often in the Bible collective figures are based on historical ones. This, the fact that woman represents the people of God [generic man] would not at all preclude a reference to an individual woman who is the basis of the symbolism.”
So, you see that Bible scholars are wrestling with the concept that what we have in Revelation 12 is the remedy for Eve. All the stereotypical womanhood elements, all the failures, all the mistakes, all the errors associated with the Eve-subordinated woman have now been swallowed up in the Transfiguration of womanhood clothed with the sun and the moon under her feet. Remember that part of the curse on womanhood humanly is the periodic monthly complaints, monthly-and-moon-related.
We find that this ideal view of spiritual womanhood in Verse 1 of Chapter 12 restores the dignity of women’s dominion. Her feet are on the moon. That is the Scriptural symbol long-recognized in the Bible for dominion, “the moon under her feet.” Thus the Book of Revelation, a book that is attributed in its first verse to Jesus, which authorizes our including it in a course relating “Jesus and the Equality of Women”: this comparison between Eve and the dominion woman, the contest again between Genesis 2 and Genesis 1, and womanhood having that right on earth to embody the dominion of Genesis 1.
Should a man be entitled to overcome the problems or stereotypes on womanhood?
If so, woman would not have dominion. Is it womanhood’s right to respond to her God-given role prophetically? Are we ourselves perhaps, living in one of the most thrilling times of history? What would make these times thrilling despite their inherent dangers? It would be the spirit of prophecy. Is that happening? Can we see the signs of the times? Is manhood waiting to be fulfilled and completed as in the seven days when God himself rested after the completion of “male and female created he them”? (Genesis 1:27)
Until womanhood receives her appropriate Scriptural place, her God-given place, how can man rest in completion? How can man be generic? How can we, hand-in-hand symbolizing a higher spiritual unity than ever before, find ourselves co-residents of the Holy City, a city that has nothing but what is holy in it, a city that establishes our original relationship? No wonder when the Bible closes, we are asked to respond to one of the most heavenly invitations in its pages, “the Spirit and the Bride say, Come” (Revelation 22:17)
But, Ladies and Gentlemen, we cannot respond to that invitation to the wedding feast, God‘s view of creation, without our having on a wedding garment. That, hopefully, is what our search the Scriptures will give us. And we bring to that wedding feast our own thoughts uplifted to the sense of manhood and womanhood united forever by God with full dominion, no subordination or domination—no thought of sex— but a full, complete, joyous image of the Father-Mother divine parent. That’s what the Scriptures are holding out for us to prove in our lives. Then, let us go forward and be part of the fulfillment of that prophecy.”
“Jesus and the Equality Of Woman,” by B. Cobbey Crisler**
Mine THE G.E.M.s or affirming the mistakes of Eden expunged! —Cobbey Crisler’s insights on Rev. 12 (B21)
“Now we come to Revelation 12 – a great and portentous moment in the Bible. The word “sign” which the King James Version translates “wonder” appears in verse 1 for the first time and in its only positive use in Revelation.
Rev 12:1 And there appeared a great wonder in heaven; a woman clothed with the sun, and the moon under her feet, and upon her head a crown of twelve stars:
This unique sign is the epiphany of God’s womanhood – a contrast with the succeeding negative uses of the word sign is vivid. It stands out as does Isaiah’s well known and similar pronouncement that “the Lord himself shall give you a sign; Behold, a virgin shall conceive, and bear a son.” (Isa 7:14) …
But comprehension of this and interpretation of Isaiah’s statement, as well as the twelfth chapter of Revelation, have run the gamut of controversy. Scholars and theologians agree one thing that Revelation 12 is difficult if not impossible to explain. There may be a good reason for this, for the title of the book is not explanation but revelation.
To John at Revelation 12, verse 1 (see above) there appeared a great Symeon in heaven. The Greek word usually stands for a distinctive feature, identifying someone or something clearly. According to the Anchor Bible, “Symeon” usually translates in the Hebrew, that is, “some event assuring man of a divine intervention; it is a form of revelation.”
And we have a woman and her attire is celestial for it is associated with sun, moon, and stars. …
The Expositor’s Bible Commentary and the Anchor Bible have pointed out the sun, moon, and stars were part of the high priest’s garments. Does it follow, then, that this woman has something to do with the highest responsibilities in church?
In the Revelation 1, the son of man’s garments identify him as well with the priesthood, and thus, with the highest God-appointed responsibilities of church. … The arch priest of Israel has the exclusive right annually to enter the Holy of Holies where God’s presence was held in symbol to be. This is also where The Commandments rested inside the Ark, and where two Cherubim of purest gold, later overlaid on olive wood, stood symbolically on the right hand and left hand of God’s presence. In fact, if you remember, God is frequently cited in the Old Testament as dwelling between the Cherubim.
Consider then this Apocalyptic Picture of the woman with priestly implications and meanings and a crown of victory or dominion. How far this is from the stereotype subordinate role accorded woman by Ecclesiastical traditions through the centuries.
Although the very first statement about woman in the Bible is that God created her with dominion which precludes subjection. The first representative of womanhood in the text is Eve, and Eve is not only dominated by her husband, she is evicted from Eden, her home, woman’s special domain. This eviction has been used as Ecclesiastical pretext for her exclusion from high church offices.
Webster: pretext, noun — a reason given in justification of a course of action that is not the real reason.
Theologians have been kinder to man’s Genesis 1 dominion, than to woman’s simultaneously declared right. Going even further, Ecclesiastism continues solemnly to blame woman for the downfall of the race. This is why the dominion woman of Revelation 12 is such a radical sign that sends tremors through anciently rooted traditions and overturns them.
For Revelation 12 reverberates with news of woman’s God-ordained assignment, to complete the salvation of the race, which Jesus inaugurated. The Anchor Bible refers to this one as a “key figure in the drama of salvation.” Then the author adds “there can be no doubt that Revelation is giving the Christian enactment of the drama foreshadows in Gen 3:15 where enmity is placed between the serpent and the woman – between the serpent’s seed and her seed.
Gen 3:15 And I will put enmity between thee and the woman, and between thy seed and her seed; it shall bruise thy head, and thou shalt bruise his heel.
“Revelation 12 is unquestionably set against the background of Genesis 3,” from the Anchor Bible.
But shouldn’t we regard this woman simply as an Apotheosis – God’s ideal.
Rev 12, Verse 1 certainly casts about her certainly such a heavenly outline.
Rev 12:1 And there appeared a great wonder in heaven; a woman clothed with the sun, and the moon under her feet, and upon her head a crown of twelve stars:
The Bible has conditioned us, however, to look for God’s ideals to make an earthly statement, to have a concrete, practical application to present living.
In fact, The Lord’s Prayer petitions that God’s will be done in earth as it is in heaven. So, the Apocalyptic Picture in verse one of spiritual womanhood as God has created her must appear at some point as answered prayer “in earth as it is in heaven.”
Matt 6:10 Thy kingdom come. Thy will be done in earth, as it is in heaven.
Otherwise, woman’s God-given dominion would remain unexercised on earth. Her spiritual potential would remain unseen. She would never escape from Eve’s mold.
Wrestling with these implications, the Anchor Bible’s author continues: “It is generally agreed that the woman of Revelation is a symbol of the people of God; however, often in the Bible, collective figures are based on historical ones. Thus, the fact that the woman represents the people of God would not at all preclude a reference to an individual who is the basis of the symbolism.” (From the Anchor Bible.)
Rev 12, verse 2, with its Eve’s imagery of birth throes and pain contrasts with the dominion woman of verse 1: “…she being with child cried, travailing in birth, and pained to be delivered. (Rev 12:2)
As Jesus had foreseen in the Gospel of John, “…her hour is come.” (John 16:21) …
The Genesis 1 womanhood and her spiritual dominion must now be fulfilled on earth. The curse on Eve must be remedied and her stereotype transfigured. …
To exemplify this spiritual ideal is no easy task. The woman is opposed by the dragon’s animalism and its sworn enmity against life and health. This is the second sign – the great red dragon. Woman has met this symbol before in Genesis 3. It was smaller then – a serpent beguiling Eve.
Now, although John identifies it as that old serpent, it has grown to the proportions of a dragon, face to face with the woman of the Apocalypse. At this point in scripture, one could well reflect upon a young Sunday School boy’s ingenuous question: “Why didn’t they kill it when it was little?”
It may also be worth pondering that the symbols chosen – a talking serpent and a dragon – are not real entities in nature. They belong to the language of mythology. Even if a myth has ballooned for centuries, it is still a myth.
Have you noticed in Genesis there is no reported dialog between Adam and the serpent? Adams was commanded directly by God not to eat of the fruit of the tree; In fact, it is the first “thou shalt not” in the Bible. (Gen 2:17) …The tree, then, not the serpent, represents Adam’s problem, and Jesus is the remedy for Adam, Paul tells us. That would require that Jesus gloriously succeed at each point where Adam dismally failed.
Where, for example, in Jesus’ career, do we find the remedy for the tree?
The first epistle of Peter speaks of Jesus baring our sins in his own body on the tree. (I Pet 2:24)… Although tree here is a reference to the cross, the Greek word is the same, used in the Greek Old Testament for Adam’s tree. The act of nailing Jesus to the cross thus takes on symbolically the attempt to nail him to the tree of sin and its fruit, and to see him perish in the demoralization of Adam, and in the shame and futility of the Adam race. This would have left Jesus career as barely a footnote to human history. But, Jesus solved the problem of that tree; he called himself the bright and morning star, and this was the dawning of an entirely new human race. …
Sealed by God, rather than marked by the beast – a race that could now heal in the name of Jesus of Nazareth, rather than die in the name of Adam of Eden.
But Adam was not all there was to this surrender in Eden, there was Eve. Logic would conclude that she needs to be remedied as well, in order for all Eden’s mistakes to be expunged.
God’s logic and His revelation could not be counteracted, so we should pursue what Revelation waits to disclose on this theme. Eve’s failure was listening to the serpent; she was beguiled, as Paul writes. The serpent then, not the tree, represents Eve’s problem.
Gen 3:13 And the Lord God said unto the woman, What is this that thou hast done? And the woman said, The serpent beguiled me, and I did eat.
II Cor 11:3 But I fear, lest by any means, as the serpent beguiled Eve through his subtilty, so your minds should be corrupted from the simplicity that is in Christ. (Paul writes.)
How is the serpent’s apparent success to be remedied? The woman in Genesis One has dominion; this is the only remedy for manipulation and its fruits of subjection and subordination. The matrix of God’s womanhood is not the stereotype of man’s making. Only God’s type of womanhood could stand impervious to beguilement and subtlety, listen solely to God and free her seed from the magnetic pull of the dragon’s tail. Can such a role model be lived on earth as it is in heaven? Prophesy’s answer is an unequivocal “Yes!”
Scriptural text also foresees a serpent’s final grip on the ancient and modern history of man, both species and genera, will loosen and fall away. (Genera is plural of Genus – Def Webster)
No precedent will remain for allegiance to ought than one omnipotent God, and the human will be found living and embodying the First Commandment.
The magnitude of these two witnesses and their mission in prophesy, as well as the divine responsibilities they bear, grow in scripturally receptive hearts and burn within them. Let us turn to Isaiah 42, verse 13 for a few moments.
Here the prophet lists the only two witness to God’s full nature and essence.
One can discover, in Genesis One, the male and female of His creating. Isaiah refers to the first representation of God’s nature thus: “The Lord shall go forth as a mighty man.” (Isa 42:13) The New England Bible continues the translation like this: “As a warrior, he will rouse the frenzy of battle; like a hero, he will shout, he will raise the battle cry and triumph over his foes.”
Isa 42:13 The Lord shall go forth as a mighty man, he shall stir up jealousy like a man of war: he shall cry, yea, roar; he shall prevail against his enemies.
Is this a prophetic summons for manhood on earth to represent the essentials of manhood in heaven, to exercise dominion on earth as the master? All this is phrased in the language of battle.
The next verse, Isa 42:14, interposes a time transition, and God said, “I have long time holden my peace; I have been still, and refrained myself.”
Isa 42:14 I have long time holden my peace; I have been still, and refrained myself: now will I cry like a travailing woman; I will destroy and devour at once. Zzz47:20
Then comes the prophesy of a second representation of God’s nature “Now, will I cry like a travailing woman.” The Interpreter’s Bible Dictionary translates the Bible verse: “I will gasp and pant.” For the original Hebrew words are borrowed from vocabulary peculiar to the throes of childbirth.
So, Rev 12 is not without its antecedents in prophesy. What kind of a birth is being portrayed, however? Turn back to Rev 12:2 to the phrase “travailing in birth.”
Rev 12:2 And she being with child cried, travailing in birth, and pained to be delivered.
In the original Greek travailing in birth in conveyed by one word, and it connotes intense pain in general – that is the physical and mental senses. The verb’s usual meaning is in anguish or being in torment with no references to the pangs of childbirth in a literal sense. The Anchor Bible comments: “The present tenses indicate prolonged suffering – the terminology no ordinary childbirth.” The phrase with child does not always refer to physical motherhood. Similarly, “cries out” is not confined to an association with childbirth.
In the Septuagint, or Greek Old Testament, it is also used for crying out to Yahweh. “In John it occurs four times in the sense of proclaiming in the face of contradiction.” (Anchor Bible) Philo, a Jewish philosopher, roughly contemporary to Jesus, uses the word, according to The Anchor Bible, “in the sense of the soul bringing forth thoughts.” The woman of Rev 12, verse 1, wears a crown or corona in Jerome’s Latin translation. The woman of Rev 12, verse 2, is pained or cruciator in the same Latin translation – a word that shares the same root with cross and crucifixion. In this combination of crown and cross, we have appears to be a divine human coincidence, an event divinely prescribed, but humanly carried out. It comes as no surprise to read further in the Anchor Bible that “the woman’s symbol is almost as important as The Lamb.”…
Later in Revelation, references to the Lamb’s wife divulges her complementary role to The Lamb. Jesus calls himself the bridegroom, a prophetic word. The title, however, is not suitable unless there is a bride. ….
Going back to Genesis One, the next reference to the number two is not in numerical form, but rather illustrated in the product of God’s nature, as male and female. Both are said to be the image of God, having His dominion, and absolutely God-like – “Male and female, created He them.” For what reason we ask? — Logic responds, “To be like Him, to be two witnesses of his nature – manhood and womanhood, two luminaries, two candlesticks…
What a radical challenge this is both to our present traditions as to God’s essential being as well as to the relationships between the sexes. First, we must conclude from the text of Genesis One, that image is male and female, the original, or God, is revealing His nature, and Her nature, as Father/Mother." | https://cedarscamps.org/inspiration/article/psst-expand-your-revelation-12-view-on-the-role-of-womanhood-motherhood-daughterhood-as-well-as-of-the-comforter/ |
Happy Friday! What a week, huh? Between Super Tuesday and the coronavirus, there is certainly a lot of news to digest, which is why we are eternally grateful for your readership. ( ??: Alex Posner, Young Conservatives for Carbon Dividends, taken from CPAC.)
This week’s must read: climate change no longer dirty words for Florida’s GOP, but how green will Trump go? (Palm Beach Post) Alex Bozmoski is quoted in this article exploring the shift in Florida GOP lawmakers position on climate change, compared to how the Trump Administration has positioned itself.
“I think it is more likely than not that the president’s rhetoric on climate change will be less offensive to reality than it has been in the past as we approach the election,” Alex said. “What you are seeing in Florida is the direction the Republican party must go if it wants to continue to be a national political party.”
This week’s other must read: Climate solutions, Texas style (Texas GOP Vote) written by our dear Bob Inglis. “While for years, conservatives were the 800-pound elephant in the room when it came to debate on climate change, those on the fringes of American politics should not penalize House leaders for their enthusiasm to move forward on a set of solutions that aligns with the values of limited federal government and a vibrant free market,” Bob writes. “Texas finds itself in a unique position. Long the oil and gas giant of the U.S., in recent years, the Lone Star State has catapulted over Iowa and Oklahoma to also become the top wind energy generator, with enough power to keep the lights on in over six million homes. No one knows that better than Texas, where those abundant fossil fuels and the promise of renewable energy work side by side to power the state. The EcoRight runs strong in Texas because Texas is a free enterprise state that’s ready to drive innovation.”
Fear and Loathing: Utah Senator Mitt Romney, a leading EcoRight climate voice in the U.S. Senate, called climate change one of his three greatest fears to “standing applause from the crowd.” (FTR the other two are the national debt and China.)
Romney said: “People say to me, ‘Are you sure that we’re causing (climate change)?’ And I say, ‘I hope we’re causing it. Because if we’re not causing it, there’s nothing we can do about it. So I hope we’re causing it, and I believe we’re causing it to a great degree,” according to the report. “Passing laws in Washington about restricting the size of your washing machine and how many watts your lightbulb has that’s nice, but it’s not going to change global warming…The only way you’re going to reduce or bring down the growth rate in CO2 emissions in the planet is if we develop technologies across all the things that emit CO2 that are low-emitting and that are less expensive than the current technologies.”
Side note: ??Happy early birthday?? to Senator Romney, who celebrates next week on March 12th (h/t CCL Conservative Caucus for the intel.)
Quote of the week: “The question is not whether or not you view climate change as an issue that requires a solution, but what is your policy and how do you intend to reduce carbon emissions?” says former Pennsylvania Rep. Ryan Costello, who lobbies for the carbon dividend plan.
Spotlight on spokespeople: We love seeing our people’s names in print, so finding the profile on John Sweeney was a welcome way to usher in Monday. In the article What’s your climate hope for 2020? John says: “Regardless of how the election turns out, there must be a commitment on the part of our government and public policy to take some sort of action and start leading a coordinated global response,” he said. “And whether that’s President Trump doing it, or whoever becomes the Democratic nominee if he or she should win, that’s what needs to happen.”
Plus, we are here for the photo of John with the elephant.??
Also, check out Young Conservatives for Carbon Dividends led by Kiera O’Brien blow minds at CPAC as they lead the path for conservative climate action.
These young conservatives believe Greta Thunberg about the climate crisis and want to bring Republicans with them. CNN’s Bill Weir reports https://t.co/khovmIC19P pic.twitter.com/dNGdBQEvNt
CNN Politics (@CNNPolitics) March 6, 2020
And we read the end of another week. ?Spring ahead! Turn your clocks forward, friends who still have clocks that require manual changing. And don’t forget to wash your hands regularly while chanting “the EcoRight believes the free market can solve climate change” 20 times. ??Or the ABCs will do too, but we think ours is more fun and a great way to raise the energy level on our mission. | https://republicen.org/blog/climate-week-en-review-march-6-2020 |
Internal combustion engines use fuel injectors to precisely control the amount of fuel inducted into the engine's cylinders. Also, fuel injectors atomize the liquid fuel, increasing the homogeneity of the air and fuel mixture. Air assist injectors are devices that use airflow to enhance the atomization of fuel injected into an engine's cylinder. Air assist injectors may be required on some vehicles where additional fuel vaporization can promote better combustion and lower regulated emissions. Further, the air flowing through the air assist injector can be controlled to maximize the benefit as a function of engine operating conditions.
For example, at low engine operating temperature, fuel atomization can be enhanced by controlling a flow valve to be substantially open, thereby allowing a large airflow through the air assist injectors. On the other hand, air assist injector airflow can be restricted by controlling the flow valve to be substantially closed as the temperature increases to prevent overrunning of the engine. Another example, which can be combined with the previous example, is that the flow valve can be controlled to open proportionally to an engine load, thereby allowing an increasing airflow through the air assist injectors as engine load increases to counteract the decreasing pressure ratio caused by increasing manifold pressure. Such a system is disclosed in U.S. Pat. No. 5,460,148.
The inventor herein has recognized numerous disadvantages with the above approaches. For example, when the engine is operating at a mid-load condition, the airflow through the air assist injectors will not be maximized because the flow valve will be partially restricting the airflow to the air assist injectors. This is due to the valve being open proportionally to engine load. In other words, at mid-load, the valve is not fully open. Further, when the engine is started at a warm temperature, the flow valve will be restricting the airflow, thus preventing optimal atomization of the injected fuel, which can cause less than optimal emission control. Another disadvantage is related to the reliance on the operating temperature of the engine. For example, as an engine ages, less torque, and thus less air, may be required to maintain a given speed at a given temperature due to decreased friction. Thus, if temperature alone is used, the engine may develop an overrunning condition due to excess air flowing through the air assist injectors, which is utilized in combustion.
| |
Jamia Millia Islamia (JMI) has announced that even semester examinations for the academic session 2020-21will be conducted through online open book mode. The scheduled exam dates have also been published on the official website of the varsity.
The university has issued the detailed guidelines for the open book exams. A mock examination will be conducted before the exams to provide orientation to students for the main examination. The exact date and time of the mock test will be communicated to the students on their registered e-mail id as well as on students’ portal on Jamia examination website.
A helpdesk number and email id has been created to address the issue of the students during the online mock tests. One hour of mock examination is compulsory for each student.
Students would be allowed to appear for the examinations from their chosen place of convenience, as per the guidelines issued by the varsity. They are advised to login at the students’ portal at least 30 minutes before the scheduled time for examination to avoid any last minute hurry.
Students will be given four hours including three hours to write the exam and one hour to upload the answer sheets. Students need not be online for the entire duration of the test, however, while downloading the question paper and uploading answer sheets, they must be online, Jamia said in an official notification.
The student will be able to view the question paper on their test screen. In case of any technical difficulty, students may contact their subject teacher on phone. The concerned teacher will send the question paper directly to the student’s email or WhatsApp. However, this option may be exercised only in case of an emergency situation.
Student must write the answers to the questions on A-4 size white papers in own handwriting and the answers are to be written using black or blue pen only.
If a students has uploaded wrong answer sheet and wants to make any corrections, they must do so within the specified duration of the online exams. | https://earlypost360.com/jamia-to-hold-open-book-exams-issues-important-guidelines/ |
The home of baobaobs and elephants
The fierce sun sucks the moisture from the landscape, baking the earth a dusty red, the withered grass as brittle as straw. The Tarangire River has shrivelled to a shadow of its wet season self. But it is choked with wildlife.
Thirsty nomads have wandered hundreds of parched kilometres knowing that here, always, there is water. Herds of up to 300 elephants scratch the dry river bed for underground streams, while migratory wildebeest, zebra, buffalo, impala, gazelle, hartebeest and eland crowd the shrinking lagoons. It’s the greatest concentration of wildlife outside the Serengeti ecosystem – a smorgasbord for predators – and the one place in Tanzania where dry-country antelope such as the stately fringe-eared oryx and peculiar long-necked gerenuk can be observed, although very rarely.
Tarangire is one of the most diverse parks in Tanzania and situated in the north-western corner of Tanzania’s Masai Steppe, east of The Great Rift Valley. Covering an area of 1,360 sq km comprising scattered acacia woodland, baobab and palm trees, plains, swamps and rivers. There is an abundance of big game including lion, elephant and buffalo, as well as a vast bird and lesser game population.
More ardent bird-lovers might keep an eye open for screeching flocks of the dazzlingly colourful yellow-collared lovebird, the somewhat drabber rufous-tailed weaver and ashy starling – all endemic to the dry savannah of north-central Tanzania.
TARANGIRE
NATIONAL
PARK
When is the best time to visit?
Tarangire is one of Lemasani’s favourites; it is a gem that is overlooked by many travellers because it is not one of the more famous parks in the northern circuit. Tarangire is amazing for game viewing between July and January; starting mid January and forward it’s not as good although bird watching is excellent this period, maybe even one of the best in Tanzania.
What is there to do?
Day game driving is the main activity in Tarangire and in season it’s amazing; the large area of the park will give you a quiet game viewing you will not find anywhere else in the north. If you like elephants then you will love Tarangire; the park has more than 5000 elephants. Night game driving and walking safaris are only available if you stay outside the park.
How about accomodation?
Our by far favourite camps to stay are actually situated outside the park boarders; Twc’s Lake Burunge and Maromboi are both situated beautifully and secluded with amazing views and lot of game activitiy nearby.
Other great places to stay in outside the boarders are Osupuko Lodge and Kirurumu Lodge and our favourite on the higher end Elewana’s Tarangire Tree Tops that is situated in the tree tops.
Inside the park Tarangire Safari Lodge and Tarangire Sopa Lodge are classic and very good value. On the absolute high end there Oliver’s Camp and Swala Tarangire Camp.
For a camping safari Tarangire offers the best there is; the location of the public campsites are absolutely beautiful with a lot of animal activity both daytime and nighttime. | http://www.lemasanisafari.com/tarangire-national-park/ |
“Then he shall confirm a covenant with many for one week; But in the middle of the week He shall bring an end to sacrifice and offering.” (Daniel 9:27a)
Here in the last verse of Daniel chapter 9, we have a reference to the Antichrist making some kind of covenant with many people. Even until very recently, I’ve assumed this verse was referring to a “seven-year peace agreement.” It has become so common for people to refer to this verse as a peace treaty of some sort that I confess I took it for granted.
However, there is no reason to think this covenant is speaking of a peace treaty. In all the Bible versions I have available to me through Bible software and the Internet (a considerable number), the word peace is not mentioned or even implied. In addition, I suggest whatever this covenant is that the Antichrist makes must be a covenant that was already in place, based on the underlying Hebrew text.
I believe this verse is referring to the Antichrist trying to fulfill the modern Jewish expectations of a “new covenant” that the Messiah will make in the last days. This concept is detailed in many places in the Old Testament, but a notable one is in Jeremiah 31:31, which states:
“Behold, the days are coming, says the Lord, when I will make a new covenant with the house of Israel and with the house of Judah.”
Both Christians and Jews believe this verse is messianic, but their two views of this “new covenant” are vastly different. The Jews believe this means that when the Messiah comes, He will reconfirm the covenant they already had; that is, the Messiah will make it possible for them to once again abide by the laws given by Moses, especially regarding the daily sacrifices in the temple. The Jewish view of the phrase “new covenant” is no more than a renewed national commitment to abide by God’s laws.
Jewish scholar Uri Yosef, PhD, , concludes his paper called “Will the Real New Covenant Please Stand Up?” this way:
“It is evident that Jeremiah’s use of the term שׁהָ דָחֲ ריתִבְּ , a new covenant, does not involve the replacement of the (eternal) Torah by the New Testament. Rather, it signals a renewal of the original Sinai Covenant.”1
JewsForJudaism.org states:
“Jeremiah’s ‘new covenant’ is not a replacement of the existing covenant, but merely a figure of speech expressing the reinvigoration and revitalization of the existing covenant.”2
Keep in mind that Uri Yosef and the writers of the article in JewsForJudaism.org, like many Jewish people, would agree that this renewing of the Mosaic covenant will happen when the Messiah comes. They believe that one of the ways He will do this—probably the most important way—is by reestablishing the sacrificial system.
Interestingly, this is exactly what Daniel 9:27 states with the words “he shall ‘confirm a covenant’” (NKJV). This phrase, “confirm a covenant,” is very interesting, and the Hebrew words are apparently difficult to translate into English. Note a sample of how differently it is translated in popular versions of the English Bible:
NET Bible (NET): “He will confirm a covenant.”
English Standard Version (ESV): “And he shall make a strong covenant.”
King James Bible (KJV): “And he shall confirm the covenant.”
Young’s Literal Translation (YLT): “And he hath strengthened a covenant.”
Notice that it isn’t just the words, but their core meaning, that vary. In the NET translation, “he” is confirming an already existing covenant; in the ESV, “he” makes a new strong covenant; in the KJV, “he” confirms the covenant, suggesting it is the Mosaic covenant; and in the YLT, “he” is strengthening an already-existing covenant. Of the nineteen versions of the Bible I checked, eleven have the Antichrist confirming or strengthening an already-existing covenant as opposed to making a new covenant altogether.
The obvious question is: Which one is right? I will add a discussion about the details of this linguistic problem in the footnotes,3 but I believe the original Hebrew expresses a confirming or strengthening of an already-existing covenant. The idea of the covenant being strengthened comes from the fact that the Hebrew word sometimes translated “confirm” carries the meaning of making something strong. I would even suggest that this covenant was meant to be understood as the covenant (i.e., the Mosaic covenant). Some translations, like the KJV, even render the word a as the, which suggests a reference to a particular, preexisting covenant. Contextually, that must be the Mosaic covenant.
There seems to be confirmation that we’re on the right track with this idea, because the second part of Daniel 9:27 says: “But in the middle of the week He shall bring an end to sacrifice and offering,” as if to suggest that it is obvious that the covenant being strengthened began by starting the daily sacrifices. This verse is contrasting these two ideas; it’s like the verse is saying: He confirms the covenant (which started the daily sacrifices), but then (three-and-a-half years later) he stops the sacrifices. The words presuppose that the reader understands the covenant began with restarting the daily sacrifices.
If this is speaking of the Antichrist trying to fulfill the Jewish expectations of the “New Covenant” of Jeremiah 31, then the singling out of the daily sacrifice here and in other places where this event is mentioned is pretty interesting, because without the daily sacrifice it is very difficult, if not impossible, to truly keep the Mosaic covenant. It is the first and most important of all sacrifices to the Jews, it made daily atonement for their collective sin, and it’s believed that this sacrifice must start again for God’s blessing to rest in its fullness on the Jewish people. In the Jewish mind, the reinstatement of the daily sacrifices is tangible proof that the Messiah has come and Jeremiah 31:31 has come true.
If this scenario is true, the idea that the Antichrist will announce a seven-year covenant, as opposed to announcing an eternal covenant, is absurd. He would not say, “Hey, everyone, I’m the Messiah, and now you have a new covenant, but it’s really not eternal; it’s only going to last seven years.” Here again, I think we are victims of modern Bible prophecy teaching. Scripture never says he will say he is setting up a seven-year covenant. It only says that the covenant will last seven years. In fact, according to a lengthy study on grammar by the Pulpit Commentary, linked in the footnotes, the underlying Hebrew suggests this, too. That study concludes by translating that part of the verse in this way: “The covenant shall prevail for many during one week.”4
So, it seems clear that the seven-year time frame will not be announced to the people who are agreeing to it. The Antichrist will in, all probability, say that this will be an eternal covenant. The mention of the seven years is, therefore, just God telling us how long this false covenant will really last. Note also that Scripture says it will continue to last the entire seven years. It won’t go away at the midpoint. Only the daily sacrifices will be taken away.
I believe the covenant made by the Antichrist is an argument in favor of the case that he will claim to be the Jewish Messiah. The Jews are wholeheartedly expecting the Messiah to do the exact thing Daniel 9:27 is saying the Antichrist will do—that is, confirm a covenant and start the daily sacrifices. We can be sure that whoever does this will be looked at as the Messiah by the Jews as well as by many Christians, who may see this as the beginning of the millennial reign of Christ.
Notes
Uri Yosef, PhD. Jeremiah 31:30–36[31-37]1 “Will the Real ‘New Covenant’ Please Stand Up?” 2001–2011 for the Messiah Truth Project.
Gerald Segal. “Is Jeremiah’s ‘New Covenant’ (Jeremiah 31:31–34) a Prophecy Fulfilled by the New Testament?”, n.d., http://jewsforjudaism.org/knowledge/articles/jeremiah/is-jeremiahs-qnew-covenantq-jeremiah-3131-34-a-prophecy-fulfilled-by-the-new-testament/.
And he shall confirm the covenant—literally, “he shall make strong”—והגביר vehı̂gebı̂yr. The idea is that of giving strength, or stability; of making firm and sure.—Barnes Notes on the Bible (Daniel 9:27). (See also the following footnote.)
The clause, “the covenant shall be strong (δυναστεύσει) upon many,” is a doublet of the clause, “when he shall confirm the covenant to many weeks.” The clause, “and after seven and seventy times and sixty-two years,” is a doublet of the beginning of the twenty-sixth verse; “Till the end of the war, and the desolation shall be taken away,” is an alternative version of the last clause of the twenty-sixth verse. When those extraneous elements are got rid of, we have left a rendering of the twenty-seventh verse, which may afford us light as to the text. “The covenant shall be strong upon many” is a possible rendering of the Hebrew (see Psalm 12:5).—Pulpit Commentary (Daniel 9:27). | https://bibleprophecytext.com/books/islamic-antichrist-debunked/appendix-5/ |
- A juristic person, as opposed to a “natural person” (that is, a human being), is an entity whom the law vests with a personality.
- In other words, it is not an individual natural person but an artificially created person which is to be recognised to be in law as such.” Gods, corporations, rivers, and animals, have all been treated as juristic persons by courts.
- The treatment of deities as juristic persons started under the British. Temples owned huge land and resources, and British administrators held that the legal owner of the wealth was the deity, with a shebait or manager acting as trustee
- Installed deities at Hindu places of worship have been treated like other real persons for the purpose of law.”However it is not all idols that will qualify for being ‘juristic person’ but only when it is consecrated and installed at a public place for the public at large.”
The rights deities have
- Owning property
- Paying taxes
- Suing, and being sued
Important Note :
“Deities have property rights, but not fundamental rights or other constitutional rights.” This was upheld by Justice D Y Chandrachud in the Sabarimala judgment: “Merely because a deity has been granted limited rights as juristic persons under statutory law does not mean that the deity necessarily has constitutional rights.”
Other than Hinduism
- A mosque has never been held as a juristic person, because it’s a place where people gather to worship; it is not an object of worship itself. Neither has a church.
- In Shiromani Gurdwara Parbandhak Committee vs Som Nath Dass and Others (2000), the SC ruled that the “Guru Granth Sahib… cannot be equated with other sacred books… Guru Granth Sahib is revered like a Guru… (and) is the very heart and spirit of gurudwara. The reverence of Guru Granth on the one hand and other sacred books on the other hand is based on different conceptual faith, belief and application.”
- However, the court clarified that “every Guru Granth Sahib cannot be a juristic person unless it takes juristic role through its installation in a gurudwara or at such other recognised public place.”
Other Legal entities
- Entire animal kingdom has a distinct legal persona with corresponding rights, duties, and liabilities of a living person”.
- Uttarakhand High Court declared that the Ganga and Yamuna would be legally treated as “living people,” and enjoy “all corresponding rights, duties and liabilities of a living person”. The order was stayed by the Supreme Court in July that year because it “raised several legal questions and administrative issues”. | https://www.iasabhiyan.com/god-as-a-juristic-person/ |
Ultrasounds measure the size of the fetus to predict a due date and are usually very accurate, within two weeks, so I would safely assume that it would not be off by five weeks. You can ask your doctor, it won't be the first time he or she has answered that question,I promise.
Also it depends on when the U/S is. U/S before 12 weeks of pregnancy are very accurate, plus or minus 2 weeks. After that there are more varibles, babies grow at different rates so they are not as accurate.
You can use a pregnancy conception calculator to determine when your baby was conceived. In order to find out your pregnancy conception date you need to know the date of your last menstrual period, the average length of your menstrual cycle and the average length of your luteal phase. Knowing the length of your luteal phase is very important to accurately determine the conception date.
I am guessing you mean that you want to know your date of conception? It really depends on a couple of factors. If your normal periods are regular, you can be fairly accurate with conception date within a couple of days. Count back 14 days from when your period was DUE (ie but didn't come because you were pregnant) and this will be around the time of conception. Conception date will be within two days either side of this date. If you are pregnant now, an ultrasound will tell you very accurately what your conception date is. As long as you have an ultrasound within the first 10 weeks - the earlier the better. An experienced ultrasonic person can tell you down to the day - ie six weeks and three days.
Where is the origin of the Panama hat?
Have you ever crashed a wedding or had your wedding crashed, if so what happened?
How many times did Joe Biden run for president?
What is the world’s oldest soft drink?
How many novels did Charles Dickens write?
What do the colors on America's flag mean?
How did Harry Houdini come up with his stage name?
What is modal fabric?
Accountancy is necessary while auditing is a luxury comment?
When arranging equipment at the front desk that factor should be considered?
When arranging equipment at the front desk what factors should be considered?
What is the shape of SiOCl2?
What does CTA stands for in ICSE board?
2. Under what condition is a diode never intentionally operated?
How did Angel Rain died?
BA-28 which is a recommended water-skiing safety practice?
Copyright © 2020 Multiply Media, LLC. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Multiply. | https://www.answers.com/Q/How_accurately_can_an_ultrasound_determine_the_date_of_conception |
She also teaches on the Era of the U.S. Civil War and Reconstruction,
on Crime, Heredity, and Insanity in American History,
and on Law and Religion in U.S. History, and A Nation of Slobs.
Learn more about the History Department at the University of Notre Dame
Professor Pski was inspired to create this University Seminar after a story about her edition of the memoirs of Malvina Shanklin Harlan appeared on the front page of the New York Times. What kinds of history catch the public eye? What is gained or lost when a scholar writes for a popular audience? One class spent time looking at how scholars, museums, and films present Abraham Lincoln as a president, husband, and vampire hunter. Notre Dame's Institute for Studies in the Liberal Arts funded a class visit to the Abraham Lincoln Presidential Library and Museum where students had a chance to talk to James M. Cornelius, Curator of the Lincoln Collection.
For more on the ALPLM, click here.
First-year Notre Dame students at the Abraham Lincoln Presidential Library and Museum
Professor Pski created this upper-level seminar to introduce students to the history of dress, fashion, and the distribution of fashion in Europe and the United States. It starts in the late 19th century when the department store was invented and reformers of women's dress were railing against the tight corset and the excessive frippery found on women's clothing. Students learn about about the rise of ready-to-wear clothing, how Europeans and Americans dressed for two world wars, how they coped with periods of depression and prosperity, and how they argued over the meaning of clothing and appearance to men and women from the bobbed hair of the 1920s to the denim overalls of the American Civil Rights Movement in the 1960s.
Professor Pski
Linda Przybyszewski, PhD
This is the Biennial Dress, an attempt in 1916 to design a dress that would flatter every woman and never go out of style.
It didn't quite work, did it? | http://www.professorpski.com/teaching.html |
Skateboarders can return to Shakespeare Park – if there’s room for them to kickflip at least two metres apart.
City officials announced the reopening of the all-wheels skate park on Facebook Thursday, making it one of the first recreational facilities in Stratford to do so following the loosening of some provincial pandemic guidelines on May 19.
Fencing surrounding the park has been replaced with signage reminding users to keep their distance from each other.
“In keeping with guidance from health professionals, we also suggest that if you arrive at the skate park and find that it is crowded, please wait until there is enough space to physically distance, or return at another time,” the post said.
Stratford police will be monitoring the park, the post added, and users are being encouraged to use hand sanitizer or frequently wash their hands, and stay home if they’re ill. | |
In this letter, a computationally feasible technique for dimension scaling of antenna structures is introduced. The proposed methodology is based on inverse surrogate modeling where the geometry parameters of the antenna structure of interest are explicitly related to the operating frequency. The surrogate model is identified based on a few antenna designs optimized for selected reference frequencies. For the sake of computational...
-
Inverse modeling for fast design optimization of small-size rat-race couplers incorporating compact cellsPublication
In the paper, a framework for computationally-efficient design optimization of compact rat-race couplers (RRCs) is discussed. A class of hybrid RRCs with variable operating conditions is investigated, whose size reduction is obtained by replacing ordinary transmission lines with compact microstrip resonant cells (CMRCs). Our approach employs a bottom-up design strategy leading to the development of compact RRCs through rapid design...
-
Inverse surrogate modeling for low-cost geometry scaling of microwave and antenna structuresPublication
Purpose–The purpose of this paper is to investigate strategies for expedited dimension scaling ofelectromagnetic (EM)-simulated microwave and antenna structures, exploiting the concept of variable-fidelity inverse surrogate modeling.Design/methodology/approach–A fast inverse surrogate modeling technique is described fordimension scaling of microwave and antenna structures. The model is established using referencedesigns obtained...
-
Expedited Geometry Scaling of Compact Microwave Passives by Means of Inverse Surrogate ModelingPublication
In this paper, the problem of geometry scaling of compact microwave structures is investigated. As opposed to conventional structures (i.e., constructed using uniform transmission lines), re-design of miniaturized circuits (e.g., implemented with artificial transmission lines, ATSs) for different operating frequencies is far from being straightforward due to considerable cross-couplings between the circuit components. Here, we...
-
Rapid dimension scaling of triple-band antennas by means of inverse surrogate modelingPublication
Geometry scaling of antennas, i.e., finding optimum dimensions of the structure for given operating conditions and material parameters is an important yet challenging problem. In this paper, we discuss fast dimension scaling of triple-band antennas with respect to operating frequencies. We adopt the inverse surrogate modeling approach where the surrogate model is a function of the three operating frequencies of the antenna and...
-
Editorial for the special issue on advances in forward and inverse surrogate modeling for high-frequency designPublication
The design of modern‐day high‐frequency devices and circuits, including microwave/RF, antenna and photonic components, historically has relied on full‐wave electromagnetic (EM) simulation tools. Initially used for design verification, EM simulations are nowadays used in the design process itself, for example, for finding optimum values of geometry and/or material parameters of the structures of interest. In a growing number of...
-
Inverse surrogate models for fast geometry scaling of miniaturized dual-band couplersPublication
Re-design of microwave structures for various sets of performance specifications is a challenging task, particularly for compact components where considerable electromagnetic (EM) cross-couplings make the relationships between geometry parameters and the structure responses complex. Here, we address geometry scaling of miniaturized dual-band couplers by means of inverse surrogate modeling. Our approach allows for fast estimation...
-
Cost-Efficient Bi-Layer Modeling of Antenna Input Characteristics Using Gradient Kriging SurrogatesPublication
Over the recent years, surrogate modeling has been playing an increasing role in the design of antenna structures. The main incentive is to mitigate the issues related to high cost of electromagnetic (EM)-based procedures. Among the various techniques, approximation surrogates are the most popular ones due to their flexibility and easy access. Notwithstanding, data-driven modeling of antenna characteristics is associated with serious...
-
Performance-Driven Surrogate Modeling of High-Frequency StructuresPublication
The development of modern high-frequency structures, including microwave and antenna components, heavily relies on full-wave electromagnetic (EM) simulation models. Notwithstanding, EM-driven design entails considerable computational expenses. This is especially troublesome when solving tasks that require massive EM analyzes, parametric optimization and uncertainty quantification be-ing representative examples. The employment of...
-
On Computationally-Efficient Reference Design Acquisition for Reduced-Cost Constrained Modeling and Re-Design of Compact Microwave PassivesPublication
Full-wave electromagnetic (EM) analysis has been playing a major role in the design of microwave components for the last few decades. In particular, EM tools allow for accurate evaluation of electrical performance of miniaturized structures where strong cross-coupling effects cannot be adequately quantified using equivalent network models. However, EM-based design procedures (parametric optimization, statistical analysis) generate...
-
TECHNIKI CAD W INŻYNIERII ELEKTRYCZNEJ - WYBRANE ZAGADNIENIAPublication
W pracy przedstawiono różne techniki CAD (ang. Computer Aided Design) wykorzystywane w inżynierii elektrycznej dla potrzeb komputerowego modelowania 3D przetworników elektromechanicznych. Wirtualne modele 3D różnych urządzeń są użyteczne nie tylko przy opracowywaniu dokumentacji technicznej ale są także wykorzystywane w obliczeniach inżynierskich:...
-
Modeling and control of a redundantly actuated variable mass 3RRR planar manipulator controlled by a model-based feedforward and a model-based-proportional-derivative feedforward–feedback controllerPublication
In the paper, dynamics of a complex mechatronics system is considered. A redundantly actuated planar manipulator is the base of the mechanical part of it. It is a 3RRR 1 platform based parallel manipulator. To control its trajectory, a model-based feedforward controller is employed. Three aspects are fundamental in the presented investigations. The first focus is on development of an accurate numerical model used to solve the inverse...
-
Accelerated Re-Design of Antenna Structures Using Sensitivity-Based Inverse SurrogatesPublication
The paper proposes a novel framework for accelerated re-design (dimension scaling) of antenna structures using inverse surrogates. The major contribution of the work is a sensitivity-based model identification procedure, which permits a significant reduction of the number of reference designs required to render the surrogate. Rigorous formulation of the approach is supplemented by its comprehensive numerical validation using a...
-
Comprehensive dimension scaling of multi-band antennas for operating frequencies and substrate parametersPublication
In this paper, low-cost and comprehensive redesign of multi-band antennas with respect to the operating frequencies and material parameters of the substrate is presented. Our approach exploits an inverse surrogate model identified based on a set of reference designs optimized at the level of coarse-discretization EM simulations of the antenna at hand. An iterative correction procedure is also implemented to account for the initial...
-
Expedited two-objective dimension scaling of compact microwave passives using surrogate modelsPublication
Geometry scaling of compact microwave structures is a challenging problem because of complex relationships between the physical dimensions and electrical characteristics, mostly caused by considerable cross-couplings in densely arranged layouts. Here, a procedure for expedited dimension scaling of compact microwave couplers with respect to two independent criteria has been presented. Our approach involves inverse surrogate models...
-
Rapid dimension scaling of compact microwave couplers with power split correctionPublication
In this paper, a technique for rapid re-design ofcompact microwave couplers with respect to operating frequency is discussed. Our methodology involves an inverse surrogate model setup using several reference designs optimized (at the level of equivalent circuit representation of the coupler) for a set of operating frequencies within a range of interest. The surrogate establishes the relationship between the operating frequency... | https://mostwiedzy.pl/en/search?s=INVERSE%20MODELING |
1 C++ Programming Module-I Introduction To Object Oriented Programming There are many different programming languages, and many ways to classify them. Example, "high-level" programming languages are languages whose syntax is relatively close to natural language, whereas the syntax of "low-level" languages includes many technical references to the nuts and bolts (0's and 1's, etc.) of the computer. "Declarative" languages (as opposed to "imperative" or "procedural" languages) enable the programmer to minimize his or her account of how the computer is to solve a problem or produce a particular output. "Objectoriented languages" reflect a particular way of thinking about problems and tasks in terms of identifying and describing the behavior of the relevant "objects". Smalltalk is an example of a pure object-oriented language. C++ includes facilities for object-oriented programming, as well as for more conventional procedural programming. Object Oriented Programming-Philosophy In The Design and Evolution of C++ (1994), Bjarne Stroustrup describes some rules that he uses for the design of C++: C++ is designed to be a statically typed, general-purpose language that is as efficient and portable as C . C++ is designed to directly and comprehensively support multiple programming styles (procedural programming, data abstraction, object-oriented programming, and generic programming) . C++ is designed to give the programmer choice, even if this makes it possible for the programmer to choose incorrectly. C++ is designed to be as compatible with C as possible, therefore providing a smooth transition from C . C++ avoids features that are platform specific or not general purpose. C++ does not incur overhead for features that are not used (the "zero-overhead principle") . C++ is designed to function without a sophisticated programming environment. Stroustrup also mentions that C++ was always intended to make programming more fun and that many of the double meanings in the language are intentional.
2 Object Oriented Approach The key ideas of the object oriented approach are: Object Message Passing OOP Class Conce pts Data Abstraction Dynamic Binding Polymorphism Conce pts Data Encapsulation Inheritance Objects: Definition: Objects are primary runtime entities in an OOP. Programming problem is analyzed in terms of objects and the nature of communication between them. Occupy space in memory and have an associated address like structure in C. Every object has its own properties. It is the instance of a class. The state of object varies according to procedure used is called the action of the object. Each object contains data and code to manipulate the data. A program is executed; the objects interacted by sending message to one another. It is generated at run time. Two ways to represent an Object. Object: Student DATA Name Marks FUNCTIONS Total Average Display…. Total Average STUDENT Display E.g.: OOP approach, the traffic-flow problem will be viewed in terms of the objects involved i.e. car, trucks, scooters, auto, taxi etc are objects.
3 Pen, pencil, scale, mango, apple, monkey, human, program etc are some real-world objects. In case of a pen and scale being objects, their communication yields a line on the paper. 1.1. Classes: Definition: A Class is group of objects having identical properties, common behavior and shared relationship. Class is a template for defining objects. Objects are variable of type class. Once a class is defined, create number of objects belonging to that class. These are used to implement the concept of Abstract Data Type(ADT). The entire group of data and code of an object can be built as a user defined data types using Class. A class is a collection of objects of similar type. Every object has its own value for each of its member variables. It shares the property name or operations with other instances of the class. Thus ,class defines the characteristics and actions of different objects. A group of objects that share common properties and relationships. In C++, a class is a new data type that contains member variables and member functions that operate on the variables called Object of this class. Class is a type just like int. A class is a definition of an object. A class resembles a struct with just one difference: all struct members are public by default. All classes’ members are private. E.g.: 1. 2. Class: Car Properties: Company, model, color and capacity. Action: Speed (), Break (). Class: Computer Properties: brand, price, monitor resolution, hard disk and RAM size. Action: processing (), display (). The syntax of creating an object: class_name object_name1, object_name2…,object_namen; E.g.: A fruit to be a class, then mango, orange, apple etc will be objects in this class. fruit mango, orange, apple; 1.2. Data Abstraction: Definition: Abstraction directs to the procedure of representing essential features without including the background details.
4 Classes use the concept of abstraction and are defined as a list of attributes such as size, weight and cost, and functions to operate these attributes. They encapsulate all the essential properties of objects that are to be created. Since the classes use the concept of data abstraction, they are known as Abstract Data Type (ADT). E.g.: in switch broad press certain switches according to our requirements, what is happening inside, how it is happening etc.we needn’t know. This is abstraction, only the essential things to operate on switch board without knowing the background details of switchboard. 1.3. Data Encapsulation: Definition: the packing of data and functions into a single unit (class) is known as Encapsulation. The data is not accessible by outside functions. Only those functions that are able to access the data are defined with in the class. It hides the functional details of a class from objects that send messages to it. It accomplishes data hiding. By data hiding an object can be used by the user without knowing how it works internally. The goal of the class is to encapsulate complication and also has mechanism for hiding the data. Each member in the class may be private or public. Therefore any non-member function cannot access the data of the class. Encapsulation is a way to implement data abstraction. E.g.: consider fopen () function, it is used to open the file .several internal variables are created and initialized .In user program is concerned, these variables are hidden and not accessible. 1.4. Polymorphism: Definition: Polymorphism allows the same function to act differently in different class. It has ability to take more than one form. An important role in allowing objects having different internal structure to share the same external interface. It accomplishes an important part in allowing objects of different classes to share the same external interface. An operation may show different behavior in different objects/instances. The behavior depends upon the types of data used in the operation. E.g.: two number, operation will generate a sum, if operands are string, then the operation will generate string concatenation. The process of making an operator to show different behavior in different object is called operator overloading. Using a single function name can be used to handle different number and different type of arguments to perform different types of operations is called function overloading. E.g.: | https://lecturenotes.in/notes/15244-note-for-object-oriented-programming-using-cpp-oop-by-diyan-jimsy |
A large and enthusiastic team gathered in Tunis March 24-28 on the politically charged terrain of the World Social Forum, to argue from many angles the burning relevance of communist revolution—specifically the new synthesis of communism brought forward by Bob Avakian.
The World Social Forum, whose slogan is “Another World is Possible,” sees itself as based on “international solidarity, equality and social justice.” The WSF’s more than 1,000 workshops and forums addressed and discussed solutions for many grave social problems plaguing the world and drawing people into opposition and resistance. They included the oppression and degradation of women worldwide; the reasons why immigrants risk their lives to cross the Mediterranean; the environmental crisis with a focus on climate change, land, agriculture and water issues; human rights and equality before the law; developments in Rojova (west Kurdistan in northern Syria); and the outcome of the Arab Spring and the situation of Arab youth in particular, in terms of why many are drawn to become jihadi fighters in Syria, Iraq, Afghanistan and elsewhere.
WSF organizers reported that more than 48,000 people registered to participate this year. Most were progressive-minded individuals and groups from North Africa and around the world. Tunisians were by far the most numerous. They had serious questions about what they considered the hijacking of their “revolution” by political parties whose goal was to get into or come to terms with the existing power structure rather than change the system. Many non-governmental organizations (NGOs) also took part. Some are sponsored by the same corporations who create the very conditions that the workshops exposed and opposed. The main leadership of the WSF promotes various approaches to challenge some of the glaring inequalities and social injustices in the world, but stop short of going for ending the system responsible. This results in a limited framework regarding the possibilities of solving the complex and pervasive problems the WSF brings to light and debates. Thus there is need and grounds for serious and ongoing discussion, which many participants came to the WSF to find.
Our team of two dozen included people from Europe, Asia, the Middle East and North America, with a large number of supporters of the Communist Party of Iran (Marxist-Leninist-Maoist—CPI[MLM]), and a strong contingent of women. The goal was to participate in these wide-ranging debates and unite with the outrage those attending the WSF share over these crimes, while at the same time wrangle over how to overcome these major problems and challenge the assumption that fundamental change can be achieved through the existing system. We wanted to engage with why this can only be done through communist revolution, which requires applying the best theoretical understanding, the new synthesis.
People who yearn for revolutionary solutions need the vigorous scientific method and approach that characterizes the new synthesis, with its unflinching search to understand actual patterns and dynamics of material reality and discern the contradictory nature of reality that provides the basis to act and bring about the revolutionary transformations that all humanity needs urgently.
Leaflets were prepared in French, Arabic and English, on the intolerable dead-end alternatives of imperialism and Islamic fundamentalism, women’s oppression, the anti-austerity debate (Greece) and capitalism’s destruction of the planet. The leaflet “From Ferguson to Palestine, We Can’t Breathe!” brought out the common threads, the common oppressive system, as well as the particular complexities of resistance emerging in the world today, all pointing to the need for revolution. They were very well received.
World events affect Tunisia
After being held in Tunis in 2013, the WSF returned there for the second time, implicitly promoting Tunisia as an oasis of stability in a region torn apart by chaos. The dynamic of the “two outmodeds” was the major theme in the main leaflet by the Revolutionary Communist Manifesto Group (RCMG) entitled Caught Between the Deadly, Dead-end Alternatives of Imperialism & Religious Fundamentalism: Only Revolution Can Get Us Out of this Situation, and The Many Faces of Terrorism by the CPI-MLM. This dynamic was in many ways visible throughout the forum. Less than a week before the WSF began, the criminal attack at the Bardo museum, killing 18 tourists, by Islamic fundamentalist jihadists sympathetic to ISIS/Daesh (the Arabic acronym for ISIS), exposed illusions of calm and highlighted the real intensifying dynamics of the situation in the region and the world.
This further complicated and added confusion to the contested political terrain in Tunisia. In many discussions held informally and throughout the workshops, the urgency of struggling over a correct and scientific understanding of the reactionary dynamic between imperialism and Islamic fundamentalism became pivotal and controversial.
The Islamic fundamentalists’ operations in the Middle East and North Africa reached all the way to the Tunisian capital and provided an opportunity for the newly-elected government of Beji Caid Essebsi, a former minister under the deposed President Ben Ali, to present its pro-Western allegiance as the choice of the people and a reflection of national unity.
The general mood among the masses broadly speaking was certainly less optimistic than two years ago about advancing the revolutionary struggle. Ordinary people in the streets, taxi drivers, shop keepers and other people we chatted with in cafes and restaurants who tended to welcome foreigners, felt that the Bardo attack was just an isolated incident, minimizing fundamentalism as a real and growing threat in Tunis.
Lowering of sights, dashing of hopes for revolution and no small amount of demoralization had set in after the high tide of rebellion and the overthrow of the Ben Ali regime. The effects of the situation in Syria, Libya and Egypt added to an unfavorable polarization. Some sections of the people want to hold on to what exists today without ceding further ground to the Islamic fundamentalists. They are hunkering down in hope that the democratic process will keep the Islamists out of power and think they can ignore the intensification of contradictions and gathering storms like those occurring in Syria and Libya (with whom Tunisia has a long border—being ripped apart by reactionary war). Others from the small business class tend to complain about disorder, security problems and economic hardships in the wake of Ben Ali’s overthrow. For the youth of the countryside and lower classes in the cities nothing has changed since 26-year-old Mohamed Bouazizi set himself on fire in December 2010, igniting the Tunisian revolt. Since then thousands of youth from Tunisia have gone to Syria and elsewhere to join Islamic jihadists.
While the high tide of radical sentiments has ebbed, a considerable number of people, especially youth and women, but also a small important section of older activists are determined to find a way out of this situation. They long to understand what happened to the “revolution” and refuse to come to terms with the existing order.
The new members in our group were pleasantly surprised to see some Tunisian youth and others eagerly help us with various aspects of printing, logistics and translation. They had met us in 2013 and introduced us to their friends as comrades from the RCMG. When we learned of their disillusionment with previous political affiliations and the situation in Tunisia and that they were studying Marxist political theory, our discussions with them invariably veered into how the new synthesis is a more scientifically grounded theory of revolution and communism. We argued that study of revolutionary theory should proceed from Bob Avakian’s theoretical contributions, analytical method and deep summation of the first wave of revolutions. This was just the beginning of an eventful week.
Despite heavy downpours and occasional strong winds, our literature table became a hub of political discussion and debate, as it had been two years ago. There was an extensive outlay of revolutionary communist literature in English, French and Arabic projecting revolutionary optimism and a liberating vision of socialism. In addition to leaflets and pamphlets focusing on Islamic fundamentalism and the woman question from the CPI(MLM), and RCMG leaflets, there were DVDs of Bob Avakian’s speeches and books by him (BAsics, Away With All Gods), the Constitution of the Revolutionary Communist Party, USA, the Constitution For The New Socialist Republic In North America (Draft Proposal), Demarcations journal articles and Revolution newspaper supplements devoted to themes on the environment, “Set the Record Straight on Communism” and the struggle of African-Americans in the U.S. Large banners hung high behind the table. One from the RCMG read (in French), “Humanity Needs Revolution, Long Live the New Synthesis of Bob Avakian.” Next to it was, “There Is a War Against Women... Revolution Is the Only Solution, Forward to a New Wave of Communist Revolution,” signed by the CPI-(MLM). Palm cards with the website revcom.us were given out along with the leaflets. Hundreds of copies in Arabic of Communism: The Beginning of a New Stage, A Manifesto from the Revolutionary Communist Party, USA and the Demarcations article “Egypt, Tunisia and the Arab Revolts: How They Came to an Impasse and How to Get Out of It” went out. Our table was definitely one of the preferred sites for “‘selfies” with the banners as a backdrop.
Invitations to address workshops
Some comrades were busy providing material and answering questions at the table while others were engaged in controversial group debates that continued throughout each day. Remembering our table and our banners from two years ago, people from Tunisia and other countries were happy to see us again and enthusiastically pursued the ideological and political struggle, including some from the southern part of the country, 500 hundred kilometers away. They invited us to speak out at workshops where they considered our line needed to engage the topic being addressed.
For example, at one workshop the main speaker was putting forward a familiarly tired reformist recipe that the initial revolution in Tunisia failed so people needed to go into the social movements and trade unions. There was no mention of the dynamic behind the threat of Islamic fundamentalism, the need to defeat U.S. imperialism or the need to go for world revolution. The invited revolutionary comrade who intervened paraphrased a well-known quote from Malcolm X, saying “I came here to say things you might not want to, but need to hear.” He continued that communists should not bury themselves in the existing social and political movements. Resistance against the regime must be part of building for revolution, and draw strength and confidence from the material basis of internationalism.
At the literature table, a number of Iranian women comrades were engaging actively in heated discussions around the role of religion and Islamic fundamentalism. They were an effective force calling for all-the-way revolution and the crucial and integral role of the emancipation of women in this struggle. Young activists from Tunisia paid close attention to their experience and the bloody history of repression by the Islamic Republic of Iran.
Debate and discussion and intense line struggle in the international movement and the impasse of the Arab Spring provided additional reasons this year to check out Avakian’s new synthesis. Some questions were new, freshly stemming from contending evaluations that were circulating about the new synthesis spread by some of those calling themselves Maoists in Tunisia.
In the pouring rain, WSF organizers led the opening march to the front gates of the Bardo museum as a symbolic protest against Islamic fundamentalism but failed to really distinguish themselves from the political message of the government’s call for national unity. The government’s show of specialized security forces at this march represented a certain paradox that was in the air—whether these forces of repression were deployed actually to protect or to intimidate the protesters.
Many issues but only one solution—revolution
Our group planned several workshops as part of the official WSF program. One of these focused on the theme “Kobane and the broader situation in the Middle East.” The Kurdish town of Kobane concentrates the contradictions of the whole region wreaking havoc in the Middle East. On the one hand, the workings of the capitalist imperialist system undermine and break apart current borders and social structures. On the other hand, among the forces of opposition and resistance (with the exception of Islamic fundamentalist reactionary forces), there is a prevalent acceptance of the existing oppressive system and the idea that nothing can be achieved without or beyond democracy, promoted by the guardians of the system.
In a lively discussion, deadly illusions and cynical realpolitik were brought to light and the idea that it is impossible to fight off Islamic fundamentalism without relying on the help of the U.S. and its allies was criticized, along with the claim that there is no need to fight U.S. imperialism because fighting ISIS, considered a puppet of the U.S., amounts to fighting the U.S. itself. A widespread view falsely considers ISIS to be a deliberate conspiracy created as a direct tool of U.S. policy. A back and forth discussion took place with some progressive radical minded individuals from Europe over what is called by some a non-state “radical grass roots democracy” experiment in Kobane, and how these self-deceptions are dependent on the existing order and reactionary states.
A fatal flaw and tragic consequence of this logic is that if you rely on the U.S. to fight Islamic fundamentalism you will only get more Islamic fundamentalism, and moreover, you will be used and betrayed by the U.S. one more time.
This discussion on Kobane revealed an acute particular manifestation of the current ideological polarization in the region and beyond, the capture and enlisting of political forces by one or the other of the two equally reactionary poles, U.S. imperialism with its accompaniment of bourgeois democracy, or the Islamic fundamentalists. Without a communist approach, the revolutionary potential among the masses is squandered, while the erstwhile rebellious insurgent forces seek accommodation with the existing oppressive system.
Our team pursued debate around these questions in other workshops. In one entitled “Solidarity with the Syrian people”, we pointed out that opposition to imperialism and reactionary regimes was being left to the reactionary Islamists.
Another workshop, entitled “From Ferguson to Palestine: We Can’t Breathe,” broadened out the discussion from another angle. This slogan, popularized in Palestine at the time of the Ferguson rebellion, expressed a felt bond between those demanding justice in Ferguson, Missouri and elsewhere in the U.S., and the victims and opponents of the U.S. and other Western powers in Asia, Latin America, Africa and especially, occupied Palestine. Our speaker put forth that the same system of capitalist exploitation oppresses Black people in America and Palestinians. It’s one system, with one solution. Capitalism in the U.S. (and Europe) arose with slavery, and without understanding that, we can’t understand mass incarceration and other forms of brutality inflicted on Black people today. This same system has pillaged and plundered the Middle East and North Africa, now being ripped apart by a reactionary polarization between imperialists, the main enemy, and Islamic fundamentalism. Everywhere there is a crying need for a liberating alternative that targets both and strives to end the divisions and inequalities that exist.
An international human rights lawyer on the panel expressed both broad agreement with the presentation and reservations. She felt that the new synthesis’ analysis of the two outmodeds may alienate some people who adhere to the religion of Islam if they falsely perceive we are making the dividing line to be between religion and secularism. This view tends to downplay the deep influence that religion has on many people, often holding them back from transforming themselves and fully participating in the revolutionary struggle, people who will be and need to be the bedrock of this struggle. The fight against injustice and oppression can and must include large numbers of believers while struggling to transform their limited and even sometimes obscurantist views and thinking. Only with a more scientific view of the world will people be able to fully fight for the emancipation of humanity, including building a new socialist society. Another speaker from the panel argued in favor of Franz Fanon’s anti-colonialist analysis and how genuine democracy can still be relevant today if it were actually rendered to mean genuine independence from imperialist domination for the oppressed nations.
The discussion became sharp around whether the communist revolution is the solution to capitalism and imperialism worldwide. An Occupy activist from Britain asked whether we were proposing “to kill millions like Mao and Stalin”. These prejudices about the first wave of communist revolution, heavily influenced by the propaganda of the guardians and ideologues of the system, were sharply rebuked by a woman from Iran. After denouncing the horrendous crimes and brutal enslavement brought upon humanity by the system, she wholeheartedly called for getting rid of this system through communist revolution. Her comments received a hearty round of applause from the majority of the audience.
Considerable summation has been made by Bob Avakian of the first wave of proletarian revolution relating to this point. In opposition to the seemingly endless distortions and slanders spewed forth against socialism and communism, the conclusion must be clear that the historical experience of socialism in the Soviet Union (and more so in China) was positive, even with significant secondary shortcomings and errors, including in how these societies handled opposition and dissent, that must be unsparingly criticized. Only through this approach and method can a better, more liberatory vision for a future socialism come about.
With the orientation of “a Marxist-feminist theorization as a dialectical understanding of exploitation and oppression which constitute a regime of social relations often conceptualized as capitalist patriarchy,” some Iranian comrades held joint panels and workshops on the woman question with other organizations and trends.
One of these workshops discussed the experiences of Muslim women under Ben Ali’s state repression of Islam and women’s experiences in Iran during different periods, particularly under the vicious suppression of women inside and outside the dungeons of the Islamic Republic. The brutality faced by Kurdish women in the dungeons of the Turkish state was discussed, bringing out the sinister reach of patriarchy through the state and its prison system. This was documented in different ways through film and dance. Women wrangled over the pervasiveness of violence in state institutions and questioned how to mobilize and reconstruct the experience of women as a form of resistance. One Iranian comrade asked how all this resistance would be tied in with the struggle for revolution.
The RCMG leaflet on the environmental crisis, “Capitalism is destroying the environment and can never cure the problem: What is it going to take?” raised critical points about the human exploitation and destruction of lives and livelihoods connected to the massive wreckage of the environment underway in many forms today. It showed why capitalism and its political representatives cannot and will not offer any real or lasting solution to the threat to the world’s ecosystems, climate destabilization and the resulting impact on life on earth. The leaflet gave a sense of the possibilities of conceiving the protection of the physical environment within the perspective of a revolutionary society and power, repairing the damage to the earth and consciously mobilizing human activity and scientific understanding.
Our team debated with many people harboring ideas that developing local alternative energy sources was the only practical way to oppose corporate control, and why the system itself is the problem. At the same time we were also clear that we had in no way exhausted the opportunities to raise the stakes at the WSF over the struggle around the environment, which tended to be much too confined to agendas that avoid holding the capitalist social order responsible for much of the crisis and mobilizing people on that basis. Further discussion pointed to the importance of intervening in activities around the upcoming United Nations summit on climate change (COP21) to be held in Paris in December 2015 with participation of 196 countries.
The sovereign debt crisis in Europe, especially concerning Greece, where the so-called radical left Syriza government came to power in January 2015, drew many leftists enthusiastic about the example of Syriza as a possible solution to the debt crisis and model for other European countries. In the workshop entitled Syriza, Podemos... restructuration or annulation of the illegitimate debt?, there was struggle between reformist illusions, centering on Syriza’s anti-austerity platform and the need for disengaging with imperialism. The RCMG leaflet argued that the situation in Greece was one of “concentration of the global contradiction between the severe imbalances built up between the financial system—and its expectations of future profits—and the accumulation of capital, that is, the structures and actual production of profit based on exploitation of wage-labor. Questions that require serious answers are posed by this situation. How can capitalism in Greece unzip itself from the global, competition-driven profit system—which is not Syriza’s intention anyway? How could radical change in Greece—or anywhere else, for that matter—take place except as part of a country by country but ultimately worldwide revolution whose ultimate aim is the abolition of all exploitation and all the oppressive relations of class society?”
An Iranian comrade intervened from the floor provoking a debate and drawing applause when she pointed out that the illusions the workshop speakers were so desperate to preserve, are built upon the bones, the broken backs and the stolen wealth of the rest of humanity. She asked why should activists spend so much time discussing how to repair this now malfunctioning machine? Why should they spend such energy wrangling over how to divide the loot of imperial pillage? Why would they contribute to helping this system of murderous injustice to recover and regain its smooth, efficient functioning, to the despair of all humanity?
Step forward to take up revolutionary responsibilities
For the interested people we met, our team held extended evening discussions about the new synthesis. Presentations focused on identifying the problem and the solution—why the masses’ yearning for liberation will not be realized without the most advanced scientific understanding of communist revolution. We aimed to help these revolutionary youth from various political trends in Algeria and Tunisia to have a real sense of how the new synthesis provides the required method and approach to understand and have a strategic grasp of the revolutionary process, to prepare and carry out revolution. We tried to impress on people why the new synthesis is crucial in today’s world to conceptualize and carry out revolutionary work. The question was posed whether one ultimately makes peace with the existing order as happened in Tunisia in the aftermath of the Arab Spring, something those attending were acutely aware of, or whether one steps forward to develop vanguards of the future and prepare the next stage of communist revolution.
Other features of the new synthesis also presented included internationalism, revolutionary strategy, the underlying revolutionary opportunities in the region and how crucial it is for potential revolutionary forces to wield the new synthesis. This was followed by discussion of particular issues of the political process unfolding in Tunisia, and how to view the role of elections and bourgeois democratic procedures.
At the end of the week, the WSF organized a closing march in solidarity with Palestine that ended where Yasser Arafat lived while in exile in Tunisia. Several thousand people marched, many fewer than two years ago. The low attendance was due partly to the confusion around the issue of national unity against Islamic fundamentalism. The government sponsored a march to the Bardo museum the following day, with heads of state of a few African countries and president François Hollande of France, which continues to preside over neo-colonial relations with Tunisia.
For the closing WSF march another banner was made to sharply delineate our position of not yielding any ground whatsoever to either of these two outmoded reactionary forces with the slogan: “Caught between the deadly, dead-end alternatives of imperialism and religious fundamentalism, Only revolution can liberate us.” Again people wanted their photos taken with our banner in the background. Many Arabic-language copies of the Manifesto from the RCP,USA were sold and the few remaining leaflets got into the hands of some youth on the march.
Within all the complexities of the WSF situation, promoting, explaining and fighting for people to engage with the new synthesis was particularly crucial, even in an immediate sense of being able to bring out to people that the only way out is revolution guided by this approach to communism, the world’s most advanced revolutionary thinking. Our contingent had a lot of rich experience and was enthusiastic about the work done. They felt that their experience brought out the truth of the statement by Bob Avakian, “It is very important not to underestimate the significance and potential positive force of this new synthesis.” We all were learning, and are now continuing to seriously engage with at a new level, how to do this work better, how to reach out boldly and broadly, and how to make people’s introduction to the new synthesis a real enabling leap to consciously step forward and take up revolutionary responsibility.
Volunteers Needed... for revcom.us and Revolution
If you like this article, subscribe, donate to and sustain Revolution newspaper. | https://revcom.us/a/385/report-on-promoting-bob-avakians-new-synthesis-of-communism-at-the-tunis-world-social-forum-en.html |
Kitchen Tip: Sandwiched cookies will start to soften after 2 days in a covered container. Store plain sugar cookies in a covered container up to 1 week, or freeze up to 1 month. Decorate with chocolate and sandwich with jam the night before serving for best results.
Raspberry sugar sandwich cookiesBy Chatelaine
31
PREP TIME
45 min
TOTAL TIME
1 h 35 min
Makes
24 cookies
* PLUS 1 hr chilling time
Ingredients
- 1 1/2 cups all-purpose flour
- 1/2 tsp baking powder
- 1/4 tsp salt
- 1/3 cup unsalted butter , softened
- 1/3 cup granulated sugar
- 1 large egg
- 1 tsp vanilla
- 170 g finely chopped white chocolate
- 43 g finely chopped cacao butter
- 1/4 tsp red gel food colouring , such as Christmas red
- 1 1/2 tbsp pink peppercorns , finely crushed, divided
- 1/3 cup seedless raspberry jam
- 1 tsp balsamic vinegar
Instructions
- STIR flour with baking powder and salt in a medium bowl. Using an electric mixer on medium-high, beat butter with sugar in a large bowl for 2 min. Beat in egg, scraping down side of bowl as needed. Beat in vanilla, then reduce speed to low and gradually beat in flour mixture until just combined.
- DIVIDE dough into 2 portions. Shape each into a ball, flattening slightly into a disc. Wrap separately with plastic wrap and refrigerate until firm, at least 1 hr or up to 1 week.
- POSITION rack in centre of oven, then preheat to 350F. Line 2 baking sheets with parchment paper. Remove 1 disc from refrigerator and let sit for 5 min. Roll to 1/8 -in. thickness on a lightly floured surface. Cut out shapes with a 1 3/4-in. fluted square (or square) cookie cutter. Arrange on prepared baking sheets, 1/2 in. apart. Bake until cookies are golden, 9 to 11 min. Let cookies cool on sheets for 1 min, then transfer to a wire rack to cool completely. Repeat with remaining dough, chilling scraps as needed.
- FLIP over parchment paper on baking sheets. Temper chocolate and cacao butter. Stir food colouring into chocolate until combined. Dip half of a cookie into chocolate diagonally. Shake off excess. Lay on prepared sheets. Sprinkle chocolate side of cookie with a pinch of peppercorns; repeat with remaining cookies. Let stand until chocolate is firm, about 30 min.
- STIR jam with vinegar and remaining peppercorns. Spread half batch of cookies with about 1/2 tsp jam mixture, then sandwich with remaining cookies.
Chatelaine Cookies: Hamantaschen
Nutrition (per serving)
- Calories
- 115,
- Protein
- 2 g,
- Carbohydrates
- 14 g,
- Fat
- 6 g,
- Sodium
- 39 mg. | https://www.chatelaine.com/recipe/desserts/raspberry-sugar-sandwich-cookies/ |
Small Batch Peanut Butter Cookies are soft, creamy pillows of peanut butter goodness! They cook in just 9 minutes and best of all this recipe makes a small batch so that you don’t have tons leftover!
The boys were out of school last week. When they’re home, I always make more desserts. They love to help cook; they especially love helping me make cookies. I warned them beforehand that this was going to be a small batch cookie and that we wouldn’t have much dough to eat if we wanted to have any cooked cookies to eat. They assured me it was okay, but when all was said and done, they’re a lot like me and regretted not getting to eat any of the cookie dough.
Small Batch Peanut Butter Cookies
I made these cookies and thought it made just the right amount of cookies. Cutting down the batch to make just 10 to 12 cookies was genius. That was until the boys helped me make a batch. They much prefer to have plenty of dough to eat before baking the cookies. Note to self, when they help make a regular batch and freeze the leftover dough!
These Small Batch Peanut Butter Cookies have a rich peanut butter flavor. I like to undercook my cookies so they’re still soft and gooey. These cookies take just minutes, maybe seven, to mix together. I do recommend chilling to the dough before cooking. If you don’t chill the dough you’ll have thin cookies, not fat chewy cookies. When you plan to make them, plan for that chilling time.
Small Batch Peanut Butter Cookies
Want to save recipes? Create an account or login & then you can use the “Save Recipe” button when viewing a recipe to save it to your Recipe Box. You can access your saved recipes on any device and generate a shopping list for recipes in your collections.Save To Your Recipe Box Go to your saved recipes
Ingredients
- 2 tablespoon butter softened
- 1/2 cup brown sugar packed
- 1 tablespoon brown sugar packed
- 1 large egg
- 1/3 cup peanut butter creamy (crunchy can be substituted)
- 1 teaspoon vanilla
- 1 cup all-purpose flour sifted then measured
- 1 teaspoon baking powder
- 1/8 teaspoon salt
Instructions
- Add egg, vanilla, and peanut butter.
- Mix until smooth
- Combine flour, baking powder and salt in a small bowl.
- Slowly add to mixer and mix until well incorporated. The batter will be thick.
- Refrigerate 45 minutes to 1 hour or freeze 20 to 30 minutes.
- When you're ready to bake, preheat oven to 350°F.
- Scoop dough onto an ungreased cookie sheet.
- Bake for 9 minutes. Allow to cool on a cookie sheet 2 minutes before removing to a wire rack to cool
- Store in a airtight container up to 3 days.
Notes
Nutrition
More cookie recipes to enjoy! | https://www.callmepmc.com/small-batch-peanut-butter-cookies/ |
This week we have another terrific guest expert joining us to share their perspective on learning to play by ear.
We’re very pleased to welcome the founder of Theta Music: Steve Myers!
I started playing guitar at age 11, and learned songs by sitting down with guitarists who could show me the fingering step-by-step, or by going out and purchasing the sheet music. Everything I learned was by ‘sight’ – watching another player or reading the tablature and then simply memorizing where to put my fingers.
Several years later in high school, I had my first encounter with guitarists who could ‘play by ear’ at a high level. These guys would work out new songs fairly quickly after hearing them just once or twice. They would jump in and start playing with a group on a song they had never heard before. If a string slipped out of tune during a performance, it was quickly corrected – as they continued to play. But the thing that impressed me the most was the way they could improvise endlessly over all kinds of chord progressions and musical styles.
These players had a deep understanding of music, and at the time their skills seemed like magic to me. I had no idea how they were able to play that way – spontaneously creating great solos one after another – but I knew that I wanted to do it too. I spent a tremendous amount of time and energy trying to learn how to improvise music, but came away with very limited results. Eventually, I became frustrated and gave up, believing that the ability to play by ear was a talent that you had to have been born with.
The thing that impressed me the most was the way they could improvise endlessly over all kinds of chord progressions and musical styles. These players had a deep understanding of music, and at the time their skills seemed like magic to me.
More years passed, and although I continued to play guitar occasionally, I found that I didn’t have much motivation to practice on a regular basis. At some point, though, I came across a mail-order course for ear training and music theory, and decided to give it a try. The course turned out to be long, tough and very tedious at times, but it finally started me on the path to developing my ear. At the same time, it opened up a whole new world of musical understanding for me that has made playing much more fun and exciting.
I’ve since come to the conclusion that all of the skills which go into playing by ear can be developed, often to a far greater extent than we realize. There are many ways to build these skills, and it’s up to you to experiment and find what works best for you, given your particular musical goals.
There are certain strategies, though, that I’ve seen used to some extent by just about every proficient ‘ear player’ I’ve ever met, and that I would recommend to others who wish to improve their musicianship:
1. Sing
Your voice is an important link between your instrument and the music you hear in your mind. In order to do just about anything musical by ear, you must be able to sing simple melodies in key. Some people can do this effortlessly, especially those who grew up in environments where they were surrounded by music and encouraged to sing from an early age. If this is not your case, then you may have to work at it a bit. Begin by learning how to match pitch and then proceed on to the tones of the major scale. You don’t need a great singing voice or vocal technique – you’re just trying to sing the right pitches.
It’s up to you to experiment and find what works best for you, given your particular musical goals.
2. Break things down into small chunks
To play by ear, you must develop a specific set of ‘soft’ skills, such as aurally identifying scale degrees and chords. For each of these skills, it helps to work in small units. For example, if you want to learn how to work out a melody by ear, start by trying to identify common melodic patterns consisting of just three tones. Eventually, you will be able to hear a three-tone major arpeggio as a single ‘chunk’ of information, without having to worry about each of the three tones separately.
Think of typing: the reason that you can type a sequence of words much faster than you type a sequence of random letters is that you process and type each word as a single familiar chunk. It’s much harder to do this with an unfamiliar sequence of letters. The same idea applies to music.
3. Pay attention to patternsSome patterns occur frequently in music
Once you can recognize small chunks of melody, harmony or rhythm, you should notice how certain chunks often precede or follow certain other chunks, in much the same way that certain words tend to combine into common phrases. These patterns are everywhere in music – melodies and chord progressions almost always contain sequences comprised of common patterns. Once you have internalized these patterns, you will become much better at figuring out songs by ear, harmonizing new melodies, and even remembering the chords to songs.
4. Transcribe and play along
When learning a new song, instead of going straight to the tablature or sheet music, try instead to first work out some of the music on your own. Even if it’s just a single chord or pair of chords, those are the initial ‘small chunks’ that you can start to build upon. As you do this with many songs over time, look for the patterns: are there any three- or four-chord sequences that appear in multiple songs? Try playing along with the recording, even if it’s just small bits and pieces. When you get stuck on a particular note, stop and sing it. If you can’t figure out a particular chord, see if you can sing the individual tones of the chord.
5. Have fun
Fun is something that is generally not associated with ear training and music theory. It doesn’t need to be that way, though. Most of the skills you need for playing by ear are ‘soft’ skills – they are primarily mental skills that require flexibility and pattern recognition. And the best way to develop soft skills is to play and explore, to give yourself challenges that are rich in variety and make you stretch a bit.
Try using different tools – software, games, quizzes, courses – and mix up your routine.
The point is to experiment and enjoy the process. You want this practice to be more like play – something that you look forward to doing each day.
Thanks, Steve, for some great tips on developing your aural skills and learning to play by ear. If you want to follow through on Steve’s suggestions we recommend trying out the range of Theta Music games, such as:
- Dango Brothers for developing pitch awareness
- Vocal Steps for singing back common melodic patterns
- Speaker Chords to learn to recognise chord progressions
Want to become more musical?
Whether you want to sing in tune, play by ear, improvise, write your own songs, perform more confidently or just make faster progress, first you need to know where you're starting from.
The Musicality Checklist will quickly reveal your personal musicality profile and how you can improve your natural musicianship.
Available FREE today!
Learn More inside Musical U
Musical U provides in-depth training modules, an easy-to-use personalised planning system, a friendly and supportive community, and access to expert help whenever you need it. | https://www.musical-u.com/learn/guest-post-5-top-tips-to-learn-to-play-by-ear-steve-myers/ |
The fifth in a series of workbooks for children by Sr. Karol O’Connell. An introduction to new rhythms, pitch development, melody and composition, inner hearing, slight, singing, melodic dictation, Irish folk songs and folk songs from around the world. It is a direct continuation of module no. 4.
Enjoy working with it!
Sr Karol O’Connell OSB MA
Kylemore Abbey
Using Workbook No 5
New rhythms are introduced. Several clapping exercises follow for the class to do together, later the child can do them alone. Half way through the chapter the exercises get more difficult and partner work is encouraged. Silent beats are included to sharpen rhythm awareness.
Tones and semitones are dealt with in this section. Keys and keyboard awareness is taught with many visible aids gently leading on to the next section about sharps and flats.
The child, now able to cope with sharps and flats is ready to learn about absolute names of these sharpened and flattened notes while relating them to the keyboard.
This section deals with discords and concords and is a section that will involve a lot of singing…..It is well worth spending time on these exercises, they will help intonation no end.
A lengthy section to encourage the child in rhythmic composition. The child has to be familiar with both rhythm names and with stick notation. All of these exercises should be performed by each pair for the rest of the class. Use a mechanical pencil and write small. The exercise may be done in many different ways. Explore and have fun with these.
This section incorporates sight singing, rhythm writing and melody transcription on the stave.Each exercise is designed for partner work. The exercises can be used over and over again and can be mixed and matched in many different ways. Encourage the children to find as many ways as possible.
This section is very like the previous section but a little more challenging. The awareness of Tonic and Dominant must be to the fore in all of these classes. Remind the children again and again ‘sound before symbol’ Take time with each page and get the entire class to sing and re sing both phrases. Don’t just do this at one class….sing the pages in the correct order many times.
Again like the two previous sections this section expects the child to be able to sight sing with reasonable fluency. If this series of books has been followed from the start there is no reason why this would not happen. Make sure the class can sing theses one bar melodies from any given pitch, the pitch need not be the same while the class is working through a new page .Again , take lots of time going through these pages, no need to rush. The important thing is that the children are comfortable with the level of reading and the each child in the group never gets discouraged.
The best way to approach this section is by dividing the class into three groups and literally SINGING your way through it .The child learns how to write the chord grid. This should be encouraged in different keys. There are three different ideas given for teaching chords. It is a good idea to teach all three. Notice how written and aural skills are improving together!
This is a very short, though important section introducing function in music. The musical phrase is also introduced for the first time. This is an important step forward in any child’s musical development and time should not be spared in developing musicality and in the shaping of musical phrases.
A section on sight reading using f and t .Notice a keyboard on each page, as the child sings the melody he/she points to the notes on the keyboard.
This section is similar to Section 11 but in section 12 hand signs are once again used. The second half of this section is given over to melodic composition. Almost game like, the melodies are shaded so that the child learns how to write a good four bar melody, darkest shade is written first etc.
Six beautiful Irish folksongs to read and sing in solfa. Enjoy them!!
Folk songs from around the world. Have fun sight singing these beautiful songs.
Three more instruments follow on page 153.
On page 156 be sure to point out to the children the position of the conductor and of all the instruments, a modern symphony orchestra.
Enjoy using this beautiful book. | http://music-is-fun.com/workbook-no-5/ |
You are here
The "Antikythera Mechanism" Exhibitions
List of countries and cities that hosted the "Antikythera Mechanism within the Astronomy and Technology of its Time" exhibitions. In some cases, the exhibitions were adapted in order to include objects from local collections, within a wider thematic about time and astronomy. The 2009-2012 exhibitions were funded by the Hephaestus Project (FP7 - Capacities, Regpot-2008-1) and coordinated by Efthymios Nicolaidis and Yanis Bitsakis. Part of the material used in the exhibitions was created in the scope of the research carried by Yanis Bitsakis, entitled "Educational aspects of the history of the Antikythera Mechanism ", at the National and Kapodistrian University of Athens. This research has been co-financed by the European Union (European Social Fund – ESF) and Greek national funds through the Operational Program "Education and Lifelong Learning" of the National Strategic Reference Framework (NSRF) - Research Funding Program: Heracleitus II. The original fragments of the Antikythera Mechanism are on display at the National Archaeological Museum in Athens, Greece.
| |
Kruger Park Mammals - African Elephant
The African Elephant (Loxodonta africana) is the most distinguishable animal in the World and many people who come to Kruger seek out the largest land mammal in the World. The Kruger Elephants can weigh up to 7 tons and live for up to 75 years.
African Elephant Kruger National Park Distribution Map
The African Elephant is common all through the Kruger National Park and can be found in all the different ecozones and habitats in the Kruger. There are more Elephants in certain areas of the park due to food and water availability. Areas such as Letaba, Olifants, Shingwedzi, Lower Sabie, Crocodile Bridge have particularly high densities of African Elephant.
More Information On Kruger's African Elephant
There are a lot of African Elephant's in the Kruger National Park and it is an amazing experience observing the habits of this animal and you can watch herds of Elephant for hours in the Kruger. What I have noticed is that, the male Elephants in the northern areas of the Kruger Park are a lot more aggressive than in the central and southern regions. This could be because fewer visitors enter the north of the Kruger or because of past and present poaching activity around the Zimbabwe and Mozambique borders. One should take extreme care when approaching male African Elephants in the Kruger National Park, always keep your distance, especially when they are in musth. The same applies to Elephant herds with young babies (Breeding herds). Keep your distance and watch for irritation or warning signs from the Elephants and you will be fine. A word of advice, if you encounter a male Elephant on a dirt road between Shingwedzi and Punda Maria, keep at least 50 meters away from him and put your car in reverse. | https://www.thekruger.com/mammals/elephant.htm |
Sodium is an essential nutrient but is something that the body cannot produce itself. It plays a vital role in the regulation of many bodily functions and is contained in body fluids that transport oxygen and nutrients. It is also essential in maintaining the body’s overall fluid balance.
To survive everyone needs to consume Sodium regularly. It is a principal component of a person’s internal environment – the extracelluar fluid. Nutrients reach your body’s cells through these fluids. Sodium facilitates many bodily functions including fluid volume and acid-base balance.
An adult human body contains about 250g of salt and any excess is naturally excreted by the body.
Sodium enables the transmission of nerve impulses around the body. It is an electrolyte, like Potassium, Calcium and Magnesium; it regulates the electrical charges moving in and out of the cells in the body. It controls your taste, smell and tactile processes. The presence of Sodium ions is essential for the contraction of muscles, including that largest and most important muscle, the heart. It is fundamental to the operation of signals to and from the brain. Without sufficient sodium your senses would be dulled and your nerves would not function.
Chlorine in the Body
Chlorine too is essential to good health and is a fundamental element in the digestion process. It preserves the acid-base balance in the body. It aids Potassium absorption. It supplies the essence of Hydrochloric Acid in the gastric juices used in the stomach to help us break down and digest the food we eat and control the level of bacteria present in the stomach. It enhances the ability of the blood to carry Carbon Dioxide from respiring tissues to the lungs. | https://www.saltassociation.co.uk/education/salt-health/salt-function-cells/ |
Over the last three decades, memory studies have inspired scholars in both modern and premodern Chinese fields to explore interdisciplinary approaches to history, tradition, canonization, identity formation, and more. The convergence of memory and Chinese studies brings new vantage points, as well as questions and challenges. How can critical concepts from memory theories be productively appropriated or even revised for the purpose of Chinese studies? Conversely, how can case studies on China refine and broaden our understanding about memory in the larger field of humanities?
The study of memory is almost unthinkable without examining the medium, or the various media, through which the memory is communicated. At both individual level and collective level, memory may be embodied and mediated through texts, objects, oral narratives, music, visual arts, rituals, bodily performances, and so forth. As Astrid Erll has pointed out, “each of these media has its specific way of remembering and will leave its trace on the memory it creates.” The dynamic interplay between memory and media helps us conceptualize memory as not just a product, but a process.
What is the relationship between memory and media? How do different forms of media encode, communicate, and shape memory differently? How do we understand memory as a process in pluri- medial networks?
Are certain media more “powerful” than others in transmitting certain memories? How do we conceptualize the mutual influences between the choice of media and memory making?
How is individual/group identity negotiated through the processes and products of memory? How do different media relate the past of an individual or a group to its present and future?
Xiaoqiao Ling is Assistant Professor of Chinese at School of International Letters & Cultures in Arizona State University. She has published in both Chinese and English on fiction and drama commentary, legal imagination in literature, memory and trauma in 17th-century China. Her first book, Feeling the Past in Seventeenth-Century China, explores traumatic memories and their transmission across generations during the Manchu conquest of China. She is currently working on a second book-length project on the romantic play The Story of the Western Wing. By investigating how various social groups across cultural and regional geographies interpreted, adapted, and appropriated the play, this project aims at revealing how the play’s social life helped the text to achieve the status of a cultural icon.
Successful applicants will be notified no later than October 1, 2018.
Please share this CFP with those who may be interested. | https://u.osu.edu/mclc/2018/09/03/memory-and-media-graduate-conference-cfp/ |
Meetings come in all shapes and sizes, from the convention to a quick huddle in an office hallway. This one-day workshop will be concerned with small working meetings; with groups that have a job to do requiring the energy, commitment, and talents of those who participate. Members of such a group want to get some kind of result out of their time together: solving problems, brainstorming, or simply sharing information. At its best, such a group knows what it is about, and knows and utilizes the strengths of individual members.
This one-day workshop teaches participants to:
- Understand the value of meetings as a management tool
- Recognize the critical planning step that makes meeting time more effective
- Identify process tools that can help create an open and safe forum for discussion
- Develop and practice techniques for handling counterproductive behaviors
Outline
Lesson 1: Course Overview
- You will spend the first part of the day getting to know participants and discussing what will take place during the workshop. Students will also have an opportunity to identify their personal learning objectives.
Lesson 2: The Basics for Effective Meetings
- To begin, participants will explore the key characteristics of successful meetings. Participants will also discuss types of meetings and alternatives to holding a meeting.
Lesson 3: The Best and Worst of Meetings
- Participants will work in small groups to identify the characteristics of effective meetings and ineffective meetings.
Lesson 4: Holding Productive Meetings
- During this session, participants will explore the keys to productive meetings through large group discussion and a case study.
Lesson 5: Preparing for Meetings
- Participants will be given planning guidelines, including tips on determining the time and attendees.
Lesson 6: Agendas
- This session will educate participants about the importance of agendas. Participants will also take part in a small group activity to reinforce the concepts.
Lesson 7: Setting the Place
- During this session, participants will look at some things to consider when choosing the location and physical setup for the meeting.
Lesson 8: Leading a Meeting
- Next, participants will learn skills for leading a successful meeting.
Lesson 9: Process and Content
- This session will explore the differences between process and content. Participants will also learn about ground rules, different techniques for engaging meetings, and facilitation skills.
Lesson 10: How to Control a Meeting
- Participants will explore types of difficult dynamics and solutions in a group exercise.
Lesson 11: A Plan for Success
- To wrap up the day, participants will work in small groups to create an action plan for areas of weakness identified in their pre-assignment.
Lesson 12: Workshop Wrap-Up
- At the end of the course, students will have an opportunity to ask questions and fill out an action plan.
Scheduled Courses
-
Nov 19, 2019
Need to request this course on a Different Day?
LANTEC is very responsive to local client needs and unique or custom class demands. If you require a delivery date option for a class title on our schedule, please submit your specific request for immediate consideration. We can often accommodate countless additional courses NOT available on our public schedules, please inquire for personal assistance. | http://www.lantecctc.com/courses/planning-amp-delivering-productive-meetings |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.