content
stringlengths 0
1.88M
| url
stringlengths 0
5.28k
|
|---|---|
"Climate Change and Transformation Science" is a new interdisciplinary 2-year Master programme offered within the Environmental Systems Sciences study programme. It is fully taught in English by internationally leading experts in their field. The programme is hosted mainly by the Wegener Center for Climate and Global Change at the University of Graz, but offers links with other institutes, faculties and institutions.
The Idea of the Programme:
There are many interdisciplinary programmes on climate change out there, offered at great Universities. We believe, however, that our curriculum is exceptional in a very important way: after your studies, you will often work in either the natural sciences - related to the physical foundations of climate change or its impacts on the physical environment - or in the social and economic sciences, working on the societal impacts, options to adapt to climate resilience or to transform societies into towards sustainability and net-zero carbon emissions. Many programmes are broad in all these aspects, but ultimately you may suffer from not knowing any discipline in depth. Disciplinary programmes provide in depth knowledge, but often fail to expose students to the interdisciplinary context climate research is embedded in. We believe that our programme offers you an education which is closer to real life needs: depending on your background and interests, you can choose to specialise in either natural or social sciences, but at the same time you will learn about the basic concepts, research questions and state-of-the-art knowledge of the other field. In cross-cutting modules you will collaborate with each other on real world problems. Just as in real life, pysical climate scientists often collaborate with social scientists, and as scientists collaborate with stakeholders outside academica. In short: you will develop strong disciplinary expertise, but at the same time study and experience interdisciplinary and transdisciplinary asepcts of climate change. | https://umweltsystemwissenschaften.uni-graz.at/en/master-studies/environmental-system-sciences-climate-change-and-transformation-science/ |
Nearly pure mass of sea-green botryoidal prehnite with minor beige silica coating from Fassathal, Tyrol, Austria. Measures 2.5 x 1.75 x 1.5 inches (6.4 x 4.4 x 3.8 cm). Fine condition. With old label. | http://www.theadamscollection.com/catalog/item/5284057/10042030.htm |
A database index is a data structure that is associated with a table, a group of tables, or database files. The database index allows faster retrieval of database objects. For example, an index on a column of a table allows for retrieval of rows from the table without having to scan each row and compare the values in the column.
One type of database index is an inverted index. An inverted index maps content to their locations in a database file or document. For example, an inverted index may map a keyword to a set of one or more documents that contain the keyword.
To increase query efficiency, location values may be packed into as few rows as possible. That is, a single row may store a plurality of location values for a keyword, rather than storing each location value in a separate row. For example, if a plurality of documents each contain a particular keyword, a row in the inverted index table may store a list indicating the document IDs for the plurality of documents.
When a database object or file is changed, added, or removed by a database transaction, the inverted index needs to be updated to reflect the changes. For example, if a document is added that contains a keyword, then the corresponding row in the inverted index table is updated to include the document ID. However, as location values for a keyword are packed into the same row(s), the row for the keyword is locked while it is updated. If a second transaction affects the same keyword, the second transaction must wait for the lock to be released before it can update the row. This slows down the processing of database transactions.
A separate row may be created in the index table for each keyword that is updated by a database transaction. Since each database transaction has its own rows, a database transaction does not have to wait for any other database transactions to complete before writing to its rows. However, as the number of database transactions increase, the number of different rows for a keyword increases. The index table becomes fragmented, and using the index table for queries becomes less efficient.
A staging table may be used to store rows from database transactions. The staging table collects the fragmented rows and is periodically merged into the main index table. Rows are updated or added to the index table based on each row of the staging table. However, because rows in the index table cannot be modified at the same time, merging the index table with the staging table is processed serially. If the work for merging the staging table is divided between multiple slave processes and performed in parallel, there is a risk that two slave processes will attempt to modify the same row at the same time.
One solution is to write a custom program that can manipulate kernel threads in order to avoid contention. However, this is a low-level solution that is not flexible across different database systems. Therefore, there is a desire for an efficient method for merging index tables.
The approaches described in this section are approaches that could be pursued, but not necessarily approaches that have been previously conceived or pursued. Therefore, unless otherwise indicated, it should not be assumed that any of the approaches described in this section qualify as prior art merely by virtue of their inclusion in this section.
| |
Join Joseph Lowery for an in-depth discussion in this video Loading data, part of Up and Running with Google Cloud Platform (2013).
In this lesson, we'll create a data set to be used by BigQuery. I've compiled a list of the most popular baby names as recorded by the US government from 2002 to 2012 for our demo. Let's start by looking at the CSV file in Excel. You can find the file in the Chapter 3 0302 Assets folder of the exercise files. It's called babynames.csv. As you can see, it's a pretty simple file. There are four columns, named, gender, frequency, and year.
If you look down at the bottom of the screen, you can see that there are 366,322 Rose, maybe not massive, but pretty darn big. Okay, let's switch to the Google Cloud Console. And, click on our Project Name. Now, click on BigQuery. On the BigQuery page, click on the down arrow next to the project name on the left, and choose Create new dataset. First, we'll give the data set an ID. Use only numbers, letters, and underscores for this.
I'm going to enter baby_names_lynda, and then click OK. You'll see the data set appear under the project name. Hover over the name until you see a plus symbol and a down triangle. Click the plus to bring up the Create and Import dialogue box. Now, we'll add a table ID. Again, only letters, numbers, and underscores. I'll enter bn_2002_2012 for baby names from 2002 to 2012.
When you have that, click Next. Next up, we choose the source of the data. Ours is a CSV file, which happens to be the default. We also have the option of importing JSON file or Using an App Engine data store backup. Let me click Choose File and I'll navigate to my Exercise Files. I'll go into Chapter 3, 0302 > Assets, and then choose baby_names.csv. If you want to look at the entire Zip of baby names, they're organized by year and they go back to 1880. Those are also included for your own use and play. Be warned though, you can waste many hours of precious time investigating your own birth name and those of others.
All right, I have my file ready to upload. Now, I'll click Next. And now, it's time to define the schema. BigQuery needs to know the name of each column and its data type. The syntax is column name, colon, data type, comma, and then the next column name and data type. So, I'll enter the name of the first column, which is name, a colon, and then the data type. And this is a string. Enter in a comma and we can enter in the next name value pair.
Next column name is gender, colon, this is also a string. Follow that with a comma, and then frequency, the number of times that that baby name appeared in that year, colon this is an integer, comma. And then, our final column, year, colon. And you could set this up, either as an integer, or a string. I'm going to put it in as an integer. And once you have that, click Next. The final panel allows us to define the field delimiter. Which in our case is a comma, the default option.
We can also include the number of header rows to skip. For us, that's going to be 1. I don't want to allow any errors, so I'm going to leave the number of errors allowed at 0. I'm ready to hit Submit. You'll see the table name appear under the dataset. And in a few moments, it will show a loading message. When it's finished loading, if all went well, you'll see a success message. Depending on the size of the file and your internet connection, it could take a moment or two. If the file upload completes, and you don't see any success message, click on Job History, and that will verify that the load has been completed. If there was a problem, you'd see an error message here. Okay.
It looks like we're in. Our data set is established. And table loaded with ten years of baby names. We're ready to analyze our data, which we'll do in the next lesson.
Released7/12/2013
- Why Google Cloud Platform? | https://www.lynda.com/Cloud-tutorials/Loading-data/133317/141986-4.html |
BACKGROUND OF THE INVENTION
The invention relates to a new type of clip and osteosynthesis plate having characteristics of dynamic compression and self-retention.
The term "dynamic compression" signifies the ability of these clips or plates to generate a compression force resulting between the two points at the level of which they are implanted and, more particularly, on each side of a bone fracture area.
The surgical clips used for the fixation of the bones and soft tissues must possess a number of essential characteristics. First, they must develop a compression which is constant over time. In addition, they must be anchored perfectly in such a way as to prevent unhooking after their implantation, this unhooking generally being due to movements of the articulation or simply of the bone on which they are implanted. Finally, the method of implantation or removal of the clips and plates must be simple, easy to implement, and cause a minimum level of osseous traumatism.
Various types of clips or plates aimed at achieving these aims are currently known. For example, in order to ensure their retention in the soft bone, clips have been proposed whose lateral branches are equipped with projecting parts or ridges, which are intended to prevent the withdrawal of the clip from the tissue (FR-A-2,525,102). However, although it is true that this type of clip eliminates any risk of unloosening from the bone to be fixed, it does not generate any dynamic compression and, in addition, the removal of the clip results in considerable osseous traumatism.
It has also been proposed, particularly in the document DE-A-2, 703, 529, to produce clips made of martensitic material (of alloy of the Ni-- Ti or Ti--Nb type), and to confer upon the branches of the clips a shape memory capable of inducing a moving together of their ends above the austenitic temperature of the said martensitic material of which the clip is made. This "shape memory" phenomenon is due to the reversible thermoelastic martensitic transformation. This phenomenon is well known and consists in giving to a material a defined shape which is treated at a temperature above the austenitic temperature As of the material, then in giving it another shape, likewise defined, at a temperature below the martensitic temperature Ms of the said material, and finally in repeating this operation several times as a function of the nature of the alloy used, in order to give this material its definitive shape memory. This temperature Ms is below the temperature As.
However, although it is true that this type of clip provides a dynamic compression at the level of the end of the clips, this dynamic compression generally proves inadequate for the whole of the fracture at the level of which the clip is implanted, and is even in some cases damaging because this compression is asymmetrical; indeed, it brings together the deeper areas of the fracture zone and distances the superficial area of this same zone.
SUMMARY OF THE INVENTION
The invention aims to overcome these various disadvantages. It concerns a clip or an osteosynthesis plate capable of satisfying the various criteria set out hereinabove and able to generate a global dynamic compression at the level of the actual fracture on which the clip or the plate is implemented, and additionally having qualities of self- retention.
This osteosynthesis plate is made of a thermoelastic martensitic alloy whose transformation temperatures are:
martensitic transformation temperature Ms below 10° C.;
austenitic transformation temperature As above 15° C.,
the cross-over from the martensitic temperature to the austenitic temperature bringing about a shortening of the length of the plate.
It is characterised in that it is educated to take a rectilinear shape at a temperature below the martensitic transformation temperature Ms and an undulated shape at a temperature above the austenitic transformation temperature As.
The invention also relates to an osteosynthesis clip having two branches intended to be inserted on each side of the area of the bone fracture to be repaired, the said branches being educated so as to deform and in particular move together under the effect of the temperature, above the austenitic transformation temperature As, the said branches being connected via a connection base, which consists of a plate of the type previously mentioned.
Thus, when the clip assembly is at a temperature greater than or equal to the austenitic transformation temperature, not only do the ends of the clips move together, but in addition, and in particular, the connection base itself shortens, inducing at the level of the fracture on which it is implanted a dynamic compression both at the level of the spongy bone and at the level of the cortical bone, or at the level of both the upper and lower parts of the cortical bone when the clip passes right through the bone.
Advantageously, in practice:
the clip is a monobloc clip;
the branches are mounted on the connection base;
only a portion of the connection base is educated;
the portion of the base which is reduced and educated has a cross- section smaller than the total cross-section of the base;
the plate or the connection base has at least two continuous openings situated in the vicinity of their end, and intended to permit the said plate or base to be fixed by any suitable means, and in particular by screws;
the free ends of the lateral branches of the clip are also educated to increase their surface in the general plane containing them at a temperature above the austenitic temperature;
one of the lateral branches consists of at least three sections, a first and a third section, respectively, these sections being educated so as to be on the whole perpendicular to the connection base at a temperature below the martensitic temperature, the first section, adjoining the said base, being educated to move away from the other lateral branch at a temperature above the austenitic temperature, and the third section being educated, in contrast, to move towards the other lateral branch at a temperature above the austenitic temperature, the said first and third sections being in addition connected via a second section which is on the whole parallel to the connection base;
the free end of the third section is split longitudinally, the two zones thus defined being educated so as to remain parallel and in alignment with the said third section at a temperature below the martensitic temperature, and to move apart in the plane of the said section at a temperature above the austenitic temperature;
the clip is made up of two clips of the type in question, joined together in the vicinity of the middle of their connection base, these clips being educated on each side of this joining zone, or on one side only;
the clip comprises three branches, in a Y shape, the connection bases of the said branches in the joining zone, or only some of them, being educated in accordance with the invention;
the alloy of the clip is an alloy based on titanium/nickel or a copper/aluminium/zinc alloy.
BRIEF DESCRIPTION OF THE DRAWINGS
The manner in which the invention can be implemented and the advantages which derive therefrom will emerge more clearly from the exemplary embodiments which follow and which are given by way of indication and as non-limiting examples, with reference to the attached figures, in which:
FIG. 1 is a diagrammatic view of the clip according to the invention at a temperature below the martensitic transformation temperature;
FIG. 2 is a view similar to that in FIG. 1 at a temperature above the austenitic transformation temperature;
FIG. 3 is a view of an osteosynthesis plate according to the invention at a temperature below the martensitic transformation temperature;
FIG. 4 is a view similar to that in FIG. 3 at a temperature above the austenitic transformation temperature;
FIG. 5 is a view of another embodiment of the clip, at a temperature below the martensitic temperature;
FIG. 6 is a view similar to that in FIG. 5, at a temperature above the austenitic temperature;
FIG. 7 is a representation of another embodiment of the clip, at a temperature below the martensitic temperature;
FIG. 8 is a view similar to that in FIG. 7, at a temperature above the austenitic temperature;
FIG. 9 is a representation of another embodiment of the clip, at a temperature below the martensitic temperature;
FIG. 10 is a view similar to that in FIG. 9, at a temperature above the austenitic temperature;
FIG. 11 is a diagrammatic representation of another embodiment of the clip, at a temperature below the martensitic temperature;
FIG. 12 is a view similar to that in FIG. 11, at a temperature above the austenitic temperature;
FIG. 13 is a diagrammatic representation of another embodiment of the clip, at a temperature below the martensitic temperature;
FIG. 14 is a view similar to that in FIG. 13, at a temperature above the austenitic temperature.
DETAILED DESCRIPTION OF A PREFERRED EMBODIMENT
An osteosynthesis clip essentially consists of a base (1) on which the two lateral branches (2,3) are mounted. These lateral branches (2,3) are smooth, or granular, and can be slightly tapered at their free end (7,8) in order to facilitate their insertion during implantation of the clip, at the martensitic temperature, in the bone tissues of the fracture. In a known manner, and in accordance with the particular therapeutic applications, the length of the branches (2,3) can be identical or different. Moreover, the branches can be perpendicular or inclined relative to the connection base.
According to an essential characteristic of the invention, the clip is made of a thermoelastic martensitic material satisfying the necessary criteria of biocompatibility. This martensitic material typically consists of a nickel/titanium alloy or an alloy based on copper, aluminium and zinc.
The martensitic temperature Ms of the material is typically in the region of 10° C. At this temperature, the lateral branches (2, 3) on the one hand and the connection base (1) on the other hand undergo repeated deformations in order to induce a shape-memory effect, which will be restored when the austenitic temperature threshold, i.e. typically 25° C., is exceeded. This shape memory can be acquired by the various elements, namely lateral branches and connection base, by giving them a particular shape at a temperature above the austenitic transformation temperature As, then by giving them another shape, and in particular a straight shape, at a temperature below the martensitic transformation temperature. By repeating these mechanical transformations a certain number of times, a rectilinear shape memory, respectively for the connection base and the lateral branches, at a temperature below the martensitic temperature, and an undulated shape memory, such as that shown in FIG. 2, for the connection base, with the lateral branches moving together at a temperature above the austenitic threshold, are obtained.
In a particular embodiment, the clip is monobloc. However, in another embodiment, it is possible for the lateral branches (2,3) to be mounted., by any known means, on the connection base (1).
In an embodiment shown in FIGS. 5 and 6, the connection base consists of three parts, namely two end parts (4,5) of given profile, and an intermediate part (6) of smaller cross-section, joining these two parts. In this way, it is therefore possible to give a shape memory solely to this intermediate part, an undulated shape memory such as that shown in FIG. 6. This undulation of the intermediate section (6) can be effected in the general plane of the connection base (1), as shown in FIG. 6, or in another plane, and in particular in a plane perpendicular to the general plane of the said base (1). This undulation of the intermediate section (6) brings about a shortening of the connection base (1) of the clip, and consequently a dynamic compression of the fracture at this level. It will be noted in FIGS. 3, 4, 5 and 6 that the length L of the joining section (6), when it is rectilinear, that is to say at a temperature below the martensitic transformation temperature Ms, is reduced to the length L' < l at a temperature above the austenitic transformation temperature. This reduction results in the reduction of the overall length L of the connection base to a value L' < L, this reduction having a typical value in the region of one and a half millimeters (1.5 mm).
When the connection base (1) attains a certain length, it may be necessary to connect it to the bone to be repaired. This connection is carried out by means of screws which are inserted into the bone through continuous openings (9,10) formed in the connection base in the vicinity of its ends (see FIGS. 3-6).
In other words, the clip according to the invention makes it possible to obtain a double compression effect, namely both at the intramedullary level, by way of the lateral branches (2,3) whose ends (7, 8) move together, and at the outer level at the very surface of the bone, in the region of the cortical bone. In addition, given the deformation of the ends of the lateral branches of the clip, the latter is self- retaining.
For its positioning, the clip assembly is brought to a temperature below the martensitic transformation temperature. At this temperature, the connection base (1) and the two lateral branches (2,3) are rendered rectilinear, the said branches being on the whole perpendicular to the connection base (1). The clip is then implanted in the rectilinear position on each side of the fracture area, and this is done by means of compaction, preliminary holes having been made beforehand by the surgeon. Since the temperature of the human body is above the austenitic temperature, the clip deforms and adopts a shape defined by the shape memory already acquired. A shortening of the connection base is observed on the one hand and, on the other hand, a moving together of the free ends (7,8) of its lateral branches (2,3), this leading not only to the double compression effect already mentioned, but also to a self-retention of the clip.
Thus, as long as the temperature of the clip remains above the austenitic temperature, the clip remains firmly implanted in the bone. In order to remove the clip, it suffices to cool the clip to a temperature below the martensitic transformation temperature, and this is done by any suitable means. It is thus possible to remove the clip gently, without any risk of causing osseous traumatism.
In FIGS. 3 and 4, an osteosynthesis plate has been shown which is of a type entirely similar to the connection base hereinabove. This plate comprises, in particular, continuous openings (9,10) intended to permit its fixation, by means of screws, on the bone to be repaired. As in the preceding case, at a temperature above the austenitic temperature the intermediate section is reduced from a length L to a length L' < l, thus bringing about a dynamic compression in the bone to be repaired.
In an embodiment illustrated more particularly in FIGS. 7 and 8, the free end (7,8) of each of the lateral branches of the clip is educated so as to increase its surface in the plane containing each of the said branches (FIG. 8), at a temperature above the austenitic temperature. This is due to the fact that when under the martensitic transformation temperature the lateral branches are longer than they are when above the austenitic transformation temperature. When above the austentitic transformation temperature the connection base is educated to take on an undulating shape and thus the branches are closer together. This reduction in length when above the austenitic temperature induces, by shape memory effect, a corresponding increase in the planar surfaces of the lateral branches. This widening (11,12) thus makes it possible to increase the bearing surface of the said ends at the level of the spongy bone, and thereby to improve the "internal" dynamic compression in the bone to be repaired.
In another embodiment described in conjunction with FIGS. 9 and 10 and more especially adapted to the knee, one of the lateral branches (3) consists of three sections (13,14,15), each of them being rectilinear at a temperature below the martensitic transformation temperature. At such a temperature, the first section (13) is slightly distanced, by education, from the vertical, by a value in the region of 15 degrees. In contrast, the direction of the third section (15) is on the whole perpendicular to the connection base (1) of the clip. They are connected to one another via a second section (14) which is essentially parallel to the said base (1). In addition, the third section (15) has at its end a longitudinal slot (16) extending over a few millimetres, typically ten millimetres.
The first section (13) receives a shape-memory education which is such that, at a temperature above the austenitic temperature, it moves towards the other lateral branch (2) and becomes on the whole perpendicular to the connection base (1), this resulting, consequently, in the other sections (14,15) moving closer to the said branch (2).
The third section (15) also receives a shapememory education, and this at two levels. First, at a temperature above the austenitic temperature the said third section (15) moves towards the lateral branch (2), and this in order to bring about a dynamic compression effect similar to that described in the preceding examples. Finally, at such a temperature, the two zones (17,18) defined by the slot (16) at the level of the end (8) of this section move apart from one another in the plane of the said section (15), in order to bring about a retention effect at this level.
It is also possible, in this embodiment, to provide continuous openings (not shown) on the connection base (1), on the one hand, and on the second section (14) of the lateral branch, on the other hand, in order to permit a more substantial fixation of the clip on its implantation site.
In another embodiment described more particularly in FIGS. 11 and 12, the clip has the shape of an X and is in fact made up of two clips of a type previously described, joined together, for example by welding, in the vicinity of the middle (19) of their connection base. In this particular case, the said connection bases (1) are educated to take an undulated shape at a temperature above the austenitic transformation temperature As of the material from which they are made. More specifically, and in an advantageous embodiment, the said connection bases each comprise two intermediate parts (6) of smaller cross-section, positioned on each side of the joining zone of the two clips. In this way, the resulting clip proves especially suitable for the reduction of a complicated fracture.
Similarly, the embodiment shown in FIGS. 13 and 14 concerns a complex clip having the shape of a Y. The three branches (20) of the Y are joined together, for example by welding. However, it is conceivable that this particular structure could be obtained by folding a simple clip whose two original ends are educated to curve inwards at a temperature above the austenitic transformation temperature of the material, as for the clips described above, and whose folding zone (21), constituting the end of the base branch (22) of the Y, is also educated to adopt this particular profile.
In addition, it is conceivable that each of the branches could comprise an intermediate portion of smaller cross-section (6), as described above, or that only some of them could be provided with such a cross-section, educated to adopt an undulated shape at a temperature above the austenitic transformation temperature of the material from which they are made, in such a way as to induce a shortening of the branch in question. Thus, it is possible to select the most suitable structure depending on the particular application of the clip.
The osteosynthesis plates and clips according to the invention prove perfectly adapted to the roles which are assigned to them, particularly for generating a double dynamic compression effect at the level of the bone fractures. | |
Pendl's Bakery Secret Recipe: Wild Blueberry MuffinsMoist. Flaky. Heavenly? Let's dig in and find out.Introduction About this RecipeBy: Martha Pendl Ingredients 2 cups AP flour 1 teaspoon salt 1 cup buttermilk 1 teaspoon soda 1 cup sugar 2 eggs 12 oz. wild...
Mermaid’s Bakery and Pie House Secret Recipe: Peanut Butter Sandwich Cookies
This delicious, creamy peanut butter cookie recipe from chef and founder of Mermaid’s Bakery in Denver, Colorado, not only has a pretty quick cooking time, but you likely already have everything you need in your pantry. Have fun!
[wd_hustle id="2" type="embedded"/]
Open Every Day:
Monday-Friday: All day!
Weekends: All day! | https://thebaker.com/secret-recipes/ |
By The Brain and Spine Team, Cleveland Clinic
If you eat well and exercise regularly but don’t get at least seven hours of sleep every night, you may undermine all your other efforts.
Sleep disorders expert Harneet Walia, M.D., says it’s important to focus on getting enough sleep, something many of us lack. “First and foremost, we need to make sleep a priority,” she says. “We always recommend a good diet and exercise to everyone. Along the same lines, we need to focus on sleep as well.”
How much sleep do you actually need?
Everyone feels better after a good night’s rest. But now, thanks to a report from the National Sleep Foundation, you can aim for a targeted sleep number tailored to your age.
The foundation based its report on two years of research. Published in a recent issue of the foundation’s journal, Sleep Health, the report updates previous sleep recommendations. It breaks them into nine age-specific categories with a range for each, which allows for individual differences:
–Older adults, 65-plus years: 7 to 8 hours
–Adults, 26 to 64 years: 7 to 9 hours
–Young adults, 18 to 25 years: 7 to 9 hours
–Teenagers, 14 to 17 years: 8 to 10 hours
–School-age children, 6 to 13 years: 9 to 11 hours
–Preschool children, 3 to 5 years: 10 to 13 hours
–Toddlers, 1 to 2 years: 11 to 14 hours
–Infants, 4 to 11 months: 12 to 15 hours
–Newborns, 0 to 3 months: 14 to 17 hours
Walia says there’s evidence that genetic, behavioral and environmental factors help determine how much sleep an individual needs for the best health and daily performance. But a minimum of seven hours of sleep is a step in the right direction to improve your health, she says.
What happens when you don’t get enough sleep?
Your doctor urges you to get enough sleep for good reason, Walia says. Shorting yourself on shut-eye has a negative impact on your health in many ways.
Short-term problems can include:
—Lack of alertness: Even missing as little as 1.5 hours can have an impact, research shows.
—Impaired memory: Lack of sleep can affect your ability to think and to remember and process information.
—Relationship stress: It can make you feel moody, and you can become more likely to have conflicts with others.
—Quality of life: You may become less likely to participate in normal daily activities or to exercise.
–Greater likelihood for car accidents: Drowsy driving accounts for thousands of crashes, injuries and fatalities each year, according to the National Highway Traffic Safety Administration.
If you continue to operate without enough sleep, you may see more long-term and serious health problems. Some of the most serious potential problems associated with chronic sleep deprivation are high blood pressure, diabetes, heart attack, heart failure or stroke. Other potential problems include obesity, depression and lower sex drive.
Chronic sleep deprivation can even affect your appearance. Over time, it can lead to premature wrinkling and dark circles under the eyes. Also, research links a lack of sleep to an increase of the stress hormone cortisol in the body. Cortisol can break down collagen, the protein that keeps skin smooth. | https://chicagohealthonline.com/what-happens-to-your-body-when-you-dont-get-enough-sleep/ |
Christopher Garcia is an Associate Professor in the College of Business at the University of Mary Washington.
Areas of Expertise (8)
Accomplishments (7)
Jepson Fellow (professional)
2014-2015
Conferred by the University of Mary Washington
Faculty Award in Engineering Management and System Engineering (professional)
2011
Awarded by Old Dominion University.
National Defense Industrial Association (NDIA) Scholar (professional)
2009
Engineering Doctoral Fellowship (professional)
2009
Awarded by Old Dominion University.
GAANN Fellowship (professional)
2001
Conferred by Old Dominion University.
Phi Kappa Phi Honor Society (professional)
Membership.
Golden Key International Honour Society (professional)
Membership.
Education (3)
Old Dominion University: Ph.D., Engineering Management 2010
Dissertation Title: Optimization Models and Algorithms for Spatial Scheduling
Florida Institute of Technology: M.S., Operations Research 2008
Old Dominion University: B.S., Computer Science and Mathematics 2001
Media Appearances (4)
Chris Garcia Publishes Chapter in Heuristics, Meta-heuristics and Approximate Methods in Planning and Scheduling
Springer Science + Business print
2016-03-07
Chris Garcia, assistant professor in the College of Business, co-authored a chapter with Ghaith Rabadi titled “Approximation Algorithms for Spatial Scheduling” in Rabadi, G. (ed) Heuristics, Meta-heuristics and Approximate Methods in Planning and Scheduling, Vol. 236 of the series International Series in Operations Research & Management Science, Springer Science + Business, New York. (The chapter is available online: http://link.springer.com/chapter/10.1007%2F978-3-319-26024-2_1)
Garcia Publishes in Computational Economics
Eagle Eye online
2015-02-24
Christopher Garcia, assistant professor in the College of Business, recently had his article “Winner Determination Algorithms for Combinatorial Auctions with Sub-cardinality Constraints” accepted for publication in Computational Economics...
Garcia Presents at Complex Adaptive Systems Conference
Eagle Eye online
2013-11-20
Chris Garcia, assistant professor in the College of Business, attended the Complex Adaptive Systems 2013 conference in Baltimore, Md., and presented a paper titled “Demystifying MapReduce” in the Analytics and Big Data track. The paper will be published in the journal Procedia Computer Science...
EDITORIAL: Tweaking Smart Scale's metrics
The Free Lance-Star online
2019-01-07
EDITORIAL: Tweaking Smart Scale's metrics (The Free Lance-Star)
Christopher Garcia and Mukesh Srivastava at the university’s Center for Business Research ran the numbers and independently verified that “there was no discrepancy between the calculated scores and scores assigned by the state, indicating that the Smart Scale methodology was consistently applied across all projects.”
Articles (5)
ABSTRACT: This work studies a scheduling problem where each job must be either accepted and scheduled to complete within its specified due window, or rejected altogether. Each job has a certain processing time and contributes a certain profit if accepted or penalty cost if rejected. There is a set of renewable resources, and no resource limit can be exceeded at any time....jective is to maximize total profit. A mixed-integer programming formulation and three approximation algorithms are presented: a priority rule heuristic, an algorithm based on the metaheuristic for randomized priority search and an evolutionary algorithm....
2015
ABSTRACT: We examine the winner determination problem for combinatorial auctions with sub-cardinality constraints (WDP-SC). In this type of auction, bidders submit bids for packages of items of interest together with a specific number of items they want. All items in a package ...
ABSTRACT: Spatial scheduling problems involve scheduling jobs that each require certain amounts of two-dimensional space within a processing area of limited width and length. Thus, this requires not only assigning time slots to each job but also locations and orientations within the limited physical processing space as well. Such problems, often encountered in shipbuilding and aircraft manufacturing, are generally difficult to solve, and there is a relatively small amount of literature addressing these problems compared to other types of scheduling. In this paper, we consider a particularly complex class of spatial scheduling problems that involve scheduling each job into one of several possible processing areas in parallel to minimize the total amount of tardy time. In addition, each job has a release time before which it may not be processed. We introduce two methods for solving this type of problem: an integer programming (IP) model and a heuristic algorithm. We perform computational tests and comparisons of each method over a large number of generated benchmark problems with varying characteristics, and also compare these to a more naïve heuristic. Solving the IP model was effective for small problems but required excessive amounts of time for larger ones. The heuristic was effective and produced solutions of comparable quality to the IP model for many problems while requiring very little computational time.
ABSTRACT: Recent innovations in Big Data have enabled major strides forward in our ability to glean important insights from massive amounts of data, and to use these insights to make better decisions. Underlying many of these innovations is a computational paradigm known as MapReduce, which enables computational processes to be scaled up to very large sizes and to take advantage of cloud computing. While very powerful, MapReduce also requires a nontrivial shift in algorithm design strategies. In this paper we provide an overview of MapReduce and types of problems it is suited for. We discuss general strategies for designing MapReduce-based algorithms and provide an illustration using social media analytics.
ABSTRACT: We consider a multiproduct sourcing problem where each finished product must meet explicit reliability requirements. The critical reliability of each product is determined by its components, and the objective is to source the components at a minimum cost from a combination of new and used sources while ensuring each product meets its critical reliability requirement. We develop two models to determine optimal sourcing policies: an exact model that uses mixed integer non-linear programming, and an approximate model that uses integer linear programming. We perform computational tests on a large number of diverse benchmark problems and compare the solution quality and computational time of each model. We find that while the exact model requires significant amounts of time for modest-sized problems, the approximation model provides near-optimal solutions across all problem characteristics in very small amounts of time. We also characterize circumstances whereby cost savings can be realized through used sources. | https://expertfile.com/experts/christopher.garcia |
William Alfred Webster was born on 26 December 1875 in Orangeville, Ontario. His parents Joseph John Webster, a painter, and Elizabeth Zillah Gibbins were both from Barrow Upon Soar, Leicestershire, England, their marriage registered during the third quarter of 1866. The couple gave birth to daughter Ellen Elizabeth followed by son George before immigrating to Canada in 1969, with Joseph, Zillah, and George arriving in Quebec in July aboard the Nestorian and Ellen at a later date. Settling in Orangeville where Joseph worked as a painter, children added to the family were Joseph (abt 1871), Ethel Jane (abt 1874), William, and Zillah (1881). By the time of the 1891 census the family had moved to Winnipeg, Manitoba.
Moving to Kenora, Ontario, on 7 November 1908, in Kenora, William married Olivia Kate Gordon. At the time of the marriage William was working as a clerk, occupation later given the next year as manager. Born on 20 December 1886 in the Kensington area of London, England, Olivia was the daughter of John Gordon, a dairyman, and Laura Kate Griffin. Her parents’ marriage was registered during the third quarter of 1882 in Brighton, Sussex. By the time of the 1901 England census, Olivia was a boarder at a ladies school in Axminster, Devonshire. William and Olivia gave birth to daughter Laura Margaret in September of 1909. Moving to Edmonton, Alberta, son Gordon William was born in 1913.
William first enlisted with the 51st Battalion on 7 January 1915 in Edmonton. His date of birth was given as 25 December 1875, occupation as accountant, and his wife Olivia in Edmonton as next of kin. He was discharged from service by purchase on 23 June 1915 in Calgary. With the family moving to Calgary, William enlisted with the 239th Battalion on 15 July 1916. His date of birth was given as 26 December 1876, his occupation as railway contractor and accountant, and his wife Olivia in Calgary as next of kin. The 239th Battalion was based in Camp Valcartier and had begun recruiting in the spring of 1916, seeking experienced railway men. After arriving in England on 28 December 1916 aboard the Olympic, the battalion was absorbed into the Canadian Railway Construction Corps and became the 3rd Battalion, Canadian Railway Troops in February of 1917. Upon leaving Canada, William was appointed Acting Sergeant. Arriving in France in late March 1917, by late June William was back in England. Diagnosed with valvular disease of the heart and a thickening of the left pleura, he was granted an extended leave to Canada. Arriving in Halifax on 21 July on the Olympic, his leave was to be until early October. However William was discharged from service as medically unfit on 12 February 1918 in Calgary, rank of Sergeant.
In 1915 William had applied for a land grant near Grande Prairie in Alberta, a later record of 1922 indicating that he had cleared 30 acres but had not erected a home. Living in Calgary at the time, sadly Olivia died on 25 December 1918, a victim of the influenza pandemic. At some point the couple had given birth to daughter Elizabeth Patricia (Betsy). At the time of the 1921 census, it is not known where the two girls were, but William and son Gordon were living outside of Penticton in British Columbia where William was working a fruit farm. Returning to Calgary, according to his obituary by 1922 he began working for the Imperial Oil Refinery, retiring in 1944. A 1949 Calgary Voters list showed William living with his son Gordon and family. Known as the “cowboy mayor”, William’s brother George served as mayor of Calgary from 1923 to 1926.
William died on 18 April 1958 in Calgary. At the time of his death he was survived by his daughter Laura (Christopher) Oliver, son Gordon (Eva), both in Calgary, and daughter Betty (WJ) Williams of Nipigon, Ontario as well as four grandchildren. He was predeceased by his wife Olivia, father Joseph (1897, Winnipeg), mother Zillah (1929, Winnipeg), siblings Joseph (bef 1930), George (1933, Calgary), Ellen (Fred) Davis (1951, Neepawa, Manitoba), Ethel (Alexander) Logan (1951, Winnipeg), and Zillah (Charles) Andrews (1957, Winnipeg). William’s parents and siblings Ethel and Zillah are interred in St John’s Cemetery in Winnipeg. Along with Olivia, his brother George, and George’s sons George and Douglas, William is interred in the Union Cemetery in Calgary.
By Judy Stockham
Grave marker photographs by Sandra (SLW), findagrave.com. | https://www.kenoragreatwarproject.ca/canadian-railway-troops/webster-william-alfred/ |
Q:
Create one hot encoded vector from category list in Spark
If I have data containing 5 categories (A,B,C,D,E) and a dataset of customers where each customer can belong to one, many or none of the categories. How can I take a data set like this:
id, categories
1 , [A,C]
2 , [B]
3 , []
4 , [D,E]
and transform the categories column to one hot encoded vectors, like this
id, categories, encoded
1 , [A,C] , [1,0,1,0,0]
2 , [B] , [0,1,0,0,0]
3 , [] , [0,0,0,0,0]
4 , [D,E] , [0,0,0,1,1]
Has anyone found a simple way to do this in spark?
A:
To achieve your desired output you can extend Stephen Carman answer with Spark's UDF (user-defined functions):
// Prepare training documents from a list of (id, text, label) tuples.
val data = spark.createDataFrame(Seq(
(0L, Seq("A", "B")),
(1L, Seq("B")),
(2L, Seq.empty),
(3L, Seq("D", "E"))
)).toDF("id", "categories")
// Get distinct tags array
val tags = data
.flatMap(r ⇒ r.getAs[Seq[String]]("categories"))
.distinct()
.collect()
.sortWith(_ < _)
val cvmData = new CountVectorizerModel(tags)
.setInputCol("categories")
.setOutputCol("sparseFeatures")
.transform(data)
val asDense = udf((v: Vector) ⇒ v.toDense)
cvmData
.withColumn("features", asDense($"sparseFeatures"))
.select("id", "categories", "features")
.show()
Which will give you desired output
+---+----------+-----------------+
| id|categories| features|
+---+----------+-----------------+
| 0| [A, B]|[1.0,1.0,0.0,0.0]|
| 1| [B]|[0.0,1.0,0.0,0.0]|
| 2| []|[0.0,0.0,0.0,0.0]|
| 3| [D, E]|[0.0,0.0,1.0,1.0]|
+---+----------+-----------------+
A:
Something very easy to do, which is somewhat the same is using a CountVectorizerModel
val df = spark.createDataFrame(Seq(
(1, Seq("A","C")),
(2, Seq("B")),
(3, Seq()),
(4, Seq("D","E")))
).toDF("id", "category")
val cvm = new CountVectorizerModel(Array("A","B","C","D","E"))
.setInputCol("category")
.setOutputCol("features")
cvm.transform(df).show()
/*
+---+--------+-------------------+
| id|category| features|
+---+--------+-------------------+
| 1| [A, C]|(5,[0,2],[1.0,1.0])|
| 2| [B]| (5,[1],[1.0])|
| 3| []| (5,[],[])|
| 4| [D, E]|(5,[3,4],[1.0,1.0])|
+---+--------+-------------------+
*/
This isn't exactly like what you had wanted, but the feature vector will tell you what Categories exist in your data. For instance in row 1, [0,2] corresponds to the first and 3rd element of the dictionary, or "A" and "C" as written there.
| |
UFO Sighting Report - USA
August 20th 2007 : Loveland, Colorado
Location of Sighting: Loveland, CO.
Number of witnesses: 1
Number of objects: 2
Shape of objects: Round non blinking white lights in trail.
Full Description of event/sighting: Just as a previous sighting a couple months ago, two round solid white lights traveled from North to South at an altitude of approximately 500 - 1000 feet above ground level (about 6000 above see level). Lights were steady, no blinking. Distance between the two was not great. The rear light appeared just slightly higher than the leading light, and for a brief moment the trailing light became about twice as bright as it was, then returned to normal. It was still twilight, and no apparent fuselage or wing/tail shapes could be discerned. No sound was emitted. Lights were in sight for approximately one minute as they traveled south. The path of these lights was nearly identical as reported a month or two ago, though slightly earlier in the evening. Still nothing to indicate a civil aircraft of any type.
| |
How long does it take to get through customs in the Bahamas?
If you are going to the Bahamas, then you must be aware of their customs norms. Every passenger wants a hassle-free journey, but they are unfamiliar with the items they must carry. They often get late in the process. You must gather information related to customs before you depart for your destination. Most people face trouble as they have no information about the customs. There can be two scenarios one when you arrive at the Bahamas airport and the other when you are departing from the Bahamas.
In both scenarios, it will take different times:
- If you are arriving in the Bahamas, then you do not have to spend enough time on the custom check. It will roughly take 20 minutes for you to get through customs.
- But, if you depart from the Bahamas for the United States of America, it will take almost 02 to 03 hours to get through customs.
Do you have to go through customs coming from the Bahamas?
A person must get through the customs. Whenever one crosses a territory, they have to provide their documents and check themselves, so they do not carry any objects, foods, or items that are prohibited in that country. Whether you are arriving in the Bahamas or departing from the Bahamas, you must go through customs. The security agency of the Bahamas will check whether you have brought any prohibited object or not. You must check at the customs as it is not optional but mandatory.
What is allowed through Bahamas Customs?
The Bahamas allow you to carry certain products. You can have many items with you. They permit the following items in the Bahamas:
- You can import items up to the value of $100. You are not allowed to carry items that are worth over $ 100.
- You can carry local currency only before the Central Bank Of Bahamas approves.
- There are no such restrictions on the amount of foreign currency you can carry.
- Prohibited items like drugs are not allowed inside the country.
- You can carry fruits, vegetables, foods, printing items, paintings, books, cards, etc.
It is mandatory to get yourself checked at customs. You must spend at least 20 minutes at the customs if you have not carried any prohibited items. You must be familiar with the things that are not allowed at the custom. If you depart from the Bahamas for the U.S.A, it will take around two to three hours. | https://www.faresbank.com/blog/how-long-does-it-take-to-get-through-customs-in-the-bahamas |
When RoboCop hit the big screen in 1987, he was patrolling the dystopian future.
More than 30 years on, no crime-stomping cyborgs have emerged in the Queen City. But police are hoping a gadget can lighten their workload.
The force wants to acquire a “3D laser scanner” to help them with on-scene measurement — a FARO Focus X130, according to a police spokesperson.
The device is among items on the proposed 2018 police budget, which was included as part of the full city budget released Thursday.
Chief Evan Bray explained the merits of such a device following a police commissioners meeting this week.
He asked reporters to imagine the meeting room was a crime scene, and that the distance between each chair needed to be measured and documented.
“I hold one end of the tape measure, and you measure that the top corner of the chair is nine feet, two inches. The bottom corner is nine feet, one inch,” he said.
“Okay, next chair.”
He then asked reporters to imagine the time it would take to complete the task.
“With that 3D laser scanner, we set it up in the middle of the room on a tripod, it does about a minute and a half of revolution taking video and pictures,” he said.
Then, snapping his fingers, he emphasized that the machine “instantly” calculates the distance between all items in its proximity.
The device in the video below may not be the exact model police are considering.
“So, literally saving thousands of hours of investigators doing what I would call manual measurements and evidence gathering.”
Further, the device would assist with difficult tasks such as taking measurements in the dark and beneath vehicles.
“It’s mind-blowing the labour that it saves on the back end and the accuracy and all the rest of it,” Bray said, noting that after a major vehicle collision, the device could drastically reduce the time that roadways are closed.
Such a piece of equipment carries an up-front cost, but Bray says purchasing one would prove to be a cost-saving measure in the long run, and its results would be admissible in court.
The gizmo is part of a list of items under a proposed $2,545,200 in funding for information technology, which also includes computer equipment replacement, video recording equipment and software acquisition, among other things.
Comments
We encourage all readers to share their views on our articles and blog posts. We are committed to maintaining a lively but civil forum for discussion, so we ask you to avoid personal attacks, and please keep your comments relevant and respectful. If you encounter a comment that is abusive, click the "X" in the upper right corner of the comment box to report spam or abuse. We are using Facebook commenting. Visit our FAQ page for more information. | |
Introduction {#s1}
============
In clinical microbiology laboratories, traditional culture based techniques remain the primary methodology used for identifying bacterial isolates. These methods are time-consuming, can involve multiple biochemical tests, and can be expensive, particularly for fastidious organisms. In recent years, the introduction of automated identification instruments has resulted in greater reliability, but discrepancies between the various platforms have been reported [@pone.0048558-Jin1]--[@pone.0048558-Woodford1]. Furthermore, many research laboratories lack the funds necessary to invest in these instruments, and often rely on labor-intensive biochemical characterization or *16S* rRNA sequencing to confirm species type.
Despite significant advances in molecular biology, molecular methods for species identification have not achieved widespread use, with the possible exception of the Biodefense community [@pone.0048558-Stenger1]. Factors such as allelic variation within target genes, cross-reaction with other species [@pone.0048558-Maurer1] and the lack of experienced molecular technicians have all contributed to their relative scarcity. However, despite these limitations, molecular methods can provide significant advantages over phenotypic-based methods, including rapid turnaround time, scalability, and high sensitivity [@pone.0048558-Maurer1]. Furthermore, using appropriate bioinformatic tools and careful primer design, many of the limitations outlined above can be mitigated considerably.
Even prior to recent global calls to help combat the spread of carbapenem-resistant *Enterobacteriaceae* (CRE), particularly *E.coli* and *K. pneumoniae* [@pone.0048558-Canton1]--[@pone.0048558-Walsh1], research on CRE, multi-drug resistant *A. baumannii* and *P. aeruginosa*, and methicillin-resistant *Staphylococcus aureus* (MRSA) has been prolific, as befits their status as the most important nosocomial pathogens. A number of conventional PCR and real-time PCR assays have been developed targeting these organisms [@pone.0048558-Anuj1]--[@pone.0048558-Thong1], but a comprehensive panel that can target all five clinically important species is lacking.
We recently published a highly sensitive and specific real-time PCR assay for the detection of MRSA [@pone.0048558-McGann1]. This report adds an additional four real-time PCR primers, designed using a combination of *in silico* and *in vitro* methodologies that are highly specific to the four most common nosocomial pathogens. This primer set will allow researchers to rapidly identify these pathogens directly from culture in less than 90 minutes with a high degree of accuracy and sensitivity. We also describe a novel bacterial *16S* rRNA real-time PCR primer designed from the alignment of 962,279 bacterial *16S r*RNA gene sequences, which will amplify a product from the *16S* rRNA gene in 93.6% of all bacterial *16S* rRNA genes published to date. The combination of *16S* rRNA gene detection with species-specific primers can greatly reduce the effort required in screening large populations of unknown organisms, with samples negative for *16S* rRNA being excluded from further testing.
Materials and Methods {#s2}
=====================
Primer Design {#s2a}
-------------
Primer characteristics are presented in [Table 1](#pone-0048558-t001){ref-type="table"}. Unless noted otherwise, all primers were designed using Primer Express version 2.0 (Applied Biosystems, Carlsbad, CA). All primers were designed to have an optimal annealing temperature of 56°C, and real-time PCR reactions were performed in 20 µl volumes with 200 nM primers. Where appropriate, alignment of individual gene sequences was performed using MegAlign version 10.0.1 (DNAStar Inc, Madison, WI).
10.1371/journal.pone.0048558.t001
###### Primer characteristics.
{#pone-0048558-t001-1}
Name[1](#nt101){ref-type="table-fn"} Gene Target species Sequence (5′ to 3′) Eff (%)[2](#nt102){ref-type="table-fn"} Length[3](#nt103){ref-type="table-fn"}
-------------------------------------- -------- -------------------- ---------------------------- ----------------------------------------- ----------------------------------------
U16SRT-F *16S* variable ACTCCTACGGGAGGCAGCAGT \>96.4% 180
U16SRT-R TATTACCGCGGCTGCTGGC
secERT-F *A.baumannii* GTTGTGGCTTTAGGTTTATTATACG
secERT-R *secE* *A. nosocomialis* AAGTTACTCGACGCAATTCG 99.4 94
secERT-Probe *A. pitii* ACCCATCAAGGTAAAGGCTTCGTTCG
yccTRT-F *Escherichia coli* GCATCGTGACCACCTTGA
yccTRT-R *yccT* *Shigella* spp. CAGCGTGGTGGCAAAA 98.1 59
yccTRT-Probe TGCATTATGTTTGCCGGTATCCG
gltART-F *gltA* *K. pneumoniae* ACGGCCGAATATGACGAATTC 97.1 68
gltART-R AGAGTGATCTGCTCATGAA
ecfXRT-F *ecfX* *P.aeruginosa* AGCGTTCGTCCTGCACAAGT 93.8 81
ecfXRT-R TCCACCATGCTCAGGGAGAT
Probe sequences were generated for the *secE* and *yccT* real-time PCR primers, but no *in vitro* testing was performed. The probe sequences are provided here for the benefit of researchers wishing to perform multiplex real-time PCR reactions using these primers. All primers have an optimal annealing temperature of 56°C.
Primer efficiency was calculated from the slope and intercept of the trendline produced following amplification of serial dilutions of genomic DNA from the ATCC strains of each species, as described previously [@pone.0048558-McGann1].
Amplicon size in base pairs.
16S Real-time PCR Primers {#s2b}
-------------------------
*16S* rRNA real-time PCR primers were designed manually from a consensus sequence based on an alignment of 962,279 bacterial *16S* rRNA gene sequences obtained from the Ribosomal Database Project release 10 [@pone.0048558-Cole1]. To derive the consensus sequence, nucleotide frequencies were determined at each position in the alignment using a custom script in Perl ver 5.8.8 running on the Red Hat Linux operating system; positions where the majority of sequences had a gap were excluded. Regions of the consensus sequence where the majority nucleotide was present in \>90% of the sequences were used for primer design. A synopsis of each nucleotide frequency is presented as supplemental material ([Table S1](#pone.0048558.s001){ref-type="supplementary-material"}).
*E. coli* and *A. baumannii* -- Specific Primers {#s2c}
------------------------------------------------
To identify genes specific to *E. coli* and *A. baumannii*, annotated complete genome sequences for 38 *E. coli* strains, and 8 completed and 52 draft *A. baumannii* genomes were selected ([Table S2](#pone.0048558.s002){ref-type="supplementary-material"} and [S3](#pone.0048558.s003){ref-type="supplementary-material"}). In addition, the two draft genomes of *A. nosocomialis* (RUH 2624 and NCTC 8102) and the four draft genomes of *A. pitii* (SH024, D499, DSM 21653, and DSM 9306) were used to ensure that all *Acinetobacter*-specific primers would also amplify products from these two species. For each protein in a strain, BLASTP [@pone.0048558-Altschul1] was used to find the best match to a protein family in the HOGENOM release 5 database; orthologous proteins from different strains show the best match to the same HOGENOM protein family [@pone.0048558-Penel1]. Genes that are not single copy (that is, two or more proteins from the same strain are members of the same HOGENOM protein family) were excluded from further analysis. In addition genes for which the nucleotide length of any ortholog varies from the mean gene length by more than 5% were excluded in order to restrict the analysis to those genes that were highly conserved. For the genes that met these criteria and had the fewest variable positions, BLASTN analysis was performed against the NCBI non-redundant nucleotide database using a gene sequence randomly selected from the final species-specific gene targets.
Four genes showed no significant match to non-*Escherichia* species: HBG518163 (acid chaperone protein, *hde*A), HBG636731 (predicted secreted protein, function unknown, *ynfB*), HBG473849 (conserved protein, function unknown, *yccT*), and HBG758393 (function unknown, DUF1418 family, *ybjC*). Nineteen genes showed no significant match to non-*Acinetobacter* species ([Table S4](#pone.0048558.s004){ref-type="supplementary-material"}), and the top three candidates, based on total gene length and number of mismatches between all genomes; HBG594899 (*rpiN,* 50S ribosomal protein L14), HBG701403 (*secE,* preprotein translocase, SecE subunit), and HBG752450 (*scpB,* segregation and condensation protein B) were selected for further analysis.
Starting with a multiple sequence alignment, a custom Perl script was used to identify positions within each gene that are invariant among all strains. With *E. coli*, two of the four genes (*hdeA* and *yccA*) contained regions \>100 bp that were suitable for primer design. All three genes from the *Acinetobacter* analysis contained extensively conserved regions suitable for primer design.
*K. pneumoniae* and *P. aeruginosa* -- Specific Primers {#s2d}
-------------------------------------------------------
The limited number of published genome sequences available for *K. pneumoniae* and *P. aeruginosa* precluded extensive bioinformatic analysis. Therefore, the top two candidate genes from both species (*K. pneumoniae*; *gltA* and *khe*; *P. aeruginosa; ecfX* and *23S*) were selected based on conserved gene sequences from the available genomes.
Validation of Real-time PCR Primers {#s2e}
-----------------------------------
All primer sets were tested for sensitivity, optimal annealing temperature and primer efficiency as previously described [@pone.0048558-Bustin1], [@pone.0048558-Bustin2]. Briefly, high quality gDNA was was extracted using the GeneJET Genomic DNA Purification Kit (Fermentas Inc, Glen Burnie, MD, USA) with an additional bead-beating step to maximize lysis. DNA was quantified using both a Nanodrop 2000 (Nanodrop, Wilmington, DE, USA) and Qubit 2.0 Fluorometer (Life technologies, Grand Island, NY, USA).
Genome copies of DNA were calculated using the following formula:
Size of genome (in bp) × 650 Daltons/bp = molecular weight of Genome in g/mol.
\# copies of genome in 1 ng of DNA = (1×10^−9^ g ÷ Mw of genome)×6.02×10^23^ molecules/mole (Avogadro's number).
To get 10^8^ copies in 2 µl = (10^8^ ÷ \# copies of genome in 1 ng)/2.
Serial dilutions of DNA from 10^8^ to 10^2^ copies were prepared and tested in duplicate with each primer set to calculate primer efficiency and sensitivity.
Primers were tested using two different instruments, the Roche Light Cycler 480 II (LC 480 II) with SYBR Green I Master Mix (Roche Applied Sciences, Indianapolis, IN), and the BioRad CFX96 with SsoAdvanced SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA). Each primer was tested for specificity by two methods. First, the primers were tested against genomic DNA extracted from a panel of American Type Culture Collection strains (ATCC, Manassas, VA, USA) and clinical isolates representing fifty different bacterial species, including closely related members from the same genus ([Table S5](#pone.0048558.s005){ref-type="supplementary-material"}). Secondly, primers were tested against 200 clinical isolates of each species, identified to the species level using three automated identification systems; the Vitek 2 (bioMerieux, Durham, NC), the BD Pheonix (Diagnostics Systems, Sparks, MD), and the Microscan Walkway (Siemens Healthcare Diagnostics Inc, Deerfield, IL), selected from a large repository of isolates (\>10,000 strains) collected between 2002 to 2012 from 23 different facilities in the United States of America, Europe, Asia and the Middle East. Pulsed-field gel electrophoresis (PFGE) indicated that the selected clinical isolates represented a variety of different pulse-types (unpublished results).
High throughput Testing of Clinical Isolates {#s2f}
--------------------------------------------
The primers were incorporated into a 96-well plate assay to allow high throughput testing of multiple clinical isolates. All bacterial isolates were cultured overnight on Blood Agar plates at 37°C, and all samples were prepared in a BioSafety hood in a certified BSL2 laboratory. Single colonies from an overnight culture of each isolate were re-suspended in 200 µl of sterile, ultra-pure water and mixed by vortexing. 10 µl of the resulting suspension (or 10 µl taken directly from an overnight broth culture) was added to 20 µl of Lyse-and-Go reagent (Thermo Scientific, Waltham, MA) in 96-well plates, and run in a thermal cycler using the manufacturer's protocol for the isolation of total genomic DNA. Isolates were held at 80°C for 15 minutes at the end of the program to maximize lysis, and 2 µl of the resulting lysate was used directly for real-time PCR. Leftover bacterial DNA in Lyse-and-Go reagent was stored at −20°C, and no reduction in real-time PCR amplification was evidenced after 9 months (data not shown). Appropriate positive (ATCC Type strains for each species), negative (two ATCC type strains from species other than the target organism), and no template controls (ultra-pure water) were incorporated onto every plate. Cycling parameters were 95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 56°C for 10 seconds. A melting curve analysis was included at the end of every program to assist in data analysis. Quantification cycle (Cq; CFX96) and crossing threshold (Ct; LC 480 II) values were calculated automatically using instrument software.
{#pone-0048558-g001}
Results and Discussion {#s3}
======================
16S rRNA Real-time PCR Primers {#s3a}
------------------------------
Analysis of the alignment of 962,279 bacterial *16S* rRNA gene sequences revealed considerable nucleotide variation between species ([Table S1](#pone.0048558.s001){ref-type="supplementary-material"}). However, two regions were identified that were suitable for primer design, where the nucleotide sequence was highly conserved in \>90% of all rRNA sequences. Forward and reverse primers were manually designed, with the nucleotide sequence of the forward primer being conserved in 98.5% of *16S* rRNA sequences, and the nucleotide sequence in the reverse primer being conserved in 93.8% ([Table S1](#pone.0048558.s001){ref-type="supplementary-material"}).
Primers were tested against serial dilutions of genomic DNA from *A. bauamnnii* ATCC 19606, *E. coli* ATCC 35218, and *P. aeruginosa* ATCC 27853. The primers were reproducibly capable of detecting \<100 copies of genomic DNA, and primer efficiency was 96.4%, 98.2% and 97.9% respectively, with an R^2^\>99%. The primers successfully amplified a product from the 50 ATCC and clinical strains ([Table S5](#pone.0048558.s005){ref-type="supplementary-material"}), providing *in vitro* support for the *in silico* primer design method employed. No amplification was seen from no-template negative controls, or from DNA extracted from 15 clinical isolates of *Candida parapsilosis* and *C. albicans* (data not shown).
The *16S* rRNA gene is a frequent target for many assays, and universal PCR primers are routinely used for species identification [@pone.0048558-Weisburg1]. A number of real-time primers for this gene have also been developed, but they either contain degenerate nucleotides [@pone.0048558-Liu1], or produce long amplicons that are not suitable for optimal real-time PCR [@pone.0048558-Nadkarni1]. The primer set described here overcomes both these limitations, and has proved a valuable tool in detecting bacterial contamination of environmental swabs (manuscript in preparation), as a positive control for bacterial lysis, confirming that plasmid DNA is free of contaminating genomic DNA, and determining if a colony in a mixed culture is bacterial.
Species-specific Real-time PCR Primers {#s3b}
--------------------------------------
Five sets of primers were tested for sensitivity and specificity for *A. baumannii;* three primers were generated using the genome alignment algorithm (*rpiN, secE* and *scpB*), one primer was designed in-house from an alignment of 54 *ompA* sequences, and the fifth primer, also targeting the *ompA* gene, has been published previously [@pone.0048558-McConnell1]. *OmpA* was included as a potential target as this gene has been used as a target for *A. baumannii*-specific primers in previous publications [@pone.0048558-McConnell1]. However, though *ompA* was identified as a potential target using our algorithm, sequence variation among *A. baumannii*, *A. nosocomialis* and *A. pitii*, as well as variation in the protein length, resulted in this gene being flagged as unsuitable as an *Acinetobacter*-specific target. All five primers did not cross-react with other bacterial species ([Table S5](#pone.0048558.s005){ref-type="supplementary-material"}), including *A. lwoffi*. Primer efficiency at 56°C, based on serial dilutions of *A. baumannii* AB0057 and *A. baumannii* ACICU, ranged from 97.2% (*rpiN*) to 99.4% (*secE*), with R^2^\>99%, and all primers were reproducibly capable of detecting \<100 genome copies of DNA. Furthermore, all five primers successfully amplified products from the 200 clinical test isolates. The primer pair targeting the *secE* gene consistently provided greater sensitivity than all other primers at an annealing temperature of 56°C, and was therefore selected as the optimal candidate for identifying *A. baumannii*. *In silico* analysis of the *secE* primer with the draft *A. nosocomialis* and *A. pitii* genomes demonstrated that these primers would also amplify a product from these two species.
Four sets of primers were tested for sensitivity and specificity for *E.coli*; two primers were generated using the genome alignment algorithm (*hdeA* and *yccT*), one primer was designed from an alignment of 38 *uidA* genes ([Table S2](#pone.0048558.s002){ref-type="supplementary-material"}), and a fourth primer, also targeting the *uidA* gene, has been described previously [@pone.0048558-Nordmann1], [@pone.0048558-Bustin1]. *UidA* was included as this gene has been used as a species-specific target in a number of previous publications [@pone.0048558-Frahm1], [@pone.0048558-Pavlovic1], [@pone.0048558-Anklam1]--[@pone.0048558-Donhauser1], but it did not meet the criteria demanded by the species-specific algorithm in this study. This was confirmed by both *in silico* and *in vitro* testing. An alignment of 38 *E.coli* genomes indicated that published *uidA* primer sequences [@pone.0048558-Frahm1], [@pone.0048558-Pavlovic1] have 3 nucleotide variations in the forward primer and 1 nucleotide variation in the reverse primer when aligned with some *E.coli uidA* gene sequences. When tested against the 200 clinical isolates, the primers failed to amplify any product from 8 strains ([Figure 1a](#pone-0048558-g001){ref-type="fig"}). A second set of *uidA* primers was designed, targeting a conserved region of the 38 *uidA* gene sequences. However, no amplification was again observed from 7 of the same 8 strains that were *uidA* negative from the first primer pair. One of these 7 isolates amplified a product after 28 cycles, indicative of inefficient primer annealing, most likely due to primer/target mismatches within the *uidA* gene.
The final two primers, targeting the *yccT* and *hdeA* genes, were identified as the most promising candidates based on the algorithm used in this study. Primer efficiency was 98.1% and 97.4% respectively, with R^2^\>99%. However, 9 of the 200 clinical isolates failed to amplify a product with the *hdeA* primer, including 3 of the 8 *uidA*-negative isolates. In contrast, the *yccT* primer successfully amplified a highly conserved product from all 200 isolates ([Figure 1b](#pone-0048558-g001){ref-type="fig"}), and was therefore selected as the final *E. coli-*specific primer. As expected, due to the very high homology between *E. coli* and *Shigella* strains [@pone.0048558-Lukjancenko1], the *yccT* primer set also amplified a product from *Shigella flexneri* ATCC 12022, but did not cross-react with any other species ([Table S5](#pone.0048558.s005){ref-type="supplementary-material"}).
Despite 38 sequenced genomes of *E. coli*, developing an *E. coli*-specific primer pair is challenging. We have shown that current targets, such as the *uidA* gene are not suitable due to considerably allelic variation, particularly among *E. coli* clinical isolates from diverse regions. The remarkable diversity among *E. coli* strains is also highlighted in the bioinformatic approach that we used, where just 2 candidate genes passed all of the criteria employed, and just a single gene, *yccT*, was eventually successful *in vitro*.
The paucity of completed genomic sequences for both *K. pneumoniae* and *P. aeruginosa* limited the application of our algorithm to just a single genome for *P. aeruginosa* with an additional 4 whole genome shotgun sequences, and 5 genomes for *K. pneumoniae*.
BLAST analysis suggested a potential cross-reaction between the *K. pneumoniae khe* primer set and *Citrobacter fruendii*, and this was confirmed *in vitro*. However, the *gltA* primer set demonstrated no cross-reactivity with other species ([Table S5](#pone.0048558.s005){ref-type="supplementary-material"}), a primer efficiency of 97.1%, and successfully amplified a product from all 200 clinical isolates of *K. pneumoniae*.
Both sets of *P. aeruginosa* primers demonstrated no cross-reactivity with other species, including *P. flourescens*, *P. stutzeri* and *P. putida*. However, when tested against a panel of 200 clinical isolates of *P. aeruginosa* only the *ecfX* primer successfully amplified a product from all strains, with 12 strains failing to generate a product with the *23S* rRNA primer set. The *ecfX* primer set demonstrated a primer efficiency of 93.8% with an R^2^ value of 99.1%.
Species-specific primers targeting the *ecfX* gene in *P. aeruginosa* have been published for both conventional [@pone.0048558-Hillenbrand1], [@pone.0048558-Lavenir1] and real-time PCR assays [@pone.0048558-Anuj1], [@pone.0048558-Cattoir1]. Our results support the continued use of this gene as a target for *P. aeruginosa*-specific primers, at least until further full genome sequences of this strain become available. In contrast, species-specific primers for *K. pneumoniae* are less well described, and primarily involve detecting targets that are specific to certain strains, such as the ST258 clone [@pone.0048558-Chen1], or those with the hypermucoviscosity phenotype [@pone.0048558-Hartman1]. In addition, a number of conventional PCR assays to detect *K. pneumoniae* have been described [@pone.0048558-Thong1], [@pone.0048558-OLeary1], though to our knowledge, no assay described to date uses *gltA* as the target gene.
Conclusion {#s3c}
----------
We describe a set of real-time PCR primers, designed to have the same optimal annealing temperature, and displaying high specificity for four clinically important pathogens. The primers are well suited for high-throughput testing of isolates, with results available in less than 90 minutes from bacterial colonies or overnight broth cultures. We also demonstrate the power of bioinformatics in designing optimal primer sequences, and provide a novel *16S* rRNA real-time PCR primer designed from the alignment of over 960,000 bacterial *16S* rRNA sequences. The primers described herein have been an invaluable addition to our surveillance network, and have demonstrated a 100% concordance with traditional phenotypic identification systems.
Supporting Information {#s4}
======================
######
**Nucleotide frequencies at each position from an alignment of 962,279** ***16S*** **rRNA sequences.**
(DOCX)
######
Click here for additional data file.
######
**List of assembled** ***E. coli*** **genomes used in the design of** ***E.coli*** **-specific primers.**
(DOCX)
######
Click here for additional data file.
######
**Complete and draft** ***A. baumannii*** **genomes used the design of** ***Acinetobacter*** **-specific primers.**
(DOCX)
######
Click here for additional data file.
######
**The top 28 gene targets for designing** ***Acinetobacter*** **-specific primers.**
(DOCX)
######
Click here for additional data file.
######
**Bacterial species used for specificity testing of species-specific primers.**
(DOCX)
######
Click here for additional data file.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Conceived and designed the experiments: RJC DVZ PEW EPL PMG. Performed the experiments: RJC MM JP RQ YIK PMG. Analyzed the data: RJC PMG PEW EPL. Contributed reagents/materials/analysis tools: EPL PEW YIK. Wrote the paper: PMG RJC PEW EPL.
| |
Executive Summary
Pinniped predation on fish farms is a worldwide problem and
causes the industry financial losses of up to 10% of the total farm
gate value (Nash et al. 2000). This has led to a need for the
industry to look at non-lethal measures controlling seal damage,
which include tensioning nets, deployment of a predator net or use
of Acoustic Deterrent Devices (
ADDs)
(Würsig and Gailey 2002).
ADDs have
often been considered a non-harmful method of dealing with the
problem. However, the main problems with
ADDs appear to
be a lack of long-term efficiency and unintended effects on other
marine wildlife (Jefferson and Curry 1996). A recent study has
found a new method of acoustic deterrence using the acoustic
startle reflex (Gotz & Janik 2011), which proved successful in
deterring seals and avoiding effects on harbour porpoises over a
two month period. This project tested (a) the effects of startling
sounds on seal predation and marine mammal abundance around a test
farm compared to adjacent control farms without
ADDs over a 13
months period and (b) determined the startle threshold for
bottlenose dolphins to prepare the method for use in other
applications such as marine construction. The project also tested
the short-term effectiveness of the startle method on two
additional farms when they experienced high seal predation
rates.
The use of the startle method resulted in a highly significant
reduction in the number of lost fish on the long-term test site
compared to the pre-deployment period (Mann-Whitney U, n=16, U=38,
p=0.004, Fig 3). In fact, median losses per month were zero on the
test site when the sound was played. This was a highly significant
difference in predation losses compared to the control sites (Poll
na Gile, Mann-Whitney U, n=22, U=103, p=0.001; Ardmaddy, n=21,
U=20.5, p=0.01). Median losses were 41 fish/month on control site 1
(Poll na Gile), 39 fish/month on control site 2 (Ardmaddy), 98
fish/month on the test site before the deployment of the startle
equipment and zero fish per month when the equipment was operating
(Fig 3). There were only 5 consecutive events of negligible to
moderate predation on the test site during the 13 months study,
which consisted of 58, 14, 7, 5 and 1 fish losses. The direct
comparison of monthly losses between the pre-deployment period,
test period and control sites showed that the startle method was
capable of reducing predation losses significantly throughout the
one year deployment (Fig 3). This was also confirmed by a
statistical model which showed that sound exposure was the most
important explanatory factor with respect to variation in seal
predation. The model also revealed that predation varied throughout
the year, although different sites did not differ in their losses
during different times of year. Similarly, overall predation levels
did not differ across sites. Seals, porpoises and otters approached
the farm throughout the entire test period. There was no
significant difference in number of seals and porpoises at
different distances from the fish farm throughout the test
period.
Rapid response trials at two fish farms with high seal predation
rates also proved highly successful. At the first farm 405 fish
were killed by seals in the month before the startle equipment was
deployed (Fig 8). Dive reports after deployment of the equipment
showed no new, seal-related kills for 2 weeks at which time the
farm was harvested. At the second farm predation also dropped to
zero in the first week after deployment. However, the equipment was
damaged in a storm afterwards and predation levels returned to the
high levels found prior to deployment.
Our tests showed that the startle method was highly successful
in limiting seal predation at an operating fish farm with no
evidence for habituation during a 13 month period. Similarly, the
method was highly successful at limiting predation in cases where
predation pressure was high. A likely explanation for the five
events of predation while the startle equipment was operating in
the long term test is that the predating individuals could have had
compromised hearing which could be either the result of genetic
predisposition, disease, old age or previous exposure to
anthropogenic noise source (such as commercially available seal
scarers).
Movement data of marine mammals showed that the startle method
did not influence the distribution of harbour seals, porpoises and
otters. The fact that harbour seals still approached the farm quite
closely when the startle equipment was operating is in contrast
with previous findings when measuring approaches. However, in the
previous test sound exposure was more varied and lasted for only 2
months. It is therefore likely that seals observed at the surface
near the fish farm did try to avoid the sound by swimming with
their heads above the water. The fact that there was virtually no
predation confirms that the sound had an effect on seals. Harbour
porpoises were also observed at the surface near the equipment, but
kept their heads underwater confirming that the sound did not have
an effect on them. The deterrence system tested in this study
operated at a duty cycle of less than 1% which is between one and
two orders of magnitude lower than in current commercially
available deterrent devices. The fact that brief, isolated pulses
were emitted at only moderate levels means that noise pollution was
greatly reduced and the potential for masking of communication
signals or hearing damage is low. This is in contrast to current
commercially available
ADDs which
emit sound at high duty cycles and high source levels. We would
recommend the use of this novel technology at fish farms.
The startle method would potentially also be useful to
temporarily deter cetaceans from marine construction sites. One
possible problem with the application for echolocating toothed
whales is that these animals produce very loud echolocation pulses
and therefore might have an auditory mechanism to avoid startling
themselves. We therefore tested whether bottlenose dolphins would
startle to pulsed sounds and what their startle threshold would be.
We used two captive bottlenose dolphins to conduct tests of their
reactions when listening to startle sounds. The startle was
quantified through an accelerometer attached to the animal that
recorded any kind of muscle flinches during playbacks of sounds. We
found that both animals clearly startled to our pulses and that the
startle threshold for this species lies at around 80 dB above their
hearing thresholds. Since we have shown here that echolocating
animals also startle, the method is likely to work also with
harbour porpoises. Our results allow us now to design startle
sounds specifically for dolphins and porpoises. However, further
tests to see whether dolphins and porpoises sensitize in the same
way as seals are still needed. If they do, the startle method can
be used to deter either only seals, only dolphins and porpoises, or
all of these taxa.
| |
11126684 - Bought or Baked?
12473748 - Freshly baked scones on baking paper (top view)
11383772 - Freshly baked homemade bread sticks in glasses on a wooden table
11952873 - A girl with freshly baked muesli biscuits
11952874 - A girl sitting with freshly baked muesli biscuits and a glass of milk
12323728 - Freshly baked garlic bread
12430302 - Oven-baked, heart-shaped vegan doughnuts with icing and rose petals
11296500 - Rohrnudeln (baked, sweet yeast dumplings) with cherries
11260344 - Blueberry muffins baked in glasses
12498189 - Baked gooseberry with classic vanilla custard and phyllo pastry
12406780 - Baked plums with amaretti cookies
11954032 - Baked pasta and Parmesan baskets filled with caprese salad
12430299 - Vegan English muffins (pan-baked yeast dough dusted in cornflour)
12594031 - Love Baked In
12484726 - Baked pierogi in a paper bag next to a milk bottle
11406463 - Freshly baked Christmas buns with dried fruit and spices
11329814 - Kunefe (baked shredded pastry with cheese, Turkey)
12460947 - Crispy baked bubble waffles in a waffle iron
12355166 - Oven baked doughnuts with two different fruit glazes (vegan)
12343988 - Gluten-free, heart shaped sesame biscuits, baked with coconut fat and honey
11517544 - Freshly baked blueberry scones
11513707 - Freshly baked scones with herbs on a baking tray
11354642 - Homemade blueberry jam with freshly baked English muffins
11305187 - A market stand selling baked goods featuring syrup cakes and vegetable pizzas (England)
11206692 - Gingerbread crepes with baked apple wedges and caramel sauce
12372678 - Freshly baked bread out of a wood fired oven
12083087 - Freshly baked apple turnovers on a cooling tray
12531620 - Mini stollen cupcakes with cranberries, baked in glasses
13202698 - Baked to Perfection
12479307 - Chocolate snails baked in a pan with white chocolate
12359814 - A plate of golden baked spelt doughballs with a dish of garlic herb coconut dairy free coconut butter on a white plate
11213879 - Freshly baked chocolate muffins in a baking tin
12462359 - Pesto bread baked in glasses (vegan)
12404034 - Baked homemade quiche pie in mini metal forms served with fresh greens, plate and cutlery on terracotta board
12374314 - Freshly baked bread rolls with poppy seeds on a cooling rack
11267724 - Freshly baked oat biscuits with almonds and cranberries
11196494 - Two girls looking at freshly baked carrot cakes
12546691 - Freshly baked apple pie bread with nuts and crumble (paleo, gluten-free)
12507616 - Mini cranberry cakes baked in jars on gold foil
12474267 - Pea hummus, puff pastry with carrots, and baked tomatoes on a rustic wooden table
11515250 - Freshly baked muesli bars with chocolate and brown sugar
11440421 - Freshly baked savoury pastries
00444443 - A pre-baked Bakewell tart being removed from the oven
12486915 - Closeup view of freshly baked bagels with apricot jam filling
12359815 - A plate of golden baked spelt doughballs with a dish of garlic herb coconut dairy free coconut butter on a white plate
12367862 - Tea and Cake
12243653 - Bagels filled with cold meat salad and oven-baked radishes (soul food)
12105526 - Freshly baked French baguettes
12091028 - Freshly baked parts of a gingerbread house for Christmas
12351731 - Rustic Christmas
12341514 - Freshly baked sourdough bread on a chopping board with a knife
12316370 - Freshly baked vegan 'tijgerbolletjes' (tiger bread rolls, Netherlands)
11985589 - Eclairs, raw and baked
11980088 - Freshly baked scones (close-up)
11234506 - Baked carp with almonds, raisins and gingerbread sauce, for Christmas
12571482 - Top view of baked croissants
12465022 - Close up of breakfast table with fresh baked croissants and waffles, served with coffee, strawberries and homemade berry jam
12319519 - A baker holding several freshly baked wood oven bread loaves in his hands
12561314 - Sugar buns baked in muffin tins
12560558 - Freshly baked rye sourdough bread
12339725 - Wheat bread baked with yeast and carrots in a tin
12100174 - A glowing wood stove and freshly baked bread rolls in wicker baskets
12507115 - Freshly baked croissants with strawberries, honey, cup of black coffee, pitcher with milk and spoon with brown sugar
11440888 - Freshly baked peanut butter cookies
11436694 - Baked eggs with bacon in paper cases
12354891 - A plate of fresh, oven baked, doughnuts (vegan)
12344381 - Homemade and baked rustic bread, selective focus
12294734 - Baked cinnamon rolls with glazing
12311443 - Baked dumplings (pierogi) stuffed with black pudding and topped with black caraway seeds. Served with glass of dark beer
11458418 - Freshly baked mulberry muffins in a muffin tin (seen from above)
12466911 - B-A-N-A-N-A-S
11410937 - Freshly baked cupcakes in orange paper cases
11392484 - Freshly baked yeast cake with dried fruits, sliced
11365839 - Freshly baked pita bread in a bread basket
12369063 - A baker holding a loaf of freshly baked bread
12267071 - Sliced fresh baked homemade apple strudel over towel on kitchen table with jug of milk and apples
12100176 - Tin loaves on metal shelves after being baked in a coal-fired oven in a small countryside bakery
12100171 - Loaves of Graham bread baked in a wood-fired oven on metal shelves in a bakery
12090693 - A baked apple filled with chopped almonds, cranberries and buttery biscuits
11514297 - Freshly baked croissants on a baking tray
11514294 - Freshly baked doughnuts being dusted with icing sugar
11513688 - A baked Easter lamb on decorative grass
11023115 - Little girl being excited about freshly baked gingerbread
12548815 - Freshly baked bread on dark background
12462352 - Oven baked donuts glazed with chocolate (vegan)
12356392 - Freshly baked white loaf
11980039 - Crispy baked eggs for Easter
11954028 - Almond muffins with blueberries baked in glasses
next page
Not found the right one? Contact us!
We are happy to curate a selection of images according to your specifications and wishes or produce tailor-made food photos and videos for you. We have solutions for every project and budget. | https://www.stockfood.co.uk/images/Baked%20Products |
How To Study for Chemistry
Chemistry is one of those classes you either love or dread. At the high school level chemistry is usually not a required course – it's an elective. However, most reputable colleges require all undergraduate students to take at least one chemistry course as a prerequisite to graduation. If you plan on pursuing a career in medicine, engineering, or a field of natural science, then you're likely going to be required to take at least one chemistry courses before you graduate. Chemistry is a challenging subject for most people, but it doesn't have to be. The number one reason people struggle with chemistry is that they don't approach it the right way. Below we'll explore proven strategies and techniques that will, if applied, improve your ability to study and learn chemistry.
Review and Study Material Before Going to Class
In a traditional learning model, students arrive at class, the instructor introduces the material, expounds on relevant concepts, assigns follow up readings and assignments, and ends class. Students are then expected to go home, review their class notes, attempt to complete assigned readings and assignments, actually learn what was taught in class (which doesn't always happen), come to class the following week with any questions they have from the previous lecture, and be ready to move on and explore new material and concepts. The problem with this model is that it's ineffectively, especially with subjects and material that are challenging to learn.
The best way to learn chemistry is to come to each lecture having already read and studied the material that is going to be presented that day. This method of learning is known as the 'Flipped Classroom', sometimes referred to as 'Class Reversed', and it is a growing trend for teaching many subjects in schools and colleges nation wide. This model is especially effective for learning (and teaching) chemistry for several reasons. First, it gets students to come to class having already studied the material to be presented. Second, arriving at class already familiar with the subject matter, students are able to follow along and understand what is being taught. If students did not understand concepts from their studies, they are able to ask questions during the relevant lecture. Finally, classroom time is used more effectively as a learning tool. Students come away from each lecture with a much better understanding of course concepts and with fewer questions.
Studying your chemistry assignments, readings, and material before going to each class is one of the most effective strategies for learning chemistry.
Seek Understanding
As with any of the sciences, there is a lot of new information to learn and memorize in chemistry. In fact, there is so much new information you'll be presented with as you begin to study chemistry that you'll get bogged down quickly if you get caught up trying to memorize all the details. First focus on gaining understanding of fundamental concepts. Once you have a sound understanding of the fundamentals, you can spend time memorizing the details. Also, as you master the fundamentals of chemistry and gain understanding of the concepts, you'll find it much easier to memorize everything else.
Remember, memorization should never replace understanding. Seek to gain understanding first.
Take Good Notes
Attending class regularly and paying attention is important, but it's not enough. As you study chemistry, it's necessary to take copious, intelligible notes that further your understanding of the concepts being discussed. Note taking is of particular importance to the study of chemistry for the following reasons.
- Note taking also forces you to write things down. The formulas and equations you'll be introduced to as you study chemistry will be far easier to remember and understand after you've written them down.
- Taking good notes, and then reviewing those notes, will help you to determine what you do and don't understand.
- Make sure your note taking is organized. Taking organized notes will help you review lectures effectively and prepare for exams.
- Note taking will enable you participate in study groups. The better your notes, the better you'll be able to participate and contribute to your study group.
When taking notes, don't just focus on what your instructor writes on the board. Listen and copy down all key verbal points and concepts discussed during the lecture.
After each lecture take a few minutes to review your notes. Make sure you understand all the concepts covered in the lecture. Use your textbook to improve your notes and understanding of key concepts covered.
Practice Daily
A key to learning and studying chemistry is practice. Completing practice problems, solving equations, working formulas, etc. should be a core feature of your daily study routine. That's right, daily study routine. You should spend a little time each day (1 hour) studying chemistry if you want to learn it and stay at the top of your game. Test your understanding and knowledge of chemistry by reviewing and working the practice problems found on sample chemistry tests, as well as problems found on previous chemistry tests (if you can get your hands on them.)
When working chemistry problems, don't look at the answer key unless (1) you've been able to work out the answer or (2) are completely stumped. Before looking at the answer, ask for help understanding how to work the problem from a study companion, teacher's aide or your instructor. Re-read your text book to gain understanding and clarification.
If you get a problem wrong, work it again on paper until you're able to get it correct. Make sure you understand each step of the problem and why it is necessary. Once you've been able to figure out the problem, find another problem of the same type and work it. Continue to do so until you thorough understand the concept being taught.
Take Advantage of Lab Time
When it comes to understanding and learning chemistry, there is no substitute for hands-on experience, and there is no better way to get this experience than by attending chemistry labs. Take every opportunity presented to work in the lab. Working through chemistry problems and conducting chemistry experiments in a practical environment will strengthen your understanding and knowledge of chemistry.
Use Flashcards
Flashcards are nothing new, but they work. They are particularly useful for studying chemistry. Chemistry is full of scientific symbols, formulas and vocabulary that must be memorized and interpreted correctly. Flashcards are ideal for organizing and studying chemical symbols, formulas, and vocabulary – including the periodic table of elements. Once you've created an organized set of flashcards you'll find memorization must easier.
Use Study Groups
Using a well-organized study group is a great way to tackle learning any challenging subject, including chemistry. Study groups allow chemistry students to share their insights with one another, exchange ideas, explain difficult concepts to one another, teach what they've learned, share notes, study for exams, and cover more material. The following are tips for forming effective study groups.
- Keep groups between 3 and 6 people.
- All members must come prepared to group study sessions.
- Include members who are dedicated to their individual success as well as the success of the other group members.
- Schedule group study sessions at the same time and place each week.
- Keep study sessions between 2 to 3 hours.
- Keep study sessions focused. Don't let them turn into social events.
- Study as a group in an environment free from distractions.
Break Large Tasks Into Smaller Ones
When studying chemistry, break the material down into smaller pieces that you can master. Even though this may seem at times to be slow and tedious, it will help you actually learn what you're studying. Once you've master one concept, move on to the next. You'll be surprised to find that after you really understand a few of the smaller concepts well, it will become much easier to learn and master larger concepts.
Focus on Your Work, Not Your Grade
Learning chemistry requires total concentration. Continually focusing on your grade takes focus away from learning chemistry. If you will focus on learning chemistry, your grade will follow. There are no shortcuts. At the end of the day, what you learn is what's important. And if you learn the chemistry, you'll get a good grade.
Jump in With Both Feet
As with other challenging subjects, including biology, jumping in with both feet is key to your success studying and learning chemistry. Partial efforts don't cut it. Decided now that you're going to succeed in chemistry and that you're going to give it your all.
The following are links to other study skills resources we recommend for chemistry students. | https://www.educationcorner.com/chemistry-study-skills-guide.html |
Starts:
Sunday, December 8th 2019 at 5:30 pm
Ends:
Sunday, December 8th 2019 at 9:30 pm
Good food, fun and friends are waiting for everyone at our annual Christmas Celebration on Sunday, December 8th at 5:30 pm!
Our wonderful Men’s Association are cooking us Holiday turkeys and hams plus there will be festive decorations, a Christmas tree forest, lots of games, music, carols and Santa is rumoured to be flying past with Rudolph and might drop in for a visit.
Please bring a potluck dish to share – salads and side dishes are especially appreciated along with appy’s or dessert – enough to feed 5-6 people. (If you are bringing extra guests please includethem in the number of people to prepare a dish for.)
The CWL are kindly lending their organizational talents to set up and serve the buffet style meal. | http://www.stedwardsparish.ca/events/st-edwards-christmas-celebration/ |
Primary specialty: Nurse Practitioner in Little Rock, AR1 views - No reviews yet - be the first to write a review
Audra P Arant specializes in nurse practitioner in Little Rock area. Audra P Arant has a medical practice at 4301 West Markham Street, Little Rock AR, and has over 10 years of experience in the field of medicine. She graduated from her medical school with her medical degree in 2007. She is affiliated with numerous hospitals, including Uams Medical Center (AR) and more. Arant is accepting new patients at her medical office and practice location in Little Rock, Arkansas.
Check locations where Audra practices near Little Rock AR and make an appointment.
Specialty: Nurse Practitioner
She received medical licensing as follows:
An affiliated hospital is a hospital where a doctor can practice and admit patients. Audra P Arant is professionally affiliated with multiple hospitals in Little Rock area and more.
Appointments may be made for routine visits or new problems that you may be experiencing. Knowing what questions to ask before, during and after appointments is vital to better understand, and therefore manage, an illness.
Audra's opening hours:
Audra P Arant does not have any insurances listed.
If your insurance plan is accepted and have any questions regarding your insurance, please visit the office location or call to this doctor find out.
There are currently no reviews for Audra in Little Rock, Arkansas. Tell us about your experience by posting a comment or review about Audra to help others decide which doctor is right for them. | https://www.topnpi.com/ar1053593509/dr-audra-arant |
QUESTION: A government agency librarian asks about a recent report proposing an amendment to section 105 of the Copyright Act to create some exceptions that would permit government employees to own copyright in the works they create even in the course of their employment.
ANSWER: In response to an inquiry from the House Judiciary Committee about reforming copyright, the Chair of the Joint Chiefs of Staff responded asking for an exception to section 105, the section of the Act that generally provides that no copyright shall exist in works created by the U.S. Government. The concern is for faculty members at the service academies, war or staff colleges and other schools of professional military education. According to the proposal, this ban on copyright ownership is making it difficult to recruit faculty members for these institutions. Section 105 prevents government authors from publishing in many outlets such as many scholarly journals and university press publications since there can be no copyright in these government works. Authors or agencies that cannot own copyright cannot transfer nonexistent rights to a publisher in order to have the work published.
The recommendation of the Chair is to amend the Copyright Act to allow publishing of official works outside of the Government Printing Office to facilitate the recruitment of highly qualified faculty members. Safeguards could be in place to prevent individual authors from profiting financially from their works. The recommendation goes on to suggest that the Secretary of Defense develop regulations to specify which type of scholarly works would qualify for copyright protection.
QUESTION: A public librarian notes that the Metropolitan Museum of Art has recently announced that a huge number of its images are now available for free access and use. Is this true?
ANSWER: Yes, it is true. The Met has a policy called Open Access that allows one to access and use 375,000 of its images for either noncommercial or commercial purposes. According to the Met, it has worked in collaboration with the Creative Commons (CC) to promote the sharing of these images via the CC’s model licenses. The images may be accessed through the Met’s website. When searching, click on “Public Domain Artworks” under “Show Only.” One may also browse the images on the CC website under “Metropolitan Museum of Art.” For a helpful FAQ about the use of the Met’s images, see http://www.metmuseum.org/about-the-met/policies-and-documents/image-resources/ frequently-asked-questions.
QUESTION: A school librarian asks whether a student may use a portion of a movie or a music recording for a class project such as a website, a video or to incorporate into a PowerPoint presentation.
ANSWER: The simple answer is yes. Section 110(1) of the Copyright Act permits the performance of portions copyrighted works in a nonprofit educational institution. The Act envisions that the performance will occur in a classroom or similar place that instruction occurs. Logically, in this digital age, those portions must be reproduced to place them on a website, on a slide or in a video, in order to facilitate the performance.
Any difficulty occurs when the student then posts the presentation containing the portions of copyrighted works on the web so that others may access it and enjoy the performance. At that point, the student has published the work and, depending on the type of work, the amount and substantiality of the work that is used, the effect on the market for the work (the fair use factors), the student may need permission from the copyright owner. If the work is made available only on Blackboard or other password-protected course management system or site, there is less problem than if the work is simply posted on the web.
QUESTION: An academic librarian asks about the closing of Tate Publishing Company and what happens to the copyrighted works of the 40,000 authors in their portfolio.
ANSWER: Tate operated as a Christian vanity press, with authors paying about $4,000 for the publication of their books. The publisher indicated that if there were sufficient sales of a work, about 2,500 copies, the publishing costs would be refunded to the author. On January 17, 2017, Oklahoma-based Tate Publishing announced that it was closing. Prior to the closing, there had been many complaints against the company with more than 150 complaints filed with the Oklahoma Attorney General and about 95 filed with the Better Business Bureau over the past three years. Several months before it closed, Lightning Source and Xerox, which leased printing equipment to Tate, sued Tate for $1.7 million. There were also additional suits against the company and a pending U.S. Department of Labor investigation. For additional information, see http://www.victoriastrauss.com/2016/06/16/tate-publishing-enterprises-slapped-with-1-7-million-lawsuit/.
When Tate closed, its website was changed to add additional information aimed at assisting its authors. Its website contains the following statement: “Our primary commitment at this time is to find a new home for all authors and artists we represent, and ensure that each one has the best possible opportunity for success.” Authors were given an option to terminate existing contracts for books not yet released. The website contains an option that will release to the author the digital files of that author’s work for a $50 fee. Several other publishers have offered to help Tate authors.
Critics of the publishing industry point out that pay-to-publish publishers are also being negatively impacted by changes in the industry itself such as direct online publishing. Authors are becoming more perceptive, and they are less likely to sign up for expensive package deals to publish, market and service their works. This trend affected Tate’s bottom line since its income was not based on the sales of authors’ works but on payments from authors.
QUESTION: A college faculty member asks when he obtains permission to publish something on the web once, what further rights does he have?
ANSWER: When one seeks permission to reproduce or perform a copyrighted work, the permission is limited by what was actually requested. For example, if the faculty member asks only to publish the work on the web, that is exactly what is granted. If there was no date restriction, then it may remain on the web. Typically, permission might be restricted to making the work available on password-protected sites so that the faculty member’s students and colleagues have access to the work, but not others. In this question, it appears that there were no restrictions on posting the work on the web.
For example, such permission would not include the right to set the work to music, to produce a motion picture script based on the work, to sell copies, publish an edited version of the work, etc.
QUESTION: A university librarian asks about distributing copies of an article to workshop participants. Many of the participants are not authorized users for campus resources. What type of authorization is needed in order to distribute the article to participants?
ANSWER: It is possible that this distribution is a fair use. If the workshop is offered by an educational institution or by a professional librarians or faculty group, the reproduction and distribution may well be a fair use. There are other options, however.
(1) The librarian may seek permission to distribute copies of the article and pay royalties through the Copyright Clearance Center. (2) The librarian may contact the publisher directly for permission and pay royalties if requested. (3) In lieu of distributing the article, the presenter could send the bibliographic information to participants and ask them to read the article in advance and/or bring a copy with them. (4) Lastly, the librarian could simply provide the URL to participants who would then make their own copies under their own institutional licenses.
QUESTION: A public librarian asks whether permission is needed to use Google Map images.
ANSWER: Use how? This question does not contain enough information to provide a complete answer. A person, who accesses and copies a map online for an upcoming trip, is using the map as it was intended. Projecting the map to a class in a nonprofit educational institution would not require permission. Reproducing the map and distributing it to the members of a class for use likewise would require no permission. It is not clear what other uses the librarian might envision. | https://against-the-grain.com/2017/05/v28-2-questions-answers-copyright-column/ |
BACKGROUND
SUMMARY
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
1. Field of the Invention
The present invention relates to a display apparatus including a display panel whose height can be adjusted through a height adjusting device.
2. General Background
Display apparatuses are used in many types of equipment, such as personal computers, navigation systems, notebooks, and so on. In order to provide a better viewing angle for users, a height adjustable function for a display apparatus used with a personal computer is desired.
FIG. 8
FIG. 9
1
11
12
13
12
11
13
13
13
11
11
1
Referring to and , a typical display apparatus includes a base , a support , and a display panel . The support is fixed on the base , and supports the display panel . The stand can adjust a height of the display panel relative to the base . The base is substantially disc-shaped, and is positioned on a horizontal surface (not shown) to maintain the stability of the display apparatus .
12
121
123
125
127
129
130
121
11
123
121
125
123
121
129
121
121
127
125
129
121
130
121
123
125
121
The support includes a tubular body , a compression spring , a slider , a magnet set , a ring , and a nut . The tubular body is located at a center portion (not labeled) of the base , and defines an accommodating space therein. The compression spring is accommodated in the accommodating space of the tubular body . The slider is fixed at one end of the compression spring , and is also accommodated in the accommodating space of the tubular body . The ring is fitted around the tubular body , and can be moved up or down along the tubular body . Two parts of the magnet set are disposed in the slider and the ring respectively, and are spaced by a wall (not labeled) of the tubular body . The nut covers a top opening of the tubular body , so as to prevent the compression spring and the slider from sliding out from the tubular body .
13
13
129
129
121
The display panel is configured to display, e.g., images or videos. The display panel is fixed to the ring through bolts (not labeled), and can be moved up and down with the ring along the tubular body .
1
127
125
129
125
129
121
127
125
121
129
121
123
125
125
13
13
The operation principle of the display apparatus is as follows. Because the two parts of the magnet set are attractive to each other and are disposed in the slider and the ring respectively, the slider and the ring clamp the wall of the tubular body due to an attraction force between the two parts of the magnet set . Friction forces are generated, between the slider and the wall of the tubular body and between the ring and the wall of the tubular body . At the same time, the compression spring generates an elastic force to support the slider and push the slider upward. By adjusting the elastic force and the friction forces, the elastic force, the friction forces, and gravity acting on the display panel can cooperatively keep the display panel steady at a desired height.
13
13
13
13
13
13
13
When lifting the display panel , an upward external force is applied to the display panel . If a sum of the external force and the elastic force is greater than a sum of the friction forces and the force of gravity, the display panel can be lifted to a higher position. When the external force is removed, the display panel stays at the higher position because directions of the friction forces are reversed. When lowering the display panel , a downward external force is applied to the display panel . If a sum of the external force and the force of gravity is greater than a sum of the elastic force and the friction forces, the display panel can be lowered to a lower position. When the external force is removed, the display panel stays at the lower position because directions of the friction forces are reversed.
13
1
127
1
127
1
However, in order to achieve the height adjustable function of the display panel , the display apparatus needs the magnet set to generate the friction forces. Therefore the display apparatus has a rather complicated structure. In addition, a process of adjustment and calibration of the magnet set is needed in order to achieve suitable attraction force. This makes a process of fabricating the display apparatus somewhat complicated.
Therefore, a new display apparatus that can overcome the above-described problems is desired.
In one preferred embodiment, a display apparatus includes a display panel and a height adjusting device for adjusting a height of the display panel. The height adjusting device includes a base, a supporting member, a locking unit, and an elastic member. The display panel is fixed to the locking unit. The supporting member is fixed on the base and defines an accommodating space. The supporting member includes two generally vertical friction grooves. A depth of one of the friction grooves decreases with increasing height above the base, and a depth of the other friction groove increases with increasing height above the base. The locking unit is accommodated in the accommodating space of the supporting member. The locking unit includes two sliders corresponding to the two friction grooves of the supporting member respectively. One of the sliders abuts a corresponding one of the friction grooves. The elastic member is accommodated in the accommodating space of the supporting member, and spans between the locking unit and the base.
Other novel features and advantages will become more apparent from the following detailed description when taken in conjunction with the accompanying drawings. In the drawings, all the views are schematic.
FIG. 1
FIG. 2
2
2
21
22
25
22
21
25
21
22
21
22
25
21
Referring to and , a display apparatus according to an exemplary embodiment of the present invention is shown. The display apparatus includes a display panel , a pivot mechanism , and a height adjusting device . The pivot mechanism is fixed to the display panel and to the height adjusting device respectively, so that the display panel can be rotated about the pivot mechanism . The display panel together with the pivot mechanism can move up and down along the height adjusting device . The display panel can be any of various kinds of display panels, such as for example a liquid crystal display panel or a plasma display panel.
FIG. 3
FIG. 4
25
26
27
28
29
30
Referring also to and , the height adjusting device includes a base , a support , an elastic member , a column , and a locking unit .
26
2
26
261
The base is a rectangular plate, and is positioned on a horizontal surface (not shown) to maintain the stability of the display apparatus . The base includes a plurality of threaded holes in a center portion thereof.
27
26
261
26
27
271
272
273
274
275
276
277
271
26
273
271
274
273
272
271
273
274
275
273
274
276
274
273
272
273
275
272
274
276
277
271
277
271
272
273
274
275
276
The support is substantially a long box-shaped structure, and is mounted on the base by a plurality of bolts (not labeled) screwed into the threaded holes of the base . The support includes a bottom wall , a friction wall , a first locking wall , a second locking wall , a first extending wall , a second extending wall , and a top wall . The bottom wall is fixed on the base by the bolts and the threaded holes. The first locking wall is perpendicularly connected with the bottom wall . The second locking wall is parallel and opposite to the first locking wall . The friction wall is perpendicularly connected with the bottom wall and the first and second locking walls , . The first extending wall vertically extends from the first locking wall toward the second locking wall . The second extending wall vertically extends from the second locking wall toward the first locking wall . Thus, the friction wall , the first locking wall , and the first extending wall cooperatively define a substantially U-shaped first sliding channel (not labeled), and the friction wall , the second locking wall , and the second extending wall cooperatively define a substantially U-shaped second sliding channel (not labeled). The top wall is parallel and opposite to the bottom wall . The top wall , the bottom wall , the friction wall , the first and second locking walls , , and the first and second extending walls , cooperatively define a column-shaped accommodating space (not labeled) having an opening.
272
2721
2723
2725
2723
2721
272
2723
2725
272
2721
272
2723
2725
273
274
2723
2723
275
27
2725
2725
276
27
2723
2725
The friction wall includes a stopper , a first friction groove , and a second friction groove parallel to the first friction groove . The stopper is located near a center portion of an inner surface of the friction wall . The first and second friction grooves , are defined at the inner surface of the friction wall , and are substantially located between the stopper and a top portion of the friction wall . The first and second friction grooves , are both substantially parallel to the first and second locking walls , . A depth of the first friction groove (as measured in a horizontal direction) decreases from bottom to top. That is, a horizontal distance between a base surface (not labeled) of the first friction groove and the first extending wall decreases with increasing height along the support . A depth of the second friction groove (as measured in the horizontal direction) increases from bottom to top. That is, a horizontal distance between a base surface (not labeled) of the second friction groove and the second extending wall increases with increasing height along the support . The base surface of each of the first and second friction grooves , are slightly curved, but can be considered to essentially define a slight acute angle relative to the vertical.
28
29
27
29
271
27
277
27
29
271
26
28
29
28
271
27
28
30
The elastic member and the column are disposed in the accommodating space of the support . One end of the column is fixed at a center portion of the bottom wall of the support , and the other end is fixed to a center portion of the top wall of the support . Thereby, the column is substantially perpendicular to both the bottom wall and the base . The elastic member can for example be a compression spring fitted around the column . A bottom end of the elastic member is fixed to the bottom wall of the support , and a top and of the elastic member supports the locking unit .
30
30
27
29
22
30
21
30
The locking unit is substantially box-shaped, and has a size substantially corresponding to an overall width spanned by the first and second sliding channels. The locking unit is also disposed in the accommodating space of the support , and is fitted around the column . The pivot mechanism is fixed to the locking unit , such that the display panel and the locking unit can move up and down together.
FIG. 5
FIG. 6
30
31
33
35
31
29
29
31
310
33
35
310
33
310
2723
272
27
33
2723
35
310
2725
272
27
35
2725
Referring also to and , the locking unit includes a frame , a first slider , and a second slider . The frame is fitted around the column , and can move up and down along the column . The frame includes two containing cavities . The first and second sliders , are accommodated in the two containing cavities respectively. Part of the first slider protruding beyond the corresponding containing cavity is received in the first friction groove of the friction wall of the support , with a rear slide surface of the first slider abutting the base surface of the first friction groove . Part of the second slider protruding beyond the corresponding containing cavity is received in the second friction groove of the friction wall of the support , with a rear slide surface of the second slider abutting the base surface of the second friction groove .
FIG. 7
33
330
332
331
333
335
337
330
310
330
332
330
331
337
333
333
337
331
335
333
337
335
332
333
337
2723
272
Referring also to , the first slider includes a first fixing portion , a first compression spring , a second fixing portion , a first rotating portion , a first axle , and a first roller . The first fixing portion is substantially a rectangular block, and is accommodated in the corresponding containing cavity . The first fixing portion can be made of resin. The first compression spring spans between the first and second fixing portions , . The first roller is mounted on a top end of the first rotating portion . The first rotating portion together with the first roller is pivoted on the second fixing portion through the first axle such that the first rotating portion and the first roller can be rotated about the first axle . Under elastic urging by the first compression spring , the first rotating portion and the first roller are received in the first friction groove of the friction wall .
35
350
352
351
353
355
357
350
310
350
352
350
351
357
353
353
357
351
355
353
357
355
352
353
357
2725
272
The second slider includes a third fixing portion , a second compression spring , a fourth fixing portion , a second rotating portion , a second axle , and a second roller . The third fixing portion is substantially a rectangular block, and is accommodated in the corresponding containing cavity . The third fixing portion can be made of resin. The second compression spring spans between the third and fourth fixing portions , . The second roller is mounted on a bottom end of the second rotating portion . The second rotating portion together with the first roller is pivoted on the fourth fixing portion through the second axle such that the second rotating portion and the first roller can be rotated about the second axle . Under elastic urging by the second compression spring , the second rotating portion and the second roller are received in the second friction groove of the friction wall .
25
28
30
27
31
30
29
28
30
30
27
333
353
337
357
33
35
2723
2725
27
27
26
333
353
333
2723
357
2725
337
2723
353
2725
333
353
2723
2725
337
357
2723
2725
The height adjusting device is assembled as follows. First, the elastic member and the locking unit are placed into the accommodating space of the support , with the frame of the locking unit being fitted around the column . The top end of the elastic member is fixed to the locking unit . Two opposite side surfaces of the locking unit are received in the first and second U-shaped sliding channels of the support . The first and second rotating portions , , and the first and second rollers , of the first and second sliders , are received in the first and second friction grooves , of the support , respectively. Then, the support is mounted on the base . The first and second rotating portions , are configured to ensure that the first rotating portion abuts the base surface of the first friction groove , and the second roller abuts the base surface of the second friction groove ; or that the first roller abuts the base surface of the first friction groove , and the second rotating portion abuts the base surface of the second friction groove . That is, the first and second rotating portions , do not simultaneously abut the base surfaces of the first and second friction grooves , respectively; and the first and second rollers , do not simultaneously abut the base surfaces of the first and second friction grooves , respectively.
25
The working principle of the height adjusting device is as follows:
21
337
33
2723
2723
337
2723
353
35
2725
1
35
2725
1
35
2725
2725
276
352
1
When the display panel is lifted by a user, the first roller of the first slider abuts the base surface of the first friction groove , and rolls to move up along the first friction groove . Thereby, a downward rolling friction force is generated between the first roller and the first friction groove . However, because a coefficient of rolling friction is very small, the downward rolling friction force can be disregarded. At the same time, the second rotating portion of the second slider abuts and presses the base surface of the second friction groove , thereby generating a pressure N. Thus, a downward sliding friction force is generated between the second slider and the second friction groove according the following formula: F=N×μ, wherein μ denotes a friction coefficient between the second slider and the second friction groove . Because the horizontal distance between the base surface of the second friction groove and the second extending wall increases with increasing height, an elastic force of the second compression spring decreases, and therefore the pressure N decreases. Thus, the downward sliding friction force decreases with increasing height.
28
30
28
35
2725
21
28
30
21
30
28
21
30
21
On the other hand, a force of the elastic member supporting the locking unit decreases with increasing height. By configuring an appropriate relationship between an elastic coefficient of the elastic member and the friction coefficient between the second slider and the second friction groove , when the lifting force applied by the user on the display panel is removed, a sum of the force of the elastic member supporting the locking unit and the downward sliding friction force approaches a predetermined value, e.g., a total force of gravity acting on the display panel and the locking unit . Thus, the elastic force of the elastic member , the downward sliding friction force, and the total force of gravity acting on the display panel and the locking unit cooperatively maintain the display panel at the current height as desired by the user.
21
333
2723
2
33
2723
2
33
2723
2723
275
332
2
357
35
2725
2725
357
2725
When the display panel is lowered by a user, the first rotating portion abuts and presses the base surface of the first friction groove , thereby generating a pressure N. Thus, an upward sliding friction force is generated between the first slider and the first friction groove according the following formula: F=N×μ, wherein μ denotes a friction coefficient between the first slider and the first friction groove . Because the horizontal distance between the base surface of the first friction groove and the first extending wall increases with decreasing height, an elastic force of the first compression spring decreases, and therefore the pressure N decreases. Thus, the upward sliding friction force decreases with decreasing height. At the same time, the second roller of the second slider abuts the base surface of the second friction groove , and rolls to move down along the second friction groove . Thereby, an upward rolling friction force is generated between the second roller and the second friction groove . However, because a coefficient of rolling friction is very small, the upward rolling friction force can be disregarded.
28
30
28
33
2723
21
28
30
21
30
28
21
30
21
On the other hand, the force of the elastic member supporting the locking unit increases with decreasing height. By configuring an appropriate relationship between the elastic coefficient of the elastic member and the friction coefficient between the first slider and the second friction groove , when the lowering force applied by the user on the display panel is removed, a sum of the force of the elastic member supporting the locking unit and the upward sliding friction force approaches a predetermined value, e.g., the total force of gravity acting on the display panel and the locking unit . Thus, the elastic force of the elastic member , the upward sliding friction force, and the total force of gravity acting on the display panel and the locking unit cooperatively maintain the display panel at the current height as desired by the user.
21
28
30
30
272
21
28
30
30
272
Overall, with increasing height of the display panel , the force of the elastic member supporting the locking unit decreases, and the downward sliding friction force between the locking unit and the friction wall decreases; and with decreasing height of the display panel , the force of the elastic member supporting the locking unit increases, and the upward sliding friction force between the locking unit and the friction wall decreases.
21
30
277
27
21
30
2721
21
2721
27
26
277
27
2721
The greatest height of the display panel is obtained when the locking unit abuts the top wall of the support , and the least height of the display panel is obtained when the locking unit abuts the stopper . That is, a range of heights along which the display panel can be moved is determined by a height of the stopper of the support above the base , and by a distance between the top wall of the support and the stopper support.
1
30
2723
2725
21
21
21
In summary, the display apparatus uses the friction force between the locking unit and the first and second friction grooves , of the support to achieve a height adjustable function of the display panel when an external force is applied to the display panel , with the display panel being stably maintained at a currently adjusted height when external force applied by a user is removed.
273
274
30
27
33
35
30
27
Further or alternative embodiments may include the following. In one example, the first and second locking walls , each include an antiskid layer coated on the inner surface thereof. In such case, the antiskid layers are used to enhance the friction force between the locking unit and the support . In another example, a material of the first and sliders , can be selectable so as to appropriately configure the friction coefficients between the locking unit and the support .
It is to be further understood that even though numerous characteristics and advantages of the present embodiments have been set out in the foregoing description, together with details of the structures and functions of the embodiments, the disclosure is illustrative only; and that changes may be made in detail, especially in matters of arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1
is an isometric view of a display apparatus according to an exemplary embodiment of the present invention, the display apparatus including a height adjusting device.
FIG. 2
FIG. 1
is a right side plan view of the display apparatus of .
FIG. 3
FIG. 1
is an isometric view of the height adjusting device of , the height adjusting device including a locking unit.
FIG. 4
FIG. 3
is an exploded view of the height adjusting device of .
FIG. 5
FIG. 3
is an enlarged, isometric view of the locking unit of , but viewed from a rear thereof.
FIG. 6
FIG. 5
is an exploded view of the locking unit of , the locking unit including two sliders.
FIG. 7
FIG. 6
is an exploded view of the sliders of .
FIG. 8
is an exploded, isometric view of a conventional display apparatus, the display apparatus including a support.
FIG. 9
FIG. 8
is a side plan view of the display apparatus of when fully assembled, showing the support thereof in cross-section. | |
Welcome to our new website. We have a new login system for you to access the full newspaper online.
Please click here to learn how to activate your new account.
Bear with us as we move into this new site and bring over all our old articles and photos.
Now, more than ever, the world needs trustworthy reporting—but good journalism isn’t free. Please support us by making a contribution.
Idaho Wheat Commission Executive Director Blaine Jacobson, top center, leads an IWC meeting last year. Like Jacobson, leaders and employees of the state’s farm commissions and agriculture-related organizations are still working during the coronavirus lockdown, but mostly from home.
Farm commissions still working to support producers
Idaho Wheat Commission Executive Director Blaine Jacobson, top center, leads an IWC meeting last year. Like Jacobson, leaders and employees of the state’s farm commissions and agriculture-related organizations are still working during the coronavirus lockdown, but mostly from home.
POCATELLO – Just like the farmers and ranchers they serve, Idaho’s agricultural commissions and organizations are plowing ahead with their normal activities.
That includes programs and efforts to promote the commodities they represent, educate producers and fund important research projects.
“We may not be at the office, but everyone I know is working,” said Idaho Barley Commission Administrator Laura Wilder. “We’re just working remotely and we all have plenty of projects and programs going to support our growers.”
Even during a pandemic, “agriculture doesn’t stop and that includes all of the people who are working hard to add value to what growers do,” she added. “Nothing’s stopped; we just have to work a little differently.”
Like Wilder, other farm organization leaders are working mostly from home but stop by the office occasionally to pick up mail.
“We’re still rolling,” said Idaho Cattle Association Executive Vice President Cameron Mulrony. “We’re working remotely, from home, and I’m going to the office on a limited basis when I need to.”
He said the ICA is still moving forward with planning for the association’s annual summer meeting in late June, although that could change depending on how the state’s COVID-19 response plays out.
While working remotely, farm organization leaders and employees are doing a lot more conference calls.
While the Idaho Wheat Commission’s other three employees are working from home, executive director Blaine Jacobson is still working in his office inside the wheat commission building that also houses several other farm-related organizations, including ones that represent barley, bean, wine and milk producers.
The two-story building in downtown Boise is often times the epicenter of meetings and activities among Idaho’s agricultural community but right now Jacobson is about the only person working in the building.
“The office is pretty well deserted,” he said. “I see people come by occasionally to pick up mail … but for the most part, it’s an empty building.”
Idaho Potato Commission employees are working hard to try to resolve the many issues the potato industry faces right now due to the COVID-19 outbreak, said IPC President and CEO Frank Muir.
“We are basically all guns blazing to try to address this problem,” he said. “This is such a fluid situation (and) we are working around the clock on this issue.”
Shatz-Dolsby said that farm organizations are trying their best to continue serving producers while at the same time being socially responsible and doing their part to help prevent spread of the coronavirus.
“We’re trying to do our part,” she said. “At the end of the day, we’re just grateful we still have our health.” | |
From personal experience, one serving of dried pasta is about 100 grams . Some sources say that a serving is just 57 grams , but this might refer to the case when pasta is served as a first course, as is common in Italian restaurants, rather than as a main course. With an emission factor of ~1.5 kg CO2e / kg, these 100 grams amount to about 0.15 kg CO2e / portion.
Pasta approximately doubles in weight when cooked al dente , so a serving of cooked pasta is about 200 grams. | https://livelca.com/products/pasta_6f521cea-8fd9-404a-a3da-332ed81f7dca |
In November, the White House announced its ambitious diversity, equity, inclusion, and accessibility (DEIA) initiative, following an executive order issued in June (EO 14035). Many noted the addition of accessibility into the mix, which expands the nation’s diversity, equity, and inclusion (DEI) efforts to also include consideration toward everyone along the continuum of human ability. Since the Executive Order was published, the government-wide DEIA plan has raised a number of questions. Here we answer some of those and offer information on how to get started and find resources that can help.
Q: What are the essential guidelines steering the federal DEIA strategy?
A: The federal DEIA initiative is founded on five principles:
- Use data and evidence-based decision-making, including a close look at demographic data and “qualitative and quantitative examination of organizational practices, policies, and programs.”
- Focus on continuous improvement aimed at “achieving systemic, ongoing improvement of processes and outcomes, instead of cyclical or one-time achievements.”
- Adopt a collaborative whole-agency mandate while engaging partners, making the initiative “a priority that must be integrated into and across agency functions and embedded into agency culture.”
- Prioritize accountability and sustainability, “ensuring that … DEIA is integrated into the decision-making, the governance structure, the core mission, and the goals of the agency.”
- Understand the perspectives of the workforce and the customers.
A data-driven approach, the White House said, “embeds accountability and transparency” into the federal DEIA process. The order also requires agencies to submit quarterly reviews to evaluate findings on a regular basis. These findings should take a 360-degree assessment of each phase of employment practices—from sourcing and outreach to recruitment, hiring, development and retention. Additionally, the federal DEIA plan says, “a data-driven approach allows agencies to assess activities and outcomes, and then use proven practices, programs, and policies to advance DEIA.”
“Use of data and evidence-based decision-making has become a major component of the federal DEIA plan.”
Q: Does the federal DEIA strategy lay out specific steps for agencies to develop and sustain DEIA initiatives?
A: The federal DEIA plan includes a roadmap for each of the four areas comprising DEIA.
- The Diversity Roadmap calls for an open and fair employment process consistent with the federal government’s merit systems principles. Among other factors, this means creating an inclusive workforce by finding talent through various channels, offering support to new recruits, mitigating bias and overcoming obstacles in job opportunities.
- Similarly, the Equity Roadmap calls for mitigating bias and generally ensuring all employees “have equal opportunities to advance in their careers and grow as leaders.”
- The federal DEIA strategy’s Inclusion Roadmap sets out an agenda to ensure employees have the support to learn, develop and thrive in a non-discriminatory environment.
- And the Accessibility Roadmap guides agencies toward ensuring fair access to all—including people with disabilities—to government “facilities, technology, programs, and services.”
“Integrating a commitment to DEIA across the agency may require leaders to rethink how they do business, including working across traditional siloes, identifying and collaborating with new partners, challenging long-held assumptions and processes, and demonstrating a willingness to try new approaches.”
Q: Is there a blueprint or other guidance on how to implement a DEIA strategy?
A: Three cornerstone concepts are recommended as part of the general guidance:
- Building foundational capacity beyond just taking steps to simply comply with regulations or check off boxes.
- Embedding the DEIA initiative into an agency’s culture and mission—above and beyond what’s required by law.
- Evaluating progress on a continuous basis, and tweaking the plan as necessary, serving as a model for other organizations to follow.
For agencies where more specific, actionable guidance is needed, a comprehensive instruction manual such as BiasSync’s Five-Stage Inclusivity Roadmap™ can be effective.
“Government must design and deliver services with a constant focus on the lived experiences of the people it serves.”
Q: Does the Government-wide DEIA Plan include measures to address workplace harassment?
A: The Government-wide Strategic Plan to Advance Diversity, Equity, Inclusion, and Accessibility in the Federal Workforce explicitly addresses harassment in detail. Describing harassment—including sexual harassment, as part of a continuum of harm that is rooted in personal biases and individual perspectives, many of which can occur at the subconscious level. The federal DEIA plan lays out a three-part framework for preventing harassment, including self-assessment, plan implementation and regular data gathering, among other evidence-based policies.
For agencies seeking viable options, BiasSync’s Baseline software provides scalable, out-of-the-box implementation that addresses key behavior drivers - such as unconscious bias - at the root source. Through BiasSync’s data-driven approach, agencies can mitigate the impact of bias using scientifically-validated self-assessment tools and compelling educational content developed by leading social psychologists and adult learning experts. Agencies using BiasSync Baseline also receive dashboard analytics - including BiasSync’s proprietary SyncScore™- to easily identify areas of concern, track progress, and meet federal requirements.
“Government must also work to deliver services more equitably and effectively, including for those who belong to underserved communities and doing so requires understanding the inextricable link between the employee experience and the American public’s experience.”
Q: How else does the new federal strategic DEIA differ from previous initiatives?
A: In addition to requiring a data-driven approach, another new element within the most recent federal strategic DEIA plan is the inclusion and coverage of individuals who identify as LGBTQIA+. According to the United States Office of Personnel Management, federal agencies are now specifically required to “improve equitable access to employee services and health/medical benefits, update employee identification standards, expand availability of non-binary facilities, and mitigate barriers to security clearance.”
“Agencies are now specifically required to ‘improve equitable access to employee services and health/medical benefits, update employee identification standards, expand availability of non-binary facilities, and mitigate barriers to security clearance.’”
Q: What are the next steps?
A: The immediate next step is for federal agencies to each develop their own strategic plan that will address how they plan to advance DEIA within their workforce and address any potential barriers to equal employment opportunities. The plan is due March 23, 2022 and a number of agencies are reaching out for external support to help them meet this aggressive deadline.
Q: Are there any resources to help agencies comply with Executive Order (EO 14035)?
A: BiasSync, a science-based solution designed to help organizations more effectively assess and manage unconscious bias in the work environment, can help. BiasSync is specifically equipped to assist agencies in their DEIA efforts, particularly as they are related to the Executive Order (EO 14035) with tools that:
- Use data and evidence-based decision making
- Use data to assess progress, evaluate root causes, and build evidence on key DEIA initiatives
- Obtain qualitative workforce data regularly for implementation and feedback
- Use feedback and data to analyze the results of change and determine whether it made a difference
- Use sources beyond those focused solely on recruitment to extend the reach of government in sustaining relationships with underserved communities
- Advance equity for LGBTQI+ employees by, among other things, expanding the usage of gender markers and pronouns that respect transgender, gender non-conforming, and non-binary employees, and working to create a more inclusive workplace
- Review policies and procedures (e.g., assessment tests, vacancy announcements, eligibility criteria, sustainability requirements, etc.) to identify and address potential barriers to full participation in the workplace
- Adopt an approach that maps and assesses the employee experience (employee journey mapping)
- Expand availability of DEIA trainings so that federal employees are supported and encouraged to promote respectful, safe, and inclusive workplaces and have increased understanding of implicit and unconscious biases
- Design a “Voice of the Employee” program with a sophisticated, mixed-method approach to collecting employee feedback
- Ensure effective, ongoing, and interactive training on workplace harassment, antibullying, anti-discrimination, and implicit and unconscious bias
Contact us now to learn how BiasSync can help you meet the requirements of EO 14035, https://biassync.com/contact-us.
Not just diversity. Inclusion.
Diversity is not just about numbers. It’s about people’s experiences in the workplace. If you’re ready to understand how bias impacts your company—with data to make effective changes, contact us now. | https://biassync.com/blog/federal-deia-strategy-questions-and-answers-about-the-u-s-government-wide/ |
Today was Jane's Christmas show. She's in Year 1 now and I've settled into a relaxed routine. Jane beams with pride at every...
6 comments:
Friday, 7 December 2018
How we got an Elf on the Shelf our autistic kids can cope with
›
December came and so did a new comment from our youngest, Jane. “Sarah and Julian both have a magical Elf on the Shelf that talks to Fa...
6 comments:
Wednesday, 5 December 2018
Guest Post: The importance of enjoying play via @About_ASD
›
Hi, my name is Jade and I am delighted to be able to guest post here. I found Rainbows are too Beautiful through its linky series #spect...
Sunday, 2 December 2018
SEND & SpectrumSunday 78
›
Good day SEND & Spectrum Sunday linkers and welcome back to the place you can share and find blog posts about autism, mental health,...
Tuesday, 27 November 2018
Could my kids use of technology help them when they are older?
›
I don't shy away from the amount of time my kids spend with tech . There's no doubt that David uses his iPad for far more than ...
1 comment:
Friday, 23 November 2018
Helping my kids eat
›
Restricted diets. Honestly, sometimes it can be depressing. There's no medical reason why my boys can't eat things. They are n...
2 comments:
Wednesday, 21 November 2018
Four inclusive and supportive kids books for Christmas
›
Through no fault of their own, many kids books miss out on the opportunity to be inclusive. Many writers draw on their own experiences w...
12 comments:
Thursday, 15 November 2018
How my autistic son talks about the trees as they lose their leaves
›
For the last month or so, Anthony has spent several journey's to school pointing out all the trees that are loosing their leaves. &...
1 comment:
Thursday, 8 November 2018
Autumn to Winter motor skills craft - making a Pine Cone Snowy Owl Family
›
Learn about the seasons, autumnal materials and animals by making our Pine Cone Snowy Owls with this fun and easy craft that helps motor...
3 comments: | http://www.rainbowsaretoobeautiful.com/?m=1 |
Technology Archives - Eagle Feather Enterprises: computer networking, IT support and computer consulting services serving Westchester, New York City, Fairfield and New Jersey.
Twas the night before the release of Windows 10, and not a creature was stirring not even an infrared mouse! So I crept to my computer quietly and carefully and I began my venture into an early test of Windows 10!
I didn’t really want to be the Grinch who stole Christmas (and that’s exactly the way I felt) when I sent out my emails, telling everyone not to upgrade to Windows 10. I also contacted many of you by phone alerting you to the dangers and risks of installing Windows 10, and again I felt like a Grinch, telling a child Christmas morning, not to open up his new present. | https://www.eaglefeather.net/category/technology/ |
Getting Chicago workers back in business
Every time I travel around the City of Chicago, I see a “Help Wanted” sign. There has been a recent labor shortage around the city, grocery stores, restaurants, and all other types of jobs have had a shortage of workers.
The reasoning behind the labor shortage has to do with multiple things. People are still nervous about Covid, and many jobs are as well. “City of Chicago employees must, as a condition of employment, be fully vaccinated against COVID-19 effective October 15, 2021,” said Mayor of Chicago Lori Lightfoot. “This policy applies to all City employees, personnel of contractors, and vendors who have regular direct contact with, or regularly work close to, City employees and volunteers. It does not apply to visitors.”
This is a big reason jobs are always looking for workers. Also contributing to a lack of workers is the minimum wage. Chicago’s minimum wage is $15 an hour, and some people need more than that to get by while paying for bills, food, and more. But some cons for raising the minimum wage would be inflation. The rise of the minimum wage would raise store expenses and businesses would be forced to take away job positions due to the rise in the minimum wage. Increasing the minimum wage would help with the poverty rate, but it could cause a huge loss in jobs and it would be a repeated process of help wanted signs over the city of Chicago. Every time the minimum wage has been raised, the unemployment rate has gone up because more money equals fewer workers. Chicago’s unemployment rate is currently 7.50%.
Chicago had changed the minimum wage from $10 in 2015 to $15 an hour in 2021. “Chicago, however, isn’t the only city with workers who have gone far too long without proper protection, so it is my hope and expectation that our members of Congress and national corporate partners join our city and work to implement a federal living wage to give workers all around the country the opportunity to lead financially stable lives,” said Lightfoot in an interview regarding the minimum wage raise. The mayor wants to continue this so people won’t be in poverty and can have a balanced income.
A huge shortage in labor has been because of lack of salary, but it is not just about the money; a lot goes into applying for jobs like the flexibility of schedule, the work environment, lack of work benefits, and availability. The main cause has been the lack of work benefits, “The lack of these benefits is affecting employees’ overall work performance, and impacting companies in lost productivity and reduced employee retention,” said Donna Levin one of the co-founders of Care.com and current Vice President of Public Policy at CSR and Global Workplace Solutions. Work benefits, minimum wage, and much more have been the main causes of the lack of workers. Jobs would have to provide better work benefits, the flexibility of schedule, and more in order to have more jobs having workers. | https://mccaravan.org/opinion/2021/11/21/getting-chicago-workers-back-in-business/ |
IEA encourages Luxembourg to push for a smart, sustainable energy and transport system
In a review of Luxembourg’s energy policies launched today, the International Energy Agency welcomes the progress the country has made on reinforcing security of its energy supply, integrating its gas and electricity markets at the regional level, prioritising research and development in clean energy and eco-innovation, and taking strong action on energy efficiency.
The report, Energy Policies of IEA Countries – Luxembourg 2014, notes that Luxembourg greenhouse gas emissions have stabilised as energy-intensive industries scaled back their activities and as robust energy efficiency policies were put in place, notably for buildings. However, the country has also seen an increase in road fuel sales to non-residents, which inflate Luxembourg’s emissions and its oil-stockholding needs. In this context, the IEA sees room for building on the existing surcharge imposed on road fuel sales, dubbed the “Kyoto cent”, which feeds into Luxembourg’s new Climate and Energy Fund.
Given Luxembourg’s high share of commuters and transit, the IEA encourages Luxembourg to implement planned measures aimed at increasing the number of electric vehicles on its roads and encouraging greater use of public transport. The IEA also welcomes the planned national roll-out of smart meters. If coupled with a greater deployment of electric vehicles, this would create synergies between the transport and energy systems and would be the first country-wide system among IEA countries.
“Promoting clean transport solutions can improve both sustainability and security of energy supply. But Luxembourg has the possibility to do something no IEA country has done, which is to combine smart grids and electric vehicles at country-wide level to create a smart energy and transport network,” said IEA Executive Director Maria van der Hoeven as she presented the report.
Because Luxembourg imports all of its energy needs, energy security is a priority. Luxembourg has sought to address this through regional market integration. As neighbouring countries invest in ambitious energy transition policies, regional electricity trade and electricity markets are changing. Luxembourg is set to increase its interconnections. Therefore, it is both a necessity and opportunity to support competitive electricity markets and increase co-ordination of system operation, including the pooling of regional reserves and flexibility to meet demand peaks. “Luxembourg’s pumped-storage hydro capacity is a good example of cross-border balancing. At a time of national approaches on capacity reserves, regional intra-day and balancing markets illustrate how we ensure that Europe’s energy markets are efficient and make renewable energies an integral part,” the IEA Executive Director added.
With the highest per capita income in the OECD, Luxembourg is well-placed to continue its development towards an innovative and green economy. Among its key recommendations, the IEA report calls for Luxembourg to:
- Build on the “Kyoto cent” by strengthening the Climate and Energy Fund to support domestic renewable energy, energy efficiency and other decarbonisation solutions, notably in the transport sector.
- Engage in international co-operation on technology and innovation with a view to leveraging the full potential from public energy R&D investment, notably in smart mobility and energy efficiency.
- Ensure efficient and competitive electricity and gas markets by integrating balancing and intra-day markets at regional and EU levels; in turn, this would support the efficient and cost-effective integration of renewable energies.
Energy Policies of IEA Countries – Luxembourg 2014 is available for free download, as are the following resources:
- The executive summary.
- A factsheet.
- The Executive Director's German-language presentation at the release of the report.
- The Executive Director's English-language presentation concerning the report.
About the IEA
The International Energy Agency is an autonomous organisation that works to ensure reliable, affordable and clean energy for its 29 member countries and beyond. Founded in response to the 1973/4 oil crisis, the IEA’s initial role was to help countries co-ordinate a collective response to major disruptions in oil supply. While this remains a key aspect of its work, the IEA has evolved and expanded. It is at the heart of global dialogue on energy, providing authoritative research, statistics, analysis and recommendations. | https://prod.iea.org/news/iea-encourages-luxembourg-to-push-for-a-smart-sustainable-energy-and-transport-system |
Q:
metric has morse index 2
I am reading Richard Schoen's classical example on the multiplicity of solutions of yamabe problem. He says on $S^1(T)\times S^{n-1}$, there exists a critical number $T_0$ such that if $T\leq T_0$, then there is only metric, which is the product metric, whose scalar curvature is $n(n-1)$.
When $T\in (T_0,2T_0]$, there exist two metrics, one is product metric and the other is a minimizer for yamabe problem. He also said at this time the product metric has morse index 2. I have no idea of why you can say a metric has morse index? Is it infinite dimensional morse index? why 2?
A:
I assume you mean these notes: http://www.math.jhu.edu/~js/Math646/schoen.totalscalar.pdf?
In general it does not make sense to say that a "metric has morse index 2" without any context. Before proceeding further, you should make sure that you understand classical Morse theory for functions on finite dimensional manifolds. If you don't, I would recommend reading Milnor's famous book: http://www.amazon.com/Morse-Theory-Annals-Mathematic-Studies/dp/0691080089. It's very accessible.
What Schoen means here is that he is considering the Yamabe functional as a function on a conformal class (in this case the conformal class containing the product metric $S^1(T)\times S^{n-1}$). Here, the Yamabe functional is
$$
Y_g(u) := E({u^\frac{4}{n-2}g}) = \frac{\int_M R_{u^\frac{4}{n-2}g}dV_{u^\frac{4}{n-2}g}}{\left(Vol(M,{u^\frac{4}{n-2}g}) \right)^{\frac{n-2}{n}}}
$$
Then you can ask for critical points and for the Morse index.
The critical points of the Yamabe functional Y(u correspond to constant scalar curvature metrics in the conformal class. See, p. 39 of http://projecteuclid.org/euclid.bams/1183553962 (which is a great survey of the Yamabe problem). Essentially this amounts to computing that the derivative of the Yamabe functional vanishes
$$
DY_g(u)v : = \frac{d}{dt} E((u+tv)^{\frac{4}{n-2}}g) = 0
$$
if and only if $u^{\frac{4}{n-2}}g$ has constant scalar curvature.
At a critical point, it make sense to talk about the Hessian of the Yamabe functional, i.e.
$$
D^2Y_g(u)\cdot(v,w) : = \frac{d^2}{dsdt} E((u+sv+tw)^{\frac{4}{n-2}}g).
$$
It's not hard to see that this is essentially the same as linearizing the scalar curvature equation. The reason for this is that the first derivative gives the constant scalar curvature equation, while the second derivative linearizes this equation. One may check that (see Schoen (1.8)), up to constants (which I won't try to get right here) the Hessian is given by
$$
D^2Y_g(u)\cdot(v,w) = C\int_M ((n-1)\Delta_{u^{\frac{4}{n-2}}g}v + R_{u^{\frac{4}{n-2}}g}v)w dV_{u^{\frac{4}{n-2}}g}.
$$
In particular, the "negative Morse directions" correspond to eigenfunctions of $\Delta_{u^{\frac{4}{n-2}}g}$ with eigenvalue less than $\frac{R_{u^{\frac{4}{n-2}}g}}{n-1}$.
In the $S^1(T)\times S^{n-1}$ discussion, Schoen does not make use of this fact/computation. He explicitly linearizes the equation for scalar curvature given in this case to find destabilizing directions (i.e. an eigenfunction of the linearized operator with negative eigenvalue). So, for example, if the product has "Morse index 2," then there are two such eigendirections for the linearized operator $L$.
| |
Image and text ©2008 Akira Fujii/David Malin Images.
In the picture above, north is at the top and the image covers 57 x 71 degrees.
Image centre is located at 00:56:23.4, +43:08:11 (H:M:S, D:M:S, J2000) Astrometric data from Astrometry.net.
The main page for Andromeda is here. The image above also contains the constellations of Lacerta (the Lizard) and Triangulum (the Triangle) and the familiar 'W' of Cassiopeia (but not the whole constellation).
Mirach (β And). Sadiradra (δ And).
Triangulum Deltotum (β Tri), Mothallah (Ras Muthallath, Caput Trianguli, α Tri). | http://davidmalin.com/fujii/source/And_2.html |
Alcoholics Anonymous, also known as AA, is the original 12 Step group. It consists of men and women who come together voluntarily to achieve and maintain sobriety. The goal is total abstinence from alcohol, one day at a time. The method consists of meetings and working the 12 Steps. The 12 Steps are found in the book, Alcoholics Anonymous, also known as the Big Book.
Meetings or groups are found in almost every country of the world. They range in size from a few people, to as many as 100 or more. Most groups meet once a week. Meeting styles include: speaker meetings where one or two members share the story of their alcoholism and recovery from a podium; discussion meetings where members share their experience with a particular topic, and step studies where members discuss their experience working with the 12 Steps. There are also Big Book studies and meetings for special interest groups like women only, men only, gay and lesbian only, etc. All meetings are based, one-way or another, on the sharing of members experience, strength and hope.
Membership in AA is informal. A person becomes a member when they decide they want to stop drinking and begin attending meetings. There is no registration; no attendance is taken, although the group's secretary may note the number of people in the room. The commitment to anonymity is taken seriously and people can attend AA meetings with little fear that others, outside the meetings, will find out they have joined.
AA meetings can be found in various ways. There are meeting lists on the web. In the United States, Alcoholics Anonymous can be found in the white pages of most telephone books; a call to information will also usually result in a phone number where meetings can be located. Meetings in most western countries, and some non-western countries can be found in similar ways. | https://www.soberrecovery.com/addiction/alcoholics-anonymous-defined/ |
Executive functions supported by prefrontal cortical (PFC) systems can be broadly conceived in terms of control or planning mechanisms that mediate and guide goal-directed behavior. While different conceptual frameworks for executive function have been proposed, this review will take the perspective that the term "executive function" conceptualizes a toolbox of dissociable mechanisms which share a common neuroanatomical basis in prefrontal cortex but which can be recruited somewhat independently depending on cognitive and environmental demands and which therefore warrant independent consideration (Robbins, [@B93]). These processes include cognitive functions such as attention, inhibition, working memory, cognitive flexibility (e.g., shifting between attentional sets) and decision making. Given that executive functions are often framed in terms of "higher order" cognitive functions and that the primate prefrontal cortex is significantly more complex than rodent, executive functions are sometimes characterized as being unique to primates. However, there is substantial evidence indicating that rodents have neuroanatomical and functional cortical homologues to primates and that rodents are capable of a variety of complex goal-directed behaviors (for review, see Brown and Bowman, [@B20]; Uylings et al., [@B111]; Kesner and Churchwell, [@B59]). Indeed, as many molecular, genetic, and behavioral approaches that hold promise for increasing our understanding of how aging impacts executive function are impractical or infeasible in non-rodent species, rodent models of executive function represent an important tool for cognitive aging research. Advancing our understanding of the neural underpinnings of declining executive function in aging could directly impact the development of novel intervention strategies to promote and optimize a broad range of cognitive capacities across the lifespan.
This review will primarily focus on two aspects of executive function that are highly sensitive to decline with age across species and which are well-characterized in rodent models: working memory and cognitive flexibility (e.g., set-shifting). These functions in rodents parallel those in humans with respect to both their psychological constructs and neuroanatomical substrates. For both working memory and cognitive flexibility, key methods and approaches for rodent assessments in aging will be reviewed. Work from non-human primates will be incorporated to help bridge human and rodent comparisons. Notably, working memory and cognitive flexibility are relatively complex operations which likely engage multiple subcomponents of executive function (including information processing, updating, and multiple forms of attention and inhibition) which can be reliably fractionated and assessed independently in human aging. As such, approaches in rodent models that might be better utilized to investigate these more circumscribed components of executive processes (specifically inhibition and information processing speed) in aging are also discussed below.
Working memory
==============
Working memory refers to the ability to encode, maintain, and flexibility manipulate information no longer present in the environment, including information about abstract rules, recent events, and goals for future actions. Across species, the term "working memory" refers to a limited capacity brain system which maintains information for a relatively short time. In humans, working memory is generally confined to seconds, whereas in rodents, it can encompass seconds, minutes, or even hours. Across both human and rodent tasks, trial-unique information must be isolated from information on previous trials, a process that involves active resistance to proactive interference and distraction. In humans, working memory assessments often include both the recall (e.g., of a phone number) and manipulation of the information being remembered (e.g., reversing the number sequence) or recall of information in the presence of explicit distracters. In animals, such explicit manipulations may be impractical or infeasible, and therefore, increasing the delay duration is often used as a method for increasing working memory load and the possibility of distraction.
Indeed, a number of executive processes contribute to working memory abilities, including but not limited to updating, attention, and inhibition and these processes can be differentially engaged depending on circumstances or task demands. As described above, promoting selective attention and minimizing proactive interference during encoding and retrieval of memories are thought to be critical for maintaining stable representations in working memory and protecting these memories from distraction (Goldman-Rakic, [@B51]; Arnsten, [@B3]). Notably, working memory can also be viewed as a subcomponent of other more complex cognitive processes which are supported by prefrontal cortex and which are vulnerable to decline across the lifespan. Indeed, deficits in working memory have been implicated in age-related deficits in a wide range of cognitive tasks, including long-term memory, language, problem solving, and decision making (Axmacher et al., [@B4]; Morrison et al., [@B77]; Duarte et al., [@B32]).
Historical perspective and neural circuitry
-------------------------------------------
As described in more detail below, a classic working memory assessment in non-human primates is the spatial delayed response task (recently reviewed in Rodriguez and Paule, [@B96]; Hara et al., [@B52]). While there are many variants of this task, most require a match-to-place design in which information regarding spatial location must be held over some delay interval and accurately recalled in a choice setting. Lesions of dorsolateral PFC (Broadman\'s area 46) disrupt delayed response performance (Mishkin, [@B73]; Butters and Pandya, [@B24]; Goldman and Rosvold, [@B50]; Passingham, [@B84]; Funahashi et al., [@B46]) and electrophysiological recordings from neurons from this region reveal persistent spatial tuning during the delay period of these tasks (Goldman-Rakic, [@B51]). Humans with focal lesions of dorsolateral PFC are also impaired in spatial delayed response tasks (Freedman and Oscar-Berman, [@B42]), providing further support for a primary role of primate dorsolateral PFC in the ability to encode and maintain information in mind that is no longer present in the environment and in the ability to use this information to accurately drive future goal-directed behavior. Aged monkeys take longer to acquire delayed response tasks and are significantly impaired relative to younger subjects at longer delays (Bartus et al., [@B10]; Rapp and Amaral, [@B91]; Bachevalier et al., [@B5]; Voytko and Tinkler, [@B113]). In agreement with these findings, a number of studies across species show that PFC-supported cognition is among the most sensitive to decline with age, and the neural and behavioral alterations associated with PFC often precede age-related changes in other brain circuitry (e.g., Rapp and Amaral, [@B91]; Frick et al., [@B43]; Buckner, [@B21]; Bizon et al., [@B17]).
The rodent PFC is not as anatomical complexity as the primate; however, many of the critical neuroanatomical and functional characteristics are preserved in rodents, which allow meaningful cross species comparisons relevant to study of the neurocognitive and neurobiological mechanisms that underlie changes in executive functioning across the lifespan. As indicated in Figure [1](#F1){ref-type="fig"}, the medial portion of rodent PFC \[which includes anterior cingulate, prelimbic, and infralimbic cortices; medial prefrontal cortex (mPFC)\] shares strong anatomical homology with primate dorsolateral PFC (including Broadman\'s area 46). Like dorsolateral PFC in non-human primate, the rat mPFC receives afferents from the medial dorsal and midline thalamic nuclei as well as from limbic structures (including perirhinal, entorhinal cortex, hippocampus, amygdala, and basal forebrain), and sends efferents to caudate-putamen and nucleus accumbens. These regions also receive comparable monoaminergic innervation from locus coereleus, ventral tegmental area, and raphe nuclei (Uylings et al., [@B111]). Moreover, rodents are capable of many complex cognitive operations, including those associated with working memory and other aspects of executive functioning. As described in more detail below, mPFC in both rats and mice is critical for working memory for both spatial (Ragozzino et al., [@B87]; Horst and Laubach, [@B55]) and visual object (Ragozzino et al., [@B88]; Di Pietro et al., [@B31]) information as well as for other types of executive functions (Birrell and Brown, [@B14]; Brown and Bowman, [@B20]; Ragozzino et al., [@B89]; Bissonette et al., [@B15]; Floresco et al., [@B36]).
![**Homology between human and rodent prefrontal cortex.** Panel **(A)** shows a schematic of human brain in which Broadman\'s area 46 is shaded in gray. This region of dorsolateral prefrontal cortex has been heavily implicated in executive function, including working memory and cognitive flexibility. Panel **(B)** shows a schematic of rat brain in which medial prefrontal cortex (mPFC), the functional and neuroanatomical homologue to primate dorsolateral cortex, is shaded in gray. The black line shows the approximate plane of section for the coronal view that is shown in Panel **(C)**, which better illustrates the subdivisions of mPFC (including prelimbic, infralimbic, and anterior cingulate cortices). Abbreviations: aCg, anterior cingulate cortex; PL, prelimbic cortex; IL, infralimbic cortex; OFC, orbitofrontal cortex. The coronal section **(C)** is adapted from Paxinos and Watson, [@B85a].](fnagi-04-00019-g0001){#F1}
Based largely on pioneering work conducted in non-human primates, Goldman-Rakic ([@B51]) originally proposed that working memory could be fractionated at the level of PFC depending upon the type of information being processed. This model has gained support from neurophysiological and lesion studies which have linked distinct PFC subregions to specific types of working memory (for example, spatial vs. motor working memory as recently reviewed by Kesner and Churchwell, [@B59]). Of particular interest to rodent aging is working memory associated with spatial information. Many of the commonly employed approaches used to assess long-term spatial (reference) memory in rodents (see Foster et al. ([@B41]) in this issue), can be adapted to assess working memory.
Interpreting working and reference memory assessments in aged rodents
---------------------------------------------------------------------
The prefrontal cortex (PFC) and hippocampus represent an important functional system for encoding and remembering new declarative, explicit, and spatial information. Important for assessing the integrity of individual aspects of this system, however, a common division of memory systems can be made between "reference" and "working" memory, depending on the type of information to be remembered. "Working memory" is engaged when tasks are designed such that different stimuli govern the criterion response across different trials and the cue the subject must remember varies from trial-to-trial. This is distinguished from "reference memory," which is required for remembering information which remains constant over time (recently reviewed in Rodriguez and Paule, [@B96]). As described in detail in other chapters in this issue, the hippocampus and medial temporal lobe system are critically important for spatial memory, including reference memory, whereas PFC is preferentially engaged in working memory. Not surprisingly, given that the PFC-hippocampal system is important for encoding new information, many of the tasks employed to assess working memory across species also actively engage the hippocampus (Friedman and Goldman-Rakic, [@B44]; Eberling et al., [@B35]). While we refer readers to Foster et al. ([@B41]) for an in-depth discussion of hippocampal involvement in spatial memory, we will review data relevant to hippocampal/medial temporal lobe contributions to performance in the working memory tasks described here, as these represent important considerations for interpreting age-related deficits. In cases in which hippocampal/medial temporal lobe and PFC contributions to task performance are not dissociable, it is important to acknowledge that age-related impairments may be the consequence of dysfunction across multiple brain regions.
### Delayed alternation task
Delayed alternation takes advantage of rodents\' natural preference for novelty (reflected in spontaneous alternation), and is a commonly used behavioral assay for assessing working memory in aged rodents (Wenk et al., [@B114]; Ramos et al., [@B90]; Segovia et al., [@B102]). Advantages to this assay include the fact that age-related deficits appear robust across rodent species and strains, and that relatively little specialized equipment is required.
As shown in Figure [2A](#F2){ref-type="fig"}, this assessment is performed using a T- or Y-maze apparatus. On each trial, rats are placed on the stem of the maze, which is equidistant between the other two (choice) arms. On the first trial, rats are rewarded for entering either of the choice arms. Thereafter, rats are only rewarded if they enter the arm which was not chosen on the previous trial. As such, the correct choice alternates between the left and right arms across trials. Rats and mice normally alternate at levels well above chance (hence, "spontaneous" alternation), although it should be noted that stress and anxiety can significantly impact alternation. Spatial working memory is assessed on this task by varying the retention interval between successive trials (usually ranging from 10--60 s). Rats with mPFC lesions show impairments in both spontaneous and learned alternation (Wikmark et al., [@B115]; Divac et al., [@B117]; Delatour and Gisquet-Verrier, [@B28]), and electrophysiological studies have shown sustained neural activity in mPFC during the delay period in this task (Baeg et al., [@B6]). Notably, a number of studies have shown that hippocampal lesions can also impair performance on spontaneous alternation (Kirkby et al., [@B61]; Johnson et al., [@B57]) and that these deficits are more pronounced as delays between trials are increased (Isseroff, [@B56]). Lesions of basal forebrain, dorsomedial thalamus, basal ganglia, and vestibular circuitry can also impair alternation behavior (for review, see Lalonde, [@B64]). Hence, while this task unquestionably depends upon PFC integrity, the lack of neuroanatomical specificity associated with performance deficits in this task cautions that multiple brain systems must be considered for interpretations of age-related changes in alternation behavior.
{#F2}
***Sensitivity to aging.*** A number of investigators have reported delay-dependent deficits in aged rats and mice on delayed alternation tasks in comparison to young cohorts, as indicated by an increase in the number of errors at long delays (Ramos et al., [@B90]; Segovia et al., [@B102]; Mizoguchi et al., [@B74]). Importantly, aged rats perform comparably with young rats at short delays, suggesting that these age-related deficits are not due to impairments in task performance *per se* Ramos et al. ([@B90]) reported that aged rats required almost twice as many trials to reach criterion at long delays on a delayed alternation task and that there was significant variation in performance among aged rats, with some aged rats performing on par with young and others demonstrating varying degrees of impairment. Moreover, manipulations of mPFC in aged rats could attenuate these impairments, providing evidence for a role of mPFC dysfunction in this age-related deficit. A notable advantage of the delayed alternation task is its high degree of repeatability across test sessions which make it particularly suitable for studies requiring within-subjects measures (i.e., those involving behavioral pharmacology or longitudinal aging).
### Radial arm maze task
Radial arm maze tasks have been used for nearly four decades to investigate mnemonic processes in rodents (Olton and Samuelson, [@B82]). The basic apparatus consists of an elevated central platform from which some number of arms (ranging from 6 to as many at 17) radiate like the spokes of a wheel (Figure [2B](#F2){ref-type="fig"}). Some of the arms are baited with a small food reward, and the subject must learn and remember which arms contain the food. Within this basic task design, however, there are numerous variants which can be employed to assess different aspects of learning and memory. At their core, most radial maze designs assume that rodents use spatial strategies to identify, learn, and remember the arms of the maze (unless such strategies are specifically discouraged; see Packard et al., [@B83]; Hodges, [@B54]). Accordingly, lesions of hippocampus and other medial temporal lobe structures produce profound performance impairments on radial maze tasks (Becker et al., [@B12]; Bouffard and Jarrard, [@B19]; Hodges, [@B54]). However, radial maze tasks can also be designed to incorporate a working memory component, by requiring retention of trial-unique information regarding which arms have already been visited and no longer contain food (Seamans et al., [@B101]; Shen et al., [@B103]; Floresco et al., [@B38]). For example, in one such version of the task (conducted in an 8 arm radial maze apparatus shown in Figure [2B](#F2){ref-type="fig"}), rats are first given a "sample" trial in which they are placed in the center of the maze with 4 of the 8 arms baited and the other 4 arms blocked. In this sample trial, the rats must visit each of the 4 baited arms to consume the food. Following a delay period, rats are again placed in the center of the maze for a "retention" trial, in which all arms are open but only the 4 arms which were blocked during the sample trial are baited. To perform most efficiently on the retention trial, rats must both remember and avoid the arms that were baited (and from which food was collected) during the sample trial, as well as to avoid revisiting the arms baited on the retention trial once food has been collected.
In this task, permanent lesions or inactivation of the hippocampal formation impair working memory performance irrespective of delay (Packard et al., [@B83]; Floresco et al., [@B37], [@B38]). Such findings suggest that the hippocampus may be particularly important for acquisition/maintenance of spatial information concerning the location of the baited arms and/or "episodic" memory for which arms have already been visited (Floresco et al., [@B38]). The effects of permanent lesions of PFC on working memory performance in the radial arm maze have been more variable, with different studies reporting profound, transient, or no lesion effects (Fritts et al., [@B45]; Gisquet-Verrier and Delatour, [@B49]; Klein et al., [@B62]), and it is difficult to disentangle these differential effects from the variety of lesion methods and delays employed. More temporally selective manipulations using reversible inactivation techniques have revealed a critical role for the prelimbic division of mPFC specifically during the retention (and not the acquisition) phase of the task, suggesting that prelimbic cortex is involved in the use of information retrieved from memory after a delay, but not when such information is retrieved immediately (Seamans et al., [@B101]; Fritts et al., [@B45]).
***Sensitivity to aging.*** Radial maze performance is adversely affected in aging, with aged rodents making a greater number of working memory errors (revisits to previously chosen arms) than young cohorts, particularly at long delays (Luine et al., [@B67]; Mizumori et al., [@B75]). Similar age-related working memory impairments are also observed in a water-escape-motivated version of the radial maze, in which subjects must swim to the location of escape platforms located in only some of the arms of the maze (Shukitt-Hale et al., [@B104]; Bennett et al., [@B13]). The extent to which such impairments are related to deficits in PFC as opposed to hippocampal function, however, remain difficult to discern, as there has been little investigation of the contributions of age-related alterations in PFC structure or function to age-relative working memory deficits on radial maze tasks.
### Barnes maze task
Similar types of analyses can also be performed using the Barnes maze, which is conceptually similar to the radial arm maze in a number of ways. The Barnes maze apparatus consists of a large, elevated, brightly lit circular central platform, at the edge of which are numerous (18--50) holes, only one of which leads to an escape tunnel. Hence, escape from the brightly lit open space is the motivation for task performance. A notable advantage of this task is that it does not depend upon food reward and thus does not require food restriction. Accurate performance requires subjects to learn and remember the location of the "correct" hole, and hence the task has a strong spatial and hippocampus-dependent component (Barnes, [@B8]). Working memory errors can also be scored in this task as revisits to "incorrect" holes which subjects have already investigated within a trial (Barr et al., [@B9]; Popovic et al., [@B86]). However, to our knowledge, the role of PFC in working memory performance in the Barnes maze has not been investigated.
### Delayed match-to-sample water maze task
In addition to land-based spatial navigation tasks, working memory can also be assessed using a standard Morris water maze apparatus (Means and Kennard, [@B71]; Baxter et al., [@B11]; Shukitt-Hale et al., [@B105]; Bizon et al., [@B17]). Assessments in the water maze hold several advantages over food-rewarded land-based tasks, including rapid learning and the absence of food restriction. We recently used such a task to assess working memory in young, middle-aged, and aged Fischer 344 rats (Bizon et al., [@B17]), as described below. Whereas spatial reference memory versions of the water maze require maintenance of the same information (the escape platform location) across many consecutive days, in the delayed match-to-place version of this task, rats learn a different platform location each day, and must remember this trial-unique location after a delay period. Hence, the platform location on a given day must be separated in memory from other recent events (i.e., previously encoded platform locations), placing demands upon PFC.
This task is performed in a standard water maze apparatus in which an escape platform is submerged below the water\'s surface and obscured from view. The maze is surrounded by curtains to which are affixed large geometric designs, which provide visual cues to aid spatial navigation. The delayed-match-to-place version of this task involves consecutive days of training in which rats receive two trials a day with varying inter-trial intervals. As shown in Figure [2C](#F2){ref-type="fig"}, on the first trial of each day (the information trial) the submerged platform is located in a novel position, which differs from the previous day with respect to both the maze quadrant and the distance from the edge of the maze. On the second trial (the retention trial), the submerged platform is located in the same position as the information trial. The start position is always distal from the platform. The inter-trial interval can be systematically varied to assess working memory (our lab has employed delays ranging from 30 min to 6 h; see Bizon et al., [@B17]). Difference measures comparing pathlength on retention and information trials can be used to assess performance.
***Sensitivity to aging.*** As described in Bizon et al. ([@B17]) and shown in Figure [3](#F3){ref-type="fig"}, we observed a delay-dependent, age-associated deficit on this task, such that all rats performed comparably at the 30 min delay, aged rats were impaired at the 2 h delay and both middle-aged and aged rats were impaired at the 6 h delay. Notably, performance on the delayed match-to-place task was not correlated with spatial reference memory performance in the same rats, suggesting independent age-related deficits in PFC- and hippocampal-mediated cognition. Nevertheless, the hippocampus would be expected to impact performance on this task and this age-related deficit most likely reflects age-dependent deficits across both hippocampal and PFC circuitry (although neither has been directly addressed experimentally using this task design).
![**Performance of young (6 mo., *n* = 17), middle-aged (12 mo., *n* = 29) and aged (24 mo., *n* = 21) male F344 rats on a delayed match-to-place version of the water maze task.** The "pathlength difference" measure shown reflects the difference in the distance swum to reach the platform on information and retention trials. Panel **(A)** shows that while all age groups performed comparably at the short (30 min) delay, the aged rats were impaired relative to younger rats at the intermediate (2 h) delay and middle-aged rats were impaired relative to young at the longest (6 h) delay interval. Panel **(B)** shows young and aged rat performance on the delayed match-to-place task with the aged rats sub-grouped based on their spatial reference memory abilities. Hippocampal-dependent spatial reference memory performance was assessed prior to the delayed match-to-place task using procedures described in Bizon et al. ([@B17]). Note that delayed match-to-place performance did not correspond to impairment on the spatial reference memory task, providing evidence that age-related impairments in these tasks are mediated by distinct brain circuitry. Adapted with permission from Bizon et al., [@B17]. *Neurobiology of Aging*.](fnagi-04-00019-g0003){#F3}
Comparing working memory assessments across species
---------------------------------------------------
Spatial navigation tasks are less commonly used for non-human primate and human studies although recent advances in virtual environments have made it possible to adapt spatial navigation procedures to humans. Virtual mazes capitalize on the wealth of information obtained from spatial navigation tasks such as those described above and reviewed in Foster et al. ([@B41]). The majority of data from aged individuals in virtual environments to date have investigated hippocampal-dependent spatial reference memory. However, virtual radial maze environments have been used to demonstrate working memory deficits in schizophrenia, a neuropsychiatric disorder that is characterized by PFC dysfunction and disorganized thoughts and behavior (Spieker et al., [@B108]). Schizophrenic patients exhibit an increase in spatial working memory errors as they learn the rules for navigating through a virtual environment (Ku et al., [@B63]; Sorkin et al., [@B107]). These performance errors are highly correlated with performance on the wisconsin card sorting task (WCST; describe below) which is dependent upon dorsolateral PFC, providing support that deficits in the virtual maze are mediated by this circuitry. Future work extending these working memory assessments to aged non-human primates and humans offers significant potential for making cross species comparisons.
More common for primates than spatial navigation tasks are working memory tasks that rely on visuospatial information. As described above, a classic working memory experiment originally designed in non-human primate is the spatial delayed response task. This task is schematized in Figure [4](#F4){ref-type="fig"} and involves the animal observing an experimenter placing a food reward into one of two or more identical food wells. These wells are then covered with two identical objects and a barrier is lowered between the animal and food wells. Following a delay (usually on the order of seconds), the screen is raised and the animal has to choose the food port in which the food was placed in order to obtain the reward. A number of delayed response task variants have been used in non-human primates, including alternation and oculomotor versions. As is the case in the rodent assessments described above, across these delayed response tasks, the subject is required to identify in a choice setting a previously identified place or object following a delay interval. Lesions of dorsolateral PFC disrupt performance on spatial delayed response, delayed alternation, and delayed oculomotor tasks (Mishkin, [@B73]; Butters and Pandya, [@B24]; Goldman and Rosvold, [@B50]; Passingham, [@B84]; Funahashi et al., [@B46]). Moreover, deficits on delayed response tasks were recently correlated with greater reductions of regional gray matter in prefrontal cortex as measured by anatomical magnetic resonance imaging in a non-human primate study of aging (Alexander et al., [@B1]). Delayed response tasks have also been employed in humans and in agreement with non-human primate, errors increase with age and aged individuals are proportionally less accurate at longer delays (Lyons-Warren et al., [@B68]; Nagel et al., [@B79]).
![**Task schematic of a delayed response task used in non-human primates (A) and an analogous delayed match-to-sample task used in rodents (B).** Both tasks consist of information presented in a sample phase and recalled in a choice phase, with the two phases separated by a delay period. Panel **(A)** illustrates the non-human primate task in which the subject watches while one of two ports is baited with a food reward in the sample phase. Both ports are blocked from view during the delay period. In the choice phase, both ports are made accessible and the subject must choose the port baited during the sample phase to obtain the reward. **(B)** In the analogous rat task (adapted from Sloan et al., [@B106]), which is performed in operant chambers, the rat is presented with one of two levers in the sample phase. Both levers are retracted during the delay period. In the sample phase, both levers are presented and the rat must choose the lever that was presented in the sample phase to receive a food reward.](fnagi-04-00019-g0004){#F4}
A highly analogous delayed response (match-to-sample) operant task has recently been developed for rodents. This task has a unique advantage over many others described in this section in that while sensitive to mPFC damage, performance is unaffected by lesions of the hippocampus (Sloan et al., [@B106]). The basic design of the delayed match-to-sample task is shown in Figure [4](#F4){ref-type="fig"}. Rats are trained in operant chambers containing two retractable levers on either side of a centrally located food trough, into which a food pellet reward is delivered. Each trial in the task consists of three phases: a sample phase, a delay phase, and a choice phase. In the sample phase, a single lever (either left or right, presented randomly within each two trial block) is extended into the test chamber, and it remains extended until pressed. Once pressed, the lever is retracted and a light is illuminated in the food trough, indicating the start of the delay phase. Variable delays (e.g., ranging from 0--24 s) are used, and each delay is presented once (in random order) within a trial block. Sessions are of a fixed duration, which allows rats to complete multiple trials (usually over 10) at each delay. In the choice phase, both levers are extended, and a press on the lever presented in the sample phase results in delivery of a single food pellet reward. A press on the incorrect lever results in no food delivery and a brief timeout period. The percentage of correct choices (relative to the total number of trials completed) at each delay is the measure of task performance.
Using this task, Sloan et al. ([@B106]) found that excitotoxic lesions of mPFC impaired performance in a delay-dependent manner (i.e., impairments were larger in magnitude at long delays). However, performance was not impaired by lesions of the hippocampus, suggesting that this task may provide a more selective index of mPFC function relative to the spatial tasks described above. To our knowledge, this task has not been used to assess working memory in aged rats, but it has significant potential for cross species comparisons and for isolating the effects of age on mPFC.
Cognitive flexibility
=====================
While the ability to maintain stable representations of previously learned information is essential for optimal working memory, adaptive behavior also requires a system that allows for flexible updating of these representations in response to changing environmental contingencies. Inherent to such flexibility is the inhibition of previously acquired information or response rules that are inappropriate in a new situation. Such abilities are critically dependent on PFC, and a decline in cognitive flexibility frequently accompanies the aging process across species. For example, both aged monkeys and humans have difficulty modifying appropriate responses when a location or cue previously associated with a reward is made irrelevant (Rapp and Amaral, [@B91]; Steere and Arnsten, [@B109]; Voytko, [@B112]; Lamar and Resnick, [@B65]; Denburg et al., [@B29]). Similarly, as described in more detail below, several studies have shown that aged rats also exhibit a decline in their ability to modify their responses in tasks during which previously learned information must be discarded or inhibited in favor of new information (Barense et al., [@B7]; Schoenbaum et al., [@B98]). Notably, across species, distinct subregions of PFC have been implicated in this type of behavior, depending on the type of information to be modified.
Historical perspective and neural circuitry
-------------------------------------------
The WCST can be used to assess the ability to form and switch between attentional sets in humans. In this task, subjects learn to sort a deck of cards that contain multiple stimulus features (e.g., color and shape). After learning an initial rule (e.g., sort by color), there is an unsignaled shift in sorting rule (ignore color, sort by shape) and the subject must adapt his behavior accordingly. Dias et al. ([@B30]) developed an analog of this task for non-human primates that included different types of behavioral "shifts": intradimensional shifts (IDSs) and extradimensional shifts (EDSs). In an IDS, a subject must solve a novel discrimination problem within the same stimulus dimension that was attended to in the previous problem (for example, in a discrimination between two objects that differ in both shape and color, if a subject solved a problem on the basis of color, a subsequent IDS problem would involve novel colors but color would remain the dimension relevant to the correct choice). In contrast, an EDS requires a subject to attend to a different perceptual dimension to solve a new discrimination problem (to continue the example above in which color was originally relevant to the correct choice in an object discrimination, in a subsequent EDS problem, the objects\' shape would become the basis for discrimination). Reversals represent a third problem type in which, while confined to a single perceptual dimension, the cue-outcome contingencies are reversed (e.g., within the color dimension, if red represented the correct choice in a discrimination problem, then blue (and not red) would become the correct choice on reversal of that problem). Dias et al. ([@B30]) showed a double dissociation between the roles of dorsolateral and orbital PFC in EDS and reversal performance. Dorsolateral PFC lesions impaired EDS (but not reversal) performance, whereas orbital PFC lesions had the opposite effect. Importantly, neither lesion affected IDS performance, indicating that general impairments in learning novel discrimination problems did not account for the effects of PFC lesions.
Assessing cognitive flexibility in rodents
------------------------------------------
A number of different approaches have been used to assess set-shifting and reversal learning in rodents. One task designed by Birrell and Brown ([@B14]) is an adaptation for rodents of the set-shifting task described above for non-human primates. This task takes advantage of rodents\' natural propensity to dig for food and involves a series of compound discrimination problems between stimuli that differ on two dimensions: odors and digging media. The use of compound stimuli, only one dimension of which is relevant to any given discrimination problem, allows performance to be assessed on IDSs, reversals, and EDSs. In this task, which is described in detail below, Birrell and Brown ([@B14]) showed that mPFC lesions did not influence acquisition of attentional sets (IDS) but selectively impaired performance on EDSs (i.e.,---the ability to shift attentional sets). In contrast, OFC lesions impaired reversal learning but not IDS or EDS (McAlonan and Brown, [@B69]). Notably, similar functional dissociations have also been reported in mice using the same procedures (Bissonette et al., [@B15]). As such, there is a strong degree of homology in the neural circuitry that is critical for set-shifting and reversal learning across species (Birrell and Brown, [@B14]; Brown and Bowman, [@B20]; Schoenbaum et al., [@B99]; Chudasama and Robbins, [@B25]; McAlonan and Brown, [@B69]; Ragozzino et al., [@B89]; Stefani et al., [@B110]; Kim and Ragozzino, [@B60]; Floresco et al., [@B36]).
### Digging set-shifting task
Testing procedures are conducted in an open-topped opaque plexiglass chamber divided into start and test compartments by an opaque sliding barrier. A smaller apparatus can be used for testing mice. Two terra cotta flower pots are placed side by side against the back wall of the box and are affixed to the box floor (see Figure [5A](#F5){ref-type="fig"}).
{ref-type="table"} and associated text for an example of the testing procedures. Panel **(B)** shows a schematic of set-shift procedures performed in an automated version of the task. Rats are first trained to choose between two extended levers based on a light cue that is associated with one of the levers. After reaching criterion performance on that discrimination, there is an unsignaled change in rule and now the rat must ignore the light and choose levers based on their spatial location (e.g., choose the left lever irrespective of the light cue; adapted from Floresco et al., [@B36]). See text for additional details.](fnagi-04-00019-g0005){#F5}
Note that in our own experience, we have found that performing digging tasks in the dark under red light and reversing the light/dark cycle of the housing conditions (so that testing is in accord with the rats\' dark cycle, during which they are more active) is beneficial for procedural aspects of the task (i.e., aged rats complete more trials in less time). In addition, using a camera to monitor activity such that the experimenter is removed from the immediate vicinity of the apparatus also appears to reduce anxiety and enhance rodent performance.
Rats are food-restricted and shaped to dig in both pots in order to obtain a food reward. On the day following shaping, rats begin discrimination problems. Throughout testing, only one pot contains the food reward and the position (left or right) of the rewarded pot is varied pseudorandomly across trials. The set-shifting protocol involves a sequence of problems in which the relationship between the two stimulus features (odor and digging media) and the food reward is altered systematically. Problems are presented sequentially after reaching criterion performance (6 consecutive correct trials) on each test phase. First, subjects receive a "simple discrimination" problem requiring discrimination between either two odors (using home cage bedding or mixed media) or two digging media (in the absence of odors). Second, subjects receive a "compound discrimination" problem in which the same positive stimulus used in the simple discrimination is presented again but the second dimension (either odor or digging media---whichever was not used initially) is now introduced but made irrelevant to the correct choice. Third, subjects receive an "intradimensional shift" in which a new compound discrimination problem with novel stimuli is presented, but in which the dimension predictive of reward in the simple and compound discriminations still predicts reward. Fourth, the subjects receive a "reversal" problem that uses identical stimuli to those used in the intradimensional shift but the stimuli in the relevant dimension are reversed, such that the previously negative stimulus now predicts the food reward and vice versa. Finally, rats are presented with an "extradimensional shift" in which the formerly irrelevant dimension (across all previous four problems) is now made relevant to the food reward. Table [1](#T1){ref-type="table"} shows an example of odor and digging media pairs across phases of testing. Trials- and errors-to-criterion on each testing phase are the performance measures.
######
**Shows an example of a problem sequence in the attentional set-shift dig task**.
**Stimulus dimension 1** **Stimulus dimension 2** **Rewarded dimension**
------------------------- ---------------------------- -------------------------- ------------------------
Simple discrimination Rose (+), Citrus (−) ODOR
Compound discrimination Rose (+), Citrus (−) Gravel, Sand ODOR
IDS Peppermint (+), Coffee (−) Styrofoam, Yarn ODOR
Reversal Peppermint (−), Coffee (+) Styrofoam, Yarn ODOR
EDS Coconut, Banana Beads(+), Sequins(−) DIGGING MEDIUM
(+) Indicates the rewarded feature in each problem. (−) Indicates the unrewarded stimulus within that same dimension.
Note that relevant dimensions and stimuli used in testing are counterbalanced across experimental groups, and olfactory detection thresholds are determined at the conclusion of testing to confirm that any deficits observed on the set-shifting task are not secondary to gross olfactory impairments (see Lasarge et al., [@B66] for detailed procedures). The latter is an important control in aging as we and others have observed olfactory discrimination learning deficits in aged rats and mice of some strains (Lasarge et al., [@B66]; Patel and Larson, [@B85]). Advantages of these task procedures include the fact that digging is a naturalistic rat behavior and the fact that there is a strong foundation in lesion studies from both rodent and non-human primate in which the acquisition of attentional sets (IDS) is clearly dissociable from shifting of attentional sets across stimulus dimensions (EDS) and from reversal learning (Dias et al., [@B30]; Birrell and Brown, [@B14]).
***Sensitivity to aging.*** Using these procedures, Barense et al. ([@B7]) reported that aged (24 mo.) Long Evans rats acquired attentional sets (IDS) on par with young (6 mo.) cohorts but that aged rats were selectively impaired on EDSs (see also Rodefer and Nguyen, [@B95]). These authors further showed substantial variability in performance among aged rats on the EDS and that these individual differences in set-shifting abilities did not correlate with hippocampal function as assessed in the Morris water maze. A strong trend toward an age-related deficit on reversal learning problems was also described in this same cohort of aged rats, and reversal and EDS performance were strongly related. Notably, these latter data agree with Schoenbaum et al. ([@B98]) who reported impaired performance of aged Long Evans rats in a odor-guided go/no-go odor discrimination task after the reward contingencies were reversed.
### Maze-based set-shifting task
Another paradigm that has been used to assess behavioral flexibility in young rodents employs a plus-shaped maze in which rats shift between visual cue- and spatial-based discrimination strategies. Rats are initially trained to enter an arm marked by a distinctive visual cue in order to receive a food reward. For the set-shift, rats must then learn to turn in a specific direction (e.g., turn left) regardless of the position of the visual cue. On this task, manipulations of mPFC markedly and selectively impair performance during the set-shift (Ragozzino et al., [@B89]; Stefani et al., [@B110]; Floresco et al., [@B39]). These same manipulations do not, however, impair learning of the initial discrimination nor of reversal learning using the same apparatus and stimuli. Notably, unlike the aforementioned set-shift tasks in which novel stimuli are used during the EDSs (see Table [1](#T1){ref-type="table"}), in the plus-maze task, the stimuli remain constant across different phases of the procedure. In this sense, it could be argued that performance in the maze task is more similar to the WCST used in humans, as it places a greater demand on response conflict (i.e.,---although it requires a shift of attentional set from visual cue to turn direction, the rat is explicitly presented with the same set of stimuli during both the initial discrimination learning and during the set-shift). Therefore, an advantage of this task is that it can be used to distinguish between different types of impairments in set-shifting (e.g., perseveration on the previously reinforced strategy versus impairments in learning the new strategy). It is notable that some studies show that perseverative errors on WCST are particularly affected by aging in humans (Ridderinkhof et al., [@B92]; Moore et al., [@B76]; Gamboz et al., [@B48]). Thus the ability to isolate such errors in rodent analyses may offer a stronger parallel to human and potentially greater sensitivity to detection of age-related deficits. To our knowledge, this task design has not been explored in aged rats or mice to date, perhaps in part because well-described age-related spatial learning and memory deficits could make it difficult to isolate deficits in behavioral flexibility in contexts with heavy spatial demands.
### Operant set-shifting task
Recently, the same approach to attentional set-shifting offered by the plus maze task has been adapted to operant chambers and the basic task design is shown in Figure [5B](#F5){ref-type="fig"}. Rats are initially trained to press a lever signaled with a light for a food reward (visual cue discrimination). After reaching criterion on this visual discrimination, the contingencies are altered such that now the rat has to ignore the light and must respond instead to lever position (e.g., always press the left lever) in order to receive the food reward. Much like the plus maze version, the same set of stimuli is used across both phases of the task and the order of discrimination types can be counterbalanced). Using these procedures, Floresco et al. ([@B36]) showed that inactivating mPFC impairs performance after task contingencies are altered but does not affect acquisition of the initial discrimination (see also Darrah et al., [@B27]). Advantages of this operant procedure in aging include the absence of olfactory or spatial demands (both of which can be affected by age). In addition, this automated procedure has advantages from the perspective of the time devoted to individual rat testing as well as its consistency and repeatability across investigators and laboratories. Validation of this and the T-maze tasks in aging would offer several approaches for rodent assessment that are well-grounded in the appropriate neuroanatomical and neurochemical systems and that strongly parallel neuropsychogical mechanisms associated with flexible updating and adaptively shifting behavior in humans.
Comparing cognitive flexibility across species
----------------------------------------------
As described above, across species aged subjects are impaired in their ability to switch between attentional sets and among response rules used to guide behavior. In humans, the WCST has historically represented the gold standard for assessing this ability and thus many non-human primate and rodent models are designed to be analogous to this task. These models, which differ primarily with respect to species-specific adaptations of stimulus features and task demands, have proven to be very sensitive to aging across non-human primates and rodents and offer a strong model for developing cross species comparisons. Notably, however, the WCST has disadvantages in that it is not neuropsychologically specific, which can make interpretation of deficits measured by this task challenging. As such, in humans, assays which assess different subcomponents of executive function (e.g., that assess inhibition of prepotent responses) are often employed to assess "flexibility" or task-switching. As described below, other rodent behavioral assays largely developed to model aspects of impulsivity in neuropsychiatric diseases might offer more specific parallels to some human assessments detailed in Alexander et al. ([@B2]) (this issue).
Modeling other aspects of executive function relevant to human aging
====================================================================
Response inhibition
-------------------
Inhibition is an executive process important to performance in both working memory (in which proactive interference must be minimized or inhibited) and in reversal and set-shifting assays (in which previously-reinforced responses must be inhibited). Drawing on behavioral models developed to study impulsivity and response inhibition in psychiatric disorders, there are a number of approaches in rodents that offer parallels to assays of inhibition that are sensitive to decline in human aging. Using such tasks to characterize age-related changes in rodent models offers potential to advance our understanding of the unique behavioral, cognitive and neurobiological mechanisms that mediate inhibition and to determine the extent to which maladaptive changes in this specific aspect of executive function inhibition mediate deficits observed in more complex tasks.
The term "response inhibition" refers broadly to the ability to stop (inhibit) a prepotent (either learned or innate) behavior. As such, performance on a wide range of tasks likely requires some degree of this form of inhibition, although the extent to which such control is important for accurate task performance is not clear. For example, both attentional set-shifting and reversal learning require subjects to inhibit a previously learned response rule or cue-outcome association, respectively. Although both set-shifting and reversal learning are impaired in aging and following PFC damage (described above), the presence of a double-dissociation between the PFC neural substrates supporting performance in these two tasks suggests that a unitary response inhibition function is not the only relevant mediator of these behaviors (Dias et al., [@B30]; Barense et al., [@B7]; Brown and Bowman, [@B20]; Schoenbaum et al., [@B98]; Bissonette et al., [@B15]). In addition, performance on other tasks which would be expected to require inhibitory control (e.g., go/no-go) are less sensitive to aging than either set-shifting and reversal learning (Schoenbaum et al., [@B98], [@B100]).
Several additional tasks have been widely used to assess inhibitory control processes in rodents, including the 5-choice serial reaction time (5-CSRT) task and a rodent version of the stop signal reaction time task (Robbins, [@B94]; Eagle et al., [@B33]). The 5-choice task was originally designed to model the continuous performance test of attention used in human subjects, but has been more recently used to test motor inhibition. In contrast, the stop signal task was designed to model the "same name" task used in human subjects. As with other aspects of executive function, performance in both tasks depends upon neural circuitry that includes the PFC and basal ganglia (Dalley et al., [@B26]; Eagle and Baunez, [@B34]). The vast majority of work with these tasks has been in the context of animal models of impulse control disorders (e.g., attention deficit-hyperactivity disorder and addiction \[see Winstanley ([@B116]) for review\], but a small number of studies has investigated the effects of aging, particularly in the 5-choice task. In this task, rats must nosepoke into one of five chambers following the presentation of short light stimulus in order to receive a food reward from a distally located food trough. The stimulus duration can be varied (2--0.2 s) to make the task more difficult (increase attentional demands) and accuracy is used as a measure of attention. Prepotent motor responses are recorded when the rat chooses a port (nosepokes) before the light stimulus is illuminated. Studies using this task have revealed either no effects of age or even an enhancement in the ability to withhold a prepotent motor response in this task, despite consistent age-related impairments on task measures of attentional performance (Jones et al., [@B58]; Muir et al., [@B78]; Harati et al., [@B53]). To our knowledge, the stop signal reaction time task has not been employed to study response inhibition in aged rodents.
Task sensitivity might contribute to some of the negative results associated with inhibition in aging on the tasks described above. Moreover, a challenge for employing such tasks in aging is the concern about dissociating age-related decline in motor function from performance measures of inhibition. Indeed, the enhanced inhibition of prepotent motor responses in aging could be attributable to slower responding in general which would be expected to decrease the number of prepotent responses. Nevertheless, these findings highlight the need for additional work directed at investigating the effects of normal aging on subcomponents of executive function like inhibition which may contribute to performance on complex tasks such as the set-shifting and working memory tasks described above.
Information processing speed
----------------------------
Recent findings which indicate that cognitive slowing can account for much of the variance associated with decline of other cognitive functions, including those described for working memory and cognitive flexibility (Salthouse et al., [@B97]). Such work has directed significant attention to better understanding the associated neural mechanisms contributing to loss of processing speed. Approaches to the study of information processing in rodents generally involve assessments of reaction time in both simple stimulus-response tasks as well as in choice settings (e.g., using the 5-CSRT task described above).
In a simple stimulus-response task, performed in operant chambers, very little change in reaction time is observed between young adult (4--6 months) and aged (24 months) rats (Menich and Baron, [@B72]; Burwell and Gallagher, [@B23]), although some slowing of reaction time latencies was evident at very advanced ages (\>24 mo.). Notably, considerable individual variability in performance has been reported in simple reaction time but these differences were unrelated to impairment on a spatial reference memory task (Burwell and Gallagher, [@B23]), suggesting that in as much as reaction time is reflective of information processing speed, it does not account for age-related spatial learning deficits.
Choice reaction time is generally assessed using the 5-CSRT task described above (Harati et al., [@B53]). While overall accuracy in responding is generally used as a measure of attention, the latency to make a correct response to the light stimulus has been used as a measure of decision making speed. Likewise, latency between a correct response and food collection has been used as a measure of motor function. Lesion studies indicate that the mPFC is critical for processing efficiency on this task as lesions reduce choice accuracy and increase the latency to respond correctly to the light target (i.e., decision making speed; Muir et al., [@B118]).
Using standard conditions (0.5 s visual stimulus duration) decision making speed was reduced in aged animals (25 months), compared to young adult and middle-aged rats. Decision making speed was also reduced when a longer stimulus (2 s) was employed. This effect could be ameliorated by prior exposure to environmental enrichment conditions. However, prior enrichment also improved the latency for food collection in aged animals, making it difficult to dissociate changes in decision making speed from global benefits on health and function resulting from enrichment. Attentional processes, as measured by total number of correct responses, were impaired in aged animals when the stimulus was shortened (0.2 ms) and this effect was also ameliorated by enriched housing. Reducing the brightness of the stimulus light decreased choice accuracy similarly across all age groups, indicating that these age-related differences were not due to altered sensory function (Muir et al., [@B78]).
As noted above, a significant challenge to the interpretation that deficits in reaction time are indicative of changes in processing speed is to convincingly dissociate such changes from age-related impairments in motor function. Certainly, there is substantial evidence for motor slowing in aged rodents that is dissociable from loss of cognitive function (e.g., Burwell and Gallagher, [@B23]; Bizon et al., [@B17]). While the latency to collect food might be used as a subtractive measure to help account for motor dysfunction, this measure may be confounded by motivational differences to obtain the food reward. One approach that might be applied in future work is to employ task designs which assess latency to respond in situations that systematically vary their cognitive demand. The expectation would be that age-related deficits in processing speed would become more evident (increased latency) in settings with high cognitive demand in comparison to low-demand settings. Any age-related changes in motor function would be expected to affect performance comparably irrespective of cognitive demand. As such, performance deficits that are attributable to age-related slowing of peripheral motor functions would be more clearly dissociable from those associated with central brain effects of aging.
Conclusion {#s1}
==========
Rodents offer less complex but still analogous model systems for studying executive function, in which neurobiological factors are relatively easily manipulated and investigated. Indeed, the use of behaviorally characterized rodents has significantly advanced our understanding of the mechanisms that contribute to loss of hippocampal-dependent cognition in aging (Bizon et al., [@B16], [@B18]; Burke and Barnes, [@B22]; Foster, [@B40]; Gallagher et al., [@B47]); however, to date, this approach has not been as widely applied to the study of executive function. Arguably, such questions are increasingly important given the increased lifespan associated with healthy lifestyles, the early and pronounced decline of executive functioning with aging, and evidence suggesting that the cellular and behavioral mechanisms responsible for supporting working memory and other executive functions may be somewhat distinct from those that support hippocampal-dependent cognition (Ramos et al., [@B90]; Gallagher et al., [@B47]; McQuail et al., [@B70]). Here, we reviewed a number of behavioral approaches in rodents that hold great promise for such investigations of executive processes, including tasks that have already been well-validated in rodent aging (e.g., Nicolle and Baxter, [@B80]; Ramos et al., [@B90]; Nieves-Martinez et al., [@B81]), as well as tasks that have not been well-characterized in aging but that strongly parallel aspects of human executive function vulnerable to age-related decline. The ability to reliably assess executive functions in non-human animal models of aging should aid in our understanding of both the shared and distinct factors that contribute to decline of function across multiple cognitive domains with advancing age. Moreover, these models can be leveraged to evaluate interventions in rodents that can then be translated to clinical trials in humans.
Conflict of interest statement
------------------------------
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
The authors would like to thank the entire McKnight-sponsored cognitive test battery working group for their contributions to this manuscript and Dr. Barry Setlow for his input and comments regarding the rodent behavioral tasks. This work was supported by the McKnight Brain Research Foundation and AG029421 to Jennifer L. Bizon, AG014979, AG037984, AG036800 to Thomas C. Foster, and AG025526, the state of Arizona and Arizona Department of Health Services, Arizona Advanced Research Institute for Biomedical Imaging, and the Evelyn F. McKnight Brain Institute to Gene E. Alexander.
[^1]: Edited by: Gemma Casadesus, Case Western Reserve University, USA
[^2]: Reviewed by: Gemma Casadesus, Case Western Reserve University, USA; Barbara Shukitt-Hale, U.S. Department of Agriculture, USA
| |
Through all my research I have not found an article that has done a better job than "Training the Energy Systems" by the late Dr. Fritz Hagerman. Dr. Hagerman was the exercise physiologist for the U.S. National team for about 30 years. I cannot begin to express my gratitude for his contributions to the sport of rowing. I've attached the document below since it has been rather difficult to find online. If you would like a copy sent to you in an email feel free to contact me.
I profiled a few key points that stood out to me, and that help to define my program, but please take the time to read the article for yourself. There is a treasure trove of information in these 8 pages. It took me about a year of research to learn all of this on my own. You will be saving yourself a lot of time by diving into this piece of work.
1) Use the 10% rule
"Overload the physiological systems, but don't concentrate this overload; follow the 10% rule when starting a training program, meaning an increase of no more than 10% per week in training frequency, duration, and intensity. As training progresses, then the weekly increase can be reduced to as low as 5%"(Hagerman 1).
2) Don't forget about recovery
"Rest and recovery are vital ingredients in the best training recipe; a failure to plan for these can produce disastrous results, including peaking at the wrong time, overtraining, or chronic fatigue. Remember, undertraining is usually never a problem for the motivated rower. If you are unusually tired, injured, or sick, then taking a day or two off should not be considered a serious training set-back"(Hagerman 1).
3) Plan ahead
"It is well known that the timing of increasing or decreasing intensity determines whether an athlete "peaks" at the desired time or not. In addition, if intensity is increased at too high a rate it can lead to overtraining, injury, and fatigue" (Hagerman 2).
4) Emphasize quality over quantity
"Do not interpret the value of aerobic training in only quantitative terms. Every workout, even of a low intensity, must always stress quality" (Hagerman 6).
5) Avoid 30+ minute pieces
"We have convincing data, including muscle biopsy histochemical and biochemical indicators, which support that rowing continuously at a low steady state intensity for 60 minutes or longer for any caliber of rower, is not more effective in maintaining aerobic capacity than 30 minutes of rowing at the same work intensity. Furthermore, performing 2 intermittent 30 minute exercise bouts of relatively high aerobic work intensity...is a much stronger aerobic training stimulus than lower intensity continuous rowing. Intermittent high intensity work not only proved significantly more effective than either 30 or 60 minutes of rowing in the improvement of aerobic capacity, but it was also more neuromuscularly task specific" (Hagerman 7).
How Posture Can Improve Your Life
10/2/2014
No matter how much time you spend training, exercising, or being active, there are always more hours left in the day. Although the amount of time that we dedicate to exercise is very important, we may want to look deeper into how we are spending our remaining hours. Lets take a closer look at an average person that exercises 3 times a week.
Total hours of exercise in a week: 3
Total hours in a week: 168
Total hours not spent exercising in a week: 165
In this example we are spending less than 2% of our time exercising. Yes, I know, a lot of these hours are spent sleeping but I would argue that most of us don't spend enough time there either (as I write this at 1:00am in the morning).
To keep it simple, we are spending 165 hours a week in either a good position, or a bad position. Overtime, the way we hold ourselves throughout the day has a greater impact on our minds and bodies than the 3 hours spent on exercise. Poor posture results in altered body mechanics, decreased blood flow, increased stress levels, increased feelings of depression, and decreased energy levels. Poor posture affects how others feel about us, and more importantly, it affects how we feel about ourselves. All of this results from just walking or sitting in a slouched position!
In a study where scientists studied participants in "high-power" postures vs. "low-power" postures the "high-power" participants experienced a 20% increase in testosterone (power hormone) and a 25% decrease in cortisol (stress hormone). The "low-power" participants on the other hand experienced a 10% loss in testosterone and a 15% increase in cortisol. Oh, and by the way, these chemical changes took effect after only 2 minutes. What does all this mean? Holding ourselves in a good position makes us happier, more confident, less stressed, and less likely to experience negative health effects including stress related health issues and injuries.
The bottom line: be aware of your posture and body position in day-to-day life and you will notice dramatic changes in how you feel, move, and ultimately perform. The body is powerful...use it to your advantage!
If you are interested you can learn more from the links below: | http://www.movementevolution.com/blog/archives/10-2014 |
In terms of skill, poker is a game of ranges and bluffs. Usually, the player who has the highest hand wins the pot, but the odds are not skewed in favor of the player who has the lowest hand. In addition, the game involves a lot of analysis, which is a must for success in poker. Here are some strategies for winning in poker. Listed below are some of the most common strategies.
Players are often required to make a contribution to the pot before the game begins, called the ante. The first player to bet is referred to as the “bet” player, while a second player who matches the previous bettor is called the “call” player. If no one bets, that player stays in the game without making a decision. To remain in the game of poker, a player must make sure that no other players have bet before he can make his/her last move.
The game is played using chips. Each player receives a different set of chips, which are worth different amounts. If there are seven or more players, poker chips must be provided for each player. The lowest-valued chip is a white chip. The red chip is worth five whites, while the blue chip is worth two, four, or five reds. The players “buy in” by buying a number of chips equal to the total contribution of the players before them. | https://rushfordgatheringspace.com/index.php/2022/03/21/strategies-for-winning-in-poker/ |
The author promises to revolutionize storytelling in this powerful story about three college students, one Christian and the others Muslim, who find themselves unlikely roommates at a small, private American university.
Tamika, the main character of this novel, is of African American heritage. She is a sophomore in college who dreams of becoming a famous singer. After a fight with her roommate, she is forced to move out of her room and ends up living with two Muslims, one who is religious, while the other is becoming discontented with the religion. Tamika is immediately drawn to Durrah, the latter, who shares her love for singing. Durrah is emerging as a successful model and singer in her own right and enjoys a growing level of prominence in her career, which has earned her many admirers, Tamika being one. Captivated by Durrah's magnetic personality, breathtaking beauty, and powerful singing voice, Tamika has found both a friend and mentor in life. As the seeds of friendship are sown between them, the doors of fame are beginning to open for Tamika. But she is unprepared for the one obstacle that stands in her way to success.
This novel is studied in the English paper for the BA in Islamic Studies at the International Open University (IOU).
Themes explored in this novel:
- African American struggle and racial inequality
- Interfaith dialogue between Muslims and Christians
- Reverting to Islam
- Da'wah (inviting to Islamic faith)
Have a look at more titles by Umm Zakiyyah here!
Format: Paperback
Pages: 198
Published: first published 2001, this edition 2020
Dimensions: 14 x 21.6 x 1cm
ISBN: 9780970766700
Payment & Security
Your payment information is processed securely. We do not store credit card details nor have access to your credit card information. | https://www.darulhijrah.co.nz/products/if-i-should-speak-a-novel |
By GERRY FOLEY
Uruguay, formerly known as the Switzerland of Latin America, seems to be plunging into a deep social and political crisis parallel to that of its larger neighbor Argentina. On Aug. 25, Uruguayan independence day, according to the Mexico City daily La Jornada, 100,000 marched in Montevideo to protest the government’s economic austerity policy and capitulation to the demands of imperialist finance.
The action was called by the Uruguayan union federation, the PIT/ CNT, along with an organization representing small and medium businesses. A union representative, Jose Suarez, told the crowd that since the government decided to allow the local currency to float on June 20, workers had lost 25 to 30 percent of their purchasing power. The currency has lost 50 percent of its value. But despite the cheaper exchange rate, since the beginning of the year, exports have fallen by 40 percent.
On July 30, the government declared a bank holiday to try to stop the drain on the banking reserves. Since January, according to a report in the Aug. 7 issue of Le Monde, the country’s currency reserves have shrunk by 80 percent, and bank deposits by 45 percent. According to the PIT/CNT, the jobless now number 250,000 in a country whose total population is only 3.3 million, and 50 percent of new babies are born into families living below the poverty level.
The slide into economic disaster provoked a general strike on Aug. 7 that totally closed down the banks, the government offices, and education. In its Aug. 13 issue, La Jornada reported that students at the national university had started an unlimited strike against the government’s neoliberal policy and its acceptance of the IMF demand for slashing public spending and liquidating public services.
The eruption of economic crises in Uruguay and Brazil has forced the United States to offer some loans, despite its announcement that it would do nothing to bail out the Argentine economy. In the case of Uruguay, the U.S. loan amounted to $1.5 billion. But the loan was not sufficient nor intended to solve Uruguay’s economic difficulties. It was designed only to facilitate the mechanism of austerity, to prevent an uncontrolled collapse of the banking system. | https://socialistaction.org/2002/09/01/uruguay-hit-by-economic-crisis/ |
When a colony of the swarm-founding social wasp Polybia occidentals loses its nest to severe weather or predation, the adult population evacuates and temporarily clusters on nearby foliage. Most of the adults remain inactive in the cluster, while foragers bring in nectar and scout wasps search the surrounding area for a new nesting site. After several hours, the scouts stimulate the rest of the swarm to leave the cluster and follow their pheromone trail to the chosen site. How scouts communicate to their swarm-mates that a site has been chosen and how they induce the swarm to depart are unknown. Video records of six Costa Rican swarms were used to quantitatively document changes in the frequencies of social behaviors leading to swarm departure. This was accomplished by going backward through the video record and following the behavior of individuals prior to their departure. Analysis of the behavior of scouts and inactive wasps indicated an increase in the frequency with which scouts bump into inactive wasps prior to swarm departure, as well as a shift in the behavior of inactive wasps from primarily receiving bumps to bumping others before departure. Thus, bumping is propagated by recently activated individuals before they take off. These observations suggest that not only is bumping an activation stimulus that causes swarm members to depart for the new nest site, but it is contagious, leading to its amplification throughout the swarm.
Introduction
In social insects that initiate colonies by means of swarming, three organizational challenges must be faced when swarms disperse. The first is that a subset of the population, the scouts, must find and agree upon a suitable nest site. Second, the scouts must induce the rest of the colony to leave for the new site. Finally, scouts must guide the migrating swarm of adults to the new site. The process has been best studied in the honey bee, Apis mellifera. Scout bees leave the temporary cluster to search for potential nesting sites. After several hours or days, a single site is agreed upon based on quorum sensing by scouts; that is, scouts favor a site at which they observe a sufficient number of other scouts visiting (Seeley and Visscher 2004). Once a site is selected, scouts return to the swarm and prepare it for liftoff by rapidly running over the clustered bees and piping (producing short, rising sound pulses) (Seeley and Tautz 2001). The actual liftoff of the swarm, however, is triggered by buzz running, wherein excited bees run in zigzag patterns while pushing their way through the cluster and occasionally buzzing the wings (Lindauer 1955; Esch 1967; Seeley and Tautz 2001). Within a few minutes, the entire swarm takes to the air and is then guided by scouts, which streak through the flying swarm in the direction of the new nest site (Beekman et al. 2005).
Much less is known about the emigration process in swarm-founding social wasps. Best studied in this regard is the Neotropical species Polybia occidentalis. In Guanacaste, Costa Rica, reproductive swarms typically depart from the natal nest at the end of the wet season (Forsyth 1978; Jeanne 1999). Absconding swarms, however, may be produced at any time as a result of brood-raiding by ants (Bouwma et al. 2007) or when a nest is damaged beyond repair by a vertebrate predator, severe weather, or accident. The entire adult population abandons the nest, at first scattering widely, but within 30 minutes coalescing into a single dense cluster on a leafy twig near the nest (Bouwma et al. 2000, 2003). Scouts then begin to explore the surrounding area for a suitable nesting site (Bouwma et al. 2003). Scouts appear to be drawn from the ranks of foragers (Forsyth 1981; West-Eberhard 1982). They inspect several sites at first, but within a day or so narrow the choices to one. After the scouts have reinforced their trail to the chosen nest site by leaving pheromone spots on leaves, they induce the other wasps in the cluster to follow the trail (Jeanne 1975; Naumann 1975). Unlike in honey bees, the clustered individuals of P. occidentalis leave their resting site one by one over a period of 10 to 30 minutes and follow the trail individually (Jeanne 1981a; PJS, personal observation). If there are males in the swarm, they remain behind (Bouwma et al. 2000). Upon arrival at the new site, workers immediately begin construction of the new nest (Jeanne and Bouwma 2002).
Still unknown is how the scouts communicate to the cluster that a site has been chosen and how they stimulate inactives to leave for the new site. Here, for Polybia occidentals, we describe the behavior of wasps on the swarm cluster during the period leading up to and including liftoff. The mean frequency with which scouts bump others in the swarm was found to increase as the departure approaches and that wasps in the cluster shift their behavior from inactivity and receiving bumps to moving over the cluster and bumping others before taking off. This is the first detailed, quantitative study of preemigration swarm behavior for a social wasp and the first systematic study done on multiple swarms of the same species.
Methods
Location
The study was conducted at Las Pumas, a private estate 5 km west of Cañas, Guanacaste, Costa Rica (10°25′N, 85°7′W). Cañas is located in the tropical dry forest life zone and has a wet season extending from May into November. Much of the native vegetation at the site was replaced by pasture, but tropical dry-forest species were still represented. The colonies used in this study nested in trees and shrubs.
Swarming and videotaping
The study site consisted of a pasture containing a scattering of low trees, predominantly Guazuma ulmifolia (Sterculiaceae). Active nests of P. occidentalis were moved into this area for ease of observation. The twig bearing the nest was cut and carried to the study site, where it was spring-clipped to a low twig in a tree in the pasture. Each translocation was done after dark to ensure that all adult wasps remained inside the nest.
The day following the move, the colony was induced to swarm by dismantling the nest in mid-afternoon. This gave the absconding population time to coalesce into a single cluster, but not enough time to find and move to a new nest site before dark. The size of the swarm was determined using a highly accurate predawn census technique described elsewhere (Bouwma et al. 2000). After the swarm had re-clustered following the census, its supporting twig was cut and spring-clipped to a wooden board (30 cm wide × 22.5 cm high) mounted vertically on a tripod and placed in the shade of the tree near where the swarm had re-clustered. We coaxed the swarm from its twig and onto the board by carefully removing one leaf at a time (Figure 1). With the removal of the last bit of twig, the swarm formed a cluster no more than two wasps deep on the board. At this point we began videotaping the swarm, using a digital camcorder (Sony DCH-HC1000) zoomed so that the board almost filled the LCD screen of the camcorder. Videotaping continued until the last wasp departed from the board. Behavioral data were taken by viewing the tapes on a digital videocassette recorder (Sony DHR-1000). One swarm was studied in 1998 and five in 2005. An additional swarm on a twig was videotaped and the video reviewed to determine whether the behavior of unmanipulated swarms differed qualitatively from that of our manipulated swarms.
Preliminary study of the videotapes allowed the discrimination of three categories of individuals on the swarms. “Scouts” were defined as individuals that landed on the board and spent time ranging from a few seconds to several minutes walking or running over the clustered wasps, bumping into them, and stopping only occasionally and briefly to engage in trophallaxis before taking off again. “Foragers” landed on the board and moved more slowly over the clusters of inactives for up to several minutes at a time. They stopped frequently to engage in trophallaxis with both inactives and scouts, but did not exhibit bumping behavior. “Inactives” comprised the largely unmoving wasps clustered densely on the board. These constituted the majority of each swarm and presumably included queens, males, and younger workers. Despite their designation, inactives did in fact become active shortly before departing, as we describe below.
The total number of wasps present on the board was determined every ten minutes by pausing the digital tape of the swarm and counting. This record was used as a measure of emigration progress against which scout behavior was compared. The beginning of emigration was defined as the start of the 10-minute sample period in which the number of wasps present on the board showed at least a 15% drop from the previous 10-min period.
All variables were plotted against time to reveal changes in behavior leading up to and through departure of the last wasp from the board.
Behavior of scouts
In each swarm five scouts were sampled for detailed behavioral analysis every 20 minutes throughout the preemigration and emigration periods recorded on videotape. The scouts selected were the first to land in each of the first five consecutive minutes of each 20-minute period. For each scout the number of bumps it issued during its entire stay on the swarm was recorded. A bump was defined as the butting of the head against any part of the body of another individual in the cluster (Figure 2). No attempt was made to discriminate “intentional” bumps from “incidental” bumps. From these data, bumping frequency (bumps per minute) was calculated for each scout and the mean computed for each set of five scouts. In addition to sampling individual scout behavior, overall scout activity level was quantified as the number of scouts landing on the board during the first five minutes of each 20-min interval.
Behavior of inactives
To explore what might stimulate an inactive wasp to become active and depart, the pre-takeoff behavior of a sample of inactives was analyzed from each swarm. Wasps were selected for the sample by playing the videotape in reverse from the end of emigration and identifying individuals that were not only seen departing from the swarm, but remained clearly visible on the video screen for a full five minutes before departure. Fifty individuals were sampled in each swarm, taking care that they were distributed as uniformly as possible across the entire emigration period. Each selected individual was followed backwards on the tape for five minutes prior to its takeoff. The tape was then played forwards while scoring the behavior of the focal individual at each second up to takeoff. Scored behaviors fell into one of the following categories: inactive (unmoving), moving (walking on the board or cluster), bump received (bumped by another individual), bump given (focal individual bumps another individual), or trophallaxis (mouthpart-to-mouthpart contact with another wasp). Inactives were reliably distinguished from scouts and foragers by being present on the cluster and inactive five minutes before departure. Individuals identified as scouts or foragers were omitted, leaving 35–43 inactives in each sample.
For each swarm, the occurrences of each behavior were summed for all individuals for each one-second interval. These sums were then binned into five-second intervals for smoothing. The mean number of inactives performing each behavior in each five-second interval was calculated. Results are plotted against time as the proportion of inactives performing a given behavior (mean number of inactives performing the behavior divided by the number of inactives in the sample). This can be interpreted as the probability of an inactive's engaging in that behavior in that time interval.
In addition, the total number of bumps given by the sample of inactives from each swarm was divided by the total number of bumps they received to yield a rate of propagation of bumping behavior in each swarm.
Results
The population of wasps on the board rarely existed as one continuous cluster. Most of the time, from two to several dozen semi-distinct clusters were present, with a scattering of individuals on the outskirts of clusters and even fewer completely outside any cluster (Figure 1). After emigration began, clusters diminished in size as wasps became active and departed. After the breakup of a cluster of wasps, remaining individuals tended to either depart or join another cluster.
The variation in observation time among swarms (Table 1) is due in part to the differing times required to coax the wasps from their twig onto the board, and also to the varying times required by swarms to locate a new nest site and emigrate to it. The maximum numbers of wasps on the boards at any one time represented 53–67% of the total swarm population, as determined by the predawn census (Table 1). After emigration began, 10–26 minutes passed before the last wasp left the board (Figure 3).
Table 1.
Data on Polybia occidentalis swarms used in the present study.
Behavior of scouts
Because the camcorder was focused on the plane of the observation board, the videotapes revealed little about the flight paths of wasps as they arrived at and departed from the board. Hovering close to the clusters, which would have been visible on the tapes, was not observed. Once emigration began, visual observation of flying wasps in the greater vicinity of the board suggested that most of these were searching for the scent trail to the new nest site selected by the scouts.
Two patterns were observed with respect to scout behavior. First, the frequency of scout landings remained steady or increased slightly until after the emigration began, at which time landing frequencies decreased (Figure 3). An exception to this trend was swarm #2, in which scout landings continued to climb after the emigration began (Figure 3). The second pattern, observed in all six colonies, was that the rate of bumping by individual scouts steadily increased as emigration approached (Figure 3).
Since scouts were not individually marked, it is possible that on occasion the same scout was included more than once in our samples. However, because the high rates of landing by scouts (Figure 3) suggest that large numbers of scouts were active, we believe that the chance of repeat sampling of the same scout was small.
Behavior of inactives
Beginning five minutes before taking off, a typical inactive experienced a continually rising probability of being bumped by others (Figure 4). Approximately 100 seconds before takeoff the probability that the inactive was either moving or bumping others started to rise more steeply. At approximately 75 seconds before takeoff, the probability of receiving a bump reached its peak value before dropping off dramatically due to its replacement by increasing probabilities of moving and of bumping others (Figure 4). Trophallaxis events were rare (0.5 –5.4% of observations) and were not included in this analysis.
The mean rate of propagation of bumping by inactives (total bumps given divided by total bumps received for each swarm–s sample of inactives) was 0.63 (range across swarms: 0.44–0.84) (Table 2). Although the duration of emigration appears to decrease with increasing propagation rate (Figure 5), the slope of the regression did not significantly differ from zero (p = .18). None of the patterns observed correlated with swarm size.
Viewing the videotape of the unmanipulated swarm on a twig did not reveal any behavior patterns in scouts or inactives that differed from those observed on the boards and reported here. In particular, in neither context were scouts seen burrowing their way through clusters or buzzing their wings as they moved over clustered wasps.
Discussion
Since the maximum counts of wasps present on the board were 53–67% of the pre-dawn censuses and since the mortality rate for the census method used is very small (Bouwma et al. 2000), it was concluded that at any time at least 33–47% of the swarm was actively engaged in either foraging for nectar or scouting for new nest sites. This range is a minimum because the counts on the board included all foragers and scouts that happened to be present at the instant the count was taken.
The increase in bumping frequency by individual scouts as emigration approached may reflect increased enthusiasm for a site just inspected. Another possibility is that the strengthening of the pheromone trail leading to the new site stimulates scouts to bump at higher rates. While a similar trend is seen for scout landing frequencies in some cases, the relationship is not as consistent as the increase in bumping rates by scouts. This may be due to the possibility that while many scouts continue to land on the cluster once a site is chosen, others may be occupied with visiting the site for longer periods of time or reinforcing the pheromone trail, but still bump more frequently when they do visit the cluster. This would account for the lack of a dramatic rise in number of scout landings, but the maintenance of a high frequency of bumping during departure.
Table 2.
Behavior of sampled Polybia occidentals inactives.
The probability of an inactive–s receiving a bump peaked approximately 75 seconds before it took off. From this point on, the probabilities of receiving a bump, giving a bump, and moving total nearly 1.0, indicating that the typical individual has become fully activated. The most notable behavioral change observed in inactives, however, is that they go from being passive receivers of bumps to active producers of bumps before departing.
The short duration of emigration itself relative to how long scouts search for a new site indicates that emigration is a relatively brief and definable event in time. This in turn suggests that it is initiated by one or more cues or signals. Several observations of both scouts and inactives suggest that bumping is a signal that stimulates inactive individuals to become active and take off. First, individual scouts bump inactive swarm-mates at an increasing rate as the emigration event approaches, as expected if scouts use bumping as a signal to activate the rest of the swarm once a nest site has been selected. Second, activation and departure by an inactive are preceded by an increasing rate of being bumped. Again, a marked increase in the number of bumps received before becoming active would be expected if bumps were an activation stimulus. Third, after becoming active, previously inactive individuals tend to bump others before departing. That is, bumping is contagious, leading to its amplification through the swarm. Amplification further supports the notion that bumping is an emigration signal.
These results suggest the following scenario for the initiation of emigration of the temporary cluster. When a scout has visited a high-quality site, perhaps evaluating its attractiveness based on quorum sensing, as in honey bees (Seeley and Visscher 2004), she lays down a pheromone trail on foliage between the site and the cluster (Forsyth 1981; Jeanne 1981a, 1991). Upon returning to the cluster, the scout physically bumps into and runs over inactive individuals at a higher rate than if she had not found a favorable site. This may have the effect of stimulating other scouts on the cluster at the time to follow the trail. As more and more scouts visit the favorable site, the cluster will, as a result, receive much more bumping from the scout population. This increased rate of bumping causes the previously inactive individuals to become active, move, and propagate the signal by bumping others before departing to follow the pheromone trail to the new nest site. This hypothesis would be supported if activity among swarm members could be significantly increased experimentally by simulating bumping using models, or experimentally decreased by keeping scouts away from selected clusters on the swarm.
This scenario does not rule out the possibility that additional signals may be involved in this process. Apoica pallens, for example, apparently initiates emigration by releasing an airborne trail pheromone (Howard et al. 2002). In several species, including P. occidentalis, scouts or foragers have been observed to run rapidly, with wings buzzing, through groups of immobile wasps in clusters on the nest (Forsyth 1981). The effect is to break up these clusters, causing the inactive wasps to become active. Wing buzzing may be associated with pheromone release and dispersal. Pheromone release in other contexts on the nest is often accompanied by wing buzzing. An example is alarm-pheromone release in P. occidentalis, where the buzzing probably serves to disperse the chemical more quickly than by simple release (Jeanne 1981b). As stated above, no such wing buzzing was ever observed during the run-up to emigration in our P. occidentalis swarms, either on our observation boards or on the twig. It is possible that wing buzzing, with or without accompanying pheromone release, may be a stronger stimulus than mere bumping and is used in P. occidentalis when preparing for emigration directly from the nest, but not from the temporary cluster sites used in this study. In other genera, however, wing buzzing does occur on temporary swarm clusters away from the nest (Jeanne 1975; Naumann 1975) and is sometimes accompanied by rapid lateral shaking of the gaster (West-Eberhard 1982). We tentatively conclude that there is little evidence that pheromones were involved in the stimulation of flight in the swarms that were studied.
Other behavior may also be involved in inducing swarm movement. Following nest damage, foragers/scouts of P. occidentalis perform ‘loop flights,’ described as “relatively slow flights or circular motion with the wasp usually facing the nest and looping in a radius of 0.5 to 2 meters from the nest” (Forsyth 1978: 94). It has been suggested that these flights stimulate wasps in the cluster to become active and take flight (West-Eberhard 1982), but there is little direct evidence for this. The increase in loop flights in the minutes before emigration, as reported for P. raui (West-Eberhard 1982) may be an effect of other causes of flight, such as bumping, rather than its direct cause. Slow flights around the swarm as emigration got underway did occur in our swarms, but these were typically not close enough to clusters on the board to suggest that they could provide effective visual and/or chemical stimuli causing flight by inactives. Rather, it is likely that the slow, looping flights around the swarm are performed by non-scouts that have been activated to fly by bumping behavior and are now searching for emigration-trail scent marks left by the scouts. Nevertheless, the cause-effect relationships among the phenomena of bumping, wingbuzzing, and loop flights may differ among species and warrant more careful investigation.
Acceleration of the emigration process via the propagation of bumping by previously inactive wasps may be adaptive. Since wasps follow the emigration trail individually, the trail must be maintained long enough to ensure that all swarm members successfully reach the new site. Distributing some of the responsibility for stimulating inactives to depart onto the inactives themselves accelerates the process, thereby reducing the number of round trips the scouts must make to reinforce the pheromone trail leading to the new nest site. This in turn would reduce both the energy expended by scouts on flight and their risk of predation while en route. Further research will be necessary to determine if higher propagation rates translate into shorter emigration times.
Bumping behavior can be thought of as an activation signal, stimulating inactive individuals to become active and thus serving to regulate swarm emigration. Mechanical signals appear to regulate social activity in other contexts, as well. For example, biting behavior among workers of P. occidentalis stimulates foraging and thus plays a role in regulating task performance (O'Donnell 2001, 2006). Worker-on-worker vibration signals in Apis mellifera appear to have a similar effect (Hyland et al. 2007). Such signals may play a larger role in fine-tuning the regulation of social activities than has been recognized.
Acknowledgments
We are extremely grateful to the Hagnauer family of Costa Rica for allowing us the opportunity to work on their property and for providing housing and logistical support during June of 2005. Peter Bouwma assisted in the field and Erik Nordheim and Peter Crump provided help with statistical analyses. We thank Ken Howard, Teresa Léon, Kevin Loope, Ben Taylor, Thomas Seeley, and two anonymous reviewers for helpful suggestions for improving the manuscript. This study was supported by a 2006–2007 Wisconsin Hilldale Undergraduate/Faculty Research Award and by the College of Agricultural and Life Sciences, University of Wisconsin-Madison. | https://bioone.org/journals/journal-of-insect-science/volume-9/issue-11/031.009.1101/Initiation-of-Absconding-Swarm-Emigration-in-the-Social-Wasp-Polybia/10.1673/031.009.1101.full |
I received an advance copy of this book in return for an honest review.
Released April 22, 2014
224 pages
YA / Contemporary
Find it on Goodreads
Amazon | Barnes & Noble | Book Depository | Indie Bound
Laureth Peak's father has taught her to look for recurring events, patterns, and numbers--a skill at which she's remarkably talented. Her secret: She is blind. But when her father goes missing, Laureth and her 7-year-old brother Benjamin are thrust into a mystery that takes them to New York City where surviving will take all her skill at spotting the amazing, shocking, and sometimes dangerous connections in a world full of darkness. She Is Not Invisible is an intricate puzzle of a novel that sheds a light on the delicate ties that bind people to each other.
Marcus Sedgwick is a very unique and interesting writer. He can take the seemingly ordinary and somehow make it feel extraordinary. While his previous work Midwinterblood had fantasy elements, She Is Not Invisible is straight contemporary told from the point of view of Laureth, a blind teenager, who fears something very bad has happened to her father. Even with the straight forward settings of London and New York City, there is a mythical shimmer of something not quite real world on top of the story simply by Sedgwick’s manner of writing.
Laureth “borrows” her precocious 7-year-old brother and her mother’s credit card after her fears about her father went unacknowledged by her mother. With the help of her brother, she navigates from her London home to New York City with no clue on the whereabouts of her father other than an email from a stranger claiming to have found his notebook.
The major plot points are secondary to the journey Laureth and her little brother takes. Though she is blind, Laureth has developed as many secret talents as possible to hide her disability from the wider world. Just reading how ingenious she is in fooling the world and how cruel people can be to strangers was a fascinating glimpse at what those will disabilities face on a daily basis. Laureth is an incredibly independent character while having to remain frustratingly dependent on others in many situations. This is the first real time she’s been “on her own” and fending for herself, though she has put on the added responsibility of protecting her younger brother by bringing him along.
Due to that previously mentioned “mythical shimmer” element of Sedgwick’s writing, I expected a turn into the fantastical at any moment, but was completely satisfied when nothing magic or unrealistic came into play. It’s a story of misunderstandings, coincidences and what we do when we believe those we love are in danger. The climax of the story is incredibly satisfying with Laureth using what everyone else sees as her faults to protect herself and her brother from imminent danger.
She Is Not Invisible is a short, fast-paced book that is gripping in its drama and compelling in its humanity. Laureth is a unique and unexpected heroine that had a solid head on her shoulders while still being young and ignorant to the greater world. This is a lovely short book that deserves much more attention.
I received an ARC of this book from the publisher. All opinions are my own. | http://www.workingforthemandroid.com/main/2014/6/16/mini-review-she-is-not-invisible-by-marcus-sedgwick.html |
Delhi records highest rainfall in Sept in 19 years, city inundated
Email this article to a friend
Delhi recorded 112.1 mm rainfall in 24 hours ending at 8:30 am on Wednesday, the highest single-day precipitation in September in 19 years, according to India Meteorological Department (IMD).
Pedestrians and motorists wade through waterlogged road during heavy rains, in Gurugram
New Delhi:
The capital had recorded 126.8 mm rainfall on September 13, 2002. The all-time record is 172.6 mm rainfall on September 16, 1963.
The heavy burst of rain submerged several areas, including the diplomatic enclave of Chanakyapuri, in knee-deep water and affected traffic movement in parts of the city. The city gauged 75.6 mm rainfall in just three hours starting 8:30 am. This means that Delhi has already recorded more than the monthly quota of rain on the first two days of the month.
On an average, the capital gauges 125.1 mm precipitation in September every year, according to the IMD. Asked if the IMD expected such heavy rainfall — 187.1 mm since 8:30 am on Tuesday, an official said it is difficult to make “precise predictions” for a small area like Delhi two to three days in advance.
“The predictions are for larger areas, say like Haryana and Punjab. This applies across the world,” he said.
Mahesh Palawat, Vice President, Skymet Weather, a private forecasting agency, said the monsoon pattern is changing due to climate change. | |
"What's with all this nonsense coming out of you? She's just a friend." Brian stared at him and spoke like he was going to quickly lose his patience.
"OK, then. Just let her take a good rest and give her something nutritious to eat for her health when she wakes up."
Brian finally eased up on his tension when he was assured that nothing serious was affecting Janet.
After two o'clock in the afternoon
A Lamborghini SUV car parked in front of the military hospital's gates, and a middle-aged couple walked out of it and hurried into the hospital.
"Welcome, but this is a military hospital and entry for unauthorized people is strictly prohibited."
Two soldiers stopped them in their tracks when they were about to enter the hospital.
"The patient in Room 506 is my daughter, Janet Shao." Ella gave Jane's room number. They didn't know that Jane was sent to a hospital until Lola told them what had happened.
The two soldiers looked at each other: "Wait a moment please." Then, one of the soldiers ran inside and quickly made a phone call.
He returned within two minutes' time, and said,"Please wait here, Mr. Han is coming right now to receive you."
Samuel was so concerned that he could hardly wait any longer. "Call Mr. Liu, the hospital's director, and tell him my name Samuel Shao."
Ella held on to Samuel's arm, and said to the soldiers,"It's no need. Someone is already coming, right? We'll just wait here."
No sooner had Ella finished speaking her words, and Brian, who was dressed in his military uniform, quickly ran up to them, and he asked them,"Hello, are you Janet's parents?" Then he guided Samuel and Ella courteously into the hospital.
"How is my daughter doing?" Samuel stared at Brian and was already trying to guess the relationship between his daughter and the man in front of him.
"Don't worry, Janet is just... it's nothing serious." Before Brian finished speaking, Ella already understood.
As her mother, she knew her daughter well enough, and immediately understood what had happened with her.
In the patient's room
Janet was now up and was drinking her black chicken soup.
"Dad, Mom!" When she saw Samuel and Ella, Janet put down the spoon in her hand and hastily got out of bed and walked towards them.
"Jane, how are you feeling?" Samuel he
Drugged one night by her ex-boyfriend, a mysterious man took advantage of her in an ecstatic night filled with sex. To take her revenge, she married the man, and used him. "As long as I'm alive, I'm still his legal wife, while all of you are just his mistresses.”She remained adamant even when he was involved in scandals with other women...
may be granted permission to skip the military training." Dead silence filled the air.
Daniel didn't say anything, but he didn't hang up either. Janet didn't know what was happening.
"Mr. Si?"
"You got involved in a dubious relationship with a military officer during the training, which has had a bad impact on the company's reputation. Half of your salary will be cut off as punishment."
...
Janet tightly gripped her quilt, and protested,"Daniel Si! Why do you treat me so stringently? Must you act so vicious with me all the time?"
"Janet Shao, pay close attention to your manners!" Daniel could imagine her expressions and reactions on the other side of the line.
"Daniel, let me tell you one thing: from this moment on, I resign from the SL Group!" Again a dead silence appeared after Janet's words.
Finally, a cold voice came from the other side of the line,"If you want to resign, that's OK, but come and tell it to me face to face."
Janet stood up in her bed instantly, and said,"No problem, Daniel! Just you wait!"
Janet was so irritated that she actually forgot about one essential thing. She was only a trainee there, and had only signed a temporary contract. So, if she wanted to resign, she could just stop going to work.
Ella was drinking a glass of water when she saw Janet rushing outside dressed only in her nightgown. She asked her,"Jane, where are you going?"
Janet rolled up her sleeves and shouted: "Mom, don't try to stop me. I have to end this thing with Daniel. He treats me horribly!" | https://www.moboreader.net/Home/BookRead/18155322%20377578 |
Jul 9, 2015 Today we take a look at 15 privacy fence ideas that reflect a range of materials and. [photo from Matthew Cunningham Landscape Design].
Feb 5, 2018 Here's a collection of fence ideas in a variety of styles to get you thinking about what Looking for a modern fence style that preserves privacy without stifling your yard? Photo: Courtesy of Farmhouse Design and Furniture.
Browse 268 photos of Privacy Fence Ideas. Find ideas and inspiration for Mid-sized trendy backyard concrete paver patio photo in London. Save Photo.
See more ideas about Garden fencing, Gardening and Privacy screens. Ideas About Privacy Screens Outdoor Gallery Including Modern Screen Images.
27 Awesome DIY Outdoor Privacy Screen Ideas with Picture. By A high privacy fence produces a sense of privacy under the shade of trees initial to the area.
Jun 1, 2018 67 DIY Backyard Ideas That Won't Break the Bank Arielle Peters Photography/Lakeside Occasions. Transform . Brighten Up a Basic Fence. | http://warrencofire.org/wpc-wall-panel/5889-patio-privacy-fence-ideas-pictures.html |
One of the most persistent characteristics of written user-generated content (UGC) is the use of non-standard words. This characteristic contributes to an increased difficulty to automatically process and analyze UGC. Text normalization is the task of transforming lexical variants to their canonical forms and is often used as a pre-processing step for conventional NLP tasks in order to overcome the performance drop that NLP systems experience when applied to UGC. In this work, we follow a Neural Machine Translation approach to text normalization. To train such an encoder-decoder model, large parallel training corpora of sentence pairs are required. However, obtaining large data sets with UGC and their normalized version is not trivial, especially for languages other than English. In this paper, we explore how to overcome this data bottleneck for Dutch, a low-resource language. We start off with a small publicly available parallel Dutch data set comprising three UGC genres and compare two different approaches. The first is to manually normalize and add training data, a money and time-consuming task. The second approach is a set of data augmentation techniques which increase data size by converting existing resources into synthesized non-standard forms. Our results reveal that, while the different approaches yield similar results regarding the normalization issues in the test set, they also introduce a large amount of over-normalizations.
Comparing MT Approaches for Text Normalization
Claudia Matos Veliz | Orphee De Clercq | Veronique Hoste
Proceedings of the International Conference on Recent Advances in Natural Language Processing (RANLP 2019)
One of the main characteristics of social media data is the use of non-standard language. Since NLP tools have been trained on traditional text material their performance drops when applied to social media data. One way to overcome this is to first perform text normalization. In this work, we apply text normalization to noisy English and Dutch text coming from different social media genres: text messages, message board posts and tweets. We consider the normalization task as a Machine Translation problem and test the two leading paradigms: statistical and neural machine translation. For SMT we explore the added value of varying background corpora for training the language model. For NMT we have a look at data augmentation since the parallel datasets we are working with are limited in size. Our results reveal that when relying on SMT to perform the normalization it is beneficial to use a background corpus that is close to the genre you are normalizing. Regarding NMT, we find that the translations - or normalizations - coming out of this model are far from perfect and that for a low-resource language like Dutch adding additional training data works better than artificially augmenting the data. | http://aclanthology.lst.uni-saarland.de/people/c/claudia-matos-veliz/ |
Which Programming Languages in Demand & Earn The Highest Salaries?
436302 views
Top 10 Best Countries for Software Engineers to Work & High in-Demand Programming Languages
424743 views
50+ Data Structure, Algorithms & Programming Languages Interview Questions for Programmers
256236 views
Which Country Has The Best Programming Language Programmer?
219489 views
A Data Scientist's Guide to Data Structures & Algorithms, Part 1
- O(log n): aka log time
- O(n): aka linear time
- O(n log n)
- O(n²)
- O(n!)
- Search through the list to find the largest number
- Add that number to a new list
- Go to the original list, search through it again to find the next largest number
- Add that number to the new list and so on...
- Pick an element from your list, known as the pivot. The selection of a pivot is important in determining how quickly a quicksort algorithm will run. For now, we can select the last element each time as the pivot. (For additional information on pivot selection, I recommend the Stanford Coursera algorithms course.)
- Partition the list so that all numbers smaller than the pivot are to its left and all numbers greater than the pivot are to its right.
- For each 'half' of the list, you can treat it as a new list with a new pivot and rearrange each half until it is sorted. | https://houseofbots.com/news-detail/3410-A-Data-Scientist's-Guide-to-Data-Structures-&-Algorithms-Part-1 |
The embodiment of the invention provides a model parameter generation method and device, electronic equipment and a readable storage medium, and relates to the technical field of computers. The model parameters comprise texture coordinates of model vertexes, and the method comprises the following steps: segmenting the surface of a target three-dimensional model into a plurality of regions; for each region, generating a two-dimensional image corresponding to the region, the two-dimensional image being a two-dimensional flattened image corresponding to the region, and the two-dimensional image including a mapping point corresponding to a model vertex of the target three-dimensional model; and according to the two-dimensional image corresponding to each region and the corresponding relationship between the mapping point in the two-dimensional image and the model vertex, obtaining texture coordinates of the model vertex of the target three-dimensional model. Therefore, the texture coordinates of the model vertex of the target three-dimensional model can be automatically obtained, and the texture coordinates do not need to be obtained through a long-time-consuming manual mode. | |
Acknowledged authors Gray Smith, Monique wrote Speaking Our Truth: A Journey of Reconciliation comprising 160 pages back in 2017. Textbook and eTextbook are published under ISBN 1459815831 and 9781459815834. Since then Speaking Our Truth: A Journey of Reconciliation textbook was available to sell back to BooksRun online for the top buyback price or rent at the marketplace.
Description
Canada's relationship with its Indigenous people has suffered as a result of both the residential school system and the lack of understanding of the historical and current impact of those schools. Healing and repairing that relationship requires education, awareness and increased understanding of the legacy and the impacts still being felt by Survivors and their families. Guided by acclaimed Indigenous author Monique Gray Smith, readers will learn about the lives of Survivors and listen to allies who are putting the findings of the Truth and Reconciliation Commission into action.
We would LOVE it if you could help us and other readers by reviewing the book
Book review
Congratulations! We have received your book review. | https://booksrun.com/textbooks/9781459815834-speaking-our-truth-a-journey-of-reconciliation |
Assignment:
This week you will write a paper reflecting on “Healthcare Administrators – Contemporary Issues and Common Challenges” and answer the following questions:
- The organization you just started working for as a healthcare administrator has a current shortage of nurses and high turnover rates. Your priority is to propose a solution to recruit and retain nursing staff. Discuss 3 viable options for ameliorating the current nursing shortage.
- For each of the options proffered, summarize the impact on costs, quality, and access to healthcare services from the administrator/organizational perspective.
- Based on the assessment of costs, quality, and access for each of the 3 options, choose the best option with appropriate justification.
Assignment Expectations-
Length: 500 words per essay prompt (1500 total for this assignment)
Structure: Include a title page and reference page in APA style. These do not count towards the minimal word amount for this assignment.
References: Use the appropriate APA style in-text citations and references for all resources utilized to answer the questions. Include at least three (3) scholarly citations to support your claims.
Format: Save your assignment as a Microsoft Word document (.doc or .docx).
File name: Name your saved file according to your first initial, last name, and the assignment number (for example, “RHall Assignment 1.docx”)
What Students Are Saying About Us.......... Customer ID: 12*** | Rating: ⭐⭐⭐⭐⭐
"Honestly, I was afraid to send my paper to you, but you proved you are a trustworthy service. My essay was done in less than a day, and I received a brilliant piece. I didn’t even believe it was my essay at first 🙂 Great job, thank you!"
.......... Customer ID: 11***| Rating: ⭐⭐⭐⭐⭐
"This company is the best there is. They saved me so many times, I cannot even keep count. Now I recommend it to all my friends, and none of them have complained about it. The writers here are excellent." | https://essayfount.com/health-care-administrator-contemporary-issues-and-common-challenges/ |
CROSS REFERENCE TO RELATED APPLICATIONS
FIELD
This application is based on and claims the benefit of priority from the prior Japanese Patent Application No. 2019-51079, filed on Mar. 19, 2019, the entire contents of which are incorporated herein by reference.
The present invention relates to a display device and a manufacturing method of the display device. For example, the present invention relates to a display device with a pixel including a liquid crystal element and a manufacturing method thereof.
BACKGROUND
A liquid crystal display device is represented as one of the most commonly used display devices. For example, liquid crystal display devices have been widely utilized as an interface of a variety of electronic devices including not only a television device but also a computer, a tablet, a portable telephone, and the like.
In recent years, many small-size portable electronic terminals are designed so that the region (frame region or peripheral region) other than the display region is as small as possible in order to expand a display surface for improved display visibility and improved designability. In such a design strategy, the region required by the elements supporting the functions of the electronic terminals, such as an image-capturing element, a sensor, and an audio inputting/outputting device, is strictly limited. Hence, it has been proposed to form a cutoff or an opening in a part of a display and arrange an image-capturing element, a sensor, or the like therein. For example, it is disclosed in Japanese Patent Application Publication No. 2010-15015 and Japanese Patent No. 2869452 that a display device is configured so that a structure or a driving method of a portion of a display region is different from that of the other portion to form a light-transmitting region in the portion of the display region. The use of this light-transmitting region allows a variety of elements to be arranged at a position overlapping with the display region.
SUMMARY
An embodiment of the present invention is a display device. The display device possesses an array substrate, a pixel, a dimming element, and a counter substrate. The pixel is located over the array substrate and includes a first electrode, a second electrode, and a liquid crystal layer over the first electrode and the second electrode. The dimming element is located over the array substrate and includes a third electrode, the liquid crystal layer over the third electrode, and a fourth electrode over the liquid crystal layer. The counter substrate is located over the fourth electrode.
An embodiment of the present invention is a display device. The display device possesses an array substrate, a pixel, a dimming element, a black matrix, a counter substrate, a first linear polarizing plate, a second linear polarizing plate, and a third linear polarizing plate. The pixel is located over the array substrate and includes a first electrode, a second electrode, and a liquid crystal layer over the first electrode and the second electrode. The dimming element is located over the array substrate and includes a third electrode, a fourth electrode, and the liquid crystal layer over the third electrode and the fourth electrode. The black matrix is located over the liquid crystal layer. The counter substrate is located over the black matrix. The first linear polarizing plate is located under the array substrate and overlaps with the pixel. The second linear polarizing plate is located over the counter substrate and overlaps with the pixel and the dimming element. The third linear polarizing plate is located under the array substrate and overlaps with the dimming element. The black matrix overlaps with the first linear polarizing plate and the third linear polarizing plate.
An embodiment of the present invention is a manufacturing method of a display device. The manufacturing method includes forming a first electrode over an array substrate, forming an interelectrode insulating film over the first electrode, forming a second electrode and a third electrode over the interelectrode insulating film, forming a fourth electrode over a counter electrode, and forming a liquid crystal layer between the array substrate and the counter substrate so that the first electrode, the second electrode, the third electrode, and the fourth electrode are sandwiched by the array substrate and the counter electrode, the fourth electrode overlaps with the third electrode, and the first electrode and the second electrode are exposed from the fourth electrode.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1
is a schematic top view of a display device according to an embodiment of the present invention;
FIG. 2
is a schematic cross-sectional view of a display device according to an embodiment of the present invention;
FIG. 3
is a schematic top view of pixels and a dimming element of a display device according to an embodiment of the present invention;
FIG. 4
is a schematic top view of a pixel of a display device according to an embodiment of the present invention;
FIG. 5
is a schematic cross-sectional view of a pixel of a display device according to an embodiment of the present invention;
FIG. 6
is a schematic top view of a dimming element of a display device according to an embodiment of the present invention;
FIG. 7
is a schematic cross-sectional view of a dimming element of a display device according to an embodiment of the present invention;
FIG. 8A
FIG. 8B
and are schematic perspective views for explaining the operation of a display device according to an embodiment of the present invention;
FIG. 9A
FIG. 9B
and are schematic perspective views for explaining the operation of a display device according to an embodiment of the present invention;
FIG. 10A
FIG. 10B
and are schematic perspective views for explaining the operation of a display device according to an embodiment of the present invention;
FIG. 11A
FIG. 11B
and are respectively schematic top and cross-sectional views of a dimming element of a display device according to an embodiment of the present invention;
FIG. 12A
FIG. 12B
and are schematic top views of a dimming element of a display device according to an embodiment of the present invention;
FIG. 13A
FIG. 13B
and are respectively schematic cross-sectional and top views of a dimming element of a display device according to an embodiment of the present invention;
FIG. 14
is a schematic top view of a dimming element of a display device according to an embodiment of the present invention;
FIG. 15
is a schematic cross-sectional view of a dimming element of a display device according to an embodiment of the present invention;
FIG. 16
is a schematic cross-sectional view of a pixel and a dimming element of a display device according to an embodiment of the present invention;
FIG. 17
is a schematic cross-sectional view of a pixel and a dimming element of a display device according to an embodiment of the present invention;
FIG. 18A
FIG. 18B
and are schematic perspective views for explaining the operation of a display device according to an embodiment of the present invention;
FIG. 19A
FIG. 19C
to are schematic cross-sectional views for explaining a manufacturing method of a display device according to an embodiment of the present invention;
FIG. 20A
FIG. 20B
and are schematic cross-sectional views for explaining a manufacturing method of a display device according to an embodiment of the present invention;
FIG. 21A
FIG. 21C
to are schematic cross-sectional views for explaining a manufacturing method of a display device according to an embodiment of the present invention; and
FIG. 22
is a schematic cross-sectional view for explaining a manufacturing method of a display device according to an embodiment of the present invention.
DESCRIPTION OF EMBODIMENTS
First Embodiment
1. Outline Structure
2. Structure of Display Module
3. Operation
4. Modified Example
Second Embodiment
Third Embodiment
Fourth Embodiment
Hereinafter, each embodiment of the present invention is explained with reference to the drawings. The invention can be implemented in a variety of different modes within its concept and should not be interpreted only within the disclosure of the embodiments exemplified below.
The drawings may be illustrated so that the width, thickness, shape, and the like are illustrated more schematically compared with those of the actual modes in order to provide a clearer explanation. However, they are only an example, and do not limit the interpretation of the invention. In the specification and the drawings, the same reference number is provided to an element that is the same as that which appears in preceding drawings, and a detailed explanation may be omitted as appropriate. A reference number is used when plural structures which are the same as or similar to each other are collectively represented, while a hyphen and a natural number are added behind the reference number when these structures are independently represented.
In the present specification and claims, when a plurality of films is formed by processing one film, the plurality of films may have functions or roles different from each other. However, the plurality of films originates from a film formed as the same layer in the same process and has the same layer structure and the same material. Therefore, the plurality of films is defined as films existing in the same layer.
In the specification and the claims, unless specifically stated, when a state is expressed where a structure is arranged “over” another structure, such an expression includes both a case where the substrate is arranged immediately above the “other structure” so as to be in contact with the “other structure” and a case where the structure is arranged over the “other structure” with an additional structure therebetween.
In the specification and the claims, an expression “a structure is exposed from another structure” means a mode in which a part of the structure is not covered by the other structure and includes a mode where the part uncovered by the other structure is further covered by another structure.
100
In the present invention, a structure of a display device according to an embodiment of the present invention is described.
100
100
100
300
100
200
400
300
400
FIG. 1
FIG. 2
FIG. 1
FIG. 1
FIG. 2
FIG. 1
FIG. 2
FIG. 2
The outline structure of the display device is explained using and . is a schematic top view of the display device , and a schematic view of a cross section along a chain line A-A′ in is illustrated in . As shown in and , the display device possesses a display module . The display device may further include a backlight unit and a photoelectric transducer underneath the display module . In , an example is demonstrated where two photoelectric transducers are provided.
300
1-1. Display Module
FIG. 2
FIG. 1
300
302
304
306
308
302
304
306
302
304
302
304
306
302
304
302
308
308
302
304
306
308
302
304
306
100
As shown in , the display module possesses a pair of substrates and fixed to each other with a sealing material and a liquid crystal layer sealed with the pair of substrates and and the sealing material . Hereinafter, the substrates and are referred to as an array substrate and a counter substrate , respectively. The sealing material is sandwiched by the array substrate and the counter substrate and provides a single closed shape on the array substrate as shown in . The inside of this closed shape is filled with the liquid crystal layer . Thus, a single liquid crystal layer is structured in this single space formed by the array substrate , the counter substrate , and the sealing material . A unit composed of this single crystal layer , the array substrate , the counter substrate , and the sealing material is a liquid crystal cell. One display device possesses a single liquid crystal cell.
300
310
312
302
304
312
310
312
300
FIG. 2
The display module may further include a pair of linear polarizing plates and at least one pair of quarterwave plates (hereinafter, referred to as a λ/4 plate) each sandwiching the array substrate and the counter substrate . The pair of λ/4 plates is sandwiched by the pair of linear polarizing plates . In , two pairs of λ/4 plates are illustrated. The detailed structure of the display module is described later.
1-2. Backlight Unit
FIG. 2
FIG. 2
200
302
202
204
202
214
204
204
206
208
200
300
212
As shown in , the backlight unit is disposed under the array substrate and possesses, as fundamental elements, a reflecting plate , a light-guiding plate over the reflecting plate , a light source provided on a side surface of the light-guiding plate , and a variety of optical films formed over the light-guiding plate . The structure of the optical films is arbitrarily determined, and an optical film in which a prism sheet and a light-diffusing film are combined is demonstrated as an example in . The backlight unit is fixed to the display module with an adhesive layer .
214
200
204
214
204
204
300
202
300
204
300
204
206
204
300
208
The light source includes a light-emitting element such as a light-emitting diode and a cold-cathode tube. The light-emitting element is preferred to have an emission wavelength covering the whole of the visible light region. The backlight unit and the light-guiding plate are arranged so that the light from the light-source enters into the light-guide plate , and the light-guiding plate is configured to diffuse and reflect the incident light in the inside thereof and to uniformly emit the light in the direction toward the display module . The reflecting plate is provided on an opposite side to the display module with respect to the light-guiding plate and is configured to reflect the light radiating to the opposite side to the display module and return the light to the light-guiding plate . The prism sheet is provided in order to collect the light emitted from the light-guiding plate and radiate the collected light toward the front direction of the display module , and a plurality of prism-shaped depressions and projections is arranged in a stripe form on a surface thereof, for example. The light-diffusing film is a member for making the light uniform and includes light-diffusing fine particles and a polymer matrix fixing the fine particles.
216
204
202
200
216
400
216
400
216
206
208
FIG. 2
FIG. 2
At least one through hole passing through at least the light-guiding plate and the reflecting plate is formed in the backlight unit . The number of the through holes may be the same as the number of the photoelectric transducers , and an example is shown in where two through holes respectively corresponding to two photoelectric transducers are disposed. In the example demonstrated in , through holes overlapping with the through holes are also formed in the prism sheet and the light-diffusing film . It is not always necessary to form these through holes.
1-3. Semiconductor Element
400
216
400
216
400
FIG. 2
The photoelectric transducer is provided so as to overlap with the through hole . In , a state is demonstrated where two photoelectric transducers respectively overlap with the through holes . The function and the structure of the photoelectric transducer may be arbitrarily selected, and an image-capturing element such as a CCD (Charge-Coupled Device) image sensor and a CMOS (Complementary Metal Oxide Semiconductor) image sensor, a photosensor, and the like are exemplified.
300
Hereinafter, the structure of the display module is explained in detail.
2-1. Layout
302
322
324
326
328
330
324
324
324
322
324
FIG. 1
FIG. 1
A variety of patterned semiconductor films, insulating films, and conductive films is stacked over the array substrate , and a plurality of pixels , a dimming element , circuits for driving these elements (scanning-line driver circuits and signal-line driver circuit ), terminals , and the like are structured by these films (). An example is demonstrated in in which two dimming elements are provided. However, the number of the dimming elements is not limited and may be one. Three or more dimming elements may be included. As described below, liquid crystal elements different in operation mode from each other are respectively arranged in the pixel and the dimming element .
322
200
100
322
308
322
322
322
320
322
216
The pixel is structured to allow a part of the light from the backlight unit to pass toward the outside of the display device and serves as a minimum unit providing information of a single color. The pixel possesses a pixel circuit and the liquid crystal layer overlapping with the pixel circuit as fundamental elements. The arrangement of the plurality of pixels is not limited, and the plurality of pixels may be arranged in a variety of arrangements such as the tripe arrangement, the mosaic arrangement, and the delta arrangement. A region defined by the plurality of pixels is a display region . The pixels are arranged so as not to overlap with the thorough hole .
324
324
320
324
322
324
322
324
FIG. 3
FIG. 3
A schematic top view of the dimming element and the periphery thereof is shown in . The dimming element is located in the display region , and one dimming element is arranged so as to be surrounded by the plurality of pixels . The dimming element may be configured so that the size (area) thereof is larger than that of each pixel . The shape of the dimming element is not limited to a circular shape shown in and may be arbitrarily determined. For example, an arbitral shape such as a quadrangle including a square, a rectangle, a trapezoid, and the like, a polygon, and an ellipse may be employed.
324
216
324
400
322
324
324
308
324
400
The dimming element is arranged at the position overlapping with the through hole . Thus, the dimming element may overlap with the photoelectric transducer . A pixel circuit having a different structure from that of the pixel circuit in the pixel is also formed in the dimming element , and the dimming element possesses this pixel circuit and the liquid crystal layer overlapping with the pixel circuit as fundamental elements. The dimming element has a function to control transmissivity of outside light, which allows the amount of the light incident on the photoelectric transducer to be adjusted.
326
328
320
322
324
330
326
328
322
324
330
326
328
322
324
308
200
322
324
A variety of signal lines (a gate line, an image-signal line, an initializing signal line, a power source line, and the like), which is not illustrated, extend from the scanning-line driver circuits and the signal-line driver circuit to the display region , and these signal lines are electrically connected to the respective pixels and the dimming element . A connector such as a flexible printed circuit substrate (FPC), which is not illustrated, is connected to the terminals , and the signals and a power source supplied from an external circuit (not illustrated) are provided to the scanning-line driver circuits , the signal-line driver circuit , the pixels , and the dimming element through the connector and the terminals . The scanning-line driver circuits and the signal-line driver circuit operate the pixel circuits in the pixels and the dimming element on the basis of the supplied signals and power source, by which orientation of the liquid crystal molecules in the liquid crystal layer is controlled, the amount of the light provided from the backlight unit is controlled in the pixels , and the amount of the incident outside light is controlled in the dimming element .
2-2. Pixel
322
322
350
348
346
350
308
350
348
370
1
370
2
322
340
326
342
342
344
FIG. 4
FIG. 4
FIG. 5
An example of the layout of the pixels is shown in , whereas a schematic view of a cross section along a chain line B-B′ in is shown in . As shown in these figures, the pixel circuit in the pixel includes a pixel electrode , a common electrode , a transistor electrically connected to the pixel electrode , the liquid crystal layer provided over the pixel electrode and the common electrode , orientation films (a first orientation film - and a second orientation film -), and the like. The pixel is electrically connected to the gate line extending from the scanning-line driver circuit , the image signal line extending from the signal-line driver circuit , and the power-source line . The pixel circuit shown in these figures is merely an example and may include other elements such as a storage capacitor and a transistor.
FIG. 5
302
360
302
360
302
As shown in , the pixel circuit is disposed over the array substrate through an undercoat . The array substrate includes a material selected from glass, quartz, a plastic containing a polymer such as a polyamide, or the like. The undercoat functions as a protection film for preventing diffusion of impurities in the array substrate and is composed of one or a plurality of films including a silicon-containing inorganic compound such as silicon oxide and silicon nitride.
346
352
362
340
364
342
354
340
352
346
342
346
352
362
364
354
352
346
346
The transistor is structured by a semiconductor film , a part of a gate insulating film , a part of the gate line , a part of an interlayer insulating film , a part of the image-signal line , a drain electrode , and the like. A part of the gate line overlapping with the semiconductor film functions as a gate electrode of the transistor , while a part of the aforementioned image-signal line functions as a source electrode of the transistor . Openings reaching the semiconductor film are formed in the gate insulating film and the interlayer insulating film , and the drain electrode and the source electrode are electrically connected to the semiconductor film through these openings. In the example demonstrated here, the transistor is a top-gate type transistor. However, the transistor may be a transistor having another structure (a bottom-gate type transistor, etc.).
366
346
346
366
A leveling film is disposed over the transistor , by which depressions and projections formed by the transistor are absorbed to provide a flat surface. The leveling film includes a polymer material such as an acrylic resin, an epoxy resin, a polysiloxane resin, and a polyamide.
348
366
348
322
348
340
322
340
348
342
322
342
322
FIG. 4
The common electrode is arranged over the leveling film . The common electrode is formed to be shared by the plurality of pixels . For example, the common electrode is arranged parallel to the gate line and shared by the plurality of pixels connected to one gate line as shown in . Although not illustrated, the common electrode may be arranged parallel to the image-signal line to be shared by the plurality of pixels connected to one image-signal line or may be formed to be shared by all of the pixels .
344
348
348
344
342
342
348
344
348
The power-source line in contact with the common electrode is disposed over the common electrode . The power-source line may be arranged to overlap with the image-signal line . A potential (Vcom) slightly lower than an intermediate potential between the maximum and minimum potentials of the image signal is supplied to the image-signal line , and this potential is provided to the common electrode . Although not illustrated, the power-source line may be arranged under the common electrode .
350
348
344
368
350
354
366
368
342
350
346
350
322
350
350
350
350
350
350
350
FIG. 4
The pixel electrode is formed over the common electrode and the power-source line through an interelectrode insulating film . The pixel electrode is electrically connected to the drain electrode through an opening formed in the leveling film and the interelectrode insulating film . With this structure, the image signal supplied to the image-signal line is provided to the pixel electrode through the transistor , and the potential of the pixel electrode is independently controlled for every pixel in accordance with the image signal. As shown in , the pixel electrode possesses a slit having a closed shape, and a part of the pixel electrode is exposed from the slit. Although not illustrated, the pixel electrode may have a cutoff instead of a slit. Alternatively, the pixel electrode may simultaneously possess a slit and a cutoff. Note that a slit is an opening formed in the pixel electrode and having a closed shape, and its outer circumference corresponds to an internal circumference of the pixel electrode . When this outer circumference of the opening is a part of an outer circumference of the pixel electrode , the opening is defined as a cutoff.
370
1
350
370
1
308
370
1
370
1
370
1
370
370
1
The first orientation film - is disposed over the pixel electrode . The first orientation film - has a polymer such as a polyimide, and a surface thereof is turned to control the orientation of the liquid crystal molecules included in the liquid crystal layer . Specifically, a rubbing treatment is performed on the surface of the first orientation film -. Alternatively, polarized ultraviolet light is applied once or a plurality of times in order to orient the liquid crystalline unit in the first orientation film - when the first orientation film - is formed using a photo-curable resin having a liquid crystalline unit. Alternatively, a film of a photo-decomposable type polyimide or the like may be formed, and then polarized ultraviolet light may be applied. Hereinafter, the treatments for orientation control performed on the orientation films are collectively referred to an orientation treatment. The direction in which the liquid crystal molecules orient over the first orientation film -, which is subjected to the orientation treatment, in the absence of an electric field is referred to an orientation treatment direction.
374
376
304
200
374
322
374
322
376
346
342
340
372
374
376
304
304
370
2
374
376
370
1
370
2
370
1
A color filter and a black matrix are formed over the counter substrate . A color is provided to the light from the backlight unit by the color filter , which enables the pixel to provide color information. The color filter is configured so that optical properties thereof are different between the adjacent pixels . The black matrix is configured to exhibit a low transmissivity with respect to visible light or not to substantially transmit visible light and is formed so as to cover the transistor , the image-signal line , and the gate line . As an optional element, an overcoat covering the color filter and the black matrix may be disposed over the counter substrate . The counter substrate further possesses the second orientation film - covering the color filter and the black matrix . Similar to the first orientation film -, the orientation treatment is also performed on the second orientation film -, and the orientation treatment direction thereof is the same as that of the first orientation film -.
308
302
304
350
348
370
1
370
2
302
304
308
308
306
302
304
100
308
322
The liquid crystal layer is provided between the array substrate and the counter substrate , and the pixel electrode , the common electrode , the first orientation film -, and the second orientation film - are sandwiched by the array substrate and the counter electrode . The liquid crystal layer includes a positive-type liquid crystal having a positive dielectric anisotropy. As described above, the liquid crystal layer is sealed in the space formed by the sealing material , the array substrate , and the counter substrate , and the display device possesses a single liquid crystal cell. Hence, one liquid crystal layer is shared by all of the pixels .
302
304
378
302
378
322
322
378
302
302
304
A distance between the array substrate and the counter substrate is controlled by a spacer formed over the array substrate , for example. The spacer includes a polymer such as an acrylic resin and an epoxy resin and is formed for every pixel or for every plural pixels . The spacer may be formed over the array substrate . Alternatively, a sphere spacer which is not fixed to the array substrate and the counter substrate may be used.
100
310
310
1
310
2
310
320
322
310
302
304
350
348
100
310
310
As described above, the display device possesses the pair of linear polarizing plates (a first linear polarizing plate - and a second linear polarizing plate -). The pair of linear polarizing plates overlaps with the display region and is arranged so as to sandwich the pixels . More specifically, the pair of linear polarizing plates is arranged so as to sandwich the array substrate and the counter substrate and overlap with the pixel electrode and the counter electrode . In the display device , the pair of linear polarizing plates has a crossed Nichol relationship. That is, the pair of linear polarizing plates is arranged so that the transmission axes thereof perpendicularly intersect with each other.
322
308
370
1
370
2
302
350
350
350
348
302
302
350
348
308
322
322
350
348
308
350
348
In each pixel , the initial orientation of the liquid crystal molecules included in the liquid crystal layer is mainly determined by the orientation treatment directions of the first orientation film - and the second orientation film -. In the absence of an electric field, the liquid crystal molecules orient along the orientation treatment directions substantially parallel to a surface of the array substrate . When a potential difference is provided between the pixel electrode and the common electrode , this initial orientation varies. That is, the electric field generated between the pixel electrode and the common electrode and substantially parallel to the surface of the array substrate causes the liquid crystal molecules to rotate in a plane substantially parallel to the surface of the array substrate . Accordingly, the orientation direction of the liquid crystal molecules changes, and the control of this change with the potential difference between the pixel electrode and the common electrode enables the light transmissivity of the liquid crystal layer to be controlled, thereby realizing gradation display. Accordingly, an FFS (Fringe Field Switching) liquid crystal element is formed in each pixel . Here, a pair of electrodes and a portion of a liquid crystal layer driven by the pair of electrodes are collectively defined as a liquid crystal element in the present specification. Therefore, each pixel possesses a liquid crystal element including the pixel electrode , the common electrode , and a part of the liquid crystal layer driven by the pixel electrode and the common electrode
322
348
322
348
350
Although not illustrated, the liquid crystal element in each pixel may be an IPS (In-Plane Switching) liquid crystal element. In this case, the common electrode also has a slit and/or a cutoff, and the pixel is configured so that the common electrode exists in the same layer as the pixel electrode .
2-3. Dimming Element
324
324
349
351
349
308
349
351
324
358
328
358
328
349
358
349
326
349
400
FIG. 6
FIG. 6
FIG. 7
FIG. 6
A top view of the dimming element is shown in , whereas a schematic view of a cross section along a chain line C-C′ in is shown in . As demonstrated in these figures, the pixel circuit of the dimming element includes a lower electrode , an upper electrode overlapping with the lower electrode , and the liquid crystal layer arranged between the lower electrode and the upper electrode . The dimming element is electrically connected to a dimming-controlling line extending from the signal-line driver circuit . The dimming-controlling line is provided with a dimming-controlling signal from the signal-line driver circuit , and a potential of this signal is supplied to the lower electrode through the dimming-controlling line . The lower electrode may be formed so as to cover the whole of the through hole as shown in . Alternatively, although not illustrated, the lower electrode may be formed so as to cover the whole of the light-receiving surface of the photoelectric transducer .
322
324
302
360
358
302
360
362
364
322
366
356
358
366
349
366
356
349
358
349
324
324
349
351
349
308
Similar to the pixel circuit of the pixel , the pixel circuit of the dimming element is also disposed over the array substrate through the undercoat . The dimming element is formed over the array substrate via the undercoat as well as the gate insulating film and the interlayer insulating film extending from the pixel , over which the leveling film is arranged. An opening reaching the dimming-controlling line is formed in the leveling film , and the lower electrode is arranged over the leveling film so as to cover this opening , by which the lower electrode and the dimming-controlling line are electrically connected to each other. In the present embodiment, one lower electrode is arranged in one dimming element . In other words, one dimming element possesses one liquid crystal element including one lower electrode , one upper electrode overlapping with the lower electrode , and a part of the liquid crystal layer therebetween.
349
370
1
322
370
1
349
322
322
The lower electrode is covered by the first orientation film - extending from the pixel . Therefore, the first orientation film - over the lower electrode is shared by the pixel , and the orientation treatment direction thereof is the same as that in the pixel .
304
351
351
348
348
372
322
351
304
372
370
2
322
351
304
370
1
370
2
322
322
374
324
372
304
376
324
358
322
349
358
349
FIG. 7
The counter substrate is provided with the upper electrode . The upper electrode may be configured so that the same potential (Vcom) as that of the common electrode is supplied or a potential different from that of the common electrode is supplied. When the overcoat is disposed in the pixel , the upper electrode is formed over the counter electrode through the overcoat . The second orientation film - extending from the pixel and covering the upper electrode is also formed over the counter substrate . Similar to the first orientation film -, this second orientation film - is also shared by the pixel , and the orientation treatment direction thereof is the same as that in the pixel . Note that the color filter may not be formed in the dimming element . In this case, the overcoat may be in contact with the counter substrate as shown in . The black matrix may be formed in the dimming element so as to overlap with the dimming-controlling line , for example. Although not illustrated, similar to the pixels , a transistor electrically connected to the lower electrode and the dimming-controlling line may be provided therebetween to supply the dimming-controlling signal to the lower electrode through the transistor.
308
349
351
349
351
370
1
370
2
302
304
306
302
308
324
322
324
322
308
322
324
322
378
324
349
351
The liquid crystal layer is arranged between the lower electrode and the upper electrode , and the lower electrode , the upper electrode , the first orientation film -, and the second orientation film - are sandwiched by the array substrate and the counter substrate . As described above, the sealing material forms a single closed shape over the array substrate . Hence, the liquid crystal layer is not divided between the dimming element and the pixel and is shared by the dimming element and the pixel . In other words, one liquid crystal layer is shared by all of the pixels and the dimming element . Similar to the pixel , the spacer may be disposed in the dimming element to maintain the distance between the lower electrode and the upper electrode .
100
310
312
312
1
312
2
302
304
324
312
322
322
312
312
As described above, the display device possesses the pair of linear polarizing plates and the pair of λ/4 plates . The pair of λ/4 plates (a first λ/4 plate - and a second λ/4 plate -) is respectively arranged under the array substrate and over the counter substrate to sandwich the dimming element . The pair of λ/4 plates does not overlap with the pixel . In other words, the pixels are exposed from the pair of λ/4 plates . The slow axes of the pair of λ/4 plates perpendicularly intersect with each other.
310
302
304
324
312
324
310
312
310
322
310
322
324
322
310
324
310
1
322
324
310
2
322
324
312
310
In addition, the pair of linear polarizing plates is respectively disposed under the array substrate and over the counter substrate to sandwich the dimming element and the pair of λ/4 plates . Therefore, in the region where the dimming element is formed, the pair of linear polarizing plates and the pair of λ/4 plates overlap with each other, and the latter is sandwiched by the former. Since the pair of linear polarizing plates is arranged so as to overlap with the pixels , the pair of linear polarizing plates is shared by the pixel and the dimming element . Similar to the pixel , the transmission axes of the linear polarizing plates also perpendicularly intersect with each other in the dimming element . Moreover, the direction of the transmission axis of the first linear polarizing plate - is the same between the pixel and the dimming element , and the direction of the transmission axis of the second linear polarizing plate - is also the same between the pixel and the dimming element . The slow axes of the pair of λ/4 plates respectively shift from the transmission axes of the pair of linear polarizing plates by 45°.
324
308
370
1
370
2
302
370
322
324
349
351
349
351
302
302
349
351
308
324
100
In the dimming element , the initial orientation of the liquid crystal molecules included in the liquid crystal layer is also mainly determined by the orientation treatment directions of the first orientation film - and the second orientation film -. In the absence of an electric field, the liquid crystal molecules orient along the orientation treatment direction substantially parallel to the surface of the array substrate . Since the orientation treatment directions of the orientation films are the same as each other between the pixel and the dimming element , the orientation direction of the liquid crystal molecules is also the same as each other. When a potential difference is provided between the lower electrode and the upper electrode , this initial orientation varies. That is, the electric field generated between the lower electrode and the upper electrode and substantially perpendicular to the surface of the array substrate causes the liquid crystal molecules to be raised (tilted) from the surface of the array substrate so as to diagonally or perpendicularly orient from the surface. The control of this change in orientation state with the potential difference between the lower electrode and the upper electrode enables the control of the light transmissivity of the liquid crystal layer . Accordingly, an ECB (Electrically Controlled Birefringence) liquid crystal element is formed in the dimming element . Hence, the display device possesses two kinds of liquid crystal element different in operation mode.
324
322
351
349
324
310
312
310
312
FIG. 8A
FIG. 8B
FIG. 9A
FIG. 9B
Operation of the dimming element is explained using and , whereas operation of the pixel is explained using and . For visibility, the upper electrode and the lower electrode in the dimming element are not illustrated in these figures. Although the linear polarizing plates and the λ/4 plates are separately illustrated, this is merely for convenience of explanation, and these items may be in contact with each other. The dotted arrows shown over the linear polarizing plates and the λ/4 plates respectively express the transmission axis and the slow axis thereof, and the solid arrows express the polarizing direction of the light.
3-1. Dimming Element
(1) Initial State
324
370
1
370
2
370
1
370
2
FIG. 8A
A schematic perspective view of the dimming element in the initial state, i.e., in an off state, is shown in . In this state, the orientation of the liquid crystal molecules illustrated as ellipses is determined by the orientation treatment directions of the first orientation film - and the second orientation film -. Since the orientation treatment directions of the first orientation film - and the second orientation film - are the same as each other, the liquid crystal molecules substantially orient along the orientation treatment direction in the absence of an electric field.
302
310
1
304
310
2
310
1
312
1
312
1
310
1
312
1
308
308
312
2
312
1
312
2
312
1
310
1
310
1
310
2
312
2
310
2
304
302
310
1
324
324
Here, a case is considered where the light proceeds from the array substrate side (i.e., the side of the first linear polarizing plate -) toward the counter electrode side (i.e., the side of the second linear polarizing plate -). This light indicated by the hollow arrow becomes linearly polarized light (a) when passing through the first linear polarizing plate -. When this linearly polarized light (a) next enters into the first λ/4 plate -, the phase shifts by π/2 because the slow axis of the first λ/4 plate - shifts from the transmission axis of the first linear polarizing plate - by 45°. As a result, the light becomes circularly polarized light (b) when passing through the first λ/4 plate -. When this circularly polarized light (b) passes through the liquid crystal layer , this light becomes inverted circularly polarized light (c) because the phase is π-retarded due to the anisotropy of the refractive index of the liquid crystal molecules included in the liquid crystal layer . When this circularly polarized light (c) further enters into the second λ/4 plate -, this light is −π/2-retarded because the first λ/4 plate - and the second λ/4 plate - are in an orthogonal relationship. As a result, the phase difference from the light incident on the first λ/4 plate - becomes π, and therefore, the circularly polarized light (c) becomes linearly polarized light (d). The polarizing axis at this time perpendicularly intersects with that of the polarized light (a) formed by the first linear polarizing plate -. Since the first linear polarizing plate - and the second linear polarizing plate - are in the cross Nichol relationship with each other, the linearly polarized light (d) generated when passing through the second λ/4 plate - is capable of passing through the second linear polarizing plate -. The same is applied when the outside light proceeds from the counter substrate side to the array substrate side. Thus, the outside light is capable of passing through the first linear polarizing plate -. Hence, the light can pass through the dimming element , and the dimming element functions as the so-called normally white element.
(2) Operation
324
349
351
302
312
1
310
2
310
2
310
1
310
2
310
1
324
310
2
310
1
FIG. 8B
A schematic perspective view of the dimming element in the case where a potential difference is provided between the lower electrode and the upper electrode , that is, in an on state, is illustrated in . When this potential difference exceeds the threshold voltage, the liquid crystal molecules gradually rise from the surface of the array substrate , and the tilt angle thereof increases with increasing potential difference. Thus, the birefringence decreases with respect to the light incident on the liquid crystal molecules. When the birefringence is 0, the circularly polarized light (b) generated when passing through the first λ/4 plate - enters the second linear polarizing plate - while maintaining its polarization property. Although this circularly polarized light (c) is converted into the linearly polarized light (d) by the second linear polarizing plate -, the polarizing axis at this time is the same as the polarizing axis of the linearly polarizing light (a) formed by the first linear polarizing plate - and perpendicularly intersects with the transmission axis of the second linear polarizing plate -. Therefore, the light incident on the first linear polarizing plate - cannot pass through the dimming element . The behavior of the outside light incident on the second linear polarizing plate - is also the same and cannot pass through the first linear polarizing plate -.
351
349
324
The birefringence of the liquid crystal molecules with respect to the light incident on the liquid crystal molecules is controlled by the tilt angle of the liquid crystal molecules, and the tilt angle is determined by the potential difference provided between the upper electrode and the lower electrode . Therefore, the control of this potential difference using the dimming-controlling signal enables the transmissivity of the dimming element to be adjusted.
216
204
202
324
324
324
400
216
324
324
351
349
324
324
400
322
As described above, the through hole formed in the light-guiding plate and the reflecting plate is locate in the region where the dimming element is provided. Hence, when the dimming element is in an off state (i.e., normally white), the outside light is capable of passing through the dimming element , which enables sensing of the outside light, capturing an image, and the like by utilizing the photoelectric transducer arranged in or under the through hole . On the other hand, it is possible to adjust the transmissivity of the dimming element by driving the dimming element while controlling the potential difference between the upper electrode and the lower electrode , which allows the dimming element to function as a neutral density (ND) filter or a shutter. When the dimming element functions as a shutter, the outside light reflected by the photoelectric transducer can be shielded. Thus, it is possible to exclude an adverse influence on the display produced by the pixels as described below.
349
324
100
349
324
349
216
400
324
400
In addition, it is not necessary to form a slit or a cutoff in the lower electrode in the dimming element of the display device , and the lower electrode has the same thickness in almost all of the dimming element . Moreover, the lower electrode is arranged to cover the whole of the through hole or all of the light-receiving surface of the photoelectric transducer as described above. Therefore, it is possible to avoid the generation of a refractive index distribution caused by a slit or a cutoff, and no adverse influence is provided to the outside light incident on the dimming element . Accordingly, when an image-capturing element is used as the photoelectric transducer , no adverse influence such as generation of a fringe or unevenness is exerted on the captured image, and a high-quality image can be obtained.
3-2. Pixel
(1) Initial State
322
324
370
1
370
2
370
1
370
2
FIG. 9A
A schematic perspective view of the pixel in the off state is shown in . Similar to the dimming element , the orientation of the liquid crystal molecules is determined by the orientation characteristics of the first orientation film - and the second orientation film -. Since the orientation treatment directions of the first orientation film - and the second orientation film - are the same as each other, the liquid crystal molecules substantially orient along the orientation treatment direction in the absence of an electric field.
200
310
1
310
2
200
310
1
312
322
308
370
310
1
310
2
310
2
310
1
310
2
310
2
322
322
b
Here, a case is considered where the light from the backlight unit is incident on the side of the first linear polarizing plate - and proceeds toward the side of the second linear polarizing plate -. The light derived from the backlight unit and indicated by the hollow arrow becomes linearly polarized light (a) parallel to the transmitting axis when passing through the first linear polarizing plate -. Since no λ/4 plate is provided in the pixel , this linearly polarized light (a) is next incident on the liquid crystal layer . When the orientation treatment is performed on the orientation films so that the orientation treatment directions perpendicularly intersect with the transmission axis of the first linear polarizing plate -, the polarizing axis of the linearly polarized light (a) almost perpendicularly intersect with the orientation direction of the liquid crystal molecules. Hence, no birefringence appears, and no phase retardation of the light occurs. As a result, the linearly polarized light (a) enters the second linear polarizing plate - while maintaining its polarizing axis and intensity. However, since the transmission axis of the second linear polarizing plate - perpendicularly intersects with the polarizing axis of the linear polarizing plate -, the light incident on the second linear polarizing plate - () is absorbed by the second linear polarizing plate - and does not radiate from the pixel . Therefore, the pixel is in the so-called normally off state in the off state.
(2) Operation
322
350
348
302
302
308
308
308
100
310
1
310
2
308
310
2
FIG. 9B
A schematic perspective view of the pixel in the case where a potential difference is provided between the pixel electrode and the common electrode , that is in an on state, is illustrated in . This potential difference generates an electric field substantially parallel to the surface of the array substrate , and the liquid crystal molecules rotate in the plane parallel to the surface of the array substrate due to the dielectric anisotropy of the liquid crystal molecules. Hence, the polarizing axis of the linearly polarized light (a) incident on the liquid crystal layer and the orientation direction of the liquid crystal molecules shift from each other, and the phase retardation of the light incident on the liquid crystal layer occurs. Here, the thickness of the liquid crystal layer is controlled according to the refractive indexes of the liquid crystal molecules in the long axis direction and the short axis direction so that the phase retardation is approximately 11 in the display device . Therefore, the light which has passed through the liquid crystal layer becomes the linearly polarized light (b) obtained by rotating the polarizing axis of the linearly polarized light (a). When the orientation of the liquid crystal molecules rotates by 90°, the polarizing axis of this linearly polarized light (b) perpendicularly intersects with the polarizing axis of the linearly polarized light (a). In addition, the first linear polarizing plate - and the second linear polarizing plate - are in the cross Nichol relationship. Thus, the linearly polarized light radiating from the liquid crystal layer is capable of passing through the second linear polarizing plate -.
350
348
322
374
320
The amount of the extracted light depends on the rotation angle of the liquid crystal molecules, and the rotation angle can be controlled by the potential difference between the pixel electrode and the common electrode based on the potential of the image signal. Hence, gradation can be obtained in each pixel by controlling this potential difference. Moreover, since the color filter with a different optical property is formed in every pixel as described above, it is possible to control the gradation for every color, which enables full-color display on the display region .
322
320
100
322
100
As described above, since the pixel disposed in the display region is normally off in the display device , display having a high contrast can be realized. Furthermore, an FFS liquid crystal element is formed in the pixel , it is possible to perform display with excellent viewing-angle characteristics. Therefore, high-quality full-color display is attainable by the display device .
324
322
400
320
400
320
320
324
400
324
Moreover, the dimming element is arranged so as to be surrounded by the pixels , and the photoelectric transducer such as an image-capturing element can be disposed so as to overlap with the display region . Therefore, the photoelectric transducer is not required to be arranged in the frame region, which allows the frame region to be reduced or excluded and an area of the display region relative to the whole of the display device to be increased. As a result, an electric apparatus with a large display region and excellent designability can be provided. In addition, it is also possible to control the light transmissivity of the dimming element , the amount of the light incident on the photoelectric transducer can be appropriately adjusted without decreasing display quality caused by the dimming element .
100
314
312
100
FIG. 10A
FIG. 10B
FIG. 10A
FIG. 10B
FIG. 8A
FIG. 8B
The display device may possess a pair of halfwave plates (hereinafter, referred to as a λ/2 plate) instead of the pair of λ/4 plates . The structure and operation in this case are explained using and . and are respectively schematic perspective views of the display device in the initial state and in operation and respectively correspond to and .
314
324
310
314
314
1
302
310
1
314
2
304
310
2
314
310
The pair of λ/2 plates is disposed so as to sandwich the dimming element and is sandwiched by the pair of linear polarizing plates . The pair of λ/2 plates is arranged so that the slow axis of the λ/2 plate (first λ/2 plate -) arranged on the side of the array substrate shifts from that of the first linear polarizing plate - by 22.5°, and, in a similar way, the λ/2 plate (second λ/2 plate -) arranged on the side of the counter substrate shifts from that of the second linear polarizing plate - by 22.5°. Hence, the slow axes of the λ/2 plates are in an orthogonal relationship, and the pair of linear polarizing plates is also in the cross Nichol relationship.
(1) Initial State
312
310
1
310
1
314
1
314
1
310
1
314
1
310
1
310
1
308
308
100
308
314
2
314
2
310
2
310
1
310
2
310
2
324
FIG. 8A
FIG. 10A
Similar to the case using the pair of λ/4 plates (), the liquid crystal molecules substantially orient along the orientation treatment direction in the off state (). The light proceeding from the side of the linear polarizing plate - becomes linearly polarizing light (a) when passing through the first linear polarizing plate -. The phase π-shifts when this linearly polarized light (a) next enters the first λ/2 plate -. However, since the slow axis of the first λ/2 plate - shifts from the transmission axis of the first linear polarizing plate - by 22.5°, the polarizing axis of the linearly polarized light (a) which has passed through the first λ/2 plate - shifts by π/2 from the transmission axis of the first linear polarizing plate -, that is, by 45° from the transmission axis of the first linear polarizing plate -, and the linear polarizing light (a) becomes linearly polarized light (b). When this linearly polarized light (b) passes through the liquid crystal layer , further phase retardation occurs. Here, the thickness of the liquid crystal layer is controlled according to the refractive indexes of the liquid crystal molecules in the long axis direction and the short axis direction so that the phase retardation is approximately π in the display device . Hence, the polarizing axis further shifts by 90°, and the linearly polarized light (b) becomes linearly polarizing light (c) when the linearly polarized light (b) passes through the liquid crystal layer . When this linearly polarizing light (c) further enters the second λ/2 plate -, a π phase difference arises. However, since the slow axis of the second λ/2 plate - shifts from the transmission axis of the second linear polarizing plate - by an angle of 25.5°, a π/2 phase difference is provided. As a result, the polarizing axis shifts by 45°, and the linearly polarized light (c) becomes linearly polarized light (d) having a polarizing axis perpendicularly intersecting with the transmission axis of the first linear polarizing plate -. This polarizing axis perpendicularly intersects with the transmission axis of the second linear polarizing plate -, and the light cannot pass through the second linear polarizing plate -. Thus, the dimming element is in the so-called normally black state in the off state.
(2) Operation
349
351
302
314
1
314
2
314
2
314
2
310
2
310
2
310
2
310
2
310
1
When the potential difference provided between the lower electrode and the upper electrode exceeds the threshold voltage, the liquid crystal molecules gradually rise from the surface of the array substrate , and the tilt angle thereof increases with increasing potential difference. Thus, the birefringence decreases with respect to the light incident on the liquid crystal molecules. When the birefringence is 0, the polarization property of the linearly polarized light (b) generated when passing through the first λ/2 plate - is maintained, and the linearly polarized light (c) is incident on the second λ/2 plate -. This linearly polarized light (c) is converted into linearly polarized light (d) by the second λ/2 plate -. However, since the slow axis of the second λ/2 plate - shifts from the transmission axis of the second linear polarizing plate - by 22.5°, the polarizing axis thereof is the same as the transmission axis of the linear polarizing plate -. Therefore, this linearly polarized light (d) is capable of passing through the second linear polarizing plate -. Similarly, the behavior of the light incident from the second linearly polarizing plate - is able to pass through the first linear polarizing plate -.
351
349
324
324
400
324
322
324
324
315
349
324
400
351
349
349
216
400
324
400
The birefringence of the liquid crystal molecules with respect to the light incident on the liquid crystal molecules is controlled by the tilt angle of the liquid crystal molecules, and the tilt angle is determined by the potential difference provided between the upper electrode and the lower electrode . Therefore, the control of this potential difference using the dimming-controlling signal enables the transmissivity of the dimming element to be adjusted. For example, when the dimming element is in an off state (i.e., in a normally black state), the light reflected by the photoelectric transducer can be shielded because the outside light cannot pass through the dimming element , which prevents an adverse influence on the display produced by the pixels . In addition, the transmissivity of the dimming element can be adjusted by operating the dimming element with a controlled potential difference between the upper electrode and the lower electrode , which allows the dimming element to function as an ND filter or a shutter. Hence, it is possible to optimize the amount of the light incident on the photoelectric transducer by appropriately controlling the potential difference between the upper electrode and the lower electrode depending on the external environment. Moreover, since the single number of the lower electrode is arranged so as to cover the whole of the through hole or all of the light-receiving surface of the photoelectric transducer , it is possible to avoid generation of a refractive-index distribution. Hence, no adverse influence is exerted on the outside light incident on the dimming element , and a high-quality image can be obtained without any adverse influence such as generation of a fringe or unevenness on the image captured by the photoelectric transducer .
324
In the present embodiment, a modified example of the dimming element shown in the First Embodiment is demonstrated. An explanation of the structure the same as or similar to those described in the First Embodiment may be omitted.
324
324
349
1
349
2
349
3
358
358
1
358
2
358
3
351
324
FIG. 11A
FIG. 11A
FIG. 11B
FIG. 11A
A schematic top view of the dimming element of the present embodiment is shown in , whereas a schematic view of a cross section along a chain line D-D′ in is shown in . As shown in these figures, the dimming element of the present embodiment is divided into a plurality of regions (e.g., a first region -, a second region -, and a third region -) electrically independent from one another. In the structure shown in , the number of these regions is three. However, there is no limitation to the number of the regions. The plurality of regions is electrically connected to the respective dimming-controlling lines (e.g., a first dimming-controlling line -, a second dimming-controlling line -, and a third dimming-controlling line -) independently controlled from one another. On the other hand, the upper electrode may be arranged so as to overlap with the plurality of regions. Therefore, one dimming element includes a plurality of liquid crystal elements in the present embodiment.
FIG. 11A
FIG. 11B
349
1
349
2
349
2
349
3
The shape and the arrangement of the plurality of regions are not limited, and the outer circumference of each region may be configured to be a circle or a part of a circle while one region is surrounded by another region as shown in and . In this case, a k-th region selected from first to n-th regions is surrounded by a (k+1)-th region where the total number of the regions is n, the innermost region is the first region, and an outermost region is the n-th region. Here, n is a natural number larger than 1, and k is a natural number equal to 1 and less than n. For example, the innermost first region - is surrounded by the second region -, whereas the second region - is surrounded by the third region -.
324
324
324
Such a structure allows the transmissivity of the liquid crystal element to be controlled in every plural region in the dimming element , which enables more precise control of the light transmissivity of the dimming element . Hence, the dimming element can be used as an ND filter or a shutter having more precisely controlled transmissivity.
349
a
FIG. 12A
In addition, a plurality of slits arranged in a stripe form may be provided in each region as shown in .
351
351
349
351
349
351
a
a
a
FIG. 12B
FIG. 13A
FIG. 13A
FIG. 13B
In a similar way, a plurality of slits arranged in a stripe form may be formed in the upper electrode as shown in . An enlarged schematic top view of the case where the slits and are respectively provided to the lower electrode and the upper electrode is shown in , and a schematic view of a cross section along a chain line E-E′ in is shown in .
FIG. 13A
1
2
1
2
3
4
3
4
1
2
349
351
349
351
349
351
349
351
a
a
a
a
a
a
a
a
As shown in , a width Wof the slit is preferred to be the same as or substantially the same as a width Wof the slit . Specifically, the widths Wand Ware equal to or more than 2 μm and equal to or less than 20 μm and typically 10 μm. On the other hand, a width Wof a region between adjacent slits is preferred to be the same as or substantially the same as a width Wof a region between adjacent slits . Specifically, the widths Wand Ware equal to or more than 200 μm and equal to or less than 600 μm and typically 400 μm. Furthermore, the slits and the slits are provided so that a pitch Pof the slits and a pitch Pof the slits are the same as each other.
351
349
349
351
351
349
349
302
351
100
351
302
349
a
a
a
a
a
a
a
a.
1
2
The upper electrode and the lower electrode are arranged so that slit overlaps with the region between two adjacent slits , and the slit similarly overlaps with the region between two adjacent slits . Here, it is preferred that a linear line Lpassing through a center of the region between the adjacent slits and extends in a plane parallel to the surface of the array substrate pass through a center of the slit when the display device is viewed from above. In a similar way, it is preferred that a linear line Lpassing through a center of the region between the adjacent slits and extends in a plane parallel to the surface of the array substrate pass through a center of the slit
324
322
302
351
349
302
324
349
351
302
349
351
349
351
349
351
a
a
a
a
a
a
FIG. 13B
In the dimming element , the initial orientation of the liquid crystal molecules is the same as that in the pixel and is substantially parallel to the surface of the array substrate . Application of a potential difference between the upper electrode and the lower electrode causes the liquid crystal molecules to rise from the plane parallel to the array substrate . However, when the pre-tilt angle of the liquid crystal molecules is extremely small in an off state, the rising direction varies, which may result in regions (domains) different in the rising direction. If the domains are randomly formed, the viewing angle characteristics and uniformity of the transmissivity in the dimming element are influenced. However, the use of the lower electrode and the upper electrode having the aforementioned structures and arrangements causes the electric field generated therebetween to be tilted from a normal line of the array substrate , by which the rising direction can be controlled. For example, when focus is placed on one region between the adjacent slits , the liquid crystal molecules on the right side of the slit in the drawing (the liquid crystal molecules overlapping with the region between one of the adjacent slits and the slit ) rises in substantially a single direction, while the liquid crystal molecules on the left side (the liquid crystal molecules overlapping with the region between the other of the adjacent slits and the slit ) rises in a substantially reverse direction as shown in . Therefore, the domain size is decreased, and the distribution thereof is suppressed. As a result, it is possible to prevent deterioration or in-plane unevenness of the viewing angle dependence of the transmissivity.
324
In the present embodiment, a modified example of the dimming element described in the First and Second Embodiments is demonstrated. An explanation of the structure the same as or similar to those described in the First and Second Embodiments may be omitted.
324
324
324
368
349
351
324
351
358
356
366
368
349
351
344
349
348
322
FIG. 14
FIG. 14
FIG. 15
FIG. 14
FIG. 15
A schematic top view of the dimming element of the present embodiment is shown in , and a schematic view of a cross section along a chain line F-F′ in is shown in . The dimming element of the present embodiment is different from the dimming element of the First Embodiment in that an FFS liquid crystal element is formed. Specifically, the interelectrode insulating film is provided over the lower electrode over which the upper electrode is formed in the dimming element of the present embodiment as shown in and . The upper electrode possesses a comb-teeth shape having a plurality of cutoffs and is connected to the dimming-controlling line through the opening formed in the leveling film and the interelectrode insulating film . Hence, a part of the lower electrode is exposed from the upper electrode . The power-source line is connected to the lower electrode by which the potential (Vcom) the same as that of the common electrode disposed in the pixels can be supplied.
370
1
349
351
308
370
1
370
2
349
351
370
1
370
2
370
1
370
2
322
349
351
302
324
The first orientation film - is arranged so as to cover the lower electrode and the upper electrode , and the liquid crystal layer is arranged so as to be sandwiched by the first orientation film - and the second orientation film - and cover the lower electrode and the upper electrode . The orientation treatment directions of the first orientation film - and the second orientation film - are the same as each other and also the same as the orientation treatment directions of the first orientation film - and the second orientation film - in the pixel . The liquid crystal molecules are rotated by the electric field generated by the potential difference between the lower electrode and the upper electrode and parallel to the surface of the array substrate , thereby controlling the transmissivity of the dimming element .
324
310
3
302
310
2
304
302
304
324
310
3
310
1
322
310
2
310
2
322
310
2
322
310
2
324
322
324
310
2
322
324
310
3
310
2
In the dimming element of the present embodiment, no λ/4 plate nor λ/2 plate is provided. Instead, a third linear polarizing plate - under the array substrate and a second linear polarizing plate - over the counter substrate are provided so as to sandwich the array substrate , the counter electrode , and the dimming element . A transmission axis of the third linear polarizing plate - perpendicularly intersects with the transmission axis of the first linear polarizing plate - provided in the pixel . On the other hand, the second linear polarizing plate - is the same as the second linear polarizing plate - disposed in the pixel . In other words, the second linear polarizing plate - disposed in the pixel and the second linear polarizing plate - disposed over the dimming element are integrated into a single polarizing plate shared by the pixel and the dimming element . Hence, the transmission axis of the second linear polarizing plate - is the same between the pixel and the dimming element , and the third linear polarizing plate - and the second linear polarizing plate - are in the parallel Nichol relationship to each other.
310
1
310
1
322
302
310
2
324
310
3
304
324
310
1
322
324
310
2
310
3
322
324
Note that, although not illustrated, the first linear polarizing plate - integrated with the first linear polarizing plate - provided in the pixel may be arranged under the array substrate , the second linear polarizing plate - may be arranged so as not to overlap with the dimming element , and the third linear polarizing plate - may be arranged over the counter electrode so as to overlap with the dimming element . In this case, the first linear polarizing plate - is shared by the pixel and the dimming element , and the transmission axes thereof is the same therebetween. On the other hand, the second linear polarizing plate - and the third linear polarizing plate - are in a relationship in which the transmission axes are different from each other by 90° between the pixels and the dimming element .
FIG. 16
FIG. 17
FIG. 16
FIG. 17
324
322
310
1
310
3
324
322
310
3
310
1
310
1
310
3
302
376
310
1
310
3
310
1
310
3
302
310
1
310
3
376
310
3
310
1
and are schematic cross-sectional views respectively centering the dimming element and the pixel . As shown in this , a part of the first linear polarizing plate - and a part of the third linear polarizing plate - may overlap with each other between the dimming element and the pixel . The third linear polarizing plate - may overlap with the part of the first linear polarizing plate - so that the part of the first linear polarizing plate - is located between the third linear polarizing plate - and the array substrate , or a reverse relationship may be employed. In this case, the black matrix may be disposed so as to overlap with the first linear polarizing plate - and the third linear polarizing plate -. Alternatively, the first linear polarizing plate - and the third linear polarizing plate - may be placed with a gap therebetween as shown in . In this case, a part of the array substrate is exposed from the first linear polarizing plate - and the third linear polarizing plate -. The black matrix may be disposed so as to overlap with the exposed portion, the third linear polarizing plate -, and the first linear polarizing plate - in order to shield light.
324
308
FIG. 18A
FIG. 18B
FIG. 8A
FIG. 8B
The operation of the dimming element having the aforementioned structure is explained using and . These figures respectively correspond to and , and a part of the components such as the liquid crystal layer is omitted.
(1) Initial State
FIG. 18A
324
370
1
370
2
370
1
370
2
is a schematic perspective view of the dimming element in an off state. In this state, the orientation of the liquid crystal molecules is determined by the orientation characteristics of the first orientation film - and the second orientation film -. Since the orientation treatment directions of the first orientation film - and the second orientation film - are the same as each other, the liquid crystal molecules substantially orient along the orientation treatment directions in the absence of an electric field.
310
3
310
2
310
3
308
370
310
2
310
2
310
3
310
2
324
Here, a case is considered in which light indicated by a hollow arrow proceeds from the side of the third linear polarizing plate - toward the side of the second linear polarizing plate -. This light becomes linearly polarized light (a) parallel to the transmission axis when passing through the third linear polarizing plate - and then enters the liquid crystal layer . When the orientation treatment is performed on the orientation films so that the orientation treatment directions are parallel to the transmission axis, the polarizing axis of the linearly polarized light (a) and the orientation direction of the liquid crystal molecules are substantially parallel. Hence, no phase variation of the light occurs, and this linearly polarized light (a) is incident on the second linear polarizing plate - as linearly polarized light (b), maintaining the polarizing axis and intensity. Since the transmission axis of the second linear polarizing plate - is parallel to that of the third linear polarizing plate -, the linearly polarized light (b) passes through the second linear polarizing plate - and radiates outside. Thus, the dimming element is normally white in the off state.
(2) Operation
FIG. 18B
349
351
302
302
308
308
100
308
308
308
310
3
310
2
310
2
is a schematic perspective view in an on state produced by providing a potential difference between the lower electrode and the upper electrode . This potential difference generates an electric field substantially parallel to the surface of the array substrate , and the liquid crystal molecules rotate in the plane parallel to the surface of the array substrate due to the dielectric anisotropy of the liquid crystal molecules. Hence, the polarizing axis of the linearly polarized light (a) incident on the liquid crystal layer and the orientation direction of the liquid crystal molecules are shifted from each other, which causes a phase retardation of the light incident on the liquid crystal layer . In the display device , it is preferred to control the thickness of the liquid crystal layer in accordance with the refractive indexes of the liquid crystal molecules in the long axis direction and the short axis direction so that the phase retardation is π. In such a case, when passing through the liquid crystal layer , the light becomes linearly polarized light (b) which is obtained by rotating the polarizing axis of the linearly polarized light immediately before entering the liquid crystal layer . When the orientation of the liquid crystal molecules rotates by 90°, the polarizing axis of this linearly polarized light (b) perpendicularly intersects with the polarizing axis of the linearly polarized light (a). Since the third linear polarizing plate - and the second linear polarizing plate - are in the parallel Nichol relationship, the linearly polarized light (b) cannot pass through the second linear polarizing plate -.
349
351
324
324
400
351
349
324
324
322
400
The amount of the extracted light is determined by the rotation angle of the liquid crystal molecules, and the rotation angle can be controlled by the potential difference between the lower electrode and the upper electrode based on the potential of the dimming-controlling signal. Therefore, control of this potential enables the transmissivity of the dimming element to be controlled, which allows the dimming element to function as a neutral density filter (ND filter) or a shutter. For example, the amount of light incident on the photoelectric transducer can be optimized by appropriately controlling the potential difference between the upper electrode and the lower electrode in accordance with an external environment. In addition, when the dimming element is controlled by further increasing this potential difference so that light cannot substantially transmit the dimming element , it is possible to prevent an adverse influence on the display formed by the pixels because the outside light reflected by the photoelectric transducer can be shielded.
100
An example of a manufacturing method of the display device having the structure described in the First Embodiment is explained in the present embodiment. An explanation of the structure the same as or similar to those described in the First to Third Embodiments may be omitted.
FIG. 19A
FIG. 22
100
322
324
to are schematic cross-sectional views showing the manufacturing method of the display device , and the left side and the right side respectively demonstrate a part of the pixel and a part of the dimming element in each drawing.
1. Array Substrate
FIG. 19A
364
302
is a schematic view in which the components up to the interlayer insulating film are formed over the array substrate . An explanation is omitted because this structure can be fabricated applying the known methods and materials.
364
352
342
354
358
346
342
346
FIG. 19B
Etching is performed on the interlayer insulating film to form openings reaching the semiconductor film , and a metal film is prepared to cover these openings. The metal film can be formed by stacking metal films including a metal such as molybdenum, tungsten, titanium, or aluminum with a sputtering method, a chemical vapor deposition (CVD) method, and the like. After that, the metal film is subjected to etching processing to form the image-signal line , the drain electrode , and the dimming-controlling element (). With this process, the transistor is fabricated. As described above, the part of the image-signal line functions as the source electrode of the transistor .
366
346
358
FIG. 19C
After that, the leveling film is formed so as to cover the transistor and the dimming-controlling line (). The leveling film is formed by applying a precursor of the polymer described in the First Embodiment with a wet-type film formation method such as a spin-coating method, a dip-coating method, an ink-jet method, and a printing method, and then curing the precursor.
348
366
348
348
344
348
344
324
349
348
348
349
FIG. 19C
After that, the common electrode is fabricated over the leveling film (). The common electrode is configured so as to transmit visible light. Therefore, the common electrode may be formed with a sputtering method and the like using a conductive oxide exhibiting transmitting properties with respect to visible light, such as a mixed oxide of indium and tin (ITO) and a mixed oxide of indium and zinc (IZO). Although not illustrated, the power-source line is formed after forming the common electrode . The power-source line is fabricated by stacking the films including the aforementioned metal with a sputtering method, a CVD method, or the like. Note that, when the dimming element forms an FFS liquid crystal element as described in the Third Embodiment, the lower electrode may be simultaneously formed when the common electrode is formed. Hence, the common electrode and the lower electrode can exist in the same layer and possess the same composition and thickness in this case.
368
348
358
368
368
366
357
356
354
358
FIG. 20A
FIG. 20A
After that, the interelectrode insulating film is formed so as to cover the common electrode and the dimming-controlling line (). The interelectrode insulating film includes the aforementioned silicon-containing inorganic compound and is formed using a CVD method or a sputtering method. Next, etching is performed on the interelectrode insulating film and the leveling film to form the openings and respectively reaching the drain electrode and the dimming-controlling line ().
350
349
354
358
350
349
324
351
350
350
351
FIG. 20B
After that, the pixel electrode and the lower electrode are fabricated so as to be in contact with the drain electrode and the dimming-controlling line , respectively (). These electrodes are also preferred to have a high transmitting property with respect to visible light, and therefore, may be formed with a sputtering method using a conductive oxide having a light-transmitting property, such as ITO and IZO. Since the pixel electrode and the lower electrode can be simultaneously formed, these electrodes can exist in the same layer and have the same composition and thickness. Although not illustrated, when the dimming element forms an FFS liquid crystal element, the upper electrode may be simultaneously formed when the pixel electrode is fabricated. Therefore, the pixel electrode and the upper electrode can exist in the same layer and have the same composition and thickness in this case.
370
1
350
349
370
1
FIG. 20B
After that, the first orientation film - is formed so as to cover the pixel electrode and the lower electrode (). The first orientation film - may be formed by applying a polyimide precursor with a wet-type film formation method, curing the precursor, and then performing a rubbing treatment. The known methods may be applied in the rubbing treatment.
2. Counter Electrode
374
376
304
376
346
342
340
322
376
358
324
324
374
374
372
372
374
376
374
376
374
FIG. 21A
FIG. 21B
The color filter and the black matrix are formed over the counter substrate (). The black matrix is prepared so as to cover the transistor , the image-signal line , the gate line , and the like in the pixel , while the black matrix is prepared so as to cover the dimming-controlling line in the dimming element . In the dimming element , a transparent film may be formed as the color filter , or no color filter may be provided. In the case where the overcoat is formed, the overcoat is formed so as to cover the color filter and the black matrix (). The color filter , black matrix , and overcoat can be prepared using the known methods and materials. Thus, a detailed explanation is omitted.
351
324
351
349
348
350
370
2
374
376
351
370
2
370
1
378
370
2
378
370
1
302
FIG. 21C
FIG. 21C
After that, the upper electrode of the dimming element is fabricated (). The upper electrode may be formed by applying the same method for the fabrication of the lower electrode , the common electrode , and the pixel electrode . After that, the second orientation film - is formed so as to cover the color filter , the black matrix , and the upper electrode . The second orientation film - may be also formed with the same method as that of the first orientation film -. The spacer which is an optional element is formed over the second orientation film - by applying the known methods and materials (). The spacer may be fabricated over the first orientation film - formed over the array substrate .
3. Cell Fabrication
308
306
302
304
306
302
304
306
350
348
349
351
302
304
306
350
348
351
351
302
304
302
304
306
306
306
306
306
306
306
306
378
After that, the liquid crystal layer is formed. Specifically, the sealing material is applied over one of the array substrate and the counter substrate , and the liquid crystal is dropped on the region formed by the sealing material . After that, the other of the array substrate and the counter substrate is arranged over the liquid crystal and the sealing film so that the pixel electrode , the common electrode , the lower electrode , and the upper electrode are sandwiched by the array substrate and the counter substrate , and then the sealing material is cured. At this time, the pixel electrode and the common electrode do not overlap with the upper electrode and are exposed from the upper electrode . With this process, the array substrate and the counter electrode are bonded and fixed to each other. Alternatively, the array substrate and the counter electrode are bonded using the sealing material in advance. In this case, the sealing material is formed so as not to have a closed shape but to be divided into two portions. After curing the sealing material , the liquid crystal is injected from the gap between the separated two sealing materials , the sealing material is further applied between the cured sealing films , and then the sealing film is cured. With this process, the sealing film provides a single closed shape. Note that, when the spacer is not fabricated, particle spacers may be mixed in the liquid crystal.
100
Through the aforementioned processes, the display device can be manufactured.
Implementation of the embodiments of the present invention, a display device with a small frame region and a wide display region can be produced. Since a variety of photoelectric transducers can be mounted so as to overlap with the display region in this display device, the embodiments of the present invention provide a high degree of freedom in designing a display device. In addition, it is possible to control the amount of light incident on the photoelectric transducer without reduction of display quality by controlling transmissivity of the dimming element disposed in the display region and overlapping with the photoelectric transducer.
It is understood that another effect different from that provided by each of the aforementioned embodiments is achieved by the present invention if the effect is obvious from the description in the specification or readily conceived by persons ordinarily skilled in the art. | |
Abstract. Net primary production (NPP) is a fundamental process of natural ecosystems. Temporal variation of NPP not only reflects how communities respond to environmental fluctuations, but it also has important implications for regional carbon assessment. Unfortunately, studies based on field measurements to directly address this issue in the extreme environment of alpine grasslands are rare. In this study, we measured aboveground NPP (ANPP) and species richness in 40 sites across the Tibetan alpine grasslands from 2006 to 2009 to investigate the regional pattern of temporal variation in ANPP and to quantify the effects of climate fluctuation and biodiversity on this variation. The results showed that, during the 4-year period, the average ANPP varied 1.5-fold, from 83.9 to 125.7 g m−2, with a mean coefficient of variation of temporal variation of 36.6% across the 40 sites. Compared with other studies, alpine grasslands are not more sensitive to climate fluctuations than other grassland types. Aboveground NPP exhibited synchronous temporal variation and consistent spatial patterns over the 4-year period due to the regionally similar climatic fluctuations caused by monsoon-dominated plateau climate. Surprisingly, rainfall fluctuation had a more profound effect on the ANPP dynamics than temperature variation, which suggests that production in the Tibetan alpine grasslands is primarily driven by precipitation. Therefore, ANPP in the Tibetan alpine grasslands are mainly constrained by water availability. Finally, we found a reduction in interannual variation (i.e., CV) in ANPP with increasing species richness of plant communities, suggesting that diversity can stabilize community production in high-altitude grasslands. | https://bg.copernicus.org/articles/11/2003/2014/ |
If you want to learn to memorize better the different information that you have to study and remember, we present 6 memorization techniques.
To make the task of learning simpler and more interesting, there are several memorization techniques that can be used. Here are some tips from the assistant of the Department of Psychology at the University of Toronto, Ryan Howes, to learn how to memorize. Take note!
This memorization technique involves the creation of associations between the elements of a list and the allocation of images to each connection to help you better memorize.
While creating images for each element, using the link method, you combine everything into a great story. This technique helps to memorize the sequence of the images and therefore the order of the elements.
This method of memorization consists of the association of terms or elements of the list with known places. In addition, it can become something more sensory incorporating sounds, smells, flavors or whatever is necessary to obtain the best results.
This system is useful for memorizing lists of words in a particular order. This method can be carried out through two steps. The first step requires memorizing words that are easy to associate with numbers, using words that rhyme with the number of shapes that resemble the series. Once this list is memorized, the second step is to associate the words to the list of objects that we really need to memorize.
This method is used for the memorization of concepts or any structured information. The mind maps work when a structure must be maintained while allowing make the flow of information clearer.
This technique can improve a person’s memory and when practiced fluently, the memorization process becomes natural.
The Roman room is a technique that can be applied to memorize a list of words or any information where it is not possible to create visual representations of abstract words.
It consists of bringing to mind a room that is very familiar. Upon entering the room, the corner above the left shoulder is number 1 and then the other walls will be the successive numbers, always with movements in a clockwise direction, around the room. The following numbers will be the floor and the ceiling. It is important that these listed places automatically become identifiable objects, which symbolically represent the information that you want to remember.
As these memorization techniques are used more frequently, the process becomes more and more natural and more and more rooms can be incorporated. By connecting the rooms, in a memorable order, you can expand the amount of information remembered and sequentially. | http://www.prforeducators.com/6-techniques-to-develop-your-memory/ |
When R Chandrika was gifted a 3x3x3 Rubik’s Cube by an aunt from United States, she could have had no inkling of how the gadget would come to rule her life. Chandrika was just a nine-year-old child at that time. She did not give as much mind to solving the three-dimensional puzzle as she did to understanding the mechanism behind it.
“My dad is a mechanic and I always loved to dirty my hands, and so I took a screwdriver and disassembled the pieces to figure out its functioning but I was not successful,” says Chandrika.
Little did Chandrika realise that she would make a profession out of the teaching puzzles to others. Chandrika along with her two siblings — R Bindu Priyanka and R Anand — run the Tamil Nadu Cube Association, a registered body that trains the young and the old to take up competitive cubing and also conducts cubing events.
“I was finding it difficult to concentrate on studies and my mother pushed me to take up sports, and that is when I slowly started discovering the puzzle,” says Chandrika, in her early 30s now.
Her maternal grandfather tried teaching her all about three-dimensional puzzles but she could not crack it. Later, she learnt to solve it on her own. “We did not have a phone or a computer at home to learn about the formula or techniques, and so I started by solving one colour at a time and jotting the steps in a book so that I would not forget it,” says Chandrika.
It took her almost one-and-a-half years to solve a basic Rubik’s Cube completely. Chandrika has since been collecting and solving different kinds of cubes, but being a costly hobby, her parents began to feel the pinch.
“My mom, Bhuvana, started selling saris and working in a canteen to buy us cubes,” says Chandrika, adding “My siblings got hooked on cubing and the persistent clicks of cubes being arranged and rearranged became an undying soundtrack in our home.”
Bhuvana would send money to her sister in the United States to make sure the children got a hang of the Rubik’s Cube in a variety of shapes and sizes.
By 2013, Chandrika learnt to solve a variety of cubes in a matter of seconds and started teaching her neighbours under the name of Dharshan Academy. However, her first competitive event was a damp squib. “I did well for a beginner but did not match the speed of other participants as I had no one to guide me. That is the reason I have taken up coaching,” says Chandrika, who is engaged with three city schools as a Rubik’s Cube teacher.
The journey has not been easy for the trio. In 2018, the siblings fought hard to rechristen their centre as Tamil Nadu Cube Association. “We wanted to break myths surrounding cubing and take players to international level but it was a challenge as awareness about cubing was low,” says Chandrika.
Bindu, who takes charge of the marketing, says that persuading school managements to promote cubing was a challenge.
“How will you train our students using a toy?” was the remark we received. “Today, we have thousands of students and adults enrolled with us, many are competing at the international level,” says Bindu.
For the recent Rubik Cube World Championship held in 2019, their students came fourth and seventh. “We still have a long way to go,” says Bindu.
Since last year they started to train the enthusiasts online. Chandrika points out that their big moment arrived when one of her students Shaktivel, a four-year-old, created a world record completing the cube blindfolded in 28 seconds.
What is the difference the trio brings to the hobby? Thousands of formulae are available on the internet but not all of them work for everyone. “A left-hander might have difficulty in making turns. A cube that requires 20 moves can be solved in 18 moves with a different formula, so we customise as per a student’s age and ability,” says Chandrika.
Blindfolded Rubik’s Cube is something she takes pride in. “Instead of learning it through an algorithm, I introduced it through stories,” she says. Chandrika is next working on introducing Rubik’s Cube to teach mathematics.
Social initiatives
The trio has been teaching the art for free to students who cannot afford a nominal fee. For example, students of Mahanadhi Savithri School, a government school at Machlipatnam, have benefited from their classes. For those who cannot afford to buy Rubik’s Cube, they give it on rent. “We have a few visually challenged students learning from us and we do not charge them any fee,” says Chandrika, who shuttles between Chennai and Madurai. For senior citizens living in old age homes, they use cubes as a memory booster. | https://www.thehindu.com/news/cities/chennai/ambassadors-of-the-rubiks-cube/article36541097.ece |
Q:
More robust mathematical argument? Streamlines and Stream function
I'm working on part (c) of this problem:
The only argument I can come up with is that in the $x$ direction, there is $0$ velocity at intervals of $n\pi$ and the same can be said about the $y$ direction because of the $\sin(x)$ and $\sin(y)$ terms.
Is there a more robust mathematical way of saying this?
Also, I'm unsure what part ii) in (c) means for me to show because $\mu$ doesn't change the behaviour of the velocity components.
A:
At any given time, a streamline is a level curve of the streamfunction in $\mathbb{R}^2$. This is a set of points $(x,y)$ such that $\psi(x,y) = C(t)$ where $C(t)$ is a constant when $t$ is fixed.
On the boundary of the square $S=\{(x,y): 0 \leqslant x \leqslant \pi, 0 \leqslant y \leqslant \pi\}$ we have $x = 0 \text{ or } \pi$ for $0 \leqslant y \leqslant \pi$ or $y = 0 \text{ or } \pi$ for $0 \leqslant x \leqslant \pi.$ Since,
$$\psi(0,y) = \psi(\pi,y) = \psi(x,0) = \psi(x,\pi) = g(t)= C(t),$$
it follows that the boundary is a streamline.
Equivalently, the velocity field is tangential to every point on a streamline. This is because $u_x = \frac{\partial \psi}{\partial y}$ and $u_y = -\frac{\partial \psi}{\partial x}$ relates the velocity field and the streamfunction. At any point $(x,y)$ on a streamline,the vector $\nabla\psi(x,y)$ is normal, and the vector $(u_x(x,y),u_y(x,y))$ is tangential since
$$(u_x(x,y),u_y(x,y))\cdot \nabla \psi(x,y) = \left(\frac{\partial \psi}{\partial y},-\frac{\partial \psi}{\partial x}\right)\cdot \left(\frac{\partial \psi}{\partial x},\frac{\partial \psi}{\partial y}\right)= \frac{\partial \psi}{\partial y}\frac{\partial \psi}{\partial x} - \frac{\partial \psi}{\partial x}\frac{\partial \psi}{\partial y} = 0$$
As you began to show, this is true for the segments that constitute the boundary of $S$. Individually, then, these segments are on streamlines. To show they are on the same streamline we revert back to the first argument where it was shown that $\psi(x,y) = C(t)$ for the same constant, i.e, $C(t) = g(t)$, for each of these segments.
For the last part, in viscous flow where $\mu \neq 0$, we have the no-slip condition where both components of the velocity field must vanish on a solid boundary. In this case, the boundary of the square could not be a solid surface. For example, when $x = 0$ and $0 < y < \pi$, we have
$$u_y = e^{-2\mu t/\rho}\sin y \neq 0$$
In inviscid flow, where $\mu = 0$, the only physical requirement is that the velocity field is tangential at a solid surface. This has already been shown for the boundary of the square.
| |
There is known a hybrid vehicle including a power source such as an electromotor and a motor generator, in addition to an engine. In the hybrid vehicle, while the engine operates as efficiently as possible, excess and deficiency of a driving force and an engine braking force are adjusted by the electromotor and/or the motor generator.
As for the above hybrid vehicle, there is disclosed an example of a speed change mechanism capable of operating with switching an infinite variable speed mode and a fixed gear ratio mode in Patent Reference 1. Concretely, a power distribution mechanism including four revolution components is formed by combining two planetary gear mechanisms, and the four revolution components are connected to an engine, a first motor generator, an output axis and a brake, respectively. In such a state that the brake is released, the number of revolutions of the engine continuously changes by continuously changing the number of revolutions of the first motor generator, and the operation in the infinite variable speed mode is executed. Meanwhile, in such a state that the brake is fixed, the gear ratio is fixed by preventing the revolution of one of the above-mentioned revolution components, and the operation in the fixed gear ratio mode is executed. In addition, as the speed change mechanism for switching the infinite variable speed mode and the fixed gear ratio mode, there is known a speed change mechanism which applies not a normal wet multiple disc clutch but an engagement mechanism for engaging teeth of the revolution component and teeth of the fixed component.
[Patent Reference 1] Japanese Patent Application Laid-open under No. 2004-345527
In the technique disclosed in Patent Reference 1, drivability sometimes deteriorates because the number of engine revolutions changes at the time of shifting the speed gear between the infinite variable speed mode and the fixed gear ratio mode. For example, when the speed gear is shifted from the fixed gear ratio mode to the infinite variable speed mode and acceleration is executed, the number of engine revolutions decreases once, and uncomfortable feeling sometimes occurs.
| |
There are mainly conductor DC resistance, insulation resistance, finished product voltage test and insulated wire-core voltage test, each of which is very important. The conductor resistance directly reflects the electrical transmission performance of the cable and directly affects the temperature, life and voltage of the cable during energized operation. It mainly examines the material and cross-sectional area of the conductor. If the material of the conductor is not good or the cross-sectional area is seriously insufficient, the DC resistance of the conductor will be seriously exceeded. This kind of cable laying in the line will increase the current on the line. The loss during passing will cause the cable conductor itself to heat up, cause the insulation of the coated conductor to age and crack, cause leakage and short circuit of the power supply line, and even cause fire, endangering the safety of people and property. The standard has strict regulations on the conductor DC resistance value of cables of different specifications, which shall not be greater than the value specified in the standard.
Insulation resistance, finished product voltage test and insulated wire-core voltage test all examine the electrical insulation performance of the cable insulation layer and sheath layer. Insulation resistance is to detect the resistance of the insulating material between two conductors. It should be large enough. To insulation protection. The voltage test of the finished product and the voltage test between the insulated wires not only requires the cable to have sufficient insulation capacity, but also requires the insulation or sheath material to be uniform, free of impurities, and sufficiently uniform in thickness. There should be no invisible trachoma, pinholes, etc. on the surface, otherwise it will cause Partial breakdown during the withstand voltage test.
Mechanical performance testing
Mainly to examine the tensile strength and elongation at break of the insulation and sheath plastic materials, including before and after aging, as well as the bending test, bending test, load breaking test, insulation core tearing test, Static torsion test, etc. Tensile strength before and after aging, and elongation at break before and after aging are the most important and basic indicators of cable insulation and sheath materials. It is required to be used as a material for cable insulation and sheath, and it must have sufficient tensile strength and not easy to pull. It must have a certain degree of flexibility.
Aging refers to the ability of insulation and sheath materials to maintain their original performance under high temperature conditions. Aging should not seriously affect the tensile strength and elongation of the material, which will directly affect the service life of the cable. If the tensile strength and If the elongation at break is unqualified, it is easy to break the sheath or insulator during the construction and installation of the cable, or the sheath and insulation of the cable used in the light or heat environment are easy to become brittle and break, causing the live conductor to be exposed. Risk of electric shock.
In addition, since flexible cables are not fixedly laid, there are repeated pulling and bending during use. Therefore, the standard for flexible cables additionally stipulates that dynamic bending tests, bending tests, load breaking tests, and insulated cores should be added to the finished cables. Tearing test, static bending test, etc., to ensure that this cable meets the requirements in actual use. For example, the dynamic torsion test mainly examines whether the twisted wires of the flexible conductor break and reduce the electrical transmission performance when the flexible cable is subjected to external stresses such as mechanical tension and bending, or whether the insulation is pierced and the electrical performance of the insulation is reduced; Being under stress is a test method to determine whether the electrical insulation performance of the cable is affected by deformation or cracking.
Insulation and sheath material performance test
Including thermal weight loss, thermal shock, high temperature pressure, low temperature bending, low temperature stretching, low temperature impact, flame retardant properties and so on. These are to examine the performance of plastic materials for insulation and sheathing. For example, the thermal weight loss test is to detect the degree of degradation and volatilization of the material after 7 days of high temperature aging at 80 ℃; the thermal shock test is subjected to a special roll after a high temperature of 150 ℃ for 1 hour. Whether the insulation surface of the winding is cracked; high temperature pressure tests the degree of elasticity retention of the insulating material after high temperature and then cooling; all low temperature tests generally refer to the change of its mechanical properties under the condition of -15 ℃, and it is the detection of the cable material Whether it becomes brittle, easy to crack or break under low temperature environment. In addition, the flame retardant performance of the cable is very important. The test to examine this performance is the non-flame test, that is, the finished cable installed according to the standard is ignited with a special flame for a certain period of time, and the flame is checked after the flame is extinguished. In the case of burning, of course, the less burnt part, the better, indicating that it has poor combustibility, good flame retardancy, and safer.
Sign check
The standard requires that the cable package should be accompanied by a label or logo indicating the product model, specification, standard number, manufacturer name and place of origin. The specifications include rated voltage, number of cores and nominal conductor cross-section, etc.; the cable surface should be printed with the manufacturer’s name and product model For continuous marks with rated voltage, the spacing between marks is required to be ≤200mm (insulation surface) or ≤500mm (sheath surface), and the content of the mark should be complete, clear and scratch-resistant. This requirement is to facilitate users to understand the cable's model specifications and voltage levels. To prevent laying errors.
In addition, the color of the wire insulation core should be the color recommended by the standard, especially the yellow/green two-color core. This kind of wire is generally used in the power cord of electrical products. This special two-color wire is dedicated to grounding. /Green matching standard also has the following provisions: that is, for each length of two-color insulated core, one of the colors should cover at least 30% of the surface of the insulated core, and not more than 70%, and the other color should cover the insulation The rest of the core, that is, the yellow/green color should be basically balanced.
Structure size inspection
Including insulation and sheath thickness, thinnest thickness, overall dimensions, etc. The thickness of the insulation and sheath plays an important role in the strength of the cable and its mechanical properties. Therefore, for cables of different specifications, the standards have strict regulations on the thickness, and the requirements must not be lower than that of the country. The specified value of the standard. If the insulation thickness of the cable is too thin, it will seriously affect the safety of the cable. It will bring potential safety hazards such as cable breakdown, exposed conductors and leakage. Of course, the thicker the better, it should not affect the installation. Therefore, the standard sets a requirement for external dimensions. Limit this.
Common certification marks
1. CCC certification compulsory certification is a passport to enter the domestic market.
2. CB certification is conducive to the export of electrical products directly related to personal safety that are used in homes, offices, workshops and similar places. Such products are subject to compulsory certification in some countries, that is, only after obtaining the country’s certification certificate. It is allowed to be exported to the country and sold in the country’s market. Even in countries that do not implement compulsory certification, consumers are willing to buy certified products with certification marks for their own safety.
3. CE certification is a passport for products to enter the European Union and European Free Trade Zone countries. Products that have been certified and affixed with the CE mark will reduce the risk of selling on the European market:
1) The risk of being detained and investigated by the customs;
2) Risks investigated and dealt with by market supervision agencies;
3) The risk of accusations by peers for competitive purposes.
4) UL certification In the US market, consumers and purchasing units are more willing to buy products with UL certification marks. | http://www.esanschool.com/en/News/Show_784.html |
North Dakota - a new state for both of us!
On our fall road trip, we headed north. We spent four nights and three days in the North Dakota Badlands, in the western part of the state. Who knew North Dakota could be so gorgeous? We certainly didn't -- it was the first time in the state for both Barry and me. I'm glad we finally made it here as it wasn't the flat, boring place I imagined at all. One thing I'm learning as we travel more (now that I'm retired!) is that most places have their own charm and beauty, if only you open your eyes to it. And western North Dakota is no exception. In September the crowds are certainly way down in Theodore Roosevelt National Park, the big tourist destination here, from summertime.
We stayed in Dickinson, about a half hour east of the park. This city is suffering growing pains due to the recent oil boom in the Bakken Formation. Hotels, even the most basic, are much higher priced than most places we visit, because they are filled with oil workers. It's all supply and demand, baby. There was a ton of traffic and construction on the road right in front of the (very nice) La Quinta where we stayed, so we spent most of our daylight hours a bit west in and around the park area, which was much more to our liking. Quiet and beautiful.
There's a dinosaur museum in town, but it closes after Labor Day.
On our first full day in town, we woke up to a steady rain. Fortunately it stopped by lunchtime, and we were able to take a drive over to the park. We decided to postpone hiking until the next day since we'd missed the morning, but we enjoyed seeing the Painted Canyon area, walking around the small town of Medora outside the park, visiting the park information center, and then doing the loop drive through the park. The scenery was stunning.
Painted Canyon -- wish the sky had been blue for this one!
Bison poop on visitor center's grounds!
This cute little western town outside the park obviously gets a lot of visitors during the summer months but was pretty dead as we walked through. At least half the shops and restaurants were closed. We looked around for a refrigerator magnet but found very few available, so we didn't buy anything.
We first checked out Teddy R's Maltese Cross cabin, now re-located behind the park's visitor center. Just the right size and nicely preserved. With a bit of modernization, I could easily live there! Most of the logs are original to the structure, constructed in 1883.
The sun finally made an appearance during our drive of the 36-mile park loop. It was really beautiful and we couldn't wait to come back for a long hike the next day.
A real highlight was seeing this herd of bison heading up the rocks -- even some young'uns!
We passed numerous "prairie dog towns". I've never seen so many of these cute little critters in one place before.
Stay tuned for two more days in North Dakota -- a long hike and a mountain bike ride.
Who says North Dakota isn't gorgeous? | https://travelingtwosome.weebly.com/traveling-twosome-blog/north-dakota-a-new-state-for-both-of-us |
June 14, 2019
More than 14,000 cases of King Arthur unbleached all-purpose flour is being recalled because of potential E.coli contamination.
The Norwich, Vermont-based manufacturer announced Thursday that the five-pound bags of flour under the recall had been distributed nationally.
The company does note, however, that “no products sold through our website, Baker's Catalogue, the Baker's Store in Norwich, VT, or the Baking School in Burlington, WA are included in this voluntary recall.”
RELATED READ: Tyson recalls 190,000 pounds of chicken fritters distributed to schools, institutions
The affected bags of all purpose flour feature the following “Best Used By” dates and lot codes:
• BEST USED BY 12/07/19 LOT: L18A07C
• BEST USED BY 12/08/19 LOTS: L18A08A, L18A08B
• BEST USED BY 12/14/19 LOTS: L18A14A, L18A14B, L18A14C
King Arthur announced the recall after being informed by ADM Milling Co. that wheat used in the affected lots had been tied to an ongoing outbreak of E. coli infections. To date, there have been no reported illnesses connected to King Arthur flour, the announcement states.
According to Mayo Clinic, symptoms of E.coli infection typically rise from three to four days after exposure, including bloody diarrhea, cramps and nausea.
Further, King Arthur reminds consumers to wash their hands, work surfaces and utensils thoroughly after contact with raw dough or flour, and to never eat raw dough or batter. | https://www.phillyvoice.com/king-arthur-unbleached-all-purpose-flour-recalled-e-coli/ |
What is Gear Cutting?
Gear cutting is the process of creating a precise gear from a steel, or any other material, blank in order to coincide with the teeth of an opposing gear. Gear cutting is done through a number of methods, all with the same goal. The purpose or objective is to create a precisely timed gear, meaning the ratio of the gear creates the desired rotational speed. The gear must also be perfectly sized and able to be incorporated into a mechanical system as a means of transferring power from an energy source, such as a motor or drive shaft.
Gear cutting has evolved from a process in which a toothed radius was carved out of a piece of wood. Today, the process allows for a hardened steel alloy made to be cut by lasers to exact dimensions within .001 inch (0.00254 cm). The process of gear cutting has evolved to create gears that are able to withstand tremendous amounts of force and pressure.
Advances in gears have mainly come as a result of the use of stronger materials that make up the gear itself. The problem with these stronger materials is that the stronger the material used to create the gear, the harder it is to cut the gear out of the material. As such, there have been quite a few different methods of gear cutting developed over time to be used as efficient means of creating strong, durable gears.
These methods include everything from laser cutting to extrusion, since gears can be made out of virtually any material that lends itself to manipulation. For example, plastics can be extruded in precise shapes and sizes that are very hard and resilient to chemicals. Different metallurgical sciences have also created alloys that allow for hardened metals that are much lighter yet much stronger than that of ordinary steel, which is a very resilient material. Materials can also be cut from wood, which is mostly done today as a traditionalist or hobbyist method of gear cutting, such as in clock making.
When a gear has to be created with absolute precision, a laser that is guided by a computer is used to manufacture the gear to the specifications entered into the computer system. This precision machining method of cutting gears is generally used in high-performance engine parts. It can also be used in systems that require the utmost accuracy in their primary function. | https://www.wisegeek.net/what-is-gear-cutting.htm |
Radioactive waste and spent fuel rods (Energiaklub's statement)
Energiaklub published nine guidelines to follow in the management of radioactive waste (and spent nuclear fuel).
1. Stop more waste production
The first and most important step of responsible waste management is emissions reductions. No other industry in the world has been operating for decades while the fate of the hazardous waste it produces remains unsolved. The only reasonable strategy in this situation is decommissioning existing nuclear power plants and not building any new ones. This is the only way to ensure that the problem – and the amount of waste to be handled – will not increase drastically.
2. Not just a technological issue
It is important to realise that the long-term management of radioactive waste is not just a technological issue. The solution to this problem requires a holistic approach as it involves social, economic, political and ethical aspects among others, which are at least as important as the technological-scientific aspects. These questions cannot be excluded when making decisions with such high stakes.
3. Temporary storage – use the best technology available
Even in temporary storage, radioactive waste must be secured in the most cautious way possible, using the best technology available in order to prevent radioactive radiation from escaping into the environment. Establishing an adequate monitoring system is crucial, and continuous access must be provided to nuclear waste to allow maintenance and damage control. However, temporary storage facilities for spent nuclear fuel rods are more exposed to natural disasters and terrorism than nuclear power plants themselves, because these facilities are more vulnerable and not guarded as vigilantly. Therefore reinforcing the security of temporary storage facilities must be a priority.
4. Deep geological disposal – no guarantee for safety
There is no perfect solution for the final disposal of nuclear waste, such as underground storage facilities. A facility suitable for the final disposal of high-level radioactive waste and spent fuel rods does not exist anywhere in the world. Such facilities would have to insulate radiation emitting from this waste for hundreds of thousands of years, which understandably cannot be guaranteed. Despite research spanning several decades, researchers are still challenged by unsolved technological problems. Until the development of a long-term waste management method that is both technologically proven and socially accepted, the disposal of nuclear waste – as described about temporary storage – must be done in the most secure way possible, ensuring access to this waste for long-term management.
5. Reprocessing spent fuel rods is dangerous and polluting
Nuclear reprocessing is a method where plutonium produced in the fuel and unused uranium are extracted from spent fuel rods. It is a complicated and dangerous process that produces additional amounts of high-level radioactive waste. Furthermore, plutonium extracted this way can be used for nuclear weapons, creating significant security risk. Therefore we oppose the reprocessing of fuel rods.
6. Do not transport radioactive waste
Nuclear waste must be managed in the country where it is produced. If we enjoy the benefits of nuclear energy (the electricity generated) we must also bear the responsibility and cannot pass the burden and consequences of waste management on to the residents of other countries. Based on the same principle, Hungary cannot become an international or regional disposal country. Transporting spent fuel rods involves significant risk, therefore it is unacceptable.
7. Establish adequate financial resources
The total costs of waste management and nuclear power plant decommissioning must be incorporated into the price of nuclear energy, and this income must be kept in a suitable financial fund. We must ensure that the full amount is allocated to this fund during the operation of the nuclear power plant in order to not pass the burden of financing waste management on to future generations. Although we have hardly any experience in the world about the costs of waste management and power plant decommissioning, calculations must be performed in a way to guarantee that this fund has significant security reserves and holds its value in the long run.
8. Total transparency and social participation
All the information pertaining to the management of radioactive waste should be available for the public. Preparation of decisions must be transparent, and the public should be included in the decision-making process. In addition to available data, the public should be informed about the risks and possible consequences of planned activities, and about measures planned to minimise risks. Full-scale social involvement is necessary because this subject involves issues that span thousands of years, that affect or even determine the life of future generations, thus it is unacceptable that, for instance, the construction of a deep geological disposal site is decided by a few current decision-makers and the residents of municipalities in the area surrounding the planned site.
9. Information dissemination through generations
Spent nuclear fuel rods remain radioactive for hundreds of thousands of years, and although their hazard decreases over time, they are still severely dangerous to the environment, wildlife and human health for thousands of years. Therefore, unless a technology is developed further in the future that can significantly decrease the volume and time of radioactivity, dissemination of all information pertaining to nuclear waste must be ensured for a long timeframe. Future generations must know exact details on the location, type and amount of nuclear waste and on the security system of disposal sites. This is absolutely necessary to maintain safety. It requires the development of a comprehensive operational, institutional and legal system that can guarantee the long-term maintenance of such information. | https://energiaklub.hu/en/news/radioactive-waste-and-spent-fuel-rods-energiaklubs-statement-4591 |
The growth of data has begun to transform the transportation research and policy, and open a new window for analyzing the impact of crashes. Currently for the crash impact analysis, researchers tend to rely on reported incident duration, which may not always be accurate. Further, impact of the crashes could linger a much longer time at upstream, even if the records are correct for the crash spot and it is a challenge to quantify the impact of a crash from the complex dynamics of the recurrent and non-recurrent congested condition. Therefore, a difference-in-speed approach is developed in this research to estimate the true crash impact duration using stationary sensor data and incident logs. The proposed method used the Kalman filter algorithm to establish traveler’s anticipated travel speed under incident-free condition and then employ the difference-in-speed approach to quantify the temporal and spatial extent of the crash. Moreover, potential applications such as statistical models for predicting the impact duration and total delay were developed in this research. Later, an analysis on distribution of travel rate was performed to describe and numerically show to what extent crashes influenced travel rates compared with the normal conditions at different periods of the day and by the crash types. This study can help to shape incident management policies for different types of crashes at different periods and illustrates the usages of data to improve the understanding of crashes, their impact, and their distribution in a spatial-temporal domain.
Digital Object Identifier (DOI)
https://doi.org/10.13023/ETD.2016.516
Recommended Citation
Kazi, Obaidur Rahman, "A Data Driven Approach to Quantify the Impact of Crashes" (2016). Theses and Dissertations--Civil Engineering. 50. | https://uknowledge.uky.edu/ce_etds/50/ |
1296839 Alpha-amylase NOVO TERAPEUTISK LABORATORIUM A/S 19 May 1970 [29 May 1969 21 July 1969] 27352/69 and 36528/69 Heading C3H An enzyme material comprising alphaamylase is produced by culture of a microorganism of the species Bacillus licheniformis in a nutrient medium. The enzyme may be isolated ...
The present invention discloses a microbial polyunsaturated fatty acid(PUFA)-containing oil with a high triglyceride content and a high oxidative stability. In addition, a method is described for the recovery of such oil from a microbial biomass derived from a pasteurised fermentation broth, wherein ...
Acids are recovered from their aqueous solution by an extraction process comprising a first extraction stage at which the aqueous solution is contacted with a water-immiscible extractant comprising a water-immiscible organic solvent and, dissolved therein, at least one secondary or tertiary amine in ...
The present invention relates to a process for preparing a biomass, such as from a microbial fermentation, for an extraction process to separate desired chemicals, nutritional products, bioactive components, proteins, carbohydrates, and lipids, from the biomass. Particularly preferred substances to ...
A process for producing ethanol by the conversion of carbohydrates from a corn dry milling process in which the bottoms fraction from distillation of ethanol in a conventional yeast fermentation is used in a process including a combination of biochemical and synthetic conversions. The process result ...
A process for producing and purifying succinic acid comprises growing a succinate salt-producing microorganism on an inexpensive substrate containing carbohydrate, other nutrients, sodium ions and tryptophan under a CO.sub.2 partial pressure until most of the carbohydrate is converted to succinate. ...
Disclosed in a process for growing the microflora Thraustochytrium, Schizochytrium, and mixtures thereof, which includes the growing of the microflora in fermentation medium containing non-chloride containing sodium salts, in particular sodium sulfate. In a preferred embodiment of the present invent ...
The present invention discloses a microbial polyunsaturated fatty acid(PUFA)-containing oil with a high triglyceride content and a high oxidative stability. In addition, a method is described for the recovery of such oil from a microbial biomass deriverd from a pasteurized fermentation broth, wherei ...
The instant invention describes a process for the manufacture of butanol and like volatile organic compounds by fermenting carbohydrates, mainly polysaccharide, with micro-organisms which convert carbohydrates into mainly butyric acid and other acids. The acids are subsequently transferred to the so ...
| |
PTSD: What is it? Its causes? Symptoms and treatments
Post-Traumatic Stress Disorder (PTSD) is caused by having any traumas in the past that could have led them to feel fearful, shocked, or helpless and can also lead to long-term effect such as flashbacks, sleeping disorder and anxieties. Any experience that can lead to PTSD can include the following:
Although, PTSD can effect a person’s life for the long-term but through proper treatment it could also be cured and here we will discuss a few ways of how you can also recover from PTSD.
Symptoms and Diagnosis
Symptoms usually start within 3 months of the trauma that they have faced or it can even occur much later. A person can also receive diagnosis if they face any of the following:
|
|
Intrusion Symptoms
· Nightmares
· Flashback and/or sensation
· Fearful thoughts
|
|
Avoidance Symptoms
· Refusing to discuss and event
· Avoiding a situation
|
|
Symptoms That Affect Mood And Thinking
· Difficulty sleeping
· Inability and angry outbursts
· Feeling tense and anxious
|
|
Arousal And Reactivity Symptoms
· Inability to remember an aspect of an event
· Feeling of guilt and blame
· Having reduced interest in life
Physical Symptoms
These may eventually lead to breakdowns and can also hamper work and other relationships.
Complications
There are some complications that can occur through PTSD which include:
Other issues may include anxiety, depression, personality disorders, abuse of substances, etc.
Treatments
Cognitive processing therapy (CPT): Also known as cognitive restructuring, the individual learns how to think about things in a new way. Mental imagery of the traumatic event may help them work through the trauma, to gain control of the fear and distress.
Exposure therapy: Talking repeatedly about the event or confronting the cause of the fear in a safe and controlled environment may help the person feel they have more control over their thoughts and feelings. The effectiveness of this treatment has been questioned, however, and it must be carried out with care, or there may be a risk of worsening of the symptoms.
When it would be advisable to see a doctor?
Many people can experience anxiety, depression and/or disorders in their life at any stage but this is not necessarily a case of PTSD.
Prompting treatment with a professional doctor can help before the symptoms worsen. These should be taken under consideration if:
Self Help Tips
A person should actively to cope with the trauma that they have faced. It will help to accept the situation that they were put in and help them try to move on, but it can only be made possible if they learn to accept, that yes, the situation happened and I should try improving on my situation.
Some ways that a person going through PTSD can do this by:
Other ways can be: | https://www.hospitallcare.com/blog/Post-Traumatic-Stress-Disorder-Causes-Symptoms&Treatment |
A vegan food festival will take place at Thong Nhat Park in Hanoi from November 1 to 3, accommodating over 100 booths with nearly 1,000 vegan dishes, according to the Government’s news site.
Restaurants, chefs, environmentalists and businesses will introduce a range of vegan dishes from different regions of the country that are cooked in a creative way, organic products, environmentally friendly goods, and environmental solutions and services.
The festival also offers an opportunity for visitors to relax, enjoy nature and music performances that show humans’ love for nature, contemplate artistic works, have fun with family, or learn more about the vegan lifestyle.
The three-day event is open to public, expecting to attract some 30,000 visitors. | https://english.vov.vn/pntertainment/vegan-food-festival-to-be-held-in-hanoi-405301.vov |
A Quantitative Study on Global Banks P? nar Gungor Okan University, Istanbul, 34722 Turkey Abstract The primary goal of this study is to research the relationship between the reward management system applications and employee performance of bank employees on global banks in Istanbul.
It also focuses on the role of motivation as an intervening factor. According to the literature review on the previous studies it is proven that organizations use reward systems and strategies to motivate their employees and to increase their performance. This study will have lots of contributions to the business world. Organizations may improve or change their reward systems to survive in today’s environment with the help of this study. They may renew their reward systems and put more efficient and effective ones.
In this study, employee performance effectiveness is determined on reward systems. At the beginning of the study, there is a literature review and there are hypotheses concerning the effects of reward management system and motivation on employee performance. Secondly, theoretical framework is discussed through the effects of reward management system applications and motivation on employee performance. Finally hypotheses are tested using data from 116 bank employees in 12 global banks and research results or findings are analyzed.
Keywords: Reward Management System, Employee Performance, Motivation, Global Bank © 2011 Published by Elsevier Ltd. Selection and/or peer-review under responsibility of 7th International Strategic © 2011 Published by Elsevier Ltd. Selection and/or peer-review under responsibility 7th International Management Conference Strategic Management Conference ? Corresponding author. Tel. + 90-216-677-1630 fax. +90-216-677-1647 Email address: pinar. akinci@okan. edu. tr 1. Introduction Globalization is a concept that encompasses change and competition.
The findings of the study is consistent with the previous studies which, Herpen, Praag, Cools, (2005), have investigated empirically the effects of pay on performance. They mentioned that some theories predict that the practice of a compensation system affects the motivation of employees. The results of their study bring out a positive relationship between the perceived features of the reward system and extrinsic motivation. According to their findings similar with the results of this study, Intrinsic motivation is not affected by the design of monetary compensation, but by promotion opportunities.
The limitation of the study is the response rate of the bank employees who are expected to be 250 appropriate with the number of the items. For further studies, the ineffectiveness of the non-financial rewards on employee performance should be investigated to find the weakness of the non-financial part of the reward system.
ACC401 Auditing Principles and Procedures
The Assignment must be submitted on Blackboard (WORD format only) via allocated folder.
Assignments submitted through email will not be accepted.
Students are advised to make their work clear and well presented, marks may be reduced for poor presentation. This includes filling your information on the cover page.
Students must mention question number clearly in their answer.
Late submission will NOT be accepted.
Avoid plagiarism, the work should be in your own words, copying from students or other resources without proper referencing will result in ZERO marks. No exceptions.
All answers must be typed using Times New Roman (size 12, double-spaced) font. No pictures containing text will be accepted and will be considered plagiarism.
Submissions without this cover page will NOT be accepted.
Assignment Question(s): (Marks 10)
IMPORTANT NOTE: Answer in your own words, DO NOT COPY from slides, fellow students, or internet sources without proper citation.
Q1. Explain the relationship between audit, attest, and assurance services. (3 Marks).
Q2. Assume that you are the new audit senior on the Sameer Drug Corporation (SD) engagement. SD is a pharmaceutical company that has three successful drugs and several drugs in progress in its research and development pipeline. You are considering your audit plan and it is important to identify the inherent risks that SD has and how they relate to the planning process. (2 Marks).
Required:For each of the following factors, indicate whether it will tend to increase, decrease, or have no effect on inherent risk, and the reasoning for your answer.a. Dr. Ahmad is the major shareholder of SD and its CEO.b. Your firm has audited SD for the last four years.c. There has been a high turnover of key accounting personnel during the last two years.d. The internal audit function reports to the audit committee.
Q3. Discuss the purposes for planning the audit and identify the steps that are performed during this phase of the engagement. (3 Marks).
Q4. Name and describe three supervisory activities that should be performed by the engagement partner and other engagement team members performing supervisory activities. (2 Marks). | https://onlinecustomessaywriting.com/employee-motivation-buy-argumentative-essay-help-criminology-online-class-help/ |
Top Story
During a worldwide pandemic and its ensuing essential lockdown, it would have been easy for members of our community to bemoan our circumstances and take on a victimized persona. Sure, we see a few examples of that around these parts. But we have far more examples of people and organizations…
Top Story
Northwest River Supplies plans to distribute tens of thousands of personal protective equipment to area medical personnel and first responders in the coming weeks to combat the shortage of equipment because of the COVID-19 pandemic, NRS CEO Bryan Dingel said.
More Headlines
Kyle Schultheis holds a handful of garbanzo beans, which he was planting Sunday with a no-till air drill. The red shell covering the beans is a seed treatment and protects the seed while it germinates in the soil.
Kyle Schultheis uses a no-till air drill to plant kabuli-type garbanzo beans at his family’s farm south of Colton on Sunday afternoon. The beans are a larger type of garbanzo used mainly for canning purposes.
Kyle Schultheis digs through the soil to show where garbanzo beans were planted in one of the fields on his family’s farm south of Colton on Sunday afternoon. Garbanzo beans are just one of several different crops Schultheis and his family are planting this year.
Demand for legumes has grown, spurred on by consumers looking for ‘shelf-stable foods’
Kyle Schultheis holds a handful of garbanzo beans, which he was planting Sunday with a no-till air drill. The red shell covering the beans is a seed treatment and protects the seed while it germinates in the soil.
Pete Caster/Lewiston Tribune
Kyle Schultheis uses a no-till air drill to plant kabuli-type garbanzo beans at his family’s farm south of Colton on Sunday afternoon. The beans are a larger type of garbanzo used mainly for canning purposes.
Pete Caster/LewistonTribune
Kyle Schultheis digs through the soil to show where garbanzo beans were planted in one of the fields on his family’s farm south of Colton on Sunday afternoon. Garbanzo beans are just one of several different crops Schultheis and his family are planting this year.
Toilet paper isn’t the only thing being whisked off the grocery store shelves these days.
Ever since the coronavirus pandemic settled in, agriculture producers have experienced a bean boom as consumers stock up on dry beans, peas, lentils and chickpeas. Jeff VanPevenage, president and CEO of Columbia Grain International at Portland, said his company has seen a 40 percent increase in demand for these products over the past couple of months, and processing plants are working around the clock to fulfill an ever-increasing number of orders.
“As the news started coming out, dry beans and shelf-stable foods were right in there with toilet paper,” VanPevenage said. “If you started going to the grocery stores in early February, you started to see toilet paper was gone, but dry beans and lentils were wiped out, and it continues to be wiped out.”
VanPevenage said he took a personal tour of seven grocery stores in the Portland area about a month ago and the empty shelves of legumes confirmed his suspicions.
“That’s not just something the general public shops for,” in bulk, he said.
At the same time, demand for legumes began escalating around the world. Buyers began to call American producers, wanting to buy more product and “wanting it shipped immediately,” VanPevenage said.
Transportation, however, has been a problem in some parts of the world, delaying how quickly the products can be shipped.
“I think what has happened, prices have been relatively cheap the last two or three years and buyers have become accustomed to buying what they want with immediate shipment,” VanPevenage said.
“When everybody in the world all of a sudden needed to restock, capacity (to resupply) was gone, just like that. The Canadians have had worse transportation problems than the U.S. and then (shipping) containers got tied up in China when they were shut down. So, with the lack of container availability to move this product, people could ship in June or July, but not now.”
The shipping capacity in the Pacific Northwest, however, appears to be fine for the time being. There have been enough containers to bring from Seattle and Tacoma to load at Lewiston and return to the coast, VanPevenage added.
“It hasn’t been perfect, but OK for the most part,” he said. “Unlike Canada (that is) 40 percent in need of containers.”
The bean boom has brought about a nice increase in prices for farmers in the region. VanPevenage said prices are up about 10 to 15 percent for pulses from a year ago.
As of Friday, the Pacific Northwest Farmers Cooperative listed cash bids for garbanzo beans at $18 a hundred weight; $15 for small brown lentils and $12 for whole green peas.
And although many farmers have nearly finished spring seeding, VanPevenage said growers were aware a few weeks ago of the rising demand for legumes and had time to adjust their plans to grow more acres, if they so choose.
“The Palouse is used to seeding a lot of chickpeas but the whole world decided to seed chickpeas (recently), so prices have been lower,” VanPevenage said. “So we’re seeing some switch from chickpeas toward peas and lentils this year.”
Other agriculture products that have been affected by the coronavirus outbreak include:
Northwest Farm Credit Services recently released a snapshot of the effect of the pandemic on other agriculture commodities. The 12-month outlook for cattle suggests variable profitability with strong domestic demand. Dairy products are not as likely to be profitable, according to the study. Much of the profitability will depend on producers ability to keep up with demand.
The outlook for the nursery and greenhouse industry remains positive for 2020 with growers reporting strong orders and an early start to the spring shipping season.
Wheat growers are looking at break-even returns with the season’s average farm price on all varieties of wheat at $4.55 per bushel, down 61 cents from last year.
Apples, cherries and pears are expected to have slightly profitable returns for growers. Improving export markets are positive for the industry, but domestic demand is sluggish.
The 12-month outlook anticipates slight profits for wineries and vineyards. With overproduction in two of the largest wine-producing areas in the Northwest, grape prices are falling and sales by volume are declining as consumers cut back on alcohol consumption, according to the study.
Twenty-one groups representing agriculture and food businesses recently sent a letter to congressional leaders demanding better support for independent farmers who have been impacted by COVID-19. The letter specifically addresses these businesses’ eligibility for the Small Business Administration’s Economic Injury Disaster Loan program. Among the signatories was the Idaho Organization of Resource Councils. | |
TECHNICAL FIELD
BACKGROUND
SUMMARY OF THE INVENTION
0001 The present invention relates generally to electronically controlled common rail fuel injection systems, and more particularly to rail pressure sampling in a common rail fuel injection system.
0002 Common rail fuel injection systems come in many forms. For instance, a common rail fuel injection system might maintain fuel at injection pressure levels in the common rail, and then inject at that pressure by respective fuel injectors connected to the common rail. In another example, a separate actuation fluid, such as lubricating oil, is maintained in a common rail at a medium pressure level. This actuating fluid is then supplied to individual injectors which utilize the actuation fluid to hydraulically pressurize fuel within the individual injectors to injection pressure levels. In still another example, fuel is maintained in a common rail at a medium pressure level. The individual fuel injectors connected to such a rail have the ability to inject directly at the medium pressure level, or utilize the medium pressure fuel to hydraulically intensify the pressure of the fuel to be injected from the fuel injector. In all of these cases, the fuel injection rate is strongly a function of the rail pressure. Thus, as one would expect, the determination of injection control signals are currently based at least in part upon an estimated rail pressure. The accuracy of any given fuel injection event is strongly related to the accuracy of a rail pressure estimate used in determining the injection control signals that will be used in an attempt to deliver those desired injection characteristics.
0003 Engineers have observed that rail pressure can vary substantially between injection sequences but also within an injection sequence itself. In many cases, these fluctuations in rail pressure can exceed 15% of the average rail pressure, especially, and possibly to a larger extent, during cold starting. These fluctuations in rail pressure can be attributable to a number of phenomena. For instance, localized rail pressure fluctuations can be attributable to pressure waves bouncing around in the common rail due to such events as the opening and closing of various valves. More significantly, however, is the fact that in most cases the common rail is steadily supplied with fluid from a high pressure pump, but fluid is consumed from the rail by the injectors in brief gulps. Thus, one could expect rail pressure to drop with each injection event, and then recover between events. Much more accurate delivery timings and quantities can be achieved if the rail pressure is known at the start of each injection event. Unfortunately, it is currently difficult to instantaneously obtain an accurate rail pressure measurement, and in the same instant generate control signals based upon that rail pressure measurement, and again in that same instant carryout the determined control signal. Thus, one problem associated with improving delivery and timing accuracy of fuel injection events is the problem of accurately determining what the rail pressure will be at the beginning of each one of those events.
0004 In most systems, a single CPU processor is used by the electronic control module to control the engine, which includes the fuel injection system. Since the processor can only do one thing at a time and because the processor is generally occupied with processing data in regular periodic intervals and controlling injector drivers during an injection event, only a limited amount of time is available to determine desired injection characteristics, determine control signals and set up for a subsequent injection event, especially at high speeds and loads. In fact, under some higher speed and load conditions, the time available may be so short as to require the electronic control module to calculate control signals for more than one injection event for two different cylinders. In all of these cases, rail pressure is sensed sometime before the determination of control signals for some subsequent injection event. For instance, in some cases rail pressure is sensed at regular intervals, such as every so many milliseconds. Unfortunately, such a strategy can result in an inaccurate rail pressure being used to determine control signals since the rail pressure measurement might be taken a relatively long period of time before the subsequent injection event. In other cases, a rail pressure measurement is taken at the start of current for an injection event, and then that rail pressure measurement is used as an estimate for determining control signals for one or more later injection events. While such a strategy avoids the possibility of a processor interrupt at an inopportune time, the rail pressure data can be relatively stale since the rail pressure measurement used in calculating control signals is based upon a rail pressure that occurred at the beginning of a preceeding injection event.
0005 The present invention is directed to these and other problems associated with determining rail pressure in a common rail fuel injection system.
0006 In one aspect, a method of improving accuracy of a fuel injection event in a common rail fuel injection system includes a step of sensing rail pressure at least a predetermined time before a start of control signal for a succeeding injection event but after an end of control signal of an immediately preceeding injection event. The succeeding injection event control signals are determined based at least in part on the sensed rail pressure.
0007 In another aspect, a fuel injection system includes a common rail containing a pressurized fluid. A plurality of fuel injectors have inlets fluidly connected to the common rail. An electronic control module is operably coupled to the fuel injectors and includes a rail pressure determinator operable to determine rail pressure at least a predetermined time before a start of control signal for a succeeding injection event but after an end of control signal for an immediately preceeding injection event.
0008 In still another aspect, an article includes a computer readable data storage medium. A rail pressure determinator is stored on the medium and is operable to determine rail pressure at least a predetermined time before a start of control signal for a succeeding injection event but after an end of control signal for an immediately preceeding injection event. A control signal determination algorithm is stored on the medium and is operable to determine a succeeding injection event control signal based at least in part on a sensed rail pressure generated by the rail pressure determinator.
BRIEF DESCRIPTION OF THE DRAWINGS
0009FIG. 1 is a schematic illustration of an engine with a common rail fuel injection system according to one example embodiment of the present invention;
0010FIG. 2 are graphs of control signal current and rail pressure verses time for four different engine speeds according to one aspect of the present invention;
0011FIG. 3 is a software flow diagram according to one aspect of the present invention;
0012FIG. 4 is a software flow diagram according to another aspect of the present invention; and
0013FIG. 5 is a table of cylinder data, crank data and cam shaft data verses engine angle according to one aspect of the present invention.
DETAILED DESCRIPTION
INDUSTRIAL APPLICABILITY
9
10
11
12
13
11
0014 Referring to FIG. 1, an internal combustion engine , which is preferably a compression ignition engine, includes a common rail fuel injection system that includes a pump , a high pressure common rail and a plurality of fuel injectors . Pump can be any suitable high pressure pump, but is preferably a fixed displacement sleeve metered variable delivery axial piston pump of the type generally described in co-owned U.S. Pat. No. 6,035,828. Those skilled in the art will appreciate that any suitable pump, such as a variable angle swash plate pump whose output is controlled via an electrical signal, could be substituted for the illustrated pump without departing from the intended scope of the present invention. In addition, fixed delivery pumps could also be utilized with the inclusion of some means to control rail pressure. For instance, in some previous common rail fuel injection systems, a fixed delivery pump is used, and a separate rail pressure control valve is utilized to control rail pressure by leaking a portion of the pressurized fluid in the common rail back to drain. In the illustrated example, the common rail contains an amount of pressurized actuating fluid, which is preferably engine lubricating oil, but could be any other suitable fluid, such as fuel.
13
13
39
0015 Fuel injectors are preferably hydraulically actuated fuel injectors of the type manufactured by Caterpillar, Inc. of Peoria, Ill., but could be any suitable common rail type fuel injector, including but not limited to pump and line common rail fuel injectors, or possibly a Bosch type common rail fuel injector of the type described in Heavy Duty Diesel EnginesThe Potential of Injection Rate Shaping for Optimizing Emissions and Fuel Consumption, presented by Messrs Bemd Mahr, Manfred Durnholz, Wilhelm Polach, and Hermann Grieshaber, Robert Bosch GmbH, Stuttgart, Germany at the 21 st International Engine Symposium, May 4-5, 2000, Vienna, Austria. Thus, those skilled in the art will appreciate that, depending upon the structure of the common rail fuel injection system, another fluid, such as diesel fuel (Bosch) could be used in the common rail without departing from the intended scope of the present invention. Preferably, fuel injectors include a hydraulically driven pressure intensifier .
11
17
14
20
16
11
27
12
37
12
28
35
29
13
14
25
31
13
12
0016 In the preferred embodiment illustrated, variable delivery pump includes an inlet connected to a low pressure reservoir/oil pan via a low pressure supply line . An outlet of variable delivery pump is fluidly connected to an inlet of high pressure common rail via a high pressure supply line . Common rail includes a plurality of outlets that are fluidly connected to fuel injector inlets via a plurality of high pressure supply lines . After being used by the respective fuel injectors , the used oil returns to low pressure reservoir via an oil return line for recirculation. The system also includes, in this example embodiment, a fuel tank that is fluidly connected to fuel injectors via a fuel supply line, which is preferably at a relatively low pressure relative to that in high pressure common rail .
10
9
15
11
13
21
12
15
22
12
23
9
15
24
33
10
12
15
34
15
10
10
0017 In order to control fuel injection system and the operation of engine , an electronic control module receives various sensor inputs, and uses those sensor inputs and other data to generate desired injection characteristics and control signals. These signals are usually in the form of a control current level, control signal duration and timing, to control the various devices, including the variable delivery pump and the fuel injectors . In particular, a pressure sensor senses pressure somewhere in the common rail and communicates a pressure signal to control module via a sensor communication line . The electronic control module uses the pressure sensor signal to estimate the pressure in the common rail . A speed sensor which is suitably located on engine , communicates a sensed speed signal to electronic control module via a sensor communication line . A temperature sensor , which can be located at any suitable location in common rail fuel injection system , but preferably in rail , communicates an oil temperature sensor signal to electronic control module via a sensor communication line . Like the other sensors, electronic control module uses the signal to estimate the oil temperature in fuel injection system . The electronic control module preferably combines the temperature estimate with other data, such as an estimate of the grade of the oil in system , to generate a viscosity estimate for the oil. Those skilled in the art will appreciate that viscosity estimates can be gained by other means, such as by pressure drop sensors, viscosity sensors, etc. In other common rail systems, viscosity is less of a concern.
15
13
26
0018 Electronic control module controls the activity of fuel injectors in a conventional manner via an electronic control signal communicated via injector control lines , only one of which is shown. A typical control signal for an injection event is characterized by the timing at which the control signal is initiated and the duration of that signal. In addition, the current level may change during the event, such as starting at a high pull-in level and dropping to a lower hold-in level. Nevertheless, the present invention is not limited to those systems in which fuel injection quantity is a function of the control signal duration. Thus, in most instances and in the example embodiment, the electronic control module determines and controls current levels, durations and timings.
15
19
36
18
36
11
18
36
11
19
15
10
0019 Electronic control module also controls a pump output controller that includes an electro hydraulic actuator and a control communication line . Preferably, electro hydraulic actuator controls the output of variable delivery pump in proportion to an electric current supplied via control communication line in a conventional manner. For instance, in the preferred embodiment, electro hydraulic actuator moves sleeves surrounding pistons in pump to cover spill ports to adjust the effective stroke of the pump pistons, and hence the output from the pump. The pump output controller could be analog, but preferably includes a digital control strategy that updates all values in the system at a suitable rate, such as every so many milliseconds. The pump control signal generated by electronic control module is preferably a function of the desired rail pressure, the estimated rail pressure and the estimated consumption rate of the entire fuel injection system and whatever other devices, such as engine brake actuators, that are connected to the rail.
21
0020 At regular and/or irregular intervals, the electronic control module determines a set of desired injection characteristics for a succeeding injection sequence. Each injection sequence includes one or more injection events, and the electronic control module determines a desired timing for each injection event and a desired quantity of fuel to inject in each injection event. The desired injection sequence characteristics are preferably determined at an appropriate time before a succeeding injection sequence. Also, at some time between the preceding injection event and a succeeding injection event, a rail pressure measurement is taken via rail pressure sensor . The control signal characteristics to be determined include a timing delay between the start of current and the start of injection, and a control signal duration. These delay and duration variables are determined in a conventional manner, such as by utilizing equations and/or look up tables. In the case of the illustrated fuel injection system, the timing delay is preferably calculated using rail pressure and temperature as independent variables. The duration signal is preferably calculated using a lookup table that uses rail pressure and desired fuel injection quantity as independent variables. Thus, in order to produce the desired injection event at the desired timing, current to the individual injector is initiated at a timing that corresponds to the desired injection event timing as advanced by the determined delay. The control signal continues for the determined duration in order to cause the injector to inject fuel in a manner that corresponds to the desired injection quantity. It is simply not practical to measure the rail pressure at the start of current and then do the necessary lookups regarding duration. It is not possible to measure the rail pressure at start of current and use it to determine the delay between start of current and start of injection. A more practical option is to measure the pressure after the previous cylinder events are complete, but before setting up the first injection event on the current cylinder.
0021 Those skilled in the art will recognize that it takes a finite amount of time to do the necessary look ups and/or calculations to determine the start of current/start of injection delay as well as the control signal duration. In addition, after these control signal characteristics are determined, it also takes a finite amount of time to set up the injector drivers with those control signal values. Thus, in one aspect, the pressure measurement according to the present invention occurs at least a predetermined time before the start of current for the first injection event of the succeeding injection sequence. In other words, the pressure measurement should be taken with adequate time to determine the injection control signal characteristics and set up the injector drivers with the same before the start of control signal timing for the succeeding injection event.
0022 After determining the minimum amount of time before the start of control signal for a succeeding injection event in which to take the pressure measurement, one should preferably determine what time window is available for taking the pressure measurement across the engine/injectors expected operating range. Those skilled in the art will appreciate that at high engine speeds and loads, injection durations are relatively long and come close in time in successive cylinder events. This exercise can reveal whether the invention can be implemented by taking the rail pressure at a predetermined timing before top dead center across the entire engine operating range, or whether two or more strategies should be implemented depending upon engine operating conditions.
9
21
33
45
57
69
51
0023 Referring now to FIGS. 4 and 5, one possible methodology of implementing the present invention is illustrated. In this embodiment, the engine's hardware is modified to include a marker on some rotational element, such as a marker tooth on a crank shaft and/or a cam shaft. These marker(s) are set to pass a marker reader at a preset angle before top dead center for each cylinder of the engine. For instance, FIG. 5 shows an example table for including appropriate markers to trigger a rail pressure sampling event at a fixed timing that is about 70 before top dead center for each cylinder. With this basic strategy, the ECM triggers a rail pressure measurement when it senses crank teeth , , , , and . FIG. 4 shows the software algorithm strategy for implementing this embodiment of the present invention. In box A, an injection characteristic determinator determines the desired injection characteristics (quantity and timing) for each injection event in the succeeding injection sequence. A marker reader algorithm triggers a processor interrupt I when the predetermined marker tooth rotates past a marker reader that is of conventional construction and appropriately located on the engine. At the following box D, the electronic control module samples and filters a rail pressure measurement. Using the desired injection characteristics and the sampled rail pressure, the delay between start of current and start of injection is determined with appropriate look ups and/or calculations in box E. Preferably, this timing offset is determined from a 3D map lookup using oil temperature and rail pressure as independent variables. Next, the injection duration is preferably determined using a 3Dlookup map using desired fuel quantity and rail pressure as independent variables in box F. In box G, the injector driver set up algorithm sets up the injector drivers for the succeeding injection event in a conventional manner, such as by placing the determined injection control signal characteristics in appropriate memory locations in or associated with the electronic control module. Finally, in box H the electronic control module executes the injection event, such as by initiating current to the selected injector at the determined start of current timing.
4
5
4
5
0024 Referring now to FIG. 3, an embodiment of the invention is illustrated that requires only software changes rather than software and hardware changes as in the FIGS. - embodiment. Like the other embodiment, the process begins with an injection characteristic determinator A that determines desired injection characteristics in a conventional manner. Next, in box B, a pressure sensing event determinator can be a fixed constant, or possibly be mapped against one or more engine variables. For instance, the pressure sensing event determinator could be the functional equivalent of the marker teeth of the FIGS. - embodiment by setting the pressure sensing event to occur at a fixed and predetermined timing before top dead center for each cylinder. Alternatively, the pressure sensing event determinator might be mapped against engine operating conditions, such as speed and load, to determine the angle before top dead center that a rail pressure measurement is taken. Thus, in this later strategy, the timing at which the rail pressure measurement is taken could be different depending upon different engine speeds and loads, for instance.
50
0025 Pressure sensing event determinator box B could be as simple as a fixed constant throughout the engine's operating range or as sophisticated as desired to suit any individual application of the present invention. An engine angle determinator then determines whether the engine is at the angle determined by pressure sensing event determinator B. When the engine is at the predetermined angle X as determined by the pressure sensing event determinator B, a processor interrupt I is initiated. As in the previously described embodiment, a rail pressure determinator D takes a rail pressure sample, conducts appropriate filtering, if any, and provides the same to the duration control signal determinator F in the control signal timing determinator G. After the control signal characteristics are determined, the injector drivers are set up in a conventional manner. Finally, the injection event is executed in a conventional manner at step H.
0026 In still another embodiment, the ECM might determine a desired angle at which to take the rail pressure measurement. Next, the ECM determines which marker tooth that desired angle corresponds to. It then commands a rail pressure measurement when the designated marker tooth is used. Such a strategy permits the marker tooth strategy to be made dynamic through appropriate software changes.
0027 Those skilled in the art will appreciate that the various algorithms and look up tables, etc. are preferably stored on a computer readable data storage medium. For instance, in the case of the present invention, the rail pressure determinator, the control signal determination algorithm, the rail pressure sensing event timing determinator, the engine angle determinator and marker reader algorithm, if any, are preferably stored on a computer readable data storage medium, which may be a portion of the electronic control module, be located in memory accessible to the electronic control module, or stored on some other computer readable device before being transferred to the electronic control module. Preferably, the entire array of algorithms used by the electronic control module are stored on a conventional computer readable data storage medium and then transferred to the electronic control module in a conventional manner.
0028 The present invention finds potential application in virtually any electronically controlled common rail fuel injection system. Such systems include, but are not limited to, pump and line systems with a pressurized fuel rail, hydraulically actuated systems that utilize a pressurized oil rail, and other systems that allow for injection directly from a pressurized fuel rail or utilize that pressurized fuel to intensify fuel to even higher injection pressure levels. In all of these systems, the ability to inject fuel in a predictable manner requires that the rail pressure be known with accuracy and timeliness. By implementing hardware and/or software changes, the present invention facilitates the sensing of rail pressure after the end of control signal for an immediately preceeding injection event but at least a predetermined time before a start of control signal for a succeeding injection event. The predetermined time before the start of control signal for the succeeding injection event preferably corresponds to the minimum amount of time required by the electronic control module to do the necessary look ups and calculations to convert a desired set of injection characteristics and a rail pressure measurement into control signal characteristics, and set up the system, including injection drivers, with those control signal characteristics. By taking the rail pressure measurement in this available window, the rail pressure measurement is preferably taken between rail pressure recovery events. In other words, not only is the rail pressure measurement taken relatively close in time to the succeeding injection event but also preferably after rail pressure has stabilized after recovering from a pressure drop due to a preceeding injection event. In most instances, the common rail is continuously supplied with pressurized fluid from a pump, but fluid is consumed from the rail in relatively brief gulps. Thus, the present invention preferably takes the rail pressure measurement a sufficient amount of time after the preceeding injection event that rail pressure in the common rail has recovered and stabilized. Nevertheless, it is within the scope of the present invention to take the rail pressure measurement while pressure fluctuations are occurring, such as during a rail pressure recovery event.
0029 Preferably, the invention is implemented by commanding a rail pressure sensing event at a predetermined timing before top dead center for each individual cylinder. This timing could be fixed, or more preferably determined as a function of known variables such as speed, load and temperature. This can be accomplished by examining engine and injector performance across the engine's operating range, especially at high loads and speeds. If this examination reveals there is a timing window available between injection events that includes a fixed angle before top dead center across the engine's operating range it might be desirable to implement the invention by taking the rail pressure measurement at that fixed timing before top dead center across the entire engine's operating range. As previously described, such a strategy can be accomplished with hardware, such as by including a marker tooth or other marker on a rotating portion of the engine, such as the crank or cam shaft, or through the software means such that the electronic control module continuously monitors the current crank angle and commands the rail pressure sensor measurement at the predetermined fixed timing. In other instances, it might be desirable to command the pressure measurement at different timings depending upon specific conditions such as the engine speed, temperature and the start of a succeeding injection event. For instance, instead of using a fixed timing before top dead center at which to take all rail pressure measurements, it might be desirable to determine a desired timing for taking a rail pressure measurement based at least in part upon a timing of a succeeding injection event, temperature and engine speed. While such a strategy would likely be more complex and require additional memory storage capability for mapping the rail pressure sensing event timing, such a strategy could permit the rail pressure measurement event to occur as close in time as possible to the start of current for a succeeding injection event across the engine's entire operating range. This dynamic strategy could be implemented with software alone or by a modified marker tooth strategy. In the later, the ECM would determine which marker tooth corresponds to the desired measurement angle, and then command the measurement when that marker tooth is sensed. In general, the closer in time to the injection event that the rail pressure is taken, the more accurate the determined control signals will produce the desired injection characteristics.
15
0030 Referring now to FIG. 2, a graph of injector current IC and rail pressure P are graphed against time for four example engine speeds according to an implementation of the present invention according to either the FIG. 3 or FIG. 4 embodiments. The vertical dotted lines of FIG. 2 reflect the electronic control module processor clock interval Z milliseconds, and demonstrates that the rail pressure sensor timing T is tied more to engine crank angle than the regular periodicity of the electronic control module (FIG. 1). These graphs are also useful in illustrating that a rail pressure recovery event occurs in conjunction with each injection event.
0031 The rail pressure sensing event timing T occurs at least a predetermined time before the start of current for the succeeding injection event. This predetermined time allows the electronic control module to do the necessary look ups and set ups to determine and implement control signal characteristics based at least in part upon the sensed rail pressure measurement. Although the graphs in FIG. 2 show only a single injection event each injection sequence, those skilled in the art will appreciate that the present invention is also applicable to injection sequences that include two or more injection events. Thus, the present invention contemplates scenarios in which a single rail pressure measurement is used to set up a plurality of injection events in a succeeding injection sequence, or possibly a rail pressure sensing event between injection events within a single injection sequence, provided enough time is available to do necessary look ups and/or calculations. FIG. 2 also shows each injection event being initiated with a high pull-in current and then dropping to a hold-in current level.
0032 It should be understood that the above description is intended for illustrative purposes only, and is not intended to limit the scope of the present invention in any way. Thus, those skilled in the art will appreciate that other aspects, objects, and advantages of the invention can be obtained from a study of the drawings, the disclosure and the appended claims. | |
General view of a Bendix MA-2 Time-of-Flight Mass Spectrometer. The Time-of-Flight Mass Spectrometer (TOFMS) was the flagship analytical instrument of the Bendix Corporation.
Mass spectrometry is an analytical technique used to identify qualitatively and quantitatively the atomic and molecular composition of inorganic and organic materials by sorting ions according to their mass-to-charge ratios. Mass spectrometers consist of four basic parts: a handling system used to introduce the unknown sample into the equipment; an ion source, in which a beam of particles characteristic of the sample is produced; an analyzer that separates the particles according to mass; and a detector, in which the separated ion components are collected and characterized.
|Creator|
|Format|
|Genre|
|Extent|
|Subject|
|Rights|
|Credit line||
|
Physical location
|Department|
|Collection|
|Physical container|
|View in library catalog|
Cite as
Bendix Corporation. “Bendix MA-2 Time-of-Flight Mass Spectrometer,” 1960–1969. Photographs from the Bendix Time-of-Flight Mass Spectrometer Collection, Box 1. Science History Institute. Philadelphia. https://digital.sciencehistory.org/works/8k71nh26t.
This citation is automatically generated and may contain errors. | https://digital.sciencehistory.org/works/8k71nh26t |
Investigating the interaction of direct and indirect relation on memory judgments and retrieval.
This study examined the interactive relationship between two measures of association (direct and indirect associations) when predicting relatedness judgments and cued-recall performance. Participants were recruited from Amazon's Mechanical Turk and were given word pairs of varying relatedness to judge for their semantic, thematic, and associative strength. After completing a distractor task, participants then completed a cued-recall task. First, we sought to expand previous work on judgments of associative memory to include semantic- and thematic-based judgments (judgments of relatedness), while also replicating bias and sensitivity findings. Next, we tested for an interaction between direct and indirect association when predicting participant judgments while also expanding upon previous work by examining that interaction when predicting recall. The interaction between direct and indirect association was significant for both judgments and recall. For low indirect association, direct association was the primary predictor of both judgment strength and recall proportions. However, this trend reversed for high indirect association, as higher levels of indirect relation decreased the effectiveness of direct relation as a predictor. Overall, our findings indicate the degree to which the processing of similarity information impacts cognitive processes such as retrieval and item judgments, while also parsing apart the underlying, interactive relationship that exists between the norms used to represent concept information.
| |
We are doing a HERO wod for Remembrance day. What we’ve actually decided to do is a Week of Hero Wods to honour the fallen soldiers and first Responders. We will be doing 3 HERO wods this week: Jennifer, Nutts and Donny. Yes it’s going to be a tough week but you will have to dig deep and do it. Remember the men and women who have lost their lives. I know everyone has a special someone who was killed in the line of duty. Remember.
Monday: Jennifer
Hero WOD: Jennifer
WOD Type: AMRAP
26 minutes
10 pull-ups
15 kettlebell swings, 1.5 pood
20 box jumps (24 inch box)
Saturday: NUTTS
Hero WOD: Nutts
WOD Type: For Time
10 handstand push-ups
15 deadlifts (250 pounds)
25 box jumps (30 inch box)
50 pull-ups
100 wallballs (20 pounds, 10 inch target)
200 double-unders
Bike 1 KM
Lieutenant Andrew Richard Nuttall, 30, from the 1st Battalion Princess Patricia’s Canadian Light Infantry (1 PPCLI), based in Edmonton, Alberta, serving as a member of the 1 PPCLI Battle Group was killed by an improvised explosive device that detonated during a joint foot patrol near the village of Nakhonay in Panjwaii District, about 25 km southwest of Kandahar City on December 23, 2009. He is survived by his parents, Richard and Ethel Jane Nuttall. | https://crossfitpickering.com/2019/11/10/remembrance-day-and-week/ |
BACKGROUND
SUMMARY OF THE INVENTION
DETAILED DESCRIPTION
The invention relates generally to medical devices and more particularly to devices and methods for use in electrical stimulation treatment.
Nerve cells consist of an axon for transmitting action potentials or neural impulses, and dendrites for receiving such impulses. Normally, nerves transmit action potentials from the impulse-sending axon of one nerve cell to the impulse-receiving dendrites of an adjacent nerve cell. At synapses, the axon secretes neurotransmitters to trigger the receptors on the next nerve cell's dendrites to initiate a new electrical current.
In some pathological states, transmission of action potentials is impaired, thus, activation of neural impulses is required to restore normal functioning. Electrically-excitable bodily tissues, such as nerves and muscles, may be activated by an electrical field applied between electrodes applied externally to the skin. Electric current flows through the skin between a cathodic electrode and an anodic electrode, eliciting action potentials in the nerves and muscles underlying the electrodes. This method is known for use in different types of stimulators, including transcutaneous electrical nerve stimulators (TENS), which relieve pain, therapeutic electrical stimulators, which activate muscles for exercise purposes, functional electrical stimulators which activate muscles for tasks of daily life, and stimulators that promote regeneration of damaged bones.
In other pathological states, action potentials are transmitted which do not serve a useful purpose; hence, blocking of unnecessary neural impulses is required to restore normal functioning. It has been reported that high-frequency stimulation can produce temporary reversible blocks of nerve axons. Generally, the frequency range is between 500 and 30,000 Hz.
Stimulation of nerves to either activate or block neural impulses is typically achieved with the use of an implanted stimulator (also known as a neural prosthesis or neuroprosthesis). Neural prostheses have been developed to restore hearing, to restore movement in paralyzed muscles, to modulate activity in nerves controlling urinary tract function and to suppress pain and tremor. In some cases, neural prostheses are designed to inhibit or suppress unwanted neural activity, for example to block pain sensation or tremors. However, all neural prostheses intended for long-term use require the implantation of a stimulator that contains electronic components and often a battery. In the case of pain and tremor suppression, the activated nerves reflexly inhibit the activity of neural circuits within the central nervous system. This indirect mode of reducing unwanted neural activity is sometimes called neuromodulation.
Surface electrical stimulators are used reflexly, for example, to reduce spastic hypertonus. A disadvantage of stimulation through electrodes attached to the body surface is that many non-targeted tissues may be co-activated along with the targeted tissues. This lack of selectivity often causes unwanted sensations and/or unwanted movements. Furthermore, tissues that lie deep within the body can be difficult or impossible to stimulate adequately, because most of the electrical current flowing between the electrodes flows through tissues closer to the electrodes than the targeted tissues. Selectivity may be improved by implanting insulated wires within the body that route electrical current from an implanted stimulator to the vicinity of the targeted tissues. This method is used, for example, in cardiac pacemakers, dorsal column stimulators, deep brain stimulators and sacral root stimulators. Cuffs containing the uninsulated ends of the wires may be placed around peripheral nerves to restrict most of the current to the vicinity of the nerve and limiting the spread of current to surrounding tissues, thereby improving selectivity. Implanted stimulators are expensive and often require a controller and/or power source external to the body. Batteries within the implanted stimulators need periodic replacement, entailing surgery.
In a minority of cases, stimulating wires are implanted in bodily tissues and led through the skin (percutaneously) to a connector located outside the body, to which an external stimulator is attached. External stimulators are typically less expensive than implanted stimulators, but the percutaneous wires provide a conduit for infection and therefore require daily cleaning and maintenance. This has generally limited the use of percutaneous electrodes to short-term applications. There is a need for a system which overcomes such problems and has the capability of activating or blocking nerve impulses depending upon the disorder to be treated. For example, a system and method is needed that can treat various indications such as; urinary incontinence through stimulation of the tibial nerve and/or the common peroneal nerve; in conjunction with a joint replacement procedure or prior to such a procedure; to promote wound healing; to treat a bone defect, such as, a fracture or a break; and/or to reduce or prevent muscle atrophy.
Systems and methods of treating a targeted body tissue (e.g., bone, soft tissue, muscle, ligaments, etc.) by stimulating the body tissue with an electric current are described herein. In one embodiment, a method includes implanting an implant entirely under the subject's skin. The implant includes a passive electrical conductor of sufficient length to extend from subcutaneous tissue located below either a surface cathodic electrode(s) or a surface anodic electrode(s) to the tibial nerve. The surface electrodes are positioned in spaced relationship on the subject's skin, with one of the electrodes positioned over the pick-up end of the electrical conductor such that the portion of the current is transmitted through the conductor to the tibial nerve, and such that the current flows through the tibial nerve and returns to the other of the surface cathodic electrode and the surface anodic electrode. An electrical current is applied between the surface cathodic electrode and the surface anodic electrode to cause the portion of the electrical current to flow through the implant to stimulate the tibial nerve. In some embodiments, a method includes electrical stimulation of a common peroneal nerve; stimulation applied in conjunction with a joint replacement procedure or prior to such a procedure, stimulation to promote wound healing, stimulation to treat a bone defect, such as, a fracture or a break and/or stimulation to reduce or prevent muscle atrophy.
Systems and methods are described herein that include the use of passive electrical conductors that can route electrical current to electrically stimulate a target body tissue. Such devices and methods can be used to either activate or block neural impulses, depending upon the frequency and the disorder to be treated.
A system as described herein can include, for example, an implant, a stimulator, such as an electric pulse generator, external electrodes, and a power source. An implant is provided for electrically stimulating a target body tissue in a subject to either activate or block neural impulses. Once implanted, the implant can provide a conductive pathway for at least a portion of the electrical current flowing between surface cathodic and anodic electrodes positioned in spaced relationship on a subject's skin, and transmits that portion of electrical current to the target body tissue to either activate or block neural impulses. Systems and methods incorporating such an implant are described herein.
As described herein, a “subject” can be, for example, an animal including a human. A body tissue can be, for example, a neural tissue (in the peripheral or central nervous system), a nerve, a muscle (skeletal, respiratory, or cardiac muscle) or an organ, for example, the brain, cochlea, optic nerve, heart, bladder, urethra, kidneys and bones.
The systems, methods and devices described herein can be used to treat various conditions in which stimulation to either activate or block neural impulses may be desired. Such conditions can include, for example, movement disorders (e.g., spasticity, hypertonus, rigidity, tremor and/or muscle weakness, Parkinson's disease, dystonia, cerebral palsy), muscular disorders (e.g., muscular dystrophy), incontinence (e.g., urinary bladder disorders), urinary retention, pain (e.g., migraine headaches, neck and back pain, pain resulting from other medical conditions), epilepsy (e.g., generalized and partial seizure disorder), cerebrovascular disorders (e.g., strokes, aneurysms), sleep disorders (e.g., sleep apnea), autonomic disorders (e.g., gastrointestinal disorders, cardiovascular disorders), disorders of vision, hearing and balance, and neuropsychiatric disorders (e.g., depression). The systems, methods and devices can also be used for promoting bone growth (as required, for example, in the healing of a fracture), wound healing or tissue regeneration.
The systems, methods and devices described herein can also be used, for example, in the prevention of muscle atrophy, venous thrombosis and joint stiffness due to long-term disability resulting from spinal cord injury, stroke, brain injury or neural disorder. The systems, methods and devices described herein can also be used in cases of acute or short term disabilities, resulting in immobilization, such as joint replacement or other surgeries, fractured bones, or a variety of other reasons. Some examples of such uses are described below.
Other treatment procedures and methods described herein include systems and methods for use in tibial nerve and/or common peroneal nerve stimulation in the treatment of urinary incontinence; for use in conjunction with joint replacement procedures; and for use in applications to rehabilitate muscle attached to bone, such as in podiatry applications. In some embodiments, the systems and methods described herein are used to provide for movement of an immobile limb or body part. In some embodiments, systems and methods described herein can be used to increase blood flow through, for example, a limb, to reduce or eliminate muscle atrophy, and/or to improve muscle development. In some embodiments, an orthosis, such as a cast applied to a broken limb, can have a pulse generator (described in more detail below) embedded therein that can be used to apply an electrical current to an implant within the patient's body.
For stimulation of a target body tissue, particular frequencies to be applied depend upon many factors; for example, the type of nerve to be stimulated or blocked, the tissue which the nerve innervates, the size of the nerve, the subject to be treated, the type of condition, the severity of the condition, and the receptiveness of the subject to the treatment. In general, for blocking, high frequencies are useful, for example, the cyclical waveform can be applied at a frequency in the range of between 100 and 30,000 Hz, or alternatively in the range of between 100 and 20,000 Hz. Alternatively, the cyclical waveform can be applied at a frequency in the range of between 100 and 10,000 Hz, or in the range between 200 and 5,000 Hz. For stimulation or activation, low frequencies are generally used, for example, a frequency in the range of between 1 and 100 Hz, or alternatively, in the range of between 1 and 50 Hz. Alternatively, the frequency can be in the range of between 1 and 20 Hz. A.
FIG. 1
FIG. 1
10
12
14
16
18
20
22
18
12
18
20
22
is a schematic illustration of portions of a subject's body tissues, including skin , a nerve with an overlying nerve sheath , and a muscle . also illustrates an implant , a surface cathodic electrode and a surface anodic electrode . The implant is provided for electrically stimulating a target body tissue, such as a nerve , in a subject to either activate or block neural impulses. Once implanted, the implant provides a conductive pathway for at least a portion of the electrical current flowing between the surface cathodic and anodic electrodes , .
10
20
22
10
20
22
20
22
10
When positioned in spaced relationship on the subject's skin , the surface cathodic and anodic electrodes , make electrical contact with the skin and transmit electrical current to the target body tissue. Surface cathodic and anodic electrodes , can be selected from a conductive plate or sheet, a conductive gel electrode, a conductive rubber or polymer electrode that may be partially coated with an electrode paste or gel, or a moistened absorbent pad electrode. For example, self-adhesive hydrogel electrodes of the type used to stimulate muscles, with surface areas, for example, of 5 square centimeter, can be used. In some embodiments, electrodes having larger or smaller surface areas can alternatively be used. Platinum iridium electrodes, which are composed typically of 80% or more platinum and 20% or less iridium, can also be used (for example, 85% platinum-15% iridium alloy; 90% platinum-10% iridium alloy). The positions of the surface cathodic and anodic electrodes , on the skin may vary, depending upon the location and nature of the target body tissue.
18
24
20
12
24
24
26
28
26
28
The implant includes a passive electrical conductor of sufficient length to extend, once implanted, from subcutaneous tissue located below the surface cathodic electrode to the target body tissue, for example nerve . The electrical conductor can be formed from a metal wire, carbon fibers, a conductive rubber or other conductive polymer, or a conductive salt solution in rubber. Multistranded, TEFLON-insulated, stainless-steel wire conductors of the type used in cardiac pacemaker leads can also be used. MP35N alloy (a nonmagnetic, nickel-cobalt-chromium-molybdenum alloy) which is commonly used in parts for medical applications is also suitable. The electrical conductor has a pick-up end and a stimulating end , and is insulated between the pick-up end and the stimulating end .
26
28
24
26
28
26
28
30
26
28
24
26
30
24
20
22
28
30
12
The electrical impedance of the interface between the pick up end and the stimulating end of the conductor (when implanted) and the surrounding body tissue may be reduced by enlarging the surface area of the ends , . For that purpose, one or both of the pick-up end and the stimulating end form electrical terminations having sufficient surface area for reducing the electrical impedance of the interface between the pick-up end and the stimulating end of the electrical conductor and the surrounding body tissues. The pick-up end forms an electrical termination which has a sufficient surface area to allow a sufficient portion of the electrical current to flow through the electrical conductor , rather than flowing through body tissue between the surface cathodic electrode and the surface anodic electrode , such that the target body tissue is stimulated to either activate or block neural impulses. The stimulating end also forms an electrical termination for delivering the portion of electrical current to the target body tissue (i.e., nerve ).
30
24
30
26
28
30
26
28
30
26
28
30
26
28
20
22
24
30
10
20
22
24
12
16
20
22
16
20
22
16
20
22
2
Terminations have sufficient surface area for providing high conductivity contact with body tissues, and lowering the electrical impedance between the body tissue and the conductor . If the surface area is minimal, the amount of current flowing through a conductor to the termination is reduced to an ineffective amount. The surface area required can be determined by a knowledge of the electrical impedance of the interface between the tissue and the terminations at the receiving or pick-up end and the stimulating end . Beneficial results have been obtained by making the surface area of metal terminations at the ends , , for example, about 0.5 cm. The terminations at the ends , can alternatively have a larger or smaller surface area. The electrical impedance of each interface between tissue and terminations at ends , can be about 5 times the electrical impedance of all the subcutaneous tissue between surface electrodes , . For example, a typical value of tissue impedance is 200 ohms. The impedance of the conductor can be chosen to be very small, for example, 5 ohms. In such a case, the sum of the two interface impedances of the terminations plus the conductor impedance can be about 2000 ohms, or ten times the tissue impedance. Thus, about % of the current applied between surface electrodes , flows through conductor to the target tissue. In the case of the target tissue being a nerve supplying a muscle , the amount of current between surface electrodes , required to produce a useful muscle contraction of the target muscle remains below the threshold level of activation of nerve endings in the subcutaneous tissue immediately between surface electrodes , . This is a beneficial relationship, because it means that target muscles can be activated with little or no local sensation or local muscle contractions under the surface electrodes , .
30
30
30
26
24
28
14
12
14
14
FIG. 1
Terminations of various shapes, materials and spatial arrangements can be used; for example, terminations can provide an enlarged surface in the form of a coil, spiral, cuff, rod, or a plate or sheet in the form of an oval or polygon. As an example, illustrates a termination as a plate or sheet in the form of an oval at the pick-up end of the electrical conductor , and in the form of a cuff at the stimulating end . The cuff or a portion thereof can encircle or partially encircle the entirety or part of the nerve sheath of the nerve . The cuff or a portion thereof can be positioned proximate to the nerve sheath , or the inner surface of the cuff or a portion thereof can directly contact the nerve sheath .
2
2
2
30
Beneficial results can be obtained with stainless-steel plates or sheets in the form of an oval that is about 0.5 cmin surface area and 1 mm thick, or made, for example, of metal foil and stainless-steel mesh and being about 0.5 cmin surface area and 0.3 mm thick. For terminations of conductors in the form of a nerve cuff, nerve cuffs made, for example, of metal foil or stainless-steel mesh and being 0.5 to 1 cmin surface area and 0.3 mm thick can be used. Further, silastic elastomer cuffs, for example, ranging from 5 mm to 15 mm in length, having a 4 mm to 6 mm inside diameter, and that are 1 mm thick are also suitable.
30
26
28
24
30
30
26
28
24
30
24
24
24
30
26
28
30
In some embodiments, terminations can be formed from uninsulated ends , of the electrical conductor , or from other conductive or capacitive materials. In some embodiments, the terminations can include an electrode. Terminations can be formed by coiling, spiraling or weaving long, uninsulated lengths of the pick-up or stimulating ends , to provide a sufficient surface. The surface area of the termination is thus “enlarged” relative to the surface area of a shorter length of the electrical conductor . This raises the effective surface area of the terminations within a small space to provide higher conductivity contact with body tissues, and to lower the electrical impedance between the body tissue and the conductor to allow current flow in the conductor in preference to in the body tissue. Sufficient current flow is thereby provided in the conductor to stimulate the target tissue. Alternatively, prefabricated terminations (for example, plates or sheets in the form of ovals or polygons) can be attached directly to the pick-up end and/or stimulating end . Further, terminations can be coated or modified with conductive materials to maximize the flow of electrical current through the target body tissue.
30
30
30
32
12
32
The spatial arrangement of the terminations can be varied; for example, multiple terminations can also be applied to different parts of a body tissue. In some embodiments, the terminations can be in the form of closely-spaced contacts enclosed within an embracing cuff placed around the nerve . The embracing cuff can be formed, for example, with conductive silicone rubber.
30
30
Electrical impedance can be further reduced by providing conductive or capacitive coatings, or an oxide layer on the terminations . The coating can be selected from a material whose structural or electrical properties improve the electrical conductance between the tissue and the conductor, for example, by providing a complex surface into which tissue can grow (for example, a polymer such as poly-diethoxy-thiophene, or suitable oxide layers including tantalum and sintered iridium). In addition, the terminations can have coatings which provide an anti-inflammatory, anti-bacterial or tissue in-growth effect. The coating can be, for example, a substance selected from an anti-inflammatory agent, antibacterial agent, antibiotic, or a tissue in-growth promoter.
34
18
34
22
34
22
34
34
36
38
36
38
36
38
30
24
36
38
34
36
30
34
38
30
22
22
FIG. 1
FIG. 1
FIG. 1
In some embodiments, a second implant including an electrical return conductor can be included with the implant , as shown in . The electrical return conductor can be sufficient length to extend from the target body tissue to subcutaneous tissue located below the surface anodic electrode . The electrical return conductor provides a low-impedance conductive pathway from the target body tissue to the surface anodic electrode , thereby concentrating the electric field through the target tissue. The electrical return conductor can be formed, for example, from a metal wire, carbon fibers, a conductive rubber or other conductive polymer, or a conductive salt solution in rubber. The electrical return conductor has a collecting end and a returning end , and is insulated between its ends , . Both the collecting end and the returning end form electrical terminations (as described above for conductor ) for reducing the electrical impedance of the interface between the collecting end and returning end of the electrical return conductor and the surrounding body tissues. The collecting end forms an electrical termination (shown in in the form of a cuff), which has a sufficient surface area to allow a portion of the electrical current delivered to the target body tissue to return through the electrical return conductor in preference to returning through body tissue. The returning end forms an electrical termination (shown in as a plate or sheet in the form of an oval), which returns the electrical current to the surface anodic electrode via the subcutaneous tissue and skin underlying the surface anodic electrode .
20
22
10
30
24
Multiple surface electrodes , can be fabricated on a single non-conductive substrate to form an electrode array that may be conveniently attached to the skin . Similarly, multiple terminations of implanted conductors can be fabricated on a substrate to form an array. By matching the physical layout of the surface electrode array to that of the implanted terminations array, a good spatial correspondence of surface and implanted conductors may be achieved in a convenient and reproducible manner. Surface electrode arrays in which the conductivity of each element of the array may be independently controlled could also be used to adjust the conductivity between the surface electrodes and the terminations in an implanted array.
20
22
42
44
20
22
20
22
A power source (not shown) can be used to provide operating power to a stimulator (not shown), which is disposed external to the subject's body. The stimulator can be electrically connected to the surface cathodic and anodic electrodes , via electrical wires or conductors and , to supply electrical current to the surface cathodic and anodic electrodes , . The current can be resistive or capacitive, depending on the net impedance encountered between the electrodes , .
40
10
42
20
44
22
The stimulator can be, for example, a pulse generator. Examples of stimulators are described in U.S. Patent Publication No. 2006/0184211 (“the '211 publication”), the disclosure of which is hereby incorporated by reference in its entirety. The use of a pulse generator and various examples applications are also described in the '211 publication. In general, a flow of electrical current from the power source can be supplied into the skin via a cathodic wire at the surface cathodic electrode , and via an anodic wire at the surface anodic electrode . Power can be provided to the stimulator either through a wire connection or through a wireless connection, via a wireless energy source, such as, radiofrequency (RF).
20
22
24
12
34
20
26
24
24
22
34
22
FIG. 1
Although most of the electrical current flows through the body tissues in proximity to the surface cathodic and anodic electrodes , , there is also flow of electrical current through the electrical conductor , nerve , and electrical return conductor . As shown in , the surface cathodic electrode is positioned over the pick-up end of the electrical conductor , so that a portion of the current is transmitted through the conductor to the target body tissue, and current flows through the target body tissue and returns to the anodic surface electrode through body tissues. This can also be achieved through the implanted electrical return conductor extending between the target body tissue and subcutaneous tissue located below the surface anodic electrode .
42
20
10
30
26
24
28
30
14
12
30
36
34
38
30
10
22
44
12
16
12
16
The complete electrical path of the portion of the electrical current is as follows: cathodic wire , surface cathodic electrode , skin , termination , pick-up end , electrical conductor , stimulating end , termination , nerve sheath , nerve , termination , collecting end , electrical return conductor , returning end , termination , skin , surface anodic electrode and anodic wire . The pulses of electrical current can elicit action potentials which are conducted along nerve to muscle , causing it to contract. Alternatively, electrical current in the form of high frequency waveforms can block action potentials conducted along nerve to muscle to prevent muscle contractions.
18
FIG. 1
Various disorders are amenable to treatment using an implant, such as implant , shown in . As described below and in the '211 publication incorporated herein, the implanted passive electrical conductors are capable of routing electrical current to stimulate various target body tissues to either activate or block neural impulses depending upon the frequency and disorder to be treated.
In one example procedure, a stimulation system can be used in conjunction with a joint replacement procedure (for example, knee replacement or hip replacement) to condition the muscles before the surgery, reduce the post-procedure pain, enhance the post-operative recovery and/or reduce or prevent some of the side effects associated with a joint replacement procedure.
Joint replacement is a common operation used in modern orthopaedic surgery. It includes the replacement of painful, arthritic, worn or cancerous parts of a joint with artificial surfaces shaped in such a way as to allow joint movement. Although not always accomplished, many joint replacement procedures result in a full recovery of range of motion. Because joint replacement is a major surgery, an extensive pre-operative activity is typically required. This activity includes selection of implant design and size by matching x-ray images. Early mobilization of the patient is thought to be a key to reducing the chances of complications, such as venous thromboembolism and Pneumonia. It is common practice to try to mobilize a patient as soon as possible after surgery and to ambulate with walking aids when tolerated. Depending on the joint involved, and the pre-op status of the patient, the time of hospitalization can vary, for example, from 1 day to 2 weeks, with an average being 4-7 days.
Physiotherapy is also used extensively to help patients recover function after joint replacement surgery. A graded exercise program can be used. Initially, the patients' muscles have not healed after the surgery; exercises for range of motion of the joints and ambulation should not be strenuous. Later when the muscle is healed the aim of exercise expands to include strengthening and recovery of function.
The stress of a surgical operation may result in medical problems of varying incidence and severity, like heart attack, stroke, venous thromboembolism, pneumonia, increased confusion, and urinary tract infection (UTI). Intra-operative risks include mal-position of the components, shortening, instability/dislocation, loss of range of motion, fracture of the adjacent bone, nerve damage, or damage to blood vessels. Some immediate risks include deep or superficial infection and dislocation. Some medium-term risks include dislocation, persistent pain, loss of range of motion, weakness, indolent infection. Long-term risks can include loosening of the components due to fatigue and/or wear of the bearing surfaces. As a result, the component may move inside the bone resulting in pain. Fragments of wear debris may also cause an inflammatory reaction with bone absorption which can cause loosening.
Knee replacement, or knee arthroplasty, is a common procedure performed to relieve the pain and disability from degenerative arthritis, most commonly osteoarthritis, but other arthritides as well. Such procedures include replacing the diseased and painful joint surfaces of the knee with metal and plastic components that are shaped to allow continued motion of the knee. A total knee replacement (TKR) may be performed to treat incapacitating pain from arthritis of the knee that may affect such activities as walking and/or standing. A TKR surgery involves exposure of the front of the knee, with detachment of part of the quadriceps muscle (vastus medialis) from the patella. Minimally invasive surgery is being developed in TKR, but has not yet found complete acceptance. The goal is to spare the patient a large cut in the quadriceps muscle which could increase post-operative pain or lengthen disability.
A unicompartmental arthroplasty (UKA), also called partial knee replacement, is an option for some patients. In such a procedure, the knee is generally divided into three “compartments”: medial (the inside part of the knee), lateral (the outside), and patellofemoral (the joint between the kneecap and the thighbone). Most patients with arthritis severe enough to consider knee replacement have significant wear in two or more of these compartments and are best treated with total knee replacement. A minority of patients (for example, 10-30%) have wear confined primarily to one compartment, usually the medial, and may be candidates for unicompartmental knee replacement. Advantages of UKA, as compared to TKR, include smaller incision, easier post-op rehabilitation, shorter hospital stay, less blood loss, lower risk of infection, stiffness, and blood clots, and easier revision if necessary. Lupus, Psoriatic, or marked deformity may not be candidates for a UKA procedure.
Post-operative rehabilitation usually includes the use of protected weight bearing on crutches or a walker until the quadriceps muscle has healed and recovered its strength. Continuous passive motion (CPM) is also commonly used. Post operative hospitalization can vary, for example, from one day to seven days on average depending on the health status of the patient and the amount of support available outside the hospital setting. Usually full range of motion is recovered over the first two weeks. At six weeks, patients typically have progressed to full weight bearing with a cane. Complete recovery from the operation involving return to full normal function can take, for example, three months, and some patients notice a gradual improvement lasting many months longer than that.
There are risks and complications that accompany TKR or UKA procedures. For example, blood clots in the leg veins are the most common complication of knee replacement surgery. Periprosthetic fractures are also becoming more frequent with aging patients and can occur intraoperatively or postoperatively. The knee at times may not recover its normal range of motion (e.g., 0-135 degrees) after total knee replacement. Some patients can achieve 0-110 degrees of motion, but in some cases stiffness of the joint can occur. In some situations, manipulation of the knee under anesthetic is used to improve post operative stiffness. In some patients, the kneecap is unstable post-surgery and dislocates to the outer side of the knee. This can be painful and may require surgery to realign the kneecap. Knee replacement implants can last up to, for example, 20 years in many patients, and this can depend, for example, on how active the patient is after surgery.
Hip replacement, also referred to as hip arthroplasty, is a surgical procedure in which the hip joint is replaced by a prosthetic implant. Such joint replacement orthopaedic surgery generally is conducted to relieve arthritis pain or fix severe physical joint damage as part of the hip fracture treatment. Some hip replacement patients can suffer chronic pain after the surgery. Because such side effects are usually not detectable with X-ray or MRI, it can be difficult to determine the source of such pain. Generally, it is believed that such pain is caused by nerve damage during the replacement surgery.
As an alternative to seeking a joint replacement, such as hip and knee replacement described above, the use of electrical stimulation can delay or defer the need for such joint replacement surgery. For example, a pulsed electrical stimulation device can be used to defer total knee replacement surgery.
Following a TKR procedure, patients can exhibit long-term weakness of the quadriceps and diminished functional capacity compared to age-matched healthy controls. The pain and swelling resulting from surgery may contribute to quadriceps weakness. Electrical stimulation can also be used to enhance recovery after a joint replacement procedure. For example, neuromuscular electrical stimulation (NMES) can be added to a voluntary exercise program to improve quadriceps muscle strength. The application of electrical stimulation during recovery from TKR can also effectively reduce extensor lag and decrease the length of the hospital stay.
26
24
28
Thus, a stimulation system as described herein and in the '211 publication can be used in conjunction with joint replacement. As described above, a portion of the electrical stimulation delivered transcutaneously by the external stimulator (e.g., pulse generator) is picked up by the pick-up end (e.g., ) of the implanted conductor (e.g., conductor ) and is delivered to the stimulating end (e.g., ) of the conductor, which is located near the targeted stimulating location. For example, the stimulating end can be positioned in proximity to a joint, such as a hip or knee joint, or it may be positioned near the motor point(s) activating the muscles associated with the joint.
With a stimulation system as described herein as compared with a transcutaneous device, the stimulation may be delivered to the specific location (e.g. to the specific nerve) with no unpleasant sensation from cutaneous receptors due to delivery of the stimulation thru the skin and with no risk of activating non-targeted areas (as in TENS). In addition, as compared with percutaneous stimulation, the risk of inflammation or contamination due to the lead protruding thru the skin can be reduced or eliminated using a stimulation system as described herein. As compared to full size implantable stimulators, only a minimally invasive procedure is required with the stimulation system described herein. A stimulation system as described herein is usually also not associated with tunneling the leads from the targeted stimulation location to the place available for implantation of the stimulator (under-skin pocket), which may be relatively far away. For example, stimulating the arm may require tunneling the leads from the arm to the chest, where the stimulator will be implanted. In addition to the invasiveness of such a procedure, there is a risk of lead migration or lead damage associated with the long leads crossing the joints.
A stimulation system as described herein used in conjunction with a joint replacement procedure can be used to achieve a variety of different benefits. For example, use of stimulation can delay or defer the need for a joint replacement procedure. Conditioning of the muscles/joint can be done before a replacement procedure (e.g. increasing range of motion). Stimulation of a joint can also improve recovery after a joint replacement procedure. For example, improvements can be made in pain management and/or in management of muscle performance. In some cases, stimulation of a joint can also help prevent deep venous thrombosis.
FIG. 2
FIG. 3
For example, to improve range of motion or muscle condition related to a knee replacement procedure, knee extensors and/or knee flexors can be stimulated using a stimulation system as described herein. In this example, knee extension is performed by Quadriceps Femoris muscle (which include Sartorius, Vastus intermedius, Vastus Lateralis and Vastus medialis), innervated by the Femoral nerve), as shown . Knee flexion can be performed by the Hamstring (Lateral Hamstring and Medial Hamstring), controlled by the Sciatic nerve and Tibial nerve, as shown in .
18
To cause motor point stimulation, a stimulation system including an implant (e.g., implant ) can be implanted near the subject nerves. The stimulation frequency can be, for example, lower than 50 Hz. A single implant can be used, for example, causing knee extension, and it can be operated cyclically. For example, stimulus can be applied every 30 seconds for 5 seconds. The knee will be extended during the stimulation, and will be relaxed to its original position (by gravity) during the rest of the cycle. It is also possible to use two or more implants. For example, one implant to cause knee extension and the other to cause knee flexion. In this case, the implants can be operated synchronously, for example, a cycle of 5 seconds stimulating the extension, 10 seconds pause, 5 seconds stimulating flexors, 10 seconds pause, etc. When using a higher frequency of stimulation (e.g., above 30 Hz), pain relief can be achieved, which may be helpful at any of multiple stages of a knee replacement procedure.
FIGS. 4-8
FIGS. 4-8
In another example application, a stimulation system as described herein can be used to treat urinary incontinence by applying electrical stimulation to the common peroneal (CP) nerve (e.g., common fibular nerve; external popliteal nerve; peroneal nerve), and/or the tibial nerve. illustrate applications of various configurations of a implant with the cathodic electrode(s) and anodic electrode(s) positioned at various locations on a feline F. A schematic illustration of a feline subject is illustrated in .
FIG. 4
FIG. 4
FIG. 4
FIGS. 5-8
FIG. 4
118
124
126
128
133
128
118
124
126
128
135
128
118
118
118
118
illustrates the feline F with two implants implanted under the skin of the feline F. A first implant includes a passive conductor having a pick-up end and a stimulating or delivery end and terminations . The delivery end is disposed in proximity to a common peroneal nerve (not shown in ) of the feline F. A second implant ′ includes a passive conductor ′ having a pick-up end ′ and a stimulating or delivery end ′, and terminations . The delivery end ′ is disposed in proximity of a tibial nerve (not shown in ) of the feline F. do not show the implants and ′ disposed under the skin of the feline F for purposes of illustration. Reference to the implants and ′ in the below description refer to .
FIG. 5
118
118
120
126
124
121
126
124
120
121
126
126
124
124
124
124
128
128
124
124
122
121
120
illustrates a stimulation system attached to the feline F with the implants and ′ implanted within the feline F. A first cathodic electrode is attached to the external surface of the feline F over the pick-up end of a the conductor and a second cathodic electrode is attached to the surface of the feline F over the pick-up end ′ of the conductor ′. In this example, an electrical current is applied to the first cathodic electrode and the second cathodic electrode (e.g., via a pulse generator), and a portion of the electrical current is picked up by the pick-up ends , ′ of the conductors , ′, passed through the conductors , ′ to the stimulating ends , ′ of the conductors , ′ in proximity of the CP nerve and the tibial nerve, respectively. Thus, this example provides cathodic stimulation. In this example, a single anodic electrode is positioned 8 cm from the cathodic electrode and 5 cm from the cathodic electrode .
FIG. 6
120
128
118
121
128
118
122
120
123
121
126
126
124
124
124
124
128
128
118
118
120
121
illustrates a system having cathodic electrodes over the delivery terminals (e.g., stimulating ends of the implants) in the proximity of the nerves to be treated, and anodic electrodes over the pick-up terminals of the implants. In this embodiment, a first cathodic electrode is attached to the feline F over the delivery end of the implant in the proximity of the CP nerve, and a second cathodic electrode is attached to the feline F over the delivery end ′ of the implant ′ in the proximity of the tibial nerve. A first anodic electrode is attached to the feline F at 7 cm from the first cathodic electrode , and a second anodic electrode is attached to the feline F at 7 cm from the second cathodic electrode . In this embodiment, electrical current is provided and a portion of the electrical current is picked up by the pick-up ends , ′ of the conductors , ′, passed through the conductors , ′ to the stimulating ends , ′ of the implants , ′ over which the cathodic electrodes , are disposed.
FIG. 7
120
126
118
121
126
118
122
128
118
123
128
118
120
12
122
121
15
123
120
121
126
126
124
124
124
124
128
128
122
123
illustrates a system having a cathodic pick-up and an anodic delivery configuration. In this embodiment, a first cathodic electrode is attached to the feline F over the pick-up end of the implant , and a second cathodic electrode is attached to the feline F over the pick-up end ′ of the implant ′. A first anodic electrode is attached to the feline F over the delivery end of the implant in the proximity of the CP nerve, and a second anodic electrode is attached to the feline F over the delivery end ′ of the implant ′ in the proximity of the tibial nerve. In this embodiment, the first cathodic electrode is positioned cm from the first anodic electrode , and the second cathodic electrode is positioned cm from the second anodic electrode . Electrical current is provided to the cathodic electrodes , and a portion of the electrical current is picked up by the pick-up ends , ′ of the conductors , ′, passed through the conductors , ′ to the delivery ends , ′ over which the anodic electrodes , are disposed.
FIG. 8
FIG. 7
120
128
118
121
128
118
122
126
118
123
126
118
120
122
121
123
122
123
126
126
124
124
124
124
128
128
120
121
is an example of a system having the cathodic electrodes over the delivery terminals and the anodic electrodes over the pick-up terminals. In this configuration, a first cathodic electrode is placed over the delivery end of the implant in the proximity of a CP nerve, and a second cathodic electrode is placed over the delivery end ′ of the implant ′ in the proximity of the tibial nerve. A first anodic electrode is placed over the pick-up end of the implant and a second anodic electrode is placed over the pick-up end ′ of the implant ′. As with the embodiment of , the first cathodic is positioned 12 cm from the first anodic electrode , and the second cathodic electrode is positioned 15 cm from the second anodic electrode . In this embodiment, electrical current is provided to the anodic electrodes , , a portion of the electrical current is picked up by the pick-up ends , ′ of the conductors , ′, passed through the conductors , ′, to the delivery ends , ′ over which the cathodic electrodes , are disposed. Thus, this configuration is an example of anodic stimulation.
FIGS. 5-8
FIG. 9
FIG. 9
FIGS. 7 and 8
FIG. 5
For each of the illustrated configurations in , a surface threshold current can be determined. is a graph illustrating an example of the threshold currents associated with each configuration when a cuff-style implant was implanted within the feline F. As shown in , when external electrodes are placed over both the pick-up ends and the stimulating ends of the conductors (as shown in ), only half the threshold is required than for the configuration where there is no external electrode placed over the pick-up end of the conductor ().
In another example application, an implant described herein can be used to rehabilitate muscle attached to bone, such as in podiatry applications. An implant can also be used to provide assistance to movement of immobile limbs, such as a paralyzed hand. Such electrical stimulation is described in U.S. Pat. No. 6,961,623 (“the '623 patent”) the disclosure of which is hereby incorporated herein by reference in its entirety. For example, the '623 patent describes an apparatus and method for controlling a device or process with vibrations produced through clicking together of a patient's teeth. Such a device can be used to actuate a stimulator (e.g., pulse generator) in a stimulation system as described herein.
Other applications for which a system and implant as described herein can be used include increasing blood flow, for example, within a limb, and/or to increase the speed of recovery of wounds. Chronic wounds, including venous ulcers, diabetic foot ulcers and pressure sores, can be a major public health problem. The total prevalence of such wounds in the United States has been estimated to range from 3 to 6 million. Difficult to heal wounds may lead to high rates of morbidity and mortality, and negative effects on quality of life. While leg and foot ulcers have numerous causes, such as venous disease, arterial disease, mixed venous-arterial disease, diabetic neuropathy, trauma, immobility, and vasculitis, over 90% of chronic lesions are related to venous disease, arterial disease, and neuropathy. Chronic wounds may require intervention to promote healing and to prevent infection, progression, and recurrence. Regardless of the cause, ulcer treatment usually begins with conservative therapies such as pressure relief, sterile dressings, and topical antibiotics. If conservative treatments fail to promote wound healing, surgical treatments such as sclerotherapy of the affected vein, skin flap reconstruction, or amputation of a digit or foot may be necessary. A less invasive approach to management of chronic wounds involves electrical stimulation.
When skin is damaged, not only are epithelial cells sometimes destroyed, but a large quantity of collagen can also be lost. This is important because collagen makes up approximately 75% of the weight of the skin. To stimulate skin healing, a variety of methods have been used, such as, for example, the topical application of herbal remedies like Aloe Vera extract, the use of soft laser, natural honey, electromagnetic pulses and fibroblast growth factor. Even though good results have been achieved by these methods, the customary approach remains the prevention of infection using antibacterial and antiseptic agents, and sometimes hygroscopic powders. However, these approaches may be of limited benefit if an adequate blood supply to the affected area is not promoted especially in severe cases such as extensive burn injuries, diabetic ulcers, ischemic flaps, necrotic wounds and large areas of skin.
Thus, stimulating wound healing using electricity can be done using an implant as described herein. In addition, numerous morphological and functional effects of electric stimulation have been identified, both at the cellular and at the tissue level.
As described above, electrical stimulation refers to the application of an electrical current through electrodes placed directly onto the skin in close proximity of the wound. Electrical stimulation as a technique to promote wound healing may: 1) increase ATP concentration in the skin, 2) increase DNA synthesis, 3) attract epithelial cells and fibroblasts to wound sites, 4) accelerate recovery of damaged neural tissue, 5) reduce edema, 6) increase blood flow, and/or 7) inhibit pathogenesis.
Similar to the other above-described applications of a stimulation system and implant, electrical stimulation (ES) in wound care involves the placement of electrodes in direct contact, or in close proximity to a skin wound, thereby creating an electrical current that passes through the wound. The skin possesses an electrical field, and the presence of a wound can disrupt this electrical field. The use of ES as an adjunctive treatment for wound healing can help repair the electrical field of the skin. There are several modalities of ES used in the treatment of chronic wounds. In one example, low intensity direct current (LIDC) can be applied, which involves application of direct current of low intensity, typically between 100 μA and 1 mA. In another example, low intensity pulsed current (LIPC) can be applied, which involves application of a pulsed direct current of about 10 mA, with a pulse repetition of the order of 100 pulses per second. In another example, high voltage pulsed current (HVPC) can be applied, which includes the application of a pulsed direct current of high voltage. The pulses, can be, for example, twin pulses of short duration, between 100 and 500 V.
FIGS. 10-12
FIG. 10
220
246
222
248
246
Electrical stimulation can be applied in several ways as illustrated in . For example, as shown in , a first electrode (positive or negative polarity) is applied to a sterile, conductive material, such as saline-moistened gauze pad placed in the wound W. A conductive surface of a second electrode is applied nearby on intact dry skin. An external pulse generator (EPG) is connected to the first electrode (and gauze pad ).
FIG. 11
320
322
324
320
322
348
324
348
is a top view illustrating an example application including positioning a conductive surface of each of two gel electrodes , with the same polarity on intact dry skin on opposite borders of a wound W, such that they straddle the wound W. A third gel electrode with the opposite polarity is placed nearby on intact dry skin. The first electrode and the second electrode are connected to a first terminal of an external pulse generator (EPG) , and the third electrode is connected to a second terminal of the external pulse generator .
FIG. 12
FIGS. 10-12
450
452
450
448
452
448
is a top view illustrating an example application that includes positioning multiple electroacupuncture needles and around a perimeter of a wound W. In this embodiment, three electroacupuncture needles are connected to a first terminal of an external pulse generator (EPG) and have a first polarity, and two electroacupuncture needles are connected to a second terminal of the external pulse generator and have an opposite polarity. In each of the applications described and shown with reference to , the pulse frequency can be, for example, set to about 100 pulses/second, and the voltage can be set, for example, to deliver a current that produces a moderately strong, but comfortable tingling sensation (in sensate skin) or a just-visible muscle contraction (in insensate skin, as in patients with spinal cord injuries).
FIG. 11
The polarity of the electrode or electrodes placed in a straddling position around a wound, as shown in , can depend on the wound's clinical need. To promote autolysis, positive polarity may be desired to attract negatively charged neutrophils and macrophages. To encourage granulation tissue development, negative polarity may be desired to attract positively charged fibroblasts. To stimulate wound resurfacing, it may be desirable to use positive polarity to attract negatively charged epidermal cells.
Electrical stimulation with negative polarity can be used, for example, to improve collagen deposition in excisional wounds of diabetic and non-diabetic animals. Direct current (DC) stimulation can be used, for example, to reduce wound area more rapidly than alternating current (AC), but AC stimulation can reduce wound volume more rapidly than DC. Both DC and AC stimulation can cause significant increase of collagen content around experimental incisions and a similar result can arise using AC with switching polarities every second. DC currents of, for example, 50 to 300 μA can in some cases accelerate the rate of epithelialization, suggesting that electrical fields can influence the proliferative and/or migratory capacity of epithelial and connective tissue cells.
FIG. 13
FIG. 13
518
524
526
528
528
520
522
548
520
526
526
524
528
528
548
522
Use of an implant as described herein for wound healing can provide several advantages over other known techniques. illustrates one example use of an implant for wound healing. In this example, the electrical stimulation can be delivered through the wound by placing the stimulating end or stimulating electrode below or within the wound. As shown in , an implant includes a conductor (e.g. lead) that is connected on one end to a pick-up electrode (i.e., pick-up end) and at another end to a stimulating electrode (i.e., stimulating end). The stimulating electrode is positioned beneath a wound W. An external cathodic electrode and an external anodic electrode are attached to the surface of the skin. An external pulse generator (EPG) delivers electrical current to the external electrode and a portion of the electrical current is picked-up by the pick-up electrode . The pick-up electrode delivers the electrical current through the conductor and to the stimulating electrode located near the wound W. The stimulation returns from the stimulating electrode to the EPG via the wound W and the anodic electrode . Thus, electrical current passes through the wound W, stimulating deeper parts of the wound W.
FIG. 14
FIG. 14
618
624
626
624
628
618
628
620
622
648
620
626
626
624
628
622
648
622
illustrates an example of a use of an implant where the stimulation is applied to deeper parts of a wound or to a deep or internal wound. As shown in , an implant includes a conductor (e.g. lead) , a pick-up electrode (i.e., pick-up end) connected to one end of the conductor and a stimulating electrode (i.e., stimulating end) connected to the other end of the conductor . The stimulating electrode is positioned beneath a deep wound W. An external cathodic electrode and an external anodic electrode are attached to the surface of the skin. An external pulse generator (EPG) delivers electrical current to the external electrode and a portion of the electrical current is picked-up by the pick-up electrode . The pick-up electrode delivers the electrical current through the conductor and to the stimulating electrode located near the wound W. As with the previous embodiment, the stimulation passes through the wound W, to the anodic electrode and to the EPG . It also noted that other embodiments can include, for example, an additional implanted lead (e.g. conductor) on the other side of the wound with one terminal near the wound and the other terminal below the surface electrode .
In some embodiments, an implant can also be used in applications to enhance healing of fractures or breaks in bones and/or to promote bone growth. For example, bone in an area of a fracture can be electronegative with respect to the ephysis or diaphysis (relatively inactive areas of growth or repair). When the fracture is healed, the area of electronegativity has been found to be no longer observed. The region under compression of a bone that is, for example, bent, can be electronegative and the region under tension can be, for example, electropositive compared to the non-stressed portion of the bone. The production of electricity accompanying the stress is sometimes called the “piezoelectricity of bone.” It has been observed that changes in environmental conditions (e.g., chemical, thermal, or mechanical) are first converted to electrical energy or stimuli that act on bone cells causing callus formation. The connection between the environmental stimulus and the callus is electricity, and therefore, the callus can be produced by electricity. Electrodes can be inserted into, for example, a medullary canal of a femur and a current can be applied such that over time, a ridge of callus is formed between the electrodes. Thus, greater new bone formation in the region of a negative electrode can be achieved.
In one example, a fracture in an ankle can be treated with electrical stimulation. For example, a cathodic electrode can be surgically inserted into the fracture site and an anodic electrode can be placed on the skin over the medial aspect of the foot. A constant electric current can then be applied to the cathodic electrode to deliver electrical stimulation to the fracture site. There are various modalities of electrical stimulation that can be used. For example DC stimulation, capacitive-coupled (or pulsed DC) stimulation, or pulsed electromagnetic filed stimulation (inductive coupled stimulation).
In an example of a DC stimulation (DC) application, multiple cathodic electrodes can be surgically inserted into a fracture site. The current source can be, for example, either implanted or external, or connected percutaneously to the implanted electrodes. An anodic electrode is placed on the skin close to the non-united (e.g. fractured or broken) site. The current carried by each cathodic electrode can vary depending on the material from which the cathodic electrode is made.
In another example application, capacitively coupled stimulation (CC) is applied in a non-invasive procedure. Electrodes are placed on either side of the fracture site. Windows are cut into a cast at the fracture site, if needed. An electrical field (e.g., 1-10 mV/cm) can be established in the tissue between the electrodes and the induced current is dispersed over a wide volume of tissue. The stimulation can be applied, for example, for 24 hours a day.
In an example using pulsed electromagnetic field (PEMF), an inductive coupling involving a time-varying magnetic field is applied. An electric field is produced when specific current waveforms are passed through coils placed around the fracture site. In some embodiments, two waveforms can be used, for example, pulsing electromagnetic fields and combined magnetic fields. With either waveform, voltage gradients (e.g., 1-10 mV) can be produced. The stimulation can be applied over a time period, for example, of 30 minutes to 10 hours per day.
FIG. 15
718
724
726
728
728
720
726
722
720
720
722
The use of an implant as described herein can provide a minimally invasive, efficient delivery of electrical stimulation to an area of a bone defect, such as a fracture or a break in a bone structure. As described for previous embodiments, and as illustrated in , an implant includes a conductor , a pick-up electrode and a stimulating electrode that can be implanted under a patient's skin. The stimulating electrode is positioned adjacent or in contact with a bone defect, such as fracture site Fr to be treated. An electrode (e.g., a cathodic electrode or an anodic electrode) is positioned at an exterior location on the patient's skin and over the pick-up electrode . Another electrode (e.g., the other of a cathodic electrode or anodic electrode) is positioned at a location on the patient's skin at a spaced distance from the electrode . The electrodes and can be, for example, gel electrodes.
748
720
726
728
724
An external pulse generator (EPG) can be used to deliver electrical stimulation transcutaneously via the electrode . Part of the delivered stimulation is then picked up by the pick-up electrode and is delivered to the stimulating electrode implanted in the targeted area via the conductor .
The electrodes can be attached to a patient's skin out of the area covered by, for example, a case or cast disposed over a fracture site. In some embodiments, an opening is made in the cast, which will enable access to the skin and replacement of the electrodes, as desired. For example, it may be desirable to replace gel electrodes periodically. It is also possible to use wetted electrodes, which my be either replaceable or be attached between the cast and the skin. In such a case, periodic wetting of the electrodes may be performed via small openings in the cast.
In some embodiments, the case or cast can serve as an orthosis, carrying the electrodes and the EPG. For example, the stimulator (e.g., pulse generator) can be embedded within a cast or coupled to a cast that has been disposed over a broken or fractured limb (e.g., an arm or leg). An example of such an embodiment is described in U.S. Pat. No. 6,607,500, the disclosure of which is hereby incorporated by reference in its entirety.
FIG. 16
818
824
826
828
848
820
822
826
824
828
820
822
820
822
illustrates an embodiment of a system that includes a cast C disposed over a portion of a patient's anatomy, for example, over an area of a bone defect (not shown). In this embodiment, a system includes an implant having a conductor (e.g., lead), a pick-up electrode , and a stimulating electrode . An external pulse generator (EPG) can be used to deliver electrical stimulation transcutaneously via the gel electrodes and attached to the skin S. As described above, a portion of the delivered stimulation is picked up by the pick-up electrode and is delivered via the conductor to the stimulating electrode implanted in the targeted area. In this embodiment, the gel electrodes , are attached to the skin out of the area covered by the case/cast C. In some situations, this can provide an advantage as compared to a standard TENS stimulation. For example, the external gel electrodes and can enable easy access and replacement being located outside the cast, while still delivering stimulation to the targeted location.
FIGS. 15 and 16
Thus, electrical stimulation has a variety of short-term therapeutic applications after injury or surgery as well as long-term applications for bone healing, or for prevention of muscle atrophy in paralyzed muscles as described above (see e.g., ).
Electrical stimulus can also be used in the prevention of deep venous thrombosis. During periods of immobilization, it can be important to continue to contract the limb muscles to move the venous blood back to the heart and to prevent pooling of the blood. This is especially applicable after pelvic fractures, as well as after total hip or knee replacements. If there is pooling of blood in the legs, a blood clot or thrombus formation can result in a small portion of the clot (emboli) breaking off. The emboli can lodge in the lungs resulting in pulmonary embolism and possible death. Electrical stimulation can be used to prevent the blood from pooling by frequent contraction of the muscles (for example the calf muscles). In addition to the creation of a muscle pump, electrical stimulation may increase plasma fibrinolytic activity and reduce the potential of clotting.
Electrical stimulation can also be used in the management of stiffness and joint contractures after immobilization. Electrical stimulation can provide several benefits in the rehabilitation of stiff joints. Electrical stimulation can be used to augment contraction of the muscles and hold the contraction at the end of the available joint range. Electrical stimulation can modulate discomfort or pain during the early mobilization period, and can enhance the force production, work capability and endurance of the stimulated muscles. Severe muscle atrophy can occur rapidly following traumatic spinal cord injury. In such a case, electrical stimulation may be beneficial in preventing secondary impairments of patients with spinal cord injuries when applied before extensive post-injury atrophy occurs.
Electrical stimulation can also be used in the management of muscle performance. For example, electrical stimulation of a muscle or of a nerve innervating the muscle may be applied to maintain muscle contractility during periods of immobilization when the effect of muscle contraction would not interfere with the healing. Although electrical stimulation during immobilization may not completely prevent shrinkage or atrophy of muscle, it may minimize the loss and maintain the metabolic capability of muscle to speed recovery when it is safe to resume movement and exercise. When the resumption of exercise is permitted after injury or surgery, electrical stimulation may be used to provide sensory input and to improve muscle recruitment.
In a situation where a nerve block (neuropraxia) is present, electrical stimulation may be used to maintain the paralyzed muscle until the nerve block resolves. Depending on the location of the weak or paralyzed muscles, electrical stimulation may be used to substitute a brace or orthosis. In some embodiments, augmentation of muscle strength with electrically elicited muscle contractions can occur in a similar manner to augmentation of muscle strength with voluntary exercise. In some cases, augmentation of muscle strength using percutaneous stimulation is fundamentally different from augmentation of strength with voluntary exercise.
Electrical stimulation can be delivered transcutaneously, percutaneously or using fully implanted stimulators. In one example, electrical stimulation includes the use of electrical stimulation of quadriceps femoris and hamstring muscle groups during a period of low extremity cast immobilization for an athlete who sustained grade II medial, collateral and anterior cruciate ligament sprains. Three weeks after cast removal, single-leg, vertical-leap height was 92% of that accomplished by the dominant, uninjured leg, and the patient was able to return to athletic competition. This example illustrates that electrical stimulation may attenuate denervation and age-related muscle atrophy. In another example, electrical stimulators were implanted in rats, stimulating the extensor digitorum longus. This example illustrates that electrical stimulation can be used to reduce age-related atrophy and weakness by ensuring that all of the muscle fibers underwent titanic contraction. In another example, percutaneous electrical stimulation can be used in preventing immobilization-induced muscle atrophy. In some cases, brief periods of percutaneous electrical stimulation can reduce quadriceps atrophy secondary to knee immobilization, and can aid in the prevention of the fall in muscle protein synthesis that usually occurs on immobilization. In some cases, electrical stimulation can prevent a fall in oxidative enzyme activity.
Each of the above described procedures can also be performed using a miniature implantable stimulator(s) for delivery of the electrical stimulation in a patient Such miniature implantable electrical stimulators are described in U.S. Pat. Nos. 6,735,475, 6,941,171 and 6,735,474, each of the disclosures of which is hereby incorporated by reference in its entirety.
For example, a miniature implantable electrical stimulator(s) can be used in conjunction with a joint replacement procedure to improve patient healing and decrease pain. A miniature implantable stimulator has several advantages compared to other techniques, for example, as follows. Compared with a transcutaneous device, with a miniature implantable electrical stimulator, an electrical stimulation can be delivered to a specific location (e.g. to the specific nerve), with no unpleasant sensation from cutaneous receptors, due to delivery of the stimulation thru the skin. There are also no external gel electrodes, which may cause skin irritation and require replacement and/or re-alignment. As with the stimulation systems and implants described above, compared with percutaneous stimulation, with a miniature implantable electrical stimulator, the risk of inflammation or contamination due to the lead protruding thru the skin can be reduced or eliminated. Also, compared to a full size implantable stimulator, with a miniature implantable electrical stimulator, only a minimally invasive procedure is typically required.
Miniature implantable electrical stimulator(s) used in conjunction with a joint replacement procedure can also be used to delay or defer the need for a joint replacement procedure as described above. Conditioning of the muscles/joint can be done before a joint replacement procedure (e.g. increasing range of motion). Improvements can be made in pain management and/or in management of muscle performance. In some cases, stimulation of a joint can also help prevent deep venous thrombosis. It is also noted that the use of electrical stimulation based on implanted passive conductors as described herein can have benefits similar to those of miniature stimulators, while providing a significantly less expensive alternative.
While various embodiments have been described above, it should be understood that they have been presented by way of example only, and not limitation. Where methods and steps described above indicate certain events occurring in certain order, those of ordinary skill in the art having the benefit of this disclosure would recognize that the ordering of certain steps may be modified and that such modifications are in accordance with the variations of the invention. Additionally, certain of the steps may be performed concurrently in a parallel process when possible, as well as performed sequentially as described above. The embodiments have been particularly shown and described, but it will be understood that various changes in form and details may be made.
18
118
118
518
618
718
818
34
FIG. 1
FIG. 1
Although various embodiments have been described as having particular features and/or combinations of components, other embodiments are possible having a combination or sub-combination of any features and/or components from any of the embodiments described herein. For example, one or more of the implants (e.g., , , ′, , , , ) can be used in a procedure to stimulate a bodily tissue (e.g., soft tissue, muscle, ligaments, bone structures, etc.). Thus, in any procedure described herein, although not necessarily illustrated, a second implant can be included, such as shown in (e.g., including return conductor ). It is also noted that any embodiment of an implant can be used for any of the various procedures described herein. For example, an implant can be used for any of the above-described procedures with or without a cuff electrode (as described in ).
FIGS. 5-8
Further, the quantity of electrodes can vary depending on the particular treatment. The type of electrode can also vary, for example, a plate electrode or a cuff electrode can be used. Although some embodiments describe applying or delivering electric current from a stimulator (e.g., pulse generator) to a cathodic electrode attached to a surface of a patient over the pick-up end or pick-up electrode of an implant, it should be understood, that an anodic electrode can alternatively be placed over the pick-up end or pick-up electrode and electrical current delivered thereto. For example, as described with reference to , various configurations and combinations of cathodic electrodes and anodic electrodes (e.g., positioning relative to the implanted conductor) can be used.
30
24
124
26
126
28
128
20
22
120
122
Further, the various components of an implant as described herein can have a variety of different shapes and or size not specifically illustrated. For example, the terminations (e.g., ), the conductors (e.g., , , etc.), the pick-up end or pick-up electrode (e.g., , , etc.), the stimulating ends or stimulating electrodes (also referred to as delivering ends or electrodes) (e.g., , , etc.) can each have a variety of different shapes sizes, cross-sections, thickness, etc. In addition, the electrodes (e.g., , , , , etc.), can be a variety of different shapes, sizes, types, etc.. Although a stimulator for delivering electric current to the electrodes was described as a pulse generator, in some embodiments, other types of stimulators can alternatively be used. Various power sources can also be used, including for example, a wireless or wired connection to the stimulator.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1
is a schematic illustration of a three-dimensional view of an embodiment of the invention having an implanted electrical conductor, surface cathodic and anodic electrodes, and an implanted electrical return conductor.
FIG. 2
illustrates the musculature and nervous system of a knee in extension.
FIG. 3
illustrates the musculature and nervous system of a knee in flexion.
FIG. 4
is a top view of a schematic illustration of an implant according to an embodiment disposed within a schematic illustration of a feline.
FIG. 5
FIG. 4
is a top view of a schematic illustration of a portion of a system according to an embodiment disposed within the schematic illustration of a feline of illustrating a first configuration.
FIG. 6
FIG. 4
is a top view of a schematic illustration of a portion of a system according to an embodiment disposed within the schematic illustration of a feline of illustrating a second configuration.
FIG. 7
FIG. 4
is a top view of a schematic illustration of a portion of a system according to an embodiment disposed within the schematic illustration of a feline of illustrating a third configuration.
FIG. 8
FIG. 4
is a top view of a schematic illustration of a portion of a system according to an embodiment disposed within the schematic illustration of a feline of illustrating a fourth configuration.
FIG. 9
FIGS. 5-8
is a graph illustrating the surface threshold currents associated with each of the configurations of the system of .
FIG. 10
is a side view of a schematic illustration of a system illustrating an application to treat a wound.
FIG. 11
is a top view of a schematic illustration of a system illustrating another application to treat a wound.
FIG. 12
is a top view of a schematic illustration of a system illustrating another application to treat a wound.
FIG. 13
is a side view of a schematic illustration of a system according to an embodiment illustrating an application to treat a wound.
FIG. 14
is a side view of a schematic illustration of a system according to an embodiment illustrating an application to treat a deep wound.
FIG. 15
is a side view of a schematic illustration of a system according to an embodiment illustrating an application to treat a bone fracture.
FIG. 16
is a side view of a schematic illustration of a system according to an embodiment illustrating an application to treat a bone defect and/or muscle. | |
The clinical requirements described here are representative of those that must be met by an employee to successfully perform the essential functions of this job.
- Providing Basic and Advanced Life Support care and transport while working as a member of an emergency medical team to patients while in adherence to the scope of practice, patient care procedures, protocols and medical direction according to their level of certification / licensure.
- Communicating with professional medical personnel interagency and at emergency and non-emergency treatment facilities.
- Obtaining instructions regarding further treatment from qualified personnel and arranging for reception of patients at treatment facilities.
- Assists health care facilities and personnel to obtain and record information related to patients’ vital statistics, circumstances of transport/emergency and the documentation of patient care provided.
- Insure management of medical equipment and supplies including the arrangement of resupply of consumables.
- Acknowledges accountability for all patient care provided.
- Maintains and continues to obtain at least the minimum prescribed continuing education required to keep your certification/licensure in the state.
- Attends mandatory minimum continuing medical education (CME) meetings as required by Ministry of Health Malaysia.
- Attends mandatory crew meetings and other mandatory training events as prescribed and required by FFA’s or other regulating agencies.
- Ability to interpret written, oral, and diagnostic form instructions.
- Ability to work throughout an entire work shift without interruption.
- Ability to learn, use and become proficient in all equipment related to patient care.
- Is mentally robust and able to manage large amounts of pressure while still keeping an overview
- Ability to remain calm in high stress situations and make good judgments, ability to be unaffected by loud noises, flashing lights and strobes. Simple and complex mathematic skills, reasoning.
- Logic, ethical judgment and reasoning, active listening skills, decision making, ability to communicate effectively in written and verbal formats, as well as via telephone and radio equipment.
- Ability to read and understand road maps, discern street signs and address numbers.
- Certificate, Diploma or Degree in Nursing/Medical Assistant registered by Ministry of Health Malaysia.
- Certificate in Basic Life Support, Advance Life Support , Pre-hospital Trauma Life Support will be an added advantage.
- Fresh graduates are invited to apply. Within 6 months of employment the Staff Nurse / Medical Assistant will be required to obtain the required certifications.
- Possess good working knowledge of English / Bahasa Malaysia. | https://www.firstambulance.com.my/careers/ |
General Shift Register
Basically, we can make the shift registerusing a variety of flip-flop, such as flip-flops RS, JK, D, and T. Importantly, it is in synchronous sequential circuits, which means that the output state is determined by the input, the output current (current output) and each output is changed at the same time (the connotation of synchronous) to guarantee data integrity.
In the picture below looks a series of generic shift register, which is made by using 7 flip-flop D. Four first flip-flop (from left) are connected with preset X4, X3, X2, and X1, which is intended as input data. Preset input this data can only be used if the preset enable value 1.
General Circuit For Shift Register
If the first four flip-flop (from left) serves to receive and represent data, then the last three flip-flop serves as a buffer reservoir, to open up the possibility of cascading. If the initial conditions X4, X3, X2, and X1 respectively value 1, 0, 0, and 0 and presets enable is 1, then the circuit get input valued at 1000. When in this state in the circuit given a ticking clock, there will be a shift to the right data, resulting in the output value of 0100 (000), with the numbers in parentheses are the contents of the buffer. On the next clock ticking, the output will be 0010 (000), and so on. Examples of commands that can be used to perform this function are: <opcode data,n> where n is the number of shifts required and will become a benchmark calculation of this rate clock provided to the circuit.
Of concern here, relates to a series of Shift Register above, is that to shift the data to the right as much as two steps (identical division with 22 required two clock ticking. Means, to perform data shifts to the right as much as three steps ( identical division by 23) required three clock rate. It is also of concern is that the circuit above can only make the process of shifting to the right (identical division by 2n) and can not shift to the left (identical to multiplication by 2n). Functions latter can be met by increasing the number of components that can alter the flow of data shift. | http://schematiccircuit.com/general-shift-register/ |
Abstract:
Microblog platforms allow users to post publicly viewable short messages. Unfortunately, not all posted information may be credible and these platforms have become a prime target for the spread of fake news and misinformation when some major event occurs. Despite advances in tools and techniques for the detection and verification of fake news, assessing the credibility of information remains a challenge.
We observe that a micropost typically contain multiple pieces of information, each of which may have different level of credibility. We first introduce the notion of a claim based on subject and predicate terms, and draw upon work done in open information extraction to extract from microposts, tuples that comprises of subjects and their predicate. Then we cluster these tuples to identify claims such that each claim refers to only one aspect of an event. Next, we propose an interactive framework called iFACT for assessing the credibility of claims. The proposed framework collects independent evidence from web search results and utilizes features from the search results to estimate the likelihood of a claim being credible, not credible or inconclusive. In addition to sourcing for external independent sources of evidence in the form of WSRs, we also identify the dependencies among claims, and use these dependencies to adjust the likelihood estimates of a claim being credible, not credible or inconclusive. Finally, we examine how the framework can be expanded for time sensitive claims, where the credibility of claims depends not just on the content, but also on the time period that the claim is purported to be valid for. We generate alternate claims and consider relationships between these alternate claims and the target claim, in order to perform a joint credibility assessment for all the claims. | https://events.comp.nus.edu.sg/view/16520 |
- I used loose leaf Thai tea that you can find here, but you can actually substitute this with the tea of your choice, like Earl Grey, matcha, jasmine, etc. If you’re using looseleaf tea, use 3-4 tablespoons. If you’re using tea bags, use 2-3 tea bags.
- 10 tablespoons (145g) butter
- 1/2 cup (100g) granulated sugar
- 1/4 cup (50g) brown sugar
- 2 tablespoons honey
- 1 large egg
- 1 tablespoon heavy cream
- You can also use coconut milk in it’s place too.
- 1 teaspoon vanilla extract
- 1 1/2 cups (192g) all purpose flour
- 1/2 teaspoon baking soda
- 1/2 teaspoon salt
- 1 cup white chocolate chips and a bit more for decoration
This makes approximately 2 dozen cookies.
Instructions
- Preheat the oven to 375 degrees and line a cookie sheet with parchment paper.
- Let’s prepare the Thai tea leaves! Grind the Thai tea leaves into as fine of a powder as possible. Then, run the Thai tea powder through a sieve.
- Then, melt the butter until it’s completely melted. While it’s still hot, add the Thai tea powder and mix until combined. Let it sit for about 7 minutes.
- In a separate mixing bowl, add granulated sugar, brown sugar, honey, egg, heavy cream, and vanilla extract. Mix with a spatula until evenly combined. Add the Thai tea butter mixture and mix again.
- Then, add the all purpose flour, baking soda, and salt. Mix until evenly combined.
- Pour in the white chocolate chips and fold in evenly.
- Scoop approximately 1 tablespoon of cookie dough and place it onto the parchment paper for each cookie. Press any additional white chocolate chips on top to make them look pretty.
- Bake at 375 degrees for approximately 12 minutes. Repeat until you finish all the dough. You’re done!
Crispy Thai Tea Cookies are the perfect way to enjoy Thai tea, but in cookie form. If you don’t know what Thai tea is, it’s a black tea blend with spices like star anise, crushed tamarind, cardamom, and more! It’s usually served as a creamy cold beverage that’s delicious. In this form, these cookies are crispy, so the texture is perfect if you want some crunch. It also shows off the Thai tea flavor super well, since the white chocolate really balances the spice notes from the Thai tea. Let me know in the comments below if you made these Thai Tea Cookies and how it went! | https://jensfoodlab.com/2020/09/13/crispy-thai-tea-cookies/ |
Just downloaded the CLI binaries from getmonero. When trying to load a wallet in the CLI I get one of two errors:
Error: failed to load wallet: std::bad_alloc Error: failed to load wallet: basic_string::_M_replace_aux
The errors don't appear together. Each time I try I get one of them, seems pretty random to me.
I can load the wallet using the old CLI binary.
Anything to do about it?
Edit:
The solution suggested by dEBRUYNE works in the sense that my wallet can now be opened. However, this way I lose information I cannot restore, about past outgoing transactions (specifically, addresses I sent to).
Furthermore, I just noticed that v0.11.1.0 doesn't support subaddresses yet, and I should note that my previous cli did support it, and my wallet did have subaddresses, so I guess this caused the incompatibility. | https://monero.stackexchange.com/questions/6611/cant-load-wallet-in-cli-v0-13-0-2-or-gui-v0-13-0-3-error-stdbad-alloc-err |
This post may contain affiliate links.
Electromagnetic door locks, often called maglocks, are strong locks found in some homes, apartments, and other buildings. If you’re looking into how to remove your magnetic door lock to replace it, you’re probably confused by all the wires and screws. Which part should you remove first? Will it take a long time? Don’t worry, because we did the research to help you answer these questions.
To remove the magnetic door lock attached to your door, you should follow these steps:
- Unplug the unit from the power source.
- Remove the screws that connect the armature to the door.
- Unscrew the magnet from the door jamb.
- Uninstall any accessories.
The steps above are simple and easy to do. However, you may want to know more about your magnetic door locks before completely uninstalling and removing them. How do they work? How strong are they? Continue reading to learn all there is to know about removing your magnetic door lock.
Removing A Magnetic Door Lock
To remove an electromagnetic door lock from your door and jamb, you simply have to do the installation process in reverse. The following steps will help you to safely remove your magnetic lock:
1. Unplug The Unit From The Power Source
First and foremost, you have to remove the power source of your electromagnetic lock. This step can be as simple as pulling a plug from an outlet or disconnecting the battery.
In doing so, you will eliminate the risk of electrocution. Removing the power supply will also remove the chances of your alarm inadvertently going off during the process.
2. Remove The Screws That Connect The Armature To The Door
The armature plate is a metal plate attached to your door. It’s often secured by screws on two sides and a bolt in the middle to hold it securely.
You can remove the plate by using a screwdriver to loosen the screws and an Allen wrench to remove the bolt. This will allow it to slip off easily.
The only issue after you remove the armature from your door is that the screw holes are now exposed. Aside from looking unsightly, they can also allow water and pests to come in.
If you want to know how to fill in holes in your wooden door, check out this post: How To Fix A Hole In An Oak Door.
If you bought your new home with a magnetic door lock already installed, you might not have the necessary wrenches to remove the bolt. It would be best to use the right tools for the right screws and bolts, or you might damage the screw so much that it will be nearly impossible to pull out.
Click here to see this Allen wrench set on Amazon.
3. Unscrew The Magnet From The Door Jamb
With the plate gone and the power supply disconnected, you can now safely work on the electromagnet. Using an Allen wrench, loosen the fixing screws that attach the electromagnet to the mounting plate.
This will loosen the electromagnet, and you will be able to remove it from the mounting plate. You can then use a screwdriver to detach the mounting plate from the door frame completely.
4. Uninstall Any Accessories
With the magnet and the armature plate out of the way, you can proceed to remove all accessories attached to the mechanism. These could be any alarms, sensors, keypads, access control boxes, and wires.
Like the magnet and the plate, these can be removed by simply removing the screws and bolts.
How Do Magnetic Door Locks Work?
Magnetic locks have two parts: an armature attached to the door and an electromagnet attached to the door frame. The electromagnet on the frame is then plugged into a power source; it is usually a battery or an outlet nearby.
The locking mechanism works much like regular magnets that attract metal. However, the difference is that the electromagnet uses an electric current to create a stronger, more secure hold.
The door opens when the electric current turns off through access control. You can open the door from the outside by entering the correct code on a keypad, using a fingerprint, or an RFID fob that can open the door.
On the inside, there is a button that opens the door with a simple press. Some models also have infrared sensors that can detect whenever a person wants to go out.
Electromagnetic door locks are fail-safe. This means that in case of emergencies and subsequent power outages, the door will open to allow for a safe exit.
How Strong Are Magnetic Door Locks?
Magnetic door locks are very strong and nearly impossible to pry open. A magnetic door lock produces a holding force ranging from 551 to 2,205 pounds.
To put that in perspective, an average human who’s dragging a load can exert around 107 pounds of pressure for a short time.
How To Reset Magnetic Door Locks?
When your magnetic door locks fail to latch on completely, you can try a couple of methods to reset and troubleshoot the problem. The first thing you should try is to tighten all the screws on both the armature and the magnet to fix misalignment.
If that does not fix it, try to check if your power source is connected properly. If your magnetic lock uses a battery, you should try replacing it or the wires that connect it to the magnet.
Are Magnetic Door Locks Secure?
Magnetic door locks are secure. They are nearly impossible to pry open through sheer force since the magnet pulls the door with up to 2,000 pounds of force.
However, these locks require a constant electricity supply, or else they shut off. If you live in an area where regular power outages are the norm, you might want to add an additional lock for protection.
There are also ways to bypass an electromagnetic lock, although the process is difficult. If hacking is one of your concerns, you can install tamper alarms connected to your locking mechanism.
If you want to know more about door alarms and sensors, read this other post: Do Door Alarm Sensors Have Batteries?
How Do You Bypass A Magnetic Door Lock?
You can bypass a magnetic door lock in two ways. You can use the paperclip method and the magnet method.
To bypass a magnetic door lock using the paperclip method, you need a paperclip and a screwdriver. Use the screwdriver to take the keypad apart to access the board inside.
Once you see the board, as shown in the video above, look for two wires labeled “NO” and “COM.” Use the paperclip to bridge the NO and COM in the circuit board, and the door will open instantly.
For the magnet method, you will need a strong magnet. As demonstrated in the video below, some access controls have multiple relays, with one specifically opening the door.
By simply placing the magnet in the right relay area of your keypad or access area, you can instantly open the door. However, some keypads and magnetic door lock access controls have a relay that triggers an anti-tamper system.
It would be best to look at your manual to see where the relay that opens your door is located.
In Closing
Removing your electromagnetic door lock is a simple task. Firstly, remove the power supply. Afterward, using a screwdriver and an Allen wrench, remove the screws and bolts that attach the magnetic lock, mounting plate, and armature plate to your door and frame.
The final step is to remove all the accessories installed in connection to your magnetic lock. However, you may want to reconsider removing your magnetic lock since it is one of the most reliable and secure pieces of technology that homeowners can use to keep their properties safe. | https://doordodo.com/how-to-remove-magnetic-door-lock/ |
Issue 72 of the CBD Technical Series is now out focusing on "EARTH OBSERVATION FOR BIODIVERSITY MONITORING : A review of current approaches and future opportunities for tracking progress towards the Aichi Biodiversity Targets". The issue shows how earth observation technologies can and should fit into systems for biodiversity monitoring, as well as demonstrates how these approaches could further improve relevant indicators for the Aichi Biodiversity Targets. It illustrates a clear track from observations done by remote sensing platforms through Essential Biodiversity Variables to biodiversity indicators and ultimately to the assessment of progress towards the Aichi Biodiversity Targets and ultimately in support of evidence-based decision making. EU BON is also featured in this report.
The goal of the CBD Technical Series is to contribute to the dissemination of up-to-date and accurate information on selected topics that are important for the conservation of biological diversity, the sustainable use of its components and the equitable sharing of its benefits. A large and growing body of evidence has clearly established the need to disseminate synthesis publications relevant to CBD objectives and selected reports presented at CBD meetings.
The CBD Technical Series is intended to:
- Foster scientific and technical cooperation;
- Improve communication between the Convention and the scientific community;
- Increase awareness of current biodiversity-related problems and concerns; and
- Facilitate widespread and effective use of the growing body of scientific and technical information on conserving and using biological diversity.
The full report is available here. | http://eubon.eu/show.php?storyid=10837&title=Issue%2072%20of%20the%20CBD%20Technical%20Series:%20Earth%20observation%20for%20biodiversity%20monitoring |
Canadian Government Introduces Legislation To Improve The Operation Of The Criminal Justice System
The Government of Canada is committed to keeping Canadians safe and making the criminal justice system more accessible, efficient and effective. This includes supporting the increased use of technology in courts across Canada.
The effects of the ongoing COVID-19 pandemic are still being felt throughout the criminal justice system, and particularly in the operation of criminal courts. The pandemic has both created and amplified challenges and limitations within the criminal justice system. Canada’s criminal courts have been adapting and modernizing to address the challenges they face, but many remain unable to operate at their pre-pandemic capacity.
Today, Senator Gold introduced proposed changes to the Criminal Code, the Identification of Criminals Act and other federal legislation to help address the challenges faced by criminal courts caused or exacerbated by the COVID-19 pandemic, and modernize our criminal justice system now and for the future. These proposed changes are substantially the same as the ones introduced by former Bill C-23 in February 2021 by the Honourable David Lametti, Minister of Justice and Attorney General of Canada.
The Bill proposes a number of targeted changes to the Criminal Code that would give courts increased flexibility in how they hold criminal proceedings and issue orders. These changes would not compromise public safety, or participants’ rights and freedoms, and would support greater access to justice moving forward, including for those living in remote communities.
The Bill would make changes in the following areas:
remote appearances for accused individuals: clarify and expand the law by providing clear mechanisms to allow accused persons or offenders to appear remotely by videoconference or audioconference in most criminal proceedings, with consent, at the discretion of the court and with other appropriate safeguards
remote participation for jury selection proceedings: allow videoconference participation by prospective jurors in the jury selection process under certain circumstances, with the consent of the parties, at the discretion of the court and with other appropriate safeguards
use of technology for jury selection: allow for the enhanced use of technology to draw the names of prospective jurors in the jury selection process
fingerprinting process: allow fingerprinting under the Identification of Criminals Act to occur at a later date, particularly where previous attempts at fingerprinting were not possible due to exceptional circumstances, such as those posed by COVID-19
The Bill would also make minor technical changes to the Criminal Code and the Identification of Criminals Act that were identified during the implementation of former Bill C-75 (delays in the criminal justice system, 2019).
While in-person appearances would remain the norm, the proposed changes would clarify the availability of remote appearances in appropriate circumstances.
These proposed changes aim to ensure that both victims and accused receive fair and timely justice by allowing the system to function in a safer, more effective, efficient and flexible manner. They would also help the criminal justice system manage the impacts of the COVID-19 pandemic, including the backlog of cases. These changes are intended to help reduce the risks of further delays incurred during the pandemic and provide for increased efficiency both during the COVID-19 pandemic and in the long term. | |
As the COVID-19 delta variant grips the nation and workforce shortages impact every industry, the effects on healthcare providers and the implications on quality of care are urgent.
Public discourse around this issue has largely focused on increased costs to healthcare institutions as the great resignation hits healthcare. Indeed, hospital expenses per discharged patient have increased by over 15% year-to-date compared to 2019, and much of that increase relates directly to contract temporary labor, the cost of which has skyrocketed by over 100% for both full- and part-time staff.
But the downstream impacts of our healthcare workforce shortage present more direct challenges to patients and families. University Hospital is projecting a 17.5% overall turnover rate this year, an all-time high driven mostly by nursing and technical staff resigning or taking lucrative agency opportunities. Meanwhile, our agencies tell us that even updating our pay schedules to “crisis” levels still may not allow them to fulfill more of our requests.
The result has been an all-hands-on-deck effort to fully staff clinicians and support staff in critical units of our hospital. Our ideal nurse staffing level in the emergency department has been difficult to achieve. And while we have kept up safe staffing standards in our intensive-care units, we often must exhaust every temporary or agency staff option to do so, and we are very concerned about staffing as increases in census are expected during the winter months. Unfortunately, our experience is not unique—this is on the agenda of local and national hospital associations across the country, as it represents the biggest systemic risk to hospital performance this year.
National workforce trends could pose safety risks to individuals presenting for care at any hospital in 2021. Nurse staffing shortages in key areas of the hospital can increase your risk of death, cardiac arrest, failure to rescue and hospital-acquired infections, especially in the ICU. Moreover, as high-reliability frameworks come to dominate our collective thinking on how best to achieve zero harm in healthcare environments, experts agree that team training and dynamics are crucial. I know firsthand that the basic elements of high-functioning teams—trust, psychological safety in identifying problems, and a shared understanding of policies and procedures—are exceedingly difficult to achieve in environments of high turnover.
While I share the hope that a post-delta abatement in cases could offer relief in hospital workforce challenges, there are reasons to be skeptical. A Centers for Disease Control and Prevention study published in September highlighted significant increases in hospital-acquired infections throughout the pandemic, and offered that staffing challenges against increased patient caseloads were a major reason. Even as COVID-19 abates, hospitals are still extremely busy with patients who have other conditions because of deferred or delayed care, with some indications that EDs are more filled now than they were pre-pandemic.
There is much we can do from a policy standpoint to stem these challenges. First, the federal government should expand recruitment and deployment of the U.S. Public Health Commissioned Corps, a program under the Surgeon General that consists of healthcare professionals who are uniformed officers and can be deployed in a manner similar to National Guard or military reservists. These professionals have already done much to support health systems and localities during case surges throughout the pandemic, and should be funded even better.
Second, governments at all levels should increase their investment in the healthcare workforce pipeline, with an eye toward encouraging folks in vulnerable communities to enter educational and training tracks that will fill critical vacancies.
Third, the Justice Department and Federal Trade Commission should consider investigating the behavior of contract staffing firms to ensure that the bulk of their higher prices are transferred to staff themselves, rather than to agency profits. The implications for patient safety and quality of care warrant such scrutiny.
Finally healthcare leaders must focus on workforce burnout and support clinicians who have worked through an unprecedented time over the last 20 months. We offer peer-to-peer support, chaplaincy services and direct mental healthcare to employees who need it most. This is the right thing to do, but could also do much to improve retention.
As healthcare leaders, we would do better to frame the healthcare workforce shortage debate around the downstream effects on patients and families. This is a strategy that is more likely to lead to solutions that both our communities and our employees deserve.
Our healthcare staffing crisis is a patient safety crisis, too
As the COVID-19 delta variant grips the nation and workforce shortages impact every industry, the effects on healthcare providers and the implications on quality of care are urgent.
Send us a letter
Have an opinion about this story? Click here to submit a Letter to the Editor, and we may publish it in print. | https://www.modernhealthcare.com/opinion-editorial/our-healthcare-staffing-crisis-patient-safety-crisis-too |
Well-Defined Thiolated Nanographene as Hole-Transporting Material for Efficient and Stable Perovskite Solar Cells.
Perovskite solar cells (PSCs) have been demonstrated as one of the most promising candidates for solar energy harvesting. Here, for the first time, a functionalized nanographene (perthiolated trisulfur-annulated hexa-peri-hexabenzocoronene, TSHBC) is employed as the hole transporting material (HTM) in PSCs to achieve efficient charge extraction from perovskite, yielding the best efficiency of 12.8% in pristine form. The efficiency is readily improved up to 14.0% by doping with graphene sheets into TSHBC to enhance the charge transfer. By the HOMO-LUMO level engineering of TSHBC homologues, we demonstrate that the HOMO levels are critical for the performance of PSCs. Moreover, beneficial from the hydrophobic nature of TSHBC, the devices show the improved stability under AM 1.5 illumination in the humidity about 45% without encapsulation. These findings open the opportunities for efficient HTMs based on the functionalized nanographenes utilizing the strong interactions of their functional groups with perovskite.
| |
A curriculum that balances rigor and flexibility.
Physics and astronomy programs of study prepare students for graduate study, positions as high school teachers, and entry-level work as physicists in government or industry. Several degree options meet a range of needs and interests.
All majors in the College of Arts and Sciences complete at least 124 total credits to earn a bachelor’s degree.
There are four different options a student may choose to pursue. All four options share 19 credit hours of required courses in common, making it easy for students to switch from one to another if their career objectives change.
This degree offers a broad background in basic physics to students pursuing a second major or minor in any discipline, including arts, humanities, and social sciences.
This degree program highlights students’ interest and preparation in astronomy. Students interested in pursuing graduate study in astronomy generally complete about 40 credit hours in the department – the number required for a stand-alone astronomy major with no minor or second major.
This versatile major plan can be tailored to many interests through elective courses and optional concentrations. Faculty advisors can help students to accomplish double majors efficiently. A stand-alone physics major (with no minor or second major) requires 40 hours of physics credits.
The program is designed for students who are interested in teaching physics in secondary education, allowing them to take most of the core physics courses while still having room to take education courses.
All minors require a minimum of 16 credit hours.
An overview of important topics in physics.
An applied-science minor, focusing on the action of forces on bodies and the properties of matter.
Courses of special interest in the design and development of electronic devices.
Qualified students may combine semesters in applied physics or research at a professional work site with other semesters of traditional academic studies on campus. Enrollment in this program is limited by the availability of positions offered by suitable cooperating companies. | https://www.valpo.edu/physics-astronomy/academics/degree-programs/ |
What was North America called before European colonization?
Pre-Colonial North America (also known as Pre-Columbian, Prehistoric, and Precontact) is the period between the migration of the Paleo-Indians to the region between 40,000-14,000 years ago and contact between indigenous tribes and European colonists in the 16th century CE which eradicated the Native American culture.
Who lived in North America before the Europeans came?
Who lived in America before the Europeans arrived? Great American Indian tribes such as the Navajo, Sioux, Cherokee, and Iroquois lived in America at the time the Pilgrims arrived. The Pilgrims settled in an area where a tribe called the Wampanoag lived.
What is the earliest map of North America?
The so-called oldest map of North America — the Vinland Map — sits in Yale’s Beinecke collection in a slim volume along with a medieval manuscript.
What was North America before 1492?
What were the Americas like in 1491, before Columbus landed? Our founding myths suggest the hemisphere was sparsely populated mostly by nomadic tribes living lightly on the land and that the land was, for the most part, a vast wilderness.
Who first mapped North America?
The first historical records of Europeans to set eyes on this ocean, the Pacific, are recorded as Vasco Núñez de Balboa in 1513. That is five to six years after Waldseemüller made his map.
Where did the first map of North America come from?
Early map of the northeast coast of North America showing New Sweden later to become a part of New Netherland. Map of the Country East of the Mississippi, 1650 A map of the country east of the Mississippi for the year 1650, forty-seven years after the settlement of Jamestown.
What can maps tell us about colonial America?
The documents in this collection include maps of varying styles and purposes made by the diverse peoples that created colonial North America. Together, these documents illustrate the utility of maps as historical sources and, more specifically, illuminate colonial North America’s multicultural and contested origins.
Why are maps important in the history of colonization?
During the formative centuries of European exploration, cross-cultural encounter, and colonization, maps played an essential role in the process of transforming North America into a new world populated by American Indians, Africans, and Europeans.
Where were the original colonies of the United States located? | https://www.skinscanapp.com/users-questions/what-was-north-america-called-before-european-colonization/ |
THE City of Bayswater is tasking residents to help shape the future of the City over the next 10 years.
City staff will be asking the public two questions; “What does being part of the City of Bayswater community mean to you?” and “What would you like us to do over the next 10 years to improve the City of Bayswater?”.
They will be seeking feedback at various community events during February and March.
Residents can also provide feedback in person at the civic centre, Maylands, Bayswater and Morley libraries or on the Engage Bayswater website.
Results of the consultation will lead to the development of the City’s new strategic community plan.
Mayor Dan Bull said the plan was a key planning document.
“It captures the City’s vision, priorities and aspirations for the next 10 years as outlined by you, the community,” he said.
“Whether you are a resident, community member or business owner, now is the time to have your say.
“As councillors, we are elected to champion the needs of our community.
“We need your help to guide us in the right direction.
“I am confident our community will embrace the opportunity to contribute to a new vision for Bayswater and help shape the future of our fabulous community.”
Councillor Lorna Clarke said she loved being part of Bayswater’s communities.
“Whether it’s through vibrant local community groups, bowls clubs, our libraries or meeting in our parks and gardens, we are kind and sharing,” she said. | https://www.perthnow.com.au/community-news/eastern-reporter/residents-to-help-shape-bayswater-c-898856 |
Over the past decade, companies on average have given less guidance on expected financial results than they had previously. One reason for that is an increase in the volatility of uncontrollable factors, such as those facing the oil industry.
In the past year in particular, the strengthening dollar, along with falling prices for oil and other commodities, have created many variances to plan — both positive and negative — in companies’ sales, operating margin, and net income. Given the market’s start in 2016, this year may be no different.
Variances attributable to fluctuating commodity prices and foreign exchange rates typically are, indeed, usually uncontrollable, so many companies resort to hedging those risks. But hedging can take you only so far, and its availability doesn’t mean you shouldn’t prepare for negative fallout from those risks in ways that could mitigate the impact to the business.
Even variances that are at least somewhat controllable may not get the attention they deserve. Unfortunately, there is a tendency for management, in the wake of any negative variance, to explain it away as simply an uncontrollable exogenous force.
The risk in an uncontrollable does not derive from its expected level (for example, deflation of -2%). Expected levels can be planned for. The risk lies in its degree of volatility, measured by the variance of business drivers such as demand and price, inflation/deflation, degree of regulation, supply chain disruptions, weather, political events — in other words, many of the business risks listed in a company’s Form 10-K.
Deflation, for example, can be tough on a variety of businesses, but if the level of deflation can be reasonably projected (for example, the aforementioned -2%) management can at least create a plan to reduce its impact.
Too often following a negative event, an executive enters a press conference without the proper information and makes excuses and assumptions that subsequently have to be recast. The excuses often ring hollow, because the same executive who blames a negative variance to plan on uncontrollable external events may be quick to take credit when such events work in the company’s favor — for example, crediting a drop in commodity prices to successful supplier management.
If you experience a miss due to an uncontrollable circumstance, can you look back and honestly say that you and your team did everything reasonable and within your resources to be prepared for dealing with the negative outcome? If so, you have no need to offer an excuse. Just ensure that your team adapts its future planning to incorporate learnings from the negative event.
Following are ways to anticipate and get ahead of the potential for uncontrollable to damage your business.
General managers who are quick to give excuses around uncontrollable events tend to rely on single-point budget estimates. In a chaotic and volatile global economy, cross-functional decision-making cannot rely on point estimates. It is critical today to look at ranges of outcomes instead.
The decision-making process has to encourage team members to voice divergent opinions, creating a dialogue around extreme events that can point to new ideas. When contrarian views are not allowed to enter the discussion, there is real risk of being caught unprepared by a negative that was overlooked.
After a negative has occurred, ask yourself if that outcome was within the range of the feasible outcomes you originally analyzed. If so, you probably did all that you could have done and the negative variance to plan will become a positive learning.
Even when ranges of outcomes are considered, misses can still occur, and even the best business leader will never be fully prepared for some uncontrollables. For instance, a negative variance on top-line volume or pricing can be very difficult to make up via cost reduction.
Being prepared as much as possible to minimize the downside involves asking tough questions and being honest with your answers. Examples of reasonable questions to ask in today’s world might be: “Are we prepared for the potential of parity, or less, of the dollar versus the euro?” Or, “How would business be impacted if a key supplier in a particular part of the world experienced a tsunami, leading to a critical supply chain disruption?” Or more generally, “Do we have an effective enterprise risk management process in place?”
An effective ERM process recognizes that things can and will go wrong; it prepares you to respond quickly and to know a priori the degree to which internal controls are in place to deal with the risk in question.
Always keep emotions at the door and ensure that your team understands that biases can negatively impact decision-making. Self-serving bias often manifests itself in the making of excuses.
One common bias is overconfidence, so recognize that some members of your team will be naturally subject to it. You should watch out for it, because overconfidence inherently will tilt the scale toward thinking that exogenous shocks are more controllable than they really are.
Allowing excuses can harm proper development of your people and weaken your business. Uncontrollables will inevitably occur and, when they do, someone must take responsibility for them. If you are a true leader, the buck will stop with you.
A leader will never use uncontrollables as an excuse for a negative variance, and likewise should not take credit for a positive one. If the fact that you did not put into practice the ideas outlined above contributes to a variance, that’s something that should only occur once in your career.
Thomas E. Conine, Jr., Ph.D., is president of TRI Corporation, which specializes in corporate education, experiential leadership, and simulation programs for corporate finance departments. He is also a professor of finance at Fairfield University in Connecticut. | https://www.cfo.com/accounting-tax/2016/02/uncontrollables-no-excuse-missing-numbers/ |
A value recorded during evaluation of an assertion, along with the column it
is associated with in the assertion's normalized source text.
Value
(Object value, int column)
int
getColumn()
Object
getValue()
class Object
wait, wait, wait, equals, toString, hashCode, getClass, notify, notifyAll
Copyright © 2003-2019 The Apache Software Foundation. All rights reserved. | http://man.hubwiz.com/docset/Groovy.docset/Contents/Resources/Documents/org/codehaus/groovy/runtime/powerassert/Value.html |
Apple’s new operating system for mobile devices will support all the same devices as iOS 13. It is expected that Apple will present iOS 14 and iPadOS 14 at the WWDC Developer Conference in June 2020. According to the French resource iPhonesoft, iPhone SE is also among the supported smartphones.
True, the company may change the decision regarding support for iOS 14 smartphones iPhone SE and iPhone 6s, but the final decision will be made in the next six months of development.
Smartphones that will receive iOS 14:
- iPhone 11, Pro, Pro Max
- iPhone XR, XS, XS Max
- iPhone X
- iPhone 8, 8 Plus
- iPhone 7, 7 Plus
- iPhone 6s, 6s Plus
- iPhone SE
- iPod touch (7th generation)
For Apple tablets, the new operating system will not support the iPad Air 2 and iPad Mini 2, which were introduced in October 2014 and September 2015, respectively.
As noted by 9to5mac, some iPhonesoft forecasts were not confirmed earlier. | https://egadget.pk/ios-14-will-work-on-all-devices-supporting-ios-13/ |
Founded in 1952 by Gaby Aghion, French fashion house, Chloé, is a leading luxury brand that has remained at the top of the fashion hierarchy for decades. It was one of the first prêt-à-porter design houses in a fashion industry strictly based on haute couture. Since its inception, the maison has established the identity of a Chloé woman: elegant, bohemian and stylish. Some of the brand’s favorite bags include the Faye, Drew and Marcie.
9700 Collins Avenue
Bal Harbour, FL 33154
305.861.1909
Monday-Saturday:
10 am - 9 pm
Sunday: | https://www.balharbourshops.com/store-directory/chloe/ |
Optimizing Workflow and Data Accessibility/Interpretation
The Cardiovascular Informatics Program is focused on optimizing clinical and administrative staff workflow and data accessibility/interpretability for research and quality improvement. This is done through improved computer information systems, including online medical record technology easily shared among physicians and patients.
Brigham and Women’s Hospital (BWH) has a robust history of internal developments in information technology at the enterprise, site and division level. In 2015, BWH transitioned from our internally-developed inpatient and outpatient information systems to integrated, electronic health information technology developed by Epic Systems Corp. This new, fully integrated clinical and administrative information system across the Partners HealthCare enterprise pulls together all existing systems, such as patient scheduling and research databases; clinical systems for doctors, nurses, emergency personnel, and other care providers; systems for lab technologists, pharmacists, and radiologists; and billing systems for insurers.
Informatics improvements in cardiovascular care at BWH include the following areas:
Cardiac Invasive
- Developed internal Structured Query Language (SQL) databases for quality improvement and research, as well as for National Cardiovascular Data Registry (NCDR) and state reporting.
- Staggered migration to “Cupid” structured reporting.
Cardiac Non-invasive
- Staggered migration to “Cupid” structured reporting
Ambulatory
- Installed real-time location system to enable intelligent workflow redesign and optimization.
Computer Information Support System
Computer information system support is shared across multiple teams within Brigham and Women’s Hospital and Partners HealthCare:
- Partners eCare (PeC) build and clinical content team. Partners eCare refers to the initiative to implement a shared electronic health record (EHR) system at all Partners HealthCare-affiliated academic medical centers, hospitals, physician offices, rehabilitation centers and home health providers by 2017. It builds off the industry-leading Epic software and, once fully-functional, will support more than 60,000 clinical and administrative professionals.
- Partners Information Systems (departmental systems group)
- Cardiovascular Medicine division systems administrators for catheter laboratory and electrophysiology laboratory
- Biomedical devices supported by BWH Biomedical Engineering and PeC Biomedical Device Integration teams
Read this Boston Globe article about Brigham and Women’s Hospital’s transition to Partners eCare and Epic’s information technology system. | http://www.brighamandwomens.org/Departments_and_Services/heart-and-vascular-center/programs/cardiovascular-informatics-program.aspx |
MDS clinical trials are the most effective way to evaluate new treatments for myelodysplastic syndromes. Most trials are designed to compare an emerging therapy to a treatment that is already recommended for MDS patients. This helps researchers determine if the new treatment is more effective than the current standard of care, and also whether one treatment causes fewer side effects than the other.
Through our MDS clinical trials, Moffitt has given countless patients a way to benefit from innovative treatments that aren’t yet available in other settings. In some cases, these treatments opened new doors for patients who didn’t respond to traditional therapies; in other cases, these treatments provided hope to patients who were not eligible for bone marrow transplants. While no patient is ever required to participate in a clinical trial, our malignant hematologists can help match interested individuals with trials that meet their specific needs.
To learn more about MDS clinical trials at Moffitt, call 813-745-6100 or 1-800-679-0775 (toll-free) or submit a clinical trials inquiry form online. Referrals are not required. | https://moffitt.org/cancers/myelodysplastic-syndromes-mds/clinical-trials/ |
dissociative identity disorder(redirected from Split-personality)
Also found in: Dictionary, Medical.
Related to Split-personality: Alternate personality, Multiple Personality Syndrome
dissociative identity disorder:see multiple personalitymultiple personality,
a very rare psychological disorder in which a person has two or more distinct personalities, each with its own thoughts, feelings, and patterns of behavior.
..... Click the link for more information. . | https://encyclopedia2.thefreedictionary.com/Split-personality |
CoreSite Realty Co. (NYSE:COR) Short Interest Update
CoreSite Realty Co. (NYSE:COR) was the target of a significant increase in short interest in September. As of September 30th, there was short interest totalling 1,470,000 shares, an increase of 24.6% from the September 15th total of 1,180,000 shares. Approximately 3.9% of the shares of the stock are short sold. Based on an average daily volume of 260,900 shares, the days-to-cover ratio is presently 5.6 days.
In other CoreSite Realty news, SVP Juan Font sold 600 shares of CoreSite Realty stock in a transaction dated Thursday, August 5th. The stock was sold at an average price of $139.11, for a total value of $83,466.00. Following the transaction, the senior vice president now owns 25,971 shares in the company, valued at $3,612,825.81. The transaction was disclosed in a document filed with the SEC, which is accessible through this hyperlink. Also, CAO Mark R. Jones sold 750 shares of CoreSite Realty stock in a transaction dated Tuesday, August 3rd. The shares were sold at an average price of $139.24, for a total value of $104,430.00. Following the completion of the transaction, the chief accounting officer now owns 11,876 shares in the company, valued at approximately $1,653,614.24. The disclosure for this sale can be found here. In the last ninety days, insiders sold 10,856 shares of company stock valued at $1,508,604. 1.40% of the stock is owned by insiders.
Get CoreSite Realty alerts:
Several large investors have recently modified their holdings of the company. Vanguard Group Inc. raised its position in shares of CoreSite Realty by 2.2% during the second quarter. Vanguard Group Inc. now owns 6,219,196 shares of the real estate investment trust’s stock worth $837,104,000 after purchasing an additional 136,643 shares during the period. BlackRock Inc. raised its position in CoreSite Realty by 22.7% in the 2nd quarter. BlackRock Inc. now owns 5,092,674 shares of the real estate investment trust’s stock valued at $685,476,000 after buying an additional 943,379 shares during the last quarter. Massachusetts Financial Services Co. MA raised its position in CoreSite Realty by 3.2% in the 2nd quarter. Massachusetts Financial Services Co. MA now owns 2,441,092 shares of the real estate investment trust’s stock valued at $328,571,000 after buying an additional 74,809 shares during the last quarter. Principal Financial Group Inc. raised its position in CoreSite Realty by 12.6% in the 2nd quarter. Principal Financial Group Inc. now owns 1,846,706 shares of the real estate investment trust’s stock valued at $248,567,000 after buying an additional 207,252 shares during the last quarter. Finally, State Street Corp raised its position in CoreSite Realty by 45.7% in the 2nd quarter. State Street Corp now owns 1,512,288 shares of the real estate investment trust’s stock valued at $205,465,000 after buying an additional 474,075 shares during the last quarter. 95.13% of the stock is currently owned by institutional investors.
COR has been the topic of several research reports. Cowen boosted their price target on CoreSite Realty from $153.00 to $158.00 and gave the stock an “outperform” rating in a report on Friday, July 30th. Royal Bank of Canada boosted their price target on CoreSite Realty from $130.00 to $136.00 and gave the stock a “sector perform” rating in a report on Monday, August 16th. They noted that the move was a valuation call. Zacks Investment Research cut CoreSite Realty from a “buy” rating to a “hold” rating in a report on Tuesday, October 5th. Wells Fargo & Company upped their target price on CoreSite Realty from $120.00 to $130.00 and gave the company an “underweight” rating in a report on Friday, July 30th. Finally, Credit Suisse Group upped their target price on CoreSite Realty from $157.00 to $161.00 and gave the company an “outperform” rating in a report on Friday, July 30th. Two analysts have rated the stock with a sell rating, five have assigned a hold rating and three have assigned a buy rating to the company. Based on data from MarketBeat.com, the stock currently has an average rating of “Hold” and a consensus target price of $141.33.
Shares of COR opened at $140.74 on Wednesday. CoreSite Realty has a 52-week low of $107.23 and a 52-week high of $155.40. The company has a debt-to-equity ratio of 80.93, a quick ratio of 0.18 and a current ratio of 0.18. The business’s 50 day moving average price is $145.11 and its two-hundred day moving average price is $134.49. The firm has a market cap of $6.22 billion, a PE ratio of 68.32, a price-to-earnings-growth ratio of 1.26 and a beta of 0.28.
CoreSite Realty (NYSE:COR) last issued its earnings results on Thursday, July 29th. The real estate investment trust reported $0.59 earnings per share for the quarter, missing analysts’ consensus estimates of $1.35 by ($0.76). CoreSite Realty had a return on equity of 143.10% and a net margin of 13.98%. Research analysts predict that CoreSite Realty will post 5.59 EPS for the current fiscal year.
The company also recently announced a quarterly dividend, which was paid on Friday, October 15th. Stockholders of record on Thursday, September 30th were given a dividend of $1.27 per share. This represents a $5.08 dividend on an annualized basis and a dividend yield of 3.61%. The ex-dividend date was Wednesday, September 29th. CoreSite Realty’s payout ratio is 95.67%.
CoreSite Realty Company Profile
CoreSite Realty Corp. is a real estate investment trust, which engages in the ownership, acquisition, construction and operation of strategically located data centers. The firm also offers collocation and interconnection solutions for networks, cloud services, and industry solutions. The company was founded in 2001 and is headquartered in Denver, CO. | |
Being an only child, you may have felt the pain of skipping the "siblings," tab while filling out documents and college applications. They have been forced to skip giving sibling descriptions while introducing themselves. They may have even been told, "You're so lucky! My sibling drives me insane," or, "Isn't it boring being all alone?"
As an only child myself, I have experienced all of the situations above and then some. However, having no siblings to share life with hasn't been (and doesn't have to be) an entirely negative situation. Unlike what many people assume about us, being an only child does not automatically reduce us to selfish, spoiled and inconsiderate brats. In fact, the amount of successful diplomats, activists, authors, politicians and entertainers without siblings say otherwise. Here is a list of the top seven misconceptions people often believe about being an only born.
1. Isolation
Often what people associate only children with is being constantly alone all of the time. This unfortunate stereotype is actually the furthest from the truth. Yes, we may not share a bedroom with a sibling but we do share our lives with our dearest loved ones! It's not uncommon for only children to develop a strong bond with their parents as their parents have only one child to direct their attention toward. Having an extended family, cousins, best friends, neighbors and pets all contribute to developing a rich and fulfilling life. There are alternative ways for only children to be exposed to people, and we often make a conscious effort to include ourselves in society. We make just as many friends as those with siblings. Moreover, we even find quirky methods to keep ourselves entertained while being alone, like engaging in sports, taking extracurricular classes, creating artistic crafts, drawing, singing, writing or learning new skills. Just remember, lacking siblings is not always synonymous with lacking social companions.
2. Lack of Social Skills
Many others believe that only children are doomed to be socially awkward. This stereotype has been researched since the 19th century, where having many children was the cultural norm. A study done by scientist E.W. Bohannon in 1896 concluded that sibling-less children were more likely to be "peculiar, ugly, poorly behaved, and stupid." Later, an expert claims that families with only one child were more likely to be dysfunctional both physically and mentally. To debunk this myth, modern research done by professor Falbo has helped to reverse the stereotype by conducting a successful social experiment which proved that single children scored higher for self esteem than their counterparts. They also have a much easier time avoiding peer pressure since this submission often begins with siblings at home.
Additionally, some of the onlyborns I have met have been the most outgoing, social and gregarius individuals that I've ever encountered. They are so full of life because of the innate desire to learn about people different from their own kin! Only children often showcase an incredible ability to fully listen and exibit empathetic qualities while engaging in conversation. This may be because they're exposed to more adult conversation and parental attention which contributes to advanced language skills and knowledge at a younger age. Old souls for the win!
3. Introversion
On the topic of Carl Jung's introversion/extraversion theory, only children aren't confined to only one personality type. The inclination for a person to take on the psychological traits of an extravert or introvert are a matter of environmental circumatance. As Northwestern University student Alissa D. Eischens states, "Ultimately, an only child's environment forces him or her to take on both characteristics of introversion and extraversion despite natural inclinations to be one or the other." For example, a typically reserved and introverted student may wish to make friends and thus expand their extraverted qualities. The reverse is also common, as a typically open and extraverted student may showcase their introverted qualities in order to remain in touch with their own thoughts.
4. Selfishness & Being Spoiled Brats
"You're an only child, you must get everything you ask for, don't you?," is a fairly familiar line many of us sibling-less individuals have probably heard in our youth. Perhaps the most common myth related to being the onlyborn is that we are "all about oursevles." Being labeled as "spoiled" or "attention-seeking" is only due to the century old biases poisoned by personal opinion that I touched on earlier. Our parents are not our personal fairy godmothers waiting to grant our every wish. Just like everyone else in the world, we often have to work for the items we may want. We do not have problems sharing our possessions. Likewise, we are some of the most contented and friendly people due to the absence of "sibling bullying" which has also been proven to contribute to unhappiness. Not to mention, we are aware of our blessings and remain grateful over our situations.
5. Being Controlling
While being raised, people complain that only children are demanding of their parents constant attention and become extremely needy. They say we take them for granted because we know that they will "always be there for us and only us." However, isn't this the general mindset of any naive, learning, growing and developing child? When we reach adulthood they state that we feel entitled to have more than equal standing in relationships and we often assume that we are always right. As kids, adults and everything in between, the human brain hasn't even had a chance to be fully developed yet, and they don't reach full maturity until the age of 25 years old. We all learn something new every day! With that being said, let's collectively learn to be more empathetic. Please, don't blame an only child for being young.
6. Lower Academic Achievement Than Those With Siblings
Sibling-less children should thank their lack of brothers and sisters for their high test scores. Research suggests that only children may perform better academically and may also have higher IQ scores on average – surprisingly, on verbal skills.
7. Lack of Success
Have you ever watched a movie starring Samuel L. Jackson or Betty White? Listened to a song by Elvis, Frank Sinatra or Alicia Keys? Maybe even heard a speech by American diplomat, activist and former First Lady of the United States, Eleanor Roosevelt? These successful indivuduals happen to be only children! Psychologist Carl E. Pickhardt comments that only children are "typically supported by parents to develop themselves, achieve highly and live up to their parents' high investment and expectations." Constantly being around the presence of adults may sharpen social and verbal skills, skills highly valued within the workforce.
A solid quote by Pickhardt states that "Growing up as an 'only' can be very empowering, creating very self-dedicated, strong-willed individuals who push themselves hard to achieve what they want." While this mindset creates strong-willed, hardworking individuals, it can also turn us into perfectionists. It's important to state that only children are not perfect and people with siblings aren't either. Constantly striving to be the best versions of ourselves should be viewed as the ultimate goal.
With family sizes shrinking more and more and one-child households doubling every decade, the days being labeled as the "lonely only" are long gone, folks! Be proud of your upbringing, whatever circumstance it happened to be. | https://www.freshu.io/ciara-freeman/top-7-misconceptions-of-being-an-only-child |
- Fire in the City: Savonarola and the Struggle for Renaissance Florence
In this vivid account of Savonarola's forty-month ascendancy in Florence Lauro Martines has aimed to convey "the factual essentials" provided by Savonarola specialists to a wider readership while adding his "own lines of analysis." He succeeds admirably on both counts. The History Book Club Editor's Choice for April 2006, Fire in the City is both skillful haute vulgarisation and sophisticated historical commentary. Dramatic effect dictates the book's organization and scene selection, but the author's expert knowledge of Florentine government, politics, and society, and a perceptive reading of Savonarola's sermons and writings, as well as of the secondary literature, enrich the enterprise.
That a reinvigorated republicanism found traction in Florence rather than, say, in socially, politically, and culturally frozen Venice or in Savonarola's court-dominated hometown of Ferrara was due in no small part, Martines observes, to the Florentines' long-standing sense of participating in a "public world" (a concept innovatively applied to Florence by the late Marvin Becker). But that the largely upper-class coup d'état of November 1494 morphed into a genuine revolution in December was the result of several factors including the disarray of the ruling group itself (interchangeably and confusingly termed "nobles," "aristocrats," "patricians," and "oligarchs"), the angry reaction from below when it was realized that the cry of popolo e libertà had not been meant to be taken literally, and the charismatic preaching of Savonarola which played to that anger. Martines's remarks on the disruption of upper-class patronage networks are particularly insightful, and his account of the incremental way Savonarola was drawn into the political crisis avoids the hagiographic determinism that has warped the judgment of so many before him. Persuaded by some dissident patricians to endorse a reform plan featuring a Venetian-style Great Council, Savonarola, tentatively at first, then with increasing conviction that it was God's design, incorporated the governo largo into his apocalyptic vision. Florence was God's chosen city. By doing penance and reforming itself politically as well as morally the Florentines would survive the coming tribulations to become "more glorious, richer, more powerful than ever," the model and center from which would radiate the new piety. The New Cyrus from France would scourge the Church to begin its renewal, then go East to conquer the Infidel. There, zealous new Christians would battle the Antichrist and win a great victory, thus preparing the way for the Second Coming and the millennium.
That so many Florentines accepted the friar's drastic scenario, believed his graphic accounts of his visions, and did their best to conform to his severely ascetic standards, demonstrates the power of Christian belief, even in this most Renaissance of cities. Despite appalling abuse by Rome and the clerical hierarchy and notwithstanding the (much-exaggerated) influence of the classical Renaissance, religion continued to be a major force in most people's lives and a normative [End Page 1183] source of ideas about such vital matters as saints, miracles, morals, patriotism, and eschatology. Besides, Florentines who had long promoted the idea that theirs was a city of destiny did not have too much difficulty accepting that it was to be a New Jerusalem. As Martines puts it in one lapidary sentence: "Florence's encounter with Savonarola was a meeting with much of its own soul."
Positioning Savonarola in historical context is Martines's primary methodological guideline and in following it he covers a rich variety of subjects, including fifteenth-century preaching, Savonarola's philosophical and theological culture, Borgia Rome, Renaissance Florence, and the vicious diplomatic game played by Italian rulers. But he also declares that "the drama of Savonarola's years in Florence transcends its time and place, because it links high politics and religious activity in a time of epochal crisis." Readers may see in this an allusion to the current world situation. If so, they will also find relevant... | https://muse.jhu.edu/article/234277/pdf |
BACKGROUND
SUMMARY
DETAILED DESCRIPTION
One will note that this requires no multiplication over the finite field GF(2), and the addition is simply the XOR (eXclusive OR). Therefore, the computation is very efficient on computers.
Data transmission is the conveyance of any kind of information from one space to another. Inherent with data transmission is the possibility that information may become corrupted once the information is transmitted. Encoding/decoding methods have been developed to detect and correct corrupted data in digital data streams or signals. The encoding method encodes the information to form encoded data. The encoded data is then transmitted over some channel. The decoding method receives the encoded data and decodes the encoded data. In order to accurately decode the encoded data, the decoding method must have the ability to detect and correct errors in the encoded data.
Unfortunately, decoding methods that detect and correct errors are typically quite complex and depend on the type of encoding method that is used to originally encode the information. Therefore, these complex decoding methods are not efficient when implemented on computing devices with limited memory and/or processing capabilities. In addition, for each type of encoded data that the computing device receives, a separate decoding method is needed.
The present decoding technique provides a universal decoding method that is capable of decoding encoded data from multiple different linear block encoders. When an error in a code sequence is detected, the decoding technique estimates a confidence for each bit within the code sequence. Based on the confidence, a subset of bits within the code sequence is obtained. The subset of bits is then incrementally flipped to determine a corrected codeword which can be used to obtain information.
This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.
The following description is directed at a decoding technique capable of decoding encoded data from different types of encoders. The decoding technique handles linear block codes that contain a manageable set of error bits. The size for the manageable set of error bits may be dependent on the capabilities of the computing device on which the present decoding technique is executed. These and other aspects of the present decoding technique are now described in detail.
FIG. 1
FIG. 1
100
100
100
102
104
104
104
106
108
110
108
140
106
112
is an illustrative system that may be used to implement the decoding technique described herein. The system includes a computing device, such as computing device . Computing device represents any type of computing device such as a personal computer, a laptop, a server, a game console, a handheld or mobile device (e.g., a cellular phone, digital assistant, cellular camera phone), and the like. In a very basic configuration, computing device typically includes at least one processing unit and system memory . Depending on the exact configuration and type of computing device, system memory may be volatile (such as RAM), non-volatile (such as ROM, flash memory, etc.) or some combination of the two. System memory typically includes an operating system , one or more program modules , and may include program data . For the present decoding technique, the program modules may include one or more components for implementing the decoding technique. Alternatively, the operating system may include one or more components for implementing the decoding technique. This basic configuration is illustrated in by those components within dashed line .
100
100
120
122
104
120
122
100
100
FIG. 1
Computing device may have additional features or functionality. For example, computing device may also include additional data storage devices (removable and/or non-removable) such as, for example, magnetic disks, optical disks, or tape. Such additional storage is illustrated in by removable storage and non-removable storage . Computer storage media may include volatile and nonvolatile, removable and non-removable media implemented in any method or technology for storage of information, such as computer readable instructions, data structures, program modules, or other data. System memory , removable storage and non-removable storage are all examples of computer storage media. Thus, computer storage media is accessible by the computing device and includes, but is not limited to, RAM, ROM, EEPROM, flash memory or other memory technology, CD-ROM, digital versatile disks (DVD) or other optical storage, magnetic cassettes, magnetic tape, magnetic disk storage or other magnetic storage devices, or any other medium which can be used to store the desired information. Any such computer storage media may be part of device .
100
124
100
100
126
Computing device may also have input device(s) such as keyboard, mouse, pen, voice input device, touch input device, etc. For example, computing device may include a data capture device as an input device. The data capture device may be a digital/electronic still camera, a video camera, a film/photographic scanner, or the like. The data capture device may be configured to capture a single or a sequence of images. The images captured by the data capture device may then be stored as image data within computing device via an appropriate interface, such as USB, IEEE 1394, BLUETOOTH, or the like. Output device(s) such as a display, speakers, printer, etc. may also be included. These devices are well known in the art and are not discussed at length here.
100
128
130
128
Computing device may also contain communication connections that allow the device to communicate with other computing devices , such as over a network. Communication connection(s) is one example of communication media. Communication media may typically be embodied by computer readable instructions, data structures, program modules, or other data in a modulated data signal, such as a carrier wave or other transport mechanism, and includes any information delivery media. The term “modulated data signal” means a signal that has one or more of its characteristics set or changed in such a manner as to encode information in the signal. By way of example, and not limitation, communication media includes wired media such as a wired network or direct-wired connection, and wireless media such as acoustic, RF, infrared and other wireless media. Computer readable media can be any available media that can be accessed by a computer. By way of example, and not limitation, computer readable media may comprise “computer storage media” and “communications media.”
Various modules and techniques may be described herein in the general context of computer-executable instructions, such as program modules, executed by one or more computers or other devices. Generally, program modules include routines, programs, objects, components, data structures, etc. for performing particular tasks or implement particular abstract data types. These program modules and the like may be executed as native code or may be downloaded and executed, such as in a virtual machine or other just-in-time compilation execution environment. Typically, the functionality of the program modules may be combined or distributed as desired in various embodiments. An implementation of these modules and techniques may be stored on or transmitted across some form of computer readable media.
FIG. 2
202
212
204
202
210
202
is a block diagram illustrating an encoder transmitting encoded data to a universal decoder that is configured in accordance with the present decoding technique. As mentioned above, encoder may implement one of the various encoding methods on data (e.g., information) that is supplied. For the present application, the encoder implements a linear block code encoding method.
In overview, a linear block code refers to a code in which there are two finite sets: a source alphabet and a code alphabet. The source alphabet may have any number of elements. For example, a binary source alphabet has two elements, such as zero and one. The code alphabet is then unique groupings of a number n of these elements (e.g., 01100011). Each linear block code can be represented as [n,k,d] or simply [n,k], where n is the code length, k is the number of information bits within a codeword, and d is the least Hamming distance between two codewords. Thus, each codeword is n bits in length, contains k bits of information, and differs from another codeword by at least d bits. Extra n−k bits within each codeword are commonly referred to as parity bits and provide error detection and correction ability.
n
k
n
k
Given that each block is the same n bits in length, there are Apossible combinations of the elements of the source alphabet A. In other words, each bit within the block can be any one of the elements within the source alphabet. However, because the amount of information in each block is k bits, there are Avalid codewords. The remaining permutations (A−A) represent invalid codewords. The term “code sequence” is used throughout this discussion to refer to both valid codewords and invalid codewords. If a receiver receives an invalid codeword, the receiver attempts to correct the code sequence into the most likely valid codeword. The most likely valid codeword is the codeword in which the minimum number of bits needs to be modified in order for the invalid code sequence to become a valid codeword.
Because each linear block code may be represented as a k-dimensional subspace of an n-dimensional space, vectors are used to simplify the representation for the codewords. Thus, a vector (i.e., vector c) represents the subspace for the valid codewords of a linear block code. Each codeword is then an element from the set of all the vectors c. As is known to those skilled in the art, each linear block code may be completely defined by a corresponding generator matrix G. The generator matrix G defines the length of each codeword n, the number of information bits k in each codeword, and the type of redundancy that is added for error handling. The generator matrix G is a n×k matrix.
The generator matrix G is multiplied by the k information bits to obtain the corresponding n bit codeword. The generator matrix G may be defined in a manner such that the information bits within the codeword appear in a pre-defined position (e.g., the last bits) within the n bit codeword. This type of resulting code is referred to as a systematic code. Thus, for systematic codes, the information bits are passed into the codeword unchanged and parity bits are added. Alternatively, the generator matrix G may produce a codeword where the information bits are not directly represented within the code. This is called a nonsystematic code. One advantage of systematic codes is that the encoder only needs to produce (n−k) bits instead of having to produce the entire codeword.
FIG. 2
FIG. 3
212
202
204
204
204
Returning to , the encoded data represents the code sequences after the codewords have been transmitted from the encoder . As mentioned above, some of these code sequences may be valid codewords and other may have become corrupted during transmission. The code sequences are input into decoder . In contrast with traditional decoders, decoder can decode the code sequences encoded from different types of encoders. Briefly, universal decoder , described in detail in conjunction with , performs error correction on code sequences that are invalid codewords based on a confidence that is determined for each bit in the code sequence.
FIG. 3
FIG. 2
300
300
300
300
302
300
304
is a flow diagram illustrating an exemplary decoding process suitable for use in the universal decoder shown in . For each linear block encoding process supported by decoding process , a corresponding generation matrix G and parity check matrix H is made available to decoding process . In addition, the type of encoding that was performed to generate the code sequence is made available to the decoding process . For example, the type of encoding may be recognized based on a file extension of the encoded bit stream. Process begins at block where a code sequence within the encoded bit stream is received. As mentioned above, the code sequence may or may not have errors. Process is performed for each code sequence within the encoded bit stream. Processing continues at block .
304
314
306
T
At block , a syndrome h for the code sequence is computed and saved. The syndrome h is computed using conventional methods by multiplying the transpose parity check matrix Hby the received code sequence c. The computed syndrome h is then saved so that, if necessary, it may be used in the processing performed in block . Processing continues at decision block .
306
304
308
310
At decision block , a determination is made whether the code sequence contains an error. This determination is based on the syndrome calculated in block . If the received code sequence is a valid codeword, the syndrome is zero and processing continues at block . If the syndrome is not zero, processing continues at block . In another embodiment, the valid codewords may be available in a look-up table based on the type of encoding method that was used. For this embodiment, an invalid codeword is determined if the code sequence is not located within the look-up table.
308
310
316
1
2
k
1
2
k
−1
At block , information bits are obtained from the code sequence. An arbitrary k linearly independent rows (e.g., m, M, . . . , m-th rows) of the generation matrix G are selected to form a square non-degenerative sub-matrix {tilde over (G)}. Using conventional techniques, the square non-degenerative sub-matrix {tilde over (G)} is then used in solving for the information bits r using r={tilde over (G)}{tilde over (c)}, where {tilde over (c)} is the sub-vector of c by selecting the m, m, . . . , m-th bits of c. The processing for that code sequence is then complete. The present decoding technique, however, provides a technique for handling non-valid code sequences for different types of linear block encoded data that is not as complex and computationally expensive as decoding techniques specific to an encoding technique. The present decoding technique has obtained successful results for when the number of error bits is small. This technique is now described in conjunction with blocks -.
310
0
1
1
0
312
At block , a confidence for each bit within the code sequence is estimated. The estimation of the confidence of each bit is based on a source from where the information bits derived. For example, estimating the confidence of the bit may be based on measuring an intensity of a pixel if the source is an image, a voltage if the source is an electrical signal, or the like. A higher confidence correlates to a higher probability that the bit is correct. For example, assuming the example source is an image where a prefect bit is represented by a white dot and a perfect bit is represented by a black dot. The darker the measurement of the pixel, the higher the confidence that the bit actually represents a 1. Similarly, assuming the example source is an electrical signal where a prefect bit is represented with a one volt voltage and a perfect bit is represented by a zero volt voltage. Then, the higher the voltage, the higher the probability that the bit actually is a value of 1. Conversely, the lower the voltage, the higher the probability that the bit is 0. Once the confidence level of each bit is estimated, processing continues at block .
312
314
At block , a subset c′ of the bits having the least confidence is determined. The subset may be any size and may depend on the computational resources available on the computing device performing the decoding process. For one embodiment, the number of bits in the subset c′ may be set equal to 12. In another embodiment, the size of the subset may be based on the code's ability of correcting error bits, namely its Hamming distance d. For this embodiment, the size of the subset may equal one plus the Hamming distance d divided by 2 (i.e., (1+d)/2)). However, other values for the subset size may be determined based on the computational resources available on the computing device and on the accuracy of the encoded data. Processing continues at block .
314
316
FIG. 4
At block , a “corrected” codeword is determined for the code sequence. The “corrected” codeword may be the same as the original codeword or may be slightly different. Briefly, determining the corrected codeword, described later in detail in conjunction with , incrementally flips the bits within the subset c′ and then determines the “corrected” codeword based on which valid result required the least number of flipped bits. Once the “corrected” codeword is determined, processing continues at block .
316
308
300
At block , information is obtained from the corrected codeword. The information is obtained using the same technique as described above in block . However, instead of using the code sequence, the corrected codeword is used. The decoding process is then complete.
FIG. 4
FIG. 3
400
400
is a flow diagram illustrating one embodiment for determining the corrected codeword which is suitable for use within the flow diagram of . In overview, process provides an efficient method for determining the most likely corrected codeword by incrementally flipping bits. Before describing process , the concept underlying the incremental flipping of bits is first described.
T
T
(i|1)
i
In overview, at a receiver, a decoder may check whether a received code sequence belongs to the code by using a parity check matrix H. As described above, multiplying the transposed parity check matrix Hby the received code sequence c yields a syndrome h (i.e., h=Hc). If the syndrome h is equal to zero, the received code sequence c is a valid codeword. The inventors discovered that the next syndrome (i.e., h) can be computed efficiently from the current syndrome (i.e., h), where the superscripts i and (i+1) indicate the i-th and (i+1)-th choices of bits that are flipped within the subset c′.
1
2
t
j
j
j
j
j
j
1
q
i
i+1
i
i
1
2
t
i+1
i+1
1
2
t
i
i+1
i,i+1
1
2
q
c
c
t
(i)
(i)
(i)
(i+1)
(i+1)
(i+1)
FIG. 5
500
To further describe this concept, the choice of which bits are flipped within the subset c′ having t bits may be denoted in vector notation as f=(α, α, . . . α). Each bit that can be flipped, α, is an element of a finite field, such as GF(q) where q represents the number of elements in the finite field. Thus, the n-th bit of c (i.e., n) is changed by α, where j=1,2, . . . , t and n represents the code length of the code sequence c. Note that if α=0, this means that nis not flipped (i.e., changed). Because each of the bits within the subset c′ having t bits can be flipped to one of the elements of the finite field, there are a possible qarrangements for vector f. These possible arrangements for vector f may take the form of a sequence f, . . . , f, where fand fonly differ by one bit. The sequence fmay be represented as f=(α, α, . . . α) and the sequence fmay be represented as f=(α, α, . . . α). The difference between fand fmay then be represented symbolically as f. is a flow diagram illustrating an exemplary process for incrementally flipping bits where the finite field GF(q) has elements β, β, . . . β. Each consecutive vector (i.e., modified code sequence) differs by one bit.
(i+1)
For notational brevity, without any loss of generality, the subset c′ having t bits may be assumed to have the t bits positioned as the last t bits in the received code sequence c. Then the next syndrome hcan be derived as follows:
h
=H
{tilde over (c)}
(i+1)
T
(i+1)
(1)
h
=H
{tilde over (c)}
{tilde over (f)}
{tilde over (f)}
(i+1)
T
(i)
i+1
i
(+()) (2)
h
=h
+H
e
(i+1)
(i)
T
(i+1)
(i)
f
i,i+1
f
i,i+1
(n−k)+f
i, i+1
(α−α) (3)
h
=h
H
(i+1)
(i)
(i+1)
(i)
Y
T
f
i,i+1
f
i,i+1
(n−k)
i,i+1
+(α−α)+f. (4)
(i+1)
(i)
(j)
(j)
(j)
i+1
i
j
1
2
t
For the following discussion, the vector {tilde over (c)} denotes a modified code sequence from the originally received code sequence c. In addition, the vector {tilde over (f)} represents the change vector for the entire modified code sequence in contrast with vector f that represents the change vector for only the bits within the subset c′. The first equation is the definition for a syndrome. The second equation illustrates that the (i+1) modified code sequence (i.e., {tilde over (c)}) is equal to the i-th modified code sequence (i.e., {tilde over (c)}) plus the difference between the (i+1)-th and the i-th change vector {tilde over (f)} (i.e. {tilde over (f)}−{tilde over (f)}). For example, change vector {tilde over (f)} may be represented as follows: {tilde over (f)}=(0,0,Λ,0,α,α,Λ,α). One will note that because the t least confident bits are positioned as the last t bits in this example, the first bits in the change vector {tilde over (f)} have a value of 0 which represents that they do not undergo any change with respect to the originally received code sequence c.
T
T
(i)
(i+1)
(i)
i+1
i
f
i,i+1
f
i,i+1
s
s
The third equation illustrates that multiplying the transposed parity check matrix Hby the current modified code sequence yields a syndrome h (i.e., h=H{tilde over (c)}). In addition, the difference between the change vectors {tilde over (f)}−{tilde over (f)}may be represented as the difference in the one bit that was flipped (i.e., α−α) and vector ewhose entries are all 0's except the s-th entry which is a 1. One will note that the index s for vector eis determined by taking the code length n subtracting the message bits k and adding the bit position associated with the bit that was flipped.
s
T
T
(i+1)
T
(i+1)
(i+1)
(i+1)
(i+1)
(i+1)
(i+1)
(i+1)
The fourth equation illustrates that the vector emultiplied by the transposed parity check matrix Hyields the s-th column of matrix H(i.e., the s-th row of matrix H). The last term in equation 4 represents as an update vector. Thus, the next syndrome can be updated from the current syndrome by adding the update vector. This requires one scalar-vector multiplication and one vector-vector addition. In comparison, if the next syndrome is not computed incrementally, but rather computed from using the next code sequence directly (i.e., h=H{tilde over (c)}), then {tilde over (m)}scalar-vector multiplication and ñ−1 vector-vector additions are required, where {tilde over (m)}is the number of entries of {tilde over (c)}that are neither 0 nor 1, and ñis the number of non-zero entries of {tilde over (c)}. Therefore, the present bit flipping technique is much more efficient than a brute-force approach.
As a special case, the above decoding process is particularly efficient when the source alphabet has two elements (i.e., q=2). In this case, the code is binary. The next syndrome may then be calculated as follows:
h
=h
+H
(i+1)
(i)
T
(n−k)+f
i,i+1
. (5)
400
400
402
404
FIG. 4
FIG. 5
Given the above explanation, process illustrated in is now described. Process begins at block where modified code sequences are obtained by incrementally flipping one of the bits within the subset. As described above, any one of the bits may be flipped to create a new modified code sequence. Typically, it is advantageous to flip one of the bits within the subset c′ in a systematic manner until all of the bits have been flipped, such as illustrated in . One will note that “flipping” refers to changing one of the bits to one of the elements in the source alphabet. Therefore, flipping does not limit the number of changes of a bit to two, but rather is limited by the number of elements q within the source alphabet. Processing continues at block .
404
402
406
At block , one of the modified code sequences generated in block is selected. Processing continues at block .
406
304
408
406
406
408
410
At block , a syndrome for the modified code sequence is computed using equation (4) or (2) described above, depending on the number of elements within the source alphabet. Thus, as described, the syndrome for the modified code sequence is computed based on the previous syndrome and an update vector. One will note that for the first pass, the syndrome computed in block is used as the previous syndrome. Thereafter, the syndrome is saved at block and used in the computation of block . Processing proceeds from block to block and then to block decision block .
410
412
412
414
At decision block , a determination is made whether the modified code sequence is valid. Again, this determination is based on the computed syndrome. If the syndrome is a value of zero, this indicates that the modified code sequence is valid and processing continues at block . At block , the modified code sequence is saved. Processing continues at decision block same as if the modified code sequence was not valid.
414
404
416
At decision block , a determination is made whether another modified code sequence is available. If there is another modified code sequence, processing loops back to block and continues as described above. However, once all the modified code sequences for the code sequence have been checked, processing continues at block .
416
FIG. 3
At block , a corrected codeword is identified from the saved modified code sequences. The corrected codeword is determined to be the modified code sequence with the fewest number of bits changed from the originally received code sequence. If two or more modified sequences have the same number of bits that were changed, other criteria may be used to determine the corrected codeword, such as the distance between the changed bits or the like. Once the corrected codeword is determined, processing returns to .
FIG. 5
FIG. 4
FIG. 5
500
502
illustrates an exemplary incremental bit flipping technique suitable for use in the flow diagram shown in . For convenience, process assumes that the subset of bits which are to be incrementally flipped occur sequentially. Therefore, the additional logic that identifies which bits within the code sequence are within the subset is not included in . However, one skilled in the art can easily add the necessary logic so that the bits within the subset are located anywhere within the code sequence and do not necessarily need to be sequential bits. In addition, for further convenience, an example sequence is described where the number n of elements in the subset equals 3 and the number q of elements within the finite set is 2 (e.g., 0 and 1). Processing begins at block .
502
504
506
1,1
At block , a sequence of length n is initialized with elements from a finite field. For example, sequence Smay be initialized to {(0,0,0)}. Processing continues at block where index i and r are both initialized to a value of 1. Processing continues at block .
506
508
S
S
1,1
1,1
1,1
i−1
At block , a subsequence is obtained by copying entries from the prior sequence S. The number of entries that are copied is based on the number of elements q and on index i, such that qentries are copied. For our example, this yields ={(0,0,0)}. Processing continues at block .
508
510
At block , the order of the modified code sequences within the subsequence are reversed. Because there is currently one modified code sequence in the subsequence, reversing the subsequence does not affect the subsequence at this time. Processing continues at block .
510
512
S
1,1
At block , the i-th bit of entries in the subsequence are incremented to the next element in the finite field. Continuing with our example, the finite field has two elements: 0 and 1. Thus, this yields ={(1,0,0)}. Processing continues at block .
512
514
516
1,1
1,1
S
At block , the subsequence and prior sequence are concatenated to obtain a new sequence. Continuing with our example, S⊕ ={(0,0,0),(1,0,0)}, which becomes the new sequence. Here ⊕ represents the concatenation operation. Processing continues at block where index r is incremented and then to decision block .
516
506
514
518
At decision block , a determination is made whether index r equals q+1. In other words, blocks - are performed so that each location in the sequence may be “flipped” to one of the elements in the finite set. Because the number of elements in our example finite set equals 2, processing continues at decision block instead.
518
506
514
524
520
522
506
516
At decision block , a determination is made whether index i equals n. When this is true, this means that blocks - have been performed for each location within the sequence. Processing continues at block . However, until each location within the sequence has been flipped, processing continues to block where index i is incremented and to block where index r is set back to 1. Processing then continues through blocks - as described above.
524
400
500
500
FIG. 4
(0,0,0),(1,0,0),(2,0,0),(2,1,0),(1,1,0),(0,1,0),(0,2,0),(1,2,0),(2,2,0), (2,2,1),(1,2,1),(0,2,1),(0,1,1),(1,1,1),(2,1,1),(2,0,1),(1,0,1),(0,0,1), (0,0,2),(1,0,2),(2,0,2),(2,1,2),(1,1,2),(0,1,2),(0,2,2),(1,2,2),(2,2,2).
Once each location with the sequence has been incrementally flipped with each of the elements in the finite field, the resulting sequence represents an output sequence that contains the modified code sequences (block ). Each of these modified code sequences is then analyzed to determine the “correct” modified code sequence in accordance with process shown in . Continuing with our example, process yields {(0,0,0),(1,0,0),(1,1,0),(0,1,0),(0,1,1),(1,1,1),(1,0,1),(0,0,1)} for the output sequence. When q=3 and n=3, process yields the following output sequence:
The above described decoding process may be implemented in several different types of computing devices and for several different types of applications. It is envisioned that the above decoding process may be implemented within a camera phone that captures a 2D bar code. The camera phone can use the above described decoding method to decode the embedded information within the 2D bar code and/or look up additional information via a network. The 2D bar code may be an identification code, such as for identifying audios and videos.
While example embodiments and applications have been illustrated and described, it is to be understood that the invention is not limited to the precise configurations and resources described above. Various modifications, changes, and variations apparent to those skilled in the art may be made in the arrangement, operation, and details of the disclosed embodiments herein without departing from the scope of the claimed invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Non-limiting and non-exhaustive embodiments are described with reference to the following figures, wherein like reference numerals refer to like parts throughout the various views unless otherwise specified. For convenience, the left-most digit of a component reference number identifies the particular Figure in which the component first appears.
FIG. 1
is an illustrative computing device that may be used to implement the universal decoding technique described herein.
FIG. 2
FIG. 1
is a block diagram illustrating an encoder transmitting encoded data to a universal decoder configured to decode the encoded data using the present decoding process, the universal decoder being implemented within the computing device shown in .
FIG. 3
FIG. 2
is a flow diagram illustrating an exemplary decoding process suitable for use in the universal decoder shown in .
FIG. 4
FIG. 3
is a flow diagram illustrating an exemplary process for determining a corrected codeword suitable for use in the flow diagram shown in .
FIG. 5
FIG. 4
illustrates an exemplary incremental bit flipping technique suitable for use in the flow diagram shown in . | |
BACKGROUND
SUMMARY OF THE INVENTION
BRIEF DESCRIPTION OF THE DRAWINGS
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention relates to the art of twisting ball electric-paper displays. It finds particular application in conjunction with fabrication of polarized small balls for use in an electric-paper display sheet.
An electric paper display device, also known as gyricon-based electric paper display, is typically in sheet form as described in U.S. Pat. Nos. 4,126,854 and 4,143,103 assigned to the present assigpee and which are fully incorporated herein by reference. The electric paper display comprises a thin transparent sheet having many of the attributes of paper documents. It looks like paper, has ambient light valve behavior like paper (i.e. the brighter the ambient light, the more easily it may he seen), flexible like paper, can be carried around like paper, can be written on like paper, can be copied like paper, and has nearly the archival memory paper. It is also possible to form the display device as a rigid structure incorporating a array of addressing electrodes. In both embodiments, the salient features are a elastomeric host layer a few mils thick which is heavily loaded with bichromal balls tens of microns in diameter. Each bichromal ball has hemispheres of contrasting colors, such as a white half and a black half, and is contained in its own spherical cavity filled with a dielectric liquid. Upon application of an electrical field between electrodes located on opposite surfaces of the host layer, the balls will rotate according to the interaction of their dipole and depending on the polarity of the electric field generated, presenting one or the other hemisphere to an observer.
In a previous method for fabricating bichromal balls as shown in U.S. Pat. No. 5,344,594 assigned to the present assignee, monochromatic glass balls are formed and heavily loaded with titanium dioxide so as to appear white. The balls are deposited in a monolayer upon a substrate. Then the surface of each ball is coated from one direction in a vacuum evaporation chamber with a dense layer of nonconductive black material which coats one hemisphere. The bichromal balls are mounted in liquid filled cavities ad suspended in a host matrix. Both the liquid surrounding the balls and the balls themselves are dielectric. Therefore, although the balls are macroscopically electrically neutral, on a microscopic scale they have an electrical double layer comprising two layers of charges of opposite sign. One charge layer is localized at the surface of the ball and the other charge layer is in the nature of a space charge extending outward from the surface of the ball into the dielectric liquid.
A measurable aspect of the electrical double layer, known as the zeta potential, is the net surface and volume charge that lies within a shear surface associated with the motion of the ball through the dielectric liquid. For a given liquid, the zeta potential is a function only of the ball surface material. Thus, the material properties which give rise to differences associated with the color or reflectivity of each hemisphere of a ball gives rise to different characteristic zeta potentials with respect to the dielectric liquid in the cavity containing a ball. It is the difference in zeta potential between the hemispheres of the ball which causes the ball to act like a dipole in the presence of an electrical field generated by oppositely disposed electrodes. In other words, each ball will rotate until its dipole moment lines up with the direction of the electrical field established between the opposed electrodes.
In addition to the dipole charge distribution found on the bichromal ball in the presence of an electrical field, there is also a monopole charge with the net electrical charge. It is quite unlikely that the two hemispheres of a ball having zeta potentials of opposite polarity will have the same magnitude. However, if that is the case, a monopole charge will not be established. As a result of the monopole charge, a ball is caused to translate in the direction of the electrical field and will rest and be retained against the cavity wall. In order for the ball to rotate easily in the liquid within the cavity, due to the dipole charge, it must move from contact with the cavity wall. When at rest against the cavity wall, friction and other forces will prevent it from rotating until it has been moved away once again, due to the monopole charge. It is this feature which enables long term image retention in this display device.
Other methods of fabricating bichromal balls are described in U.S. Patent Nos. 5,262,098 and 5,344,594 assigned to the present assignee. In the '098 patent, a spinning disc method is described. In the '594 patent, balls are formed by the flowing together of two side-by-side streams of differently colored hardenable liquids into the center of a laminarly flowing host liquid. As the bichromal stream is transported by the host liquid as a free jet, its forward end becomes unstable and breaks up into droplets which form into spherical balls as they are moved by the host liquid. Further transport of the balls by the host liquid moves them past a curing station and a separating station.
The prior art methods of fabricating bichromal balls for an electric paper display involve a chemical process which adds a chemical charge to the surface of each ball by applying differently charged dyes or pigments to the ball hemispheres. The hemispherically-differential surface chemistry, thus, creates a dipolar ball which will align in an external electric field. Each half of a ball is made with differentiating pigment and/or constituent materials, which charge to different degrees in the fluid in which the balls rotate. Alternately, a hemispherical coating is applied to one hemisphere of a monochromal ball to differentiate its surface charge characteristics from the uncoated hemisphere. The chemical surface charging of bichromal balls suffers from being susceptible to neutralization by triboelectricity or the presence of impurity ions adjacent to and/or mixed within the charged surface coating.
The present invention contemplates a new and improved method of fabricating twisting balls for electric-paper displays which overcomes the above-referenced problems and others.
A new and improved method of forming multichromal balls for a electric paper display is provided. A plurality of balls are formed from a core material and each ball is encapsulated in a shell. The core material of each of the plurality of balls are transformed into a dipole electret having a first charged pole and a second charged pole where the first charged pole is different from the second charged pole. Each of the plurality of balls are colored forming multichromal balls such that the first charged pole of each ball is distinct from the second charged pole.
In accordance with a more limited aspect of the present invention, the plurality of balls are adhered to a substrate and heated to a fluid state. Two electrodes are provided for generating a electric field therebetween. The substrate and the plurality of balls are positioned between the two electrodes and the plurality of balls are polarized by the electric field. The plurality of balls are then cooled to a solid state in the presence of the electric field.
In accordance with another aspect of the present invention, a method of forming an electric paper video display is provided. Once the multichromal balls are formed with a first charged pole and a second charged pole, the video display is fabricated by encapsulating the multichromal balk in an array such that each multichromal ball is capable of rotating to display a colorant in response to a electric field selectively applied thereto.
One advantage of the present invention is that by polarizing the core of each ball, a more stable dipole is created than with chemically charged balls.
Still further advantages of the present invention will become apparent to those of ordinary skill in the art upon reading and understanding the following detailed description of the preferred embodiments.
FIGURE 1 is an illustration is a plurality of twisting balls being polarized between two electrodes in accordance with the present invention;
FIGURE 2 is a illustration of the plurality of balls having a colorant applied thereto;
FIGURE 3 is a perspective view of an electric paper display formed with the balls of the present invention;
FIGURE 4 is an illustration of an alternative embodiment of the present invention showing an initial position of monochromal balls in a electric field; and
FIGURE 5 illustrates the balls of FIGURE 4 being poled and hemispherically colored in accordance with the present invention.
The invention may take form in various components and arrangements of components, and in various steps and arrangements of steps. The drawings are only for purposes of illustrating a preferred embodiment and are not to be construed as limiting the invention.
10
10
With reference to FIGURE 1, small balls , typically 0.05 to 0.5 millimeters in diameter, are formed by any process which atomizes a selected fluid into droplets as described, for example, in U.S. Patent No. 5,262,098 assigned to the present assignee. The balls are formed as monochromal balls which are subsequently colored or, alternately, are formed as bichromal balls during the forming process. A polarizable material is used to form a core of the balls such as a polymer or wax. In the preferred embodiment, a polyethylene based wax material is used.
10
12
10
10
12
Once a set of balls are formed, each ball is encapsulated in a protective cover or shell to maintain its generally circular shape. The shell material is selected such that it can be applied as a thin coating around each ball . Alternately, the shell is formed as a sheet which continuously and collectively encloses a plurality of balls . Furthermore, as will be described below, each ball will be heated to a molten state, and since waxes and polymers expand when heated, the shell material further serves to contain the melted core of wax or polymer. Typically, wax expands greater than 10% when melted creating a significant stress on the shell coating . Therefore, the shell material is selected such that it is thick enough to avoid pinholes, but thin enough to remain elastic. Using a less-crystalline wax material as the ball core would reduce the melt-expansion characteristics of each ball and thereby reduce the possibility of shell rupture.
10
10
10
14
16
14
16
10
In order to function as a twisting ball in a electric paper display, portions of each ball are charged such that each ball reacts (eg. aligns) in the presence of an electric field. To obtain the desired charged properties, each encapsulated ball is polarized to transform each ball into a dipole electret. This is obtained by disposing the encapsulated balls between two electrodes, namely, a top electrode which is positive and a bottom electrode . The electrodes and generate an electric field between each other. Since the conductivity of wax or polymer media used to form the core of each ball is significantly higher in a molten state than when in a solid state, the balls are heated as the electrodes generate a sufficiently high electric field. The molten state of the core causes ions of the core material to become mobile and the electric field causes the mobile ions to migrate or drift toward a oppositely charged electrode. Bach ball is, thus, transformed into a dipole having a substantially positive hemisphere and a negative hemisphere. Alternately, in a non-net neutral ball or net monopole ball, each ball may have a similar charge on both hemispheres except that one hemisphere may have a sufficiently higher charge than the other hemisphere thereby distinguishing the two hemispheres.
10
Afier the balls are exposed to the electric field for a selected time period to achieve a desired polarization, the core of the balls are cooled to a solid state. In the solid state, the rate of decay of the polarization of each ball is significantly decreased such that each ball maintains its dipole properties for long periods of time, even after the electric field is removed.
10
10
18
14
16
18
20a
10
10
20b
With reference to FIGURE 2, once the balls are polarized into dipoles, they are aligned with hemispherical colorant, that is, the pole and coloration are correlated. In one embodiment, an array of balls are fixed to a substrate and polarized the between two electrodes and as described above. The substrate and polarized balls are then transferred to a coloring device for deposition of a colorant to the "top" of the polarized balls . For example, if the top of the balls are poled negative and a black colorant is applied to the top of each ball, bictromal balls are produced which are bipolar having black side negative.
18
10
22
14
16
Alternately, during the polarization step, the substrate and attached balls are surrounded by an insulating medium such as a dielectric fluid to prevent air breakdown. Air breakdown occurs when a high electric field generated by the two electrodes and ionizes the airfield therebetween to a point where arcing occurs. Arcing is undesirable because it can damage the balls and/or the electrodes and introduce uncontrolled ion charge.
30
10
32
32
34
10
36
34
10
32
38
40
50
38
32
52
40
32
50
60
32
10
30
10
With reference to Figure 3, an electric paper display sheet (not to scale) is fabricated by encapsulating an array of the bipolar bichromal balls in a panel made from an elastomer or other suitable material such that each ball is capable of rotating in response to a selectively applied electric field but without having translational movement. The panel is provided with cavities which each contain one ball and have a diameter slightly larger than a diameter of the contained ball . Alternately, in less confined cavities or grids having one or more balls per cavity, translational movement may be possible. An optically transparent fluid fills each cavity such that each ball is allowed rotational movement. The panel is disposed between substrates and . A first grid of electrical conductors is disposed between the substrate and the panel which a second grid of electrical conductors is disposed between the substrate and the panel . The second grid of electrical conductors is preferably disposed at an angle to the first grid , for example, orthogonal. A power source is coupled across the electrical conductors to generate an electric field in selected regions of the panel which causes one or more balls in that region to rotate in accordance to its charged dipole. The display sheet includes optically transparent material such that the encapsulated balls are visible to an observer.
10
10
70
14
72
74
With reference to FIGURES 4 and 5, an alternate process for aligning the colorant with the dipole of a ball is to electrophoretically move the colorant or pigment with the mobile charge of the core material. The balls are initially gray or some other mixture of white and a colorant. For example, one colorant is a neutral dye and the other an electrophoretically-charged pigment. As an electric field is applied to the balls during the polarization process, the ions within the core material begin to migrate to the attracting electrode. Since the applied pigment is also charged, it also migrates to one hemisphere as shown in FIGURE 5, where a white pigment is positively charged and thus, migrates to the opposite hemisphere away from the positive top electrode . This results in a dipole bichromal ball having a negative counterion at a top pole which is colored with a black dye .
10
Another alternative process for aligning the colorant with the dipole is to use a metastable pigment dispersion which will "settle" in combination with an immobile dye and mobile ions. After a pigmented dye is applied, it settles to form one colored hemisphere as shown in Figure 5, and an electric field subsequently creates a dipole of the mobile charge. The dye, however, remains dispersed to color the opposite hemisphere. Thus, one side of each ball is pigmented by settling or centrifugation and an electric field produces a dipole without disturbing the pigment. The steps in this process include fabrication of mixed-chromal balls (e.g., immobile dye and pigment, and mobile ions) by spinning disk or other device, encapsulating each ball with a suitable shell material, disposing each ball layer between electrodes with an optional dielectric fluid to prevent air breakdown, heating the ball assembly above the melting point of the ball core material, centrifuging to settle the pigment, applying a DC electric field for a sufficient time to plate pigment on one side of each ball, cooling the ball assembly to freeze each core material and recovering the balls. Lastly, an electric paper sheet is fabricated by encapsulating an array of balls in an elastomer or other suitable material as explained above.
For exemplary purposes, the following is a description of a fabrication process. Polyethylene-oxide-doped polywax balls, with white pigment, are coated with about 4 micrometers of parylene and encapsulated in sylgard elastomer sheets. The sheets were spun for about 30 minutes in a centrifuge and heated above the melting point of the wax, and then cooled. At this point, the balls are hemispherically white and clear. The sheets are then reheated between two electrodes with approximately 200V applied voltage for about 30 minutes, and then cooled. These steps may be performed simultaneously by disposing an electrode within the centrifuge to polarize the balls during the centrifuging. The elastomer sheets are swelled in isopar and observed in an alternating electric field. The balls were observed to switch with the alternating field, namely, the white pigmented side of the balls were positive, in agreement with the expected dipole produced in the polling field.
The invention has been described with reference to the preferred embodiment. Obviously, modifications and alterations will occur to others upon a reading and understanding of this specification. It is intended to include all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof. | |
These Authors Are Writing in Indigenous Languages to Keep Native Traditions Alive
Those who write books in indigenous languages are not in it for the E.L. James money or fame. Javier Castellanos, who won the 2002 Premio Nacional de Literatura Indígena Nezahualcóyotl, said that authors of books in indigenous languages rarely have critics, let alone readers. Despite the modest audience for the work, the importance can’t be overstated. It’s one way that native languages are being kept alive.
Castellanos, with the help of Jóvenes Creadores del Fondo Nacional para la Cultura y las Artes, tutors a group of young writers who have been working on ambitious and completely badass projects. There’s Pergentino José from Oaxaca, who plans to take the oral stories and traditions of Zapoteco de Loxicha into stories that can be held. For Elizabeth Sáenz Díaz, it’s about writing stories so that newer generations can continue to have a connection to Zoque. | https://gradsage.com/2015/11/02/these-authors-are-writing-in-indigenous-languages-to-keep-native-traditions-alive/ |
Technical Field
The present disclosure regards techniques for performing an encryption method that envisages performing a masking on the sensitive data.
Description of the Related Art
In the encryption sector it is in general known, in order to retrieve the key, in particular of symmetric-key block encryption algorithms, such as the AES algorithm, but also of non-symmetric public-key algorithms, to use so-called “side-channel” attacks, e.g., attacks that exploit the information that can be derived, through a process of so-called “leakage” of information, from the physical implementation of the encryption procedure, for example by measuring energy-absorption levels of the circuit.
It is known, for example, to use as countermeasure against side-channel attacks operations of linear, Boolean, masking of the data.
According to the above technique, each datum is masked via a Boolean XOR operation with mask values.
In general, a side-channel attack is said to be of d-th order if it requires considering statistical moments of order d to distinguish the correct hypotheses from the wrong ones.
Several of the countermeasures against such side-channel attacks exploit, for example, the presence of look-up tables (LUTs) in the circuits that implement the algorithms, and operations of initialization of the values contained in these tables are carried out. Look-up tables, also known as “association tables”, are data structures that facilitate association to each admissible combination of input data of a corresponding (not necessarily unique) configuration of output data. Normally, the use of a look-up table makes it possible to speed up the operations in so far as access to the datum in the table is faster than its calculation. Look-up tables are hence frequently used in encryption algorithms, whether hardware or software ones, for carrying out complex calculations. For example, a look-up table, the so-called Substitution Box (SBOX), is used in the known AES (Advanced Encryption Standard) encryption algorithm for implementing operations such as, for example, the SubBytes operation.
FIG. 1A shows a flowchart representing an implementation 200 of the AES encryption procedure. The steps represented constitute the steps for encryption of a 16-byte block, known as AES state. This procedure 200, as likewise the detail of the operations 210, 220, 230, 240, are in themselves known to the person skilled in the sector (see, for example: NIST, “Announcing the Advanced Encryption Standard (AES),” FIPS-197 (Nov. 26, 2001))
Since it is advantageous from the standpoint of management of Boolean masking to separate the non-linear part (corresponding to the SBOX) from the linear parts, the AES state to be encrypted, designated by A, is for example subjected to a first SubBytes operation 210, to supply at output a state B, which is subjected to a set 220 of operations ShiftRows+MixColumns+AddKey, to generate a state C. The operations 210, 220 correspond to a first round. Then, in a next round, a second SubBytes operation 230 is carried out, to obtain a state D, as well as a further set 240 of operations ShiftRows+MixColumns+AddKey, to generate a state E. A number of rounds that is envisaged by the procedure 200 and depends upon the number of corresponding round subkeys to be added is carried out. The various modalities of management of the AES rounds are in any case in themselves known to the person skilled in the sector. As has been said, the SubBytes operation 210 or 230, which contains a non-linear portion, is carried out with the aid of a Substitution Box (SBOX), which comprises a look-up table.
At the end of the AES encryption procedure 200, the masks are removed from the ciphertext that is the product of the AES encryption procedure 200.
Represented in FIG. 1B are the masks applied by the method with reference to the very same encryption procedure 200 of FIG. 1A.
For the input of the SBOX (input for sixteen 1-byte elements of the ABS state) input masks L are provided for masking in the first round (steps 210-220) and input masks N are provided for masking in the second round (steps 230-240). Output masks M of the SBOX are provided for masking in the first round (steps 210-220) and output masks O are provided for masking in the second round (steps 230-240).
The so-called high-order side-channel attacks attack different points of the algorithm that use the same mask values so as to be able to remove the protection of the mask. In general, given a mask, the initialization of the look-up table with this mask and the access to the masked data during calculation means having at least two different operations in two different instants in time that use the same mask, the corresponding attack thus being a second-order attack.
In this context, the countermeasures for high-order attacks are usually complex and are very penalizing in terms of latency time and circuit area required for their implementation. In addition, in hardware implementations the protection level is defined in the design stage since this affects the design itself and, as has been said, the area of the circuit to be designed. This constitutes a further complexity and drawback.
In order for the countermeasure to be effective, the masks generally present certain properties: for example, they are unknown to the hacker, are randomly extracted with uniform distribution, and are independent of one another.
A possibility, which may provide the best protection, is to use masks that are all independent of one another, produced by a true-random number generator (TRNG). However, generation of a large amount of values by a TRNG is slow. The large number of values is particularly critical for encryption operations carried out in constrained devices, such as smartcards. The storage space for the masks may easily reach ten times the space occupied by the actual data.
In general, TRNGs presuppose an entropy source based upon some unpredictable physical phenomenon. It is alternatively possible to use masks that appear independent of one another, produced by a pseudo-random number generator (PRNG). In order for the generation to be effectively faster and able to withstand the high demand for random values, this typically requires a dedicated hardware pseudo-random number generator. Moreover, it is difficult to evaluate the side-channel leakages associated to the above pseudo-random number generator, which could introduce new side-channel vulnerabilities.
In addition, in order to reduce the number of true random values, it is possible to reuse some masks that are to be applied to intermediate values. However, this may jeopardize the level of protection.
| |
Author – Nigel Sainsbury, PhD researcher, Environment and Sustainability Institute
Potential changes in the frequency and intensity of storms over the world’s oceans could have a catastrophic impact on global fisheries, risking the lives, livelihoods, food security and health of billions of people around the world.
In a new commentary article published in Nature Climate Change, I argue, along with my co-authors from ExeterMarine, Cefas, Willis Towers Watson, Met Office and the University of Bristol, that a new global research effort into changing storminess and global capture fisheries is required to help fisheries adapt to this aspect of climate change. We outline a research roadmap encompassing aspects of climate modelling, fisher behaviour, marine ecosystems and fishery vulnerability and adaptation.
There is growing evidence that storminess will alter in the future with climate change. There are great uncertainties in both future predictions and reanalyses of historic storms, owing to a lack of historic data and the limitations of storm representation in climate models. Whilst the number of studies is growing in both number and coverage of the world’s ocean basins, research is required to develop projections of future storminess at local scales with significantly more confidence.
Storms have the potential to cause extensive socio-economic impacts on fisheries. It is estimated that every year, night-time thunder storms kill between 3,000 – 5,000 fishers every year on Lake Victoria. When Cyclone Nargis struck Myanmar in 2008, 28,000 fishers were killed or missing and over 100,000 fishing boats were destroyed. Closer to where I am based, at the University of Exeter’s Penryn campus, the winter of 2013-2014, the stormiest on record, caused an estimated £7 million loss of income, £400,000 in lost fishing gear and £1.1 million in fisheries onshore infrastructure damage.
Our knowledge of how storms impact marine ecosystems is limited. There is evidence that storms damage mangrove forests, seagrass beds and corals and cause the redistribution of fish and mass fish mortality events. However, this is taken from a handful of studies. Research is required in different ecosystem contexts around the world to identify how storms will impact ecosystems and how this links to socio-economic impacts on fisheries.
Changing storminess differs from other climate stressors affecting fisheries, such as ocean warming and acidification, because it has a direct social dimension as well as causing ecological impacts on target fish species. Whilst a myriad of social and economic factors have been shown to affect fishers’ decisions about where and when to fish, the role of weather in fisher behaviour has received little attention. Exploring how fishers perceive weather risks and how the uncertainties of physical danger and financial outcomes factor in fishers’ decision making in different social and cultural contexts will be important to predict the future fishing disruption caused by changing storminess.
If the scientific community is to help fisheries adapt to changing storminess, research into the ecological, socio-economic and climate aspects of changing storminess must translate into assessments of fisheries vulnerability to this environmental change. This will support national governments in assessing the threat their fisheries face and, if required, help them to prioritise where to focus adaptation efforts. Social scientists can also support this effort by identifying and evaluating adaption actions in different contexts. Financial mechanisms currently being used in terrestrial agriculture to improve farmers’ resilience to environmental shocks, such as drought, may offer potential. It must also be considered that fisheries in areas of projected reduced storminess may experience an increase in potential fishing days, bringing socio-economic benefits but also increasing the challenges of unsustainable natural resource use.
#ExeterMarine is an interdisciplinary group of marine related researchers with capabilities across the scientific, medical, engineering, humanities and social science fields. If you are interested in working with our researchers or students, contact Michael Hanley or visit our website! | https://blogs.exeter.ac.uk/exetermarine/2018/07/04/changing-storminess-and-global-capture-fisheries/ |
Chicago Build 2019 takes place on September 19 & 20th at McCormick Place, IL.
This is the leading construction and design event for Chicago and Illinois.
Chicago Build is a free to attend show that focuses on the future construction projects, the latest legislation, upcoming contracts and key trends that are shaping the construction and design industry. Join us to see the industry come to life across two exciting days filled with meetings, business and entertainment.
The ticket gives you access to all feature areas including the exhibition, conferences, AIA CES approved workshops and networking events taking place at the McCormick Place from September 19-20, 2019.
Be sure to register your interest to reserve your free ticket before general release and to stay up to date on the latest developments.
What's on at Chicago Build? | https://www.eventbrite.com/e/chicago-build-2019-free-conference-aia-ces-workshops-registration-47906470543?aff=erelexpmlt |
Note: This is a simplified and shortened English translation of my film review, which was written in Vietnamese and published in Sinh viên Việt Nam (Vietnamese Students) a few years ago.
Lost in translation follows Bob Harris (Bill Murray), an American middle-aged movie star who comes to Tokyo to shoot a commercial for whiskey. His career is on the downward slope and his marriage seems to have cooled down for years. Finding himself lost in an alien city, Harris is soon drawn to a young married woman who appears to be as adrift and lonely as he is. Charlotte is a philosophy graduate of Yale, the wife of a photographer who is so consumed with his work that he spends more time with starlets than with her. Feeling neglected all the time and disillusioned with her marriage, Charlotte spends most of her time wandering the streets of Tokyo, seeking the purpose of her life. Like Harris, she cannot sleep at night and thus, the two lost souls keep bumping into each other in the hotel bar. They strike up a relationship that soon turns into a platonic love with no possibility to develop further.
On the surface, Lost in translation is a movie about culture shock in which people experience alienation and disorientation. Both Harris and Charlotte find themselves lonely and lost in an alien culture beyond their comprehension. It is only when the two of them get together that they find comfort and feel happy.
However, it is doubtful that the two main characters feel lost only because of the strangeness of Japanese culture or because of their inability to speak Japanese. Before setting foot in Japan, Bob and Charlotte must have been “lost” already, as them do not know what to do with their lives and have trouble with their marriage. They are two lost souls in a big city, two lonely persons who couldn’t find happiness in the lives they have chosen. Both of them feel disillusioned. Both are not contented with their lives. That is why they understand each other so easily, get along so well and feel affection as well as attraction towards each other.
What makes Lost in translation special is its subtlety. The film keeps the audience spellbound by the quiet, trivial details of life it presents. Every scene is dealt with meticulous direction. The cinematography is beautiful. At times, the images of Tokyo can be seen in the distance, indicating the sense of alienation and disconnection that the characters experience. Both Bob and Charlotte, at one time or another, gaze through the huge windows at the big city below. Both of them feel lost in the bustling metropolis, asking themselves what they are doing, wondering what to do with their lives.
The acting is particularly good. Bill Murray, in the prime of his career, delivers a strong, understated and charming performance. He brings his character to life, he makes us laugh and sympathize with him. And he has a perfect match. Scarlett Johansson, only 18 then, rises to stardom after the film thanks to her good acting skills and pure beauty.
Lost in translation is not another love story. It is about friendship, connection and mutual understanding between man and woman. The ending is left open for one’s own prediction but satisfyingly so. In the crowded street, Bob finds Charlotte wandering around, approaches her and whispers something into her ear – something the audience could not hear – before they part ways. The audience will leave the cinema wondering about the fates of Bob and Charlotte as well as their fleeting romance, feeling overwhelmed with mixed emotions.
Lost in translation is “a movie to remember”, the sort of film that affects both the head and the heart. | https://minhthi.net/2013/11/24/fleeting-romance-for-the-lost-souls/ |
Extracting entities from scientific texts is an important task of Natural Language Processing. While traditional methods were based on manually generated features, pre-trained language models such as BERT(devlin-etal-2019-bert) have recently achieved competitive results. However, since BERT was pre-trained on general text from Wikipedia and Bookcorpus, its performance on domain-specific tasks has been shown to be suboptimal in several previous works (beltagy-etal-2019-scibert; Lee_2019). Those empirical findings have motivated the development of domain-specific pre-trained language models. In particular, several domain-specific transformers have been made publicly available through the hugging face’s transformer library. For example, there are SciBERT (beltagy-etal-2019-scibert) for the scientific domain, BioBERT (Lee_2019) for the biomedical domain, and FinBERT (yang2020finbert) for the financial domain.
Pre-trained transformers such as SciBERT or BioBERT have achieved excellent performance in scientific NER compared to previous work. However, despite this success, their traditional fine-tuning for NER can be suboptimal, as they typically classify the first subtoken representation of each word to label sequences. Some work has attempted to avoid this problem by designing NER as a span-based classification instead of sequence labeling (Eberts2020SpanbasedJE)
. However, these methods are more difficult to implement and require many additional hyperparameters such as the number of negative samples and window size. In this work, we adopt the conventional sequence labeling approach using the BIO scheme, but instead of directly classifying word labels, a transformer layer(vaswani2017attention) is added on top of the subword representation to better encode the word-level interaction. More specifically, each first subtoken of every word is passed through an additional transformer layer before the word classification. This small change in the architecture can significantly induce additional performance.
2 Model
In this paper, we treat the NER task as a classification of BIO tags. Our model consists of three main elements: a pre-trained transformer layer, a word-level interaction layer and a classification layer composed of a linear layer and a CRF layer.
Pre-trained transformer layer
The first part of our architecture is a pre-trained transformer model to encode input subwords into contextualized embeddings. Usually, a model like BERT (devlin-etal-2019-bert) or RoBERTa (liu2019roberta) is considered for this step, but since we deal with scientific documents, we used a domain-specific model called Scibert (beltagy-etal-2019-scibert).
Word-level layer
This component takes as input the first subword of each word in the previous layer and encodes their interaction with a single-layer transformer (vaswani2017attention). Unlike previous models that directly classify the first subtoken, the addition of this layer provides a better representation for the sequence labeling.
Classification layer
Finally, this component classifies each word representation into the corresponding label using a linear layer. Furthermore, with the use of a CRF layer (10.5555/645530.655813), we ensure that all output labels are valid by adding constraints during inference (e.g., label O must not precede label I) whitch also make evaluation easier.
3 Experiments
3.1 Datasets
SciERC is a dataset introduced by (luan-etal-2018-multi)
for scientific information extraction. The dataset consists of 500 abstracts extracted from papers related to Artificial Intelligence. They have been annotated with scientific entities, their relations and conference clusters.
TDM is a NER dataset that was recently published (hou2021tdmsci) for detecting Tasks, Datasets, and Metrics (TDM) from Natural Language Processing papers. It consists of sentences extracted from the full text of natural language processing papers, not just abstracts.
NCBI (DOGAN20141) is a NER dataset that is designed to identify disease mentions in biomedical texts from PubMed article abstracts.
3.2 Implementation details
Architecture
For all experiments, we used the recommended version of SciBERT (beltagy-etal-2019-scibert), which contains 12 transform layers and a hidden dimension of 768 for the pre-trained model. In the case of the word-level layer, we employ a one-layer bidirectional transformer with a hidden dimension of 768 and 8 attention heads. We also experiment with a Bi-LSTM (10.1162/neco.1997.9.8.1735) with a hidden dim of 768 in place of the word-level transformer layer to see the difference in performance. The final layer is a linear layer that is used to project the word representation into label space before feeding it into a CRF layer for decoding.
Hyperparameters
We did not conduct an extensive search for hyperparameters, but rather the ones recommended by (devlin-etal-2019-bert)
. For all datasets, we picked a learning rate of 3e-5 and used a batch size of 4 for TDM and SciERC and a batch size of 16 for the NCBI dataset. We trained all our models for up to 25 epochs and upon completion, we selected the checkpoints with the best f1 score on the validation set.
Inspired by research on semi- and self-supervised learning(tarvainen2018mean; he2020momentum), we maintain an exponential moving average (EMA) of all parameters during learning. We find that this simple technique yields additional performance at almost no cost. More formally, after each gradient, where and represent the parameters of the model and the parameter of the moving average at the step k, respectively. Furthermore, is a hyperparameter for the EMA update that is usually set to a floating number close to 1.0; in our experiment, we used a of 0.99.
All of our models were trained with a single V100 GPU.
3.3 Evaluation
We evaluate the models on the exact correspondence between the gold entities and the predicted entities. Furthermore, in line with previous research, we exclude non-entity spans. We therefore consider precision, recall and F-score as metrics, implemented by the seqeval library(seqeval). For SciERC, we reported both micro and macro averages, however, we only reported the micro average for TDM and NCBI-Disease for comparison with previous works..
3.4 Main results
The main results of our experimentation are presented in Table 2. It shows that our best models are able to outperform the state of the art on SciERC and TDM and obtain a competitive result on the NCBI dataset.
On SciERC, our model is able to surpass SciBERT (beltagy-etal-2019-scibert) by a significant margin (+2 on F1-macro). Our method is also capable of outperforming span-based approaches such as PURE (zhong-chen-2021-frustratingly) and Spert (Eberts2020SpanbasedJE) while employing a much simpler approach. More specifically, we achieved 70.91 on F1-micro while SPERT, the current state of the art got 70.33.
Our model also exceeds the state of the art on the TDM dataset by 5 points on F1-micro without using any data augmentation technique.
Finally, our approach also showed competitive results on the NCBI dataset, while not exceeding the state of the art. Our model has roughly the same performance as the original SciBERT NER model. However, the current state of the art, the BioBERT NER model, outperforms our model by more than one point on the F1-micro
3.5 Bi-LSTM vs Transformer
Table 2 also reports our experimentation using a Bi-LSTM as the word-level layer. We can see that the transformer is more efficient than the Bi-LSTM layer for all datasets. However, the additional gain of the transformer may be due to the fact that it contains more parameters.
3.6 Ablation studies
Here, we undertake an ablation study to see the contribution of different components of our proposed model. In detail, we examine the addition of the word-level layer and the effectiveness of the exponential moving average model. The reported results is the micro-F1 averaged accross three different random seeds.
Word level layer
In this study, we examine the effectiveness of our word-level interaction approach by comparing it to subword-level interaction with the same number of parameters. More concretely, the subword-level interaction is achieved by simply adding another layer of transformers on top of the scibert representation. The following table shows the comparison between the two approaches:
As shown in the table 3, encoding the information at the word level is in fact beneficial. We demonstrate from the results of this experiment that the additional performance provided by our approach is not only due to the larger number of parameters but to the fact that it produces a better representation between words to predict NER tags. Intuitively, our approach forces each first subtoken to encode the entire word information through a self-attention mechanism, and then the addition of the transformation layer models their interaction.
Exponential Moving Average
We also investigate the effectiveness of keeping an Exponential Moving Average (EMA) of the parameters during training which consist in keeping a moving average of the model parameter after each gradient step.
This table 4
shows that keeping an exponential moving average of the parameter during training can provide additional performance gain almost for free. The EMA version outperforms the baseline for all datasets on which we trained our model. In fact, keeping an moving average of the parameters can be seen as a soft ensembling of all the previous model checkpoints. Furthermore, keeping an EMA of model parameters could be employed for any deep learning task and not limited to Named Entity Recognition. It could be interesting to investigate its effectiveness across a wider range of NLP task, but it is not in the scope of our study so we leave it for future work.
4 Related Work
Early works in NER were made up of handcrafted features and CRF-like models. The advent of deep learning allowed for end-to-end model training. In the early days of deep learning, the majority of NER models used an LSTM-based architecture with word- and character-level encoding and CRF layer for decoding (lample-etal-2016-neural; huang2015bidirectional)
. Recently, the arrival of BERT has dramatically transformed the field of NLP. In terms of NER, BERT’s paper proposed to do NER by classifying the hidden representation of the first subtoken of each word for sequence labeling. Then, this approach has been adapted to different domains such as the scientific domain through the works ofbeltagy-etal-2019-scibert and Lee_2019 among others. For example, beltagy-etal-2019-scibert use scibert as an encoder and project the first subtoken into the label space and then employ a CRF layer for decoding (Eberts2020SpanbasedJE; zhong-chen-2021-frustratingly). Some work has employed span-based approach as opposed to traditional sequence labelling. In the span-based approach, each span in a sequence up to a maximum sequence length is enumerated, aggregated, and then classified. These methods are particularly useful for modelling joint entity and relation extraction (Wadden2019EntityRA) and nested named entity recognition.
5 Conclusion
In this paper, we proposed a new architecture for applied named entity recognition. Our model outperforms the state of the art on two scientific NER benchmarks, namely the SciERC and TDM datasets, and achieves competitive performance on the NCBI-disease dataset. The advantage of our model is that it is simple, does not require additional data or external resources such as gazetter to achieve competitive results. Our empirical results also show that maintaining an exponential moving average of the model parameters during learning can provide an additional performance gain for a negligible computational resource (time complexity). | https://deepai.org/publication/hierarchical-transformer-model-for-scientific-named-entity-recognition |
Automation and Optimization of Multipulse Laser Zona Drilling of Mouse Embryos During Embryo Biopsy.
Laser zona drilling (LZD) is a required step in many embryonic surgical procedures, for example, assisted hatching and preimplantation genetic diagnosis. LZD involves the ablation of the zona pellucida (ZP) using a laser while minimizing potentially harmful thermal effects on critical internal cell structures. Develop a method for the automation and optimization of multipulse LZD, applied to cleavage-stage embryos. A two-stage optimization is used. The first stage uses computer vision algorithms to identify embryonic structures and determines the optimal ablation zone farthest away from critical structures such as blastomeres. The second stage combines a genetic algorithm with a previously reported thermal analysis of LZD to optimize the combination of laser pulse locations and pulse durations. The goal is to minimize the peak temperature experienced by the blastomeres while creating the desired opening in the ZP. A proof of concept of the proposed LZD automation and optimization method is demonstrated through experiments on mouse embryos with positive results, as adequately sized openings are created. Automation of LZD is feasible and is a viable step toward the automation of embryo biopsy procedures. LZD is a common but delicate procedure performed by human operators using subjective methods to gauge proper LZD procedure. Automation of LZD removes human error to increase the success rate of LZD. Although the proposed methods are developed for cleavage-stage embryos, the same methods may be applied to most types LZD procedures, embryos at different developmental stages, or nonembryonic cells.
|
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.