blob_id
stringlengths 40
40
| directory_id
stringlengths 40
40
| path
stringlengths 3
616
| content_id
stringlengths 40
40
| detected_licenses
sequencelengths 0
112
| license_type
stringclasses 2
values | repo_name
stringlengths 5
115
| snapshot_id
stringlengths 40
40
| revision_id
stringlengths 40
40
| branch_name
stringclasses 777
values | visit_date
timestamp[us]date 2015-08-06 10:31:46
2023-09-06 10:44:38
| revision_date
timestamp[us]date 1970-01-01 02:38:32
2037-05-03 13:00:00
| committer_date
timestamp[us]date 1970-01-01 02:38:32
2023-09-06 01:08:06
| github_id
int64 4.92k
681M
⌀ | star_events_count
int64 0
209k
| fork_events_count
int64 0
110k
| gha_license_id
stringclasses 22
values | gha_event_created_at
timestamp[us]date 2012-06-04 01:52:49
2023-09-14 21:59:50
⌀ | gha_created_at
timestamp[us]date 2008-05-22 07:58:19
2023-08-21 12:35:19
⌀ | gha_language
stringclasses 149
values | src_encoding
stringclasses 26
values | language
stringclasses 1
value | is_vendor
bool 2
classes | is_generated
bool 2
classes | length_bytes
int64 3
10.2M
| extension
stringclasses 188
values | content
stringlengths 3
10.2M
| authors
sequencelengths 1
1
| author_id
stringlengths 1
132
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
86b909ea6e240fb015ef52450aafadc2ae431396 | 43d138375c9068b3ea9dc0f75bab9d3f3bc0b8f1 | /polling_stations/apps/data_collection/management/commands/import_gosport.py | 5836560a0aa2361284d553d80dc5010b0b82230f | [] | permissive | dantagg/UK-Polling-Stations | 69da767c934dd38d74d7ff632fefacdae82053cb | 2271b3fbfe5242de659892d24fad4d8851c804ba | refs/heads/master | 2023-01-03T20:19:58.315246 | 2020-09-28T11:09:40 | 2020-09-28T11:10:29 | 300,301,660 | 0 | 0 | BSD-3-Clause | 2020-10-01T14:07:00 | 2020-10-01T14:06:59 | null | UTF-8 | Python | false | false | 3,585 | py | from data_collection.management.commands import BaseXpressDemocracyClubCsvImporter
class Command(BaseXpressDemocracyClubCsvImporter):
council_id = "E07000088"
addresses_name = (
"parl.2019-12-12/Version 1/2019 PGE - Democracy_Club__12December2019gosport.TSV"
)
stations_name = (
"parl.2019-12-12/Version 1/2019 PGE - Democracy_Club__12December2019gosport.TSV"
)
elections = ["parl.2019-12-12"]
csv_delimiter = "\t"
allow_station_point_from_postcode = False
def address_record_to_dict(self, record):
rec = super().address_record_to_dict(record)
uprn = record.property_urn.strip().lstrip("0")
if uprn in [
"37013642", # PO122BY -> PO123BY : Duncan Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Hood Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Onslow Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Ussher Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Beaufort Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Ramsey Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Rodney Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Cunningham Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Inman Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Nelson Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Oates Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Vian Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Yarmouth Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Keyes Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : JRAC Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Esmonde Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Whitworth Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Benbow Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Sommerville Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Phoebe Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Quiberon Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Salisbury Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Jervis Block, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Mountbatten Block, HMS Sultan, Military Road, Gosport, Hampshire
"37042796", # PO122BY -> PO123BG : The Wardroom, HMS Sultan, Military Road, Gosport, Hampshire
"37013642", # PO122BY -> PO123BY : Lefanu Block, HMS Sultan, Military Road, Gosport, Hampshire
]:
rec["accept_suggestion"] = True
return rec
| [
"[email protected]"
] | |
5fce8eb114c61690bccaf214eb1d37748c5e824f | d6c059cb3a9d58904464f048f5ea195857bc005d | /0730-线程、进程、协程/2、进程/9、封装进程对象/aspiringProcess.py | 664a50d5be61970e84dcde536681414842c698fe | [] | no_license | j415/DjangoBasics | 19f49f5dad9635c6e12e13ec43e728b2a808216c | 2d738d655bd996e8755611caf090e3aea8f321ed | refs/heads/master | 2020-03-23T22:03:34.874545 | 2018-09-05T03:31:14 | 2018-09-05T03:31:14 | 142,150,295 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 378 | py | from multiprocessing import Process
import os, time
class AspiringProcess(Process):
def __init__(self, name):
Process.__init__(self)
self.name = name
def run(self):
print('子进程(%s-%s)启动' % (self.name, os.getpid()))
# 子进程的功能
time.sleep(3)
print('子进程(%s-%s)结束' % (self.name, os.getpid()))
| [
"[email protected]"
] | |
2a7acf79a0890d9bf7c03f9a000a6219641ec060 | 3ef12b52ab73d12d0a6ee1ba818f561edbb2e4f8 | /django_app/music/migrations/0001_initial.py | 8092eb5b7224fc751c08d76f05dc2a5b338c2eea | [] | no_license | juliahwang/WS_practice | 7978f73fb3813632fba531f27fcb08548ab51dc0 | 70760095eea88b67113676a55ca7e18ec0224afb | refs/heads/master | 2021-01-01T16:53:12.232351 | 2017-08-03T18:23:28 | 2017-08-03T18:23:28 | 97,942,129 | 0 | 1 | null | null | null | null | UTF-8 | Python | false | false | 3,493 | py | # -*- coding: utf-8 -*-
# Generated by Django 1.11.3 on 2017-08-02 13:27
from __future__ import unicode_literals
from django.conf import settings
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
migrations.swappable_dependency(settings.AUTH_USER_MODEL),
]
operations = [
migrations.CreateModel(
name='Music',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('img_music', models.ImageField(blank=True, upload_to='img_music')),
('name_music', models.CharField(max_length=100)),
('name_singer', models.CharField(max_length=100)),
('file_music', models.FileField(upload_to='music')),
('name_album', models.CharField(blank=True, max_length=100)),
('date_created', models.DateTimeField(auto_now_add=True)),
('sunny', models.PositiveIntegerField(default=1, verbose_name='맑음')),
('foggy', models.PositiveIntegerField(default=1, verbose_name='안개')),
('rainy', models.PositiveIntegerField(default=1, verbose_name='비')),
('cloudy', models.PositiveIntegerField(default=1, verbose_name='흐림')),
('snowy', models.PositiveIntegerField(default=1, verbose_name='눈')),
('name_author', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)),
],
),
migrations.CreateModel(
name='Playlist',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('name_playlist', models.CharField(default='playlist', max_length=30)),
],
),
migrations.CreateModel(
name='PlaylistMusics',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('date_added', models.DateTimeField(auto_now_add=True)),
('music', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='music.Music')),
('name_playlist', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to='music.Playlist')),
],
),
migrations.CreateModel(
name='Weather',
fields=[
('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')),
('latitude', models.FloatField(verbose_name='위도')),
('longitude', models.FloatField(verbose_name='경도')),
('location', models.CharField(max_length=100)),
('time_saved', models.DateTimeField(auto_now_add=True)),
('cur_weather', models.CharField(max_length=100)),
],
),
migrations.AddField(
model_name='playlist',
name='playlist_musics',
field=models.ManyToManyField(related_name='playlist_musics', through='music.PlaylistMusics', to='music.Music'),
),
migrations.AddField(
model_name='playlist',
name='user',
field=models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL),
),
]
| [
"[email protected]"
] | |
c420454c31093dccbd03cc54672bcf97c527f1cd | 8e2b49a1f570c51c2cd7766387c058cdfadce864 | /src/services/package_service.py | a1ed5c7f92c6084c40feb28b8a93081e052d92dd | [
"MIT"
] | permissive | c-w-m/mongo-quickstart | c6dc9fdc0232df757f57f00a6d4fd0a4bd10c962 | dc61993a07bfbdeb1e36c47dfbc210fe9177ed8e | refs/heads/master | 2023-02-25T01:10:11.779036 | 2021-01-31T20:20:13 | 2021-01-31T20:20:13 | 334,733,471 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,326 | py | from typing import Optional, List
from data.downloads import Download
from data.packages import Package
from data.release_history import ReleaseHistory
from data.users import User
class PackageService:
@classmethod
def package_count(cls):
return Package.objects().count()
@classmethod
def release_count(cls):
return ReleaseHistory.objects().count()
@classmethod
def user_count(cls):
return User.objects().count()
@classmethod
def download_count(cls):
return Download.objects().count()
@classmethod
def find_package_by_name(cls, name):
package = Package.objects(name=name).first()
return package
@classmethod
def latest_release(cls, package: Package) -> Optional[ReleaseHistory]:
release = ReleaseHistory \
.objects(package_id=package.id) \
.order_by('-created') \
.first()
return release
@classmethod
def find_maintainers(cls, package: Package) -> List[User]:
users = User.objects(id__in=package.maintainers)
return list(users)
@classmethod
def popular_packages(cls, limit: int) -> List[Package]:
packages = Package.objects()\
.order_by('-total_downloads')\
.limit(limit)
return list(packages)
| [
"[email protected]"
] | |
8ddf4392d11c57dd223b27ee91a3bed6a6cb8c9d | 9b9a02657812ea0cb47db0ae411196f0e81c5152 | /repoData/martomo-SublimeTextXdebug/allPythonContent.py | a04f1db77c7881088fcabb0a1dd1689cd6185c72 | [] | no_license | aCoffeeYin/pyreco | cb42db94a3a5fc134356c9a2a738a063d0898572 | 0ac6653219c2701c13c508c5c4fc9bc3437eea06 | refs/heads/master | 2020-12-14T14:10:05.763693 | 2016-06-27T05:15:15 | 2016-06-27T05:15:15 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 208,867 | py | __FILENAME__ = main
import sublime
import sublime_plugin
import os
import sys
import threading
# Load modules
try:
from .xdebug import *
except:
from xdebug import *
# Set Python libraries from system installation
python_path = config.get_value(S.KEY_PYTHON_PATH)
if python_path:
python_path = os.path.normpath(python_path.replace("\\", "/"))
python_dynload = os.path.join(python_path, 'lib-dynload')
if python_dynload not in sys.path:
sys.path.append(python_dynload)
# Define path variables
try:
S.PACKAGE_PATH = os.path.dirname(os.path.realpath(__file__))
S.PACKAGE_FOLDER = os.path.basename(S.PACKAGE_PATH)
except:
pass
# Initialize package
sublime.set_timeout(lambda: load.xdebug(), 1000)
# Define event listener for view(s)
class EventListener(sublime_plugin.EventListener):
def on_load(self, view):
filename = view.file_name()
# Scroll the view to current breakpoint line
if filename and filename in S.SHOW_ROW_ONLOAD:
V.show_at_row(view, S.SHOW_ROW_ONLOAD[filename])
del S.SHOW_ROW_ONLOAD[filename]
# Render breakpoint markers
sublime.set_timeout(lambda: V.render_regions(view), 0)
def on_activated(self, view):
# Render breakpoint markers
V.render_regions(view)
def on_post_save(self, view):
filename = view.file_name()
# Render breakpoint markers
V.render_regions(view)
# Update config when settings file or sublime-project has been saved
if filename and (filename.endswith(S.FILE_PACKAGE_SETTINGS) or filename.endswith('.sublime-project')):
config.load_package_values()
config.load_project_values()
#TODO: Save new location of breakpoints on save
def on_selection_modified(self, view):
# Show details in output panel of selected variable in context window
if view.name() == V.TITLE_WINDOW_CONTEXT:
V.show_context_output(view)
elif view.name() == V.TITLE_WINDOW_BREAKPOINT:
V.toggle_breakpoint(view)
elif view.name() == V.TITLE_WINDOW_STACK:
V.toggle_stack(view)
elif view.name() == V.TITLE_WINDOW_WATCH:
V.toggle_watch(view)
else:
pass
class XdebugBreakpointCommand(sublime_plugin.TextCommand):
"""
Add/Remove breakpoint(s) for rows (line numbers) in selection.
"""
def run(self, edit, rows=None, condition=None, enabled=None, filename=None):
# Get filename in current view and check if is a valid filename
if filename is None:
filename = self.view.file_name()
if not filename or not os.path.isfile(filename):
return
# Add entry for file in breakpoint data
if filename not in S.BREAKPOINT:
S.BREAKPOINT[filename] = {}
# When no rows are defined, use selected rows (line numbers), filtering empty rows
if rows is None:
rows = V.region_to_rows(self.view.sel(), filter_empty=True)
# Loop through rows
for row in rows:
expression = None
if condition is not None and len(condition.strip()) > 0:
expression = condition
# Check if breakpoint exists
breakpoint_exists = row in S.BREAKPOINT[filename]
# Disable/Remove breakpoint
if breakpoint_exists:
if S.BREAKPOINT[filename][row]['id'] is not None and session.is_connected(show_status=True):
async_session = session.SocketHandler(session.ACTION_REMOVE_BREAKPOINT, breakpoint_id=S.BREAKPOINT[filename][row]['id'])
async_session.start()
if enabled is False:
S.BREAKPOINT[filename][row]['enabled'] = False
elif enabled is None:
del S.BREAKPOINT[filename][row]
# Add/Enable breakpoint
if not breakpoint_exists or enabled is True:
if row not in S.BREAKPOINT[filename]:
S.BREAKPOINT[filename][row] = { 'id': None, 'enabled': True, 'expression': expression }
else:
S.BREAKPOINT[filename][row]['enabled'] = True
if condition is not None:
S.BREAKPOINT[filename][row]['expression'] = expression
else:
expression = S.BREAKPOINT[filename][row]['expression']
if session.is_connected(show_status=True):
async_session = session.SocketHandler(session.ACTION_SET_BREAKPOINT, filename=filename, lineno=row, expression=expression)
async_session.start()
# Render breakpoint markers
V.render_regions()
# Update breakpoint list
try:
if V.has_debug_view(V.TITLE_WINDOW_BREAKPOINT):
V.show_content(V.DATA_BREAKPOINT)
except:
pass
# Save breakpoint data to file
util.save_breakpoint_data()
class XdebugConditionalBreakpointCommand(sublime_plugin.TextCommand):
"""
Add conditional breakpoint(s) for rows (line numbers) in selection.
"""
def run(self, edit):
self.view.window().show_input_panel('Breakpoint condition', '', self.on_done, self.on_change, self.on_cancel)
def on_done(self, condition):
self.view.run_command('xdebug_breakpoint', {'condition': condition, 'enabled': True})
def on_change(self, line):
pass
def on_cancel(self):
pass
class XdebugClearBreakpointsCommand(sublime_plugin.TextCommand):
"""
Clear breakpoints in selected view.
"""
def run(self, edit):
filename = self.view.file_name()
if filename and filename in S.BREAKPOINT:
rows = H.dictionary_keys(S.BREAKPOINT[filename])
self.view.run_command('xdebug_breakpoint', {'rows': rows, 'filename': filename})
# Continue debug session when breakpoints are cleared on current script being debugged
if S.BREAKPOINT_ROW and self.view.file_name() == S.BREAKPOINT_ROW['filename']:
self.view.window().run_command('xdebug_execute', {'command': 'run'})
def is_enabled(self):
filename = self.view.file_name()
if filename and S.BREAKPOINT and filename in S.BREAKPOINT and S.BREAKPOINT[filename]:
return True
return False
def is_visible(self):
filename = self.view.file_name()
if filename and S.BREAKPOINT and filename in S.BREAKPOINT and S.BREAKPOINT[filename]:
return True
return False
class XdebugClearAllBreakpointsCommand(sublime_plugin.WindowCommand):
"""
Clear breakpoints from all views.
"""
def run(self):
view = sublime.active_window().active_view()
# Unable to run to line when no view available
if view is None:
return
for filename, breakpoint_data in S.BREAKPOINT.items():
if breakpoint_data:
rows = H.dictionary_keys(breakpoint_data)
view.run_command('xdebug_breakpoint', {'rows': rows, 'filename': filename})
# Continue debug session when breakpoints are cleared on current script being debugged
self.window.run_command('xdebug_execute', {'command': 'run'})
def is_enabled(self):
if S.BREAKPOINT:
for filename, breakpoint_data in S.BREAKPOINT.items():
if breakpoint_data:
return True
return False
def is_visible(self):
if S.BREAKPOINT:
for filename, breakpoint_data in S.BREAKPOINT.items():
if breakpoint_data:
return True
return False
class XdebugRunToLineCommand(sublime_plugin.WindowCommand):
"""
Run script to current selected line in view, ignoring all other breakpoints.
"""
def run(self):
view = sublime.active_window().active_view()
# Unable to run to line when no view available
if view is None:
return
# Determine filename for current view and check if is a valid filename
filename = view.file_name()
if not filename or not os.path.isfile(filename):
return
# Get first line from selected rows and make sure it is not empty
rows = V.region_to_rows(filter_empty=True)
if rows is None or len(rows) == 0:
return
lineno = rows[0]
# Check if breakpoint does not already exists
breakpoint_exists = False
if filename in S.BREAKPOINT and lineno in S.BREAKPOINT[filename]:
breakpoint_exists = True
# Store line number and filename for temporary breakpoint in session
if not breakpoint_exists:
S.BREAKPOINT_RUN = { 'filename': filename, 'lineno': lineno }
# Set breakpoint and run script
view.run_command('xdebug_breakpoint', {'rows': [lineno], 'enabled': True, 'filename': filename})
self.window.run_command('xdebug_execute', {'command': 'run'})
def is_enabled(self):
return S.BREAKPOINT_ROW is not None and session.is_connected()
def is_visible(self):
return S.BREAKPOINT_ROW is not None and session.is_connected()
class XdebugSessionStartCommand(sublime_plugin.WindowCommand):
"""
Start Xdebug session, listen for request response from debugger engine.
"""
def run(self, launch_browser=False, restart=False):
# Define new session with DBGp protocol
S.SESSION = protocol.Protocol()
S.SESSION_BUSY = False
S.BREAKPOINT_EXCEPTION = None
S.BREAKPOINT_ROW = None
S.CONTEXT_DATA.clear()
async_session = session.SocketHandler(session.ACTION_WATCH, check_watch_view=True)
async_session.start()
# Remove temporary breakpoint
if S.BREAKPOINT_RUN is not None and S.BREAKPOINT_RUN['filename'] in S.BREAKPOINT and S.BREAKPOINT_RUN['lineno'] in S.BREAKPOINT[S.BREAKPOINT_RUN['filename']]:
self.window.active_view().run_command('xdebug_breakpoint', {'rows': [S.BREAKPOINT_RUN['lineno']], 'filename': S.BREAKPOINT_RUN['filename']})
S.BREAKPOINT_RUN = None
# Set debug layout
self.window.run_command('xdebug_layout')
# Launch browser
if launch_browser or (config.get_value(S.KEY_LAUNCH_BROWSER) and not restart):
util.launch_browser()
# Start thread which will run method that listens for response on configured port
threading.Thread(target=self.listen).start()
def listen(self):
# Start listening for response from debugger engine
S.SESSION.listen()
# On connect run method which handles connection
if S.SESSION and S.SESSION.connected:
sublime.set_timeout(self.connected, 0)
def connected(self):
sublime.set_timeout(lambda: sublime.status_message('Xdebug: Connected'), 100)
async_session = session.SocketHandler(session.ACTION_INIT)
async_session.start()
def is_enabled(self):
if S.SESSION:
return False
return True
def is_visible(self, launch_browser=False):
if S.SESSION:
return False
if launch_browser and (config.get_value(S.KEY_LAUNCH_BROWSER) or not config.get_value(S.KEY_URL)):
return False
return True
class XdebugSessionRestartCommand(sublime_plugin.WindowCommand):
def run(self):
self.window.run_command('xdebug_session_stop', {'restart': True})
self.window.run_command('xdebug_session_start', {'restart': True})
sublime.set_timeout(lambda: sublime.status_message('Xdebug: Restarted debugging session. Reload page to continue debugging.'), 100)
def is_enabled(self):
if S.SESSION:
return True
return False
def is_visible(self):
if S.SESSION:
return True
return False
class XdebugSessionStopCommand(sublime_plugin.WindowCommand):
"""
Stop Xdebug session, close connection and stop listening to debugger engine.
"""
def run(self, close_windows=False, launch_browser=False, restart=False):
try:
S.SESSION.clear()
except:
pass
finally:
S.SESSION = None
S.SESSION_BUSY = False
S.BREAKPOINT_EXCEPTION = None
S.BREAKPOINT_ROW = None
S.CONTEXT_DATA.clear()
async_session = session.SocketHandler(session.ACTION_WATCH, check_watch_view=True)
async_session.start()
# Remove temporary breakpoint
if S.BREAKPOINT_RUN is not None and S.BREAKPOINT_RUN['filename'] in S.BREAKPOINT and S.BREAKPOINT_RUN['lineno'] in S.BREAKPOINT[S.BREAKPOINT_RUN['filename']]:
self.window.active_view().run_command('xdebug_breakpoint', {'rows': [S.BREAKPOINT_RUN['lineno']], 'filename': S.BREAKPOINT_RUN['filename']})
S.BREAKPOINT_RUN = None
# Launch browser
if launch_browser or (config.get_value(S.KEY_LAUNCH_BROWSER) and not restart):
util.launch_browser()
# Close or reset debug layout
if close_windows or config.get_value(S.KEY_CLOSE_ON_STOP):
if config.get_value(S.KEY_DISABLE_LAYOUT):
self.window.run_command('xdebug_layout', {'close_windows': True})
else:
self.window.run_command('xdebug_layout', {'restore': True})
else:
self.window.run_command('xdebug_layout')
# Render breakpoint markers
V.render_regions()
def is_enabled(self):
if S.SESSION:
return True
return False
def is_visible(self, close_windows=False, launch_browser=False):
if S.SESSION:
if close_windows and config.get_value(S.KEY_CLOSE_ON_STOP):
return False
if launch_browser and (config.get_value(S.KEY_LAUNCH_BROWSER) or not config.get_value(S.KEY_URL)):
return False
return True
return False
class XdebugExecuteCommand(sublime_plugin.WindowCommand):
"""
Execute command, handle breakpoints and reload session when page execution has completed.
Keyword arguments:
command -- Command to send to debugger engine.
"""
def run(self, command=None):
async_session = session.SocketHandler(session.ACTION_EXECUTE, command=command)
async_session.start()
def is_enabled(self):
return session.is_connected()
class XdebugContinueCommand(sublime_plugin.WindowCommand):
"""
Continuation commands when on breakpoint, show menu by default if no command has been passed as argument.
Keyword arguments:
command -- Continuation command to execute.
"""
commands = H.new_dictionary()
commands[dbgp.RUN] = 'Run'
commands[dbgp.STEP_OVER] = 'Step Over'
commands[dbgp.STEP_INTO] = 'Step Into'
commands[dbgp.STEP_OUT] = 'Step Out'
commands[dbgp.STOP] = 'Stop'
commands[dbgp.DETACH] = 'Detach'
command_index = H.dictionary_keys(commands)
command_options = H.dictionary_values(commands)
def run(self, command=None):
if not command or not command in self.commands:
self.window.show_quick_panel(self.command_options, self.callback)
else:
self.callback(command)
def callback(self, command):
if command == -1 or S.SESSION_BUSY:
return
if isinstance(command, int):
command = self.command_index[command]
self.window.run_command('xdebug_execute', {'command': command})
def is_enabled(self):
return S.BREAKPOINT_ROW is not None and session.is_connected()
def is_visible(self):
return S.BREAKPOINT_ROW is not None and session.is_connected()
class XdebugStatusCommand(sublime_plugin.WindowCommand):
"""
Get status from debugger engine.
"""
def run(self):
async_session = session.SocketHandler(session.ACTION_STATUS)
async_session.start()
def is_enabled(self):
return session.is_connected()
def is_visible(self):
return session.is_connected()
class XdebugEvaluateCommand(sublime_plugin.WindowCommand):
def run(self):
self.window.show_input_panel('Evaluate', '', self.on_done, self.on_change, self.on_cancel)
def on_done(self, expression):
async_session = session.SocketHandler(session.ACTION_EVALUATE, expression=expression)
async_session.start()
def on_change(self, expression):
pass
def on_cancel(self):
pass
def is_enabled(self):
return session.is_connected()
def is_visible(self):
return session.is_connected()
class XdebugUserExecuteCommand(sublime_plugin.WindowCommand):
"""
Open input panel, allowing user to execute arbitrary command according to DBGp protocol.
Note: Transaction ID is automatically generated by session module.
"""
def run(self):
self.window.show_input_panel('DBGp command', '', self.on_done, self.on_change, self.on_cancel)
def on_done(self, line):
# Split command and arguments, define arguments when only command is defined.
if ' ' in line:
command, args = line.split(' ', 1)
else:
command, args = line, ''
async_session = session.SocketHandler(session.ACTION_USER_EXECUTE, command=command, args=args)
async_session.start()
def on_change(self, line):
pass
def on_cancel(self):
pass
def is_enabled(self):
return session.is_connected()
def is_visible(self):
return session.is_connected()
class XdebugWatchCommand(sublime_plugin.WindowCommand):
"""
Add/Edit/Remove watch expression.
"""
def run(self, clear=False, edit=False, remove=False, update=False):
self.edit = edit
self.remove = remove
self.watch_index = None
# Clear watch expressions in list
if clear:
try:
# Python 3.3+
S.WATCH.clear()
except AttributeError:
del S.WATCH[:]
# Update watch view
self.update_view()
# Edit or remove watch expression
elif edit or remove:
# Generate list with available watch expressions
watch_options = []
for index, item in enumerate(S.WATCH):
watch_item = '[{status}] - {expression}'.format(index=index, expression=item['expression'], status='enabled' if item['enabled'] else 'disabled')
watch_options.append(watch_item)
self.window.show_quick_panel(watch_options, self.callback)
elif update:
self.update_view()
# Set watch expression
else:
self.set_expression()
def callback(self, index):
# User has cancelled action
if index == -1:
return
# Make sure index is valid integer
if isinstance(index, int) or H.is_digit(index):
self.watch_index = int(index)
# Edit watch expression
if self.edit:
self.set_expression()
# Remove watch expression
else:
S.WATCH.pop(self.watch_index)
# Update watch view
self.update_view()
def on_done(self, expression):
# User did not set expression
if not expression:
return
# Check if expression is not already defined
matches = [x for x in S.WATCH if x['expression'] == expression]
if matches:
sublime.status_message('Xdebug: Watch expression already defined.')
return
# Add/Edit watch expression in session
watch = {'expression': expression, 'enabled': True, 'value': None, 'type': None}
if self.watch_index is not None and isinstance(self.watch_index, int):
try:
S.WATCH[self.watch_index]['expression'] = expression
except:
S.WATCH.insert(self.watch_index, watch)
else:
S.WATCH.append(watch)
# Update watch view
self.update_view()
def on_change(self, line):
pass
def on_cancel(self):
pass
def set_expression(self):
# Show user input for setting watch expression
self.window.show_input_panel('Watch expression', '', self.on_done, self.on_change, self.on_cancel)
def update_view(self):
async_session = session.SocketHandler(session.ACTION_WATCH, check_watch_view=True)
async_session.start()
# Save watch data to file
util.save_watch_data()
def is_visible(self, clear=False, edit=False, remove=False):
if (clear or edit or remove) and not S.WATCH:
return False
return True
class XdebugViewUpdateCommand(sublime_plugin.TextCommand):
"""
Update content of sublime.Edit object in view, instead of using begin_edit/end_edit.
Keyword arguments:
data -- Content data to populate sublime.Edit object with.
readonly -- Make sublime.Edit object read only.
"""
def run(self, edit, data=None, readonly=False):
view = self.view
view.set_read_only(False)
view.erase(edit, sublime.Region(0, view.size()))
if data is not None:
view.insert(edit, 0, data)
if readonly:
view.set_read_only(True)
class XdebugLayoutCommand(sublime_plugin.WindowCommand):
"""
Toggle between debug and default window layouts.
"""
def run(self, restore=False, close_windows=False, keymap=False):
# Get active window
window = sublime.active_window()
# Do not restore layout or close windows while debugging
if S.SESSION and (restore or close_windows or keymap):
return
# Set layout, unless user disabled debug layout
if not config.get_value(S.KEY_DISABLE_LAYOUT):
if restore or keymap:
V.set_layout('normal')
else:
V.set_layout('debug')
# Close all debugging related windows
if close_windows or restore or keymap:
V.close_debug_windows()
return
# Reset data in debugging related windows
V.show_content(V.DATA_BREAKPOINT)
V.show_content(V.DATA_CONTEXT)
V.show_content(V.DATA_STACK)
V.show_content(V.DATA_WATCH)
panel = window.get_output_panel('xdebug')
panel.run_command("xdebug_view_update")
# Close output panel
window.run_command('hide_panel', {"panel": 'output.xdebug'})
def is_enabled(self, restore=False, close_windows=False):
disable_layout = config.get_value(S.KEY_DISABLE_LAYOUT)
if close_windows and (not disable_layout or not V.has_debug_view()):
return False
if restore and disable_layout:
return False
return True
def is_visible(self, restore=False, close_windows=False):
if S.SESSION:
return False
disable_layout = config.get_value(S.KEY_DISABLE_LAYOUT)
if close_windows and (not disable_layout or not V.has_debug_view()):
return False
if restore and disable_layout:
return False
if restore:
try:
return sublime.active_window().get_layout() == config.get_value(S.KEY_DEBUG_LAYOUT, S.LAYOUT_DEBUG)
except:
pass
return True
class XdebugSettingsCommand(sublime_plugin.WindowCommand):
"""
Show settings file.
"""
def run(self, default=True):
# Show default settings in package when available
if default and S.PACKAGE_FOLDER is not None:
package = S.PACKAGE_FOLDER
# Otherwise show User defined settings
else:
package = "User"
# Strip .sublime-package of package name for syntax file
package_extension = ".sublime-package"
if package.endswith(package_extension):
package = package[:-len(package_extension)]
# Open settings file
self.window.run_command('open_file', {'file': '${packages}/' + package + '/' + S.FILE_PACKAGE_SETTINGS });
########NEW FILE########
__FILENAME__ = config
import sublime
# Settings variables
try:
from . import settings as S
except:
import settings as S
def load_project_values():
try:
settings = sublime.active_window().active_view().settings()
# Use 'xdebug' as key which contains dictionary with project values for package
S.CONFIG_PROJECT = settings.get(S.KEY_XDEBUG)
except:
pass
def load_package_values():
# Clear previous settings
config = {}
try:
# Load default/user package settings
settings = sublime.load_settings(S.FILE_PACKAGE_SETTINGS)
# Loop through all configuration keys
for key in S.CONFIG_KEYS:
# Set in config if available
if settings and settings.has(key):
config[key] = settings.get(key)
except:
pass
# Set settings in memory
S.CONFIG_PACKAGE = config
def get_value(key, default_value=None):
"""
Get value from package/project configuration settings.
"""
# Get value from project configuration
value = get_project_value(key)
# Use package configuration when value has not been found
if value is None:
value = get_package_value(key)
# Return package/project value
if value is not None:
return value
# Otherwise use default value
return default_value
def get_package_value(key, default_value=None):
"""
Get value from default/user package configuration settings.
"""
try:
config = sublime.load_settings(S.FILE_PACKAGE_SETTINGS)
if config and config.has(key):
return config.get(key)
except RuntimeError:
sublime.set_timeout(lambda: load_package_values(), 0)
if S.CONFIG_PACKAGE:
if key in S.CONFIG_PACKAGE:
return S.CONFIG_PACKAGE[key]
return default_value
def get_project_value(key, default_value=None):
"""
Get value from project configuration settings.
"""
# Load project coniguration settings
try:
load_project_values()
except RuntimeError:
sublime.set_timeout(lambda: load_project_values(), 0)
# Find value in project configuration
if S.CONFIG_PROJECT:
if key in S.CONFIG_PROJECT:
return S.CONFIG_PROJECT[key]
# Otherwise use default value
return default_value
def get_window_value(key, default_value=None):
"""
Get value from window session settings.
NOTE: Window object in Sublime Text 2 has no Settings.
"""
try:
settings = sublime.active_window().settings()
if settings.has(S.KEY_XDEBUG):
xdebug = settings.get(S.KEY_XDEBUG)
if isinstance(xdebug, dict) and key in xdebug.keys():
return xdebug[key]
except:
pass
return default_value
def set_package_value(key, value=None):
"""
Set value in package configuration settings.
"""
try:
config = sublime.load_settings(S.FILE_PACKAGE_SETTINGS)
if value is not None:
config.set(key, value)
elif config and config.has(key):
return config.erase(key)
except:
pass
def set_project_value(key, value=None):
"""
Set value in project configuration settings.
"""
# Unable to set project value if no project file
if not sublime.active_window().project_file_name():
return False
# Get current project data
project = sublime.active_window().project_data()
# Make sure project data is a dictionary
if not isinstance(project, dict):
project = {}
# Create settings entries if they are undefined
if S.KEY_SETTINGS not in project.keys() or not isinstance(project[S.KEY_SETTINGS], dict):
project[S.KEY_SETTINGS] = {}
if S.KEY_XDEBUG not in project[S.KEY_SETTINGS].keys() or not isinstance(project[S.KEY_SETTINGS][S.KEY_XDEBUG], dict):
project[S.KEY_SETTINGS][S.KEY_XDEBUG] = {}
# Update Xdebug settings
if value is not None:
project[S.KEY_SETTINGS][S.KEY_XDEBUG][key] = value
elif key in project[S.KEY_SETTINGS][S.KEY_XDEBUG].keys():
del project[S.KEY_SETTINGS][S.KEY_XDEBUG][key]
# Save project data
sublime.active_window().set_project_data(project)
return True
def set_window_value(key, value=None):
"""
Set value in window session settings.
NOTE: Window object in Sublime Text 2 has no Settings.
"""
try:
settings = sublime.active_window().settings()
if settings.has(S.KEY_XDEBUG):
xdebug = settings.get(S.KEY_XDEBUG)
else:
xdebug = {}
if value is not None:
xdebug[key] = value
elif key in xdebug.keys():
del xdebug[key]
settings.set(S.KEY_XDEBUG, xdebug)
except:
pass
########NEW FILE########
__FILENAME__ = dbgp
"""
Status and feature management commands
"""
STATUS = 'status';
FEATURE_GET = 'feature_get';
FEATURE_SET = 'feature_set';
FEATURE_NAME_MAXCHILDREN = 'max_children'
FEATURE_NAME_MAXDATA = 'max_data'
FEATURE_NAME_MAXDEPTH = 'max_depth'
"""
Continuation commands
"""
RUN = 'run';
STEP_INTO = 'step_into';
STEP_OVER = 'step_over';
STEP_OUT = 'step_out';
STOP = 'stop';
DETACH = 'detach';
"""
Breakpoint commands
"""
BREAKPOINT_SET = 'breakpoint_set'
BREAKPOINT_GET = 'breakpoint_get'
BREAKPOINT_UPDATE = 'breakpoint_update'
BREAKPOINT_REMOVE = 'breakpoint_remove'
BREAKPOINT_LIST = 'breakpoint_list'
"""
Context/Stack/Property commands
"""
CONTEXT_NAMES = 'context_names'
CONTEXT_GET = 'context_get'
STACK_DEPTH = 'stack-depth'
STACK_GET = 'stack_get'
PROPERTY_GET = 'property_get'
PROPERTY_SET = 'property_set'
PROPERTY_VALUE = 'property_value'
"""
Extendend commands
"""
STDIN = 'stdin'
BREAK = 'break'
EVAL = 'eval'
EXPR = 'expr'
EXEC = 'exec'
"""
Status codes
"""
STATUS_STARTING = 'starting';
STATUS_STOPPING = 'stopping';
STATUS_STOPPED = 'stopped';
STATUS_RUNNING = 'running';
STATUS_BREAK = 'break';
"""
Reason codes
"""
REASON_OK = 'ok';
REASON_ERROR = 'error';
REASON_ABORTED = 'aborted';
REASON_EXCEPTION = 'exception';
"""
Response attributes/elements
"""
ATTRIBUTE_STATUS = 'status'
ATTRIBUTE_REASON = 'reason'
ATTRIBUTE_SUCCESS = 'success'
ATTRIBUTE_BREAKPOINT_ID = 'id'
ELEMENT_INIT = 'init'
ELEMENT_BREAKPOINT = 'xdebug:message'
ELEMENT_ERROR = 'error'
ELEMENT_MESSAGE = 'message'
ELEMENT_PROPERTY = 'property'
ELEMENT_STACK = 'stack'
ELEMENT_PATH_INIT = '{urn:debugger_protocol_v1}init'
ELEMENT_PATH_BREAKPOINT = '{http://xdebug.org/dbgp/xdebug}message'
ELEMENT_PATH_ERROR = '{urn:debugger_protocol_v1}error'
ELEMENT_PATH_MESSAGE = '{urn:debugger_protocol_v1}message'
ELEMENT_PATH_PROPERTY = '{urn:debugger_protocol_v1}property'
ELEMENT_PATH_STACK = '{urn:debugger_protocol_v1}stack'
"""
Initialization attributes
"""
INIT_APPID = 'appid'
INIT_IDEKEY = 'idekey'
INIT_SESSION = 'session'
INIT_THREAD = 'thread'
INIT_PARENT = 'parent'
INIT_LANGUAGE = 'language'
INIT_PROTOCOL_VERSION = 'protocol_version'
INIT_FILEURI = 'fileuri'
"""
Breakpoint atrributes
"""
BREAKPOINT_TYPE = 'type'
BREAKPOINT_FILENAME = 'filename'
BREAKPOINT_LINENO = 'lineno'
BREAKPOINT_STATE = 'state'
BREAKPOINT_FUNCTION = 'function'
BREAKPOINT_TEMPORARY = 'temporary'
BREAKPOINT_HIT_COUNT = 'hit_count'
BREAKPOINT_HIT_VALUE = 'hit_value'
BREAKPOINT_HIT_CONDITION = 'hit_condition'
BREAKPOINT_EXCEPTION = 'exception'
BREAKPOINT_EXPRESSION = 'expression'
"""
Property attributes
"""
PROPERTY_NAME = 'name'
PROPERTY_FULLNAME = 'fullname'
PROPERTY_CLASSNAME = 'classname'
PROPERTY_PAGE = 'page'
PROPERTY_PAGESIZE = 'pagesize'
PROPERTY_TYPE = 'type'
PROPERTY_FACET = 'facet'
PROPERTY_SIZE = 'size'
PROPERTY_CHILDREN = 'children'
PROPERTY_NUMCHILDREN = 'numchildren'
PROPERTY_KEY = 'key'
PROPERTY_ADDRESS = 'address'
PROPERTY_ENCODING = 'encoding'
"""
Stack attributes
"""
STACK_LEVEL = 'level'
STACK_TYPE = 'type'
STACK_FILENAME = 'filename'
STACK_LINENO = 'lineno'
STACK_WHERE = 'where'
STACK_CMDBEGIN = 'cmdbegin'
STACK_CMDEND = 'cmdend'
########NEW FILE########
__FILENAME__ = ElementInclude
#
# ElementTree
# $Id: ElementInclude.py 1862 2004-06-18 07:31:02Z Fredrik $
#
# limited xinclude support for element trees
#
# history:
# 2003-08-15 fl created
# 2003-11-14 fl fixed default loader
#
# Copyright (c) 2003-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Limited XInclude support for the ElementTree package.
##
import copy
import ElementTree
XINCLUDE = "{http://www.w3.org/2001/XInclude}"
XINCLUDE_INCLUDE = XINCLUDE + "include"
XINCLUDE_FALLBACK = XINCLUDE + "fallback"
##
# Fatal include error.
class FatalIncludeError(SyntaxError):
pass
##
# Default loader. This loader reads an included resource from disk.
#
# @param href Resource reference.
# @param parse Parse mode. Either "xml" or "text".
# @param encoding Optional text encoding.
# @return The expanded resource. If the parse mode is "xml", this
# is an ElementTree instance. If the parse mode is "text", this
# is a Unicode string. If the loader fails, it can return None
# or raise an IOError exception.
# @throws IOError If the loader fails to load the resource.
def default_loader(href, parse, encoding=None):
file = open(href)
if parse == "xml":
data = ElementTree.parse(file).getroot()
else:
data = file.read()
if encoding:
data = data.decode(encoding)
file.close()
return data
##
# Expand XInclude directives.
#
# @param elem Root element.
# @param loader Optional resource loader. If omitted, it defaults
# to {@link default_loader}. If given, it should be a callable
# that implements the same interface as <b>default_loader</b>.
# @throws FatalIncludeError If the function fails to include a given
# resource, or if the tree contains malformed XInclude elements.
# @throws IOError If the function fails to load a given resource.
def include(elem, loader=None):
if loader is None:
loader = default_loader
# look for xinclude elements
i = 0
while i < len(elem):
e = elem[i]
if e.tag == XINCLUDE_INCLUDE:
# process xinclude directive
href = e.get("href")
parse = e.get("parse", "xml")
if parse == "xml":
node = loader(href, parse)
if node is None:
raise FatalIncludeError(
"cannot load %r as %r" % (href, parse)
)
node = copy.copy(node)
if e.tail:
node.tail = (node.tail or "") + e.tail
elem[i] = node
elif parse == "text":
text = loader(href, parse, e.get("encoding"))
if text is None:
raise FatalIncludeError(
"cannot load %r as %r" % (href, parse)
)
if i:
node = elem[i-1]
node.tail = (node.tail or "") + text
else:
elem.text = (elem.text or "") + text + (e.tail or "")
del elem[i]
continue
else:
raise FatalIncludeError(
"unknown parse type in xi:include tag (%r)" % parse
)
elif e.tag == XINCLUDE_FALLBACK:
raise FatalIncludeError(
"xi:fallback tag must be child of xi:include (%r)" % e.tag
)
else:
include(e, loader)
i = i + 1
########NEW FILE########
__FILENAME__ = ElementPath
#
# ElementTree
# $Id: ElementPath.py 1858 2004-06-17 21:31:41Z Fredrik $
#
# limited xpath support for element trees
#
# history:
# 2003-05-23 fl created
# 2003-05-28 fl added support for // etc
# 2003-08-27 fl fixed parsing of periods in element names
#
# Copyright (c) 2003-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Implementation module for XPath support. There's usually no reason
# to import this module directly; the <b>ElementTree</b> does this for
# you, if needed.
##
import re
xpath_tokenizer = re.compile(
"(::|\.\.|\(\)|[/.*:\[\]\(\)@=])|((?:\{[^}]+\})?[^/:\[\]\(\)@=\s]+)|\s+"
).findall
class xpath_descendant_or_self:
pass
##
# Wrapper for a compiled XPath.
class Path:
##
# Create an Path instance from an XPath expression.
def __init__(self, path):
tokens = xpath_tokenizer(path)
# the current version supports 'path/path'-style expressions only
self.path = []
self.tag = None
if tokens and tokens[0][0] == "/":
raise SyntaxError("cannot use absolute path on element")
while tokens:
op, tag = tokens.pop(0)
if tag or op == "*":
self.path.append(tag or op)
elif op == ".":
pass
elif op == "/":
self.path.append(xpath_descendant_or_self())
continue
else:
raise SyntaxError("unsupported path syntax (%s)" % op)
if tokens:
op, tag = tokens.pop(0)
if op != "/":
raise SyntaxError(
"expected path separator (%s)" % (op or tag)
)
if self.path and isinstance(self.path[-1], xpath_descendant_or_self):
raise SyntaxError("path cannot end with //")
if len(self.path) == 1 and isinstance(self.path[0], type("")):
self.tag = self.path[0]
##
# Find first matching object.
def find(self, element):
tag = self.tag
if tag is None:
nodeset = self.findall(element)
if not nodeset:
return None
return nodeset[0]
for elem in element:
if elem.tag == tag:
return elem
return None
##
# Find text for first matching object.
def findtext(self, element, default=None):
tag = self.tag
if tag is None:
nodeset = self.findall(element)
if not nodeset:
return default
return nodeset[0].text or ""
for elem in element:
if elem.tag == tag:
return elem.text or ""
return default
##
# Find all matching objects.
def findall(self, element):
nodeset = [element]
index = 0
while 1:
try:
path = self.path[index]
index = index + 1
except IndexError:
return nodeset
set = []
if isinstance(path, xpath_descendant_or_self):
try:
tag = self.path[index]
if not isinstance(tag, type("")):
tag = None
else:
index = index + 1
except IndexError:
tag = None # invalid path
for node in nodeset:
new = list(node.getiterator(tag))
if new and new[0] is node:
set.extend(new[1:])
else:
set.extend(new)
else:
for node in nodeset:
for node in node:
if path == "*" or node.tag == path:
set.append(node)
if not set:
return []
nodeset = set
_cache = {}
##
# (Internal) Compile path.
def _compile(path):
p = _cache.get(path)
if p is not None:
return p
p = Path(path)
if len(_cache) >= 100:
_cache.clear()
_cache[path] = p
return p
##
# Find first matching object.
def find(element, path):
return _compile(path).find(element)
##
# Find text for first matching object.
def findtext(element, path, default=None):
return _compile(path).findtext(element, default)
##
# Find all matching objects.
def findall(element, path):
return _compile(path).findall(element)
########NEW FILE########
__FILENAME__ = ElementTree
#
# ElementTree
# $Id: ElementTree.py 2326 2005-03-17 07:45:21Z fredrik $
#
# light-weight XML support for Python 1.5.2 and later.
#
# history:
# 2001-10-20 fl created (from various sources)
# 2001-11-01 fl return root from parse method
# 2002-02-16 fl sort attributes in lexical order
# 2002-04-06 fl TreeBuilder refactoring, added PythonDoc markup
# 2002-05-01 fl finished TreeBuilder refactoring
# 2002-07-14 fl added basic namespace support to ElementTree.write
# 2002-07-25 fl added QName attribute support
# 2002-10-20 fl fixed encoding in write
# 2002-11-24 fl changed default encoding to ascii; fixed attribute encoding
# 2002-11-27 fl accept file objects or file names for parse/write
# 2002-12-04 fl moved XMLTreeBuilder back to this module
# 2003-01-11 fl fixed entity encoding glitch for us-ascii
# 2003-02-13 fl added XML literal factory
# 2003-02-21 fl added ProcessingInstruction/PI factory
# 2003-05-11 fl added tostring/fromstring helpers
# 2003-05-26 fl added ElementPath support
# 2003-07-05 fl added makeelement factory method
# 2003-07-28 fl added more well-known namespace prefixes
# 2003-08-15 fl fixed typo in ElementTree.findtext (Thomas Dartsch)
# 2003-09-04 fl fall back on emulator if ElementPath is not installed
# 2003-10-31 fl markup updates
# 2003-11-15 fl fixed nested namespace bug
# 2004-03-28 fl added XMLID helper
# 2004-06-02 fl added default support to findtext
# 2004-06-08 fl fixed encoding of non-ascii element/attribute names
# 2004-08-23 fl take advantage of post-2.1 expat features
# 2005-02-01 fl added iterparse implementation
# 2005-03-02 fl fixed iterparse support for pre-2.2 versions
#
# Copyright (c) 1999-2005 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2005 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
__all__ = [
# public symbols
"Comment",
"dump",
"Element", "ElementTree",
"fromstring",
"iselement", "iterparse",
"parse",
"PI", "ProcessingInstruction",
"QName",
"SubElement",
"tostring",
"TreeBuilder",
"VERSION", "XML",
"XMLTreeBuilder",
]
##
# The <b>Element</b> type is a flexible container object, designed to
# store hierarchical data structures in memory. The type can be
# described as a cross between a list and a dictionary.
# <p>
# Each element has a number of properties associated with it:
# <ul>
# <li>a <i>tag</i>. This is a string identifying what kind of data
# this element represents (the element type, in other words).</li>
# <li>a number of <i>attributes</i>, stored in a Python dictionary.</li>
# <li>a <i>text</i> string.</li>
# <li>an optional <i>tail</i> string.</li>
# <li>a number of <i>child elements</i>, stored in a Python sequence</li>
# </ul>
#
# To create an element instance, use the {@link #Element} or {@link
# #SubElement} factory functions.
# <p>
# The {@link #ElementTree} class can be used to wrap an element
# structure, and convert it from and to XML.
##
import string, sys, re
class _SimpleElementPath:
# emulate pre-1.2 find/findtext/findall behaviour
def find(self, element, tag):
for elem in element:
if elem.tag == tag:
return elem
return None
def findtext(self, element, tag, default=None):
for elem in element:
if elem.tag == tag:
return elem.text or ""
return default
def findall(self, element, tag):
if tag[:3] == ".//":
return element.getiterator(tag[3:])
result = []
for elem in element:
if elem.tag == tag:
result.append(elem)
return result
try:
import ElementPath
except ImportError:
# FIXME: issue warning in this case?
ElementPath = _SimpleElementPath()
# TODO: add support for custom namespace resolvers/default namespaces
# TODO: add improved support for incremental parsing
VERSION = "1.2.6"
##
# Internal element class. This class defines the Element interface,
# and provides a reference implementation of this interface.
# <p>
# You should not create instances of this class directly. Use the
# appropriate factory functions instead, such as {@link #Element}
# and {@link #SubElement}.
#
# @see Element
# @see SubElement
# @see Comment
# @see ProcessingInstruction
class _ElementInterface:
# <tag attrib>text<child/>...</tag>tail
##
# (Attribute) Element tag.
tag = None
##
# (Attribute) Element attribute dictionary. Where possible, use
# {@link #_ElementInterface.get},
# {@link #_ElementInterface.set},
# {@link #_ElementInterface.keys}, and
# {@link #_ElementInterface.items} to access
# element attributes.
attrib = None
##
# (Attribute) Text before first subelement. This is either a
# string or the value None, if there was no text.
text = None
##
# (Attribute) Text after this element's end tag, but before the
# next sibling element's start tag. This is either a string or
# the value None, if there was no text.
tail = None # text after end tag, if any
def __init__(self, tag, attrib):
self.tag = tag
self.attrib = attrib
self._children = []
def __repr__(self):
return "<Element %s at %x>" % (self.tag, id(self))
##
# Creates a new element object of the same type as this element.
#
# @param tag Element tag.
# @param attrib Element attributes, given as a dictionary.
# @return A new element instance.
def makeelement(self, tag, attrib):
return Element(tag, attrib)
##
# Returns the number of subelements.
#
# @return The number of subelements.
def __len__(self):
return len(self._children)
##
# Returns the given subelement.
#
# @param index What subelement to return.
# @return The given subelement.
# @exception IndexError If the given element does not exist.
def __getitem__(self, index):
return self._children[index]
##
# Replaces the given subelement.
#
# @param index What subelement to replace.
# @param element The new element value.
# @exception IndexError If the given element does not exist.
# @exception AssertionError If element is not a valid object.
def __setitem__(self, index, element):
assert iselement(element)
self._children[index] = element
##
# Deletes the given subelement.
#
# @param index What subelement to delete.
# @exception IndexError If the given element does not exist.
def __delitem__(self, index):
del self._children[index]
##
# Returns a list containing subelements in the given range.
#
# @param start The first subelement to return.
# @param stop The first subelement that shouldn't be returned.
# @return A sequence object containing subelements.
def __getslice__(self, start, stop):
return self._children[start:stop]
##
# Replaces a number of subelements with elements from a sequence.
#
# @param start The first subelement to replace.
# @param stop The first subelement that shouldn't be replaced.
# @param elements A sequence object with zero or more elements.
# @exception AssertionError If a sequence member is not a valid object.
def __setslice__(self, start, stop, elements):
for element in elements:
assert iselement(element)
self._children[start:stop] = list(elements)
##
# Deletes a number of subelements.
#
# @param start The first subelement to delete.
# @param stop The first subelement to leave in there.
def __delslice__(self, start, stop):
del self._children[start:stop]
##
# Adds a subelement to the end of this element.
#
# @param element The element to add.
# @exception AssertionError If a sequence member is not a valid object.
def append(self, element):
assert iselement(element)
self._children.append(element)
##
# Inserts a subelement at the given position in this element.
#
# @param index Where to insert the new subelement.
# @exception AssertionError If the element is not a valid object.
def insert(self, index, element):
assert iselement(element)
self._children.insert(index, element)
##
# Removes a matching subelement. Unlike the <b>find</b> methods,
# this method compares elements based on identity, not on tag
# value or contents.
#
# @param element What element to remove.
# @exception ValueError If a matching element could not be found.
# @exception AssertionError If the element is not a valid object.
def remove(self, element):
assert iselement(element)
self._children.remove(element)
##
# Returns all subelements. The elements are returned in document
# order.
#
# @return A list of subelements.
# @defreturn list of Element instances
def getchildren(self):
return self._children
##
# Finds the first matching subelement, by tag name or path.
#
# @param path What element to look for.
# @return The first matching element, or None if no element was found.
# @defreturn Element or None
def find(self, path):
return ElementPath.find(self, path)
##
# Finds text for the first matching subelement, by tag name or path.
#
# @param path What element to look for.
# @param default What to return if the element was not found.
# @return The text content of the first matching element, or the
# default value no element was found. Note that if the element
# has is found, but has no text content, this method returns an
# empty string.
# @defreturn string
def findtext(self, path, default=None):
return ElementPath.findtext(self, path, default)
##
# Finds all matching subelements, by tag name or path.
#
# @param path What element to look for.
# @return A list or iterator containing all matching elements,
# in document order.
# @defreturn list of Element instances
def findall(self, path):
return ElementPath.findall(self, path)
##
# Resets an element. This function removes all subelements, clears
# all attributes, and sets the text and tail attributes to None.
def clear(self):
self.attrib.clear()
self._children = []
self.text = self.tail = None
##
# Gets an element attribute.
#
# @param key What attribute to look for.
# @param default What to return if the attribute was not found.
# @return The attribute value, or the default value, if the
# attribute was not found.
# @defreturn string or None
def get(self, key, default=None):
return self.attrib.get(key, default)
##
# Sets an element attribute.
#
# @param key What attribute to set.
# @param value The attribute value.
def set(self, key, value):
self.attrib[key] = value
##
# Gets a list of attribute names. The names are returned in an
# arbitrary order (just like for an ordinary Python dictionary).
#
# @return A list of element attribute names.
# @defreturn list of strings
def keys(self):
return self.attrib.keys()
##
# Gets element attributes, as a sequence. The attributes are
# returned in an arbitrary order.
#
# @return A list of (name, value) tuples for all attributes.
# @defreturn list of (string, string) tuples
def items(self):
return self.attrib.items()
##
# Creates a tree iterator. The iterator loops over this element
# and all subelements, in document order, and returns all elements
# with a matching tag.
# <p>
# If the tree structure is modified during iteration, the result
# is undefined.
#
# @param tag What tags to look for (default is to return all elements).
# @return A list or iterator containing all the matching elements.
# @defreturn list or iterator
def getiterator(self, tag=None):
nodes = []
if tag == "*":
tag = None
if tag is None or self.tag == tag:
nodes.append(self)
for node in self._children:
nodes.extend(node.getiterator(tag))
return nodes
# compatibility
_Element = _ElementInterface
##
# Element factory. This function returns an object implementing the
# standard Element interface. The exact class or type of that object
# is implementation dependent, but it will always be compatible with
# the {@link #_ElementInterface} class in this module.
# <p>
# The element name, attribute names, and attribute values can be
# either 8-bit ASCII strings or Unicode strings.
#
# @param tag The element name.
# @param attrib An optional dictionary, containing element attributes.
# @param **extra Additional attributes, given as keyword arguments.
# @return An element instance.
# @defreturn Element
def Element(tag, attrib={}, **extra):
attrib = attrib.copy()
attrib.update(extra)
return _ElementInterface(tag, attrib)
##
# Subelement factory. This function creates an element instance, and
# appends it to an existing element.
# <p>
# The element name, attribute names, and attribute values can be
# either 8-bit ASCII strings or Unicode strings.
#
# @param parent The parent element.
# @param tag The subelement name.
# @param attrib An optional dictionary, containing element attributes.
# @param **extra Additional attributes, given as keyword arguments.
# @return An element instance.
# @defreturn Element
def SubElement(parent, tag, attrib={}, **extra):
attrib = attrib.copy()
attrib.update(extra)
element = parent.makeelement(tag, attrib)
parent.append(element)
return element
##
# Comment element factory. This factory function creates a special
# element that will be serialized as an XML comment.
# <p>
# The comment string can be either an 8-bit ASCII string or a Unicode
# string.
#
# @param text A string containing the comment string.
# @return An element instance, representing a comment.
# @defreturn Element
def Comment(text=None):
element = Element(Comment)
element.text = text
return element
##
# PI element factory. This factory function creates a special element
# that will be serialized as an XML processing instruction.
#
# @param target A string containing the PI target.
# @param text A string containing the PI contents, if any.
# @return An element instance, representing a PI.
# @defreturn Element
def ProcessingInstruction(target, text=None):
element = Element(ProcessingInstruction)
element.text = target
if text:
element.text = element.text + " " + text
return element
PI = ProcessingInstruction
##
# QName wrapper. This can be used to wrap a QName attribute value, in
# order to get proper namespace handling on output.
#
# @param text A string containing the QName value, in the form {uri}local,
# or, if the tag argument is given, the URI part of a QName.
# @param tag Optional tag. If given, the first argument is interpreted as
# an URI, and this argument is interpreted as a local name.
# @return An opaque object, representing the QName.
class QName:
def __init__(self, text_or_uri, tag=None):
if tag:
text_or_uri = "{%s}%s" % (text_or_uri, tag)
self.text = text_or_uri
def __str__(self):
return self.text
def __hash__(self):
return hash(self.text)
def __cmp__(self, other):
if isinstance(other, QName):
return cmp(self.text, other.text)
return cmp(self.text, other)
##
# ElementTree wrapper class. This class represents an entire element
# hierarchy, and adds some extra support for serialization to and from
# standard XML.
#
# @param element Optional root element.
# @keyparam file Optional file handle or name. If given, the
# tree is initialized with the contents of this XML file.
class ElementTree:
def __init__(self, element=None, file=None):
assert element is None or iselement(element)
self._root = element # first node
if file:
self.parse(file)
##
# Gets the root element for this tree.
#
# @return An element instance.
# @defreturn Element
def getroot(self):
return self._root
##
# Replaces the root element for this tree. This discards the
# current contents of the tree, and replaces it with the given
# element. Use with care.
#
# @param element An element instance.
def _setroot(self, element):
assert iselement(element)
self._root = element
##
# Loads an external XML document into this element tree.
#
# @param source A file name or file object.
# @param parser An optional parser instance. If not given, the
# standard {@link XMLTreeBuilder} parser is used.
# @return The document root element.
# @defreturn Element
def parse(self, source, parser=None):
if not hasattr(source, "read"):
source = open(source, "rb")
if not parser:
parser = XMLTreeBuilder()
while 1:
data = source.read(32768)
if not data:
break
parser.feed(data)
self._root = parser.close()
return self._root
##
# Creates a tree iterator for the root element. The iterator loops
# over all elements in this tree, in document order.
#
# @param tag What tags to look for (default is to return all elements)
# @return An iterator.
# @defreturn iterator
def getiterator(self, tag=None):
assert self._root is not None
return self._root.getiterator(tag)
##
# Finds the first toplevel element with given tag.
# Same as getroot().find(path).
#
# @param path What element to look for.
# @return The first matching element, or None if no element was found.
# @defreturn Element or None
def find(self, path):
assert self._root is not None
if path[:1] == "/":
path = "." + path
return self._root.find(path)
##
# Finds the element text for the first toplevel element with given
# tag. Same as getroot().findtext(path).
#
# @param path What toplevel element to look for.
# @param default What to return if the element was not found.
# @return The text content of the first matching element, or the
# default value no element was found. Note that if the element
# has is found, but has no text content, this method returns an
# empty string.
# @defreturn string
def findtext(self, path, default=None):
assert self._root is not None
if path[:1] == "/":
path = "." + path
return self._root.findtext(path, default)
##
# Finds all toplevel elements with the given tag.
# Same as getroot().findall(path).
#
# @param path What element to look for.
# @return A list or iterator containing all matching elements,
# in document order.
# @defreturn list of Element instances
def findall(self, path):
assert self._root is not None
if path[:1] == "/":
path = "." + path
return self._root.findall(path)
##
# Writes the element tree to a file, as XML.
#
# @param file A file name, or a file object opened for writing.
# @param encoding Optional output encoding (default is US-ASCII).
def write(self, file, encoding="us-ascii"):
assert self._root is not None
if not hasattr(file, "write"):
file = open(file, "wb")
if not encoding:
encoding = "us-ascii"
elif encoding != "utf-8" and encoding != "us-ascii":
file.write("<?xml version='1.0' encoding='%s'?>\n" % encoding)
self._write(file, self._root, encoding, {})
def _write(self, file, node, encoding, namespaces):
# write XML to file
tag = node.tag
if tag is Comment:
file.write("<!-- %s -->" % _escape_cdata(node.text, encoding))
elif tag is ProcessingInstruction:
file.write("<?%s?>" % _escape_cdata(node.text, encoding))
else:
items = node.items()
xmlns_items = [] # new namespaces in this scope
try:
if isinstance(tag, QName) or tag[:1] == "{":
tag, xmlns = fixtag(tag, namespaces)
if xmlns: xmlns_items.append(xmlns)
except TypeError:
_raise_serialization_error(tag)
file.write("<" + _encode(tag, encoding))
if items or xmlns_items:
items.sort() # lexical order
for k, v in items:
try:
if isinstance(k, QName) or k[:1] == "{":
k, xmlns = fixtag(k, namespaces)
if xmlns: xmlns_items.append(xmlns)
except TypeError:
_raise_serialization_error(k)
try:
if isinstance(v, QName):
v, xmlns = fixtag(v, namespaces)
if xmlns: xmlns_items.append(xmlns)
except TypeError:
_raise_serialization_error(v)
file.write(" %s=\"%s\"" % (_encode(k, encoding),
_escape_attrib(v, encoding)))
for k, v in xmlns_items:
file.write(" %s=\"%s\"" % (_encode(k, encoding),
_escape_attrib(v, encoding)))
if node.text or len(node):
file.write(">")
if node.text:
file.write(_escape_cdata(node.text, encoding))
for n in node:
self._write(file, n, encoding, namespaces)
file.write("</" + _encode(tag, encoding) + ">")
else:
file.write(" />")
for k, v in xmlns_items:
del namespaces[v]
if node.tail:
file.write(_escape_cdata(node.tail, encoding))
# --------------------------------------------------------------------
# helpers
##
# Checks if an object appears to be a valid element object.
#
# @param An element instance.
# @return A true value if this is an element object.
# @defreturn flag
def iselement(element):
# FIXME: not sure about this; might be a better idea to look
# for tag/attrib/text attributes
return isinstance(element, _ElementInterface) or hasattr(element, "tag")
##
# Writes an element tree or element structure to sys.stdout. This
# function should be used for debugging only.
# <p>
# The exact output format is implementation dependent. In this
# version, it's written as an ordinary XML file.
#
# @param elem An element tree or an individual element.
def dump(elem):
# debugging
if not isinstance(elem, ElementTree):
elem = ElementTree(elem)
elem.write(sys.stdout)
tail = elem.getroot().tail
if not tail or tail[-1] != "\n":
sys.stdout.write("\n")
def _encode(s, encoding):
try:
return s.encode(encoding)
except AttributeError:
return s # 1.5.2: assume the string uses the right encoding
if sys.version[:3] == "1.5":
_escape = re.compile(r"[&<>\"\x80-\xff]+") # 1.5.2
else:
_escape = re.compile(eval(r'u"[&<>\"\u0080-\uffff]+"'))
_escape_map = {
"&": "&",
"<": "<",
">": ">",
'"': """,
}
_namespace_map = {
# "well-known" namespace prefixes
"http://www.w3.org/XML/1998/namespace": "xml",
"http://www.w3.org/1999/xhtml": "html",
"http://www.w3.org/1999/02/22-rdf-syntax-ns#": "rdf",
"http://schemas.xmlsoap.org/wsdl/": "wsdl",
}
def _raise_serialization_error(text):
raise TypeError(
"cannot serialize %r (type %s)" % (text, type(text).__name__)
)
def _encode_entity(text, pattern=_escape):
# map reserved and non-ascii characters to numerical entities
def escape_entities(m, map=_escape_map):
out = []
append = out.append
for char in m.group():
text = map.get(char)
if text is None:
text = "&#%d;" % ord(char)
append(text)
return string.join(out, "")
try:
return _encode(pattern.sub(escape_entities, text), "ascii")
except TypeError:
_raise_serialization_error(text)
#
# the following functions assume an ascii-compatible encoding
# (or "utf-16")
def _escape_cdata(text, encoding=None, replace=string.replace):
# escape character data
try:
if encoding:
try:
text = _encode(text, encoding)
except UnicodeError:
return _encode_entity(text)
text = replace(text, "&", "&")
text = replace(text, "<", "<")
text = replace(text, ">", ">")
return text
except (TypeError, AttributeError):
_raise_serialization_error(text)
def _escape_attrib(text, encoding=None, replace=string.replace):
# escape attribute value
try:
if encoding:
try:
text = _encode(text, encoding)
except UnicodeError:
return _encode_entity(text)
text = replace(text, "&", "&")
text = replace(text, "'", "'") # FIXME: overkill
text = replace(text, "\"", """)
text = replace(text, "<", "<")
text = replace(text, ">", ">")
return text
except (TypeError, AttributeError):
_raise_serialization_error(text)
def fixtag(tag, namespaces):
# given a decorated tag (of the form {uri}tag), return prefixed
# tag and namespace declaration, if any
if isinstance(tag, QName):
tag = tag.text
namespace_uri, tag = string.split(tag[1:], "}", 1)
prefix = namespaces.get(namespace_uri)
if prefix is None:
prefix = _namespace_map.get(namespace_uri)
if prefix is None:
prefix = "ns%d" % len(namespaces)
namespaces[namespace_uri] = prefix
if prefix == "xml":
xmlns = None
else:
xmlns = ("xmlns:%s" % prefix, namespace_uri)
else:
xmlns = None
return "%s:%s" % (prefix, tag), xmlns
##
# Parses an XML document into an element tree.
#
# @param source A filename or file object containing XML data.
# @param parser An optional parser instance. If not given, the
# standard {@link XMLTreeBuilder} parser is used.
# @return An ElementTree instance
def parse(source, parser=None):
tree = ElementTree()
tree.parse(source, parser)
return tree
##
# Parses an XML document into an element tree incrementally, and reports
# what's going on to the user.
#
# @param source A filename or file object containing XML data.
# @param events A list of events to report back. If omitted, only "end"
# events are reported.
# @return A (event, elem) iterator.
class iterparse:
def __init__(self, source, events=None):
if not hasattr(source, "read"):
source = open(source, "rb")
self._file = source
self._events = []
self._index = 0
self.root = self._root = None
self._parser = XMLTreeBuilder()
# wire up the parser for event reporting
parser = self._parser._parser
append = self._events.append
if events is None:
events = ["end"]
for event in events:
if event == "start":
try:
parser.ordered_attributes = 1
parser.specified_attributes = 1
def handler(tag, attrib_in, event=event, append=append,
start=self._parser._start_list):
append((event, start(tag, attrib_in)))
parser.StartElementHandler = handler
except AttributeError:
def handler(tag, attrib_in, event=event, append=append,
start=self._parser._start):
append((event, start(tag, attrib_in)))
parser.StartElementHandler = handler
elif event == "end":
def handler(tag, event=event, append=append,
end=self._parser._end):
append((event, end(tag)))
parser.EndElementHandler = handler
elif event == "start-ns":
def handler(prefix, uri, event=event, append=append):
try:
uri = _encode(uri, "ascii")
except UnicodeError:
pass
append((event, (prefix or "", uri)))
parser.StartNamespaceDeclHandler = handler
elif event == "end-ns":
def handler(prefix, event=event, append=append):
append((event, None))
parser.EndNamespaceDeclHandler = handler
def next(self):
while 1:
try:
item = self._events[self._index]
except IndexError:
if self._parser is None:
self.root = self._root
try:
raise StopIteration
except NameError:
raise IndexError
# load event buffer
del self._events[:]
self._index = 0
data = self._file.read(16384)
if data:
self._parser.feed(data)
else:
self._root = self._parser.close()
self._parser = None
else:
self._index = self._index + 1
return item
try:
iter
def __iter__(self):
return self
except NameError:
def __getitem__(self, index):
return self.next()
##
# Parses an XML document from a string constant. This function can
# be used to embed "XML literals" in Python code.
#
# @param source A string containing XML data.
# @return An Element instance.
# @defreturn Element
def XML(text):
parser = XMLTreeBuilder()
parser.feed(text)
return parser.close()
##
# Parses an XML document from a string constant, and also returns
# a dictionary which maps from element id:s to elements.
#
# @param source A string containing XML data.
# @return A tuple containing an Element instance and a dictionary.
# @defreturn (Element, dictionary)
def XMLID(text):
parser = XMLTreeBuilder()
parser.feed(text)
tree = parser.close()
ids = {}
for elem in tree.getiterator():
id = elem.get("id")
if id:
ids[id] = elem
return tree, ids
##
# Parses an XML document from a string constant. Same as {@link #XML}.
#
# @def fromstring(text)
# @param source A string containing XML data.
# @return An Element instance.
# @defreturn Element
fromstring = XML
##
# Generates a string representation of an XML element, including all
# subelements.
#
# @param element An Element instance.
# @return An encoded string containing the XML data.
# @defreturn string
def tostring(element, encoding=None):
class dummy:
pass
data = []
file = dummy()
file.write = data.append
ElementTree(element).write(file, encoding)
return string.join(data, "")
##
# Generic element structure builder. This builder converts a sequence
# of {@link #TreeBuilder.start}, {@link #TreeBuilder.data}, and {@link
# #TreeBuilder.end} method calls to a well-formed element structure.
# <p>
# You can use this class to build an element structure using a custom XML
# parser, or a parser for some other XML-like format.
#
# @param element_factory Optional element factory. This factory
# is called to create new Element instances, as necessary.
class TreeBuilder:
def __init__(self, element_factory=None):
self._data = [] # data collector
self._elem = [] # element stack
self._last = None # last element
self._tail = None # true if we're after an end tag
if element_factory is None:
element_factory = _ElementInterface
self._factory = element_factory
##
# Flushes the parser buffers, and returns the toplevel documen
# element.
#
# @return An Element instance.
# @defreturn Element
def close(self):
assert len(self._elem) == 0, "missing end tags"
assert self._last != None, "missing toplevel element"
return self._last
def _flush(self):
if self._data:
if self._last is not None:
text = string.join(self._data, "")
if self._tail:
assert self._last.tail is None, "internal error (tail)"
self._last.tail = text
else:
assert self._last.text is None, "internal error (text)"
self._last.text = text
self._data = []
##
# Adds text to the current element.
#
# @param data A string. This should be either an 8-bit string
# containing ASCII text, or a Unicode string.
def data(self, data):
self._data.append(data)
##
# Opens a new element.
#
# @param tag The element name.
# @param attrib A dictionary containing element attributes.
# @return The opened element.
# @defreturn Element
def start(self, tag, attrs):
self._flush()
self._last = elem = self._factory(tag, attrs)
if self._elem:
self._elem[-1].append(elem)
self._elem.append(elem)
self._tail = 0
return elem
##
# Closes the current element.
#
# @param tag The element name.
# @return The closed element.
# @defreturn Element
def end(self, tag):
self._flush()
self._last = self._elem.pop()
assert self._last.tag == tag,\
"end tag mismatch (expected %s, got %s)" % (
self._last.tag, tag)
self._tail = 1
return self._last
##
# Element structure builder for XML source data, based on the
# <b>expat</b> parser.
#
# @keyparam target Target object. If omitted, the builder uses an
# instance of the standard {@link #TreeBuilder} class.
# @keyparam html Predefine HTML entities. This flag is not supported
# by the current implementation.
# @see #ElementTree
# @see #TreeBuilder
class XMLTreeBuilder:
def __init__(self, html=0, target=None):
try:
from xml.parsers import expat
except ImportError:
raise ImportError(
"No module named expat; use SimpleXMLTreeBuilder instead"
)
self._parser = parser = expat.ParserCreate(None, "}")
if target is None:
target = TreeBuilder()
self._target = target
self._names = {} # name memo cache
# callbacks
parser.DefaultHandlerExpand = self._default
parser.StartElementHandler = self._start
parser.EndElementHandler = self._end
parser.CharacterDataHandler = self._data
# let expat do the buffering, if supported
try:
self._parser.buffer_text = 1
except AttributeError:
pass
# use new-style attribute handling, if supported
try:
self._parser.ordered_attributes = 1
self._parser.specified_attributes = 1
parser.StartElementHandler = self._start_list
except AttributeError:
pass
encoding = None
if not parser.returns_unicode:
encoding = "utf-8"
# target.xml(encoding, None)
self._doctype = None
self.entity = {}
def _fixtext(self, text):
# convert text string to ascii, if possible
try:
return _encode(text, "ascii")
except UnicodeError:
return text
def _fixname(self, key):
# expand qname, and convert name string to ascii, if possible
try:
name = self._names[key]
except KeyError:
name = key
if "}" in name:
name = "{" + name
self._names[key] = name = self._fixtext(name)
return name
def _start(self, tag, attrib_in):
fixname = self._fixname
tag = fixname(tag)
attrib = {}
for key, value in attrib_in.items():
attrib[fixname(key)] = self._fixtext(value)
return self._target.start(tag, attrib)
def _start_list(self, tag, attrib_in):
fixname = self._fixname
tag = fixname(tag)
attrib = {}
if attrib_in:
for i in range(0, len(attrib_in), 2):
attrib[fixname(attrib_in[i])] = self._fixtext(attrib_in[i+1])
return self._target.start(tag, attrib)
def _data(self, text):
return self._target.data(self._fixtext(text))
def _end(self, tag):
return self._target.end(self._fixname(tag))
def _default(self, text):
prefix = text[:1]
if prefix == "&":
# deal with undefined entities
try:
self._target.data(self.entity[text[1:-1]])
except KeyError:
from xml.parsers import expat
raise expat.error(
"undefined entity %s: line %d, column %d" %
(text, self._parser.ErrorLineNumber,
self._parser.ErrorColumnNumber)
)
elif prefix == "<" and text[:9] == "<!DOCTYPE":
self._doctype = [] # inside a doctype declaration
elif self._doctype is not None:
# parse doctype contents
if prefix == ">":
self._doctype = None
return
text = string.strip(text)
if not text:
return
self._doctype.append(text)
n = len(self._doctype)
if n > 2:
type = self._doctype[1]
if type == "PUBLIC" and n == 4:
name, type, pubid, system = self._doctype
elif type == "SYSTEM" and n == 3:
name, type, system = self._doctype
pubid = None
else:
return
if pubid:
pubid = pubid[1:-1]
self.doctype(name, pubid, system[1:-1])
self._doctype = None
##
# Handles a doctype declaration.
#
# @param name Doctype name.
# @param pubid Public identifier.
# @param system System identifier.
def doctype(self, name, pubid, system):
pass
##
# Feeds data to the parser.
#
# @param data Encoded data.
def feed(self, data):
self._parser.Parse(data, 0)
##
# Finishes feeding data to the parser.
#
# @return An element structure.
# @defreturn Element
def close(self):
self._parser.Parse("", 1) # end of data
tree = self._target.close()
del self._target, self._parser # get rid of circular references
return tree
########NEW FILE########
__FILENAME__ = HTMLTreeBuilder
#
# ElementTree
# $Id: HTMLTreeBuilder.py 2325 2005-03-16 15:50:43Z fredrik $
#
# a simple tree builder, for HTML input
#
# history:
# 2002-04-06 fl created
# 2002-04-07 fl ignore IMG and HR end tags
# 2002-04-07 fl added support for 1.5.2 and later
# 2003-04-13 fl added HTMLTreeBuilder alias
# 2004-12-02 fl don't feed non-ASCII charrefs/entities as 8-bit strings
# 2004-12-05 fl don't feed non-ASCII CDATA as 8-bit strings
#
# Copyright (c) 1999-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Tools to build element trees from HTML files.
##
import htmlentitydefs
import re, string, sys
import mimetools, StringIO
import ElementTree
AUTOCLOSE = "p", "li", "tr", "th", "td", "head", "body"
IGNOREEND = "img", "hr", "meta", "link", "br"
if sys.version[:3] == "1.5":
is_not_ascii = re.compile(r"[\x80-\xff]").search # 1.5.2
else:
is_not_ascii = re.compile(eval(r'u"[\u0080-\uffff]"')).search
try:
from HTMLParser import HTMLParser
except ImportError:
from sgmllib import SGMLParser
# hack to use sgmllib's SGMLParser to emulate 2.2's HTMLParser
class HTMLParser(SGMLParser):
# the following only works as long as this class doesn't
# provide any do, start, or end handlers
def unknown_starttag(self, tag, attrs):
self.handle_starttag(tag, attrs)
def unknown_endtag(self, tag):
self.handle_endtag(tag)
##
# ElementTree builder for HTML source code. This builder converts an
# HTML document or fragment to an ElementTree.
# <p>
# The parser is relatively picky, and requires balanced tags for most
# elements. However, elements belonging to the following group are
# automatically closed: P, LI, TR, TH, and TD. In addition, the
# parser automatically inserts end tags immediately after the start
# tag, and ignores any end tags for the following group: IMG, HR,
# META, and LINK.
#
# @keyparam builder Optional builder object. If omitted, the parser
# uses the standard <b>elementtree</b> builder.
# @keyparam encoding Optional character encoding, if known. If omitted,
# the parser looks for META tags inside the document. If no tags
# are found, the parser defaults to ISO-8859-1. Note that if your
# document uses a non-ASCII compatible encoding, you must decode
# the document before parsing.
#
# @see elementtree.ElementTree
class HTMLTreeBuilder(HTMLParser):
# FIXME: shouldn't this class be named Parser, not Builder?
def __init__(self, builder=None, encoding=None):
self.__stack = []
if builder is None:
builder = ElementTree.TreeBuilder()
self.__builder = builder
self.encoding = encoding or "iso-8859-1"
HTMLParser.__init__(self)
##
# Flushes parser buffers, and return the root element.
#
# @return An Element instance.
def close(self):
HTMLParser.close(self)
return self.__builder.close()
##
# (Internal) Handles start tags.
def handle_starttag(self, tag, attrs):
if tag == "meta":
# look for encoding directives
http_equiv = content = None
for k, v in attrs:
if k == "http-equiv":
http_equiv = string.lower(v)
elif k == "content":
content = v
if http_equiv == "content-type" and content:
# use mimetools to parse the http header
header = mimetools.Message(
StringIO.StringIO("%s: %s\n\n" % (http_equiv, content))
)
encoding = header.getparam("charset")
if encoding:
self.encoding = encoding
if tag in AUTOCLOSE:
if self.__stack and self.__stack[-1] == tag:
self.handle_endtag(tag)
self.__stack.append(tag)
attrib = {}
if attrs:
for k, v in attrs:
attrib[string.lower(k)] = v
self.__builder.start(tag, attrib)
if tag in IGNOREEND:
self.__stack.pop()
self.__builder.end(tag)
##
# (Internal) Handles end tags.
def handle_endtag(self, tag):
if tag in IGNOREEND:
return
lasttag = self.__stack.pop()
if tag != lasttag and lasttag in AUTOCLOSE:
self.handle_endtag(lasttag)
self.__builder.end(tag)
##
# (Internal) Handles character references.
def handle_charref(self, char):
if char[:1] == "x":
char = int(char[1:], 16)
else:
char = int(char)
if 0 <= char < 128:
self.__builder.data(chr(char))
else:
self.__builder.data(unichr(char))
##
# (Internal) Handles entity references.
def handle_entityref(self, name):
entity = htmlentitydefs.entitydefs.get(name)
if entity:
if len(entity) == 1:
entity = ord(entity)
else:
entity = int(entity[2:-1])
if 0 <= entity < 128:
self.__builder.data(chr(entity))
else:
self.__builder.data(unichr(entity))
else:
self.unknown_entityref(name)
##
# (Internal) Handles character data.
def handle_data(self, data):
if isinstance(data, type('')) and is_not_ascii(data):
# convert to unicode, but only if necessary
data = unicode(data, self.encoding, "ignore")
self.__builder.data(data)
##
# (Hook) Handles unknown entity references. The default action
# is to ignore unknown entities.
def unknown_entityref(self, name):
pass # ignore by default; override if necessary
##
# An alias for the <b>HTMLTreeBuilder</b> class.
TreeBuilder = HTMLTreeBuilder
##
# Parse an HTML document or document fragment.
#
# @param source A filename or file object containing HTML data.
# @param encoding Optional character encoding, if known. If omitted,
# the parser looks for META tags inside the document. If no tags
# are found, the parser defaults to ISO-8859-1.
# @return An ElementTree instance
def parse(source, encoding=None):
return ElementTree.parse(source, HTMLTreeBuilder(encoding=encoding))
if __name__ == "__main__":
import sys
ElementTree.dump(parse(open(sys.argv[1])))
########NEW FILE########
__FILENAME__ = SgmlopXMLTreeBuilder
#
# ElementTree
# $Id$
#
# A simple XML tree builder, based on the sgmlop library.
#
# Note that this version does not support namespaces. This may be
# changed in future versions.
#
# history:
# 2004-03-28 fl created
#
# Copyright (c) 1999-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Tools to build element trees from XML, based on the SGMLOP parser.
# <p>
# The current version does not support XML namespaces.
# <p>
# This tree builder requires the <b>sgmlop</b> extension module
# (available from
# <a href='http://effbot.org/downloads'>http://effbot.org/downloads</a>).
##
import ElementTree
##
# ElementTree builder for XML source data, based on the SGMLOP parser.
#
# @see elementtree.ElementTree
class TreeBuilder:
def __init__(self, html=0):
try:
import sgmlop
except ImportError:
raise RuntimeError("sgmlop parser not available")
self.__builder = ElementTree.TreeBuilder()
if html:
import htmlentitydefs
self.entitydefs.update(htmlentitydefs.entitydefs)
self.__parser = sgmlop.XMLParser()
self.__parser.register(self)
##
# Feeds data to the parser.
#
# @param data Encoded data.
def feed(self, data):
self.__parser.feed(data)
##
# Finishes feeding data to the parser.
#
# @return An element structure.
# @defreturn Element
def close(self):
self.__parser.close()
self.__parser = None
return self.__builder.close()
def finish_starttag(self, tag, attrib):
self.__builder.start(tag, attrib)
def finish_endtag(self, tag):
self.__builder.end(tag)
def handle_data(self, data):
self.__builder.data(data)
########NEW FILE########
__FILENAME__ = SimpleXMLTreeBuilder
#
# ElementTree
# $Id: SimpleXMLTreeBuilder.py 1862 2004-06-18 07:31:02Z Fredrik $
#
# A simple XML tree builder, based on Python's xmllib
#
# Note that due to bugs in xmllib, this builder does not fully support
# namespaces (unqualified attributes are put in the default namespace,
# instead of being left as is). Run this module as a script to find
# out if this affects your Python version.
#
# history:
# 2001-10-20 fl created
# 2002-05-01 fl added namespace support for xmllib
# 2002-08-17 fl added xmllib sanity test
#
# Copyright (c) 1999-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Tools to build element trees from XML files, using <b>xmllib</b>.
# This module can be used instead of the standard tree builder, for
# Python versions where "expat" is not available (such as 1.5.2).
# <p>
# Note that due to bugs in <b>xmllib</b>, the namespace support is
# not reliable (you can run the module as a script to find out exactly
# how unreliable it is on your Python version).
##
import xmllib, string
import ElementTree
##
# ElementTree builder for XML source data.
#
# @see elementtree.ElementTree
class TreeBuilder(xmllib.XMLParser):
def __init__(self, html=0):
self.__builder = ElementTree.TreeBuilder()
if html:
import htmlentitydefs
self.entitydefs.update(htmlentitydefs.entitydefs)
xmllib.XMLParser.__init__(self)
##
# Feeds data to the parser.
#
# @param data Encoded data.
def feed(self, data):
xmllib.XMLParser.feed(self, data)
##
# Finishes feeding data to the parser.
#
# @return An element structure.
# @defreturn Element
def close(self):
xmllib.XMLParser.close(self)
return self.__builder.close()
def handle_data(self, data):
self.__builder.data(data)
handle_cdata = handle_data
def unknown_starttag(self, tag, attrs):
attrib = {}
for key, value in attrs.items():
attrib[fixname(key)] = value
self.__builder.start(fixname(tag), attrib)
def unknown_endtag(self, tag):
self.__builder.end(fixname(tag))
def fixname(name, split=string.split):
# xmllib in 2.0 and later provides limited (and slightly broken)
# support for XML namespaces.
if " " not in name:
return name
return "{%s}%s" % tuple(split(name, " ", 1))
if __name__ == "__main__":
import sys
# sanity check: look for known namespace bugs in xmllib
p = TreeBuilder()
text = """\
<root xmlns='default'>
<tag attribute='value' />
</root>
"""
p.feed(text)
tree = p.close()
status = []
# check for bugs in the xmllib implementation
tag = tree.find("{default}tag")
if tag is None:
status.append("namespaces not supported")
if tag is not None and tag.get("{default}attribute"):
status.append("default namespace applied to unqualified attribute")
# report bugs
if status:
print "xmllib doesn't work properly in this Python version:"
for bug in status:
print "-", bug
else:
print "congratulations; no problems found in xmllib"
########NEW FILE########
__FILENAME__ = SimpleXMLWriter
#
# SimpleXMLWriter
# $Id: SimpleXMLWriter.py 2312 2005-03-02 18:13:39Z fredrik $
#
# a simple XML writer
#
# history:
# 2001-12-28 fl created
# 2002-11-25 fl fixed attribute encoding
# 2002-12-02 fl minor fixes for 1.5.2
# 2004-06-17 fl added pythondoc markup
# 2004-07-23 fl added flush method (from Jay Graves)
# 2004-10-03 fl added declaration method
#
# Copyright (c) 2001-2004 by Fredrik Lundh
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The SimpleXMLWriter module is
#
# Copyright (c) 2001-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Tools to write XML files, without having to deal with encoding
# issues, well-formedness, etc.
# <p>
# The current version does not provide built-in support for
# namespaces. To create files using namespaces, you have to provide
# "xmlns" attributes and explicitly add prefixes to tags and
# attributes.
#
# <h3>Patterns</h3>
#
# The following example generates a small XHTML document.
# <pre>
#
# from elementtree.SimpleXMLWriter import XMLWriter
# import sys
#
# w = XMLWriter(sys.stdout)
#
# html = w.start("html")
#
# w.start("head")
# w.element("title", "my document")
# w.element("meta", name="generator", value="my application 1.0")
# w.end()
#
# w.start("body")
# w.element("h1", "this is a heading")
# w.element("p", "this is a paragraph")
#
# w.start("p")
# w.data("this is ")
# w.element("b", "bold")
# w.data(" and ")
# w.element("i", "italic")
# w.data(".")
# w.end("p")
#
# w.close(html)
# </pre>
##
import re, sys, string
try:
unicode("")
except NameError:
def encode(s, encoding):
# 1.5.2: application must use the right encoding
return s
_escape = re.compile(r"[&<>\"\x80-\xff]+") # 1.5.2
else:
def encode(s, encoding):
return s.encode(encoding)
_escape = re.compile(eval(r'u"[&<>\"\u0080-\uffff]+"'))
def encode_entity(text, pattern=_escape):
# map reserved and non-ascii characters to numerical entities
def escape_entities(m):
out = []
for char in m.group():
out.append("&#%d;" % ord(char))
return string.join(out, "")
return encode(pattern.sub(escape_entities, text), "ascii")
del _escape
#
# the following functions assume an ascii-compatible encoding
# (or "utf-16")
def escape_cdata(s, encoding=None, replace=string.replace):
s = replace(s, "&", "&")
s = replace(s, "<", "<")
s = replace(s, ">", ">")
if encoding:
try:
return encode(s, encoding)
except UnicodeError:
return encode_entity(s)
return s
def escape_attrib(s, encoding=None, replace=string.replace):
s = replace(s, "&", "&")
s = replace(s, "'", "'")
s = replace(s, "\"", """)
s = replace(s, "<", "<")
s = replace(s, ">", ">")
if encoding:
try:
return encode(s, encoding)
except UnicodeError:
return encode_entity(s)
return s
##
# XML writer class.
#
# @param file A file or file-like object. This object must implement
# a <b>write</b> method that takes an 8-bit string.
# @param encoding Optional encoding.
class XMLWriter:
def __init__(self, file, encoding="us-ascii"):
if not hasattr(file, "write"):
file = open(file, "w")
self.__write = file.write
if hasattr(file, "flush"):
self.flush = file.flush
self.__open = 0 # true if start tag is open
self.__tags = []
self.__data = []
self.__encoding = encoding
def __flush(self):
# flush internal buffers
if self.__open:
self.__write(">")
self.__open = 0
if self.__data:
data = string.join(self.__data, "")
self.__write(escape_cdata(data, self.__encoding))
self.__data = []
##
# Writes an XML declaration.
def declaration(self):
encoding = self.__encoding
if encoding == "us-ascii" or encoding == "utf-8":
self.__write("<?xml version='1.0'?>\n")
else:
self.__write("<?xml version='1.0' encoding='%s'?>\n" % encoding)
##
# Opens a new element. Attributes can be given as keyword
# arguments, or as a string/string dictionary. You can pass in
# 8-bit strings or Unicode strings; the former are assumed to use
# the encoding passed to the constructor. The method returns an
# opaque identifier that can be passed to the <b>close</b> method,
# to close all open elements up to and including this one.
#
# @param tag Element tag.
# @param attrib Attribute dictionary. Alternatively, attributes
# can be given as keyword arguments.
# @return An element identifier.
def start(self, tag, attrib={}, **extra):
self.__flush()
tag = escape_cdata(tag, self.__encoding)
self.__data = []
self.__tags.append(tag)
self.__write("<%s" % tag)
if attrib or extra:
attrib = attrib.copy()
attrib.update(extra)
attrib = attrib.items()
attrib.sort()
for k, v in attrib:
k = escape_cdata(k, self.__encoding)
v = escape_attrib(v, self.__encoding)
self.__write(" %s=\"%s\"" % (k, v))
self.__open = 1
return len(self.__tags)-1
##
# Adds a comment to the output stream.
#
# @param comment Comment text, as an 8-bit string or Unicode string.
def comment(self, comment):
self.__flush()
self.__write("<!-- %s -->\n" % escape_cdata(comment, self.__encoding))
##
# Adds character data to the output stream.
#
# @param text Character data, as an 8-bit string or Unicode string.
def data(self, text):
self.__data.append(text)
##
# Closes the current element (opened by the most recent call to
# <b>start</b>).
#
# @param tag Element tag. If given, the tag must match the start
# tag. If omitted, the current element is closed.
def end(self, tag=None):
if tag:
assert self.__tags, "unbalanced end(%s)" % tag
assert escape_cdata(tag, self.__encoding) == self.__tags[-1],\
"expected end(%s), got %s" % (self.__tags[-1], tag)
else:
assert self.__tags, "unbalanced end()"
tag = self.__tags.pop()
if self.__data:
self.__flush()
elif self.__open:
self.__open = 0
self.__write(" />")
return
self.__write("</%s>" % tag)
##
# Closes open elements, up to (and including) the element identified
# by the given identifier.
#
# @param id Element identifier, as returned by the <b>start</b> method.
def close(self, id):
while len(self.__tags) > id:
self.end()
##
# Adds an entire element. This is the same as calling <b>start</b>,
# <b>data</b>, and <b>end</b> in sequence. The <b>text</b> argument
# can be omitted.
def element(self, tag, text=None, attrib={}, **extra):
apply(self.start, (tag, attrib), extra)
if text:
self.data(text)
self.end()
##
# Flushes the output stream.
def flush(self):
pass # replaced by the constructor
########NEW FILE########
__FILENAME__ = TidyHTMLTreeBuilder
#
# ElementTree
# $Id: TidyHTMLTreeBuilder.py 2304 2005-03-01 17:42:41Z fredrik $
#
from elementtidy.TidyHTMLTreeBuilder import *
########NEW FILE########
__FILENAME__ = TidyTools
#
# ElementTree
# $Id: TidyTools.py 1862 2004-06-18 07:31:02Z Fredrik $
#
# tools to run the "tidy" command on an HTML or XHTML file, and return
# the contents as an XHTML element tree.
#
# history:
# 2002-10-19 fl added to ElementTree library; added getzonebody function
#
# Copyright (c) 1999-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
##
# Tools to build element trees from HTML, using the external <b>tidy</b>
# utility.
##
import glob, string, os, sys
from ElementTree import ElementTree, Element
NS_XHTML = "{http://www.w3.org/1999/xhtml}"
##
# Convert an HTML or HTML-like file to XHTML, using the <b>tidy</b>
# command line utility.
#
# @param file Filename.
# @param new_inline_tags An optional list of valid but non-standard
# inline tags.
# @return An element tree, or None if not successful.
def tidy(file, new_inline_tags=None):
command = ["tidy", "-qn", "-asxml"]
if new_inline_tags:
command.append("--new-inline-tags")
command.append(string.join(new_inline_tags, ","))
# FIXME: support more tidy options!
# convert
os.system(
"%s %s >%s.out 2>%s.err" % (string.join(command), file, file, file)
)
# check that the result is valid XML
try:
tree = ElementTree()
tree.parse(file + ".out")
except:
print "*** %s:%s" % sys.exc_info()[:2]
print ("*** %s is not valid XML "
"(check %s.err for info)" % (file, file))
tree = None
else:
if os.path.isfile(file + ".out"):
os.remove(file + ".out")
if os.path.isfile(file + ".err"):
os.remove(file + ".err")
return tree
##
# Get document body from a an HTML or HTML-like file. This function
# uses the <b>tidy</b> function to convert HTML to XHTML, and cleans
# up the resulting XML tree.
#
# @param file Filename.
# @return A <b>body</b> element, or None if not successful.
def getbody(file, **options):
# get clean body from text file
# get xhtml tree
try:
tree = apply(tidy, (file,), options)
if tree is None:
return
except IOError, v:
print "***", v
return None
NS = NS_XHTML
# remove namespace uris
for node in tree.getiterator():
if node.tag.startswith(NS):
node.tag = node.tag[len(NS):]
body = tree.getroot().find("body")
return body
##
# Same as <b>getbody</b>, but turns plain text at the start of the
# document into an H1 tag. This function can be used to parse zone
# documents.
#
# @param file Filename.
# @return A <b>body</b> element, or None if not successful.
def getzonebody(file, **options):
body = getbody(file, **options)
if body is None:
return
if body.text and string.strip(body.text):
title = Element("h1")
title.text = string.strip(body.text)
title.tail = "\n\n"
body.insert(0, title)
body.text = None
return body
if __name__ == "__main__":
import sys
for arg in sys.argv[1:]:
for file in glob.glob(arg):
print file, "...", tidy(file)
########NEW FILE########
__FILENAME__ = XMLTreeBuilder
#
# ElementTree
# $Id: XMLTreeBuilder.py 2305 2005-03-01 17:43:09Z fredrik $
#
# an XML tree builder
#
# history:
# 2001-10-20 fl created
# 2002-05-01 fl added namespace support for xmllib
# 2002-07-27 fl require expat (1.5.2 code can use SimpleXMLTreeBuilder)
# 2002-08-17 fl use tag/attribute name memo cache
# 2002-12-04 fl moved XMLTreeBuilder to the ElementTree module
#
# Copyright (c) 1999-2004 by Fredrik Lundh. All rights reserved.
#
# [email protected]
# http://www.pythonware.com
#
# --------------------------------------------------------------------
# The ElementTree toolkit is
#
# Copyright (c) 1999-2004 by Fredrik Lundh
#
# By obtaining, using, and/or copying this software and/or its
# associated documentation, you agree that you have read, understood,
# and will comply with the following terms and conditions:
#
# Permission to use, copy, modify, and distribute this software and
# its associated documentation for any purpose and without fee is
# hereby granted, provided that the above copyright notice appears in
# all copies, and that both that copyright notice and this permission
# notice appear in supporting documentation, and that the name of
# Secret Labs AB or the author not be used in advertising or publicity
# pertaining to distribution of the software without specific, written
# prior permission.
#
# SECRET LABS AB AND THE AUTHOR DISCLAIMS ALL WARRANTIES WITH REGARD
# TO THIS SOFTWARE, INCLUDING ALL IMPLIED WARRANTIES OF MERCHANT-
# ABILITY AND FITNESS. IN NO EVENT SHALL SECRET LABS AB OR THE AUTHOR
# BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY
# DAMAGES WHATSOEVER RESULTING FROM LOSS OF USE, DATA OR PROFITS,
# WHETHER IN AN ACTION OF CONTRACT, NEGLIGENCE OR OTHER TORTIOUS
# ACTION, ARISING OUT OF OR IN CONNECTION WITH THE USE OR PERFORMANCE
# OF THIS SOFTWARE.
# --------------------------------------------------------------------
##
# Tools to build element trees from XML files.
##
import ElementTree
##
# (obsolete) ElementTree builder for XML source data, based on the
# <b>expat</b> parser.
# <p>
# This class is an alias for ElementTree.XMLTreeBuilder. New code
# should use that version instead.
#
# @see elementtree.ElementTree
class TreeBuilder(ElementTree.XMLTreeBuilder):
pass
##
# (experimental) An alternate builder that supports manipulation of
# new elements.
class FancyTreeBuilder(TreeBuilder):
def __init__(self, html=0):
TreeBuilder.__init__(self, html)
self._parser.StartNamespaceDeclHandler = self._start_ns
self._parser.EndNamespaceDeclHandler = self._end_ns
self.namespaces = []
def _start(self, tag, attrib_in):
elem = TreeBuilder._start(self, tag, attrib_in)
self.start(elem)
def _start_list(self, tag, attrib_in):
elem = TreeBuilder._start_list(self, tag, attrib_in)
self.start(elem)
def _end(self, tag):
elem = TreeBuilder._end(self, tag)
self.end(elem)
def _start_ns(self, prefix, value):
self.namespaces.insert(0, (prefix, value))
def _end_ns(self, prefix):
assert self.namespaces.pop(0)[0] == prefix, "implementation confused"
##
# Hook method that's called when a new element has been opened.
# May access the <b>namespaces</b> attribute.
#
# @param element The new element. The tag name and attributes are,
# set, but it has no children, and the text and tail attributes
# are still empty.
def start(self, element):
pass
##
# Hook method that's called when a new element has been closed.
# May access the <b>namespaces</b> attribute.
#
# @param element The new element.
def end(self, element):
pass
########NEW FILE########
__FILENAME__ = helper
"""
Helper module for Python version 3.0 and above
- Ordered dictionaries
- Encoding/decoding urls
- Unicode/Bytes (for sending/receiving data from/to socket, base64)
- Exception handling (except Exception as e)
"""
import base64
import urllib.parse
from collections import OrderedDict
def modulename():
return "Helper module for Python version 3.0 and above"
def url_decode(uri):
return urllib.parse.unquote(uri)
def url_encode(uri):
return urllib.parse.quote(uri)
def new_dictionary():
return OrderedDict()
def dictionary_keys(dictionary):
return list(dictionary.keys())
def dictionary_values(dictionary):
return list(dictionary.values())
def data_read(data):
# Convert bytes to string
return data.decode('utf8')
def data_write(data):
# Convert string to bytes
return bytes(data, 'utf8')
def base64_decode(data):
# Base64 returns decoded byte string, decode to convert to UTF8 string
return base64.b64decode(data).decode('utf8')
def base64_encode(data):
# Base64 needs ascii input to encode, which returns Base64 byte string, decode to convert to UTF8 string
return base64.b64encode(data.encode('ascii')).decode('utf8')
def unicode_chr(code):
return chr(code)
def unicode_string(string):
# Python 3.* uses unicode by default
return string
def is_digit(string):
# Check if string is digit
return isinstance(string, str) and string.isdigit()
########NEW FILE########
__FILENAME__ = helper_26
"""
Helper module for Python version 2.6 and below
- Ordered dictionaries
- Encoding/decoding urls
- Unicode
- Exception handling (except Exception, e)
"""
import base64
from urllib import unquote, quote
try:
from ordereddict import OrderedDict
except:
pass
def modulename():
return "Helper module for Python version 2.6 and below"
def url_decode(uri):
return unquote(uri)
def url_encode(uri):
return quote(uri)
def new_dictionary():
try:
return OrderedDict()
except:
return {}
def dictionary_keys(dictionary):
return dictionary.keys()
def dictionary_values(dictionary):
return dictionary.values()
def data_read(data):
# Data for reading/receiving already a string in version 2.*
return data
def data_write(data):
# Using string in version 2.* for sending/writing data
return data
def base64_decode(data):
return base64.b64decode(data)
def base64_encode(data):
return base64.b64encode(data)
def unicode_chr(code):
return unichr(code)
def unicode_string(string):
if isinstance(string, unicode):
return string
return string.decode('utf8', 'replace')
def is_digit(string):
# Check if basestring (str, unicode) is digit
return isinstance(string, basestring) and string.isdigit()
########NEW FILE########
__FILENAME__ = helper_27
"""
Helper module for Python version 2.7
- Ordered dictionaries
- Encoding/decoding urls
- Unicode
- Exception handling (except Exception as e)
"""
import base64
from urllib import unquote, quote
from collections import OrderedDict
def modulename():
return "Helper module for Python version 2.7"
def url_decode(uri):
return unquote(uri)
def url_encode(uri):
return quote(uri)
def new_dictionary():
return OrderedDict()
def dictionary_keys(dictionary):
return list(dictionary.keys())
def dictionary_values(dictionary):
return list(dictionary.values())
def data_read(data):
# Data for reading/receiving already a string in version 2.*
return data
def data_write(data):
# Using string in version 2.* for sending/writing data
return data
def base64_decode(data):
return base64.b64decode(data)
def base64_encode(data):
return base64.b64encode(data)
def unicode_chr(code):
return unichr(code)
def unicode_string(string):
if isinstance(string, unicode):
return string
return string.decode('utf8', 'replace')
def is_digit(string):
# Check if basestring (str, unicode) is digit
return isinstance(string, basestring) and string.isdigit()
########NEW FILE########
__FILENAME__ = ordereddict
# Copyright (c) 2009 Raymond Hettinger
#
# Permission is hereby granted, free of charge, to any person
# obtaining a copy of this software and associated documentation files
# (the "Software"), to deal in the Software without restriction,
# including without limitation the rights to use, copy, modify, merge,
# publish, distribute, sublicense, and/or sell copies of the Software,
# and to permit persons to whom the Software is furnished to do so,
# subject to the following conditions:
#
# The above copyright notice and this permission notice shall be
# included in all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
# EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
# OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
# NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
# HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
# WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
# FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
# OTHER DEALINGS IN THE SOFTWARE.
from UserDict import DictMixin
class OrderedDict(dict, DictMixin):
def __init__(self, *args, **kwds):
if len(args) > 1:
raise TypeError('expected at most 1 arguments, got %d' % len(args))
try:
self.__end
except AttributeError:
self.clear()
self.update(*args, **kwds)
def clear(self):
self.__end = end = []
end += [None, end, end] # sentinel node for doubly linked list
self.__map = {} # key --> [key, prev, next]
dict.clear(self)
def __setitem__(self, key, value):
if key not in self:
end = self.__end
curr = end[1]
curr[2] = end[1] = self.__map[key] = [key, curr, end]
dict.__setitem__(self, key, value)
def __delitem__(self, key):
dict.__delitem__(self, key)
key, prev, next = self.__map.pop(key)
prev[2] = next
next[1] = prev
def __iter__(self):
end = self.__end
curr = end[2]
while curr is not end:
yield curr[0]
curr = curr[2]
def __reversed__(self):
end = self.__end
curr = end[1]
while curr is not end:
yield curr[0]
curr = curr[1]
def popitem(self, last=True):
if not self:
raise KeyError('dictionary is empty')
if last:
key = reversed(self).next()
else:
key = iter(self).next()
value = self.pop(key)
return key, value
def __reduce__(self):
items = [[k, self[k]] for k in self]
tmp = self.__map, self.__end
del self.__map, self.__end
inst_dict = vars(self).copy()
self.__map, self.__end = tmp
if inst_dict:
return (self.__class__, (items,), inst_dict)
return self.__class__, (items,)
def keys(self):
return list(self)
setdefault = DictMixin.setdefault
update = DictMixin.update
pop = DictMixin.pop
values = DictMixin.values
items = DictMixin.items
iterkeys = DictMixin.iterkeys
itervalues = DictMixin.itervalues
iteritems = DictMixin.iteritems
def __repr__(self):
if not self:
return '%s()' % (self.__class__.__name__,)
return '%s(%r)' % (self.__class__.__name__, self.items())
def copy(self):
return self.__class__(self)
@classmethod
def fromkeys(cls, iterable, value=None):
d = cls()
for key in iterable:
d[key] = value
return d
def __eq__(self, other):
if isinstance(other, OrderedDict):
if len(self) != len(other):
return False
for p, q in zip(self.items(), other.items()):
if p != q:
return False
return True
return dict.__eq__(self, other)
def __ne__(self, other):
return not self == other
########NEW FILE########
__FILENAME__ = load
import sublime
import os
# Settings variables
try:
from . import settings as S
except:
import settings as S
# Load modules
from .view import DATA_BREAKPOINT, DATA_CONTEXT, DATA_STACK, DATA_WATCH, TITLE_WINDOW_BREAKPOINT, TITLE_WINDOW_CONTEXT, TITLE_WINDOW_STACK, TITLE_WINDOW_WATCH, has_debug_view, render_regions, show_content
from .util import load_breakpoint_data, load_watch_data
from .log import clear_output, debug, info
from .config import get_window_value, set_window_value, load_package_values, load_project_values
def xdebug():
# Clear log file
clear_output()
if not S.PACKAGE_FOLDER:
info("Unable to resolve current path for package.")
info("==== Loading '%s' package ====" % S.PACKAGE_FOLDER)
# Load config in package/project configuration
load_package_values()
load_project_values()
# Load breakpoint data
try:
load_breakpoint_data()
finally:
# Render breakpoint markers
render_regions()
# Load watch data
load_watch_data()
# Clear/Reset content in debug windows
if has_debug_view(TITLE_WINDOW_BREAKPOINT):
show_content(DATA_BREAKPOINT)
if has_debug_view(TITLE_WINDOW_CONTEXT):
show_content(DATA_CONTEXT)
if has_debug_view(TITLE_WINDOW_STACK):
show_content(DATA_STACK)
if has_debug_view(TITLE_WINDOW_WATCH):
show_content(DATA_WATCH)
# Check for conflicting packages
if S.PACKAGE_FOLDER:
# Get package list from Package Control
packages = None
try:
packages = sublime.load_settings('Package Control.sublime-settings').get('installed_packages', [])
except:
pass
# Make sure it is a list
if not isinstance(packages, list):
packages = []
# Get packages inside Package directory
for package_name in os.listdir(sublime.packages_path()):
if package_name not in packages:
packages.append(package_name)
# Strip .sublime-package of package name for comparison
package_extension = ".sublime-package"
current_package = S.PACKAGE_FOLDER
if current_package.endswith(package_extension):
current_package = current_package[:-len(package_extension)]
# Search for other conflicting packages
conflict = []
for package in packages:
if package.endswith(package_extension):
package = package[:-len(package_extension)]
if (package.lower().count("xdebug") or package.lower().count("moai")) and package != current_package:
conflict.append(package)
# Show message if conficting packages have been found
if conflict:
info("Conflicting packages detected.")
debug(conflict)
if not get_window_value('hide_conflict', False):
sublime.error_message("The following package(s) could cause conflicts with '{package}':\n\n{other}\n\nPlease consider removing the package(s) above when experiencing any complications." \
.format(package=S.PACKAGE_FOLDER, other='\n'.join(conflict)))
set_window_value('hide_conflict', True)
else:
set_window_value('hide_conflict', False)
########NEW FILE########
__FILENAME__ = log
import sublime
import logging
import os
# Settings variables
try:
from . import settings as S
except:
import settings as S
# Config module
from .config import get_value
def clear_output():
# Clear previous output file and configure logging module
output_file = os.path.join(sublime.packages_path(), 'User', S.FILE_LOG_OUTPUT)
logging.basicConfig(filename=output_file, filemode='w', level=logging.DEBUG, format='[%(asctime)s] %(levelname)s - %(message)s', datefmt='%m/%d/%Y %I:%M:%S%p')
def debug(message=None):
if not get_value(S.KEY_DEBUG) or message is None:
return
# Write message to output file
logging.debug(message)
def info(message=None):
if message is None:
return
# Write message to output file
logging.info(message)
########NEW FILE########
__FILENAME__ = protocol
import re
import socket
import sys
# Helper module
try:
from .helper import H
except:
from helper import H
# Settings variables
try:
from . import settings as S
except:
import settings as S
# Config module
from .config import get_value
# Log module
from .log import debug
# HTML entities
try:
from html.entities import name2codepoint
except ImportError:
from htmlentitydefs import name2codepoint
# XML parser
try:
from xml.etree import cElementTree as ET
except ImportError:
try:
from xml.etree import ElementTree as ET
except ImportError:
from .elementtree import ElementTree as ET
try:
from xml.parsers import expat
except ImportError:
# Module xml.parsers.expat missing, using SimpleXMLTreeBuilder
from .elementtree import SimpleXMLTreeBuilder
ET.XMLTreeBuilder = SimpleXMLTreeBuilder.TreeBuilder
ILLEGAL_XML_UNICODE_CHARACTERS = [
(0x00, 0x08), (0x0B, 0x0C), (0x0E, 0x1F), (0x7F, 0x84),
(0x86, 0x9F), (0xD800, 0xDFFF), (0xFDD0, 0xFDDF),
(0xFFFE, 0xFFFF),
(0x1FFFE, 0x1FFFF), (0x2FFFE, 0x2FFFF), (0x3FFFE, 0x3FFFF),
(0x4FFFE, 0x4FFFF), (0x5FFFE, 0x5FFFF), (0x6FFFE, 0x6FFFF),
(0x7FFFE, 0x7FFFF), (0x8FFFE, 0x8FFFF), (0x9FFFE, 0x9FFFF),
(0xAFFFE, 0xAFFFF), (0xBFFFE, 0xBFFFF), (0xCFFFE, 0xCFFFF),
(0xDFFFE, 0xDFFFF), (0xEFFFE, 0xEFFFF), (0xFFFFE, 0xFFFFF),
(0x10FFFE, 0x10FFFF) ]
ILLEGAL_XML_RANGES = ["%s-%s" % (H.unicode_chr(low), H.unicode_chr(high))
for (low, high) in ILLEGAL_XML_UNICODE_CHARACTERS
if low < sys.maxunicode]
ILLEGAL_XML_RE = re.compile(H.unicode_string('[%s]') % H.unicode_string('').join(ILLEGAL_XML_RANGES))
class Protocol(object):
"""
Class for connecting with debugger engine which uses DBGp protocol.
"""
# Maximum amount of data to be received at once by socket
read_size = 1024
def __init__(self):
# Set port number to listen for response
self.port = get_value(S.KEY_PORT, S.DEFAULT_PORT)
self.clear()
def transaction_id():
"""
Standard argument for sending commands, an unique numerical ID.
"""
def fget(self):
self._transaction_id += 1
return self._transaction_id
def fset(self, value):
self._transaction_id = value
def fdel(self):
self._transaction_id = 0
return locals()
# Transaction ID property
transaction_id = property(**transaction_id())
def clear(self):
"""
Clear variables, reset transaction_id, close socket connection.
"""
self.buffer = ''
self.connected = False
self.listening = False
del self.transaction_id
try:
self.socket.close()
except:
pass
self.socket = None
def unescape(self, string):
"""
Convert HTML entities and character references to ordinary characters.
"""
def convert(matches):
text = matches.group(0)
# Character reference
if text[:2] == "&#":
try:
if text[:3] == "&#x":
return H.unicode_chr(int(text[3:-1], 16))
else:
return H.unicode_chr(int(text[2:-1]))
except ValueError:
pass
# Named entity
else:
try:
# Following are not needed to be converted for XML
if text[1:-1] == "amp" or text[1:-1] == "gt" or text[1:-1] == "lt":
pass
else:
text = H.unicode_chr(name2codepoint[text[1:-1]])
except KeyError:
pass
return text
return re.sub("&#?\w+;", convert, string)
def read_until_null(self):
"""
Get response data from debugger engine.
"""
# Check socket connection
if self.connected:
# Get result data from debugger engine
try:
while not '\x00' in self.buffer:
self.buffer += H.data_read(self.socket.recv(self.read_size))
data, self.buffer = self.buffer.split('\x00', 1)
return data
except:
e = sys.exc_info()[1]
raise ProtocolConnectionException(e)
else:
raise ProtocolConnectionException("Xdebug is not connected")
def read_data(self):
"""
Get response data from debugger engine and verify length of response.
"""
# Verify length of response data
length = self.read_until_null()
message = self.read_until_null()
if int(length) == len(message):
return message
else:
raise ProtocolException("Length mismatch encountered while reading the Xdebug message")
def read(self, return_string=False):
"""
Get response from debugger engine as XML document object.
"""
# Get result data from debugger engine and verify length of response
data = self.read_data()
# Show debug output
debug('[Response data] %s' % data)
# Return data string
if return_string:
return data
# Remove special character quoting
data = self.unescape(data)
# Replace invalid XML characters
data = ILLEGAL_XML_RE.sub('?', data)
# Create XML document object
document = ET.fromstring(data)
return document
def send(self, command, *args, **kwargs):
"""
Send command to the debugger engine according to DBGp protocol.
"""
# Expression is used for conditional and watch type breakpoints
expression = None
# Seperate 'expression' from kwargs
if 'expression' in kwargs:
expression = kwargs['expression']
del kwargs['expression']
# Generate unique Transaction ID
transaction_id = self.transaction_id
# Append command/arguments to build list
build_command = [command, '-i %i' % transaction_id]
if args:
build_command.extend(args)
if kwargs:
build_command.extend(['-%s %s' % pair for pair in kwargs.items()])
# Remove leading/trailing spaces and build command string
build_command = [part.strip() for part in build_command if part.strip()]
command = ' '.join(build_command)
if expression:
command += ' -- ' + H.base64_encode(expression)
# Show debug output
debug('[Send command] %s' % command)
# Send command to debugger engine
try:
self.socket.send(H.data_write(command + '\x00'))
except:
e = sys.exc_info()[1]
raise ProtocolConnectionException(e)
def listen(self):
"""
Create socket server which listens for connection on configured port.
"""
# Create socket server
server = socket.socket(socket.AF_INET, socket.SOCK_STREAM)
if server:
# Configure socket server
try:
server.setsockopt(socket.SOL_SOCKET, socket.SO_REUSEADDR, 1)
server.settimeout(1)
server.bind(('', self.port))
server.listen(1)
self.listening = True
self.socket = None
except:
e = sys.exc_info()[1]
raise ProtocolConnectionException(e)
# Accept incoming connection on configured port
while self.listening:
try:
self.socket, address = server.accept()
self.listening = False
except socket.timeout:
pass
# Check if a connection has been made
if self.socket:
self.connected = True
self.socket.settimeout(None)
else:
self.connected = False
self.listening = False
# Close socket server
try:
server.close()
except:
pass
server = None
# Return socket connection
return self.socket
else:
raise ProtocolConnectionException('Could not create socket server.')
class ProtocolException(Exception):
pass
class ProtocolConnectionException(ProtocolException):
pass
########NEW FILE########
__FILENAME__ = session
import sublime
import sys
import threading
# Helper module
try:
from .helper import H
except:
from helper import H
# Settings variables
try:
from . import settings as S
except:
import settings as S
# DBGp protocol constants
try:
from . import dbgp
except:
import dbgp
# Config module
from .config import get_value
# Log module
from .log import debug, info
# Protocol module
from .protocol import ProtocolConnectionException
# Util module
from .util import get_real_path
# View module
from .view import DATA_CONTEXT, DATA_STACK, DATA_WATCH, TITLE_WINDOW_WATCH, generate_context_output, generate_stack_output, get_response_properties, has_debug_view, render_regions, show_content, show_file, show_panel_content
ACTION_EVALUATE = "action_evaluate"
ACTION_EXECUTE = "action_execute"
ACTION_INIT = "action_init"
ACTION_REMOVE_BREAKPOINT = "action_remove_breakpoint"
ACTION_SET_BREAKPOINT = "action_set_breakpoint"
ACTION_STATUS = "action_status"
ACTION_USER_EXECUTE = "action_user_execute"
ACTION_WATCH = "action_watch"
def is_connected(show_status=False):
"""
Check if client is connected to debugger engine.
Keyword arguments:
show_status -- Show message why client is not connected in status bar.
"""
if S.SESSION and S.SESSION.connected:
return True
elif S.SESSION and show_status:
sublime.status_message('Xdebug: Waiting for response from debugger engine.')
elif show_status:
sublime.status_message('Xdebug: No Xdebug session running.')
return False
def connection_error(message):
"""
Template for showing error message on connection error/loss.
Keyword arguments:
message -- Exception/reason of connection error/loss.
"""
sublime.error_message("Please restart Xdebug debugging session.\nDisconnected from Xdebug debugger engine.\n" + message)
info("Connection lost with debugger engine.")
debug(message)
# Reset connection
try:
S.SESSION.clear()
except:
pass
finally:
S.SESSION = None
S.SESSION_BUSY = False
S.BREAKPOINT_EXCEPTION = None
S.BREAKPOINT_ROW = None
S.BREAKPOINT_RUN = None
S.CONTEXT_DATA.clear()
async_session = SocketHandler(ACTION_WATCH)
async_session.start()
# Reset layout
sublime.active_window().run_command('xdebug_layout')
# Render breakpoint markers
render_regions()
class SocketHandler(threading.Thread):
def __init__(self, action, **options):
threading.Thread.__init__(self)
self.action = action
self.options = options
def get_option(self, option, default_value=None):
if option in self.options.keys():
return self.options[option]
return default_value
def run_command(self, command, args=None):
if not isinstance(args, dict):
args = {}
self.timeout(lambda: self._run_command(command, args))
def _run_command(self, command, args=None):
try:
sublime.active_window().run_command(command, args)
except:
# In case active_window() is not available
pass
def run_view_command(self, command, args=None):
if not isinstance(args, dict):
args = {}
self.timeout(lambda: self._run_view_command)
def _run_view_command(self, command, args=None):
try:
sublime.active_window().active_view().run_command(command, args)
except:
# In case there is no active_view() available
pass
def status_message(self, message):
sublime.set_timeout(lambda: sublime.status_message(message), 100)
def timeout(self, function):
sublime.set_timeout(function, 0)
def run(self):
# Make sure an action is defined
if not self.action:
return
try:
S.SESSION_BUSY = True
# Evaluate
if self.action == ACTION_EVALUATE:
self.evaluate(self.get_option('expression'))
# Execute
elif self.action == ACTION_EXECUTE:
self.execute(self.get_option('command'))
# Init
elif self.action == ACTION_INIT:
self.init()
# Remove breakpoint
elif self.action == ACTION_REMOVE_BREAKPOINT:
self.remove_breakpoint(self.get_option('breakpoint_id'))
# Set breakpoint
elif self.action == ACTION_SET_BREAKPOINT:
self.set_breakpoint(self.get_option('filename'), self.get_option('lineno'), self.get_option('expression'))
# Status
elif self.action == ACTION_STATUS:
self.status()
# User defined execute
elif self.action == ACTION_USER_EXECUTE:
self.user_execute(self.get_option('command'), self.get_option('args'))
# Watch expression
elif self.action == ACTION_WATCH:
self.watch_expression()
# Show dialog on connection error
except ProtocolConnectionException:
e = sys.exc_info()[1]
self.timeout(lambda: connection_error("%s" % e))
finally:
S.SESSION_BUSY = False
def evaluate(self, expression):
if not expression or not is_connected():
return
# Send 'eval' command to debugger engine with code to evaluate
S.SESSION.send(dbgp.EVAL, expression=expression)
if get_value(S.KEY_PRETTY_OUTPUT):
response = S.SESSION.read()
properties = get_response_properties(response, expression)
response = generate_context_output(properties)
else:
response = S.SESSION.read(return_string=True)
# Show response data in output panel
self.timeout(lambda: show_panel_content(response))
def execute(self, command):
# Do not execute if no command is set
if not command or not is_connected():
return
# Send command to debugger engine
S.SESSION.send(command)
response = S.SESSION.read()
# Reset previous breakpoint values
S.BREAKPOINT_EXCEPTION = None
S.BREAKPOINT_ROW = None
S.CONTEXT_DATA.clear()
self.watch_expression()
# Set debug layout
self.run_command('xdebug_layout')
# Handle breakpoint hit
for child in response:
if child.tag == dbgp.ELEMENT_BREAKPOINT or child.tag == dbgp.ELEMENT_PATH_BREAKPOINT:
# Get breakpoint attribute values
fileuri = child.get(dbgp.BREAKPOINT_FILENAME)
lineno = child.get(dbgp.BREAKPOINT_LINENO)
exception = child.get(dbgp.BREAKPOINT_EXCEPTION)
filename = get_real_path(fileuri)
if (exception):
info(exception + ': ' + child.text)
# Remember Exception name and first line of message
S.BREAKPOINT_EXCEPTION = { 'name': exception, 'message': child.text.split('\n')[0], 'filename': fileuri, 'lineno': lineno }
# Check if temporary breakpoint is set and hit
if S.BREAKPOINT_RUN is not None and S.BREAKPOINT_RUN['filename'] == filename and S.BREAKPOINT_RUN['lineno'] == lineno:
# Remove temporary breakpoint
if S.BREAKPOINT_RUN['filename'] in S.BREAKPOINT and S.BREAKPOINT_RUN['lineno'] in S.BREAKPOINT[S.BREAKPOINT_RUN['filename']]:
self.run_view_command('xdebug_breakpoint', {'rows': [S.BREAKPOINT_RUN['lineno']], 'filename': S.BREAKPOINT_RUN['filename']})
S.BREAKPOINT_RUN = None
# Skip if temporary breakpoint was not hit
if S.BREAKPOINT_RUN is not None and (S.BREAKPOINT_RUN['filename'] != filename or S.BREAKPOINT_RUN['lineno'] != lineno):
self.run_command('xdebug_execute', {'command': 'run'})
return
# Show debug/status output
self.status_message('Xdebug: Breakpoint')
info('Break: ' + filename + ':' + lineno)
# Store line number of breakpoint for displaying region marker
S.BREAKPOINT_ROW = { 'filename': filename, 'lineno': lineno }
# Focus/Open file window view
self.timeout(lambda: show_file(filename, lineno))
# On breakpoint get context variables and stack history
if response.get(dbgp.ATTRIBUTE_STATUS) == dbgp.STATUS_BREAK:
# Context variables
context = self.get_context_values()
self.timeout(lambda: show_content(DATA_CONTEXT, context))
# Stack history
stack = self.get_stack_values()
self.timeout(lambda: show_content(DATA_STACK, stack))
# Watch expressions
self.watch_expression()
# Reload session when session stopped, by reaching end of file or interruption
if response.get(dbgp.ATTRIBUTE_STATUS) == dbgp.STATUS_STOPPING or response.get(dbgp.ATTRIBUTE_STATUS) == dbgp.STATUS_STOPPED:
self.run_command('xdebug_session_stop', {'restart': True})
self.run_command('xdebug_session_start', {'restart': True})
self.status_message('Xdebug: Finished executing file on server. Reload page to continue debugging.')
# Render breakpoint markers
self.timeout(lambda: render_regions())
def get_context_values(self):
"""
Get variables in current context.
"""
if not is_connected():
return
context = H.new_dictionary()
try:
# Super global variables
if get_value(S.KEY_SUPER_GLOBALS):
S.SESSION.send(dbgp.CONTEXT_GET, c=1)
response = S.SESSION.read()
context.update(get_response_properties(response))
# Local variables
S.SESSION.send(dbgp.CONTEXT_GET)
response = S.SESSION.read()
context.update(get_response_properties(response))
except ProtocolConnectionException:
e = sys.exc_info()[1]
self.timeout(lambda: connection_error("%s" % e))
# Store context variables in session
S.CONTEXT_DATA = context
return generate_context_output(context)
def get_stack_values(self):
"""
Get stack information for current context.
"""
response = None
if is_connected():
try:
# Get stack information
S.SESSION.send(dbgp.STACK_GET)
response = S.SESSION.read()
except ProtocolConnectionException:
e = sys.exc_info()[1]
self.timeout(lambda: connection_error("%s" % e))
return generate_stack_output(response)
def get_watch_values(self):
"""
Evaluate all watch expressions in current context.
"""
for index, item in enumerate(S.WATCH):
# Reset value for watch expression
S.WATCH[index]['value'] = None
# Evaluate watch expression when connected to debugger engine
if is_connected():
if item['enabled']:
watch_value = None
try:
S.SESSION.send(dbgp.EVAL, expression=item['expression'])
response = S.SESSION.read()
watch_value = get_response_properties(response, item['expression'])
except ProtocolConnectionException:
pass
S.WATCH[index]['value'] = watch_value
def init(self):
if not is_connected():
return
# Connection initialization
init = S.SESSION.read()
# More detailed internal information on properties
S.SESSION.send(dbgp.FEATURE_SET, n='show_hidden', v=1)
response = S.SESSION.read()
# Set max children limit
max_children = get_value(S.KEY_MAX_CHILDREN)
if max_children is not False and max_children is not True and isinstance(max_children, int):
S.SESSION.send(dbgp.FEATURE_SET, n=dbgp.FEATURE_NAME_MAXCHILDREN, v=max_children)
response = S.SESSION.read()
# Set max data limit
max_data = get_value(S.KEY_MAX_DATA)
if max_data is not False and max_data is not True and isinstance(max_data, int):
S.SESSION.send(dbgp.FEATURE_SET, n=dbgp.FEATURE_NAME_MAXDATA, v=max_data)
response = S.SESSION.read()
# Set max depth limit
max_depth = get_value(S.KEY_MAX_DEPTH)
if max_depth is not False and max_depth is not True and isinstance(max_depth, int):
S.SESSION.send(dbgp.FEATURE_SET, n=dbgp.FEATURE_NAME_MAXDEPTH, v=max_depth)
response = S.SESSION.read()
# Set breakpoints for files
for filename, breakpoint_data in S.BREAKPOINT.items():
if breakpoint_data:
for lineno, bp in breakpoint_data.items():
if bp['enabled']:
self.set_breakpoint(filename, lineno, bp['expression'])
debug('breakpoint_set: ' + filename + ':' + lineno)
# Set breakpoints for exceptions
break_on_exception = get_value(S.KEY_BREAK_ON_EXCEPTION)
if isinstance(break_on_exception, list):
for exception_name in break_on_exception:
self.set_exception(exception_name)
# Determine if client should break at first line on connect
if get_value(S.KEY_BREAK_ON_START):
# Get init attribute values
fileuri = init.get(dbgp.INIT_FILEURI)
filename = get_real_path(fileuri)
# Show debug/status output
self.status_message('Xdebug: Break on start')
info('Break on start: ' + filename )
# Store line number of breakpoint for displaying region marker
S.BREAKPOINT_ROW = { 'filename': filename, 'lineno': 1 }
# Focus/Open file window view
self.timeout(lambda: show_file(filename, 1))
# Context variables
context = self.get_context_values()
self.timeout(lambda: show_content(DATA_CONTEXT, context))
# Stack history
stack = self.get_stack_values()
if not stack:
stack = H.unicode_string('[{level}] {filename}.{where}:{lineno}\n' \
.format(level=0, where='{main}', lineno=1, filename=fileuri))
self.timeout(lambda: show_content(DATA_STACK, stack))
# Watch expressions
self.watch_expression()
else:
# Tell script to run it's process
self.run_command('xdebug_execute', {'command': 'run'})
def remove_breakpoint(self, breakpoint_id):
if not breakpoint_id or not is_connected():
return
S.SESSION.send(dbgp.BREAKPOINT_REMOVE, d=breakpoint_id)
response = S.SESSION.read()
def set_breakpoint(self, filename, lineno, expression=None):
if not filename or not lineno or not is_connected():
return
# Get path of file on server
fileuri = get_real_path(filename, True)
# Set breakpoint
S.SESSION.send(dbgp.BREAKPOINT_SET, t='line', f=fileuri, n=lineno, expression=expression)
response = S.SESSION.read()
# Update breakpoint id
breakpoint_id = response.get(dbgp.ATTRIBUTE_BREAKPOINT_ID)
if breakpoint_id:
S.BREAKPOINT[filename][lineno]['id'] = breakpoint_id
def set_exception(self, exception):
if not is_connected():
return
S.SESSION.send(dbgp.BREAKPOINT_SET, t='exception', x='"%s"' % exception)
response = S.SESSION.read()
def status(self):
if not is_connected():
return
# Send 'status' command to debugger engine
S.SESSION.send(dbgp.STATUS)
response = S.SESSION.read()
# Show response in status bar
self.status_message("Xdebug status: " + response.get(dbgp.ATTRIBUTE_REASON) + ' - ' + response.get(dbgp.ATTRIBUTE_STATUS))
def user_execute(self, command, args=None):
if not command or not is_connected():
return
# Send command to debugger engine
S.SESSION.send(command, args)
response = S.SESSION.read(return_string=True)
# Show response data in output panel
self.timeout(lambda: show_panel_content(response))
def watch_expression(self):
# Evaluate watch expressions
self.get_watch_values()
# Show watch expression
self.timeout(lambda: self._watch_expression(self.get_option('check_watch_view', False)))
def _watch_expression(self, check_watch_view):
# Do not show if we only want to show content when Watch view is not available
if check_watch_view and not has_debug_view(TITLE_WINDOW_WATCH):
return
show_content(DATA_WATCH)
########NEW FILE########
__FILENAME__ = settings
DEFAULT_PORT = 9000
DEFAULT_IDE_KEY = 'sublime.xdebug'
PACKAGE_PATH = None
PACKAGE_FOLDER = None
FILE_LOG_OUTPUT = 'Xdebug.log'
FILE_BREAKPOINT_DATA = 'Xdebug.breakpoints'
FILE_PACKAGE_SETTINGS = 'Xdebug.sublime-settings'
FILE_WATCH_DATA = 'Xdebug.expressions'
KEY_SETTINGS = 'settings'
KEY_XDEBUG = 'xdebug'
KEY_PATH_MAPPING = "path_mapping"
KEY_URL = "url"
KEY_IDE_KEY = "ide_key"
KEY_PORT = "port"
KEY_SUPER_GLOBALS = "super_globals"
KEY_MAX_CHILDREN = "max_children"
KEY_MAX_DATA = "max_data"
KEY_MAX_DEPTH = "max_depth"
KEY_BREAK_ON_START = "break_on_start"
KEY_BREAK_ON_EXCEPTION = "break_on_exception"
KEY_CLOSE_ON_STOP = "close_on_stop"
KEY_HIDE_PASSWORD = "hide_password"
KEY_PRETTY_OUTPUT = "pretty_output"
KEY_LAUNCH_BROWSER = "launch_browser"
KEY_BROWSER_NO_EXECUTE = "browser_no_execute"
KEY_DISABLE_LAYOUT = "disable_layout"
KEY_DEBUG_LAYOUT = "debug_layout"
KEY_BREAKPOINT_GROUP = "breakpoint_group"
KEY_BREAKPOINT_INDEX = "breakpoint_index"
KEY_CONTEXT_GROUP = "context_group"
KEY_CONTEXT_INDEX = "context_index"
KEY_STACK_GROUP = "stack_group"
KEY_STACK_INDEX = "stack_index"
KEY_WATCH_GROUP = "watch_group"
KEY_WATCH_INDEX = "watch_index"
KEY_BREAKPOINT_CURRENT = 'breakpoint_current'
KEY_BREAKPOINT_DISABLED = 'breakpoint_disabled'
KEY_BREAKPOINT_ENABLED = 'breakpoint_enabled'
KEY_CURRENT_LINE = 'current_line'
KEY_PYTHON_PATH = "python_path"
KEY_DEBUG = "debug"
# Region scope sources
REGION_KEY_BREAKPOINT = 'xdebug_breakpoint'
REGION_KEY_CURRENT = 'xdebug_current'
REGION_KEY_DISABLED = 'xdebug_disabled'
REGION_SCOPE_BREAKPOINT = 'comment.line.settings'
REGION_SCOPE_CURRENT = 'string.quoted.settings'
# Window layout for debugging output
LAYOUT_DEBUG = {
"cols": [0.0, 0.5, 1.0],
"rows": [0.0, 0.7, 1.0],
"cells": [[0, 0, 2, 1], [0, 1, 1, 2], [1, 1, 2, 2]]
}
# Default single layout (similar to Alt+Shift+1)
LAYOUT_NORMAL = {
"cols": [0.0, 1.0],
"rows": [0.0, 1.0],
"cells": [[0, 0, 1, 1]]
}
RESTORE_LAYOUT = None
RESTORE_INDEX = None
SESSION_BUSY = False
SESSION = None
BREAKPOINT = {}
CONTEXT_DATA = {}
WATCH = []
BREAKPOINT_EXCEPTION = None
# Breakpoint line number in script being debugged
BREAKPOINT_ROW = None
# Placholder for temporary breakpoint filename and line number
BREAKPOINT_RUN = None
# Will hold breakpoint line number to show for file which is being loaded
SHOW_ROW_ONLOAD = {}
CONFIG_PROJECT = None
CONFIG_PACKAGE = None
CONFIG_KEYS = [
KEY_PATH_MAPPING,
KEY_URL,
KEY_IDE_KEY,
KEY_PORT,
KEY_SUPER_GLOBALS,
KEY_MAX_CHILDREN,
KEY_MAX_DATA,
KEY_MAX_DEPTH,
KEY_BREAK_ON_START,
KEY_BREAK_ON_EXCEPTION,
KEY_CLOSE_ON_STOP,
KEY_HIDE_PASSWORD,
KEY_PRETTY_OUTPUT,
KEY_LAUNCH_BROWSER,
KEY_BROWSER_NO_EXECUTE,
KEY_DISABLE_LAYOUT,
KEY_DEBUG_LAYOUT,
KEY_BREAKPOINT_GROUP,
KEY_BREAKPOINT_INDEX,
KEY_CONTEXT_GROUP,
KEY_CONTEXT_INDEX,
KEY_STACK_GROUP,
KEY_STACK_INDEX,
KEY_WATCH_GROUP,
KEY_WATCH_INDEX,
KEY_BREAKPOINT_CURRENT,
KEY_BREAKPOINT_DISABLED,
KEY_BREAKPOINT_ENABLED,
KEY_CURRENT_LINE,
KEY_PYTHON_PATH,
KEY_DEBUG
]
########NEW FILE########
__FILENAME__ = util
import sublime
import json
import os
import re
import sys
import webbrowser
# Helper module
try:
from .helper import H
except:
from helper import H
# Settings variables
try:
from . import settings as S
except:
import settings as S
# Config module
from .config import get_value
# Log module
from .log import debug, info
def get_real_path(uri, server=False):
"""
Get real path
Keyword arguments:
uri -- Uri of file that needs to be mapped and located
server -- Map local path to server path
TODO: Fix mapping for root (/) and drive letters (P:/)
"""
if uri is None:
return uri
# URLdecode uri
uri = H.url_decode(uri)
# Split scheme from uri to get absolute path
try:
# scheme:///path/file => scheme, /path/file
# scheme:///C:/path/file => scheme, C:/path/file
transport, filename = uri.split(':///', 1)
except:
filename = uri
# Normalize path for comparison and remove duplicate/trailing slashes
uri = os.path.normpath(filename)
# Pattern for checking if uri is a windows path
drive_pattern = re.compile(r'^[a-zA-Z]:[\\/]')
# Append leading slash if filesystem is not Windows
if not drive_pattern.match(uri) and not os.path.isabs(uri):
uri = os.path.normpath('/' + uri)
path_mapping = get_value(S.KEY_PATH_MAPPING)
if isinstance(path_mapping, dict):
# Go through path mappings
for server_path, local_path in path_mapping.items():
server_path = os.path.normpath(server_path)
local_path = os.path.normpath(local_path)
# Replace path if mapping available
if server:
# Map local path to server path
if local_path in uri:
uri = uri.replace(local_path, server_path)
break
else:
# Map server path to local path
if server_path in uri:
uri = uri.replace(server_path, local_path)
break
else:
sublime.set_timeout(lambda: sublime.status_message("Xdebug: No path mapping defined, returning given path."), 100)
# Replace slashes
if not drive_pattern.match(uri):
uri = uri.replace("\\", "/")
# Append scheme
if server:
return H.url_encode("file://" + uri)
return uri
def get_region_icon(icon):
# Default icons for color schemes from default theme
default_current = 'bookmark'
default_disabled = 'dot'
default_enabled = 'circle'
# Package icons (without .png extension)
package_breakpoint_current = 'breakpoint_current'
package_breakpoint_disabled = 'breakpoint_disabled'
package_breakpoint_enabled = 'breakpoint_enabled'
package_current_line = 'current_line'
# List to check for duplicate icon entries
icon_list = [default_current, default_disabled, default_enabled]
# Determine icon path
icon_path = None
if S.PACKAGE_FOLDER is not None:
# Strip .sublime-package of package name for comparison
package_extension = ".sublime-package"
current_package = S.PACKAGE_FOLDER
if current_package.endswith(package_extension):
current_package = current_package[:-len(package_extension)]
if sublime.version() == '' or int(sublime.version()) > 3000:
# ST3: Packages/Xdebug Client/icons/breakpoint_enabled.png
icon_path = "Packages/" + current_package + '/icons/{0}.png'
else:
# ST2: ../Xdebug Client/icons/breakpoint_enabled
icon_path = "../" + current_package + '/icons/{0}'
# Append icon path to package icons
package_breakpoint_current = icon_path.format(package_breakpoint_current)
package_breakpoint_disabled = icon_path.format(package_breakpoint_disabled)
package_breakpoint_enabled = icon_path.format(package_breakpoint_enabled)
package_current_line = icon_path.format(package_current_line)
# Add to duplicate list
icon_list.append(icon_path.format(package_breakpoint_current))
icon_list.append(icon_path.format(package_breakpoint_disabled))
icon_list.append(icon_path.format(package_breakpoint_enabled))
icon_list.append(icon_path.format(package_current_line))
# Get user defined icons from settings
breakpoint_current = get_value(S.KEY_BREAKPOINT_CURRENT)
breakpoint_disabled = get_value(S.KEY_BREAKPOINT_DISABLED)
breakpoint_enabled = get_value(S.KEY_BREAKPOINT_ENABLED)
current_line = get_value(S.KEY_CURRENT_LINE)
# Duplicate check, enabled breakpoint
if breakpoint_enabled not in icon_list:
icon_list.append(breakpoint_enabled)
else:
breakpoint_enabled = None
# Duplicate check, disabled breakpoint
if breakpoint_disabled not in icon_list:
icon_list.append(breakpoint_disabled)
else:
breakpoint_disabled = None
# Duplicate check, current line
if current_line not in icon_list:
icon_list.append(current_line)
else:
current_line = None
# Duplicate check, current breakpoint
if breakpoint_current not in icon_list:
icon_list.append(breakpoint_current)
else:
breakpoint_current = None
# Use default/package icon if no user defined or duplicate detected
if not breakpoint_current and icon_path is not None:
breakpoint_current = package_breakpoint_current
if not breakpoint_disabled:
breakpoint_disabled = default_disabled if icon_path is None else package_breakpoint_disabled
if not breakpoint_enabled:
breakpoint_enabled = default_enabled if icon_path is None else package_breakpoint_enabled
if not current_line:
current_line = default_current if icon_path is None else package_current_line
# Return icon for icon name
if icon == S.KEY_CURRENT_LINE:
return current_line
elif icon == S.KEY_BREAKPOINT_CURRENT:
return breakpoint_current
elif icon == S.KEY_BREAKPOINT_DISABLED:
return breakpoint_disabled
elif icon == S.KEY_BREAKPOINT_ENABLED:
return breakpoint_enabled
else:
info("Invalid icon name. (" + icon + ")")
return
def launch_browser():
url = get_value(S.KEY_URL)
if not url:
sublime.set_timeout(lambda: sublime.status_message('Xdebug: No URL defined in (project) settings file.'), 100)
return
ide_key = get_value(S.KEY_IDE_KEY, S.DEFAULT_IDE_KEY)
operator = '?'
# Check if url already has query string
if url.count("?"):
operator = '&'
# Start debug session
if S.SESSION and (S.SESSION.listening or not S.SESSION.connected):
webbrowser.open(url + operator + 'XDEBUG_SESSION_START=' + ide_key)
# Stop debug session
else:
# Check if we should execute script
if get_value(S.KEY_BROWSER_NO_EXECUTE):
# Without executing script
webbrowser.open(url + operator + 'XDEBUG_SESSION_STOP_NO_EXEC=' + ide_key)
else:
# Run script normally
webbrowser.open(url + operator + 'XDEBUG_SESSION_STOP=' + ide_key)
def load_breakpoint_data():
data_path = os.path.join(sublime.packages_path(), 'User', S.FILE_BREAKPOINT_DATA)
data = {}
try:
data_file = open(data_path, 'rb')
except:
e = sys.exc_info()[1]
info('Failed to open %s.' % data_path)
debug(e)
try:
data = json.loads(H.data_read(data_file.read()))
except:
e = sys.exc_info()[1]
info('Failed to parse %s.' % data_path)
debug(e)
# Do not use deleted files or entries without breakpoints
if data:
for filename, breakpoint_data in data.copy().items():
if not breakpoint_data or not os.path.isfile(filename):
del data[filename]
if not isinstance(S.BREAKPOINT, dict):
S.BREAKPOINT = {}
# Set breakpoint data
S.BREAKPOINT.update(data)
def load_watch_data():
data_path = os.path.join(sublime.packages_path(), 'User', S.FILE_WATCH_DATA)
data = []
try:
data_file = open(data_path, 'rb')
except:
e = sys.exc_info()[1]
info('Failed to open %s.' % data_path)
debug(e)
try:
data = json.loads(H.data_read(data_file.read()))
except:
e = sys.exc_info()[1]
info('Failed to parse %s.' % data_path)
debug(e)
# Check if expression is not already defined
duplicates = []
for index, entry in enumerate(data):
matches = [x for x in S.WATCH if x['expression'] == entry['expression']]
if matches:
duplicates.append(entry)
else:
# Unset any previous value
data[index]['value'] = None
for duplicate in duplicates:
data.remove(duplicate)
if not isinstance(S.WATCH, list):
S.WATCH = []
# Set watch data
S.WATCH.extend(data)
def save_breakpoint_data():
data_path = os.path.join(sublime.packages_path(), 'User', S.FILE_BREAKPOINT_DATA)
with open(data_path, 'wb') as data:
data.write(H.data_write(json.dumps(S.BREAKPOINT)))
def save_watch_data():
data_path = os.path.join(sublime.packages_path(), 'User', S.FILE_WATCH_DATA)
with open(data_path, 'wb') as data:
data.write(H.data_write(json.dumps(S.WATCH)))
########NEW FILE########
__FILENAME__ = view
import sublime
import operator
import os
import re
# Helper module
try:
from .helper import H
except:
from helper import H
# Settings variables
try:
from . import settings as S
except:
import settings as S
# DBGp protocol constants
try:
from . import dbgp
except:
import dbgp
# Config module
from .config import get_value, get_window_value, set_window_value
# Util module
from .util import get_real_path, get_region_icon, save_watch_data
DATA_BREAKPOINT = 'breakpoint'
DATA_CONTEXT = 'context'
DATA_STACK = 'stack'
DATA_WATCH = 'watch'
TITLE_WINDOW_BREAKPOINT = "Xdebug Breakpoint"
TITLE_WINDOW_CONTEXT = "Xdebug Context"
TITLE_WINDOW_STACK = "Xdebug Stack"
TITLE_WINDOW_WATCH = "Xdebug Watch"
def close_debug_windows():
"""
Close all debugging related views in active window.
"""
window = sublime.active_window()
for view in window.views():
if is_debug_view(view):
window.focus_view(view)
window.run_command('close')
window.run_command('hide_panel', {"panel": 'output.xdebug'})
def generate_breakpoint_output():
"""
Generate output with all configured breakpoints.
"""
# Get breakpoints for files
values = H.unicode_string('')
if S.BREAKPOINT is None:
return values
for filename, breakpoint_data in sorted(S.BREAKPOINT.items()):
breakpoint_entry = ''
if breakpoint_data:
breakpoint_entry += "=> %s\n" % filename
# Sort breakpoint data by line number
for lineno, bp in sorted(breakpoint_data.items(), key=lambda item: (int(item[0]) if isinstance(item[0], int) or H.is_digit(item[0]) else float('inf'), item[0])):
# Do not show temporary breakpoint
if S.BREAKPOINT_RUN is not None and S.BREAKPOINT_RUN['filename'] == filename and S.BREAKPOINT_RUN['lineno'] == lineno:
continue
# Whether breakpoint is enabled or disabled
breakpoint_entry += '\t'
if bp['enabled']:
breakpoint_entry += '|+|'
else:
breakpoint_entry += '|-|'
# Line number
breakpoint_entry += ' %s' % lineno
# Conditional expression
if bp['expression'] is not None:
breakpoint_entry += ' -- "%s"' % bp['expression']
breakpoint_entry += "\n"
values += H.unicode_string(breakpoint_entry)
return values
def generate_context_output(context, indent=0):
"""
Generate readable context from dictionary with context data.
Keyword arguments:
context -- Dictionary with context data.
indent -- Indent level.
"""
# Generate output text for values
values = H.unicode_string('')
if not isinstance(context, dict):
return values
for variable in context.values():
has_children = False
property_text = ''
# Set indentation
for i in range(indent): property_text += '\t'
# Property with value
if variable['value'] is not None:
if variable['name']:
property_text += '{name} = '
property_text += '({type}) {value}\n'
# Property with children
elif isinstance(variable['children'], dict) and variable['numchildren'] is not None:
has_children = True
if variable['name']:
property_text += '{name} = '
property_text += '{type}[{numchildren}]\n'
# Unknown property
else:
if variable['name']:
property_text += '{name} = '
property_text += '<{type}>\n'
# Remove newlines in value to prevent incorrect indentation
value = ''
if variable['value'] and len(variable['value']) > 0:
value = variable['value'].replace("\r\n", "\n").replace("\n", " ")
# Format string and append to output
values += H.unicode_string(property_text \
.format(value=value, type=variable['type'], name=variable['name'], numchildren=variable['numchildren']))
# Append property children to output
if has_children:
# Get children for property (no need to convert, already unicode)
values += generate_context_output(variable['children'], indent+1)
# Use ellipsis to indicate that results have been truncated
limited = False
if isinstance(variable['numchildren'], int) or H.is_digit(variable['numchildren']):
if int(variable['numchildren']) != len(variable['children']):
limited = True
elif len(variable['children']) > 0 and not variable['numchildren']:
limited = True
if limited:
for i in range(indent+1): values += H.unicode_string('\t')
values += H.unicode_string('...\n')
return values
def generate_stack_output(response):
values = H.unicode_string('')
# Display exception name and message
if S.BREAKPOINT_EXCEPTION:
values += H.unicode_string('[{name}] {message}\n' \
.format(name=S.BREAKPOINT_EXCEPTION['name'], message=S.BREAKPOINT_EXCEPTION['message']))
# Walk through elements in response
has_output = False
try:
for child in response:
# Get stack attribute values
if child.tag == dbgp.ELEMENT_STACK or child.tag == dbgp.ELEMENT_PATH_STACK:
stack_level = child.get(dbgp.STACK_LEVEL, 0)
stack_type = child.get(dbgp.STACK_TYPE)
stack_file = H.url_decode(child.get(dbgp.STACK_FILENAME))
stack_line = child.get(dbgp.STACK_LINENO, 0)
stack_where = child.get(dbgp.STACK_WHERE, '{unknown}')
# Append values
values += H.unicode_string('[{level}] {filename}.{where}:{lineno}\n' \
.format(level=stack_level, type=stack_type, where=stack_where, lineno=stack_line, filename=stack_file))
has_output = True
except:
pass
# When no stack use values from exception
if not has_output and S.BREAKPOINT_EXCEPTION:
values += H.unicode_string('[{level}] {filename}.{where}:{lineno}\n' \
.format(level=0, where='{unknown}', lineno=S.BREAKPOINT_EXCEPTION['lineno'], filename=S.BREAKPOINT_EXCEPTION['filename']))
return values
def generate_watch_output():
"""
Generate output with all watch expressions.
"""
values = H.unicode_string('')
if S.WATCH is None:
return values
for watch_data in S.WATCH:
watch_entry = ''
if watch_data and isinstance(watch_data, dict):
# Whether watch expression is enabled or disabled
if 'enabled' in watch_data.keys():
if watch_data['enabled']:
watch_entry += '|+|'
else:
watch_entry += '|-|'
# Watch expression
if 'expression' in watch_data.keys():
watch_entry += ' "%s"' % watch_data['expression']
# Evaluated value
if watch_data['value'] is not None:
watch_entry += ' = ' + generate_context_output(watch_data['value'])
else:
watch_entry += "\n"
values += H.unicode_string(watch_entry)
return values
def get_context_variable(context, variable_name):
"""
Find a variable in the context data.
Keyword arguments:
context -- Dictionary with context data to search.
variable_name -- Name of variable to find.
"""
if isinstance(context, dict):
if variable_name in context:
return context[variable_name]
for variable in context.values():
if isinstance(variable['children'], dict):
children = get_context_variable(variable['children'], variable_name)
if children:
return children
def get_debug_index(name=None):
"""
Retrieve configured group/index position of of debug view(s) within active window.
Returns list with tuple entries for all debug views or single tuple when specified name of debug view.
Structure of tuple entry for debug view is as followed:
(group position in window, index position in group, name/title of debug view)
Keyword arguments:
name -- Name of debug view to get group/index position.
"""
# Set group and index for each debug view
breakpoint_group = get_value(S.KEY_BREAKPOINT_GROUP, -1)
breakpoint_index = get_value(S.KEY_BREAKPOINT_INDEX, 0)
context_group = get_value(S.KEY_CONTEXT_GROUP, -1)
context_index = get_value(S.KEY_CONTEXT_INDEX, 0)
stack_group = get_value(S.KEY_STACK_GROUP, -1)
stack_index = get_value(S.KEY_STACK_INDEX, 0)
watch_group = get_value(S.KEY_WATCH_GROUP, -1)
watch_index = get_value(S.KEY_WATCH_INDEX, 0)
# Create list with all debug views and sort by group/index
debug_list = []
debug_list.append((breakpoint_group, breakpoint_index, TITLE_WINDOW_BREAKPOINT))
debug_list.append((context_group, context_index, TITLE_WINDOW_CONTEXT))
debug_list.append((stack_group, stack_index, TITLE_WINDOW_STACK))
debug_list.append((watch_group, watch_index, TITLE_WINDOW_WATCH))
debug_list.sort(key=operator.itemgetter(0,1))
# Recalculate group/index position within boundaries of active window
window = sublime.active_window()
group_limit = window.num_groups()-1
sorted_list = []
last_group = None
last_index = 0
for debug in debug_list:
group, index, title = debug
# Set group position
if group > group_limit:
group = group_limit
# Set index position
if group == last_group:
last_index += 1
else:
index_limit = len(window.views_in_group(group))
if index > index_limit:
index = index_limit
last_group = group
last_index = index
# Add debug view with new group/index
sorted_list.append((group, last_index, title))
# Sort recalculated list by group/index
sorted_list.sort(key=operator.itemgetter(0,1))
# Find specified view by name/title of debug view
if name is not None:
try:
return [view[2] for view in sorted_list].index(name)
except ValueError:
return None
# List with all debug views
return sorted_list
def get_response_properties(response, default_key=None):
"""
Return a dictionary with available properties from response.
Keyword arguments:
response -- Response from debugger engine.
default_key -- Index key to use when property has no name.
"""
properties = H.new_dictionary()
# Walk through elements in response
for child in response:
# Read property elements
if child.tag == dbgp.ELEMENT_PROPERTY or child.tag == dbgp.ELEMENT_PATH_PROPERTY:
# Get property attribute values
property_name_short = child.get(dbgp.PROPERTY_NAME)
property_name = child.get(dbgp.PROPERTY_FULLNAME, property_name_short)
property_type = child.get(dbgp.PROPERTY_TYPE)
property_children = child.get(dbgp.PROPERTY_CHILDREN)
property_numchildren = child.get(dbgp.PROPERTY_NUMCHILDREN)
property_classname = child.get(dbgp.PROPERTY_CLASSNAME)
property_encoding = child.get(dbgp.PROPERTY_ENCODING)
property_value = None
# Set property value
if child.text:
property_value = child.text
# Try to decode property value when encoded with base64
if property_encoding is not None and property_encoding == 'base64':
try:
property_value = H.base64_decode(child.text)
except:
pass
if property_name is not None and len(property_name) > 0:
property_key = property_name
# Ignore following properties
if property_name == "::":
continue
# Avoid nasty static functions/variables from turning in an infinitive loop
if property_name.count("::") > 1:
continue
# Filter password values
if get_value(S.KEY_HIDE_PASSWORD, True) and property_name.lower().find('password') != -1 and property_value is not None:
property_value = '******'
else:
property_key = default_key
# Store property
if property_key:
properties[property_key] = { 'name': property_name, 'type': property_type, 'value': property_value, 'numchildren': property_numchildren, 'children' : None }
# Get values for children
if property_children:
properties[property_key]['children'] = get_response_properties(child, default_key)
# Set classname, if available, as type for object
if property_classname and property_type == 'object':
properties[property_key]['type'] = property_classname
# Handle error elements
elif child.tag == dbgp.ELEMENT_ERROR or child.tag == dbgp.ELEMENT_PATH_ERROR:
message = 'error'
for step_child in child:
if step_child.tag == dbgp.ELEMENT_MESSAGE or step_child.tag == dbgp.ELEMENT_PATH_MESSAGE and step_child.text:
message = step_child.text
break
if default_key:
properties[default_key] = { 'name': None, 'type': message, 'value': None, 'numchildren': None, 'children': None }
return properties
def has_debug_view(name=None):
"""
Determine if active window has any or specific debug view(s).
Keyword arguments:
name -- Name of debug view to search for in active window.
"""
for view in sublime.active_window().views():
if is_debug_view(view):
if name is not None:
if view.name() == name:
return True
else:
return True
return False
def is_debug_view(view):
"""
Check if view name matches debug name/title.
Keyword arguments:
view -- View reference which to check if name matches debug name/title.
"""
return view.name() == TITLE_WINDOW_BREAKPOINT or view.name() == TITLE_WINDOW_CONTEXT or view.name() == TITLE_WINDOW_STACK or view.name() == TITLE_WINDOW_WATCH
def set_layout(layout):
"""
Toggle between debug and default window layouts.
"""
# Get active window and set reference to active view
window = sublime.active_window()
previous_active = window.active_view()
# Do not set layout when disabled
if get_value(S.KEY_DISABLE_LAYOUT):
S.RESTORE_LAYOUT = window.get_layout()
set_window_value('restore_layout', S.RESTORE_LAYOUT)
S.RESTORE_INDEX = H.new_dictionary()
set_window_value('restore_index', S.RESTORE_INDEX)
return
# Show debug layout
if layout == 'debug':
debug_layout = get_value(S.KEY_DEBUG_LAYOUT, S.LAYOUT_DEBUG)
if window.get_layout() != debug_layout:
# Save current layout
S.RESTORE_LAYOUT = window.get_layout()
set_window_value('restore_layout', S.RESTORE_LAYOUT)
# Remember view indexes
S.RESTORE_INDEX = H.new_dictionary()
for view in window.views():
view_id = "%d" % view.id()
group, index = window.get_view_index(view)
S.RESTORE_INDEX[view_id] = { "group": group, "index": index }
set_window_value('restore_index', S.RESTORE_INDEX)
# Set debug layout
window.set_layout(S.LAYOUT_NORMAL)
window.set_layout(debug_layout)
# Show previous (single) layout
else:
# Get previous layout configuration
if S.RESTORE_LAYOUT is None:
S.RESTORE_LAYOUT = get_window_value('restore_layout', S.LAYOUT_NORMAL)
if S.RESTORE_INDEX is None:
S.RESTORE_INDEX = get_window_value('restore_index', {})
# Restore layout
window.set_layout(S.LAYOUT_NORMAL)
window.set_layout(S.RESTORE_LAYOUT)
for view in window.views():
view_id = "%d" % view.id()
# Set view indexes
if view_id in H.dictionary_keys(S.RESTORE_INDEX):
v = S.RESTORE_INDEX[view_id]
window.set_view_index(view, v["group"], v["index"])
# Restore focus to previous active view
if not previous_active is None:
window.focus_view(previous_active)
def show_content(data, content=None):
"""
Show content for specific data type in assigned window view.
Note: When view does not exists, it will create one.
"""
# Hande data type
if data == DATA_BREAKPOINT:
title = TITLE_WINDOW_BREAKPOINT
content = generate_breakpoint_output()
elif data == DATA_CONTEXT:
title = TITLE_WINDOW_CONTEXT
elif data == DATA_STACK:
title = TITLE_WINDOW_STACK
elif data == DATA_WATCH:
title = TITLE_WINDOW_WATCH
content = generate_watch_output()
else:
return
# Get list of group/index for all debug views
debug_index = get_debug_index()
# Find group/index of debug view for current data type
try:
key = [debug[2] for debug in debug_index].index(title)
except ValueError:
return
# Set group and index position
group, index, _ = debug_index[key]
# Get active window and set reference to active view
window = sublime.active_window()
previous_active = window.active_view_in_group(window.active_group())
# Loop through views in active window
found = False
view = None
previous_key = -1
active_debug = None
for v in window.views():
# Search for view assigned to data type
if v.name() == title:
found = True
view = v
continue
# Adjust group/index of debug view depending on other debug view(s)
if is_debug_view(v):
try:
current_key = [debug[2] for debug in debug_index].index(v.name())
except ValueError:
continue
# Get current position of view
view_group, view_index = window.get_view_index(v)
# Recalculate group/index for debug view
current_group, current_index, _ = debug_index[current_key]
if group == current_group:
if key > previous_key and key < current_key:
index = view_index
if key > current_key:
index = view_index + 1
# Remember debug view for setting focus
if v == window.active_view_in_group(group):
active_debug = v
previous_key = current_key
# Make sure index position is not out of boundary
index_limit = len(window.views_in_group(group))
if index > index_limit:
index = index_limit
# Create new view if it does not exists
if not found:
view = window.new_file()
view.set_scratch(True)
view.set_read_only(True)
view.set_name(title)
window.set_view_index(view, group, index)
# Set focus back to active debug view
if active_debug is not None:
window.focus_view(active_debug)
# Strip .sublime-package of package name for syntax file
package_extension = ".sublime-package"
package = S.PACKAGE_FOLDER
if package.endswith(package_extension):
package = package[:-len(package_extension)]
# Configure view settings
view.settings().set('word_wrap', False)
view.settings().set('syntax', 'Packages/' + package + '/Xdebug.tmLanguage')
# Set content for view and fold all indendation blocks
view.run_command('xdebug_view_update', {'data': content, 'readonly': True})
if data == DATA_CONTEXT or data == DATA_WATCH:
view.run_command('fold_all')
# Restore focus to previous active view/group
if previous_active is not None:
window.focus_view(previous_active)
else:
window.focus_group(0)
def show_context_output(view):
"""
Show selected variable in an output panel when clicked in context window.
Keyword arguments:
view -- View reference which holds the context window.
"""
# Check if there is a debug session and context data
if S.SESSION and S.SESSION.connected and S.CONTEXT_DATA:
try:
# Get selected point in view
point = view.sel()[0]
# Check if selected point uses variable scope
if point.size() == 0 and sublime.score_selector(view.scope_name(point.a), 'variable'):
# Find variable in line which contains the point
line = view.substr(view.line(point))
pattern = re.compile('^\\s*(\\$.*?)\\s+\\=')
match = pattern.match(line)
if match:
# Get variable details from context data
variable_name = match.group(1)
variable = get_context_variable(S.CONTEXT_DATA, variable_name)
if variable:
# Convert details to text output
variables = H.new_dictionary()
variables[variable_name] = variable
data = generate_context_output(variables)
# Show context variables and children in output panel
window = sublime.active_window()
panel = window.get_output_panel('xdebug')
panel.run_command("xdebug_view_update", {'data' : data} )
panel.run_command('set_setting', {"setting": 'word_wrap', "value": True})
window.run_command('show_panel', {"panel": 'output.xdebug'})
except:
pass
def show_file(filename, row=None):
"""
Open or focus file in window, which is currently being debugged.
Keyword arguments:
filename -- Absolute path of file on local device.
"""
# Check if file exists if being referred to file system
if os.path.exists(filename):
# Get active window
window = sublime.active_window()
window.focus_group(0)
# Check if file is already open
found = False
view = window.find_open_file(filename)
if not view is None:
found = True
window.focus_view(view)
# Set focus to row (line number)
show_at_row(view, row)
# Open file if not open
if not found:
view = window.open_file(filename)
window.focus_view(view)
# Set focus to row (line number) when file is loaded
S.SHOW_ROW_ONLOAD[filename] = row
def show_panel_content(content):
# Show response data in output panel
try:
window = sublime.active_window()
panel = window.get_output_panel('xdebug')
panel.run_command('xdebug_view_update', {'data': content})
panel.run_command('set_setting', {"setting": 'word_wrap', "value": True})
window.run_command('show_panel', {'panel': 'output.xdebug'})
except:
print(content)
def show_at_row(view, row=None):
"""
Scroll the view to center on the given row (line number).
Keyword arguments:
- view -- Which view to scroll to center on row.
- row -- Row where to center the view.
"""
if row is not None:
try:
# Convert row (line number) to region
row_region = rows_to_region(row)[0].a
# Scroll the view to row
view.show_at_center(row_region)
except:
# When defining row_region index could be out of bounds
pass
def rows_to_region(rows):
"""
Convert rows (line numbers) to a region (selection/cursor position).
Keyword arguments:
- rows -- Row number(s) to convert to region(s).
"""
# Get current active view
view = sublime.active_window().active_view()
# Unable to convert rows to regions when no view available
if view is None:
return
# List for containing regions to return
region = []
# Create list if it is a singleton
if not isinstance(rows, list):
rows = [rows]
for row in rows:
# Check if row is a digit
if isinstance(row, int) or H.is_digit(row):
# Convert from 1 based to a 0 based row (line) number
row_number = int(row) - 1
# Calculate offset point for row
offset_point = view.text_point(row_number, 0)
# Get region for row by offset point
region_row = view.line(offset_point)
# Add to list for result
region.append(region_row)
return region
def region_to_rows(region=None, filter_empty=False):
"""
Convert a region (selection/cursor position) to rows (line numbers).
Keyword arguments:
- region -- sublime.Selection/sublime.RegionSet or sublime.Region to convert to row number(s).
- filter_empty -- Filter empty rows (line numbers).
"""
# Get current active view
view = sublime.active_window().active_view()
# Unable to convert regions to rows when no view available
if view is None:
return
# Use current selection/cursor position if no region defined
if region is None:
region = view.sel()
# List for containing rows (line numbers) to return
rows = []
# Create list if it is a singleton
if isinstance(region, sublime.Region):
region = [region]
# Split the region up, so that each region returned exists on exactly one line
region_split = []
for region_part in region:
region_split.extend(view.split_by_newlines(region_part))
# Get row (line) number for each region area
for region_area in region_split:
# Retrieve line region for current region area
row_line = view.line(region_area)
# Check if line region is empty
if filter_empty and row_line.empty():
continue
# Get beginning coordination point of line region
row_point = row_line.begin()
# Retrieve row (line) number and column number of region
row, col = view.rowcol(row_point)
# Convert from 0 based to a 1 based row (line) number
row_number = str(row + 1)
# Add to list for result
rows.append(row_number)
return rows
def render_regions(view=None):
"""
Set breakpoint/current line marker(s) for current active view.
Note: View rendering conflict when using same icon for different scopes in add_regions().
"""
# Get current active view
if view is None:
view = sublime.active_window().active_view()
# Unable to set regions when no view available
if view is None:
return
# Do no set regions if view is empty or still loading
if view.size() == 0 or view.is_loading():
return
# Remove all markers to avoid marker conflict
view.erase_regions(S.REGION_KEY_BREAKPOINT)
view.erase_regions(S.REGION_KEY_CURRENT)
view.erase_regions(S.REGION_KEY_DISABLED)
# Get filename of current view and check if is a valid filename
filename = view.file_name()
if not filename:
return
# Determine icon for regions
icon_current = get_region_icon(S.KEY_CURRENT_LINE)
icon_disabled = get_region_icon(S.KEY_BREAKPOINT_DISABLED)
icon_enabled = get_region_icon(S.KEY_BREAKPOINT_ENABLED)
# Get all (disabled) breakpoint rows (line numbers) for file
breakpoint_rows = []
disabled_rows = []
if filename in S.BREAKPOINT and isinstance(S.BREAKPOINT[filename], dict):
for lineno, bp in S.BREAKPOINT[filename].items():
# Do not show temporary breakpoint
if S.BREAKPOINT_RUN is not None and S.BREAKPOINT_RUN['filename'] == filename and S.BREAKPOINT_RUN['lineno'] == lineno:
continue
# Determine if breakpoint is enabled or disabled
if bp['enabled']:
breakpoint_rows.append(lineno)
else:
disabled_rows.append(lineno)
# Get current line from breakpoint hit
if S.BREAKPOINT_ROW is not None:
# Make sure current breakpoint is in this file
if filename == S.BREAKPOINT_ROW['filename']:
# Remove current line number from breakpoint rows to avoid marker conflict
if S.BREAKPOINT_ROW['lineno'] in breakpoint_rows:
breakpoint_rows.remove(S.BREAKPOINT_ROW['lineno'])
# Set icon for current breakpoint
icon_breakpoint_current = get_region_icon(S.KEY_BREAKPOINT_CURRENT)
if icon_breakpoint_current:
icon_current = icon_breakpoint_current
if S.BREAKPOINT_ROW['lineno'] in disabled_rows:
disabled_rows.remove(S.BREAKPOINT_ROW['lineno'])
# Set current line marker
if icon_current:
view.add_regions(S.REGION_KEY_CURRENT, rows_to_region(S.BREAKPOINT_ROW['lineno']), S.REGION_SCOPE_CURRENT, icon_current, sublime.HIDDEN)
# Set breakpoint marker(s)
if breakpoint_rows and icon_enabled:
view.add_regions(S.REGION_KEY_BREAKPOINT, rows_to_region(breakpoint_rows), S.REGION_SCOPE_BREAKPOINT, icon_enabled, sublime.HIDDEN)
if disabled_rows and icon_disabled:
view.add_regions(S.REGION_KEY_DISABLED, rows_to_region(disabled_rows), S.REGION_SCOPE_BREAKPOINT, icon_disabled, sublime.HIDDEN)
def toggle_breakpoint(view):
try:
# Get selected point in view
point = view.sel()[0]
# Check if selected point uses breakpoint line scope
if point.size() == 3 and sublime.score_selector(view.scope_name(point.a), 'xdebug.output.breakpoint.line'):
# Find line number of breakpoint
line = view.substr(view.line(point))
pattern = re.compile('^\\s*(?:(\\|\\+\\|)|(\\|-\\|))\\s*(?P<line_number>\\d+)\\s*(?:(--)(.*)|.*)')
match = pattern.match(line)
# Check if it has found line number
if match and match.group('line_number'):
# Get all breakpoint filenames
breakpoint_file = view.find_by_selector('xdebug.output.breakpoint.file')
# Locate line with filename related to selected breakpoint
file_line = None
for entry in breakpoint_file:
# Stop searching if we have passed selected breakpoint
if entry > point:
break
file_line = view.substr(view.line(entry))
# Do not continue without line containing filename
if file_line is None:
return
# Remove unnecessary text from line to get filename
file_pattern = re.compile('^\\s*(=>)\\s*(?P<filename>.*)')
file_match = file_pattern.match(file_line)
# Check if it is a valid filename
if file_match and file_match.group('filename'):
filename = file_match.group('filename')
line_number = match.group('line_number')
enabled = None
# Disable breakpoint
if sublime.score_selector(view.scope_name(point.a), 'entity') and S.BREAKPOINT[filename][line_number]['enabled']:
enabled = False
# Enable breakpoint
if sublime.score_selector(view.scope_name(point.a), 'keyword') and not S.BREAKPOINT[filename][line_number]['enabled']:
enabled = True
# Toggle breakpoint only if it has valid value
if enabled is None:
return
sublime.active_window().run_command('xdebug_breakpoint', {"enabled": enabled, "rows": [line_number], "filename": filename})
# Check if selected point uses breakpoint file scope
elif point.size() > 3 and sublime.score_selector(view.scope_name(point.a), 'xdebug.output.breakpoint.file'):
# Get filename from selected line in view
file_line = view.substr(view.line(point))
file_pattern = re.compile('^\\s*(=>)\\s*(?P<filename>.*)')
file_match = file_pattern.match(file_line)
# Show file when it's a valid filename
if file_match and file_match.group('filename'):
filename = file_match.group('filename')
show_file(filename)
except:
pass
def toggle_stack(view):
try:
# Get selected point in view
point = view.sel()[0]
# Check if selected point uses stack entry scope
if point.size() > 3 and sublime.score_selector(view.scope_name(point.a), 'xdebug.output.stack.entry'):
# Get fileuri and line number from selected line in view
line = view.substr(view.line(point))
pattern = re.compile('^(\[\d+\])\s*(?P<fileuri>.*)(\..*)(\s*:.*?(?P<lineno>\d+))\s*(\((.*?):.*\)|$)')
match = pattern.match(line)
# Show file when it's a valid fileuri
if match and match.group('fileuri'):
filename = get_real_path(match.group('fileuri'))
lineno = 0
if match.group('lineno'):
lineno = match.group('lineno')
show_file(filename, lineno)
except:
pass
def toggle_watch(view):
# Do not try to toggle when no watch expressions defined
if not S.WATCH:
return
try:
# Get selected point in view
point = view.sel()[0]
# Check if selected point uses watch entry scope
if point.size() == 3 and sublime.score_selector(view.scope_name(point.a), 'xdebug.output.watch.entry'):
# Determine if watch entry is enabled or disabled
line = view.substr(view.line(point))
pattern = re.compile('^(?:(?P<enabled>\\|\\+\\|)|(?P<disabled>\\|-\\|))\\.*')
match = pattern.match(line)
if match and (match.group('enabled') or match.group('disabled')):
# Get all entries and determine index by line/point match
watch = view.find_by_selector('xdebug.output.watch.entry')
watch_index = 0
for entry in watch:
# Stop searching if we have passed selected breakpoint
if entry > point:
break
# Only increment watch index when it contains expression
watch_line = view.substr(view.line(entry))
watch_match = pattern.match(watch_line)
if watch_match and (watch_match.group('enabled') or watch_match.group('disabled')):
watch_index += 1
# Disable watch expression
if sublime.score_selector(view.scope_name(point.a), 'entity') and S.WATCH[watch_index]['enabled']:
S.WATCH[watch_index]['enabled'] = False
# Enable watch expression
if sublime.score_selector(view.scope_name(point.a), 'keyword') and not S.WATCH[watch_index]['enabled']:
S.WATCH[watch_index]['enabled'] = True
# Update watch view and save watch data to file
sublime.active_window().run_command('xdebug_watch', {"update": True})
except:
pass
########NEW FILE########
| [
"[email protected]"
] | |
a84b063eec175fb6c346c4f36e9ac302df8415ab | b6c069539ae1caf59686b93aef6a6eb2609b0ac1 | /hw1/utils.py | 270002cec77166431781a3c3482f3a0f3840da13 | [] | no_license | Vivek-23-Titan/CMU-16824-Vision-Learning-and-Recognition | 2e52ead0ca318190cf4a32ebdbe2c75de19a9a50 | 2b5fca32ca313781d2c137e1f9c5ea77eb332797 | refs/heads/main | 2023-08-23T11:14:29.281288 | 2021-10-15T19:48:12 | 2021-10-15T19:48:12 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 4,745 | py | # --------------------------------------------------------
# Written by Yufei Ye (https://github.com/JudyYe)
# Modified by Sudeep Dasari
# --------------------------------------------------------
import os
import torch
import numpy as np
import sklearn.metrics
from torch.utils.data import DataLoader
class ARGS(object):
"""
Tracks hyper-parameters for trainer code
- Feel free to add your own hparams below (cannot have __ in name)
- Constructor will automatically support overrding for non-default values
Example::
>>> args = ARGS(batch_size=23, use_cuda=True)
>>> print(args)
args.batch_size = 23
args.device = cuda
args.epochs = 14
args.gamma = 0.7
args.log_every = 100
args.lr = 1.0
args.save_model = False
args.test_batch_size = 1000
args.val_every = 100
"""
# input batch size for training
batch_size = 64
# input batch size for testing
test_batch_size=1000
# number of epochs to train for
epochs = 14
# learning rate
lr = 1.0
# Learning rate step gamma
gamma = 0.7
# how many batches to wait before logging training status
log_every = 100
# how many batches to wait before evaluating model
val_every = 100
# set flag to True if you wish to save the model after training
save_at_end = False
# set this to value >0 if you wish to save every x epochs
save_freq=-1
# set true if using GPU during training
use_cuda = False
def __init__(self, **kwargs):
for k, v in kwargs.items():
assert '__' not in k and hasattr(self, k), "invalid attribute!"
assert k != 'device', "device property cannot be modified"
setattr(self, k, v)
def __repr__(self):
repr_str = ''
for attr in dir(self):
if '__' not in attr and attr !='use_cuda':
repr_str += 'args.{} = {}\n'.format(attr, getattr(self, attr))
return repr_str
@property
def device(self):
return torch.device("cuda" if self.use_cuda else "cpu")
def get_data_loader(name='voc', train=True, batch_size=64, split='train'):
if name == 'voc':
from voc_dataset import VOCDataset
dataset = VOCDataset(split, 224)
else:
raise NotImplementedError
loader = DataLoader(
dataset,
batch_size=batch_size,
shuffle=train,
num_workers=4,
)
return loader
def compute_ap(gt, pred, valid, average=None):
"""
Compute the multi-label classification accuracy.
Args:
gt (np.ndarray): Shape Nx20, 0 or 1, 1 if the object i is present in that
image.
pred (np.ndarray): Shape Nx20, probability of that object in the image
(output probablitiy).
valid (np.ndarray): Shape Nx20, 0 if you want to ignore that class for that
image. Some objects are labeled as ambiguous.
Returns:
AP (list): average precision for all classes
"""
nclasses = gt.shape[1]
AP = []
for cid in range(nclasses):
gt_cls = gt[:, cid][valid[:, cid] > 0].astype('float32')
pred_cls = pred[:, cid][valid[:, cid] > 0].astype('float32')
# As per PhilK. code:
# https://github.com/philkr/voc-classification/blob/master/src/train_cls.py
pred_cls -= 1e-5 * gt_cls
ap = sklearn.metrics.average_precision_score(
gt_cls, pred_cls, average=average)
AP.append(ap)
return AP
def eval_dataset_map(model, device, test_loader):
"""
Evaluate the model with the given dataset
Args:
model (keras.Model): model to be evaluated
dataset (tf.data.Dataset): evaluation dataset
Returns:
AP (list): Average Precision for all classes
MAP (float): mean average precision
"""
gt, pred, valid = None, None, None
with torch.no_grad():
for data, target, wgt in test_loader:
## TODO insert your code here
data, target, wgt = data.to(device), target.to(device), wgt.to(device)
softmax = torch.nn.Softmax(dim=1)
if gt is None:
gt = target.cpu().detach().numpy()
pred = softmax(model(data)).cpu().detach().numpy()
valid = wgt.cpu().detach().numpy()
else:
gt = np.concatenate((gt, target.cpu().detach().numpy()), axis=0)
pred = np.concatenate((pred, softmax(model(data)).cpu().detach().numpy()), axis=0)
valid = np.concatenate((valid, wgt.cpu().detach().numpy()), axis=0)
AP = compute_ap(gt, pred, valid)
mAP = np.mean(AP)
return AP, mAP
| [
"[email protected]"
] | |
48bcd1eda9bf5d5c7cffb68b6c5ce2ff420166b9 | a958b5eca7ef63695e317fe87144b85b475306cf | /hypha/apply/funds/migrations/0001_initial.py | b148de45cbacf495758597f423ab37507c2cd2be | [
"BSD-3-Clause"
] | permissive | ResetNetwork/apply-app | 2fe0a4aed05e7609cca9cd8e0202d13bbc0b272f | a5f998b8a6c3059f31373f5c4aa700d1a563d844 | refs/heads/main | 2022-02-16T22:39:13.099637 | 2021-02-16T07:49:31 | 2022-02-01T13:26:32 | 201,969,914 | 1 | 4 | BSD-3-Clause | 2021-02-16T08:03:32 | 2019-08-12T16:38:58 | Python | UTF-8 | Python | false | false | 802 | py | # -*- coding: utf-8 -*-
# Generated by Django 1.11.7 on 2017-12-22 09:28
from __future__ import unicode_literals
from django.db import migrations, models
import django.db.models.deletion
class Migration(migrations.Migration):
initial = True
dependencies = [
('images', '0001_initial'),
('wagtailcore', '0040_page_draft_title'),
]
operations = [
migrations.CreateModel(
name='FundType',
fields=[
('page_ptr', models.OneToOneField(auto_created=True, on_delete=django.db.models.deletion.CASCADE, parent_link=True, primary_key=True, serialize=False, to='wagtailcore.Page')),
],
options={
'abstract': False,
},
bases=('wagtailcore.page',),
),
]
| [
"[email protected]"
] | |
d9e4848a0179fdd7bc93c029226ed24b09f7e898 | c6d22cf128819af1d48d02972bb9296a1687b9bb | /venv/Lib/site-packages/traitsui/editors/time_editor.py | 95807375757c299d670c057392cc5ed9fd49bfc8 | [] | no_license | GenomePhD/Bio1-HIV | 92808a1e7e6339da6d07190ba3e1a2071f3e8428 | b5059e7f121e4abb6888893f91f95dd79aed9ca4 | refs/heads/master | 2022-10-28T21:55:42.998205 | 2018-04-16T18:52:32 | 2018-04-16T18:52:32 | 129,792,081 | 0 | 1 | null | 2022-10-05T18:36:22 | 2018-04-16T19:03:26 | Python | UTF-8 | Python | false | false | 1,448 | py | #------------------------------------------------------------------------------
#
# Copyright (c) 2008, Enthought, Inc.
# All rights reserved.
#
# This software is provided without warranty under the terms of the BSD
# license included in enthought/LICENSE.txt and may be redistributed only
# under the conditions described in the aforementioned license. The license
# is also available online at http://www.enthought.com/licenses/BSD.txt
#
# Thanks for using Enthought open source!
#
# Author: Judah De Paula
# Date: 10/7/2008
#
#------------------------------------------------------------------------------
""" A Traits UI editor that wraps a WX timer control.
"""
from traits.api import Str
from ..editor_factory import EditorFactory
from ..ui_traits import AView
class TimeEditor(EditorFactory):
""" Editor factory for time editors. Generates _TimeEditor()s.
"""
#-------------------------------------------------------------------------
# Trait definitions:
#-------------------------------------------------------------------------
#-- ReadonlyEditor traits ------------------------------------------------
# Message to show when Time is None.
message = Str('Undefined')
# The string representation of the time to show. Uses time.strftime
# format.
strftime = Str('%I:%M:%S %p')
# An optional view to display when a read-only text editor is clicked:
view = AView
| [
"[email protected]"
] | |
80ce61a7d4adb75a865075dabf522a08ff7a377b | ca7aa979e7059467e158830b76673f5b77a0f5a3 | /Python_codes/p03786/s371328153.py | c0a9c347530052541335ff74e3633b64f918869c | [] | no_license | Aasthaengg/IBMdataset | 7abb6cbcc4fb03ef5ca68ac64ba460c4a64f8901 | f33f1c5c3b16d0ea8d1f5a7d479ad288bb3f48d8 | refs/heads/main | 2023-04-22T10:22:44.763102 | 2021-05-13T17:27:22 | 2021-05-13T17:27:22 | 367,112,348 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 174 | py | n=int(input())
a=list(map(int,input().split()))
a.sort()
count1=0
count2=0
for i in range(n-1):
count1+=a[i]
if 2*count1<a[i+1]:
count2=i+1
print(n-count2)
| [
"[email protected]"
] | |
b13fb8504577ae8cd6f334dc8d2406c131437b6f | 5e5db4c8e514e68161290e6293513db33df6bf49 | /test/jit/test_list_dict.py | 949ed485403d0fa1c7a33d502db5e92abe1c01cf | [
"BSD-2-Clause",
"BSD-3-Clause",
"LicenseRef-scancode-generic-cla",
"BSL-1.0",
"Apache-2.0"
] | permissive | MarcioPorto/pytorch | 5e51a8937722c886e23c68d2c5180b0425832bf2 | c52700dbcdec0acadf81473438192d1bb2beebc8 | refs/heads/master | 2023-04-25T09:41:25.126363 | 2021-05-12T16:44:05 | 2021-05-12T16:45:10 | 300,316,842 | 1 | 0 | NOASSERTION | 2020-10-01T14:52:49 | 2020-10-01T14:52:48 | null | UTF-8 | Python | false | false | 63,607 | py | import os
import sys
import inspect
import unittest
from typing import Any, Dict, List, NamedTuple, Optional, Tuple
from textwrap import dedent
from collections import OrderedDict
from torch import Tensor
import torch
import torch.nn as nn
import types
from torch.testing import FileCheck
# Make the helper files in test/ importable
pytorch_test_dir = os.path.dirname(os.path.dirname(os.path.realpath(__file__)))
sys.path.append(pytorch_test_dir)
from torch.testing._internal.jit_utils import JitTestCase
if __name__ == '__main__':
raise RuntimeError("This test file is not meant to be run directly, use:\n\n"
"\tpython test/test_jit.py TESTNAME\n\n"
"instead.")
class TestList(JitTestCase):
def test_list_bool_conversion(self):
def if_predicate(l: List[int]):
if l:
s = 0
for n in l:
s += n
return s
else:
return -1
self.checkScript(if_predicate, ([1, 2, 3],))
self.checkScript(if_predicate, ([],))
def while_predicate(l: List[int]):
s = 0
while l:
s += l.pop()
self.checkScript(while_predicate, ([1, 2, 3],))
self.checkScript(while_predicate, ([],))
def ternary_predicate(l: List[int]):
return "non-empty" if l else "empty"
self.checkScript(ternary_predicate, ([1, 2, 3],))
self.checkScript(ternary_predicate, ([],))
def test_in_check(self):
def int_in(x: List[int]) -> bool:
return 2 in x
self.checkScript(int_in, ([1, 2, 3],))
self.checkScript(int_in, ([1, 3, 3],))
def float_in(x: List[float]) -> bool:
return 2. in x
self.checkScript(float_in, ([1., 2., 3.],))
self.checkScript(float_in, ([1., 3., 3.],))
def str_in(x: List[str]) -> bool:
return 'hi' in x
self.checkScript(str_in, (['not', 'here'],))
self.checkScript(str_in, (['hi', 'bye'],))
self.checkScript(str_in, ([],))
def test_list_literal(self):
def reassign():
x = [1]
if 1 == 1:
x = [2, 3]
return
self.checkScript(reassign, (), optimize=False)
def reassign_arity_change():
x = [1]
if 1 == 1:
x = [1, 2, 3]
return
self.checkScript(reassign_arity_change, (), optimize=False)
def reassign_from_empty_literal():
x = []
if 1 == 1:
x = [1, 2, 3]
return
with self.assertRaisesRegexWithHighlight(RuntimeError, r"previously has type List\[Tensor\]", "x"):
self.checkScript(reassign_from_empty_literal, (), optimize=False)
def reassign_from_empty_builtin():
x = torch.jit.annotate(List[int], [])
if 1 == 1:
x = [1, 2, 3]
y = torch.jit.annotate(List[float], [])
if 1 == 1:
y = [1.0, 2.0, 3.0]
z = []
if 1 == 1:
z = [torch.randn([1])]
return
self.checkScript(reassign_from_empty_builtin, (), optimize=False)
def reassign_bad_type():
x = [1]
if 1 == 1:
x = [1.0]
return
with self.assertRaisesRegexWithHighlight(RuntimeError, "previously has type", "x"):
self.checkScript(reassign_bad_type, (), optimize=False)
def reassign_nested():
x = torch.jit.annotate(List[int], [])
if 1 == 1:
x = [1, 2, 3]
if 1 == 1:
x = [1.0]
return
with self.assertRaisesRegexWithHighlight(RuntimeError, "previously has type", "x"):
self.checkScript(reassign_nested, (), optimize=False)
def test_del(self):
def inputs():
return [1, 2, 3, 4]
def fn(x: List[int]) -> List[int]:
del x[1]
return x
python_out = fn(inputs())
# checkScript reuses the same object, but here it's being mutated so do
# it manually
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(fn)))
self.assertEqual(cu.fn(inputs()), python_out)
self.assertEqual(torch.jit.script(fn)(inputs()), python_out)
@torch.jit.script
def fn2(x: List[int]) -> List[int]:
del x[100]
return x
with self.assertRaisesRegexWithHighlight(RuntimeError, "out of range", "x[100]"):
fn2([])
with self.assertRaisesRegexWithHighlight(RuntimeError, "deletion at a single index", "x[1:3]"):
@torch.jit.script
def fn(x: List[int]) -> List[int]:
del x[1:3]
return x
def test_list_keyword(self):
def foo():
return list([1, 2, 3]), list(("a", "b")), list(range(5)), list("abcdefg") # noqa: C410
self.checkScript(foo, ())
def foo2():
x: List[int] = list()
x.append(1)
return x,
self.checkScript(foo2, ())
def foo3():
return list(list("abc"))
self.checkScript(foo3, ())
FileCheck().check_count("aten::list", 2, exactly=True).run(torch.jit.script(foo3).graph)
def test_dict_keyword_with_kwargs(self):
def fn():
return dict(foo=1, bar=2, baz=3)
self.checkScript(fn, ())
def test_dict_keyword_with_kwargs_using_container_values(self):
def fn():
return dict(foo=[1, 2, 3], bar=[4, 5, 6], baz=[7, 8, 9])
self.checkScript(fn, ())
def test_dict_keyword_with_iterable(self):
def fn():
return dict([("foo", 1), ("bar", 2), ("baz", 3)]) # noqa: C406
self.checkScript(fn, ())
def test_dict_keyword_with_empty_iterable(self):
def fn():
return dict([]) # noqa: C406
self.checkScript(fn, ())
def test_dict_keyword_with_internal_aggregate_function(self):
def fn():
return dict(zip(["foo", "baz", "bar"], [1, 2, 3]))
self.checkScript(fn, ())
def test_dict_keyword_with_mapping(self):
def fn():
return dict({"foo" : 1, "bar" : 2, "baz" : 3})
self.checkScript(fn, ())
def test_dict_keyword_with_mapping_and_kwargs(self):
def fn():
return dict({"foo" : 1, "bar" : 2}, baz=3)
self.checkScript(fn, ())
def test_dict_keyword_with_dict_comprehension(self):
def fn():
return dict({i: chr(i + 65) for i in range(4)})
self.checkScript(fn, ())
def test_dict_keyword_with_dict_comprehension_and_kwargs(self):
def fn():
return dict({chr(65 + i) : i for i in range(4)}, foo=2)
self.checkScript(fn, ())
def test_dict_keyword_with_empty_dict_comprehension(self):
def fn():
return dict({})
self.checkScript(fn, ())
def test_dict_keyword_is_correctly_typed(self):
def fn():
x: Dict[str, int] = dict()
x["foo"] = 1
return x
self.checkScript(fn, ())
def test_dict_keyword_with_mismatched_annotations(self):
# TODO: This fails during function schema matching, so the error
# message is not very informative to the user. Change logic so
# that the error is thrown at a different time?
err_msg = "Arguments for call are not valid"
highlight_msg = "dict([(\"foo\", 1), (\"bar\", 2), (\"baz\", 3"
with self.assertRaisesRegexWithHighlight(RuntimeError, err_msg, highlight_msg):
@torch.jit.script
def fn():
x: Dict[int, str] = dict([("foo", 1), ("bar", 2), ("baz", 3)]) # noqa: C406
return x
def test_dict_keyword_with_nested_call(self):
def fn():
return dict(dict(foo=1, bar=2, baz=3))
self.checkScript(fn, ())
def test_dict_keyword_with_previously_declared_variable(self):
def fn():
d = {"foo" : 1, "bar" : 2}
return dict(d)
self.checkScript(fn, ())
def test_dict_keyword_with_previously_declared_variable_and_kwargs(self):
def fn():
d = {"foo" : 1, "bar" : 2}
return dict(d, baz=3)
self.checkScript(fn, ())
def test_min_bool_list(self):
def jit_min_list(a: List[bool], b: List[bool]) -> List[bool]:
return min(a, b)
self.checkScript(jit_min_list, ([True, False], [False, True]))
def test_min_max_list(self):
def jit_min_list(a: List[int], b: List[int]) -> List[int]:
return min(a, b)
def jit_min_list_float(a: List[float], b: List[float]) -> List[float]:
return min(a, b)
def jit_min_list_bool(a: List[bool], b: List[bool]) -> List[bool]:
return min(a, b)
def run_tests(func, a, b):
for t in zip(a, b):
self.checkScript(func, t)
args_left_int = [[1, 8, 8], [2, 1, 1], [], [2], [1], [1, 2, 3]]
args_right_int = [[2, 1, 1], [1, 8, 8], [], [1], [], [1, 2]]
run_tests(jit_min_list, args_left_int, args_right_int)
args_left_float = [[1., 8., 8.], [2., 1., 1.], [], [2.], [1.], [1., 2., 3.]]
args_right_float = [[2., 1., 1.], [1., 8., 8.], [], [1.], [], [1., 2.]]
run_tests(jit_min_list_float, args_left_float, args_right_float)
args_left_bool = [[], [], [], [False], [True], [False, True], [True, True],
[False, False, False], [False, False, True]]
args_right_bool = [[], [False], [True], [True], [False], [True, True],
[False, True], [False, False, True], [False, False, False]]
run_tests(jit_min_list_bool, args_left_bool, args_right_bool)
def jit_max_list(a: List[int], b: List[int]) -> List[int]:
return max(a, b)
def jit_max_list_float(a: List[float], b: List[float]) -> List[float]:
return max(a, b)
def jit_max_list_bool(a: List[bool], b: List[bool]) -> List[bool]:
return max(a, b)
args_left_int = [[1, 8, 8], [8, 1, 1], [], [1], [], [1, 2]]
args_right_int = [[8, 1, 1], [1, 8, 8], [], [2], [1], [1, 2, 3]]
run_tests(jit_max_list, args_left_int, args_right_int)
args_left_float = [[1., 8., 8.], [8., 1., 1.], [], [1.], [], [1., 2.]]
args_right_float = [[8., 1., 1.], [1., 8., 8.], [], [2.], [1.], [1., 2., 3.]]
run_tests(jit_max_list_float, args_left_float, args_right_float)
run_tests(jit_max_list_bool, args_left_bool, args_right_bool)
def test_list_gather(self):
def index():
a = [1, 2, 3]
return a[1]
self.checkScript(index, ())
def negative_index():
a = [1, 2, 3]
return a[-1]
self.checkScript(negative_index, ())
def bad_index():
a = [1, 2, 3]
return a[4]
self.checkScriptRaisesRegex(bad_index, (), Exception,
"list index out of range")
def bad_negative_index():
a = [1, 2, 3]
return a[-5]
self.checkScriptRaisesRegex(bad_negative_index, (), Exception,
"list index out of range")
def test_list_len(self):
def func():
a = [1, 2, 3]
return len(a) == 3
self.checkScript(func, ())
def func2():
a = []
return len(a) == 0
self.checkScript(func2, ())
def test_list_ops(self):
def test_equality():
a = [1, 2, 3]
b = [1, 2, 3]
return a == b
self.checkScript(test_equality, (), optimize=True)
def test_equality_str():
a = ["foo", "bar"]
b = ["foo", "bar"]
return a == b
self.checkScript(test_equality_str, (), optimize=True)
def test_inequality():
a = [1, 2, 3]
b = [1, 2, 3]
return a != b
self.checkScript(test_inequality, (), optimize=True)
def test_inequality_str():
a = ["foo", "bar"]
b = ["foo", "bar", "food"]
return a != b
self.checkScript(test_inequality_str, (), optimize=True)
def test_non_equality():
a = [1, 2, 3]
b = [3]
return a == b
self.checkScript(test_non_equality, (), optimize=True)
def test_non_inequality():
a = [1, 2, 3]
b = [3]
return a != b
self.checkScript(test_non_equality, (), optimize=True)
def test_list_equality_as_cond():
a = [1, 2, 3]
b = [3]
if a == b:
c = 1
else:
c = 2
return c
self.checkScript(test_list_equality_as_cond, (), optimize=True)
def test_list_add():
a = [1, 2, 3]
b = [2]
c = a + b
return c == [1, 2, 3, 2]
self.checkScript(test_list_add, (), optimize=True)
def test_list_add_empty():
a = [1, 2, 3]
b = torch.jit.annotate(List[int], [])
c = a + b
return c == [1, 2, 3]
self.checkScript(test_list_add_empty, (), optimize=True)
def test_tensor_list_equality():
t1 = torch.ones([1, 1])
t2 = torch.ones([1, 1])
x = [t1, t2]
y = [t2, t1]
return x == y
self.checkScript(test_tensor_list_equality, (), optimize=True)
def test_invalid_list_equality():
t1 = torch.ones([2, 2])
t2 = torch.ones([2, 2])
x = [t1, t2]
y = [t2, t1]
# will throw since the tensors have more than one element
return x == y
self.checkScriptRaisesRegex(
test_invalid_list_equality,
(),
RuntimeError,
"Boolean value of Tensor")
def test_list_sort(self):
template = dedent('''
def func():
li_1 = {list_create}
li_2 = {list_create}
li_3 = {list_create}
li_1.sort()
li_2.sort(reverse=True)
li_4 = sorted(li_3)
return li_1, li_2, li_3, li_4
''')
lists = ["[]", "[1, 3, 2]", "[True, False, True]", "[1.2, .2, 3.2]",
"[torch.tensor(1.0), torch.tensor(0.2), torch.tensor(0.5)]",
"[torch.tensor(5), torch.tensor(-2), torch.tensor(4)]"]
for li in lists:
code = template.format(list_create=li)
scope = {}
exec(code, globals(), scope)
cu = torch.jit.CompilationUnit(code)
t1 = cu.func()
t2 = scope['func']()
self.assertEqual(t1, t2)
def test_fail(x: List[Tensor]) -> List[Tensor]:
x.sort()
return x
self.checkScriptRaisesRegex(test_fail, (([torch.zeros([2]), torch.zeros([2])],)), Exception,
"Boolean value of Tensor with more than one value")
@torch.jit.script
def test_mutation():
a = [1, 2, 3]
a.sort()
return a
test_mutation()
FileCheck().check("aten::sort").run(test_mutation.graph_for())
def test_sorted_copy():
a = [torch.tensor(2), torch.tensor(0), torch.tensor(1)]
b = sorted(a)
a[0] = torch.tensor(10)
return a, b
self.checkScript(test_sorted_copy, ())
def test_list_slice(self):
def test_regular_slice():
a = [0, 1, 2, 3, 4]
return a[2:3] == [2]
self.checkScript(test_regular_slice, ())
def test_open_ended_slice():
a = [0, 1, 2, 3, 4]
return a[2:] == [2, 3, 4]
self.checkScript(test_open_ended_slice, ())
def test_open_ended_slice2():
a = [0, 1, 2, 3, 4]
return a[:2] == [0, 1]
self.checkScript(test_open_ended_slice2, ())
def test_negative_slice():
a = [0, 1, 2, 3, 4]
return a[:-1] == [0, 1, 2, 3]
self.checkScript(test_negative_slice, ())
def test_negative_slice2():
a = [0, 1, 2, 3, 4]
return a[-3:-1] == [2, 3]
self.checkScript(test_negative_slice2, ())
def test_backward_slice():
a = [0, 1, 2, 3, 4]
return a[3:2] == torch.jit.annotate(List[int], [])
self.checkScript(test_backward_slice, ())
def test_over_slice():
a = [0, 1, 2, 3, 4]
return a[3:10] == [3, 4]
self.checkScript(test_backward_slice, ())
def test_slice_index(self):
a = torch.tensor(
[
[[1, 11], [2, 22]],
[[3, 33], [4, 44]],
[[5, 55], [6, 66]],
]
)
def test_index_slice1(x):
x = x[:, :, [0, 1]]
return x
self.checkScript(test_index_slice1, (a,))
def test_index_slice2(x):
x = x[[2, 1, 0], :, :]
return x
self.checkScript(test_index_slice2, (a,))
def test_index_slice3(x):
x = x[[0, 1], :, [1]]
return x
self.checkScript(test_index_slice3, (a,))
def test_index_slice_empty_list(x):
empty_list: List[int] = []
x = x[empty_list, :, :]
return x
self.checkScript(test_index_slice_empty_list, (a,))
def test_index_slice_out_of_bounds_index(x):
x = x[[4], :, :]
return x
with self.assertRaisesRegexWithHighlight(RuntimeError, "index 4 is out of bounds for dimension 0 with size 3",
"x[[4], :, :]"):
self.checkScript(test_index_slice_out_of_bounds_index, (a,))
def test_mutable_list_append(self):
def test_append():
a = [0, 1]
a.append(2)
a.append(3)
return a == [0, 1, 2, 3]
self.checkScript(test_append, ())
def test_comprehensions_basic(self):
def comp(l: List[int]) -> List[int]:
n = [x * 3 for x in l]
return n
comp([1, 2, 3])
self.checkScript(comp, ([1, 2, 3],))
def test_comprehensions_basic_float(self):
def comp(l: List[float]) -> List[float]:
n = [x * 3 for x in l]
return n
self.checkScript(comp, ([1.0, 2.0, 3.0],))
def test_comprehensions_two_comps(self):
@torch.jit.script
def comp(l1: List[int], l2: List[int]) -> List[int]:
n = [x * 3 for x in l1]
n2 = [x + 2 for x in l2]
return n + n2
self.assertEqual(comp([1, 2, 3], [4, 5]), [3, 6, 9, 6, 7])
def test_comprehension_out_type_not_in_type(self):
def list_cast() -> int:
li = [int(i) for i in [torch.tensor(0), torch.tensor(1), torch.tensor(2)]]
return li[0] + li[1] + li[2]
self.checkScript(list_cast, ())
def test_comprehension_iterable(self):
def test_func(fn, inputs):
self.assertEqual(fn(*inputs), torch.jit.script(fn)(*inputs))
def foo(names: List[int], results: List[int]) -> List[Tuple[int, int]]:
return [(k + 5, v - 2) for k, v in zip(names, results)]
test_func(foo, ([1, 2, 4], [4, 7, 9]))
test_func(foo, ([5], [4, 7, 9]))
def fn(x: int) -> List[int]:
return [i for i in range(x)] # noqa: C416
test_func(fn, (9,))
test_func(fn, (0,))
test_func(fn, (-1,))
def changes_type():
a = [float(i) for i in range(5)]
b = [float(i) for i in [1, 2, 3, 4]]
c = [(float(i), j) for i, j in enumerate([1, 2, 3, 8])]
return a, b, c
test_func(changes_type, ())
def test_zero_iter():
return [str(i) for i, j in zip("", "")]
test_func(test_zero_iter, ())
def test_mutable_list_append_2(self):
def test_append_2():
a = [0, 1]
a.append(2)
a = [1]
a.append(4)
return a == [1, 4]
self.checkScript(test_append_2, ())
def test_mutable_list_append_if(self):
def test_append_if():
a = [1]
if 1 == 1:
a.append(4)
return a == [1, 4]
self.checkScript(test_append_if, ())
def test_mutable_list_append_if_else(self):
def test_append_if_else():
a = [1]
if 1 == 2:
a.append(4)
else:
a.append(10)
return a == [1, 10]
self.checkScript(test_append_if_else, ())
def test_mutable_list_append_loop(self):
def test_append_loop():
a = torch.jit.annotate(List[int], [])
for i in range(5):
a.append(i)
return a == [0, 1, 2, 3, 4]
self.checkScript(test_append_loop, ())
def test_mutable_list_append_loop_if(self):
def test_append_loop_if():
a = torch.jit.annotate(List[int], [])
for i in range(5):
if i > 3:
a.append(i)
else:
a.append(0)
return a == [0, 0, 0, 0, 4]
self.checkScript(test_append_loop_if, ())
def test_mutable_list_nested_loop(self):
def test_nested_loop():
a = torch.jit.annotate(List[int], [])
for i in range(2):
for j in range(2):
a.append(i + j)
return a == [0, 1, 1, 2]
self.checkScript(test_nested_loop, ())
def test_mutable_list_function_inline(self):
@torch.jit.script
def bar(y: List[int]) -> None:
y.append(4)
@torch.jit.script
def foo():
x = [1, 2, 3]
bar(x)
return x
self.assertEqual(foo(), [1, 2, 3, 4])
def test_mutable_list_reverse_empty(self):
def test_reverse_empty():
a = []
a.reverse()
return a == []
self.checkScript(test_reverse_empty, ())
def test_mutable_list_reverse(self):
def test_reverse():
a = [1, 2, 3, 4]
a.reverse()
return a == [4, 3, 2, 1]
self.checkScript(test_reverse, ())
def test_mutable_tensor_list_reverse(self):
def test_tensor_reverse():
a = [torch.tensor(1), torch.tensor(2)]
a.reverse()
return a == [torch.tensor(2), torch.tensor(1)]
self.checkScript(test_tensor_reverse, ())
def test_mutable_list_pop_empty(self):
@torch.jit.script
def test_pop_empty():
a = torch.jit.annotate(List[int], [])
return a.pop()
with self.assertRaisesRegexWithHighlight(RuntimeError, "pop from empty list", "a.pop"):
test_pop_empty()
def test_mutable_list_pop(self):
def test_pop():
a = [1, 2, 3, 4]
b = a.pop()
return b == 4
self.checkScript(test_pop, ())
def test_mutable_list_pop2(self):
def test_pop2():
a = [1, 2, 3, 4]
b = a.pop()
return len(a) == 3
self.checkScript(test_pop2, ())
def test_mutable_list_pop_at(self):
def test_pop_at():
a = [1, 2, 3, 4]
b = a.pop(1)
return b == 2
self.checkScript(test_pop_at, ())
def test_mutable_list_pop_at2(self):
def test_pop_at2():
a = [1, 2, 3, 4]
b = a.pop(1)
return len(a) == 3
self.checkScript(test_pop_at2, ())
def test_mutable_list_pop_at_negative(self):
def test_pop_at_negative():
a = [1, 2, 3, 4]
b = a.pop(-2)
return b == 3
self.checkScript(test_pop_at_negative, ())
def test_mutable_list_pop_at_negative2(self):
def test_pop_at_negative2():
a = [1, 2, 3, 4]
b = a.pop(-2)
return len(a) == 3
self.checkScript(test_pop_at_negative2, ())
def test_mutable_list_pop_slice(self):
def test_pop_slice():
a = [1, 2, 3, 4]
b = [1, 2, 3, 4]
a.pop()
b = b[:-1]
return a == b
self.checkScript(test_pop_slice, ())
def test_mutable_list_clear_empty(self):
def test_clear_empty():
a = torch.jit.annotate(List[int], [])
a.clear()
return len(a) == 0
self.checkScript(test_clear_empty, ())
def test_mutable_list_clear(self):
def test_clear():
a = [1, 2, 3, 4]
a.clear()
return len(a) == 0
self.checkScript(test_clear, ())
def test_mutable_list_insert(self):
def test_list_insert():
a = [1, 2, 3, 4]
a.insert(2, 5)
return a == [1, 2, 5, 3, 4]
self.checkScript(test_list_insert, ())
def test_mutable_list_insert_negative(self):
def test_list_insert_negative():
a = [1, 2, 3, 4]
a.insert(-1, 5)
return a == [1, 2, 3, 5, 4]
self.checkScript(test_list_insert_negative, ())
def test_mutable_list_insert_neg_out_of_bounds(self):
def test_list_insert_neg_out_of_bounds():
a = [1, 2, 3, 4]
a.insert(-10, 5)
return a == [5, 1, 2, 3, 4]
self.checkScript(test_list_insert_neg_out_of_bounds, ())
def test_mutable_list_insert_out_of_bounds(self):
def test_list_insert_out_of_bounds():
a = [1, 2, 3, 4]
a.insert(10, 5)
return a == [1, 2, 3, 4, 5]
self.checkScript(test_list_insert_out_of_bounds, ())
def test_mutable_list_remove_not_existing(self):
@torch.jit.script
def test_list_remove_not_existing():
a = [1, 2, 3, 4]
a.remove(5)
return a
with self.assertRaisesRegexWithHighlight(RuntimeError, "x not in list", "a.remove"):
test_list_remove_not_existing()
def test_mutable_list_remove(self):
def test_list_remove():
a = [1, 2, 3, 4]
a.remove(3)
return a == [1, 2, 4]
self.checkScript(test_list_remove, ())
def test_str_list_remove():
a = ["foo", "bar"]
a.remove("foo")
return a == ["bar"]
self.checkScript(test_str_list_remove, ())
def test_list_index_not_existing(self):
@torch.jit.script
def list_index_not_existing():
a = [4, 1, 3, 2]
i = a.index(5)
return i
with self.assertRaisesRegexWithHighlight(RuntimeError, "'5' is not in list", "a.index"):
list_index_not_existing()
def test_list_index(self):
def list_index():
a = [4, 1, 3, 2]
i = a.index(3)
return i == 2
self.checkScript(list_index, ())
def list_str_index():
a = ["foo", "bar"]
i = a.index("bar")
return i == 1
self.checkScript(list_str_index, ())
def test_tensor_list_index(self):
def tensor_list_index():
a = [torch.tensor(4), torch.tensor(1), torch.tensor(3), torch.tensor(2)]
i = a.index(torch.tensor(3))
return i == 2
self.checkScript(tensor_list_index, ())
def test_tensor_list_index_not_existing(self):
@torch.jit.script
def tensor_list_index_not_existing():
a = [torch.tensor(4), torch.tensor(1), torch.tensor(3), torch.tensor(2)]
i = a.index(torch.tensor(5))
return i
with self.assertRaisesRegexWithHighlight(RuntimeError, "is not in list", "a.index"):
tensor_list_index_not_existing()
def test_list_count(self):
def list_count():
a = [4, 1, 4, 2, 4]
i = a.count(4)
return i == 3
self.checkScript(list_count, ())
def list_str_count():
a = ["foo", "bar", "foo"]
i = a.count("foo")
return i == 2
self.checkScript(list_str_count, ())
def test_list_count_not_existing(self):
def list_count_not_existing():
a = [4, 1, 4, 2, 4]
i = a.count(5)
return i == 0
self.checkScript(list_count_not_existing, ())
def test_tensor_list_count(self):
def tensor_list_count():
a = [torch.tensor(4), torch.tensor(1), torch.tensor(4), torch.tensor(4)]
i = a.count(torch.tensor(4))
return i == 3
self.checkScript(tensor_list_count, ())
def test_tensor_list_count_not_existing(self):
def tensor_list_count_not_existing():
a = [torch.tensor(4), torch.tensor(1), torch.tensor(4), torch.tensor(4)]
i = a.count(torch.tensor(5))
return i == 0
self.checkScript(tensor_list_count_not_existing, ())
def test_mutable_list_remove_tensor(self):
def test_list_remove_tensor():
a = [torch.ones(1), torch.zeros(1), torch.ones(2)]
a.remove(torch.zeros(1))
return len(a) == 2
self.checkScript(test_list_remove_tensor, ())
def test_mutable_list_remove2(self):
def test_list_remove2():
a = [1]
a.remove(1)
return len(a) == 0
self.checkScript(test_list_remove2, ())
def test_extend_list_mutable(self):
@torch.jit.script
def extend_list(a: List[Tensor], b: List[Tensor]) -> List[Tensor]:
a.extend(b)
return a
for l in [[], [torch.rand(2)], [torch.rand(2), torch.rand(2), torch.rand(2)]]:
for r in [[], [torch.rand(2)], [torch.rand(2), torch.rand(2), torch.rand(2)]]:
self.assertEqual(extend_list(l, r), l + r)
def test_extend_list_immutable(self):
@torch.jit.script
def extend_list(a: List[int], b: List[int]) -> List[int]:
a.extend(b)
return a
for l in [[], [1], [1, 2, 3]]:
for r in [[], [1], [1, 2, 3]]:
self.assertEqual(extend_list(l, r), l + r)
def test_copy_list_mutable(self):
@torch.jit.script
def copy_list(a: List[Tensor]) -> List[Tensor]:
return a.copy()
for l in [[], [torch.rand(2)], [torch.rand(2), torch.rand(2), torch.rand(2)]]:
self.assertEqual(copy_list(l), l)
def test_copy_list_immutable(self):
@torch.jit.script
def copy_list(a: List[int]) -> List[int]:
return a.copy()
for l in [[], [1], [1, 2, 3]]:
self.assertEqual(copy_list(l), l)
def test_min_max_single_list(self):
def min_intlist(li: List[int]) -> int:
return min(li)
def max_intlist(li: List[int]) -> int:
return max(li)
def min_boollist(li: List[bool]) -> bool:
return min(li)
def max_boollist(li: List[bool]) -> bool:
return max(li)
def min_floatlist(li: List[float]) -> float:
return min(li)
def max_floatlist(li: List[float]) -> float:
return max(li)
int_lists = [1], [2, 1, 2], [-3, 4, 2], [-2, -7, 1, 4], [2, 1, 0, 4], []
def check_list(fn, li):
if len(li) == 0:
self.checkScriptRaisesRegex(fn, (li,), Exception, "arg is an empty sequence")
else:
self.checkScript(fn, (li,))
for int_list in int_lists:
check_list(min_intlist, int_list)
check_list(max_intlist, int_list)
bool_li = [bool(x) for x in int_list]
check_list(min_boollist, bool_li)
check_list(max_boollist, bool_li)
float_li = [float(x) for x in int_list]
check_list(min_floatlist, float_li)
check_list(max_floatlist, float_li)
def test_to_list(self):
"""Unit tests for Tensor.tolist() function."""
"""
Boolean dtype unit tests.
"""
def to_list_bool_0D(x: torch.Tensor) -> bool:
li = torch.jit.annotate(bool, x.tolist())
return li
def to_list_bool_1D(x: torch.Tensor) -> List[bool]:
li = torch.jit.annotate(List[bool], x.tolist())
return li
def to_list_bool_2D(x: torch.Tensor) -> List[List[bool]]:
li = torch.jit.annotate(List[List[bool]], x.tolist())
return li
def to_list_bool_3D(x: torch.Tensor) -> List[List[List[bool]]]:
li = torch.jit.annotate(List[List[List[bool]]], x.tolist())
return li
self.checkScript(to_list_bool_0D, (torch.tensor(False, dtype=torch.bool),))
bool_input_1D = torch.tensor([True, False, True, False], dtype=torch.bool)
self.checkScript(to_list_bool_1D, (bool_input_1D,))
bool_input_2D = torch.tensor(
[[True, True, False], [False, True, False]], dtype=torch.bool
)
self.checkScript(to_list_bool_2D, (bool_input_2D,))
bool_input_3D = torch.tensor(
[[[True, False], [False, True]], [[True, False], [False, False]]],
dtype=torch.bool,
)
self.checkScript(to_list_bool_3D, (bool_input_3D,))
bool_input_noncontiguous = torch.tensor(
[[[True, False], [False, True]], [[True, False], [False, False]]],
dtype=torch.bool,
).transpose(0, 1)
self.checkScript(to_list_bool_3D, (bool_input_noncontiguous,))
"""
Int dtype unit tests.
"""
def to_list_int_0D(x: torch.Tensor) -> int:
li = torch.jit.annotate(int, x.tolist())
return li
def to_list_int_1D(x: torch.Tensor) -> List[int]:
li = torch.jit.annotate(List[int], x.tolist())
return li
def to_list_int_2D(x: torch.Tensor) -> List[List[int]]:
li = torch.jit.annotate(List[List[int]], x.tolist())
return li
def to_list_int_3D(x: torch.Tensor) -> List[List[List[int]]]:
li = torch.jit.annotate(List[List[List[int]]], x.tolist())
return li
self.checkScript(to_list_int_0D, (torch.tensor(1, dtype=torch.long),))
int_input_1D = torch.tensor([1, 2, 3, 4], dtype=torch.long)
self.checkScript(to_list_int_1D, (int_input_1D,))
int_input_2D = torch.tensor([[1, 2, 3], [3, 4, 5]], dtype=torch.long)
self.checkScript(to_list_int_2D, (int_input_2D,))
int_input_3D = torch.tensor(
[[[1, 2], [3, 4]], [[5, 6], [7, 8]]], dtype=torch.long
)
self.checkScript(to_list_int_3D, (int_input_3D,))
int_input_noncontiguous = torch.tensor(
[[[1, 2], [3, 4]], [[5, 6], [7, 8]]], dtype=torch.long
).transpose(0, 1)
self.checkScript(to_list_int_3D, (int_input_noncontiguous,))
"""
Float dtype unit tests.
"""
def to_list_float_0D(x: torch.Tensor) -> float:
li = torch.jit.annotate(float, x.tolist())
return li
def to_list_float_1D(x: torch.Tensor) -> List[float]:
li = torch.jit.annotate(List[float], x.tolist())
return li
def to_list_float_2D(x: torch.Tensor) -> List[List[float]]:
li = torch.jit.annotate(List[List[float]], x.tolist())
return li
def to_list_float_3D(x: torch.Tensor) -> List[List[List[float]]]:
li = torch.jit.annotate(List[List[List[float]]], x.tolist())
return li
# Test with torch.float dtype Tensors to check that they are converted to double automatically.
self.checkScript(to_list_float_0D, (torch.randn(5, dtype=torch.float)[0],))
self.checkScript(to_list_float_1D, (torch.randn(5, dtype=torch.float),))
self.checkScript(to_list_float_2D, (torch.randn(5, 6, dtype=torch.float),))
self.checkScript(to_list_float_3D, (torch.randn(5, 6, 7, dtype=torch.float),))
self.checkScript(to_list_float_3D, (torch.randn(5, 6, 7, dtype=torch.float).transpose(0, 1),))
self.checkScript(to_list_float_0D, (torch.randn(5, dtype=torch.double)[0],))
self.checkScript(to_list_float_1D, (torch.randn(5, dtype=torch.double),))
self.checkScript(to_list_float_2D, (torch.randn(5, 6, dtype=torch.double),))
self.checkScript(to_list_float_3D, (torch.randn(5, 6, 7, dtype=torch.double),))
self.checkScript(to_list_float_3D, (torch.randn(5, 6, 7, dtype=torch.double).transpose(0, 1),))
"""
Complex dtype unit tests.
"""
def to_list_complex_0D(x: torch.Tensor) -> complex:
li = torch.jit.annotate(complex, x.tolist())
return li
def to_list_complex_1D(x: torch.Tensor) -> List[complex]:
li = torch.jit.annotate(List[complex], x.tolist())
return li
def to_list_complex_2D(x: torch.Tensor) -> List[List[complex]]:
li = torch.jit.annotate(List[List[complex]], x.tolist())
return li
def to_list_complex_3D(x: torch.Tensor) -> List[List[List[complex]]]:
li = torch.jit.annotate(List[List[List[complex]]], x.tolist())
return li
# Test with torch.complex dtype Tensors to check that they are converted to double automatically.
self.checkScript(to_list_complex_0D, (torch.randn(5, dtype=torch.cfloat)[0],))
self.checkScript(to_list_complex_1D, (torch.randn(5, dtype=torch.cfloat),))
self.checkScript(to_list_complex_2D, (torch.randn(5, 6, dtype=torch.cfloat),))
self.checkScript(to_list_complex_3D, (torch.randn(5, 6, 7, dtype=torch.cfloat),))
self.checkScript(to_list_complex_3D, (torch.randn(5, 6, 7, dtype=torch.cfloat).transpose(0, 1),))
self.checkScript(to_list_complex_0D, (torch.randn(5, dtype=torch.cdouble)[0],))
self.checkScript(to_list_complex_1D, (torch.randn(5, dtype=torch.cdouble),))
self.checkScript(to_list_complex_2D, (torch.randn(5, 6, dtype=torch.cdouble),))
self.checkScript(to_list_complex_3D, (torch.randn(5, 6, 7, dtype=torch.cdouble),))
self.checkScript(to_list_complex_3D, (torch.randn(5, 6, 7, dtype=torch.cdouble).transpose(0, 1),))
"""
Non-happy path tests:
- missing type annotation
- mismatch between type annotation and input
- type annotation with unsupported type
- type annotation with the wrong dimension
- type annotation with scalar type that doesn't match the input scalar type
"""
def to_list_missing_type_annotation(x: torch.Tensor) -> List[float]:
li = x.tolist()
return li
def to_list_incorrect_type_annotation(x: torch.Tensor) -> List[float]:
li = torch.jit.annotate(float, x.tolist())
return li
def to_list_unsupported_type_annotation(x: torch.Tensor) -> List[float]:
li = torch.jit.annotate(List[str], x.tolist())
return li
def to_list_type_annotation_wrong_dim(x: torch.Tensor) -> List[List[float]]:
li = torch.jit.annotate(List[List[float]], x.tolist())
return li
def to_list_type_annotation_incorrect_scalar_type(x: torch.Tensor) -> List[float]:
li = torch.jit.annotate(List[float], x.tolist())
return li
with self.assertRaisesRegexWithHighlight(
RuntimeError,
r"Expected type hint for result of tolist()",
"x.tolist("
):
self.checkScript(to_list_missing_type_annotation, (torch.randn(5),))
with self.assertRaisesRegexWithHighlight(
RuntimeError,
r"Return value was annotated as having type List\[float\] but is actually of type float",
"return li"
):
self.checkScript(to_list_incorrect_type_annotation, (torch.randn(5),))
with self.assertRaisesRegex(
RuntimeError, r"str is not one of the supported element types for tolist"
):
self.checkScript(to_list_unsupported_type_annotation, (torch.randn(5),))
with self.assertRaisesRegex(
RuntimeError,
r"Output annotation list dimension and runtime tensor dimension must match",
):
self.checkScript(to_list_type_annotation_wrong_dim, (torch.randn(5, dtype=torch.double),))
with self.assertRaisesRegex(
RuntimeError,
r"Output annotation element type and runtime tensor element type must match",
):
self.checkScript(
to_list_type_annotation_incorrect_scalar_type,
(torch.ones(5, dtype=torch.long),),
)
def test_to_list_gpu(self):
"""GPU tests for Tensor.tolist() function."""
if not torch.cuda.is_available() or torch.cuda.device_count() == 0:
self.skipTest("CUDA is not available")
def to_list_bool_1D(x: torch.Tensor) -> List[bool]:
li = torch.jit.annotate(List[bool], x.tolist())
return li
def to_list_int_1D(x: torch.Tensor) -> List[int]:
li = torch.jit.annotate(List[int], x.tolist())
return li
def to_list_float_1D(x: torch.Tensor) -> List[float]:
li = torch.jit.annotate(List[float], x.tolist())
return li
self.checkScript(to_list_bool_1D, (torch.tensor(
[True, False, True, False], dtype=torch.bool).cuda(),))
self.checkScript(to_list_int_1D, (torch.tensor(
[1, 2, 3, 4], dtype=torch.long).cuda(),))
self.checkScript(to_list_float_1D, (torch.randn(
5, dtype=torch.double).cuda(),))
def test_no_element_type_annotation(self):
def fn_with_comment(x: torch.Tensor) -> List:
a: List = x.tolist()
return a
def annotated_fn(x: torch.Tensor) -> List:
a: List = x.tolist()
return a
with self.assertRaisesRegex(RuntimeError, r"Attempted to use List without a contained type"):
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(fn_with_comment)))
with self.assertRaisesRegex(RuntimeError, r"Attempted to use List without a contained type"):
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(annotated_fn)))
with self.assertRaisesRegex(RuntimeError, r"Attempted to use List without a contained type"):
torch.jit.script(fn_with_comment)
with self.assertRaisesRegex(RuntimeError, r"Attempted to use List without a contained type"):
torch.jit.script(annotated_fn)
def test_list_none(self):
with self.assertRaisesRegex(RuntimeError, "Can not create ListType with None type"):
x = torch._C.ListType(None)
def test_list_unification_hint(self):
with self.assertRaisesRegex(RuntimeError, "Expected a List type hint"):
@torch.jit.script
def x():
b : int = [2, 3]
return b
class TestDict(JitTestCase):
def dict(self):
return {u'a': torch.ones(1), u'b': torch.ones(1) + 1, u'c': torch.ones(1) + 2}
def dict2(self):
return {'x': torch.ones(1) + 100, 'y': torch.ones(1) + 101, 'z': torch.ones(1) + 102}
def dict_bool(self):
return {True: 1}
def test_dict_bool_conversion(self):
def if_predicate(d: Dict[int, int]):
if d:
s, t = 0, 0
for k, v in d.items():
s += k
t += v
return s, t
else:
return -1, -1
self.checkScript(if_predicate, ({1: 2, 3: 5},))
self.checkScript(if_predicate, ({},))
def while_predicate(d: Dict[int, int]):
while d:
d.clear()
self.checkScript(while_predicate, ({1: 2, 3: 5},))
self.checkScript(while_predicate, ({},))
def ternary_predicate(d: Dict[int, int]):
return "non-empty" if d else "empty"
self.checkScript(ternary_predicate, ({1: 2, 3: 5},))
self.checkScript(ternary_predicate, ({},))
def test_del(self):
def inputs():
return {'hi': 2, 'bye': 3}
def fn(x: Dict[str, int]) -> Dict[str, int]:
del x['hi']
return x
python_out = fn(inputs())
# checkScript reuses the same object, but here it's being mutated so do
# it manually
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(fn)))
self.assertEqual(cu.fn(inputs()), python_out)
self.assertEqual(torch.jit.script(fn)(inputs()), python_out)
with self.assertRaisesRegexWithHighlight(RuntimeError, "KeyError", "x['hi']"):
self.checkScript(fn, [{}])
def test_keys(self):
@torch.jit.script
def keys(x: Dict[str, Tensor]) -> List[str]:
return list(x.keys())
self.assertEqual(set(keys(self.dict())), set(self.dict().keys()))
@torch.jit.script
def specialized_list():
li = {1: 1, 2: 2}.keys()
li.append(3)
return li
self.assertTrue(set(specialized_list()) == set([1, 2, 3]))
def test_values(self):
@torch.jit.script
def values(x: Dict[str, Tensor]) -> List[Tensor]:
return list(x.values())
the_dict = self.dict()
self.assertEqual(set(values(the_dict)), set(the_dict.values()))
def test_len(self):
def length(x: Dict[str, Tensor]) -> int:
return len(x)
self.checkScript(length, (self.dict(),))
def test_copy(self):
def func(x: Dict[str, Tensor]) -> Dict[str, Tensor]:
return x.copy()
self.checkScript(func, (self.dict(),))
def test_items(self):
def func(x: Dict[str, Tensor]) -> List[Tuple[str, Tensor]]:
return x.items()
# The value returned by Python is in arbitrary order, so we can't use
# checkScript
scripted_func = torch.jit.script(func)
eager_out = (func(self.dict()))
script_out = (scripted_func(self.dict()))
self.assertEqual(len(eager_out), len(script_out))
for item in eager_out:
self.assertTrue(item in script_out)
def test_pop(self):
def pop(x: Dict[str, Tensor], key: str) -> Tuple[Tensor, Dict[str, Tensor]]:
return x.pop(key), x
# checkScript doesn't copy the inputs, so we can't use it since this mutates
# the dict
def tester(fn, *args):
eager_out = fn(self.dict(), *args)
script_out = torch.jit.script(fn)(self.dict(), *args)
self.assertEqual(eager_out, script_out)
tester(pop, 'a')
with self.assertRaisesRegexWithHighlight(RuntimeError, "KeyError", "x.pop"):
torch.jit.script(pop)(self.dict(), 'x')
def default_pop(x: Dict[str, Tensor], key: str, default: Tensor) -> Tuple[Tensor, Dict[str, Tensor]]:
return x.pop(key, default), x
tester(default_pop, 'a', torch.randn(2, 2))
tester(default_pop, 'x', torch.randn(2, 2))
def test_setdefault(self):
def setdefault(x: Dict[str, Tensor], key: str, default: Tensor) -> Dict[str, Tensor]:
x.setdefault(key, default)
return x
self.checkScript(setdefault, (self.dict(), 'a', torch.randn(2, 2)))
self.checkScript(setdefault, (self.dict(), 'nonexistant', torch.randn(2, 2)))
def test_update(self):
def update(a: Dict[str, Tensor], b: Dict[str, Tensor]) -> Tuple[Dict[str, Tensor], Dict[str, Tensor]]:
a.update(b)
return a, b
self.checkScript(update, (self.dict(), self.dict()))
self.checkScript(update, (self.dict(), self.dict2()))
def test_update_existing_key(self):
def foo() -> Dict[str, int]:
a: Dict[str, int] = {}
for i in range(3):
a.update({'a': i})
return a
self.checkScript(foo, ())
def test_aug_assign(self):
def aug_assign_dict_tensor(a: Dict[str, Tensor]) -> Dict[str, Tensor]:
a['a'] += 1
a['b'] -= 12
a['c'] *= 122
a['c'] /= 2
a['c'] %= 2
return a
def aug_assign_dict_prim(a: Dict[str, float]) -> Dict[str, float]:
a['a'] += 3.4
a['b'] -= 2.4
a['c'] *= 3.0
a['c'] /= 2.0
a['c'] %= 2.0
return a
self.checkScript(aug_assign_dict_tensor, (self.dict(),))
self.checkScript(aug_assign_dict_prim, ({'a': 3.0, 'b': 2.0, 'c': 4.0},))
def test_popitem(self):
@torch.jit.script
def popitem(x: Dict[str, Tensor]) -> Tuple[Tuple[str, Tensor], Dict[str, Tensor]]:
item = x.popitem()
return item, x
# The value returned by Python is arbitrary, so we can't use checkScript
eager_in = self.dict()
eager_out = (eager_in.popitem(), eager_in)
script_out = popitem(self.dict())
# Check that an item was removed
self.assertEqual(len(eager_out[1]), len(script_out[1]))
# Check that the item is the correct types
self.assertTrue(isinstance(script_out[0][0], str))
self.assertTrue(isinstance(script_out[0][1], torch.Tensor))
def test_clear(self):
def clear(x: Dict[str, Tensor]) -> Dict[str, Tensor]:
x.clear()
return x
self.checkScript(clear, (self.dict(),))
def test_get(self):
def get(x: Dict[str, Tensor], key: str) -> Optional[Tensor]:
return x.get(key)
self.checkScript(get, (self.dict(), 'a'))
self.checkScript(get, (self.dict(), "doesn't exist"))
def get_default(x: Dict[str, Tensor], key: str) -> Optional[Tensor]:
return x.get(key, torch.randn(2, 2))
self.checkScript(get, (self.dict(), 'a'))
self.checkScript(get, (self.dict(), "doesn't exist"))
def test_get_boolkey(self):
def get(x: Dict[bool, int], key: bool) -> Optional[int]:
return x.get(key)
self.checkScript(get, (self.dict_bool(), True))
self.checkScript(get, (self.dict_bool(), False))
def get_default(x: Dict[bool, int], key: bool) -> int:
return x.get(key, 42)
self.checkScript(get_default, (self.dict_bool(), True))
self.checkScript(get_default, (self.dict_bool(), False))
def test_basic(self):
def simple(x: Dict[str, int]) -> Dict[str, int]:
return x
self.checkScript(simple, ({'item': 20, 'other_item': 120},))
def index(x: Dict[str, int]) -> int:
return x['item']
self.checkScript(index, ({'item': 20, 'other_item': 120},))
def type_default() -> Dict[str, Tensor]:
return {}
self.checkScript(type_default, ())
@torch.jit.script
def missing_index(x: Dict[str, int]) -> int:
return x['dne']
with self.assertRaisesRegexWithHighlight(RuntimeError, "KeyError", "x['d"):
missing_index({'item': 20, 'other_item': 120})
code = dedent('''
def literal1():
return torch.jit.annotate(Dict[int, float], {})
def literal2():
return torch.jit.annotate(Dict[int, float], {10: 1.2})
''')
cu = torch.jit.CompilationUnit(code)
self.assertEqual({}, cu.literal1())
self.assertEqual({10: 1.2}, cu.literal2())
cu = torch.jit.CompilationUnit(dedent('''
def literal3():
return torch.jit.annotate(Dict[int, float], {10: 1.2, 11: 1.3})
'''))
self.assertEqual({10: 1.2, 11: 1.3}, cu.literal3())
def list_of_dicts() -> List[Dict[str, Tensor]]:
return [{'word': torch.ones(2) + 3}, {'other word': torch.ones(1) + 2}]
self.checkScript(list_of_dicts, ())
def test_mutability(self):
@torch.jit.script
def fn() -> Dict[str, int]:
a = torch.jit.annotate(Dict[str, int], {})
a['ok'] = 10
return a
self.assertEqual(fn(), {'ok': 10})
def test_key_type(self):
with self.assertRaisesRegexWithHighlight(RuntimeError, "but instead found type", "a[None]"):
@torch.jit.script
def fn(a: Dict[str, int]) -> int:
return a[None]
def test_loop(self):
@torch.jit.script
def fn(x: int) -> Dict[str, int]:
a = torch.jit.annotate(Dict[str, int], {})
for i in range(x):
a['ok'] = i
return a
self.assertEqual(fn(10), {'ok': 9})
def test_view(self):
def fn(x, y):
l = {"a": x}
x_view = l["a"]
a = x + x
x_view.add_(y)
b = x + x
return a == b
self.checkScript(fn, (torch.rand(2, 3), torch.rand(2, 3)))
def test_membership(self):
def fn(x: Dict[int, int], y: int) -> int:
return x.get(y, 3)
d = {1: 2, 3: 4}
self.checkScript(fn, (d, 3))
self.checkScript(fn, (d, 2))
def optional(x: Dict[int, int], y: int) -> bool:
res = x.get(y)
return res is None
self.checkScript(fn, (d, 3))
self.checkScript(fn, (d, 2))
with self.assertRaisesRegexWithHighlight(RuntimeError, "is actually of type Optional", "return x.get(y"):
@torch.jit.script
def bad_types(x: Dict[int, int], y: int) -> int:
return x.get(y) # noqa: T484
def test_dict_to_python(self):
@torch.jit.ignore
def python_lookup(my_dict: Dict[str, int], keys: List[str]) -> List[int]:
return [my_dict[k] for k in keys]
def fn(my_dict: Dict[str, int], keys: List[str]) -> List[int]:
return python_lookup(my_dict, keys)
a_dict = {'a': torch.ones(1), 'b': torch.ones(1) + 1, 'c': torch.ones(1) + 2}
self.checkScript(fn, (a_dict, ('a', 'c')))
def test_ordered_dict(self):
def test_func(fn, inputs):
self.assertEqual(fn(*inputs), torch.jit.script(fn)(*inputs))
def repeated_key():
return OrderedDict([(1, 2), (2, 3), (1, 4)])
test_func(repeated_key, ())
def no_args():
a = OrderedDict()
a["one"] = torch.tensor(1)
a["two"] = torch.tensor(2)
test_func(no_args, ())
def test_dict_constructor():
a = dict()
a["one"] = torch.tensor(1)
return a, dict([(1, 2), (2, 3), (1, 4)]) # noqa: C406
test_func(test_dict_constructor, ())
def test_dict_initializer_list():
a = {"1": torch.tensor(1), "2": torch.tensor(2)}
output_order = []
for key in a:
output_order.append(a[key])
return output_order
test_func(test_dict_initializer_list, ())
def test_dict_error():
a = dict()
a[1] = 2
return a
with self.assertRaisesRegexWithHighlight(Exception, "Arguments for call are not", "a[1] = 2"):
torch.jit.script(test_dict_error)
def test_type_annotation_missing_contained_type(self):
"""
Test that the use of a Dict type annotation without contained
key and value types produces an error.
"""
# This function uses a type comment.
def fn_with_comment(input: Dict) -> Any:
return input
# This function uses Python3 style type annotations.
def annotated_fn(input: Dict) -> Any:
return input
with self.assertRaisesRegex(RuntimeError, r"Attempted to use Dict without contained types"):
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(fn_with_comment)))
with self.assertRaisesRegex(RuntimeError, r"Attempted to use Dict without contained types"):
cu = torch.jit.CompilationUnit()
cu.define(dedent(inspect.getsource(annotated_fn)))
with self.assertRaisesRegex(RuntimeError, r"Attempted to use Dict without contained types"):
m = torch.jit.script(fn_with_comment)
with self.assertRaisesRegex(RuntimeError, r"Attempted to use Dict without contained types"):
m = torch.jit.script(annotated_fn)
def test_dict_preserves_order(self):
def dict_ordering():
a : Dict[int, int] = {}
for i in range(1000):
a[i] = i + 1
return a
self.checkScript(dict_ordering, ())
di = torch.jit.script(dict_ordering)()
res = list(di.items())
for i in range(1000):
key, value = res[i]
self.assertTrue(key == i and value == i + 1)
def test_optional_dict_construct(self):
class M(torch.nn.Module):
def use(self, buffer: Dict[str, Optional[torch.Tensor]]):
return buffer["prev_key"]
def forward(self, x):
prev_key = torch.rand(2, 3)
next_key = torch.rand(2, 3)
saved_state: Dict[str, Optional[torch.Tensor]] = {
"prev_key": prev_key,
"next_key": next_key,
}
return self.use(saved_state)
self.checkModule(M(), (torch.rand(2, 2),))
class TestNamedTuple(JitTestCase):
def test_named_tuple(self):
class FeatureVector(NamedTuple):
float_features: float
sequence_features: List[float]
time_since_first: float
@torch.jit.script
def foo(x) -> float:
fv = FeatureVector(3.0, [3.0], 3.0)
rv = fv.float_features
for val in fv.sequence_features:
rv += val
rv *= fv.time_since_first
return rv
self.assertEqual(foo(torch.rand(3, 4)), 18.0)
def test_named_tuple_constant(self):
class Tup(NamedTuple):
a: int
b: int
@torch.jit.script
def foo():
return Tup(1, 2)
self.assertEqual(foo(), Tup(1, 2))
def test_return_named_tuple(self):
class FeatureVector(NamedTuple):
float_features: float
sequence_features: List[float]
time_since_first: float
@torch.jit.script
def foo(x):
fv = FeatureVector(3.0, [3.0], 3.0)
return fv
out = foo(torch.rand(3, 4))
out = foo(torch.rand(3, 4))
self.assertEqual(out.float_features, 3.0)
self.assertEqual(out.sequence_features, [3.0])
self.assertEqual(out.time_since_first, 3.0)
def test_named_tuple_as_attr(self):
class Config(NamedTuple):
size: int
class MyMod(nn.Module):
configs: Dict[int, Config]
def __init__(self, configs):
super().__init__()
self.configs = configs
def forward(self, x):
for _id, config in self.configs.items():
x += config.size
return x
s = torch.jit.script(MyMod({0: Config(size=16)}))
def test_named_tuple_resolution(self):
class TheType(NamedTuple):
t: int
class MyModule(types.ModuleType):
def __init__(self):
super(MyModule, self).__init__('MyModule')
def __getattr__(self, attr):
return TheType
some_module = MyModule()
def fn() -> some_module.Type:
return some_module.Type(1)
self.checkScript(fn, [])
def test_named_tuple_slice_unpack(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
@torch.jit.script
def foo(a : int, b : float, c : List[int]):
tup = MyCoolNamedTuple(a, b, c)
my_a, my_b, my_c = tup
return tup[:1], my_a, my_c
self.assertEqual(foo(3, 3.5, [6]), ((3,), 3, [6]))
def test_named_tuple_lower(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
@torch.jit.script
def foo(a : int):
tup = MyCoolNamedTuple(a, 3.14, [9])
return tup
FileCheck().check('TupleConstruct').run(foo.graph)
torch._C._jit_pass_lower_all_tuples(foo.graph)
FileCheck().check_not('TupleConstruct').run(foo.graph)
def test_named_tuple_type_annotation(self):
global MyCoolNamedTuple # see [local resolution in python]
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
@torch.jit.script
def foo(x : MyCoolNamedTuple) -> MyCoolNamedTuple:
return x
mnt = MyCoolNamedTuple(42, 420.0, [666])
self.assertEqual(foo(mnt), mnt)
def test_named_tuple_wrong_types(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
with self.assertRaisesRegex(RuntimeError, "Expected a value of type 'int' for argument 'a'"
" but instead found type 'str'"):
@torch.jit.script
def foo():
tup = MyCoolNamedTuple('foo', 'bar', 'baz')
return tup
def test_named_tuple_kwarg_construct(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
@torch.jit.script
def foo():
tup = MyCoolNamedTuple(c=[1, 2, 3], b=3.5, a=9)
return tup
tup = foo()
self.assertEqual(tup.a, 9)
self.assertEqual(tup.b, 3.5)
self.assertEqual(tup.c, [1, 2, 3])
def test_named_tuple_default_error(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int] = [3, 4, 5]
with self.assertRaisesRegex(RuntimeError, 'Default values are currently not supported'):
@torch.jit.script
def foo():
tup = MyCoolNamedTuple(c=[1, 2, 3], b=3.5, a=9)
return tup
@unittest.skipIf(True, "broken while these tests were not in CI")
def test_named_tuple_serialization(self):
class MyCoolNamedTuple(NamedTuple):
a : int
b : float
c : List[int]
class MyMod(torch.jit.ScriptModule):
@torch.jit.script_method
def forward(self):
return MyCoolNamedTuple(3, 3.5, [3, 4, 5])
mm = MyMod()
mm.save('foo.zip')
torch.testing._internal.jit_utils.clear_class_registry()
loaded = torch.jit.load('foo.zip')
out = mm()
out_loaded = loaded()
for name in ['a', 'b', 'c']:
self.assertEqual(getattr(out_loaded, name), getattr(out, name))
| [
"[email protected]"
] | |
6c6a48f3986047a387a97d668a570c3d1a412af3 | 9523ce426577bb38dc1260e4095e735fb817e1fd | /utils/misc/logging.py | 46115961bf5f48aca4f03f1f25534ec7dbc9b002 | [] | no_license | Amantais/Kyrgyz-Stand-Up-Bot | 58147557aaf2e7ea714489d3614b0fa09eb943f8 | 028d36493b79f6b02e12d672688ef94e526946dc | refs/heads/master | 2023-03-28T03:28:42.001424 | 2021-03-25T17:27:49 | 2021-03-25T17:27:49 | 349,154,364 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 183 | py | import logging
logging.basicConfig(format=u'%(filename)s [LINE:%(lineno)d] #%(levelname)-8s [%(asctime)s] %(message)s',
level=logging.INFO,
) | [
"[email protected]"
] | |
7b2aa5263093ac5804b940b1cf647561c249ba97 | b5a9d42f7ea5e26cd82b3be2b26c324d5da79ba1 | /tensorflow/contrib/gan/python/features/python/virtual_batchnorm_test.py | bcc40e44e7b42a786f3841f48321f3e9d044918d | [
"Apache-2.0"
] | permissive | uve/tensorflow | e48cb29f39ed24ee27e81afd1687960682e1fbef | e08079463bf43e5963acc41da1f57e95603f8080 | refs/heads/master | 2020-11-29T11:30:40.391232 | 2020-01-11T13:43:10 | 2020-01-11T13:43:10 | 230,088,347 | 0 | 0 | Apache-2.0 | 2019-12-25T10:49:15 | 2019-12-25T10:49:14 | null | UTF-8 | Python | false | false | 11,346 | py | # Copyright 2017 The TensorFlow Authors. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# ==============================================================================
"""Tests for tfgan.python.features.virtual_batchnorm."""
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
import numpy as np
from tensorflow.contrib.framework.python.ops import variables as contrib_variables_lib
from tensorflow.contrib.gan.python.features.python import virtual_batchnorm_impl as virtual_batchnorm
from tensorflow.python.framework import constant_op
from tensorflow.python.framework import dtypes
from tensorflow.python.framework import random_seed
from tensorflow.python.layers import normalization
from tensorflow.python.ops import array_ops
from tensorflow.python.ops import math_ops
from tensorflow.python.ops import nn
from tensorflow.python.ops import random_ops
from tensorflow.python.ops import variable_scope
from tensorflow.python.ops import variables as variables_lib
from tensorflow.python.platform import test
class VirtualBatchnormTest(test.TestCase):
def test_syntax(self):
reference_batch = array_ops.zeros([5, 3, 16, 9, 15])
vbn = virtual_batchnorm.VBN(reference_batch, batch_axis=1)
vbn(array_ops.ones([5, 7, 16, 9, 15]))
def test_no_broadcast_needed(self):
"""When `axis` and `batch_axis` are at the end, no broadcast is needed."""
reference_batch = array_ops.zeros([5, 3, 16, 9, 15])
minibatch = array_ops.zeros([5, 3, 16, 3, 15])
vbn = virtual_batchnorm.VBN(reference_batch, axis=-1, batch_axis=-2)
vbn(minibatch)
def test_statistics(self):
"""Check that `_statistics` gives the same result as `nn.moments`."""
random_seed.set_random_seed(1234)
tensors = random_ops.random_normal([4, 5, 7, 3])
for axes in [(3), (0, 2), (1, 2, 3)]:
vb_mean, mean_sq = virtual_batchnorm._statistics(tensors, axes)
mom_mean, mom_var = nn.moments(tensors, axes)
vb_var = mean_sq - math_ops.square(vb_mean)
with self.cached_session(use_gpu=True) as sess:
vb_mean_np, vb_var_np, mom_mean_np, mom_var_np = sess.run([
vb_mean, vb_var, mom_mean, mom_var])
self.assertAllClose(mom_mean_np, vb_mean_np)
self.assertAllClose(mom_var_np, vb_var_np)
def test_virtual_statistics(self):
"""Check that `_virtual_statistics` gives same result as `nn.moments`."""
random_seed.set_random_seed(1234)
batch_axis = 0
partial_batch = random_ops.random_normal([4, 5, 7, 3])
single_example = random_ops.random_normal([1, 5, 7, 3])
full_batch = array_ops.concat([partial_batch, single_example], axis=0)
for reduction_axis in range(1, 4):
# Get `nn.moments` on the full batch.
reduction_axes = list(range(4))
del reduction_axes[reduction_axis]
mom_mean, mom_variance = nn.moments(full_batch, reduction_axes)
# Get virtual batch statistics.
vb_reduction_axes = list(range(4))
del vb_reduction_axes[reduction_axis]
del vb_reduction_axes[batch_axis]
vbn = virtual_batchnorm.VBN(partial_batch, reduction_axis)
vb_mean, mean_sq = vbn._virtual_statistics(
single_example, vb_reduction_axes)
vb_variance = mean_sq - math_ops.square(vb_mean)
# Remove singleton batch dim for easy comparisons.
vb_mean = array_ops.squeeze(vb_mean, batch_axis)
vb_variance = array_ops.squeeze(vb_variance, batch_axis)
with self.cached_session(use_gpu=True) as sess:
vb_mean_np, vb_var_np, mom_mean_np, mom_var_np = sess.run([
vb_mean, vb_variance, mom_mean, mom_variance])
self.assertAllClose(mom_mean_np, vb_mean_np)
self.assertAllClose(mom_var_np, vb_var_np)
def test_reference_batch_normalization(self):
"""Check that batch norm from VBN agrees with opensource implementation."""
random_seed.set_random_seed(1234)
batch = random_ops.random_normal([6, 5, 7, 3, 3])
for axis in range(5):
# Get `layers` batchnorm result.
bn_normalized = normalization.batch_normalization(
batch, axis, training=True)
# Get VBN's batch normalization on reference batch.
batch_axis = 0 if axis != 0 else 1 # axis and batch_axis can't same
vbn = virtual_batchnorm.VBN(batch, axis, batch_axis=batch_axis)
vbn_normalized = vbn.reference_batch_normalization()
with self.cached_session(use_gpu=True) as sess:
variables_lib.global_variables_initializer().run()
bn_normalized_np, vbn_normalized_np = sess.run(
[bn_normalized, vbn_normalized])
self.assertAllClose(bn_normalized_np, vbn_normalized_np)
def test_same_as_batchnorm(self):
"""Check that batch norm on set X is the same as ref of X / y on `y`."""
random_seed.set_random_seed(1234)
num_examples = 4
examples = [random_ops.random_normal([5, 7, 3]) for _ in
range(num_examples)]
# Get the result of the opensource batch normalization.
batch_normalized = normalization.batch_normalization(
array_ops.stack(examples), training=True)
for i in range(num_examples):
examples_except_i = array_ops.stack(examples[:i] + examples[i+1:])
# Get the result of VBN's batch normalization.
vbn = virtual_batchnorm.VBN(examples_except_i)
vb_normed = array_ops.squeeze(
vbn(array_ops.expand_dims(examples[i], [0])), [0])
with self.cached_session(use_gpu=True) as sess:
variables_lib.global_variables_initializer().run()
bn_np, vb_np = sess.run([batch_normalized, vb_normed])
self.assertAllClose(bn_np[i, ...], vb_np)
def test_minibatch_independent(self):
"""Test that virtual batch normalized examples are independent.
Unlike batch normalization, virtual batch normalization has the property
that the virtual batch normalized value of an example is independent of the
other examples in the minibatch. In this test, we verify this property.
"""
random_seed.set_random_seed(1234)
# These can be random, but must be the same for all session calls.
reference_batch = constant_op.constant(
np.random.normal(size=[4, 7, 3]), dtype=dtypes.float32)
fixed_example = constant_op.constant(np.random.normal(size=[7, 3]),
dtype=dtypes.float32)
# Get the VBN object and the virtual batch normalized value for
# `fixed_example`.
vbn = virtual_batchnorm.VBN(reference_batch)
vbn_fixed_example = array_ops.squeeze(
vbn(array_ops.expand_dims(fixed_example, 0)), 0)
with self.session(use_gpu=True):
variables_lib.global_variables_initializer().run()
vbn_fixed_example_np = vbn_fixed_example.eval()
# Check that the value is the same for different minibatches, and different
# sized minibatches.
for minibatch_size in range(1, 6):
examples = [random_ops.random_normal([7, 3]) for _ in
range(minibatch_size)]
minibatch = array_ops.stack([fixed_example] + examples)
vbn_minibatch = vbn(minibatch)
cur_vbn_fixed_example = vbn_minibatch[0, ...]
with self.cached_session(use_gpu=True):
variables_lib.global_variables_initializer().run()
cur_vbn_fixed_example_np = cur_vbn_fixed_example.eval()
self.assertAllClose(vbn_fixed_example_np, cur_vbn_fixed_example_np)
def test_variable_reuse(self):
"""Test that variable scopes work and inference on a real-ish case."""
tensor1_ref = array_ops.zeros([6, 5, 7, 3, 3])
tensor1_examples = array_ops.zeros([4, 5, 7, 3, 3])
tensor2_ref = array_ops.zeros([4, 2, 3])
tensor2_examples = array_ops.zeros([2, 2, 3])
with variable_scope.variable_scope('dummy_scope', reuse=True):
with self.assertRaisesRegexp(
ValueError, 'does not exist, or was not created with '
'tf.get_variable()'):
virtual_batchnorm.VBN(tensor1_ref)
vbn1 = virtual_batchnorm.VBN(tensor1_ref, name='vbn1')
vbn2 = virtual_batchnorm.VBN(tensor2_ref, name='vbn2')
# Fetch reference and examples after virtual batch normalization. Also
# fetch in variable reuse case.
to_fetch = []
to_fetch.append(vbn1.reference_batch_normalization())
to_fetch.append(vbn2.reference_batch_normalization())
to_fetch.append(vbn1(tensor1_examples))
to_fetch.append(vbn2(tensor2_examples))
variable_scope.get_variable_scope().reuse_variables()
to_fetch.append(vbn1.reference_batch_normalization())
to_fetch.append(vbn2.reference_batch_normalization())
to_fetch.append(vbn1(tensor1_examples))
to_fetch.append(vbn2(tensor2_examples))
self.assertEqual(4, len(contrib_variables_lib.get_variables()))
with self.session(use_gpu=True) as sess:
variables_lib.global_variables_initializer().run()
sess.run(to_fetch)
def test_invalid_input(self):
# Reference batch has unknown dimensions.
with self.assertRaisesRegexp(
ValueError, '`reference_batch` has unknown dimensions.'):
virtual_batchnorm.VBN(array_ops.placeholder(dtypes.float32), name='vbn1')
# Axis too negative.
with self.assertRaisesRegexp(
ValueError, 'Value of `axis` argument .* is out of range'):
virtual_batchnorm.VBN(array_ops.zeros([1, 2]), axis=-3, name='vbn2')
# Axis too large.
with self.assertRaisesRegexp(
ValueError, 'Value of `axis` argument .* is out of range'):
virtual_batchnorm.VBN(array_ops.zeros([1, 2]), axis=2, name='vbn3')
# Batch axis too negative.
with self.assertRaisesRegexp(
ValueError, 'Value of `axis` argument .* is out of range'):
virtual_batchnorm.VBN(array_ops.zeros([1, 2]), name='vbn4', batch_axis=-3)
# Batch axis too large.
with self.assertRaisesRegexp(
ValueError, 'Value of `axis` argument .* is out of range'):
virtual_batchnorm.VBN(array_ops.zeros([1, 2]), name='vbn5', batch_axis=2)
# Axis and batch axis are the same.
with self.assertRaisesRegexp(
ValueError, '`axis` and `batch_axis` cannot be the same.'):
virtual_batchnorm.VBN(array_ops.zeros(
[1, 2]), axis=1, name='vbn6', batch_axis=1)
# Reference Tensor and example Tensor have incompatible shapes.
tensor_ref = array_ops.zeros([5, 2, 3])
tensor_examples = array_ops.zeros([3, 2, 3])
vbn = virtual_batchnorm.VBN(tensor_ref, name='vbn7', batch_axis=1)
with self.assertRaisesRegexp(ValueError, 'Shapes .* are incompatible'):
vbn(tensor_examples)
if __name__ == '__main__':
test.main()
| [
"[email protected]"
] | |
5304e10f37ba2ce8b19aba3947560874a9d1e44d | de24f83a5e3768a2638ebcf13cbe717e75740168 | /moodledata/vpl_data/303/usersdata/294/83407/submittedfiles/testes.py | 3af7ad75e3ebbf1db0fb72a2d6435d6b0eab5d25 | [] | no_license | rafaelperazzo/programacao-web | 95643423a35c44613b0f64bed05bd34780fe2436 | 170dd5440afb9ee68a973f3de13a99aa4c735d79 | refs/heads/master | 2021-01-12T14:06:25.773146 | 2017-12-22T16:05:45 | 2017-12-22T16:05:45 | 69,566,344 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 151 | py | # -*- coding: utf-8 -*-
#COMECE AQUI ABAIXO
n= int(input('Digite o número: '))
i= 1
while n>0:
f= n*i
print(f)
i += 1
continue | [
"[email protected]"
] | |
c02db02524446e2a95ed0cd9397cad4639e1d4d0 | f6c7084f91434566a9aa1b821d2739edede036f8 | /AddFileInZipFile/venv/Scripts/easy_install-script.py | e91f9b665295271ec880111d88a24f435583b524 | [] | no_license | GANESH0080/Python-WorkPlace | 87fc3776e693d254661c476bfe977c696d087276 | 43196086bee26cbeae25fb7bbacb8dbbde85d648 | refs/heads/master | 2020-09-20T03:45:13.824696 | 2019-11-27T07:27:17 | 2019-11-27T07:27:17 | 224,369,263 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 447 | py | #!D:\PythonWorkPlace\AddFileInZipFile\venv\Scripts\python.exe
# EASY-INSTALL-ENTRY-SCRIPT: 'setuptools==39.1.0','console_scripts','easy_install'
__requires__ = 'setuptools==39.1.0'
import re
import sys
from pkg_resources import load_entry_point
if __name__ == '__main__':
sys.argv[0] = re.sub(r'(-script\.pyw?|\.exe)?$', '', sys.argv[0])
sys.exit(
load_entry_point('setuptools==39.1.0', 'console_scripts', 'easy_install')()
)
| [
"[email protected]"
] | |
3492118728fbc025eeeac90626281925568df458 | f0f289ed2d7376e4531ff2faa9e23beedc2fbb8c | /arsenal/nlp/wordnet/synset.py | a0a53caae30615e1e61af34ca64166d605e94e4c | [] | no_license | twocngdagz/arsenal | 5aa9908043972307e3d1c2fbeaf50242242f87f0 | 7a96a6937b94a33b8a14a71d5b0936e16e3d9f64 | refs/heads/master | 2021-01-19T03:51:37.110291 | 2013-10-15T03:55:12 | 2013-10-15T03:55:12 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 23,358 | py | # Natural Language Toolkit: Wordnet Interface: Wordnet Module
#
# Copyright (C) 2001-2008 University of Pennsylvania
# Author: Oliver Steele <[email protected]>
# David Ormiston Smith <[email protected]>>
# Steven Bird <[email protected]>
# URL: <http://nltk.sf.net>
# For license information, see LICENSE.TXT
import math, pickle, string, re
from util import *
from similarity import *
from dictionary import *
from lexname import Lexname
class Word(object):
def __init__(self, line):
"""
Extract a word from a line of a WordNet POS file.
@type line: C{string}
@param line: The appropriate line taken from the Wordnet data files.
"""
tokens = line.split()
ints = map(int, tokens[int(tokens[3]) + 4:])
self.form = tokens[0].replace('_', ' ') # orthography
self.pos = normalizePOS(tokens[1]) # NOUN, VERB, ADJECTIVE, ADVERB
self.taggedSenseCount = ints[1] # Number of senses tagged
self._synsetOffsets = ints[2:ints[0]+2] # Offsets of this word's synsets
def synsets(self):
"""
Get a sequence of the L{synsets}s of this word.
>>> from nltk.wordnet import *
>>> N['dog'].synsets()
[{noun: dog, domestic dog, Canis familiaris}, {noun: frump, dog}, {noun: dog}, {noun: cad, bounder, blackguard, dog, hound, heel}, {noun: frank, frankfurter, hotdog, hot dog, dog, wiener, wienerwurst, weenie}, {noun: pawl, detent, click, dog}, {noun: andiron, firedog, dog, dog-iron}]
@return: A list of this L{Word}'s L{Synset}s
"""
try:
return self._synsets
except AttributeError:
self._synsets = [getSynset(self.pos, offset)
for offset in self._synsetOffsets]
del self._synsetOffsets
return self._synsets
def isTagged(self):
"""
>>> from nltk.wordnet import *
>>> N['dog'].isTagged()
True
@return: True/false (1/0) if one of this L{Word}'s senses is tagged.
"""
return self.taggedSenseCount > 0
def __getitem__(self, idx):
return self.synsets()[idx]
def __iter__(self):
return iter(self.synsets())
def __contains__(self, item):
return item in self.synsets()
def __getslice__(self, i, j):
return self.synsets()[i:j]
def __len__(self):
return len(self.synsets())
def __repr__(self):
return self.__str__()
def __str__(self):
return self.form + ' (' + self.pos + ")"
class Synset(object):
"""
A set of synonyms.
Each synset contains one or more Senses, which represent a
specific sense of a specific word. Senses can be retrieved via
synset.getSenses() or through the index notations synset[0],
synset[string], or synset[word]. Synsets also originate zero or
more typed pointers, which can be accessed via
synset.getPointers() or synset.getPointers(pointerType). The
targets of a synset pointer can be retrieved via
synset.getPointerTargets() or
synset.getPointerTargets(pointerType), which are equivalent to
map(Pointer.getTarget(), synset.getPointerTargets(...)).
>>> from nltk.wordnet import *
>>> V['think'][0].synset.verbFrames
(5, 9)
@type pos: C{string}
@ivar pos: The part of speech -- one of NOUN, VERB, ADJECTIVE, ADVERB.
@type offset: C{int}
@ivar offset: An integer offset into the part-of-speech file. Together
with pos, this can be used as a unique id.
@type gloss: C{string}
@ivar gloss: A gloss (dictionary definition) for the sense.
@type verbFrames: C{list} of C{integer}
@ivar verbFrames: A sequence of integers that index into
VERB_FRAME_STRINGS. These list the verb frames that any
Sense in this synset participates in. (See also
Sense.verbFrames.) Defined only for verbs.
"""
def __init__(self, pos, offset, line):
"""Initialize the synset from a line in a WordNet synset file."""
# Part of speech -- one of NOUN, VERB, ADJECTIVE, ADVERB.
self.pos = pos
# Integer offset into the part-of-speech file. Together with pos,
# this can be used as a unique id.
self.offset = offset
# The synset entry can be broadly divided into two parts: the
# synset and relational data, and its human readable description, or
# gloss. The '|' character separates these.
dividerIndex = line.index('|')
tokens = line[:dividerIndex].split()
self.ssType = tokens[2]
self.gloss = line[dividerIndex + 1:].strip()
self.lexname = Lexname.lexnames[int(tokens[1])]
# TODO: This next code is dense and confusing. Clean up at some point.
# line is of the form:
# synset_offset lex_filenum ss_type w_cnt word lex_id [word lex_id...] p_cnt [ptr...] [frames...] | gloss
synset_cnt = int(tokens[3], 16) # hex integer representing number of items in the synset; same as w_cnt above
#extract all pairs of the form (sense, sense_index), plus a remainder
(senseTuples, remainder1) = _partition(tokens[4:], 2, synset_cnt)
self.words = [form for form, i in senseTuples]
#extract all pointer quadruples, plus a remainder
(self._pointerTuples, remainder2) = _partition(remainder1[1:], 4, int(remainder1[0]))
#frames: In data.verb only, a list of numbers corresponding to the
#generic verb sentence frames for word s in the synset. frames is of
#the form:
#f_cnt + f_num w_num [ + f_num w_num...]
#where f_cnt is a two digit decimal integer indicating the number of
#generic frames listed, f_num is a two digit decimal integer frame
#number, and w_num is a two digit hexadecimal integer indicating the
#word in the synset that the frame applies to. As with pointers, if
#this number is 00 , f_num applies to all word s in the synset. If
#non-zero, it is applicable only to the word indicated. Word numbers
#are assigned as described for pointers.
if pos == VERB:
(vfTuples, remainder3) = _partition(remainder2[1:], 3, int(remainder2[0]))
#now only used for senseVerbFrames
def extractVerbFrames(index, vfTuples):
return tuple(map(lambda t:int(t[1]), filter(lambda t,i=index:int(t[2],16) in (0, i), vfTuples)))
senseVerbFrames = []
for index in range(1, len(self.words) + 1):
senseVerbFrames.append(extractVerbFrames(index, vfTuples))
self._senseVerbFrames = senseVerbFrames
# A sequence of integers that index into VERB_FRAME_STRINGS. These
# list the verb frames that any Sense in this synset participates
# in (see also Sense.verbFrames). Defined only for verbs.
self.verbFrames = tuple(extractVerbFrames(None, vfTuples))
#A list of verb frame strings for this synset
self.verbFrameStrings = self.extractVerbFrameStrings(vfTuples)
def extractVerbFrameStrings(self, vfTuples):
"""
Return a list of verb frame strings for this synset.
"""
# extract a frame index if 3rd item is 00
frame_indices = [int(t[1]) for t in vfTuples if int(t[2], 16) == 0]
try:
verbFrames = [VERB_FRAME_STRINGS[i] for i in frame_indices]
except IndexError:
return []
#ideally we should build 3rd person morphology for this form
form = self[0]
verbFrameStrings = [vf % form for vf in verbFrames]
return verbFrameStrings
def relations(self):
"""
Return a dictionary of synsets
If pointerType is specified, only pointers of that type are
returned. In this case, pointerType should be an element of
POINTER_TYPES.
@return: relations defined on this L{Synset}.
"""
# Load the pointers from the Wordnet files if necessary.
if not hasattr(self, '_relations'):
relations = defaultdict(list)
for (type, offset, pos, indices) in self._pointerTuples:
rel = _RELATION_TABLE[type]
idx = int(indices, 16) & 255
pos = normalizePOS(pos)
offset = int(offset)
synset = getSynset(pos, offset)
if idx:
relations[rel].append(synset[idx-1])
else:
relations[rel].append(synset)
del self._pointerTuples
self._relations = dict(relations)
return self._relations
def relation(self, rel):
return self.relations().get(rel, [])
### BROKEN:
def isTagged(self):
"""
>>> from nltk.wordnet import *
>>> N['dog'][0].isTagged()
True
>>> N['dog'][1].isTagged()
False
@return: True/false (1/0) if one of this L{Word}'s senses is tagged.
"""
return len(filter(Word.isTagged, self.words)) > 0
def __str__(self):
"""
Return a human-readable representation.
>>> from nltk.wordnet import *
>>> str(N['dog'][0].synset)
'{noun: dog, domestic dog, Canis familiaris}'
"""
return "{" + self.pos + ": " + string.join(self.words, ", ") + "}"
def __repr__(self):
return "{" + self.pos + ": " + string.join(self.words, ", ") + "}"
def __cmp__(self, other):
return _compareInstances(self, other, ('pos', 'offset'))
def __eq__(self, other):
return _compareInstances(self, other, ('pos', 'offset')) == 0
def __ne__(self, other):
return not (self==other)
def __getitem__(self, idx):
try:
return self.words[idx] # integer key
except TypeError:
return self.relation(idx) # string key
def __iter__(self):
return iter(self.words)
def __contains__(self, item):
return item in self.words
def __getslice__(self, i, j):
return self.words[i:j]
def __nonzero__(self):
return 1
def __len__(self):
"""
>>> from nltk.wordnet import *
>>> len(N['dog'][0].synset)
3
"""
return len(self.words)
def max_depth(self):
"""
@return: The length of the longest hypernym path from this synset to the root.
"""
if self[HYPERNYM] == []:
return 0
deepest = 0
for hypernym in self[HYPERNYM]:
depth = hypernym.max_depth()
if depth > deepest:
deepest = depth
return deepest + 1
def min_depth(self):
"""
@return: The length of the shortest hypernym path from this synset to the root.
"""
if self[HYPERNYM] == []:
return 0
shallowest = 1000
for hypernym in self[HYPERNYM]:
depth = hypernym.max_depth()
if depth < shallowest:
shallowest = depth
return shallowest + 1
def closure(self, rel, depth=-1):
"""Return the transitive closure of source under the rel relationship, breadth-first
>>> dog = N['dog'][0]
>>> dog.closure(HYPERNYM)
[{noun: dog, domestic dog, Canis familiaris}, {noun: canine, canid}, {noun: carnivore}, {noun: placental, placental mammal, eutherian, eutherian mammal}, {noun: mammal, mammalian}, {noun: vertebrate, craniate}, {noun: chordate}, {noun: animal, animate being, beast, brute, creature, fauna}, {noun: organism, being}, {noun: living thing, animate thing}, {noun: object, physical object}, {noun: physical entity}, {noun: entity}]
"""
def breadth_first(tree, children=iter, depth=-1, queue=None):
"""Traverse the nodes of a tree in breadth-first order.
(No need to check for cycles.)
The first argument should be the tree root;
children should be a function taking as argument a tree node
and returning an iterator of the node's children.
"""
if queue == None:
queue = []
queue.append(tree)
while queue:
node = queue.pop(0)
yield node
if depth != 0:
try:
queue += children(node)
depth -= 1
except:
pass
synset_offsets = []
for synset in breadth_first(self, lambda s:s[rel], depth):
if synset.offset != self.offset and synset.offset not in synset_offsets:
synset_offsets.append(synset.offset)
yield synset
# return synsets
def hypernym_paths(self):
"""
Get the path(s) from this synset to the root, where each path is a
list of the synset nodes traversed on the way to the root.
@return: A list of lists, where each list gives the node sequence
connecting the initial L{Synset} node and a root node.
"""
paths = []
hypernyms = self[HYPERNYM]
if len(hypernyms) == 0:
paths = [[self]]
for hypernym in hypernyms:
for ancestor_list in hypernym.hypernym_paths():
ancestor_list.append(self)
paths.append(ancestor_list)
return paths
def hypernym_distances(self, distance, verbose=False):
"""
Get the path(s) from this synset to the root, counting the distance
of each node from the initial node on the way. A list of
(synset, distance) tuples is returned.
@type distance: C{int}
@param distance: the distance (number of edges) from this hypernym to
the original hypernym L{Synset} on which this method was called.
@return: A list of (L{Synset}, int) tuples where each L{Synset} is
a hypernym of the first L{Synset}.
"""
distances = set([(self, distance)])
for hypernym in self[HYPERNYM]:
distances |= hypernym.hypernym_distances(distance+1, verbose=False)
if verbose:
print "> Hypernym Distances:", self, string.join([synset.__str__() + ":" + `dist` for synset, dist in distances])
return distances
def shortest_path_distance(self, other):
"""
Returns the distance of the shortest path linking the two synsets (if
one exists). For each synset, all the ancestor nodes and their distances
are recorded and compared. The ancestor node common to both synsets that
can be reached with the minimum number of traversals is used. If no
ancestor nodes are common, -1 is returned. If a node is compared with
itself 0 is returned.
@type other: L{Synset}
@param other: The Synset to which the shortest path will be found.
@return: The number of edges in the shortest path connecting the two
nodes, or -1 if no path exists.
"""
if self == other: return 0
path_distance = -1
dist_list1 = self.hypernym_distances(0)
dist_dict1 = {}
dist_list2 = other.hypernym_distances(0)
dist_dict2 = {}
# Transform each distance list into a dictionary. In cases where
# there are duplicate nodes in the list (due to there being multiple
# paths to the root) the duplicate with the shortest distance from
# the original node is entered.
for (l, d) in [(dist_list1, dist_dict1), (dist_list2, dist_dict2)]:
for (key, value) in l:
if key in d:
if value < d[key]:
d[key] = value
else:
d[key] = value
# For each ancestor synset common to both subject synsets, find the
# connecting path length. Return the shortest of these.
for synset1 in dist_dict1.keys():
for synset2 in dist_dict2.keys():
if synset1 == synset2:
new_distance = dist_dict1[synset1] + dist_dict2[synset2]
if path_distance < 0 or new_distance < path_distance:
path_distance = new_distance
return path_distance
def tree(self, rel, depth=-1, cut_mark=None):
"""
>>> dog = N['dog'][0]
>>> from pprint import pprint
>>> pprint(dog.tree(HYPERNYM))
['dog' in {noun: dog, domestic dog, Canis familiaris},
[{noun: canine, canid},
[{noun: carnivore},
[{noun: placental, placental mammal, eutherian, eutherian mammal},
[{noun: mammal, mammalian},
[{noun: vertebrate, craniate},
[{noun: chordate},
[{noun: animal, animate being, beast, brute, creature, fauna},
[{noun: organism, being},
[{noun: living thing, animate thing},
[{noun: object, physical object},
[{noun: physical entity}, [{noun: entity}]]]]]]]]]]]]]
"""
tree = [self]
if depth != 0:
tree += [x.tree(rel, depth-1, cut_mark) for x in self[rel]]
elif cut_mark:
tree += [cut_mark]
return tree
# interface to similarity methods
def path_similarity(self, other, verbose=False):
return path_similarity(self, other, verbose)
def lch_similarity(self, other, verbose=False):
return lch_similarity(self, other, verbose)
def wup_similarity(self, other, verbose=False):
return wup_similarity(self, other, verbose)
def res_similarity(self, other, ic, verbose=False):
return res_similarity(self, other, ic, verbose)
def jcn_similarity(self, other, ic, verbose=False):
return jcn_similarity(self, other, ic, verbose)
def lin_similarity(self, other, ic, verbose=False):
return lin_similarity(self, other, ic, verbose)
# Lexical Relations
_RELATION_TABLE = {
'!': ANTONYM, '@': HYPERNYM, '~': HYPONYM, '=': ATTRIBUTE,
'^': ALSO_SEE, '*': ENTAILMENT, '>': CAUSE, '$': VERB_GROUP,
'#m': MEMBER_MERONYM, '#s': SUBSTANCE_MERONYM, '#p': PART_MERONYM,
'%m': MEMBER_HOLONYM, '%s': SUBSTANCE_HOLONYM, '%p': PART_HOLONYM,
'&': SIMILAR, '<': PARTICIPLE_OF, '\\': PERTAINYM, '+': FRAMES,
';c': CLASSIF_CATEGORY, ';u': CLASSIF_USAGE, ';r': CLASSIF_REGIONAL,
'-c': CLASS_CATEGORY, '-u': CLASS_USAGE, '-r': CLASS_REGIONAL,
'@i': INSTANCE_HYPERNYM,'~i': INSTANCE_HYPONYM,
}
# Private Utility Functions
def _index(key, sequence, testfn=None, keyfn=None):
"""
Return the index of key within sequence, using testfn for
comparison and transforming items of sequence by keyfn first.
>>> _index('e', 'hello')
1
>>> _index('E', 'hello', testfn=_equalsIgnoreCase)
1
>>> _index('x', 'hello')
"""
index = 0
for element in sequence:
value = element
if keyfn:
value = keyfn(value)
if (not testfn and value == key) or (testfn and testfn(value, key)):
return index
index = index + 1
return None
def _partition(sequence, size, count):
"""
Partition sequence into C{count} subsequences of
length C{size}, and a remainder.
Return C{(partitions, remainder)}, where C{partitions} is a sequence of
C{count} subsequences of cardinality C{size}, and
C{apply(append, partitions) + remainder == sequence}.
"""
partitions = []
for index in range(0, size * count, size):
partitions.append(sequence[index:index + size])
return (partitions, sequence[size * count:])
def _compareInstances(a, b, fields):
"""
Return -1, 0, or 1 according to a comparison first by type,
then by class, and finally by each of fields. Used when comparing two
Wordnet objects (Synsets, Words, or Senses) to each other.
"""
if not hasattr(b, '__class__'):
return cmp(type(a), type(b))
elif a.__class__ != b.__class__:
return cmp(a.__class__, b.__class__)
for field in fields:
diff = cmp(getattr(a, field), getattr(b, field))
if diff: return diff
return 0
def _equalsIgnoreCase(a, b):
"""
Return true iff a and b have the same lowercase representation.
>>> _equalsIgnoreCase('dog', 'Dog')
True
>>> _equalsIgnoreCase('dOg', 'DOG')
True
"""
return a == b or a.lower() == b.lower()
if __name__ == '__main__':
from dictionary import N, V, HYPERNYM, ADJ, ANTONYM
from pprint import pprint
dog = N['dog']
cat = N['cat']
print ".N['dog']"
print 'dog' in N
print dog
print dog.pos, dog.form
print dog.taggedSenseCount
print dog.synsets()
print dog.isTagged()
N['cat'] < N['dog']
# N['dog'] < V['dog']
print "Verb Frames:",
print V['think'][0].verbFrameStrings
print "Relations:"
print dog[0].relations()
print dog[0][HYPERNYM]
print "Glosses:"
print dog[0].gloss
print dog[0].relation(HYPERNYM)[0].gloss
print
print "Paths and Distances:"
print
print dog[0].hypernym_paths()
print dog[0].hypernym_distances(0)
print dog[0].shortest_path_distance(cat[0])
print
print "Closures and Trees:"
print
pprint(ADJ['red'][0].closure(SIMILAR, depth=1))
pprint(ADJ['red'][0].closure(SIMILAR, depth=2))
pprint(dog[0].tree(HYPERNYM))
pprint(dog[0].tree(HYPERNYM, depth=2, cut_mark = '...'))
entity = N["entity"]
print entity, entity[0]
print entity[0][HYPONYM]
pprint(entity[0].tree(HYPONYM, depth=1), indent=4)
abstract_entity = N["abstract entity"]
print abstract_entity, abstract_entity[0]
print abstract_entity[0][HYPONYM]
pprint(abstract_entity[0].tree(HYPONYM, depth=1), indent=4)
print
print 'SIMILARITY CLOSURE:'
print '-------------------------------------------------------------'
# Adjectives that are transitively SIMILAR to any of the senses of 'red'
#for cl in map(lambda sense: sense.closure(SIMILAR), ADJ['red']):
# for x in cl:
# print x,
# print '**'
print '-------------------------------------------------------------'
print "All the words in the hyponym synsets of dog[0]"
print [word for synset in dog[0][HYPONYM] for word in synset]
print "Hyponyms of the first (and only) sense of 'animal' that are homophonous with verbs:"
print [word for synset in N['animal'][0].closure(HYPONYM) for word in synset if word in V]
print
print "Similarity: dog~cat"
print
print "Path Distance Similarity:",
print dog[0].path_similarity(cat[0])
print "Leacock Chodorow Similarity:",
print dog[0].lch_similarity(cat[0])
print "Wu Palmer Similarity:",
print dog[0].wup_similarity(cat[0])
| [
"none@none"
] | none@none |
8cff9b1d4c1909959d729269cf817583caf4643b | 964f2882117ff656d7a2757c233c6dd88226d975 | /services/web/server/setup.py | 7a71b500f01dcf016b26ad41ba3046e07d2ab0fb | [
"MIT"
] | permissive | ignapas/osparc-simcore | a002dd47d7689af9c1c650eea33e31add2b182c1 | cb62e56b194265a907f260f3071c55a65f569823 | refs/heads/master | 2023-01-22T08:55:32.580775 | 2022-12-09T15:57:36 | 2022-12-09T15:57:36 | 170,852,656 | 0 | 0 | MIT | 2023-01-09T05:03:04 | 2019-02-15T11:12:34 | Python | UTF-8 | Python | false | false | 1,852 | py | import re
import sys
from pathlib import Path
from setuptools import find_packages, setup
def read_reqs(reqs_path: Path) -> set[str]:
return {
r
for r in re.findall(
r"(^[^#\n-][\w\[,\]]+[-~>=<.\w]*)",
reqs_path.read_text(),
re.MULTILINE,
)
if isinstance(r, str)
}
CURRENT_DIR = Path(sys.argv[0] if __name__ == "__main__" else __file__).resolve().parent
# Hard requirements on third-parties and latest for in-repo packages
INSTALL_REQUIREMENTS = tuple(
read_reqs(CURRENT_DIR / "requirements" / "_base.txt")
| {
"simcore-models-library",
"simcore-postgres-database",
"simcore-settings-library",
"simcore-service-library[aiohttp]>=1.2.0",
}
)
TEST_REQUIREMENTS = tuple(read_reqs(CURRENT_DIR / "requirements" / "_test.txt"))
SETUP = dict(
name="simcore-service-webserver",
version=Path(CURRENT_DIR / "VERSION").read_text().strip(),
description="Main service with an interface (http-API & websockets) to the web front-end",
author=", ".join(
(
"Pedro Crespo-Valero (pcrespov)",
"Sylvain Anderegg (sanderegg)",
"Andrei Neagu (GitHK)",
)
),
packages=find_packages(where="src"),
package_dir={
"": "src",
},
include_package_data=True,
package_data={
"": [
"api/v0/openapi.yaml",
"api/v0/schemas/*.json",
"templates/**/*.jinja2",
]
},
entry_points={
"console_scripts": [
"simcore-service-webserver=simcore_service_webserver.__main__:main",
]
},
python_requires="~=3.9",
install_requires=INSTALL_REQUIREMENTS,
tests_require=TEST_REQUIREMENTS,
setup_requires=["pytest-runner"],
)
if __name__ == "__main__":
setup(**SETUP)
| [
"[email protected]"
] | |
674d81f2daefa528467e546fa5335ec020bb5122 | 45df3588d0ec1a2bd7dbe4af104a49aa5775d034 | /group1/views.py | d7b5a1ba099f4990b20b952e33d7b7b171e8734b | [] | no_license | wittawin/DB_Project | 043db7eb3d70ef32c9c97d51a242775b3e115f73 | 1cc1fe84c75906d670f7bb4dd130093bc15035b8 | refs/heads/master | 2020-04-06T03:43:21.516583 | 2015-07-13T05:47:09 | 2015-07-13T05:47:09 | 37,700,817 | 0 | 1 | null | 2015-06-19T04:06:07 | 2015-06-19T04:06:06 | JavaScript | UTF-8 | Python | false | false | 11,091 | py | from django.shortcuts import render, render_to_response, RequestContext
from django.http import HttpResponse
from django.core.mail import send_mail
from django.core.mail.message import EmailMessage
# Create your views here.
def index(request):
template = 'group1/index.html'
context = RequestContext(request)
return render_to_response(
template,
{},
context
)
#!/usr/bin/python
# -*- coding: utf-8 -*-
from django.http import HttpResponse
from django.shortcuts import render_to_response
from django.template import RequestContext
from django.http import HttpResponseRedirect
from django.core.urlresolvers import reverse
from group1.models import Document, Category, Personal
from login.models import UserProfile
from group1.forms import DocumentForm
#######################################################################################################################
def upload_file(request):
# Handle file upload
# Load categories for the list page
category = Category.objects.all()
persons = Personal.objects.all()
if request.method == 'POST':
form = DocumentForm(request.POST, request.FILES)
name_file = request.POST.get('name_file')
category_file = request.POST.get('category_file')
year_file = request.POST.get('year_file')
number_file = request.POST.get('number_file')
number_file2 = request.POST.get('number_file2')
detail1_file = request.POST.get('detail1_file')
detail2_file = request.POST.get('detail2_file')
detail3_file = request.POST.get('detail3_file')
detail4_file = request.POST.get('detail4_file')
pres_email = request.POST.getlist('pers_email[]')
# Redirect to search page
if category_file == 'none' or category_file == '':
return render_to_response('group1/upload.html',
{'persons':persons, 'category': category, 'name_file':name_file, 'year_file':year_file,
'number_file2':number_file2, 'number_file':number_file,
'error_msg_upload':"***Please insert all data***" },
context_instance=RequestContext(request))
if form.is_valid():
try:
cate = Category.objects.get(code_name=category_file)
newdoc = Document(docfile=request.FILES['docfile'],
name=name_file,
category=cate,
year=year_file, number=number_file, number2=number_file2,
detail1=detail1_file, detail2=detail2_file, detail3=detail3_file, detail4=detail4_file
)
category_code = category_file
category_name = cate.name
newdoc.save()
for preson_in in pres_email:
if preson_in != "":
newdoc.personal.add(Personal.objects.get(name=preson_in.split(':')[0]))
# Load documents for the list page
documents = Category.objects.get(code_name=category_file)
documents = documents.document_set.all()
documents = documents.filter(year=year_file)
documents = documents.filter(name=name_file)
documents = documents.filter(number=number_file)
documents = documents.filter(number2=number_file2)
return render_to_response('group1/search.html', {'form': form,'persons':persons,
'category': category, 'documents':documents},
context_instance=RequestContext(request))
except:
# Redirect to upload page
return render_to_response('group1/upload.html', {'form': form,'persons':persons,
'category': category, 'name_file':name_file, 'year_file':year_file,
'number_file':number_file, 'number_file2':number_file2,
# 'detail5_file':detail5_file,
'error_msg_upload':"***Insert data error***",
'category_code':category_code, 'category_name':category_name},
context_instance=RequestContext(request))
else:
form = DocumentForm() # A empty, unbound form
return render_to_response('group1/upload.html', {'form': form,'persons':persons,'category': category, 'name_file':name_file,
'year_file':year_file, 'number_file':number_file, 'number_file2':number_file2,
'error_msg_upload':"***Please insert all data***"},context_instance=RequestContext(request))
form = DocumentForm() # A empty, unbound form
# Render list page with the documents and the form
return render_to_response('group1/upload.html', {'form': form,'persons':persons,
'category': category},
context_instance=RequestContext(request))
#######################################################################################################################
def search_file(request):
# Handle file search
# Load categories for the list page....
category = Category.objects.all()
persons = Personal.objects.all()
if request.method == 'POST':
name_file = request.POST.get('name_file')
category_file = request.POST.get('category_file')
year_file = request.POST.get('year_file')
number_file = request.POST.get('number_file')
number_file2 = request.POST.get('number_file2')
detail5_file = request.POST.get('detail5_file')
if name_file != '':
documents = Document.objects.filter(name__contains=name_file)
else:
documents = Document.objects.all()
if category_file != '':
documents = documents.filter(category=Category.objects.get(code_name=category_file))
if year_file != '':
documents = documents.filter(year=year_file)
if number_file != '':
documents = documents.filter(number=number_file)
if number_file2 != '':
documents = documents.filter(number2=number_file2)
if detail5_file != '':
documents = documents.filter(category=Category.objects.filter(depart=detail5_file))
return render_to_response('group1/search.html',
{'documents': documents, 'category': category},
context_instance=RequestContext(request))
return render_to_response('group1/search.html', {'category': category, 'persons':persons},
context_instance=RequestContext(request))
#######################################################################################################################
def send_email(request, doc_id):
document = Document.objects.get(id=doc_id)
return render_to_response('group1/send.html', {'document': document},context_instance=RequestContext(request))
#######################################################################################################################
def sender(request):
if request.method == 'POST':
doc_id = request.POST.get('doc_id')
comment = request.POST.get('comment')
name_email = request.POST.get('name_email')
document = Document.objects.get(id=doc_id)
personals = document.personal.all()
send_to = []
for per in personals:
send_to.append(per.email)
# Build message
email = EmailMessage(subject=name_email, body=comment, from_email='[email protected]',to=send_to, headers = {'Reply-To': '[email protected]'})
# Open file
attachment = open(u''+document.docfile.name, 'rb')
# Attach file
email.attach("attach_file.pdf", attachment.read(),'application/pdf')
# Send message with built-in send() method
email.send()
msg_ok = "Send message success"
print('Send message success')
return render_to_response('group1/send.html', {'document': document, 'msg_ok': msg_ok} ,
context_instance=RequestContext(request))
###################################################################################################
def add_category(request):
category = Category.objects.all()
if request.method == 'POST':
name_file = request.POST.get('category_name')
detail5_file = request.POST.get('detail5_file')
for i in range (1, 101):
if not(Category.objects.filter(code_name=i)):
break
newdoc = Category(code_name=i, name=name_file, depart=detail5_file)
newdoc.save()
return render_to_response('group1/category.html', {
'category': category},
context_instance=RequestContext(request))
return render_to_response('group1/category.html',
{'category': category},
context_instance=RequestContext(request))
####################################################################################################
def add_people(request):
persons = Personal.objects.all()
if request.method == 'POST':
t_name_file = request.POST.get('t_name_file')
t_code_name = request.POST.get('t_code_name')
email_file = request.POST.get('email_file')
newdoc = Personal(code_name=t_code_name, name=t_name_file, email=email_file)
newdoc.save()
return render_to_response('group1/people.html', {
'persons': persons},
context_instance=RequestContext(request))
return render_to_response('group1/people.html',
{'persons': persons},
context_instance=RequestContext(request))
#############################################################################################
def edit(request):
return render_to_response('group1/edit.html',
context_instance=RequestContext(request))
#############################################################################################
def delete(request):
documents = Document.objects.all()
## if request.method == 'POST':
## name_file = request.POST.get('name_file')
##
## Document.objects.filter(name=name_file).delete()
##
## return render_to_response('group1/search.html',
## context_instance=RequestContext(request))
return render_to_response('group1/delete.html',{'documents': documents},
context_instance=RequestContext(request))
| [
"[email protected]"
] | |
b9f07dccd6e3fb6e5a6a7332aa88808ea237dad9 | c792b076cdf8c943c344d90b21817dd501c165ab | /boj/그래프/2252_줄세우기.py | cacd0a05917fbe5ef91f3edac525e6ba96dd809d | [] | no_license | Jdoublee/CodingTestPractice | d68afa38e64de67aa53ab8c6569e07e7b310a83d | 83eb2b84f63d55808a5e9b014e023b72bf4a4e9e | refs/heads/master | 2023-06-02T16:48:52.913402 | 2021-06-16T13:34:40 | 2021-06-16T13:34:40 | 290,072,409 | 6 | 0 | null | null | null | null | UTF-8 | Python | false | false | 493 | py | from collections import deque
import sys
input = sys.stdin.readline
n, m = map(int, input().split())
graph = [[] for _ in range(n+1)]
indegree = [0] * (n+1)
for _ in range(m):
a, b = map(int, input().split())
graph[a].append(b)
indegree[b] += 1
q = deque()
for i in range(1,n+1):
if indegree[i] == 0:
q.append(i)
res = []
while q:
now = q.popleft()
res.append(now)
for i in graph[now]:
indegree[i] -= 1
if indegree[i] == 0:
q.append(i)
for i in res:
print(i, end=' ') | [
"[email protected]"
] | |
910288eeb6880457b4a0f6b9f81ba7c4775ce359 | ffc1cc3bb7b68335b115122fdc7924fc4e31d528 | /ss.py | af41d32a4c76e4a825cdfa5fd5b810976d27b19d | [] | no_license | Rihanashariff/swathi24 | dba1dd3c3d2ff583ae431b432e0ef262bfeb3ac3 | 2b0d21f2febdd2a563e8f0affeebd5ca7a5821b8 | refs/heads/master | 2020-07-02T05:28:32.199982 | 2019-06-29T08:22:10 | 2019-06-29T08:22:10 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 97 | py | #swa1
s=int(input())
if s>0:
print("Postive")
elif s<0:
print("Negative")
else:
print("Zero")
| [
"[email protected]"
] | |
d25632912251f2ba76809c013cba68857ea833a2 | 4382c60f18aba351a2e7cdab7ce2793c2d27717c | /Algorithm 190902/addnumber.py | b32d1dbc234824bd231157352bf2adefaa53d744 | [] | no_license | vxda7/pycharm | e550b1db4cabe1a0fa03e140f33b028ef08bd4cb | ce29f682a923875b62a8c7c0102790eef11ab156 | refs/heads/master | 2020-07-03T11:27:27.807096 | 2019-11-15T08:50:32 | 2019-11-15T08:50:32 | 201,891,357 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 318 | py | t = int(input())
for tc in range(1, t+1):
N, M, L = map(int, input().split()) # N 수열길이 M 필요한 숫자 L 출력인덱스
res = list(map(int, input().split()))
for i in range(M):
idx, num = map(int, input().split())
res.insert(idx, num)
print("#{} {}".format(tc, res[L]))
| [
"[email protected]"
] | |
744d9d1e4d6ea3d0eacfc2acbca5743b1b6df196 | 5a7abc4537039860c49e9a80219efa759aad1b6f | /tests/providers/aws/services/route53/route53domains_service_test.py | 75d5616d62658b4778bd6f36245dd74ea10459d7 | [
"Apache-2.0"
] | permissive | sec-js/prowler | d5a06c72f5d7e490bade1167966f83f7a5d7ed15 | f72be9a1e492ad593c9ac267d3ca07f626263ccd | refs/heads/master | 2023-08-31T22:48:33.983360 | 2022-12-22T16:02:28 | 2022-12-22T16:02:28 | 243,866,744 | 0 | 0 | Apache-2.0 | 2022-12-23T12:23:20 | 2020-02-28T22:37:02 | Python | UTF-8 | Python | false | false | 4,172 | py | from datetime import datetime
from unittest.mock import patch
import botocore
from boto3 import session
from prowler.providers.aws.lib.audit_info.audit_info import AWS_Audit_Info
from prowler.providers.aws.services.route53.route53_service import Route53Domains
# Mock Test Region
AWS_REGION = "us-east-1"
# Mocking Access Analyzer Calls
make_api_call = botocore.client.BaseClient._make_api_call
def mock_make_api_call(self, operation_name, kwarg):
"""We have to mock every AWS API call using Boto3"""
if operation_name == "ListDomains":
return {
"Domains": [
{
"DomainName": "test.domain.com",
"AutoRenew": True,
"TransferLock": True,
"Expiry": datetime(2015, 1, 1),
},
],
"NextPageMarker": "string",
}
if operation_name == "GetDomainDetail":
return {
"DomainName": "test.domain.com",
"Nameservers": [
{
"Name": "8.8.8.8",
"GlueIps": [],
},
],
"AutoRenew": True,
"AdminContact": {},
"RegistrantContact": {},
"TechContact": {},
"AdminPrivacy": True,
"RegistrantPrivacy": True,
"TechPrivacy": True,
"RegistrarName": "string",
"WhoIsServer": "string",
"RegistrarUrl": "string",
"AbuseContactEmail": "string",
"AbuseContactPhone": "string",
"RegistryDomainId": "string",
"CreationDate": datetime(2015, 1, 1),
"UpdatedDate": datetime(2015, 1, 1),
"ExpirationDate": datetime(2015, 1, 1),
"Reseller": "string",
"DnsSec": "string",
"StatusList": ["clientTransferProhibited"],
}
return make_api_call(self, operation_name, kwarg)
# Patch every AWS call using Boto3 and generate_regional_clients to have 1 client
@patch("botocore.client.BaseClient._make_api_call", new=mock_make_api_call)
class Test_Route53_Service:
# Mocked Audit Info
def set_mocked_audit_info(self):
audit_info = AWS_Audit_Info(
original_session=None,
audit_session=session.Session(
profile_name=None,
botocore_session=None,
),
audited_account=None,
audited_user_id=None,
audited_partition="aws",
audited_identity_arn=None,
profile=None,
profile_region=AWS_REGION,
credentials=None,
assumed_role_info=None,
audited_regions=None,
organizations_metadata=None,
)
return audit_info
# Test Route53Domains Client
def test__get_client__(self):
route53domains = Route53Domains(self.set_mocked_audit_info())
assert route53domains.client.__class__.__name__ == "Route53Domains"
# Test Route53Domains Session
def test__get_session__(self):
route53domains = Route53Domains(self.set_mocked_audit_info())
assert route53domains.session.__class__.__name__ == "Session"
# Test Route53Domains Service
def test__get_service__(self):
route53domains = Route53Domains(self.set_mocked_audit_info())
assert route53domains.service == "route53domains"
def test__list_domains__(self):
route53domains = Route53Domains(self.set_mocked_audit_info())
domain_name = "test.domain.com"
assert len(route53domains.domains)
assert route53domains.domains
assert route53domains.domains[domain_name]
assert route53domains.domains[domain_name].name == domain_name
assert route53domains.domains[domain_name].region == AWS_REGION
assert route53domains.domains[domain_name].admin_privacy
assert route53domains.domains[domain_name].status_list
assert len(route53domains.domains[domain_name].status_list) == 1
assert (
"clientTransferProhibited"
in route53domains.domains[domain_name].status_list
)
| [
"[email protected]"
] | |
4cbbdd29fce7808644cba278f87b92dcc23abb59 | 83e6d9a4a7aa5ced682c6d44e0853264cd7bab58 | /dixon_TIY6.1/dixon_TIY6.11.py | 61d1f358e5de460ff4b75d8a52cf95c9e3ea6d19 | [] | no_license | JaxonDimes/Python | ad3aa8e8f01fe71d9bfc47e4cc6774a9238143c3 | 0fa5dea05e726a3af4374b907178b44db98499ff | refs/heads/master | 2020-12-12T10:10:34.660981 | 2020-01-15T14:48:23 | 2020-01-15T14:48:23 | 234,101,371 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 919 | py | cities = {
'indianapolis' : {
'country': 'United States',
'population': ' 2,028,614',
'fact': 'The Children’s Museum of Indianapolis is the largest children’s museum in the world.'},
'Fort Wayne': {
'country': 'United States',
'population': '419,453',
'fact': 'Fort Wayne is known as "the city of churches." How many churches do we have? 360.'},
'Terre Haute': {
'country': 'United States',
'population': '170,943',
'fact': 'The Crime Rate for this place is 41.38 per 1,000 residents.'
}
}
for city, place in cities.items():
print(city.title())
country = place['country']
population = place['population']
fact = place['fact']
print(f"\t{city.title()} is placed in {country.title()}")
print(f"\t{city.title()}'s population is {population}.")
print(f"\tFun Fact about {city.title()}: {fact.title()}")
| [
"[email protected]"
] | |
5d16aba73f3db549de99b273aa341d6a695cb19b | d4fdbd68c42d6b9babe347cb3b65535e4d782172 | /tensorflow_datasets/image/horses_or_humans.py | a1ece687669b324b1db5a9a5d708b25eb5052d0a | [
"Apache-2.0"
] | permissive | thanhkaist/datasets | 2809260c5e95e96d136059bea042d1ed969a6fcf | 02da35c558ec8ea704e744a2008c5cecb2e7a0a1 | refs/heads/master | 2020-06-04T16:13:14.603449 | 2019-06-14T22:01:33 | 2019-06-14T22:02:54 | 192,097,735 | 2 | 0 | Apache-2.0 | 2019-06-15T16:02:18 | 2019-06-15T16:02:18 | null | UTF-8 | Python | false | false | 3,016 | py | # coding=utf-8
# Copyright 2019 The TensorFlow Datasets Authors.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
"""Horses or Humans dataset.
"""
from __future__ import absolute_import
from __future__ import division
from __future__ import print_function
import re
import tensorflow_datasets.public_api as tfds
_CITATION = """\
@ONLINE {horses_or_humans,
author = "Laurence Moroney",
title = "Horses or Humans Dataset",
month = "feb",
year = "2019",
url = "http://laurencemoroney.com/horses-or-humans-dataset"
}
"""
_TRAIN_URL = "https://storage.googleapis.com/laurencemoroney-blog.appspot.com/horse-or-human.zip"
_TEST_URL = "https://storage.googleapis.com/laurencemoroney-blog.appspot.com/validation-horse-or-human.zip"
_IMAGE_SIZE = 300
_IMAGE_SHAPE = (_IMAGE_SIZE, _IMAGE_SIZE, 3)
_NAME_RE = re.compile(r"^(humans|horses)/[\w-]*\.png$")
class HorsesOrHumans(tfds.core.GeneratorBasedBuilder):
"""Horses or Humans dataset."""
VERSION = tfds.core.Version("1.0.0")
def _info(self):
return tfds.core.DatasetInfo(
builder=self,
description="A large set of images of horses and humans.",
features=tfds.features.FeaturesDict({
"image": tfds.features.Image(shape=_IMAGE_SHAPE),
"label": tfds.features.ClassLabel(
names=["horses", "humans"]),
}),
supervised_keys=("image", "label"),
urls=["http://laurencemoroney.com/horses-or-humans-dataset"],
citation=_CITATION
)
def _split_generators(self, dl_manager):
train_path, test_path = dl_manager.download([_TRAIN_URL, _TEST_URL])
return [
tfds.core.SplitGenerator(
name=tfds.Split.TRAIN,
num_shards=10,
gen_kwargs={
"archive": dl_manager.iter_archive(train_path)
}),
tfds.core.SplitGenerator(
name=tfds.Split.TEST,
num_shards=10,
gen_kwargs={
"archive": dl_manager.iter_archive(test_path)
}),
]
def _generate_examples(self, archive):
"""Generate horses or humans images and labels given the directory path.
Args:
archive: object that iterates over the zip.
Yields:
The image path and its corresponding label.
"""
for fname, fobj in archive:
res = _NAME_RE.match(fname)
if not res: # if anything other than .png; skip
continue
label = res.group(1).lower()
yield {
"image": fobj,
"label": label,
}
| [
"[email protected]"
] | |
75b89fdd96fa2eb6208750c4e7ab2b8b8bbd262c | edfdc0d3a2fdeed95ba7aa3d0e198eb9dafe4064 | /operator_api/auditor/serializers/wallet.py | eaf23012b2e241068d6fe15719acea220a4c5144 | [
"MIT",
"LicenseRef-scancode-warranty-disclaimer"
] | permissive | xiaobai900/nocust-hub | 880e72ba4e1d324ae36adea6c03c9761a7d91621 | 76f49f9b8a6c264fcbe9e0c110e98031d463c0a8 | refs/heads/master | 2023-05-28T08:18:17.402228 | 2020-11-01T19:48:17 | 2020-11-01T19:48:17 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,337 | py | from eth_utils import remove_0x_prefix, add_0x_prefix
from rest_framework import serializers
from ledger.models import Wallet, Token
from operator_api.models import ErrorCode
class WalletSerializer(serializers.Serializer):
address = serializers.CharField(max_length=42)
token = serializers.CharField(max_length=42)
trail_identifier = serializers.IntegerField(read_only=True)
def to_internal_value(self, data):
if not isinstance(data, dict):
raise serializers.ValidationError(
detail='A valid dictionary is required.')
try:
token = Token.objects.get(
address=remove_0x_prefix(data.get('token')))
except Token.DoesNotExist:
raise serializers.ValidationError(
detail='', code=ErrorCode.TOKEN_NOT_REGISTERED)
try:
return Wallet.objects.get(address=remove_0x_prefix(data.get('address')), token=token)
except Wallet.DoesNotExist:
raise serializers.ValidationError(
detail='', code=ErrorCode.WALLET_NOT_ADMITTED)
def to_representation(self, instance):
return {
'address': add_0x_prefix(instance.address),
'token': add_0x_prefix(instance.token.address),
'trail_identifier': instance.trail_identifier
}
| [
"[email protected]"
] | |
e00019a74bd3688664d6e13f72dd4fcf038515a5 | c7770d7631f2930cce80462f9c3ee7e2abe118bb | /src/muses/collection/migrations/0006_auto_20180207_0616.py | 3443f887f88a09654de195714d5967556d14639e | [
"Apache-2.0"
] | permissive | Aincient/cleo | 4f277520a22792aa5b505601849a7ff3a4bd4196 | 933ef372fa7847d943206d72bfb03c201dbafbd6 | refs/heads/master | 2021-06-18T11:01:49.137359 | 2021-01-12T16:34:44 | 2021-01-12T16:34:44 | 150,566,366 | 0 | 3 | NOASSERTION | 2021-01-12T16:34:46 | 2018-09-27T10:00:20 | Python | UTF-8 | Python | false | false | 1,246 | py | # -*- coding: utf-8 -*-
# Generated by Django 1.11.10 on 2018-02-07 12:16
from __future__ import unicode_literals
from django.db import migrations, models
class Migration(migrations.Migration):
dependencies = [
('muses_collection', '0005_auto_20180207_0516'),
]
operations = [
migrations.AddField(
model_name='image',
name='active',
field=models.BooleanField(default=False, verbose_name='Active'),
),
migrations.AlterField(
model_name='image',
name='api_url',
field=models.TextField(unique=True, verbose_name='Image API URL'),
),
migrations.AlterField(
model_name='image',
name='created',
field=models.DateField(auto_now_add=True, verbose_name='Date imported'),
),
migrations.AlterField(
model_name='image',
name='image',
field=models.FileField(blank=True, null=True, upload_to='collection_images', verbose_name='Image'),
),
migrations.AlterField(
model_name='image',
name='updated',
field=models.DateField(auto_now=True, verbose_name='Date updated'),
),
]
| [
"[email protected]"
] | |
cee8909ec6e3cd34f3e68456ae1c5fb5b6e6b11d | ac83d1ddb84ecc904c73bdf779f458bd77efc98c | /test/programytest/test_bot.py | ff08464805034473900f9a5d83fe0d858c3f2b52 | [
"MIT"
] | permissive | secrecy27/chatbot | 77829f32a15e17563f038663aebebdb71e52c5a7 | e65a753cf665a4d6d97b57703431cba5331e4f0b | refs/heads/master | 2022-07-24T08:39:57.788009 | 2020-07-16T03:55:21 | 2020-07-16T03:55:21 | 130,678,143 | 4 | 4 | NOASSERTION | 2022-07-06T19:49:14 | 2018-04-23T10:12:01 | Python | UTF-8 | Python | false | false | 15,079 | py | import unittest
import unittest.mock
import os
from programy.brain import Brain
from programy.bot import DefaultBrainSelector
from programy.bot import BrainFactory
from programy.bot import Bot
from programy.config.bot.bot import BotConfiguration
from programy.config.brain.brain import BrainConfiguration
from programy.config.programy import ProgramyConfiguration
from programy.clients.events.console.config import ConsoleConfiguration
from programy.dialog.dialog import Sentence
from programy.context import ClientContext
from programytest.clients.arguments import MockArgumentParser
from programytest.aiml_tests.client import TestClient
class MockBrain(Brain):
def __init__(self, bot, configuration):
Brain.__init__(self, bot, configuration)
self._response = ""
def ask_question(self, clientid, sentence, srai=False):
return self._response
class MockBot(Bot):
def __init__(self, config: BotConfiguration):
Bot.__init__(self, config)
def loads_brains(self, bot):
self._brains["mock"] = MockBrain(self, self.configuration.configurations[0])
class DefaultBrainSelectorTests(unittest.TestCase):
def test_init(self):
configuration = unittest.mock.Mock()
selector = DefaultBrainSelector(configuration)
self.assertIsNotNone(selector)
brain1 = unittest.mock.Mock()
brain2 = unittest.mock.Mock()
brains = {"one": brain1, "two": brain2}
self.assertEquals(brain1, selector.select_brain(brains))
class BrainFactoryTests(unittest.TestCase):
def test_empty_config_init(self):
configuration = BotConfiguration()
configuration._bot_selector = "programy.clients.client.DefaultBrainSelector"
bot = Bot(configuration)
factory = BrainFactory(bot)
self.assertIsNotNone(factory)
brain = factory.select_brain()
self.assertIsNotNone(brain)
self.assertIsInstance(brain, Brain)
class BotTests(unittest.TestCase):
def setUp(self):
client = TestClient()
self._client_context = client.create_client_context("testid")
def test_bot_init_blank(self):
bot = Bot(BotConfiguration())
self.assertIsNone(bot.spell_checker)
self.assertIsNotNone(bot.brain)
self.assertIsNotNone(bot.conversations)
self.assertIsNotNone(bot.default_response)
self.assertIsNotNone(bot.exit_response)
self.assertIsNotNone(bot.initial_question)
self.assertTrue(bot.override_properties)
self.assertIsNotNone(bot.get_version_string)
def test_bot_init_with_config(self):
bot_config = BotConfiguration()
bot_config._bot_root = BotConfiguration.DEFAULT_ROOT
bot_config._default_response = BotConfiguration.DEFAULT_RESPONSE
bot_config._exit_response = BotConfiguration.DEFAULT_EXIT_RESPONSE
bot_config._initial_question = BotConfiguration.DEFAULT_INITIAL_QUESTION
bot_config._empty_string = BotConfiguration.DEFAULT_EMPTY_STRING
bot_config._override_properties = BotConfiguration.DEFAULT_OVERRIDE_PREDICATES
bot_config._max_question_recursion = 1000
bot_config._max_question_timeout = 60
bot_config._max_search_depth = 100
bot_config._max_search_timeout = 60
bot = Bot(bot_config)
self.assertIsNone(bot.spell_checker)
self.assertIsNotNone(bot.brain)
self.assertIsNotNone(bot.conversations)
self.assertIsNotNone(bot.default_response)
self.assertIsNotNone(bot.exit_response)
self.assertIsNotNone(bot.initial_question)
self.assertTrue(bot.override_properties)
self.assertIsNotNone(bot.get_version_string)
def test_bot_init_no_spellchecker(self):
bot_config = BotConfiguration()
bot_config.spelling._classname = None
bot = Bot(bot_config)
self.assertIsNotNone(bot)
def test_bot_init_with_invalid_spellchecker(self):
bot_config = BotConfiguration()
bot_config.spelling._classname = "programy.spelling.checker.SpellingCheckerX"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
def test_bot_init_with_spellchecker(self):
bot_config = BotConfiguration()
bot_config.spelling._classname = "programy.spelling.norvig.NorvigSpellingChecker"
bot_config.spelling._corpus = os.path.dirname(__file__) + os.sep + "test_corpus.txt"
bot_config.spelling._check_before = True
bot_config.spelling._check_and_retry = True
bot = Bot(bot_config)
self.assertIsNotNone(bot)
test_sentence = Sentence(bot.brain.tokenizer, "locetion")
bot.check_spelling_before(test_sentence)
self.assertIsNotNone(test_sentence)
self.assertEqual("LOCATION", test_sentence.text())
test_sentence = Sentence(bot.brain.tokenizer, "locetion")
response = bot.check_spelling_and_retry(self._client_context, test_sentence)
self.assertIsNone(response)
def test_bot_init_no_license_keys(self):
bot_config = BotConfiguration()
bot_config._license_keys = None
bot = Bot(bot_config)
self.assertIsNotNone(bot)
def test_bot_init_with_license_keys(self):
bot_config = BotConfiguration()
bot_config._license_keys = os.path.dirname(__file__) + os.sep + "test_license.keys"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
def test_bot_init_default_brain(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
self.assertIsNotNone(bot.brain)
def test_bot_init_supplied_brain(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
self.assertIsNotNone(bot.brain)
def test_bot_defaultresponses(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
self.assertEqual(bot.default_response, "")
self.assertEqual(bot.exit_response, "Bye!")
def test_bot_with_config(self):
configuration = ProgramyConfiguration(ConsoleConfiguration())
self.assertIsNotNone(configuration)
self.assertIsNotNone(configuration.client_configuration.configurations[0])
self.assertIsNotNone(configuration.client_configuration.configurations[0].configurations[0])
configuration.client_configuration.configurations[0].prompt = ":"
configuration.client_configuration.configurations[0].default_response = "No answer for that"
configuration.client_configuration.configurations[0].exit_response = "See ya!"
bot = Bot(config=configuration.client_configuration.configurations[0])
self.assertIsNotNone(bot)
self.assertEqual(bot.default_response, "No answer for that")
self.assertEqual(bot.exit_response, "See ya!")
def test_bot_with_conversation(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
self.assertFalse(bot.has_conversation(self._client_context))
response = bot.ask_question(self._client_context, "hello")
self.assertIsNotNone(response)
self.assertTrue(bot.has_conversation(self._client_context))
response = bot.ask_question(self._client_context, "hello")
self.assertIsNotNone(response)
self.assertTrue(bot.has_conversation(self._client_context))
client_context2 = ClientContext(TestClient(), "testid2")
client_context2._bot = bot
client_context2._brain = self._client_context.bot.brain
response = bot.ask_question(client_context2, "hello")
self.assertIsNotNone(response)
self.assertTrue(bot.has_conversation(client_context2))
def test_bot_chat_loop(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
self.assertIsInstance(bot, Bot)
bot.configuration._default_response = "Sorry, I don't have an answer for that right now"
response = bot.ask_question(self._client_context, "hello")
self.assertIsNotNone(response)
self.assertEqual(response, "Sorry, I don't have an answer for that right now")
response = bot.ask_question(self._client_context, "hello again")
self.assertIsNotNone(response)
self.assertEqual(response, "Sorry, I don't have an answer for that right now")
response = bot.ask_question(self._client_context, "goodbye")
self.assertIsNotNone(response)
self.assertEqual(response, "Sorry, I don't have an answer for that right now")
conversation = bot.get_conversation(self._client_context)
self.assertIsNotNone(conversation)
self.assertEqual(conversation.previous_nth_question(2).sentence(0).text(), "hello")
self.assertEqual(conversation.previous_nth_question(2).sentence(0).response, "Sorry, I don't have an answer for that right now")
self.assertEqual(conversation.previous_nth_question(1).sentence(0).text(), "hello again")
self.assertEqual(conversation.previous_nth_question(1).sentence(0).response, "Sorry, I don't have an answer for that right now")
self.assertEqual(conversation.previous_nth_question(0).sentence(0).text(), "goodbye")
self.assertEqual(conversation.previous_nth_question(0).sentence(0).response, "Sorry, I don't have an answer for that right now")
def test_max_recusion(self):
bot = Bot(BotConfiguration())
self.assertIsNotNone(bot)
bot.configuration._default_response = "Sorry, I don't have an answer for that right now"
bot.configuration._max_question_recursion = 0
with self.assertRaises(Exception):
bot.ask_question(self._client_context, "hello")
def test_get_default_response_empty_string(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("", bot.get_default_response(self._client_context))
def test_get_default_response_default_response_only(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.default_response = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_default_response(self._client_context))
def test_get_default_response_default_response_srai_no_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.default_response_srai = "YDEFAULTRESPONSE"
bot_config.default_response = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_default_response(self._client_context))
def test_get_default_response_default_response_srai_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.default_response_srai = "YDEFAULTRESPONSE"
bot_config.default_response = "Default response!"
bot = MockBot(bot_config)
self.assertIsNotNone(bot)
client_context2 = ClientContext(TestClient(), "testid2")
client_context2._bot = bot
client_context2._brain = MockBrain(bot, bot.configuration.configurations[0])
client_context2._brain._response = "Y DEFAULT RESPONSE"
response = bot.get_default_response(client_context2)
self.assertIsNotNone(response)
self.assertEquals("Y DEFAULT RESPONSE", response)
############################
def test_get_initial_question_empty_string(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Hello", bot.get_initial_question(self._client_context))
def test_get_initial_question_initial_question_only(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.initial_question = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_initial_question(self._client_context))
def test_get_initial_question_initial_question_srai_no_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.initial_question_srai = "YDEFAULTRESPONSE"
bot_config.initial_question = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_initial_question(self._client_context))
def test_get_initial_question_initial_question_srai_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot = MockBot(bot_config)
self.assertIsNotNone(bot)
client_context2 = ClientContext(TestClient(), "testid2")
client_context2._bot = bot
client_context2._brain = MockBrain(bot, bot.configuration.configurations[0])
client_context2._brain._response = "Y DEFAULT RESPONSE"
self.assertEquals("Y DEFAULT RESPONSE", bot.get_initial_question(client_context2))
###################
def test_get_exit_response_empty_string(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Bye!", bot.get_exit_response(self._client_context))
def test_get_exit_response_exit_response_only(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.exit_response = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_exit_response(self._client_context))
def test_get_exit_response_exit_response_srai_no_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.exit_response_srai = "YDEFAULTRESPONSE"
bot_config.exit_response = "Default response!"
bot = Bot(bot_config)
self.assertIsNotNone(bot)
self.assertEquals("Default response!", bot.get_exit_response(self._client_context))
def test_get_exit_response_exit_response_srai_match(self):
bot_config = BotConfiguration()
self.assertIsNotNone(bot_config)
bot_config.exit_response_srai = "YDEFAULTRESPONSE"
bot_config.exit_response = "Default response!"
bot = MockBot(bot_config)
self.assertIsNotNone(bot)
client_context2 = ClientContext(TestClient(), "testid2")
client_context2._bot = bot
client_context2._brain = MockBrain(bot, bot.configuration.configurations[0])
client_context2._brain._response = "Y DEFAULT RESPONSE"
self.assertEquals("Y DEFAULT RESPONSE", bot.get_exit_response(client_context2))
| [
"[email protected]"
] | |
bf14ccd8c8be7d9c8499c927482512df16ec0245 | d23dab09b21553353ad85246ebafaea790f2afbd | /src/python/pants/core/util_rules/asdf_test.py | f11f4a993b66fcffcb5fa2d7fbd49e8695986cb4 | [
"Apache-2.0"
] | permissive | asherf/pants | 00e8c64b7831f814bac3c4fa8c342d2237fef17d | c94d9e08f65e9baf3793dff0ec2c571d682f6b90 | refs/heads/master | 2023-05-28T14:45:35.325999 | 2023-01-18T15:16:07 | 2023-01-18T15:16:07 | 185,082,662 | 0 | 0 | Apache-2.0 | 2023-01-18T15:15:46 | 2019-05-05T21:09:43 | Python | UTF-8 | Python | false | false | 6,611 | py | # Copyright 2021 Pants project contributors (see CONTRIBUTORS.md).
# Licensed under the Apache License, Version 2.0 (see LICENSE).
from __future__ import annotations
from contextlib import contextmanager
from pathlib import Path, PurePath
from typing import Iterable, Mapping, Sequence, TypeVar
import pytest
from pants.core.util_rules import asdf
from pants.core.util_rules.asdf import AsdfToolPathsRequest, AsdfToolPathsResult, get_asdf_data_dir
from pants.core.util_rules.environments import (
DockerEnvironmentTarget,
DockerImageField,
EnvironmentTarget,
LocalEnvironmentTarget,
RemoteEnvironmentTarget,
)
from pants.engine.addresses import Address
from pants.engine.env_vars import CompleteEnvironmentVars, EnvironmentVars
from pants.engine.rules import QueryRule
from pants.testutil.rule_runner import RuleRunner
from pants.util.contextutil import temporary_dir
_T = TypeVar("_T")
def materialize_indices(sequence: Sequence[_T], indices: Iterable[int]) -> tuple[_T, ...]:
return tuple(sequence[i] for i in indices)
@contextmanager
def fake_asdf_root(
fake_versions: list[str],
fake_home_versions: list[int],
fake_local_versions: list[int],
*,
tool_name: str,
):
with temporary_dir() as home_dir, temporary_dir() as asdf_dir:
fake_dirs: list[Path] = []
fake_version_dirs: list[str] = []
fake_home_dir = Path(home_dir)
fake_tool_versions = fake_home_dir / ".tool-versions"
fake_home_versions_str = " ".join(materialize_indices(fake_versions, fake_home_versions))
fake_tool_versions.write_text(f"nodejs lts\njava 8\n{tool_name} {fake_home_versions_str}\n")
fake_asdf_dir = Path(asdf_dir)
fake_asdf_plugin_dir = fake_asdf_dir / "plugins" / tool_name
fake_asdf_installs_dir = fake_asdf_dir / "installs" / tool_name
fake_dirs.extend(
[fake_home_dir, fake_asdf_dir, fake_asdf_plugin_dir, fake_asdf_installs_dir]
)
for version in fake_versions:
fake_version_path = fake_asdf_installs_dir / version / "bin"
fake_version_dirs.append(f"{fake_version_path}")
fake_dirs.append(fake_version_path)
for fake_dir in fake_dirs:
fake_dir.mkdir(parents=True, exist_ok=True)
yield (
home_dir,
asdf_dir,
fake_version_dirs,
# fake_home_version_dirs
materialize_indices(fake_version_dirs, fake_home_versions),
# fake_local_version_dirs
materialize_indices(fake_version_dirs, fake_local_versions),
)
def test_get_asdf_dir() -> None:
home = PurePath("♡")
default_root = home / ".asdf"
explicit_root = home / "explicit"
assert explicit_root == get_asdf_data_dir(
EnvironmentVars({"ASDF_DATA_DIR": f"{explicit_root}"})
)
assert default_root == get_asdf_data_dir(EnvironmentVars({"HOME": f"{home}"}))
assert get_asdf_data_dir(EnvironmentVars({})) is None
def get_asdf_paths(
rule_runner: RuleRunner,
env_tgt: EnvironmentTarget,
env: Mapping[str, str],
*,
standard: bool,
local: bool,
) -> AsdfToolPathsResult:
rule_runner.set_session_values(
{
CompleteEnvironmentVars: CompleteEnvironmentVars(env),
}
)
return rule_runner.request(
AsdfToolPathsResult,
[
AsdfToolPathsRequest(
env_tgt=env_tgt,
tool_name="python",
tool_description="<test>",
resolve_standard=standard,
resolve_local=local,
paths_option_name="<test>",
)
],
)
@pytest.mark.parametrize(
("env_tgt_type", "should_have_values"),
(
(LocalEnvironmentTarget, True),
(None, True),
(DockerEnvironmentTarget, False),
(RemoteEnvironmentTarget, False),
),
)
def test_get_asdf_paths(
env_tgt_type: type[LocalEnvironmentTarget]
| type[DockerEnvironmentTarget]
| type[RemoteEnvironmentTarget]
| None,
should_have_values: bool,
) -> None:
# 3.9.4 is intentionally "left out" so that it's only found if the "all installs" fallback is
# used
all_python_versions = ["2.7.14", "3.5.5", "3.7.10", "3.9.4", "3.9.5"]
asdf_home_versions = [0, 1, 2]
asdf_local_versions = [2, 1, 4]
asdf_local_versions_str = " ".join(
materialize_indices(all_python_versions, asdf_local_versions)
)
rule_runner = RuleRunner(
rules=[
*asdf.rules(),
QueryRule(AsdfToolPathsResult, (AsdfToolPathsRequest,)),
]
)
rule_runner.write_files(
{
".tool-versions": "\n".join(
[
"nodejs 16.0.1",
"java current",
f"python {asdf_local_versions_str}",
"rust 1.52.0",
]
)
}
)
with fake_asdf_root(
all_python_versions, asdf_home_versions, asdf_local_versions, tool_name="python"
) as (
home_dir,
asdf_dir,
expected_asdf_paths,
expected_asdf_home_paths,
expected_asdf_local_paths,
):
extra_kwargs: dict = {}
if env_tgt_type is DockerEnvironmentTarget:
extra_kwargs = {
DockerImageField.alias: "my_img",
}
env_tgt = EnvironmentTarget(
env_tgt_type(extra_kwargs, Address("flem")) if env_tgt_type is not None else None
)
# Check the "all installed" fallback
result = get_asdf_paths(
rule_runner, env_tgt, {"ASDF_DATA_DIR": asdf_dir}, standard=True, local=False
)
all_paths = result.standard_tool_paths
result = get_asdf_paths(
rule_runner,
env_tgt,
{"HOME": home_dir, "ASDF_DATA_DIR": asdf_dir},
standard=True,
local=True,
)
home_paths = result.standard_tool_paths
local_paths = result.local_tool_paths
if should_have_values:
# The order the filesystem returns the "installed" folders is arbitrary
assert set(expected_asdf_paths) == set(all_paths)
# These have a fixed order defined by the `.tool-versions` file
assert expected_asdf_home_paths == home_paths
assert expected_asdf_local_paths == local_paths
else:
# asdf bails quickly on non-local environments
assert () == all_paths
assert () == home_paths
assert () == local_paths
| [
"[email protected]"
] | |
252d08db541ea7b978cda04b6a453f3f175f932e | fb5c5d50d87a6861393d31911b9fae39bdc3cc62 | /Scripts/sims4communitylib/enums/relationship_bit_collections_enum.py | d8546691caa00683e94d009a6b38e0155c43d651 | [
"CC-BY-4.0"
] | permissive | ColonolNutty/Sims4CommunityLibrary | ee26126375f2f59e5567b72f6eb4fe9737a61df3 | 58e7beb30b9c818b294d35abd2436a0192cd3e82 | refs/heads/master | 2023-08-31T06:04:09.223005 | 2023-08-22T19:57:42 | 2023-08-22T19:57:42 | 205,197,959 | 183 | 38 | null | 2023-05-28T16:17:53 | 2019-08-29T15:48:35 | Python | UTF-8 | Python | false | false | 1,917 | py | """
The Sims 4 Community Library is licensed under the Creative Commons Attribution 4.0 International public license (CC BY 4.0).
https://creativecommons.org/licenses/by/4.0/
https://creativecommons.org/licenses/by/4.0/legalcode
Copyright (c) COLONOLNUTTY
"""
from sims4communitylib.enums.enumtypes.common_int import CommonInt
class CommonRelationshipBitCollectionId(CommonInt):
"""Identifiers for vanilla relationship bit collections."""
INVALID: 'CommonRelationshipBitCollectionId' = 0
CHILD: 'CommonRelationshipBitCollectionId' = 195565
FAMILY: 'CommonRelationshipBitCollectionId' = 15806
FAMILY_ACQUIRED_NEGATIVE: 'CommonRelationshipBitCollectionId' = 162462
FAMILY_ACQUIRED_NEUTRAL: 'CommonRelationshipBitCollectionId' = 164649
FAMILY_ACQUIRED_POSITIVE: 'CommonRelationshipBitCollectionId' = 164128
FRIEND: 'CommonRelationshipBitCollectionId' = 15807
FRIEND_AT_LEAST_FRIEND: 'CommonRelationshipBitCollectionId' = 273773
ROMANTIC: 'CommonRelationshipBitCollectionId' = 240628
ROMANTIC_HAVE_BEEN_EXES: 'CommonRelationshipBitCollectionId' = 274292
SENTIMENT_ADORING: 'CommonRelationshipBitCollectionId' = 246492
SENTIMENT_BITTER: 'CommonRelationshipBitCollectionId' = 240104
SENTIMENT_CLOSE: 'CommonRelationshipBitCollectionId' = 240103
SENTIMENT_ENAMORED: 'CommonRelationshipBitCollectionId' = 240107
SENTIMENT_FURIOUS: 'CommonRelationshipBitCollectionId' = 240105
SENTIMENT_GUILTY: 'CommonRelationshipBitCollectionId' = 246491
SENTIMENT_HURT: 'CommonRelationshipBitCollectionId' = 246490
SENTIMENT_LONG_TERM: 'CommonRelationshipBitCollectionId' = 240114
SENTIMENT_MOTIVATING: 'CommonRelationshipBitCollectionId' = 252843
SENTIMENT_NEGATIVE: 'CommonRelationshipBitCollectionId' = 240110
SENTIMENT_POSITIVE: 'CommonRelationshipBitCollectionId' = 240109
SENTIMENT_SHORT_TERM: 'CommonRelationshipBitCollectionId' = 240113
| [
"[email protected]"
] | |
0d093c3ca016d6d2803a429a4bd995ada08b48ac | f576f0ea3725d54bd2551883901b25b863fe6688 | /sdk/automation/azure-mgmt-automation/azure/mgmt/automation/aio/operations/_fields_operations.py | bf24b786c68ed2d5f9cba471c8f73ce85a80e483 | [
"LicenseRef-scancode-generic-cla",
"MIT",
"LGPL-2.1-or-later"
] | permissive | Azure/azure-sdk-for-python | 02e3838e53a33d8ba27e9bcc22bd84e790e4ca7c | c2ca191e736bb06bfbbbc9493e8325763ba990bb | refs/heads/main | 2023-09-06T09:30:13.135012 | 2023-09-06T01:08:06 | 2023-09-06T01:08:06 | 4,127,088 | 4,046 | 2,755 | MIT | 2023-09-14T21:48:49 | 2012-04-24T16:46:12 | Python | UTF-8 | Python | false | false | 6,384 | py | # pylint: disable=too-many-lines
# coding=utf-8
# --------------------------------------------------------------------------
# Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT License. See License.txt in the project root for license information.
# Code generated by Microsoft (R) AutoRest Code Generator.
# Changes may cause incorrect behavior and will be lost if the code is regenerated.
# --------------------------------------------------------------------------
import sys
from typing import Any, AsyncIterable, Callable, Dict, Optional, TypeVar
from azure.core.async_paging import AsyncItemPaged, AsyncList
from azure.core.exceptions import (
ClientAuthenticationError,
HttpResponseError,
ResourceExistsError,
ResourceNotFoundError,
ResourceNotModifiedError,
map_error,
)
from azure.core.pipeline import PipelineResponse
from azure.core.pipeline.transport import AsyncHttpResponse
from azure.core.rest import HttpRequest
from azure.core.tracing.decorator import distributed_trace
from azure.core.utils import case_insensitive_dict
from azure.mgmt.core.exceptions import ARMErrorFormat
from ... import models as _models
from ..._vendor import _convert_request
from ...operations._fields_operations import build_list_by_type_request
from .._vendor import AutomationClientMixinABC
if sys.version_info >= (3, 8):
from typing import Literal # pylint: disable=no-name-in-module, ungrouped-imports
else:
from typing_extensions import Literal # type: ignore # pylint: disable=ungrouped-imports
T = TypeVar("T")
ClsType = Optional[Callable[[PipelineResponse[HttpRequest, AsyncHttpResponse], T, Dict[str, Any]], Any]]
class FieldsOperations:
"""
.. warning::
**DO NOT** instantiate this class directly.
Instead, you should access the following operations through
:class:`~azure.mgmt.automation.aio.AutomationClient`'s
:attr:`fields` attribute.
"""
models = _models
def __init__(self, *args, **kwargs) -> None:
input_args = list(args)
self._client = input_args.pop(0) if input_args else kwargs.pop("client")
self._config = input_args.pop(0) if input_args else kwargs.pop("config")
self._serialize = input_args.pop(0) if input_args else kwargs.pop("serializer")
self._deserialize = input_args.pop(0) if input_args else kwargs.pop("deserializer")
@distributed_trace
def list_by_type(
self, resource_group_name: str, automation_account_name: str, module_name: str, type_name: str, **kwargs: Any
) -> AsyncIterable["_models.TypeField"]:
"""Retrieve a list of fields of a given type identified by module name.
:param resource_group_name: Name of an Azure Resource group. Required.
:type resource_group_name: str
:param automation_account_name: The name of the automation account. Required.
:type automation_account_name: str
:param module_name: The name of module. Required.
:type module_name: str
:param type_name: The name of type. Required.
:type type_name: str
:keyword callable cls: A custom type or function that will be passed the direct response
:return: An iterator like instance of either TypeField or the result of cls(response)
:rtype: ~azure.core.async_paging.AsyncItemPaged[~azure.mgmt.automation.models.TypeField]
:raises ~azure.core.exceptions.HttpResponseError:
"""
_headers = kwargs.pop("headers", {}) or {}
_params = case_insensitive_dict(kwargs.pop("params", {}) or {})
api_version: Literal["2022-08-08"] = kwargs.pop("api_version", _params.pop("api-version", "2022-08-08"))
cls: ClsType[_models.TypeFieldListResult] = kwargs.pop("cls", None)
error_map = {
401: ClientAuthenticationError,
404: ResourceNotFoundError,
409: ResourceExistsError,
304: ResourceNotModifiedError,
}
error_map.update(kwargs.pop("error_map", {}) or {})
def prepare_request(next_link=None):
if not next_link:
request = build_list_by_type_request(
resource_group_name=resource_group_name,
automation_account_name=automation_account_name,
module_name=module_name,
type_name=type_name,
subscription_id=self._config.subscription_id,
api_version=api_version,
template_url=self.list_by_type.metadata["url"],
headers=_headers,
params=_params,
)
request = _convert_request(request)
request.url = self._client.format_url(request.url)
else:
request = HttpRequest("GET", next_link)
request = _convert_request(request)
request.url = self._client.format_url(request.url)
request.method = "GET"
return request
async def extract_data(pipeline_response):
deserialized = self._deserialize("TypeFieldListResult", pipeline_response)
list_of_elem = deserialized.value
if cls:
list_of_elem = cls(list_of_elem) # type: ignore
return None, AsyncList(list_of_elem)
async def get_next(next_link=None):
request = prepare_request(next_link)
pipeline_response: PipelineResponse = await self._client._pipeline.run( # pylint: disable=protected-access
request, stream=False, **kwargs
)
response = pipeline_response.http_response
if response.status_code not in [200]:
map_error(status_code=response.status_code, response=response, error_map=error_map)
error = self._deserialize.failsafe_deserialize(_models.ErrorResponse, pipeline_response)
raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat)
return pipeline_response
return AsyncItemPaged(get_next, extract_data)
list_by_type.metadata = {
"url": "/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Automation/automationAccounts/{automationAccountName}/modules/{moduleName}/types/{typeName}/fields"
}
| [
"[email protected]"
] | |
869dcff017fa2a44d1aecccde2ac567af4cf6ac9 | 3d9063912b3b7760005ccaf27524b1dfe998e311 | /ltp/utils/convertor.py | 7587edf06c4f929b313d022519862b887859e101 | [] | no_license | little-bigtiger/ltp | 9ca7046771752a40a57e8f49ed78074d83dd7479 | 058c374fc31a63724320f6a13d26dd897b28b220 | refs/heads/master | 2023-05-30T07:03:51.472276 | 2021-06-21T02:13:20 | 2021-06-21T02:13:20 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,287 | py | #! /usr/bin/env python
# -*- coding: utf-8 -*_
# Author: Yunlong Feng <[email protected]>
import torch
from torch._six import container_abcs
def map2device(batch, device=torch.device('cpu')):
batch_type = type(batch)
if isinstance(batch, torch.Tensor):
return batch.to(device)
elif isinstance(batch, container_abcs.Mapping):
return {key: map2device(batch[key], device=device) for key in batch}
elif isinstance(batch, tuple) and hasattr(batch, '_fields'): # namedtuple
return batch_type(*(map2device(samples, device=device) for samples in zip(*batch)))
elif isinstance(batch, container_abcs.Sequence):
return [map2device(it, device=device) for it in batch]
else:
return batch
def convert2npy(batch):
batch_type = type(batch)
if isinstance(batch, torch.Tensor):
return map2device(batch).numpy()
elif isinstance(batch, container_abcs.Mapping):
return {key: convert2npy(batch[key]) for key in batch}
elif isinstance(batch, tuple) and hasattr(batch, '_fields'): # namedtuple
return batch_type(*(convert2npy(samples) for samples in zip(*batch)))
elif isinstance(batch, container_abcs.Sequence):
return [convert2npy(it) for it in batch]
else:
return batch
| [
"[email protected]"
] | |
4234dc2895d7126760d5a72ef991a59628694535 | 463c053bcf3f4a7337b634890720ea9467f14c87 | /release/ray_release/command_runner/_wait_cluster.py | f7008828947614612adcc8a46a632853493925e1 | [
"BSD-3-Clause",
"MIT",
"Apache-2.0"
] | permissive | pdames/ray | e8faddc4440976211a6bcead8f8b6e62c1dcda01 | 918d3601c6519d333f10910dc75eb549cbb82afa | refs/heads/master | 2023-01-23T06:11:11.723212 | 2022-05-06T22:55:59 | 2022-05-06T22:55:59 | 245,515,407 | 1 | 1 | Apache-2.0 | 2023-01-14T08:02:21 | 2020-03-06T20:59:04 | Python | UTF-8 | Python | false | false | 1,259 | py | import argparse
import time
import ray
ray.init(address="auto")
parser = argparse.ArgumentParser()
parser.add_argument(
"num_nodes", type=int, help="Wait for this number of nodes (includes head)"
)
parser.add_argument("max_time_s", type=int, help="Wait for this number of seconds")
parser.add_argument(
"--feedback_interval_s",
type=int,
default=10,
help="Wait for this number of seconds",
)
args = parser.parse_args()
curr_nodes = 0
start = time.time()
next_feedback = start
max_time = start + args.max_time_s
while not curr_nodes >= args.num_nodes:
now = time.time()
if now >= max_time:
raise RuntimeError(
f"Maximum wait time reached, but only "
f"{curr_nodes}/{args.num_nodes} nodes came up. Aborting."
)
if now >= next_feedback:
passed = now - start
print(
f"Waiting for more nodes to come up: "
f"{curr_nodes}/{args.num_nodes} "
f"({passed:.0f} seconds passed)"
)
next_feedback = now + args.feedback_interval_s
time.sleep(5)
curr_nodes = len(ray.nodes())
passed = time.time() - start
print(
f"Cluster is up: {curr_nodes}/{args.num_nodes} nodes online after "
f"{passed:.0f} seconds"
)
| [
"[email protected]"
] | |
51b5cc22c33340c76b5ef0e285b2c525496e9af8 | de24f83a5e3768a2638ebcf13cbe717e75740168 | /moodledata/vpl_data/40/usersdata/62/25332/submittedfiles/main.py | 13737f40f1a9c141d8c52153a57e1b9fe8ac9897 | [] | no_license | rafaelperazzo/programacao-web | 95643423a35c44613b0f64bed05bd34780fe2436 | 170dd5440afb9ee68a973f3de13a99aa4c735d79 | refs/heads/master | 2021-01-12T14:06:25.773146 | 2017-12-22T16:05:45 | 2017-12-22T16:05:45 | 69,566,344 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,256 | py | # -*- coding: utf-8 -*-
from __future__ import division
import funcoes
#COMECE AQUI
def calcula_valor_absoluto(x):
if x<0:
x=x*(-1)
else:
x=x
return x
def calcula_pi(m):
i=1
soma=0
denominador=2
if 1<=m<=2000:
while i<=m:
if i%2!=0:
soma=soma+(4/(denominador*(denominador+1)*(denominador+2)))
else:
soma=soma-(4/(denominador*(denominador+1)*(denominador+2)))
i=i+1
denominador=denominador+2
pi=3+soma
return pi
def fat(n):
i=1
fat=1
while i<=n:
fat=fat*i
i=i+1
def calcula_co_seno(z, epsilon):
soma=0
exp=2
t=((z**exp)/fat(exp))
i=1
while t>epsilon:
t=((z**exp)/fat(exp))
if i%2!=0:
soma=soma-t
else:
soma=soma+t
exp=exp+2
i=i+1
coseno=soma+1
return coseno
def razao_Aurea(m,epsilon):
pi=calcula_pi(m)/5
razao_Aurea=2*calcula_co_seno(pi, epsilon)
return razao_Aurea
m=input('Digite o valor de m: ')
epsilon=input('Digite o valor de epsilon: ')
razao=razao_Aurea(m,epsilon)
print ('%.15f'%calcula_pi(m))
print ('%.15f'%razao) | [
"[email protected]"
] | |
3b03072ec7ed26a376ab97669dac40c77589f552 | f99341a3a043137ba2c24c06b80ff30073cf028e | /config/env_constructor.py | 1eccb22fc91fee860e4cb13babbf3617e41bcfac | [] | no_license | szrlee/ucbmq_code | 30ed4c7645800824a2db47647b2a17289b10bc88 | d7e84b1c64e3be2bd7c52057d1ff6d91ee0779cf | refs/heads/main | 2023-05-09T00:18:02.900944 | 2021-06-05T18:33:11 | 2021-06-05T18:33:11 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 206 | py | from rlberry.envs.finite import GridWorld
def constructor(nrows, ncols, success_probability):
env = GridWorld(nrows=nrows, ncols=ncols, walls=(), success_probability=success_probability)
return env | [
"[email protected]"
] | |
85d8cfdd2bdbd846ff6b5a02cc95ebf9d5be6042 | 30816710f64515d9af98b19da522ecdd2a745258 | /yeyun/rcnn/rpn.py | 9d4678547716a31c75af19b4884ce080a31fdf04 | [] | no_license | unsky/Feature-Pyramid-Networks | 457a441a500b1b552b5a89c11384e96f8cf60dd5 | 890e9c74a8fcea20bd33b90bac6c58e42294298d | refs/heads/master | 2021-06-26T00:59:50.874246 | 2017-09-06T02:57:19 | 2017-09-06T02:57:19 | 101,043,340 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 9,328 | py | """
RPN:
data =
{'data': [num_images, c, h, w],
'im_info': [num_images, 4] (optional)}
label =
{'gt_boxes': [num_boxes, 5] (optional),
'label': [batch_size, 1] <- [batch_size, num_anchors, feat_height, feat_width],
'bbox_target': [batch_size, num_anchors, feat_height, feat_width],
'bbox_weight': [batch_size, num_anchors, feat_height, feat_width]}
"""
from __future__ import print_function
import numpy as np
import numpy.random as npr
from experiments.person_detection.config import config
from common.processing.image import get_image, tensor_vstack
from common.processing.generate_anchor import generate_anchors
from common.processing.bbox_transform import bbox_overlaps, bbox_transform
def get_rpn_testbatch(roidb):
"""
return a dict of testbatch
:param roidb: ['image', 'flipped']
:return: data, label, im_info
"""
assert len(roidb) == 1, 'Single batch only'
imgs, roidb = get_image(roidb)
im_array = imgs[0]
im_info = np.array([roidb[0]['im_info']], dtype=np.float32)
data = {'data': im_array,
'im_info': im_info}
label = {}
return data, label, im_info
def get_rpn_batch(roidb):
"""
prototype for rpn batch: data, im_info, gt_boxes
:param roidb: ['image', 'flipped'] + ['gt_boxes', 'boxes', 'gt_classes']
:return: data, label
"""
assert len(roidb) == 1, 'Single batch only'
imgs, roidb = get_image(roidb)
im_array = imgs[0]
im_info = np.array([roidb[0]['im_info']], dtype=np.float32)
# gt boxes: (x1, y1, x2, y2, cls)
if roidb[0]['gt_classes'].size > 0:
gt_inds = np.where(roidb[0]['gt_classes'] != 0)[0]
gt_boxes = np.empty((roidb[0]['boxes'].shape[0], 5), dtype=np.float32)
gt_boxes[:, 0:4] = roidb[0]['boxes'][gt_inds, :]
gt_boxes[:, 4] = roidb[0]['gt_classes'][gt_inds]
else:
gt_boxes = np.empty((0, 5), dtype=np.float32)
data = {'data': im_array,
'im_info': im_info}
label = {'gt_boxes': gt_boxes}
return data, label
def assign_anchor(feat_shape, gt_boxes, im_info, feat_stride=16,
scales=(8, 16, 32), ratios=(0.5, 1, 2), allowed_border=0):
"""
assign ground truth boxes to anchor positions
:param feat_shape: infer output shape
:param gt_boxes: assign ground truth
:param im_info: filter out anchors overlapped with edges
:param feat_stride: anchor position step
:param scales: used to generate anchors, affects num_anchors (per location)
:param ratios: aspect ratios of generated anchors
:param allowed_border: filter out anchors with edge overlap > allowed_border
:return: dict of label
'label': of shape (batch_size, 1) <- (batch_size, num_anchors, feat_height, feat_width)
'bbox_target': of shape (batch_size, num_anchors * 4, feat_height, feat_width)
'bbox_inside_weight': *todo* mark the assigned anchors
'bbox_outside_weight': used to normalize the bbox_loss, all weights sums to RPN_POSITIVE_WEIGHT
"""
def _unmap(data, count, inds, fill=0):
"""" unmap a subset inds of data into original data of size count """
if len(data.shape) == 1:
ret = np.empty((count,), dtype=np.float32)
ret.fill(fill)
ret[inds] = data
else:
ret = np.empty((count,) + data.shape[1:], dtype=np.float32)
ret.fill(fill)
ret[inds, :] = data
return ret
DEBUG = False
im_info = im_info[0]
scales = np.array(scales, dtype=np.float32)
base_anchors = generate_anchors(base_size=feat_stride, ratios=list(ratios), scales=scales)
num_anchors = base_anchors.shape[0]
feat_height, feat_width = feat_shape[-2:]
if DEBUG:
print('anchors:')
print(base_anchors)
print('anchor shapes:')
print(np.hstack((base_anchors[:, 2::4] - base_anchors[:, 0::4],
base_anchors[:, 3::4] - base_anchors[:, 1::4])))
print('im_info', im_info)
print('height', feat_height, 'width', feat_width)
print('gt_boxes shape', gt_boxes.shape)
print('gt_boxes', gt_boxes)
# 1. generate proposals from bbox deltas and shifted anchors
shift_x = np.arange(0, feat_width) * feat_stride
shift_y = np.arange(0, feat_height) * feat_stride
shift_x, shift_y = np.meshgrid(shift_x, shift_y)
shifts = np.vstack((shift_x.ravel(), shift_y.ravel(), shift_x.ravel(), shift_y.ravel())).transpose()
# add A anchors (1, A, 4) to
# cell K shifts (K, 1, 4) to get
# shift anchors (K, A, 4)
# reshape to (K*A, 4) shifted anchors
A = num_anchors
K = shifts.shape[0]
all_anchors = base_anchors.reshape((1, A, 4)) + shifts.reshape((1, K, 4)).transpose((1, 0, 2))
all_anchors = all_anchors.reshape((K * A, 4))
total_anchors = int(K * A)
# only keep anchors inside the image
inds_inside = np.where((all_anchors[:, 0] >= -allowed_border) &
(all_anchors[:, 1] >= -allowed_border) &
(all_anchors[:, 2] < im_info[1] + allowed_border) &
(all_anchors[:, 3] < im_info[0] + allowed_border))[0]
if DEBUG:
print('total_anchors', total_anchors)
print('inds_inside', len(inds_inside))
# keep only inside anchors
anchors = all_anchors[inds_inside, :]
if DEBUG:
print('anchors shape', anchors.shape)
# label: 1 is positive, 0 is negative, -1 is dont care
labels = np.empty((len(inds_inside),), dtype=np.float32)
labels.fill(-1)
if gt_boxes.size > 0:
# overlap between the anchors and the gt boxes
# overlaps (ex, gt)
overlaps = bbox_overlaps(anchors.astype(np.float), gt_boxes.astype(np.float))
argmax_overlaps = overlaps.argmax(axis=1)
max_overlaps = overlaps[np.arange(len(inds_inside)), argmax_overlaps]
gt_argmax_overlaps = overlaps.argmax(axis=0)
gt_max_overlaps = overlaps[gt_argmax_overlaps, np.arange(overlaps.shape[1])]
gt_argmax_overlaps = np.where(overlaps == gt_max_overlaps)[0]
if not config.TRAIN.RPN_CLOBBER_POSITIVES:
# assign bg labels first so that positive labels can clobber them
labels[max_overlaps < config.TRAIN.RPN_NEGATIVE_OVERLAP] = 0
# fg label: for each gt, anchor with highest overlap
labels[gt_argmax_overlaps] = 1
# fg label: above threshold IoU
labels[max_overlaps >= config.TRAIN.RPN_POSITIVE_OVERLAP] = 1
if config.TRAIN.RPN_CLOBBER_POSITIVES:
# assign bg labels last so that negative labels can clobber positives
labels[max_overlaps < config.TRAIN.RPN_NEGATIVE_OVERLAP] = 0
else:
labels[:] = 0
# subsample positive labels if we have too many
num_fg = int(config.TRAIN.RPN_FG_FRACTION * config.TRAIN.RPN_BATCH_SIZE)
fg_inds = np.where(labels == 1)[0]
if len(fg_inds) > num_fg:
disable_inds = npr.choice(fg_inds, size=(len(fg_inds) - num_fg), replace=False)
if DEBUG:
disable_inds = fg_inds[:(len(fg_inds) - num_fg)]
labels[disable_inds] = -1
# subsample negative labels if we have too many
num_bg = config.TRAIN.RPN_BATCH_SIZE - np.sum(labels == 1)
bg_inds = np.where(labels == 0)[0]
if len(bg_inds) > num_bg:
disable_inds = npr.choice(bg_inds, size=(len(bg_inds) - num_bg), replace=False)
if DEBUG:
disable_inds = bg_inds[:(len(bg_inds) - num_bg)]
labels[disable_inds] = -1
bbox_targets = np.zeros((len(inds_inside), 4), dtype=np.float32)
if gt_boxes.size > 0:
bbox_targets[:] = bbox_transform(anchors, gt_boxes[argmax_overlaps, :4])
bbox_weights = np.zeros((len(inds_inside), 4), dtype=np.float32)
bbox_weights[labels == 1, :] = np.array(config.TRAIN.RPN_BBOX_WEIGHTS)
if DEBUG:
_sums = bbox_targets[labels == 1, :].sum(axis=0)
_squared_sums = (bbox_targets[labels == 1, :] ** 2).sum(axis=0)
_counts = np.sum(labels == 1)
means = _sums / (_counts + 1e-14)
stds = np.sqrt(_squared_sums / _counts - means ** 2)
print('means', means)
print('stdevs', stds)
# map up to original set of anchors
labels = _unmap(labels, total_anchors, inds_inside, fill=-1)
bbox_targets = _unmap(bbox_targets, total_anchors, inds_inside, fill=0)
bbox_weights = _unmap(bbox_weights, total_anchors, inds_inside, fill=0)
if DEBUG:
print('rpn: max max_overlaps', np.max(max_overlaps))
print('rpn: num_positives', np.sum(labels == 1))
print('rpn: num_negatives', np.sum(labels == 0))
_fg_sum = np.sum(labels == 1)
_bg_sum = np.sum(labels == 0)
_count = 1
print('rpn: num_positive avg', _fg_sum / _count)
print('rpn: num_negative avg', _bg_sum / _count)
labels = labels.reshape((1, feat_height, feat_width, A)).transpose(0, 3, 1, 2)
labels = labels.reshape((1, A * feat_height * feat_width))
bbox_targets = bbox_targets.reshape((1, feat_height, feat_width, A * 4)).transpose(0, 3, 1, 2)
bbox_weights = bbox_weights.reshape((1, feat_height, feat_width, A * 4)).transpose((0, 3, 1, 2))
label = {'label': labels,
'bbox_target': bbox_targets,
'bbox_weight': bbox_weights}
return label
| [
"[email protected]"
] | |
05d6ff8c6fbea905e0072c34bcac275e68cc1197 | ac4b9385b7ad2063ea51237fbd8d1b74baffd016 | /.history/s1_3_getHtml_20210209165850.py | 576f3f18bbd11d0765890ce07bf6aa32fbf8af7b | [] | no_license | preethanpa/ssoemprep | 76297ef21b1d4893f1ac2f307f60ec72fc3e7c6f | ce37127845253c768d01aeae85e5d0d1ade64516 | refs/heads/main | 2023-03-09T00:15:55.130818 | 2021-02-20T06:54:58 | 2021-02-20T06:54:58 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,514 | py | # This module is called from 3R Automation Component.
import os
import sys
# pdftotree is available as part of the virtual environment for 3R Python processing
import pdftotree
import json
from pprint import pprint
import pdfminer
import matplotlib.pyplot as plt
import ocr_extract as imgpdf
from utils.ocr.handle_image import *
# pdf_doc = json.loads(sys.argv[1])['doc_name']
pdf_doc = '/home/dsie/Developer/sandbox/3ray/3rml/kbc_process/documents/images/PAN_Card_Scan_AKC.png'
# html_path = json.loads(sys.argv[1])['html_path']
html_path = '/home/dsie/Developer/sandbox/3ray/3rml/kbc_process/documents/html/'+os.path.basename(pdf_doc).split('.')[0] + '.html'
print(f'HTML Path is set to {html_path}')
path_if_not_pdf_doc = ''
pdf_doc_path = '/home/dsie/Developer/sandbox/3ray/3rml/kbc_process/documents/pdf'
# Use the following for testing
# pdf_doc = '/home/dsie/Developer/sandbox/3ray/3rml/kbc_process/documents/pdf/Sri_khyati_CV.pdf'
# html_path = '/home/dsie/Developer/sandbox/3ray/3rml/kbc_process/documents/html/Sri_khyati_CV.html'
def create_hocr(pdf_doc='', html_path='', model_path='./model/model.pkl'):
return pdftotree.parse(pdf_doc, html_path=html_path, model_type=None, model_path=model_path, visualize=False)
create_hocr_output = None
try:
create_hocr_output = create_hocr(pdf_doc=pdf_doc, html_path=html_path)
except pdfminer.pdfparser.PDFSyntaxError as pdfException:
print(f'')
create_hocr_output = pdfException
path_if_not_pdf_doc = pdf_doc
try:
# pdf_doc = extract_pdf_from_image(pdf_doc, pdf_path=pdf_doc_path, action=1, psm=11)
image, line_items_coordinates = mark_region(path_if_not_pdf_doc)
# load the original image
image = cv2.imread(path_if_not_pdf_doc)
# get co-ordinates to crop the image
c = line_items_coordinates[1]
# cropping image img = image[y0:y1, x0:x1]
img = image[c[0][1]:c[1][1], c[0][0]:c[1][0]]
plt.figure(figsize=(10,10))
plt.imshow(img)
# convert the image to black and white for better OCR
ret,thresh1 = cv2.threshold(img,120,255,cv2.THRESH_BINARY)
# pytesseract image to string to get results
text = str(pytesseract.image_to_string(thresh1, config='--psm 6'))
print(text)
convert_text_to_pdf(text, pdf_doc_path, os.path.basename(pdf_doc).split('.')[0])
create_hocr_output = create_hocr(pdf_doc=pdf_doc, html_path=html_path)
except Exception as exc:
create_hocr_output = Exception
print(f'Exception 2 {exc}')
# extract_pdf_from_image(pdf_doc, pdf_path=pdf_doc_path, action=2, psm=6)
# Use the following for testing non PDF files
# print(f'{os.path.basename(pdf_doc).split(".")[0]+".pdf"}')
# print(f'{os.path.abspath(pdf_doc).split(".")[0]+".pdf"}')
# try:
# # imgpdf.convert_image_to_pdf(pdf_doc, os.path(pdf_doc)+os.path.basename(pdf_doc).split('.')[0]+'.pdf')
# imgpdf.convert_image_to_pdf(pdf_doc, os.path.dirname(pdf_doc), os.path.abspath(pdf_doc).split(".")[0]+".pdf")
# except Exception as exc:
# print(exc)
# Output of "print" statement is passed to the calling program
proc_status = "OK" if create_hocr_output == None else "Not a PDF document or unable to process image at path "+path_if_not_pdf_doc
json_out = {"pdf_doc": pdf_doc, "process_status": proc_status}
json_out = {"message": "We are testing/making some changes to this API, please try after in about 30 mins. Sorry for the inconvenience."}
print(json_out) | [
"{[email protected]}"
] | |
db7d2017f3fe4d376d26481829e2492ca16c57c1 | ca7aa979e7059467e158830b76673f5b77a0f5a3 | /Python_codes/p02393/s585346290.py | 8e0858a11d775723f75f99c894ac1365db950d68 | [] | no_license | Aasthaengg/IBMdataset | 7abb6cbcc4fb03ef5ca68ac64ba460c4a64f8901 | f33f1c5c3b16d0ea8d1f5a7d479ad288bb3f48d8 | refs/heads/main | 2023-04-22T10:22:44.763102 | 2021-05-13T17:27:22 | 2021-05-13T17:27:22 | 367,112,348 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 51 | py | a = input().split()
a.sort()
print(a[0],a[1],a[2])
| [
"[email protected]"
] | |
c1e656fc6fc8fdf41ad315d269930268dabe63c0 | c117f7064b7132778bead5a8b77b67e2429a2b7a | /gmail.py | 9832cf9a0595ba497995e39e74e170770e6e4ad1 | [] | no_license | gurudurairaj/gp | 664306f41f73f8b620ba74b048372e1c94e59bc7 | 2fce98f7428103b54b9edd075d4a83dc434c2926 | refs/heads/master | 2020-04-15T05:00:45.934019 | 2019-05-26T17:54:54 | 2019-05-26T17:54:54 | 164,405,807 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 480 | py | a=input()
c=0
if a.count("@")==1 and a.count(".")==1 and a[len(a)-4:len(a)]==".com":
s=""
for i in range(len(a)):
if a[i]=="@":
break
s=s+a[i]
if len(s)>=3:
c=c+1
s=""
v=a.index("@")
for i in range(v+1,len(a)):
if a[i]==".":
break
s=s+a[i]
if len(s)==5 and s=="gmail":
c=c+1
if c==2:
print("YES")
else:
print("NO")
else:
print("NO")
| [
"[email protected]"
] | |
e39d2e29afaf499c1d468a3292e396993aae8ec7 | 04ad466db13a382cc679d9562e515d57b54c47e6 | /scripts/schools8_eb.py | 149fb0ad7602a286b481eed890c6b06c67581f68 | [
"MIT"
] | permissive | shivaditya-meduri/pyprobml | d9423463ae7b352c52f3d005fbf33ee66d366971 | 9dbe0c95f4ec061b98bf32fa3ac1deafe2e0c04d | refs/heads/master | 2023-04-12T13:09:45.572071 | 2021-05-07T18:22:02 | 2021-05-07T18:22:02 | 356,659,290 | 1 | 0 | MIT | 2021-04-11T05:04:38 | 2021-04-10T18:07:31 | null | UTF-8 | Python | false | false | 458 | py | # Empirical Bayes for 8 schools
import numpy as np
# Data of the Eight Schools Model
J = 8
y = np.array([28., 8., -3., 7., -1., 1., 18., 12.])
sigma = np.array([15., 10., 16., 11., 9., 11., 10., 18.])
d = len(y);
mu = np.mean(y); # MLE-II
V = np.sum(np.square(y-mu));
s2 = V/d;
sigma2 = np.mean(np.square(sigma))
tau2 = np.maximum(0, s2-sigma2); # approx
lam = sigma2/(sigma2 + tau2);
print(lam)
muShrunk = mu + (1-lam)*(y-mu);
print(muShrunk) | [
"[email protected]"
] | |
ca743993675615421f0c5d02f0357b0ba36b9559 | f3acd48e0d553143e941b16b5241cb86272a87f4 | /Laboratorium/_04_klasy/Zwierzeta.py | 1ff08b829c973bb1b1696c38dfc392be78f6aa69 | [] | no_license | tborzyszkowski/PythonWyklad | 1ceb4b5e1fca8c41f4ad5fb5b32a100b58e24a4d | 58871126689418d51a4e4ba0b9ab884de260f3c5 | refs/heads/master | 2023-05-10T20:55:21.140705 | 2023-05-07T14:58:49 | 2023-05-07T14:58:49 | 44,440,440 | 14 | 44 | null | 2020-02-27T22:32:03 | 2015-10-17T14:33:07 | HTML | UTF-8 | Python | false | false | 548 | py | class Zwierz:
def replay(self):
return self.glos()
def glos(self):
pass
class Ssak(Zwierz):
def glos(self):
return "Ssak: glos"
class Kot(Ssak):
def glos(self):
return "Kot: glos"
class Pies(Ssak):
def glos(self):
return "Pies: glos"
class Naczelny(Ssak):
def glos(self):
return "Naczelny: glos"
class Haker(Naczelny):
pass
# def glos(self):
# return "Naczelny: glos"
p = Pies()
k = Kot()
print p.replay() + k.replay()
h= Haker()
print h.replay() | [
"[email protected]"
] | |
b34da93daff3b0147a5beeb599b6785d29d18905 | 9f7c106d50681b394d822fbdc5e3ad25f04d927c | /week6_nissi_miika/week6_ass4_nissi_miika.py | c35170d25f810049f893fd6c2f03cbeec7c89d04 | [] | no_license | miikanissi/python_course_summer_2020 | edf032b1d9815dfa6e0b5f7c902f7b469117c04f | 3969288b969b3db8f9d7f2fdb67905f13d4969fa | refs/heads/master | 2022-12-02T09:33:42.625374 | 2020-08-24T17:38:59 | 2020-08-24T17:38:59 | 273,909,320 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 290 | py | def factorial(x):
try:
if x < 1: raise ValueError
elif x == 1:
return 1
else:
return x *factorial(x-1)
except ValueError:
print("Factorial can not be negative.")
print(factorial(-20))
print(factorial(20))
print(factorial(4))
| [
"[email protected]"
] | |
0782a9b01c132cece78f0d640fbecb22de784ae2 | ffcf85c7866e4d95d17afadc7d823a123fd79247 | /Info/modules/passport/views.py | de73375f606b69baa4bba8b0d84658356ea3a338 | [] | no_license | CcLmL/InfoNews | 1c7b9df7f7924dac5750886444a46ace313095bc | 2c8dad2719fde697c8283ec88721479701e81bf9 | refs/heads/master | 2020-03-27T01:14:57.059554 | 2018-09-04T07:16:20 | 2018-09-04T07:16:20 | 145,694,197 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 6,916 | py | import random
import re
from datetime import datetime
from flask import request, abort, current_app, make_response, jsonify, session
from Info import sr, db
from Info.lib.yuntongxun.sms import CCP
from Info.models import User
from Info.modules.passport import passport_blu
from Info.utils.captcha.pic_captcha import captcha
# 2.使用蓝图来装饰路由
from Info.utils.response_code import RET, error_map
@passport_blu.route('/get_img_code')
def get_img_code():
# 获取参数
img_code_id = request.args.get("img_code_id")
# 校验参数
if not img_code_id:
return abort(403)
# 生成图片验证码
img_name, img_code_text, img_code_bytes = captcha.generate_captcha() # 使用的是第三方工具（utils里面）
# 将图片key和验证码文字保存到redis数据库中
# 一旦是关于数据库的操作都应当进行异常捕获,提高程序稳定性
try:
sr.set("img_code_id_" + img_code_id, img_code_text, ex=180)
except Exception as e:
current_app.logger.error(e)
return abort(500)
# 返回验证码图片
# 创建响应头
response = make_response(img_code_bytes)
# 设置响应头
response.content_type="image/jpeg"
return response
# 获取短信验证码
@passport_blu.route('/get_sms_code', methods=["POST"])
def get_sms_code():
# 获取参数 request.json可以获取到application/json格式传过来的json数据
img_code_id = request.json.get("img_code_id")
img_code = request.json.get("img_code")
mobile = request.json.get("mobile")
# 校验参数
if not all([img_code_id,img_code,mobile]):
return jsonify(errno=RET.PARAMERR,errmsg=error_map[RET.PARAMERR]) # 这里使用的是response_code文件里自定义的状态码
# 校验手机号格式
if not re.match(r"1[135678]\d{9}$",mobile):
return jsonify(errno=RET.PARAMERR, errmsg="手机格式不正确")
# 根据图片key取出验证码文字
try:
real_img_code = sr.get("img_code_id_" + img_code_id)
except Exception as e:
current_app.logger.error(e)
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
# 校验图片验证码
if not real_img_code: # 校验是否过期
return jsonify(errno=RET.PARAMERR, errmsg="验证码以过期")
if img_code.upper() != real_img_code: # 校验验证码是否正确
return jsonify(errno=RET.PARAMERR, errmsg="验证码不正确")
# 校验手机号码的正确性
# 根据手机号从数据库中取出对应的记录
try:
user = User.query.filter_by(mobile=mobile).first()
except Exception as e:
current_app.logger.error(e)
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
# 判断该用户是否存在
if user: # 提示用户已存在
return jsonify(errno=RET.DATAEXIST, errmsg=error_map[RET.DATAEXIST])
# 如果校验成功，发送短信
# 生成4位随机数字
sms_code = "%04d" % random.randint(0,9999)
current_app.logger.info("短信验证码为：%s" % sms_code)
# res_code = CCP().send_template_sms(mobile, [sms_code, 5], 1)
# if res_code == -1: # 短信发送失败
# return jsonify(errno=RET.THIRDERR, errmsg=error_map[RET.THIRDERR])
# 将短信验证码保存到redis
try:
sr.set("sms_code_id_" + mobile, sms_code, ex=60)
except Exception as e:
current_app.logger.error(e)
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
# 将短信发送结果使用json返回
return jsonify(errno=RET.OK, errmsg=error_map[RET.OK])
# 用户注册
@passport_blu.route('/register', methods=["POST"])
def register():
# 获取参数
mobile = request.json.get("mobile")
password = request.json.get("password")
sms_code = request.json.get("sms_code")
# 校验参数
if not all([mobile, password, sms_code]):
return jsonify(errno=RET.PARAMERR, errmsg=error_map[RET.PARAMERR])
# 校验手机号
if not re.match(r'1[35678]\d{9}', mobile):
return jsonify(errno=RET.PARAMERR, errmsg=error_map[RET.PARAMERR])
# 根据手机号取出短信验证码
try:
real_sms_code = sr.get("sms_code_id_" + mobile)
except Exception as e:
current_app.logger.error(e)
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
# 校验验证码
if not real_sms_code: # 校验是否过期
return jsonify(errno=RET.PARAMERR, errmsg="验证码已过期")
if sms_code != real_sms_code: # 校验验证码是否正确
return jsonify(errno=RET.PARAMERR, errmsg=error_map[RET.PARAMERR])
# 将用户数据保存到数据库中
user = User()
user.mobile = mobile
# 使用计算机属性password对密码加密过程进行封装
user.password = password
user.nick_name = mobile
# 记录用户最后登陆的时间
user.last_login = datetime.now()
try:
db.session.add(user)
db.session.commit()
except Exception as e:
current_app.logger.error(e)
db.session.rollback()
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
# 状态保持 免密码登陆
session["user_id"] = user.id
return jsonify(errno=RET.OK, errmsg=error_map[RET.OK])
# 用户登陆
@passport_blu.route('/login', methods=["POST"])
def login():
# 获取参数
mobile = request.json.get("mobile")
password = request.json.get("password")
# 校验参数
if not all([mobile, password]):
return jsonify(errno=RET.PARAMERR, errmsg=error_map[RET.PARAMERR])
# 校验手机格式
if not re.match(r"1[35678]\d{9}", mobile):
return jsonify(errno=RET.PARAMERR, errmsg=error_map[RET.PARAMERR])
# 根据手机号从数据库中取出用户模型
try:
user = User().query.filter_by(mobile=mobile).first()
except Exception as e:
current_app.logger.error(e)
return jsonify(errno=RET.DBERR, errmsg=error_map[RET.DBERR])
if not user:
return jsonify(errno=RET.USERERR, errmsg=error_map[RET.USERERR])
# 校验密码
if not user.check_password(password):
return jsonify(errno=RET.PWDERR, errmsg=error_map[RET.PWDERR])
# 注册用户最后的登陆时间
user.last_login = datetime.now()
# 这里本身需要对数据进行提交，但是设置了SQLALCHEMY_COMMIT_ON_TEARDOWN后，就会自动提交了
# 状态保持
session["user_id"] = user.id
# 将校验结果以json返回
return jsonify(errno=RET.OK, errmsg=error_map[RET.OK])
# 退出登陆
@passport_blu.route('/logout')
def logout():
# 将用户信息从session中删除 pop可以设置默认值，当减值对不存在时，不会报错并返回默认值
session.pop("user_id", None)
# 将结果返回
return jsonify(errno=RET.OK, errmsg=error_map[RET.OK])
| [
"[email protected]"
] | |
4f207fc33a82256e32426744f6f89f6799d2c8f1 | aaf12fe9de8da36f4dc85973568f7e747b312c16 | /log_output.py | 1731fde8938341360c34f445f9883c728d4d1f04 | [] | no_license | UESTC-Liuxin/pytorch | aa092f15ba2187bb9a9e73fd50309a6abbb5362c | d1029f0c38813f1a0a18bbb9499d06d93829d79a | refs/heads/master | 2021-01-02T01:20:50.132014 | 2020-04-08T02:01:12 | 2020-04-08T02:01:12 | 239,429,974 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,104 | py | import logging
class Mylog(object):
"""
@create log file and output log information
"""
def __init__(self,logFilename):
logging.basicConfig(level=logging.DEBUG,
format='%(asctime)s %(filename)s[line:%(lineno)d] %(levelname)s %(message)s',
datefmt='%a, %d %b %Y %H:%M:%S',
filename=logFilename,
filemode='a')
console = logging.StreamHandler() # 定义console handler
console.setLevel(logging.INFO) # 定义该handler级别
formatter = logging.Formatter('%(asctime)s %(filename)s : %(levelname)s %(message)s') # 定义该handler格式
console.setFormatter(formatter)
logging.getLogger().addHandler(console) # 实例化添加handler
def debug_out(self,str):
"""
output debug information
:param str: information
:return:
"""
logging.debug(str)
def info_out(self,str):
"""
output running info
:param str:
:return:
"""
logging.info(str) | [
"[email protected]"
] | |
f7f3d8f02b6d308c3f3bc24d81e2dd1a11e6d95d | 0f5668e822e30f2ebcddeb7121d5227305f3e3e7 | /rate_the_movies/admin.py | 3aaf97a82685e6ab7fc2ae93104abcb9d2835682 | [] | no_license | hpaasch/weekend_movies | ff8e7e531202d1b6a02388e5087bfcd22b89f7e8 | d7a71815358fa1dfec842d73a05f95f59eff5ab9 | refs/heads/master | 2021-01-19T00:25:43.980980 | 2016-06-12T18:31:31 | 2016-06-12T18:31:31 | 60,794,716 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 243 | py | from django.contrib import admin
# Register your models here.
from rate_the_movies.models import Rater, Movie, Rating, TopMovie
admin.site.register(Rater)
admin.site.register(Movie)
admin.site.register(Rating)
admin.site.register(TopMovie)
| [
"[email protected]"
] | |
1570ef0139326ca4a972af344522a632c7ba1439 | 6a1f6500d2319a2b7d974e3075747b86f102198e | /Path Sum2.py | 9703bc4df062f41f7e1a445a26019ace51bfb9fb | [] | no_license | vpc20/binary-trees | 257672bb3b76c63c1530787a17c664665f5ed15e | 90e074ec33acfa431285fbc3236335814a37feb2 | refs/heads/master | 2023-04-30T01:14:06.556085 | 2021-05-20T08:27:42 | 2021-05-20T08:27:42 | 271,945,306 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,264 | py | # Given the root of a binary tree and an integer targetSum, return all root-to-leaf paths where
# each path's sum equals targetSum.
#
# A leaf is a node with no children.
#
# Example 1:
# Input: root = [5, 4, 8, 11, null, 13, 4, 7, 2, null, null, 5, 1], targetSum = 22
# Output: [[5, 4, 11, 2], [5, 8, 4, 5]]
#
# Example 2:
# Input: root = [1, 2, 3], targetSum = 5
# Output: []
#
# Example 3:
# Input: root = [1, 2], targetSum = 0
# Output: []
#
# Constraints:
#
# The number of nodes in the tree is in the range[0, 5000].
# -1000 <= Node.val <= 1000
# -1000 <= targetSum <= 1000
from BinaryTrees import binary_tree
def path_sum(root, sum):
def dfs(node, accsum, path):
if node.left is None and node.right is None:
if accsum == sum:
result.append(path)
return
if node.left is not None:
dfs(node.left, accsum + node.left.val, path + [node.left.val])
if node.right is not None:
dfs(node.right, accsum + node.right.val, path + [node.right.val])
if root is None:
return []
result = []
dfs(root, root.val, [root.val])
return result
t1 = binary_tree([5, 4, 8, 11, None, 13, 4, 7, 2, None, None, None, None, 5, 1])
print(t1)
print(path_sum(t1, 22))
| [
"[email protected]"
] | |
528138c7b3242a2e6f034c7f518b4ae11ec9f5d9 | 48aacf0425c5ab071972034c3fbd388feb036578 | /node-3/site-packages/heat/db/sqlalchemy/models.py | cf9d5ea7798f3b6c01c0e09b9f9f4502429310ab | [] | no_license | wputra/MOS-centos | 2b8ec0116bb3a28632c54d6052d322a42391439f | 0a4f24dd4183d4d44e8c7beb27adce12e42f0201 | refs/heads/master | 2021-01-10T19:22:22.920342 | 2014-09-12T03:33:54 | 2014-09-12T03:33:54 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 11,877 | py | #
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
# WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
# License for the specific language governing permissions and limitations
# under the License.
"""
SQLAlchemy models for heat data.
"""
import uuid
import sqlalchemy
from sqlalchemy.orm import relationship, backref
from sqlalchemy.ext.declarative import declarative_base
from heat.openstack.common import timeutils
from heat.openstack.common.db.sqlalchemy import models
from heat.openstack.common.db.sqlalchemy import session
from sqlalchemy.orm.session import Session
from heat.db.sqlalchemy.types import Json
BASE = declarative_base()
get_session = session.get_session
class HeatBase(models.ModelBase, models.TimestampMixin):
"""Base class for Heat Models."""
__table_args__ = {'mysql_engine': 'InnoDB'}
def expire(self, session=None, attrs=None):
"""Expire this object ()."""
if not session:
session = Session.object_session(self)
if not session:
session = get_session()
session.expire(self, attrs)
def refresh(self, session=None, attrs=None):
"""Refresh this object."""
if not session:
session = Session.object_session(self)
if not session:
session = get_session()
session.refresh(self, attrs)
def delete(self, session=None):
"""Delete this object."""
if not session:
session = Session.object_session(self)
if not session:
session = get_session()
session.delete(self)
session.flush()
def update_and_save(self, values, session=None):
if not session:
session = Session.object_session(self)
if not session:
session = get_session()
session.begin()
for k, v in values.iteritems():
setattr(self, k, v)
session.commit()
class SoftDelete(object):
deleted_at = sqlalchemy.Column(sqlalchemy.DateTime)
def soft_delete(self, session=None):
"""Mark this object as deleted."""
self.update_and_save({'deleted_at': timeutils.utcnow()},
session=session)
class RawTemplate(BASE, HeatBase):
"""Represents an unparsed template which should be in JSON format."""
__tablename__ = 'raw_template'
id = sqlalchemy.Column(sqlalchemy.Integer, primary_key=True)
template = sqlalchemy.Column(Json)
files = sqlalchemy.Column(Json)
class Stack(BASE, HeatBase, SoftDelete):
"""Represents a stack created by the heat engine."""
__tablename__ = 'stack'
id = sqlalchemy.Column(sqlalchemy.String(36), primary_key=True,
default=lambda: str(uuid.uuid4()))
name = sqlalchemy.Column(sqlalchemy.String(255))
raw_template_id = sqlalchemy.Column(
sqlalchemy.Integer,
sqlalchemy.ForeignKey('raw_template.id'),
nullable=False)
raw_template = relationship(RawTemplate, backref=backref('stack'))
username = sqlalchemy.Column(sqlalchemy.String(256))
tenant = sqlalchemy.Column(sqlalchemy.String(256))
action = sqlalchemy.Column('action', sqlalchemy.String(255))
status = sqlalchemy.Column('status', sqlalchemy.String(255))
status_reason = sqlalchemy.Column('status_reason', sqlalchemy.String(255))
parameters = sqlalchemy.Column('parameters', Json)
user_creds_id = sqlalchemy.Column(
sqlalchemy.Integer,
sqlalchemy.ForeignKey('user_creds.id'),
nullable=False)
owner_id = sqlalchemy.Column(sqlalchemy.String(36), nullable=True)
timeout = sqlalchemy.Column(sqlalchemy.Integer)
disable_rollback = sqlalchemy.Column(sqlalchemy.Boolean, nullable=False)
stack_user_project_id = sqlalchemy.Column(sqlalchemy.String(64),
nullable=True)
# Override timestamp column to store the correct value: it should be the
# time the create/update call was issued, not the time the DB entry is
# created/modified. (bug #1193269)
updated_at = sqlalchemy.Column(sqlalchemy.DateTime)
class StackLock(BASE, HeatBase):
"""Store stack locks for deployments with multiple-engines."""
__tablename__ = 'stack_lock'
stack_id = sqlalchemy.Column(sqlalchemy.String(36),
sqlalchemy.ForeignKey('stack.id'),
primary_key=True)
engine_id = sqlalchemy.Column(sqlalchemy.String(36))
class UserCreds(BASE, HeatBase):
"""
Represents user credentials and mirrors the 'context'
handed in by wsgi.
"""
__tablename__ = 'user_creds'
id = sqlalchemy.Column(sqlalchemy.Integer, primary_key=True)
username = sqlalchemy.Column(sqlalchemy.String(255))
password = sqlalchemy.Column(sqlalchemy.String(255))
decrypt_method = sqlalchemy.Column(sqlalchemy.String(64))
tenant = sqlalchemy.Column(sqlalchemy.String(1024))
auth_url = sqlalchemy.Column(sqlalchemy.String)
tenant_id = sqlalchemy.Column(sqlalchemy.String(256))
trust_id = sqlalchemy.Column(sqlalchemy.String(255))
trustor_user_id = sqlalchemy.Column(sqlalchemy.String(64))
stack = relationship(Stack, backref=backref('user_creds'))
class Event(BASE, HeatBase):
"""Represents an event generated by the heat engine."""
__tablename__ = 'event'
id = sqlalchemy.Column(sqlalchemy.Integer, primary_key=True)
stack_id = sqlalchemy.Column(sqlalchemy.String(36),
sqlalchemy.ForeignKey('stack.id'),
nullable=False)
stack = relationship(Stack, backref=backref('events'))
uuid = sqlalchemy.Column(sqlalchemy.String(36),
default=lambda: str(uuid.uuid4()),
unique=True)
resource_action = sqlalchemy.Column(sqlalchemy.String(255))
resource_status = sqlalchemy.Column(sqlalchemy.String(255))
resource_name = sqlalchemy.Column(sqlalchemy.String(255))
physical_resource_id = sqlalchemy.Column(sqlalchemy.String(255))
resource_status_reason = sqlalchemy.Column(sqlalchemy.String(255))
resource_type = sqlalchemy.Column(sqlalchemy.String(255))
resource_properties = sqlalchemy.Column(sqlalchemy.PickleType)
class ResourceData(BASE, HeatBase):
"""Key/value store of arbitrary, resource-specific data."""
__tablename__ = 'resource_data'
id = sqlalchemy.Column('id',
sqlalchemy.Integer,
primary_key=True,
nullable=False)
key = sqlalchemy.Column('key', sqlalchemy.String(255))
value = sqlalchemy.Column('value', sqlalchemy.String)
redact = sqlalchemy.Column('redact', sqlalchemy.Boolean)
decrypt_method = sqlalchemy.Column(sqlalchemy.String(64))
resource_id = sqlalchemy.Column('resource_id',
sqlalchemy.String(36),
sqlalchemy.ForeignKey('resource.id'),
nullable=False)
class Resource(BASE, HeatBase):
"""Represents a resource created by the heat engine."""
__tablename__ = 'resource'
id = sqlalchemy.Column(sqlalchemy.String(36),
primary_key=True,
default=lambda: str(uuid.uuid4()))
action = sqlalchemy.Column('action', sqlalchemy.String(255))
status = sqlalchemy.Column('status', sqlalchemy.String(255))
name = sqlalchemy.Column('name', sqlalchemy.String(255), nullable=True)
nova_instance = sqlalchemy.Column('nova_instance', sqlalchemy.String(255))
status_reason = sqlalchemy.Column('status_reason', sqlalchemy.String(255))
# odd name as "metadata" is reserved
rsrc_metadata = sqlalchemy.Column('rsrc_metadata', Json)
stack_id = sqlalchemy.Column(sqlalchemy.String(36),
sqlalchemy.ForeignKey('stack.id'),
nullable=False)
stack = relationship(Stack, backref=backref('resources'))
data = relationship(ResourceData,
cascade="all,delete",
backref=backref('resource'))
# Override timestamp column to store the correct value: it should be the
# time the create/update call was issued, not the time the DB entry is
# created/modified. (bug #1193269)
updated_at = sqlalchemy.Column(sqlalchemy.DateTime)
class WatchRule(BASE, HeatBase):
"""Represents a watch_rule created by the heat engine."""
__tablename__ = 'watch_rule'
id = sqlalchemy.Column(sqlalchemy.Integer, primary_key=True)
name = sqlalchemy.Column('name', sqlalchemy.String(255), nullable=True)
rule = sqlalchemy.Column('rule', Json)
state = sqlalchemy.Column('state', sqlalchemy.String(255))
last_evaluated = sqlalchemy.Column(sqlalchemy.DateTime,
default=timeutils.utcnow)
stack_id = sqlalchemy.Column(sqlalchemy.String(36),
sqlalchemy.ForeignKey('stack.id'),
nullable=False)
stack = relationship(Stack, backref=backref('watch_rule'))
class WatchData(BASE, HeatBase):
"""Represents a watch_data created by the heat engine."""
__tablename__ = 'watch_data'
id = sqlalchemy.Column(sqlalchemy.Integer, primary_key=True)
data = sqlalchemy.Column('data', Json)
watch_rule_id = sqlalchemy.Column(
sqlalchemy.Integer,
sqlalchemy.ForeignKey('watch_rule.id'),
nullable=False)
watch_rule = relationship(WatchRule, backref=backref('watch_data'))
class SoftwareConfig(BASE, HeatBase):
"""
Represents a software configuration resource to be applied to
one or more servers.
"""
__tablename__ = 'software_config'
id = sqlalchemy.Column('id', sqlalchemy.String(36), primary_key=True,
default=lambda: str(uuid.uuid4()))
name = sqlalchemy.Column('name', sqlalchemy.String(255),
nullable=True)
group = sqlalchemy.Column('group', sqlalchemy.String(255))
config = sqlalchemy.Column('config', Json)
tenant = sqlalchemy.Column(
'tenant', sqlalchemy.String(256), nullable=False)
class SoftwareDeployment(BASE, HeatBase):
"""
Represents applying a software configuration resource to a
single server resource.
"""
__tablename__ = 'software_deployment'
id = sqlalchemy.Column('id', sqlalchemy.String(36), primary_key=True,
default=lambda: str(uuid.uuid4()))
config_id = sqlalchemy.Column(
'config_id',
sqlalchemy.String(36),
sqlalchemy.ForeignKey('software_config.id'),
nullable=False)
config = relationship(SoftwareConfig, backref=backref('deployments'))
server_id = sqlalchemy.Column('server_id', sqlalchemy.String(36),
nullable=False)
input_values = sqlalchemy.Column('input_values', Json)
output_values = sqlalchemy.Column('output_values', Json)
tenant = sqlalchemy.Column(
'tenant', sqlalchemy.String(256), nullable=False)
stack_user_project_id = sqlalchemy.Column(sqlalchemy.String(64),
nullable=True)
action = sqlalchemy.Column('action', sqlalchemy.String(255))
status = sqlalchemy.Column('status', sqlalchemy.String(255))
status_reason = sqlalchemy.Column('status_reason', sqlalchemy.String(255))
| [
"[email protected]"
] | |
6e217e6f3939ed8e26166e26843fa9f5b34e2330 | 60be3894ad491bde502b8f6909a026ee115d952e | /aiosmb/authentication/kerberos/multiplexor.py | 3f54b8c402def066580a983a3ce93219f5a30a6b | [] | no_license | topotam/aiosmb | 7c97c6a9806c84a9fae28fa372cc6903fa6ec0c5 | e2ece67bbf380f576b154b09ea5fd63d9b4ecf4c | refs/heads/master | 2023-06-25T17:41:03.605226 | 2021-07-27T18:31:12 | 2021-07-27T18:31:12 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 6,412 | py |
##
##
## Interface to allow remote kerberos authentication via Multiplexor
##
##
##
##
##
## TODO: RPC auth type is not implemented or tested!!!!
import enum
from aiosmb.authentication.spnego.asn1_structs import KRB5Token
from minikerberos.gssapi.gssapi import get_gssapi, GSSWrapToken
from minikerberos.protocol.asn1_structs import AP_REQ, AP_REP, TGS_REP
from minikerberos.protocol.encryption import Enctype, Key, _enctype_table
from multiplexor.operator.external.sspi import KerberosSSPIClient
from multiplexor.operator import MultiplexorOperator
import enum
import io
import os
from asn1crypto.core import ObjectIdentifier
class KRB5_MECH_INDEP_TOKEN:
# https://tools.ietf.org/html/rfc2743#page-81
# Mechanism-Independent Token Format
def __init__(self, data, oid, remlen = None):
self.oid = oid
self.data = data
#dont set this
self.length = remlen
@staticmethod
def from_bytes(data):
return KRB5_MECH_INDEP_TOKEN.from_buffer(io.BytesIO(data))
@staticmethod
def from_buffer(buff):
start = buff.read(1)
if start != b'\x60':
raise Exception('Incorrect token data!')
remaining_length = KRB5_MECH_INDEP_TOKEN.decode_length_buffer(buff)
token_data = buff.read(remaining_length)
buff = io.BytesIO(token_data)
pos = buff.tell()
buff.read(1)
oid_length = KRB5_MECH_INDEP_TOKEN.decode_length_buffer(buff)
buff.seek(pos)
token_oid = ObjectIdentifier.load(buff.read(oid_length+2))
return KRB5_MECH_INDEP_TOKEN(buff.read(), str(token_oid), remlen = remaining_length)
@staticmethod
def decode_length_buffer(buff):
lf = buff.read(1)[0]
if lf <= 127:
length = lf
else:
bcount = lf - 128
length = int.from_bytes(buff.read(bcount), byteorder = 'big', signed = False)
return length
@staticmethod
def encode_length(length):
if length <= 127:
return length.to_bytes(1, byteorder = 'big', signed = False)
else:
lb = length.to_bytes((length.bit_length() + 7) // 8, 'big')
return (128+len(lb)).to_bytes(1, byteorder = 'big', signed = False) + lb
def to_bytes(self):
t = ObjectIdentifier(self.oid).dump() + self.data
t = b'\x60' + KRB5_MECH_INDEP_TOKEN.encode_length(len(t)) + t
return t[:-len(self.data)] , self.data
class ISC_REQ(enum.IntFlag):
DELEGATE = 1
MUTUAL_AUTH = 2
REPLAY_DETECT = 4
SEQUENCE_DETECT = 8
CONFIDENTIALITY = 16
USE_SESSION_KEY = 32
PROMPT_FOR_CREDS = 64
USE_SUPPLIED_CREDS = 128
ALLOCATE_MEMORY = 256
USE_DCE_STYLE = 512
DATAGRAM = 1024
CONNECTION = 2048
CALL_LEVEL = 4096
FRAGMENT_SUPPLIED = 8192
EXTENDED_ERROR = 16384
STREAM = 32768
INTEGRITY = 65536
IDENTIFY = 131072
NULL_SESSION = 262144
MANUAL_CRED_VALIDATION = 524288
RESERVED1 = 1048576
FRAGMENT_TO_FIT = 2097152
HTTP = 0x10000000
class SMBKerberosMultiplexor:
def __init__(self, settings):
self.iterations = 0
self.settings = settings
self.mode = 'CLIENT'
self.ksspi = None
self.client = None
self.target = None
self.gssapi = None
self.etype = None
self.session_key = None
self.seq_number = None
self.setup()
def setup(self):
return
def get_seq_number(self):
"""
Fetches the starting sequence number. This is either zero or can be found in the authenticator field of the
AP_REQ structure. As windows uses a random seq number AND a subkey as well, we can't obtain it by decrypting the
AP_REQ structure. Insead under the hood we perform an encryption operation via EncryptMessage API which will
yield the start sequence number
"""
return self.seq_number
async def encrypt(self, data, message_no):
return self.gssapi.GSS_Wrap(data, message_no)
async def decrypt(self, data, message_no, direction='init', auth_data=None):
return self.gssapi.GSS_Unwrap(data, message_no, direction=direction, auth_data=auth_data)
def get_session_key(self):
return self.session_key
async def authenticate(self, authData = None, flags = None, seq_number = 0, is_rpc = False):
#authdata is only for api compatibility reasons
if self.ksspi is None:
await self.start_remote_kerberos()
try:
if is_rpc == True:
if self.iterations == 0:
flags = ISC_REQ.CONFIDENTIALITY | \
ISC_REQ.INTEGRITY | \
ISC_REQ.MUTUAL_AUTH | \
ISC_REQ.REPLAY_DETECT | \
ISC_REQ.SEQUENCE_DETECT|\
ISC_REQ.USE_DCE_STYLE
apreq, res = await self.ksspi.authenticate('cifs/%s' % self.settings.target, flags = str(flags.value))
self.iterations += 1
return apreq, True, None
elif self.iterations == 1:
data, err = await self.ksspi.authenticate('cifs/%s' % self.settings.target, flags = str(flags.value), token_data = authData)
if err is not None:
return None, None, err
self.session_key, err = await self.ksspi.get_session_key()
if err is not None:
return None, None, err
aprep = AP_REP.load(data).native
subkey = Key(aprep['enc-part']['etype'], self.session_key)
self.gssapi = get_gssapi(subkey)
if aprep['enc-part']['etype'] != 23: #no need for seq number in rc4
raw_seq_data, err = await self.ksspi.get_seq_number()
if err is not None:
return None, None, err
self.seq_number = GSSWrapToken.from_bytes(raw_seq_data[16:]).SND_SEQ
self.iterations += 1
await self.ksspi.disconnect()
return data, False, None
else:
raise Exception('SSPI Kerberos -RPC - auth encountered too many calls for authenticate.')
else:
apreq, res = await self.ksspi.authenticate('cifs/%s' % self.settings.target)
#print('MULTIPLEXOR KERBEROS SSPI, APREQ: %s ERROR: %s' % (apreq, res))
if res is None:
self.session_key, res = await self.ksspi.get_session_key()
await self.ksspi.disconnect()
return apreq, res, None
except Exception as e:
return None, None, err
async def start_remote_kerberos(self):
try:
#print(self.settings.get_url())
#print(self.settings.agent_id)
self.operator = MultiplexorOperator(self.settings.get_url())
await self.operator.connect()
#creating virtual sspi server
server_info = await self.operator.start_sspi(self.settings.agent_id)
#print(server_info)
sspi_url = 'ws://%s:%s' % (server_info['listen_ip'], server_info['listen_port'])
#print(sspi_url)
self.ksspi = KerberosSSPIClient(sspi_url)
await self.ksspi.connect()
except Exception as e:
import traceback
traceback.print_exc()
return None
| [
"[email protected]"
] | |
4565df909b3e0e3e2cbca97207b6da138461b346 | fa346a2d5886420e22707a7be03599e634b230a9 | /temboo/Library/GovTrack/Bill.py | 0e1c3ee23f956f8cd9161b911714ba5a64e5bbcb | [] | no_license | elihuvillaraus/entity-resolution | cebf937499ed270c3436b1dd25ab4aef687adc11 | 71dd49118a6e11b236861289dcf36436d31f06bc | refs/heads/master | 2021-12-02T17:29:11.864065 | 2014-01-08T04:29:30 | 2014-01-08T04:29:30 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 5,472 | py | # -*- coding: utf-8 -*-
###############################################################################
#
# Bill
# Retrieves bills and resolutions in the U.S. Congress since 1973 (the 93rd Congress).
#
# Python version 2.6
#
###############################################################################
from temboo.core.choreography import Choreography
from temboo.core.choreography import InputSet
from temboo.core.choreography import ResultSet
from temboo.core.choreography import ChoreographyExecution
import json
class Bill(Choreography):
def __init__(self, temboo_session):
"""
Create a new instance of the Bill Choreo. A TembooSession object, containing a valid
set of Temboo credentials, must be supplied.
"""
Choreography.__init__(self, temboo_session, '/Library/GovTrack/Bill')
def new_input_set(self):
return BillInputSet()
def _make_result_set(self, result, path):
return BillResultSet(result, path)
def _make_execution(self, session, exec_id, path):
return BillChoreographyExecution(session, exec_id, path)
class BillInputSet(InputSet):
"""
An InputSet with methods appropriate for specifying the inputs to the Bill
Choreo. The InputSet object is used to specify input parameters when executing this Choreo.
"""
def set_BillID(self, value):
"""
Set the value of the BillID input for this Choreo. ((optional, integer) Specify the ID number of the bill to return only the record for that bill.)
"""
InputSet._set_input(self, 'BillID', value)
def set_BillType(self, value):
"""
Set the value of the BillType input for this Choreo. ((optional, string) The bill's type. See documentation for acceptable bill types.)
"""
InputSet._set_input(self, 'BillType', value)
def set_Congress(self, value):
"""
Set the value of the Congress input for this Choreo. ((optional, integer) The number of the congress in which the bill was introduced. The current congress is 112.)
"""
InputSet._set_input(self, 'Congress', value)
def set_CurrentStatusDate(self, value):
"""
Set the value of the CurrentStatusDate input for this Choreo. ((optional, string) The date of the last major action on the bill corresponding to the CurrentStatus (in YYYY-MM-DD format).)
"""
InputSet._set_input(self, 'CurrentStatusDate', value)
def set_CurrentStatus(self, value):
"""
Set the value of the CurrentStatus input for this Choreo. ((optional, string) The current status of the bill. See documentation for acceptable inputs.)
"""
InputSet._set_input(self, 'CurrentStatus', value)
def set_IntroducedDate(self, value):
"""
Set the value of the IntroducedDate input for this Choreo. ((optional, string) The date the bill was introduced (in YYYY-MM-DD format).)
"""
InputSet._set_input(self, 'IntroducedDate', value)
def set_Limit(self, value):
"""
Set the value of the Limit input for this Choreo. ((optional, integer) Results are paged 20 per call by default. Set the limit input to a high value to get all of the results at once.)
"""
InputSet._set_input(self, 'Limit', value)
def set_Number(self, value):
"""
Set the value of the Number input for this Choreo. ((optional, integer) The bill's number (just the integer part).)
"""
InputSet._set_input(self, 'Number', value)
def set_Order(self, value):
"""
Set the value of the Order input for this Choreo. ((optional, string) You can order the results using fieldname (ascending) or -fieldname (descending) where "fieldname" is one of these values: current_status_date, introduced_date, senate_floor_schedule_postdate.)
"""
InputSet._set_input(self, 'Order', value)
def set_ResponseFormat(self, value):
"""
Set the value of the ResponseFormat input for this Choreo. ((optional, string) Specify the format of the response. Default is JSON, but XML is also possible.)
"""
InputSet._set_input(self, 'ResponseFormat', value)
def set_SchedulePostdate(self, value):
"""
Set the value of the SchedulePostdate input for this Choreo. ((optional, string) The date on which the bill was posted on the Senate Floor Schedule which is different from the date it was expected to be debated (in YYYY-MM-DD format).)
"""
InputSet._set_input(self, 'SchedulePostdate', value)
def set_Sponsor(self, value):
"""
Set the value of the Sponsor input for this Choreo. ((optional, integer) The ID of the sponsor of the bill.)
"""
InputSet._set_input(self, 'Sponsor', value)
class BillResultSet(ResultSet):
"""
A ResultSet with methods tailored to the values returned by the Bill Choreo.
The ResultSet object is used to retrieve the results of a Choreo execution.
"""
def getJSONFromString(self, str):
return json.loads(str)
def get_Response(self):
"""
Retrieve the value for the "Response" output from this Choreo execution. (The resopnse from GovTrack.)
"""
return self._output.get('Response', None)
class BillChoreographyExecution(ChoreographyExecution):
def _make_result_set(self, response, path):
return BillResultSet(response, path)
| [
"[email protected]"
] | |
b9cf3b8a2cf28697fa9ba6706aa2eacca14bb3ed | 767b5482f3c5b9c2c85575c711e37561f5b8f198 | /engine/plugins/no_request_check_file_url.py | 0e03353b89807171f88766e8dd5cd2fab7be8a9d | [] | no_license | zhupite233/scaner | 8e39c903f295d06195be20067043087ec8baac4f | 7c29c02bca2247a82bcbb91cc86955cc27998c95 | refs/heads/master | 2020-05-18T03:23:03.459222 | 2019-04-15T04:29:10 | 2019-04-15T04:29:10 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,112 | py | #!/usr/bin/python
# -*- coding: utf-8 -*-
import json
from engine.engine_utils.common import *
from engine.logger import scanLogger as logger
def run_url(http, ob, item):
try:
path = item['url']
params = item['params']
method = item['method']
timeout = ob.get('webTimeout')
pattern1 = r'.+(upload).*'
pattern2 = r'("type":\s*"file")'
result = []
if re.search(pattern1, path, re.I) or re.search(pattern2, json.dumps(params), re.I):
res = {'status': '200','content-location': path, 'pragma': 'no-cache', 'cache-control':
'no-cache, must-revalidate', "content-type": 'text/html;charset=utf-8'}
response = getResponse(res)
request = getRequest(path, domain=ob['domain'])
detail = "在站点上检测到潜在的文件上传风险点"
result.append(getRecord(ob, path, ob['level'], detail, request, response))
return result
except Exception,e:
logger.error("File:DirectoryTraversal.py, run_url function :%s" % (str(e)))
return []
| [
"[email protected]"
] | |
aeb1b2b02dedd76208af4900290767ab944c32da | 2fac796fa58c67fb5a4a95a6e7f28cbef169318b | /leetcode/bit-manipulation/majority-element.py | 1bf72be5da81fd021752159644b0555f580d16ab | [] | no_license | jwyx3/practices | f3fe087432e79c8e34f3af3a78dd10278b66dd38 | 6fec95b9b4d735727160905e754a698513bfb7d8 | refs/heads/master | 2021-03-12T20:41:59.816448 | 2019-04-14T06:47:30 | 2019-04-14T06:47:30 | 18,814,777 | 2 | 0 | null | null | null | null | UTF-8 | Python | false | false | 516 | py | class Solution(object):
def majorityElement(self, nums):
"""
:type nums: List[int]
:rtype: int
"""
# 投票
result = count = 0
for num in nums:
if count == 0: # 如果之前票数相同或者刚开始，重新选一个数
result = num
count = 1
elif result == num: # 如果数相同，加1
count += 1
else: # 不同则减1
count -= 1
return result
| [
"[email protected]"
] | |
1b521983045b44485e0f452dcc1e99cb5581eb79 | 9b64f0f04707a3a18968fd8f8a3ace718cd597bc | /huaweicloud-sdk-vpc/huaweicloudsdkvpc/v3/model/security_group_info.py | 76e7cc60717b39fc78380ac4d1d3214564057876 | [
"Apache-2.0"
] | permissive | jaminGH/huaweicloud-sdk-python-v3 | eeecb3fb0f3396a475995df36d17095038615fba | 83ee0e4543c6b74eb0898079c3d8dd1c52c3e16b | refs/heads/master | 2023-06-18T11:49:13.958677 | 2021-07-16T07:57:47 | 2021-07-16T07:57:47 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 8,998 | py | # coding: utf-8
import re
import six
class SecurityGroupInfo:
"""
Attributes:
openapi_types (dict): The key is attribute name
and the value is attribute type.
attribute_map (dict): The key is attribute name
and the value is json key in definition.
"""
sensitive_list = []
openapi_types = {
'id': 'str',
'name': 'str',
'description': 'str',
'project_id': 'str',
'created_at': 'datetime',
'updated_at': 'datetime',
'enterprise_project_id': 'str',
'security_group_rules': 'list[SecurityGroupRule]'
}
attribute_map = {
'id': 'id',
'name': 'name',
'description': 'description',
'project_id': 'project_id',
'created_at': 'created_at',
'updated_at': 'updated_at',
'enterprise_project_id': 'enterprise_project_id',
'security_group_rules': 'security_group_rules'
}
def __init__(self, id=None, name=None, description=None, project_id=None, created_at=None, updated_at=None, enterprise_project_id=None, security_group_rules=None):
"""SecurityGroupInfo - a model defined in huaweicloud sdk"""
self._id = None
self._name = None
self._description = None
self._project_id = None
self._created_at = None
self._updated_at = None
self._enterprise_project_id = None
self._security_group_rules = None
self.discriminator = None
self.id = id
self.name = name
self.description = description
self.project_id = project_id
self.created_at = created_at
self.updated_at = updated_at
self.enterprise_project_id = enterprise_project_id
self.security_group_rules = security_group_rules
@property
def id(self):
"""Gets the id of this SecurityGroupInfo.
功能描述：安全组对应的唯一标识 取值范围：带“-”的标准UUID格式
:return: The id of this SecurityGroupInfo.
:rtype: str
"""
return self._id
@id.setter
def id(self, id):
"""Sets the id of this SecurityGroupInfo.
功能描述：安全组对应的唯一标识 取值范围：带“-”的标准UUID格式
:param id: The id of this SecurityGroupInfo.
:type: str
"""
self._id = id
@property
def name(self):
"""Gets the name of this SecurityGroupInfo.
功能说明：安全组名称 取值范围：1-64个字符，支持数字、字母、中文、_(下划线)、-（中划线）、.（点）
:return: The name of this SecurityGroupInfo.
:rtype: str
"""
return self._name
@name.setter
def name(self, name):
"""Sets the name of this SecurityGroupInfo.
功能说明：安全组名称 取值范围：1-64个字符，支持数字、字母、中文、_(下划线)、-（中划线）、.（点）
:param name: The name of this SecurityGroupInfo.
:type: str
"""
self._name = name
@property
def description(self):
"""Gets the description of this SecurityGroupInfo.
功能说明：安全组的描述信息 取值范围：0-255个字符，不能包含“<”和“>”
:return: The description of this SecurityGroupInfo.
:rtype: str
"""
return self._description
@description.setter
def description(self, description):
"""Sets the description of this SecurityGroupInfo.
功能说明：安全组的描述信息 取值范围：0-255个字符，不能包含“<”和“>”
:param description: The description of this SecurityGroupInfo.
:type: str
"""
self._description = description
@property
def project_id(self):
"""Gets the project_id of this SecurityGroupInfo.
功能说明：安全组所属的项目ID
:return: The project_id of this SecurityGroupInfo.
:rtype: str
"""
return self._project_id
@project_id.setter
def project_id(self, project_id):
"""Sets the project_id of this SecurityGroupInfo.
功能说明：安全组所属的项目ID
:param project_id: The project_id of this SecurityGroupInfo.
:type: str
"""
self._project_id = project_id
@property
def created_at(self):
"""Gets the created_at of this SecurityGroupInfo.
功能说明：安全组创建时间 取值范围：UTC时间格式：yyyy-MM-ddTHH:mm:ss
:return: The created_at of this SecurityGroupInfo.
:rtype: datetime
"""
return self._created_at
@created_at.setter
def created_at(self, created_at):
"""Sets the created_at of this SecurityGroupInfo.
功能说明：安全组创建时间 取值范围：UTC时间格式：yyyy-MM-ddTHH:mm:ss
:param created_at: The created_at of this SecurityGroupInfo.
:type: datetime
"""
self._created_at = created_at
@property
def updated_at(self):
"""Gets the updated_at of this SecurityGroupInfo.
功能说明：安全组更新时间 取值范围：UTC时间格式：yyyy-MM-ddTHH:mm:ss
:return: The updated_at of this SecurityGroupInfo.
:rtype: datetime
"""
return self._updated_at
@updated_at.setter
def updated_at(self, updated_at):
"""Sets the updated_at of this SecurityGroupInfo.
功能说明：安全组更新时间 取值范围：UTC时间格式：yyyy-MM-ddTHH:mm:ss
:param updated_at: The updated_at of this SecurityGroupInfo.
:type: datetime
"""
self._updated_at = updated_at
@property
def enterprise_project_id(self):
"""Gets the enterprise_project_id of this SecurityGroupInfo.
功能说明：安全组所属的企业项目ID。 取值范围：最大长度36字节，带“-”连字符的UUID格式，或者是字符串“0”。“0”表示默认企业项目。
:return: The enterprise_project_id of this SecurityGroupInfo.
:rtype: str
"""
return self._enterprise_project_id
@enterprise_project_id.setter
def enterprise_project_id(self, enterprise_project_id):
"""Sets the enterprise_project_id of this SecurityGroupInfo.
功能说明：安全组所属的企业项目ID。 取值范围：最大长度36字节，带“-”连字符的UUID格式，或者是字符串“0”。“0”表示默认企业项目。
:param enterprise_project_id: The enterprise_project_id of this SecurityGroupInfo.
:type: str
"""
self._enterprise_project_id = enterprise_project_id
@property
def security_group_rules(self):
"""Gets the security_group_rules of this SecurityGroupInfo.
安全组规则
:return: The security_group_rules of this SecurityGroupInfo.
:rtype: list[SecurityGroupRule]
"""
return self._security_group_rules
@security_group_rules.setter
def security_group_rules(self, security_group_rules):
"""Sets the security_group_rules of this SecurityGroupInfo.
安全组规则
:param security_group_rules: The security_group_rules of this SecurityGroupInfo.
:type: list[SecurityGroupRule]
"""
self._security_group_rules = security_group_rules
def to_dict(self):
"""Returns the model properties as a dict"""
result = {}
for attr, _ in six.iteritems(self.openapi_types):
value = getattr(self, attr)
if isinstance(value, list):
result[attr] = list(map(
lambda x: x.to_dict() if hasattr(x, "to_dict") else x,
value
))
elif hasattr(value, "to_dict"):
result[attr] = value.to_dict()
elif isinstance(value, dict):
result[attr] = dict(map(
lambda item: (item[0], item[1].to_dict())
if hasattr(item[1], "to_dict") else item,
value.items()
))
else:
if attr in self.sensitive_list:
result[attr] = "****"
else:
result[attr] = value
return result
def to_str(self):
import simplejson as json
return json.dumps(self.to_dict())
def __repr__(self):
"""For `print` and `pprint`"""
return self.to_str()
def __eq__(self, other):
"""Returns true if both objects are equal"""
if not isinstance(other, SecurityGroupInfo):
return False
return self.__dict__ == other.__dict__
def __ne__(self, other):
"""Returns true if both objects are not equal"""
return not self == other
| [
"[email protected]"
] | |
e2399df3821254f4ef5f3dbdb2b39081cbdb0eae | d54476a109bb7a75ab18c742e53425358eae2df7 | /cart/migrations/0007_auto_20190831_1312.py | effc4f4f7371a10996aef08b421bd7b58b47fea4 | [] | no_license | OmarGonD/stickers_gallito | 8b46673a73d3fa6fdbdeb9726804f3e3c176543b | 4aa4f5aeb272b393410ed8b518aa39040f46a97b | refs/heads/master | 2022-12-09T20:38:23.672740 | 2019-12-13T14:41:41 | 2019-12-13T14:41:41 | 163,198,792 | 0 | 1 | null | 2022-04-22T21:00:01 | 2018-12-26T16:35:33 | HTML | UTF-8 | Python | false | false | 469 | py | # Generated by Django 2.2.1 on 2019-08-31 18:12
from django.db import migrations
class Migration(migrations.Migration):
dependencies = [
('cart', '0006_auto_20190831_1021'),
]
operations = [
migrations.RenameField(
model_name='sampleitem',
old_name='file_a',
new_name='file',
),
migrations.RemoveField(
model_name='sampleitem',
name='file_b',
),
]
| [
"[email protected]"
] | |
a37246089f6d753b353a98fd4c9d55fbb8fb0a98 | d0207e019bd72bd1ef77dbde369b7234ba44e7d7 | /misc/projector/tfrecords.py | 8c3d165f31b6509c86bb601a6e1774e7708955bf | [] | no_license | 307509256/tf-face-recognizer | 467458ee764fa44b18f33aa697de886a62a18263 | 3eb4b0fee1350302c57a755afb1a3b8537e7ec7e | refs/heads/master | 2021-01-14T10:37:19.812201 | 2017-02-14T13:10:34 | 2017-02-14T13:10:34 | 82,047,255 | 1 | 0 | null | 2017-02-15T10:11:39 | 2017-02-15T10:11:39 | null | UTF-8 | Python | false | false | 3,671 | py | import os
import sys
sys.path.append(os.path.join(os.path.dirname(__file__), '..', '..'))
from model.recognizer import Recognizer
from tensorflow.contrib.tensorboard.plugins import projector
import tensorflow as tf
FLAGS = tf.app.flags.FLAGS
tf.app.flags.DEFINE_string('checkpoint_path', '/tmp/model.ckpt',
"""Path to model checkpoints.""")
tf.app.flags.DEFINE_string('input_file', 'data.tfrecords',
"""Path to the TFRecord data.""")
tf.app.flags.DEFINE_string('logdir', os.path.join(os.path.dirname(__file__), 'logdir'),
"""Directory where to write checkpoints.""")
def inputs(files, batch_size=0):
fqueue = tf.train.string_input_producer(files)
reader = tf.TFRecordReader()
key, value = reader.read(fqueue)
features = tf.parse_single_example(value, features={
'label': tf.FixedLenFeature([], tf.int64),
'image_raw': tf.FixedLenFeature([], tf.string),
})
label = features['label']
image = tf.image.decode_jpeg(features['image_raw'], channels=3)
image = tf.image.resize_image_with_crop_or_pad(image, 96, 96)
return tf.train.batch(
[tf.image.per_image_standardization(image), image, label], batch_size
)
def main(argv=None):
filepath = FLAGS.input_file
if not os.path.exists(filepath):
raise Exception('%s does not exist' % filepath)
r = Recognizer(batch_size=900)
input_images, orig_images, labels = inputs([filepath], batch_size=r.batch_size)
r.inference(input_images, 1)
fc5 = tf.get_default_graph().get_tensor_by_name('fc5/fc5:0')
fc6 = tf.get_default_graph().get_tensor_by_name('fc6/fc6:0')
with tf.Session() as sess:
variable_averages = tf.train.ExponentialMovingAverage(r.MOVING_AVERAGE_DECAY)
variables_to_restore = variable_averages.variables_to_restore()
for name, v in variables_to_restore.items():
try:
tf.train.Saver([v]).restore(sess, FLAGS.checkpoint_path)
except Exception:
sess.run(tf.variables_initializer([v]))
tf.train.start_queue_runners(sess=sess)
outputs = sess.run({'fc5': fc5, 'fc6': fc6, 'images': orig_images, 'labels': labels})
# write to metadata file
metadata_path = os.path.join(FLAGS.logdir, 'metadata.tsv')
with open(metadata_path, 'w') as f:
for index in outputs['labels']:
f.write('%d\n' % index)
# write to sprite image file
image_path = os.path.join(FLAGS.logdir, 'sprite.jpg')
unpacked = tf.unpack(outputs['images'], 900)
rows = []
for i in range(30):
rows.append(tf.concat(1, unpacked[i*30:(i+1)*30]))
jpeg = tf.image.encode_jpeg(tf.concat(0, rows))
with open(image_path, 'wb') as f:
f.write(sess.run(jpeg))
# add embedding data
targets = [tf.Variable(e, name=name) for name, e in outputs.items() if name.startswith('fc')]
config = projector.ProjectorConfig()
for v in targets:
embedding = config.embeddings.add()
embedding.tensor_name = v.name
embedding.metadata_path = metadata_path
embedding.sprite.image_path = image_path
embedding.sprite.single_image_dim.extend([96, 96])
sess.run(tf.variables_initializer(targets))
summary_writer = tf.train.SummaryWriter(FLAGS.logdir)
projector.visualize_embeddings(summary_writer, config)
graph_saver = tf.train.Saver(targets)
graph_saver.save(sess, os.path.join(FLAGS.logdir, 'model.ckpt'))
if __name__ == '__main__':
tf.app.run()
| [
"[email protected]"
] | |
533b9f5190aec7b5d6e52be40c8027017425f7eb | c8d6cfc2148fe15a272110277d511fb8522c4c26 | /mongodbpro/Deleteonemongo.py | e5727beda1527ccd2402a2a26aa3b7b1e492fc4a | [] | no_license | n1e2h4a/AllBasicProgram | 9d1705315cf08678cf615a77921e17728ed41f94 | 88f27c24906de3ea2b2ee1f94adaa648ef1e51c3 | refs/heads/master | 2021-01-04T06:40:49.207179 | 2020-03-11T13:40:52 | 2020-03-11T13:40:52 | 240,428,706 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 139 | py | from pymongo import MongoClient
client = MongoClient('localhost',27017)
db=client.result
col=db.biodata
col.delete_one({"city":"Dehradun"}) | [
"[email protected]"
] | |
9d8ae1275a631e023a71b4de3489f88302c8e72a | 3de95d8882ad44e8ff821b2563a067d4e5249759 | /demo.py | 1c46efa6f932098b01ac8f6ff7f969b913d9d383 | [
"MIT"
] | permissive | wuxiaolianggit/Image-Matching | 8c74f7557b6dd7c7a6f71b2627a94f4e112ae5e9 | 3213a8a574fa7bcc476d3de1c7370c268bf817a7 | refs/heads/master | 2021-04-08T00:42:08.063935 | 2020-01-19T05:25:54 | 2020-01-19T05:25:54 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,307 | py | import math
import cv2 as cv
import numpy as np
import torch
from PIL import Image
from torchvision import transforms
from models import ResNetMatchModel
def get_image(file):
img = cv.imread(file)
img = img[..., ::-1] # RGB
img = Image.fromarray(img, 'RGB') # RGB
img = transformer(img)
img = img.to(device)
return img
def get_feature(model, file):
img = get_image(file)
imgs = img.unsqueeze(dim=0)
with torch.no_grad():
output = model(imgs)
feature = output[0].cpu().numpy()
return feature / np.linalg.norm(feature)
if __name__ == "__main__":
device = torch.device('cpu')
threshold = 21.07971786746929
filename = 'image_matching.pt'
model = ResNetMatchModel()
model.load_state_dict(torch.load(filename))
model = model.to(device)
model.eval()
transformer = transforms.Compose([
transforms.Resize(256),
transforms.CenterCrop(224),
transforms.ToTensor(),
transforms.Normalize([0.485, 0.456, 0.406], [0.229, 0.224, 0.225])
])
x0 = get_feature(model, '0.jpg')
x1 = get_feature(model, '6.jpg')
cosine = np.dot(x0, x1)
cosine = np.clip(cosine, -1, 1)
theta = math.acos(cosine)
theta = theta * 180 / math.pi
print(theta)
print(theta <= threshold)
| [
"[email protected]"
] | |
3a47c0f2f17057a6e8afd7540a9da93d03b0f165 | 4dddd01ca6a60f2fa408ee55fbaebe868917184a | /myappium/xueqiu/__init__.py | 1513984c6e62598b66393859814dc0c324b29b13 | [] | no_license | fanpl-sourse/all_study_practice | 6f056c18f0eb7afd6af649e5b595895683bb0cbd | b02f25231855e149b95476b20dd8d53318cfe1a5 | refs/heads/master | 2023-01-22T09:13:15.107616 | 2020-11-30T05:53:43 | 2020-11-30T05:53:43 | 304,493,176 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 137 | py | # -*- coding: utf-8 -*-
# @Time : 2020/11/6 11:13
# @Author : 饭盆里
# @File : __init__.py.py
# @Software: PyCharm
# @desc : | [
"[email protected]"
] | |
fcea9d0ed71026f62cb75d7cbbf6f1494928df5b | ecebefec65cc55b305419a689660eb8e2ea04fef | /release/virtual_player/mpc_performancetable_syn.py | e460983b8941a4a601b862ad941ba7af5a5c3464 | [] | no_license | generlist/ABRTuner | 4ab1d6d5e5201a7953d4565ca4574307a35513c3 | baea8fab155a71c185e74121a8f014e6ad889308 | refs/heads/master | 2020-05-26T01:09:29.712879 | 2018-08-03T23:40:01 | 2018-08-03T23:40:01 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,090,550 | py | mpc_dash_syth_hyb_pen_table_100 = {(8800, 3100): [-1.0, -1.0], (6900, 1800): [-1.0], (7100, 4400): [0.0, 0.0, -1.0], (5900, 1000): [-1.0, -1.0, -1.0], (5000, 2600): [0.0, 0.0, 0.0, 0.0], (8100, 600): [-1.0], (6300, 4500): [0.0, 45.0, 15.0, 0.0, 0.0, -1.0], (8200, 2800): [-1.0], (8000, 1500): [0.0], (7200, 1600): [0.0], (8200, 4000): [-1.0, -1.0, -1.0], (7900, 800): [-1.0], (4200, 500): [0.0], (7100, 3300): [-1.0, 0.0, -1.0, 0.0, 0.0], (7000, 4600): [0.0, 15.0, 0.0, 0.0, -1.0, 5.0, -1.0], (4700, 1300): [0.0], (3200, 1000): [5.0], (7200, 100): [-1.0], (5300, 3300): [0.0, 10.0, 0.0], (6900, 3300): [0.0, -1.0, 0.0, 0.0], (8700, 1500): [0.0], (6800, 4100): [0.0, 0.0, 0.0, -1.0, -1.0], (7100, 1500): [-1.0, 0.0], (2700, 1000): [10.0], (1300, 800): [20.0, 55.0, 5.0, 35.0, 20.0, 0.0, 70.0, 45.0], (6500, 1500): [10.0, 0.0, -1.0], (2700, 2000): [0.0, 5.0, 35.0, 5.0, 10.0, 20.0, 45.0, 60.0], (8100, 3700): [0.0, -1.0], (1500, 600): [10.0, 15.0], (800, 600): [20.0, -1.0, 50.0], (5800, 300): [-1.0, -1.0], (6400, 600): [-1.0], (2800, 100): [10.0, -1.0, 20.0], (8500, 5600): [0.0], (3700, 2300): [5.0, 5.0], (4000, 3100): [0.0], (5900, 3700): [0.0, 0.0], (7900, 4900): [-1.0, -1.0, -1.0, 0.0], (6400, 4500): [-1.0, 0.0, 10.0, 0.0], (6200, 3600): [0.0, -1.0, 15.0, 0.0, -1.0, 0.0], (4900, 1200): [-1.0, 0.0], (6700, 900): [0.0, -1.0], (8400, 5300): [-1.0, -1.0, 0.0, 0.0, 0.0], (4400, 300): [0.0, 0.0], (6200, 1800): [-1.0], (7300, 3500): [-1.0], (7900, 2000): [-1.0, -1.0], (3200, 1900): [15.0, 25.0], (7000, 3000): [0.0], (6400, 900): [-1.0, -1.0, -1.0], (8800, 0): [-1.0, -1.0], (3000, 900): [20.0, 5.0], (2200, 200): [5.0, 25.0, 20.0], (4400, 3300): [0.0, 0.0, 35.0, 0.0, 0.0, 5.0], (7900, 2300): [0.0, 10.0], (6500, 1200): [-1.0], (8900, 2700): [-1.0, -1.0, -1.0, 5.0], (3800, 1900): [0.0, 30.0, 5.0], (6100, 800): [-1.0, -1.0], (8300, 4700): [0.0, -1.0, 0.0, 10.0], (5600, 1800): [-1.0], (2100, 900): [25.0, 25.0, 60.0, 70.0, 15.0], (8700, 3000): [-1.0, -1.0, -1.0, 15.0, -1.0], (4300, 2000): [5.0], (3300, 1500): [10.0, 5.0, 0.0, 0.0, 5.0], (400, 100): [30.0], (7500, 5300): [0.0], (7900, 4700): [-1.0, -1.0], (8500, 3400): [0.0], (1600, 900): [20.0, -1.0, 15.0], (8800, 1300): [-1.0], (7300, 2600): [-1.0, -1.0], (8900, 1600): [-1.0, -1.0, -1.0], (2100, 1100): [25.0, 30.0, 75.0, 20.0], (4600, 1600): [0.0, 15.0], (8900, 3400): [-1.0, 0.0], (7500, 3600): [-1.0], (5600, 3000): [5.0], (1700, 600): [100.0, 0.0], (4500, 100): [0.0], (8500, 400): [-1.0, -1.0], (3600, 1900): [30.0, 5.0, 0.0], (3500, 2100): [5.0, 25.0, 15.0, 15.0, 10.0, 0.0, 25.0, 10.0], (6200, 1500): [-1.0], (7600, 4500): [0.0, -1.0, 10.0], (5800, 500): [-1.0, -1.0], (600, 400): [10.0, 15.0, 90.0, -1.0, 10.0, 10.0, 5.0, 20.0], (6800, 800): [-1.0], (6800, 1800): [5.0], (5800, 3100): [10.0, 0.0], (6800, 4600): [0.0, 0.0, 15.0, -1.0, 0.0], (5700, 4000): [0.0, 0.0, 0.0, 0.0, 20.0, 0.0], (6500, 700): [-1.0, -1.0], (7500, 800): [-1.0, -1.0], (6600, 2800): [-1.0], (8100, 4100): [-1.0, -1.0, -1.0, 0.0], (4500, 1700): [0.0, 10.0], (3900, 2500): [10.0, 0.0, 10.0], (4400, 1300): [0.0], (5800, 400): [-1.0, -1.0], (4600, 2100): [5.0, 0.0, -1.0, 0.0], (5000, 400): [0.0], (7100, 3600): [-1.0], (8500, 500): [-1.0], (3100, 2600): [75.0], (8500, 4600): [-1.0, 0.0], (5700, 1900): [0.0], (7500, 4400): [0.0, 15.0, 0.0, -1.0, -1.0], (4300, 500): [0.0, 0.0], (3100, 1400): [5.0], (7100, 2300): [-1.0], (300, 0): [-1.0, 30.0], (6600, 4800): [5.0, -1.0, 0.0, 45.0, -1.0], (3800, 1400): [0.0], (5700, 4300): [10.0, 0.0, 0.0, 15.0, 0.0, 0.0], (6000, 2900): [-1.0, 20.0, 0.0, -1.0, 0.0], (2000, 0): [5.0], (1000, 400): [0.0, 85.0, 90.0], (8000, 4700): [-1.0, 0.0, 0.0, -1.0], (3600, 2200): [5.0], (6000, 2000): [-1.0], (4100, 900): [0.0, 0.0], (6000, 4700): [0.0], (5900, 4400): [-1.0, 15.0, -1.0, 0.0, 0.0], (7600, 1400): [-1.0], (8800, 1700): [-1.0, -1.0], (6000, 3800): [10.0, 0.0, 0.0, 0.0], (6600, 4700): [5.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0], (2100, 200): [75.0], (7300, 100): [-1.0, -1.0], (3700, 100): [0.0], (3500, 1900): [15.0, 35.0, 10.0, 10.0, 0.0, 5.0], (6000, 2300): [-1.0, -1.0], (7400, 1400): [-1.0, -1.0], (7900, 5400): [45.0, 5.0, 0.0, -1.0, 0.0], (8300, 1200): [-1.0], (1500, 200): [0.0], (2400, 100): [35.0], (5900, 4200): [15.0, 0.0, 0.0, 0.0], (4800, 2600): [20.0, 0.0], (5300, 1100): [-1.0], (7600, 900): [-1.0, -1.0], (2700, 1600): [5.0, 80.0, 0.0, 5.0, 5.0], (4400, 3200): [30.0, 0.0, 0.0, 20.0, 0.0, 10.0], (6100, 2600): [0.0, -1.0, 0.0, -1.0], (5500, 3800): [0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0], (7200, 5100): [0.0], (7600, 2700): [-1.0, 10.0], (7700, 2100): [0.0], (6800, 4400): [-1.0, 10.0, 0.0], (4600, 2700): [0.0], (7800, 4900): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8100, 3900): [-1.0, -1.0, -1.0], (8600, 1900): [-1.0, -1.0, -1.0], (5500, 3500): [0.0, 0.0, 0.0, 0.0], (5800, 4100): [10.0, 0.0, -1.0, 0.0, 10.0, 5.0], (2800, 1400): [15.0], (7800, 3100): [10.0, 5.0, -1.0, 0.0], (5800, 3200): [0.0, 25.0], (5900, 2200): [-1.0], (8000, 4400): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5000, 700): [0.0], (6400, 1500): [-1.0], (7800, 1300): [-1.0], (5600, 800): [-1.0], (7000, 1500): [-1.0], (7800, 100): [-1.0], (8300, 4100): [0.0, -1.0], (7300, 4600): [-1.0, 15.0], (3800, 2500): [5.0, 0.0, 15.0, 20.0, 0.0, 0.0, 0.0, 25.0], (7100, 4600): [10.0, 0.0, 25.0, -1.0, 45.0, -1.0, -1.0], (4500, 2100): [0.0, 25.0], (7700, 900): [-1.0, -1.0], (7200, 1900): [-1.0, -1.0], (8600, 2300): [-1.0, -1.0], (7000, 1400): [0.0], (7100, 3400): [-1.0, -1.0], (4200, 1000): [0.0], (8000, 3900): [45.0, 0.0], (5200, 1200): [0.0, 0.0], (6900, 2800): [0.0], (6800, 400): [-1.0, -1.0, -1.0], (3100, 2000): [5.0, 15.0, 0.0, 5.0, 10.0, 25.0, 0.0], (8200, 2000): [-1.0, -1.0], (5200, 1500): [0.0, 0.0], (7700, 4400): [0.0], (8800, 500): [-1.0], (7400, 3800): [-1.0, -1.0], (3000, 1400): [15.0], (7900, 4300): [-1.0, 10.0, 0.0], (2800, 1900): [10.0, 20.0, 35.0, 0.0, 85.0, 5.0], (2000, 600): [5.0], (3800, 1500): [0.0], (7000, 4900): [-1.0, -1.0, 20.0], (7600, 1600): [-1.0], (4700, 3500): [0.0, 5.0], (8600, 2100): [-1.0, -1.0, -1.0], (7300, 3200): [0.0], (7300, 3300): [40.0, -1.0, -1.0], (4800, 2700): [45.0, 0.0], (7600, 100): [-1.0], (7400, 4000): [-1.0, -1.0, -1.0], (3500, 2500): [0.0, 20.0, 10.0, 25.0, 15.0, 35.0], (6900, 4900): [0.0, -1.0], (1700, 900): [30.0, 15.0], (8700, 3900): [-1.0, -1.0], (7900, 1100): [-1.0, -1.0, -1.0], (5500, 1000): [-1.0, -1.0], (5900, 3000): [20.0], (6400, 4700): [0.0, 40.0, 15.0, 10.0, 0.0, 5.0, -1.0, 0.0], (3400, 2200): [5.0, 45.0, 0.0, 10.0, 5.0], (7600, 800): [-1.0, -1.0], (5800, 3500): [-1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (8400, 3300): [0.0], (4000, 1300): [0.0], (3200, 2500): [15.0], (5700, 200): [0.0], (2700, 1500): [0.0, 65.0], (4800, 2300): [0.0, 5.0], (5700, 3100): [10.0], (4000, 500): [0.0, 0.0, 0.0], (5400, 3500): [15.0, 0.0, 0.0, 0.0, 0.0, 5.0], (8300, 2500): [-1.0], (4500, 1800): [0.0], (5100, 2300): [0.0, 0.0], (7600, 4600): [0.0, 0.0, 0.0], (6600, 100): [-1.0, -1.0, -1.0], (5500, 2300): [5.0], (4300, 2900): [0.0, 0.0, 0.0, 25.0], (4100, 1900): [5.0], (6300, 1200): [-1.0, -1.0, -1.0], (8400, 4100): [-1.0, 0.0], (4900, 2700): [0.0, 0.0, 30.0, 0.0], (2500, 600): [15.0, 0.0], (2900, 1500): [20.0], (8900, 3700): [-1.0], (5300, 2600): [-1.0], (3600, 300): [-1.0, 10.0], (7500, 3700): [-1.0, -1.0, -1.0], (6400, 500): [-1.0], (6700, 1900): [-1.0, 0.0], (5600, 3500): [10.0, 0.0, 0.0], (7200, 4400): [-1.0, -1.0, 35.0, 0.0], (3600, 2100): [45.0, 55.0, 0.0, 40.0], (4300, 2300): [0.0, 0.0, 0.0, 0.0, 20.0], (3000, 500): [0.0], (5400, 3300): [0.0], (7500, 1500): [-1.0], (2400, 1300): [60.0], (6700, 3200): [-1.0], (8400, 200): [-1.0], (3900, 200): [0.0], (5000, 1800): [0.0], (3800, 2400): [10.0, 0.0, 5.0, 10.0, 5.0, 0.0], (8300, 4200): [-1.0, -1.0, 0.0, 0.0], (3300, 2300): [5.0, 5.0, 10.0, 10.0, 15.0, 40.0, 80.0, 0.0, 0.0, 10.0, 10.0], (8600, 5200): [0.0, -1.0, -1.0], (5800, 3900): [0.0, 0.0], (6300, 2600): [5.0], (3200, 1100): [0.0, 15.0], (5200, 2100): [-1.0], (7500, 5500): [-1.0], (2600, 2000): [0.0], (4200, 1600): [10.0, 10.0], (4700, 2200): [5.0, 0.0], (3000, 2400): [0.0], (6800, 4900): [0.0, -1.0, 0.0, 10.0, 80.0, 0.0, 0.0], (6700, 1600): [-1.0], (3100, 2100): [10.0, 0.0, 30.0, 5.0, 10.0, 20.0, 0.0], (6400, 2400): [-1.0], (5400, 4200): [0.0, 5.0], (7200, 200): [-1.0, -1.0], (7100, 3800): [-1.0, -1.0, -1.0, -1.0, 0.0], (3100, 1300): [5.0], (4400, 1200): [10.0], (1200, 100): [-1.0], (5100, 500): [-1.0], (7200, 4900): [0.0, 0.0, 40.0, 0.0], (7400, 4700): [-1.0, 55.0, 0.0, 15.0, 0.0], (5300, 1000): [0.0], (7600, 700): [-1.0, -1.0], (7000, 1000): [-1.0], (3200, 800): [0.0, 0.0, 15.0], (8700, 200): [-1.0], (6500, 3300): [0.0, 40.0], (4700, 3600): [15.0], (6700, 1300): [-1.0], (8700, 5100): [0.0], (4300, 2600): [30.0, 5.0, 5.0, 15.0], (8900, 3900): [-1.0, -1.0], (6100, 2100): [5.0], (7500, 1600): [-1.0], (7500, 300): [-1.0, -1.0], (7700, 4800): [15.0, -1.0, 0.0, -1.0], (7500, 4600): [0.0, -1.0], (7600, 2400): [-1.0], (5600, 3300): [0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0], (5300, 100): [0.0, 0.0], (7900, 5100): [0.0, 5.0, 0.0, 10.0, -1.0, -1.0], (3600, 1200): [10.0, 0.0, 0.0], (4800, 3200): [30.0, 0.0, 0.0, 0.0, 10.0], (3800, 2100): [0.0, 5.0], (7800, 1900): [-1.0, -1.0], (3100, 800): [15.0], (6500, 2100): [-1.0], (5300, 1600): [-1.0], (7200, 4000): [-1.0, -1.0, 0.0, 15.0], (5700, 1400): [-1.0, 0.0], (7400, 500): [-1.0, -1.0], (8200, 4400): [-1.0, -1.0], (6400, 3100): [0.0, 0.0, -1.0, -1.0, -1.0, 0.0], (8900, 2600): [-1.0], (8600, 1600): [-1.0], (4400, 2500): [20.0, 15.0, 30.0, 0.0], (5900, 3500): [15.0, 0.0, 0.0, 50.0], (6900, 3400): [-1.0], (8100, 3200): [-1.0], (7100, 2900): [-1.0], (2900, 1000): [30.0, 40.0, 0.0], (3900, 1000): [5.0], (4900, 4000): [0.0], (8700, 2200): [-1.0], (3900, 2000): [10.0, 10.0, 0.0, 5.0, 0.0], (7900, 600): [-1.0], (5600, 2200): [0.0], (6300, 3900): [-1.0, 5.0], (4400, 2100): [0.0, 10.0], (7800, 3800): [5.0], (1900, 600): [65.0], (3200, 2400): [5.0, 30.0], (6000, 1300): [-1.0], (7200, 700): [-1.0, -1.0], (6600, 1700): [-1.0], (2500, 700): [0.0], (4600, 1200): [0.0, 0.0], (7500, 1300): [-1.0], (6000, 3100): [-1.0, 0.0], (8500, 3900): [15.0], (8300, 700): [-1.0, -1.0], (8600, 300): [-1.0, -1.0], (3400, 2500): [20.0, 0.0, 0.0, 45.0, 30.0, 5.0], (8800, 2400): [5.0], (5400, 2800): [0.0, -1.0, 0.0, 0.0, 0.0], (5300, 3100): [5.0, 0.0, 0.0, 0.0], (8400, 4700): [-1.0, -1.0, 5.0], (4200, 600): [0.0], (8700, 4800): [-1.0, 0.0, -1.0, -1.0], (5800, 1600): [0.0], (6700, 1500): [-1.0, -1.0], (6000, 400): [-1.0], (5200, 2700): [0.0, 20.0, 5.0], (8500, 300): [-1.0], (6400, 2000): [-1.0], (1200, 600): [80.0, 5.0], (6500, 4900): [0.0, 0.0], (4500, 3200): [0.0, 0.0, 40.0, 25.0, 0.0, 0.0, 5.0, 40.0, 10.0], (6700, 4900): [10.0], (4000, 100): [0.0], (4100, 0): [0.0, 0.0], (1900, 200): [-1.0], (1700, 0): [5.0], (1500, 900): [90.0, 55.0, 20.0, 25.0, 70.0, 95.0, 50.0, -1.0], (8300, 0): [-1.0], (8900, 4900): [-1.0, 5.0], (7100, 500): [-1.0], (4900, 3700): [25.0, 0.0, 50.0, 15.0], (8000, 4900): [-1.0], (7000, 3500): [-1.0, -1.0], (4400, 2600): [0.0, 0.0], (3600, 600): [0.0], (4900, 600): [0.0, 0.0], (8900, 5100): [-1.0, 5.0, -1.0], (7800, 1800): [-1.0], (6400, 1800): [-1.0], (6900, 1400): [-1.0], (8000, 5400): [0.0, 0.0, 5.0], (2600, 1200): [55.0, 15.0], (3800, 3000): [10.0], (6800, 4500): [15.0, -1.0, 0.0, 35.0], (6200, 4800): [35.0, 0.0, 30.0, 0.0], (3300, 0): [-1.0, 5.0], (1300, 0): [25.0], (8800, 5200): [-1.0, -1.0, -1.0, 0.0, -1.0], (6100, 2900): [0.0, 5.0], (5300, 3500): [5.0, 50.0, 0.0, 0.0], (7400, 3200): [-1.0, 25.0, 45.0], (6000, 3000): [0.0, -1.0], (6100, 3400): [0.0, 0.0, 0.0, 0.0], (5900, 1300): [10.0], (8900, 3200): [-1.0], (5100, 1100): [-1.0], (2600, 2100): [10.0], (800, 400): [65.0, 25.0], (6100, 300): [-1.0], (5200, 1100): [-1.0], (5400, 200): [0.0, 0.0], (7600, 3300): [0.0, -1.0], (8200, 2100): [-1.0], (6000, 3600): [0.0, 5.0], (6100, 1500): [-1.0], (5900, 700): [-1.0, 0.0], (8300, 5500): [-1.0, 10.0, -1.0], (4100, 2600): [5.0, 0.0, 0.0, 0.0], (2800, 700): [10.0, 0.0], (5000, 1000): [0.0], (5400, 1500): [-1.0], (6500, 4600): [-1.0, 0.0, -1.0, -1.0], (4600, 600): [0.0, 0.0], (1200, 500): [35.0, 10.0], (6000, 2600): [-1.0], (4000, 2200): [0.0], (4700, 1500): [0.0], (8700, 4700): [-1.0, -1.0, 5.0, -1.0, -1.0, -1.0], (7700, 300): [-1.0], (8800, 4600): [10.0, 0.0, -1.0], (6600, 4200): [0.0], (6600, 3300): [-1.0, 0.0], (4700, 1100): [0.0, -1.0], (6600, 2300): [-1.0], (4200, 2500): [0.0, 5.0, 5.0, 25.0, 15.0], (6400, 3900): [0.0, 0.0], (5100, 0): [0.0, 0.0, 0.0, 0.0, 0.0], (5000, 2800): [5.0, 5.0, 15.0], (1300, 300): [0.0], (5700, 2600): [0.0, 0.0, -1.0], (2300, 1500): [50.0, 75.0, 5.0, 20.0, 65.0], (8400, 1100): [-1.0], (7900, 5200): [-1.0], (5700, 4100): [0.0, 0.0, 0.0, 10.0, 0.0], (5900, 1100): [-1.0], (8300, 2000): [-1.0], (4800, 1000): [0.0], (2400, 1500): [15.0, 15.0, 25.0, 10.0, 15.0, 0.0, 30.0, 25.0], (3900, 2100): [10.0, 0.0], (3700, 2100): [0.0, 10.0, 5.0, 0.0, 5.0, 0.0], (8400, 3100): [-1.0], (6500, 3500): [0.0, 15.0], (8800, 2800): [-1.0], (6400, 3700): [-1.0, 0.0, -1.0], (7300, 4500): [30.0, 0.0, -1.0, -1.0, 0.0, -1.0], (8400, 4300): [0.0], (6800, 1200): [-1.0], (8300, 5600): [-1.0, 0.0], (8600, 5900): [-1.0], (5500, 300): [0.0], (6000, 900): [-1.0, 0.0], (5200, 2300): [5.0], (8300, 100): [-1.0, -1.0, -1.0], (8900, 400): [-1.0, -1.0], (4400, 500): [0.0, 0.0], (7100, 2200): [-1.0], (1900, 1000): [30.0, 20.0], (6600, 200): [-1.0], (3000, 1000): [0.0, 5.0], (2200, 1500): [80.0, -1.0, 10.0, 25.0], (6000, 3400): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (4400, 2300): [0.0], (4300, 3300): [5.0, 0.0], (8300, 1100): [-1.0], (7200, 2500): [-1.0], (6400, 3500): [60.0, 0.0], (6700, 4700): [0.0, 50.0, -1.0, 0.0, -1.0, 5.0, -1.0], (6300, 3300): [-1.0, 80.0], (4500, 400): [0.0, 0.0, -1.0], (5800, 700): [0.0], (5000, 800): [-1.0, -1.0], (7200, 4300): [35.0, 30.0, -1.0, 0.0], (4600, 800): [0.0], (3600, 800): [5.0, 5.0], (4900, 100): [0.0, 0.0], (8500, 5000): [0.0, -1.0, -1.0, 0.0, -1.0, 0.0], (8600, 5600): [-1.0], (5800, 3800): [15.0, -1.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0], (6400, 4600): [0.0, 0.0, 0.0, 0.0, 15.0], (4200, 2400): [10.0, 15.0, 20.0], (8700, 4400): [-1.0, 0.0], (2200, 0): [25.0], (5600, 3200): [0.0], (5000, 3800): [0.0, 5.0, 5.0], (2800, 1500): [25.0, 5.0, 75.0, 10.0], (5200, 3100): [0.0, 0.0, 0.0, 60.0, 0.0], (3600, 0): [0.0], (8500, 4100): [-1.0], (1200, 900): [35.0, 100.0, 40.0, 40.0, 45.0], (7400, 1500): [-1.0, -1.0], (4500, 1100): [0.0], (7600, 4100): [-1.0, 0.0], (5700, 1200): [5.0], (5200, 3200): [0.0, 0.0, 0.0, 55.0, 0.0, 0.0], (5300, 3000): [15.0, 0.0, -1.0], (2200, 800): [5.0], (8100, 5500): [-1.0, 10.0], (8600, 500): [-1.0, -1.0], (5400, 3600): [0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6500, 2000): [-1.0, -1.0], (3000, 700): [10.0], (7500, 1100): [-1.0, -1.0], (2900, 800): [15.0], (7300, 2500): [-1.0], (5900, 3600): [35.0, 0.0, 0.0, 0.0], (6800, 1100): [-1.0], (5500, 2500): [0.0, -1.0], (7400, 300): [-1.0], (8000, 700): [-1.0], (5900, 1800): [-1.0], (5300, 800): [0.0], (6800, 3600): [0.0, -1.0, -1.0, -1.0], (6400, 2200): [-1.0, 0.0], (6800, 2400): [10.0, 0.0], (8200, 700): [-1.0, -1.0], (2300, 800): [0.0, 25.0], (7500, 4700): [0.0, 0.0, 0.0, 0.0], (7700, 2000): [-1.0], (3600, 2600): [30.0, 35.0, 10.0, 0.0, 15.0], (7500, 4000): [-1.0, 25.0, 5.0], (3000, 200): [0.0, 5.0, 10.0], (4200, 700): [0.0], (5100, 600): [0.0, 0.0], (4300, 2200): [10.0], (4600, 2600): [10.0, 0.0], (6700, 3400): [-1.0, 0.0, -1.0], (8600, 5800): [-1.0], (2600, 1400): [5.0, 25.0, 35.0], (2800, 2200): [15.0], (5300, 1500): [-1.0], (3100, 2300): [0.0, 10.0, 15.0, 35.0, 5.0], (7100, 2400): [-1.0], (7400, 2600): [-1.0, -1.0], (2600, 1700): [30.0, 15.0, 20.0, 65.0, 25.0, 0.0, 15.0, 10.0, 5.0, 15.0], (8200, 2700): [-1.0, 0.0], (7700, 5100): [-1.0, -1.0], (6500, 2600): [0.0, 0.0, -1.0], (4800, 3300): [0.0, 10.0, 0.0, 0.0, 10.0, 70.0, 0.0, 5.0], (4300, 1100): [0.0], (2400, 1900): [55.0, 40.0], (1900, 1300): [5.0, 20.0, 50.0, 25.0, 90.0, 10.0, 65.0, 10.0, 15.0, 85.0], (4100, 3000): [5.0, 5.0, 25.0, 10.0], (3100, 1200): [10.0], (3900, 3000): [0.0, 35.0, 5.0, 20.0], (4400, 400): [0.0], (5300, 2200): [0.0, 0.0], (7200, 3800): [0.0], (8800, 800): [-1.0], (4500, 0): [0.0, 0.0, 0.0], (4400, 1600): [0.0, 5.0], (6100, 4200): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7400, 2800): [-1.0], (4400, 2200): [5.0, 5.0, 0.0, 0.0], (6100, 3600): [0.0], (2200, 1000): [25.0], (1400, 800): [40.0], (1500, 1200): [55.0], (8600, 3100): [-1.0, -1.0], (5900, 400): [-1.0], (8900, 5000): [-1.0, 0.0, -1.0], (8700, 5600): [-1.0, 45.0, 80.0, -1.0], (8000, 5100): [0.0, -1.0], (6100, 2400): [-1.0], (5700, 4800): [20.0], (2600, 200): [-1.0, 5.0], (2000, 500): [20.0, 25.0, 20.0], (4800, 3000): [0.0, 0.0], (8300, 5000): [20.0, -1.0, 0.0, 0.0, -1.0], (2800, 500): [0.0, 5.0], (7800, 4700): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0], (8000, 2200): [-1.0, -1.0], (7900, 2700): [-1.0], (5800, 3700): [-1.0, -1.0, 0.0, 10.0, 0.0, 20.0, 5.0, 20.0], (4900, 3800): [0.0, 15.0, 0.0], (8400, 800): [-1.0, -1.0, -1.0], (6300, 300): [-1.0, -1.0], (7800, 2900): [-1.0], (6400, 1600): [0.0, -1.0], (1400, 200): [15.0], (8700, 4500): [0.0], (4700, 900): [0.0], (7800, 1100): [-1.0, -1.0], (6900, 900): [-1.0], (2700, 500): [0.0], (7300, 3900): [30.0, 20.0, 0.0], (4800, 1500): [0.0], (4300, 2400): [10.0, 5.0, 35.0], (8000, 2400): [-1.0], (4700, 2800): [0.0, 15.0, 5.0, 45.0, 0.0, 0.0], (4700, 2900): [0.0, 0.0, 0.0, 65.0, 5.0], (6200, 1200): [0.0, -1.0], (8000, 4200): [-1.0, -1.0, -1.0, -1.0, -1.0], (1900, 1400): [15.0, 30.0, 60.0, 20.0, 0.0, 0.0], (1800, 700): [45.0, 35.0], (6700, 3700): [-1.0, -1.0, 0.0, 5.0], (3900, 2700): [10.0, 0.0, 15.0, 15.0, 5.0, 5.0, 0.0, 0.0], (8800, 3800): [-1.0, 0.0, -1.0, -1.0], (5400, 3100): [5.0, 5.0, -1.0, 0.0], (6300, 4100): [-1.0, 5.0, 0.0], (4200, 800): [0.0], (6100, 400): [-1.0], (4200, 0): [-1.0], (1200, 400): [0.0, 25.0, 5.0], (6000, 1400): [0.0], (6500, 4700): [-1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (6600, 2000): [-1.0], (7400, 1900): [-1.0], (1100, 400): [65.0], (7700, 3800): [-1.0, -1.0], (1900, 1200): [75.0], (5500, 2900): [10.0], (8700, 4000): [-1.0, -1.0, 10.0], (7400, 1200): [0.0, -1.0], (5200, 3500): [0.0, 0.0, 0.0, 0.0, 65.0, 5.0, 5.0, 5.0, 20.0, 0.0, -1.0, 35.0, 0.0], (8500, 1100): [-1.0], (7600, 1800): [-1.0], (5400, 1600): [0.0, -1.0, 0.0], (3000, 100): [10.0, 0.0], (6600, 5000): [-1.0], (7200, 2800): [-1.0, 0.0], (8000, 3200): [-1.0, -1.0, -1.0], (7000, 4800): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0], (2100, 400): [0.0], (4700, 2700): [0.0, 0.0], (8400, 2300): [-1.0], (2900, 2200): [45.0, 25.0, 10.0, 25.0], (3200, 300): [5.0], (5700, 300): [0.0, 0.0], (7600, 2100): [-1.0, 5.0, -1.0], (4900, 2900): [0.0, 5.0, 0.0, 0.0], (7900, 3200): [-1.0], (7900, 4600): [5.0], (5200, 400): [0.0], (1100, 800): [15.0, -1.0, -1.0, 10.0], (7100, 4000): [0.0, -1.0, 20.0, -1.0], (7300, 400): [-1.0, -1.0], (4600, 3000): [0.0, 15.0, 10.0, 0.0, 0.0, 5.0, 0.0, 35.0, 5.0], (7900, 500): [-1.0], (8800, 5700): [0.0], (3700, 2500): [15.0, 0.0, 40.0, 5.0, 20.0, 50.0, 0.0, 0.0, 5.0, 10.0], (2200, 1300): [65.0, 5.0], (8900, 500): [-1.0, -1.0], (7300, 1100): [-1.0], (3700, 1300): [0.0], (4800, 300): [0.0], (7100, 4500): [-1.0, 5.0, 0.0, -1.0, -1.0, 0.0], (900, 600): [25.0, 10.0, 75.0, 65.0, 95.0, 15.0, 50.0, 50.0, 80.0], (8800, 1500): [-1.0], (4000, 1400): [0.0], (6800, 5000): [10.0], (200, 0): [-1.0], (6200, 3900): [10.0, -1.0, 0.0, 0.0, -1.0], (5500, 4500): [45.0], (8300, 5100): [-1.0, 0.0, -1.0, -1.0], (5000, 3700): [0.0, 35.0], (7100, 2100): [-1.0, 0.0], (6800, 500): [-1.0, -1.0, -1.0], (6800, 2200): [-1.0, -1.0], (7000, 4500): [0.0, 5.0, 5.0, 10.0, 0.0, 0.0], (5100, 3100): [0.0, 0.0, 0.0], (3000, 1500): [10.0], (8900, 5700): [40.0, -1.0], (4300, 2500): [0.0, 5.0, 0.0, 15.0], (3900, 800): [0.0, 0.0], (6700, 3900): [0.0, 10.0, -1.0, 0.0], (7600, 4300): [-1.0], (7100, 4700): [5.0, 0.0, 5.0], (5500, 4400): [10.0], (3500, 2000): [35.0, 30.0], (2000, 1000): [80.0, 5.0], (8500, 0): [-1.0, -1.0], (8000, 3600): [0.0], (5500, 3200): [0.0, 10.0, 0.0, 0.0], (3600, 1500): [5.0, 5.0], (4100, 1600): [10.0, 0.0], (5800, 1400): [-1.0, 0.0, 0.0], (3400, 1100): [25.0, 0.0], (5200, 200): [0.0], (7800, 3200): [-1.0], (5900, 3800): [-1.0, 5.0, 0.0, 15.0, 45.0, 0.0], (8600, 4600): [-1.0], (4000, 1700): [0.0, 5.0, 0.0, 0.0], (3700, 2700): [20.0, 10.0], (3500, 0): [0.0], (2300, 0): [5.0], (8800, 3200): [-1.0, -1.0], (4000, 3500): [15.0], (8600, 5000): [5.0, 0.0, 0.0, 0.0, -1.0, 0.0], (5600, 1200): [-1.0], (3100, 1000): [0.0, 5.0], (8100, 5600): [0.0], (2800, 2000): [25.0, 25.0, 20.0, 0.0, 5.0, 0.0], (5000, 200): [0.0], (3000, 1200): [10.0], (2200, 100): [15.0], (5200, 1000): [-1.0, -1.0], (6900, 4700): [0.0, 0.0, 0.0], (6500, 1300): [0.0, -1.0], (5100, 2900): [0.0, 0.0, 20.0, 5.0, 0.0, 0.0], (5300, 3800): [20.0, 0.0, 0.0, 0.0], (6700, 4600): [25.0, 0.0, -1.0], (6200, 3800): [0.0, 0.0, 0.0], (4600, 2400): [20.0], (8900, 3800): [-1.0], (7700, 2800): [-1.0], (1600, 800): [35.0, 20.0], (5500, 4200): [20.0, 10.0], (8100, 1100): [-1.0, -1.0], (6700, 200): [-1.0], (2800, 2100): [0.0, 5.0, 0.0, 10.0, 5.0, 15.0, 0.0, 40.0], (7200, 5000): [10.0, -1.0], (2900, 2000): [10.0, 0.0, 5.0, 25.0, 0.0, 35.0, 30.0, 45.0, 35.0, 20.0, 70.0, 30.0, 20.0, 15.0, 25.0], (6000, 4400): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0], (5700, 3400): [0.0], (4700, 800): [0.0, 0.0], (8100, 5100): [0.0, -1.0, 0.0, 0.0, 0.0], (3300, 2200): [10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 15.0, 25.0, 5.0], (1300, 100): [0.0, 5.0, 15.0], (7100, 1900): [-1.0], (8700, 3600): [0.0, -1.0, -1.0, -1.0], (8200, 5100): [0.0, 0.0, -1.0, 0.0, -1.0, -1.0], (5600, 1900): [0.0], (5200, 3900): [0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0], (5300, 700): [0.0, 0.0], (5000, 3600): [0.0, 0.0, 0.0, 20.0], (5900, 4100): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (8700, 3100): [-1.0, -1.0], (8200, 1900): [0.0, -1.0], (5200, 2900): [0.0, 0.0], (5000, 2100): [0.0], (8300, 900): [-1.0], (8400, 3700): [0.0, -1.0], (4700, 1800): [-1.0], (6800, 700): [-1.0], (5000, 3300): [15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0], (7400, 3000): [-1.0, -1.0, -1.0], (8400, 4900): [-1.0, -1.0, -1.0], (8600, 3200): [-1.0], (5700, 600): [0.0], (5200, 800): [0.0], (8200, 5500): [0.0], (3100, 300): [0.0], (6800, 1900): [0.0], (4200, 2200): [0.0, 0.0, 0.0, 0.0, 0.0], (8700, 2800): [-1.0, -1.0], (7800, 5200): [0.0, 5.0], (2700, 1300): [5.0, 5.0], (8000, 2700): [-1.0], (7000, 200): [-1.0], (3700, 1000): [10.0, 5.0, 0.0], (3800, 2200): [35.0, 0.0], (4500, 1200): [0.0], (7800, 3400): [0.0, -1.0], (5500, 3600): [5.0, 5.0, 35.0, 0.0], (5300, 4500): [0.0], (6900, 2400): [0.0, -1.0], (5800, 3400): [-1.0, 0.0, 0.0], (1800, 200): [-1.0], (6200, 3500): [25.0, -1.0, 0.0, 10.0], (6400, 100): [-1.0, -1.0], (7800, 1600): [-1.0], (7500, 5000): [0.0, 0.0, 55.0, -1.0], (3300, 900): [40.0], (2400, 500): [0.0, 5.0], (6100, 4500): [0.0, 0.0, 0.0, 75.0, 0.0], (8300, 5800): [-1.0], (6100, 3900): [0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (8400, 700): [-1.0, -1.0, -1.0], (8000, 3000): [-1.0], (6500, 600): [-1.0, -1.0], (1800, 1200): [5.0, 0.0, 50.0, 50.0, 65.0, 35.0, 25.0, 35.0, 95.0], (7600, 5500): [5.0, 0.0], (4100, 2300): [0.0, 0.0], (4600, 1500): [0.0], (7600, 4700): [0.0, 0.0, -1.0], (4000, 2300): [5.0, 0.0], (7600, 3800): [-1.0, -1.0, 0.0, 10.0], (5200, 2500): [0.0], (8100, 1700): [-1.0], (8700, 3500): [0.0, -1.0], (6300, 3100): [0.0], (2900, 1400): [15.0], (7900, 2800): [-1.0], (5000, 3100): [15.0, 0.0, 0.0, 15.0, 15.0], (7600, 2300): [-1.0, 0.0], (5100, 2500): [0.0, 15.0], (5400, 0): [0.0], (5400, 600): [-1.0], (4700, 1900): [5.0], (8100, 5000): [5.0], (8600, 4200): [0.0, -1.0, -1.0], (7500, 0): [-1.0, -1.0, -1.0], (5900, 2400): [0.0], (3300, 1000): [0.0, 0.0], (3000, 600): [5.0], (4700, 3200): [35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0], (6000, 2700): [25.0, 10.0, -1.0, -1.0], (5000, 3000): [0.0, 10.0, 5.0, 0.0], (7000, 2500): [-1.0, -1.0], (7200, 2100): [-1.0], (8300, 400): [-1.0], (4000, 2100): [10.0, 5.0], (7000, 3800): [0.0, -1.0, -1.0], (7000, 0): [-1.0, -1.0], (3700, 1700): [0.0, 0.0], (8800, 4500): [0.0, 0.0, 0.0, -1.0], (8000, 5300): [0.0, -1.0], (3600, 700): [0.0], (2800, 800): [0.0], (3400, 700): [0.0, 0.0], (3900, 2200): [15.0, 0.0, 0.0, 0.0, 10.0], (5600, 3100): [0.0, 0.0], (3600, 200): [0.0], (8600, 1500): [-1.0, -1.0], (4000, 3300): [70.0], (5000, 3200): [0.0, 0.0, 0.0, 0.0], (8100, 1200): [-1.0, -1.0, -1.0], (7400, 3400): [-1.0, -1.0, -1.0], (8400, 2100): [-1.0, -1.0, -1.0, 5.0], (5100, 2200): [0.0], (7300, 2900): [-1.0], (6300, 3800): [0.0, 15.0, -1.0, -1.0, 0.0], (5500, 500): [0.0], (5200, 2200): [0.0, 0.0, 0.0, 0.0], (8200, 5400): [5.0, 0.0], (8800, 3500): [-1.0, -1.0], (5800, 1900): [-1.0, 0.0, -1.0, 10.0], (6100, 4600): [0.0], (8000, 1900): [-1.0], (8500, 5500): [0.0, 0.0], (8600, 4800): [-1.0], (8400, 4500): [-1.0, -1.0, -1.0], (7400, 4100): [0.0, 45.0], (6100, 4400): [-1.0, 0.0, -1.0, 0.0, 0.0], (3200, 1600): [5.0, 15.0, 5.0, 10.0, 0.0], (7400, 3100): [-1.0], (2100, 600): [55.0], (6100, 200): [-1.0], (3000, 2000): [65.0, 40.0, 5.0, 25.0], (6800, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0], (6800, 3200): [-1.0, -1.0, -1.0], (3800, 2600): [5.0, 10.0, 0.0], (5300, 4200): [15.0], (6100, 4000): [25.0, -1.0, -1.0, 0.0], (3500, 200): [0.0], (8500, 1900): [0.0, 0.0, -1.0], (3800, 600): [5.0], (2000, 900): [60.0, 30.0, 20.0, 20.0], (5200, 1700): [0.0, 5.0], (8000, 2000): [-1.0], (4700, 400): [0.0], (3500, 800): [0.0], (7000, 2100): [-1.0], (8100, 700): [-1.0, -1.0], (6500, 3700): [10.0], (8700, 800): [-1.0, -1.0], (4300, 3000): [5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0], (4300, 100): [0.0], (6200, 2700): [-1.0, -1.0], (4900, 2100): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (6900, 4000): [-1.0], (7600, 400): [-1.0, -1.0, -1.0], (5600, 2900): [0.0, 10.0, 0.0], (6100, 3000): [0.0, 0.0], (8700, 2400): [-1.0], (7100, 3200): [-1.0], (7600, 2200): [0.0, -1.0], (6400, 2300): [-1.0, 0.0], (6200, 4100): [40.0, -1.0, 50.0, 0.0, 0.0], (6800, 2600): [15.0, 0.0, -1.0, -1.0, 0.0], (8900, 1800): [-1.0, -1.0, -1.0], (8800, 100): [-1.0], (3000, 1700): [5.0, 0.0], (700, 500): [20.0, 55.0, 30.0, 20.0, 100.0, 15.0], (2900, 1800): [20.0, 65.0], (7400, 2000): [-1.0], (5700, 3200): [-1.0], (1800, 600): [40.0, 50.0], (4000, 2900): [0.0, 15.0, 5.0, 20.0, 10.0, 5.0, 0.0, 15.0], (1500, 700): [20.0, 10.0], (8200, 200): [-1.0], (2100, 1400): [65.0, 10.0, 25.0, 25.0, 55.0, 30.0, 0.0, 30.0], (5000, 2900): [5.0, 10.0, 0.0], (6400, 4400): [0.0, 5.0, 15.0, -1.0, 0.0], (6600, 3900): [0.0, -1.0, 0.0], (7500, 3800): [-1.0], (8500, 4400): [-1.0, -1.0, -1.0, -1.0], (6100, 1800): [0.0, 0.0], (6700, 4200): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0], (5800, 2900): [-1.0, -1.0], (5900, 1900): [0.0], (8600, 2900): [-1.0, -1.0], (5800, 2000): [-1.0], (4100, 700): [0.0], (6800, 900): [-1.0], (6400, 800): [-1.0], (8100, 100): [-1.0, -1.0, -1.0], (7500, 2400): [-1.0], (8500, 800): [-1.0, -1.0], (7100, 4200): [-1.0], (3400, 1800): [10.0, 10.0, 20.0, 5.0], (5300, 3900): [0.0, 0.0, 20.0], (500, 200): [45.0], (7200, 3400): [0.0, -1.0, 50.0, -1.0], (5100, 1300): [5.0, -1.0], (8500, 5300): [-1.0, -1.0], (7400, 100): [-1.0], (8000, 1300): [-1.0], (4300, 2700): [0.0, 0.0, 0.0, 0.0], (7600, 3900): [0.0, 10.0, -1.0], (4200, 1800): [0.0, 0.0], (4700, 1700): [0.0], (2000, 1500): [10.0, 35.0, 30.0, 65.0, 5.0], (3800, 800): [0.0, 5.0, 0.0], (3600, 100): [5.0, 0.0], (7200, 400): [-1.0], (6700, 4100): [-1.0, -1.0, -1.0], (1300, 1000): [10.0], (4400, 600): [0.0], (4600, 3700): [0.0, 0.0], (6300, 4600): [-1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0], (1700, 700): [-1.0], (2200, 1200): [20.0], (3600, 1000): [5.0, 5.0], (6000, 700): [-1.0, 0.0, 0.0], (7100, 5100): [0.0, -1.0], (6900, 4300): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (2700, 0): [5.0], (600, 300): [35.0, 50.0, 0.0, 85.0, 95.0, 35.0], (1500, 1000): [0.0, 5.0, 40.0, 0.0, 15.0, 0.0], (6300, 700): [-1.0], (6200, 2100): [-1.0, -1.0, -1.0], (3600, 2800): [0.0, 10.0], (8300, 4000): [-1.0], (8700, 2300): [-1.0], (6600, 2400): [-1.0], (6100, 1600): [-1.0], (3600, 2900): [5.0], (7500, 900): [-1.0], (8600, 1100): [-1.0, -1.0], (5500, 4300): [10.0], (5900, 200): [-1.0, -1.0, -1.0, -1.0], (6700, 4500): [-1.0, -1.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0], (7800, 3900): [-1.0, -1.0], (8300, 2700): [-1.0], (7800, 3500): [-1.0], (6400, 3300): [20.0, -1.0], (8500, 3500): [-1.0], (7300, 1400): [-1.0], (8900, 3600): [0.0, -1.0], (8800, 2000): [-1.0], (8000, 200): [-1.0], (4800, 3100): [0.0, 0.0, 15.0, 5.0, 0.0], (7500, 4500): [0.0, -1.0], (4800, 500): [0.0], (6600, 4000): [0.0, -1.0, 0.0, -1.0, 0.0, 5.0], (7800, 900): [-1.0, -1.0], (6700, 400): [-1.0], (6100, 2700): [-1.0, -1.0, 0.0, 0.0], (6500, 1400): [-1.0], (5400, 3000): [-1.0], (8600, 4000): [-1.0, -1.0, -1.0, -1.0], (4700, 3000): [20.0, 0.0], (3500, 2700): [20.0, 0.0], (7300, 5000): [5.0, 0.0], (5700, 3300): [0.0, 0.0, 15.0, 0.0, 20.0], (7400, 2700): [-1.0, -1.0, -1.0], (5400, 4100): [15.0, 0.0, -1.0], (8300, 1300): [-1.0, -1.0], (7700, 5000): [-1.0, -1.0, -1.0], (7800, 2500): [-1.0, -1.0, 0.0], (8400, 2700): [-1.0, -1.0, 0.0], (5000, 1200): [-1.0], (8200, 1100): [-1.0, -1.0], (7800, 2300): [-1.0, -1.0], (5000, 1300): [0.0, -1.0, 0.0], (6900, 3900): [25.0, 0.0, -1.0, 0.0, 0.0], (3100, 1600): [0.0, 0.0, 0.0, 15.0], (4500, 2800): [0.0, 0.0, 15.0, 5.0], (5900, 3400): [0.0, 0.0, 0.0, -1.0], (6600, 4600): [0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0], (7200, 5300): [10.0], (7900, 1700): [-1.0], (4600, 3600): [10.0, 0.0, 0.0], (7700, 2700): [-1.0], (7000, 4100): [-1.0, 85.0, 5.0, 0.0, 0.0], (8400, 4800): [0.0, -1.0, -1.0], (5200, 1600): [-1.0, 0.0], (4600, 3400): [10.0, 0.0, 0.0, 0.0, 5.0], (8000, 1100): [-1.0, -1.0], (8200, 4700): [0.0, 0.0, 0.0, -1.0], (4400, 2700): [0.0, 5.0, 5.0, 10.0], (8200, 500): [-1.0], (5900, 300): [-1.0], (3800, 2900): [10.0, 5.0, 5.0, 10.0], (6900, 300): [-1.0, -1.0, -1.0], (6100, 4700): [0.0], (8200, 5600): [15.0], (7900, 1500): [-1.0], (5100, 3000): [-1.0, 10.0], (8800, 2700): [-1.0], (8200, 2600): [-1.0], (5900, 2800): [35.0, -1.0], (4300, 1400): [5.0], (6000, 1100): [-1.0, -1.0], (7900, 1300): [-1.0], (7900, 3900): [-1.0, -1.0, -1.0], (6400, 4300): [-1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 35.0], (2500, 1500): [-1.0, 0.0, 5.0, 5.0, 5.0], (4000, 2500): [5.0, 5.0, 5.0, 5.0], (4100, 2900): [5.0, 20.0, 5.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 30.0, 0.0], (8300, 3100): [-1.0], (7600, 3700): [5.0], (8500, 1400): [-1.0, -1.0], (4600, 2800): [5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7300, 4300): [35.0], (1500, 500): [15.0], (5600, 3800): [10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2200, 1100): [10.0, 5.0], (8200, 1700): [-1.0], (6400, 2900): [0.0], (6500, 4800): [-1.0, -1.0], (6700, 700): [-1.0], (7800, 300): [-1.0], (7300, 3600): [-1.0, 0.0, 0.0, 15.0], (8400, 900): [-1.0, -1.0], (3700, 400): [5.0, 0.0], (4000, 0): [-1.0, -1.0], (4500, 3400): [0.0, 0.0, 20.0, 10.0, 5.0, 20.0], (6200, 3100): [-1.0, 0.0], (1600, 200): [20.0], (4600, 400): [-1.0], (5600, 200): [-1.0], (6500, 2700): [0.0], (6700, 800): [-1.0, -1.0], (7300, 4200): [0.0], (1600, 400): [0.0], (5300, 3400): [0.0, 0.0, 0.0, 30.0], (4300, 3100): [0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0], (7300, 5100): [0.0, -1.0, -1.0], (3600, 400): [0.0], (6400, 1300): [-1.0], (2100, 1000): [0.0, 20.0, 100.0], (800, 300): [20.0], (8000, 5200): [10.0, 0.0, 0.0, -1.0], (8900, 4600): [-1.0, -1.0, -1.0, 15.0], (1000, 500): [50.0, 50.0], (6500, 3800): [0.0], (7900, 2200): [0.0, -1.0], (5700, 2900): [-1.0], (2900, 2100): [0.0, 25.0, 5.0, 100.0, 50.0, 20.0], (6000, 1000): [-1.0], (6300, 4200): [25.0, 0.0, -1.0, -1.0], (6400, 4800): [0.0, 0.0, 0.0], (8300, 4900): [-1.0, -1.0, -1.0], (4900, 1900): [10.0], (6200, 400): [-1.0], (1400, 400): [10.0, 0.0, 5.0, 35.0], (8200, 3300): [0.0, 45.0], (8400, 5800): [0.0], (5800, 4300): [0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 45.0, 0.0, 55.0, 5.0, 10.0], (7900, 3300): [-1.0], (5400, 4300): [0.0], (8700, 5300): [-1.0, -1.0, -1.0, 0.0], (8500, 4000): [-1.0], (2200, 300): [0.0], (6300, 4000): [-1.0, 0.0, 35.0, 40.0, -1.0, 15.0, 0.0, 0.0], (5000, 600): [0.0, 0.0], (7400, 4500): [0.0, -1.0, -1.0], (7700, 5500): [0.0], (3100, 1700): [0.0, 5.0, 0.0, 5.0], (5500, 2400): [0.0, 5.0], (6900, 4600): [0.0, 0.0, 45.0, -1.0, -1.0], (5900, 600): [-1.0], (2200, 1400): [5.0, 10.0, 5.0, 50.0, 30.0, 5.0], (6400, 1000): [0.0, -1.0, -1.0], (3300, 300): [5.0, 5.0], (6600, 800): [-1.0, -1.0], (7100, 1200): [-1.0, -1.0, -1.0, -1.0], (7700, 400): [-1.0, -1.0], (7900, 4200): [-1.0, 0.0, 0.0], (8800, 2200): [-1.0, -1.0], (4600, 2200): [0.0], (8800, 5100): [-1.0, -1.0], (3700, 1100): [20.0], (6400, 4900): [0.0], (5700, 4500): [50.0], (4700, 2500): [10.0, 5.0], (8500, 5700): [-1.0], (3900, 0): [-1.0, -1.0], (5600, 3400): [10.0, 10.0, 0.0, 40.0], (3900, 2800): [10.0, 5.0], (4100, 1800): [0.0, 10.0], (6800, 2300): [-1.0, -1.0], (6800, 4000): [-1.0, 10.0, -1.0, 0.0, -1.0], (4800, 2500): [0.0, 0.0, 0.0, 0.0, 0.0], (4300, 1500): [0.0, 15.0, 0.0], (4900, 3200): [0.0, 25.0, 5.0, 0.0, 0.0, 0.0], (6100, 0): [-1.0, -1.0, -1.0], (2500, 1800): [0.0, 55.0, 25.0, 20.0, 0.0, 5.0, 30.0], (7600, 3400): [5.0, -1.0, -1.0, -1.0, 0.0], (3600, 1300): [0.0, 35.0], (7700, 2300): [-1.0], (3900, 2600): [25.0, 0.0, 40.0, 5.0, 15.0, 5.0, 25.0, 10.0, 0.0, 40.0], (3700, 1900): [5.0, 0.0, 20.0, 20.0], (3500, 700): [10.0], (4400, 2900): [10.0, 0.0, 0.0, 5.0], (5300, 4100): [5.0], (5900, 3900): [20.0, 0.0, 10.0, 30.0, 0.0, 0.0], (7200, 3900): [-1.0], (7900, 1900): [-1.0], (7500, 4800): [0.0, 0.0], (8000, 3700): [0.0, -1.0, -1.0], (4100, 2700): [65.0, 0.0, 5.0, 0.0, 0.0, 0.0], (8900, 5500): [-1.0, 5.0], (3400, 800): [0.0], (8600, 5500): [5.0], (3200, 1400): [15.0], (8500, 4700): [-1.0], (6900, 5000): [0.0, 0.0], (4600, 3200): [0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 1500): [0.0], (6200, 3200): [20.0], (5200, 2000): [-1.0, 0.0, -1.0], (7800, 4200): [0.0, 0.0], (3800, 1200): [0.0, 0.0, 0.0], (6300, 3600): [-1.0, -1.0], (3800, 200): [0.0, 0.0], (7700, 3100): [-1.0], (6900, 4100): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (3500, 1800): [5.0, 0.0, 0.0], (1700, 500): [85.0], (4200, 1700): [15.0], (6000, 4100): [0.0, 0.0, 0.0], (8100, 3600): [0.0], (6900, 2900): [-1.0], (0, 0): [-1.0], (5500, 200): [0.0, -1.0], (6000, 3200): [0.0, 0.0], (6300, 500): [-1.0, -1.0, -1.0, -1.0], (6900, 200): [-1.0], (7100, 1400): [-1.0, -1.0], (8700, 2900): [-1.0], (8400, 5100): [-1.0, -1.0, 0.0, -1.0], (3600, 2000): [0.0, 5.0], (1400, 700): [60.0, 75.0, 10.0, 50.0], (5600, 600): [0.0], (8000, 4300): [-1.0], (7400, 5000): [0.0, 0.0, 0.0], (7500, 400): [-1.0, -1.0], (6600, 400): [-1.0], (7800, 5100): [-1.0, -1.0, -1.0], (6900, 2600): [0.0], (8500, 5200): [0.0, 15.0, -1.0, 55.0], (7800, 5000): [-1.0, 0.0, 0.0], (4900, 3400): [-1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0], (7600, 4200): [-1.0, -1.0, 10.0], (2500, 1300): [15.0, 5.0], (8100, 4500): [0.0, 0.0], (3700, 800): [0.0, 0.0, 0.0], (4800, 2800): [0.0, 0.0, 0.0, 0.0, 0.0], (6300, 0): [-1.0], (6900, 1200): [-1.0, -1.0], (4900, 3500): [0.0, 0.0, 0.0, 0.0], (7100, 100): [-1.0, -1.0], (5600, 2100): [0.0, -1.0], (6700, 4400): [0.0, 0.0], (8600, 4300): [-1.0], (6500, 900): [-1.0], (8500, 1600): [0.0], (7300, 2700): [-1.0, -1.0, 0.0], (8200, 2500): [-1.0], (8800, 4300): [0.0, 0.0], (6800, 3800): [0.0, 0.0, 0.0], (2400, 700): [40.0], (8100, 4700): [0.0, 0.0, -1.0], (7800, 200): [-1.0, -1.0], (8700, 5500): [-1.0], (7500, 200): [-1.0], (2700, 200): [10.0], (5500, 3000): [-1.0, 0.0, 0.0, 20.0], (3900, 700): [0.0, 5.0, 0.0], (5700, 2800): [55.0, -1.0], (8600, 3000): [25.0, 0.0], (7900, 3600): [-1.0], (8800, 5000): [-1.0, -1.0, 10.0, -1.0], (2600, 100): [0.0, 20.0], (3900, 900): [0.0], (5600, 4000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (5400, 1000): [0.0], (8900, 5400): [-1.0, 0.0, -1.0, 0.0, 0.0], (1200, 700): [5.0, 25.0, 70.0, 15.0, 35.0, 10.0], (7700, 4000): [-1.0, 0.0, -1.0], (6400, 4100): [-1.0, 10.0, 0.0, 0.0], (8200, 2200): [-1.0, -1.0], (7700, 3700): [-1.0], (5800, 3600): [30.0, 10.0], (4700, 600): [-1.0, 0.0], (3500, 2300): [5.0, 10.0, 5.0, 5.0, 5.0, 25.0, 20.0, 0.0], (2800, 400): [-1.0], (5300, 3700): [20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 45.0], (4200, 3400): [5.0, 0.0], (2900, 0): [-1.0, 0.0], (2500, 1900): [10.0, 35.0, 40.0, 15.0, 40.0, 20.0], (3000, 1600): [20.0, 25.0, 20.0, 15.0], (4000, 800): [0.0, 0.0], (8700, 4900): [-1.0, 0.0], (7000, 3100): [-1.0, -1.0, 0.0, -1.0], (4400, 3400): [0.0], (5200, 2600): [65.0, 0.0, -1.0, 0.0], (8200, 3700): [-1.0, -1.0], (6900, 4500): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (2400, 1200): [20.0, 5.0, -1.0, -1.0], (4200, 2300): [10.0, 0.0, 5.0, 0.0], (1500, 100): [5.0], (8200, 4900): [-1.0, 0.0], (4600, 1400): [0.0], (2400, 0): [0.0, 5.0, 10.0, 10.0], (4700, 1000): [0.0], (8600, 4400): [-1.0], (2100, 1300): [45.0, 15.0, 15.0, 40.0, 35.0], (3800, 2300): [0.0, 15.0, 0.0], (4700, 3700): [15.0], (3400, 2300): [5.0, 30.0, 0.0, 45.0, 0.0, 10.0, 15.0], (7700, 4100): [0.0, 0.0], (8800, 700): [-1.0, -1.0], (4100, 2400): [5.0], (3600, 900): [0.0, 0.0], (6600, 3200): [0.0, 0.0], (5500, 900): [0.0], (5700, 3000): [0.0, 0.0], (2200, 1600): [70.0, 45.0, 20.0, 60.0, 80.0, 30.0, 15.0], (3600, 2700): [0.0, 5.0, 0.0, 20.0, 0.0, 15.0], (5600, 1700): [-1.0, -1.0], (500, 300): [65.0, 65.0, 0.0, 75.0, 90.0, 40.0, 50.0, 95.0, 100.0, 20.0], (6300, 2800): [-1.0], (2000, 200): [10.0], (4600, 900): [0.0], (2600, 1800): [25.0, 5.0, 45.0, 15.0], (5100, 2600): [0.0, 0.0, 0.0, 0.0, 20.0], (700, 100): [-1.0], (8300, 4800): [-1.0, -1.0, -1.0], (7300, 4900): [-1.0, -1.0, 0.0, 0.0, 0.0], (5100, 1800): [0.0, -1.0], (2900, 2300): [10.0, 25.0], (3100, 2400): [20.0, 10.0, 20.0], (8800, 1100): [-1.0], (7500, 4200): [0.0, -1.0, 20.0, -1.0, 0.0], (6300, 100): [-1.0], (6800, 2800): [-1.0], (7200, 4500): [-1.0, 0.0, -1.0, 0.0], (2900, 500): [25.0, 50.0], (5400, 100): [0.0, 0.0], (5200, 2400): [-1.0], (6300, 4300): [0.0, 0.0], (6700, 3600): [-1.0, 10.0, -1.0], (8600, 2400): [0.0], (5600, 400): [-1.0, 0.0, -1.0, -1.0], (8300, 2900): [-1.0], (8700, 1200): [-1.0], (8100, 2600): [-1.0], (5400, 3700): [5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0], (8400, 5000): [-1.0, -1.0], (3500, 2200): [0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0], (7500, 3900): [-1.0], (6200, 1400): [0.0, -1.0], (7200, 900): [-1.0, -1.0], (8100, 500): [-1.0, -1.0], (6000, 300): [-1.0, -1.0, -1.0], (7500, 3100): [0.0, -1.0, -1.0], (7000, 2000): [-1.0], (1600, 300): [-1.0], (6600, 3400): [-1.0, 5.0, 0.0, 0.0, -1.0, -1.0], (6000, 2100): [0.0, -1.0], (6200, 3400): [5.0], (8100, 1600): [-1.0, -1.0], (5900, 2600): [0.0], (6000, 1200): [-1.0], (6200, 700): [0.0], (8200, 0): [-1.0, -1.0], (5700, 400): [-1.0], (5400, 3800): [0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0], (5300, 2500): [30.0], (3000, 2100): [25.0, 45.0, 0.0, 10.0, 20.0], (7100, 300): [-1.0], (5900, 1600): [-1.0, -1.0], (7500, 3000): [-1.0], (8500, 1300): [-1.0, -1.0], (2900, 1600): [5.0, 0.0, 10.0], (7500, 4100): [35.0, -1.0], (8200, 3600): [-1.0], (7700, 5200): [0.0, 0.0, 0.0, 0.0], (5500, 3300): [0.0, 10.0], (7600, 1000): [-1.0, -1.0], (5100, 3800): [30.0, 10.0, 0.0, 0.0, 20.0, 0.0], (5500, 2100): [0.0], (8300, 200): [-1.0], (4800, 700): [0.0], (7700, 3400): [-1.0, 0.0, -1.0, -1.0], (4800, 1700): [0.0, 0.0, 5.0], (6900, 3600): [-1.0], (5100, 2100): [0.0, 10.0, 30.0], (6800, 3300): [0.0, -1.0], (7700, 2400): [-1.0, -1.0, -1.0], (3800, 2700): [5.0, 0.0, 5.0, 10.0, 0.0, 30.0, 0.0, 5.0], (8700, 5200): [0.0, -1.0, -1.0], (7700, 1600): [-1.0], (4600, 300): [0.0, 0.0], (8600, 5300): [-1.0, 0.0, 5.0, -1.0], (5800, 4900): [0.0], (4800, 0): [0.0, 0.0, 0.0, 0.0], (8200, 3500): [-1.0], (5200, 100): [0.0], (5800, 4000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0], (6900, 0): [-1.0, -1.0], (7400, 600): [-1.0, -1.0], (7000, 300): [-1.0, -1.0], (8500, 2400): [-1.0], (8000, 3500): [5.0], (700, 400): [10.0, 10.0, 15.0, 5.0], (5600, 4200): [-1.0, 0.0], (7100, 2800): [-1.0], (4700, 2600): [10.0, 0.0], (7700, 3200): [-1.0, -1.0], (7700, 4700): [-1.0, 0.0], (5200, 3000): [10.0, 0.0, 0.0, -1.0, 0.0, 5.0], (7900, 5500): [-1.0], (1900, 0): [65.0, 5.0], (8600, 1000): [-1.0, -1.0], (3300, 2500): [25.0, 0.0, 15.0], (7600, 5300): [0.0], (2600, 1300): [0.0, 50.0, 0.0], (2900, 1100): [20.0, 5.0], (8600, 2500): [-1.0, -1.0], (4400, 2000): [0.0, 0.0, 0.0, 0.0], (3200, 2100): [50.0, 0.0, 0.0, 5.0, 0.0, 5.0], (6100, 3200): [0.0, 20.0, 0.0], (7000, 600): [-1.0, -1.0], (7500, 1200): [-1.0, -1.0], (3400, 1400): [25.0], (900, 500): [45.0, 45.0], (6200, 1300): [-1.0, -1.0], (7800, 5500): [0.0, -1.0, 0.0], (8100, 2200): [0.0], (7800, 2100): [0.0], (8700, 3700): [-1.0, -1.0, -1.0, -1.0], (1500, 800): [5.0, 15.0], (1500, 1100): [0.0, 5.0, 85.0, 0.0, 30.0], (6700, 1200): [-1.0], (8300, 3300): [-1.0, -1.0], (7800, 3700): [0.0], (600, 200): [80.0], (8300, 1500): [-1.0, -1.0, -1.0], (2800, 900): [30.0], (4200, 1100): [10.0, 0.0, 0.0], (7100, 5000): [0.0], (3500, 600): [0.0], (1600, 1200): [15.0], (7300, 2200): [0.0, -1.0], (6800, 3700): [10.0, -1.0], (4700, 3800): [0.0], (5700, 500): [-1.0], (3700, 3000): [25.0], (4500, 2000): [15.0, 10.0], (8600, 0): [-1.0], (7900, 5000): [-1.0, -1.0], (7000, 3900): [0.0, -1.0, -1.0], (7300, 3400): [-1.0, -1.0], (4500, 2900): [25.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0], (7100, 2600): [-1.0], (8200, 4200): [-1.0, -1.0, -1.0, -1.0], (7300, 2000): [-1.0], (2000, 1300): [40.0, 70.0, 0.0, 80.0, 85.0, 95.0], (7900, 100): [-1.0], (8000, 2900): [-1.0], (4200, 1900): [0.0, 5.0], (3900, 2900): [5.0, 0.0, 50.0], (4000, 3000): [0.0, 25.0, 0.0, 0.0], (1700, 1100): [20.0, 35.0, 70.0, 15.0, 65.0, 15.0], (2700, 2200): [25.0], (7900, 1600): [-1.0, -1.0], (8000, 2600): [0.0, -1.0], (3500, 2600): [15.0, 10.0], (4300, 2100): [0.0, 0.0], (5100, 3500): [0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0], (800, 500): [25.0, 30.0, 45.0, 80.0, 75.0], (6400, 200): [-1.0, -1.0], (6900, 3700): [-1.0, -1.0, -1.0, -1.0], (3400, 2100): [10.0, 5.0, 35.0, 0.0, 30.0], (5500, 3700): [0.0, 0.0, 0.0, 0.0], (6600, 4400): [30.0, 5.0, 10.0, 0.0, 0.0, 0.0], (5100, 3400): [5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0], (7200, 4800): [0.0, -1.0, 0.0, 0.0, -1.0], (5700, 1600): [-1.0], (4100, 500): [-1.0, 0.0], (6000, 4200): [0.0, 25.0, 0.0, 10.0, 0.0, 60.0, 0.0, 10.0, 0.0, 45.0, 0.0], (2000, 700): [5.0], (7400, 4200): [0.0, 0.0, 25.0], (2400, 1600): [0.0, 95.0, 50.0, 100.0, 40.0, 15.0, 15.0, 0.0], (7000, 4000): [-1.0, 15.0, 0.0, -1.0, -1.0, 0.0], (8500, 1500): [-1.0, 0.0], (5200, 3600): [35.0, 5.0, 0.0, 0.0, 0.0, 0.0], (4900, 2600): [0.0], (7500, 2700): [-1.0], (6800, 4700): [0.0, 0.0, -1.0, 0.0, 0.0, -1.0], (3300, 1900): [25.0, 0.0, 5.0], (7100, 4800): [0.0, 5.0, -1.0, 0.0], (8700, 300): [-1.0, -1.0, -1.0], (2900, 1200): [5.0], (8900, 5300): [-1.0], (7600, 4400): [-1.0, -1.0, 0.0, -1.0], (6600, 4300): [0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0], (7600, 300): [-1.0], (4700, 2000): [0.0, 0.0], (6400, 3800): [0.0, 0.0, 15.0, -1.0], (6100, 3800): [0.0, 0.0, 0.0, 15.0, 0.0], (2700, 600): [20.0, 0.0], (5600, 2600): [0.0, 0.0, 0.0], (6800, 0): [-1.0], (7300, 800): [-1.0], (6300, 4700): [0.0, 0.0], (6700, 2300): [-1.0], (1700, 1000): [25.0, 5.0, 25.0, -1.0, 65.0, 50.0, 15.0], (8300, 3000): [-1.0], (7700, 1300): [0.0, -1.0, -1.0], (4700, 3400): [20.0, 10.0, 20.0, 10.0, 45.0, 0.0, 15.0], (8800, 1200): [-1.0], (8100, 4900): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0], (8300, 5700): [0.0], (2600, 900): [5.0, 20.0], (5300, 300): [0.0, 0.0], (3500, 2400): [35.0, 40.0, 5.0, 0.0, 5.0, 30.0, 30.0], (8300, 4300): [0.0, -1.0, -1.0], (7300, 4400): [65.0, -1.0, 10.0], (5300, 1800): [5.0], (7300, 4800): [0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (8000, 1400): [-1.0], (4500, 1400): [0.0], (4200, 2900): [0.0, 10.0, 5.0, 5.0], (8300, 3700): [-1.0, -1.0], (6700, 2800): [-1.0], (4000, 900): [0.0], (3800, 0): [-1.0], (6000, 3500): [-1.0, 5.0, 10.0, 0.0], (4100, 1200): [5.0], (8700, 4100): [-1.0, -1.0, 0.0], (8300, 2400): [0.0], (5200, 3400): [10.0, 0.0, 0.0, 5.0, 0.0, 10.0], (8900, 4400): [-1.0], (2800, 1600): [25.0, 35.0, 15.0, 15.0, 25.0], (1900, 400): [40.0, 25.0, 20.0], (5200, 1300): [0.0], (2100, 300): [10.0, 65.0, -1.0, 20.0], (8200, 4100): [-1.0, -1.0, 0.0, -1.0], (4900, 1700): [0.0], (5800, 2700): [0.0, -1.0, 0.0, -1.0, -1.0], (6900, 4200): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (5900, 2700): [0.0], (7800, 4000): [-1.0], (8400, 3200): [-1.0], (1500, 300): [-1.0, 5.0], (3400, 1500): [0.0, 0.0, 5.0], (3800, 400): [10.0], (8100, 5300): [10.0], (8900, 5800): [0.0, -1.0], (2900, 400): [0.0], (7200, 1100): [0.0], (8400, 5600): [-1.0, 5.0, 0.0, 0.0], (7500, 4900): [15.0, -1.0], (2700, 1700): [25.0, 5.0, 0.0], (8200, 900): [-1.0], (1200, 300): [20.0, 15.0], (4100, 3300): [20.0, 45.0], (4300, 1700): [0.0, 0.0], (2400, 600): [-1.0], (8800, 1600): [-1.0], (4000, 1600): [0.0, 10.0], (6500, 4400): [0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0], (7000, 3400): [-1.0], (8900, 1200): [-1.0], (6200, 200): [-1.0], (8300, 1000): [-1.0], (7600, 2500): [0.0], (5400, 2600): [0.0], (4700, 2100): [0.0], (7700, 4200): [-1.0, 0.0], (4500, 2500): [0.0, 10.0, 0.0, 15.0, 10.0], (4300, 200): [0.0, 0.0], (1800, 800): [50.0], (5300, 1900): [0.0], (5400, 2500): [30.0, 0.0], (7000, 4400): [0.0, -1.0, 0.0, 10.0, 0.0], (1700, 1200): [30.0, 85.0], (1100, 100): [20.0], (8900, 0): [-1.0], (5400, 500): [0.0], (4000, 2600): [20.0, 20.0, 0.0, 5.0], (6800, 4300): [-1.0, -1.0, -1.0, -1.0, -1.0], (8700, 1900): [0.0], (4200, 2000): [5.0, 5.0, 20.0, 15.0], (7400, 3500): [-1.0, 0.0, -1.0], (3400, 2400): [5.0, 30.0, 35.0, 0.0, 10.0, 0.0, 35.0], (4400, 3100): [5.0, 0.0, 0.0, 0.0, 5.0, 5.0], (300, 100): [0.0], (5700, 3800): [5.0, 5.0, 40.0, 0.0, 0.0], (3100, 2200): [0.0, 10.0, 10.0, 5.0, 55.0, 20.0, 65.0, 25.0, 0.0], (6500, 1600): [-1.0], (2900, 1900): [25.0, 0.0, 30.0, 0.0, 30.0, 0.0, 5.0, 5.0, 65.0], (8400, 100): [-1.0], (7900, 3000): [-1.0, -1.0], (5000, 1600): [15.0], (6700, 3000): [-1.0], (6900, 4800): [-1.0, 0.0], (3200, 2000): [15.0, 5.0, 25.0, 0.0, 15.0], (3300, 2100): [45.0, 5.0, 0.0, 10.0, 10.0], (5400, 3400): [0.0, 10.0, 0.0], (5000, 100): [0.0], (8200, 400): [-1.0], (6300, 2500): [0.0, 0.0], (8400, 1700): [-1.0, -1.0, 0.0], (3700, 1400): [0.0, 0.0, 20.0], (3300, 2000): [0.0, 15.0], (5200, 4000): [0.0, 0.0, 0.0], (5300, 2900): [0.0], (3300, 1300): [5.0], (4300, 3400): [0.0], (1300, 700): [30.0, 30.0], (5500, 3900): [0.0, 15.0, 5.0, 15.0, 65.0, 0.0, 0.0, 0.0, 25.0], (7100, 1100): [-1.0, -1.0], (3700, 600): [15.0, 0.0, 0.0, 0.0], (8500, 2100): [-1.0, -1.0, -1.0], (5300, 3600): [0.0, 0.0, 0.0, 5.0, 10.0, -1.0], (6400, 0): [-1.0], (7200, 2900): [5.0], (600, 100): [5.0, 40.0], (3500, 1300): [5.0], (6900, 5100): [0.0], (1900, 500): [20.0], (6200, 4700): [0.0, 55.0], (7300, 3700): [0.0], (7600, 2600): [-1.0, -1.0, -1.0], (5900, 900): [0.0], (4300, 2800): [0.0, 0.0], (7800, 4800): [10.0, 15.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 10.0, -1.0], (6900, 4400): [5.0, 10.0], (4100, 100): [-1.0], (7000, 900): [0.0], (1800, 1000): [20.0], (8200, 1500): [-1.0, -1.0], (3100, 200): [-1.0, 0.0], (6600, 4900): [-1.0, 0.0], (8400, 1400): [-1.0], (5500, 2000): [-1.0, 0.0], (2700, 1900): [25.0, 0.0, 0.0, 30.0, 5.0, 25.0, 10.0, 20.0, 40.0, 25.0], (7000, 3300): [-1.0], (3400, 2600): [5.0, 20.0, 0.0, 0.0, 0.0, 30.0], (5500, 800): [0.0], (6100, 4100): [5.0], (7300, 4700): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0], (6300, 4800): [-1.0], (2600, 300): [5.0], (5800, 2300): [-1.0, 0.0], (6000, 3900): [0.0, -1.0, -1.0, 65.0, 0.0, 0.0, -1.0, 0.0, -1.0], (7200, 800): [-1.0, -1.0, -1.0], (4700, 3300): [10.0, 90.0, 0.0, 0.0, 5.0], (5200, 3800): [0.0, 10.0, 10.0, 15.0], (6400, 3400): [0.0, -1.0], (7500, 1000): [-1.0, -1.0], (1300, 600): [10.0], (7200, 4200): [0.0, -1.0, 25.0, -1.0], (6700, 3300): [-1.0], (1900, 800): [35.0], (8100, 4200): [-1.0, -1.0, -1.0], (6000, 1500): [-1.0], (7600, 4800): [0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0], (5900, 3100): [-1.0, 10.0, 15.0], (500, 0): [0.0, 40.0], (1600, 700): [30.0], (8600, 3400): [0.0, 0.0], (8300, 3500): [-1.0], (2800, 1800): [5.0, 20.0, 10.0, 0.0], (2300, 1000): [10.0], (4900, 3100): [0.0, 0.0, -1.0], (7300, 300): [-1.0], (7200, 4100): [-1.0, 10.0, 0.0, 0.0], (8200, 1200): [-1.0], (1700, 800): [10.0, 5.0, 20.0, 20.0], (7200, 3200): [-1.0], (5100, 2700): [5.0, 0.0], (5700, 3500): [-1.0, -1.0, 5.0, -1.0], (7900, 300): [-1.0, -1.0], (6600, 1300): [-1.0], (6200, 3000): [0.0, -1.0], (8600, 3300): [-1.0], (5100, 3900): [0.0, 10.0], (3200, 100): [-1.0], (4900, 1600): [0.0, -1.0], (4900, 1400): [-1.0, 0.0], (8500, 4300): [-1.0, 0.0], (400, 200): [5.0, 35.0, 10.0, 20.0, 65.0, 40.0], (2500, 200): [60.0], (3200, 1700): [5.0], (8800, 1000): [-1.0], (7900, 4500): [-1.0, 0.0, -1.0, -1.0], (6300, 1900): [0.0], (8100, 3800): [-1.0, 0.0, -1.0, -1.0], (1100, 700): [0.0, 60.0, 85.0, 15.0, 5.0, 5.0], (5600, 3900): [0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0], (7200, 2600): [-1.0], (3200, 1200): [15.0, -1.0], (1900, 1100): [60.0, 40.0, 5.0], (3400, 1600): [0.0], (4300, 600): [0.0], (8200, 3400): [5.0], (8400, 1300): [-1.0], (5800, 900): [-1.0, -1.0], (5400, 1700): [-1.0], (8200, 4800): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (5300, 200): [0.0], (4600, 700): [5.0, 0.0], (8600, 2700): [-1.0], (8300, 3800): [-1.0, -1.0, -1.0, -1.0], (6200, 4200): [0.0, 5.0, 10.0, 10.0, -1.0], (8700, 0): [-1.0], (7100, 1700): [0.0], (700, 300): [30.0, 5.0, 35.0], (6400, 4200): [5.0, 40.0, -1.0, 0.0, 0.0, 0.0], (5400, 2300): [10.0], (8800, 1900): [-1.0, 0.0], (8600, 3600): [-1.0], (3400, 1300): [5.0, 0.0], (2400, 2000): [20.0], (7500, 2500): [-1.0, -1.0, -1.0], (6700, 2000): [0.0], (8900, 2100): [-1.0, -1.0], (8900, 3000): [0.0], (1800, 900): [65.0], (7600, 2000): [-1.0, -1.0], (4500, 3000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0], (8000, 4600): [-1.0, -1.0, 0.0], (8800, 5600): [0.0, 0.0], (6800, 300): [-1.0, -1.0], (6700, 3800): [-1.0, 0.0, -1.0, -1.0, -1.0], (6600, 600): [-1.0], (8400, 5200): [-1.0, -1.0, 10.0, -1.0, -1.0], (6400, 4000): [-1.0, -1.0, -1.0], (3900, 1900): [5.0, 0.0], (3900, 1600): [10.0, 10.0], (7000, 1300): [-1.0], (3600, 1100): [0.0], (6600, 2600): [0.0, -1.0], (8400, 5400): [0.0, -1.0, -1.0, -1.0], (400, 300): [80.0], (3900, 1200): [0.0, 0.0], (4100, 3200): [0.0, 5.0, 0.0], (8500, 2300): [-1.0], (3000, 0): [5.0], (3400, 2000): [20.0, 20.0, 5.0, 20.0], (8600, 4500): [-1.0, 0.0, 0.0], (7000, 3700): [0.0, 0.0, -1.0], (8800, 5400): [-1.0, 25.0], (5600, 3700): [15.0, 25.0, 15.0], (4700, 2300): [0.0], (5600, 2700): [10.0], (6200, 1700): [-1.0], (7300, 1900): [-1.0, -1.0, -1.0], (6200, 4300): [-1.0, 0.0, 0.0, -1.0], (3700, 1500): [0.0], (3900, 400): [5.0], (3900, 2300): [10.0, 15.0, 5.0], (6200, 2500): [0.0, -1.0, 0.0, -1.0], (900, 300): [40.0], (5600, 100): [-1.0], (8000, 3100): [-1.0], (5000, 900): [5.0, 0.0, -1.0], (3500, 1100): [10.0], (5100, 1600): [0.0, 30.0], (6200, 4400): [0.0, 0.0, 60.0, 0.0, 0.0, -1.0], (3700, 500): [0.0], (5700, 3600): [10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0], (2300, 700): [25.0, 0.0], (6500, 3900): [35.0, -1.0, 0.0, -1.0], (5100, 2800): [5.0, 60.0, 0.0, 0.0], (3700, 2000): [0.0, 5.0, 5.0, 0.0], (5500, 2600): [0.0], (4400, 1400): [0.0], (3400, 1000): [0.0, 0.0], (6600, 300): [-1.0, -1.0], (3000, 2200): [0.0, 30.0, 25.0, 20.0, 5.0], (5900, 1200): [-1.0], (2500, 800): [5.0, 45.0], (7400, 5200): [5.0, 5.0], (5900, 4000): [5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (3900, 1700): [0.0, 10.0, 0.0], (6500, 2800): [0.0], (4800, 1300): [0.0, 0.0], (200, 100): [-1.0], (5200, 4200): [20.0], (2800, 1700): [10.0, 5.0, 5.0, 20.0, 15.0, 15.0, 25.0, 15.0], (6400, 2700): [-1.0, -1.0, -1.0, -1.0], (4500, 2700): [0.0, 0.0], (6000, 4500): [30.0, 0.0], (5100, 4000): [20.0, 0.0], (5700, 2100): [-1.0, 30.0], (6000, 600): [0.0], (4200, 300): [0.0], (5300, 1200): [0.0, 0.0], (4400, 2400): [15.0], (4600, 3500): [5.0, 0.0], (8500, 1200): [-1.0], (4200, 100): [-1.0, 0.0, 0.0, 0.0], (6300, 1400): [-1.0, -1.0], (3600, 1400): [0.0, 5.0], (6800, 3400): [-1.0, 5.0, 0.0], (6200, 500): [0.0, -1.0], (7600, 4900): [0.0, -1.0, 0.0, 15.0, 0.0], (6600, 1600): [-1.0, 0.0, -1.0], (7300, 5200): [0.0], (6500, 3600): [80.0], (7200, 300): [-1.0], (8000, 2300): [-1.0], (7600, 4000): [55.0], (8800, 900): [-1.0, -1.0, -1.0], (5500, 1400): [-1.0], (4400, 3000): [40.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0], (2900, 200): [0.0], (5400, 3900): [10.0, 60.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0], (4900, 3300): [5.0, 0.0, 0.0, 0.0], (6100, 4800): [0.0], (6700, 100): [-1.0, -1.0], (8100, 4000): [-1.0], (3200, 2300): [70.0, 30.0, 30.0, 0.0, 10.0, 25.0], (6600, 1200): [0.0], (8400, 4200): [-1.0], (7000, 5000): [5.0, 0.0], (8300, 3200): [0.0], (6100, 1100): [0.0, -1.0], (8900, 5200): [-1.0, 30.0, 0.0, -1.0, 0.0, -1.0], (1900, 1500): [70.0, 45.0], (7800, 5300): [-1.0, 0.0, -1.0], (4700, 1600): [0.0], (4500, 900): [0.0, 0.0], (8200, 3200): [-1.0], (7800, 4100): [10.0, -1.0], (5600, 3600): [35.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0], (6800, 1300): [-1.0], (8600, 800): [-1.0, -1.0], (3800, 2800): [0.0, 5.0], (7200, 5200): [0.0, -1.0], (6900, 2700): [0.0], (8800, 5300): [0.0, -1.0, 0.0], (2300, 1100): [0.0], (2600, 1600): [35.0, 5.0, 15.0, 25.0, 5.0, 30.0, 70.0], (5400, 4000): [0.0, 0.0, 10.0], (6400, 3000): [0.0], (7800, 1700): [-1.0], (2600, 600): [10.0, 0.0], (3800, 1800): [5.0], (8600, 5100): [-1.0, -1.0, 5.0], (3100, 1500): [15.0], (4900, 400): [0.0], (7800, 500): [-1.0], (7000, 2300): [0.0, 0.0], (4300, 1900): [0.0], (1800, 1300): [5.0, 65.0, 15.0, 10.0, 10.0, 25.0, 5.0, 5.0], (6600, 3100): [-1.0, 0.0, -1.0, 0.0], (4200, 2600): [5.0, 0.0, 15.0, 10.0, 0.0, 10.0], (7300, 5400): [-1.0], (7100, 4100): [0.0, 0.0, 0.0], (4200, 2700): [0.0, 5.0, 0.0, 0.0, 5.0, 5.0], (5700, 3700): [-1.0, 5.0, 0.0, 35.0], (7400, 4900): [15.0, 0.0, 0.0, 0.0], (6200, 2000): [-1.0], (6800, 2000): [-1.0], (8500, 3800): [-1.0], (5600, 2300): [0.0, 0.0], (8200, 5300): [-1.0, -1.0, -1.0, 0.0], (5100, 3700): [0.0, 0.0, 0.0, 5.0], (8100, 5400): [-1.0, 5.0, -1.0], (8000, 800): [-1.0, -1.0], (8400, 4000): [0.0], (8800, 5500): [-1.0, 15.0], (4300, 1800): [5.0], (2300, 1200): [55.0, 0.0, 40.0], (5100, 2400): [0.0, 15.0, 0.0, 5.0], (8500, 2900): [-1.0, 95.0], (2500, 1200): [0.0, 45.0, 10.0, 70.0], (1700, 400): [0.0, 10.0], (4500, 2300): [15.0, 0.0, 0.0], (3100, 0): [-1.0], (5700, 1300): [-1.0], (3700, 2800): [10.0, 80.0, 0.0, 5.0], (4600, 2900): [10.0, 0.0, 0.0, 20.0], (5500, 1100): [-1.0], (7000, 3600): [-1.0, 0.0], (7200, 3700): [-1.0, -1.0], (6600, 3000): [5.0], (7400, 3600): [10.0, 10.0], (1200, 800): [45.0, 25.0], (5900, 4300): [0.0, 10.0, 0.0], (4900, 2500): [0.0], (8600, 6200): [-1.0], (4800, 2900): [0.0], (7000, 2900): [-1.0, -1.0], (8900, 2800): [-1.0, -1.0], (6500, 4300): [-1.0, -1.0, 0.0, -1.0, 50.0, -1.0, 0.0], (8900, 1700): [-1.0], (8100, 4600): [-1.0, -1.0, 0.0, 0.0, 5.0, -1.0], (7100, 1000): [-1.0], (7900, 1200): [-1.0], (6600, 4100): [0.0, 0.0, -1.0, 0.0, -1.0, 0.0], (8000, 5600): [-1.0], (2700, 1100): [0.0], (8100, 2800): [-1.0, -1.0], (5700, 2700): [-1.0, 0.0], (4700, 2400): [0.0], (2900, 100): [25.0, 5.0], (3900, 1400): [0.0], (5700, 3900): [5.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0], (4300, 1600): [10.0], (8200, 2400): [-1.0], (4700, 100): [0.0, 0.0], (7300, 2800): [-1.0, -1.0, 30.0, 0.0], (8400, 3600): [-1.0, 0.0], (4800, 2000): [0.0, 0.0, 5.0, 10.0, 0.0], (3500, 1000): [30.0, 20.0], (4900, 2300): [0.0, 25.0, 0.0], (7300, 4000): [0.0, -1.0, -1.0, 0.0], (7400, 4800): [-1.0, 30.0, 15.0, -1.0, 0.0, -1.0], (8900, 200): [-1.0], (2300, 1600): [30.0, 5.0, 5.0, 20.0, 20.0], (8800, 3900): [-1.0, -1.0], (7500, 3300): [0.0, -1.0], (6600, 2200): [-1.0], (2200, 1700): [5.0], (8200, 1400): [-1.0, -1.0], (6600, 3800): [5.0, 0.0, -1.0, 15.0], (6300, 4400): [0.0, 0.0, 10.0], (5600, 500): [0.0, -1.0], (3700, 2400): [15.0, 35.0, 0.0], (6300, 2000): [-1.0, -1.0, 0.0], (2500, 1600): [40.0, 65.0, 5.0, 0.0, 20.0, 45.0, 20.0], (6500, 3000): [0.0], (600, 500): [20.0, 10.0, 20.0, 25.0], (7200, 2400): [-1.0], (7400, 4400): [0.0], (6700, 4800): [0.0, -1.0, 0.0, -1.0, -1.0], (4800, 900): [0.0], (6300, 3400): [0.0, -1.0, 5.0], (8700, 2100): [-1.0], (5900, 2000): [-1.0], (6200, 4000): [0.0, 0.0, -1.0, 55.0, 0.0], (8500, 5100): [-1.0, 10.0, 20.0], (3300, 1800): [0.0, 10.0, 10.0], (8400, 3400): [-1.0, 0.0, 10.0], (4000, 1000): [0.0], (700, 200): [20.0, 75.0, -1.0], (6700, 4300): [0.0, 0.0, -1.0, 0.0], (7900, 5300): [-1.0, -1.0, -1.0], (5000, 2300): [0.0], (8400, 4600): [0.0, 0.0, -1.0, -1.0, 10.0], (6600, 2500): [0.0], (7200, 4600): [-1.0, 0.0, 5.0, -1.0, -1.0], (3400, 1700): [5.0], (5000, 3500): [5.0, -1.0, 0.0, 0.0, 10.0, 75.0, 45.0, 5.0, 5.0, 0.0, 20.0, 5.0, 35.0], (7200, 600): [-1.0], (5800, 600): [0.0, -1.0, -1.0], (3600, 2300): [10.0, 10.0, 0.0, 30.0], (5400, 2900): [0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0], (3100, 100): [5.0, 0.0, 0.0], (3400, 2700): [35.0], (3400, 1900): [0.0, 0.0, 80.0], (7400, 3900): [-1.0, -1.0], (4300, 1200): [0.0, 0.0], (5800, 3300): [0.0, 20.0, 0.0, 0.0, 0.0], (8800, 4700): [20.0], (1000, 600): [40.0, 50.0, 5.0, 5.0], (3800, 2000): [25.0], (7200, 1000): [-1.0, 0.0, -1.0], (4800, 3600): [0.0], (8200, 2900): [-1.0, -1.0, -1.0], (4600, 2500): [0.0, 0.0, 0.0], (3700, 2600): [10.0, 10.0, 10.0, 30.0, 5.0, 20.0], (6300, 2100): [-1.0], (5700, 1800): [0.0], (7600, 5100): [0.0, -1.0, -1.0, 55.0], (4200, 3000): [0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 35.0, 20.0, 0.0, 20.0, 0.0, 40.0, 5.0, 20.0, 5.0, 5.0], (5700, 1000): [-1.0, -1.0], (5700, 4200): [5.0, 0.0], (4400, 1500): [0.0, 10.0, 0.0], (3200, 400): [10.0, 0.0], (4900, 1000): [0.0], (7000, 4300): [10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0], (3300, 100): [0.0], (3600, 2500): [10.0, 5.0, 0.0], (5700, 4600): [5.0], (7200, 3500): [10.0, 0.0], (8800, 4000): [-1.0], (6200, 1900): [-1.0, -1.0, -1.0], (5500, 4600): [0.0], (7700, 4600): [0.0], (6600, 2700): [-1.0], (5600, 2400): [0.0], (5500, 3400): [0.0, 85.0, 5.0, -1.0, 0.0, 5.0, 5.0], (6800, 200): [-1.0], (5800, 4200): [0.0, 0.0, 65.0, 5.0, 0.0, 0.0], (6500, 4000): [0.0, -1.0, 0.0, 0.0], (6600, 2900): [0.0], (5500, 2200): [0.0, 0.0], (5900, 2100): [0.0, 0.0, 0.0], (7900, 2500): [-1.0], (7000, 2400): [0.0], (3000, 1300): [5.0, 5.0], (7800, 4500): [-1.0, -1.0, 0.0], (4900, 2800): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0], (2400, 300): [0.0], (5200, 3300): [30.0], (4900, 1300): [0.0, 0.0, 0.0, 0.0], (2500, 900): [0.0, 0.0], (8600, 4900): [5.0, -1.0], (7000, 100): [-1.0, -1.0], (5900, 100): [-1.0], (4200, 3100): [5.0, 5.0, 30.0, 10.0, 0.0], (1600, 0): [5.0, 10.0], (6500, 4100): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (7700, 1400): [-1.0], (3700, 0): [0.0, 0.0], (7800, 4600): [35.0, 5.0, -1.0], (5600, 4100): [15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0], (3800, 1600): [5.0, 5.0, 0.0], (8700, 4600): [0.0, 0.0, -1.0], (4800, 2400): [0.0, 0.0], (8300, 800): [-1.0], (7800, 2800): [-1.0, -1.0], (5000, 3400): [0.0, 0.0, 5.0, 10.0, 5.0, 5.0, 0.0, 0.0], (8800, 1400): [-1.0, -1.0], (8600, 2800): [-1.0], (7700, 2500): [-1.0, -1.0], (8900, 4500): [-1.0, -1.0], (8000, 900): [-1.0, -1.0, -1.0], (4000, 1200): [0.0], (8300, 4400): [-1.0], (3300, 2400): [5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0], (6100, 3300): [-1.0, -1.0, 0.0], (7600, 1900): [-1.0], (7700, 5400): [0.0], (8300, 5200): [30.0, 0.0, 0.0, 0.0, -1.0], (8500, 3000): [0.0], (5900, 2900): [0.0, 0.0, 0.0], (2000, 800): [15.0], (4900, 3000): [5.0, 0.0, 30.0, 0.0, 45.0], (8700, 5400): [5.0], (7700, 3600): [0.0, -1.0], (8900, 3100): [-1.0, -1.0], (7600, 5000): [-1.0, 0.0, 0.0, 45.0], (8100, 4400): [5.0, 0.0], (8100, 1500): [-1.0], (7100, 4900): [0.0, -1.0, 0.0], (7700, 1800): [-1.0, -1.0, 0.0], (4000, 2700): [5.0, 30.0, 5.0, 0.0, 10.0, 5.0, 15.0, 0.0, 10.0, 35.0, 0.0, 25.0, 20.0, 20.0], (1400, 500): [5.0, 70.0, 0.0], (3400, 600): [0.0], (7100, 3900): [0.0, 10.0], (2500, 400): [15.0, 15.0], (5100, 1700): [0.0], (7100, 2700): [-1.0, 0.0], (7900, 1400): [-1.0, -1.0], (6700, 2200): [-1.0, -1.0, -1.0], (5800, 2400): [0.0], (7000, 4700): [0.0, 0.0, -1.0], (2100, 500): [30.0, 80.0], (1600, 1100): [50.0, 5.0, 70.0, 40.0, 55.0, 25.0, -1.0, 15.0, 10.0], (400, 0): [-1.0], (7500, 3400): [0.0, -1.0], (7700, 4900): [10.0, -1.0, 0.0, -1.0, 0.0, 0.0], (6200, 2200): [-1.0], (6900, 3500): [-1.0, 0.0], (7100, 3000): [-1.0], (4200, 3200): [0.0, 0.0, 5.0, 10.0, 5.0, 15.0], (4800, 3500): [25.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0], (5700, 2200): [10.0, 0.0], (7300, 500): [-1.0], (2700, 1800): [0.0, 20.0, 40.0, 95.0, 55.0, 15.0, 20.0], (5300, 4300): [10.0], (1500, 400): [50.0], (2700, 1200): [35.0, 25.0, 45.0, 15.0, 5.0], (4600, 2000): [55.0], (600, 0): [15.0], (8400, 1500): [-1.0, 0.0], (7700, 1900): [0.0], (8400, 3900): [-1.0], (7900, 4000): [-1.0, 0.0, -1.0], (6500, 2300): [-1.0, -1.0], (900, 700): [50.0, 5.0, 5.0], (6500, 3400): [-1.0], (7300, 4100): [0.0, -1.0, -1.0, 0.0], (8200, 4500): [0.0, -1.0, -1.0, -1.0], (5800, 1000): [0.0, -1.0], (1300, 900): [45.0, 15.0, 45.0, 65.0, 10.0, 95.0, 10.0, 45.0], (7500, 2800): [5.0], (2100, 1700): [15.0], (5400, 2100): [5.0, -1.0], (7000, 2200): [0.0, -1.0, -1.0], (6900, 800): [-1.0, -1.0], (6400, 3200): [-1.0, 10.0], (6800, 4800): [0.0, 0.0], (8500, 3700): [-1.0, -1.0, -1.0], (8300, 3900): [-1.0], (7100, 3700): [-1.0], (8500, 1000): [-1.0], (8000, 1800): [-1.0], (3200, 1800): [0.0, 10.0, 5.0], (5800, 4400): [0.0, 0.0, 5.0], (6700, 4000): [10.0, 25.0, -1.0, -1.0], (6500, 3100): [-1.0], (2200, 400): [35.0], (8700, 5000): [-1.0], (7900, 2100): [-1.0], (6500, 2900): [-1.0], (8000, 4100): [0.0, -1.0, -1.0, -1.0], (6800, 1700): [-1.0], (8500, 100): [-1.0, -1.0, -1.0, -1.0], (7200, 4700): [-1.0, 10.0, 0.0, -1.0, -1.0], (8700, 3400): [-1.0], (5600, 1400): [-1.0], (3300, 2600): [15.0], (1400, 1100): [90.0, 20.0], (6100, 3700): [0.0, -1.0], (4000, 2800): [0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 30.0, 0.0], (6300, 3700): [10.0, -1.0], (4500, 1600): [0.0], (8100, 4300): [15.0], (5900, 4500): [10.0, 10.0], (7200, 2300): [-1.0], (6400, 1100): [0.0], (5000, 4000): [5.0], (7600, 3100): [0.0, 0.0, 0.0], (3500, 100): [10.0, 0.0], (2200, 900): [0.0, 25.0], (6500, 4500): [0.0, 0.0], (5700, 800): [0.0], (8000, 4800): [-1.0, -1.0, 25.0, -1.0, 25.0, 0.0], (8000, 5000): [30.0, 0.0, -1.0, -1.0], (6200, 2300): [-1.0], (6400, 1400): [0.0], (5000, 2700): [5.0, 0.0, 20.0, 0.0, 0.0], (5300, 3200): [0.0, -1.0, 0.0, 0.0], (6700, 1400): [-1.0], (2100, 1200): [45.0, 20.0, 5.0, 70.0], (6000, 2400): [0.0], (1300, 200): [5.0, 80.0, 10.0, 15.0], (3100, 1100): [5.0, 5.0], (3200, 1500): [30.0], (5500, 4100): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4500, 600): [0.0, 0.0], (8400, 3800): [-1.0], (1900, 300): [-1.0], (5700, 4400): [0.0, 0.0, 0.0, 0.0], (2100, 1500): [25.0, 15.0, 25.0, 65.0, 5.0], (3700, 1800): [0.0, 5.0, 10.0], (2900, 300): [-1.0, 20.0], (8200, 5200): [0.0, 0.0, -1.0, -1.0], (8600, 3700): [-1.0], (8600, 1800): [-1.0, -1.0], (6300, 1100): [-1.0], (7500, 4300): [-1.0, -1.0, -1.0, 5.0, -1.0], (4500, 2400): [0.0, 0.0], (3500, 900): [0.0, 15.0, 5.0], (8500, 2600): [-1.0, -1.0, -1.0, -1.0], (5900, 2300): [15.0, 0.0], (8300, 3600): [-1.0], (7800, 5600): [-1.0], (5300, 1400): [0.0], (2400, 200): [-1.0], (3900, 1800): [0.0], (8700, 1600): [-1.0], (3300, 1100): [5.0], (5000, 3900): [0.0], (5300, 2000): [-1.0], (4900, 0): [0.0, 0.0], (6700, 3500): [5.0], (2600, 1100): [10.0], (3700, 200): [0.0], (4600, 3300): [15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0], (5600, 4400): [-1.0], (8100, 3500): [-1.0, -1.0], (5000, 1500): [0.0, 0.0], (8200, 5700): [0.0], (7600, 3000): [-1.0], (4200, 1300): [20.0], (8900, 3300): [-1.0], (4200, 900): [5.0], (6300, 200): [-1.0, -1.0], (7700, 4300): [-1.0, -1.0], (4500, 2200): [0.0, 0.0], (4900, 3600): [25.0, 15.0, 15.0, 35.0, 5.0, 10.0], (4400, 0): [0.0, 0.0], (8800, 3300): [-1.0, -1.0], (2100, 100): [20.0], (7700, 4500): [0.0], (6500, 0): [-1.0], (6000, 3300): [-1.0, 0.0, 0.0, -1.0, 5.0, -1.0], (6800, 4200): [0.0, 20.0, 0.0, 0.0], (7900, 3400): [0.0, -1.0], (8700, 500): [-1.0], (7300, 0): [-1.0], (7100, 4300): [0.0, 0.0], (8000, 3300): [-1.0, -1.0, -1.0], (2900, 1700): [5.0, 10.0, 15.0, 10.0, 20.0], (8400, 2000): [-1.0, -1.0, -1.0, -1.0], (4200, 400): [0.0, 0.0], (7500, 5100): [10.0, 0.0], (8600, 3900): [-1.0, -1.0, -1.0], (8000, 3800): [-1.0, -1.0], (5800, 2100): [-1.0, 0.0], (2300, 300): [5.0], (4500, 3100): [10.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 10.0], (6300, 1600): [-1.0], (2300, 1300): [5.0, 0.0], (5800, 1200): [-1.0, -1.0], (5300, 2800): [0.0, -1.0, 0.0], (7800, 3600): [-1.0], (7900, 4100): [-1.0], (8300, 300): [-1.0, -1.0], (8300, 1800): [-1.0], (4000, 1900): [5.0, 0.0, 20.0], (4600, 2300): [0.0, 0.0], (3200, 600): [10.0], (7000, 2600): [-1.0, 10.0], (2800, 1300): [40.0], (7400, 4300): [10.0, -1.0, 30.0, -1.0], (7000, 1700): [0.0, -1.0, -1.0], (2600, 400): [5.0], (1800, 100): [35.0], (8400, 2800): [-1.0], (1900, 900): [10.0, 90.0, 10.0], (7800, 1500): [-1.0], (4800, 2200): [5.0], (7400, 2100): [5.0], (8500, 700): [-1.0, -1.0, -1.0], (7300, 3800): [-1.0, 5.0, 0.0], (6300, 3500): [10.0, -1.0, -1.0, -1.0, 45.0], (2300, 600): [15.0], (6400, 2600): [-1.0, 0.0], (4500, 1900): [0.0], (3500, 2800): [15.0, 10.0], (2100, 1600): [35.0], (8500, 4800): [-1.0], (2300, 1700): [20.0, 10.0, 55.0, 15.0, 0.0], (1100, 600): [10.0, 0.0, 75.0, 90.0], (5100, 200): [0.0, 0.0], (4800, 3400): [10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0], (7500, 1900): [0.0], (8100, 5200): [0.0, -1.0], (5900, 2500): [0.0, -1.0], (5500, 1300): [-1.0, 5.0], (5400, 1100): [15.0], (1600, 1000): [30.0, 15.0, 55.0], (1400, 1000): [95.0, 35.0, 70.0, 55.0, 75.0, 35.0, 85.0], (3000, 2300): [10.0, 5.0, 5.0], (7800, 4300): [-1.0, -1.0, 0.0], (1000, 700): [90.0, 25.0], (6900, 2100): [-1.0], (8900, 1000): [-1.0], (5100, 3200): [0.0, 0.0, 0.0, 0.0, 20.0], (7700, 800): [-1.0, -1.0], (7000, 4200): [5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (7000, 3200): [-1.0], (2000, 1100): [20.0, 90.0, 55.0], (8200, 3800): [-1.0, 0.0, 20.0], (8000, 500): [-1.0], (5600, 1300): [-1.0], (8200, 5000): [-1.0, 0.0, -1.0, 0.0, 0.0, 5.0], (5100, 3600): [0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0], (7400, 1700): [-1.0, -1.0], (8700, 3800): [-1.0], (1300, 500): [25.0], (4600, 1800): [0.0, 0.0], (6800, 3100): [-1.0, 0.0], (7400, 200): [-1.0, -1.0, -1.0], (2600, 700): [10.0], (2300, 1800): [95.0, 35.0, 20.0], (8900, 4800): [-1.0, 0.0], (4800, 1800): [0.0, 0.0], (8200, 100): [-1.0], (4300, 3200): [0.0, 0.0, 0.0, 5.0], (7300, 1200): [-1.0], (3600, 2400): [0.0, 35.0, 0.0, 10.0], (4500, 2600): [25.0], (3400, 300): [5.0], (2500, 500): [0.0], (7000, 500): [-1.0, -1.0], (7800, 400): [-1.0], (6500, 4200): [-1.0, 20.0, 0.0, -1.0], (6300, 3200): [10.0, 25.0, 0.0, -1.0], (8600, 5700): [0.0], (6100, 4300): [5.0, -1.0, 0.0, 40.0, 0.0, 0.0, -1.0], (1600, 500): [15.0, 15.0], (4400, 1100): [0.0], (6300, 2200): [-1.0, -1.0], (8100, 4800): [0.0, 0.0, -1.0, 0.0, -1.0], (4300, 1300): [0.0, 0.0], (4800, 1400): [0.0], (1200, 1000): [25.0], (8600, 4100): [5.0], (7900, 900): [-1.0], (4100, 2800): [40.0, 10.0, 0.0], (7000, 800): [-1.0, -1.0], (5400, 1400): [-1.0, -1.0], (7800, 600): [-1.0], (3000, 1900): [35.0, 5.0, 40.0, 15.0, 35.0], (3400, 500): [5.0], (2300, 900): [0.0], (7000, 5300): [-1.0, 0.0], (5300, 1300): [-1.0], (8300, 1600): [-1.0, -1.0], (5200, 3700): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6300, 2700): [10.0, 0.0], (6200, 2900): [-1.0, -1.0], (3100, 1800): [20.0, 10.0, 40.0, 0.0, 5.0], (8400, 0): [-1.0, -1.0, -1.0], (7600, 5200): [0.0, 0.0, 10.0], (8300, 3400): [0.0, 0.0, 5.0], (7600, 1100): [-1.0], (4300, 700): [0.0, 0.0], (8100, 3300): [-1.0], (6700, 5000): [10.0], (8000, 3400): [0.0], (7200, 1300): [-1.0, -1.0], (7900, 3100): [-1.0, -1.0], (1200, 0): [-1.0], (7400, 3700): [-1.0, -1.0, 0.0, 45.0], (3500, 1500): [20.0], (8900, 300): [-1.0, -1.0], (6000, 3700): [0.0, 5.0, 15.0, 0.0, 40.0], (4900, 2400): [0.0], (4100, 2100): [5.0, 5.0], (7200, 3100): [0.0, 0.0], (6600, 3500): [-1.0, -1.0, -1.0], (3400, 0): [-1.0], (6200, 4600): [0.0, 0.0, 10.0, 0.0], (8600, 3500): [-1.0], (8300, 5400): [5.0], (2000, 400): [10.0], (5800, 2500): [0.0], (6100, 2500): [0.0, -1.0], (4400, 1000): [5.0], (5600, 1000): [0.0], (6400, 1900): [-1.0], (6100, 2300): [0.0], (5400, 2700): [0.0, 0.0, -1.0, -1.0], (3300, 1600): [10.0, 25.0, 10.0], (4000, 1500): [0.0], (6000, 4600): [15.0], (4400, 2800): [0.0, 5.0, 10.0, 0.0, 30.0], (2700, 1400): [15.0], (7600, 1700): [-1.0, -1.0], (7400, 2400): [-1.0, -1.0], (8600, 1300): [-1.0, -1.0], (6100, 1900): [-1.0, -1.0], (7700, 700): [-1.0, -1.0], (4500, 3300): [10.0, 15.0, 0.0, 0.0], (5400, 3200): [25.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4600, 3100): [15.0, 15.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 5.0], (2400, 1000): [30.0, 30.0], (8500, 4500): [-1.0, 0.0, -1.0, 0.0, -1.0], (4500, 1500): [5.0, 0.0], (8900, 4000): [-1.0, -1.0, -1.0], (2400, 1700): [20.0, 30.0, 15.0, 60.0, 0.0, 15.0, 15.0, 5.0, 60.0], (4200, 2800): [15.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4800, 1600): [0.0], (5300, 600): [0.0], (4900, 700): [0.0, 0.0], (6200, 2800): [0.0, -1.0, -1.0], (5900, 3300): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0], (3300, 600): [0.0], (4200, 200): [0.0], (8500, 900): [-1.0, -1.0, -1.0], (6800, 2700): [-1.0, 0.0], (2000, 1400): [10.0, -1.0, 40.0, 5.0, 5.0, 70.0, 55.0, 35.0], (7200, 3000): [-1.0, -1.0, 0.0], (5700, 1700): [0.0, 0.0], (4200, 3300): [0.0], (5800, 2600): [0.0, 0.0, 0.0], (8900, 5600): [-1.0, -1.0, -1.0], (6100, 500): [-1.0, 0.0, -1.0], (8200, 300): [-1.0, -1.0], (6100, 3500): [-1.0, 35.0, -1.0, -1.0, 5.0, 0.0], (8100, 2500): [-1.0], (6900, 3200): [-1.0], (8700, 1700): [-1.0, -1.0], (6700, 600): [-1.0, -1.0], (7700, 3300): [-1.0, -1.0], (4500, 3500): [5.0, 0.0], (3000, 1800): [15.0], (6400, 2500): [30.0, -1.0], (8000, 600): [-1.0, -1.0], (5200, 700): [-1.0], (7600, 3200): [-1.0], (8300, 1700): [-1.0], (8400, 1900): [0.0, -1.0], (8200, 3900): [0.0], (3100, 1900): [10.0, 15.0, 0.0, 15.0, 5.0], (3400, 900): [5.0], (6900, 1100): [-1.0, 0.0, -1.0], (8800, 3700): [-1.0, -1.0], (3700, 2200): [5.0, 0.0, 5.0, 0.0, 0.0], (3100, 700): [10.0, 10.0], (1400, 100): [35.0, 10.0, 40.0], (8000, 4000): [0.0], (4300, 300): [0.0, 0.0], (8200, 3000): [0.0, 0.0, -1.0, 0.0], (6700, 3100): [-1.0, 10.0, 5.0], (300, 200): [0.0, -1.0, 0.0], (6200, 3700): [-1.0], (7600, 3600): [0.0], (8300, 5300): [0.0, -1.0, 0.0, 15.0, 5.0], (4800, 3700): [5.0], (4100, 1100): [5.0], (7800, 4400): [0.0, -1.0, 0.0, 30.0, 0.0], (5600, 4300): [0.0, 0.0, 5.0], (4900, 2000): [0.0, 5.0, 0.0], (3900, 2400): [0.0, 10.0, 45.0, 5.0, 20.0, 5.0], (5500, 4000): [0.0, 0.0, 0.0, 0.0, 20.0, 0.0], (1700, 1300): [5.0, 40.0], (2600, 1500): [25.0, 45.0, 45.0, 25.0], (6200, 4500): [15.0, 0.0, 0.0, -1.0], (5400, 400): [-1.0, -1.0], (4700, 3100): [0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0], (5500, 2800): [0.0], (4700, 700): [0.0], (7400, 1300): [-1.0], (6500, 300): [-1.0], (2600, 1900): [40.0, 30.0, 50.0, 25.0, 30.0, 45.0, 0.0, 15.0], (5500, 1600): [0.0, -1.0], (1400, 900): [10.0, 25.0, 0.0, 5.0, 80.0, 30.0, 95.0], (7300, 2100): [-1.0], (2300, 1400): [10.0, 40.0, 40.0], (7400, 400): [-1.0], (8900, 4100): [-1.0], (8200, 4300): [0.0, 0.0, 10.0], (1800, 1100): [10.0, 5.0, 10.0, 0.0, 50.0], (3200, 2200): [10.0, 15.0, 5.0, 15.0], (6400, 300): [-1.0], (6100, 3100): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (4600, 0): [-1.0], (6600, 900): [-1.0, -1.0], (2500, 1700): [40.0, 25.0, 45.0, 0.0, 25.0], (6400, 3600): [0.0, 5.0, -1.0, -1.0, -1.0], (4000, 2400): [0.0, 0.0, 5.0], (6100, 1300): [-1.0], (2900, 2400): [0.0], (6000, 4000): [0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0], (2400, 1400): [15.0, 30.0, 5.0], (5200, 500): [-1.0], (6100, 100): [-1.0, -1.0], (5800, 1800): [0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (5300, 2700): [70.0, 5.0, 0.0], (5100, 700): [0.0, -1.0], (6000, 2500): [0.0], (4100, 2500): [10.0, 15.0, 20.0, 20.0, 15.0], (6600, 4500): [0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0], (5100, 3300): [20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0], (7900, 4800): [-1.0, 0.0, -1.0], (8800, 3400): [-1.0], (6000, 4300): [0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0]}
mpc_dash_syth_hyb_pen_table_200 = {(6600, 3000): [-1.0, -1.0, -1.0, 0.0, 10.0, 5.0, 5.0, -1.0, 0.0], (7400, 4800): [-1.0, 15.0, 0.0, 15.0, 0.0, 30.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0], (7000, 3000): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (7000, 1800): [-1.0], (1200, 200): [5.0, 0.0, 20.0, 80.0, 15.0, 10.0, 15.0], (7600, 1800): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0], (5400, 1600): [-1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (8200, 5800): [-1.0], (6600, 5000): [10.0, -1.0], (1800, 1400): [70.0, 15.0, 30.0, 60.0, 20.0, 0.0, 45.0, 0.0], (7200, 2800): [-1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, 5.0], (8000, 3200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6200, 0): [-1.0, -1.0], (7000, 4800): [0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 20.0, 0.0, 0.0], (1200, 800): [20.0, 35.0, 100.0, 55.0, 5.0, 35.0, 40.0, 45.0, 20.0, 45.0, 15.0, 0.0, 45.0, 65.0, 70.0, 10.0, 25.0, 95.0, 40.0, 45.0, 45.0, 10.0, 45.0], (4600, 2400): [0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 20.0], (2000, 200): [10.0, 10.0, 65.0, -1.0, 75.0, 20.0], (8600, 6200): [-1.0], (8600, 4400): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0], (8200, 4000): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (2600, 800): [5.0, 20.0], (7000, 4600): [0.0, 10.0, 15.0, 0.0, 0.0, 5.0, 25.0, 0.0, -1.0, 0.0, 0.0, 45.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0], (7800, 1200): [-1.0, -1.0, -1.0], (2400, 1800): [10.0, 0.0, 35.0, 55.0, 40.0, 40.0, 55.0, 25.0, 20.0, 0.0, 15.0, 5.0, 40.0, 20.0, 30.0], (4600, 400): [0.0, -1.0], (5400, 4400): [10.0, 45.0], (7600, 1200): [0.0, -1.0, -1.0], (2400, 800): [5.0, 0.0, 45.0, 0.0], (4800, 800): [0.0], (5600, 600): [0.0, 0.0], (1000, 800): [15.0, -1.0, -1.0, 10.0], (7400, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0], (6000, 1600): [-1.0], (7800, 2200): [0.0, 0.0, -1.0, -1.0, -1.0, 10.0], (7200, 3200): [-1.0, 40.0, -1.0, 0.0, -1.0], (8800, 2000): [-1.0, -1.0, -1.0], (2200, 1600): [20.0, 70.0, 45.0, 20.0, 60.0, 10.0, 80.0, 30.0, 5.0, 30.0, 55.0, 15.0, 5.0, 5.0, 15.0, 20.0, 0.0, 20.0], (3400, 1200): [5.0, 5.0, 0.0], (8000, 2400): [-1.0, -1.0], (800, 600): [50.0, 25.0, 10.0, 75.0, 20.0, 65.0, -1.0, 95.0, 5.0, 15.0, 50.0, 5.0, 50.0, 50.0, 80.0], (4800, 3800): [0.0, 15.0, 0.0], (4200, 2800): [0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0], (6200, 2200): [-1.0, -1.0, -1.0, -1.0], (3800, 2000): [10.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 25.0, 0.0], (4800, 2800): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0], (8400, 3600): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7400, 4200): [0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 20.0, -1.0, 5.0, -1.0, 0.0, 25.0, -1.0, 30.0, -1.0], (1000, 0): [20.0], (5600, 3600): [10.0, 0.0, 0.0, -1.0, 35.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 25.0, 0.0, 45.0, 0.0, 15.0, 35.0, 0.0], (8600, 1200): [-1.0, -1.0, -1.0], (4000, 1400): [0.0, 0.0], (6000, 2600): [0.0, 25.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (6000, 1200): [-1.0, -1.0, -1.0], (200, 0): [-1.0, -1.0, -1.0, 0.0, 30.0], (8200, 2000): [-1.0, -1.0, -1.0, -1.0], (6200, 3600): [0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, -1.0, -1.0, 0.0], (5200, 2200): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0], (1400, 600): [60.0, 75.0, 20.0, 10.0, 10.0, 10.0, 15.0, 50.0], (5200, 3600): [20.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 45.0, -1.0], (6600, 2200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6800, 2200): [-1.0, -1.0, -1.0, -1.0], (8200, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4600, 3600): [10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0], (5800, 0): [-1.0], (5800, 3000): [10.0, -1.0, 0.0, 10.0, 20.0, 15.0], (5600, 3000): [10.0, 0.0, 0.0, 0.0, 5.0, 0.0], (8200, 3400): [-1.0, 5.0, 0.0, 0.0, 5.0, -1.0], (5200, 600): [0.0, -1.0, 0.0, 0.0], (4800, 4000): [0.0], (4600, 600): [5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (8800, 0): [-1.0, -1.0, -1.0, -1.0], (6200, 2600): [-1.0, 5.0, -1.0, 10.0, 0.0], (8200, 400): [-1.0, -1.0, -1.0], (5000, 1400): [0.0, 0.0], (6400, 0): [-1.0, -1.0, -1.0, -1.0], (8000, 2200): [-1.0, -1.0, 0.0, -1.0], (8600, 2600): [-1.0], (8400, 5000): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0], (2600, 0): [0.0, 20.0, 5.0], (8000, 3600): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (8600, 4800): [-1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (5600, 0): [-1.0], (7400, 4400): [0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5800, 1400): [-1.0, 0.0, 0.0], (7000, 2000): [-1.0, -1.0, 0.0, -1.0], (4800, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4000, 1000): [5.0, 0.0], (6600, 3400): [-1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (8400, 4600): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 5.0, 0.0], (3800, 1000): [5.0], (8000, 3400): [-1.0, -1.0, 5.0, 0.0], (8400, 5200): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 10.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0], (4600, 1600): [0.0, 0.0, 0.0, 15.0], (2200, 400): [35.0], (4200, 2400): [0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 15.0, 10.0, 25.0, 5.0, 20.0, 15.0, 35.0, 15.0], (5400, 3800): [10.0, 0.0, 60.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0, 0.0, 15.0, -1.0, 5.0, 0.0, 30.0, 0.0, 15.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0], (5600, 1200): [5.0, -1.0, -1.0, -1.0], (5400, 2000): [5.0, 0.0, -1.0, 0.0, -1.0], (4400, 1400): [0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0], (2800, 400): [0.0, -1.0, 25.0, 5.0, 0.0, 50.0], (8600, 5600): [-1.0, -1.0, 45.0, 0.0, 80.0, -1.0], (2800, 2000): [0.0, 25.0, 25.0, 10.0, 20.0, 25.0, 0.0, 0.0, 5.0, 5.0, 25.0, 0.0, 5.0, 0.0, 35.0, 30.0, 45.0, 0.0, 35.0, 100.0, 20.0, 5.0, 10.0, 5.0, 70.0, 50.0, 30.0, 20.0, 15.0, 15.0, 20.0, 0.0, 40.0, 0.0, 25.0], (5000, 200): [0.0, 0.0, 0.0], (8000, 0): [-1.0, -1.0, -1.0], (600, 400): [20.0, 10.0, 20.0, 55.0, 15.0, 30.0, 20.0, 90.0, 10.0, -1.0, 10.0, 100.0, 20.0, 10.0, 10.0, 10.0, 25.0, 15.0, 5.0, 15.0, 5.0, 20.0], (7000, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0], (4400, 2000): [0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 25.0, 10.0, 10.0], (5200, 1000): [-1.0, 0.0, -1.0, -1.0, -1.0], (5200, 2800): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0], (3000, 0): [10.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0], (5400, 2200): [0.0, 5.0, 10.0, 0.0], (7400, 3200): [-1.0, 25.0, 45.0, 0.0, -1.0], (5000, 2600): [5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0], (7800, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0], (3800, 1800): [0.0, 0.0, 5.0, 30.0, 5.0, 5.0, 0.0], (7600, 1000): [-1.0, -1.0, -1.0], (7600, 4600): [0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (6600, 4600): [0.0, 0.0, 10.0, 0.0, 50.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 5.0, -1.0], (8800, 3800): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6200, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (6000, 2800): [-1.0, 20.0, 0.0, -1.0, 0.0, 0.0, 5.0], (7600, 5200): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0], (1200, 400): [25.0, 0.0, 35.0, 25.0, 5.0, 10.0], (8400, 3400): [-1.0, 0.0, 0.0, 10.0, -1.0], (3000, 1200): [5.0, 10.0, 5.0, 5.0, 10.0], (7200, 2000): [-1.0, -1.0, -1.0], (7800, 2600): [-1.0], (4400, 2400): [0.0, 20.0, 0.0, 10.0, 15.0, 0.0, 15.0, 30.0, 0.0, 15.0, 0.0, 10.0], (4400, 1200): [10.0, 0.0, 0.0], (3200, 2000): [45.0, 15.0, 5.0, 0.0, 50.0, 5.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 15.0, 0.0, 15.0, 10.0], (1600, 800): [35.0, 10.0, 20.0, 5.0, -1.0, 30.0, 20.0, 20.0, 15.0, 15.0, 20.0], (1800, 1000): [60.0, 40.0, 30.0, 10.0, 5.0, 20.0, 10.0, 0.0, 20.0, 50.0, 5.0], (7000, 5200): [-1.0, 0.0], (4600, 3800): [0.0], (8800, 4400): [-1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0], (6600, 200): [-1.0, -1.0, -1.0, -1.0], (8600, 2400): [0.0, -1.0, -1.0, -1.0], (8400, 200): [-1.0, -1.0], (2800, 1800): [5.0, 25.0, 10.0, 0.0, 20.0, 30.0, 0.0, 30.0, 35.0, 0.0, 20.0, 0.0, 85.0, 5.0, 5.0, 5.0, 10.0, 20.0, 65.0, 65.0, 0.0], (7200, 5000): [10.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (8200, 3800): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0], (2600, 1800): [25.0, 0.0, 40.0, 30.0, 0.0, 25.0, 50.0, 5.0, 20.0, 40.0, 95.0, 25.0, 30.0, 0.0, 55.0, 30.0, 5.0, 45.0, 25.0, 10.0, 45.0, 15.0, 20.0, 40.0, 0.0, 15.0, 15.0, 25.0, 20.0], (4200, 3200): [0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0], (8800, 2400): [5.0], (3600, 2800): [5.0, 10.0, 0.0, 10.0, 80.0, 0.0, 5.0], (5200, 4200): [10.0, 20.0, 15.0], (4000, 3400): [15.0], (2800, 1400): [25.0, 5.0, 75.0, 15.0, 15.0, 20.0, 10.0], (6600, 4800): [0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 45.0, 10.0, 0.0, -1.0], (3800, 1400): [0.0, 0.0, 0.0], (3000, 1000): [5.0, 0.0, 0.0, 5.0, 5.0, 5.0], (7600, 5400): [0.0, 0.0, 5.0, 0.0], (5200, 400): [0.0, -1.0], (7400, 3400): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (7600, 2400): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (1000, 400): [0.0, 50.0, 50.0, 65.0, 85.0, 90.0], (8000, 4000): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (3600, 2200): [5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 30.0, 5.0], (6000, 2000): [5.0, 0.0, -1.0, -1.0], (7200, 2400): [-1.0, -1.0, -1.0], (1200, 0): [-1.0, 0.0, 25.0, 5.0, -1.0, 15.0], (5600, 2400): [0.0], (4200, 1600): [0.0, 15.0, 10.0, 10.0, 10.0, 0.0], (4800, 1800): [0.0, 10.0, 0.0], (4200, 600): [0.0, 0.0, 0.0, 0.0, 0.0], (4600, 2200): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5200, 2000): [-1.0, 0.0, -1.0, -1.0, -1.0], (7200, 2600): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (5800, 400): [-1.0, -1.0, -1.0, -1.0, -1.0], (5200, 3000): [15.0, 10.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 0.0, -1.0, 5.0], (8800, 200): [-1.0, -1.0, -1.0], (4000, 800): [0.0, 0.0, 0.0, 0.0, 0.0], (4800, 3000): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 30.0, 5.0, -1.0, 0.0, 45.0, 0.0, 0.0], (8800, 2200): [-1.0, -1.0], (8600, 4600): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0], (8600, 2800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8600, 3200): [-1.0, -1.0], (5800, 2400): [0.0, 0.0, 0.0, -1.0, 0.0], (7400, 1800): [-1.0, 0.0], (8800, 3200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5800, 1200): [-1.0, -1.0, 10.0, -1.0], (3600, 600): [0.0, 0.0, 15.0, 0.0, 0.0, 0.0], (5200, 200): [0.0, 0.0, 0.0, 0.0], (5200, 3800): [20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 40.0, 15.0, 0.0], (8600, 0): [-1.0, -1.0], (3000, 800): [20.0, 15.0, 5.0], (3600, 0): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8200, 600): [-1.0, -1.0, -1.0, -1.0], (4400, 1000): [5.0, 0.0, 0.0], (4600, 3200): [10.0, 35.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 15.0, 0.0, 90.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0], (6000, 1800): [-1.0, -1.0, 0.0, 0.0], (5600, 1400): [-1.0, 0.0, -1.0], (8600, 5000): [5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0], (5400, 400): [0.0, -1.0, -1.0, 0.0], (4400, 3200): [0.0, 0.0, 0.0, 35.0, 0.0, 30.0, 40.0, 10.0, 0.0, 25.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 40.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0], (4800, 400): [0.0, 0.0], (6800, 4600): [0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (3400, 1400): [0.0, 0.0, 20.0, 25.0, 5.0], (1400, 0): [35.0, 10.0, 5.0, 40.0], (3800, 1600): [5.0, 0.0, 5.0, 10.0, 10.0, 0.0, 10.0, 0.0], (5600, 4600): [5.0], (6400, 4800): [-1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (6800, 4400): [0.0, -1.0, 15.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 35.0], (7800, 5200): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0], (2800, 600): [10.0, 0.0], (7400, 2000): [-1.0, 5.0], (4800, 1200): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0], (7800, 4600): [-1.0, 5.0, 35.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (8000, 200): [-1.0], (7400, 1000): [-1.0, -1.0, -1.0, -1.0], (7800, 4000): [10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (3800, 2200): [15.0, 35.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0], (600, 200): [30.0, 35.0, 50.0, 20.0, 5.0, 0.0, 85.0, 75.0, 95.0, -1.0, 35.0, 35.0, 80.0], (5600, 2600): [-1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0], (7800, 5400): [0.0, 45.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (5200, 1600): [-1.0, -1.0, 0.0, 0.0, 5.0], (8400, 1800): [0.0, 0.0, -1.0, 0.0, -1.0], (6800, 600): [-1.0], (5000, 3400): [0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, 10.0, 0.0, 10.0, 0.0, 20.0, 5.0, 75.0, 45.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0], (4400, 1600): [0.0, 0.0, 0.0, 10.0, 5.0], (8400, 3000): [-1.0, 0.0], (8600, 1800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (7200, 2200): [-1.0, 0.0, -1.0], (7800, 1000): [-1.0, -1.0, -1.0, -1.0, -1.0], (6800, 2400): [0.0, 10.0, -1.0, 0.0], (6200, 1400): [-1.0, 0.0, -1.0, -1.0, -1.0], (7800, 400): [-1.0, -1.0, -1.0], (8200, 5400): [5.0, -1.0, 0.0, 10.0, 0.0, -1.0, 5.0], (1600, 400): [0.0, 15.0, 85.0, 0.0, 15.0, 10.0], (1800, 800): [35.0, 50.0, 10.0, 90.0, 65.0, 10.0], (8000, 3000): [-1.0, -1.0], (1800, 1200): [5.0, 20.0, 5.0, 50.0, 5.0, 0.0, 50.0, 65.0, 15.0, 10.0, 50.0, 25.0, 90.0, 10.0, 65.0, 35.0, 25.0, 75.0, 5.0, 10.0, 65.0, 25.0, 35.0, 10.0, 5.0, 95.0, 15.0, 85.0], (3400, 200): [5.0, 0.0], (5000, 3600): [0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0], (6200, 3200): [-1.0, 10.0, 80.0, 20.0, 25.0, 0.0, -1.0], (7600, 400): [-1.0, -1.0, -1.0, -1.0, -1.0], (5600, 1600): [-1.0, 0.0, -1.0, -1.0, 0.0], (5800, 2200): [-1.0, -1.0, 15.0, 0.0, 0.0], (4000, 3000): [0.0, 0.0, 5.0, 25.0, 5.0, 25.0, 0.0, 10.0, 0.0], (1600, 1200): [30.0, 5.0, 15.0, 85.0, 40.0], (4200, 1000): [10.0, 0.0, 0.0, 0.0, 0.0], (7600, 3800): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 10.0], (3600, 1600): [0.0, 0.0], (5200, 1200): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (3000, 2600): [75.0], (6400, 2400): [30.0, -1.0, -1.0], (8800, 5800): [0.0, -1.0], (3800, 200): [0.0, 0.0, 0.0], (5200, 1800): [5.0, 0.0], (8400, 2800): [-1.0, -1.0, 95.0], (7600, 5000): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 55.0, -1.0, -1.0, 45.0], (8600, 2200): [-1.0, -1.0, -1.0, -1.0], (7400, 3800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2800, 2400): [0.0], (3000, 1400): [10.0, 15.0, 15.0, 5.0], (1400, 800): [10.0, 25.0, 90.0, 0.0, 55.0, 20.0, 5.0, 5.0, 80.0, 25.0, 70.0, 95.0, 40.0, 50.0, 30.0, 15.0, 95.0, -1.0], (8600, 1400): [0.0, -1.0, -1.0], (8600, 3400): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (6400, 200): [-1.0, -1.0, -1.0, -1.0], (8400, 5600): [-1.0, 0.0, 5.0, 0.0, -1.0, 0.0], (6000, 4200): [5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 40.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 60.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 0.0], (6000, 4400): [-1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0], (4200, 2200): [10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0], (7200, 4600): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (6200, 4600): [-1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0], (7200, 3600): [-1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0], (3000, 2400): [20.0, 0.0, 10.0, 20.0], (2400, 1600): [20.0, 40.0, 30.0, 25.0, 40.0, 65.0, 45.0, 15.0, 60.0, 0.0, 0.0, 5.0, 0.0, 0.0, 95.0, 50.0, 15.0, 15.0, 100.0, 25.0, 5.0, 20.0, 45.0, 40.0, 60.0, 15.0, 15.0, 20.0, 0.0], (7000, 4000): [0.0, -1.0, 85.0, -1.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0], (8600, 3000): [-1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0], (2400, 1200): [0.0, 20.0, 45.0, 5.0, 10.0, 60.0, -1.0, 15.0, -1.0, 5.0, 70.0], (5000, 3000): [0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 15.0, 10.0, 0.0], (7400, 4000): [0.0, -1.0, -1.0, -1.0, 35.0, -1.0, 45.0, 25.0, -1.0, 5.0], (2800, 800): [0.0, 15.0, 30.0], (5200, 800): [0.0, 0.0], (5200, 2600): [65.0, 0.0, 0.0, 70.0, 5.0, 20.0, -1.0, 0.0, 0.0, -1.0, 5.0], (4600, 200): [0.0, 0.0], (6800, 1600): [-1.0], (6800, 3400): [-1.0, -1.0, 0.0, 5.0, -1.0, 0.0], (7000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4400, 600): [0.0, 0.0, 0.0], (7600, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 4400): [0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0], (6400, 3800): [0.0, 35.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0], (5600, 800): [-1.0, 0.0], (8200, 1800): [0.0, -1.0, -1.0], (800, 200): [40.0, 20.0], (4800, 2600): [0.0, 0.0, 20.0, 0.0, 0.0, 30.0, 0.0, 45.0, 0.0], (8000, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (200, 200): [0.0, -1.0, 0.0], (6000, 2200): [0.0, -1.0, -1.0], (5000, 3200): [0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0], (7000, 2800): [-1.0, -1.0, -1.0, -1.0], (600, 0): [5.0, 40.0, -1.0, 15.0], (7800, 3800): [-1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (8400, 1200): [-1.0, -1.0, -1.0, -1.0], (4200, 200): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2800, 200): [0.0, -1.0, 20.0], (7400, 1600): [-1.0, -1.0, -1.0], (2000, 600): [55.0, 5.0, 5.0], (7200, 1400): [0.0, -1.0], (4000, 600): [0.0], (5800, 3200): [-1.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 25.0], (7400, 600): [-1.0, -1.0], (5400, 4200): [0.0, 0.0, 10.0, 20.0, 5.0, 10.0], (8800, 600): [-1.0, -1.0], (3200, 800): [0.0, 0.0, 40.0, 15.0], (4400, 2200): [5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6200, 1600): [-1.0, -1.0], (5000, 2400): [0.0, 0.0, 15.0, 0.0, 15.0, 5.0], (8200, 4600): [0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0], (5800, 1000): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 1000): [-1.0, -1.0, -1.0], (3200, 600): [0.0, 10.0], (5400, 2400): [0.0, -1.0, 0.0, 5.0, 30.0, 0.0], (5400, 800): [0.0, 0.0], (7000, 2200): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (8200, 4800): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (3000, 400): [0.0], (6800, 4800): [-1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 80.0, 0.0, 0.0], (6400, 1200): [0.0, -1.0, -1.0, -1.0], (6400, 600): [-1.0, -1.0, -1.0, -1.0, -1.0], (6400, 3200): [-1.0, 0.0, 20.0, 40.0, 10.0, -1.0], (3800, 0): [-1.0, -1.0, -1.0], (3000, 2000): [10.0, 0.0, 30.0, 5.0, 5.0, 25.0, 65.0, 10.0, 45.0, 15.0, 0.0, 20.0, 40.0, 10.0, 20.0, 5.0, 0.0, 25.0, 0.0, 5.0, 10.0, 25.0, 0.0], (8000, 2600): [0.0, -1.0, -1.0, -1.0], (2800, 1600): [10.0, 5.0, 0.0, 25.0, 35.0, 10.0, 5.0, 5.0, 15.0, 10.0, 15.0, 10.0, 5.0, 15.0, 20.0, 25.0, 15.0, 15.0, 25.0, 15.0, 20.0], (6800, 3200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0], (3800, 2600): [5.0, 25.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 40.0, 15.0, 5.0, 15.0, 5.0, 5.0, 10.0, 25.0, 0.0, 10.0, 10.0, 30.0, 0.0, 40.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0], (6600, 2800): [-1.0, 0.0, -1.0], (8000, 1800): [-1.0, -1.0], (4200, 2000): [0.0, 5.0, 5.0, 20.0, 15.0, 5.0, 0.0], (6600, 3600): [-1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 5.0], (5000, 600): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0], (3800, 600): [0.0, 5.0, 0.0, 5.0], (5000, 2000): [0.0, 10.0, 0.0, 30.0], (7000, 1600): [0.0, 0.0, -1.0, -1.0], (5200, 3400): [0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 65.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 0.0, 50.0, 30.0, 0.0, -1.0, 35.0, 0.0, 0.0, 10.0, 0.0], (7800, 3400): [0.0, -1.0, -1.0, 0.0, -1.0], (5000, 1800): [0.0, 0.0, -1.0], (5200, 0): [0.0, 0.0, 0.0], (6800, 4000): [0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0], (8200, 3600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3800, 2400): [5.0, 0.0, 10.0, 10.0, 10.0, 0.0, 45.0, 0.0, 5.0, 15.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 20.0, 0.0, 5.0, 0.0, 5.0, 25.0], (6200, 3800): [10.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0], (4800, 3200): [0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 5.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 70.0, 0.0, 5.0, 0.0], (6400, 800): [-1.0, -1.0, -1.0, -1.0, -1.0], (7200, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8600, 1600): [-1.0, -1.0, -1.0, -1.0], (8200, 3200): [0.0, 0.0, 45.0, -1.0, -1.0, -1.0], (4000, 2800): [5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 15.0, 15.0, 5.0, 5.0, 5.0, 5.0, 20.0, 10.0, 10.0, 0.0, 0.0, 40.0, 5.0, 0.0, 5.0, 0.0, 15.0, 10.0, 5.0, 30.0, 25.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0], (5000, 2200): [0.0, 0.0, 0.0, 0.0], (4600, 2600): [0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0], (6800, 3800): [25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6200, 4800): [35.0, 0.0, 30.0, 0.0, -1.0], (6000, 1000): [-1.0, -1.0, 0.0, -1.0, -1.0], (5000, 2800): [0.0, 5.0, 5.0, 5.0, 5.0, 60.0, 0.0, 20.0, 0.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0], (6400, 1600): [0.0, -1.0, -1.0], (3800, 400): [5.0, 10.0], (8000, 1000): [-1.0, -1.0, -1.0, -1.0], (8400, 4400): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (3800, 3000): [0.0, 10.0, 35.0, 5.0, 20.0], (5000, 4000): [5.0, 20.0, 0.0], (6800, 5000): [0.0, 0.0, 0.0, 10.0], (6400, 1400): [-1.0, 0.0, 10.0, 0.0, -1.0, -1.0], (3600, 800): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0], (3600, 1000): [0.0, 20.0, 10.0, 5.0, 5.0, 5.0, 0.0], (5800, 4800): [0.0], (6800, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2800, 1000): [20.0, 5.0, 30.0, 40.0, 0.0], (4600, 0): [0.0, -1.0, 0.0], (8000, 4800): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 25.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (8000, 5000): [0.0, 0.0, -1.0, 30.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0], (5200, 3200): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 55.0, 0.0, 30.0, 10.0, 0.0, 0.0, 0.0, 0.0], (2200, 800): [0.0, 0.0, 25.0, 5.0, 0.0, 25.0], (1400, 1000): [95.0, 35.0, 70.0, 55.0, 0.0, 0.0, 90.0, 5.0, 40.0, 0.0, 5.0, 75.0, 85.0, 35.0, 0.0, 20.0, 15.0, 30.0, 85.0, 0.0], (8200, 1600): [-1.0, -1.0, -1.0, -1.0], (7600, 200): [-1.0, -1.0], (5800, 4200): [15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 65.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 45.0, 0.0, 55.0, 5.0, 10.0, 0.0], (8800, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8600, 400): [-1.0, -1.0, -1.0], (7400, 2600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5800, 200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 2400): [0.0, 0.0, 0.0, -1.0, -1.0], (2200, 600): [15.0, 25.0, 0.0], (4400, 3000): [5.0, 0.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 40.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0], (8600, 3800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8600, 2000): [-1.0, -1.0, -1.0, -1.0], (8600, 200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1800, 600): [65.0, 40.0, 45.0, 35.0, 50.0], (8200, 5600): [-1.0, 0.0, 0.0, 15.0, 0.0], (8200, 200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6800, 1800): [0.0, 5.0, -1.0], (7200, 1800): [-1.0, -1.0, -1.0, -1.0, -1.0], (5400, 2600): [0.0, 0.0, -1.0, -1.0, 0.0, 0.0], (5000, 400): [0.0, -1.0], (7200, 4400): [65.0, 30.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0], (7600, 4000): [0.0, -1.0, -1.0, 55.0, 0.0, 0.0, -1.0, 0.0], (6800, 3000): [-1.0, 0.0], (3600, 1200): [10.0, 0.0, 0.0, 0.0, 0.0, 35.0], (5800, 3800): [20.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, 5.0, 30.0, 0.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5400, 200): [0.0, 0.0, 0.0, -1.0, 0.0], (7000, 4400): [0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0], (4600, 1400): [0.0, 0.0, 0.0], (4000, 2600): [5.0, 30.0, 5.0, 0.0, 5.0, 0.0, 0.0, 65.0, 0.0, 20.0, 10.0, 5.0, 20.0, 15.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 0.0, 0.0, 25.0, 0.0, 5.0, 20.0, 20.0], (4800, 1000): [0.0, 0.0], (3200, 1800): [25.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 15.0, 5.0, 10.0, 25.0], (8800, 1000): [-1.0, -1.0, -1.0], (6000, 3600): [0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 40.0, 5.0, 0.0, -1.0], (6000, 1400): [0.0, -1.0, -1.0], (3400, 2400): [35.0, 0.0, 20.0, 20.0, 5.0, 30.0, 40.0, 35.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 45.0, 25.0, 30.0, 5.0, 5.0, 30.0, 10.0, 30.0, 15.0, 0.0, 35.0, 35.0], (2400, 200): [60.0, 0.0, -1.0], (1600, 0): [5.0, 5.0, 10.0], (3400, 1800): [0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 35.0, 80.0, 10.0, 10.0, 10.0, 20.0, 0.0, 5.0, 0.0, 5.0], (5800, 2800): [-1.0, 35.0, 0.0, -1.0, -1.0, 0.0, 0.0], (7600, 1400): [-1.0, -1.0], (7200, 3400): [0.0, -1.0, 50.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0], (6200, 200): [-1.0, -1.0, -1.0, -1.0, -1.0], (6000, 3400): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0], (3200, 1400): [15.0, 30.0, 10.0, 5.0, 0.0, 0.0, 5.0], (8000, 2800): [-1.0, -1.0, -1.0], (5600, 4400): [50.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4200, 1800): [0.0, 0.0, 0.0, 5.0, 5.0, 0.0], (2600, 1000): [10.0, 0.0, 10.0], (3600, 2000): [0.0, 45.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 55.0, 5.0, 0.0, 0.0, 5.0, 40.0, 0.0], (7200, 1000): [-1.0, 0.0, -1.0, 0.0, -1.0], (5400, 3400): [0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 5.0], (6000, 400): [-1.0, 0.0, -1.0, -1.0, -1.0], (5800, 4400): [-1.0, 15.0, -1.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0], (4600, 1200): [0.0, 0.0, 0.0], (5400, 1400): [-1.0, -1.0, -1.0, -1.0], (8200, 2800): [-1.0, -1.0, -1.0, -1.0, -1.0], (5000, 1600): [0.0, 0.0, 30.0, 15.0], (5200, 4000): [5.0, 0.0, 0.0, 0.0], (5400, 3600): [5.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0], (8400, 2200): [-1.0, -1.0], (6000, 3200): [-1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 5.0, 0.0, -1.0], (5600, 3400): [10.0, 10.0, 10.0, -1.0, -1.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, -1.0], (7000, 600): [-1.0, -1.0], (7600, 4200): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0], (8800, 4200): [0.0, 0.0], (2200, 1200): [65.0, 5.0, 0.0, 5.0, 20.0, 55.0, 0.0, 40.0], (5400, 2800): [0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0], (8200, 1000): [-1.0, -1.0, -1.0, -1.0], (6200, 4200): [-1.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0], (6200, 600): [-1.0, 0.0], (3400, 1000): [25.0, 0.0, 10.0, 30.0, 0.0, 20.0, 0.0], (400, 0): [0.0, -1.0, 30.0, 40.0], (5800, 1600): [-1.0, -1.0, 0.0], (2000, 1600): [35.0, 15.0], (6800, 1200): [-1.0, -1.0, -1.0, -1.0], (8400, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3200, 2600): [15.0], (6400, 2000): [-1.0, -1.0, -1.0, -1.0], (7600, 0): [-1.0], (7600, 2600): [-1.0, -1.0, -1.0, 10.0, -1.0, -1.0], (7600, 600): [-1.0, -1.0, -1.0, -1.0], (8000, 1200): [-1.0, -1.0, -1.0, -1.0], (8800, 1200): [-1.0, -1.0, -1.0], (7800, 4800): [-1.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0], (7800, 1400): [-1.0, -1.0, -1.0, -1.0], (6600, 1800): [-1.0, 0.0], (7200, 4800): [0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0], (6400, 2800): [0.0, 0.0, -1.0], (4800, 200): [0.0], (7800, 3600): [-1.0, 0.0, -1.0], (6600, 4400): [30.0, 0.0, -1.0, -1.0, 0.0, 5.0, 10.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5600, 3800): [5.0, 10.0, -1.0, 5.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0], (7800, 3000): [10.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (3800, 800): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0], (7800, 2400): [-1.0, -1.0, -1.0, 0.0], (8200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4400, 2600): [0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0], (5000, 1200): [5.0, -1.0, 0.0, -1.0, -1.0, 0.0], (6600, 800): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7600, 2800): [-1.0], (5600, 2800): [55.0, 0.0, 10.0, -1.0, -1.0, 0.0], (4000, 3200): [70.0, 20.0, 45.0, 0.0, 5.0, 0.0], (5400, 600): [-1.0], (4800, 2200): [0.0, 0.0, 25.0, 5.0, 5.0, 0.0], (3600, 3000): [25.0], (2600, 1200): [5.0, 35.0, 0.0, 50.0, 55.0, 25.0, 0.0, 45.0, 15.0, 15.0, 5.0, 5.0], (7800, 600): [-1.0, -1.0], (8000, 3800): [45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8800, 800): [-1.0, -1.0, -1.0, -1.0], (2600, 200): [-1.0, 10.0, 5.0, 5.0], (1200, 600): [5.0, 25.0, 70.0, 30.0, 15.0, 80.0, 35.0, 10.0, 30.0, 10.0, 5.0], (5000, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5600, 4800): [20.0], (6400, 2600): [0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (4600, 3000): [0.0, 20.0, 15.0, 15.0, 5.0, 15.0, 0.0, 0.0, 10.0, 50.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 35.0, 5.0, 5.0], (7800, 2800): [-1.0, -1.0, -1.0, -1.0], (5400, 3000): [-1.0, 5.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, 0.0], (3400, 2600): [5.0, 15.0, 35.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0, 30.0, 10.0], (3400, 800): [0.0, 0.0, 5.0, 15.0, 5.0, 0.0], (8800, 5200): [0.0, -1.0, -1.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (6800, 1000): [-1.0, -1.0, 0.0, -1.0], (7200, 200): [-1.0, -1.0, -1.0, -1.0], (8000, 400): [-1.0, -1.0, -1.0], (4000, 2000): [10.0, 5.0, 5.0, 5.0], (7000, 3400): [-1.0, -1.0, -1.0, -1.0, -1.0], (7200, 1200): [-1.0, -1.0, -1.0], (7800, 0): [-1.0, -1.0], (8800, 5400): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, 5.0, 15.0], (8800, 1800): [-1.0, -1.0, 0.0, -1.0, -1.0], (5400, 3200): [0.0, 0.0, 10.0, 25.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1600, 200): [20.0, -1.0], (5600, 3200): [0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 20.0, -1.0], (6200, 1800): [-1.0, 0.0, -1.0, -1.0, -1.0], (8400, 400): [-1.0, -1.0, -1.0], (8800, 3000): [-1.0, 0.0, -1.0, -1.0, -1.0], (5800, 600): [-1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0], (6400, 400): [-1.0], (800, 400): [45.0, 25.0, 45.0, 65.0, 30.0, 45.0, 80.0, 25.0, 75.0], (6800, 4200): [0.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6400, 4200): [-1.0, 5.0, 40.0, -1.0, 20.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 50.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0], (0, 0): [-1.0], (1600, 1000): [20.0, 25.0, 35.0, 50.0, 5.0, 70.0, 40.0, 5.0, 30.0, 55.0, 15.0, 25.0, 55.0, 70.0, 15.0, 25.0, -1.0, -1.0, 65.0, 65.0, 15.0, 10.0, 15.0, 50.0, 15.0], (6200, 1000): [-1.0], (7800, 2000): [-1.0, -1.0, 0.0, -1.0], (3400, 2800): [15.0, 10.0], (7400, 800): [-1.0, -1.0, -1.0], (8800, 4800): [-1.0, -1.0, 5.0, 0.0], (8400, 4800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7000, 4200): [5.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0], (4600, 3400): [10.0, 0.0, 20.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 10.0, 45.0, 5.0, 5.0, 0.0, 15.0], (4400, 400): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (7000, 3200): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (4600, 1800): [0.0, 0.0, 5.0, -1.0], (5000, 1000): [-1.0, 0.0], (8800, 1400): [-1.0, -1.0, -1.0], (7000, 800): [-1.0, 0.0, -1.0], (7400, 5400): [-1.0], (1600, 600): [-1.0, 30.0, 100.0, 0.0], (8200, 5000): [0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0], (2000, 0): [20.0, 5.0], (6200, 4000): [-1.0, -1.0, 0.0, 0.0, 35.0, 0.0, 40.0, 40.0, -1.0, -1.0, 5.0, 15.0, 0.0, -1.0, 50.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4200, 1200): [0.0, 0.0, 0.0, 20.0, 0.0], (8200, 2600): [-1.0, -1.0, 0.0, -1.0], (8200, 800): [-1.0, -1.0, -1.0], (4000, 2200): [0.0, 0.0, 5.0, 0.0, 0.0], (8000, 5400): [0.0, -1.0, 0.0, -1.0, 5.0, 10.0, 5.0, -1.0], (400, 200): [80.0, 5.0, 65.0, 65.0, 0.0, 35.0, 75.0, 90.0, 10.0, 40.0, 20.0, 50.0, 65.0, 45.0, 40.0, 95.0, 100.0, 20.0], (7200, 5400): [-1.0], (6000, 200): [-1.0, -1.0, -1.0, -1.0, -1.0], (3200, 400): [10.0, 0.0], (8800, 4600): [10.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, 15.0], (5800, 2000): [0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0], (7400, 200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2600, 400): [5.0, 0.0], (6400, 3400): [-1.0, 0.0, 0.0, -1.0, 60.0, 15.0, 0.0], (2600, 2000): [0.0, 5.0, 35.0, 5.0, 10.0, 10.0, 0.0, 20.0, 45.0, 60.0], (8000, 2000): [-1.0], (8400, 1600): [-1.0, -1.0, 0.0, 0.0], (3200, 1200): [15.0, 5.0, -1.0], (7600, 4800): [10.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6000, 3000): [0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (4600, 2800): [0.0, 0.0, 5.0, 10.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 45.0, 65.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0], (3400, 1600): [5.0, 0.0], (3600, 2600): [20.0, 0.0, 30.0, 10.0, 35.0, 10.0, 5.0, 0.0, 10.0, 20.0, 10.0, 10.0, 0.0, 0.0, 15.0, 15.0, 30.0, 5.0, 20.0], (7000, 1400): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0], (4400, 1800): [0.0, 0.0], (5600, 2000): [-1.0, 30.0, 0.0, -1.0], (7400, 4600): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, -1.0, 0.0], (5600, 1800): [0.0, -1.0, 0.0, 0.0], (3400, 0): [10.0, 0.0, -1.0, 0.0], (8200, 2400): [-1.0, 0.0, -1.0, -1.0], (7800, 1800): [-1.0, -1.0, -1.0, -1.0], (5800, 800): [-1.0, 0.0, -1.0], (3600, 200): [0.0, -1.0, 0.0, 10.0], (6600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0], (4800, 600): [0.0, 0.0, 0.0, 0.0, 0.0], (7800, 200): [-1.0, -1.0, -1.0, -1.0, -1.0], (5200, 2400): [-1.0, 30.0, 0.0], (4800, 1600): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0], (4200, 400): [0.0, 0.0, 0.0, 0.0, 0.0], (8200, 4400): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 3200): [-1.0, 0.0], (2600, 1400): [5.0, 25.0, 0.0, 25.0, 45.0, 45.0, 35.0, 15.0, 25.0, 65.0], (6600, 3800): [0.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0], (5600, 200): [0.0, 0.0, 0.0, -1.0], (4800, 1400): [-1.0, 0.0, 0.0, 0.0], (8600, 3600): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7400, 3000): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 2400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4000, 1200): [0.0, 5.0, 0.0], (6600, 1400): [-1.0, -1.0, -1.0], (4400, 200): [0.0, 0.0], (5200, 1400): [0.0, 0.0, -1.0, 0.0], (2000, 800): [15.0, 60.0, 30.0, 20.0, 25.0, 25.0, 20.0, 60.0, 70.0, 15.0], (7600, 2000): [-1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0], (3600, 400): [0.0, 5.0, 0.0, 0.0], (6600, 1600): [-1.0, 0.0, -1.0, -1.0, -1.0], (6800, 800): [-1.0, -1.0, -1.0, -1.0, -1.0], (6800, 2600): [0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0], (1800, 0): [65.0, 35.0, 5.0], (4200, 800): [5.0, 0.0], (6600, 600): [-1.0, -1.0, -1.0, -1.0], (8000, 5200): [10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0], (7600, 1600): [-1.0, -1.0, -1.0, -1.0], (7200, 600): [-1.0, -1.0, -1.0], (6200, 2400): [0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (7000, 2400): [-1.0, -1.0, -1.0, 0.0], (1400, 1200): [55.0], (7200, 1600): [0.0], (6600, 2600): [0.0, -1.0, -1.0], (5200, 4400): [0.0], (7000, 400): [-1.0, -1.0, -1.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 400): [-1.0, -1.0, -1.0, -1.0], (6200, 400): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1400, 400): [15.0, 10.0, 50.0, 5.0, 0.0, 70.0, 5.0, 0.0, 35.0], (3400, 2000): [10.0, 5.0, 25.0, 5.0, 20.0, 35.0, 15.0, 15.0, 20.0, 35.0, 10.0, 0.0, 5.0, 25.0, 30.0, 0.0, 10.0, 20.0, 30.0], (2400, 2000): [20.0], (7600, 3000): [-1.0, 0.0, 0.0, 0.0, -1.0], (8000, 1600): [-1.0, -1.0, -1.0], (5000, 800): [5.0, -1.0, -1.0, 0.0, -1.0], (4400, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5000, 3800): [30.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 20.0, 0.0], (6400, 4600): [0.0, -1.0, 0.0, 0.0, -1.0, 40.0, -1.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0], (7600, 2200): [-1.0, -1.0, 0.0, 0.0, -1.0], (5800, 3400): [15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, 0.0, 0.0, -1.0, 0.0], (6200, 3000): [0.0, -1.0, -1.0, 0.0, 0.0], (3000, 600): [10.0, 5.0, 10.0, 10.0], (8000, 4600): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0], (8400, 5400): [0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (8800, 5000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 10.0, -1.0, -1.0, -1.0, -1.0], (7000, 2600): [-1.0, -1.0, 0.0, -1.0, 10.0], (2800, 1200): [40.0, 5.0], (3600, 1800): [5.0, 0.0, 0.0, 5.0, 30.0, 5.0, 20.0, 20.0, 0.0, 10.0], (5600, 1000): [-1.0, -1.0, 0.0], (2200, 1400): [5.0, 10.0, 50.0, 10.0, 80.0, 75.0, 5.0, 5.0, -1.0, 20.0, 40.0, 10.0, 40.0, 50.0, 25.0, 65.0, 30.0, 5.0], (7800, 800): [-1.0, -1.0, -1.0, -1.0], (5800, 2600): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0], (2000, 1200): [45.0, 40.0, 15.0, 45.0, 20.0, 70.0, 15.0, 0.0, 40.0, 80.0, 85.0, 95.0, 35.0, 5.0, 70.0], (6400, 1000): [0.0, -1.0, 0.0, -1.0], (1200, 1000): [10.0, 25.0], (6000, 4600): [0.0, 0.0, 0.0, 15.0], (4400, 2800): [25.0, 0.0, 10.0, 25.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0], (7200, 3000): [0.0, -1.0, -1.0, 0.0, 0.0], (6200, 4400): [0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 60.0, 15.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (7400, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 4000): [-1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0], (5600, 4000): [0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0], (3200, 200): [5.0, 5.0, 5.0], (3200, 1000): [0.0, 5.0, 15.0, 0.0, 5.0, 0.0], (4200, 1400): [0.0, 15.0, 5.0, 0.0], (2400, 400): [0.0, 0.0, 15.0, 5.0, 15.0], (6400, 4000): [0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2400, 1000): [30.0, 30.0], (7800, 5600): [-1.0], (7000, 3600): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8800, 3600): [0.0, -1.0, -1.0, -1.0, -1.0], (6800, 0): [-1.0, -1.0, -1.0], (6800, 3600): [0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6400, 2200): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (3000, 2200): [0.0, 10.0, 0.0, 10.0, 5.0, 55.0, 0.0, 30.0, 20.0, 10.0, 65.0, 10.0, 25.0, 5.0, 25.0, 15.0, 35.0, 20.0, 5.0, 0.0, 5.0, 5.0], (8200, 2200): [-1.0, -1.0], (8200, 4200): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0], (8400, 5800): [0.0], (7400, 5200): [5.0, 5.0, 0.0], (6600, 2000): [-1.0, 0.0], (4200, 2600): [30.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0], (6200, 3400): [0.0, 5.0, 10.0, -1.0, 25.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 45.0, 5.0], (2400, 600): [15.0, 0.0, -1.0, 0.0, 40.0], (7600, 3400): [-1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6200, 2800): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8600, 1000): [-1.0, -1.0, -1.0, -1.0], (3000, 200): [0.0, -1.0, 5.0, 0.0, 0.0, 10.0], (6400, 1800): [-1.0, -1.0], (5800, 4000): [10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 90.0, -1.0, 0.0, 0.0, 5.0, 0.0], (4800, 2000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0], (2000, 1400): [65.0, 10.0, 10.0, 25.0, 25.0, -1.0, 40.0, 10.0, 55.0, 30.0, 0.0, 5.0, 35.0, 25.0, 5.0, 15.0, 30.0, 65.0, 5.0, 30.0, 70.0, 25.0, 65.0, 55.0, 5.0, 35.0], (2600, 1600): [5.0, 30.0, 80.0, 35.0, 15.0, 20.0, 5.0, 0.0, 15.0, 65.0, 25.0, 5.0, 25.0, 5.0, 0.0, 5.0, 25.0, 5.0, 0.0, 30.0, 70.0, 15.0, 10.0, 5.0, 15.0], (8800, 2800): [-1.0, -1.0, -1.0], (2800, 2200): [45.0, 10.0, 25.0, 15.0, 10.0, 25.0, 25.0], (7400, 3600): [-1.0, -1.0, 10.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 45.0], (5400, 4600): [0.0], (6000, 4000): [25.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0], (6800, 2800): [0.0, -1.0, -1.0], (3200, 2400): [5.0, 5.0, 15.0, 0.0, 0.0, 25.0, 30.0, 15.0, 0.0, 10.0, 0.0, 0.0, 15.0], (5600, 400): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5600, 2200): [10.0, 0.0, 0.0, 0.0, 0.0], (3600, 1400): [0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 5.0], (8800, 5600): [40.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0], (7800, 4200): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0], (4400, 800): [0.0, 0.0], (4600, 800): [0.0, 0.0, 0.0, 0.0, 0.0], (3800, 1200): [0.0, 0.0, 0.0, 0.0, 0.0], (8400, 2600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (3200, 2200): [10.0, 10.0, 5.0, 5.0, 0.0, 10.0, 70.0, 0.0, 10.0, 10.0, 0.0, 30.0, 30.0, 15.0, 15.0, 0.0, 5.0, 5.0, 40.0, 80.0, 0.0, 0.0, 10.0, 10.0, 10.0, 15.0, 15.0, 25.0, 25.0, 5.0], (8000, 4400): [0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0], (6800, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 3800): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0], (7000, 200): [-1.0, -1.0, -1.0, -1.0], (7000, 1000): [-1.0, -1.0, -1.0, -1.0], (5600, 4200): [-1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0], (3000, 1800): [20.0, 10.0, 15.0, 35.0, 0.0, 10.0, 40.0, 5.0, 0.0, 15.0, 15.0, 5.0, 40.0, 15.0, 5.0, 35.0], (4600, 2000): [55.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0], (8600, 5200): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0], (7200, 3800): [30.0, -1.0, 5.0, 0.0, 20.0, 0.0, 0.0, -1.0], (5800, 3600): [-1.0, -1.0, 30.0, 0.0, 0.0, 10.0, 10.0, 0.0, 35.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 20.0], (2800, 0): [-1.0, 25.0, 5.0, 0.0, 10.0, -1.0, 20.0], (3400, 600): [0.0, 0.0, 0.0, 10.0, 0.0], (7400, 2800): [5.0, -1.0], (6000, 600): [-1.0, 0.0, 0.0, 0.0], (6600, 1200): [-1.0, 0.0, -1.0, -1.0], (2200, 1000): [10.0, 10.0, 0.0, 5.0, 25.0], (8400, 4200): [0.0, -1.0, -1.0, 0.0], (8200, 3000): [0.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8000, 5600): [0.0, -1.0], (8800, 400): [-1.0, -1.0, -1.0, -1.0, -1.0], (4400, 3400): [0.0, 0.0, 20.0, 5.0, 0.0, 10.0, 5.0, 20.0, 0.0], (8200, 5200): [0.0, -1.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0], (1800, 200): [-1.0, -1.0, -1.0], (6600, 3200): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (7400, 5000): [0.0, 0.0, 0.0, 10.0, 55.0, 0.0, -1.0, 0.0, 0.0], (4800, 3400): [10.0, 25.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 5.0], (3200, 1600): [10.0, 25.0, 10.0, 5.0, 15.0, 5.0, 5.0, 10.0, 0.0], (8200, 1200): [-1.0, -1.0, -1.0, -1.0], (4000, 0): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (7600, 3600): [5.0, 0.0, 0.0, -1.0, -1.0], (7800, 5000): [-1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 4000): [-1.0, 0.0, 0.0, -1.0, -1.0], (3200, 0): [0.0, -1.0, 5.0, -1.0], (7800, 4400): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0], (6600, 4200): [0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0], (6600, 2400): [0.0, -1.0], (8800, 3400): [-1.0, -1.0, -1.0, -1.0, 0.0], (8400, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4800): [0.0], (7200, 4200): [35.0, 30.0, -1.0, 0.0, 0.0, -1.0, 25.0, -1.0, 35.0, 0.0], (4000, 1800): [5.0, 0.0, 0.0, 20.0, 5.0, 10.0], (3800, 2800): [10.0, 10.0, 5.0, 0.0, 5.0, 5.0, 10.0, 5.0, 5.0, 0.0, 50.0], (7200, 5200): [0.0, 0.0, 10.0, -1.0], (8800, 4000): [-1.0, -1.0, -1.0, -1.0, -1.0], (8400, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (5400, 0): [0.0, 0.0, 0.0], (1400, 200): [0.0, -1.0, 15.0, 5.0], (5400, 4000): [0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0], (6400, 3000): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0], (2600, 600): [20.0, 10.0, 10.0, 0.0, 0.0], (1000, 600): [40.0, 0.0, 90.0, 60.0, 50.0, 85.0, 10.0, 0.0, 15.0, 5.0, 25.0, 5.0, 75.0, 5.0, 5.0, 90.0], (8000, 1400): [-1.0, 0.0, -1.0], (8600, 4200): [0.0, -1.0, -1.0, -1.0], (7000, 5000): [0.0, 5.0, 0.0, 0.0, -1.0], (8400, 3800): [15.0, -1.0, -1.0, -1.0], (6800, 200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6800, 2000): [-1.0, -1.0], (6600, 400): [-1.0, -1.0], (2400, 0): [0.0, 5.0, 10.0, 10.0, 35.0], (7400, 400): [-1.0, -1.0, -1.0, -1.0, -1.0], (3400, 400): [5.0], (3600, 2400): [15.0, 0.0, 15.0, 0.0, 35.0, 10.0, 40.0, 5.0, 20.0, 0.0, 35.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0], (8400, 1400): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0], (6000, 800): [-1.0, -1.0, -1.0, 0.0], (6200, 1200): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (4000, 400): [0.0, 0.0, 0.0, -1.0, 0.0], (2200, 0): [5.0, 25.0, 15.0], (7600, 3200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3400, 2200): [0.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 0.0, 45.0, 0.0, 0.0, 5.0, 45.0, 25.0, 20.0, 0.0, 20.0, 10.0, 5.0, 0.0, 10.0, 0.0, 15.0], (2200, 1800): [95.0, 35.0, 20.0], (8000, 4200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0], (4200, 3000): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 35.0, 0.0, 20.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 20.0, 0.0, 40.0, 30.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 5.0, 0.0], (2000, 400): [10.0, 20.0, 30.0, 0.0, 25.0, 20.0, 80.0], (6400, 3600): [10.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 80.0, -1.0, -1.0], (5400, 1000): [15.0, -1.0, 0.0, -1.0, -1.0], (2600, 2200): [25.0], (8600, 4000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 5.0], (4000, 2400): [5.0, 0.0, 10.0, 15.0, 5.0, 20.0, 20.0, 15.0, 5.0, 0.0, 5.0, 5.0, 5.0], (2000, 1000): [20.0, 0.0, 90.0, 25.0, 20.0, 100.0, 30.0, 75.0, 55.0, 80.0, 5.0, 20.0], (4200, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0], (8600, 5400): [5.0, -1.0, 5.0], (8600, 800): [-1.0, -1.0, -1.0, -1.0], (2400, 1400): [-1.0, 0.0, 15.0, 15.0, 30.0, 15.0, 5.0, 5.0, 25.0, 10.0, 5.0, 15.0, 0.0, 5.0, 30.0, 25.0], (8600, 5800): [-1.0, -1.0], (8000, 800): [-1.0, -1.0, -1.0, -1.0, -1.0], (8800, 2600): [-1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (5800, 1800): [0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0], (4600, 1000): [0.0, -1.0, 0.0], (6400, 4400): [0.0, -1.0, 0.0, 5.0, 0.0, 15.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (3000, 1600): [0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 25.0, 20.0, 5.0, 0.0, 15.0, 15.0], (4000, 1600): [0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0], (2200, 200): [5.0, 25.0, 20.0, 0.0, 5.0], (5400, 1200): [-1.0, 5.0], (7400, 0): [-1.0, -1.0, -1.0, -1.0], (4200, 3400): [5.0, 0.0, 0.0], (1800, 400): [40.0, 20.0, 25.0, 20.0], (7800, 3200): [-1.0, -1.0, -1.0], (8400, 2400): [-1.0], (4800, 3600): [5.0, 25.0, 0.0, 15.0, 15.0, 35.0, 5.0, 25.0, 10.0, 0.0, 50.0, 15.0], (6600, 4000): [0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0], (7400, 1200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 3800): [0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 65.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0]}
mpc_dash_syth_hyb_pen_table_300 = {(6000, 4200): [5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 40.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 60.0, 0.0, 0.0, 0.0, -1.0, 60.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0], (2400, 2100): [10.0], (8700, 1500): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3300, 0): [0.0, 10.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0], (2400, 1200): [5.0, 0.0, 15.0, 25.0, 20.0, 0.0, 45.0, 30.0, 5.0, 50.0, 55.0, 10.0, 0.0, 60.0, -1.0, 35.0, 15.0, 15.0, 5.0, -1.0, 5.0, 70.0], (6600, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (2400, 0): [60.0, 0.0, -1.0, 0.0, 5.0, 10.0, 10.0, 5.0, -1.0, 20.0, 35.0], (5700, 300): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2400, 1800): [10.0, 40.0, 30.0, 0.0, 35.0, 25.0, 55.0, 50.0, 5.0, 40.0, 40.0, 25.0, 30.0, 20.0, 0.0, 45.0, 55.0, 25.0, 45.0, 15.0, 20.0, 0.0, 15.0, 5.0, 40.0, 0.0, 15.0, 20.0, 30.0], (4800, 3900): [5.0, 0.0, 0.0], (5400, 2100): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 10.0, 0.0], (5700, 1800): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0], (4800, 3000): [15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 25.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 15.0, 0.0, 30.0, 5.0, -1.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0], (5100, 2100): [0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0], (5700, 3000): [10.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 15.0, 25.0, -1.0], (1500, 600): [35.0, 10.0, -1.0, 5.0, 30.0, 5.0, 100.0, 20.0, 20.0, 20.0, 10.0, 0.0, 10.0, 15.0, 15.0, 20.0], (5700, 3900): [20.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 10.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 90.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0], (1500, 1200): [30.0, 5.0, 15.0, 85.0, 40.0, 55.0], (4200, 0): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (4800, 300): [0.0, 0.0, 0.0, 0.0], (3300, 300): [5.0, 5.0, 5.0, 5.0], (900, 600): [15.0, 40.0, 50.0, 25.0, 0.0, 10.0, 90.0, 60.0, 50.0, 75.0, 85.0, -1.0, 10.0, 0.0, 65.0, 15.0, 5.0, 25.0, 5.0, 95.0, 5.0, 75.0, -1.0, 15.0, 5.0, 50.0, 10.0, 5.0, 50.0, 5.0, 80.0, 90.0], (8100, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 2400): [0.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 10.0, 20.0, 0.0, 0.0], (7500, 3300): [0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (5100, 3000): [0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 60.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 5.0], (7500, 4200): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0], (7200, 4500): [0.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 5.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0], (4200, 600): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8700, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (8700, 5100): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8700, 2100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 900): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0], (3600, 900): [0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0], (7200, 4200): [65.0, -1.0, 0.0, -1.0, 35.0, 0.0, 10.0, 30.0, -1.0, 10.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, 35.0, 30.0, 0.0, 35.0, 0.0, -1.0], (3000, 1500): [0.0, 0.0, 5.0, 0.0, 20.0, 10.0, 5.0, 30.0, 0.0, 0.0, 25.0, 20.0, 5.0, 5.0, 15.0, 0.0, 5.0, 5.0, 10.0, 15.0, 15.0, 0.0, 15.0], (8700, 3000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 3600): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 15.0, 0.0, 40.0, 5.0, 0.0, 0.0, 0.0, -1.0], (1200, 900): [95.0, 35.0, 10.0, 70.0, 55.0, 35.0, 25.0, 100.0, 10.0, 25.0, 90.0, 0.0, 40.0, 5.0, 45.0, 75.0, 15.0, 80.0, 45.0, 65.0, 35.0, 10.0, 20.0, 95.0, 40.0, 45.0, 10.0, 45.0, 30.0, 85.0, 95.0], (5100, 900): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (8700, 3900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0], (7200, 2700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 5.0, 0.0, -1.0], (6000, 2100): [0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (4200, 3300): [0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0], (5700, 900): [0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3900, 1200): [0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0], (7200, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3900, 2100): [15.0, 10.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0], (3000, 2100): [10.0, 0.0, 0.0, 10.0, 30.0, 5.0, 10.0, 0.0, 25.0, 50.0, 10.0, 5.0, 55.0, 70.0, 0.0, 10.0, 30.0, 45.0, 30.0, 20.0, 0.0, 30.0, 15.0, 0.0, 10.0, 20.0, 0.0, 10.0, 20.0, 0.0, 5.0, 65.0, 5.0, 0.0, 5.0, 0.0, 10.0, 25.0, 5.0, 25.0, 15.0, 35.0, 10.0, 20.0, 5.0, 0.0, 5.0, 15.0, 25.0, 5.0], (8400, 1800): [0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 2700): [0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 10.0, 0.0, 30.0, 15.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 45.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0], (4200, 300): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (300, 0): [5.0, 35.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 30.0, 20.0, 0.0, 65.0, 30.0, 45.0, 40.0, 0.0, 40.0], (7500, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3000, 0): [10.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0], (4800, 900): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (5100, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5100, 300): [0.0, 0.0, -1.0, 0.0, -1.0], (4800, 3600): [5.0, 25.0, 0.0, 0.0, 0.0, 15.0, 15.0, 0.0, 15.0, 0.0, 35.0, 0.0, 5.0, 35.0, 5.0, 5.0, 25.0, 0.0, 10.0, 0.0, 0.0, 20.0, 50.0, 15.0], (5100, 1200): [0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6900, 3600): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (4200, 3000): [0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 40.0, 30.0, 0.0, 10.0, 5.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 15.0, 0.0], (7500, 4800): [10.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 55.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6600, 4200): [0.0, 0.0, 20.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0], (6900, 1800): [-1.0, -1.0, -1.0], (4800, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6900, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6600, 4800): [0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, -1.0, 10.0, 0.0, -1.0, 45.0, 10.0, 0.0, 0.0, 0.0, 80.0, -1.0, -1.0, 0.0, 0.0, 10.0], (5100, 3900): [5.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0], (6900, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8100, 5100): [0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (5700, 1500): [-1.0, 0.0, -1.0, -1.0, 0.0, 0.0], (7200, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8700, 3600): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 1500): [-1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0], (8100, 2700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6300, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8700, 5400): [-1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 25.0, 5.0, -1.0, 80.0, 15.0, 0.0, -1.0], (0, 0): [-1.0, -1.0, -1.0], (8100, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2100, 0): [5.0, 20.0, 25.0, 5.0, 20.0, 75.0, 25.0, 15.0], (2400, 300): [5.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 15.0], (6600, 2700): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5700, 2700): [-1.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0], (7500, 1200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2700, 1800): [5.0, 0.0, 5.0, 25.0, 25.0, 25.0, 0.0, 25.0, 10.0, 20.0, 35.0, 0.0, 0.0, 5.0, 5.0, 10.0, 20.0, 0.0, 25.0, 20.0, 30.0, 10.0, 40.0, 0.0, 0.0, 35.0, 95.0, 0.0, 30.0, 30.0, 0.0, 45.0, 55.0, 30.0, 35.0, 35.0, 5.0, 20.0, 5.0, 0.0, 20.0, 25.0, 10.0, 20.0, 0.0, 70.0, 30.0, 85.0, 20.0, 5.0, 5.0, 20.0, 15.0, 5.0, 45.0, 60.0, 10.0, 40.0, 20.0, 15.0, 65.0, 65.0, 25.0, 0.0, 25.0, 20.0, 0.0], (7200, 5100): [5.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, -1.0, -1.0], (8400, 3900): [-1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0], (8100, 3300): [-1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 45.0, -1.0, -1.0], (6600, 2100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 3300): [0.0, 10.0, 25.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 75.0, 45.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 70.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 35.0, 5.0, 5.0], (8400, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 1200): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4800, 2400): [0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4800, 2100): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 5.0, 5.0, 0.0], (2700, 300): [0.0, -1.0, 25.0, 0.0, -1.0, 5.0, 20.0, 0.0, 50.0], (6900, 2400): [0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0], (4800, 1200): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (6300, 4800): [-1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (8400, 3000): [-1.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0], (4500, 300): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0], (2700, 2400): [0.0], (8400, 4800): [5.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (1800, 1200): [5.0, 20.0, 10.0, 5.0, 15.0, 50.0, -1.0, 5.0, 0.0, 30.0, 40.0, 40.0, 50.0, 65.0, 15.0, 10.0, 60.0, 20.0, 50.0, 25.0, 5.0, 70.0, 90.0, 5.0, 10.0, 65.0, 0.0, 35.0, 0.0, 25.0, 75.0, 5.0, 80.0, 10.0, 65.0, 70.0, 85.0, 25.0, 55.0, 35.0, 10.0, 5.0, 0.0, 35.0, 95.0, 95.0, 15.0, 85.0], (5400, 4500): [0.0, 45.0], (8400, 6000): [-1.0], (2400, 1500): [20.0, 30.0, 35.0, 40.0, 30.0, 25.0, 40.0, 65.0, 15.0, 20.0, 5.0, -1.0, 0.0, 45.0, 15.0, 15.0, 15.0, 65.0, 60.0, 25.0, 0.0, 15.0, 25.0, 0.0, 45.0, 45.0, 5.0, 5.0, 5.0, 0.0, 0.0, 95.0, 50.0, 15.0, 15.0, 25.0, 5.0, 100.0, 25.0, 5.0, 20.0, 10.0, 5.0, 15.0, 45.0, 25.0, 40.0, 60.0, 15.0, 0.0, 15.0, 30.0, 0.0, 70.0, 15.0, 30.0, 20.0, 25.0, 0.0, 10.0, 25.0, 5.0, 15.0], (7500, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 1800): [0.0, 0.0, 0.0, 55.0, 5.0, 15.0, -1.0, 0.0, 0.0, 0.0, 10.0], (8700, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 2400): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5400, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (900, 0): [20.0], (8100, 2100): [-1.0, -1.0, -1.0, 0.0], (6000, 900): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (6300, 2400): [0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0], (7500, 5100): [0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0], (3000, 600): [10.0, 15.0, 0.0, 0.0, 10.0, 15.0, 5.0, 10.0, 10.0], (3000, 2400): [5.0, 15.0, 20.0, 0.0, 30.0, 10.0, 20.0, 75.0], (7200, 3300): [-1.0, 0.0, -1.0, -1.0, 50.0, 40.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 2700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 95.0], (6000, 2700): [-1.0, 25.0, 20.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0], (7200, 2100): [-1.0, -1.0, 5.0, 0.0, -1.0, -1.0], (7500, 2700): [5.0, -1.0, -1.0, -1.0, 10.0, -1.0], (7200, 1200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 3600): [-1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2700, 0): [-1.0, 25.0, 5.0, 0.0, 0.0, 10.0, 10.0, -1.0, 20.0, 5.0], (6300, 1200): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2700, 600): [20.0, 0.0, 10.0, 15.0, 0.0, 0.0], (2700, 900): [20.0, 0.0, 5.0, 30.0, 40.0, 10.0, 30.0, 0.0], (8100, 3000): [0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0], (2700, 1500): [5.0, 80.0, 10.0, 5.0, 25.0, 0.0, 0.0, 25.0, 5.0, 0.0, 35.0, 75.0, 5.0, 10.0, 5.0, 25.0, 5.0, 15.0, 5.0, 10.0, 0.0, 15.0, 10.0, 20.0, 5.0, 15.0, 5.0, 20.0, 25.0, 15.0, 15.0, 25.0, 10.0, 15.0, 65.0, 20.0], (4500, 3600): [10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8100, 3900): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (8100, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 2100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0], (4500, 0): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (1200, 300): [25.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 35.0, 70.0, 25.0, 5.0, 15.0, 5.0, 0.0, 35.0, 10.0], (5400, 4200): [-1.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 5.0, 0.0, 0.0, -1.0, 5.0, 10.0], (8400, 3300): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0], (600, 600): [20.0, -1.0, 50.0], (3300, 600): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0], (5400, 3300): [10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, -1.0, 85.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0], (6300, 2100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (8400, 4500): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0], (5400, 2400): [0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0], (3600, 300): [0.0, -1.0, 10.0, 5.0, 0.0, 0.0, 10.0], (2100, 600): [15.0, 55.0, 0.0, 25.0, 25.0, 5.0, 0.0], (7500, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5400, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (6300, 4500): [0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 45.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0], (7200, 3600): [-1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, -1.0, 45.0], (3600, 2100): [5.0, 0.0, 45.0, 5.0, 10.0, 35.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 30.0, 0.0, 5.0, 40.0, 0.0], (6600, 3600): [0.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, 5.0], (3600, 1200): [0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2700, 2100): [0.0, 25.0, 45.0, 0.0, 10.0, 5.0, 5.0, 0.0, 100.0, 10.0, 25.0, 5.0, 50.0, 15.0, 10.0, 15.0, 25.0, 25.0, 20.0, 25.0, 0.0, 40.0], (3600, 3000): [10.0, 25.0], (6300, 900): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8100, 4200): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, 10.0, -1.0, -1.0], (6900, 4200): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0], (8700, 4800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0], (6300, 1800): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6300, 2700): [-1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0], (8100, 2400): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2100, 300): [35.0, 30.0, 10.0, 0.0, 65.0, -1.0, 0.0, 5.0, 20.0, 80.0], (8100, 1800): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 3600): [0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 80.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8700, 2400): [5.0, -1.0, -1.0], (8100, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8700, 3300): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6600, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2400, 600): [15.0, 0.0, 5.0, 10.0, -1.0, 0.0, 45.0, 10.0, 40.0, 0.0], (8700, 4200): [-1.0, -1.0, 0.0, 0.0, 0.0], (1800, 1500): [70.0, 10.0, 35.0, 30.0, 65.0, 5.0, 45.0], (600, 0): [5.0, 40.0, -1.0, 20.0, 75.0, -1.0, 80.0, 15.0], (1800, 600): [65.0, 15.0, 40.0, 45.0, 35.0, 5.0, 50.0, 35.0, 50.0, 5.0], (7500, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5100, 4500): [0.0], (6900, 3300): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (6600, 3900): [0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6600, 3000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0], (5400, 300): [-1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (7500, 3000): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (7500, 2100): [-1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0], (7500, 3900): [0.0, -1.0, -1.0, -1.0, 55.0, 0.0, 0.0, 35.0, 10.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0], (3900, 900): [0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0], (1800, 300): [10.0, 20.0, 40.0, 20.0, 25.0, -1.0, 25.0, 20.0, 20.0], (3900, 1800): [0.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0], (7500, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4200, 2700): [0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 5.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 5.0], (7800, 5100): [10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0], (6900, 4800): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 20.0, -1.0, 0.0, 0.0, 0.0], (4200, 1800): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 15.0, 0.0, 0.0, 5.0], (3300, 2100): [0.0, 45.0, 10.0, 5.0, 25.0, 5.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 30.0, 5.0, 10.0, 0.0, 15.0, 15.0, 0.0, 15.0, 0.0, 45.0, 35.0, 0.0, 10.0, 0.0, 5.0, 0.0, 45.0, 5.0, 25.0, 20.0, 25.0, 0.0, 10.0, 20.0, 40.0, 80.0, 0.0, 0.0, 10.0, 10.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 25.0, 0.0, 10.0, 5.0, 10.0, 30.0, 15.0], (4200, 900): [10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0], (1500, 300): [0.0, 15.0, 50.0, 15.0, -1.0, 85.0, 0.0, 5.0, -1.0, 15.0, 10.0], (6000, 4800): [35.0, 0.0, 30.0, 0.0, 0.0], (7800, 4500): [-1.0, -1.0, 5.0, 35.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6000, 3300): [-1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 25.0, 35.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, -1.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0], (2400, 900): [5.0, 10.0, 20.0, 30.0, 0.0, 30.0, 0.0], (7800, 4200): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 30.0, 0.0], (600, 300): [20.0, 10.0, 25.0, 30.0, 20.0, 55.0, 35.0, 15.0, 30.0, 20.0, 90.0, 50.0, 10.0, 5.0, 0.0, 85.0, 65.0, 95.0, 30.0, -1.0, 10.0, 20.0, 100.0, 20.0, 10.0, 10.0, 10.0, 35.0, 45.0, 25.0, 80.0, 35.0, 15.0, 25.0, 75.0, 5.0, 15.0, 5.0, 20.0], (8400, 1500): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0], (6900, 5100): [-1.0, 0.0, 0.0, 0.0, -1.0], (8700, 5700): [40.0, 0.0, 0.0, -1.0, -1.0], (4500, 600): [5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7800, 5400): [0.0, 0.0, 45.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0], (1500, 0): [5.0, 20.0, 5.0, 5.0, 0.0, 10.0], (7800, 4800): [-1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, 10.0, 25.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0], (7500, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0], (1500, 900): [20.0, 25.0, 35.0, 50.0, 90.0, 20.0, 0.0, 5.0, 0.0, 5.0, 40.0, 70.0, 40.0, 5.0, 30.0, 0.0, 55.0, 55.0, 5.0, 15.0, 25.0, 20.0, 55.0, -1.0, 30.0, 70.0, 85.0, 15.0, 25.0, -1.0, 25.0, -1.0, 70.0, 15.0, 65.0, 65.0, 95.0, 0.0, 15.0, 10.0, 50.0, 15.0, 15.0, 30.0, 0.0, 50.0, 15.0, 15.0, -1.0], (7800, 3900): [10.0, 45.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0], (6300, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 3300): [0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (6300, 3300): [0.0, -1.0, 10.0, -1.0, 80.0, -1.0, -1.0, -1.0, 0.0, 20.0, 40.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 60.0, 5.0, 15.0, 0.0], (7800, 2700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 2400): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7800, 2100): [-1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0], (7500, 4500): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0], (7800, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7800, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 5400): [-1.0, 0.0, 0.0, 5.0, 0.0], (7800, 3000): [10.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0], (5700, 2400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0], (4500, 2100): [5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0], (5700, 3300): [0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 50.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 20.0, 0.0], (6000, 3900): [0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, -1.0, 0.0, -1.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, -1.0, 50.0, 55.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0], (8700, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5700, 4800): [0.0, 20.0], (3600, 600): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0], (6900, 3000): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (8400, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0], (6900, 3900): [0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 85.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0], (6000, 300): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6900, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (300, 300): [80.0, 65.0, 65.0, 0.0, 75.0, 90.0, 40.0, 50.0, 95.0, 100.0, 20.0], (2700, 1200): [5.0, 35.0, 40.0, 15.0, 15.0, 25.0, 45.0, 15.0, 5.0, 15.0, 5.0, 5.0], (7800, 1800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5100, 1800): [-1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0], (6900, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5100, 2700): [0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 60.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 70.0, 5.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0], (4200, 2100): [0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0], (3300, 1500): [0.0, 10.0, 25.0, 10.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 5.0], (5100, 3600): [0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 35.0, 0.0, 30.0, 5.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 15.0, 20.0, 45.0, -1.0, 0.0, 0.0], (4200, 1200): [0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0], (2100, 1200): [65.0, 5.0, 65.0, 10.0, 25.0, 10.0, 5.0, 0.0, 10.0, 45.0, 25.0, 5.0, 55.0, 30.0, 40.0, 0.0, 15.0, 45.0, 5.0, 20.0, 20.0, 55.0, 0.0, 40.0, 15.0, 50.0, 40.0, 30.0, 40.0, 30.0, 35.0, 5.0, 5.0, 70.0], (3900, 3300): [70.0, 20.0, 45.0, 15.0], (8400, 3600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7800, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6600, 3300): [-1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0], (4800, 1800): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0], (3600, 2400): [15.0, 5.0, 0.0, 10.0, 15.0, 0.0, 30.0, 0.0, 35.0, 10.0, 10.0, 40.0, 5.0, 20.0, 5.0, 35.0, 10.0, 0.0, 10.0, 0.0, 5.0, 35.0, 50.0, 10.0, 15.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 30.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 10.0, 0.0, 5.0, 0.0, 25.0, 10.0], (3900, 600): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8700, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2100, 900): [10.0, 0.0, 25.0, 10.0, 25.0, 25.0, 20.0, 100.0, 30.0, 60.0, 75.0, 70.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 20.0, 25.0], (3300, 1800): [25.0, 0.0, 15.0, 10.0, 20.0, 5.0, 0.0, 35.0, 0.0, 20.0, 0.0, 35.0, 80.0, 10.0, 10.0, 10.0, 5.0, 10.0, 20.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 15.0, 5.0, 20.0], (1200, 600): [20.0, 60.0, 5.0, 55.0, 5.0, 75.0, 25.0, 35.0, 45.0, 70.0, 20.0, 30.0, 0.0, 70.0, 15.0, 25.0, 80.0, 40.0, 10.0, 45.0, 35.0, 10.0, 30.0, 10.0, 5.0, 50.0], (6000, 1200): [0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (8700, 1800): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (7800, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8700, 2700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0], (1800, 900): [20.0, 60.0, 30.0, 60.0, 40.0, 20.0, 30.0, 90.0, 10.0, 5.0, 20.0, 10.0, 20.0, 10.0, 55.0, 0.0, 80.0, 5.0, 20.0, 50.0, 5.0, 90.0, 65.0, 10.0], (6600, 2400): [15.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (4500, 3000): [0.0, 35.0, 20.0, 0.0, 15.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 15.0, 40.0, 0.0, 10.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 5.0, 10.0, 25.0, 5.0], (1800, 0): [65.0, 35.0, -1.0, 10.0, 5.0, 5.0, -1.0], (6600, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3900, 0): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8100, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1200, 0): [35.0, 10.0, 5.0, -1.0, 40.0, 15.0, 0.0, 80.0, 25.0, 5.0, -1.0, 10.0, 15.0, 15.0], (6300, 4200): [0.0, -1.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, -1.0, 20.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 50.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0], (8400, 2400): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3300, 2400): [35.0, 0.0, 20.0, 5.0, 15.0, 20.0, 20.0, 0.0, 5.0, 5.0, 30.0, 0.0, 40.0, 35.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 10.0, 45.0, 25.0, 30.0, 5.0, 5.0, 30.0, 10.0, 15.0, 0.0, 10.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 15.0, 10.0, 35.0], (4200, 2400): [0.0, 30.0, 0.0, 5.0, 0.0, 20.0, 5.0, 10.0, 5.0, 0.0, 0.0, 15.0, 15.0, 5.0, 5.0, 5.0, 10.0, 30.0, 15.0, 15.0, 0.0, 15.0, 10.0, 25.0, 5.0, 0.0, 0.0, 20.0, 15.0, 35.0, 15.0, 10.0], (8400, 4200): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (3600, 0): [0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8400, 5400): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0], (5700, 0): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (3600, 1800): [0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 5.0, 5.0, 5.0, 30.0, 5.0, 5.0, 20.0, 20.0, 0.0, 0.0, 10.0, 25.0], (5700, 1200): [-1.0, 5.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0], (900, 300): [45.0, 0.0, 50.0, 45.0, 50.0, 40.0, 65.0, 85.0, 90.0], (5400, 2700): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0], (5700, 2100): [-1.0, 10.0, 0.0, 0.0, 30.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0], (5700, 3600): [-1.0, -1.0, 10.0, 5.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, 5.0, 15.0, -1.0, 10.0, 5.0, 10.0, -1.0, 0.0, 40.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 45.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 20.0, 35.0, 0.0], (8100, 4800): [0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5400, 3600): [10.0, 5.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 35.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 45.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8100, 5700): [-1.0, 0.0, 0.0], (5400, 900): [15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0], (5400, 600): [-1.0, 0.0, 0.0, -1.0], (4500, 3300): [10.0, 10.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 10.0, 0.0, 90.0, 20.0, 20.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 45.0, 5.0, 5.0, 30.0, 5.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0], (6000, 3000): [0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0], (3600, 2700): [20.0, 5.0, 0.0, 5.0, 0.0, 10.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 80.0, 0.0, 20.0, 5.0, 30.0, 10.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 5.0], (4500, 1500): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0], (5700, 600): [-1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (3900, 1500): [0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0], (8100, 3600): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0], (7200, 5400): [-1.0], (3600, 1500): [5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0], (8100, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4500): [0.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 55.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 75.0, 15.0, 0.0, 0.0], (5100, 600): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0], (7200, 3900): [-1.0, 0.0, 10.0, 0.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (8400, 5100): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, 5.0, 20.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0], (5700, 4200): [15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 45.0, 5.0, 5.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0], (7200, 3000): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 45.0, 0.0, -1.0, -1.0], (3300, 2700): [35.0, 15.0, 20.0, 0.0, 10.0], (7200, 1800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 1500): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (3000, 1200): [15.0, 5.0, 15.0, 10.0, 5.0, 5.0, 15.0, -1.0, 10.0, 5.0], (8400, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3300, 900): [25.0, 0.0, 0.0, 5.0, 5.0, 15.0, 10.0, 30.0, 5.0, 0.0, 40.0, 0.0, 0.0, 20.0, 0.0], (7200, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5400, 1800): [-1.0, 0.0, -1.0, 0.0], (3900, 3000): [0.0, 0.0, 0.0, 5.0, 25.0, 35.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0], (3000, 1800): [20.0, 15.0, 5.0, 10.0, 5.0, 15.0, 65.0, 35.0, 0.0, 10.0, 15.0, 0.0, 40.0, 25.0, 40.0, 5.0, 0.0, 5.0, 10.0, 15.0, 25.0, 0.0, 15.0, 15.0, 5.0, 0.0, 5.0, 10.0, 15.0, 5.0, 40.0, 25.0, 15.0, 5.0, 25.0, 35.0, 0.0], (5400, 3900): [10.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 60.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 20.0, 15.0, -1.0, 5.0, 0.0, 0.0, 15.0, 65.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0], (5400, 1500): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (3000, 900): [5.0, 0.0, 20.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 5.0, 5.0], (5400, 3000): [0.0, 0.0, 10.0, 25.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0], (3000, 300): [5.0, 0.0, 10.0, 0.0, 0.0], (6000, 600): [-1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0], (6300, 3000): [0.0, 10.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0], (6600, 1200): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (8400, 5700): [-1.0, -1.0, 0.0, -1.0, 0.0], (6300, 3900): [0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, 10.0, -1.0, -1.0, 35.0, 0.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2100, 1500): [20.0, 70.0, 45.0, 50.0, 20.0, 80.0, 75.0, 5.0, 35.0, 15.0, -1.0, 20.0, 60.0, 10.0, 80.0, 30.0, 5.0, 25.0, 10.0, 30.0, 15.0, 55.0, 25.0, 65.0, 15.0, 5.0, 5.0, 15.0, 25.0, 65.0, 20.0, 5.0, 0.0, 20.0], (3900, 300): [0.0, 0.0, 5.0, 0.0, -1.0, 0.0], (4500, 900): [0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (6900, 4500): [0.0, -1.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (8100, 4500): [0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, -1.0, -1.0], (3900, 2400): [25.0, 0.0, 5.0, 0.0, 10.0, 10.0, 15.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 40.0, 5.0, 20.0, 20.0, 0.0, 20.0, 45.0, 5.0, 15.0, 0.0, 5.0, 25.0, 15.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 40.0, 5.0, 10.0, 5.0, 5.0, 20.0, 5.0], (6300, 300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6900, 2700): [0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8700, 4500): [-1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 15.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (4800, 2700): [5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 30.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0], (6900, 1500): [-1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0], (6900, 900): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (4200, 1500): [0.0, 15.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0], (4800, 1500): [0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0], (5700, 4500): [50.0, 10.0, 10.0, 5.0], (3300, 1200): [5.0, 5.0, 25.0, 5.0, 0.0], (4800, 600): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6600, 1800): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0], (2100, 1800): [95.0, 35.0, 20.0], (6600, 900): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (3900, 2700): [5.0, 5.0, 20.0, 5.0, 30.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 65.0, 15.0, 0.0, 15.0, 10.0, 10.0, 5.0, 15.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 20.0, 10.0, 5.0, 0.0, 10.0, 0.0, 35.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 25.0, 10.0, 5.0, 0.0, 30.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 50.0, 0.0, 20.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0], (6900, 2100): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7200, 4800): [0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0], (8100, 5400): [-1.0, 5.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, 5.0, -1.0, 15.0], (5100, 1500): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 30.0], (5100, 2400): [65.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 20.0, 0.0, 15.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 5.0], (7500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0], (6600, 4500): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 50.0, 0.0, -1.0, 15.0, 15.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 45.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 35.0, 0.0, 5.0, 0.0, -1.0, -1.0], (5100, 3300): [0.0, 0.0, 0.0, 10.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 5.0, 5.0, 50.0, 30.0, 0.0, 0.0, 5.0, 5.0, 30.0, 10.0, -1.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0], (7800, 3600): [0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0], (8700, 600): [-1.0, -1.0, -1.0, -1.0, -1.0], (5100, 4200): [10.0, 20.0, 15.0]}
mpc_dash_syth_hyb_pen_table_400 = {(4000, 800): [10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7600, 2000): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, -1.0, -1.0], (4800, 3200): [0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 20.0, 0.0, 0.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 5.0, 5.0, 0.0, 30.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 75.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 70.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 35.0, 20.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 5.0], (6000, 2800): [-1.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0], (6800, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 1200): [5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (7200, 4000): [-1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 35.0, -1.0, 0.0, 10.0, 30.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, 0.0, -1.0, 0.0, 25.0, -1.0, 45.0, 25.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, 30.0, 0.0, 0.0, -1.0, 5.0, -1.0], (8000, 3200): [-1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (6800, 3200): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0], (6000, 4800): [35.0, 0.0, 30.0, 0.0, 0.0, -1.0], (4000, 2800): [0.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 15.0, 5.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 20.0, 0.0, 10.0, 5.0, 5.0, 35.0, 5.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 20.0, 5.0, 5.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 20.0, 25.0, 0.0, 40.0, 0.0, 5.0, 30.0, 0.0, 0.0, 10.0, 5.0, 15.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 10.0, 5.0, 20.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0], (7200, 1600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (7200, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (6400, 800): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (4800, 2400): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, 5.0], (6400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 3600): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 65.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 40.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0], (800, 400): [45.0, 40.0, 25.0, 0.0, 50.0, 50.0, 25.0, 0.0, 10.0, 90.0, 60.0, 50.0, 45.0, 75.0, 50.0, 85.0, 20.0, 65.0, 10.0, 0.0, 65.0, 65.0, 15.0, 85.0, 30.0, 5.0, 25.0, -1.0, 5.0, 95.0, 5.0, 75.0, 45.0, 90.0, 15.0, 5.0, 80.0, 50.0, 25.0, 5.0, 50.0, 50.0, 5.0, 80.0, 75.0, 90.0], (5200, 1600): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0], (1200, 0): [35.0, 10.0, 5.0, -1.0, 5.0, 40.0, 0.0, -1.0, 0.0, 20.0, 15.0, 0.0, 80.0, 15.0, 5.0, 25.0, 5.0, -1.0, 10.0, 15.0, 15.0], (8400, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (5600, 4800): [0.0, 20.0], (6400, 4800): [-1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 45.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0], (8000, 4400): [0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (4000, 2000): [0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0], (4400, 1600): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0], (5600, 3600): [20.0, -1.0, 5.0, 10.0, -1.0, -1.0, 10.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 15.0, -1.0, 10.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 45.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 20.0, 35.0, 0.0, 0.0, 5.0, 0.0], (7200, 3600): [-1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0], (1200, 1200): [55.0], (2800, 0): [-1.0, 25.0, 10.0, 0.0, 5.0, -1.0, 5.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 20.0, 20.0, 0.0], (8000, 1600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6800, 2400): [0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0], (2400, 800): [5.0, 10.0, 20.0, 30.0, 5.0, 0.0, 0.0, 45.0, 30.0, 10.0, 0.0], (4800, 800): [5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0], (4400, 0): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8800, 4800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8000, 2800): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 4400): [-1.0, 50.0, 0.0, 15.0, -1.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0], (1600, 400): [65.0, 0.0, 40.0, 40.0, 20.0, -1.0, 30.0, 45.0, 15.0, 100.0, 85.0, 35.0, 25.0, 0.0, 0.0, 50.0, 15.0, 10.0, 20.0], (4000, 1200): [0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0], (3600, 2000): [5.0, 10.0, 10.0, 0.0, 0.0, 45.0, 5.0, 5.0, 10.0, 0.0, 15.0, 0.0, 35.0, 10.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 5.0, 15.0, 0.0, 30.0, 0.0, 5.0, 40.0, 0.0], (8000, 2400): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5600, 4000): [0.0, -1.0, 15.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 20.0, 45.0, 0.0, 5.0, 0.0, 90.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0], (5200, 2800): [0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, -1.0, 15.0, 5.0, 0.0, 60.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0], (2800, 1200): [25.0, 5.0, 10.0, 10.0, 40.0, 5.0, 75.0, 5.0, 15.0, 15.0, 5.0, 15.0, 20.0, 10.0, 10.0, 15.0, 5.0, 5.0], (2800, 2000): [10.0, 0.0, 0.0, 0.0, 25.0, 30.0, 5.0, 5.0, 10.0, 0.0, 25.0, 10.0, 20.0, 25.0, 25.0, 10.0, 45.0, 0.0, 0.0, 5.0, 5.0, 55.0, 10.0, 5.0, 65.0, 25.0, 0.0, 10.0, 0.0, 5.0, 45.0, 30.0, 15.0, 0.0, 35.0, 30.0, 20.0, 0.0, 45.0, 0.0, 35.0, 100.0, 20.0, 10.0, 20.0, 5.0, 10.0, 25.0, 40.0, 10.0, 20.0, 5.0, 65.0, 5.0, 70.0, 50.0, 30.0, 0.0, 10.0, 25.0, 15.0, 25.0, 5.0, 20.0, 0.0, 25.0, 15.0, 10.0, 5.0, 15.0, 15.0, 25.0, 25.0, 10.0, 35.0, 20.0, 20.0, 5.0, 0.0, 5.0, 0.0, 40.0, 25.0, 0.0, 5.0, 25.0, 0.0], (1600, 1200): [5.0, 20.0, 5.0, 30.0, 5.0, 70.0, 15.0, 50.0, 15.0, 85.0, 5.0, 0.0, 30.0, 50.0, 65.0, 15.0, 10.0, 60.0, 20.0, 50.0, 25.0, 90.0, 40.0, 10.0, 65.0, 0.0, 35.0, 25.0, 75.0, 5.0, 10.0, 45.0, 65.0, 25.0, 35.0, 10.0, 5.0, 0.0, 95.0, 15.0, 85.0], (7200, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 3600): [-1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (5200, 4000): [0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0], (8800, 3600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2000, 1200): [65.0, 5.0, 10.0, 65.0, 10.0, 25.0, 10.0, 50.0, 5.0, 0.0, 10.0, 80.0, 45.0, 25.0, 75.0, 5.0, -1.0, 5.0, 40.0, 40.0, -1.0, 10.0, 55.0, 20.0, 30.0, 40.0, 0.0, 15.0, 45.0, 5.0, 20.0, 20.0, 5.0, 70.0, 35.0, 25.0, 5.0, 10.0, 55.0, 0.0, 40.0, 15.0, 30.0, 15.0, 50.0, 25.0, 65.0, 65.0, 5.0, 0.0, 40.0, 80.0, 30.0, 40.0, 70.0, 85.0, 25.0, 30.0, 65.0, 55.0, 5.0, 35.0, 95.0, 35.0, 5.0, 5.0, 70.0], (6000, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0], (3600, 1600): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 30.0, 10.0, 0.0, 5.0, 5.0, 30.0, 10.0, 5.0, 5.0, 20.0, 20.0, 0.0, 10.0, 0.0, 0.0], (5200, 1200): [0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0], (7200, 2800): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 30.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0], (6000, 3200): [0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, 10.0, 80.0, 0.0, 0.0, -1.0, -1.0, 25.0, 35.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, 10.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 45.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0], (4400, 2800): [0.0, 20.0, 0.0, 15.0, 5.0, 0.0, 15.0, 25.0, 5.0, 0.0, 5.0, 40.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0, 15.0, 0.0, 10.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 40.0, 10.0, 25.0, 0.0, 50.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 30.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 35.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 5.0, 0.0, 20.0, 5.0, 0.0, 5.0], (6800, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 2000): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 30.0], (8400, 2800): [-1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0], (8000, 4800): [0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (400, 0): [80.0, 5.0, 65.0, 30.0, 5.0, 35.0, 40.0, 50.0, 65.0, -1.0, 20.0, 5.0, 0.0, 0.0, 85.0, 75.0, 35.0, 75.0, 95.0, -1.0, 0.0, -1.0, 90.0, 10.0, 30.0, 40.0, 35.0, 20.0, 50.0, 65.0, 35.0, 45.0, 40.0, 95.0, 100.0, 80.0, 20.0, 40.0, 15.0], (2800, 2400): [20.0, 0.0, 0.0, 10.0, 20.0, 75.0], (8400, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0], (6000, 400): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0], (7600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6400, 4000): [0.0, 0.0, -1.0, 5.0, 40.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, -1.0, 0.0, 0.0], (8000, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6400, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (8400, 5200): [-1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 55.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6000, 4400): [-1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 55.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 60.0, 0.0, 15.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0], (6800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1600, 0): [65.0, 5.0, 35.0, -1.0, 20.0, 5.0, -1.0, 5.0, -1.0, 10.0, -1.0], (6800, 3600): [0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0], (4800, 4000): [5.0, 20.0, 0.0, 0.0], (8800, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 2000): [-1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0], (2400, 1600): [20.0, 5.0, 30.0, 80.0, 10.0, 35.0, 40.0, 25.0, 30.0, 25.0, 0.0, 40.0, 40.0, 30.0, 65.0, 15.0, 20.0, 0.0, 0.0, 35.0, 25.0, 55.0, 5.0, 50.0, 5.0, 0.0, 40.0, 20.0, 45.0, 15.0, 40.0, 40.0, 15.0, 65.0, 60.0, 95.0, 25.0, 25.0, 30.0, 0.0, 0.0, 5.0, 55.0, 30.0, 0.0, 25.0, 5.0, 5.0, 5.0, 0.0, 0.0, 45.0, 55.0, 95.0, 50.0, 15.0, 15.0, 25.0, 25.0, 0.0, 5.0, 10.0, 100.0, 25.0, 5.0, 20.0, 45.0, 45.0, 25.0, 40.0, 15.0, 20.0, 60.0, 5.0, 15.0, 0.0, 15.0, 30.0, 20.0, 70.0, 0.0, 15.0, 15.0, 5.0, 40.0, 40.0, 20.0, 0.0, 15.0, 0.0, 15.0, 20.0, 10.0, 25.0, 5.0, 30.0, 15.0, 20.0], (8800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 5600): [-1.0], (4800, 2800): [0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 15.0, 0.0, 15.0, 0.0, 30.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0], (8400, 4400): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0], (6000, 4000): [5.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, -1.0, 0.0, 25.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 40.0, 0.0, -1.0, 40.0, 40.0, 0.0, 10.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 60.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 10.0, 10.0, 10.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 50.0, 0.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 45.0, 0.0], (2400, 1200): [-1.0, 5.0, 5.0, 0.0, 35.0, 0.0, 15.0, 15.0, 25.0, 20.0, 0.0, 0.0, 45.0, 30.0, 15.0, 25.0, 5.0, 50.0, 45.0, 45.0, 5.0, 5.0, 55.0, 10.0, 25.0, 0.0, 60.0, 25.0, -1.0, 35.0, 45.0, 10.0, 5.0, 15.0, 15.0, 15.0, 15.0, 5.0, 0.0, 5.0, 15.0, 30.0, -1.0, 5.0, 25.0, 70.0, 65.0, 25.0, 5.0], (6400, 2800): [0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (8400, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4000, 3200): [0.0, 5.0, 70.0, 20.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0], (2800, 800): [5.0, 0.0, 20.0, 15.0, 20.0, 0.0, 5.0, 0.0, 5.0, 5.0, 30.0, 15.0, 5.0, 40.0, 30.0, 5.0, 0.0], (6800, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5200, 4400): [0.0, 0.0, 10.0, 45.0], (8000, 3600): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8400, 6000): [-1.0], (7200, 2000): [-1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0], (8800, 5600): [40.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0], (8800, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0], (7200, 4400): [0.0, 0.0, 65.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, 35.0, -1.0, 0.0, 0.0, 0.0], (2400, 400): [15.0, 5.0, 0.0, 0.0, 20.0, 10.0, -1.0, 0.0, 0.0, 10.0, 40.0, 0.0, 15.0, 5.0, 15.0, 0.0, 0.0], (5600, 0): [0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5600, 2800): [10.0, 10.0, 0.0, -1.0, 55.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 35.0, 10.0, 20.0, -1.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (6800, 1600): [0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0], (7600, 5200): [0.0, 0.0, 0.0, 45.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 10.0], (7600, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 4400): [0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 35.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0], (4800, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8800, 2800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (3600, 1200): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 5.0], (5600, 800): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (4800, 400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0], (6800, 2800): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (3200, 2400): [35.0, 5.0, 0.0, 20.0, 5.0, 15.0, 35.0, 20.0, 20.0, 0.0, 5.0, 15.0, 5.0, 30.0, 0.0, 40.0, 35.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 10.0, 45.0, 30.0, 25.0, 30.0, 5.0, 5.0, 30.0, 10.0, 15.0, 0.0, 10.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 15.0, 10.0, 35.0], (5600, 400): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (2000, 400): [10.0, 15.0, 55.0, 20.0, 35.0, 30.0, 5.0, 0.0, 25.0, 25.0, 20.0, 5.0, 80.0, 0.0], (7600, 2800): [-1.0, 10.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (4400, 800): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (6800, 4400): [0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 25.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (2000, 800): [20.0, 15.0, 10.0, 0.0, 60.0, 30.0, 20.0, 90.0, 25.0, 10.0, 25.0, 25.0, 20.0, 100.0, 20.0, 30.0, 60.0, 75.0, 0.0, 70.0, 0.0, 0.0, 25.0, 55.0, 5.0, 0.0, 80.0, 5.0, 5.0, 25.0, 15.0, 20.0, 25.0], (8800, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 1200): [-1.0, 5.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (7200, 1200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4400, 3600): [10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2800, 400): [0.0, 10.0, 0.0, 10.0, -1.0, 25.0, 5.0, 10.0, 10.0, 5.0, 0.0, 0.0, 50.0], (7600, 1200): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 3200): [10.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 40.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 25.0, 20.0, 0.0, -1.0], (3200, 800): [25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 10.0, 30.0, 5.0, 15.0, 0.0, 0.0, 0.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 0.0], (8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 2000): [0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (8800, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4400, 2000): [5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, -1.0, 10.0, 0.0, 0.0], (6400, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 3200): [0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (2400, 2000): [0.0, 5.0, 35.0, 5.0, 10.0, 10.0, 20.0, 0.0, 20.0, 45.0, 60.0, 25.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (0, 0): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0], (3200, 1600): [25.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 35.0, 10.0, 80.0, 5.0, 10.0, 5.0, 10.0, 10.0, 0.0, 10.0, 10.0, 20.0, 15.0, 0.0, 5.0, 5.0, 0.0, 5.0, 10.0, 5.0, 15.0, 0.0, 5.0, 10.0, 0.0, 25.0, 5.0], (6400, 3200): [-1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 40.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 60.0, -1.0, 5.0, 15.0, -1.0, 0.0, 0.0, -1.0], (6800, 4800): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 0.0, -1.0, 0.0, 80.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0], (8000, 5600): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0], (6400, 1200): [0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (7600, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2800, 1600): [0.0, 20.0, 5.0, 25.0, 10.0, 5.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 20.0, 30.0, 35.0, 0.0, 25.0, 0.0, 10.0, 0.0, 30.0, 35.0, 0.0, 25.0, 10.0, 5.0, 5.0, 40.0, 35.0, 15.0, 20.0, 0.0, 10.0, 5.0, 5.0, 15.0, 20.0, 0.0, 10.0, 5.0, 85.0, 15.0, 0.0, 15.0, 15.0, 5.0, 0.0, 5.0, 20.0, 25.0, 15.0, 15.0, 5.0, 25.0, 10.0, 15.0, 5.0, 40.0, 20.0, 15.0, 15.0, 5.0, 65.0, 65.0, 15.0, 20.0, 35.0, 0.0], (8400, 4800): [-1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 20.0, -1.0, -1.0, -1.0, 0.0], (4800, 3600): [0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 15.0, -1.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 35.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 5.0, 5.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 50.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0], (1200, 400): [60.0, 5.0, 25.0, 0.0, 15.0, 10.0, 75.0, 25.0, 50.0, 70.0, 5.0, 30.0, 0.0, 35.0, 70.0, 25.0, 5.0, 15.0, 20.0, 10.0, 80.0, 10.0, 10.0, 5.0, 15.0, 0.0, 35.0, 10.0, 35.0, 30.0, 10.0, 5.0, 10.0, 50.0], (4400, 400): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0], (4000, 0): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (7600, 3600): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0], (3200, 2000): [0.0, 45.0, 10.0, 5.0, 15.0, 25.0, 10.0, 5.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 50.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 5.0, 0.0, 10.0, 70.0, 0.0, 10.0, 0.0, 35.0, 30.0, 5.0, 10.0, 0.0, 30.0, 15.0, 15.0, 20.0, 30.0, 0.0, 15.0, 0.0, 15.0, 0.0, 45.0, 25.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 45.0, 5.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 20.0, 40.0, 15.0, 80.0, 30.0, 0.0, 0.0, 10.0, 10.0, 10.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 25.0, 0.0, 10.0, 25.0, 5.0, 15.0, 20.0, 10.0, 30.0, 15.0], (7200, 3200): [-1.0, 0.0, -1.0, -1.0, -1.0, 50.0, 40.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 4000): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0], (3200, 0): [5.0, 0.0, 10.0, 0.0, -1.0, 5.0, 5.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0], (2000, 1600): [20.0, 70.0, 45.0, 95.0, 20.0, 35.0, 15.0, 35.0, 60.0, 10.0, 80.0, 30.0, 5.0, 30.0, 20.0, 55.0, 15.0, 5.0, 5.0, 15.0, 20.0, 0.0, 20.0], (3200, 400): [10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0], (8800, 4400): [-1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 15.0, 0.0, -1.0], (5200, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6800, 4000): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 85.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (5200, 3600): [10.0, 5.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 35.0, 5.0, 0.0, 0.0, 0.0, 60.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 5.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 65.0, 0.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0], (8000, 400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3200, 2800): [15.0, 10.0], (7200, 5200): [-1.0, -1.0, 5.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0], (8800, 4000): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (7200, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8800, 2400): [-1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 5.0], (3600, 2800): [5.0, 0.0, 10.0, 10.0, 10.0, 10.0, 35.0, 5.0, 0.0, 5.0, 10.0, 25.0, 0.0, 80.0, 5.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 50.0, 20.0, 5.0], (400, 400): [20.0, 10.0, 20.0, 55.0, 15.0, 30.0, 20.0, 90.0, 10.0, -1.0, 10.0, 100.0, 20.0, 10.0, 10.0, 10.0, 25.0, 15.0, 5.0, 15.0, 5.0, 20.0], (5200, 800): [0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0], (1200, 800): [20.0, 95.0, 35.0, 10.0, 70.0, 55.0, 35.0, 25.0, 100.0, 90.0, 55.0, 10.0, 5.0, 0.0, 25.0, 0.0, 90.0, 5.0, 35.0, 40.0, 0.0, 40.0, 0.0, 55.0, 5.0, 45.0, 20.0, 5.0, 5.0, 20.0, 45.0, 75.0, 85.0, 15.0, 80.0, 0.0, 45.0, 65.0, 35.0, 70.0, 25.0, 70.0, 10.0, 95.0, 25.0, 0.0, 20.0, 95.0, 40.0, 50.0, 40.0, 45.0, 45.0, 15.0, 10.0, 45.0, 30.0, 30.0, 85.0, 0.0, 15.0, 95.0, -1.0], (800, 800): [15.0, -1.0, -1.0, 10.0], (2000, 0): [5.0, 20.0, 10.0, 25.0, 10.0, 5.0, 5.0, 20.0, 65.0, -1.0, 0.0, 75.0, 5.0, 20.0, 25.0, 15.0], (5200, 400): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0], (7600, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (6400, 1600): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 5600): [-1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 45.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0], (5600, 1600): [0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0], (2400, 0): [60.0, 0.0, -1.0, 0.0, 5.0, 10.0, 10.0, 0.0, 10.0, 5.0, -1.0, 20.0, 5.0, 35.0, 5.0], (8800, 3200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8000, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8400, 1600): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (3200, 1200): [0.0, 15.0, 15.0, 30.0, 10.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 20.0, 0.0, 25.0, 5.0, 5.0, 5.0, 0.0], (5600, 2400): [0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7600, 4800): [10.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 55.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0], (6000, 800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (4000, 400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (800, 0): [20.0, 40.0, 20.0], (8000, 5200): [10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 10.0, 5.0, -1.0, 5.0, 10.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0], (3600, 2400): [15.0, 20.0, 5.0, 0.0, 5.0, 25.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 10.0, 15.0, 0.0, 0.0, 5.0, 15.0, 0.0, 30.0, 0.0, 35.0, 40.0, 15.0, 10.0, 10.0, 40.0, 5.0, 45.0, 20.0, 5.0, 15.0, 5.0, 35.0, 5.0, 10.0, 5.0, 10.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 35.0, 10.0, 50.0, 10.0, 15.0, 20.0, 20.0, 30.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 15.0, 40.0, 30.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 20.0, 10.0, 5.0, 5.0, 10.0, 20.0, 0.0, 0.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 10.0], (5200, 2000): [-1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 10.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 4800): [0.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 55.0, -1.0, 0.0, -1.0, 5.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (6400, 2400): [0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (8400, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5200, 2400): [0.0, 0.0, 65.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, -1.0, 70.0, 5.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 5.0], (6800, 2000): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6400, 3600): [0.0, 0.0, 10.0, -1.0, 35.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 5.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 80.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0], (5200, 3200): [0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, 50.0, 0.0, 30.0, 0.0, 5.0, 30.0, 10.0, -1.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0], (4000, 2400): [5.0, 30.0, 0.0, 30.0, 5.0, 5.0, 0.0, 5.0, 10.0, 0.0, 10.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 65.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 15.0, 5.0, 5.0, 5.0, 5.0, 5.0, 20.0, 10.0, 15.0, 20.0, 0.0, 20.0, 15.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 35.0, 0.0, 5.0, 5.0, 10.0, 25.0, 0.0, 0.0, 0.0, 5.0, 25.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 20.0, 15.0, 5.0, 20.0, 0.0, 5.0, 20.0, 35.0, 15.0, 10.0], (8800, 5200): [0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 25.0, -1.0, 5.0, 15.0, 0.0, -1.0], (8800, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (3600, 400): [0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4400, 2400): [0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 25.0, 0.0, 10.0, 15.0, 30.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 20.0, 5.0, 0.0, 10.0, 0.0], (6000, 2400): [0.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0], (4800, 1600): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 30.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0], (8000, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6800, 5200): [-1.0, 0.0], (8400, 3200): [-1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3600, 800): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0], (6400, 4400): [0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 30.0, 0.0, 50.0, 0.0, 5.0, 0.0, -1.0, 5.0, 15.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 10.0, 45.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (8000, 4000): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0], (4000, 1600): [0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0, 10.0, 0.0], (6000, 1200): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1600, 800): [20.0, 35.0, 25.0, 35.0, 50.0, 10.0, 20.0, 60.0, 5.0, 40.0, 5.0, 70.0, 40.0, 5.0, 30.0, 30.0, 10.0, 35.0, 55.0, 15.0, 25.0, 5.0, 55.0, -1.0, 50.0, 30.0, 70.0, 15.0, 20.0, 25.0, 20.0, -1.0, 10.0, -1.0, 20.0, 15.0, 65.0, 65.0, 10.0, 15.0, 10.0, 0.0, 20.0, 15.0, 50.0, 5.0, 90.0, 50.0, 65.0, 15.0, 15.0, 10.0, 20.0], (8400, 2400): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (3600, 0): [0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0], (4400, 3200): [0.0, 10.0, 0.0, 10.0, 0.0, 35.0, 0.0, 15.0, 0.0, 0.0, 0.0, 35.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 40.0, 20.0, 0.0, 10.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0, 90.0, 20.0, 0.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 40.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 45.0, 0.0, 5.0, 0.0, 5.0, 30.0, 5.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 15.0], (7600, 4000): [10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 55.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0], (4400, 1200): [0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0]}
mpc_dash_syth_hyb_pen_table_500 = {(3000, 1000): [25.0, 5.0, 0.0, 0.0, 15.0, 5.0, 15.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 15.0, 5.0, 15.0, 5.0, -1.0, 10.0, 0.0, 0.0, 5.0, 5.0, 25.0, 0.0, 5.0, 5.0, 0.0, 0.0], (4500, 3000): [0.0, 10.0, 10.0, 0.0, 10.0, 35.0, 20.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 10.0, 10.0, 0.0, 10.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 40.0, 30.0, 0.0, 10.0, 0.0, 90.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 30.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 10.0, 45.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 30.0, 70.0, 5.0, 20.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 5.0, 10.0, 25.0, 0.0, 15.0, 5.0, 5.0], (5000, 1500): [0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 30.0, 5.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0], (2000, 1500): [20.0, 20.0, 30.0, 70.0, 45.0, 55.0, 95.0, 50.0, 20.0, 40.0, 80.0, 15.0, 75.0, 5.0, 15.0, 35.0, 60.0, 15.0, -1.0, 0.0, 15.0, 10.0, 35.0, 0.0, 20.0, 60.0, 10.0, 80.0, 95.0, 50.0, 30.0, 15.0, 15.0, 25.0, 35.0, 5.0, 25.0, 100.0, 5.0, 10.0, 30.0, 15.0, 10.0, 20.0, 30.0, 55.0, 15.0, 40.0, 25.0, 60.0, 15.0, 65.0, 15.0, 65.0, 15.0, 5.0, 0.0, 5.0, 5.0, 30.0, 15.0, 25.0, 65.0, 20.0, 5.0, 0.0, 0.0, 20.0, 25.0], (6500, 3500): [0.0, 0.0, -1.0, 10.0, -1.0, 35.0, 10.0, 10.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 80.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 15.0, -1.0, 0.0, 15.0, 0.0, 5.0], (7000, 3500): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 10.0, 45.0, -1.0, -1.0], (5500, 3500): [20.0, -1.0, 10.0, 5.0, 10.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 30.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 15.0, -1.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 45.0, 10.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 15.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 65.0, 45.0, 0.0, 0.0, 0.0, 0.0, 50.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0], (8000, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8500, 3500): [-1.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5000, 3500): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 35.0, 0.0, 0.0, 15.0, 30.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 60.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 75.0, 5.0, -1.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 65.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 10.0, 0.0, -1.0, 35.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 10.0, 5.0, 0.0, 40.0, 0.0, 0.0, 5.0, 15.0, 0.0, 35.0, 0.0, 0.0, 20.0, 45.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (3500, 3000): [0.0, 10.0, 35.0, 5.0, 25.0, 20.0], (6000, 1500): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (1500, 500): [35.0, 65.0, 40.0, 90.0, 10.0, 20.0, 15.0, 20.0, -1.0, 5.0, 30.0, 45.0, 35.0, 55.0, 20.0, 5.0, 15.0, -1.0, 50.0, 30.0, 100.0, 85.0, 35.0, 20.0, 20.0, 10.0, 25.0, 70.0, 15.0, 20.0, 10.0, 0.0, 95.0, 50.0, 50.0, 10.0, 15.0, 15.0, 90.0, 65.0, 15.0, 15.0, 10.0, 20.0, -1.0], (2000, 2000): [20.0], (8500, 5000): [0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 20.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0], (8000, 1000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 5000): [0.0, 0.0, 0.0, -1.0, -1.0, 45.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 55.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 55.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0], (3000, 500): [0.0, 20.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 40.0, 15.0, 5.0, 10.0, 10.0, 5.0, 0.0], (500, 500): [45.0, 20.0, 25.0, 20.0, 50.0, 25.0, 55.0, 10.0, 30.0, 20.0, 45.0, 75.0, 10.0, 20.0, 65.0, 30.0, -1.0, 100.0, 95.0, 20.0, 5.0, 45.0, 25.0, 15.0, 80.0, 50.0, 15.0, 5.0, 50.0, 50.0, 80.0, 75.0], (7000, 1500): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1500, 0): [0.0, 65.0, 5.0, 35.0, 40.0, -1.0, 20.0, 50.0, 5.0, 5.0, -1.0, 0.0, -1.0, 25.0, 5.0, -1.0, 0.0, 5.0, 10.0, -1.0, 10.0, 20.0], (4000, 0): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0], (8500, 4000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0], (8000, 3000): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5500, 0): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (7500, 3000): [0.0, 10.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5500, 3000): [10.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 15.0, 85.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 5.0, 40.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 25.0, 20.0, -1.0, 5.0], (7000, 1000): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8500, 3000): [-1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (4000, 3000): [0.0, 0.0, 0.0, 5.0, 70.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 40.0, 5.0, 35.0, 25.0, 5.0, 45.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 40.0, 30.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 5.0, 15.0, 0.0, 0.0], (2000, 500): [15.0, 55.0, 15.0, 20.0, 60.0, 30.0, 30.0, 20.0, 25.0, 5.0, -1.0, 25.0, 25.0, 20.0, 60.0, 0.0, 70.0, 0.0, 25.0, 25.0, 5.0, 0.0, 20.0, 40.0, 0.0, 5.0, 25.0, 15.0, 5.0, 80.0, 0.0], (5500, 500): [0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0], (5500, 1000): [-1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0], (8500, 6000): [-1.0], (6500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 500): [5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1500, 1500): [70.0, 45.0], (5500, 4500): [0.0, 50.0, 10.0, 10.0, 0.0, 20.0, 45.0, 5.0], (500, 0): [65.0, 10.0, 30.0, 5.0, 35.0, 15.0, 40.0, 90.0, 50.0, 65.0, -1.0, 20.0, 5.0, 40.0, 0.0, 0.0, 85.0, 75.0, 75.0, 65.0, 95.0, -1.0, -1.0, 0.0, 10.0, 20.0, 10.0, 90.0, 10.0, 40.0, 10.0, 35.0, 50.0, 35.0, 45.0, 25.0, 95.0, 100.0, 80.0, 5.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (0, 0): [80.0, 5.0, 35.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 30.0, -1.0, -1.0, 20.0, 0.0, 65.0, 30.0, 40.0, 0.0], (7500, 2000): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, -1.0, -1.0], (8000, 5000): [-1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, 10.0, 0.0, 10.0, -1.0, 0.0, 5.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (7000, 4500): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, 15.0, 0.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 40.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 45.0, 15.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 55.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0], (3500, 1500): [0.0, 0.0, 5.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 10.0, 10.0, 30.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 20.0, 5.0, 0.0, 30.0, 10.0, 5.0, 5.0, 20.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0], (3000, 1500): [0.0, 20.0, 0.0, 25.0, 0.0, 10.0, 10.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 10.0, 5.0, 30.0, 35.0, 25.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 40.0, 0.0, 10.0, 20.0, 80.0, 5.0, 5.0, 5.0, 5.0, 5.0, 10.0, 10.0, 0.0, 10.0, 0.0, 20.0, 0.0, 15.0, 0.0, 15.0, 15.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 10.0, 5.0, 15.0, 15.0, 5.0, 5.0, 5.0, 10.0, 15.0, 40.0, 0.0, 15.0, 5.0, 15.0, 25.0, 35.0], (8500, 4500): [-1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (5000, 4500): [0.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6500, 3000): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 40.0, 10.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (7000, 4000): [0.0, 5.0, -1.0, 0.0, 65.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 35.0, 0.0, 10.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, 85.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 25.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 25.0, -1.0, 45.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, 30.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0], (6000, 4000): [0.0, 5.0, -1.0, -1.0, 5.0, 25.0, 0.0, 0.0, 40.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, 40.0, -1.0, -1.0, 40.0, 0.0, 10.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, 60.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 10.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 50.0, 0.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, -1.0, 10.0, 0.0, 0.0, 0.0, 45.0, 0.0], (3500, 1000): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, 10.0, 30.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 20.0, 0.0, 5.0], (8500, 1500): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0], (5000, 3000): [0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, 55.0, 5.0, 0.0, 30.0, 0.0, 0.0, 5.0, 60.0, 10.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0], (7500, 4000): [0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 55.0, 15.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, 30.0, 0.0, -1.0], (3500, 2000): [0.0, 15.0, 35.0, 5.0, 5.0, 10.0, 25.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 0.0, 15.0, 0.0, 0.0, 35.0, 35.0, 35.0, 5.0, 10.0, 0.0, 40.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 0.0, 45.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 35.0, 5.0, 0.0, 5.0, 0.0, 5.0, 25.0, 20.0, 25.0, 0.0, 0.0, 0.0, 55.0, 30.0, 5.0, 0.0, 0.0, 20.0, 10.0, 5.0, 30.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 10.0, 20.0, 10.0, 15.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 5.0, 40.0, 0.0], (8500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3500, 2500): [20.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 10.0, 0.0, 15.0, 20.0, 10.0, 15.0, 0.0, 15.0, 10.0, 10.0, 0.0, 5.0, 15.0, 0.0, 30.0, 0.0, 10.0, 40.0, 15.0, 10.0, 10.0, 5.0, 0.0, 20.0, 40.0, 5.0, 20.0, 0.0, 5.0, 10.0, 10.0, 15.0, 5.0, 35.0, 5.0, 10.0, 5.0, 10.0, 10.0, 25.0, 0.0, 0.0, 80.0, 25.0, 10.0, 0.0, 10.0, 50.0, 10.0, 15.0, 20.0, 5.0, 20.0, 30.0, 10.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 15.0, 40.0, 30.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 10.0, 10.0, 35.0, 5.0, 50.0, 5.0, 0.0, 0.0, 25.0, 0.0, 5.0, 5.0, 10.0], (6000, 4500): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 35.0, 0.0, 0.0, 30.0, 15.0, 10.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 55.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 5.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (7000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2500, 0): [-1.0, 25.0, 5.0, 60.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 20.0, 10.0, 5.0, -1.0, -1.0, 15.0, 20.0, 20.0, 15.0, 0.0, 5.0], (7500, 4500): [10.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 15.0, -1.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0], (5500, 2000): [-1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7000, 2000): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (6500, 2000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6500, 500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4000, 2000): [0.0, 5.0, 5.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 5.0, 5.0, 35.0, 0.0, 0.0], (4500, 1500): [0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, 15.0], (4500, 1000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (5000, 2000): [0.0, -1.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0], (8000, 5500): [-1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0], (6500, 2500): [0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3500, 0): [0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0], (5500, 1500): [0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0], (5000, 500): [0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0], (4000, 3500): [15.0], (2000, 0): [10.0, 5.0, 20.0, 35.0, 0.0, 10.0, 25.0, 10.0, 0.0, 5.0, 5.0, 10.0, 10.0, 5.0, 20.0, 65.0, 0.0, -1.0, 0.0, -1.0, 75.0, 35.0, 5.0, 20.0, 25.0, 15.0], (6000, 3000): [0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, 80.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0], (4500, 3500): [25.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 10.0, 15.0, 0.0, 15.0, 15.0, 0.0, 0.0, 5.0, 5.0, 35.0, 0.0, 5.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 50.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0], (7500, 1000): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 0): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0], (8500, 5500): [40.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 45.0, 5.0, -1.0, -1.0, 0.0, 80.0, 15.0, 5.0, 0.0, -1.0, -1.0], (8000, 2500): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4000, 1500): [0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 15.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0], (3000, 0): [5.0, 10.0, 0.0, 10.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0], (2500, 1000): [10.0, 5.0, 5.0, 0.0, 35.0, 25.0, 40.0, 0.0, 45.0, 20.0, 0.0, 50.0, 15.0, 15.0, 5.0, 55.0, 10.0, 25.0, 0.0, 35.0, 45.0, 15.0, 15.0, 15.0, 5.0, 30.0, 40.0, 10.0, 15.0, 5.0, 5.0, 70.0, 0.0, 5.0], (5000, 2500): [0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 60.0, 0.0, 0.0, 0.0, 30.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 70.0, 5.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, 20.0, 5.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0], (6500, 5000): [0.0, 0.0, 10.0, 0.0, -1.0, 10.0], (5000, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6500, 1000): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7500, 1500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (3000, 2000): [10.0, 45.0, 10.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 10.0, 0.0, 5.0, 5.0, 10.0, 0.0, 5.0, 25.0, 50.0, 10.0, 5.0, 5.0, 5.0, 20.0, 0.0, 5.0, 5.0, 55.0, 10.0, 70.0, 0.0, 10.0, 65.0, 5.0, 0.0, 30.0, 10.0, 10.0, 30.0, 0.0, 30.0, 45.0, 20.0, 30.0, 15.0, 35.0, 0.0, 20.0, 0.0, 20.0, 30.0, 0.0, 15.0, 0.0, 0.0, 15.0, 10.0, 20.0, 45.0, 25.0, 0.0, 40.0, 35.0, 0.0, 0.0, 30.0, 0.0, 10.0, 20.0, 0.0, 5.0, 65.0, 45.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 10.0, 10.0, 40.0, 15.0, 25.0, 15.0, 80.0, 25.0, 5.0, 10.0, 20.0, 0.0, 0.0, 25.0, 0.0, 10.0, 15.0, 0.0, 0.0, 5.0, 10.0, 10.0, 10.0, 35.0, 10.0, 20.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 35.0, 10.0, 15.0, 0.0, 25.0, 25.0, 25.0, 5.0, 15.0, 20.0, 5.0, 10.0, 30.0, 0.0, 15.0], (4500, 4000): [0.0], (5000, 1000): [0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (1500, 1000): [20.0, 5.0, 20.0, 25.0, 35.0, 5.0, 30.0, 50.0, 5.0, 0.0, 15.0, 60.0, 5.0, 40.0, 0.0, 50.0, 15.0, 5.0, 85.0, 40.0, 70.0, 40.0, 5.0, 30.0, 30.0, 10.0, 5.0, 0.0, 0.0, 55.0, 30.0, 5.0, 15.0, 50.0, 25.0, 5.0, 55.0, 65.0, 15.0, 10.0, 70.0, 60.0, 85.0, 20.0, 50.0, 15.0, 25.0, 90.0, 40.0, 25.0, -1.0, 10.0, -1.0, 65.0, 20.0, 65.0, 0.0, 65.0, 10.0, 55.0, 0.0, 15.0, 35.0, 25.0, 75.0, 10.0, 5.0, 10.0, 0.0, 65.0, 15.0, 20.0, 25.0, 15.0, 30.0, 35.0, 10.0, 5.0, 0.0, 50.0, 5.0, 0.0, 50.0, 95.0, 15.0, 15.0, 85.0], (8500, 1000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 5500): [0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0], (6000, 3500): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 35.0, 15.0, -1.0, -1.0, -1.0, 5.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 65.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 15.0, 5.0, -1.0, 0.0, 5.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 45.0, 60.0, 40.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (6500, 1500): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 3500): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0], (8500, 500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 3500): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (7000, 3000): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 50.0, -1.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5500, 4000): [0.0, 0.0, -1.0, 15.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 65.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 20.0, 45.0, 5.0, 0.0, 5.0, 0.0, 0.0, 90.0, 0.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0], (4500, 2000): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 25.0, -1.0, 10.0, 0.0, 0.0], (6000, 1000): [0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (1000, 0): [35.0, 0.0, 10.0, 0.0, 5.0, 20.0, 10.0, -1.0, 65.0, 40.0, 0.0, 85.0, 20.0, 15.0, 0.0, 0.0, 80.0, 25.0, 5.0, 15.0, 90.0, 25.0, 5.0, 5.0, -1.0, 10.0, 15.0, 35.0, 15.0], (3500, 500): [0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7000, 2500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0], (2500, 1500): [5.0, 5.0, 30.0, 80.0, 10.0, 35.0, 25.0, 40.0, 25.0, 25.0, 0.0, 10.0, 40.0, 40.0, 5.0, 30.0, 65.0, 15.0, 20.0, 0.0, 25.0, 0.0, 35.0, 25.0, 5.0, -1.0, 50.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 20.0, 0.0, 45.0, 30.0, 40.0, 25.0, 40.0, 15.0, 5.0, 65.0, 0.0, 95.0, 0.0, 25.0, 30.0, 25.0, 30.0, 35.0, 75.0, 0.0, 5.0, 55.0, 25.0, 30.0, 10.0, 5.0, 45.0, 45.0, 25.0, 5.0, 5.0, 5.0, 35.0, 5.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 45.0, 55.0, 25.0, 25.0, 0.0, 5.0, 15.0, 10.0, 25.0, 20.0, 0.0, 10.0, 20.0, 20.0, 5.0, 45.0, 5.0, 85.0, 45.0, 25.0, 15.0, 5.0, 15.0, 20.0, 5.0, 5.0, 0.0, 20.0, 30.0, 25.0, 20.0, 70.0, 15.0, 0.0, 15.0, 5.0, 15.0, 15.0, 5.0, 25.0, 10.0, 40.0, 10.0, 40.0, 20.0, 20.0, 0.0, 25.0, 15.0, 15.0, 15.0, 20.0, 10.0, 65.0, 65.0, 65.0, 25.0, 5.0, 30.0, 20.0, 15.0, 20.0, 0.0], (4000, 2500): [0.0, 5.0, 5.0, 0.0, 20.0, 30.0, 0.0, 5.0, 30.0, 5.0, 0.0, 20.0, 5.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 10.0, 15.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 5.0, 5.0, 5.0, 20.0, 10.0, 15.0, 5.0, 20.0, 10.0, 15.0, 5.0, 20.0, 10.0, 0.0, 20.0, 30.0, 15.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 5.0, 0.0, 35.0, 10.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 5.0, 25.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 30.0, 0.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 10.0, 5.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 30.0, 0.0, 5.0, 20.0, 0.0, 15.0, 10.0], (7000, 5000): [-1.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (8500, 2500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 95.0], (6500, 4000): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6000, 2000): [0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8000, 2000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (5000, 4000): [10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 0.0, 5.0, 5.0, 20.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0], (1000, 500): [20.0, 15.0, 60.0, 40.0, 10.0, 5.0, 35.0, 25.0, 25.0, 100.0, 50.0, 0.0, 55.0, 90.0, 5.0, 60.0, 75.0, 50.0, 25.0, 35.0, 0.0, 50.0, 40.0, 85.0, -1.0, 10.0, 45.0, 0.0, 70.0, 5.0, 20.0, 45.0, 15.0, 5.0, 15.0, 30.0, 80.0, 0.0, 5.0, 45.0, 65.0, 35.0, 70.0, 70.0, 25.0, 5.0, 15.0, 75.0, 10.0, 25.0, 80.0, 95.0, -1.0, 40.0, 10.0, 40.0, 5.0, 45.0, 10.0, 45.0, 10.0, 45.0, 0.0, 35.0, 30.0, 10.0, 30.0, 5.0, 10.0, 5.0, 90.0, 10.0, 50.0, 95.0], (1000, 1000): [95.0, 35.0, 70.0, 55.0, 10.0, 25.0, 90.0, 75.0, 35.0, 20.0, 85.0], (6000, 500): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0], (6500, 4500): [-1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 50.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 45.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 5.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 80.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 35.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (7000, 500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7500, 500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 4500): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, 0.0, 10.0, 5.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (2000, 1000): [65.0, 20.0, 5.0, 10.0, 65.0, 10.0, 10.0, 0.0, 25.0, 10.0, 5.0, 0.0, 10.0, 45.0, 15.0, 30.0, 25.0, 90.0, -1.0, 20.0, 10.0, 5.0, 40.0, 40.0, 25.0, 30.0, 20.0, 100.0, 5.0, 55.0, 30.0, 40.0, 30.0, 0.0, 15.0, 45.0, 75.0, 5.0, 20.0, 20.0, 5.0, 70.0, 60.0, -1.0, 5.0, 30.0, 55.0, 0.0, 40.0, 0.0, 15.0, 50.0, 55.0, 0.0, 40.0, 5.0, 80.0, 30.0, 40.0, -1.0, 80.0, 70.0, 85.0, 5.0, 30.0, 5.0, 55.0, 35.0, 95.0, 35.0, 20.0, 5.0, 5.0, 25.0, 70.0], (2500, 2000): [0.0, 5.0, 0.0, 25.0, 25.0, 10.0, 20.0, 35.0, 25.0, 45.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 10.0, 35.0, 30.0, 45.0, 0.0, 0.0, 35.0, 100.0, 20.0, 0.0, 5.0, 10.0, 25.0, 20.0, 5.0, 70.0, 50.0, 30.0, 15.0, 20.0, 10.0, 15.0, 15.0, 25.0, 25.0, 45.0, 60.0, 20.0, 25.0, 0.0, 40.0, 0.0, 25.0], (5500, 2500): [0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4000, 1000): [0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2500, 500): [15.0, 5.0, 0.0, 20.0, 0.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, 45.0, 0.0, 10.0, 25.0, 0.0, 15.0, 10.0, 30.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0], (8500, 2000): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 4000): [0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0], (6000, 2500): [0.0, 0.0, -1.0, 25.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (7500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3000, 2500): [20.0, 5.0, 35.0, 20.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 30.0, 25.0, 45.0, 30.0, 5.0, 0.0, 15.0, 75.0], (4000, 500): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7500, 2500): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (4500, 2500): [0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 10.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, 25.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 65.0, 45.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0]}
mpc_dash_syth_hyb_pen_table_600 = {(3600, 1200): [0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 10.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0], (6600, 3000): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (1800, 0): [10.0, 5.0, 65.0, 35.0, 20.0, 20.0, 40.0, -1.0, 35.0, 20.0, 30.0, 10.0, 25.0, 10.0, 0.0, 25.0, 5.0, 5.0, -1.0, 20.0, 65.0, -1.0, 25.0, 5.0, 0.0, -1.0, 75.0, 5.0, 20.0, 20.0, 25.0, 80.0, 20.0, 15.0], (6600, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4800): [-1.0, 0.0, 35.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0], (8400, 5400): [40.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 45.0, -1.0, 25.0, 0.0, 5.0, -1.0, -1.0, 0.0, 80.0, 15.0, 0.0, 5.0, 0.0, -1.0, -1.0], (6000, 3600): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 15.0, -1.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, 65.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 40.0, -1.0, -1.0, 40.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 80.0, -1.0, 0.0, 5.0, -1.0, -1.0, 15.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 40.0, 0.0, 0.0, 50.0, 55.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (8400, 1800): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0], (2400, 1800): [5.0, 0.0, 5.0, 10.0, 25.0, 25.0, 0.0, 25.0, 0.0, 40.0, 25.0, 10.0, 30.0, 20.0, 35.0, 25.0, 0.0, 0.0, 35.0, 45.0, 0.0, 25.0, 0.0, 5.0, 5.0, 55.0, 50.0, 5.0, 10.0, 10.0, 40.0, 5.0, 20.0, 0.0, 25.0, 20.0, 30.0, 10.0, 40.0, 0.0, 40.0, 5.0, 0.0, 10.0, 35.0, 95.0, 0.0, 30.0, 25.0, 30.0, 30.0, 0.0, 45.0, 0.0, 55.0, 20.0, 30.0, 0.0, 35.0, 35.0, 100.0, 5.0, 20.0, 5.0, 0.0, 45.0, 10.0, 25.0, 20.0, 55.0, 5.0, 25.0, 25.0, 10.0, 20.0, 0.0, 70.0, 50.0, 45.0, 30.0, 85.0, 15.0, 20.0, 5.0, 15.0, 20.0, 5.0, 10.0, 20.0, 15.0, 15.0, 0.0, 25.0, 25.0, 5.0, 45.0, 15.0, 60.0, 5.0, 10.0, 40.0, 20.0, 25.0, 40.0, 0.0, 20.0, 0.0, 15.0, 40.0, 15.0, 20.0, 65.0, 65.0, 25.0, 0.0, 25.0, 30.0, 20.0, 0.0], (4800, 1200): [0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7800, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3000, 0): [5.0, 0.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 5.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0], (8400, 3000): [-1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8400, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 4200): [-1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0], (4200, 1800): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 15.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 10.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0], (3000, 600): [25.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 10.0, 30.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 10.0, 40.0, 0.0, 5.0, 5.0, 15.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, 20.0, 0.0], (6000, 1800): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0], (1800, 1200): [65.0, 20.0, 5.0, 5.0, 20.0, 10.0, 65.0, 10.0, 70.0, 5.0, 45.0, 25.0, 10.0, 50.0, 70.0, 15.0, 20.0, 5.0, 0.0, 10.0, 80.0, 45.0, 50.0, 25.0, 75.0, 5.0, -1.0, 35.0, 5.0, 0.0, 15.0, 5.0, 30.0, 40.0, 40.0, 50.0, -1.0, 10.0, 55.0, 65.0, 15.0, 20.0, 60.0, 30.0, 40.0, 0.0, 10.0, 60.0, 15.0, 20.0, 10.0, 45.0, 50.0, 80.0, 5.0, 20.0, 30.0, 25.0, 20.0, 5.0, 70.0, 90.0, 35.0, 5.0, 25.0, 5.0, 10.0, 10.0, 55.0, 0.0, 65.0, 30.0, 40.0, 15.0, 30.0, 55.0, 0.0, 15.0, 50.0, 25.0, 65.0, 65.0, 15.0, 35.0, 5.0, 0.0, 5.0, 40.0, 25.0, 75.0, 5.0, 5.0, 80.0, 10.0, 30.0, 45.0, 65.0, 40.0, 15.0, 70.0, 85.0, 25.0, 25.0, 30.0, 65.0, 20.0, 55.0, 5.0, 35.0, 10.0, 5.0, 0.0, 0.0, 35.0, 95.0, 35.0, 95.0, 20.0, 15.0, 5.0, 5.0, 70.0, 85.0], (5400, 4800): [0.0, 20.0], (8400, 6000): [-1.0], (5400, 3600): [20.0, -1.0, 0.0, 10.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, 10.0, 5.0, 15.0, -1.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 30.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 60.0, 5.0, 15.0, 0.0, -1.0, 10.0, 10.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 45.0, 10.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 0.0, 45.0, -1.0, 0.0, 5.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 65.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 90.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 25.0], (8400, 3600): [-1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0], (2400, 1200): [20.0, 5.0, 30.0, 80.0, 35.0, 40.0, 30.0, 25.0, 10.0, 40.0, 5.0, 65.0, 15.0, 20.0, 25.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 15.0, 45.0, 15.0, 15.0, 25.0, 25.0, 40.0, 15.0, 20.0, 5.0, 65.0, 0.0, 60.0, 0.0, 25.0, 45.0, 35.0, 30.0, 75.0, 0.0, 5.0, 15.0, 25.0, 0.0, 5.0, 50.0, 10.0, 5.0, 45.0, 45.0, 25.0, 5.0, 5.0, 15.0, 5.0, 15.0, 15.0, 5.0, 5.0, 0.0, 0.0, 10.0, 55.0, 95.0, 50.0, 10.0, 15.0, 25.0, 15.0, 0.0, 0.0, 60.0, 25.0, 5.0, -1.0, 15.0, 100.0, 25.0, 5.0, 35.0, 10.0, 20.0, 45.0, 20.0, 10.0, 5.0, 15.0, 5.0, 15.0, 15.0, 15.0, 45.0, 25.0, 15.0, 40.0, 5.0, 60.0, 5.0, 15.0, 0.0, 20.0, 15.0, 30.0, 25.0, 0.0, 70.0, 15.0, 15.0, 5.0, 15.0, 15.0, 30.0, 25.0, -1.0, 10.0, 5.0, 20.0, 5.0, 25.0, 0.0, 70.0, 15.0, 10.0, 65.0, 25.0, 5.0, 5.0, 20.0, 15.0], (5400, 1800): [-1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0], (7200, 2400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5400, 0): [-1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (7200, 4800): [10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, 5.0, 40.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 55.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0], (7800, 600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4200): [0.0, 5.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 40.0, 0.0, -1.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 15.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, 55.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 45.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 50.0, 60.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 75.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 0.0], (7800, 5400): [0.0, 0.0, 45.0, -1.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 10.0, 5.0, -1.0, -1.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0], (7800, 4800): [10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 15.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, 0.0, -1.0], (6600, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (4200, 600): [0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7800, 3600): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0], (3600, 1800): [0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 10.0, 0.0, 0.0, 45.0, 5.0, 5.0, 10.0, 0.0, 15.0, 0.0, 35.0, 10.0, 0.0, 5.0, 10.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 10.0, 10.0, 0.0, 30.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 20.0, 20.0, 0.0, 5.0, 0.0, 10.0, 0.0, 25.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 30.0, 0.0, 5.0, 5.0, 40.0, 0.0], (4800, 3000): [0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 15.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 20.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 65.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 55.0, 5.0, 0.0, 50.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 60.0, 10.0, 0.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, 10.0, 10.0, 70.0, -1.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 35.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0], (7800, 3000): [-1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 2400): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (7200, 1800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0], (3600, 600): [0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 600): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (7200, 3000): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 50.0, 40.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1800, 1800): [95.0, 35.0, 20.0], (3600, 3000): [70.0, 0.0, 0.0, 20.0, 0.0, 5.0, 25.0, 45.0, 10.0, 35.0, 5.0, 0.0, 5.0, 25.0, 25.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 20.0], (3600, 2400): [15.0, 5.0, 20.0, 5.0, 5.0, 0.0, 5.0, 20.0, 5.0, 25.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 10.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 65.0, 10.0, 10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 30.0, 15.0, 20.0, 10.0, 0.0, 10.0, 5.0, 35.0, 15.0, 5.0, 40.0, 15.0, 10.0, 10.0, 5.0, 5.0, 5.0, 20.0, 15.0, 0.0, 5.0, 20.0, 5.0, 20.0, 10.0, 0.0, 40.0, 20.0, 5.0, 45.0, 20.0, 5.0, 10.0, 5.0, 0.0, 10.0, 15.0, 0.0, 5.0, 0.0, 35.0, 5.0, 10.0, 5.0, 10.0, 0.0, 25.0, 0.0, 15.0, 0.0, 80.0, 10.0, 0.0, 5.0, 35.0, 10.0, 0.0, 35.0, 10.0, 50.0, 10.0, 15.0, 20.0, 5.0, 20.0, 30.0, 0.0, 0.0, 10.0, 5.0, 0.0, 40.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 15.0, 25.0, 10.0, 5.0, 5.0, 15.0, 5.0, 40.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 10.0, 5.0, 25.0, 10.0, 0.0, 5.0, 5.0, 50.0, 5.0, 0.0, 10.0, 20.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 25.0, 20.0, 0.0, 5.0, 5.0, 0.0, 10.0], (7800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1800, 600): [20.0, 65.0, 15.0, 55.0, 15.0, 10.0, 0.0, 40.0, 60.0, 30.0, 60.0, 40.0, 20.0, 30.0, 90.0, 25.0, 45.0, 10.0, 35.0, 10.0, 5.0, 25.0, 25.0, 20.0, 100.0, 5.0, 20.0, 50.0, 30.0, 60.0, 75.0, 35.0, 0.0, 70.0, 10.0, 0.0, 20.0, 25.0, 0.0, 25.0, 10.0, 55.0, 50.0, 5.0, 0.0, 0.0, 80.0, 5.0, 20.0, 5.0, 25.0, 50.0, 5.0, 15.0, 20.0, 90.0, 65.0, 5.0, 25.0, 10.0, 0.0], (6000, 1200): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 4200): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0], (4200, 2400): [0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 30.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 15.0, 5.0, 5.0, 5.0, 10.0, 25.0, 10.0, 15.0, 25.0, 0.0, 10.0, 15.0, 30.0, 15.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 45.0, 0.0, 5.0, 25.0, 10.0, 0.0, 0.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 65.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 20.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 35.0, 15.0, 10.0], (8400, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (2400, 2400): [0.0], (7200, 1200): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 3000): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, 10.0, -1.0, 80.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, 0.0, 0.0, 35.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, 10.0, -1.0, -1.0, 0.0, 20.0, 40.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, 60.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0], (3000, 1800): [10.0, 20.0, 0.0, 45.0, 10.0, 5.0, 0.0, 15.0, 25.0, 0.0, 25.0, 10.0, 5.0, 0.0, 5.0, 30.0, 15.0, 5.0, 5.0, 10.0, 0.0, 10.0, 5.0, 5.0, 10.0, 0.0, 10.0, 5.0, 25.0, 50.0, 10.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 55.0, 10.0, 70.0, 0.0, 10.0, 65.0, 0.0, 0.0, 35.0, 30.0, 10.0, 35.0, 5.0, 0.0, 10.0, 0.0, 30.0, 45.0, 10.0, 30.0, 15.0, 0.0, 15.0, 0.0, 20.0, 0.0, 15.0, 20.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 15.0, 40.0, 0.0, 10.0, 20.0, 45.0, 25.0, 80.0, 40.0, 35.0, 10.0, 0.0, 0.0, 10.0, 10.0, 20.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 65.0, 45.0, 5.0, 10.0, 10.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 10.0, 5.0, 0.0, 20.0, 10.0, 20.0, 40.0, 25.0, 15.0, 80.0, 25.0, 5.0, 0.0, 15.0, 15.0, 0.0, 5.0, 0.0, 25.0, 30.0, 0.0, 15.0, 0.0, 5.0, 0.0, 10.0, 10.0, 10.0, 5.0, 35.0, 10.0, 20.0, 15.0, 5.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 10.0, 15.0, 0.0, 40.0, 25.0, 0.0, 10.0, 25.0, 15.0, 25.0, 5.0, 5.0, 15.0, 25.0, 5.0, 20.0, 5.0, 10.0, 30.0, 35.0, 0.0, 15.0], (8400, 2400): [0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 95.0], (600, 600): [15.0, 40.0, 50.0, 25.0, 0.0, 10.0, 90.0, 60.0, 50.0, 75.0, 85.0, -1.0, 20.0, 10.0, 0.0, 65.0, 15.0, 5.0, 25.0, -1.0, 5.0, 95.0, 5.0, 75.0, -1.0, 15.0, 5.0, 50.0, 10.0, 5.0, 50.0, 50.0, 5.0, 80.0, 90.0], (3000, 1200): [0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 5.0, 30.0, 25.0, 10.0, 0.0, 10.0, 0.0, 25.0, 5.0, 0.0, 10.0, 20.0, 5.0, 5.0, 5.0, 15.0, 5.0, 5.0, 5.0, 5.0, 0.0, -1.0, 0.0, 10.0, 20.0, 15.0, 0.0, 0.0, 25.0, 5.0, 5.0, 5.0, 10.0, 15.0, 5.0, 15.0, 5.0, 0.0, 15.0, 5.0, 0.0], (5400, 3000): [10.0, 10.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 25.0, -1.0, -1.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 85.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 40.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, 5.0], (5400, 2400): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6600, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1200, 1200): [30.0, 5.0, 15.0, 85.0, 40.0, 55.0], (5400, 1200): [-1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4800, 3600): [0.0, 0.0, 5.0, 20.0, 20.0, 0.0, 0.0, 5.0, 35.0, 25.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, -1.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 50.0, 10.0, 10.0, 0.0, 40.0, 0.0, 15.0, 0.0, 5.0, 15.0, 20.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 3600): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 55.0, 0.0, -1.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 35.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 15.0, -1.0, -1.0, 45.0, -1.0, 25.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, 5.0, -1.0], (4800, 4200): [10.0, 0.0, 20.0, 15.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6600, 2400): [0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0], (6000, 2400): [0.0, 0.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0], (5400, 600): [0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7200, 4200): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 65.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 35.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, 35.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0], (4200, 1200): [0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0], (6600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (7200, 5400): [-1.0, -1.0, 0.0, 0.0, 5.0, 0.0], (6600, 4800): [-1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, -1.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0], (6600, 4200): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 5.0, 30.0, 0.0, 50.0, 0.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 45.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 45.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0], (4800, 1800): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0], (2400, 0): [-1.0, 25.0, 5.0, 60.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 5.0, -1.0, -1.0, 25.0, 20.0, 10.0, 0.0, 5.0, 35.0, -1.0, -1.0, 0.0, 15.0, 5.0, 5.0, 20.0, 20.0, 15.0, 0.0, 50.0, 5.0], (3000, 2400): [35.0, 5.0, 0.0, 20.0, 5.0, 15.0, 35.0, 20.0, 20.0, 0.0, 5.0, 15.0, 15.0, 5.0, 30.0, 0.0, 40.0, 20.0, 35.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 10.0, 45.0, 0.0, 30.0, 25.0, 30.0, 5.0, 5.0, 30.0, 10.0, 15.0, 10.0, 20.0, 0.0, 10.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 15.0, 10.0, 35.0, 75.0], (4800, 600): [0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0], (4200, 3600): [10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1200, 0): [0.0, 5.0, 35.0, 25.0, 10.0, 0.0, 5.0, 15.0, 10.0, 20.0, 50.0, 5.0, -1.0, 5.0, 40.0, 15.0, 0.0, -1.0, 0.0, 85.0, 20.0, 15.0, 5.0, 0.0, 0.0, 35.0, 70.0, 80.0, 25.0, 5.0, 0.0, 15.0, 5.0, 25.0, 5.0, 10.0, 5.0, -1.0, 0.0, 10.0, 15.0, 35.0, -1.0, 15.0, 10.0, 15.0, 10.0], (5400, 4200): [-1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 50.0, 0.0, 10.0, 0.0, 65.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 10.0, 30.0, 10.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 45.0, 5.0, 5.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 45.0, 0.0, 5.0, 0.0], (4200, 3000): [0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 0.0, 35.0, 20.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 40.0, 35.0, 5.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 15.0, 5.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 40.0, 0.0, 10.0, 0.0, 0.0, 0.0, 90.0, 20.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 50.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 30.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 10.0, 5.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 5.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 10.0, 5.0, 25.0, 5.0, 15.0, 0.0, 0.0, 15.0, 5.0], (0, 0): [80.0, 5.0, 65.0, 65.0, 0.0, 35.0, 75.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 90.0, 10.0, 30.0, 40.0, -1.0, -1.0, 20.0, 50.0, 0.0, 65.0, 30.0, 45.0, 40.0, 95.0, 0.0, 100.0, 20.0, 40.0], (7800, 1800): [-1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0], (2400, 600): [15.0, 5.0, 0.0, 10.0, 20.0, 30.0, 20.0, 5.0, 0.0, 10.0, 20.0, 0.0, -1.0, 5.0, 0.0, 45.0, 0.0, 10.0, 30.0, 30.0, 15.0, 40.0, 10.0, 10.0, 30.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4200, 0): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (600, 0): [45.0, 20.0, 10.0, 25.0, 0.0, 30.0, 5.0, 20.0, 50.0, 55.0, 35.0, 20.0, 15.0, 30.0, 40.0, 20.0, 90.0, 50.0, 45.0, 10.0, -1.0, 20.0, 5.0, 50.0, 40.0, 0.0, 85.0, 75.0, 65.0, 65.0, 95.0, 85.0, 30.0, -1.0, -1.0, 10.0, 20.0, 100.0, 20.0, 10.0, 10.0, 10.0, 35.0, 45.0, 90.0, 25.0, 80.0, 35.0, 15.0, 25.0, 75.0, 80.0, 5.0, 15.0, 5.0, 20.0, 15.0], (1200, 600): [20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 10.0, 25.0, 35.0, 5.0, 70.0, 55.0, 35.0, 25.0, 100.0, 50.0, 90.0, 10.0, 55.0, 20.0, 10.0, 5.0, 0.0, 75.0, -1.0, 25.0, 5.0, 0.0, 90.0, 5.0, 25.0, 35.0, 5.0, 40.0, 70.0, 40.0, 5.0, 30.0, 30.0, 0.0, 40.0, 0.0, 55.0, 55.0, 5.0, 15.0, 25.0, 45.0, 20.0, 55.0, 5.0, 70.0, -1.0, 5.0, 20.0, 45.0, 30.0, 70.0, 75.0, 100.0, 85.0, 15.0, 15.0, 20.0, 30.0, 25.0, 80.0, 0.0, 45.0, 20.0, 65.0, 35.0, -1.0, 70.0, 25.0, -1.0, 15.0, 70.0, 15.0, 20.0, 65.0, 65.0, 10.0, 0.0, 10.0, 95.0, 25.0, 0.0, 80.0, 15.0, 20.0, 95.0, 10.0, 40.0, 10.0, 50.0, 40.0, 10.0, 45.0, 45.0, 15.0, 15.0, 10.0, 45.0, 35.0, 30.0, 10.0, 15.0, 30.0, 30.0, 85.0, 0.0, 15.0, 10.0, 50.0, 5.0, 15.0, 50.0, 15.0, 95.0, 20.0, -1.0], (4800, 2400): [0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 65.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, 70.0, 5.0, 0.0, 0.0, 20.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 5.0, 0.0], (3600, 0): [0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0], (8400, 4800): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, 20.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0], (6600, 3600): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 85.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0]}
mpc_dash_syth_hyb_pen_table_700 = {(7700, 2100): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0], (7700, 4900): [10.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0], (3500, 0): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0], (6300, 2100): [-1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0], (3500, 1400): [0.0, 0.0, 5.0, 10.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 10.0, 5.0, 0.0, 10.0, 10.0, 30.0, 10.0, 10.0, 5.0, 5.0, 0.0, 5.0, 10.0, 0.0, 20.0, 5.0, 20.0, 5.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 20.0, 20.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 5.0], (4900, 2100): [0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, 70.0, 5.0, 0.0, 20.0, 0.0, 15.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0], (7000, 700): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 2100): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0], (7700, 700): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4900, 2800): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, 0.0, 25.0, -1.0, 5.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 60.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 20.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 30.0, 20.0, 30.0, -1.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 60.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0], (7000, 3500): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 55.0, -1.0, -1.0, 0.0, 0.0, 85.0, -1.0, -1.0, -1.0, 15.0, 10.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, 35.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0, 25.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 45.0, 5.0, -1.0, -1.0, 0.0], (5600, 700): [-1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (5600, 1400): [-1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0], (5600, 4200): [5.0, -1.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, -1.0, 15.0, 10.0, 10.0, 0.0, 0.0, 5.0, -1.0, 50.0, 55.0, -1.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 40.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 60.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, -1.0, 0.0, 55.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0], (7700, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 700): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8400, 2800): [-1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, 0.0, -1.0], (7700, 3500): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0], (2800, 1400): [0.0, 20.0, 5.0, 15.0, 0.0, 25.0, 25.0, 25.0, 0.0, 10.0, 5.0, 10.0, 25.0, 10.0, 5.0, 20.0, 10.0, 15.0, 25.0, 10.0, 0.0, 0.0, 5.0, 20.0, 5.0, 5.0, 15.0, 0.0, 20.0, 0.0, 10.0, 10.0, 65.0, 0.0, 5.0, 0.0, 25.0, 20.0, 30.0, 30.0, 35.0, 25.0, 0.0, 0.0, 25.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 30.0, 30.0, 35.0, 75.0, 20.0, 0.0, 25.0, 45.0, 10.0, 5.0, 35.0, 5.0, 15.0, 15.0, 40.0, 35.0, 0.0, 15.0, 20.0, 10.0, 25.0, 20.0, 5.0, 0.0, 80.0, 10.0, 5.0, 40.0, 15.0, 5.0, 5.0, 5.0, 5.0, 15.0, 10.0, 10.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 70.0, 10.0, 20.0, 0.0, 30.0, 5.0, 85.0, 20.0, 15.0, 25.0, 20.0, 15.0, 0.0, 15.0, 0.0, 15.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 25.0, 5.0, 20.0, 5.0, 5.0, 0.0, 25.0, 5.0, 15.0, 15.0, 15.0, 5.0, 10.0, 10.0, 25.0, 10.0, 5.0, 15.0, 10.0, 15.0, 5.0, 5.0, 5.0, 10.0, 15.0, 0.0, 40.0, 20.0, 0.0, 25.0, 15.0, 15.0, 5.0, 65.0, 65.0, 15.0, 15.0, 25.0, 20.0, 5.0, 0.0, 25.0, 20.0, 35.0, 0.0, 0.0], (2100, 1400): [20.0, 5.0, 30.0, 0.0, 65.0, 80.0, 5.0, 20.0, 10.0, 35.0, 5.0, 40.0, 25.0, 30.0, 25.0, 0.0, 40.0, 40.0, 10.0, 70.0, 30.0, 35.0, 65.0, 15.0, 20.0, 0.0, 0.0, 45.0, 25.0, 35.0, 25.0, 10.0, 5.0, 55.0, 5.0, -1.0, 95.0, 50.0, 50.0, 5.0, 0.0, 5.0, 20.0, 40.0, 20.0, 10.0, 80.0, 0.0, 15.0, 45.0, 15.0, 25.0, 75.0, 10.0, 5.0, 40.0, 15.0, 25.0, 40.0, 15.0, 35.0, 65.0, 0.0, 60.0, 95.0, 25.0, 25.0, 30.0, 15.0, 5.0, -1.0, 30.0, 0.0, 0.0, 5.0, 15.0, 55.0, 25.0, 20.0, 30.0, 35.0, 0.0, 55.0, 20.0, 0.0, 45.0, 45.0, 25.0, 5.0, 60.0, 30.0, 5.0, 40.0, 5.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 45.0, 80.0, 20.0, 55.0, 95.0, 50.0, 30.0, 15.0, 15.0, 25.0, 25.0, 0.0, 25.0, 5.0, 5.0, 25.0, 10.0, 100.0, 25.0, 5.0, 35.0, 10.0, 30.0, 20.0, 40.0, 15.0, 10.0, 5.0, 45.0, 20.0, 55.0, 15.0, 45.0, 25.0, 40.0, 50.0, 15.0, 25.0, 20.0, 60.0, 5.0, 15.0, 0.0, 15.0, 30.0, 65.0, 15.0, 20.0, 0.0, 70.0, 5.0, 0.0, 5.0, 5.0, 15.0, 15.0, 30.0, 45.0, 15.0, 30.0, 60.0, 5.0, 40.0, 15.0, 25.0, 30.0, 40.0, 65.0, 20.0, 20.0, 5.0, 0.0, 0.0, 25.0, 15.0, 0.0, 15.0, 20.0, 10.0, 65.0, 20.0, 25.0, 25.0, 5.0, 5.0, 30.0, 15.0, 20.0], (2800, 0): [-1.0, 25.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 25.0, 10.0, 10.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 5.0, 5.0, 20.0, 20.0, 0.0, -1.0, 50.0, 0.0], (700, 700): [20.0, 15.0, 5.0, 35.0, 100.0, 50.0, 0.0, 55.0, 10.0, 90.0, 5.0, 60.0, 25.0, 25.0, 35.0, 40.0, 85.0, -1.0, 45.0, 70.0, 20.0, 45.0, 15.0, 15.0, 30.0, 0.0, 45.0, 65.0, 70.0, 25.0, 5.0, 15.0, 5.0, 10.0, 25.0, 95.0, -1.0, 40.0, 5.0, 45.0, 10.0, 45.0, 10.0, 45.0, 35.0, 10.0, 5.0, 30.0], (6300, 4900): [0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, 0.0, 10.0], (0, 0): [80.0, 20.0, 5.0, 65.0, 10.0, 5.0, 35.0, 15.0, 40.0, 90.0, 50.0, 10.0, 65.0, 0.0, 0.0, 85.0, 35.0, 75.0, -1.0, 95.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 20.0, 10.0, 90.0, 10.0, 30.0, 40.0, 10.0, 35.0, -1.0, -1.0, 20.0, 50.0, 0.0, 25.0, 65.0, 30.0, 45.0, 40.0, 95.0, 0.0, 100.0, 80.0, 5.0, 20.0, 20.0, 40.0, 15.0], (6300, 4200): [0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 15.0, 5.0, 15.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, 5.0, 5.0, 5.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, 45.0, 5.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 50.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3500, 3500): [15.0], (4900, 1400): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 30.0, 0.0, 5.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4900, 4200): [10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 10.0, 20.0, 5.0, 15.0, 10.0, 45.0], (4200, 2800): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 0.0, 10.0, 35.0, 20.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 5.0, 0.0, 40.0, 35.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 15.0, 5.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 40.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, 90.0, 15.0, 20.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 50.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 15.0, 10.0, 0.0, 15.0, 0.0, 45.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 40.0, 0.0, 0.0, 30.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 5.0, 10.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 65.0, 0.0, 5.0, 0.0, 30.0, 0.0, 70.0, 5.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 10.0, 5.0, 5.0, 5.0, 25.0, 5.0, 0.0, 20.0, 15.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0], (2100, 700): [65.0, 10.0, 0.0, 5.0, 10.0, 20.0, 5.0, 0.0, 35.0, 5.0, 0.0, 45.0, 30.0, 5.0, 25.0, 20.0, 0.0, 10.0, 0.0, 10.0, 45.0, 25.0, 0.0, 25.0, 20.0, 100.0, 5.0, 50.0, 30.0, 15.0, 0.0, 45.0, 45.0, 60.0, 55.0, 75.0, 5.0, 20.0, 10.0, 25.0, 20.0, 0.0, 0.0, 60.0, -1.0, 70.0, 30.0, 0.0, 55.0, 0.0, 45.0, 15.0, 25.0, 15.0, 15.0, 0.0, 15.0, 25.0, 5.0, 10.0, 5.0, 40.0, 0.0, 40.0, 40.0, -1.0, 5.0, 5.0, 25.0, 15.0, 35.0, 70.0, 20.0, 0.0, 5.0, 5.0, 25.0, 70.0, 0.0], (1400, 700): [20.0, 60.0, 95.0, 35.0, 35.0, 20.0, 5.0, 20.0, 10.0, 15.0, 25.0, 35.0, 70.0, 55.0, 25.0, 5.0, 30.0, 50.0, 60.0, 30.0, 90.0, 10.0, 20.0, 5.0, 0.0, 75.0, -1.0, 60.0, 5.0, 40.0, 0.0, 50.0, 90.0, 15.0, 20.0, 5.0, 85.0, 5.0, 40.0, 70.0, 40.0, 5.0, 30.0, 30.0, 90.0, 30.0, 45.0, 0.0, 10.0, 35.0, 5.0, 0.0, 0.0, 55.0, 55.0, 5.0, 40.0, 15.0, 50.0, 25.0, 5.0, 20.0, 55.0, 65.0, 15.0, 5.0, -1.0, 20.0, 50.0, 5.0, 10.0, 30.0, 70.0, 75.0, 85.0, 50.0, 15.0, 25.0, 35.0, 20.0, 70.0, 90.0, 40.0, 25.0, 80.0, 20.0, 35.0, -1.0, 10.0, 10.0, 25.0, -1.0, 65.0, 20.0, 70.0, 15.0, 20.0, 65.0, 65.0, 10.0, 55.0, 95.0, 55.0, 0.0, 15.0, 20.0, 35.0, 0.0, 25.0, 75.0, 10.0, 40.0, 10.0, 50.0, 5.0, 10.0, 80.0, 10.0, 0.0, 65.0, 80.0, 85.0, 15.0, 5.0, 30.0, 20.0, 25.0, 15.0, 30.0, 35.0, 10.0, 85.0, 5.0, 0.0, 15.0, 50.0, 5.0, 95.0, 90.0, 50.0, 65.0, 5.0, 95.0, 15.0, 15.0, 50.0, 15.0, 10.0, 95.0, 20.0, -1.0, 85.0], (4900, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (8400, 700): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 4900): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 55.0, -1.0, -1.0, 5.0, -1.0, 5.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 55.0, 20.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0], (8400, 4200): [-1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (7700, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (4900, 700): [0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0], (5600, 2800): [10.0, 0.0, 10.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 35.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 40.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 25.0, 20.0, -1.0], (7000, 2800): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 50.0, -1.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 5600): [40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, 80.0, 0.0, 0.0, -1.0, -1.0], (4200, 0): [0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5600, 3500): [20.0, 0.0, -1.0, 0.0, 10.0, 5.0, 10.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 25.0, 5.0, 15.0, -1.0, 10.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, -1.0, 0.0, 25.0, 0.0, -1.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 65.0, -1.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 10.0, 20.0, -1.0, 0.0, 15.0, 10.0, 5.0, 0.0, 30.0, 40.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, -1.0, 50.0, 0.0, 20.0, 5.0, -1.0, 0.0, 0.0, 0.0, 90.0, 40.0, 0.0, 15.0, 50.0, 55.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0], (2800, 2100): [10.0, 45.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 30.0, 5.0, 20.0, 10.0, 0.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 25.0, 25.0, 35.0, 50.0, 10.0, 45.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 55.0, 10.0, 15.0, 70.0, 10.0, 0.0, 5.0, 10.0, 5.0, 0.0, 30.0, 10.0, 10.0, 30.0, 0.0, 30.0, 0.0, 5.0, 45.0, 20.0, 30.0, 35.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 100.0, 10.0, 0.0, 20.0, 45.0, 0.0, 0.0, 30.0, 10.0, 25.0, 25.0, 35.0, 45.0, 0.0, 0.0, 30.0, 0.0, 10.0, 30.0, 20.0, 5.0, 0.0, 5.0, 5.0, 65.0, 45.0, 5.0, 5.0, 0.0, 0.0, 10.0, 50.0, 5.0, 0.0, 10.0, 10.0, 40.0, 15.0, 25.0, 15.0, 80.0, 5.0, 10.0, 20.0, 0.0, 25.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 10.0, 15.0, 0.0, 25.0, 25.0, 10.0, 35.0, 10.0, 20.0, 20.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 35.0, 10.0, 15.0, 0.0, 15.0, 25.0, 40.0, 25.0, 5.0, 75.0, 5.0, 10.0, 30.0, 15.0], (3500, 2100): [0.0, 15.0, 35.0, 5.0, 20.0, 5.0, 5.0, 0.0, 5.0, 5.0, 25.0, 25.0, 0.0, 5.0, 30.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 20.0, 0.0, 10.0, 10.0, 10.0, 15.0, 10.0, 0.0, 5.0, 10.0, 0.0, 45.0, 0.0, 5.0, 5.0, 5.0, 15.0, 10.0, 0.0, 0.0, 15.0, 0.0, 65.0, 0.0, 5.0, 15.0, 0.0, 0.0, 30.0, 0.0, 20.0, 10.0, 0.0, 5.0, 35.0, 35.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 0.0, 40.0, 5.0, 20.0, 15.0, 15.0, 10.0, 20.0, 20.0, 5.0, 15.0, 0.0, 0.0, 10.0, 40.0, 0.0, 20.0, 5.0, 45.0, 20.0, 0.0, 5.0, 5.0, 5.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 5.0, 10.0, 5.0, 5.0, 10.0, 10.0, 10.0, 0.0, 10.0, 25.0, 0.0, 15.0, 25.0, 10.0, 10.0, 0.0, 5.0, 35.0, 0.0, 0.0, 35.0, 5.0, 0.0, 5.0, 10.0, 0.0, 50.0, 10.0, 5.0, 15.0, 20.0, 20.0, 30.0, 25.0, 5.0, 20.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 25.0, 30.0, 0.0, 15.0, 5.0, 40.0, 5.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 35.0, 5.0, 5.0, 5.0, 0.0, 10.0, 20.0, 10.0, 0.0, 15.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 5.0, 25.0, 5.0, 20.0, 0.0, 5.0, 40.0, 10.0, 0.0], (5600, 2100): [-1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0], (3500, 700): [0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 10.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0], (6300, 3500): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, 10.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 25.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 80.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 45.0, 60.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0], (1400, 1400): [10.0, 70.0, 15.0, -1.0, 30.0, 40.0, 10.0, 60.0, 20.0, 5.0, 35.0, 5.0, 30.0, 0.0, 65.0, 5.0, 45.0, 70.0, 55.0, 0.0, 35.0], (7000, 2100): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, -1.0, -1.0], (7000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 0): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (3500, 2800): [5.0, 70.0, 20.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 5.0, 25.0, 0.0, 45.0, 0.0, 0.0, 15.0, 10.0, 10.0, 15.0, 10.0, 15.0, 10.0, 5.0, 35.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 10.0, 10.0, 5.0, 25.0, 0.0, 80.0, 25.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 15.0, 10.0, 5.0, 5.0, 0.0, 0.0, 30.0, 10.0, 25.0, 10.0, 0.0, 0.0, 50.0, 0.0, 20.0, 0.0, 30.0, 5.0, 0.0], (7700, 2800): [-1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 4200): [0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 15.0, -1.0, 0.0, 65.0, 30.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 10.0, 5.0, 0.0, 25.0, -1.0, 35.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 15.0, 0.0, -1.0, -1.0, 20.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 45.0, 15.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 55.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, 35.0, -1.0, 0.0, 0.0, 30.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0], (8400, 4900): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 20.0, -1.0, 15.0, 55.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (2800, 700): [25.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0, 15.0, 15.0, 5.0, 10.0, 40.0, 0.0, 0.0, 20.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 10.0, 5.0, 0.0, 40.0, 0.0, 30.0, 5.0, 15.0, 5.0, 40.0, 15.0, 10.0, 30.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0], (2100, 0): [5.0, 15.0, 15.0, 55.0, 5.0, 60.0, 0.0, 20.0, 35.0, 0.0, 0.0, 30.0, 20.0, -1.0, 25.0, 0.0, 10.0, -1.0, 0.0, 5.0, 10.0, 10.0, 5.0, 20.0, 65.0, 0.0, -1.0, 10.0, 5.0, 0.0, -1.0, 20.0, 0.0, 5.0, 75.0, 10.0, 35.0, 5.0, 0.0, 15.0, 5.0, 20.0, 25.0, 15.0, 80.0, 0.0, 0.0, 5.0, 15.0], (6300, 2800): [-1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 80.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 25.0, 0.0, 20.0, 40.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0], (700, 0): [45.0, 40.0, 25.0, 0.0, 30.0, 20.0, 25.0, 50.0, 25.0, 55.0, 0.0, 10.0, 5.0, 20.0, 30.0, 20.0, 50.0, 45.0, 75.0, -1.0, 20.0, 5.0, 50.0, -1.0, 40.0, 75.0, 20.0, 65.0, 10.0, 0.0, 65.0, 65.0, 0.0, 85.0, 20.0, 30.0, 0.0, -1.0, 10.0, 20.0, 5.0, 35.0, 80.0, 25.0, -1.0, 100.0, 95.0, 10.0, 75.0, 15.0, 80.0, 45.0, 90.0, 25.0, 5.0, 15.0, 80.0, 35.0, 5.0, 50.0, -1.0, 15.0, 25.0, 50.0, 10.0, 50.0, 15.0, 5.0, 80.0, 10.0, 75.0, 5.0, 90.0, 10.0, 15.0, 15.0, 5.0], (4200, 700): [0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4200, 2100): [0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 5.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 10.0, 0.0, 25.0, 0.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 10.0, 30.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 10.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 20.0, 5.0, 15.0, 25.0, 0.0, 10.0, 10.0, -1.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0], (7700, 5600): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0], (6300, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4200, 3500): [25.0, 5.0, 0.0, 0.0, 0.0, 15.0, 10.0, 15.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0], (7700, 4200): [0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 10.0, -1.0, 15.0, -1.0, -1.0, 0.0, 35.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0], (1400, 0): [10.0, 65.0, 0.0, 65.0, 5.0, 35.0, 35.0, 40.0, 10.0, 20.0, 15.0, 10.0, 40.0, -1.0, 20.0, 20.0, 50.0, 5.0, 10.0, 5.0, 25.0, 5.0, 5.0, 40.0, 15.0, -1.0, 0.0, 100.0, -1.0, 85.0, 15.0, 5.0, 25.0, 5.0, 0.0, 70.0, 5.0, -1.0, 0.0, 10.0, 0.0, 5.0, 50.0, 20.0, 10.0, 15.0, 0.0, 35.0, -1.0, 15.0, 10.0, 20.0], (4200, 1400): [0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 5.0, 20.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0], (8400, 1400): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (2100, 2100): [10.0, 25.0], (5600, 4900): [0.0], (4900, 3500): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 35.0, 35.0, 0.0, 25.0, 0.0, 15.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, 15.0, 60.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 75.0, 5.0, 5.0, -1.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 35.0, 5.0, 0.0, 5.0, 45.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 50.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 15.0, 10.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 35.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 20.0, 10.0, 10.0, 5.0, 0.0, 40.0, 0.0, 10.0, 15.0, 0.0, 5.0, 15.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0], (8400, 3500): [-1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0]}
mpc_dash_syth_hyb_pen_table_800 = {(4800, 3200): [0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 25.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 35.0, 35.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 30.0, 10.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 60.0, 15.0, 25.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 30.0, 0.0, -1.0, 35.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, 75.0, 0.0, 5.0, -1.0, 0.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 45.0, 5.0, 0.0, 5.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 5.0, 55.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 30.0, 0.0, 15.0, 0.0, -1.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 15.0, 10.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 30.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 70.0, 0.0, -1.0, 0.0, 0.0, 35.0, 20.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 20.0, 0.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 35.0, 20.0, 0.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 25.0], (6400, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8800, 4000): [-1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0], (4000, 800): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8800, 2400): [-1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0], (8000, 3200): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (8800, 3200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (7200, 4000): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 65.0, 0.0, 30.0, 10.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 35.0, 35.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 35.0, -1.0, 0.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, 25.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 15.0, 0.0, 35.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0], (4800, 800): [0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0], (8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (800, 800): [20.0, 15.0, 95.0, 35.0, 10.0, 70.0, 55.0, 35.0, 25.0, 100.0, 90.0, 55.0, 10.0, 5.0, 0.0, 25.0, 0.0, 90.0, 5.0, 35.0, 40.0, 0.0, 40.0, 0.0, 55.0, 5.0, -1.0, 45.0, 20.0, 5.0, 5.0, 20.0, 45.0, 75.0, 85.0, 15.0, 80.0, 0.0, 45.0, 65.0, 35.0, 70.0, 25.0, 70.0, 10.0, 95.0, 25.0, 55.0, 0.0, 20.0, 95.0, -1.0, 40.0, 50.0, 40.0, 45.0, 10.0, 45.0, 15.0, 10.0, 45.0, 30.0, 30.0, 85.0, 0.0, 15.0, 95.0, -1.0], (6400, 4000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 10.0, 5.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 50.0, 0.0, 25.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 15.0, -1.0, 10.0, 5.0, -1.0, 15.0, -1.0, 0.0, 15.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 85.0, 0.0, -1.0, 0.0, 0.0, 20.0, 15.0, -1.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, -1.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 45.0, 5.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 35.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6400, 1600): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8000, 4000): [0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0], (2400, 0): [-1.0, 15.0, 25.0, 0.0, 10.0, 5.0, 60.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, 10.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, -1.0, -1.0, 25.0, 20.0, 10.0, 0.0, 5.0, 0.0, 10.0, 5.0, 35.0, 10.0, -1.0, 40.0, 0.0, 0.0, -1.0, 10.0, 0.0, 15.0, 5.0, 10.0, 5.0, 20.0, 20.0, 15.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0], (4000, 1600): [0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 20.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 15.0, 0.0, 0.0, 25.0, 5.0, 10.0, -1.0, 10.0, 10.0, 0.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (3200, 800): [25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 20.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 30.0, 5.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 20.0, 0.0, 0.0, 40.0, 0.0, 5.0, 15.0, 25.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0], (6400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8800, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (800, 0): [60.0, 45.0, 40.0, 5.0, 35.0, 25.0, 0.0, 25.0, 50.0, 10.0, 50.0, 25.0, 0.0, 0.0, 10.0, 5.0, 20.0, 90.0, 15.0, 10.0, 60.0, 75.0, 50.0, 45.0, 75.0, 25.0, 50.0, 50.0, -1.0, 40.0, 85.0, 20.0, 65.0, 10.0, 0.0, 70.0, 5.0, 40.0, 65.0, 65.0, 0.0, 15.0, -1.0, 0.0, 85.0, 20.0, 15.0, 30.0, 5.0, 0.0, 30.0, 20.0, 5.0, 0.0, 35.0, 70.0, 80.0, 25.0, 25.0, 5.0, -1.0, 5.0, 15.0, 95.0, 5.0, 20.0, 75.0, 10.0, 15.0, 80.0, 5.0, 45.0, 90.0, 25.0, 5.0, 10.0, 10.0, 15.0, 5.0, 80.0, 5.0, 50.0, 15.0, -1.0, 0.0, 35.0, 10.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 35.0, 30.0, 5.0, 80.0, 10.0, 75.0, 5.0, 90.0, 10.0, 15.0, 50.0], (6400, 4800): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, -1.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0], (8800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 4800): [10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, 5.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, 55.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 5.0, 40.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 55.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0], (7200, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 5.0, -1.0, -1.0, -1.0], (2400, 1600): [10.0, 0.0, 20.0, 5.0, 20.0, 5.0, 30.0, 0.0, 0.0, 80.0, 5.0, 10.0, 35.0, 25.0, 40.0, 0.0, 25.0, 0.0, 30.0, 25.0, 25.0, 0.0, 10.0, 30.0, 40.0, 5.0, 5.0, 10.0, 40.0, 0.0, 25.0, 10.0, 5.0, 30.0, 20.0, 10.0, 35.0, 65.0, 15.0, 25.0, 20.0, 0.0, 25.0, 0.0, 10.0, 0.0, 35.0, 45.0, 0.0, 25.0, 0.0, 5.0, 5.0, 5.0, 55.0, 5.0, 15.0, 0.0, 20.0, 50.0, 5.0, 5.0, 0.0, 55.0, 10.0, 10.0, 40.0, 5.0, 20.0, 65.0, 0.0, 5.0, 0.0, 25.0, 0.0, 20.0, 45.0, 15.0, 30.0, 10.0, 35.0, 10.0, 40.0, 0.0, 0.0, 25.0, 40.0, 0.0, 15.0, 5.0, 45.0, 10.0, 30.0, 15.0, 65.0, 60.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 30.0, 25.0, 30.0, 30.0, 20.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 45.0, 0.0, 55.0, 20.0, 30.0, 0.0, 10.0, 0.0, 5.0, 35.0, 25.0, 5.0, 5.0, 40.0, 35.0, 100.0, 5.0, 15.0, 20.0, 10.0, 20.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 45.0, 10.0, 25.0, 40.0, 20.0, 55.0, 95.0, 50.0, 15.0, 10.0, 20.0, 5.0, 15.0, 5.0, 25.0, 25.0, 0.0, 65.0, 5.0, 5.0, 15.0, 10.0, 100.0, 25.0, 5.0, 20.0, 0.0, 10.0, 5.0, 70.0, 20.0, 50.0, 45.0, 30.0, 0.0, 5.0, 85.0, 10.0, 25.0, 45.0, 25.0, 15.0, 25.0, 5.0, 20.0, 15.0, 40.0, 0.0, 15.0, 15.0, 5.0, 15.0, 0.0, 20.0, 0.0, 25.0, 60.0, 5.0, 5.0, 15.0, 15.0, 0.0, 10.0, 20.0, 15.0, 30.0, 5.0, 25.0, 20.0, 15.0, 70.0, 15.0, 15.0, 0.0, 15.0, 25.0, 25.0, 5.0, 15.0, 45.0, 15.0, 60.0, 10.0, 5.0, 25.0, 10.0, 35.0, 20.0, 15.0, 40.0, 20.0, 5.0, 5.0, 0.0, 25.0, 5.0, 40.0, 20.0, 0.0, 40.0, 20.0, 0.0, 15.0, 40.0, 0.0, 25.0, 15.0, 15.0, 15.0, 5.0, 20.0, 10.0, 65.0, 65.0, 15.0, 25.0, 0.0, 5.0, 5.0, 25.0, 30.0, 20.0, 15.0, 35.0, 20.0, 0.0, 0.0], (0, 0): [80.0, 20.0, 5.0, 65.0, 10.0, 30.0, 5.0, 20.0, 55.0, 35.0, 15.0, 30.0, 40.0, 20.0, 90.0, 50.0, 10.0, 65.0, -1.0, 20.0, 5.0, 0.0, 0.0, 85.0, 75.0, 35.0, 75.0, -1.0, 95.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 100.0, 20.0, 10.0, 90.0, 10.0, 10.0, 30.0, 40.0, 10.0, 35.0, -1.0, -1.0, 20.0, 50.0, 0.0, 25.0, 65.0, 35.0, 30.0, 45.0, 15.0, 40.0, 95.0, 0.0, 100.0, 80.0, 5.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (6400, 3200): [-1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 5.0, 35.0, 10.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 40.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 80.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 60.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0], (8000, 4800): [-1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 30.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, 20.0, 5.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 55.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (3200, 1600): [0.0, 45.0, 10.0, 0.0, 5.0, 0.0, 5.0, 15.0, 5.0, 10.0, 25.0, 25.0, 10.0, 5.0, 0.0, 5.0, 15.0, 10.0, 5.0, 5.0, 10.0, 0.0, 5.0, 50.0, 10.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 70.0, 0.0, 0.0, 10.0, 0.0, 35.0, 30.0, 35.0, 25.0, 5.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 5.0, 5.0, 15.0, 10.0, 0.0, 20.0, 0.0, 30.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 35.0, 15.0, 15.0, 0.0, 0.0, 45.0, 10.0, 25.0, 5.0, 5.0, 80.0, 5.0, 10.0, 0.0, 35.0, 10.0, 0.0, 10.0, 0.0, 10.0, 5.0, 30.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, 45.0, 0.0, 5.0, 10.0, 10.0, 0.0, 5.0, 25.0, 5.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 0.0, 10.0, 10.0, 5.0, 5.0, 0.0, 0.0, 20.0, 10.0, 20.0, 5.0, 40.0, 15.0, 5.0, 80.0, 15.0, 0.0, 30.0, 5.0, 30.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 10.0, 10.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 10.0, 20.0, 15.0, 20.0, 0.0, 10.0, 5.0, 0.0, 15.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 10.0, 5.0, 15.0, 0.0, 25.0, 0.0, 0.0, 10.0, 25.0, 5.0, 15.0, 0.0, 30.0, 15.0, 25.0, 5.0, 0.0, 20.0, 5.0, 10.0, 40.0, 30.0, 0.0, 15.0], (7200, 5600): [-1.0], (7200, 2400): [-1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (2400, 2400): [20.0, 0.0, 0.0, 10.0, 20.0, 75.0], (2400, 800): [5.0, 5.0, 0.0, 25.0, 20.0, 5.0, 10.0, 20.0, -1.0, 15.0, 5.0, 5.0, 10.0, 0.0, 35.0, 0.0, 15.0, 30.0, 10.0, 5.0, 15.0, 25.0, 40.0, 20.0, 0.0, 5.0, 0.0, 0.0, 45.0, 20.0, 0.0, 0.0, 30.0, 75.0, 15.0, 25.0, 5.0, 50.0, 5.0, 45.0, 45.0, 15.0, 5.0, 15.0, 5.0, 5.0, 45.0, 0.0, 55.0, 5.0, 15.0, 10.0, 25.0, 0.0, 60.0, 25.0, -1.0, 5.0, 30.0, 35.0, 45.0, 20.0, 10.0, 5.0, 15.0, 10.0, 15.0, 5.0, 15.0, 15.0, 5.0, 30.0, 15.0, 5.0, 40.0, 10.0, 0.0, 30.0, 5.0, 15.0, 30.0, -1.0, 10.0, 5.0, 15.0, 5.0, 25.0, 5.0, 70.0, 0.0, 65.0, 0.0, 25.0, 5.0, 5.0], (4000, 3200): [0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 70.0, 0.0, 35.0, 0.0, 15.0, 0.0, 0.0, 20.0, 0.0, 35.0, 5.0, 45.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 10.0, 10.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0, 90.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 40.0, 0.0, 10.0, 10.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 5.0, 0.0, 5.0, 30.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 25.0, 5.0, 0.0, 15.0, 0.0, 0.0, 15.0], (8000, 5600): [-1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 80.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0], (4000, 2400): [0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 20.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 40.0, 5.0, 25.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 30.0, 65.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 20.0, 10.0, 15.0, 10.0, 0.0, 15.0, 15.0, 5.0, 5.0, 0.0, 15.0, 5.0, 5.0, 15.0, 5.0, 0.0, 5.0, 5.0, 5.0, 5.0, 40.0, 10.0, 20.0, 10.0, 15.0, 0.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 15.0, 5.0, 25.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 15.0, 20.0, 35.0, 50.0, 30.0, 15.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 20.0, 10.0, 15.0, 5.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 5.0, 20.0, 25.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 20.0, 0.0, 5.0, 25.0, 20.0, 5.0, 10.0, 5.0, 20.0, 5.0, 5.0, 5.0, 0.0, 15.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 20.0, 0.0, 0.0, 10.0, 5.0, 30.0, 5.0, 0.0, 0.0, 20.0, 5.0, 20.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 15.0, 10.0], (8800, 4800): [0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 25.0, -1.0, 10.0, 5.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6400, 2400): [0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (8800, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8000, 2400): [0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0], (8000, 1600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0], (5600, 3200): [20.0, 0.0, -1.0, 10.0, 5.0, 10.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 80.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 10.0, -1.0, 5.0, 0.0, -1.0, 10.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, 25.0, 0.0, -1.0, 35.0, 10.0, 0.0, 15.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 65.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, -1.0, 25.0, 0.0, 25.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 0.0, 0.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, 0.0, 40.0, 0.0, 0.0, 15.0, -1.0, 5.0, 50.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 0.0, 15.0, 0.0, -1.0, -1.0, 5.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 25.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0], (4000, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4800, 1600): [0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, 5.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, -1.0, -1.0, 0.0, 25.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8800, 5600): [40.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0], (4800, 4000): [0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 45.0, 0.0, 0.0], (5600, 0): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5600, 4000): [5.0, 0.0, -1.0, -1.0, 15.0, -1.0, 10.0, 25.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 50.0, 55.0, -1.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 35.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 30.0, 20.0, 0.0, 40.0, 40.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, -1.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 10.0, -1.0, 15.0, 0.0, 0.0, 0.0, 20.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 75.0, -1.0, 0.0, 0.0, 0.0, 90.0, 0.0, 0.0, -1.0, 0.0, 55.0, 0.0, 5.0, 50.0, 0.0, 55.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0], (7200, 3200): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 50.0, -1.0, -1.0, 10.0, 40.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 25.0, 10.0, -1.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 5.0], (5600, 1600): [-1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (3200, 0): [0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0], (1600, 800): [20.0, 35.0, 65.0, 20.0, 5.0, 5.0, 20.0, 10.0, 65.0, 15.0, 25.0, 35.0, 10.0, 10.0, 0.0, 5.0, 30.0, 25.0, 50.0, 60.0, 30.0, 10.0, 10.0, 20.0, 50.0, 5.0, 70.0, 15.0, 5.0, 60.0, 0.0, 5.0, 40.0, 10.0, 80.0, 45.0, 50.0, 15.0, 20.0, 25.0, 85.0, 5.0, 75.0, 70.0, 40.0, 5.0, 5.0, 30.0, 90.0, 30.0, 25.0, -1.0, 10.0, 35.0, 5.0, 0.0, 10.0, 55.0, 5.0, 30.0, 40.0, 40.0, 25.0, 15.0, 50.0, -1.0, 25.0, 20.0, 10.0, 25.0, 100.0, 5.0, 55.0, 55.0, 65.0, 15.0, 20.0, 30.0, -1.0, 20.0, 50.0, 40.0, 30.0, 0.0, 10.0, 30.0, 70.0, 60.0, 15.0, 20.0, 45.0, 50.0, 60.0, 75.0, 15.0, 5.0, 20.0, 25.0, 20.0, 0.0, 5.0, 20.0, 70.0, 90.0, 40.0, 25.0, 35.0, 70.0, 20.0, 25.0, 5.0, -1.0, 10.0, 0.0, 10.0, -1.0, 10.0, 55.0, 0.0, 65.0, 40.0, 15.0, 20.0, 30.0, 15.0, 65.0, 0.0, 0.0, 15.0, 65.0, 25.0, 10.0, 50.0, 55.0, 25.0, 15.0, 65.0, 65.0, 35.0, 5.0, 0.0, 5.0, 40.0, 25.0, 0.0, 75.0, 10.0, 5.0, 80.0, 10.0, 0.0, 30.0, 45.0, 65.0, 40.0, 80.0, 70.0, 85.0, 5.0, 25.0, 20.0, 25.0, 30.0, 5.0, 65.0, 25.0, 55.0, 15.0, 5.0, 35.0, 10.0, 5.0, 50.0, 5.0, 15.0, 0.0, 35.0, 95.0, 35.0, 20.0, 90.0, 50.0, 65.0, 95.0, 15.0, 15.0, 5.0, 5.0, 25.0, 15.0, 10.0, 20.0, 70.0, 85.0], (4800, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4800, 2400): [0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 65.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 20.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 60.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, -1.0, 20.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 15.0, 0.0, 0.0, 0.0, 70.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 30.0, -1.0, 0.0, 15.0, 5.0, 5.0, -1.0, 0.0, 0.0, 20.0, 60.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 5.0, 0.0, 0.0], (5600, 800): [-1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0], (1600, 0): [10.0, 5.0, 65.0, 0.0, 65.0, 15.0, 55.0, 5.0, 35.0, 40.0, 20.0, 20.0, 40.0, -1.0, 35.0, 20.0, -1.0, 20.0, 30.0, 5.0, 30.0, 45.0, 10.0, 25.0, 10.0, 5.0, 0.0, 25.0, 5.0, 5.0, 15.0, -1.0, 20.0, 65.0, -1.0, 100.0, 85.0, 35.0, 25.0, 5.0, 0.0, -1.0, 25.0, 0.0, 0.0, 75.0, 50.0, 5.0, 20.0, 10.0, 20.0, 25.0, -1.0, 5.0, 80.0, 15.0, 10.0, 20.0, 15.0, 0.0], (1600, 1600): [20.0, 70.0, 45.0, 95.0, 20.0, 35.0, 15.0, 35.0, 60.0, 10.0, 80.0, 30.0, 5.0, 30.0, 20.0, 55.0, 15.0, 5.0, 5.0, 15.0, 20.0, 0.0, 20.0], (3200, 2400): [15.0, 35.0, 20.0, 5.0, 0.0, 5.0, 5.0, 25.0, 0.0, 5.0, 0.0, 10.0, 20.0, 0.0, 5.0, 15.0, 0.0, 35.0, 20.0, 10.0, 0.0, 10.0, 10.0, 20.0, 0.0, 15.0, 5.0, 0.0, 15.0, 10.0, 10.0, 0.0, 15.0, 5.0, 15.0, 0.0, 30.0, 5.0, 0.0, 10.0, 35.0, 10.0, 35.0, 40.0, 15.0, 10.0, 10.0, 30.0, 5.0, 0.0, 40.0, 35.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 40.0, 5.0, 45.0, 20.0, 0.0, 0.0, 5.0, 5.0, 10.0, 10.0, 0.0, 15.0, 0.0, 5.0, 25.0, 35.0, 5.0, 10.0, 5.0, 10.0, 0.0, 0.0, 30.0, 0.0, 25.0, 10.0, 25.0, 45.0, 0.0, 0.0, 80.0, 30.0, 25.0, 10.0, 0.0, 30.0, 5.0, 0.0, 5.0, 35.0, 10.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 10.0, 5.0, 30.0, 0.0, 0.0, 10.0, 10.0, 15.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 30.0, 0.0, 5.0, 15.0, 40.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 10.0, 35.0, 15.0, 10.0, 35.0, 5.0, 50.0, 5.0, 10.0, 20.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 5.0, 10.0], (7200, 800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 4800): [35.0, 0.0, 30.0, 0.0, 0.0, 0.0, 20.0, -1.0], (5600, 2400): [0.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0]}
mpc_dash_syth_hyb_pen_table_900 = {(2700, 1800): [10.0, 20.0, 0.0, 5.0, 45.0, 10.0, 35.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 25.0, 25.0, 0.0, 25.0, 25.0, 0.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 30.0, 15.0, 5.0, 5.0, 20.0, 10.0, 0.0, 10.0, 5.0, 25.0, 10.0, 5.0, 5.0, 10.0, 15.0, 0.0, 20.0, 10.0, 35.0, 5.0, 25.0, 25.0, 0.0, 20.0, 50.0, 10.0, 45.0, 0.0, 20.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 55.0, 10.0, 10.0, 15.0, 70.0, 10.0, 0.0, 5.0, 10.0, 20.0, 65.0, 0.0, 25.0, 5.0, 0.0, 0.0, 35.0, 20.0, 30.0, 30.0, 10.0, 35.0, 10.0, 40.0, 5.0, 0.0, 0.0, 10.0, 30.0, 0.0, 30.0, 0.0, 5.0, 45.0, 40.0, 10.0, 20.0, 30.0, 15.0, 0.0, 35.0, 0.0, 0.0, 15.0, 0.0, 35.0, 95.0, 0.0, 30.0, 0.0, 30.0, 20.0, 0.0, 15.0, 15.0, 0.0, 20.0, 45.0, 0.0, 55.0, 30.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 35.0, 0.0, 35.0, 15.0, 40.0, 35.0, 100.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 20.0, 45.0, 25.0, 5.0, 0.0, 80.0, 0.0, 0.0, 30.0, 10.0, 25.0, 40.0, 25.0, 10.0, 35.0, 20.0, 45.0, 10.0, 0.0, 0.0, 30.0, 25.0, 0.0, 10.0, 10.0, 30.0, 20.0, 5.0, 5.0, 25.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 65.0, 45.0, 5.0, 5.0, 10.0, 10.0, 10.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 70.0, 0.0, 10.0, 10.0, 50.0, 30.0, 5.0, 30.0, 0.0, 20.0, 85.0, 10.0, 20.0, 10.0, 40.0, 15.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 0.0, 10.0, 15.0, 20.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 25.0, 30.0, 0.0, 5.0, 10.0, 15.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 20.0, 10.0, 15.0, 15.0, 0.0, 25.0, 15.0, 25.0, 5.0, 45.0, 10.0, 60.0, 10.0, 10.0, 5.0, 35.0, 10.0, 20.0, 40.0, 20.0, 15.0, 5.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 5.0, 35.0, 10.0, 15.0, 10.0, 0.0, 10.0, 15.0, 35.0, 0.0, 40.0, 20.0, 25.0, 0.0, 10.0, 15.0, 40.0, 25.0, 15.0, 25.0, 5.0, 5.0, 65.0, 65.0, 15.0, 25.0, 5.0, 20.0, 25.0, 75.0, 0.0, 5.0, 10.0, 25.0, 30.0, 35.0, 20.0, 0.0, 0.0, 15.0], (5400, 3600): [20.0, 0.0, 5.0, -1.0, 0.0, -1.0, 10.0, 5.0, 0.0, 10.0, -1.0, 5.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 15.0, -1.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 60.0, 0.0, 5.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, -1.0, 40.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, -1.0, 0.0, 65.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 40.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 20.0, 0.0, 15.0, 45.0, 10.0, 5.0, 30.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 60.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 45.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 0.0, 0.0, 65.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, -1.0, -1.0, 10.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 20.0, 45.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 55.0, 15.0, 5.0, 50.0, 0.0, 55.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 25.0], (5400, 0): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7200, 5400): [0.0, -1.0, 0.0, 45.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0], (7200, 900): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 2700): [-1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 10.0, 80.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 20.0, -1.0, 40.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, 60.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (6300, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0], (5400, 1800): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0], (4500, 1800): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 25.0, 0.0, 10.0, 30.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, 0.0, 25.0, 30.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6300, 4500): [0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 45.0, 0.0, 5.0, 10.0, 45.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, 5.0, 45.0, -1.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, -1.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0], (7200, 2700): [-1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 50.0, -1.0, -1.0, 40.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 4500): [10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 30.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 5.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 15.0, 0.0, -1.0, 0.0, 55.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, -1.0, 40.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, 5.0, 0.0, 15.0, -1.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 55.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 45.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0], (900, 0): [20.0, 15.0, 60.0, 35.0, 45.0, 40.0, 0.0, 5.0, 5.0, 35.0, 0.0, 25.0, 50.0, 10.0, 50.0, 25.0, 0.0, 0.0, 10.0, 10.0, 55.0, 5.0, 20.0, 90.0, 15.0, 10.0, 5.0, 60.0, 75.0, -1.0, 50.0, 20.0, 45.0, 75.0, 25.0, 35.0, 50.0, 5.0, 5.0, 30.0, 50.0, -1.0, 40.0, 85.0, -1.0, 65.0, 10.0, 45.0, 0.0, 5.0, 70.0, 5.0, 40.0, 15.0, 65.0, 0.0, 20.0, 15.0, 100.0, -1.0, 0.0, 85.0, 85.0, 20.0, 15.0, 5.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 20.0, 35.0, 70.0, 80.0, 70.0, 25.0, 25.0, 5.0, 5.0, 15.0, 95.0, 5.0, 0.0, 20.0, 75.0, 10.0, 0.0, 15.0, 25.0, 80.0, 5.0, 90.0, 25.0, 5.0, -1.0, 40.0, 10.0, 10.0, 15.0, 5.0, 10.0, 45.0, 5.0, 50.0, 10.0, 15.0, -1.0, 0.0, 35.0, 10.0, 5.0, 50.0, 10.0, 15.0, 35.0, 30.0, -1.0, 5.0, 80.0, 15.0, 10.0, 5.0, 15.0, 90.0, 10.0, 15.0, 10.0, 50.0, 20.0], (4500, 2700): [0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 35.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 15.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, -1.0, 15.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 25.0, 90.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 50.0, 0.0, -1.0, 20.0, 45.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 70.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 10.0, 45.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 65.0, 0.0, 45.0, 5.0, 0.0, 30.0, 10.0, 70.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 10.0, 5.0, 0.0, 5.0, 25.0, 5.0, 10.0, 0.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0], (7200, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0], (2700, 2700): [35.0, 15.0, 20.0, 0.0, 10.0], (900, 900): [20.0, 95.0, 35.0, 10.0, 25.0, 35.0, 70.0, 55.0, 35.0, 25.0, 100.0, 30.0, 50.0, 90.0, 20.0, 10.0, 5.0, 0.0, 25.0, 5.0, 0.0, 90.0, 15.0, 5.0, 85.0, 40.0, 70.0, 40.0, 5.0, 30.0, 0.0, 40.0, 0.0, 55.0, 55.0, 5.0, 15.0, 25.0, 20.0, 55.0, -1.0, 5.0, 45.0, 30.0, 70.0, 75.0, 85.0, 15.0, 15.0, 40.0, 25.0, 80.0, 45.0, 65.0, 35.0, -1.0, 25.0, -1.0, 70.0, 15.0, 65.0, 65.0, 10.0, 95.0, 55.0, 0.0, 15.0, 20.0, 95.0, 10.0, 50.0, 40.0, 45.0, 15.0, 10.0, 45.0, 30.0, 15.0, 30.0, 85.0, 0.0, 50.0, 15.0, 15.0, 95.0, -1.0], (0, 0): [80.0, 20.0, 5.0, 65.0, 10.0, 25.0, 30.0, 5.0, 20.0, 55.0, 35.0, 15.0, 30.0, 40.0, 20.0, 90.0, 50.0, 10.0, 65.0, -1.0, 20.0, 5.0, 0.0, 0.0, 85.0, 75.0, 20.0, 35.0, 75.0, 65.0, -1.0, 95.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, 10.0, 20.0, -1.0, -1.0, -1.0, 100.0, 20.0, 10.0, 90.0, 10.0, 10.0, 30.0, 40.0, 10.0, 35.0, -1.0, -1.0, 20.0, 45.0, 50.0, 0.0, 25.0, 65.0, 80.0, 35.0, 30.0, 45.0, 15.0, 25.0, 50.0, 40.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (4500, 0): [0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8100, 2700): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, 0.0, -1.0, -1.0], (4500, 3600): [0.0, 0.0, 10.0, 5.0, 20.0, 20.0, 0.0, 0.0, 5.0, 35.0, 25.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, -1.0, 10.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 20.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 15.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 50.0, 10.0, 10.0, 0.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 5.0, 15.0, 20.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1800, 1800): [10.0, 40.0, 30.0, 0.0, 35.0, 25.0, 55.0, 95.0, 50.0, 5.0, 40.0, 40.0, 10.0, 25.0, 30.0, 20.0, 35.0, 0.0, 45.0, 55.0, 25.0, 45.0, 20.0, 15.0, 20.0, 0.0, 15.0, 5.0, 40.0, 0.0, 15.0, 20.0, 30.0], (4500, 4500): [0.0], (5400, 4500): [0.0, 35.0, 0.0, 0.0, 30.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 50.0, 55.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 75.0, 15.0, 20.0, 0.0, 45.0, 0.0, 5.0], (4500, 900): [0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6300, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8100, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1800, 0): [10.0, 5.0, 65.0, 65.0, 15.0, 15.0, 55.0, 15.0, 35.0, 5.0, 60.0, 40.0, 20.0, 0.0, 20.0, 40.0, -1.0, 35.0, 0.0, 0.0, 20.0, 30.0, 5.0, -1.0, 45.0, 10.0, 25.0, 10.0, 35.0, 0.0, 10.0, 5.0, -1.0, 0.0, 5.0, 25.0, 5.0, 10.0, 10.0, 5.0, -1.0, 20.0, 65.0, 50.0, 0.0, -1.0, 0.0, 45.0, 5.0, 35.0, 25.0, 0.0, 5.0, 0.0, -1.0, -1.0, 25.0, 20.0, 25.0, 5.0, 75.0, 10.0, 50.0, 35.0, 5.0, 5.0, 20.0, 40.0, 0.0, 15.0, 5.0, 20.0, 25.0, 15.0, 5.0, 80.0, 0.0, 20.0, 15.0, 0.0], (8100, 900): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (6300, 3600): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, 10.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, 5.0, -1.0, 15.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 85.0, 0.0, 5.0, -1.0, 0.0, 20.0, -1.0, 15.0, -1.0, 0.0, 15.0, 5.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, 80.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 35.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6300, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3600, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (7200, 3600): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 55.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 35.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 15.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, 25.0, 0.0, 15.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 35.0, -1.0, 10.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, -1.0, -1.0, 0.0, 30.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0], (8100, 5400): [40.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, 25.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 10.0, 5.0, 80.0, 15.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0], (3600, 900): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 5.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0], (5400, 900): [-1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0], (3600, 2700): [0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 5.0, 70.0, 0.0, 20.0, 0.0, 5.0, 0.0, 30.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 40.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 65.0, 10.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 15.0, 10.0, 10.0, 15.0, 5.0, 5.0, 15.0, 10.0, 5.0, 35.0, 15.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 15.0, 5.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 80.0, 5.0, 5.0, 25.0, 0.0, 35.0, 0.0, 0.0, 5.0, 10.0, 0.0, 10.0, 20.0, 5.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 15.0, 15.0, 5.0, 0.0, 15.0, 25.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 20.0, 25.0, 10.0, 5.0, 5.0, 0.0, 5.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 10.0, 0.0, 20.0, 10.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0, 5.0, 15.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2700, 0): [-1.0, 25.0, 5.0, 0.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 15.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, -1.0, 25.0, 10.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 15.0, 5.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 10.0, 5.0, 5.0, 20.0, 20.0, 0.0, 0.0, 0.0, -1.0, 50.0, 0.0, 0.0, 5.0], (3600, 1800): [0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 30.0, 0.0, 25.0, 5.0, 0.0, 5.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 45.0, 5.0, 5.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 35.0, 35.0, 40.0, 10.0, 10.0, 10.0, 15.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 20.0, 10.0, 5.0, 0.0, 10.0, 20.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 10.0, 0.0, 45.0, 30.0, 15.0, 20.0, 20.0, 5.0, 15.0, 0.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 35.0, 5.0, 10.0, 5.0, 0.0, 10.0, 15.0, 5.0, 10.0, 0.0, 0.0, 25.0, 15.0, 0.0, 10.0, 0.0, 0.0, 30.0, 5.0, 0.0, 35.0, 5.0, 10.0, 0.0, 20.0, 50.0, 10.0, 15.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 5.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 5.0, 40.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 20.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 20.0, 10.0, 5.0, 0.0, 25.0, 5.0, 20.0, 15.0, 5.0, 5.0, 10.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 30.0, 0.0, 5.0, 5.0, 25.0, 5.0, 35.0, 0.0, 40.0, 0.0, 15.0, 10.0, 0.0, 10.0], (8100, 3600): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0], (2700, 900): [0.0, 5.0, 25.0, 0.0, 80.0, 10.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 25.0, 20.0, 10.0, 5.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 5.0, 10.0, 35.0, 5.0, 0.0, 5.0, 30.0, 25.0, 10.0, 25.0, 40.0, 0.0, 5.0, 0.0, 10.0, 0.0, 35.0, 20.0, 0.0, 0.0, 75.0, 5.0, 0.0, 25.0, 5.0, 10.0, 5.0, 5.0, 25.0, 5.0, 15.0, 15.0, 15.0, 0.0, 10.0, 15.0, 5.0, 10.0, 20.0, 5.0, 5.0, 10.0, 5.0, 30.0, 5.0, 15.0, 5.0, 5.0, 5.0, 15.0, 25.0, 5.0, 0.0, 5.0, 15.0, 5.0, 0.0, 10.0, -1.0, 45.0, 20.0, 0.0, 10.0, 5.0, 15.0, 5.0, 0.0, 20.0, 15.0, 15.0, 0.0, 5.0, 40.0, 0.0, 0.0, 30.0, 5.0, 5.0, 5.0, 40.0, 25.0, 10.0, 5.0, 20.0, 5.0, 25.0, 5.0, 15.0, 30.0, 15.0, 10.0, 15.0, 25.0, 15.0, 10.0, 5.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, 20.0, 0.0, 65.0, 15.0, 5.0, 5.0, 0.0, 0.0, 20.0], (8100, 1800): [0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0], (5400, 2700): [0.0, 10.0, 10.0, 0.0, 15.0, 0.0, 10.0, -1.0, -1.0, 25.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 85.0, 0.0, -1.0, 10.0, 10.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 35.0, 10.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 5.0, 40.0, -1.0, 0.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, 5.0], (8100, 4500): [0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, 20.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 55.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0], (1800, 900): [20.0, 30.0, 65.0, 20.0, 20.0, 35.0, 5.0, 40.0, 5.0, 30.0, 20.0, 25.0, 10.0, 65.0, 40.0, 10.0, 10.0, 0.0, 70.0, 5.0, 5.0, 65.0, 15.0, 20.0, 45.0, 25.0, 60.0, 30.0, 10.0, 10.0, 20.0, 5.0, -1.0, 50.0, 70.0, 5.0, 0.0, 15.0, 20.0, 5.0, 60.0, 0.0, 40.0, 10.0, 80.0, 45.0, 50.0, 0.0, 15.0, 30.0, 20.0, 45.0, 15.0, 25.0, 75.0, 5.0, 30.0, 15.0, 90.0, 25.0, 25.0, -1.0, 15.0, 20.0, 10.0, 0.0, 35.0, 65.0, 60.0, 5.0, 0.0, 0.0, 25.0, 10.0, 45.0, 15.0, 5.0, 30.0, 40.0, 40.0, 25.0, 50.0, -1.0, 30.0, 0.0, 25.0, 15.0, 20.0, 25.0, 10.0, 100.0, 5.0, 0.0, 5.0, 50.0, 55.0, 65.0, 15.0, 20.0, 45.0, 45.0, 5.0, 60.0, 30.0, 5.0, 20.0, 40.0, 30.0, 0.0, 10.0, 60.0, 5.0, 15.0, 20.0, 10.0, 0.0, 0.0, 45.0, 50.0, 60.0, 55.0, 80.0, 75.0, 95.0, 50.0, 5.0, 20.0, 30.0, 10.0, 15.0, 25.0, 20.0, 15.0, 5.0, 0.0, 70.0, 60.0, 90.0, 25.0, 5.0, -1.0, 35.0, 70.0, 5.0, 25.0, 5.0, 30.0, 10.0, 100.0, 0.0, 10.0, 25.0, 5.0, 35.0, 10.0, 55.0, 0.0, 65.0, 30.0, 20.0, 40.0, 15.0, 20.0, 10.0, 5.0, 15.0, 30.0, 15.0, 55.0, 15.0, 0.0, 45.0, 25.0, 0.0, 15.0, 40.0, 10.0, 50.0, 55.0, 25.0, 60.0, 15.0, 65.0, 0.0, 15.0, 30.0, 65.0, 15.0, 35.0, 5.0, 0.0, 0.0, 70.0, 5.0, 40.0, 25.0, 5.0, 0.0, 75.0, 5.0, 5.0, 80.0, 10.0, 15.0, 0.0, 30.0, 45.0, 30.0, 65.0, 40.0, -1.0, 80.0, 15.0, 70.0, 85.0, 5.0, 5.0, 25.0, 20.0, 25.0, 30.0, 5.0, 65.0, 25.0, 20.0, 55.0, 20.0, 5.0, 35.0, 10.0, 5.0, 50.0, 0.0, 5.0, 15.0, 25.0, 0.0, 0.0, 35.0, 95.0, 35.0, 70.0, 20.0, 90.0, 65.0, 10.0, 95.0, 0.0, 20.0, 25.0, 15.0, 5.0, 5.0, 25.0, 5.0, 15.0, 10.0, 70.0, 85.0]}
mpc_dash_syth_hyb_pen_table_1000 = {(8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 6000): [-1.0], (5000, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (3000, 1000): [0.0, 20.0, 0.0, 0.0, 5.0, 25.0, 0.0, 25.0, 0.0, 0.0, 15.0, 5.0, 10.0, 10.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 5.0, 15.0, 0.0, 15.0, 5.0, 0.0, 20.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 30.0, 20.0, 10.0, 35.0, 25.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 35.0, 40.0, 0.0, 10.0, 10.0, 20.0, 80.0, 5.0, 5.0, 30.0, 5.0, 5.0, 15.0, 10.0, 0.0, 5.0, 5.0, 15.0, 10.0, 5.0, 30.0, 5.0, 10.0, 5.0, 5.0, 5.0, 10.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 10.0, 0.0, 20.0, 20.0, 0.0, 20.0, 5.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 15.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 25.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 5.0, 5.0, 15.0, 20.0, 15.0, 20.0, 5.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 10.0, 15.0, 40.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 5.0, 5.0, 15.0, 25.0, 5.0, 5.0, 0.0, 0.0, 35.0], (7000, 2000): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0], (2000, 0): [10.0, 5.0, -1.0, 15.0, 25.0, 15.0, 55.0, 15.0, 5.0, 5.0, 60.0, 20.0, 0.0, 60.0, 20.0, 30.0, 20.0, 5.0, 35.0, 0.0, 0.0, 30.0, 20.0, 20.0, 5.0, -1.0, 25.0, 10.0, 25.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 25.0, 5.0, 25.0, 0.0, 5.0, 10.0, 10.0, 5.0, 20.0, 20.0, 65.0, 0.0, 0.0, -1.0, 0.0, 45.0, 10.0, 0.0, 60.0, 5.0, 0.0, 10.0, 70.0, 0.0, 0.0, -1.0, -1.0, 25.0, 25.0, 20.0, 25.0, 10.0, 0.0, 15.0, 5.0, 75.0, 10.0, 35.0, 30.0, 5.0, 0.0, 5.0, 20.0, -1.0, 40.0, -1.0, 0.0, 15.0, 5.0, 20.0, 25.0, 25.0, 5.0, 20.0, 15.0, 20.0, 15.0, 0.0, 5.0, 0.0, 80.0, 0.0, 50.0, 0.0, 0.0, 5.0, 15.0, 0.0], (7000, 5000): [0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 55.0, 0.0, -1.0, -1.0, 5.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, -1.0, 55.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 10.0], (8000, 5000): [-1.0, 10.0, 0.0, 40.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 10.0, -1.0, 0.0, 5.0, 20.0, 5.0, -1.0, 5.0, -1.0, 10.0, -1.0, 5.0, 80.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0], (4000, 3000): [0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 70.0, 0.0, 10.0, 25.0, 35.0, 20.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 25.0, 20.0, 5.0, 0.0, -1.0, 0.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 15.0, 25.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 15.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, 40.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 90.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 50.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 0.0, 5.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 30.0, 0.0, 5.0, 10.0, 30.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 30.0, 70.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 50.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 5.0, 10.0, 0.0, 5.0, 10.0, 5.0, 5.0, 25.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0], (8000, 4000): [0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0], (4000, 1000): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0], (8000, 2000): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 95.0, -1.0], (6000, 1000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 2000): [0.0, 0.0, -1.0, -1.0, 25.0, 20.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (0, 0): [80.0, 45.0, 20.0, 5.0, 65.0, 10.0, 25.0, 30.0, 5.0, 20.0, 50.0, 25.0, 55.0, 10.0, 35.0, 15.0, 30.0, 40.0, 20.0, 90.0, 50.0, 45.0, 75.0, 10.0, 65.0, -1.0, 20.0, 5.0, 40.0, 0.0, 0.0, 85.0, 75.0, 20.0, 35.0, 75.0, 65.0, -1.0, 65.0, 95.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, 10.0, 20.0, -1.0, -1.0, -1.0, 100.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 10.0, 35.0, -1.0, -1.0, 20.0, 45.0, 50.0, 0.0, 25.0, 15.0, 65.0, 80.0, 35.0, 50.0, 30.0, 45.0, 15.0, 25.0, 5.0, 50.0, 50.0, 40.0, 80.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2000, 2000): [0.0, 5.0, 0.0, 25.0, 25.0, 10.0, 20.0, 35.0, 25.0, 45.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 10.0, 35.0, 30.0, 45.0, 0.0, 20.0, 0.0, 35.0, 100.0, 20.0, 0.0, 5.0, 10.0, 25.0, 20.0, 5.0, 70.0, 50.0, 30.0, 15.0, 20.0, 10.0, 15.0, 15.0, 25.0, 25.0, 45.0, 60.0, 20.0, 25.0, 0.0, 40.0, 0.0, 25.0], (5000, 3000): [20.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 15.0, 20.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, -1.0, 0.0, 30.0, 15.0, 0.0, 35.0, -1.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, 35.0, 0.0, 0.0, 15.0, 5.0, 30.0, 10.0, 20.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 60.0, 5.0, 15.0, -1.0, -1.0, 10.0, 10.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, -1.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 40.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 85.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, 15.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 5.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 20.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 55.0, 35.0, 0.0, 5.0, 0.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 20.0, 0.0, 60.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 30.0, 30.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 50.0, 20.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 45.0, 15.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, -1.0, 0.0, 35.0, -1.0, 25.0, 0.0, 5.0, 20.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 25.0], (4000, 2000): [0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 5.0, 5.0, 25.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 15.0, 30.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 15.0, 0.0, 15.0, 20.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 20.0, 10.0, 15.0, 0.0, 5.0, 25.0, 20.0, 10.0, 15.0, 5.0, 55.0, 25.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 20.0, 10.0, 30.0, 15.0, 20.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 5.0, 0.0, 15.0, 0.0, 0.0, 45.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 5.0, 25.0, 0.0, 15.0, 5.0, 10.0, 0.0, 0.0, 0.0, 25.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 5.0, 10.0, 0.0, 0.0, 0.0, 15.0, 25.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 65.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 20.0, 5.0, 10.0, 20.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 30.0, 5.0, 0.0, 0.0, 5.0, 20.0, 5.0, 20.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0], (3000, 3000): [0.0, 10.0, 35.0, 5.0, 25.0, 20.0], (3000, 0): [0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 20.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0], (8000, 1000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (3000, 2000): [10.0, 0.0, 45.0, 10.0, 15.0, 35.0, 5.0, 0.0, 20.0, 5.0, 15.0, 0.0, 5.0, 5.0, 5.0, 10.0, 25.0, 0.0, 10.0, 5.0, 25.0, 0.0, 5.0, 30.0, 5.0, 5.0, 0.0, 10.0, 5.0, 20.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 15.0, 0.0, 0.0, 5.0, 25.0, 35.0, 20.0, 50.0, 10.0, 10.0, 10.0, 0.0, 10.0, 10.0, 0.0, 20.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 45.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 10.0, 5.0, 5.0, 0.0, 15.0, 55.0, 10.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 15.0, 70.0, 5.0, 0.0, 15.0, 0.0, 30.0, 10.0, 65.0, 5.0, 0.0, 0.0, 35.0, 0.0, 30.0, 10.0, 35.0, 35.0, 10.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 5.0, 0.0, 0.0, 45.0, 40.0, 20.0, 30.0, 15.0, 35.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 20.0, 20.0, 0.0, 5.0, 15.0, 15.0, 10.0, 40.0, 0.0, 20.0, 5.0, 45.0, 30.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, 10.0, 10.0, 0.0, 15.0, 15.0, 15.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 45.0, 25.0, 5.0, 35.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 0.0, 30.0, 10.0, 0.0, 0.0, 40.0, 25.0, 10.0, 35.0, 25.0, 45.0, 0.0, 0.0, 80.0, 0.0, 0.0, 30.0, 25.0, 10.0, 0.0, 10.0, 0.0, 10.0, 30.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 5.0, 5.0, 0.0, 5.0, 65.0, 10.0, 45.0, 0.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 5.0, 5.0, 0.0, 10.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 10.0, 10.0, 5.0, 10.0, 40.0, 15.0, 10.0, 25.0, 15.0, 80.0, 25.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, 30.0, 0.0, 10.0, 15.0, 5.0, 0.0, 15.0, 0.0, 30.0, 0.0, 5.0, 5.0, 0.0, 10.0, 15.0, 40.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 5.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 35.0, 10.0, 25.0, 15.0, 5.0, 10.0, 15.0, 35.0, 0.0, 5.0, 50.0, 5.0, 25.0, 0.0, 10.0, 20.0, 10.0, 25.0, 25.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 30.0, 15.0, 0.0, 20.0, 5.0, 25.0, 5.0, 75.0, 0.0, 5.0, 5.0, 10.0, 5.0, 40.0, 30.0, 0.0, 10.0, 0.0, 15.0], (8000, 3000): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (2000, 1000): [5.0, 20.0, 5.0, 30.0, 65.0, 80.0, 20.0, 20.0, 10.0, 35.0, 25.0, 5.0, 40.0, 25.0, 30.0, 25.0, 0.0, 10.0, 10.0, 65.0, 40.0, 40.0, 10.0, 10.0, 0.0, 5.0, 70.0, 30.0, 65.0, 15.0, 20.0, 0.0, 25.0, 0.0, 45.0, 25.0, 35.0, 25.0, 10.0, 10.0, 55.0, 5.0, -1.0, 95.0, 50.0, 50.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 35.0, 20.0, 5.0, 40.0, 0.0, 20.0, 0.0, 0.0, 10.0, 80.0, 45.0, 20.0, 0.0, 15.0, 30.0, 45.0, 15.0, 25.0, 30.0, 75.0, 5.0, 40.0, 15.0, 90.0, 25.0, 25.0, 40.0, 40.0, -1.0, 15.0, 20.0, 5.0, 35.0, 65.0, 0.0, 60.0, 0.0, 95.0, 0.0, 25.0, 30.0, 10.0, 45.0, 25.0, 30.0, 15.0, 5.0, 40.0, 40.0, 35.0, 25.0, 20.0, 0.0, -1.0, 30.0, 75.0, 0.0, 0.0, 5.0, 15.0, 20.0, 55.0, 25.0, 10.0, 100.0, 30.0, 35.0, 0.0, 5.0, 50.0, 55.0, 20.0, 10.0, 5.0, 45.0, 45.0, 25.0, 5.0, 5.0, 60.0, 15.0, 30.0, 5.0, 15.0, 35.0, 40.0, 5.0, 30.0, 15.0, 0.0, 5.0, 5.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 45.0, 10.0, 45.0, 55.0, 80.0, 75.0, 55.0, 95.0, 50.0, 5.0, 20.0, 30.0, 10.0, 15.0, 25.0, 20.0, 15.0, 25.0, 25.0, 5.0, 0.0, 0.0, 70.0, 60.0, 25.0, 5.0, -1.0, 15.0, 35.0, 5.0, 25.0, 10.0, 5.0, 30.0, 100.0, 25.0, 5.0, 20.0, 0.0, 35.0, 10.0, 10.0, 55.0, 0.0, 30.0, 20.0, 40.0, 15.0, 45.0, 20.0, 10.0, 5.0, 15.0, 45.0, 5.0, 20.0, 85.0, 15.0, 30.0, 15.0, 55.0, 15.0, 45.0, 25.0, 0.0, 15.0, 15.0, 40.0, 5.0, 50.0, 5.0, 55.0, 15.0, 25.0, 20.0, 60.0, 30.0, 5.0, 5.0, 15.0, 40.0, 10.0, 65.0, 0.0, 20.0, 15.0, 30.0, 65.0, 15.0, 25.0, 5.0, 0.0, 20.0, 0.0, 70.0, 15.0, 5.0, 0.0, 40.0, 15.0, 5.0, 5.0, 80.0, 5.0, 15.0, 15.0, 30.0, 15.0, 30.0, 5.0, 25.0, 10.0, 40.0, -1.0, 40.0, 80.0, 10.0, 15.0, 70.0, 85.0, 5.0, 5.0, 25.0, 30.0, 5.0, 40.0, 65.0, 20.0, 55.0, 20.0, 5.0, 5.0, 20.0, 0.0, 0.0, 25.0, 15.0, 0.0, 35.0, 15.0, 95.0, 35.0, 70.0, 20.0, 15.0, 20.0, 0.0, 10.0, 65.0, 65.0, 65.0, 20.0, 25.0, 5.0, 25.0, 5.0, 5.0, 25.0, 5.0, 30.0, 20.0, 15.0, 70.0, 20.0, 0.0], (7000, 1000): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4000): [0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 15.0, 10.0, 5.0, -1.0, 15.0, 0.0, -1.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, 5.0, 55.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 40.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 40.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 45.0, -1.0, 5.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 10.0, 45.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 50.0, -1.0, 60.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 5.0, 0.0, 75.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 80.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 5.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 35.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0], (4000, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0], (6000, 3000): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, 35.0, -1.0, 10.0, 10.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 25.0, 80.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 65.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, 15.0, 40.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, 80.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 45.0, 60.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 15.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0], (7000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 4000): [0.0, 10.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 15.0, -1.0, 15.0, 0.0, 65.0, 0.0, 30.0, 10.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, -1.0, 0.0, 15.0, 10.0, 5.0, -1.0, 0.0, 0.0, 25.0, -1.0, -1.0, 35.0, 35.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 55.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, 5.0, 15.0, -1.0, 0.0, 0.0, 85.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 20.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 40.0, 0.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, 10.0, 15.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, -1.0, 35.0, -1.0, -1.0, 0.0, 0.0, 0.0, 55.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, 5.0, 0.0, 25.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 35.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6000, 5000): [0.0, 0.0, 10.0, 0.0, -1.0, 10.0], (5000, 1000): [0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0], (1000, 0): [20.0, 15.0, 60.0, 35.0, 65.0, 40.0, 0.0, 65.0, 10.0, 5.0, 5.0, 35.0, 35.0, 25.0, 0.0, 25.0, 100.0, 35.0, 40.0, 10.0, 50.0, 0.0, 0.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 90.0, 15.0, 10.0, 40.0, 5.0, -1.0, 60.0, 20.0, 75.0, -1.0, 50.0, 20.0, 25.0, 35.0, 50.0, 5.0, 5.0, 30.0, 45.0, 0.0, 50.0, 35.0, 40.0, -1.0, 55.0, 85.0, -1.0, 65.0, 10.0, 45.0, 20.0, 0.0, 5.0, 70.0, 5.0, 40.0, 15.0, -1.0, -1.0, 50.0, 0.0, 5.0, 20.0, 45.0, 15.0, 30.0, 100.0, -1.0, 0.0, 85.0, 85.0, 20.0, 15.0, 5.0, 0.0, 35.0, 25.0, 15.0, 20.0, 30.0, 80.0, 0.0, 5.0, 5.0, 45.0, 0.0, 20.0, 65.0, 35.0, 10.0, 70.0, 80.0, 70.0, 25.0, 25.0, 25.0, 5.0, 5.0, 15.0, -1.0, 70.0, 0.0, 15.0, 20.0, 75.0, 10.0, 0.0, 15.0, 10.0, 95.0, 25.0, 80.0, 5.0, 50.0, 90.0, 95.0, 25.0, 5.0, -1.0, 40.0, 10.0, 50.0, 40.0, 10.0, 5.0, 10.0, 45.0, 5.0, 10.0, 45.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 10.0, 10.0, 15.0, 35.0, 30.0, -1.0, 5.0, 15.0, 10.0, 90.0, 65.0, 5.0, 15.0, 90.0, 15.0, 10.0, 15.0, 10.0, 50.0, 20.0, 10.0, 95.0, 20.0, -1.0], (4000, 4000): [0.0], (5000, 4000): [0.0, 0.0, -1.0, 15.0, 10.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 50.0, 0.0, 10.0, 0.0, 65.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 20.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 45.0, 5.0, 0.0, 5.0, 0.0, 0.0, 90.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0], (1000, 1000): [20.0, 95.0, 35.0, 5.0, 20.0, 25.0, 35.0, 70.0, 55.0, 5.0, 30.0, 50.0, 10.0, 5.0, 70.0, 0.0, 15.0, 60.0, 25.0, 5.0, 40.0, 0.0, 50.0, 90.0, 15.0, 5.0, 85.0, 40.0, 70.0, 40.0, 5.0, 30.0, 30.0, 10.0, 5.0, 0.0, 0.0, 55.0, 30.0, 5.0, 15.0, 50.0, 25.0, 5.0, 55.0, 65.0, 15.0, 10.0, 70.0, 75.0, 60.0, 85.0, 20.0, 50.0, 15.0, 25.0, 90.0, 40.0, 25.0, 35.0, -1.0, 10.0, -1.0, 65.0, 20.0, 65.0, 0.0, 65.0, 10.0, 55.0, 0.0, 15.0, 20.0, 35.0, 25.0, 75.0, 10.0, 5.0, 10.0, 0.0, 45.0, 65.0, 15.0, 20.0, 25.0, 15.0, 30.0, 35.0, 10.0, 85.0, 5.0, 0.0, 50.0, 5.0, 0.0, 50.0, 95.0, 15.0, 15.0, 85.0], (7000, 3000): [-1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, 50.0, -1.0, -1.0, -1.0, 10.0, 40.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 30.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 10.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0], (5000, 2000): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 55.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 30.0, 0.0, 60.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, 20.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 70.0, 0.0, 5.0, 0.0, 20.0, 0.0, 15.0, 15.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 20.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0]}
mpc_dash_syth_hyb_pen_table_1100 = {(3300, 3300): [5.0, 70.0, 20.0, 5.0, 45.0, 0.0, 0.0, 15.0, 0.0, 0.0], (1100, 1100): [20.0, 65.0, 20.0, 5.0, 20.0, 10.0, 35.0, 10.0, 5.0, 30.0, 25.0, 50.0, 5.0, 70.0, 15.0, 60.0, 5.0, 40.0, 45.0, 0.0, 50.0, 90.0, 15.0, 25.0, 85.0, 70.0, 40.0, 90.0, -1.0, 10.0, 35.0, 5.0, 0.0, 15.0, 55.0, 30.0, 5.0, 40.0, 40.0, 25.0, 50.0, 10.0, 25.0, 5.0, 55.0, 65.0, 15.0, 30.0, 30.0, 0.0, 10.0, 70.0, 60.0, 15.0, 85.0, 20.0, 45.0, 50.0, 75.0, 15.0, 25.0, 20.0, 5.0, 70.0, 90.0, 40.0, 35.0, 25.0, 5.0, -1.0, 10.0, 65.0, 15.0, 30.0, 65.0, 0.0, 15.0, 10.0, 55.0, 55.0, 0.0, 15.0, 65.0, 20.0, 35.0, 5.0, 0.0, 40.0, 25.0, 75.0, 10.0, 5.0, 80.0, 10.0, 0.0, 30.0, 45.0, 65.0, 70.0, 85.0, 25.0, 25.0, 65.0, 55.0, 15.0, 30.0, 5.0, 35.0, 10.0, 5.0, 50.0, 5.0, 0.0, 35.0, 95.0, 35.0, 20.0, 95.0, 15.0, 5.0, 70.0, 85.0], (8800, 4400): [0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 25.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6600, 3300): [-1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 10.0, 0.0, 10.0, 0.0, -1.0, 35.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 50.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 40.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 55.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 85.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, 20.0, 0.0, -1.0, 10.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, -1.0, -1.0, -1.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 35.0, -1.0, -1.0, 10.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 45.0, 0.0, 10.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0], (3300, 2200): [0.0, 0.0, 15.0, 0.0, 5.0, 35.0, 20.0, 5.0, 5.0, 0.0, 5.0, 5.0, 20.0, 30.0, 0.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 0.0, 5.0, 10.0, 35.0, 20.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 5.0, 25.0, 15.0, 10.0, 0.0, 20.0, 5.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 15.0, 65.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 30.0, 10.0, 15.0, 15.0, 5.0, 5.0, 35.0, 35.0, 15.0, 10.0, 5.0, 35.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 40.0, 5.0, 5.0, 20.0, 35.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 5.0, 15.0, 5.0, 0.0, 20.0, 0.0, 10.0, 5.0, 20.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 20.0, 5.0, 35.0, 10.0, 45.0, 15.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 45.0, 0.0, 25.0, 0.0, 35.0, 20.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, 30.0, 0.0, 25.0, 10.0, 0.0, 25.0, 45.0, 20.0, 0.0, 15.0, 0.0, 80.0, 0.0, 0.0, 5.0, 25.0, 5.0, 10.0, 25.0, 0.0, 0.0, 0.0, 30.0, 5.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 35.0, 5.0, 10.0, 5.0, 10.0, 45.0, 0.0, 20.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 0.0, 0.0, 5.0, 25.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 30.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 20.0, 10.0, 0.0, 25.0, 5.0, 10.0, 10.0, 40.0, 40.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 30.0, 0.0, 80.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 0.0, 15.0, 25.0, 5.0, 0.0, 0.0, 0.0, 30.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 40.0, 0.0, 0.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 5.0, 20.0, 20.0, 10.0, 5.0, 0.0, 35.0, 25.0, 10.0, 15.0, 10.0, 20.0, 5.0, 0.0, 10.0, 35.0, 15.0, 5.0, 5.0, 0.0, 50.0, 5.0, 0.0, 25.0, 0.0, 10.0, 20.0, 5.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 30.0, 0.0, 30.0, 5.0, 0.0, 15.0, 5.0, 5.0, 25.0, 5.0, 20.0, 0.0, 5.0, 35.0, 0.0, 0.0, 5.0, 0.0, 15.0, 10.0, 10.0, 15.0], (6600, 4400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 15.0, 0.0, 65.0, 10.0, 30.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 15.0, 15.0, -1.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, 0.0, 55.0, -1.0, 0.0, 10.0, -1.0, 5.0, -1.0, 5.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 40.0, -1.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, 0.0, 15.0, 0.0, -1.0, 45.0, -1.0, 0.0, 10.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 5.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, 45.0, 55.0, -1.0, 20.0, 0.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 35.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0], (7700, 4400): [0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 5.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, 20.0, 5.0, -1.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 55.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 10.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (6600, 5500): [-1.0, 5.0, 0.0], (7700, 3300): [-1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0], (1100, 0): [20.0, 15.0, 60.0, 95.0, 35.0, 35.0, 10.0, 65.0, 0.0, 65.0, 10.0, 55.0, 15.0, 5.0, 25.0, 5.0, 70.0, 0.0, 55.0, 35.0, 35.0, 25.0, 25.0, 100.0, 35.0, 40.0, 10.0, 20.0, 0.0, 60.0, 0.0, 20.0, 30.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 15.0, 10.0, 40.0, 5.0, -1.0, 0.0, 60.0, 20.0, 75.0, -1.0, 25.0, 20.0, 30.0, 20.0, 5.0, 25.0, 35.0, 50.0, 5.0, 40.0, 5.0, 5.0, 30.0, 30.0, 30.0, 25.0, 45.0, 10.0, 0.0, 35.0, 40.0, -1.0, 10.0, 0.0, 5.0, 55.0, 85.0, -1.0, 15.0, 0.0, 25.0, 20.0, 65.0, 100.0, 25.0, 10.0, 45.0, 20.0, 0.0, 55.0, 5.0, 70.0, 5.0, 5.0, 40.0, 15.0, -1.0, -1.0, 20.0, 65.0, 50.0, 0.0, 5.0, 20.0, 45.0, 15.0, 30.0, 75.0, -1.0, 100.0, -1.0, 0.0, 85.0, 60.0, 20.0, 15.0, 5.0, 0.0, 35.0, 25.0, 15.0, 20.0, 30.0, 25.0, 80.0, 0.0, 5.0, 45.0, 70.0, 0.0, 20.0, 65.0, 35.0, 35.0, 10.0, 70.0, 80.0, 70.0, 25.0, 25.0, -1.0, 5.0, 5.0, 20.0, 15.0, -1.0, 70.0, 0.0, 15.0, 20.0, 75.0, 65.0, 10.0, 0.0, 15.0, 10.0, 95.0, 25.0, 80.0, 75.0, 5.0, 50.0, 95.0, 25.0, 5.0, -1.0, 20.0, 40.0, 10.0, 50.0, 40.0, 10.0, 5.0, 10.0, 45.0, 5.0, 10.0, 80.0, 20.0, 45.0, 15.0, 15.0, 5.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 20.0, 10.0, 10.0, 15.0, 35.0, 30.0, -1.0, 85.0, 0.0, 15.0, 15.0, 10.0, 90.0, 50.0, 65.0, 5.0, 5.0, 80.0, 15.0, 90.0, 15.0, 10.0, 15.0, 10.0, 50.0, 20.0, 15.0, 10.0, 95.0, 20.0, -1.0], (4400, 4400): [0.0], (4400, 3300): [0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 10.0, 25.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 20.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 35.0, 0.0, 0.0, 25.0, 0.0, -1.0, 5.0, 35.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 30.0, 5.0, 10.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 15.0, -1.0, 20.0, 0.0, 0.0, 0.0, 15.0, 0.0, 60.0, 10.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 90.0, 5.0, 0.0, 20.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 5.0, 5.0, -1.0, 45.0, 0.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 20.0, 65.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 5.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 0.0, 5.0, 10.0, 0.0, 5.0, 50.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 20.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 15.0, 0.0, 20.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 10.0, 30.0, 10.0, 70.0, 0.0, -1.0, 0.0, 35.0, 5.0, 20.0, 0.0, 20.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 50.0, 20.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 35.0, 0.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0], (0, 0): [80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 25.0, 0.0, 30.0, 5.0, 20.0, 50.0, 50.0, 25.0, 55.0, 10.0, 35.0, 90.0, 15.0, 30.0, 40.0, 20.0, 50.0, 90.0, 50.0, 45.0, 75.0, 10.0, 65.0, -1.0, 20.0, 5.0, 50.0, 40.0, 0.0, 0.0, 85.0, 75.0, 20.0, 35.0, 75.0, 65.0, -1.0, 65.0, 95.0, 85.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, 10.0, 20.0, 5.0, -1.0, 25.0, -1.0, -1.0, 100.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 10.0, 35.0, -1.0, -1.0, 20.0, 45.0, 50.0, 0.0, 90.0, 25.0, 15.0, 65.0, 80.0, 35.0, 50.0, 30.0, 45.0, 15.0, 25.0, 5.0, 50.0, 50.0, 5.0, 40.0, 80.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (7700, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2200, 0): [5.0, -1.0, 15.0, 25.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 5.0, 60.0, 0.0, 10.0, 0.0, 20.0, 5.0, -1.0, 15.0, 35.0, 0.0, 0.0, 5.0, 30.0, 20.0, 5.0, -1.0, 25.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 45.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, -1.0, -1.0, 25.0, 25.0, 20.0, 5.0, 10.0, 25.0, 10.0, 0.0, 30.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 10.0, 10.0, 5.0, 35.0, 10.0, 30.0, 5.0, 0.0, 5.0, -1.0, 40.0, 0.0, 0.0, -1.0, 10.0, 0.0, 15.0, 5.0, 25.0, 10.0, 25.0, 5.0, 20.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 50.0, 0.0, 25.0, 0.0, 0.0, 5.0, 15.0, 0.0], (3300, 1100): [0.0, 45.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 25.0, 0.0, 10.0, 25.0, 25.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 45.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 25.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 5.0, 20.0, 0.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 15.0, 10.0, 10.0, 10.0, 5.0, 80.0, 5.0, 10.0, 5.0, 10.0, 0.0, 35.0, 10.0, 0.0, 5.0, 5.0, 10.0, 10.0, 5.0, 30.0, 10.0, 5.0, 0.0, 10.0, 5.0, 0.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, 5.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 10.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 20.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 5.0, 10.0, 20.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 5.0, 5.0, 0.0, 20.0, 0.0, 20.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 5.0, 10.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 40.0, 30.0, 0.0, 0.0], (2200, 1100): [10.0, 0.0, 20.0, 5.0, 20.0, 5.0, 30.0, 0.0, 15.0, 80.0, 5.0, 20.0, 10.0, 35.0, 25.0, 5.0, 40.0, 0.0, 25.0, 0.0, 30.0, 25.0, 25.0, 0.0, 10.0, 65.0, 30.0, 40.0, 5.0, 5.0, 5.0, 40.0, 10.0, 25.0, 10.0, 5.0, 70.0, 30.0, 20.0, 10.0, 35.0, 65.0, 15.0, 15.0, 25.0, 20.0, 0.0, 25.0, 25.0, 0.0, 45.0, 50.0, 5.0, 0.0, 35.0, 0.0, 25.0, 5.0, 10.0, 10.0, 0.0, 5.0, 5.0, 5.0, 55.0, 15.0, 5.0, -1.0, 15.0, 0.0, 20.0, 95.0, 50.0, 50.0, 5.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 35.0, 20.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 0.0, 5.0, 0.0, 25.0, 10.0, 80.0, 20.0, 0.0, 15.0, 30.0, 45.0, 15.0, 30.0, 75.0, 10.0, 35.0, 10.0, 5.0, 40.0, 10.0, 0.0, 15.0, 0.0, 25.0, 25.0, 40.0, 40.0, 0.0, 15.0, 5.0, 20.0, 45.0, 10.0, 5.0, 15.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 0.0, 30.0, 45.0, 25.0, 30.0, 5.0, 30.0, 35.0, 0.0, 20.0, 0.0, -1.0, 30.0, 75.0, 0.0, 0.0, 5.0, 0.0, 15.0, 25.0, 45.0, 0.0, 55.0, 25.0, 20.0, 30.0, 35.0, 0.0, 5.0, 50.0, 5.0, 20.0, 10.0, 0.0, 0.0, 5.0, 45.0, 45.0, 35.0, 25.0, 5.0, 5.0, 60.0, 15.0, 5.0, 15.0, 40.0, 35.0, 100.0, 40.0, 5.0, 15.0, 20.0, 20.0, 5.0, 5.0, 25.0, 20.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 45.0, 5.0, 10.0, 55.0, 40.0, 80.0, 20.0, 5.0, 55.0, 15.0, 95.0, 50.0, 5.0, 20.0, 15.0, 30.0, 10.0, 15.0, 10.0, 25.0, 20.0, 5.0, 15.0, 5.0, 25.0, 25.0, 0.0, 0.0, 0.0, 60.0, 25.0, 5.0, -1.0, 5.0, 15.0, 5.0, 10.0, 100.0, 5.0, 25.0, 5.0, 0.0, 20.0, 0.0, 35.0, 10.0, -1.0, 10.0, 55.0, 0.0, 5.0, 70.0, 0.0, 30.0, 20.0, 40.0, 10.0, 50.0, 45.0, 20.0, 10.0, 5.0, 15.0, 45.0, 5.0, 30.0, 0.0, 10.0, 5.0, 20.0, 85.0, 15.0, 15.0, 55.0, 15.0, 45.0, 25.0, 15.0, 0.0, 25.0, 20.0, 15.0, 40.0, 0.0, 15.0, 15.0, 5.0, 15.0, 50.0, 5.0, 15.0, 0.0, 25.0, 20.0, 5.0, 0.0, 60.0, 5.0, 5.0, 15.0, 0.0, 5.0, 20.0, 15.0, 30.0, 5.0, 65.0, 15.0, 25.0, 5.0, 20.0, 0.0, 15.0, 70.0, 15.0, 15.0, 5.0, 0.0, 15.0, 5.0, 5.0, 5.0, 10.0, 15.0, 15.0, 45.0, 15.0, 30.0, 60.0, 10.0, 5.0, 25.0, 10.0, 40.0, -1.0, 15.0, 40.0, 20.0, 10.0, 15.0, 15.0, 5.0, 5.0, 30.0, 5.0, 40.0, 20.0, 20.0, 15.0, 0.0, 40.0, 5.0, 20.0, 0.0, 0.0, 0.0, 25.0, 15.0, 40.0, 0.0, 25.0, 15.0, 15.0, 5.0, 70.0, 15.0, 5.0, 20.0, 10.0, 65.0, 65.0, 65.0, 20.0, 25.0, 15.0, 25.0, 5.0, 25.0, 5.0, 5.0, 0.0, 5.0, 25.0, 30.0, 20.0, 15.0, 35.0, 20.0, 0.0, 0.0], (8800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5500, 1100): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0], (4400, 1100): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, -1.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 30.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5500, 3300): [0.0, 20.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 10.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 10.0, 0.0, 40.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 35.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 15.0, 80.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 40.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 35.0, 10.0, 10.0, 10.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 85.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 5.0, 20.0, -1.0, 0.0, 15.0, -1.0, -1.0, 15.0, 0.0, 0.0, 65.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 10.0, 20.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 45.0, 40.0, 10.0, 40.0, 5.0, 0.0, -1.0, 0.0, 0.0, 30.0, -1.0, 40.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 5.0, -1.0, 10.0, 20.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 45.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 50.0, 0.0, 0.0, 0.0, 60.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 65.0, 10.0, 0.0, -1.0, 5.0, 10.0, 10.0, -1.0, -1.0, 10.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, 45.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, 50.0, 0.0, 0.0, 20.0, 5.0, 0.0, -1.0, 45.0, 0.0, 60.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 90.0, -1.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 15.0, 5.0, 0.0, 50.0, 0.0, -1.0, 55.0, 0.0, 15.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 35.0, 5.0, 5.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 5.0, 0.0, 25.0], (8800, 2200): [-1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5500, 4400): [0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 30.0, 5.0, 0.0, 15.0, 0.0, 15.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 50.0, 55.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 10.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 45.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0], (4400, 0): [0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7700, 1100): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0], (5500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6600, 2200): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, 30.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0], (8800, 5500): [40.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 15.0, 0.0, -1.0], (7700, 5500): [0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 80.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 15.0, 0.0, -1.0], (4400, 2200): [0.0, 0.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 15.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 20.0, 5.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 65.0, 0.0, 0.0, 10.0, 5.0, 0.0, 40.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, -1.0, 0.0, 15.0, 10.0, -1.0, 5.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, 60.0, 15.0, 40.0, 30.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 30.0, -1.0, 20.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 60.0, 0.0, 10.0, 15.0, 0.0, 5.0, 0.0, 10.0, 5.0, -1.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 65.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 45.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 30.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 5.0, 5.0, 0.0, -1.0, 25.0, 5.0, 0.0, 20.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0], (7700, 2200): [-1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 95.0, -1.0, -1.0, -1.0, -1.0], (6600, 1100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8800, 1100): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (2200, 2200): [0.0, 5.0, 10.0, 10.0, 0.0, 10.0, 45.0, 5.0, 55.0, 15.0, 70.0, 10.0, 0.0, 30.0, 20.0, 30.0, 20.0, 30.0, 15.0, 10.0, 0.0, 25.0, 0.0, 30.0, 0.0, 5.0, 65.0, 10.0, 25.0, 15.0, 5.0, 10.0, 20.0, 25.0, 15.0, 10.0, 25.0, 25.0, 35.0, 10.0, 20.0, 5.0, 0.0, 25.0, 5.0, 15.0, 25.0, 75.0, 5.0], (8800, 3300): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (5500, 2200): [0.0, 10.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 10.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 35.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 30.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0], (3300, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, -1.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 30.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0]}
mpc_dash_syth_hyb_pen_table_1200 = {(6000, 1200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0], (4800, 4800): [0.0, 20.0], (8400, 1200): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (4800, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (7200, 1200): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6000, 4800): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0], (2400, 2400): [35.0, 5.0, 0.0, 20.0, 5.0, 15.0, 35.0, 20.0, 20.0, 0.0, 5.0, 15.0, 15.0, 5.0, 30.0, 0.0, 40.0, 20.0, 35.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 10.0, 45.0, 0.0, 30.0, 25.0, 30.0, 5.0, 5.0, 30.0, 10.0, 15.0, 10.0, 20.0, 0.0, 10.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 15.0, 10.0, 35.0, 75.0], (3600, 2400): [0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 10.0, 5.0, 0.0, 70.0, 0.0, 0.0, 5.0, 35.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 25.0, 10.0, 20.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 10.0, 5.0, 35.0, 25.0, 5.0, 15.0, 10.0, 0.0, 5.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 0.0, 30.0, 65.0, 10.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 30.0, 10.0, 0.0, 15.0, 0.0, 20.0, 10.0, 15.0, 0.0, 10.0, 10.0, 10.0, 0.0, 15.0, 15.0, 5.0, 5.0, 10.0, 35.0, 0.0, 15.0, 10.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 10.0, 10.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 5.0, 10.0, 5.0, 5.0, 15.0, 40.0, 0.0, 10.0, 20.0, 10.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 5.0, 25.0, 20.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 40.0, 0.0, 20.0, 5.0, 0.0, 35.0, 50.0, 45.0, 30.0, 15.0, 20.0, 0.0, 5.0, 10.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 5.0, 25.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 80.0, 5.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 10.0, 0.0, 40.0, 5.0, 35.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 50.0, 10.0, 10.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 0.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 0.0, 25.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 10.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 10.0, 5.0, 0.0, 15.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 15.0, 5.0, 40.0, 30.0, 45.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 20.0, 10.0, 0.0, 5.0, 25.0, 20.0, 5.0, 10.0, 5.0, 20.0, 5.0, 5.0, 5.0, 0.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 35.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 20.0, 15.0, 5.0, 5.0, 25.0, 0.0, 20.0, 5.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 15.0, 5.0, 15.0, 10.0, 10.0], (2400, 0): [25.0, -1.0, 15.0, 25.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 5.0, 60.0, 0.0, 10.0, 0.0, 10.0, 0.0, 20.0, 5.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 30.0, 20.0, 5.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 10.0, 10.0, -1.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 10.0, 0.0, 5.0, 30.0, 5.0, 15.0, 0.0, 5.0, 10.0, 10.0, 0.0, 5.0, 30.0, -1.0, -1.0, 25.0, 20.0, 5.0, 0.0, 10.0, 0.0, 40.0, 10.0, 0.0, 5.0, 0.0, 30.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 10.0, 10.0, 5.0, 35.0, 10.0, 30.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 5.0, 20.0, 20.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 50.0, 0.0, 0.0, 0.0, 0.0, 5.0], (4800, 2400): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 10.0, 15.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, -1.0, 55.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 25.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, -1.0, 5.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 60.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 85.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 20.0, 45.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 70.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 55.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, 15.0, 30.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 10.0, 0.0, 40.0, -1.0, 15.0, 0.0, 45.0, 5.0, 0.0, 10.0, 50.0, 0.0, 70.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 20.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, -1.0, -1.0, 0.0, 25.0, 0.0, 5.0, 5.0, 20.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0], (1200, 0): [20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 10.0, 20.0, 5.0, 65.0, 0.0, 65.0, 10.0, 15.0, 55.0, 15.0, 5.0, 25.0, 35.0, 5.0, 10.0, 70.0, 0.0, 55.0, 35.0, 35.0, 25.0, 25.0, 100.0, 35.0, 40.0, 10.0, 50.0, 20.0, 60.0, 0.0, 20.0, 30.0, 90.0, 10.0, 55.0, 5.0, 20.0, 10.0, 15.0, 10.0, 40.0, 5.0, -1.0, 0.0, 35.0, 20.0, 75.0, -1.0, 60.0, 25.0, 5.0, 20.0, 40.0, 30.0, 0.0, 90.0, 20.0, 5.0, 25.0, 35.0, 50.0, 5.0, 40.0, 70.0, 40.0, 5.0, 5.0, 30.0, 30.0, 90.0, 30.0, 25.0, 45.0, 10.0, 0.0, 10.0, 25.0, 35.0, 40.0, -1.0, 10.0, 10.0, 0.0, 5.0, 55.0, 55.0, 5.0, 25.0, 15.0, 0.0, 25.0, 20.0, 25.0, 100.0, 5.0, 25.0, 45.0, 20.0, 55.0, 5.0, 70.0, 5.0, 5.0, 5.0, 40.0, 15.0, -1.0, 20.0, -1.0, 20.0, 65.0, 50.0, 0.0, 5.0, 20.0, 30.0, 45.0, 30.0, 70.0, 75.0, -1.0, 100.0, -1.0, 0.0, 85.0, 85.0, 60.0, 75.0, 20.0, 15.0, 15.0, 5.0, 0.0, 35.0, 25.0, 15.0, 0.0, 20.0, 30.0, 25.0, 80.0, 0.0, 5.0, 45.0, 70.0, 0.0, 20.0, 65.0, 0.0, 35.0, 35.0, -1.0, 10.0, 70.0, 0.0, 80.0, 70.0, 25.0, 25.0, -1.0, 5.0, 20.0, 15.0, -1.0, 25.0, 70.0, 0.0, 15.0, 20.0, 65.0, 0.0, 65.0, 25.0, 10.0, 10.0, 55.0, 0.0, 15.0, 10.0, 95.0, 25.0, 0.0, 80.0, 75.0, 15.0, 5.0, 50.0, 20.0, 95.0, 25.0, 5.0, 5.0, 0.0, 5.0, 10.0, 20.0, 40.0, 10.0, 50.0, 40.0, 10.0, 0.0, 10.0, 45.0, 5.0, 80.0, 20.0, 45.0, 15.0, 15.0, 25.0, 5.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 20.0, 10.0, 5.0, 25.0, 10.0, 15.0, 15.0, 30.0, 35.0, 30.0, -1.0, 85.0, 0.0, 15.0, 50.0, 5.0, 15.0, 10.0, 20.0, 90.0, 50.0, 65.0, 5.0, 5.0, 80.0, 15.0, 15.0, 10.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 10.0, 95.0, 20.0, -1.0, 15.0, 0.0], (0, 0): [15.0, 80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 25.0, 0.0, 30.0, 5.0, 20.0, 50.0, 50.0, 25.0, 0.0, 55.0, 10.0, 35.0, 20.0, 90.0, 15.0, 30.0, 60.0, 40.0, 20.0, 50.0, 90.0, 50.0, 45.0, 75.0, 10.0, 65.0, -1.0, 20.0, 5.0, 50.0, 40.0, 0.0, 0.0, 85.0, -1.0, 85.0, 75.0, 20.0, 65.0, 10.0, 35.0, 0.0, 75.0, 65.0, -1.0, 65.0, 15.0, 95.0, 85.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, 10.0, 20.0, 5.0, -1.0, 25.0, -1.0, -1.0, 100.0, 5.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 75.0, 10.0, 35.0, -1.0, -1.0, 20.0, 45.0, 50.0, 0.0, 90.0, -1.0, 25.0, 15.0, 65.0, 5.0, 80.0, 35.0, 50.0, 10.0, 30.0, 45.0, 15.0, 25.0, 5.0, 50.0, 50.0, 5.0, 40.0, 80.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 90.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4800, 1200): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 5.0, 0.0, 5.0, -1.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 4800): [10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, -1.0, 10.0, 15.0, 0.0, -1.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 40.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 25.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 55.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3600, 3600): [10.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0], (2400, 1200): [10.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 20.0, 5.0, 5.0, 30.0, 0.0, 0.0, 15.0, 0.0, 80.0, 5.0, 10.0, 35.0, 25.0, 25.0, 40.0, 0.0, 25.0, 25.0, 0.0, 30.0, 25.0, 10.0, 25.0, 5.0, 0.0, 0.0, 10.0, 5.0, 30.0, 15.0, 40.0, 5.0, 5.0, 10.0, 40.0, 0.0, 10.0, 5.0, 25.0, 10.0, 5.0, 10.0, 5.0, 0.0, 30.0, 20.0, 10.0, 35.0, 65.0, 15.0, 15.0, 5.0, 25.0, 20.0, 0.0, 25.0, 25.0, 0.0, 50.0, 10.0, 10.0, 5.0, 0.0, 35.0, 45.0, 0.0, 25.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 55.0, 15.0, 5.0, -1.0, 15.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 50.0, 5.0, 5.0, 0.0, 55.0, 10.0, 5.0, 10.0, 5.0, 10.0, 0.0, 35.0, 70.0, 10.0, 0.0, 40.0, 5.0, 10.0, 20.0, 65.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 15.0, 30.0, 30.0, 45.0, 15.0, 30.0, 10.0, 35.0, 10.0, 25.0, 40.0, 5.0, 10.0, 0.0, 15.0, 0.0, 25.0, 25.0, 10.0, 40.0, 40.0, 0.0, 30.0, 0.0, 15.0, 5.0, 20.0, 45.0, 10.0, 30.0, 5.0, 15.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 30.0, 45.0, 25.0, 30.0, 30.0, 20.0, 35.0, 0.0, 15.0, 30.0, 75.0, 0.0, 20.0, 0.0, 5.0, 0.0, 15.0, 25.0, 45.0, 0.0, 55.0, 25.0, 30.0, 20.0, 30.0, 0.0, 5.0, 50.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 5.0, 45.0, 45.0, 35.0, 25.0, 5.0, 5.0, 15.0, 5.0, 15.0, 35.0, 15.0, 40.0, 35.0, 0.0, 100.0, 5.0, 0.0, 15.0, 20.0, 10.0, 20.0, 45.0, 10.0, 5.0, 25.0, 20.0, 5.0, 5.0, 0.0, 80.0, 0.0, 5.0, 0.0, 10.0, 45.0, 5.0, 10.0, 55.0, 25.0, 40.0, 35.0, 20.0, 5.0, 55.0, 15.0, 10.0, 95.0, 50.0, 0.0, 5.0, 5.0, 10.0, 0.0, 15.0, 10.0, 10.0, 25.0, 5.0, 20.0, 5.0, 15.0, 5.0, 25.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 60.0, 5.0, 0.0, 65.0, 25.0, 45.0, 5.0, 5.0, -1.0, 5.0, 15.0, 10.0, 10.0, 10.0, 5.0, 25.0, 100.0, 5.0, 20.0, 25.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 10.0, 0.0, 35.0, 10.0, -1.0, 5.0, 70.0, 0.0, 10.0, 20.0, 10.0, 50.0, 45.0, 20.0, 10.0, 0.0, 5.0, 15.0, 45.0, 5.0, 30.0, 0.0, 10.0, 5.0, 20.0, 85.0, 15.0, 15.0, 10.0, 20.0, 20.0, 40.0, 15.0, 25.0, 45.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 15.0, 40.0, 0.0, 15.0, 0.0, 15.0, 5.0, 15.0, 5.0, 0.0, 15.0, 0.0, 20.0, 5.0, 0.0, 25.0, 60.0, 30.0, 0.0, 5.0, 5.0, 15.0, 15.0, 25.0, 0.0, 0.0, 5.0, 10.0, 20.0, 5.0, 15.0, 30.0, 5.0, 0.0, 25.0, 5.0, 20.0, 10.0, 0.0, 15.0, 70.0, 15.0, 15.0, 0.0, 15.0, 5.0, 25.0, 25.0, 5.0, 10.0, 15.0, 15.0, 45.0, 15.0, 30.0, 10.0, 60.0, 10.0, 5.0, 25.0, 10.0, 5.0, 35.0, 10.0, -1.0, 20.0, 15.0, 40.0, 20.0, 10.0, 15.0, 5.0, 5.0, 5.0, 10.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 0.0, 25.0, 0.0, 5.0, 40.0, 10.0, 10.0, 20.0, 15.0, 0.0, 15.0, 0.0, 40.0, 5.0, 20.0, 25.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 15.0, 40.0, 0.0, 25.0, 15.0, 25.0, 5.0, 15.0, 70.0, 15.0, 5.0, 20.0, 10.0, 65.0, 65.0, 65.0, 25.0, 15.0, 15.0, 25.0, 5.0, 5.0, 20.0, 25.0, 5.0, 0.0, 0.0, 5.0, 5.0, 10.0, 25.0, 30.0, 20.0, 15.0, 30.0, 35.0, 20.0, 0.0, 0.0, 15.0], (7200, 2400): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 50.0, -1.0, -1.0, 5.0, -1.0, 40.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 4800): [-1.0, 0.0, 40.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, 10.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, 20.0, -1.0, 80.0, 15.0, -1.0, 0.0, 55.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0], (6000, 2400): [-1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 15.0, 80.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 35.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 25.0, 10.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0, 40.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 5.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 60.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 15.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0], (7200, 3600): [0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, 0.0, 30.0, 10.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 55.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 25.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 35.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 0.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, 25.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 20.0, 0.0, 35.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0], (3600, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (6000, 3600): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 10.0, 5.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 50.0, 0.0, 10.0, 25.0, -1.0, 5.0, 5.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 15.0, -1.0, 0.0, 10.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 85.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, 15.0, -1.0, 5.0, 55.0, 0.0, 15.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 35.0, 5.0, 0.0, -1.0, 0.0, -1.0, 65.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 40.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 45.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 45.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 20.0, 0.0, -1.0, -1.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 5.0, -1.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, 0.0, 60.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0, 10.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, 75.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 50.0, 5.0, 0.0, -1.0, 0.0, -1.0, 55.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 35.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (1200, 1200): [65.0, 20.0, 5.0, 5.0, 20.0, 10.0, 65.0, 10.0, 70.0, 5.0, 30.0, 45.0, 25.0, 10.0, 95.0, 50.0, 5.0, 70.0, 15.0, 20.0, 5.0, 0.0, 10.0, 80.0, 45.0, 50.0, 15.0, 25.0, 85.0, 75.0, 5.0, -1.0, 35.0, 5.0, 0.0, 15.0, 5.0, 30.0, 40.0, 40.0, 50.0, -1.0, 10.0, 35.0, 55.0, 65.0, 15.0, 20.0, 60.0, 30.0, 40.0, 0.0, 10.0, 60.0, 15.0, 20.0, 10.0, 45.0, 50.0, 80.0, 5.0, 20.0, 30.0, 25.0, 20.0, 5.0, 70.0, 90.0, 40.0, 35.0, 5.0, 25.0, 5.0, 10.0, 10.0, 55.0, 0.0, 65.0, 30.0, 40.0, 15.0, 20.0, 30.0, 55.0, 0.0, 15.0, 50.0, 25.0, 55.0, 65.0, 65.0, 15.0, 35.0, 5.0, 0.0, 5.0, 40.0, 25.0, 75.0, 5.0, 5.0, 80.0, 10.0, 30.0, 45.0, 65.0, 40.0, 15.0, 70.0, 85.0, 25.0, 25.0, 30.0, 65.0, 20.0, 55.0, 5.0, 35.0, 10.0, 5.0, 0.0, 0.0, 35.0, 95.0, 35.0, 95.0, 20.0, 15.0, 5.0, 5.0, 70.0, 85.0], (8400, 2400): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, 0.0, -1.0], (8400, 3600): [-1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0], (4800, 3600): [20.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, -1.0, 5.0, 15.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 5.0, 20.0, 5.0, 0.0, 15.0, 20.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 30.0, 0.0, 35.0, 35.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 35.0, 0.0, 30.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 15.0, -1.0, 15.0, 60.0, 15.0, 5.0, 15.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 15.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 40.0, -1.0, 0.0, 0.0, 20.0, 0.0, -1.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 50.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 30.0, 20.0, 0.0, 5.0, 45.0, 10.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 5.0, 20.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 15.0, 10.0, 0.0, 0.0, 65.0, 10.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 20.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 90.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, 5.0, 50.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, 10.0, 0.0, 15.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 15.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 45.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0], (3600, 1200): [0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 10.0, 5.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 55.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 15.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 25.0, 5.0, 0.0, 0.0, 25.0, 5.0, 10.0, 15.0, 0.0, -1.0, 10.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 30.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0], (8400, 6000): [-1.0]}
mpc_dash_syth_hyb_pen_table_1300 = {(1300, 1300): [20.0, 65.0, 20.0, 10.0, 5.0, 40.0, 5.0, 30.0, 20.0, 25.0, 10.0, 65.0, 40.0, 10.0, 70.0, 5.0, 65.0, 0.0, 45.0, 25.0, 35.0, 10.0, 55.0, -1.0, 95.0, 50.0, 5.0, 70.0, 15.0, 20.0, 5.0, 40.0, 0.0, 10.0, 80.0, 45.0, 50.0, 0.0, 15.0, 45.0, 15.0, 25.0, 75.0, 5.0, 15.0, 40.0, -1.0, 35.0, 60.0, 15.0, 5.0, 30.0, 40.0, 40.0, -1.0, 30.0, 0.0, 15.0, 10.0, 20.0, 35.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 60.0, 30.0, 5.0, 40.0, 0.0, 10.0, 60.0, 5.0, 15.0, 20.0, 10.0, 0.0, 0.0, 80.0, 55.0, 95.0, 50.0, 5.0, 30.0, 15.0, 25.0, 15.0, 25.0, 5.0, 70.0, 60.0, 90.0, 40.0, 25.0, 35.0, 5.0, 25.0, 5.0, 100.0, 10.0, 25.0, 5.0, 10.0, 30.0, 20.0, 40.0, 15.0, 10.0, 5.0, 15.0, 20.0, 30.0, 55.0, 15.0, 0.0, 45.0, 15.0, 40.0, 50.0, 25.0, 20.0, 60.0, 15.0, 65.0, 15.0, 65.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 40.0, 25.0, 5.0, 5.0, 5.0, 80.0, 10.0, 30.0, 45.0, 15.0, 30.0, 65.0, 5.0, 15.0, 70.0, 85.0, 5.0, 25.0, 30.0, 40.0, 65.0, 20.0, 55.0, 20.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 35.0, 95.0, 35.0, 20.0, 20.0, 25.0, 15.0, 5.0, 30.0, 85.0], (7800, 2600): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0], (6500, 2600): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 50.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 10.0, -1.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, 80.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0], (3900, 3900): [5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0], (7800, 5200): [10.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, 10.0, 10.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, 10.0, -1.0, 5.0, 80.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0], (0, 0): [15.0, 80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 5.0, 35.0, 25.0, 0.0, 30.0, 5.0, 20.0, 100.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 20.0, 90.0, 15.0, 30.0, 60.0, 40.0, 20.0, 50.0, 25.0, 90.0, 50.0, 45.0, 75.0, 10.0, 25.0, 65.0, -1.0, 20.0, 5.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 85.0, -1.0, 85.0, 75.0, 20.0, 65.0, 10.0, 45.0, 35.0, 0.0, 75.0, 70.0, 65.0, -1.0, 65.0, 15.0, 95.0, 85.0, 0.0, -1.0, 20.0, 30.0, -1.0, -1.0, 0.0, 10.0, 20.0, 5.0, -1.0, 35.0, 25.0, 25.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 75.0, 10.0, 15.0, 35.0, -1.0, 25.0, -1.0, 20.0, 80.0, 45.0, 50.0, 0.0, 90.0, -1.0, 40.0, 25.0, 15.0, 65.0, 5.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, -1.0, 35.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 50.0, 5.0, 40.0, 80.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 5.0, 90.0, 10.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (3900, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5200, 3900): [0.0, 20.0, 5.0, 0.0, -1.0, 10.0, 5.0, 0.0, -1.0, 15.0, -1.0, 10.0, 5.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 60.0, 35.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 50.0, -1.0, 55.0, 25.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 15.0, 0.0, 65.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 30.0, 20.0, 0.0, 0.0, 10.0, 40.0, -1.0, 30.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 60.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 15.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 15.0, 15.0, 0.0, -1.0, -1.0, -1.0, 65.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 45.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 75.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 0.0, 5.0, 50.0, 5.0, 0.0, 55.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 40.0, -1.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 45.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 25.0], (2600, 0): [25.0, 0.0, -1.0, 0.0, 5.0, 25.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, -1.0, 0.0, 20.0, 15.0, 0.0, 5.0, 0.0, -1.0, 15.0, 35.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 20.0, 10.0, 10.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 30.0, 55.0, 5.0, 5.0, 15.0, 25.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, -1.0, 25.0, 45.0, 0.0, 10.0, 20.0, 15.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 40.0, 10.0, 0.0, 5.0, 0.0, 30.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 10.0, 0.0, 30.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, -1.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0], (1300, 0): [20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 10.0, 20.0, 5.0, 65.0, 0.0, 65.0, 15.0, 10.0, 15.0, 55.0, 15.0, 5.0, 25.0, 35.0, 10.0, 70.0, 0.0, 55.0, 35.0, 25.0, 25.0, 30.0, 35.0, 60.0, 40.0, 10.0, 50.0, 20.0, 0.0, 60.0, 20.0, 30.0, 90.0, 10.0, 55.0, 5.0, 20.0, 10.0, 15.0, 10.0, 40.0, 5.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 20.0, 75.0, -1.0, 60.0, 5.0, 20.0, 40.0, 30.0, 0.0, 30.0, 90.0, 15.0, 20.0, 5.0, 35.0, 85.0, 50.0, 5.0, 40.0, 70.0, 40.0, 5.0, 5.0, 30.0, 5.0, 30.0, 90.0, 30.0, 25.0, 45.0, 20.0, 10.0, 0.0, 10.0, 25.0, 0.0, 35.0, 5.0, 10.0, 0.0, 10.0, 0.0, 45.0, 5.0, 55.0, 55.0, 5.0, 25.0, 15.0, 50.0, -1.0, 0.0, 25.0, 20.0, 25.0, 100.0, 5.0, 5.0, 25.0, 5.0, 20.0, 55.0, 5.0, 5.0, 5.0, 10.0, 10.0, 5.0, 40.0, 15.0, -1.0, 20.0, -1.0, 20.0, 65.0, 50.0, 0.0, 5.0, 20.0, 30.0, 0.0, 45.0, 30.0, 70.0, 75.0, -1.0, 100.0, -1.0, 0.0, 0.0, 85.0, 45.0, 85.0, 45.0, 50.0, 60.0, 75.0, 15.0, 15.0, 20.0, 5.0, 0.0, 10.0, 35.0, 20.0, 25.0, 15.0, 0.0, 20.0, 30.0, 25.0, 80.0, 0.0, -1.0, 5.0, 45.0, 70.0, 0.0, 20.0, 65.0, 0.0, 35.0, 30.0, -1.0, 10.0, 70.0, 0.0, -1.0, 80.0, 70.0, 25.0, -1.0, 5.0, 55.0, 0.0, 65.0, 20.0, -1.0, 25.0, 70.0, 0.0, 15.0, 20.0, 65.0, 0.0, 65.0, 25.0, 10.0, 10.0, 55.0, 0.0, 10.0, 95.0, 55.0, 0.0, 75.0, 15.0, 5.0, 50.0, 35.0, 20.0, 35.0, 95.0, 25.0, 5.0, 5.0, 0.0, 5.0, 75.0, 10.0, 20.0, 40.0, 10.0, 50.0, 10.0, 40.0, 0.0, 10.0, 45.0, 40.0, 0.0, 15.0, -1.0, 80.0, 5.0, 20.0, 15.0, 15.0, 25.0, 5.0, 10.0, 45.0, 0.0, 30.0, 20.0, 25.0, 5.0, 25.0, 10.0, 15.0, 15.0, 30.0, 35.0, 30.0, 35.0, -1.0, 85.0, 0.0, 15.0, 50.0, 5.0, 15.0, 10.0, 70.0, 20.0, 90.0, 15.0, 50.0, 65.0, 5.0, 95.0, 80.0, 15.0, 0.0, 15.0, 5.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 10.0, 95.0, 20.0, 70.0, -1.0, 15.0, 0.0], (3900, 1300): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, -1.0, 55.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 20.0, -1.0, 10.0, 45.0, 30.0, 15.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 15.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 10.0, 5.0, 20.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 15.0, 25.0, 5.0, 20.0, 30.0, 0.0, 10.0, 0.0, -1.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 10.0, 5.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0], (5200, 1300): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 30.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0], (6500, 1300): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (7800, 1300): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5200, 2600): [0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 20.0, 25.0, 0.0, 20.0, 0.0, 20.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 10.0, 0.0, 0.0, 30.0, 15.0, 0.0, 35.0, -1.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 65.0, -1.0, 0.0, -1.0, -1.0, 35.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 80.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 85.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 10.0, 0.0, -1.0, 15.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 35.0, 5.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 15.0, 0.0, 45.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 70.0, 0.0, 0.0, -1.0, 0.0, 20.0, 5.0, 0.0, 20.0, 0.0, 10.0, 5.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 55.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, -1.0, 0.0, 45.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 30.0, 10.0, 0.0, -1.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 45.0, 5.0, -1.0, 0.0, 0.0, 30.0, 30.0, 0.0, -1.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, -1.0, 5.0, 10.0, 50.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 45.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 35.0, -1.0, 0.0, 25.0, 0.0, 5.0, 20.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0], (7800, 3900): [0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 10.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, 20.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (2600, 1300): [10.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 15.0, 5.0, 35.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 80.0, 5.0, 5.0, 5.0, 5.0, 35.0, 25.0, 25.0, 0.0, 25.0, 25.0, 0.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 15.0, 5.0, 5.0, 20.0, 10.0, 40.0, 0.0, 10.0, 5.0, 25.0, 10.0, 5.0, 10.0, 5.0, 0.0, 30.0, 20.0, 10.0, 35.0, 0.0, 15.0, 15.0, 5.0, 25.0, 20.0, 25.0, 25.0, 0.0, 20.0, 50.0, 10.0, 10.0, 5.0, 0.0, 10.0, 45.0, 0.0, 25.0, 0.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 5.0, 15.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 20.0, 10.0, 0.0, 50.0, 5.0, 5.0, 5.0, 0.0, 0.0, 55.0, 10.0, 0.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 0.0, 15.0, 70.0, 10.0, 0.0, 5.0, 0.0, 10.0, 20.0, 65.0, 0.0, 0.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 30.0, 30.0, 30.0, 35.0, 35.0, 10.0, 35.0, 10.0, 25.0, 40.0, 5.0, 0.0, 0.0, 0.0, 25.0, 25.0, 10.0, 10.0, 40.0, 10.0, 30.0, 0.0, 30.0, 0.0, 15.0, 5.0, 0.0, 45.0, 40.0, 10.0, 20.0, 30.0, 5.0, 15.0, 65.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 30.0, 0.0, 25.0, 30.0, 0.0, 30.0, 20.0, 35.0, 0.0, 5.0, 15.0, 75.0, 0.0, 10.0, 40.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 25.0, 45.0, 0.0, 55.0, 25.0, 30.0, 30.0, 50.0, 20.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 45.0, 45.0, 35.0, 25.0, 5.0, 0.0, 15.0, 0.0, 15.0, 35.0, 15.0, 40.0, 35.0, 0.0, 100.0, 0.0, 5.0, 0.0, 15.0, 20.0, 10.0, 0.0, 0.0, 20.0, 45.0, 10.0, 25.0, 20.0, 5.0, 5.0, 5.0, 0.0, 5.0, 80.0, 5.0, 0.0, 10.0, 45.0, 5.0, 0.0, 10.0, 25.0, 40.0, 25.0, 10.0, 35.0, 20.0, 45.0, 5.0, 15.0, 10.0, 0.0, 0.0, 5.0, 5.0, 30.0, 25.0, 0.0, 10.0, 0.0, 10.0, 30.0, 5.0, 20.0, 30.0, 5.0, 5.0, 5.0, 25.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 5.0, 0.0, 65.0, 45.0, 5.0, 50.0, 5.0, 5.0, 15.0, 5.0, 5.0, 20.0, 15.0, 10.0, 10.0, 10.0, 5.0, 25.0, 5.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 55.0, 5.0, 70.0, 0.0, 10.0, 10.0, 50.0, 20.0, 0.0, 45.0, 30.0, 5.0, 30.0, 0.0, 5.0, 0.0, 5.0, 20.0, 85.0, 0.0, 20.0, 10.0, 20.0, 10.0, 5.0, 20.0, 40.0, 15.0, 25.0, 25.0, 15.0, 15.0, 5.0, 80.0, 25.0, 5.0, 20.0, 15.0, 5.0, 0.0, 15.0, 10.0, 0.0, 15.0, 20.0, 15.0, 5.0, 0.0, 30.0, 15.0, 0.0, 5.0, 0.0, 0.0, 25.0, 30.0, 0.0, 5.0, 5.0, 10.0, 0.0, 15.0, 25.0, 0.0, 30.0, 0.0, 5.0, 10.0, 20.0, 0.0, 5.0, 30.0, 5.0, 0.0, 25.0, 5.0, 20.0, 0.0, 10.0, 15.0, 70.0, 15.0, 15.0, 0.0, 15.0, 0.0, 25.0, 15.0, 25.0, 0.0, 0.0, 5.0, 10.0, 15.0, 15.0, 45.0, 5.0, 5.0, 10.0, 10.0, 0.0, 60.0, 10.0, 25.0, 10.0, 5.0, 35.0, 0.0, 0.0, 0.0, 10.0, 20.0, 15.0, 40.0, 20.0, 10.0, 20.0, 15.0, 5.0, 20.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 15.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 35.0, 10.0, 35.0, 25.0, 15.0, 10.0, 5.0, 15.0, 0.0, 15.0, 35.0, 0.0, 40.0, 0.0, 20.0, 5.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, 25.0, 15.0, 40.0, 25.0, 15.0, 25.0, 0.0, 5.0, 15.0, 15.0, 15.0, 5.0, 5.0, 0.0, 10.0, 5.0, 65.0, 65.0, 65.0, 30.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 20.0, 25.0, 25.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 10.0, 25.0, 20.0, 15.0, 40.0, 30.0, 35.0, 20.0, 0.0, 10.0, 0.0, 0.0, 15.0], (3900, 2600): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 70.0, 0.0, 10.0, 25.0, 0.0, 35.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 25.0, 15.0, 15.0, 5.0, 5.0, 0.0, 0.0, 30.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, -1.0, 5.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 20.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 10.0, 25.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 20.0, 0.0, 10.0, 15.0, 10.0, 10.0, 10.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, 15.0, 40.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 20.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 10.0, 90.0, 5.0, 15.0, 5.0, 25.0, 20.0, 5.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 35.0, 50.0, -1.0, 20.0, 45.0, 15.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 20.0, 15.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 15.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 30.0, 0.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 25.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 40.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 65.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 0.0, 70.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 50.0, 25.0, 20.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 5.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 5.0, 25.0, 5.0, 0.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0], (6500, 5200): [0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0], (2600, 2600): [20.0, 5.0, 0.0, 5.0, 5.0, 15.0, 35.0, 20.0, 0.0, 0.0, 15.0, 10.0, 10.0, 5.0, 30.0, 10.0, 10.0, 5.0, 0.0, 0.0, 20.0, 15.0, 0.0, 10.0, 10.0, 5.0, 25.0, 35.0, 10.0, 5.0, 10.0, 0.0, 30.0, 0.0, 0.0, 80.0, 10.0, 0.0, 10.0, 20.0, 5.0, 30.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 15.0, 5.0, 15.0, 30.0, 5.0, 0.0, 0.0, 20.0, 10.0, 75.0, 5.0, 5.0], (5200, 0): [-1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6500, 3900): [0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, -1.0, 15.0, 0.0, 65.0, 10.0, 0.0, 30.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 35.0, 10.0, 5.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 35.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, 15.0, -1.0, 10.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 55.0, 85.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, 10.0, -1.0, -1.0, 15.0, 5.0, 20.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 30.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 40.0, 0.0, -1.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, -1.0, 0.0, 10.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, -1.0, 0.0, -1.0, 0.0, 50.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 5.0, 45.0, 55.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, -1.0, -1.0, 35.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (6500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_1400 = {(5600, 1400): [-1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 10.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (4200, 4200): [10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 10.0, 20.0, 5.0, 15.0, 10.0, 45.0], (2800, 2800): [5.0, 70.0, 20.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 5.0, 25.0, 0.0, 45.0, 0.0, 0.0, 15.0, 10.0, 10.0, 15.0, 10.0, 15.0, 10.0, 5.0, 35.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 10.0, 0.0, 10.0, 10.0, 5.0, 25.0, 0.0, 80.0, 25.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 15.0, 5.0, 15.0, 10.0, 5.0, 5.0, 0.0, 0.0, 30.0, 10.0, 25.0, 10.0, 0.0, 0.0, 50.0, 0.0, 20.0, 0.0, 30.0, 5.0, 0.0], (5600, 4200): [0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, 50.0, -1.0, 5.0, 55.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 40.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 30.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 45.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 50.0, -1.0, 60.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 45.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 80.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, -1.0, 35.0, 20.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 35.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 45.0, 0.0], (8400, 5600): [40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, 80.0, 0.0, 0.0, -1.0, -1.0], (4200, 1400): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 20.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 25.0, 0.0, -1.0, 0.0, 10.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 30.0, 15.0, 20.0, 0.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 30.0, 20.0, 0.0, 70.0, 5.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, -1.0, 10.0, 0.0, 0.0, 5.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 45.0, 0.0, 5.0, 0.0, 10.0, 10.0, 5.0, -1.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, 20.0, 5.0, 0.0, 15.0, 30.0, 0.0, 25.0, 0.0, 30.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0], (0, 0): [20.0, 15.0, 80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 5.0, 35.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 55.0, 5.0, 20.0, 10.0, 90.0, 15.0, 5.0, 30.0, 60.0, 40.0, 20.0, 50.0, 25.0, 90.0, 50.0, 45.0, 75.0, 10.0, 25.0, 35.0, 65.0, -1.0, 20.0, 5.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 85.0, -1.0, 85.0, 75.0, 20.0, 65.0, 10.0, 45.0, 35.0, 0.0, 75.0, 70.0, 65.0, -1.0, 65.0, 20.0, 45.0, 15.0, 0.0, 95.0, 85.0, 0.0, -1.0, 20.0, 30.0, 0.0, -1.0, 15.0, 30.0, -1.0, 0.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 65.0, 35.0, 80.0, 70.0, 25.0, 25.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 75.0, 10.0, 15.0, 35.0, 10.0, -1.0, 25.0, -1.0, 20.0, 80.0, 45.0, 50.0, 0.0, 90.0, 95.0, 25.0, 5.0, -1.0, 40.0, 25.0, 15.0, 65.0, 5.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 10.0, 45.0, -1.0, 35.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 30.0, 5.0, 40.0, 80.0, 10.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 5.0, 90.0, 10.0, 15.0, 15.0, 5.0, 20.0, 20.0, 40.0, 15.0], (2800, 1400): [10.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 15.0, 0.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 10.0, 25.0, 25.0, 0.0, 25.0, 0.0, 25.0, 10.0, 5.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 15.0, 30.0, 5.0, 0.0, 10.0, 5.0, 20.0, 10.0, 0.0, 10.0, 5.0, 5.0, 0.0, 25.0, 10.0, 0.0, 5.0, 5.0, 10.0, 15.0, 5.0, 0.0, 20.0, 10.0, 5.0, 0.0, 15.0, 5.0, 25.0, 25.0, 25.0, 35.0, 20.0, 50.0, 10.0, 10.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 45.0, 15.0, 10.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 5.0, 5.0, 5.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 55.0, 10.0, 0.0, 0.0, 10.0, 5.0, 10.0, 65.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 30.0, 10.0, 65.0, 0.0, 0.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 35.0, 20.0, 10.0, 20.0, 0.0, 30.0, 30.0, 30.0, 5.0, 35.0, 0.0, 35.0, 10.0, 35.0, 25.0, 5.0, 40.0, 0.0, 0.0, 0.0, 25.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 45.0, 40.0, 10.0, 5.0, 20.0, 30.0, 5.0, 15.0, 0.0, 20.0, 35.0, 0.0, 0.0, 15.0, 15.0, 10.0, 5.0, 0.0, 35.0, 10.0, 0.0, 30.0, 20.0, 0.0, 0.0, 30.0, 20.0, 20.0, 35.0, 5.0, 0.0, 5.0, 15.0, 0.0, 15.0, 0.0, 75.0, 10.0, 40.0, 0.0, 20.0, 20.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, 45.0, 30.0, 20.0, 5.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 35.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 15.0, 10.0, 35.0, 15.0, 40.0, 35.0, 15.0, 0.0, 100.0, 15.0, 0.0, 0.0, 15.0, 20.0, 10.0, 10.0, 0.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 0.0, 25.0, 20.0, 5.0, 35.0, 5.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 80.0, 0.0, 10.0, 0.0, 30.0, 10.0, 5.0, 10.0, 0.0, 10.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 25.0, 45.0, 15.0, 0.0, 15.0, 10.0, 0.0, 0.0, 5.0, 30.0, 25.0, 10.0, 10.0, 0.0, 10.0, 0.0, 10.0, 30.0, 5.0, 20.0, 30.0, 5.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 35.0, 5.0, 5.0, 0.0, 10.0, 5.0, 65.0, 10.0, 45.0, 0.0, 5.0, 50.0, 10.0, 5.0, 15.0, 5.0, 20.0, 5.0, 20.0, 15.0, 30.0, 10.0, 5.0, 10.0, 0.0, 5.0, 25.0, 5.0, 5.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 20.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 70.0, 0.0, 10.0, 10.0, 50.0, 20.0, 0.0, 30.0, 5.0, 30.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 85.0, 10.0, 0.0, 20.0, 10.0, 20.0, 5.0, 10.0, 5.0, 20.0, 40.0, 15.0, 0.0, 10.0, 25.0, 15.0, 15.0, 5.0, 0.0, 80.0, 25.0, 0.0, 5.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 15.0, 10.0, 0.0, 0.0, 15.0, 20.0, 15.0, 5.0, 0.0, 30.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 30.0, 0.0, 5.0, 10.0, 15.0, 0.0, 25.0, 15.0, 25.0, 0.0, 30.0, 5.0, 10.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 25.0, 5.0, 0.0, 10.0, 15.0, 15.0, 15.0, 5.0, 15.0, 40.0, 15.0, 5.0, 0.0, 0.0, 30.0, 25.0, 15.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 10.0, 0.0, 10.0, 25.0, 10.0, 5.0, 35.0, 0.0, 0.0, 0.0, 20.0, 10.0, 20.0, 15.0, 20.0, 10.0, 5.0, 20.0, 15.0, 5.0, 20.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 35.0, 10.0, 0.0, 25.0, 15.0, 10.0, 5.0, 15.0, 0.0, 10.0, 15.0, 35.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 20.0, 5.0, 25.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 40.0, 25.0, 15.0, 25.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 15.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 65.0, 65.0, 30.0, 15.0, 15.0, 25.0, 5.0, 0.0, 5.0, 20.0, 5.0, 25.0, 5.0, 75.0, 5.0, 20.0, 0.0, 0.0, 5.0, 10.0, 25.0, 5.0, 20.0, 40.0, 30.0, 35.0, 0.0, 10.0, 0.0, 0.0, 15.0], (2800, 0): [0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 5.0, 25.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 10.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 5.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 10.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 35.0, -1.0, 5.0, 0.0, 5.0, 5.0, 5.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, -1.0, 50.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (4200, 2800): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, -1.0, 15.0, 0.0, 35.0, 25.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 40.0, 5.0, 35.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 60.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 25.0, -1.0, 10.0, 15.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 35.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, 90.0, 15.0, 5.0, 0.0, 20.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 5.0, 35.0, 5.0, -1.0, 10.0, 50.0, 0.0, -1.0, 20.0, 45.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 10.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 45.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 45.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 0.0, 50.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, 5.0, -1.0, 20.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 60.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 10.0, 10.0, 5.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 5.0, 10.0, 0.0, 30.0, 10.0, 0.0, 70.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 50.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, -1.0, 35.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 5.0, 25.0, 5.0, 5.0, 10.0, -1.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 5.0, 25.0], (7000, 2800): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 50.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 55.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 85.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, 10.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 20.0, 30.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0], (5600, 2800): [0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 10.0, -1.0, 10.0, 0.0, 25.0, 0.0, 5.0, 20.0, 0.0, 15.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 55.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 10.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, 35.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 35.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 65.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, 0.0, -1.0, 35.0, 35.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 15.0, 0.0, 40.0, 10.0, -1.0, 40.0, 10.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 45.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, 45.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, 40.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 50.0, 0.0, 0.0, 20.0, 5.0, 0.0, -1.0, -1.0, 45.0, 0.0, 60.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 90.0, 0.0, 40.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 50.0, 0.0, -1.0, -1.0, 5.0, -1.0, 55.0, 0.0, 15.0, 5.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0], (8400, 4200): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, 5.0, 20.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0], (7000, 4200): [0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 15.0, -1.0, 15.0, 0.0, -1.0, 65.0, -1.0, -1.0, 30.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, 10.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 35.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, 5.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 40.0, 0.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 25.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 10.0, 15.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 5.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, 55.0, -1.0, 15.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 25.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 35.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0], (1400, 1400): [20.0, 5.0, 30.0, 0.0, 65.0, 80.0, 5.0, 20.0, 10.0, 35.0, 5.0, 40.0, 25.0, 30.0, 25.0, 0.0, 10.0, 40.0, 40.0, 10.0, 70.0, 30.0, 35.0, 65.0, 15.0, 20.0, 0.0, 0.0, 45.0, 25.0, 35.0, 25.0, 10.0, 5.0, 55.0, 5.0, -1.0, 95.0, 50.0, 50.0, 5.0, 0.0, 70.0, 5.0, 15.0, 20.0, 40.0, 20.0, 10.0, 80.0, 0.0, 15.0, 45.0, 15.0, 25.0, 75.0, 10.0, 5.0, 40.0, 15.0, 25.0, 40.0, -1.0, 15.0, 35.0, 65.0, 0.0, 60.0, 10.0, 95.0, 25.0, 25.0, 30.0, 15.0, 5.0, 30.0, 40.0, -1.0, 30.0, 0.0, 0.0, 5.0, 15.0, 55.0, 25.0, 10.0, 20.0, 30.0, 35.0, 0.0, 55.0, 20.0, 0.0, 45.0, 45.0, 25.0, 5.0, 60.0, 30.0, 5.0, 40.0, 5.0, 0.0, 60.0, 5.0, 5.0, 20.0, 10.0, 0.0, 0.0, 45.0, 80.0, 20.0, 55.0, 95.0, 50.0, 30.0, 15.0, 15.0, 25.0, 25.0, 5.0, 0.0, 25.0, 5.0, 35.0, 5.0, 25.0, 10.0, 5.0, 100.0, 25.0, 5.0, 35.0, 10.0, 30.0, 20.0, 40.0, 15.0, 10.0, 5.0, 45.0, 20.0, 30.0, 55.0, 15.0, 0.0, 45.0, 25.0, 40.0, 50.0, 15.0, 25.0, 20.0, 60.0, 5.0, 15.0, 65.0, 0.0, 15.0, 30.0, 65.0, 15.0, 5.0, 20.0, 0.0, 70.0, 5.0, 0.0, 5.0, 5.0, 15.0, 15.0, 30.0, 45.0, 45.0, 15.0, 30.0, 60.0, 5.0, 40.0, 15.0, 70.0, 25.0, 25.0, 30.0, 40.0, 65.0, 20.0, 55.0, 20.0, 5.0, 0.0, 0.0, 25.0, 0.0, 15.0, 0.0, 35.0, 15.0, 20.0, 10.0, 65.0, 20.0, 25.0, 25.0, 5.0, 5.0, 30.0, 15.0, 20.0], (7000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 2800): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 95.0, 0.0, 0.0, -1.0], (4200, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7000, 1400): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7000, 5600): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0], (8400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8400, 1400): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0], (1400, 0): [20.0, 60.0, 95.0, 35.0, 35.0, 10.0, 20.0, 5.0, 65.0, 5.0, 0.0, 20.0, 65.0, 15.0, 65.0, 10.0, 15.0, 55.0, 15.0, 5.0, 25.0, 35.0, 10.0, 70.0, 0.0, 55.0, 35.0, 25.0, 5.0, 5.0, 30.0, 35.0, 5.0, 60.0, 40.0, 10.0, 50.0, 20.0, 0.0, 60.0, 20.0, 30.0, 10.0, 20.0, 90.0, 10.0, 20.0, 15.0, 10.0, 40.0, 5.0, -1.0, 0.0, 35.0, 5.0, 0.0, 0.0, 0.0, 35.0, 20.0, 75.0, 5.0, -1.0, 60.0, 0.0, 5.0, 20.0, 40.0, 45.0, 30.0, 0.0, 50.0, 30.0, 90.0, 15.0, 20.0, 5.0, 85.0, 20.0, 50.0, 5.0, 40.0, 70.0, 40.0, 5.0, 5.0, 30.0, 5.0, 30.0, 90.0, -1.0, 30.0, 25.0, 45.0, 20.0, 10.0, 0.0, 10.0, 25.0, 0.0, 10.0, 35.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 5.0, 55.0, 55.0, 5.0, 40.0, 25.0, 15.0, 50.0, 0.0, -1.0, 0.0, 25.0, 20.0, 25.0, 100.0, 5.0, 5.0, 25.0, 5.0, 50.0, 20.0, 55.0, 65.0, 15.0, 5.0, 5.0, 5.0, 10.0, 10.0, 5.0, 40.0, 15.0, -1.0, 20.0, -1.0, 20.0, 65.0, 50.0, 0.0, 5.0, 30.0, 0.0, 10.0, 30.0, 70.0, 75.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 45.0, 85.0, 10.0, 45.0, 50.0, 60.0, 5.0, 55.0, 75.0, 15.0, 15.0, 5.0, 20.0, 5.0, 10.0, 25.0, 25.0, 35.0, 20.0, 25.0, 0.0, 20.0, 0.0, 70.0, 60.0, 90.0, 40.0, 25.0, 80.0, -1.0, 5.0, 70.0, 0.0, 20.0, 0.0, 35.0, 30.0, -1.0, 10.0, 70.0, 0.0, -1.0, 10.0, 25.0, -1.0, 5.0, 55.0, 0.0, 65.0, 45.0, 20.0, 15.0, -1.0, 25.0, 70.0, 20.0, 0.0, 15.0, 15.0, 15.0, 20.0, 65.0, 0.0, 15.0, 65.0, 25.0, 5.0, 10.0, 10.0, 55.0, 0.0, 0.0, 95.0, 55.0, 5.0, 0.0, 10.0, 75.0, 15.0, 5.0, 10.0, 50.0, 35.0, 20.0, 35.0, 0.0, 5.0, 40.0, 25.0, 0.0, 5.0, 75.0, 10.0, 20.0, 40.0, 10.0, 50.0, 5.0, 10.0, 80.0, 40.0, 10.0, 0.0, 65.0, 10.0, 40.0, 0.0, 15.0, -1.0, 80.0, 5.0, 20.0, 85.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 30.0, 20.0, 25.0, 5.0, 25.0, 15.0, 30.0, 35.0, 35.0, 10.0, -1.0, 85.0, 5.0, 0.0, 15.0, 50.0, 5.0, 15.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 50.0, 65.0, 5.0, 95.0, 80.0, 15.0, 0.0, 15.0, 5.0, 15.0, 5.0, 10.0, 0.0, 50.0, 25.0, 20.0, 0.0, 15.0, 10.0, 95.0, 20.0, 70.0, 5.0, -1.0, 15.0, 0.0, 85.0]}
mpc_dash_syth_hyb_pen_table_1500 = {(4500, 4500): [0.0, 0.0, 50.0, 10.0, 10.0, 0.0, 20.0, 45.0, 5.0], (4500, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0], (3000, 0): [0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 20.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 30.0, 5.0, 5.0, 15.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 5.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 20.0, 25.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 35.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1500, 1500): [5.0, 20.0, 5.0, 30.0, 0.0, 80.0, 5.0, 20.0, 10.0, 35.0, 25.0, 40.0, 25.0, 0.0, 30.0, 25.0, 25.0, 0.0, 10.0, 40.0, 40.0, 25.0, 10.0, 5.0, 70.0, 30.0, 20.0, 35.0, 65.0, 15.0, 25.0, 20.0, 0.0, 25.0, 0.0, 45.0, 35.0, 45.0, 0.0, 25.0, 0.0, 5.0, 5.0, 55.0, 5.0, -1.0, 95.0, 50.0, 50.0, 5.0, 0.0, 70.0, 10.0, 20.0, 10.0, 40.0, 5.0, 20.0, 0.0, 0.0, 25.0, 80.0, 20.0, 0.0, 45.0, 15.0, 30.0, 75.0, 10.0, 5.0, 40.0, 0.0, 15.0, 25.0, 40.0, 15.0, 5.0, 5.0, 35.0, 65.0, 0.0, 60.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 30.0, 25.0, 30.0, 15.0, 30.0, 35.0, -1.0, 75.0, 0.0, 0.0, 5.0, 15.0, 45.0, 0.0, 55.0, 25.0, 10.0, 20.0, 30.0, 35.0, 0.0, 20.0, 10.0, 0.0, 5.0, 45.0, 45.0, 35.0, 25.0, 5.0, 5.0, 60.0, 5.0, 35.0, 100.0, 5.0, 15.0, 20.0, 0.0, 5.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 45.0, 10.0, 25.0, 80.0, 20.0, 55.0, 95.0, 50.0, 30.0, 15.0, 15.0, 5.0, 25.0, 25.0, 0.0, 25.0, 5.0, 15.0, 35.0, 5.0, 25.0, 10.0, 100.0, 25.0, 5.0, 20.0, 0.0, 10.0, 10.0, 70.0, 30.0, 20.0, 15.0, 50.0, 20.0, 10.0, 5.0, 45.0, 30.0, 5.0, 20.0, 85.0, 30.0, 55.0, 15.0, 45.0, 25.0, 15.0, 20.0, 15.0, 40.0, 5.0, 15.0, 25.0, 20.0, 60.0, 5.0, 5.0, 15.0, 65.0, 0.0, 10.0, 20.0, 15.0, 30.0, 65.0, 15.0, 25.0, 5.0, 20.0, 0.0, 15.0, 70.0, 15.0, 15.0, 5.0, 0.0, 15.0, 5.0, 25.0, 25.0, 5.0, 15.0, 45.0, 45.0, 15.0, 30.0, 60.0, 5.0, 25.0, 10.0, 40.0, 20.0, 10.0, 15.0, 25.0, 25.0, 40.0, 65.0, 20.0, 20.0, 0.0, 5.0, 20.0, 0.0, 0.0, 25.0, 15.0, 40.0, 0.0, 15.0, 15.0, 20.0, 10.0, 65.0, 65.0, 65.0, 20.0, 25.0, 25.0, 0.0, 5.0, 25.0, 30.0, 20.0, 15.0, 20.0, 0.0], (3000, 1500): [10.0, 0.0, 20.0, 0.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 10.0, 20.0, 30.0, 25.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 5.0, 25.0, 0.0, 0.0, 5.0, 30.0, 15.0, 30.0, 5.0, 5.0, 5.0, 0.0, 10.0, 5.0, 20.0, 10.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 15.0, 5.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, 25.0, 10.0, 35.0, 0.0, 20.0, 10.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 20.0, 10.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 55.0, 10.0, 0.0, 0.0, 15.0, 5.0, 10.0, 5.0, 15.0, 65.0, 10.0, 10.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 30.0, 10.0, 65.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 30.0, 10.0, 30.0, 15.0, 5.0, 35.0, 0.0, 35.0, 15.0, 5.0, 10.0, 35.0, 25.0, 5.0, 40.0, 0.0, 0.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 40.0, 5.0, 10.0, 5.0, 20.0, 30.0, 15.0, 0.0, 20.0, 35.0, 0.0, 0.0, 10.0, 15.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 20.0, 10.0, 15.0, 5.0, 0.0, 20.0, 10.0, 0.0, 20.0, 20.0, 5.0, 0.0, 5.0, 15.0, 0.0, 5.0, 15.0, 0.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 5.0, 10.0, 0.0, 0.0, 25.0, 45.0, 30.0, 15.0, 20.0, 30.0, 20.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, 10.0, 15.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 35.0, 15.0, 40.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 0.0, 25.0, 20.0, 5.0, 35.0, 5.0, 10.0, 5.0, 5.0, 10.0, 80.0, 0.0, 0.0, 10.0, 15.0, 0.0, 30.0, 5.0, 5.0, 10.0, 0.0, 0.0, 40.0, 25.0, 10.0, 35.0, 25.0, 45.0, 10.0, 0.0, 15.0, 10.0, 0.0, 80.0, 0.0, 0.0, 0.0, 5.0, 30.0, 5.0, 25.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 30.0, 5.0, 20.0, 30.0, 5.0, 5.0, 35.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 35.0, 5.0, 5.0, 0.0, 10.0, 5.0, 65.0, 10.0, 45.0, 0.0, 20.0, 5.0, 50.0, 10.0, 5.0, 15.0, 5.0, 20.0, 5.0, 5.0, 20.0, 30.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 5.0, 25.0, 5.0, 5.0, 0.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 40.0, 5.0, 0.0, 5.0, 0.0, 30.0, 0.0, 25.0, 5.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 10.0, 20.0, 25.0, 5.0, 10.0, 5.0, 20.0, 10.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 15.0, 5.0, 5.0, 0.0, 80.0, 25.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 30.0, 0.0, 10.0, 10.0, 15.0, 5.0, 0.0, 15.0, 25.0, 5.0, 0.0, 0.0, 15.0, 0.0, 30.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 40.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 10.0, 5.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 20.0, 15.0, 30.0, 5.0, 20.0, 15.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 35.0, 25.0, 10.0, 0.0, 25.0, 15.0, 10.0, 5.0, 10.0, 20.0, 15.0, 5.0, 0.0, 10.0, 15.0, 35.0, 15.0, 0.0, 5.0, 40.0, 5.0, 50.0, 5.0, 0.0, 25.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 25.0, 15.0, 25.0, 10.0, 0.0, 5.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 30.0, 0.0, 30.0, 10.0, 15.0, 15.0, 25.0, 5.0, 0.0, 5.0, 20.0, 5.0, 5.0, 25.0, 5.0, 75.0, 20.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 10.0, 5.0, 40.0, 0.0, 30.0, 35.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 15.0], (7500, 1500): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 95.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (4500, 3000): [0.0, 20.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, -1.0, 20.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 15.0, 0.0, 10.0, 0.0, 10.0, 15.0, 15.0, 0.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 5.0, 0.0, -1.0, 0.0, 30.0, 15.0, 0.0, 35.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 60.0, 0.0, 10.0, 15.0, 15.0, 5.0, 15.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 0.0, -1.0, 10.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 35.0, 40.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 10.0, 10.0, 90.0, 10.0, 5.0, 0.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 85.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, -1.0, 50.0, 0.0, -1.0, 45.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 65.0, 15.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 65.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, 15.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 20.0, 0.0, 20.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 35.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 50.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 15.0, 30.0, 0.0, 5.0, 20.0, 10.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 60.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 15.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 65.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 45.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 5.0, 5.0, 30.0, 10.0, 50.0, 70.0, 20.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 50.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 35.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 15.0, 0.0, 10.0, -1.0, 35.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 45.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, -1.0, 10.0, 0.0, 35.0, -1.0, 25.0, 0.0, 0.0, 5.0, 25.0, 5.0, 20.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 25.0], (7500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (0, 0): [20.0, 15.0, 60.0, 95.0, 35.0, 80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 10.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 10.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 55.0, 5.0, 20.0, 10.0, 90.0, 10.0, 15.0, 5.0, 30.0, 60.0, 75.0, 40.0, 20.0, 50.0, 25.0, 90.0, 50.0, 45.0, 75.0, 90.0, 10.0, 25.0, 35.0, 65.0, -1.0, 20.0, 5.0, 0.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 85.0, -1.0, 85.0, 75.0, 20.0, 65.0, 10.0, 45.0, 35.0, 0.0, 75.0, 70.0, 40.0, 65.0, -1.0, 65.0, 5.0, 20.0, 45.0, 15.0, 75.0, 0.0, 95.0, 85.0, 0.0, -1.0, 20.0, 15.0, 30.0, 5.0, 0.0, -1.0, 15.0, 30.0, -1.0, 0.0, 80.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 0.0, 65.0, 35.0, 35.0, 70.0, 80.0, 70.0, 25.0, 25.0, 5.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 10.0, 30.0, 40.0, 75.0, 10.0, 15.0, 35.0, 10.0, -1.0, 25.0, -1.0, 20.0, 80.0, 45.0, 50.0, 20.0, 0.0, 90.0, 95.0, 25.0, 5.0, -1.0, 40.0, 10.0, 40.0, 25.0, 15.0, 65.0, 5.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 35.0, 30.0, 5.0, 40.0, 85.0, 80.0, 10.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 5.0, 90.0, 10.0, 15.0, 50.0, 15.0, 5.0, 95.0, 20.0, 20.0, 40.0, 15.0], (7500, 3000): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 5.0, 25.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 45.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6000, 1500): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (4500, 1500): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 55.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 30.0, 0.0, 60.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 55.0, 25.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, 5.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 20.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, -1.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 70.0, 0.0, 5.0, 45.0, 0.0, -1.0, 15.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 15.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 20.0, 0.0, -1.0, 10.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 65.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 30.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7500, 6000): [-1.0], (6000, 4500): [0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 15.0, 0.0, -1.0, 0.0, 10.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, 0.0, -1.0, 30.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 5.0, 15.0, -1.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 5.0, 55.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 40.0, -1.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, 0.0, 15.0, 0.0, -1.0, 45.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 45.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 25.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, 45.0, -1.0, 20.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 75.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 15.0, -1.0, 35.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0], (3000, 3000): [0.0, 0.0, 0.0, 5.0, 70.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 40.0, 5.0, 35.0, 25.0, 5.0, 45.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 40.0, 30.0, 0.0, 5.0, 10.0, 5.0, 15.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 10.0, 5.0, 5.0, 15.0, 0.0, 0.0], (6000, 3000): [0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 65.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, 10.0, -1.0, 30.0, -1.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 35.0, 5.0, 10.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 50.0, 0.0, 25.0, 0.0, -1.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 40.0, -1.0, 30.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 35.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 85.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 20.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 15.0, -1.0, 5.0, 0.0, -1.0, 10.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 65.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 15.0, -1.0, 40.0, -1.0, 40.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 25.0, 5.0, -1.0, -1.0, 10.0, 10.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 20.0, 5.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, 50.0, -1.0, -1.0, 20.0, 0.0, 60.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, 10.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, 25.0, 0.0, -1.0, -1.0, 45.0, 60.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 50.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 55.0, 0.0, 15.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 35.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, -1.0, 0.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0], (1500, 0): [20.0, 35.0, 65.0, 10.0, 20.0, 5.0, 65.0, 5.0, 5.0, -1.0, 0.0, 20.0, 65.0, 15.0, 10.0, 65.0, 25.0, 15.0, 55.0, 15.0, 5.0, 25.0, 35.0, 10.0, 10.0, 0.0, 5.0, 5.0, 30.0, 25.0, 35.0, 5.0, 60.0, 40.0, 50.0, 20.0, 0.0, 60.0, 20.0, 30.0, 10.0, 10.0, 20.0, 5.0, 90.0, 10.0, 20.0, 15.0, 40.0, 5.0, -1.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 20.0, 15.0, 5.0, -1.0, 60.0, 0.0, 5.0, 20.0, 40.0, 10.0, 45.0, 30.0, 0.0, 50.0, 15.0, 30.0, 15.0, 20.0, 5.0, 25.0, 85.0, 20.0, 50.0, 5.0, 40.0, 70.0, 40.0, 5.0, 5.0, 30.0, 5.0, 30.0, 90.0, 25.0, -1.0, 30.0, 40.0, 25.0, 45.0, -1.0, 20.0, 10.0, 10.0, 25.0, 0.0, 10.0, 35.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 45.0, 5.0, 55.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 25.0, 20.0, 15.0, 50.0, 0.0, 30.0, -1.0, 0.0, 25.0, 20.0, 25.0, 100.0, 5.0, 5.0, 25.0, 5.0, 50.0, 20.0, 55.0, 55.0, 65.0, 15.0, 5.0, 0.0, 5.0, 5.0, 10.0, 10.0, 5.0, 15.0, 15.0, -1.0, 30.0, 20.0, 15.0, -1.0, 20.0, 65.0, 50.0, 0.0, 40.0, 30.0, 0.0, 0.0, 10.0, 30.0, 70.0, 60.0, 0.0, 5.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 20.0, 45.0, 85.0, 10.0, 45.0, 0.0, 50.0, 60.0, 5.0, 55.0, 75.0, 15.0, 5.0, 20.0, 10.0, 25.0, 25.0, 35.0, 20.0, 25.0, 0.0, 5.0, 20.0, 0.0, 70.0, 60.0, 90.0, 10.0, 40.0, 25.0, -1.0, 5.0, 70.0, 20.0, 5.0, 0.0, 30.0, -1.0, 10.0, 0.0, -1.0, 10.0, 25.0, -1.0, 35.0, 55.0, 0.0, -1.0, 65.0, 25.0, 40.0, 45.0, 20.0, 15.0, -1.0, 25.0, 70.0, 20.0, 0.0, 15.0, 15.0, 15.0, 20.0, 65.0, 0.0, 0.0, 15.0, 65.0, 25.0, 5.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 0.0, 95.0, 30.0, 55.0, 15.0, 5.0, 40.0, 0.0, 10.0, 75.0, 15.0, 5.0, 10.0, 50.0, 35.0, 35.0, 0.0, 30.0, 5.0, 40.0, 25.0, 5.0, 0.0, 5.0, 75.0, 10.0, 20.0, 50.0, -1.0, 5.0, 10.0, 80.0, 40.0, 10.0, 15.0, 0.0, 30.0, -1.0, 65.0, 10.0, 40.0, 0.0, 15.0, -1.0, 80.0, 5.0, 70.0, 20.0, 85.0, 15.0, 15.0, 25.0, 5.0, 5.0, 20.0, 25.0, 30.0, 5.0, 25.0, 55.0, 15.0, 5.0, 30.0, 35.0, 10.0, -1.0, 5.0, 5.0, 0.0, 20.0, 15.0, 50.0, 5.0, 15.0, 20.0, 0.0, 35.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 50.0, 65.0, 5.0, 0.0, 0.0, 95.0, 80.0, 15.0, 0.0, 15.0, 5.0, 15.0, 5.0, 5.0, 50.0, 10.0, 0.0, 25.0, 20.0, 0.0, 15.0, 10.0, 20.0, 70.0, 5.0, -1.0, 15.0, 0.0, 85.0], (7500, 4500): [0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 55.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 25.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, 55.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, 45.0, -1.0, 5.0, 0.0, 0.0, 20.0, 5.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, 80.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0]}
mpc_dash_syth_hyb_pen_table_1600 = {(4800, 3200): [20.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 10.0, 10.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 35.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 30.0, 10.0, 20.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 60.0, 0.0, 15.0, 0.0, 5.0, 15.0, 80.0, 0.0, 25.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 15.0, -1.0, 0.0, 10.0, 0.0, 10.0, 25.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 35.0, 0.0, -1.0, 40.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 35.0, 15.0, 10.0, 10.0, 10.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 45.0, 0.0, 0.0, 15.0, 0.0, 50.0, 55.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 65.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 65.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 10.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 45.0, 5.0, 10.0, 40.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 40.0, 20.0, 0.0, 0.0, 10.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 20.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 45.0, 0.0, 15.0, 0.0, 5.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 60.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 50.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 60.0, 0.0, 5.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, 10.0, 0.0, -1.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 20.0, 10.0, 45.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 5.0, 10.0, 50.0, 0.0, 0.0, 0.0, 0.0, 70.0, 20.0, 0.0, -1.0, 5.0, 0.0, 0.0, 75.0, 0.0, 35.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, -1.0, -1.0, 55.0, 0.0, 50.0, 5.0, 20.0, 0.0, 15.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 40.0, 0.0, -1.0, 10.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 15.0, 0.0, 10.0, -1.0, 35.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, 45.0, 15.0, 0.0, 0.0, 0.0, 0.0, 45.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 10.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, 5.0, 25.0], (3200, 1600): [0.0, 0.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 35.0, 5.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 5.0, 10.0, 20.0, 20.0, 30.0, 25.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 25.0, 15.0, 0.0, 0.0, 5.0, 0.0, 15.0, 30.0, 5.0, 5.0, 0.0, 10.0, 20.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0, 15.0, 15.0, 5.0, 20.0, 0.0, 5.0, 5.0, 5.0, 0.0, 25.0, 0.0, 5.0, 15.0, 10.0, 35.0, 0.0, 20.0, 10.0, 0.0, 50.0, 10.0, 5.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 10.0, 5.0, 25.0, 15.0, 10.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 15.0, 5.0, 0.0, 5.0, 15.0, 30.0, 65.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 70.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 35.0, 15.0, 0.0, 20.0, 10.0, 0.0, 15.0, 0.0, 10.0, 30.0, 10.0, 0.0, 15.0, 15.0, 5.0, 5.0, 35.0, 0.0, 35.0, 0.0, 15.0, 10.0, 5.0, 35.0, 25.0, 5.0, 40.0, 0.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 5.0, 0.0, 30.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 40.0, 5.0, 5.0, 40.0, 10.0, 0.0, 20.0, 35.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 5.0, 15.0, 5.0, 0.0, 55.0, 25.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 5.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 10.0, 5.0, 15.0, 0.0, 15.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 5.0, 35.0, 10.0, 0.0, 50.0, 45.0, 30.0, 15.0, 20.0, 30.0, 20.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 35.0, 15.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 45.0, 10.0, 10.0, 0.0, 0.0, 25.0, 5.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 80.0, 0.0, 0.0, 10.0, 10.0, 0.0, 15.0, 0.0, 30.0, 5.0, 10.0, 5.0, 10.0, 0.0, 0.0, 25.0, 10.0, 0.0, 35.0, 0.0, 25.0, 45.0, 20.0, 10.0, 0.0, 15.0, 10.0, 0.0, 80.0, 0.0, 0.0, 30.0, 5.0, 25.0, 5.0, 0.0, 10.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 30.0, 5.0, 30.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 35.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 45.0, 0.0, 20.0, 5.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 45.0, 5.0, 15.0, 5.0, 25.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 40.0, 5.0, -1.0, 5.0, 20.0, 30.0, 0.0, 25.0, 5.0, 15.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 20.0, 25.0, 5.0, 10.0, 10.0, 5.0, 0.0, 10.0, 40.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 5.0, 30.0, 0.0, 5.0, 0.0, 80.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, 5.0, 5.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 15.0, 5.0, 40.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 65.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 10.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 15.0, 5.0, 30.0, 5.0, 20.0, 15.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 20.0, 10.0, 0.0, 5.0, 0.0, 35.0, 25.0, 10.0, 0.0, 25.0, 20.0, 15.0, 5.0, 10.0, 5.0, 10.0, 5.0, 20.0, 5.0, 5.0, 5.0, 0.0, 10.0, 15.0, 35.0, 15.0, 0.0, 5.0, 5.0, 5.0, 0.0, 35.0, 50.0, 5.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 5.0, 0.0, 25.0, 10.0, 0.0, 20.0, 5.0, 0.0, 10.0, 15.0, 0.0, -1.0, 10.0, 10.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 10.0, 5.0, 30.0, 5.0, 0.0, 30.0, 15.0, 25.0, 5.0, 0.0, 0.0, 5.0, 20.0, 20.0, 5.0, 5.0, 25.0, 5.0, 20.0, 5.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 10.0, 5.0, 40.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 15.0], (3200, 3200): [0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 70.0, 0.0, 35.0, 0.0, 15.0, 0.0, 0.0, 20.0, 0.0, 35.0, 5.0, 45.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 10.0, 10.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0, 90.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 40.0, 0.0, 10.0, 10.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 5.0, 0.0, 5.0, 30.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 25.0, 5.0, 0.0, 15.0, 0.0, 0.0, 15.0], (8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6400, 3200): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 15.0, -1.0, 0.0, -1.0, 65.0, -1.0, 0.0, 10.0, 0.0, 30.0, 10.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, 35.0, 10.0, 5.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 50.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, 35.0, 35.0, 5.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 50.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 10.0, 40.0, -1.0, 30.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 10.0, 5.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 55.0, 15.0, 5.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 85.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 5.0, 0.0, 20.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 30.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, 5.0, -1.0, 10.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, 50.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 80.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 10.0, 15.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 10.0, 25.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 15.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, -1.0, 35.0, -1.0, -1.0, -1.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0], (3200, 0): [0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 30.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 30.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (4800, 0): [-1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (0, 0): [20.0, 15.0, 60.0, 95.0, 35.0, 80.0, 45.0, 20.0, 40.0, 5.0, 65.0, 10.0, 10.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 10.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 90.0, 55.0, 5.0, 20.0, 10.0, 90.0, 15.0, 10.0, 15.0, 5.0, 0.0, 30.0, 60.0, 75.0, 40.0, 20.0, 50.0, 25.0, 90.0, 50.0, 0.0, 45.0, 75.0, 90.0, 10.0, 5.0, 25.0, 35.0, 65.0, -1.0, 50.0, 40.0, 20.0, 5.0, 0.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 55.0, 0.0, 5.0, 85.0, -1.0, 85.0, 75.0, 20.0, 65.0, 10.0, 45.0, 35.0, 20.0, 0.0, 5.0, 75.0, 70.0, 5.0, 40.0, 65.0, -1.0, 65.0, 0.0, 5.0, 20.0, 45.0, 15.0, 75.0, -1.0, 0.0, 85.0, 95.0, 85.0, 0.0, -1.0, 20.0, 15.0, 30.0, 5.0, 0.0, -1.0, 15.0, 30.0, -1.0, 0.0, 80.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 0.0, 65.0, 35.0, 35.0, 70.0, 80.0, 70.0, 25.0, 25.0, 25.0, 5.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 70.0, 10.0, 30.0, 20.0, 40.0, 75.0, 10.0, 10.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 5.0, 45.0, 50.0, 20.0, 0.0, 90.0, 95.0, 25.0, 5.0, -1.0, 40.0, 10.0, 50.0, 40.0, 10.0, 25.0, 15.0, 65.0, 5.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 15.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 30.0, 35.0, 30.0, 5.0, 40.0, 85.0, 0.0, 80.0, 15.0, 10.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 5.0, 90.0, 10.0, 15.0, 50.0, 15.0, 5.0, 95.0, 20.0, 20.0, 40.0, -1.0, 15.0], (1600, 0): [20.0, 35.0, 65.0, 10.0, 20.0, 5.0, 65.0, 5.0, 5.0, -1.0, 0.0, 20.0, 65.0, 15.0, 10.0, 65.0, 25.0, 15.0, 5.0, 55.0, 15.0, 5.0, 25.0, 35.0, 10.0, 0.0, 10.0, 10.0, 0.0, 5.0, 5.0, 0.0, 25.0, 20.0, 30.0, 25.0, 35.0, 5.0, 60.0, 5.0, 40.0, 50.0, 20.0, 0.0, 60.0, 10.0, 20.0, 30.0, 10.0, 10.0, 0.0, 20.0, -1.0, 5.0, 10.0, 20.0, 50.0, 40.0, 5.0, -1.0, 70.0, 15.0, -1.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 20.0, 15.0, 5.0, -1.0, 60.0, 0.0, 5.0, 5.0, 20.0, 40.0, 10.0, 80.0, 45.0, 30.0, 50.0, 0.0, 15.0, 30.0, 15.0, 20.0, 25.0, 85.0, 20.0, 5.0, 75.0, 70.0, 40.0, 5.0, 5.0, 10.0, 5.0, 30.0, 5.0, 30.0, 15.0, 90.0, 25.0, -1.0, 30.0, 40.0, 25.0, 45.0, -1.0, 20.0, 10.0, 10.0, 25.0, -1.0, 0.0, 10.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 45.0, 5.0, 55.0, 5.0, 30.0, 40.0, 40.0, 5.0, 25.0, 20.0, 15.0, 50.0, 0.0, -1.0, 0.0, 30.0, 75.0, -1.0, 0.0, 25.0, 15.0, 20.0, 25.0, 10.0, 25.0, 100.0, 5.0, 5.0, 25.0, 5.0, 50.0, 55.0, 55.0, 0.0, 5.0, 65.0, 15.0, 20.0, 0.0, 5.0, 45.0, 45.0, 10.0, 10.0, 5.0, 15.0, 15.0, -1.0, 30.0, 5.0, 20.0, 5.0, 15.0, -1.0, 20.0, 65.0, 50.0, 40.0, 30.0, 0.0, 0.0, 10.0, 30.0, 70.0, 60.0, 0.0, 5.0, -1.0, 100.0, 5.0, 15.0, 0.0, 20.0, 45.0, 85.0, 10.0, 45.0, 0.0, 50.0, 60.0, 5.0, 55.0, 75.0, 5.0, 15.0, 15.0, 5.0, 20.0, 10.0, 25.0, 25.0, 35.0, 20.0, 25.0, 0.0, 5.0, 20.0, 0.0, 70.0, 60.0, 90.0, 10.0, 40.0, 25.0, 25.0, -1.0, 5.0, 35.0, 5.0, 70.0, 20.0, 25.0, 5.0, 0.0, 30.0, -1.0, 10.0, 0.0, -1.0, 10.0, -1.0, 35.0, 10.0, 55.0, 0.0, -1.0, 65.0, 25.0, 40.0, 15.0, 45.0, 20.0, 20.0, 10.0, 5.0, 15.0, -1.0, 25.0, 10.0, 20.0, 0.0, 15.0, 5.0, 30.0, 15.0, 15.0, 65.0, 15.0, 0.0, 0.0, 15.0, 65.0, 25.0, 5.0, 10.0, 10.0, 50.0, 55.0, 0.0, 25.0, 0.0, 30.0, 15.0, 5.0, 5.0, 40.0, 0.0, 10.0, 75.0, 15.0, 65.0, 10.0, 50.0, 5.0, 65.0, 35.0, 35.0, 5.0, 0.0, 10.0, 0.0, 30.0, 5.0, 40.0, 25.0, 5.0, 0.0, 5.0, 75.0, 10.0, 20.0, -1.0, 5.0, 80.0, 40.0, 10.0, 0.0, 15.0, 0.0, 30.0, 45.0, 0.0, -1.0, 30.0, 10.0, 65.0, 10.0, 40.0, 0.0, 15.0, -1.0, 80.0, 10.0, 5.0, 70.0, 20.0, 85.0, 25.0, 5.0, 5.0, 25.0, 10.0, 20.0, 25.0, 30.0, 5.0, 65.0, 25.0, 55.0, 15.0, 5.0, 15.0, 5.0, 35.0, 10.0, -1.0, 5.0, 5.0, 20.0, 50.0, 5.0, 15.0, 20.0, 25.0, 0.0, 35.0, 95.0, 5.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 50.0, 65.0, 5.0, 0.0, 65.0, 0.0, 95.0, 80.0, 15.0, 0.0, 25.0, 15.0, 5.0, 15.0, 5.0, 5.0, 5.0, 50.0, 10.0, 0.0, 25.0, 0.0, 20.0, 0.0, 15.0, 10.0, 20.0, 70.0, 5.0, 15.0, 0.0, 85.0], (6400, 4800): [10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, 5.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 40.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 45.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 10.0, 10.0, -1.0, 55.0, -1.0, 20.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0], (8000, 1600): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 95.0, -1.0, 0.0, -1.0], (6400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 3200): [-1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (4800, 1600): [0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 15.0, -1.0, 5.0, 0.0, 25.0, 20.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 65.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 30.0, -1.0, 5.0, 0.0, 0.0, 60.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 20.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 30.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 70.0, 0.0, -1.0, 0.0, 20.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 5.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 25.0, 0.0, 15.0, 0.0, 30.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 20.0, 60.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 5.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0], (1600, 1600): [10.0, 0.0, 20.0, 5.0, 20.0, 5.0, 30.0, 0.0, 0.0, 80.0, 5.0, 20.0, 10.0, 35.0, 25.0, 40.0, 0.0, 25.0, 0.0, 30.0, 25.0, 25.0, 0.0, 10.0, 30.0, 40.0, 5.0, 5.0, 10.0, 40.0, 0.0, 25.0, 10.0, 5.0, 70.0, 30.0, 20.0, 10.0, 35.0, 65.0, 15.0, 25.0, 20.0, 0.0, 25.0, 0.0, 45.0, 10.0, 0.0, 35.0, 45.0, 0.0, 25.0, 0.0, 5.0, 5.0, 5.0, 55.0, 5.0, 15.0, 0.0, 20.0, 95.0, 50.0, 5.0, 5.0, 0.0, 55.0, 10.0, 20.0, 10.0, 40.0, 5.0, 20.0, 65.0, 0.0, 5.0, 0.0, 25.0, 0.0, 20.0, 45.0, 15.0, 30.0, 10.0, 35.0, 10.0, 40.0, 0.0, 0.0, 25.0, 40.0, 0.0, 15.0, 5.0, 45.0, 10.0, 20.0, 30.0, 15.0, 35.0, 65.0, 60.0, 0.0, 10.0, 35.0, 95.0, 0.0, 25.0, 30.0, 25.0, 30.0, 15.0, 30.0, 20.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 45.0, 0.0, 55.0, 20.0, 30.0, 35.0, 0.0, 10.0, 0.0, 5.0, 35.0, 25.0, 5.0, 5.0, 60.0, 40.0, 35.0, 100.0, 5.0, 15.0, 20.0, 10.0, 0.0, 20.0, 20.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 45.0, 10.0, 25.0, 40.0, 80.0, 20.0, 55.0, 95.0, 0.0, 50.0, 30.0, 15.0, 10.0, 20.0, 5.0, 15.0, 5.0, 25.0, 25.0, 0.0, 65.0, 5.0, 5.0, 15.0, 5.0, 10.0, 100.0, 25.0, 5.0, 20.0, 0.0, 10.0, 5.0, 70.0, 30.0, 20.0, 50.0, 45.0, 30.0, 0.0, 5.0, 20.0, 85.0, 55.0, 10.0, 25.0, 45.0, 25.0, 15.0, 25.0, 5.0, 20.0, 15.0, 40.0, 0.0, 10.0, 15.0, 20.0, 15.0, 5.0, 15.0, 0.0, 20.0, 0.0, 25.0, 60.0, 5.0, 5.0, 15.0, 15.0, 0.0, 10.0, 20.0, 15.0, 30.0, 5.0, 15.0, 25.0, 20.0, 15.0, 70.0, 15.0, 15.0, 5.0, 0.0, 15.0, 5.0, 25.0, 25.0, 5.0, 15.0, 45.0, 15.0, 60.0, 10.0, 5.0, 25.0, 10.0, 35.0, 20.0, 15.0, 40.0, 20.0, 15.0, 5.0, 5.0, 0.0, 25.0, 5.0, 40.0, 20.0, 20.0, 0.0, 40.0, 20.0, 0.0, 0.0, 15.0, 40.0, 0.0, 25.0, 15.0, 15.0, 15.0, 5.0, 20.0, 10.0, 65.0, 65.0, 20.0, 15.0, 25.0, 75.0, 0.0, 5.0, 5.0, 25.0, 30.0, 20.0, 15.0, 35.0, 20.0, 0.0, 0.0], (4800, 4800): [35.0, 0.0, 30.0, 0.0, 0.0, 0.0, 20.0, -1.0], (6400, 1600): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (8000, 4800): [-1.0, 10.0, 0.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 25.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 20.0, 5.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 5.0, 80.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_1700 = {(8500, 1700): [-1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, -1.0, -1.0, -1.0], (3400, 0): [0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 20.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1700, 1700): [10.0, 20.0, 5.0, 45.0, 20.0, 30.0, 0.0, 0.0, 15.0, 5.0, 20.0, 5.0, 10.0, 25.0, 40.0, 0.0, 25.0, 25.0, 0.0, 30.0, 25.0, 10.0, 25.0, 5.0, 0.0, 10.0, 30.0, 5.0, 5.0, 10.0, 40.0, 0.0, 25.0, 10.0, 10.0, 0.0, 30.0, 20.0, 10.0, 35.0, 15.0, 5.0, 25.0, 20.0, 0.0, 25.0, 0.0, 50.0, 10.0, 0.0, 35.0, 45.0, 0.0, 25.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 55.0, 15.0, 0.0, 0.0, 95.0, 50.0, 5.0, 5.0, 5.0, 55.0, 10.0, 10.0, 15.0, 70.0, 10.0, 0.0, 40.0, 5.0, 10.0, 20.0, 65.0, 0.0, 5.0, 25.0, 0.0, 20.0, 45.0, 15.0, 30.0, 10.0, 35.0, 10.0, 40.0, 0.0, 0.0, 10.0, 40.0, 0.0, 30.0, 5.0, 45.0, 10.0, 20.0, 30.0, 15.0, 65.0, 60.0, 0.0, 0.0, 0.0, 10.0, 35.0, 95.0, 0.0, 30.0, 25.0, 30.0, 15.0, 30.0, 20.0, 0.0, 15.0, 0.0, 45.0, 0.0, 55.0, 30.0, 20.0, 30.0, 35.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 35.0, 25.0, 5.0, 15.0, 40.0, 35.0, 100.0, 5.0, 20.0, 10.0, 0.0, 20.0, 25.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 10.0, 45.0, 10.0, 25.0, 40.0, 25.0, 20.0, 55.0, 0.0, 30.0, 0.0, 15.0, 10.0, 20.0, 5.0, 15.0, 5.0, 25.0, 25.0, 0.0, 0.0, 5.0, 65.0, 5.0, 5.0, 15.0, 10.0, 10.0, 5.0, 25.0, 5.0, 0.0, 20.0, 0.0, 10.0, 5.0, 70.0, 0.0, 10.0, 10.0, 50.0, 45.0, 5.0, 30.0, 0.0, 5.0, 20.0, 85.0, 55.0, 10.0, 40.0, 15.0, 25.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 0.0, 10.0, 15.0, 20.0, 15.0, 5.0, 15.0, 0.0, 20.0, 5.0, 0.0, 0.0, 25.0, 60.0, 0.0, 5.0, 10.0, 15.0, 0.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 5.0, 20.0, 10.0, 15.0, 15.0, 15.0, 5.0, 0.0, 15.0, 0.0, 25.0, 25.0, 5.0, 15.0, 45.0, 15.0, 10.0, 60.0, 10.0, 5.0, 25.0, 10.0, 35.0, 10.0, 20.0, 40.0, 20.0, 15.0, 15.0, 5.0, 5.0, 0.0, 15.0, 5.0, 25.0, 5.0, 40.0, 15.0, 10.0, 0.0, 15.0, 0.0, 40.0, 20.0, 25.0, 0.0, 0.0, 15.0, 40.0, 25.0, 15.0, 25.0, 5.0, 15.0, 15.0, 5.0, 20.0, 10.0, 65.0, 65.0, 15.0, 25.0, 25.0, 75.0, 0.0, 5.0, 5.0, 10.0, 25.0, 30.0, 20.0, 15.0, 35.0, 20.0, 0.0, 0.0], (5100, 0): [-1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (3400, 1700): [0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 35.0, 5.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 70.0, 0.0, 5.0, 5.0, 0.0, 35.0, 10.0, 20.0, 20.0, 30.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 25.0, 15.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 30.0, 5.0, 5.0, 0.0, 10.0, 0.0, 15.0, 20.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 15.0, 5.0, 20.0, 5.0, 5.0, 5.0, 0.0, 25.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 35.0, 0.0, 20.0, 20.0, 10.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 0.0, 10.0, 5.0, 35.0, 25.0, 15.0, 10.0, 0.0, 0.0, 20.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 10.0, 5.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 0.0, 5.0, 0.0, 15.0, 30.0, 65.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 35.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 15.0, 0.0, 10.0, 30.0, 10.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 5.0, 5.0, 10.0, 35.0, 5.0, 35.0, 0.0, 15.0, 10.0, 5.0, 5.0, 35.0, 5.0, 40.0, 0.0, 10.0, 15.0, 10.0, 5.0, 10.0, 10.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 40.0, 0.0, 10.0, 5.0, 5.0, 15.0, 40.0, 30.0, 0.0, 10.0, 0.0, 0.0, 20.0, 35.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 5.0, 0.0, 55.0, 25.0, 20.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 10.0, 40.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 5.0, 0.0, 35.0, 10.0, 0.0, 50.0, 45.0, 30.0, 15.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 35.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 45.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 5.0, 10.0, 0.0, 80.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 25.0, 45.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 80.0, 0.0, 0.0, -1.0, 5.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 5.0, 30.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 45.0, 30.0, 0.0, 20.0, 5.0, 15.0, 50.0, 10.0, 0.0, 10.0, 0.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 45.0, 0.0, 5.0, 15.0, 5.0, 25.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 20.0, 25.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 55.0, 0.0, 15.0, 5.0, 0.0, 0.0, 40.0, 5.0, -1.0, 5.0, 20.0, 30.0, 0.0, 25.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0, 0.0, 0.0, 20.0, 25.0, 5.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, 10.0, 30.0, 0.0, 30.0, 5.0, 10.0, 30.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 30.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 40.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 10.0, 0.0, 70.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 5.0, 20.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 20.0, 10.0, 0.0, 5.0, 0.0, 35.0, 25.0, 0.0, 10.0, 0.0, 0.0, 25.0, 20.0, 5.0, 5.0, 10.0, 5.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 10.0, 0.0, 35.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 35.0, 50.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 15.0, 0.0, -1.0, 10.0, 10.0, 0.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 30.0, 25.0, 5.0, 5.0, 0.0, 0.0, 5.0, 20.0, 20.0, 15.0, 5.0, 5.0, 25.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 15.0], (6800, 1700): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (6800, 3400): [-1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 15.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, 65.0, -1.0, 0.0, 30.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 5.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 5.0, -1.0, 15.0, 10.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 50.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 55.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 15.0, 0.0, 0.0, -1.0, 5.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, 85.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 40.0, -1.0, -1.0, 0.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 25.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, -1.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 10.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 5.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 20.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 80.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 20.0, 0.0, 10.0, 35.0, 0.0, -1.0, 35.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0], (3400, 3400): [0.0, 10.0, 0.0, 10.0, 25.0, 0.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 25.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 15.0, 20.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 10.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 75.0, 5.0, 45.0, 15.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 5.0, 35.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, 5.0, 20.0, 20.0, 5.0, 50.0, 20.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0], (6800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (8500, 5100): [0.0, 40.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, 15.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 20.0, 80.0, 15.0, 55.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0], (5100, 1700): [0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 80.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 30.0, 5.0, 0.0, 60.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, 5.0, -1.0, 20.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, -1.0, -1.0, 40.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 70.0, 0.0, 0.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, -1.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 55.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 60.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, -1.0, 5.0, 20.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0], (8500, 3400): [-1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (0, 0): [20.0, 15.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 20.0, 40.0, 5.0, 0.0, 65.0, 10.0, 10.0, 5.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 10.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 90.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 15.0, 5.0, 0.0, 30.0, 60.0, 75.0, 40.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 50.0, 0.0, 45.0, 75.0, 90.0, 15.0, 10.0, 5.0, 25.0, 35.0, 65.0, -1.0, 50.0, 40.0, 20.0, 70.0, 40.0, 5.0, 30.0, 30.0, 0.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 55.0, 0.0, 55.0, 5.0, 85.0, -1.0, 15.0, 85.0, 75.0, 20.0, 65.0, 25.0, 10.0, 45.0, 35.0, 20.0, 0.0, 55.0, 5.0, 75.0, 70.0, 5.0, 40.0, 15.0, 65.0, -1.0, -1.0, 65.0, 0.0, 5.0, 20.0, 45.0, 15.0, 75.0, -1.0, 0.0, 85.0, 95.0, 85.0, 0.0, -1.0, 20.0, 15.0, 30.0, 5.0, 0.0, -1.0, 15.0, 30.0, -1.0, 0.0, 80.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 0.0, 65.0, 35.0, 35.0, -1.0, 70.0, 80.0, 70.0, 25.0, 25.0, 25.0, 5.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 70.0, 10.0, 30.0, 20.0, 40.0, 75.0, 10.0, 10.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 15.0, 5.0, 45.0, 50.0, 20.0, 0.0, 90.0, 95.0, 25.0, 5.0, -1.0, 10.0, 40.0, 10.0, 50.0, 40.0, 10.0, 25.0, 15.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 15.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 30.0, 35.0, 30.0, -1.0, 5.0, 40.0, 85.0, 0.0, 80.0, 15.0, 10.0, 95.0, 75.0, 0.0, 100.0, 80.0, 5.0, 5.0, 15.0, 90.0, 15.0, 10.0, 15.0, 50.0, 15.0, 5.0, 95.0, 20.0, 20.0, 20.0, 40.0, -1.0, 15.0], (5100, 3400): [0.0, 0.0, 20.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 10.0, -1.0, 5.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, -1.0, -1.0, 5.0, 0.0, 0.0, 15.0, 20.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 5.0, 10.0, 5.0, 0.0, 40.0, 0.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 15.0, 0.0, 30.0, -1.0, 35.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 50.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 60.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 15.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 40.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, 35.0, 15.0, 10.0, 10.0, 10.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, 50.0, -1.0, 5.0, 55.0, 0.0, 25.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 65.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 40.0, -1.0, 0.0, 0.0, -1.0, 35.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 30.0, 10.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 45.0, 5.0, 10.0, -1.0, 40.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 40.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 10.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 45.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 60.0, 0.0, 0.0, 0.0, 15.0, 0.0, 50.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 30.0, 15.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, -1.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, 0.0, -1.0, 0.0, 0.0, 0.0, 60.0, 0.0, 5.0, -1.0, -1.0, 5.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, -1.0, 20.0, -1.0, 45.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 10.0, 50.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 15.0, -1.0, 5.0, 0.0, 0.0, 75.0, 35.0, 0.0, -1.0, 0.0, 45.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 90.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 50.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 55.0, 0.0, 15.0, 0.0, 15.0, 5.0, -1.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 20.0, 0.0, 40.0, 0.0, 10.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, -1.0, 35.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 45.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 45.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 35.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 5.0, 0.0, 25.0], (6800, 5100): [-1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 30.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, -1.0, 55.0, 15.0, -1.0, 0.0, 10.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, 5.0, -1.0, 0.0, -1.0, 10.0], (1700, 0): [0.0, 20.0, 5.0, 65.0, 80.0, 10.0, 20.0, 5.0, 35.0, 65.0, 5.0, 5.0, -1.0, 20.0, 65.0, 15.0, 10.0, 65.0, 25.0, 15.0, 40.0, 5.0, 5.0, 55.0, 15.0, 25.0, 35.0, 10.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 70.0, 5.0, 5.0, 0.0, 65.0, 15.0, 25.0, 20.0, 30.0, 10.0, 45.0, 25.0, 35.0, 10.0, 5.0, 60.0, 5.0, 40.0, 20.0, 0.0, 60.0, 10.0, 0.0, 20.0, 30.0, 10.0, 10.0, 0.0, 20.0, 15.0, 5.0, -1.0, 5.0, 10.0, 20.0, 50.0, 40.0, 0.0, 5.0, -1.0, 70.0, 15.0, -1.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 20.0, 15.0, 20.0, 5.0, -1.0, 60.0, 0.0, 5.0, 0.0, 40.0, 10.0, 80.0, 45.0, 30.0, 50.0, 0.0, 15.0, 30.0, 30.0, 20.0, 25.0, 85.0, 20.0, 5.0, 75.0, 5.0, 25.0, 5.0, 10.0, 5.0, 30.0, 5.0, 15.0, 90.0, 25.0, 25.0, -1.0, 40.0, 25.0, 45.0, -1.0, 0.0, 15.0, 20.0, 10.0, 10.0, 25.0, -1.0, 0.0, 10.0, 5.0, 35.0, 35.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 25.0, 0.0, 0.0, 10.0, 45.0, 5.0, 5.0, 30.0, 40.0, 40.0, 35.0, 5.0, 25.0, 20.0, 50.0, 0.0, -1.0, 0.0, 30.0, 75.0, -1.0, 0.0, 5.0, 0.0, 0.0, 25.0, 15.0, 20.0, 25.0, 25.0, 10.0, 100.0, 5.0, 5.0, 25.0, 5.0, 50.0, 55.0, 0.0, 5.0, 65.0, 15.0, 20.0, 0.0, 10.0, 5.0, 45.0, 5.0, 45.0, 10.0, 5.0, 10.0, 5.0, 60.0, -1.0, 15.0, -1.0, 30.0, 5.0, 20.0, 5.0, 15.0, 0.0, 20.0, 65.0, 50.0, 40.0, 30.0, 0.0, 15.0, 0.0, 10.0, 30.0, 70.0, 60.0, 0.0, 5.0, -1.0, 100.0, 10.0, 5.0, 15.0, 0.0, 20.0, 20.0, 45.0, 85.0, 5.0, 0.0, 10.0, 45.0, 0.0, 5.0, 50.0, 60.0, 5.0, 55.0, 80.0, 75.0, 5.0, 15.0, 95.0, 50.0, 15.0, 5.0, 5.0, 5.0, 20.0, 15.0, 30.0, 10.0, 25.0, 25.0, 0.0, 35.0, 20.0, 25.0, 5.0, 0.0, 5.0, 20.0, 0.0, 70.0, 60.0, 90.0, 10.0, 40.0, 25.0, 25.0, 5.0, -1.0, 5.0, 0.0, 35.0, 5.0, 70.0, 5.0, 20.0, 25.0, 5.0, 0.0, 30.0, 10.0, 100.0, 0.0, -1.0, 10.0, -1.0, 35.0, -1.0, 10.0, 55.0, 0.0, -1.0, 65.0, 30.0, 25.0, 20.0, 40.0, 15.0, 45.0, 20.0, 20.0, 10.0, 0.0, 5.0, 15.0, -1.0, 25.0, 10.0, 20.0, 0.0, 15.0, 5.0, 30.0, 15.0, 15.0, 10.0, 65.0, 15.0, 0.0, 45.0, 0.0, 15.0, 65.0, 25.0, 15.0, 40.0, 15.0, 0.0, 5.0, 40.0, 10.0, 10.0, 0.0, 50.0, 55.0, 0.0, 25.0, 5.0, 0.0, 30.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 10.0, 75.0, 65.0, 10.0, 5.0, 5.0, 15.0, 50.0, 30.0, 5.0, 65.0, 15.0, 25.0, 35.0, 35.0, 5.0, 0.0, 10.0, 0.0, 70.0, 30.0, 5.0, 40.0, 25.0, 5.0, 0.0, 5.0, 75.0, 20.0, 5.0, -1.0, 5.0, 80.0, 40.0, 10.0, 0.0, 10.0, 15.0, 0.0, 30.0, 45.0, 0.0, -1.0, 30.0, 10.0, 65.0, 40.0, 0.0, 15.0, -1.0, 15.0, 80.0, 10.0, 5.0, 70.0, 20.0, 85.0, 25.0, 5.0, 5.0, 25.0, 10.0, 20.0, 25.0, 30.0, 5.0, 65.0, 25.0, 20.0, 55.0, 15.0, 20.0, 5.0, 15.0, 5.0, 35.0, 10.0, 5.0, 5.0, 20.0, 0.0, 50.0, 5.0, 15.0, 20.0, 25.0, 0.0, 0.0, 35.0, 0.0, 95.0, 5.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 50.0, 65.0, 5.0, 0.0, 65.0, 0.0, 95.0, 80.0, 0.0, 20.0, 25.0, 15.0, -1.0, 15.0, 5.0, 5.0, 5.0, 5.0, 50.0, 10.0, 0.0, 25.0, 0.0, 20.0, 0.0, 15.0, 10.0, 70.0, 5.0, 15.0, 0.0, 85.0]}
mpc_dash_syth_hyb_pen_table_1800 = {(5400, 3600): [0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, -1.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 40.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 10.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 50.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 60.0, 0.0, 35.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, 5.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 40.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, 10.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 85.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, -1.0, 15.0, 0.0, 15.0, 50.0, -1.0, 5.0, 55.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 65.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 35.0, 5.0, 10.0, 0.0, 0.0, 15.0, -1.0, 0.0, -1.0, 65.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, 35.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 5.0, 0.0, 20.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 45.0, 10.0, -1.0, 40.0, 5.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 45.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 60.0, 20.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 5.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 50.0, 0.0, -1.0, -1.0, 0.0, 0.0, 60.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 65.0, 10.0, 0.0, -1.0, 20.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 45.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, -1.0, 20.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, 75.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 90.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 50.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, -1.0, 35.0, 20.0, 0.0, -1.0, 10.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 10.0, 0.0, 0.0, -1.0, 10.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 35.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 25.0], (5400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (7200, 5400): [40.0, 0.0, -1.0, -1.0, 0.0, 45.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 10.0, 5.0, 80.0, 15.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0], (1800, 0): [0.0, 20.0, 5.0, 30.0, 65.0, 25.0, 0.0, 80.0, 20.0, 10.0, 20.0, 5.0, 35.0, 65.0, 5.0, 40.0, 5.0, 30.0, -1.0, 20.0, 65.0, 25.0, 15.0, 10.0, 10.0, 65.0, 25.0, 15.0, 40.0, 5.0, 5.0, 55.0, 15.0, 10.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 5.0, 5.0, 0.0, 65.0, 15.0, 15.0, 20.0, 0.0, 25.0, 20.0, 10.0, 45.0, 0.0, 25.0, 35.0, 10.0, 0.0, 5.0, 60.0, 5.0, 40.0, 0.0, 20.0, 0.0, 60.0, 10.0, 0.0, 20.0, 30.0, 10.0, 10.0, 0.0, 5.0, 20.0, 15.0, 5.0, -1.0, 5.0, 0.0, 20.0, 50.0, 40.0, 0.0, -1.0, 70.0, 15.0, -1.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 20.0, 15.0, 20.0, 0.0, 5.0, 60.0, 0.0, 5.0, 5.0, 0.0, 40.0, 10.0, 80.0, 45.0, 30.0, 50.0, 0.0, 5.0, 15.0, 30.0, 30.0, 20.0, 45.0, 15.0, 25.0, 20.0, 75.0, 25.0, 5.0, 10.0, 30.0, 5.0, 15.0, 90.0, 25.0, 25.0, -1.0, 40.0, 25.0, 45.0, -1.0, 0.0, 15.0, 20.0, 10.0, 10.0, 25.0, -1.0, 0.0, 10.0, 5.0, 0.0, 35.0, 35.0, 65.0, 0.0, 60.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 25.0, 0.0, 0.0, 10.0, 45.0, 5.0, 15.0, 5.0, 0.0, 30.0, 40.0, 40.0, 35.0, 5.0, 25.0, 20.0, 50.0, 0.0, -1.0, 0.0, 30.0, 75.0, -1.0, 0.0, 5.0, 0.0, 0.0, 25.0, 15.0, 20.0, 25.0, 25.0, 10.0, 100.0, 5.0, 5.0, 25.0, 0.0, 5.0, 50.0, 55.0, 0.0, 5.0, 65.0, 15.0, 20.0, 0.0, 10.0, 5.0, 5.0, 45.0, 5.0, 45.0, 25.0, 10.0, 5.0, 5.0, 10.0, 5.0, 60.0, -1.0, 15.0, -1.0, 30.0, 5.0, 20.0, 5.0, 15.0, 5.0, 15.0, 0.0, 0.0, 20.0, 65.0, 50.0, 40.0, 10.0, 30.0, 0.0, 15.0, 0.0, 10.0, 60.0, 0.0, 5.0, -1.0, 10.0, 5.0, 15.0, 0.0, 20.0, 5.0, 20.0, 10.0, 45.0, 0.0, 5.0, 5.0, 0.0, 10.0, 45.0, 10.0, 0.0, 5.0, 50.0, 60.0, 5.0, 30.0, 55.0, 80.0, 75.0, 5.0, 15.0, 95.0, 50.0, 5.0, 5.0, 5.0, 5.0, 20.0, 15.0, 30.0, 10.0, 15.0, 25.0, 25.0, 5.0, 0.0, 35.0, 20.0, 25.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 70.0, 60.0, 90.0, 10.0, 10.0, 25.0, 5.0, -1.0, 5.0, 5.0, 15.0, 0.0, 35.0, 5.0, 70.0, 5.0, 25.0, 5.0, 0.0, 30.0, 10.0, 100.0, 0.0, -1.0, 10.0, 25.0, 0.0, 5.0, 35.0, 10.0, -1.0, 10.0, 55.0, 0.0, -1.0, 65.0, 30.0, 25.0, 20.0, 40.0, 15.0, 45.0, 20.0, 20.0, 10.0, 0.0, 5.0, 15.0, -1.0, 25.0, 10.0, 20.0, 5.0, 15.0, 5.0, 30.0, 15.0, 55.0, 0.0, 20.0, 10.0, 15.0, 0.0, 45.0, 25.0, 0.0, 15.0, 25.0, 15.0, 40.0, 15.0, 0.0, 0.0, 5.0, 40.0, 10.0, 10.0, 0.0, 50.0, 55.0, 0.0, 25.0, 5.0, 0.0, 60.0, 30.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 25.0, 10.0, 75.0, 65.0, 0.0, 10.0, 5.0, 20.0, 5.0, 15.0, 50.0, 30.0, 5.0, 65.0, 15.0, 25.0, 35.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 70.0, 15.0, 30.0, 5.0, 5.0, 40.0, 25.0, 15.0, 5.0, 0.0, 5.0, 75.0, 20.0, 5.0, 0.0, -1.0, 5.0, 80.0, 40.0, 10.0, 0.0, -1.0, 10.0, 15.0, 15.0, 0.0, 30.0, 45.0, 0.0, -1.0, 30.0, 10.0, 65.0, 25.0, 40.0, 0.0, 15.0, -1.0, 15.0, 80.0, 10.0, 15.0, 5.0, 5.0, 70.0, 20.0, 85.0, 25.0, 5.0, 5.0, 25.0, 0.0, 10.0, 20.0, 25.0, 30.0, 5.0, 65.0, 25.0, 20.0, 55.0, 20.0, 5.0, 15.0, 5.0, 35.0, 10.0, 5.0, 5.0, 5.0, 5.0, 20.0, 0.0, 50.0, 0.0, 5.0, 15.0, 20.0, 25.0, 0.0, 0.0, 35.0, 0.0, 0.0, 95.0, 5.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 15.0, 20.0, 65.0, 5.0, 0.0, 10.0, 65.0, 0.0, 95.0, 80.0, 0.0, 20.0, 25.0, 15.0, -1.0, 15.0, 5.0, 5.0, 5.0, 5.0, 50.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 5.0, 20.0, 15.0, 10.0, 70.0, 5.0, 15.0, 0.0, 85.0], (3600, 1800): [0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 70.0, 0.0, 0.0, 10.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 10.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 15.0, 15.0, 5.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 20.0, -1.0, 5.0, 5.0, 5.0, 15.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 10.0, 5.0, 5.0, 65.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 5.0, 0.0, 10.0, 5.0, 35.0, 25.0, 5.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 45.0, 10.0, 0.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 15.0, 0.0, 10.0, 10.0, -1.0, 5.0, 10.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 5.0, 5.0, 10.0, 35.0, 5.0, 35.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 10.0, 5.0, 10.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 60.0, 5.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 5.0, 55.0, 25.0, 20.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 75.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 35.0, 10.0, 0.0, 50.0, 0.0, 45.0, 30.0, 15.0, 20.0, -1.0, 20.0, 45.0, 20.0, 0.0, 5.0, 5.0, 10.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 20.0, 65.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 20.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 80.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 5.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 20.0, 5.0, 15.0, 50.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 5.0, 20.0, 30.0, 15.0, 70.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 55.0, 0.0, 15.0, 5.0, 0.0, 0.0, 40.0, 5.0, -1.0, 5.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 55.0, 0.0, 25.0, 5.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 50.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 10.0, 30.0, 0.0, 30.0, 0.0, 5.0, -1.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 25.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 40.0, -1.0, 30.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 65.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0, 5.0, 5.0, 0.0, 0.0, 30.0, 10.0, 5.0, 10.0, 0.0, 70.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 35.0, 5.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 5.0, 20.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 20.0, 20.0, 5.0, 10.0, 0.0, 5.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, 25.0, 20.0, 5.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 35.0, 50.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 20.0, 35.0, 5.0, 20.0, 30.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 35.0, 0.0, 10.0, 5.0, 30.0, 5.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 25.0, 5.0, 5.0, 10.0, 0.0, 0.0, 5.0, 20.0, 15.0, 5.0, 5.0, 25.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0], (0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 20.0, 40.0, 5.0, 0.0, 65.0, 10.0, 10.0, 5.0, 25.0, 35.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 10.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 5.0, 15.0, 5.0, 0.0, 30.0, 60.0, 75.0, 40.0, -1.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 50.0, 0.0, 45.0, 75.0, 90.0, 15.0, 10.0, 5.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 0.0, 50.0, 40.0, -1.0, 40.0, 0.0, 0.0, 55.0, 0.0, 55.0, 5.0, 85.0, -1.0, 15.0, 85.0, 75.0, 20.0, 65.0, 25.0, 10.0, 45.0, 35.0, 20.0, 0.0, 55.0, 5.0, 75.0, 70.0, 5.0, 40.0, 15.0, 65.0, -1.0, -1.0, 65.0, 0.0, 5.0, 20.0, 45.0, 15.0, 30.0, 70.0, 75.0, 100.0, -1.0, 0.0, 85.0, 95.0, 85.0, 85.0, 0.0, -1.0, 20.0, 15.0, 15.0, 30.0, 5.0, 0.0, -1.0, 15.0, 20.0, 30.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 0.0, 20.0, 65.0, 35.0, 35.0, -1.0, 70.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, -1.0, -1.0, 100.0, 5.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 15.0, 20.0, 65.0, 40.0, 75.0, 65.0, 10.0, 10.0, 0.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 15.0, 5.0, 45.0, 50.0, 20.0, 0.0, 90.0, 95.0, 25.0, 5.0, -1.0, 10.0, 40.0, 10.0, 50.0, 40.0, 10.0, 25.0, 15.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 15.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 15.0, 30.0, 35.0, 30.0, -1.0, 5.0, 40.0, 85.0, 0.0, 80.0, 15.0, 10.0, 95.0, 75.0, 50.0, 0.0, 100.0, 80.0, 5.0, 5.0, 15.0, 90.0, 15.0, 10.0, 15.0, 10.0, 50.0, 15.0, 15.0, 5.0, 95.0, 20.0, 20.0, 20.0, 40.0, -1.0, 15.0], (1800, 1800): [10.0, 20.0, 0.0, 5.0, 45.0, 10.0, 35.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0, 25.0, 25.0, 0.0, 25.0, 25.0, 0.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 30.0, 15.0, 5.0, 5.0, 20.0, 10.0, 40.0, 0.0, 10.0, 5.0, 25.0, 10.0, 5.0, 5.0, 10.0, 15.0, 0.0, 30.0, 20.0, 10.0, 35.0, 5.0, 25.0, 0.0, 25.0, 35.0, 0.0, 20.0, 50.0, 10.0, 35.0, 45.0, 0.0, 25.0, 20.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 55.0, 15.0, 5.0, 5.0, 0.0, 95.0, 0.0, 50.0, 5.0, 5.0, 5.0, 55.0, 10.0, 15.0, 10.0, 15.0, 70.0, 10.0, 0.0, 40.0, 5.0, 10.0, 20.0, 65.0, 0.0, 25.0, 5.0, 0.0, 0.0, 35.0, 20.0, 30.0, 30.0, 10.0, 35.0, 10.0, 40.0, 5.0, 0.0, 0.0, 10.0, 40.0, 30.0, 0.0, 30.0, 0.0, 5.0, 45.0, 40.0, 10.0, 20.0, 30.0, 15.0, 0.0, 35.0, 0.0, 0.0, 15.0, 0.0, 10.0, 35.0, 95.0, 0.0, 30.0, 0.0, 25.0, 30.0, 30.0, 20.0, 20.0, 0.0, 15.0, 15.0, 0.0, 20.0, 45.0, 0.0, 55.0, 30.0, 20.0, 30.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 35.0, 10.0, 0.0, 35.0, 15.0, 40.0, 35.0, 100.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 20.0, 45.0, 25.0, 5.0, 0.0, 80.0, 0.0, 0.0, 30.0, 45.0, 10.0, 25.0, 40.0, 25.0, 10.0, 35.0, 20.0, 45.0, 55.0, 10.0, 0.0, 0.0, 30.0, 25.0, 0.0, 10.0, 10.0, 30.0, 20.0, 5.0, 5.0, 25.0, 0.0, 25.0, 0.0, 5.0, 5.0, 5.0, 0.0, 65.0, 45.0, 5.0, 5.0, 10.0, 10.0, 10.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 70.0, 0.0, 10.0, 10.0, 50.0, 45.0, 30.0, 5.0, 30.0, 0.0, 20.0, 20.0, 85.0, 10.0, 20.0, 10.0, 40.0, 15.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 0.0, 10.0, 15.0, 20.0, 15.0, 5.0, 0.0, 15.0, 20.0, 5.0, 0.0, 0.0, 25.0, 30.0, 0.0, 5.0, 10.0, 15.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 20.0, 10.0, 15.0, 15.0, 0.0, 0.0, 25.0, 15.0, 25.0, 5.0, 45.0, 15.0, 10.0, 60.0, 10.0, 5.0, 10.0, 5.0, 35.0, 10.0, 20.0, 40.0, 20.0, 15.0, 5.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 5.0, 35.0, 40.0, 10.0, 15.0, 10.0, 0.0, 10.0, 15.0, 35.0, 0.0, 40.0, 20.0, 25.0, 0.0, 0.0, 10.0, 15.0, 40.0, 25.0, 15.0, 25.0, 5.0, 15.0, 5.0, 20.0, 65.0, 65.0, 15.0, 25.0, 5.0, 20.0, 25.0, 75.0, 0.0, 5.0, 10.0, 25.0, 30.0, 30.0, 35.0, 20.0, 0.0, 0.0, 15.0], (3600, 0): [0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 35.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (5400, 1800): [0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 55.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 15.0, 80.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 30.0, 10.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 85.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, 40.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, 10.0, 5.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 15.0, -1.0, 0.0, 5.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 30.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 40.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 50.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 45.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 15.0, 5.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, -1.0, 20.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0], (3600, 3600): [0.0, 0.0, 10.0, 5.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 35.0, 25.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, -1.0, 10.0, 15.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 20.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 35.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 15.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, 50.0, 10.0, 10.0, 0.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 5.0, 15.0, 20.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (7200, 3600): [-1.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 65.0, -1.0, -1.0, -1.0, 0.0, 30.0, 10.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 55.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 15.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, 40.0, -1.0, -1.0, 10.0, 0.0, 15.0, -1.0, 0.0, -1.0, 20.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, 5.0, 25.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 35.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, 45.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, 5.0, -1.0, -1.0, 10.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7200, 1800): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 25.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 50.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, 5.0, -1.0, -1.0, 40.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, 15.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, 0.0, 95.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_1900 = {(7600, 5700): [40.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0], (3800, 0): [0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 10.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0], (1900, 0): [0.0, 20.0, 5.0, 20.0, 5.0, 30.0, 65.0, 25.0, 0.0, 80.0, 20.0, 10.0, 20.0, 5.0, 35.0, 65.0, 5.0, 40.0, 5.0, 30.0, -1.0, 0.0, 20.0, 65.0, 25.0, 0.0, 15.0, 10.0, 0.0, 10.0, 65.0, 25.0, 15.0, 40.0, 5.0, 5.0, 55.0, 15.0, 10.0, 10.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 5.0, 0.0, 65.0, 15.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 10.0, 5.0, 45.0, 0.0, 25.0, 10.0, 0.0, 5.0, 60.0, 5.0, 0.0, 20.0, 0.0, 0.0, 60.0, 25.0, 10.0, 0.0, 20.0, 30.0, 10.0, 10.0, 0.0, 5.0, 20.0, 15.0, 5.0, -1.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 95.0, 50.0, 40.0, 5.0, 0.0, -1.0, 70.0, 15.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 20.0, 15.0, 20.0, 0.0, 0.0, 5.0, 60.0, 0.0, 10.0, 20.0, 0.0, 5.0, 5.0, 0.0, 40.0, 10.0, 80.0, 45.0, 0.0, 30.0, 50.0, 0.0, 5.0, 15.0, 30.0, 30.0, 20.0, 45.0, 15.0, 20.0, 0.0, 25.0, 20.0, 10.0, 75.0, 25.0, 5.0, 40.0, 0.0, 10.0, 30.0, 5.0, 15.0, 90.0, 25.0, 25.0, -1.0, 40.0, 25.0, -1.0, 0.0, 15.0, 20.0, 10.0, 25.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 35.0, 35.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 95.0, 5.0, 25.0, 0.0, 0.0, 10.0, 45.0, 5.0, 5.0, 15.0, 5.0, 0.0, 0.0, 30.0, 40.0, 40.0, 35.0, 5.0, 25.0, 0.0, 20.0, 15.0, 0.0, -1.0, 0.0, 30.0, 75.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 15.0, 20.0, 25.0, 55.0, 25.0, 10.0, 0.0, 100.0, 5.0, 25.0, 35.0, 0.0, 5.0, 50.0, 55.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, -1.0, 5.0, 5.0, 0.0, 45.0, 5.0, 45.0, 25.0, 10.0, 5.0, 5.0, 10.0, 5.0, 60.0, -1.0, 15.0, -1.0, 30.0, 5.0, 20.0, 5.0, 15.0, 5.0, 15.0, 40.0, 0.0, 0.0, 20.0, 65.0, 40.0, 10.0, 30.0, 0.0, 15.0, 0.0, 60.0, 0.0, 5.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 20.0, 5.0, 0.0, 20.0, 10.0, 45.0, 0.0, 5.0, 5.0, 0.0, 10.0, 45.0, 10.0, 0.0, 5.0, 60.0, 5.0, 30.0, 55.0, 80.0, 5.0, 75.0, 5.0, 55.0, 15.0, 95.0, 50.0, 5.0, 5.0, 5.0, 5.0, 20.0, 15.0, 30.0, 10.0, 15.0, 25.0, 25.0, 5.0, 0.0, 20.0, 25.0, 15.0, 25.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 70.0, 60.0, 90.0, 10.0, 10.0, 25.0, 5.0, -1.0, 5.0, 5.0, 5.0, 15.0, 0.0, 35.0, 5.0, 70.0, 10.0, 5.0, 25.0, 10.0, 5.0, 0.0, 30.0, 10.0, 100.0, 10.0, 0.0, 0.0, -1.0, 25.0, 0.0, 5.0, 20.0, 35.0, 10.0, -1.0, 10.0, 55.0, 0.0, -1.0, 30.0, 25.0, 20.0, 40.0, 10.0, 15.0, 45.0, 0.0, 20.0, 10.0, 0.0, 5.0, 15.0, -1.0, 45.0, 25.0, 10.0, 0.0, 20.0, 5.0, 20.0, 15.0, 5.0, 30.0, 20.0, 15.0, 55.0, 20.0, 0.0, 20.0, 10.0, 15.0, 0.0, 45.0, 25.0, 0.0, 15.0, 5.0, 25.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 5.0, 40.0, 10.0, 0.0, 15.0, 50.0, 55.0, 15.0, 0.0, 25.0, 5.0, 20.0, 5.0, 0.0, 60.0, 30.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 25.0, 0.0, 10.0, 75.0, 0.0, 65.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 15.0, 0.0, 30.0, 5.0, 65.0, 15.0, 25.0, 35.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 70.0, 15.0, 30.0, 5.0, 5.0, 0.0, 40.0, 0.0, 15.0, 5.0, 0.0, 5.0, 75.0, 0.0, 20.0, 5.0, 5.0, 0.0, -1.0, 80.0, 40.0, 10.0, 0.0, -1.0, 10.0, 15.0, 15.0, 30.0, 45.0, 0.0, -1.0, 30.0, 10.0, 65.0, 5.0, 25.0, 10.0, 5.0, 40.0, 0.0, 15.0, -1.0, 15.0, 80.0, 10.0, 15.0, 5.0, 5.0, 5.0, 70.0, 20.0, 85.0, 25.0, 5.0, 10.0, 5.0, 5.0, 25.0, 0.0, 0.0, 10.0, 20.0, 30.0, 5.0, 0.0, 35.0, 65.0, 25.0, 10.0, 20.0, 55.0, 20.0, 5.0, 15.0, 5.0, 10.0, 5.0, 5.0, 20.0, 5.0, 20.0, 0.0, 0.0, 5.0, 15.0, 20.0, 25.0, 0.0, 15.0, 0.0, 0.0, 35.0, 0.0, 0.0, 95.0, 5.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 15.0, 20.0, 5.0, 0.0, 10.0, 5.0, 65.0, 65.0, 0.0, 80.0, 0.0, 20.0, 25.0, 15.0, -1.0, 15.0, 5.0, 5.0, 5.0, 5.0, 50.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 30.0, 20.0, 15.0, 10.0, 70.0, 20.0, 0.0, 5.0, 15.0, 0.0, 85.0], (1900, 1900): [10.0, 0.0, 45.0, 10.0, 15.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 15.0, 0.0, 5.0, 5.0, 5.0, 10.0, 25.0, 25.0, 0.0, 25.0, 25.0, 0.0, 25.0, 10.0, 5.0, 0.0, 0.0, 5.0, 30.0, 15.0, 5.0, 5.0, 5.0, 20.0, 10.0, 40.0, 0.0, 5.0, 25.0, 10.0, 5.0, 5.0, 10.0, 15.0, 0.0, 30.0, 20.0, 10.0, 35.0, 0.0, 5.0, 25.0, 25.0, 35.0, 0.0, 20.0, 50.0, 10.0, 35.0, 45.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 0.0, 55.0, 15.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 50.0, 5.0, 5.0, 0.0, 55.0, 10.0, 0.0, 15.0, 10.0, 10.0, 15.0, 70.0, 10.0, 0.0, 40.0, 5.0, 0.0, 30.0, 10.0, 65.0, 0.0, 25.0, 5.0, 0.0, 0.0, 35.0, 20.0, 30.0, 30.0, 35.0, 10.0, 35.0, 10.0, 5.0, 0.0, 0.0, 10.0, 10.0, 40.0, 10.0, 10.0, 30.0, 0.0, 30.0, 0.0, 5.0, 0.0, 45.0, 40.0, 20.0, 30.0, 15.0, 0.0, 35.0, 0.0, 15.0, 0.0, 5.0, 10.0, 35.0, 0.0, 30.0, 0.0, 25.0, 30.0, 30.0, 20.0, 20.0, 0.0, 5.0, 15.0, 15.0, 0.0, 10.0, 40.0, 0.0, 20.0, 5.0, 45.0, 0.0, 30.0, 20.0, 30.0, 20.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 35.0, 10.0, 0.0, 0.0, 35.0, 15.0, 35.0, 100.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 20.0, 45.0, 25.0, 5.0, 25.0, 35.0, 5.0, 10.0, 5.0, 0.0, 5.0, 80.0, 0.0, 0.0, 30.0, 45.0, 10.0, 25.0, 40.0, 25.0, 10.0, 35.0, 20.0, 45.0, 0.0, 10.0, 80.0, 0.0, 0.0, 30.0, 25.0, 10.0, 0.0, 10.0, 0.0, 10.0, 30.0, 20.0, 5.0, 5.0, 25.0, 0.0, 0.0, 5.0, 35.0, 5.0, 5.0, 0.0, 65.0, 45.0, 5.0, 50.0, 5.0, 20.0, 10.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 55.0, 5.0, 70.0, 0.0, 10.0, 50.0, 30.0, 0.0, 5.0, 30.0, 0.0, 5.0, 20.0, 85.0, 10.0, 10.0, 5.0, 40.0, 15.0, 10.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 5.0, 10.0, 0.0, 15.0, 20.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 25.0, 30.0, 0.0, 5.0, 10.0, 15.0, 0.0, 15.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 20.0, 10.0, 15.0, 15.0, 15.0, 0.0, 30.0, 25.0, 15.0, 25.0, 0.0, 5.0, 45.0, 15.0, 5.0, 10.0, 0.0, 60.0, 10.0, 35.0, 0.0, 0.0, 0.0, 10.0, 20.0, 40.0, 20.0, 5.0, 20.0, 15.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 25.0, 0.0, 20.0, 0.0, 5.0, 35.0, 40.0, 10.0, 15.0, 5.0, 0.0, 10.0, 15.0, 35.0, 0.0, 40.0, 5.0, 25.0, 0.0, 10.0, 0.0, 10.0, 40.0, 25.0, 15.0, 25.0, 5.0, 15.0, 5.0, 20.0, 65.0, 30.0, 15.0, 25.0, 5.0, 20.0, 25.0, 5.0, 75.0, 0.0, 5.0, 5.0, 10.0, 25.0, 40.0, 30.0, 35.0, 0.0, 10.0, 0.0, 15.0], (0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 20.0, 40.0, 5.0, 0.0, 65.0, 10.0, 10.0, 5.0, 25.0, 35.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 35.0, 40.0, 10.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 5.0, 15.0, 5.0, -1.0, 0.0, 30.0, 60.0, 75.0, 40.0, -1.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 50.0, 0.0, 45.0, 75.0, 90.0, 15.0, 10.0, 5.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 45.0, 0.0, 10.0, 50.0, 5.0, 40.0, -1.0, 0.0, 40.0, 0.0, 0.0, 55.0, 0.0, 55.0, 5.0, 85.0, -1.0, 15.0, 50.0, 85.0, 75.0, 20.0, 65.0, 25.0, 5.0, 10.0, 45.0, 35.0, 20.0, 0.0, 55.0, 65.0, 15.0, 5.0, 75.0, 70.0, 5.0, 40.0, 15.0, 65.0, -1.0, -1.0, 65.0, 50.0, 0.0, 5.0, 20.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 100.0, -1.0, 0.0, 85.0, 95.0, 85.0, 85.0, 0.0, 50.0, -1.0, 20.0, 15.0, 15.0, 30.0, 5.0, 0.0, 35.0, -1.0, 15.0, 20.0, 30.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 20.0, 5.0, -1.0, 45.0, 0.0, 20.0, 65.0, 35.0, 35.0, -1.0, 70.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, -1.0, -1.0, 65.0, 100.0, 5.0, 20.0, 15.0, 95.0, 20.0, 10.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 15.0, 20.0, 65.0, 40.0, 75.0, 65.0, 10.0, 10.0, 10.0, 0.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 15.0, 5.0, 45.0, 50.0, 50.0, 20.0, 35.0, 0.0, 90.0, 95.0, 25.0, 5.0, 25.0, -1.0, 10.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 25.0, 0.0, 15.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 15.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 25.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 15.0, 30.0, 35.0, 30.0, 35.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 10.0, 95.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 95.0, 15.0, 90.0, 15.0, 10.0, 15.0, 10.0, 50.0, 15.0, 15.0, 5.0, 95.0, 20.0, 20.0, 20.0, 40.0, -1.0, 15.0], (3800, 3800): [10.0, 0.0, 10.0, -1.0, 10.0, 0.0, 20.0, 15.0, -1.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 60.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 35.0, 0.0, -1.0, 20.0, 15.0, -1.0, 5.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 0.0, 0.0, 15.0, 65.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 40.0, 10.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 0.0, 20.0, 0.0, 45.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 25.0], (5700, 1900): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 50.0, 0.0, 15.0, 80.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 10.0, -1.0, 40.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 35.0, -1.0, 35.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, -1.0, 40.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 25.0, -1.0, 10.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 80.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 50.0, 0.0, 20.0, 15.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, 60.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 40.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 15.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 20.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, 0.0, 25.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0], (3800, 1900): [0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 70.0, 0.0, 10.0, 10.0, 25.0, 5.0, 0.0, 0.0, 35.0, 10.0, 0.0, 10.0, 20.0, 5.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 25.0, 15.0, 15.0, 5.0, 5.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 20.0, -1.0, 5.0, 5.0, 5.0, 15.0, 35.0, 25.0, 0.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 5.0, 65.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 5.0, 10.0, 5.0, 35.0, 25.0, 5.0, 0.0, 15.0, 10.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 45.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 5.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 0.0, 0.0, 25.0, -1.0, 15.0, 0.0, 0.0, 20.0, -1.0, 0.0, 10.0, 0.0, 15.0, 0.0, 10.0, 10.0, -1.0, 5.0, 10.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 5.0, 5.0, 0.0, 10.0, 5.0, 0.0, -1.0, 35.0, 0.0, 0.0, 15.0, 10.0, 0.0, 10.0, 5.0, 0.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, 5.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 35.0, 0.0, 0.0, 20.0, 0.0, 10.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 0.0, 5.0, 55.0, 25.0, 20.0, 5.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 85.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 35.0, 10.0, 0.0, -1.0, 10.0, 50.0, 0.0, 45.0, 30.0, 15.0, 20.0, -1.0, 20.0, 45.0, 15.0, 10.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 20.0, 65.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 15.0, 10.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 10.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 30.0, 15.0, 0.0, 5.0, 70.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 45.0, 0.0, 10.0, 5.0, 15.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 5.0, 20.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 55.0, 0.0, 5.0, 25.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 45.0, 0.0, 5.0, 10.0, 30.0, 0.0, 5.0, -1.0, 10.0, 10.0, 0.0, 5.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 25.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 40.0, -1.0, 30.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 65.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 30.0, 10.0, 5.0, 10.0, 0.0, 0.0, 70.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 35.0, 5.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 20.0, 5.0, 10.0, 0.0, 5.0, 50.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, 25.0, 20.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 15.0, 35.0, 50.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 35.0, 5.0, 20.0, 30.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 45.0, 20.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 5.0, 30.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 25.0, 5.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 15.0, 5.0, 5.0, 25.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 5.0], (5700, 3800): [0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 15.0, -1.0, 15.0, 0.0, -1.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 10.0, 5.0, 5.0, 10.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 35.0, 10.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 50.0, 0.0, 10.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 5.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 35.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, 10.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 10.0, 10.0, 10.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, 0.0, 85.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 50.0, -1.0, 5.0, 55.0, 20.0, 0.0, 15.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 65.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 40.0, 0.0, -1.0, 35.0, 5.0, 10.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 65.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 0.0, 40.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 30.0, 5.0, 20.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, -1.0, 10.0, -1.0, 40.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 45.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 20.0, 5.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 20.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 35.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 50.0, -1.0, -1.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, 5.0, -1.0, 45.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 20.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 45.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, 75.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, -1.0, 90.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, 15.0, 5.0, 0.0, 50.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, -1.0, 35.0, 20.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 35.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 35.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0], (7600, 3800): [-1.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 55.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, 45.0, -1.0, 5.0, 0.0, 20.0, -1.0, 5.0, -1.0, 10.0, -1.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, 80.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 5.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 10.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 30.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0], (7600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7600, 1900): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 25.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, 0.0, 95.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (5700, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_2000 = {(2000, 2000): [10.0, 0.0, 45.0, 10.0, 15.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 15.0, 0.0, 5.0, 5.0, 5.0, 5.0, 10.0, 25.0, 0.0, 0.0, 25.0, 10.0, 5.0, 25.0, 0.0, 5.0, 30.0, 5.0, 5.0, 0.0, 10.0, 5.0, 20.0, 10.0, 0.0, 5.0, 0.0, 25.0, 10.0, 5.0, 5.0, 10.0, 15.0, 0.0, 20.0, 35.0, 0.0, 5.0, 25.0, 25.0, 35.0, 20.0, 50.0, 10.0, 10.0, 10.0, 0.0, 0.0, 10.0, 45.0, 10.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 10.0, 5.0, 5.0, 0.0, 15.0, 55.0, 10.0, 0.0, 0.0, 15.0, 10.0, 10.0, 0.0, 15.0, 70.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 10.0, 65.0, 25.0, 5.0, 0.0, 0.0, 35.0, 0.0, 30.0, 10.0, 35.0, 35.0, 10.0, 10.0, 35.0, 10.0, 5.0, 40.0, 0.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 45.0, 40.0, 20.0, 30.0, 15.0, 0.0, 35.0, 0.0, 15.0, 0.0, 5.0, 10.0, 35.0, 10.0, 5.0, 0.0, 30.0, 20.0, 20.0, 0.0, 5.0, 15.0, 15.0, 10.0, 40.0, 0.0, 20.0, 5.0, 45.0, 0.0, 45.0, 30.0, 20.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 35.0, 10.0, 0.0, 15.0, 15.0, 100.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 20.0, 5.0, 45.0, 25.0, 5.0, 25.0, 35.0, 5.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 0.0, 30.0, 10.0, 0.0, 10.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 20.0, 25.0, 45.0, 0.0, 0.0, 80.0, 0.0, 0.0, 30.0, 25.0, 10.0, 0.0, 10.0, 0.0, 10.0, 30.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 5.0, 5.0, 0.0, 5.0, 65.0, 10.0, 45.0, 0.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 5.0, 25.0, 5.0, 20.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 5.0, 5.0, 70.0, 0.0, 10.0, 50.0, 30.0, 0.0, 5.0, 30.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 10.0, 10.0, 5.0, 10.0, 40.0, 15.0, 10.0, 25.0, 15.0, 15.0, 80.0, 25.0, 5.0, 20.0, 0.0, 0.0, 5.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, 30.0, 0.0, 10.0, 15.0, 5.0, 0.0, 15.0, 0.0, 30.0, 10.0, 0.0, 5.0, 5.0, 0.0, 10.0, 15.0, 15.0, 15.0, 40.0, 0.0, 30.0, 25.0, 15.0, 25.0, 0.0, 0.0, 45.0, 0.0, 10.0, 10.0, 0.0, 60.0, 10.0, 35.0, 0.0, 0.0, 0.0, 10.0, 20.0, 20.0, 5.0, 5.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 25.0, 0.0, 20.0, 10.0, 0.0, 5.0, 35.0, 10.0, 25.0, 15.0, 5.0, 0.0, 10.0, 15.0, 35.0, 0.0, 5.0, 50.0, 5.0, 25.0, 0.0, 10.0, 20.0, 10.0, 40.0, 25.0, 25.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 30.0, 15.0, 0.0, 20.0, 5.0, 25.0, 5.0, 75.0, 0.0, 0.0, 5.0, 5.0, 10.0, 25.0, 5.0, 40.0, 30.0, 0.0, 10.0, 0.0, 15.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (4000, 4000): [0.0, 0.0, -1.0, 15.0, 10.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 50.0, 0.0, 10.0, 0.0, 65.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 20.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 45.0, 5.0, 0.0, 5.0, 0.0, 0.0, 90.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0], (6000, 2000): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 20.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 50.0, 0.0, 25.0, 15.0, 80.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 35.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, 10.0, 30.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 65.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 15.0, -1.0, 40.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 25.0, -1.0, -1.0, 10.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 20.0, 5.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 80.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 15.0, -1.0, -1.0, -1.0, 45.0, 0.0, 60.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 15.0, 5.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0], (0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 20.0, 65.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 10.0, 5.0, 25.0, 35.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 35.0, 40.0, 10.0, 50.0, 50.0, 25.0, 0.0, 55.0, 0.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 30.0, 60.0, 20.0, 15.0, 75.0, 40.0, -1.0, 60.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 50.0, 0.0, 45.0, 50.0, 75.0, 90.0, 15.0, 10.0, 5.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 30.0, 45.0, 0.0, 10.0, 50.0, 35.0, 5.0, 40.0, -1.0, 0.0, 40.0, 0.0, 0.0, 55.0, 0.0, 55.0, 30.0, 5.0, 85.0, -1.0, 15.0, 50.0, 85.0, 75.0, 20.0, 65.0, 25.0, 5.0, 10.0, 45.0, 35.0, 20.0, 0.0, 55.0, 65.0, 15.0, 5.0, 75.0, 70.0, 5.0, 40.0, 15.0, 65.0, -1.0, -1.0, -1.0, 65.0, 50.0, 0.0, 5.0, 20.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, 100.0, -1.0, 0.0, 85.0, 95.0, 20.0, 85.0, 85.0, 0.0, 50.0, -1.0, 20.0, 15.0, 15.0, 30.0, 5.0, 0.0, 25.0, 35.0, -1.0, 25.0, 15.0, 20.0, 30.0, 90.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 5.0, 20.0, 5.0, -1.0, 45.0, 0.0, 20.0, 65.0, 35.0, 35.0, -1.0, 10.0, 70.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, -1.0, -1.0, 65.0, 100.0, 5.0, 20.0, 15.0, 95.0, 20.0, 10.0, -1.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 15.0, 20.0, 65.0, 40.0, 0.0, 75.0, 65.0, 10.0, 10.0, 10.0, 0.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 15.0, 5.0, 45.0, 50.0, 50.0, 20.0, 35.0, 0.0, 90.0, 95.0, 25.0, 5.0, 25.0, -1.0, 75.0, 10.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 10.0, 25.0, 0.0, 45.0, 15.0, 65.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 30.0, 45.0, 15.0, 15.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 50.0, 15.0, 15.0, 30.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 5.0, 10.0, 0.0, 95.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 95.0, 15.0, 90.0, 15.0, 15.0, 10.0, 15.0, 10.0, 50.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 40.0, -1.0, 15.0, 85.0], (8000, 6000): [-1.0], (8000, 2000): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 95.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (4000, 2000): [0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 70.0, 0.0, 0.0, 10.0, 10.0, 10.0, 5.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, 0.0, 20.0, 5.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, 15.0, 15.0, -1.0, 5.0, 5.0, 20.0, 0.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 20.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 5.0, 30.0, 15.0, 0.0, 35.0, -1.0, 25.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 5.0, -1.0, 5.0, 35.0, 25.0, 5.0, 0.0, -1.0, 15.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 45.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 55.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 60.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, 15.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, 10.0, 0.0, 25.0, -1.0, -1.0, 10.0, 15.0, 0.0, 0.0, 20.0, -1.0, 0.0, 10.0, 0.0, 15.0, 0.0, 10.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 20.0, 15.0, 5.0, 0.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 5.0, 10.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 60.0, 5.0, 15.0, 0.0, 40.0, 30.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 20.0, 40.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 25.0, 20.0, 10.0, 90.0, 15.0, 5.0, 0.0, 5.0, 55.0, 25.0, 20.0, 5.0, 20.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 85.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 35.0, 10.0, -1.0, 0.0, -1.0, 10.0, 50.0, 0.0, 30.0, 15.0, 20.0, -1.0, 20.0, 45.0, 0.0, 15.0, 10.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 20.0, 10.0, 15.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 35.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 35.0, 25.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 70.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 20.0, 0.0, 45.0, 0.0, 10.0, 5.0, 5.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 0.0, 10.0, 0.0, 5.0, 20.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 55.0, 5.0, 35.0, 25.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 10.0, 0.0, 30.0, 0.0, 5.0, 5.0, -1.0, 10.0, 10.0, 0.0, 5.0, 0.0, 30.0, -1.0, 0.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 25.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, -1.0, 10.0, 0.0, 0.0, 5.0, 65.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 5.0, -1.0, 30.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 40.0, -1.0, 0.0, 15.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 30.0, 10.0, 5.0, 50.0, 0.0, 0.0, 70.0, 20.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 10.0, 0.0, 35.0, 5.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 45.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, 20.0, 5.0, 0.0, 5.0, 50.0, 25.0, 20.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 40.0, 15.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 15.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 0.0, 45.0, 0.0, 10.0, 15.0, -1.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 35.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 35.0, 30.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 25.0, 0.0, 5.0, 25.0, 5.0, 20.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 15.0, 5.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, -1.0, 10.0, 5.0, 25.0], (2000, 0): [0.0, 20.0, 5.0, 20.0, 0.0, 0.0, 5.0, 30.0, 0.0, 65.0, 5.0, 25.0, 0.0, 80.0, 20.0, 10.0, 20.0, 10.0, 5.0, 35.0, 25.0, 5.0, 40.0, 25.0, 25.0, 30.0, 0.0, -1.0, 0.0, 25.0, 5.0, 0.0, 15.0, 10.0, 0.0, 0.0, 10.0, 65.0, 25.0, 15.0, 15.0, 40.0, 5.0, 5.0, 55.0, 15.0, 40.0, 10.0, 10.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 70.0, 30.0, 10.0, 0.0, 10.0, 5.0, 0.0, 65.0, 15.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 10.0, 5.0, 0.0, 45.0, 0.0, 25.0, 10.0, 0.0, 5.0, 60.0, 0.0, 5.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 60.0, 25.0, 10.0, 0.0, 20.0, 30.0, 10.0, 10.0, -1.0, 0.0, 5.0, 20.0, 55.0, 15.0, 5.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 20.0, 95.0, 0.0, 50.0, 50.0, 5.0, 0.0, -1.0, 15.0, 35.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 80.0, 45.0, 0.0, 30.0, 20.0, 0.0, 0.0, 5.0, 15.0, 30.0, 30.0, 20.0, 45.0, 15.0, 20.0, 0.0, 25.0, 30.0, 20.0, 10.0, 75.0, 35.0, 25.0, 5.0, 40.0, 0.0, 10.0, 5.0, 15.0, 90.0, 0.0, 25.0, 25.0, -1.0, 40.0, 40.0, 25.0, -1.0, 0.0, 15.0, 20.0, 10.0, 25.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 35.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 95.0, 5.0, 0.0, 25.0, 0.0, 0.0, 30.0, 10.0, 45.0, 5.0, 5.0, 25.0, 30.0, 15.0, 5.0, 0.0, 0.0, 40.0, 40.0, 35.0, 5.0, 5.0, 25.0, 0.0, 20.0, 15.0, 0.0, -1.0, 0.0, 30.0, 75.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 15.0, 20.0, 25.0, 55.0, 25.0, 10.0, 0.0, 100.0, 5.0, 25.0, 30.0, 35.0, 0.0, 5.0, 50.0, 55.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 10.0, -1.0, 5.0, 5.0, 0.0, 45.0, 5.0, 45.0, 25.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, -1.0, 15.0, 30.0, 5.0, 20.0, 5.0, 15.0, 5.0, 35.0, 15.0, 40.0, 35.0, 0.0, 0.0, 20.0, 65.0, 40.0, 5.0, 10.0, 30.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 20.0, 5.0, 0.0, 80.0, 0.0, 10.0, 45.0, 0.0, 5.0, 5.0, 0.0, 10.0, 45.0, 10.0, 0.0, 45.0, 5.0, 60.0, 5.0, 30.0, 55.0, 80.0, 5.0, 75.0, 5.0, 55.0, 15.0, 10.0, 0.0, 95.0, 50.0, 5.0, 5.0, 5.0, 5.0, 20.0, 15.0, 10.0, 30.0, 10.0, 15.0, 25.0, 5.0, 0.0, 20.0, 30.0, 5.0, 15.0, 25.0, 25.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 70.0, 60.0, 10.0, 10.0, 25.0, 5.0, 5.0, -1.0, 5.0, 5.0, 15.0, 0.0, 35.0, 5.0, 70.0, 10.0, 5.0, 25.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 30.0, 5.0, 100.0, 10.0, 0.0, 0.0, -1.0, 25.0, 0.0, 5.0, 20.0, 10.0, 0.0, 35.0, 0.0, 10.0, -1.0, 10.0, 55.0, 0.0, -1.0, 30.0, 25.0, 20.0, 40.0, 10.0, 15.0, 45.0, 0.0, 20.0, 10.0, 0.0, 5.0, 15.0, 45.0, 25.0, 10.0, 0.0, 20.0, 5.0, 20.0, 85.0, 15.0, 5.0, 30.0, 20.0, 15.0, 55.0, 20.0, 0.0, 20.0, 10.0, 15.0, 45.0, 25.0, 0.0, 15.0, 5.0, 25.0, 0.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 40.0, 10.0, 0.0, 15.0, 50.0, 5.0, 0.0, 55.0, 30.0, 15.0, 0.0, 25.0, 5.0, 20.0, 5.0, 0.0, 60.0, 30.0, 5.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 25.0, 0.0, 10.0, 75.0, 0.0, 65.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 15.0, 0.0, 30.0, 5.0, 5.0, 65.0, 0.0, 15.0, 25.0, 35.0, 5.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 70.0, 15.0, 30.0, 5.0, 5.0, 0.0, 40.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 20.0, 5.0, 5.0, 0.0, -1.0, 80.0, 40.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 30.0, 5.0, 15.0, 5.0, 0.0, -1.0, 30.0, 10.0, 5.0, 25.0, 10.0, 5.0, 40.0, 0.0, 15.0, -1.0, 15.0, 40.0, 80.0, 10.0, 15.0, 20.0, 5.0, 10.0, 15.0, 20.0, 5.0, 5.0, 70.0, 20.0, 85.0, 0.0, 25.0, 5.0, 10.0, 5.0, 5.0, 25.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 30.0, 5.0, 40.0, 0.0, 0.0, 35.0, 65.0, 25.0, -1.0, 10.0, 20.0, 55.0, 20.0, 5.0, 15.0, 5.0, 5.0, 40.0, 5.0, 0.0, 20.0, 0.0, 5.0, 20.0, 0.0, 0.0, 15.0, 20.0, 25.0, 15.0, 0.0, 15.0, 0.0, 35.0, 15.0, 0.0, 0.0, 95.0, 5.0, 35.0, 70.0, 20.0, 15.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 5.0, 65.0, 65.0, 65.0, -1.0, 0.0, 80.0, 0.0, 20.0, 25.0, -1.0, 15.0, 25.0, 5.0, 5.0, 25.0, 5.0, 5.0, 5.0, 50.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 30.0, 20.0, 15.0, 70.0, 35.0, 20.0, 0.0, 5.0, 15.0, 0.0], (4000, 0): [0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 5.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0], (6000, 4000): [0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 15.0, -1.0, 15.0, 0.0, -1.0, 65.0, -1.0, 0.0, 10.0, 0.0, 0.0, 30.0, 10.0, 0.0, 5.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 40.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 10.0, 5.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, 5.0, 35.0, 0.0, 35.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 35.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 30.0, 0.0, 10.0, -1.0, -1.0, -1.0, 15.0, -1.0, 10.0, -1.0, 5.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 55.0, 0.0, 5.0, 0.0, 15.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, -1.0, -1.0, 15.0, -1.0, 5.0, 55.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 40.0, 0.0, -1.0, 35.0, 5.0, 10.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 40.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 40.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 40.0, -1.0, -1.0, 10.0, 0.0, -1.0, 45.0, 0.0, 0.0, 10.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 45.0, -1.0, -1.0, 5.0, -1.0, 0.0, 10.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 10.0, 35.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 50.0, -1.0, 0.0, -1.0, 60.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 10.0, 5.0, -1.0, 45.0, -1.0, -1.0, 55.0, -1.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, 75.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 50.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, 0.0, -1.0, 10.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 35.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 35.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 10.0, 35.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0], (8000, 4000): [0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 40.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 10.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, 20.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, 5.0, 80.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0]}
mpc_dash_syth_hyb_pen_table_2100 = {(8400, 4200): [-1.0, -1.0, 0.0, 40.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 25.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, 20.0, 0.0, 5.0, -1.0, 80.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0], (0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 10.0, 20.0, 20.0, 65.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 10.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 70.0, 55.0, 35.0, 35.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 35.0, 40.0, 10.0, 50.0, 50.0, 20.0, 25.0, 0.0, 60.0, 55.0, 0.0, 30.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 30.0, 60.0, 20.0, 15.0, 75.0, 40.0, -1.0, 60.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 50.0, 0.0, 45.0, 50.0, 75.0, 90.0, 15.0, 20.0, 10.0, 5.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 90.0, 30.0, 45.0, -1.0, 10.0, 0.0, 10.0, 50.0, 35.0, 5.0, 40.0, -1.0, 0.0, 40.0, 0.0, 0.0, 5.0, 55.0, 0.0, 55.0, 30.0, 5.0, 40.0, 40.0, 85.0, -1.0, 15.0, 50.0, 85.0, 75.0, 20.0, 65.0, 10.0, 25.0, 5.0, 25.0, 10.0, 45.0, 35.0, 20.0, 0.0, 55.0, 65.0, 15.0, 5.0, 75.0, 70.0, 5.0, 5.0, 40.0, 15.0, 65.0, -1.0, -1.0, -1.0, 65.0, 20.0, 50.0, 0.0, 5.0, 20.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, 100.0, -1.0, 0.0, 85.0, 95.0, 20.0, 85.0, 85.0, 0.0, 50.0, -1.0, 20.0, 15.0, 15.0, 30.0, 5.0, 0.0, 25.0, 35.0, -1.0, 25.0, 15.0, 5.0, 20.0, 30.0, 70.0, 90.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 0.0, 20.0, 5.0, 65.0, 35.0, 35.0, -1.0, 10.0, 70.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, -1.0, -1.0, 65.0, 100.0, 5.0, 20.0, 15.0, 95.0, 20.0, 10.0, -1.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 30.0, 15.0, 20.0, 65.0, 40.0, 0.0, 75.0, 65.0, 10.0, 10.0, 10.0, 55.0, 0.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 15.0, 65.0, 5.0, 45.0, 50.0, 50.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 25.0, 5.0, 25.0, -1.0, 75.0, 10.0, 20.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 10.0, 25.0, 0.0, 45.0, 15.0, 65.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 80.0, 70.0, 30.0, 85.0, 45.0, 15.0, 15.0, 5.0, 10.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 10.0, 15.0, 25.0, 5.0, 50.0, 10.0, 55.0, 50.0, 15.0, 15.0, 30.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 5.0, 10.0, 0.0, 35.0, 95.0, 95.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 5.0, 95.0, 15.0, 90.0, 15.0, 15.0, 10.0, 15.0, 10.0, 50.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 40.0, -1.0, 15.0, 85.0], (4200, 4200): [5.0, -1.0, -1.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, -1.0, 20.0, 15.0, 10.0, 10.0, 0.0, 0.0, 0.0, 5.0, -1.0, 50.0, 55.0, -1.0, 0.0, 10.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 40.0, 0.0, 0.0, -1.0, 10.0, 30.0, 0.0, 10.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 60.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, -1.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, -1.0, 0.0, 55.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 45.0, 0.0], (2100, 2100): [10.0, 0.0, 45.0, 10.0, 15.0, 5.0, 35.0, 5.0, 0.0, 20.0, 5.0, 5.0, 70.0, 0.0, 5.0, 5.0, 5.0, 20.0, 25.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 25.0, 0.0, 5.0, 30.0, 30.0, 5.0, 5.0, 0.0, 10.0, 20.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 0.0, 0.0, 5.0, 25.0, 25.0, 35.0, 20.0, 20.0, 50.0, 10.0, 0.0, 10.0, 10.0, 0.0, 10.0, 5.0, 45.0, 25.0, 15.0, 10.0, 0.0, 0.0, 20.0, 5.0, 45.0, 5.0, 5.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 15.0, 55.0, 10.0, 0.0, 15.0, 65.0, 10.0, 10.0, 0.0, 15.0, 70.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 30.0, 10.0, 5.0, 0.0, 0.0, 15.0, 20.0, 10.0, 0.0, 30.0, 10.0, 5.0, 35.0, 35.0, 15.0, 10.0, 5.0, 10.0, 35.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 5.0, 0.0, 5.0, 0.0, 5.0, 45.0, 40.0, 5.0, 20.0, 30.0, 20.0, 35.0, 0.0, 15.0, 15.0, 0.0, 10.0, 10.0, 5.0, 20.0, 5.0, 5.0, 0.0, 20.0, 10.0, 20.0, 20.0, 0.0, 5.0, 15.0, 0.0, 15.0, 0.0, 10.0, 40.0, 0.0, 0.0, 20.0, 5.0, 0.0, 45.0, 30.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 15.0, 100.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 5.0, 45.0, 0.0, 25.0, 35.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 30.0, 10.0, 0.0, 10.0, 25.0, 25.0, 10.0, 35.0, 25.0, 45.0, 0.0, 15.0, 0.0, 80.0, 0.0, 0.0, 30.0, 25.0, 10.0, 25.0, 0.0, 10.0, 0.0, 10.0, 30.0, 20.0, 5.0, 35.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 35.0, 5.0, 5.0, 0.0, 5.0, 65.0, 10.0, 45.0, 0.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 0.0, 0.0, 25.0, 5.0, 5.0, 20.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, 5.0, 0.0, 0.0, 10.0, 50.0, 40.0, 5.0, 30.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 10.0, 5.0, 10.0, 10.0, 40.0, 0.0, 15.0, 0.0, 10.0, 25.0, 5.0, 15.0, 0.0, 80.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 25.0, 0.0, 15.0, 10.0, 15.0, 5.0, 0.0, 15.0, 25.0, 15.0, 0.0, 30.0, 10.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 15.0, 5.0, 40.0, 5.0, 0.0, 30.0, 25.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 35.0, 0.0, 0.0, 0.0, 10.0, 20.0, 20.0, 30.0, 5.0, 5.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 0.0, 25.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 35.0, 25.0, 10.0, 15.0, 5.0, 10.0, 0.0, 0.0, 10.0, 15.0, 35.0, 5.0, 5.0, 0.0, 50.0, 5.0, 0.0, 25.0, 0.0, 10.0, 20.0, 10.0, 40.0, 25.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 30.0, 30.0, 0.0, 5.0, 5.0, 25.0, 5.0, 75.0, 20.0, 0.0, 5.0, 5.0, 10.0, 5.0, 40.0, 0.0, 30.0, 10.0, 0.0, 15.0], (4200, 0): [-1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 55.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0], (4200, 2100): [0.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, 0.0, 20.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, 0.0, 15.0, 15.0, -1.0, 25.0, 5.0, 5.0, 20.0, 0.0, 0.0, 5.0, 5.0, 25.0, 0.0, 20.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, -1.0, 20.0, 0.0, 5.0, 10.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, -1.0, 25.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 5.0, -1.0, 35.0, 0.0, 5.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 55.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 60.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 10.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 15.0, 0.0, -1.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 25.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 30.0, 10.0, 5.0, 5.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 10.0, 25.0, 10.0, 90.0, 15.0, 5.0, 0.0, 25.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 85.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 35.0, 0.0, 10.0, -1.0, 5.0, 0.0, -1.0, 10.0, 50.0, 0.0, 30.0, 15.0, -1.0, 20.0, 45.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 15.0, -1.0, 65.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, 15.0, 20.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, -1.0, 10.0, 5.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 45.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 70.0, 0.0, 30.0, 0.0, 0.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 40.0, 20.0, 0.0, 0.0, 45.0, 0.0, 10.0, 5.0, 5.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 20.0, 0.0, -1.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 0.0, 5.0, 35.0, 25.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 30.0, 0.0, 0.0, 5.0, -1.0, -1.0, 20.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, -1.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 65.0, 10.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 5.0, -1.0, 30.0, 45.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 40.0, -1.0, 0.0, 15.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 5.0, 0.0, 30.0, 10.0, 5.0, 50.0, 0.0, 0.0, 0.0, 70.0, 20.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 35.0, 5.0, 5.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0, 5.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 90.0, -1.0, 5.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, 20.0, 5.0, 55.0, 0.0, 50.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 40.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 30.0, 15.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 35.0, 5.0, 0.0, 20.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 20.0, 0.0, 45.0, 0.0, 10.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 35.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 25.0, 0.0, 5.0, 25.0, 5.0, 20.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 20.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, 10.0, -1.0, 0.0, 5.0, 25.0], (8400, 0): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (6300, 2100): [-1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 35.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 50.0, -1.0, -1.0, 25.0, -1.0, 15.0, 80.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, -1.0, 40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 55.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 85.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 30.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, 40.0, 0.0, -1.0, 40.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 30.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 80.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, 45.0, -1.0, -1.0, -1.0, 45.0, 0.0, 60.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0], (8400, 2100): [-1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, 95.0, -1.0, 0.0, 0.0, -1.0], (6300, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6300, 4200): [0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 15.0, -1.0, 15.0, 0.0, -1.0, -1.0, 65.0, -1.0, 0.0, -1.0, 10.0, 30.0, 0.0, 5.0, 40.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 40.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 10.0, 5.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 30.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 5.0, 0.0, 15.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 15.0, 15.0, 0.0, -1.0, 0.0, 0.0, 5.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 20.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 40.0, 0.0, -1.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, 0.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 25.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 45.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, -1.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 25.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, 50.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 5.0, -1.0, 10.0, 5.0, -1.0, 45.0, -1.0, -1.0, 55.0, -1.0, -1.0, -1.0, 15.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, 10.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 80.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, -1.0, -1.0, -1.0, 35.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, 10.0, 15.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0], (2100, 0): [0.0, 20.0, 0.0, 5.0, 20.0, 0.0, 0.0, 5.0, 30.0, 0.0, 0.0, 65.0, 5.0, 25.0, 15.0, 0.0, 80.0, 5.0, 20.0, 0.0, 10.0, 5.0, 35.0, 10.0, 25.0, 5.0, 40.0, 25.0, 25.0, 30.0, 0.0, -1.0, 0.0, 25.0, 25.0, 5.0, 0.0, 15.0, 0.0, 0.0, 10.0, 65.0, 25.0, 15.0, 15.0, 40.0, 5.0, 5.0, 55.0, 5.0, 40.0, 10.0, 10.0, 25.0, 10.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 70.0, 30.0, 20.0, 10.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 65.0, 15.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 10.0, 5.0, 0.0, 45.0, 0.0, 25.0, 10.0, 10.0, 0.0, 5.0, 60.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 20.0, 10.0, 10.0, -1.0, 20.0, 0.0, 5.0, 5.0, 5.0, 20.0, 55.0, 15.0, 5.0, 5.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 20.0, 95.0, 0.0, 50.0, 50.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 35.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 0.0, 10.0, 20.0, 65.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 10.0, 0.0, 80.0, 35.0, 45.0, 0.0, 30.0, 20.0, 0.0, 0.0, 5.0, 15.0, 30.0, 30.0, 45.0, 15.0, 20.0, 0.0, 25.0, 30.0, 20.0, 0.0, 10.0, 0.0, 75.0, 35.0, 10.0, 25.0, 5.0, 40.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 25.0, 25.0, -1.0, 40.0, 40.0, 25.0, 0.0, 15.0, 20.0, 25.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 15.0, 0.0, 35.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 35.0, 95.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 30.0, 10.0, 45.0, 5.0, 25.0, 30.0, 15.0, 5.0, 0.0, 0.0, 30.0, 35.0, 5.0, 5.0, 25.0, 0.0, 20.0, 15.0, 0.0, -1.0, 0.0, 30.0, 75.0, 0.0, -1.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 15.0, 20.0, 25.0, 45.0, 55.0, 25.0, 0.0, 100.0, 5.0, 20.0, 30.0, 35.0, 0.0, 5.0, 50.0, 55.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, -1.0, 15.0, 30.0, 5.0, 20.0, 5.0, 15.0, 5.0, 35.0, 15.0, 40.0, 35.0, 0.0, 0.0, 65.0, 40.0, 5.0, 10.0, 30.0, 0.0, 15.0, 20.0, 0.0, 10.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, 5.0, 25.0, 15.0, 0.0, 20.0, 5.0, -1.0, 5.0, 5.0, 0.0, 80.0, 0.0, 10.0, 45.0, 0.0, 5.0, 5.0, 0.0, 10.0, 45.0, 10.0, 0.0, 45.0, 5.0, 60.0, 5.0, 30.0, 55.0, 0.0, 40.0, 80.0, 5.0, 20.0, 75.0, 5.0, 55.0, 15.0, 10.0, 0.0, 95.0, 50.0, 5.0, 5.0, 5.0, 5.0, 20.0, 15.0, 10.0, 30.0, 10.0, 15.0, 25.0, 5.0, 0.0, 20.0, 30.0, 5.0, 15.0, 25.0, 25.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 60.0, 10.0, 10.0, 0.0, 10.0, 25.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 15.0, 0.0, -1.0, 5.0, 70.0, 10.0, 5.0, 5.0, 25.0, 10.0, 0.0, 10.0, 0.0, 0.0, 30.0, 5.0, 5.0, 100.0, 10.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 5.0, 0.0, 20.0, 10.0, 0.0, 35.0, 0.0, 10.0, -1.0, 10.0, 55.0, 0.0, -1.0, 5.0, 70.0, 30.0, 25.0, 20.0, 40.0, 10.0, 15.0, 45.0, 0.0, 20.0, 10.0, 0.0, 5.0, 15.0, 45.0, 25.0, 5.0, 30.0, 10.0, 0.0, 20.0, 5.0, 20.0, 85.0, 15.0, 5.0, 20.0, 0.0, 15.0, 55.0, 20.0, 5.0, 0.0, 20.0, 10.0, 15.0, 45.0, 25.0, 15.0, 0.0, 15.0, 5.0, 25.0, 25.0, 0.0, 0.0, 20.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 40.0, 10.0, 0.0, 15.0, 50.0, 5.0, 0.0, 30.0, 15.0, 0.0, 25.0, 5.0, 20.0, 5.0, 0.0, 0.0, 60.0, 0.0, 30.0, 30.0, 5.0, 5.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 25.0, 0.0, 10.0, 75.0, 0.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 15.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 65.0, 0.0, 15.0, 25.0, 35.0, 5.0, 10.0, 20.0, 0.0, 0.0, 70.0, 15.0, 15.0, 30.0, 5.0, 5.0, 0.0, 40.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 40.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 30.0, 45.0, 5.0, 15.0, 5.0, 0.0, -1.0, 30.0, 10.0, 60.0, 10.0, 5.0, 25.0, 10.0, 5.0, 40.0, 0.0, 20.0, 15.0, -1.0, 15.0, 40.0, 10.0, 0.0, 15.0, 20.0, 5.0, 10.0, 15.0, 20.0, 5.0, 0.0, 0.0, 5.0, 20.0, 0.0, 25.0, 5.0, 10.0, 5.0, 25.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 30.0, 5.0, 40.0, 0.0, 0.0, 35.0, 25.0, 65.0, 25.0, -1.0, 10.0, 20.0, 20.0, 5.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 20.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 15.0, 20.0, 25.0, 15.0, 0.0, 25.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 35.0, 70.0, 10.0, 20.0, 15.0, 0.0, 0.0, 15.0, 20.0, 0.0, 5.0, 20.0, 0.0, 10.0, 5.0, 65.0, 65.0, 65.0, -1.0, 0.0, 80.0, 0.0, 20.0, 25.0, -1.0, 15.0, 15.0, 25.0, 5.0, 5.0, 20.0, 25.0, 5.0, 5.0, 5.0, 50.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 30.0, 20.0, 15.0, 70.0, 35.0, 20.0, 0.0, 0.0, 5.0, 15.0, 0.0]}
mpc_dash_syth_hyb_pen_table_2200 = {(4400, 2200): [0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, -1.0, 20.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 15.0, 15.0, 0.0, -1.0, 25.0, 5.0, 0.0, 5.0, 20.0, 0.0, 5.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, -1.0, 20.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, -1.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, -1.0, -1.0, 25.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 40.0, 0.0, 0.0, 5.0, -1.0, 35.0, 0.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, -1.0, 5.0, 10.0, 0.0, 35.0, 20.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 55.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, -1.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 60.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 80.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 15.0, -1.0, 0.0, -1.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 25.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 10.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 10.0, 25.0, 10.0, 90.0, 10.0, 5.0, -1.0, 0.0, 25.0, 20.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 85.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 10.0, 50.0, 0.0, 5.0, 30.0, 20.0, -1.0, -1.0, 20.0, 45.0, 0.0, -1.0, 0.0, 15.0, 10.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 25.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 65.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, 35.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 65.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 15.0, 20.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, -1.0, 25.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 10.0, -1.0, 10.0, 5.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 45.0, 40.0, 5.0, 10.0, 40.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 5.0, 70.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 40.0, 20.0, 0.0, 0.0, 45.0, 0.0, 10.0, 0.0, 5.0, 5.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 20.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 10.0, -1.0, 5.0, 0.0, 5.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, -1.0, 55.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 35.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 20.0, 10.0, -1.0, 0.0, 0.0, 30.0, 10.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 50.0, 0.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 60.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 0.0, 80.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 15.0, 10.0, -1.0, -1.0, 0.0, 15.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0, 65.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 5.0, -1.0, 10.0, 30.0, 10.0, -1.0, 45.0, 0.0, 0.0, -1.0, 5.0, -1.0, 10.0, -1.0, 30.0, 0.0, 0.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, -1.0, 0.0, 10.0, 0.0, 45.0, 40.0, 0.0, -1.0, 0.0, 15.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 45.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 5.0, -1.0, 5.0, 0.0, 30.0, 10.0, 5.0, 50.0, 0.0, 0.0, 0.0, 70.0, 20.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 35.0, -1.0, 5.0, -1.0, 45.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 45.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 90.0, -1.0, 5.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 55.0, 0.0, 0.0, 50.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 40.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 30.0, 15.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 35.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 45.0, -1.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 5.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 25.0, -1.0, 5.0, 20.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 20.0, 35.0, 5.0, 5.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 25.0], (6600, 4400): [0.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 15.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 65.0, -1.0, -1.0, -1.0, 10.0, 30.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 5.0, 30.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 50.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 15.0, 15.0, -1.0, 0.0, 0.0, 5.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 55.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 40.0, -1.0, -1.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, -1.0, 20.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, -1.0, 45.0, 45.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 5.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 55.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 5.0, -1.0, 10.0, 5.0, 45.0, -1.0, -1.0, 0.0, 55.0, -1.0, -1.0, 15.0, 20.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 45.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 20.0, 10.0, 5.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 80.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 80.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 35.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 35.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0], (8800, 2200): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (8800, 4400): [0.0, 40.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 25.0, -1.0, 10.0, 5.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 65.0, 10.0, 20.0, 20.0, 65.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 10.0, 55.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 25.0, 35.0, 40.0, 10.0, 50.0, 50.0, 20.0, 25.0, 0.0, 60.0, 55.0, 0.0, 20.0, 30.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 30.0, 60.0, 20.0, 15.0, 75.0, 40.0, -1.0, 60.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 50.0, 45.0, 30.0, 0.0, 45.0, 50.0, 75.0, 90.0, 15.0, 20.0, 10.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 90.0, 30.0, 25.0, 45.0, -1.0, 10.0, 0.0, 10.0, 50.0, 35.0, 35.0, 5.0, 40.0, -1.0, 10.0, 0.0, 40.0, 0.0, 0.0, 5.0, 55.0, 0.0, 15.0, 55.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, 85.0, 75.0, 20.0, 0.0, 25.0, 20.0, 65.0, 10.0, 25.0, 100.0, 5.0, 25.0, 10.0, 45.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 5.0, 75.0, 70.0, 5.0, 5.0, 40.0, 15.0, 65.0, -1.0, 30.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 20.0, 30.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 95.0, 20.0, 85.0, 45.0, 85.0, 0.0, 50.0, 60.0, 75.0, -1.0, 20.0, 15.0, 15.0, 30.0, 5.0, 0.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 5.0, 20.0, 30.0, 70.0, 90.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 20.0, 25.0, 5.0, 65.0, 35.0, 35.0, -1.0, 10.0, 70.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, -1.0, -1.0, 65.0, 100.0, 5.0, 15.0, 20.0, 15.0, 95.0, 20.0, 10.0, -1.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 30.0, 15.0, 20.0, 65.0, 40.0, 0.0, 75.0, 15.0, 65.0, 10.0, 10.0, 10.0, 55.0, 0.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 75.0, 15.0, 65.0, 5.0, 45.0, 50.0, 50.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 25.0, 5.0, 40.0, 25.0, -1.0, 75.0, 10.0, 20.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 10.0, 25.0, 0.0, 30.0, 45.0, 15.0, 65.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 80.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 10.0, 15.0, 25.0, 5.0, 65.0, 50.0, 10.0, 55.0, 50.0, 15.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 5.0, 15.0, 10.0, 0.0, 35.0, 95.0, 95.0, 35.0, 20.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 5.0, 95.0, 80.0, 15.0, 90.0, 15.0, 15.0, 10.0, 5.0, 15.0, 10.0, 50.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 85.0], (4400, 4400): [0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 30.0, 5.0, 0.0, 15.0, 0.0, 15.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 50.0, 55.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 60.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 10.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 45.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0], (6600, 2200): [-1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 25.0, -1.0, -1.0, 5.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 50.0, -1.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 10.0, 40.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 55.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 85.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 30.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 25.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, 5.0, 15.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 25.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 10.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 95.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0], (4400, 0): [-1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 55.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0], (8800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2200, 2200): [0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 35.0, 0.0, 20.0, 5.0, 5.0, 70.0, 0.0, 5.0, 5.0, 5.0, 20.0, 30.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 20.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 0.0, 5.0, 10.0, 35.0, 20.0, 20.0, 10.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 5.0, 45.0, 25.0, 5.0, 15.0, 10.0, 0.0, 20.0, 5.0, 45.0, 0.0, 5.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 55.0, 10.0, 0.0, 15.0, 15.0, 65.0, 10.0, 10.0, 0.0, 0.0, 15.0, 70.0, 5.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 30.0, 10.0, 15.0, 15.0, 5.0, 5.0, 35.0, 35.0, 15.0, 10.0, 5.0, 35.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 5.0, 40.0, 5.0, 5.0, 20.0, 30.0, 20.0, 35.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 10.0, 5.0, 15.0, 5.0, 0.0, 20.0, 0.0, 10.0, 5.0, 20.0, 20.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 20.0, 5.0, 35.0, 10.0, 45.0, 15.0, 30.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 10.0, 15.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 15.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 45.0, 0.0, 25.0, 0.0, 35.0, 20.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, 30.0, 0.0, 25.0, 25.0, 10.0, 0.0, 25.0, 45.0, 20.0, 0.0, 15.0, 0.0, 80.0, 0.0, 0.0, 0.0, 30.0, 5.0, 25.0, 5.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 35.0, 5.0, 5.0, 10.0, 5.0, 65.0, 10.0, 45.0, 0.0, 20.0, 5.0, 50.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 0.0, 0.0, 5.0, 25.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 30.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 20.0, 10.0, 0.0, 10.0, 25.0, 5.0, 10.0, 10.0, 40.0, 40.0, 0.0, 15.0, 0.0, 0.0, 10.0, 25.0, 5.0, 30.0, 15.0, 0.0, 80.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 5.0, 0.0, 25.0, 5.0, 0.0, 15.0, 10.0, 15.0, 5.0, 0.0, 0.0, 15.0, 25.0, 5.0, 0.0, 0.0, 15.0, 0.0, 30.0, 10.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 40.0, 0.0, 0.0, 0.0, 30.0, 25.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 35.0, 0.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 5.0, 25.0, 0.0, 5.0, 20.0, 20.0, 10.0, 5.0, 0.0, 5.0, 35.0, 25.0, 10.0, 15.0, 10.0, 20.0, 5.0, 0.0, 10.0, 15.0, 35.0, 15.0, 5.0, 5.0, 0.0, 50.0, 5.0, 0.0, 25.0, 0.0, 10.0, 20.0, 5.0, 25.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 30.0, 0.0, 30.0, 5.0, 0.0, 15.0, 5.0, 5.0, 25.0, 5.0, 75.0, 20.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 10.0, 10.0, 15.0], (2200, 0): [10.0, 0.0, 20.0, 0.0, 5.0, 45.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 30.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 80.0, 5.0, 20.0, 0.0, 10.0, 5.0, 35.0, 10.0, 25.0, 25.0, 5.0, 40.0, 0.0, 25.0, 25.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 25.0, 25.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 10.0, 65.0, 30.0, 25.0, 15.0, 15.0, 40.0, 5.0, 5.0, 5.0, 5.0, 40.0, 10.0, 10.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 5.0, 0.0, 70.0, 30.0, 20.0, 10.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 65.0, 15.0, 0.0, 15.0, 25.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 5.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 50.0, 10.0, 10.0, 0.0, 5.0, 60.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 10.0, 10.0, -1.0, 20.0, 0.0, 45.0, 0.0, 5.0, 5.0, 5.0, 20.0, 55.0, 15.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 20.0, 10.0, 95.0, 0.0, 50.0, 50.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 35.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 5.0, 0.0, 0.0, 10.0, 20.0, 65.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 10.0, 0.0, 80.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 15.0, 30.0, 30.0, 45.0, 15.0, 20.0, 0.0, 30.0, 20.0, 0.0, 10.0, 0.0, 75.0, 10.0, 35.0, 10.0, 25.0, 5.0, 40.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 25.0, 25.0, -1.0, 40.0, 40.0, 0.0, 15.0, 5.0, 20.0, 45.0, 0.0, 25.0, -1.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 15.0, 0.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 35.0, 95.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 30.0, 10.0, 45.0, 5.0, 25.0, 30.0, 5.0, 0.0, 0.0, 30.0, 35.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, 20.0, 15.0, 0.0, -1.0, 5.0, 0.0, 30.0, 75.0, 0.0, 5.0, -1.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 25.0, 45.0, 0.0, 55.0, 25.0, 0.0, 20.0, 5.0, 20.0, 30.0, 35.0, 0.0, 5.0, 50.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, -1.0, 15.0, 0.0, 5.0, 20.0, 5.0, 15.0, 5.0, 35.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 100.0, 40.0, 5.0, 15.0, 10.0, 0.0, 15.0, 20.0, 10.0, 20.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 25.0, 0.0, 20.0, 0.0, 5.0, -1.0, 5.0, 5.0, 0.0, 80.0, 0.0, 10.0, 45.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 10.0, 30.0, 55.0, 0.0, 40.0, 80.0, 35.0, 5.0, 20.0, 5.0, 55.0, 15.0, 10.0, 0.0, 95.0, 50.0, 5.0, 5.0, 5.0, 5.0, 20.0, 15.0, 10.0, 30.0, 10.0, 15.0, 10.0, 10.0, 25.0, 5.0, 0.0, 20.0, 30.0, 5.0, 15.0, 5.0, 25.0, 25.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 60.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 25.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, -1.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 30.0, 5.0, 5.0, 100.0, 5.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 25.0, 25.0, 0.0, 5.0, 0.0, 20.0, 10.0, 0.0, 35.0, 0.0, 10.0, -1.0, 0.0, 10.0, 55.0, 0.0, 0.0, 55.0, -1.0, 5.0, 70.0, 0.0, 10.0, 30.0, 25.0, 20.0, 40.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 15.0, 45.0, 25.0, 5.0, 5.0, 15.0, 30.0, 0.0, 10.0, 0.0, 20.0, 5.0, 20.0, 85.0, 15.0, 5.0, 20.0, 0.0, 15.0, 55.0, 20.0, 0.0, 5.0, 0.0, 20.0, 10.0, 15.0, 0.0, 45.0, 25.0, 15.0, 0.0, 5.0, 25.0, 25.0, 0.0, 0.0, 20.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 40.0, 10.0, 0.0, 15.0, 50.0, 5.0, 0.0, 30.0, 15.0, 0.0, 25.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 60.0, 0.0, 30.0, 30.0, 5.0, 5.0, 10.0, 5.0, 15.0, 5.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 20.0, 25.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 5.0, 20.0, 5.0, 15.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 65.0, 0.0, 15.0, 25.0, 35.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 70.0, 15.0, 15.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 40.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 45.0, 5.0, 15.0, 5.0, 0.0, -1.0, 30.0, 10.0, 60.0, 10.0, 5.0, 25.0, 10.0, 5.0, 5.0, 40.0, 0.0, 0.0, 20.0, 15.0, -1.0, 15.0, 40.0, 20.0, 10.0, 0.0, 15.0, 20.0, 5.0, 10.0, 0.0, 15.0, 20.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 10.0, -1.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 30.0, 5.0, 40.0, 0.0, 0.0, 35.0, 25.0, 25.0, -1.0, 10.0, 5.0, 20.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 20.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 20.0, 25.0, 15.0, 40.0, 0.0, 25.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 70.0, 10.0, 15.0, 0.0, 0.0, 15.0, 20.0, 0.0, 5.0, 20.0, 0.0, 10.0, 5.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 0.0, 20.0, 25.0, -1.0, 15.0, 15.0, 25.0, 5.0, 5.0, 5.0, 20.0, 25.0, 5.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 25.0, 0.0, 30.0, 20.0, 15.0, 0.0, 40.0, 30.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0], (6600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_2300 = {(0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 65.0, 10.0, 20.0, 20.0, 5.0, 65.0, 5.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 65.0, 10.0, 55.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 45.0, 25.0, 35.0, 40.0, 10.0, 50.0, 50.0, 20.0, 25.0, 0.0, 60.0, 55.0, 0.0, 20.0, 30.0, 10.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 90.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 30.0, 60.0, 20.0, 15.0, 20.0, 75.0, 40.0, -1.0, 60.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 75.0, 90.0, 15.0, 20.0, 10.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 30.0, 30.0, 90.0, 30.0, 25.0, 45.0, -1.0, 10.0, 0.0, 10.0, 50.0, 25.0, 35.0, 35.0, 5.0, 40.0, -1.0, 10.0, 0.0, 40.0, 0.0, 0.0, 5.0, 55.0, 0.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, -1.0, 85.0, 75.0, 20.0, 0.0, 25.0, 20.0, 65.0, 10.0, 25.0, 100.0, 5.0, 25.0, 10.0, 45.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 5.0, 75.0, 70.0, 5.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 20.0, 30.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 95.0, 20.0, 85.0, 45.0, 85.0, 0.0, 50.0, 60.0, 80.0, 75.0, -1.0, 20.0, 15.0, 15.0, 5.0, 20.0, 30.0, 5.0, 0.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 5.0, 20.0, 30.0, 70.0, 90.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 20.0, 25.0, 5.0, 65.0, 0.0, 35.0, 35.0, -1.0, 10.0, 70.0, 0.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, 10.0, -1.0, -1.0, 65.0, 100.0, 5.0, 30.0, 15.0, 20.0, 15.0, 95.0, 20.0, 10.0, -1.0, 90.0, 10.0, 5.0, 70.0, 10.0, 0.0, 30.0, 30.0, 15.0, 20.0, 65.0, 40.0, 0.0, 75.0, 15.0, 65.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 25.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 75.0, 15.0, 65.0, 5.0, 45.0, 50.0, 15.0, 50.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 25.0, 5.0, 5.0, 5.0, 40.0, 25.0, -1.0, 75.0, 10.0, 20.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 10.0, 25.0, 0.0, 30.0, 45.0, 15.0, 65.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 5.0, 50.0, 10.0, 80.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 65.0, 25.0, 50.0, 10.0, 55.0, 50.0, 15.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 5.0, 15.0, 10.0, 0.0, 35.0, 95.0, 95.0, 35.0, 20.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 5.0, 95.0, 80.0, 15.0, 90.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 15.0, 85.0], (6900, 4600): [0.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, 5.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, -1.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 55.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 40.0, -1.0, 10.0, 15.0, 0.0, -1.0, 20.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 45.0, 0.0, 0.0, 10.0, 15.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, 5.0, -1.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 55.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, -1.0, 5.0, -1.0, 45.0, -1.0, -1.0, 55.0, -1.0, 15.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 5.0, 45.0, -1.0, 5.0, -1.0, 0.0, 0.0, 20.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 5.0, 80.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0], (4600, 2300): [0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, -1.0, 20.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 15.0, 15.0, 0.0, -1.0, 25.0, 5.0, 0.0, 5.0, 20.0, 0.0, 0.0, -1.0, 5.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, -1.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 25.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, -1.0, 5.0, 10.0, 0.0, 35.0, 20.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 20.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 60.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 15.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 15.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 60.0, 15.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 15.0, 10.0, 10.0, 90.0, 10.0, 5.0, -1.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 85.0, 0.0, 10.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 10.0, 50.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, -1.0, -1.0, -1.0, 20.0, 45.0, 0.0, -1.0, 0.0, 15.0, 10.0, 0.0, 50.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 25.0, 5.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 65.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 20.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, -1.0, 10.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 65.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 5.0, 10.0, 20.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 25.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 30.0, 5.0, 10.0, 0.0, -1.0, 10.0, 5.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 45.0, 40.0, 5.0, 10.0, -1.0, 40.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 70.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 0.0, 45.0, 0.0, 10.0, 0.0, 5.0, 5.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 5.0, 20.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 10.0, -1.0, 5.0, 0.0, 5.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, -1.0, 10.0, 10.0, 0.0, 60.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 30.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 60.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 0.0, 80.0, 0.0, 10.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 10.0, -1.0, -1.0, -1.0, 0.0, 15.0, 10.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 65.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 5.0, -1.0, 10.0, 10.0, -1.0, 45.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 10.0, -1.0, 30.0, 0.0, -1.0, 0.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 30.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 20.0, -1.0, 10.0, 0.0, 45.0, 40.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 45.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, -1.0, 5.0, 0.0, 30.0, 10.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 70.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 75.0, -1.0, 0.0, 0.0, 0.0, 35.0, -1.0, 5.0, -1.0, 45.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 90.0, -1.0, 5.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, 55.0, 0.0, 0.0, 50.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 35.0, 0.0, -1.0, -1.0, 40.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 15.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 35.0, -1.0, 0.0, 20.0, 0.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 45.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 45.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 25.0, -1.0, 5.0, 20.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 20.0, 35.0, -1.0, 5.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 25.0], (4600, 4600): [-1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 40.0, 0.0, -1.0, -1.0, 0.0, 50.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 55.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 80.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0], (6900, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (6900, 2300): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, -1.0, -1.0, 0.0, 30.0, 10.0, 0.0, 5.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 25.0, -1.0, -1.0, 5.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 50.0, -1.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 85.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 30.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 25.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 25.0, 15.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, 30.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 15.0, 45.0, -1.0, 0.0, -1.0, 10.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 95.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 30.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0], (2300, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 80.0, 5.0, 20.0, 5.0, 0.0, 10.0, 35.0, 10.0, 25.0, 25.0, 40.0, 0.0, 25.0, 25.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 25.0, 10.0, 25.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 30.0, 25.0, 15.0, 15.0, 40.0, 5.0, 5.0, 5.0, 5.0, 10.0, 40.0, 10.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 5.0, 0.0, 30.0, 20.0, 10.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 65.0, 15.0, 0.0, 15.0, 25.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 5.0, 60.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 5.0, 20.0, 0.0, 0.0, 45.0, 0.0, 5.0, 5.0, 5.0, 20.0, 55.0, 15.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 95.0, 0.0, 50.0, 50.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 55.0, 15.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 10.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 15.0, 30.0, 30.0, 45.0, 15.0, 20.0, 0.0, 30.0, 20.0, 0.0, 10.0, 35.0, 0.0, 0.0, 75.0, 10.0, 35.0, 10.0, 25.0, 5.0, 40.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 25.0, 25.0, -1.0, 40.0, 40.0, 0.0, 0.0, 15.0, 5.0, 0.0, 20.0, 0.0, 45.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 5.0, 15.0, 0.0, 0.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 35.0, 95.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 30.0, 10.0, 45.0, 5.0, 25.0, 30.0, 0.0, 0.0, 30.0, 20.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 30.0, 75.0, 0.0, 5.0, -1.0, 0.0, 5.0, 20.0, 10.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 25.0, 45.0, 0.0, 55.0, 25.0, 0.0, 20.0, 5.0, 20.0, 30.0, 35.0, 0.0, 5.0, 50.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 15.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 10.0, 5.0, 5.0, 0.0, 10.0, 5.0, -1.0, 15.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 35.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 0.0, 100.0, 0.0, 40.0, 5.0, 15.0, 0.0, 10.0, 0.0, 15.0, 20.0, 10.0, 20.0, 0.0, 5.0, 5.0, 45.0, 0.0, 10.0, 5.0, 25.0, 0.0, 20.0, 0.0, 5.0, -1.0, 5.0, 5.0, 0.0, 5.0, 80.0, 0.0, 10.0, 45.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 10.0, 30.0, 55.0, 0.0, 25.0, 40.0, 35.0, 5.0, 20.0, 5.0, 55.0, 15.0, 10.0, 0.0, 95.0, 50.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 10.0, 30.0, 0.0, 10.0, 0.0, 15.0, 0.0, 10.0, 10.0, 25.0, 5.0, 0.0, 20.0, 30.0, 5.0, 15.0, 5.0, 25.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 60.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 10.0, 65.0, 25.0, 0.0, 5.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, -1.0, 5.0, 10.0, 5.0, 5.0, 10.0, 0.0, 10.0, 0.0, 15.0, 30.0, 5.0, 5.0, 100.0, 5.0, 10.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 25.0, 25.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 10.0, -1.0, 0.0, 55.0, 0.0, 0.0, 55.0, -1.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 25.0, 20.0, 40.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 15.0, 45.0, 0.0, 25.0, 5.0, 5.0, 15.0, 30.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 20.0, 20.0, 85.0, 15.0, 5.0, 10.0, 0.0, 20.0, 0.0, 15.0, 55.0, 20.0, 0.0, 5.0, 0.0, 20.0, 10.0, 15.0, 0.0, 25.0, 45.0, 25.0, 15.0, 0.0, 15.0, 5.0, 25.0, 25.0, 0.0, 0.0, 20.0, 15.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 40.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 15.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 25.0, 60.0, 0.0, 0.0, 30.0, 30.0, 0.0, 5.0, 5.0, 10.0, 5.0, 15.0, 5.0, 0.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 20.0, 25.0, 0.0, 10.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 20.0, 5.0, 15.0, 0.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 65.0, 0.0, 25.0, 35.0, 10.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 0.0, 0.0, 15.0, 70.0, 15.0, 15.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 25.0, 40.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 0.0, 45.0, 5.0, 15.0, 0.0, 5.0, 0.0, -1.0, 30.0, 10.0, 60.0, 10.0, 5.0, 25.0, 0.0, 10.0, 0.0, 5.0, 5.0, 40.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, 20.0, 15.0, 40.0, 20.0, 10.0, 0.0, 15.0, 20.0, 5.0, 10.0, 0.0, 15.0, 20.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 15.0, 5.0, 10.0, -1.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 25.0, 0.0, -1.0, 0.0, 5.0, 40.0, 0.0, 0.0, 35.0, 25.0, -1.0, 10.0, 5.0, 20.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 20.0, 25.0, 25.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 20.0, 25.0, 15.0, 40.0, 0.0, 25.0, 15.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 70.0, 10.0, 15.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 5.0, 0.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 0.0, 20.0, 25.0, -1.0, 10.0, 15.0, 15.0, 25.0, 5.0, 5.0, 5.0, 20.0, 25.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 25.0, 0.0, 30.0, 20.0, 15.0, 0.0, 40.0, 30.0, 0.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0], (4600, 0): [-1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 55.0, -1.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0], (2300, 2300): [0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 35.0, 20.0, 5.0, 5.0, 0.0, 70.0, 0.0, 0.0, 5.0, 5.0, 20.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 20.0, 5.0, 0.0, 25.0, 5.0, 10.0, 35.0, 20.0, 20.0, 10.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 40.0, 10.0, 5.0, 35.0, 25.0, 5.0, 15.0, 10.0, 0.0, 20.0, 5.0, 45.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 15.0, 0.0, 15.0, 0.0, 65.0, 10.0, 10.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 10.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 30.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 0.0, 0.0, 10.0, 30.0, 10.0, 15.0, 15.0, 5.0, 5.0, 10.0, 35.0, 15.0, 10.0, 5.0, 35.0, 5.0, 40.0, 15.0, 10.0, 10.0, 10.0, 10.0, 30.0, 5.0, 30.0, 5.0, 0.0, 15.0, 5.0, 0.0, 5.0, 5.0, 40.0, 5.0, 5.0, 20.0, 40.0, 20.0, 35.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 25.0, 20.0, 10.0, 5.0, 15.0, 5.0, 0.0, 25.0, 20.0, 20.0, 0.0, 0.0, 10.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 10.0, 40.0, 0.0, 0.0, 0.0, 20.0, 5.0, 35.0, 45.0, 30.0, 15.0, 30.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 30.0, 0.0, 0.0, 25.0, 10.0, 0.0, 0.0, 25.0, 45.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 0.0, 5.0, 80.0, 0.0, 0.0, 30.0, 5.0, 25.0, 0.0, 5.0, 10.0, 25.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 35.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 40.0, 0.0, 35.0, 5.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 45.0, 20.0, 50.0, 10.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 0.0, 0.0, 5.0, 25.0, 0.0, 20.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 30.0, 0.0, 25.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 10.0, 25.0, 5.0, 10.0, 0.0, 0.0, 10.0, 40.0, 40.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 30.0, 0.0, 0.0, 80.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 15.0, 25.0, 5.0, 0.0, 0.0, 15.0, 20.0, 0.0, 0.0, 30.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 15.0, 5.0, 40.0, 30.0, 0.0, 0.0, 0.0, 30.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 10.0, 0.0, 10.0, 5.0, 35.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 0.0, 5.0, 20.0, 20.0, 10.0, 5.0, 35.0, 25.0, 10.0, 15.0, 5.0, 10.0, 20.0, 5.0, 5.0, 5.0, 0.0, 10.0, 35.0, 15.0, 5.0, 5.0, 5.0, 0.0, 50.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 25.0, 0.0, 20.0, 10.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 30.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 25.0, 5.0, 75.0, 0.0, 20.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 10.0, 10.0, 15.0]}
mpc_dash_syth_hyb_pen_table_2400 = {(0, 0): [20.0, 15.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 65.0, 20.0, 10.0, 20.0, 20.0, 5.0, 65.0, 5.0, 5.0, 40.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 65.0, 10.0, 15.0, 55.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 45.0, 25.0, 35.0, 40.0, 10.0, 50.0, 50.0, 20.0, 25.0, 0.0, 60.0, 55.0, 0.0, 20.0, 30.0, 10.0, 10.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 30.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 60.0, 0.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 75.0, 90.0, 15.0, 20.0, 10.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 5.0, 30.0, 30.0, 90.0, 30.0, 25.0, 45.0, -1.0, 10.0, 0.0, 10.0, 50.0, 25.0, 35.0, 35.0, 5.0, 40.0, -1.0, 10.0, 0.0, 40.0, 10.0, 0.0, 0.0, 5.0, 55.0, 0.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, -1.0, 85.0, 75.0, 20.0, 0.0, 25.0, 20.0, 65.0, 10.0, 25.0, 100.0, 5.0, 25.0, 35.0, 10.0, 45.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 75.0, 70.0, 5.0, 5.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 20.0, 30.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 95.0, 20.0, 10.0, 85.0, 45.0, 85.0, 0.0, 50.0, 60.0, 80.0, 75.0, -1.0, 20.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 0.0, 5.0, 20.0, 30.0, 70.0, 90.0, 40.0, 25.0, -1.0, 0.0, 80.0, 10.0, 0.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 5.0, 65.0, 0.0, 35.0, 35.0, -1.0, 10.0, 70.0, 0.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, 10.0, 55.0, -1.0, 0.0, -1.0, 65.0, 100.0, 5.0, 30.0, 40.0, 15.0, 20.0, 15.0, 95.0, 20.0, 10.0, -1.0, 25.0, 90.0, 10.0, 5.0, 70.0, 10.0, 20.0, 0.0, 30.0, 30.0, 55.0, 15.0, 20.0, 65.0, 40.0, 0.0, 75.0, 0.0, 15.0, 65.0, 25.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 25.0, 15.0, 35.0, 10.0, -1.0, 95.0, 25.0, 55.0, -1.0, 20.0, 0.0, 80.0, 75.0, 15.0, 65.0, 5.0, 45.0, 50.0, 65.0, 15.0, 50.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 25.0, 5.0, 5.0, 5.0, 40.0, 25.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 10.0, 25.0, 0.0, 30.0, 45.0, 15.0, 65.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 40.0, 5.0, 50.0, 10.0, 80.0, 15.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 0.0, 35.0, 95.0, 95.0, 35.0, 20.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 5.0, 95.0, 80.0, 15.0, 20.0, 90.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 0.0, 15.0, 85.0], (7200, 2400): [-1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, -1.0, -1.0, 0.0, 30.0, 10.0, -1.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 25.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 50.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 55.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 30.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 15.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 15.0, 45.0, -1.0, 0.0, 0.0, 25.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 95.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (4800, 4800): [-1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, -1.0, 0.0, 10.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0], (4800, 0): [-1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (4800, 2400): [0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, 10.0, 10.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, 10.0, 0.0, 15.0, -1.0, 0.0, -1.0, 25.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, -1.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 15.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 40.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 35.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 30.0, 0.0, -1.0, 10.0, 0.0, 35.0, 20.0, 10.0, 5.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, 10.0, 0.0, 10.0, 25.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 60.0, 0.0, 0.0, 25.0, 15.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 15.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 60.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, -1.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 15.0, 0.0, 10.0, 10.0, 10.0, 15.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 45.0, 0.0, 15.0, -1.0, 0.0, 15.0, 10.0, 0.0, 50.0, -1.0, 0.0, -1.0, 5.0, 55.0, 0.0, -1.0, 0.0, 25.0, 0.0, 5.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 65.0, 15.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 65.0, 10.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 20.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 10.0, 10.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 5.0, 5.0, 10.0, 0.0, -1.0, 10.0, 5.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, -1.0, 0.0, 45.0, 40.0, 5.0, 10.0, -1.0, 40.0, 10.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 70.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 5.0, -1.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 20.0, -1.0, 5.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0, -1.0, 5.0, 0.0, 5.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 15.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 10.0, 0.0, 0.0, 60.0, 20.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 50.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 15.0, 10.0, 0.0, 10.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 50.0, 0.0, -1.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, 60.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 80.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 10.0, 0.0, 0.0, 5.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 65.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 10.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 30.0, 0.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, -1.0, 10.0, 0.0, 45.0, 40.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 10.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 70.0, 20.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 75.0, -1.0, 0.0, 0.0, 0.0, 35.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 45.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 90.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 50.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, 50.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 35.0, 0.0, -1.0, -1.0, 40.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 15.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, -1.0, 35.0, -1.0, 0.0, 20.0, 0.0, 0.0, 15.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 5.0, 0.0, 0.0, 20.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 35.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 20.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 35.0, -1.0, 5.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 25.0], (2400, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 0.0, 80.0, 5.0, 5.0, 0.0, 0.0, 10.0, 35.0, 10.0, 25.0, 25.0, 40.0, 0.0, 25.0, 25.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 10.0, 25.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 25.0, 15.0, 40.0, 5.0, 5.0, 5.0, 5.0, 10.0, 40.0, 0.0, 10.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, 0.0, 30.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 65.0, 15.0, 0.0, 15.0, 5.0, 25.0, 15.0, 20.0, 0.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 5.0, 60.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 5.0, 5.0, 5.0, 20.0, 55.0, 15.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 50.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 55.0, 15.0, 10.0, 0.0, 0.0, 5.0, 10.0, 5.0, 15.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 70.0, 0.0, 10.0, 0.0, 40.0, 5.0, 0.0, 0.0, 10.0, 10.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 15.0, 30.0, 30.0, 30.0, 45.0, 15.0, 20.0, 0.0, 30.0, 20.0, 0.0, 10.0, 35.0, 0.0, 0.0, 10.0, 35.0, 10.0, 25.0, 40.0, 5.0, 0.0, 10.0, 0.0, 5.0, 15.0, 0.0, 25.0, 25.0, -1.0, 10.0, 40.0, 40.0, 10.0, 0.0, 30.0, 0.0, 15.0, 5.0, 0.0, 20.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 5.0, 15.0, 0.0, 0.0, 65.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 0.0, 35.0, 10.0, 95.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 30.0, 45.0, 5.0, 55.0, 25.0, 30.0, 0.0, 0.0, 30.0, 20.0, 5.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 30.0, 75.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 25.0, 45.0, 0.0, 55.0, 25.0, 0.0, 20.0, 5.0, 30.0, 20.0, 30.0, 0.0, 5.0, 50.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 10.0, 5.0, 5.0, 0.0, 10.0, -1.0, 15.0, 0.0, -1.0, 0.0, 5.0, 5.0, 15.0, 5.0, 35.0, 15.0, 0.0, 15.0, 40.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 100.0, 0.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 15.0, 20.0, 10.0, 10.0, 20.0, 0.0, 5.0, 5.0, 45.0, 0.0, 10.0, 5.0, 25.0, 0.0, 20.0, 0.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 5.0, 80.0, 0.0, 45.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 10.0, 30.0, 55.0, 0.0, 25.0, 40.0, 35.0, 5.0, 20.0, -1.0, 5.0, 55.0, 15.0, 10.0, 0.0, 95.0, 50.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 25.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 0.0, 5.0, 15.0, 5.0, 25.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 60.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 65.0, 5.0, 25.0, 0.0, 45.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, -1.0, 5.0, 10.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 15.0, 30.0, 5.0, 25.0, 5.0, 0.0, 100.0, 5.0, 10.0, 10.0, 5.0, 0.0, -1.0, 20.0, 0.0, 0.0, 25.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 25.0, 20.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 5.0, 15.0, 45.0, 0.0, 5.0, 5.0, 15.0, 30.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 5.0, 0.0, 20.0, 85.0, 15.0, 5.0, 10.0, 0.0, 20.0, 0.0, 15.0, 10.0, 20.0, 0.0, 5.0, 5.0, 0.0, 20.0, 10.0, 40.0, 15.0, 0.0, 25.0, 45.0, 25.0, 15.0, 15.0, 5.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 5.0, 40.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 5.0, 40.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 15.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 25.0, 60.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 40.0, 0.0, 15.0, 0.0, 0.0, 20.0, 15.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 20.0, 5.0, 15.0, 0.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 35.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 70.0, 15.0, 15.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 25.0, 25.0, 40.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 0.0, 45.0, 5.0, 15.0, 0.0, 5.0, 0.0, -1.0, 30.0, 10.0, 10.0, 60.0, 10.0, 5.0, 25.0, 0.0, 10.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, 15.0, -1.0, 20.0, 15.0, 40.0, 20.0, 15.0, 10.0, 0.0, 20.0, 5.0, 10.0, 0.0, 15.0, 5.0, 20.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 10.0, -1.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 0.0, -1.0, 0.0, 5.0, 40.0, 0.0, 10.0, 0.0, 35.0, 25.0, -1.0, 10.0, 5.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 0.0, 20.0, 25.0, 25.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 20.0, 25.0, 15.0, 40.0, 0.0, 25.0, 15.0, 25.0, 0.0, 10.0, 5.0, 15.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 70.0, 10.0, 0.0, 15.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 0.0, 25.0, 30.0, -1.0, 10.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 5.0, 20.0, 25.0, 5.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 25.0, 0.0, 30.0, 20.0, 15.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0], (7200, 4800): [10.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 55.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, 40.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, 5.0, -1.0, 0.0, 0.0, 15.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 55.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 5.0, 45.0, -1.0, 0.0, 0.0, 20.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0], (7200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2400, 2400): [0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 35.0, 20.0, 5.0, 10.0, 5.0, 0.0, 70.0, 0.0, 0.0, 5.0, 5.0, 35.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 15.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 15.0, 20.0, 5.0, 0.0, 25.0, 10.0, 35.0, 20.0, 20.0, 0.0, 5.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 10.0, 5.0, 35.0, 25.0, 5.0, 15.0, 10.0, 0.0, 20.0, 5.0, 45.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 0.0, 30.0, 65.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 15.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 30.0, 10.0, 0.0, 5.0, 15.0, 0.0, 20.0, 10.0, 15.0, 0.0, 10.0, 10.0, 10.0, 0.0, 15.0, 15.0, 5.0, 5.0, 10.0, 35.0, 0.0, 15.0, 10.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 10.0, 10.0, 30.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 5.0, 40.0, 10.0, 5.0, 5.0, 20.0, 15.0, 40.0, 0.0, 10.0, 20.0, 35.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 5.0, 0.0, 25.0, 20.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 40.0, 0.0, 20.0, 5.0, 0.0, 35.0, 50.0, 45.0, 30.0, 15.0, 20.0, 0.0, 15.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 5.0, 25.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 25.0, 10.0, 0.0, 0.0, 25.0, 45.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 80.0, 0.0, 30.0, 5.0, 25.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 40.0, 5.0, 35.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 50.0, 10.0, 10.0, 5.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 0.0, 0.0, 0.0, 45.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 30.0, 0.0, 25.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 10.0, 10.0, 0.0, 0.0, 10.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, 30.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, 15.0, 5.0, 40.0, 30.0, 45.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 20.0, 10.0, 0.0, 5.0, 35.0, 25.0, 20.0, 15.0, 5.0, 10.0, 5.0, 20.0, 0.0, 5.0, 5.0, 5.0, 0.0, 10.0, 35.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 20.0, 15.0, 5.0, 5.0, 25.0, 75.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 15.0, 5.0, 15.0, 10.0, 10.0]}
mpc_dash_syth_hyb_pen_table_2500 = {(0, 0): [20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 65.0, 20.0, 10.0, 20.0, 20.0, 5.0, 65.0, 5.0, 5.0, 40.0, 30.0, 5.0, 0.0, 20.0, 65.0, 65.0, 10.0, 65.0, 10.0, 15.0, 55.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 25.0, 5.0, 25.0, 0.0, 30.0, 5.0, 20.0, 25.0, 100.0, 50.0, 30.0, 45.0, 25.0, 35.0, 40.0, 10.0, 50.0, 50.0, 20.0, 25.0, 0.0, 60.0, 55.0, 0.0, 20.0, 30.0, 10.0, 10.0, 55.0, 35.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 30.0, 0.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 40.0, 60.0, 0.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 15.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 5.0, 30.0, 30.0, 15.0, 90.0, 30.0, 25.0, 45.0, -1.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 35.0, 35.0, 60.0, 5.0, 40.0, -1.0, 10.0, 0.0, 40.0, 10.0, 0.0, 0.0, 5.0, 55.0, 0.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, -1.0, 30.0, 85.0, -1.0, 75.0, 20.0, 0.0, 0.0, 25.0, 15.0, 20.0, 65.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 35.0, 0.0, 10.0, 45.0, 5.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 75.0, 70.0, 5.0, 5.0, 10.0, 10.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 20.0, 30.0, 0.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 15.0, 0.0, 85.0, 95.0, 20.0, 10.0, 85.0, 45.0, 85.0, 0.0, 50.0, 60.0, 80.0, 75.0, -1.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 15.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 15.0, 0.0, 5.0, 20.0, 30.0, 70.0, 60.0, 90.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, -1.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 10.0, 55.0, -1.0, 0.0, -1.0, 65.0, 100.0, 5.0, 30.0, 40.0, 15.0, 20.0, 10.0, 15.0, 95.0, 20.0, 10.0, -1.0, 25.0, 90.0, 10.0, 5.0, 70.0, 10.0, 20.0, 0.0, 30.0, 30.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 0.0, 15.0, 65.0, 25.0, 40.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 25.0, 15.0, 35.0, 10.0, 60.0, -1.0, 95.0, 25.0, 55.0, -1.0, 15.0, 20.0, 0.0, 80.0, 75.0, 15.0, 65.0, 5.0, 45.0, 15.0, 50.0, 65.0, 15.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 0.0, 25.0, 5.0, 5.0, 5.0, 40.0, 25.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 40.0, 10.0, 25.0, 0.0, 30.0, 45.0, 15.0, 65.0, 30.0, 5.0, 65.0, 10.0, 45.0, 80.0, 35.0, 40.0, 0.0, -1.0, 5.0, 50.0, 10.0, 80.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 35.0, 95.0, 95.0, 35.0, 20.0, 90.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 5.0, 95.0, 80.0, 15.0, 20.0, 90.0, 25.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 15.0, 5.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 0.0, 15.0, 85.0], (7500, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2500, 2500): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 10.0, 5.0, 0.0, 70.0, 0.0, 0.0, 10.0, 25.0, 5.0, 35.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 5.0, 0.0, 30.0, 5.0, 5.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 15.0, 20.0, 5.0, 25.0, 0.0, 5.0, 0.0, 35.0, 0.0, 25.0, 20.0, 20.0, 0.0, 5.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 15.0, 10.0, 0.0, 20.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 20.0, 15.0, 0.0, 30.0, 0.0, 65.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 15.0, 0.0, 10.0, 5.0, 25.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 15.0, 10.0, 0.0, 15.0, 0.0, 20.0, 10.0, 15.0, 0.0, 10.0, 10.0, 10.0, 0.0, 0.0, 15.0, 20.0, 15.0, 5.0, 5.0, 10.0, 5.0, 0.0, 15.0, 10.0, 5.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 5.0, 15.0, 40.0, 30.0, 0.0, 10.0, 0.0, 20.0, 10.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 20.0, 10.0, 90.0, 5.0, 15.0, 5.0, 0.0, 25.0, 20.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 40.0, 0.0, 20.0, 5.0, 0.0, 35.0, 50.0, 30.0, 20.0, 0.0, 15.0, 0.0, 5.0, 5.0, 10.0, 15.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 5.0, 25.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 0.0, 25.0, 10.0, 0.0, 25.0, 45.0, 0.0, 20.0, 15.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 80.0, 5.0, 25.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 35.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 50.0, 10.0, 0.0, 0.0, 10.0, 15.0, 20.0, 5.0, 20.0, 30.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 20.0, 0.0, 25.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 10.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 30.0, 0.0, 10.0, 5.0, 0.0, 15.0, 0.0, 15.0, 5.0, 0.0, 15.0, 25.0, 0.0, 5.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 40.0, 30.0, 45.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 65.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 30.0, 5.0, 0.0, 70.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 20.0, 10.0, 0.0, 5.0, 50.0, 25.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 10.0, 35.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 5.0, 25.0, 5.0, 0.0, 0.0, 20.0, 15.0, 5.0, 25.0, 75.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 5.0, 5.0, 15.0, 10.0, 10.0], (5000, 5000): [-1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0], (5000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0], (7500, 2500): [-1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 5.0, 25.0, 15.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 55.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 5.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 35.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 45.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 95.0, -1.0, -1.0, -1.0, 0.0, 10.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (7500, 5000): [-1.0, 10.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 30.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 55.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 5.0, 45.0, 0.0, 20.0, 5.0, -1.0, 5.0, -1.0, 0.0, 10.0, -1.0, 5.0, 0.0, 80.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0], (5000, 2500): [0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, -1.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 25.0, 5.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 65.0, 5.0, 0.0, -1.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 30.0, -1.0, 10.0, 0.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 15.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 40.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 35.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 30.0, 0.0, -1.0, -1.0, 10.0, 0.0, 35.0, 20.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 0.0, 5.0, 0.0, 50.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, -1.0, 60.0, 0.0, 35.0, 50.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, 10.0, 40.0, 0.0, 0.0, 0.0, -1.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 60.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 35.0, -1.0, 15.0, 0.0, 10.0, 10.0, 10.0, 15.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 85.0, 0.0, 0.0, -1.0, 0.0, 0.0, 75.0, 0.0, -1.0, 0.0, 85.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 45.0, 0.0, 15.0, -1.0, 0.0, 15.0, -1.0, 10.0, 0.0, 50.0, -1.0, 0.0, -1.0, 5.0, 55.0, 0.0, -1.0, 0.0, 25.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 65.0, -1.0, 10.0, 15.0, 0.0, -1.0, 0.0, 5.0, 10.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, -1.0, 65.0, 0.0, 0.0, 20.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 10.0, 10.0, 10.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 5.0, 5.0, 10.0, 0.0, -1.0, 10.0, 5.0, 0.0, 20.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 15.0, 5.0, -1.0, 0.0, 45.0, 40.0, 5.0, 10.0, -1.0, 40.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 70.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, 20.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 25.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, 20.0, -1.0, 15.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 20.0, 5.0, 5.0, 10.0, -1.0, 5.0, 30.0, 5.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 60.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 50.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 30.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, -1.0, 5.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, 5.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 15.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 55.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 5.0, 0.0, 0.0, 50.0, 0.0, -1.0, -1.0, -1.0, 5.0, 20.0, 0.0, 0.0, 0.0, -1.0, 60.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 15.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 80.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 65.0, 10.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 30.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 30.0, -1.0, 0.0, 0.0, -1.0, 20.0, -1.0, -1.0, 0.0, 45.0, 40.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 10.0, 50.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 25.0, 75.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 80.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 90.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 0.0, 15.0, -1.0, 5.0, 0.0, 0.0, 50.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, 15.0, 5.0, -1.0, 5.0, 20.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, -1.0, -1.0, 35.0, 20.0, 0.0, -1.0, -1.0, 40.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 30.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, -1.0, -1.0, 30.0, 35.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 45.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 20.0, -1.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 35.0, -1.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0], (2500, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 35.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 0.0, 80.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 35.0, 10.0, 25.0, 25.0, 40.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 10.0, 25.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 25.0, 15.0, 40.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 40.0, 0.0, 10.0, 0.0, 5.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, 0.0, 30.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 0.0, 65.0, 15.0, 0.0, 15.0, 5.0, 25.0, 15.0, 20.0, 0.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 5.0, 60.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 15.0, 10.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 50.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 55.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 15.0, 0.0, 5.0, 10.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 70.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 30.0, 30.0, 45.0, 20.0, 0.0, 30.0, 20.0, 35.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, 10.0, 25.0, 40.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 25.0, -1.0, 10.0, 40.0, 40.0, 0.0, 10.0, 0.0, 30.0, 0.0, 30.0, 0.0, 15.0, 5.0, 0.0, 0.0, 45.0, 40.0, 0.0, 0.0, -1.0, 0.0, 10.0, 20.0, 10.0, 0.0, 30.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 65.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 0.0, 35.0, 10.0, 95.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 30.0, 0.0, 45.0, 5.0, -1.0, 55.0, 25.0, 30.0, 0.0, 10.0, 0.0, 30.0, 20.0, 5.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 75.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, 55.0, 45.0, 15.0, 25.0, 0.0, 20.0, 30.0, 30.0, 50.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 5.0, 5.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, 5.0, 5.0, 15.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 100.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 15.0, 20.0, 10.0, 10.0, 0.0, 0.0, 20.0, 0.0, 5.0, 5.0, 45.0, 0.0, 10.0, 5.0, 25.0, 0.0, 0.0, 20.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 80.0, 0.0, 0.0, 45.0, 0.0, 5.0, 5.0, 10.0, 15.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 0.0, 10.0, 30.0, 55.0, 0.0, 25.0, 40.0, 35.0, 5.0, 0.0, 20.0, 0.0, 0.0, -1.0, 5.0, 55.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 25.0, 0.0, 0.0, 25.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 65.0, 5.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 5.0, 0.0, 5.0, 5.0, 0.0, 15.0, 0.0, -1.0, 5.0, 10.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 5.0, 25.0, 5.0, 0.0, 5.0, 0.0, 10.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 25.0, 20.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, -1.0, 0.0, 5.0, 15.0, 45.0, 30.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 30.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 20.0, 85.0, 15.0, 5.0, 10.0, 0.0, 20.0, 0.0, 15.0, 10.0, 20.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 25.0, 45.0, 0.0, 25.0, 15.0, 15.0, 5.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 25.0, 15.0, 5.0, 40.0, 20.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 15.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 30.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 15.0, 25.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 15.0, 70.0, 15.0, 15.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 10.0, 15.0, 15.0, 0.0, 45.0, 5.0, 15.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, 10.0, 60.0, 10.0, 5.0, 25.0, 0.0, 10.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 20.0, 10.0, -1.0, 15.0, 20.0, 15.0, 40.0, 20.0, 15.0, 10.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 10.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 5.0, 35.0, 40.0, 0.0, 10.0, 0.0, 35.0, 25.0, 20.0, -1.0, 10.0, 5.0, 20.0, 5.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 0.0, 20.0, 25.0, 25.0, 0.0, 10.0, 0.0, 5.0, 5.0, 20.0, 0.0, 20.0, 10.0, 20.0, 0.0, 25.0, 15.0, 40.0, 25.0, 15.0, 25.0, 0.0, 10.0, 5.0, 15.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 70.0, 10.0, 0.0, 15.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 0.0, 30.0, -1.0, 10.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 5.0, 20.0, 25.0, 5.0, 5.0, 5.0, 0.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 25.0, 0.0, 30.0, 20.0, 15.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0]}
mpc_dash_syth_hyb_pen_table_2600 = {(7800, 5200): [10.0, 0.0, 40.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 30.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, 10.0, 10.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, 10.0, -1.0, 5.0, 80.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 55.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0], (0, 0): [20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 65.0, 20.0, 10.0, 20.0, 20.0, 10.0, 5.0, 65.0, 5.0, 40.0, 5.0, 40.0, 30.0, 5.0, 0.0, 20.0, 65.0, 25.0, 65.0, 15.0, 10.0, 65.0, 10.0, 15.0, 40.0, 55.0, 15.0, 10.0, 5.0, 25.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 25.0, 5.0, 25.0, 0.0, 30.0, 65.0, 5.0, 0.0, 20.0, 25.0, 100.0, 50.0, 30.0, 45.0, 25.0, 35.0, 60.0, 40.0, 10.0, 50.0, 35.0, 50.0, 20.0, 0.0, 25.0, 0.0, 60.0, 55.0, 0.0, 20.0, 30.0, 10.0, 10.0, 55.0, 35.0, -1.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 15.0, 10.0, 40.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 30.0, 0.0, 0.0, 0.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 40.0, 60.0, 0.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 0.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 45.0, 15.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 5.0, 30.0, 5.0, 30.0, 15.0, 90.0, 30.0, 40.0, 25.0, 45.0, -1.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 0.0, 35.0, 35.0, 60.0, 5.0, 40.0, -1.0, 10.0, 0.0, 40.0, 10.0, 0.0, 0.0, 45.0, 5.0, 55.0, 0.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, -1.0, 30.0, 85.0, -1.0, 75.0, 20.0, 0.0, 0.0, 25.0, 15.0, 20.0, 65.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 35.0, 0.0, 10.0, 45.0, 5.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 75.0, 70.0, 5.0, 5.0, 10.0, 5.0, 10.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 5.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 20.0, 30.0, 0.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 5.0, 15.0, 0.0, 0.0, 85.0, 95.0, 20.0, 10.0, 45.0, 85.0, 0.0, 0.0, 45.0, 85.0, 0.0, 50.0, 60.0, 80.0, 75.0, -1.0, 55.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 10.0, 15.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 25.0, 15.0, 0.0, 5.0, 20.0, 30.0, 70.0, 60.0, 90.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, -1.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 10.0, 55.0, -1.0, 0.0, -1.0, 65.0, 100.0, 5.0, 30.0, 20.0, 40.0, 15.0, 20.0, 10.0, 15.0, 95.0, 20.0, 5.0, 15.0, 10.0, -1.0, 25.0, 90.0, 10.0, 5.0, 70.0, 10.0, 20.0, 0.0, 30.0, 30.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 45.0, 0.0, 15.0, 65.0, 25.0, 40.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 25.0, 15.0, 20.0, 35.0, 10.0, 60.0, -1.0, 95.0, 25.0, 55.0, -1.0, 15.0, 20.0, 0.0, 80.0, 75.0, 15.0, 65.0, 5.0, 45.0, 15.0, 50.0, 65.0, 15.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 0.0, 25.0, 5.0, 5.0, 5.0, 0.0, 40.0, 25.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 40.0, 10.0, 25.0, 0.0, 30.0, 45.0, 15.0, 15.0, 65.0, 30.0, 5.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 40.0, 0.0, 15.0, -1.0, 5.0, 50.0, 10.0, 80.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 40.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 20.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 0.0, 0.0, 35.0, 95.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 20.0, 5.0, 95.0, 80.0, 15.0, 0.0, 20.0, 90.0, 25.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 50.0, 25.0, 20.0, 15.0, 15.0, 5.0, 30.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 0.0, 15.0, 85.0], (2600, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 35.0, 5.0, 30.0, 0.0, 0.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 0.0, 0.0, 80.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 35.0, 10.0, 25.0, 25.0, 0.0, 25.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 25.0, 15.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 20.0, 10.0, 40.0, 0.0, 10.0, 0.0, 5.0, 5.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, 20.0, 0.0, 30.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 5.0, 25.0, 15.0, 20.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 15.0, 10.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 5.0, 5.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 20.0, 15.0, 10.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 50.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 55.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 15.0, 5.0, 10.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 20.0, 0.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 30.0, 5.0, 30.0, 0.0, -1.0, 20.0, 0.0, 30.0, 20.0, 35.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 35.0, 10.0, 25.0, 0.0, 40.0, 5.0, 0.0, 10.0, 0.0, 0.0, 25.0, 25.0, -1.0, 10.0, 10.0, 40.0, 0.0, 10.0, 0.0, 30.0, 0.0, 30.0, 0.0, 15.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 45.0, 40.0, 0.0, 0.0, -1.0, 10.0, 5.0, 20.0, 10.0, 0.0, 30.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 65.0, 0.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 10.0, 0.0, 35.0, 10.0, 95.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 5.0, -1.0, 0.0, 55.0, 0.0, 25.0, 30.0, 0.0, 10.0, 0.0, 0.0, 30.0, 20.0, 5.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 75.0, 15.0, 0.0, 10.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, -1.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, 55.0, 45.0, 30.0, 15.0, 25.0, 0.0, 20.0, 30.0, 30.0, 50.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 45.0, 5.0, 45.0, 35.0, 25.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 15.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 100.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 5.0, 45.0, 10.0, 0.0, 10.0, 25.0, 0.0, 20.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 80.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 5.0, 0.0, 10.0, 0.0, 10.0, 0.0, 45.0, 5.0, 5.0, 5.0, 10.0, 0.0, 10.0, 30.0, 55.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 5.0, 0.0, 20.0, 0.0, 45.0, 0.0, -1.0, 5.0, 15.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 25.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 30.0, 25.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 5.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 65.0, 5.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 50.0, 5.0, 5.0, 5.0, 15.0, 0.0, 5.0, 5.0, 20.0, 0.0, 15.0, 0.0, -1.0, 5.0, 10.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 25.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, -1.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, -1.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 25.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 30.0, 0.0, 5.0, 0.0, 5.0, 0.0, 15.0, 0.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 20.0, 5.0, 10.0, 0.0, 20.0, 85.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 15.0, 10.0, 20.0, 25.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 25.0, 0.0, 25.0, 15.0, 15.0, 5.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 25.0, 15.0, 5.0, 40.0, 20.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 15.0, 25.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 15.0, 70.0, 15.0, 5.0, 15.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 15.0, 0.0, 10.0, 15.0, 15.0, 0.0, 45.0, 5.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, 10.0, 0.0, 60.0, 10.0, 25.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 35.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, -1.0, 20.0, 15.0, 40.0, 20.0, 15.0, 10.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, 10.0, 5.0, 0.0, 5.0, 35.0, 0.0, 10.0, 0.0, 35.0, 0.0, 25.0, 20.0, 15.0, -1.0, 10.0, 5.0, 5.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 35.0, 5.0, 0.0, 15.0, 0.0, 40.0, 5.0, 0.0, 0.0, 20.0, 5.0, 25.0, 25.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 20.0, 0.0, 20.0, 10.0, 30.0, 20.0, 0.0, 25.0, 15.0, 40.0, 25.0, 15.0, 25.0, 0.0, 10.0, 0.0, -1.0, 5.0, 15.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 0.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 30.0, -1.0, 0.0, 10.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 5.0, 20.0, 25.0, 5.0, 25.0, 5.0, 5.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 25.0, 0.0, 20.0, 15.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0], (5200, 5200): [0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 10.0], (5200, 2600): [0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, -1.0, 15.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 65.0, 0.0, -1.0, 0.0, 5.0, 10.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 40.0, 0.0, 0.0, 0.0, 30.0, 0.0, 15.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 5.0, 0.0, 50.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 60.0, 0.0, 35.0, -1.0, 50.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, -1.0, 30.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 35.0, -1.0, 15.0, 0.0, 10.0, 10.0, 10.0, 10.0, 15.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 55.0, 85.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 85.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 15.0, -1.0, 10.0, 0.0, 50.0, -1.0, -1.0, 5.0, 55.0, 0.0, -1.0, 20.0, 0.0, -1.0, 25.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 65.0, -1.0, 10.0, 0.0, -1.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 65.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 5.0, -1.0, -1.0, 5.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 30.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 45.0, 40.0, 5.0, 10.0, -1.0, 40.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 70.0, 0.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 20.0, 5.0, 0.0, 0.0, 40.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, -1.0, 10.0, -1.0, 5.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 25.0, 5.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, 10.0, -1.0, 20.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 5.0, 5.0, 10.0, -1.0, 30.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 60.0, 20.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 50.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 30.0, 20.0, 15.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 45.0, 5.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 15.0, 10.0, 0.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 55.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 5.0, 0.0, 0.0, 50.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 15.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 20.0, 60.0, 0.0, 0.0, 80.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 10.0, 0.0, 5.0, -1.0, 45.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 65.0, 10.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, 10.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 30.0, -1.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, 0.0, 45.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 0.0, 10.0, 50.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, 75.0, -1.0, 0.0, 0.0, 0.0, -1.0, 35.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 80.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 90.0, -1.0, 0.0, 25.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 0.0, 15.0, -1.0, 5.0, 0.0, 0.0, 50.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, -1.0, 15.0, 5.0, -1.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 35.0, 5.0, -1.0, -1.0, -1.0, 35.0, 20.0, 0.0, -1.0, 0.0, -1.0, 40.0, -1.0, -1.0, 10.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 10.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 45.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, 0.0, 0.0, 35.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 10.0, -1.0, 10.0, 0.0, -1.0, 35.0, -1.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 25.0], (7800, 2600): [-1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 10.0, 0.0, 25.0, -1.0, 15.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 35.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 25.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 10.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, -1.0, -1.0, 0.0, 10.0, 30.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0], (5200, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (7800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (2600, 2600): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 20.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 70.0, 0.0, 0.0, 10.0, 25.0, 0.0, 35.0, 20.0, 20.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 25.0, 15.0, 15.0, 5.0, 5.0, 0.0, 0.0, 30.0, 5.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 15.0, -1.0, 5.0, 25.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 25.0, 20.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 0.0, 20.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 65.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 10.0, 5.0, 25.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 15.0, 0.0, 15.0, 0.0, 20.0, 0.0, 10.0, 15.0, 10.0, 10.0, 10.0, 0.0, 0.0, 15.0, 0.0, 20.0, 15.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 5.0, 35.0, 40.0, 10.0, 0.0, 15.0, 5.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 5.0, 60.0, 15.0, 40.0, 30.0, 0.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 20.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 10.0, 90.0, 5.0, 15.0, 5.0, 25.0, 20.0, 5.0, 20.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 35.0, 5.0, 50.0, -1.0, 20.0, 45.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 10.0, 0.0, 15.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 35.0, 20.0, 0.0, 0.0, 0.0, 5.0, 25.0, 10.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 20.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 20.0, 15.0, 10.0, 0.0, 0.0, 5.0, 5.0, 0.0, 80.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 10.0, 0.0, 0.0, 10.0, 0.0, 5.0, 20.0, 5.0, 30.0, 15.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 15.0, 5.0, 0.0, 40.0, 5.0, 10.0, 5.0, 20.0, 0.0, 25.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 5.0, 10.0, 40.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 30.0, 0.0, 20.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 25.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 15.0, 40.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 65.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 0.0, 70.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 20.0, 0.0, 50.0, 25.0, 20.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 5.0, 20.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 5.0, 25.0, 5.0, 0.0, 0.0, 20.0, 15.0, 5.0, 75.0, 0.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0]}
mpc_dash_syth_hyb_pen_table_2700 = {(0, 0): [20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 80.0, 45.0, 30.0, 65.0, 20.0, 10.0, 20.0, 20.0, 10.0, 5.0, 35.0, 65.0, 5.0, 40.0, 5.0, 40.0, 30.0, 5.0, 0.0, 20.0, 65.0, 25.0, 65.0, 15.0, 10.0, 65.0, 10.0, 15.0, 40.0, 55.0, 15.0, 10.0, 5.0, 25.0, 40.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 30.0, 25.0, 5.0, 25.0, 5.0, 0.0, 30.0, 65.0, 15.0, 5.0, 20.0, 0.0, 20.0, 25.0, 100.0, 50.0, 30.0, 45.0, 25.0, 35.0, 5.0, 60.0, 40.0, 10.0, 50.0, 35.0, 50.0, 20.0, 0.0, 25.0, 0.0, 60.0, 55.0, 25.0, 0.0, 20.0, 30.0, 10.0, 10.0, 10.0, 20.0, 55.0, 35.0, 5.0, -1.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 50.0, 15.0, 10.0, 40.0, 5.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 5.0, 30.0, 0.0, 0.0, 0.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 40.0, 60.0, 0.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 0.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 45.0, 15.0, 5.0, 25.0, 25.0, 35.0, 85.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 5.0, 5.0, 5.0, 5.0, 30.0, 5.0, 30.0, 15.0, 90.0, 25.0, -1.0, 30.0, 40.0, 25.0, 45.0, -1.0, 15.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 0.0, 10.0, 35.0, 35.0, 65.0, 60.0, 5.0, 0.0, 0.0, 40.0, 10.0, -1.0, 10.0, 0.0, 40.0, 25.0, 10.0, 0.0, 0.0, 45.0, 5.0, 55.0, 0.0, 25.0, 30.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, -1.0, 30.0, 85.0, -1.0, 75.0, 20.0, 0.0, 0.0, 25.0, 15.0, 20.0, 65.0, 25.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 35.0, 0.0, 10.0, 45.0, 5.0, 50.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 0.0, 75.0, 70.0, 5.0, 45.0, 5.0, 45.0, 10.0, 5.0, 10.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 5.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 20.0, 30.0, 0.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 5.0, 15.0, 0.0, 0.0, 85.0, 95.0, 20.0, 10.0, 45.0, 85.0, 0.0, 0.0, 45.0, 85.0, 0.0, 45.0, 50.0, 60.0, 5.0, 55.0, 80.0, 75.0, -1.0, 55.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 10.0, 15.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 25.0, 15.0, 0.0, 5.0, 20.0, 0.0, 30.0, 70.0, 60.0, 90.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, 5.0, -1.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 35.0, 10.0, 55.0, -1.0, 0.0, -1.0, 65.0, 100.0, 5.0, 30.0, 20.0, 40.0, 15.0, 20.0, 10.0, 15.0, 95.0, 20.0, 5.0, 15.0, 10.0, -1.0, 45.0, 25.0, 90.0, 10.0, 5.0, 70.0, 20.0, 10.0, 20.0, 0.0, 30.0, 30.0, 15.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 45.0, 25.0, 0.0, 15.0, 65.0, 25.0, 40.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 15.0, 25.0, 15.0, 20.0, 35.0, 10.0, 60.0, -1.0, 95.0, 25.0, 55.0, -1.0, 15.0, 20.0, 5.0, 0.0, 80.0, 75.0, 15.0, 65.0, 0.0, 5.0, 10.0, 45.0, 15.0, 50.0, 30.0, 65.0, 15.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 0.0, 70.0, 25.0, 5.0, 5.0, 5.0, 0.0, 40.0, 25.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 40.0, 10.0, 25.0, 15.0, 0.0, 30.0, 45.0, 15.0, 15.0, 65.0, 30.0, 5.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 40.0, 0.0, 15.0, -1.0, 5.0, 50.0, 10.0, 80.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 40.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 20.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 0.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 25.0, 0.0, 0.0, 35.0, 95.0, 15.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 20.0, 10.0, 5.0, 95.0, 80.0, 15.0, 0.0, 20.0, 90.0, 25.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 10.0, 0.0, 50.0, 25.0, 20.0, 15.0, 15.0, 5.0, 5.0, 30.0, 15.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 40.0, -1.0, 15.0, 0.0, 15.0, 85.0], (2700, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 25.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 80.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 30.0, 25.0, 0.0, 25.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 25.0, 15.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 20.0, 10.0, 0.0, 10.0, 0.0, 5.0, 5.0, 25.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 65.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 55.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 15.0, 5.0, 10.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 10.0, 20.0, 0.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, 20.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 5.0, 30.0, 5.0, -1.0, 30.0, 0.0, -1.0, 20.0, 0.0, 15.0, 0.0, 0.0, 20.0, 30.0, 20.0, 35.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 35.0, 10.0, 25.0, 0.0, 40.0, 5.0, 40.0, 0.0, 10.0, 0.0, 0.0, 25.0, 10.0, 10.0, 40.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 30.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 45.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 5.0, 20.0, 0.0, 30.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 35.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 35.0, 10.0, 95.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 5.0, -1.0, 0.0, 55.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 30.0, 20.0, 5.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, 0.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 75.0, 15.0, 0.0, 10.0, 0.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, 55.0, 45.0, 30.0, 15.0, 0.0, 20.0, 30.0, 30.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 35.0, 25.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 15.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 100.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 5.0, 45.0, 10.0, 0.0, 10.0, 25.0, 0.0, 0.0, 20.0, 0.0, 5.0, 35.0, -1.0, 5.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 80.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 5.0, 0.0, 10.0, 30.0, 0.0, 10.0, 20.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 30.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 5.0, 0.0, 20.0, 0.0, 25.0, 45.0, 0.0, -1.0, 5.0, 15.0, -1.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 25.0, 5.0, 15.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 30.0, -1.0, 25.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 5.0, 25.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, -1.0, 5.0, 35.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 65.0, -1.0, 10.0, 5.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 50.0, 5.0, 10.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 25.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, -1.0, 10.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, -1.0, 0.0, 5.0, 0.0, 70.0, 0.0, 10.0, 25.0, 10.0, 50.0, 45.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 20.0, 85.0, 15.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 20.0, 25.0, 0.0, 0.0, 5.0, 10.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 15.0, 15.0, 5.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 25.0, 15.0, 5.0, 40.0, 20.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 15.0, 25.0, 0.0, 10.0, 0.0, 30.0, 0.0, 0.0, 5.0, 5.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 10.0, 0.0, 15.0, 0.0, 15.0, 15.0, 5.0, 15.0, 40.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 15.0, 0.0, 10.0, 15.0, 0.0, 45.0, 5.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, 10.0, 0.0, 60.0, 10.0, 25.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 10.0, 35.0, 0.0, 5.0, 0.0, 0.0, 20.0, 10.0, -1.0, 20.0, 15.0, 40.0, 20.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, -1.0, 20.0, 5.0, -1.0, -1.0, 10.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 25.0, 20.0, 15.0, -1.0, 10.0, 5.0, 0.0, 5.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 35.0, 5.0, 0.0, 15.0, 0.0, 40.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 5.0, 25.0, 25.0, 0.0, 0.0, 10.0, 5.0, 5.0, 20.0, 0.0, 20.0, 10.0, 30.0, 20.0, 0.0, -1.0, 15.0, -1.0, 40.0, 25.0, 15.0, 0.0, 25.0, 0.0, 10.0, 0.0, -1.0, 5.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 65.0, 65.0, 65.0, -1.0, 0.0, 0.0, 30.0, -1.0, 0.0, 10.0, 15.0, 15.0, 25.0, 5.0, 5.0, 0.0, 5.0, 20.0, 25.0, 5.0, 25.0, 5.0, 75.0, 5.0, 0.0, 5.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 20.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 20.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 10.0, 15.0, 0.0], (2700, 2700): [0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 20.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 70.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 35.0, 10.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 15.0, 5.0, 5.0, 20.0, 0.0, 0.0, 30.0, 5.0, 0.0, 10.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 5.0, -1.0, 15.0, 35.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 35.0, 0.0, 25.0, 20.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 65.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, 10.0, 5.0, 25.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 15.0, 10.0, 15.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 0.0, 15.0, 5.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 5.0, 35.0, 10.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 35.0, 0.0, 0.0, 15.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 25.0, 10.0, 90.0, 5.0, 15.0, 5.0, 0.0, 5.0, 20.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, 35.0, 5.0, 50.0, 0.0, -1.0, 20.0, 45.0, 0.0, 0.0, 0.0, 15.0, 0.0, 25.0, 5.0, 10.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 15.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 10.0, 0.0, 0.0, 5.0, 5.0, 80.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 20.0, 5.0, 30.0, 15.0, 0.0, 5.0, 70.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 20.0, 45.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 40.0, 5.0, 10.0, 0.0, 5.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 5.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 50.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 30.0, 0.0, -1.0, 20.0, 10.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 15.0, 25.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 0.0, 5.0, 20.0, 60.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 65.0, 0.0, 0.0, 45.0, 0.0, 5.0, 10.0, 0.0, 0.0, 30.0, 10.0, 5.0, 0.0, 70.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 50.0, 25.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 35.0, 5.0, 20.0, 0.0, 5.0, 0.0, 5.0, 20.0, 45.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, 10.0, 5.0, 30.0, 5.0, 5.0, 0.0, 0.0, 5.0, 25.0, 5.0, 5.0, 10.0, -1.0, 0.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0], (5400, 5400): [0.0, -1.0, 0.0, 45.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0], (8100, 2700): [-1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, 5.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, 20.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 95.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0], (8100, 5400): [40.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 45.0, -1.0, 25.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 10.0, 5.0, 80.0, 15.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0], (5400, 2700): [0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 10.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 25.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, -1.0, 15.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 65.0, 0.0, -1.0, -1.0, 0.0, 5.0, 10.0, 0.0, 0.0, 30.0, -1.0, 10.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 45.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 35.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 0.0, 50.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 35.0, 0.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 60.0, 0.0, 35.0, -1.0, 50.0, -1.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 30.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, 0.0, 10.0, 10.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, -1.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 35.0, -1.0, 15.0, 0.0, 10.0, 10.0, 10.0, 10.0, 15.0, -1.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 15.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 55.0, 85.0, 0.0, 0.0, -1.0, 0.0, 0.0, 85.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, 15.0, 10.0, 50.0, -1.0, -1.0, 5.0, 55.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, -1.0, 10.0, 0.0, -1.0, 0.0, 10.0, 30.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 10.0, 25.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 5.0, 10.0, 0.0, -1.0, 0.0, 20.0, 0.0, 10.0, 0.0, -1.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 45.0, 40.0, 10.0, -1.0, 40.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 25.0, 5.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, 10.0, -1.0, 20.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 5.0, 5.0, 10.0, -1.0, 30.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 45.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 60.0, 0.0, 20.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 25.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 25.0, 0.0, 5.0, 20.0, 15.0, 0.0, -1.0, 5.0, 0.0, -1.0, 5.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 5.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 35.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 15.0, 0.0, 55.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 5.0, 0.0, 0.0, 50.0, 0.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 80.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 15.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, 10.0, 0.0, 5.0, -1.0, 45.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 65.0, 10.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 10.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 45.0, -1.0, 40.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 5.0, 0.0, 0.0, 15.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 50.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, 75.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 60.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 80.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 90.0, -1.0, 0.0, 25.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 15.0, -1.0, 5.0, 0.0, 0.0, -1.0, 50.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, 5.0, -1.0, 10.0, 0.0, -1.0, 15.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 35.0, 5.0, -1.0, -1.0, -1.0, -1.0, 35.0, 20.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 35.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 45.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 35.0, -1.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, -1.0, 25.0], (5400, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0], (8100, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_2800 = {(0, 0): [20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 5.0, 80.0, 45.0, 30.0, 0.0, 65.0, 80.0, 5.0, 20.0, 10.0, 20.0, 20.0, 10.0, 5.0, 35.0, 65.0, 5.0, 40.0, 5.0, 40.0, 25.0, 30.0, 5.0, 0.0, 20.0, 65.0, 25.0, 65.0, 0.0, 15.0, 10.0, 65.0, 10.0, 15.0, 40.0, 55.0, 15.0, 10.0, 5.0, 25.0, 40.0, 35.0, 5.0, 10.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 30.0, 25.0, 5.0, 25.0, 5.0, 35.0, 0.0, 30.0, 65.0, 15.0, 5.0, 20.0, 0.0, 20.0, 25.0, 100.0, 50.0, 30.0, 0.0, 45.0, 25.0, 35.0, 5.0, 60.0, 40.0, 10.0, 50.0, 35.0, 50.0, 20.0, 0.0, 25.0, 0.0, 60.0, 55.0, 25.0, 0.0, 20.0, 30.0, 10.0, 10.0, 5.0, 10.0, 20.0, 55.0, 35.0, 5.0, -1.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 50.0, 15.0, 10.0, 40.0, 5.0, 0.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 5.0, 5.0, 30.0, 0.0, 0.0, 0.0, 35.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 40.0, 60.0, 0.0, 20.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 50.0, 0.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 45.0, 15.0, 5.0, 25.0, 25.0, 35.0, 85.0, 20.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 10.0, 5.0, 5.0, 40.0, 5.0, 5.0, 30.0, 5.0, 30.0, 15.0, 90.0, 25.0, -1.0, 30.0, 40.0, 25.0, 45.0, -1.0, 15.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 0.0, 10.0, 35.0, 35.0, 65.0, 0.0, 60.0, 5.0, 0.0, 0.0, 40.0, 10.0, -1.0, 10.0, 0.0, 40.0, 95.0, 25.0, 10.0, 0.0, 0.0, 45.0, 5.0, 55.0, 0.0, 25.0, 30.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 25.0, -1.0, 15.0, 50.0, 0.0, -1.0, 30.0, 0.0, 85.0, -1.0, 75.0, 20.0, 0.0, 5.0, 0.0, 25.0, 15.0, 20.0, 65.0, 55.0, 25.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 30.0, 35.0, 0.0, 10.0, 45.0, 5.0, 50.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 0.0, 75.0, 70.0, 5.0, 45.0, 5.0, 45.0, 25.0, 10.0, 5.0, 10.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 5.0, 20.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 5.0, 20.0, 30.0, 0.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 5.0, 15.0, 0.0, 0.0, 5.0, 85.0, 95.0, 20.0, 10.0, 45.0, 85.0, 0.0, 0.0, 10.0, 45.0, 85.0, 0.0, 45.0, 50.0, 60.0, 5.0, 55.0, 80.0, 20.0, 75.0, -1.0, 55.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 10.0, 15.0, 25.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 25.0, 25.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0, 30.0, 70.0, 60.0, 90.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, 5.0, -1.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 10.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 35.0, 10.0, 55.0, -1.0, 0.0, -1.0, 65.0, 100.0, 5.0, 30.0, 20.0, 40.0, 15.0, 45.0, 20.0, 10.0, 15.0, 95.0, 20.0, 5.0, 15.0, 10.0, -1.0, 45.0, 25.0, 90.0, 10.0, 5.0, 70.0, 20.0, 10.0, 20.0, 0.0, 15.0, 30.0, 30.0, 15.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 45.0, 25.0, 0.0, 15.0, 65.0, 25.0, 40.0, 10.0, 5.0, 10.0, 50.0, 10.0, 55.0, 0.0, 15.0, 25.0, 15.0, 20.0, 0.0, 35.0, 10.0, 60.0, -1.0, 95.0, 5.0, 25.0, 55.0, -1.0, 15.0, 20.0, 5.0, 0.0, 80.0, 10.0, 75.0, 15.0, 65.0, 0.0, 5.0, 10.0, 45.0, 15.0, 50.0, 30.0, 65.0, 15.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 20.0, 0.0, 70.0, 25.0, 5.0, 5.0, 5.0, 0.0, 40.0, 25.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 40.0, 10.0, 25.0, 15.0, 15.0, 0.0, 30.0, 45.0, 45.0, 15.0, 15.0, 65.0, 30.0, 5.0, 60.0, 65.0, 5.0, 10.0, 45.0, 80.0, 35.0, 40.0, 0.0, 15.0, -1.0, 5.0, 40.0, 50.0, 10.0, 80.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 25.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 40.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 20.0, 15.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 0.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 25.0, 0.0, 15.0, 0.0, 35.0, 95.0, 15.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 75.0, 50.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 20.0, 10.0, 65.0, 5.0, 95.0, 80.0, 15.0, 0.0, 20.0, 90.0, 25.0, 15.0, 5.0, 15.0, 25.0, 5.0, 10.0, 5.0, 15.0, 10.0, 0.0, 50.0, 25.0, 20.0, 15.0, 0.0, 15.0, 5.0, 5.0, 30.0, 15.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 20.0, 40.0, 5.0, -1.0, 15.0, 0.0, 15.0, 85.0], (8400, 2800): [-1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 30.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 55.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 95.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0], (5600, 2800): [0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 10.0, 0.0, 10.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 15.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, 0.0, 65.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 30.0, -1.0, 10.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 40.0, 0.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 40.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 45.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 5.0, 0.0, 35.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 55.0, 10.0, 0.0, 50.0, 0.0, 10.0, 0.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 35.0, 0.0, 0.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, 50.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 30.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 10.0, 10.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 10.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, -1.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 40.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 25.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 35.0, -1.0, 15.0, 0.0, -1.0, 10.0, 10.0, -1.0, 10.0, 10.0, -1.0, 15.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 85.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 15.0, 10.0, 50.0, -1.0, -1.0, 5.0, 55.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 40.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 15.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, -1.0, 35.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 10.0, 10.0, 10.0, 25.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, -1.0, 5.0, 10.0, 0.0, -1.0, 0.0, 20.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 40.0, 10.0, -1.0, 40.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 25.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 10.0, 10.0, -1.0, -1.0, 30.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 5.0, 5.0, 10.0, -1.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, 10.0, 0.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 60.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 25.0, -1.0, -1.0, 0.0, 5.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 45.0, 5.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, 0.0, 15.0, 10.0, -1.0, 0.0, -1.0, 0.0, 10.0, 35.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 55.0, 15.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 80.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, 0.0, 10.0, 0.0, 5.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 45.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 20.0, 10.0, -1.0, 0.0, -1.0, 45.0, 40.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 45.0, 5.0, -1.0, 0.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 50.0, 0.0, 5.0, -1.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, -1.0, 75.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 60.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 80.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 90.0, 0.0, 25.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 15.0, 0.0, 0.0, 15.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 50.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 20.0, 0.0, 10.0, 0.0, 0.0, 35.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 35.0, 20.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, 20.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, -1.0, -1.0, 35.0, -1.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, -1.0], (2800, 2800): [0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 70.0, 0.0, 10.0, 10.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 20.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 15.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, -1.0, 15.0, 0.0, 35.0, 25.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 20.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 5.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 0.0, 0.0, 45.0, 15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0, 10.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, -1.0, 20.0, 15.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 10.0, 60.0, 0.0, 10.0, 15.0, 15.0, 0.0, 0.0, 10.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, -1.0, 10.0, 15.0, 15.0, 0.0, 10.0, 10.0, 5.0, 10.0, 0.0, 0.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 35.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 60.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 35.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 0.0, 25.0, 10.0, 90.0, 5.0, 15.0, 5.0, 0.0, 5.0, 20.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 5.0, -1.0, 10.0, 50.0, 0.0, -1.0, 20.0, 45.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 25.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 25.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 10.0, 0.0, 5.0, 5.0, 80.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 45.0, 5.0, 0.0, 5.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 45.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, 5.0, 10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 40.0, 0.0, 0.0, 0.0, 50.0, 0.0, 0.0, 5.0, 30.0, 0.0, 0.0, 20.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 10.0, 30.0, 0.0, 5.0, -1.0, 20.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 10.0, 20.0, 5.0, 0.0, 0.0, 5.0, 60.0, 0.0, 0.0, 10.0, 15.0, 5.0, 0.0, 0.0, 15.0, 10.0, 10.0, 5.0, 65.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 30.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 30.0, 10.0, 0.0, 70.0, 0.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 5.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 0.0, 50.0, 25.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 40.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 35.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 45.0, 20.0, 0.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 5.0, 30.0, 5.0, 5.0, -1.0, 0.0, 5.0, 25.0, 5.0, 5.0, 10.0, -1.0, 0.0, 0.0, 20.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 5.0, 0.0, 5.0, 25.0], (8400, 0): [-1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0], (2800, 0): [10.0, 0.0, 20.0, 0.0, 0.0, 5.0, 45.0, 10.0, 0.0, 0.0, 15.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 25.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 30.0, 25.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 30.0, 25.0, 15.0, 30.0, 5.0, 5.0, 5.0, 5.0, 0.0, 10.0, 0.0, 5.0, 20.0, 10.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 25.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 20.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, 25.0, 20.0, 25.0, 10.0, 35.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 5.0, 5.0, -1.0, 5.0, 0.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 55.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 5.0, 10.0, 5.0, 65.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 0.0, 5.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 10.0, 0.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0, 5.0, 30.0, 5.0, -1.0, 30.0, 0.0, 0.0, -1.0, 20.0, 0.0, 15.0, 0.0, 0.0, 20.0, 30.0, 5.0, 35.0, 0.0, 10.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 10.0, 0.0, 35.0, 25.0, 0.0, 5.0, 40.0, 0.0, 10.0, 0.0, 0.0, 25.0, 15.0, 10.0, 10.0, 40.0, 5.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, -1.0, 45.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, -1.0, 10.0, 5.0, 20.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 20.0, 35.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 35.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 20.0, 0.0, 5.0, -1.0, 0.0, 0.0, 55.0, 25.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 30.0, 20.0, 20.0, 5.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 75.0, 15.0, 10.0, 0.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 45.0, 0.0, 45.0, 30.0, 15.0, 0.0, 20.0, 30.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 15.0, 35.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 15.0, 10.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 100.0, 0.0, 15.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 15.0, 20.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 5.0, 45.0, 10.0, 0.0, 10.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 5.0, 35.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 10.0, 80.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 5.0, 0.0, 30.0, 0.0, 10.0, 20.0, 0.0, 5.0, 5.0, 10.0, 0.0, 10.0, 30.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, -1.0, 5.0, 15.0, -1.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 25.0, 5.0, 15.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 30.0, -1.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 35.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, -1.0, 5.0, 35.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 10.0, 5.0, 65.0, -1.0, 10.0, 5.0, 0.0, 45.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 20.0, 5.0, 50.0, 5.0, 10.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 5.0, -1.0, 20.0, 0.0, 15.0, 0.0, 30.0, 0.0, 0.0, 70.0, -1.0, 5.0, 5.0, 10.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, -1.0, 25.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 10.0, -1.0, 10.0, 5.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 5.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, -1.0, 0.0, 5.0, 0.0, 0.0, 70.0, 0.0, 10.0, 25.0, 10.0, 50.0, 0.0, 20.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 10.0, 0.0, 20.0, 85.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 20.0, 25.0, 0.0, 0.0, 5.0, 10.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 15.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 25.0, 0.0, 15.0, 40.0, 20.0, 0.0, 0.0, 10.0, 0.0, 15.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 30.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 5.0, 0.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 25.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 15.0, 25.0, 0.0, 0.0, 30.0, 0.0, 0.0, 20.0, 5.0, 5.0, 10.0, 20.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 15.0, 15.0, 5.0, 15.0, 40.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 15.0, 0.0, 10.0, 0.0, 5.0, 45.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, -1.0, 10.0, 10.0, 0.0, 10.0, 25.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, 20.0, 15.0, 20.0, 15.0, 10.0, 0.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 20.0, 5.0, -1.0, -1.0, 10.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 25.0, 20.0, 15.0, -1.0, 10.0, 5.0, 0.0, 5.0, 20.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 35.0, 5.0, 0.0, 15.0, 0.0, 5.0, 40.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 25.0, 25.0, 0.0, 0.0, 10.0, 0.0, 5.0, 5.0, 20.0, 0.0, 0.0, 20.0, 10.0, 30.0, 20.0, 0.0, -1.0, -1.0, 40.0, 25.0, 15.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 65.0, 0.0, 65.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 10.0, 15.0, 15.0, 25.0, 5.0, 0.0, 5.0, 20.0, 5.0, 5.0, 25.0, 5.0, 75.0, 5.0, 0.0, 20.0, 5.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 5.0, 20.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 10.0, 15.0, 0.0], (5600, 5600): [-1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 15.0, 0.0], (8400, 5600): [40.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, -1.0, 80.0, 0.0, 0.0, -1.0, -1.0], (5600, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0]}
mpc_dash_syth_hyb_pen_table_2900 = {(2900, 2900): [0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 70.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, -1.0, 20.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 15.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 15.0, 5.0, 5.0, 0.0, -1.0, 0.0, 15.0, 0.0, 35.0, 25.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 40.0, 5.0, -1.0, 5.0, 35.0, 25.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 45.0, 15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 0.0, 10.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 0.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 60.0, 0.0, 10.0, 15.0, 15.0, 5.0, 10.0, 25.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 0.0, -1.0, 10.0, 15.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 5.0, 35.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 35.0, 0.0, 40.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 10.0, 25.0, 10.0, 90.0, 5.0, 10.0, 5.0, 0.0, 20.0, 5.0, 20.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, -1.0, 5.0, -1.0, 10.0, 50.0, 0.0, -1.0, 20.0, 45.0, 0.0, 0.0, 15.0, 10.0, 0.0, 50.0, 15.0, 0.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 20.0, 65.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 5.0, 0.0, 25.0, 0.0, 5.0, 0.0, 20.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 15.0, 5.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 35.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 40.0, 0.0, 5.0, 0.0, 50.0, 0.0, 0.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 20.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 5.0, 10.0, 30.0, 0.0, 5.0, 20.0, 10.0, 0.0, 5.0, 0.0, 30.0, 0.0, 0.0, 15.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 5.0, 5.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 10.0, 20.0, 0.0, 0.0, 0.0, 5.0, 60.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, 15.0, 10.0, 0.0, 0.0, 5.0, 65.0, 0.0, 10.0, 0.0, 0.0, 5.0, 45.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 0.0, 40.0, 0.0, 0.0, 65.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 30.0, 10.0, 70.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 20.0, 50.0, 25.0, 20.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, 40.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 35.0, 50.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 10.0, -1.0, 35.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 20.0, 45.0, 20.0, 0.0, 0.0, 45.0, 10.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, -1.0, 10.0, 0.0, 5.0, 35.0, 30.0, 5.0, 5.0, -1.0, 0.0, 0.0, 5.0, 25.0, 5.0, 20.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 20.0, 15.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, 25.0], (8700, 5800): [0.0, -1.0], (5800, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (0, 0): [5.0, 20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 5.0, 80.0, 45.0, 30.0, 0.0, 65.0, 80.0, 5.0, 20.0, 10.0, 20.0, 20.0, 10.0, 5.0, 35.0, 65.0, 5.0, 40.0, 5.0, 40.0, 25.0, 30.0, 25.0, 5.0, 0.0, 20.0, 65.0, 25.0, 65.0, 0.0, 15.0, 10.0, 10.0, 65.0, 10.0, 15.0, 40.0, 55.0, 15.0, 10.0, 5.0, 25.0, 40.0, 35.0, 5.0, 10.0, 25.0, 70.0, 10.0, 0.0, 55.0, 35.0, 35.0, 70.0, 30.0, 20.0, 25.0, 5.0, 25.0, 5.0, 35.0, 0.0, 30.0, 65.0, 15.0, 5.0, 20.0, 0.0, 20.0, 25.0, 25.0, 100.0, 50.0, 30.0, 0.0, 45.0, 25.0, 35.0, 5.0, 60.0, 40.0, 10.0, 50.0, 35.0, 50.0, 20.0, 0.0, 25.0, 0.0, 60.0, 55.0, 25.0, 0.0, 20.0, 30.0, 10.0, 10.0, 0.0, 5.0, 10.0, 20.0, 55.0, 35.0, 5.0, -1.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 50.0, 15.0, 10.0, 40.0, 5.0, 0.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 5.0, 10.0, 5.0, 30.0, 0.0, 0.0, 0.0, 35.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, -1.0, 40.0, 60.0, 0.0, 20.0, 20.0, 50.0, 25.0, 90.0, 5.0, 20.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 20.0, 50.0, 0.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 45.0, 15.0, 5.0, 25.0, 25.0, 35.0, 85.0, 20.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 10.0, 5.0, 5.0, 40.0, 5.0, 5.0, 30.0, 5.0, 30.0, 15.0, 90.0, 25.0, 25.0, -1.0, 30.0, 40.0, 40.0, 25.0, 45.0, -1.0, 15.0, 5.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 0.0, 10.0, 5.0, 35.0, 35.0, 65.0, 0.0, 60.0, 0.0, 5.0, 0.0, 0.0, 40.0, 10.0, -1.0, 10.0, 0.0, 40.0, 95.0, 25.0, 0.0, 10.0, 0.0, 0.0, 45.0, 5.0, 55.0, 0.0, 25.0, 30.0, 15.0, 55.0, 5.0, 30.0, 5.0, 40.0, 40.0, 85.0, 35.0, 25.0, -1.0, 15.0, 50.0, 0.0, -1.0, 30.0, 75.0, 0.0, 85.0, -1.0, 75.0, 20.0, 0.0, 5.0, 0.0, 25.0, 15.0, 20.0, 65.0, 0.0, 55.0, 25.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 30.0, 35.0, 0.0, 10.0, 45.0, 5.0, 50.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 0.0, 75.0, 70.0, 5.0, 5.0, 45.0, 5.0, 45.0, 25.0, 10.0, 5.0, 10.0, 5.0, 60.0, 40.0, 15.0, 65.0, -1.0, 30.0, 5.0, 20.0, 15.0, 35.0, -1.0, -1.0, 65.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 5.0, 20.0, 30.0, 0.0, 15.0, 0.0, 45.0, 15.0, 10.0, 30.0, 70.0, 75.0, 60.0, -1.0, 100.0, -1.0, 5.0, 15.0, 0.0, 0.0, 5.0, 85.0, 5.0, 95.0, 20.0, 10.0, 45.0, 85.0, 0.0, 0.0, 10.0, 45.0, 85.0, 0.0, 0.0, 45.0, 50.0, 60.0, 5.0, 10.0, 55.0, 80.0, 20.0, 75.0, -1.0, 55.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 10.0, 15.0, 25.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 5.0, 25.0, 25.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0, 30.0, 70.0, 60.0, 90.0, 10.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, 5.0, -1.0, 5.0, 20.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 10.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 20.0, 0.0, 35.0, 10.0, 55.0, -1.0, 0.0, -1.0, -1.0, 65.0, 100.0, 5.0, 30.0, 20.0, 40.0, 15.0, 45.0, 20.0, 10.0, 15.0, 95.0, 20.0, 5.0, 15.0, 10.0, -1.0, 45.0, 25.0, 90.0, 10.0, 5.0, 70.0, 20.0, 5.0, 10.0, 20.0, 85.0, 0.0, 15.0, 30.0, 30.0, 15.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 45.0, 25.0, 0.0, 15.0, 15.0, 65.0, 25.0, 15.0, 40.0, 10.0, 5.0, 10.0, 10.0, 50.0, 10.0, 55.0, 0.0, 15.0, 25.0, 15.0, 20.0, 0.0, 35.0, 10.0, 60.0, -1.0, 95.0, 5.0, 5.0, 25.0, 55.0, -1.0, 15.0, 20.0, 5.0, 0.0, 80.0, 10.0, 75.0, 15.0, 65.0, 0.0, 5.0, 10.0, 20.0, 45.0, 15.0, 50.0, 30.0, 65.0, 15.0, 25.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 20.0, 0.0, 15.0, 70.0, 15.0, 25.0, 30.0, 5.0, 5.0, 5.0, 0.0, 40.0, 25.0, 15.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, 5.0, 10.0, 80.0, 40.0, 10.0, 25.0, 15.0, 15.0, 0.0, 30.0, 45.0, 45.0, 15.0, 15.0, 65.0, -1.0, 30.0, 5.0, 60.0, 65.0, 5.0, 10.0, 25.0, 45.0, 10.0, 80.0, 35.0, 40.0, 0.0, 15.0, -1.0, 5.0, 40.0, 50.0, 10.0, 80.0, 10.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 25.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 40.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 20.0, 5.0, 15.0, 0.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 40.0, 85.0, 5.0, 0.0, 0.0, 20.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 10.0, 25.0, 0.0, 15.0, 40.0, 0.0, 35.0, 95.0, 15.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 75.0, 50.0, 15.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 20.0, 10.0, 65.0, 5.0, 95.0, 80.0, 15.0, 0.0, 20.0, 90.0, 25.0, 15.0, 5.0, 15.0, 25.0, 5.0, 10.0, 5.0, 0.0, 15.0, 10.0, 0.0, 50.0, 25.0, 20.0, 15.0, 0.0, 15.0, 5.0, 5.0, 30.0, 15.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 20.0, 40.0, 0.0, 5.0, -1.0, 15.0, 0.0, 15.0, 85.0], (2900, 0): [10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 45.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 25.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 30.0, 25.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 30.0, 25.0, 15.0, 30.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 20.0, 10.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 5.0, 10.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 5.0, 25.0, 15.0, 0.0, 0.0, -1.0, 20.0, 25.0, 10.0, 35.0, -1.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 10.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 45.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 20.0, 10.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 10.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, -1.0, 5.0, 0.0, 55.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 5.0, 0.0, 55.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 30.0, 0.0, 65.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 10.0, 0.0, 65.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 25.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 30.0, 5.0, 10.0, -1.0, 30.0, 0.0, 0.0, -1.0, 20.0, 0.0, 15.0, 0.0, 0.0, 20.0, 30.0, 5.0, 35.0, 0.0, 10.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 10.0, 0.0, 35.0, 25.0, 0.0, 5.0, 40.0, 0.0, 10.0, 0.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, 30.0, 0.0, 30.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, -1.0, 30.0, 0.0, 0.0, -1.0, 45.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, -1.0, 60.0, 10.0, 5.0, 20.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 20.0, 35.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 35.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 30.0, 20.0, 0.0, 5.0, 15.0, -1.0, 5.0, 0.0, 0.0, 55.0, 25.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 30.0, 30.0, 0.0, 20.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 20.0, 0.0, 15.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 45.0, 45.0, 30.0, 15.0, 0.0, 20.0, 30.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 10.0, 0.0, 5.0, 15.0, 35.0, 10.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 15.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 10.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 100.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 10.0, 20.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 45.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 5.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 5.0, 10.0, 80.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 10.0, 15.0, 5.0, 0.0, 30.0, 0.0, 10.0, 20.0, 5.0, 5.0, 10.0, 0.0, 30.0, 0.0, 25.0, 40.0, 25.0, 10.0, 35.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, -1.0, 5.0, 15.0, -1.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 80.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 25.0, 5.0, 15.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 30.0, -1.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 35.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 5.0, -1.0, 0.0, -1.0, 5.0, 35.0, 5.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 10.0, 5.0, 65.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 50.0, 5.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 5.0, 20.0, 0.0, 5.0, -1.0, 20.0, 0.0, 15.0, 0.0, 30.0, 0.0, 15.0, 0.0, 70.0, -1.0, 5.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, -1.0, 25.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, 5.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 10.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, 0.0, 5.0, 5.0, 0.0, 0.0, 70.0, 0.0, 10.0, 25.0, 10.0, 50.0, 40.0, 0.0, 20.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, 30.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 20.0, 25.0, 0.0, 10.0, 0.0, 5.0, 10.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 25.0, 0.0, 15.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 20.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 25.0, 0.0, 15.0, 40.0, 20.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 30.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 0.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 25.0, 5.0, 40.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 15.0, 25.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, -1.0, 20.0, -1.0, 5.0, 5.0, 10.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 15.0, 40.0, 0.0, -1.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 25.0, 0.0, 15.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 15.0, 0.0, 10.0, 0.0, 5.0, 45.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 5.0, 35.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, -1.0, 20.0, 15.0, 0.0, 0.0, 0.0, 20.0, 15.0, 30.0, 0.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 20.0, 5.0, -1.0, -1.0, 10.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, 0.0, 0.0, 10.0, 0.0, 35.0, 0.0, 25.0, 20.0, 15.0, -1.0, 10.0, 5.0, 10.0, 0.0, 20.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 35.0, 5.0, 0.0, 15.0, 0.0, 5.0, 40.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 30.0, 0.0, 5.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 30.0, 5.0, 20.0, 0.0, -1.0, -1.0, 25.0, 15.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 10.0, 65.0, 0.0, 0.0, 65.0, -1.0, 0.0, 0.0, 0.0, 30.0, -1.0, 0.0, 10.0, 15.0, 15.0, 25.0, 5.0, 0.0, 5.0, 20.0, 5.0, 5.0, 25.0, 5.0, 75.0, 5.0, 0.0, 20.0, 5.0, 50.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 25.0, 0.0, 5.0, 20.0, 0.0, 40.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 10.0, 15.0, 0.0], (5800, 5800): [-1.0, -1.0, 0.0, -1.0, -1.0], (8700, 2900): [-1.0, 0.0, -1.0, 40.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 20.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 45.0, 0.0, 15.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, 0.0, -1.0, -1.0, 25.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 80.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0], (8700, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (5800, 2900): [0.0, -1.0, 0.0, 0.0, 20.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 45.0, 10.0, 0.0, 10.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 40.0, 0.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 15.0, 40.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 15.0, 0.0, -1.0, 5.0, 0.0, 35.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 50.0, 0.0, 10.0, 0.0, 0.0, -1.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 35.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 35.0, -1.0, 50.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 15.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, 5.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 10.0, -1.0, -1.0, -1.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, -1.0, 0.0, 5.0, 0.0, 15.0, 0.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 25.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 35.0, -1.0, -1.0, 15.0, 0.0, -1.0, 10.0, 0.0, 10.0, -1.0, -1.0, 15.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, 0.0, 0.0, 85.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 20.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, 5.0, -1.0, 55.0, 0.0, 0.0, -1.0, 20.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 65.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 40.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 15.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 65.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 35.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 10.0, 10.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 40.0, 10.0, -1.0, 40.0, 0.0, -1.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, 25.0, 5.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 10.0, 10.0, -1.0, -1.0, -1.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 15.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 10.0, 0.0, -1.0, 10.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 15.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 60.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 25.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, 0.0, 15.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 10.0, 35.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 55.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, 0.0, -1.0, 60.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 80.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 10.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, 10.0, 5.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 15.0, 0.0, -1.0, -1.0, 20.0, -1.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, 10.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 45.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 45.0, 5.0, -1.0, 0.0, 0.0, 15.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 0.0, 10.0, 50.0, 0.0, 5.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 20.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, -1.0, 75.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 45.0, -1.0, 0.0, -1.0, 0.0, 60.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, 80.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 45.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 90.0, 0.0, 25.0, -1.0, 0.0, 0.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 55.0, 0.0, 0.0, 0.0, 15.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 50.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 55.0, 0.0, -1.0, 15.0, 5.0, -1.0, -1.0, 55.0, 5.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, 15.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, 10.0, 0.0, 35.0, 0.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, 35.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 15.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 20.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, 35.0, -1.0, 5.0, 0.0, 0.0, -1.0, 95.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0]}
mpc_dash_syth_hyb_pen_table_3000 = {(6000, 3000): [0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 10.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 40.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, 10.0, -1.0, -1.0, 0.0, 25.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, -1.0, 15.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 65.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 30.0, -1.0, 10.0, 0.0, 0.0, 0.0, 5.0, 10.0, 40.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 20.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 15.0, 40.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, 10.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 25.0, -1.0, 15.0, -1.0, 0.0, -1.0, 5.0, 0.0, 35.0, 10.0, 5.0, 0.0, -1.0, 30.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 10.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 50.0, 0.0, 10.0, 0.0, -1.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 35.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 0.0, 35.0, -1.0, 50.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 30.0, -1.0, 5.0, 0.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 10.0, 40.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 55.0, -1.0, 0.0, 5.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, -1.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, 25.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 25.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 35.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 10.0, -1.0, -1.0, 15.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, 15.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 55.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 85.0, -1.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 10.0, 20.0, 0.0, -1.0, 10.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 55.0, 0.0, 0.0, 20.0, -1.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 5.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, 0.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 40.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 35.0, 5.0, 10.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 65.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, -1.0, -1.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 40.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 10.0, 10.0, 0.0, -1.0, -1.0, 20.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 25.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, 25.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 5.0, 10.0, 0.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 30.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, 40.0, -1.0, 40.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 40.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 45.0, 45.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, 25.0, 5.0, 15.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 10.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 30.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 20.0, 15.0, 5.0, 10.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 45.0, -1.0, 10.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 45.0, 0.0, -1.0, 5.0, 0.0, 15.0, 5.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 0.0, 60.0, 0.0, 20.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, 25.0, -1.0, -1.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 25.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 5.0, 0.0, -1.0, 0.0, 15.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 10.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 35.0, 10.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 55.0, -1.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 45.0, 0.0, -1.0, 0.0, 0.0, 50.0, -1.0, -1.0, -1.0, -1.0, 0.0, 20.0, 0.0, -1.0, 60.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 10.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 80.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 10.0, 10.0, -1.0, 0.0, -1.0, 5.0, -1.0, -1.0, 10.0, 5.0, -1.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 55.0, -1.0, -1.0, 0.0, -1.0, 0.0, 15.0, 0.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 5.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, 10.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, 15.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, 0.0, 45.0, -1.0, 0.0, 0.0, 15.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 20.0, 0.0, -1.0, 10.0, 0.0, 5.0, -1.0, -1.0, 10.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, 45.0, -1.0, -1.0, -1.0, 0.0, 0.0, 15.0, -1.0, 0.0, 5.0, 0.0, 10.0, -1.0, 25.0, -1.0, 75.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 45.0, -1.0, -1.0, 0.0, 60.0, 0.0, -1.0, 5.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, 0.0, 80.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 45.0, -1.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 5.0, 5.0, 80.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 25.0, -1.0, 0.0, 15.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 50.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 5.0, 0.0, -1.0, 55.0, -1.0, 0.0, -1.0, -1.0, 15.0, 5.0, -1.0, -1.0, 55.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, 15.0, 5.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 20.0, 0.0, -1.0, 10.0, 0.0, 35.0, 0.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, 35.0, 5.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 30.0, -1.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 15.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, 45.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, 0.0, 10.0, 15.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 5.0, -1.0, 10.0, -1.0, -1.0, -1.0, 35.0, -1.0, 0.0, 0.0, -1.0, 0.0, 10.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, 0.0, 30.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, -1.0, 45.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, -1.0, 0.0, -1.0], (6000, 0): [-1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 25.0, -1.0, 20.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 15.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, 0.0, -1.0, 0.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 10.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 30.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 0.0, -1.0, 30.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, 10.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 5.0, 5.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, 95.0, -1.0, -1.0, -1.0, -1.0, -1.0, 10.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, 0.0, -1.0, -1.0, 0.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0, -1.0], (0, 0): [5.0, 20.0, 15.0, 20.0, 20.0, 60.0, 95.0, 35.0, 35.0, 5.0, 80.0, 45.0, 30.0, 0.0, 65.0, 80.0, 5.0, 20.0, 10.0, 20.0, 20.0, 10.0, 5.0, 35.0, 25.0, 65.0, 5.0, 40.0, 5.0, 40.0, 25.0, 0.0, 30.0, -1.0, 25.0, 5.0, 0.0, 20.0, 65.0, 25.0, 65.0, 0.0, 15.0, 10.0, 10.0, 65.0, 10.0, 25.0, 15.0, 40.0, 55.0, 15.0, 10.0, 5.0, 25.0, 40.0, 35.0, 5.0, 10.0, 25.0, 10.0, 70.0, 10.0, 0.0, 5.0, 55.0, 35.0, 35.0, 70.0, 30.0, 20.0, 25.0, 5.0, 25.0, 5.0, 35.0, 0.0, 30.0, 65.0, 15.0, 25.0, 5.0, 20.0, 0.0, 20.0, 25.0, 25.0, 100.0, 50.0, 30.0, 0.0, 45.0, 25.0, 35.0, 5.0, 60.0, 40.0, 10.0, 50.0, 35.0, 50.0, 20.0, 0.0, 45.0, 25.0, 0.0, 60.0, 55.0, 0.0, 25.0, 0.0, 20.0, 30.0, 10.0, 10.0, 0.0, 5.0, 5.0, 10.0, 20.0, 55.0, 35.0, 5.0, -1.0, 5.0, 90.0, 10.0, 55.0, 5.0, 20.0, 20.0, 10.0, 95.0, 90.0, 50.0, 50.0, 15.0, 10.0, 40.0, 5.0, 0.0, 5.0, 15.0, 70.0, 5.0, -1.0, 0.0, 35.0, 5.0, 10.0, 5.0, 30.0, 0.0, 0.0, 0.0, 35.0, 60.0, 20.0, 15.0, 20.0, 75.0, 5.0, 40.0, 10.0, -1.0, 40.0, 5.0, 60.0, 0.0, 20.0, 20.0, 0.0, 50.0, 25.0, 90.0, 0.0, 5.0, 20.0, 25.0, 40.0, 10.0, 50.0, 80.0, 45.0, 30.0, 0.0, 45.0, 20.0, 50.0, 0.0, 75.0, 15.0, 30.0, 90.0, 15.0, 20.0, 10.0, 45.0, 15.0, 5.0, 25.0, 25.0, 35.0, 30.0, 85.0, 20.0, 65.0, -1.0, 50.0, 5.0, 40.0, 75.0, 20.0, 70.0, 40.0, 10.0, 5.0, 5.0, 40.0, 5.0, 5.0, 0.0, 30.0, 5.0, 30.0, 15.0, 90.0, 25.0, 25.0, -1.0, 30.0, 40.0, 40.0, 25.0, 45.0, -1.0, 15.0, 5.0, 20.0, 10.0, 0.0, 10.0, 50.0, 25.0, 0.0, 10.0, 5.0, 35.0, 35.0, 65.0, 0.0, 60.0, 0.0, 5.0, 0.0, 0.0, 40.0, 10.0, -1.0, 10.0, 0.0, 35.0, 40.0, 95.0, 0.0, 25.0, 0.0, 30.0, 10.0, 0.0, 0.0, 45.0, 5.0, 55.0, 0.0, 25.0, 30.0, 15.0, 55.0, 5.0, 30.0, 30.0, 5.0, 40.0, 40.0, 85.0, 35.0, 25.0, -1.0, 20.0, 15.0, 50.0, 0.0, -1.0, 30.0, 75.0, 0.0, 85.0, -1.0, 75.0, 20.0, 0.0, 5.0, 0.0, 25.0, 15.0, 20.0, 65.0, 45.0, 0.0, 55.0, 25.0, 10.0, 25.0, 100.0, 5.0, 5.0, 20.0, 25.0, 30.0, 35.0, 0.0, 10.0, 45.0, 5.0, 50.0, 35.0, 20.0, 55.0, 0.0, 55.0, 65.0, 15.0, 20.0, 5.0, 0.0, 10.0, 0.0, 75.0, 70.0, 5.0, 5.0, 45.0, 5.0, 45.0, 35.0, 25.0, 10.0, 5.0, 5.0, 10.0, 5.0, 60.0, 40.0, 15.0, 15.0, 65.0, -1.0, 30.0, 5.0, 20.0, 15.0, 35.0, -1.0, -1.0, 65.0, 100.0, 20.0, 65.0, 50.0, 0.0, 5.0, 40.0, 5.0, 20.0, 30.0, 0.0, 15.0, 20.0, 0.0, 45.0, 15.0, 10.0, 0.0, 30.0, 70.0, 75.0, 60.0, 0.0, 5.0, -1.0, 100.0, -1.0, 5.0, 15.0, 0.0, 0.0, 5.0, 85.0, 5.0, 0.0, 95.0, 20.0, 10.0, 45.0, 85.0, 0.0, 0.0, 10.0, 45.0, 85.0, 10.0, 0.0, 0.0, 45.0, 50.0, 60.0, 5.0, 10.0, 55.0, 25.0, 80.0, 20.0, 75.0, -1.0, 55.0, 95.0, 20.0, 50.0, 15.0, 15.0, 5.0, 20.0, 30.0, 30.0, 5.0, 0.0, 10.0, 15.0, 25.0, 25.0, 35.0, -1.0, 20.0, 25.0, 15.0, 5.0, 25.0, 25.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0, 30.0, 70.0, 60.0, 90.0, 10.0, 40.0, 25.0, -1.0, 0.0, 25.0, 80.0, 10.0, 0.0, 5.0, -1.0, 5.0, 20.0, 15.0, 35.0, 5.0, -1.0, 45.0, 70.0, 0.0, 5.0, 20.0, 25.0, 10.0, 5.0, 65.0, 0.0, 35.0, 35.0, 30.0, -1.0, 10.0, 100.0, 70.0, 0.0, -1.0, 10.0, 80.0, 70.0, 25.0, 25.0, 25.0, 25.0, -1.0, 5.0, 5.0, 20.0, 0.0, 35.0, 10.0, 10.0, 55.0, -1.0, 0.0, -1.0, -1.0, 65.0, 70.0, 100.0, 5.0, 30.0, 25.0, 20.0, 40.0, 15.0, 50.0, 45.0, 20.0, 20.0, 10.0, 15.0, 95.0, 20.0, 5.0, 15.0, 10.0, -1.0, 45.0, 25.0, 90.0, 10.0, 5.0, 70.0, 30.0, 20.0, 5.0, 10.0, 20.0, 85.0, 0.0, 15.0, 30.0, 30.0, 15.0, 55.0, 15.0, 20.0, 65.0, 15.0, 40.0, 0.0, 75.0, 45.0, 25.0, 0.0, 15.0, 15.0, 65.0, 25.0, 20.0, 15.0, 40.0, 10.0, 5.0, 10.0, 10.0, 50.0, 10.0, 5.0, 55.0, 0.0, 15.0, 25.0, 15.0, 20.0, 0.0, 35.0, 10.0, 60.0, -1.0, 95.0, 30.0, 5.0, 5.0, 25.0, 55.0, -1.0, 15.0, 20.0, 15.0, 5.0, 40.0, 0.0, 80.0, 10.0, 75.0, 15.0, 65.0, 0.0, 5.0, 10.0, 10.0, 20.0, 45.0, 15.0, 50.0, 30.0, 65.0, 15.0, 25.0, 50.0, 35.0, 20.0, 35.0, 5.0, 0.0, 90.0, 95.0, 0.0, 20.0, 0.0, 15.0, 70.0, 15.0, 25.0, 15.0, 30.0, 5.0, 5.0, 5.0, 0.0, 40.0, 25.0, 15.0, 5.0, -1.0, 0.0, 5.0, 75.0, 10.0, 20.0, 5.0, 40.0, 10.0, 50.0, 40.0, -1.0, 5.0, 25.0, 10.0, 25.0, 80.0, 40.0, 10.0, 5.0, 25.0, 15.0, 15.0, 0.0, 30.0, 45.0, 45.0, 15.0, 15.0, 65.0, -1.0, 30.0, 5.0, 60.0, 65.0, 5.0, 10.0, 25.0, 45.0, 10.0, 80.0, 35.0, 40.0, 0.0, 15.0, -1.0, 5.0, 40.0, 50.0, 20.0, 10.0, 80.0, 10.0, 15.0, 5.0, 70.0, 20.0, 30.0, 85.0, 45.0, 15.0, 15.0, 25.0, 5.0, 5.0, 10.0, 25.0, 45.0, -1.0, 0.0, 25.0, 35.0, 30.0, 45.0, 20.0, 25.0, 30.0, 10.0, 15.0, 25.0, 5.0, 5.0, 40.0, 65.0, 25.0, 50.0, 10.0, 20.0, 55.0, 50.0, 15.0, 20.0, 5.0, 15.0, 0.0, 30.0, 5.0, 35.0, 30.0, 35.0, 10.0, -1.0, 5.0, 20.0, 5.0, 40.0, 85.0, 5.0, 0.0, 0.0, 20.0, 80.0, 15.0, 50.0, 0.0, 5.0, 15.0, 20.0, 10.0, 25.0, 0.0, 15.0, 40.0, 0.0, 35.0, 95.0, 15.0, 95.0, 35.0, 70.0, 20.0, 90.0, 15.0, 0.0, 75.0, 50.0, 15.0, 65.0, 0.0, 100.0, 80.0, 5.0, 5.0, 20.0, 0.0, 10.0, 65.0, 65.0, 5.0, 65.0, 0.0, 95.0, 80.0, 15.0, 0.0, 20.0, 90.0, 25.0, 15.0, 5.0, 15.0, 25.0, 5.0, 10.0, 5.0, 50.0, 0.0, 15.0, 10.0, 0.0, 50.0, 25.0, 20.0, 15.0, 0.0, 15.0, 5.0, 25.0, 5.0, 30.0, 20.0, 15.0, 10.0, 95.0, 20.0, 20.0, 20.0, 70.0, 20.0, 40.0, 0.0, 5.0, -1.0, 15.0, 0.0, 15.0, 85.0], (3000, 3000): [0.0, 20.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 10.0, 0.0, 70.0, 0.0, 10.0, 10.0, 10.0, 5.0, 0.0, 25.0, 0.0, 0.0, 35.0, 10.0, 10.0, -1.0, 20.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 15.0, 0.0, 10.0, 0.0, 10.0, 15.0, 15.0, 0.0, 5.0, 20.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 20.0, 15.0, -1.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 5.0, 15.0, 5.0, 5.0, 0.0, -1.0, 0.0, 30.0, 15.0, 0.0, 35.0, -1.0, 5.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 25.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 40.0, 5.0, -1.0, 5.0, 35.0, 0.0, 25.0, 5.0, 0.0, -1.0, 5.0, 35.0, 0.0, 0.0, 45.0, 15.0, 0.0, 0.0, 5.0, 30.0, 5.0, 10.0, 20.0, 0.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 40.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 60.0, 0.0, 10.0, 15.0, 15.0, 5.0, 15.0, 25.0, 0.0, 0.0, 0.0, -1.0, -1.0, 0.0, 10.0, 10.0, 15.0, 0.0, 10.0, 0.0, 0.0, 10.0, 25.0, 0.0, -1.0, 10.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 5.0, 0.0, 10.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 10.0, 10.0, 0.0, 5.0, 0.0, 35.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 10.0, -1.0, 0.0, 0.0, 15.0, 0.0, 40.0, 30.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, -1.0, 35.0, 40.0, 0.0, 0.0, -1.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, -1.0, 0.0, 10.0, 10.0, 90.0, 5.0, 10.0, 5.0, 0.0, 20.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 85.0, 0.0, 0.0, 0.0, 0.0, 75.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 35.0, 0.0, -1.0, 5.0, -1.0, 50.0, 0.0, -1.0, 45.0, 0.0, 0.0, 15.0, 0.0, 50.0, 15.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 65.0, 15.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 20.0, 65.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 15.0, 0.0, 0.0, 5.0, 0.0, 5.0, 25.0, 0.0, 5.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 10.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 20.0, 15.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 35.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 40.0, 0.0, 5.0, 0.0, 0.0, 35.0, 0.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 30.0, 5.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 15.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 45.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 30.0, 0.0, 5.0, 0.0, 20.0, 0.0, 20.0, 0.0, 10.0, 5.0, 5.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 55.0, 0.0, 0.0, 35.0, 0.0, 0.0, 5.0, 0.0, 0.0, 40.0, 5.0, 0.0, 50.0, 0.0, 30.0, 0.0, -1.0, 0.0, 0.0, 20.0, 30.0, 20.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 45.0, -1.0, 0.0, 0.0, 15.0, 5.0, 10.0, 30.0, 0.0, 5.0, 20.0, 10.0, 5.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 15.0, 0.0, -1.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 0.0, 0.0, 5.0, 60.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, 15.0, 10.0, 0.0, 0.0, 0.0, 5.0, 65.0, 10.0, 0.0, -1.0, 10.0, 0.0, 0.0, 45.0, 0.0, 0.0, 0.0, 0.0, 45.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 30.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 0.0, 10.0, 45.0, 40.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 10.0, 5.0, 0.0, 5.0, 30.0, 10.0, 50.0, 70.0, 20.0, 0.0, -1.0, 0.0, 0.0, 35.0, 5.0, 0.0, 20.0, 0.0, 0.0, 0.0, 20.0, 20.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 90.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 55.0, 15.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, -1.0, 20.0, 50.0, 20.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 0.0, -1.0, 40.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 35.0, 10.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 15.0, 0.0, 10.0, -1.0, 35.0, 5.0, 20.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 20.0, 45.0, 20.0, 15.0, 0.0, 0.0, 0.0, 0.0, 45.0, 10.0, -1.0, 0.0, 0.0, 0.0, 5.0, 20.0, 5.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 35.0, 0.0, -1.0, 10.0, 0.0, 35.0, 5.0, -1.0, 25.0, 0.0, 0.0, 5.0, 25.0, 5.0, 20.0, 5.0, 0.0, 0.0, 10.0, -1.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 5.0, 25.0], (6000, 6000): [-1.0], (3000, 0): [10.0, 0.0, 0.0, 20.0, 0.0, 0.0, 45.0, 10.0, 0.0, 0.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 35.0, 5.0, 0.0, 0.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 25.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, 10.0, 20.0, 30.0, 0.0, 25.0, 0.0, 0.0, 25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 5.0, 0.0, 5.0, 0.0, 25.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 5.0, 30.0, 15.0, 30.0, 5.0, 5.0, 5.0, 5.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, -1.0, 20.0, 10.0, 0.0, -1.0, 10.0, 0.0, 5.0, 5.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 10.0, 10.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 0.0, 10.0, 5.0, 0.0, 5.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 25.0, 0.0, 15.0, 0.0, 5.0, 0.0, 15.0, 0.0, 0.0, -1.0, 20.0, 25.0, 0.0, 10.0, 35.0, -1.0, 10.0, 5.0, 0.0, 10.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 50.0, 10.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 65.0, 0.0, 10.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 20.0, 0.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 45.0, 0.0, -1.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 15.0, 10.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 5.0, 5.0, 0.0, 0.0, 5.0, -1.0, 5.0, 0.0, 55.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 20.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 15.0, 0.0, 0.0, 5.0, 0.0, 0.0, 55.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 15.0, 5.0, 10.0, 5.0, 15.0, 30.0, 0.0, 65.0, 0.0, 0.0, 5.0, 10.0, 0.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 70.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 30.0, 10.0, 10.0, 0.0, -1.0, 65.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, 0.0, 5.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, -1.0, 35.0, 15.0, 0.0, 0.0, 20.0, 0.0, -1.0, 0.0, 10.0, 0.0, 0.0, 15.0, 0.0, 5.0, 30.0, 5.0, 10.0, -1.0, 30.0, 0.0, 0.0, -1.0, 20.0, 0.0, 15.0, 0.0, 0.0, 20.0, -1.0, 5.0, 35.0, 0.0, 10.0, -1.0, -1.0, 35.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 5.0, -1.0, 15.0, 10.0, 0.0, 35.0, 25.0, 0.0, 5.0, 40.0, 0.0, 10.0, -1.0, 0.0, 0.0, 15.0, 10.0, 10.0, 5.0, 0.0, 10.0, 10.0, 0.0, 30.0, -1.0, 0.0, 30.0, 5.0, 0.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, -1.0, 5.0, -1.0, -1.0, 30.0, 0.0, 5.0, 0.0, -1.0, 45.0, 5.0, 40.0, 0.0, 0.0, 5.0, 0.0, -1.0, -1.0, 60.0, 10.0, 5.0, 20.0, -1.0, 0.0, 30.0, -1.0, 0.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, -1.0, 0.0, 0.0, 0.0, 20.0, 35.0, 0.0, 0.0, 0.0, 0.0, 10.0, 15.0, 0.0, 15.0, 0.0, 10.0, 0.0, 5.0, 0.0, -1.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 25.0, 20.0, 10.0, 0.0, 5.0, 15.0, -1.0, 5.0, 0.0, 0.0, 55.0, 25.0, 20.0, 0.0, -1.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 30.0, 0.0, 20.0, 20.0, 5.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 15.0, -1.0, 0.0, 10.0, 5.0, 15.0, 0.0, 0.0, 0.0, 15.0, 10.0, 0.0, 5.0, 40.0, 0.0, 0.0, 0.0, 5.0, 0.0, 20.0, 20.0, 0.0, -1.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 25.0, 45.0, 30.0, 0.0, 15.0, 0.0, 20.0, 30.0, 20.0, 20.0, -1.0, 0.0, 10.0, 5.0, 5.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 5.0, -1.0, 0.0, 5.0, 0.0, 5.0, 10.0, 0.0, 5.0, 15.0, 10.0, -1.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, -1.0, 5.0, 0.0, 0.0, 10.0, -1.0, 5.0, 35.0, 15.0, 0.0, 15.0, 0.0, 40.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 15.0, -1.0, 0.0, 0.0, 0.0, 0.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 10.0, 5.0, 0.0, 0.0, 20.0, 0.0, 5.0, 0.0, 5.0, 45.0, -1.0, 10.0, 0.0, 10.0, 0.0, 0.0, 25.0, 0.0, 0.0, 20.0, 0.0, 5.0, 35.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 0.0, 10.0, 5.0, 5.0, 10.0, 80.0, 0.0, 0.0, 0.0, 0.0, -1.0, 5.0, 5.0, -1.0, 10.0, -1.0, 15.0, -1.0, 5.0, 0.0, 30.0, 0.0, 20.0, 5.0, 5.0, 10.0, 0.0, 30.0, 0.0, 40.0, 25.0, 10.0, 35.0, 5.0, 0.0, 0.0, 25.0, 45.0, 0.0, -1.0, 5.0, 15.0, -1.0, 10.0, 0.0, 15.0, 10.0, 0.0, 0.0, 0.0, 80.0, 0.0, -1.0, 0.0, -1.0, 0.0, -1.0, 5.0, 5.0, 30.0, 0.0, 5.0, 0.0, 25.0, 5.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 10.0, 30.0, -1.0, 5.0, 0.0, 0.0, 20.0, 30.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 5.0, 30.0, 35.0, -1.0, 0.0, 0.0, 10.0, 0.0, 0.0, 5.0, 0.0, -1.0, 5.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, -1.0, 5.0, 35.0, 5.0, -1.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, 0.0, 0.0, 0.0, 10.0, 5.0, 65.0, -1.0, 10.0, 10.0, 0.0, 5.0, 0.0, 0.0, 45.0, 0.0, 0.0, -1.0, 0.0, 30.0, 0.0, 0.0, 0.0, 20.0, 5.0, 5.0, 50.0, 5.0, -1.0, 0.0, 10.0, 5.0, 15.0, -1.0, 0.0, 0.0, 5.0, 20.0, -1.0, 0.0, 5.0, 5.0, -1.0, 20.0, 0.0, 0.0, 30.0, -1.0, 0.0, 15.0, 0.0, 70.0, 0.0, 0.0, -1.0, 5.0, 0.0, 5.0, 10.0, 5.0, 10.0, 0.0, 45.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 15.0, 5.0, -1.0, 25.0, 5.0, 0.0, 0.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 10.0, -1.0, 10.0, 5.0, -1.0, 0.0, -1.0, 20.0, 20.0, 0.0, 0.0, 0.0, 0.0, 0.0, 15.0, 25.0, 0.0, -1.0, 0.0, -1.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 10.0, 0.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 55.0, 0.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 40.0, 5.0, 0.0, 0.0, -1.0, 0.0, 5.0, 0.0, 0.0, 30.0, 0.0, 0.0, 5.0, 25.0, 0.0, 5.0, -1.0, 0.0, 15.0, -1.0, 0.0, 0.0, 5.0, 0.0, 10.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, -1.0, 20.0, 5.0, 0.0, 0.0, 10.0, 0.0, 0.0, 20.0, 0.0, 10.0, 5.0, 20.0, 25.0, 0.0, -1.0, 10.0, 0.0, 5.0, 10.0, 10.0, 5.0, 0.0, 20.0, 10.0, 0.0, 0.0, 15.0, 0.0, 10.0, 40.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, 25.0, 0.0, 0.0, 15.0, 5.0, 0.0, 0.0, 5.0, -1.0, 0.0, 0.0, 80.0, 25.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 5.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 25.0, 0.0, 15.0, 40.0, 20.0, 0.0, 0.0, 0.0, 15.0, 0.0, 0.0, 0.0, 30.0, 0.0, 0.0, 0.0, 0.0, 5.0, 5.0, 5.0, 0.0, -1.0, 0.0, 25.0, 0.0, 0.0, 10.0, 30.0, 0.0, 0.0, 0.0, 0.0, -1.0, -1.0, -1.0, 5.0, -1.0, 0.0, -1.0, 10.0, 15.0, 0.0, 10.0, 0.0, 15.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 15.0, 25.0, 5.0, 0.0, 5.0, 15.0, 0.0, 0.0, 0.0, 5.0, 20.0, 0.0, 15.0, 25.0, 0.0, 0.0, 30.0, 0.0, 10.0, 0.0, 5.0, -1.0, 0.0, 20.0, -1.0, 5.0, 5.0, 0.0, 0.0, 5.0, 0.0, -1.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 5.0, -1.0, 5.0, 0.0, 0.0, 10.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 5.0, 5.0, 40.0, 0.0, -1.0, 0.0, 0.0, -1.0, 30.0, 0.0, 0.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, -1.0, -1.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 30.0, 0.0, 15.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 0.0, 10.0, 0.0, -1.0, 15.0, 65.0, 0.0, 10.0, 0.0, 5.0, 0.0, 45.0, 0.0, 5.0, 0.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, 10.0, 10.0, 0.0, 0.0, 10.0, -1.0, -1.0, 0.0, 0.0, 0.0, 10.0, 0.0, 5.0, 10.0, 0.0, 5.0, 35.0, 0.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 10.0, -1.0, -1.0, 20.0, 15.0, 0.0, 0.0, 0.0, 15.0, 30.0, 0.0, -1.0, 5.0, 0.0, 5.0, 20.0, 10.0, 0.0, 15.0, 0.0, 5.0, 20.0, 5.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 10.0, 0.0, -1.0, 10.0, 5.0, 0.0, 0.0, 0.0, 15.0, 0.0, 10.0, 0.0, -1.0, 0.0, -1.0, 5.0, 0.0, 0.0, 5.0, 5.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 10.0, 5.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, -1.0, 20.0, 5.0, -1.0, -1.0, 10.0, 0.0, 5.0, 0.0, 5.0, 35.0, 25.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 35.0, 0.0, 25.0, 20.0, 15.0, 5.0, -1.0, 10.0, 5.0, 10.0, 0.0, 20.0, 0.0, 15.0, 5.0, 0.0, 5.0, 0.0, 0.0, 0.0, 10.0, 0.0, 15.0, 0.0, 35.0, 5.0, 0.0, 15.0, 0.0, 5.0, 40.0, -1.0, 5.0, 0.0, 0.0, 0.0, 30.0, 50.0, 0.0, 5.0, 0.0, 25.0, 25.0, 0.0, 0.0, 0.0, 0.0, 10.0, 0.0, -1.0, 0.0, 5.0, 5.0, 0.0, 0.0, 0.0, 20.0, 10.0, 0.0, 30.0, 5.0, 0.0, 0.0, -1.0, -1.0, 25.0, 15.0, 0.0, 25.0, 0.0, 10.0, 0.0, 0.0, -1.0, 5.0, 0.0, 10.0, 15.0, 0.0, -1.0, 0.0, 0.0, 0.0, -1.0, 0.0, 0.0, 5.0, 10.0, 10.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 20.0, 5.0, 20.0, 0.0, 5.0, 0.0, 0.0, 0.0, 5.0, 0.0, 5.0, 5.0, 0.0, 10.0, 0.0, 0.0, 0.0, -1.0, 5.0, 30.0, 5.0, 0.0, 0.0, 0.0, -1.0, 30.0, -1.0, 0.0, 10.0, 15.0, 15.0, 25.0, 5.0, 0.0, 0.0, 5.0, 20.0, 20.0, 5.0, 5.0, 25.0, 5.0, 75.0, 5.0, 0.0, 20.0, 5.0, 5.0, -1.0, 5.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 0.0, 0.0, -1.0, 0.0, 35.0, 0.0, 0.0, 0.0, 0.0, 0.0, 5.0, 0.0, 10.0, 0.0, 5.0, 0.0, 40.0, 0.0, 0.0, 30.0, 0.0, 0.0, 35.0, 0.0, 0.0, 15.0, 10.0, -1.0, 0.0, 10.0, 15.0, 0.0]}
| [
"[email protected]"
] | |
4ce882200c9fa07a0afef96fe52e55fec4ffd8c4 | 7109eecfb78e0123b534ef960dbf42be38e49514 | /x7-src/engine/engine/tests/api/x7/test_wsgi.py | 9474a89a504c694a8cdaf876bd5407c012ab83cc | [
"Apache-2.0"
] | permissive | wendy-king/x7_compute_venv | a6eadd9a06717090acea3312feebcbc9d3925e88 | 12d74f15147868463954ebd4a8e66d5428b6f56d | refs/heads/master | 2016-09-06T16:58:13.897069 | 2012-01-31T01:26:27 | 2012-01-31T01:26:27 | 3,310,779 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 24,532 | py | # vim: tabstop=4 shiftwidth=4 softtabstop=4
import json
import webob
from engine import exception
from engine import test
from engine import utils
from engine.api.x7 import wsgi
import engine.context
class RequestTest(test.TestCase):
def test_content_type_missing(self):
request = wsgi.Request.blank('/tests/123', method='POST')
request.body = "<body />"
self.assertEqual(None, request.get_content_type())
def test_content_type_unsupported(self):
request = wsgi.Request.blank('/tests/123', method='POST')
request.headers["Content-Type"] = "text/html"
request.body = "asdf<br />"
self.assertRaises(exception.InvalidContentType,
request.get_content_type)
def test_content_type_with_charset(self):
request = wsgi.Request.blank('/tests/123')
request.headers["Content-Type"] = "application/json; charset=UTF-8"
result = request.get_content_type()
self.assertEqual(result, "application/json")
def test_content_type_from_accept(self):
for content_type in ('application/xml',
'application/vnd.x7.compute+xml',
'application/json',
'application/vnd.x7.compute+json'):
request = wsgi.Request.blank('/tests/123')
request.headers["Accept"] = content_type
result = request.best_match_content_type()
self.assertEqual(result, content_type)
def test_content_type_from_accept_best(self):
request = wsgi.Request.blank('/tests/123')
request.headers["Accept"] = "application/xml, application/json"
result = request.best_match_content_type()
self.assertEqual(result, "application/json")
request = wsgi.Request.blank('/tests/123')
request.headers["Accept"] = \
"application/json; q=0.3, application/xml; q=0.9"
result = request.best_match_content_type()
self.assertEqual(result, "application/xml")
def test_content_type_from_query_extension(self):
request = wsgi.Request.blank('/tests/123.xml')
result = request.best_match_content_type()
self.assertEqual(result, "application/xml")
request = wsgi.Request.blank('/tests/123.json')
result = request.best_match_content_type()
self.assertEqual(result, "application/json")
request = wsgi.Request.blank('/tests/123.invalid')
result = request.best_match_content_type()
self.assertEqual(result, "application/json")
def test_content_type_accept_and_query_extension(self):
request = wsgi.Request.blank('/tests/123.xml')
request.headers["Accept"] = "application/json"
result = request.best_match_content_type()
self.assertEqual(result, "application/xml")
def test_content_type_accept_default(self):
request = wsgi.Request.blank('/tests/123.unsupported')
request.headers["Accept"] = "application/unsupported1"
result = request.best_match_content_type()
self.assertEqual(result, "application/json")
class ActionDispatcherTest(test.TestCase):
def test_dispatch(self):
serializer = wsgi.ActionDispatcher()
serializer.create = lambda x: 'pants'
self.assertEqual(serializer.dispatch({}, action='create'), 'pants')
def test_dispatch_action_None(self):
serializer = wsgi.ActionDispatcher()
serializer.create = lambda x: 'pants'
serializer.default = lambda x: 'trousers'
self.assertEqual(serializer.dispatch({}, action=None), 'trousers')
def test_dispatch_default(self):
serializer = wsgi.ActionDispatcher()
serializer.create = lambda x: 'pants'
serializer.default = lambda x: 'trousers'
self.assertEqual(serializer.dispatch({}, action='update'), 'trousers')
class ResponseHeadersSerializerTest(test.TestCase):
def test_default(self):
serializer = wsgi.ResponseHeadersSerializer()
context = engine.context.get_admin_context()
req = webob.Request.blank('/', environ={'engine.context': context})
response = webob.Response(request=req)
serializer.serialize(response, {'v': '123'}, 'asdf')
self.assertEqual(response.status_int, 200)
def test_custom(self):
class Serializer(wsgi.ResponseHeadersSerializer):
def update(self, response, data):
response.status_int = 404
response.headers['X-Custom-Header'] = data['v']
serializer = Serializer()
context = engine.context.get_admin_context()
req = webob.Request.blank('/', environ={'engine.context': context})
response = webob.Response(request=req)
serializer.serialize(response, {'v': '123'}, 'update')
self.assertEqual(response.status_int, 404)
self.assertEqual(response.headers['X-Custom-Header'], '123')
class DictSerializerTest(test.TestCase):
def test_dispatch_default(self):
serializer = wsgi.DictSerializer()
self.assertEqual(serializer.serialize({}, 'update'), '')
class XMLDictSerializerTest(test.TestCase):
def test_xml(self):
input_dict = dict(servers=dict(a=(2, 3)))
expected_xml = '<serversxmlns="asdf"><a>(2,3)</a></servers>'
serializer = wsgi.XMLDictSerializer(xmlns="asdf")
result = serializer.serialize(input_dict)
result = result.replace('\n', '').replace(' ', '')
self.assertEqual(result, expected_xml)
class JSONDictSerializerTest(test.TestCase):
def test_json(self):
input_dict = dict(servers=dict(a=(2, 3)))
expected_json = '{"servers":{"a":[2,3]}}'
serializer = wsgi.JSONDictSerializer()
result = serializer.serialize(input_dict)
result = result.replace('\n', '').replace(' ', '')
self.assertEqual(result, expected_json)
class TextDeserializerTest(test.TestCase):
def test_dispatch_default(self):
deserializer = wsgi.TextDeserializer()
self.assertEqual(deserializer.deserialize({}, 'update'), {})
class JSONDeserializerTest(test.TestCase):
def test_json(self):
data = """{"a": {
"a1": "1",
"a2": "2",
"bs": ["1", "2", "3", {"c": {"c1": "1"}}],
"d": {"e": "1"},
"f": "1"}}"""
as_dict = {
'body': {
'a': {
'a1': '1',
'a2': '2',
'bs': ['1', '2', '3', {'c': {'c1': '1'}}],
'd': {'e': '1'},
'f': '1',
},
},
}
deserializer = wsgi.JSONDeserializer()
self.assertEqual(deserializer.deserialize(data), as_dict)
class XMLDeserializerTest(test.TestCase):
def test_xml(self):
xml = """
<a a1="1" a2="2">
<bs><b>1</b><b>2</b><b>3</b><b><c c1="1"/></b></bs>
<d><e>1</e></d>
<f>1</f>
</a>
""".strip()
as_dict = {
'body': {
'a': {
'a1': '1',
'a2': '2',
'bs': ['1', '2', '3', {'c': {'c1': '1'}}],
'd': {'e': '1'},
'f': '1',
},
},
}
metadata = {'plurals': {'bs': 'b', 'ts': 't'}}
deserializer = wsgi.XMLDeserializer(metadata=metadata)
self.assertEqual(deserializer.deserialize(xml), as_dict)
def test_xml_empty(self):
xml = """<a></a>"""
as_dict = {"body": {"a": {}}}
deserializer = wsgi.XMLDeserializer()
self.assertEqual(deserializer.deserialize(xml), as_dict)
class RequestHeadersDeserializerTest(test.TestCase):
def test_default(self):
deserializer = wsgi.RequestHeadersDeserializer()
req = wsgi.Request.blank('/')
self.assertEqual(deserializer.deserialize(req, 'asdf'), {})
def test_custom(self):
class Deserializer(wsgi.RequestHeadersDeserializer):
def update(self, request):
return {'a': request.headers['X-Custom-Header']}
deserializer = Deserializer()
req = wsgi.Request.blank('/')
req.headers['X-Custom-Header'] = 'b'
self.assertEqual(deserializer.deserialize(req, 'update'), {'a': 'b'})
class ResponseHeadersSerializerTest(test.TestCase):
def test_request_id(self):
serializer = wsgi.ResponseHeadersSerializer()
context = engine.context.get_admin_context()
req = webob.Request.blank('/', environ={'engine.context': context})
res = webob.Response(request=req)
serializer.serialize(res, {}, 'foo')
self.assertTrue(
utils.is_uuid_like(res.headers['X-Compute-Request-Id']))
class JSONSerializer(object):
def serialize(self, data, action='default'):
return 'pew_json'
class XMLSerializer(object):
def serialize(self, data, action='default'):
return 'pew_xml'
class HeadersSerializer(object):
def serialize(self, response, data, action):
response.status_int = 404
class ResponseSerializerTest(test.TestCase):
def setUp(self):
self.body_serializers = {
'application/json': JSONSerializer(),
'application/xml': XMLSerializer(),
}
self.serializer = wsgi.ResponseSerializer(self.body_serializers,
HeadersSerializer())
def tearDown(self):
pass
def test_get_serializer(self):
ctype = 'application/json'
self.assertEqual(self.serializer.get_body_serializer(ctype),
self.body_serializers[ctype])
def test_get_serializer_unknown_content_type(self):
self.assertRaises(exception.InvalidContentType,
self.serializer.get_body_serializer,
'application/unknown')
def test_serialize_response_json(self):
for content_type in ('application/json',
'application/vnd.x7.compute+json'):
request = wsgi.Request.blank('/')
response = self.serializer.serialize(request, {}, content_type)
self.assertEqual(response.headers['Content-Type'], content_type)
self.assertEqual(response.body, 'pew_json')
self.assertEqual(response.status_int, 404)
def test_serialize_response_xml(self):
for content_type in ('application/xml',
'application/vnd.x7.compute+xml'):
request = wsgi.Request.blank('/')
response = self.serializer.serialize(request, {}, content_type)
self.assertEqual(response.headers['Content-Type'], content_type)
self.assertEqual(response.body, 'pew_xml')
self.assertEqual(response.status_int, 404)
def test_serialize_response_None(self):
request = wsgi.Request.blank('/')
response = self.serializer.serialize(request, None, 'application/json')
self.assertEqual(response.headers['Content-Type'], 'application/json')
self.assertEqual(response.body, '')
self.assertEqual(response.status_int, 404)
def test_serialize_response_dict_to_unknown_content_type(self):
request = wsgi.Request.blank('/')
self.assertRaises(exception.InvalidContentType,
self.serializer.serialize,
request, {}, 'application/unknown')
class LazySerializationTest(test.TestCase):
def setUp(self):
self.body_serializers = {
'application/json': JSONSerializer(),
'application/xml': XMLSerializer(),
}
self.serializer = wsgi.ResponseSerializer(self.body_serializers,
HeadersSerializer())
def tearDown(self):
pass
def test_serialize_response_json(self):
for content_type in ('application/json',
'application/vnd.x7.compute+json'):
request = wsgi.Request.blank('/')
request.environ['engine.lazy_serialize'] = True
response = self.serializer.serialize(request, {}, content_type)
self.assertEqual(response.headers['Content-Type'], content_type)
self.assertEqual(response.status_int, 404)
body = json.loads(response.body)
self.assertEqual(body, {})
serializer = request.environ['engine.serializer']
self.assertEqual(serializer.serialize(body), 'pew_json')
def test_serialize_response_xml(self):
for content_type in ('application/xml',
'application/vnd.x7.compute+xml'):
request = wsgi.Request.blank('/')
request.environ['engine.lazy_serialize'] = True
response = self.serializer.serialize(request, {}, content_type)
self.assertEqual(response.headers['Content-Type'], content_type)
self.assertEqual(response.status_int, 404)
body = json.loads(response.body)
self.assertEqual(body, {})
serializer = request.environ['engine.serializer']
self.assertEqual(serializer.serialize(body), 'pew_xml')
def test_serialize_response_None(self):
request = wsgi.Request.blank('/')
request.environ['engine.lazy_serialize'] = True
response = self.serializer.serialize(request, None, 'application/json')
self.assertEqual(response.headers['Content-Type'], 'application/json')
self.assertEqual(response.status_int, 404)
self.assertEqual(response.body, '')
class RequestDeserializerTest(test.TestCase):
def setUp(self):
class JSONDeserializer(object):
def deserialize(self, data, action='default'):
return 'pew_json'
class XMLDeserializer(object):
def deserialize(self, data, action='default'):
return 'pew_xml'
self.body_deserializers = {
'application/json': JSONDeserializer(),
'application/xml': XMLDeserializer(),
}
self.deserializer = wsgi.RequestDeserializer(self.body_deserializers)
def tearDown(self):
pass
def test_get_deserializer(self):
ctype = 'application/json'
expected = self.deserializer.get_body_deserializer(ctype)
self.assertEqual(expected, self.body_deserializers[ctype])
def test_get_deserializer_unknown_content_type(self):
self.assertRaises(exception.InvalidContentType,
self.deserializer.get_body_deserializer,
'application/unknown')
def test_get_expected_content_type(self):
ctype = 'application/json'
request = wsgi.Request.blank('/')
request.headers['Accept'] = ctype
self.assertEqual(self.deserializer.get_expected_content_type(request),
ctype)
def test_get_action_args(self):
env = {
'wsgiorg.routing_args': [None, {
'controller': None,
'format': None,
'action': 'update',
'id': 12,
}],
}
expected = {'action': 'update', 'id': 12}
self.assertEqual(self.deserializer.get_action_args(env), expected)
def test_deserialize(self):
def fake_get_routing_args(request):
return {'action': 'create'}
self.deserializer.get_action_args = fake_get_routing_args
request = wsgi.Request.blank('/')
request.headers['Accept'] = 'application/xml'
deserialized = self.deserializer.deserialize(request)
expected = ('create', {}, 'application/xml')
self.assertEqual(expected, deserialized)
class ResourceTest(test.TestCase):
def test_dispatch(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
method = resource.get_method(None, 'index')
actual = resource.dispatch(method, None, {'pants': 'off'})
expected = 'off'
self.assertEqual(actual, expected)
def test_get_method_unknown_controller_action(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
self.assertRaises(AttributeError, resource.get_method,
None, 'create')
def test_get_action_args(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
env = {
'wsgiorg.routing_args': [None, {
'controller': None,
'format': None,
'action': 'update',
'id': 12,
}],
}
expected = {'action': 'update', 'id': 12}
self.assertEqual(resource.get_action_args(env), expected)
def test_get_body_bad_content(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
request = wsgi.Request.blank('/', method='POST')
request.headers['Content-Type'] = 'application/none'
request.body = 'foo'
content_type, body = resource.get_body(request)
self.assertEqual(content_type, None)
self.assertEqual(body, '')
def test_get_body_no_content_type(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
request = wsgi.Request.blank('/', method='POST')
request.body = 'foo'
content_type, body = resource.get_body(request)
self.assertEqual(content_type, None)
self.assertEqual(body, '')
def test_get_body_no_content_body(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
request = wsgi.Request.blank('/', method='POST')
request.headers['Content-Type'] = 'application/json'
request.body = ''
content_type, body = resource.get_body(request)
self.assertEqual(content_type, None)
self.assertEqual(body, '')
def test_get_body(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
request = wsgi.Request.blank('/', method='POST')
request.headers['Content-Type'] = 'application/json'
request.body = 'foo'
content_type, body = resource.get_body(request)
self.assertEqual(content_type, 'application/json')
self.assertEqual(body, 'foo')
def test_deserialize_badtype(self):
class Controller(object):
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller)
self.assertRaises(exception.InvalidContentType,
resource.deserialize,
controller.index, 'application/none', 'foo')
def test_deserialize_default(self):
class JSONDeserializer(object):
def deserialize(self, body):
return 'json'
class XMLDeserializer(object):
def deserialize(self, body):
return 'xml'
class Controller(object):
@wsgi.deserializers(xml=XMLDeserializer)
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller, json=JSONDeserializer)
obj = resource.deserialize(controller.index, 'application/json', 'foo')
self.assertEqual(obj, 'json')
def test_deserialize_decorator(self):
class JSONDeserializer(object):
def deserialize(self, body):
return 'json'
class XMLDeserializer(object):
def deserialize(self, body):
return 'xml'
class Controller(object):
@wsgi.deserializers(xml=XMLDeserializer)
def index(self, req, pants=None):
return pants
controller = Controller()
resource = wsgi.Resource(controller, json=JSONDeserializer)
obj = resource.deserialize(controller.index, 'application/xml', 'foo')
self.assertEqual(obj, 'xml')
class ResponseObjectTest(test.TestCase):
def test_default_code(self):
robj = wsgi.ResponseObject({})
self.assertEqual(robj.code, 200)
def test_modified_code(self):
robj = wsgi.ResponseObject({})
robj._default_code = 202
self.assertEqual(robj.code, 202)
def test_override_default_code(self):
robj = wsgi.ResponseObject({}, code=404)
self.assertEqual(robj.code, 404)
def test_override_modified_code(self):
robj = wsgi.ResponseObject({}, code=404)
robj._default_code = 202
self.assertEqual(robj.code, 404)
def test_set_header(self):
robj = wsgi.ResponseObject({})
robj['Header'] = 'foo'
self.assertEqual(robj.headers, {'header': 'foo'})
def test_get_header(self):
robj = wsgi.ResponseObject({})
robj['Header'] = 'foo'
self.assertEqual(robj['hEADER'], 'foo')
def test_del_header(self):
robj = wsgi.ResponseObject({})
robj['Header'] = 'foo'
del robj['hEADER']
self.assertFalse('header' in robj.headers)
def test_header_isolation(self):
robj = wsgi.ResponseObject({})
robj['Header'] = 'foo'
hdrs = robj.headers
hdrs['hEADER'] = 'bar'
self.assertEqual(robj['hEADER'], 'foo')
def test_default_serializers(self):
robj = wsgi.ResponseObject({})
self.assertEqual(robj.serializers, {})
def test_bind_serializers(self):
robj = wsgi.ResponseObject({}, json='foo')
robj._bind_method_serializers(dict(xml='bar', json='baz'))
self.assertEqual(robj.serializers, dict(xml='bar', json='foo'))
def test_get_serializer(self):
robj = wsgi.ResponseObject({}, json='json', xml='xml', atom='atom')
for content_type, mtype in wsgi._MEDIA_TYPE_MAP.items():
serializer = robj.get_serializer(content_type)
self.assertEqual(serializer, mtype)
def test_get_serializer_defaults(self):
robj = wsgi.ResponseObject({})
default_serializers = dict(json='json', xml='xml', atom='atom')
for content_type, mtype in wsgi._MEDIA_TYPE_MAP.items():
self.assertRaises(exception.InvalidContentType,
robj.get_serializer, content_type)
serializer = robj.get_serializer(content_type,
default_serializers)
self.assertEqual(serializer, mtype)
def test_serialize(self):
class JSONSerializer(object):
def serialize(self, obj):
return 'json'
class XMLSerializer(object):
def serialize(self, obj):
return 'xml'
class AtomSerializer(object):
def serialize(self, obj):
return 'atom'
robj = wsgi.ResponseObject({}, code=202,
json=JSONSerializer,
xml=XMLSerializer,
atom=AtomSerializer)
robj['X-header1'] = 'header1'
robj['X-header2'] = 'header2'
for content_type, mtype in wsgi._MEDIA_TYPE_MAP.items():
request = wsgi.Request.blank('/tests/123')
response = robj.serialize(request, content_type)
self.assertEqual(response.headers['Content-Type'], content_type)
self.assertEqual(response.headers['X-header1'], 'header1')
self.assertEqual(response.headers['X-header2'], 'header2')
self.assertEqual(response.status_int, 202)
self.assertEqual(response.body, mtype)
| [
"[email protected]"
] | |
4d43d040cf2e02b62ba7af0f29b00d7da7e62a89 | 3950cb348a4a3ff6627d502dbdf4e576575df2fb | /.venv/Lib/site-packages/vtkmodules/qt/__init__.py | 2ece15c0e01ce73eb0d862377e9f2c30d7c2e0ba | [] | no_license | Bdye15/Sample_Programs | a90d288c8f5434f46e1d266f005d01159d8f7927 | 08218b697db91e55e8e0c49664a0b0cb44b4ab93 | refs/heads/main | 2023-03-02T04:40:57.737097 | 2021-01-31T03:03:59 | 2021-01-31T03:03:59 | 328,053,795 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 994 | py | """Qt module for VTK/Python.
Example usage:
import sys
import PyQt5
from PyQt5.QtWidgets import QApplication
from vtkmodules.qt.QVTKRenderWindowInteractor import QVTKRenderWindowInteractor
app = QApplication(sys.argv)
widget = QVTKRenderWindowInteractor()
widget.Initialize()
widget.Start()
renwin = widget.GetRenderWindow()
For more information, see QVTKRenderWidgetConeExample() in the file
QVTKRenderWindowInteractor.py.
"""
import sys
# PyQtImpl can be set by the user
PyQtImpl = None
# Has an implementation has been imported yet?
for impl in ["PyQt5", "PySide2", "PyQt4", "PySide"]:
if impl in sys.modules:
PyQtImpl = impl
break
# QVTKRWIBase, base class for QVTKRenderWindowInteractor,
# can be altered by the user to "QGLWidget" in case
# of rendering errors (e.g. depth check problems, readGLBuffer
# warnings...)
QVTKRWIBase = "QWidget"
__all__ = ['QVTKRenderWindowInteractor']
| [
"[email protected]"
] | |
f379b0318ac9d679ec2825d99b6de6c3bc7d5341 | 5cc204e2ecb9a756127e7c71633a1edcdb3e989b | /pyvasp/vasp/vcon2ewald.py.bak | 30a834d3cd254cafb1bd523eba78924105a3ee62 | [] | no_license | hopefulp/sandbox | 1a1d518cf7b5e6bca2b2776be1cac3d27fc4bcf8 | 4d26767f287be6abc88dc74374003b04d509bebf | refs/heads/master | 2023-06-27T17:50:16.637851 | 2023-06-15T03:53:39 | 2023-06-15T03:53:39 | 218,209,112 | 1 | 0 | null | 2022-09-13T13:22:34 | 2019-10-29T05:14:02 | C++ | UTF-8 | Python | false | false | 2,917 | bak | #!/usr/bin/python2.7
#heejin
import sys
import os
import re
import math
#usage description
if len(sys.argv)<3:
print "Usage: [contfile] [chg file]"
sys.exit()
confilename=sys.argv[1]
chgfilename=sys.argv[2]
# get ZVAL
os.system('grep ZVAL POTCAR | awk \'{print $6}\' > zval.tmp')
# direct to cartesian
poscarfile = open(confilename)
line = poscarfile.readline()
line = poscarfile.readline()
line = poscarfile.readline()
line = poscarfile.readline()
line = poscarfile.readline()
line = poscarfile.readline()
parse = line.split()
if parse[0].isalpha():
line = poscarfile.readline()
line = poscarfile.readline()
line = poscarfile.readline()
if ('Direct' in line):
poscarfile.close()
doos = 'cp ' + confilename + ' CONTCAR.tmp'
os.system(doos)
os.system('sed -i 6d CONTCAR.tmp')
os.system('convasp -cart < CONTCAR.tmp > CONTCAR.cart')
os.system('rm CONTCAR.tmp')
poscarfile.close()
# get poscar information
poscarfile = open('CONTCAR.cart')
while 1:
line = poscarfile.readline()
if not line:
break
atomlist = line.split()
line = poscarfile.readline() #mul
line = poscarfile.readline() #a
line = poscarfile.readline() #b
line = poscarfile.readline() #c
line = poscarfile.readline()
nspecies = line.count(' ')
numlist = line.split()
natoms = 0
if numlist[0].isdigit():
for i in range(nspecies):
natoms = natoms + int(numlist[i])
else:
line = poscarfile.readline()
nspecies = line.count(' ')
numlist = line.split()
for i in range(nspecies):
natoms = natoms + int(numlist[i])
break
poscarfile.close()
zval = []
zvalfile = open('zval.tmp')
for i in range(nspecies):
line = zvalfile.readline()
zval.append(line)
chgtmpfile = open('CONTCAR.chgtmp', 'w')
chgfile = open(chgfilename)
line = chgfile.readline()
for i in range(nspecies):
for j in range(int(numlist[i])):
line = chgfile.readline()
chglist = line.split()
chgval = float(zval[i]) - float(chglist[1])
if chgval > 0:
chgval2 = '+'+str(chgval)+'\n'
else:
chgval2 = str(chgval)+'\n'
chgtmpfile.write(chgval2)
chgfile.close()
chgtmpfile.close()
poscarfile = open('CONTCAR.cart')
outfile = open(confilename+'.vo', 'w')
chgfile = open('CONTCAR.chgtmp')
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
line = poscarfile.readline()
outfile.write(line)
for i in range(natoms):
line = poscarfile.readline()
line2 = line.rstrip('\n')
chgline = chgfile.readline()
outline = line2 + ' ' + chgline
outfile.write(outline)
poscarfile.close()
outfile.close()
chgfile.close()
#os.system('convasp -names +2 +5 -2 +1 < CONTCAR.cart > CONTCAR.fc')
os.system('rm zval.tmp CONTCAR.chgtmp CONTCAR.cart')
| [
"[email protected]"
] | |
964138161e808eec89f029b24c77f9aea7216d0c | a404f504febdc835b69b72c4ac28b153885fc119 | /Auditions/OneLevelToRuleThemAll.py | a52edb14ee9fa3d430484ab7d1a555d4a334a1a8 | [] | no_license | Chaboi45/CodeCombat | 6093a2eae29ef00c0c277653c4ffd075c9e2ac4c | 6e008a94e65bb72ca9292e303d391a4142de16f5 | refs/heads/master | 2021-07-02T23:24:52.050154 | 2017-09-21T07:42:21 | 2017-09-21T07:42:21 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,601 | py | # http://codecombat.com/play/level/one-level-to-rule-them-all
summonTypes = ['paladin']
def summonTroops():
type = summonTypes[len(hero.built) % len(summonTypes)]
if hero.gold > hero.costOf(type):
hero.summon(type)
def commandTroops():
for index, friend in enumerate(hero.findFriends()):
if friend.type == 'paladin':
CommandPaladin(friend)
def CommandPaladin(paladin):
if (paladin.canCast("heal")):
if (hero.health < hero.maxHealth * 0.6):
target = self
if target:
hero.command(paladin, "cast", "heal", target)
elif (paladin.health < 100):
hero.command(paladin, "shield")
else:
target = hero.findNearest(hero.findEnemies())
hero.command(paladin, "attack", target)
def moveTo(position, fast=True):
if (hero.isReady("jump") and hero.distanceTo(position) > 10 and fast):
hero.jumpTo(position)
else:
hero.move(position)
def attack(target):
if target:
if (hero.distanceTo(target) > 10):
moveTo(target.pos)
elif (hero.isReady("bash")):
hero.bash(target)
elif (hero.canCast('chain-lightning', target)):
hero.cast('chain-lightning', target)
else:
hero.attack(target)
while True:
flag = hero.findFlag()
summonTroops()
commandTroops()
if flag:
hero.pickUpFlag(flag)
else:
enemy = hero.findNearest(hero.findEnemies())
if enemy:
attack(enemy)
# find some enemy to attack
# use cleave when ready
| [
"[email protected]"
] | |
14d0c203a2e59d08e0063c7d1e58c596fec9a914 | 656def2ca5c0bd959b31b98cdbc53fea3420b2dc | /Python3.7-VideoSplice/src/tencentcloud/tiia/v20190529/models.py | ae4387b12bd517b20057594c47302f8bef8d05eb | [] | no_license | tencentyun/serverless-demo | 120271b96f8f960b6125c9d1481a5d8fe56165ae | 4c324bb186c460fe78252f0ca5c28132a8bce6c9 | refs/heads/master | 2023-08-25T17:07:04.959745 | 2023-08-25T08:10:49 | 2023-08-25T08:10:49 | 281,120,881 | 94 | 119 | null | 2023-08-31T06:34:36 | 2020-07-20T13:15:46 | null | UTF-8 | Python | false | false | 71,890 | py | # -*- coding: utf8 -*-
# Copyright (c) 2017-2021 THL A29 Limited, a Tencent company. All Rights Reserved.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
import warnings
from tencentcloud.common.abstract_model import AbstractModel
class AssessQualityRequest(AbstractModel):
"""AssessQuality请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class AssessQualityResponse(AbstractModel):
"""AssessQuality返回参数结构体
"""
def __init__(self):
r"""
:param LongImage: 取值为TRUE或FALSE，TRUE为长图，FALSE为正常图，长图定义为长宽比大于等于3或小于等于1/3的图片。
:type LongImage: bool
:param BlackAndWhite: 取值为TRUE或FALSE，TRUE为黑白图，FALSE为否。黑白图即灰度图，指红绿蓝三个通道都是以灰度色阶显示的图片，并非视觉上的“黑白图片”。
:type BlackAndWhite: bool
:param SmallImage: 取值为TRUE或FALSE，TRUE为小图，FALSE为否, 小图定义为最长边小于179像素的图片。当一张图片被判断为小图时，不建议做推荐和展示，其他字段统一输出为0或FALSE。
:type SmallImage: bool
:param BigImage: 取值为TRUE或FALSE，TRUE为大图，FALSE为否，定义为最短边大于1000像素的图片
:type BigImage: bool
:param PureImage: 取值为TRUE或FALSE，TRUE为纯色图或纯文字图，即没有内容或只有简单内容的图片，FALSE为正常图片。
:type PureImage: bool
:param ClarityScore: 综合评分。图像清晰度的得分，对图片的噪声、曝光、模糊、压缩等因素进行综合评估，取值为[0, 100]，值越大，越清晰。一般大于50为较清晰图片，标准可以自行把握。
:type ClarityScore: int
:param AestheticScore: 综合评分。图像美观度得分， 从构图、色彩等多个艺术性维度评价图片，取值为[0, 100]，值越大，越美观。一般大于50为较美观图片，标准可以自行把握。
:type AestheticScore: int
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.LongImage = None
self.BlackAndWhite = None
self.SmallImage = None
self.BigImage = None
self.PureImage = None
self.ClarityScore = None
self.AestheticScore = None
self.RequestId = None
def _deserialize(self, params):
self.LongImage = params.get("LongImage")
self.BlackAndWhite = params.get("BlackAndWhite")
self.SmallImage = params.get("SmallImage")
self.BigImage = params.get("BigImage")
self.PureImage = params.get("PureImage")
self.ClarityScore = params.get("ClarityScore")
self.AestheticScore = params.get("AestheticScore")
self.RequestId = params.get("RequestId")
class CarPlateContent(AbstractModel):
"""车牌信息
"""
def __init__(self):
r"""
:param Plate: 车牌信息。
注意：此字段可能返回 null，表示取不到有效值。
:type Plate: str
:param Color: 车牌颜色。
注意：此字段可能返回 null，表示取不到有效值。
:type Color: str
:param Type: 车牌类型；渣土车车牌遮挡时,该值为枚举值“异常”。
注意：此字段可能返回 null，表示取不到有效值。
:type Type: str
:param PlateLocation: 车牌在图片中的坐标信息。
注意：此字段可能返回 null，表示取不到有效值。
:type PlateLocation: list of Coord
"""
self.Plate = None
self.Color = None
self.Type = None
self.PlateLocation = None
def _deserialize(self, params):
self.Plate = params.get("Plate")
self.Color = params.get("Color")
self.Type = params.get("Type")
if params.get("PlateLocation") is not None:
self.PlateLocation = []
for item in params.get("PlateLocation"):
obj = Coord()
obj._deserialize(item)
self.PlateLocation.append(obj)
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class CarTagItem(AbstractModel):
"""车辆属性识别的结果
"""
def __init__(self):
r"""
:param Serial: 车系
:type Serial: str
:param Brand: 车辆品牌
:type Brand: str
:param Type: 车辆类型
:type Type: str
:param Color: 车辆颜色
:type Color: str
:param Confidence: 置信度，0-100
:type Confidence: int
:param Year: 年份，没识别出年份的时候返回0
:type Year: int
:param CarLocation: 车辆在图片中的坐标信息
:type CarLocation: list of Coord
:param PlateContent: 车牌信息
注意：此字段可能返回 null，表示取不到有效值。
:type PlateContent: :class:`tencentcloud.tiia.v20190529.models.CarPlateContent`
"""
self.Serial = None
self.Brand = None
self.Type = None
self.Color = None
self.Confidence = None
self.Year = None
self.CarLocation = None
self.PlateContent = None
def _deserialize(self, params):
self.Serial = params.get("Serial")
self.Brand = params.get("Brand")
self.Type = params.get("Type")
self.Color = params.get("Color")
self.Confidence = params.get("Confidence")
self.Year = params.get("Year")
if params.get("CarLocation") is not None:
self.CarLocation = []
for item in params.get("CarLocation"):
obj = Coord()
obj._deserialize(item)
self.CarLocation.append(obj)
if params.get("PlateContent") is not None:
self.PlateContent = CarPlateContent()
self.PlateContent._deserialize(params.get("PlateContent"))
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class Coord(AbstractModel):
"""汽车坐标信息
"""
def __init__(self):
r"""
:param X: 横坐标x
:type X: int
:param Y: 纵坐标y
:type Y: int
"""
self.X = None
self.Y = None
def _deserialize(self, params):
self.X = params.get("X")
self.Y = params.get("Y")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class CreateGroupRequest(AbstractModel):
"""CreateGroup请求参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库ID，不可重复，仅支持字母、数字和下划线。
:type GroupId: str
:param GroupName: 图库名称描述。
:type GroupName: str
:param MaxCapacity: 该库的容量限制。
:type MaxCapacity: int
:param Brief: 简介。
:type Brief: str
:param MaxQps: 该库的访问限频 ，默认10。
:type MaxQps: int
:param GroupType: 图库类型， 默认为通用。
类型：
1: 通用图库，以用户输入图提取特征。
2: 灰度图库，输入图和搜索图均转为灰度图提取特征。
:type GroupType: int
"""
self.GroupId = None
self.GroupName = None
self.MaxCapacity = None
self.Brief = None
self.MaxQps = None
self.GroupType = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.GroupName = params.get("GroupName")
self.MaxCapacity = params.get("MaxCapacity")
self.Brief = params.get("Brief")
self.MaxQps = params.get("MaxQps")
self.GroupType = params.get("GroupType")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class CreateGroupResponse(AbstractModel):
"""CreateGroup返回参数结构体
"""
def __init__(self):
r"""
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.RequestId = None
def _deserialize(self, params):
self.RequestId = params.get("RequestId")
class CreateImageRequest(AbstractModel):
"""CreateImage请求参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库ID。
:type GroupId: str
:param EntityId: 物品ID，最多支持64个字符。
若EntityId已存在，则对其追加图片。
:type EntityId: str
:param PicName: 图片名称，最多支持64个字符，
同一个EntityId，最大支持5张图。如果图片名称已存在，则会更新库中的图片。
:type PicName: str
:param ImageUrl: 图片的 Url 。对应图片 base64 编码后大小不可超过2M。
Url、Image必须提供一个，如果都提供，只使用 Url。
图片分辨率不超过1920*1080。
图片存储于腾讯云的Url可保障更高下载速度和稳定性，建议图片存储于腾讯云。
非腾讯云存储的Url速度和稳定性可能受一定影响。
支持PNG、JPG、JPEG、BMP，不支持 GIF 图片。
:type ImageUrl: str
:param ImageBase64: 图片 base64 数据，base64 编码后大小不可超过2M。
图片分辨率不超过1920*1080。
支持PNG、JPG、JPEG、BMP，不支持 GIF 图片。
:type ImageBase64: str
:param CustomContent: 用户自定义的内容，最多支持4096个字符，查询时原样带回。
:type CustomContent: str
:param Tags: 图片自定义标签，最多不超过10个，格式为JSON。
:type Tags: str
"""
self.GroupId = None
self.EntityId = None
self.PicName = None
self.ImageUrl = None
self.ImageBase64 = None
self.CustomContent = None
self.Tags = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.EntityId = params.get("EntityId")
self.PicName = params.get("PicName")
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
self.CustomContent = params.get("CustomContent")
self.Tags = params.get("Tags")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class CreateImageResponse(AbstractModel):
"""CreateImage返回参数结构体
"""
def __init__(self):
r"""
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.RequestId = None
def _deserialize(self, params):
self.RequestId = params.get("RequestId")
class CropImageRequest(AbstractModel):
"""CropImage请求参数结构体
"""
def __init__(self):
r"""
:param Width: 需要裁剪区域的宽度，与Height共同组成所需裁剪的图片宽高比例；
输入数字请大于0、小于图片宽度的像素值；
:type Width: int
:param Height: 需要裁剪区域的高度，与Width共同组成所需裁剪的图片宽高比例；
输入数字请请大于0、小于图片高度的像素值；
宽高比例（Width : Height）会简化为最简分数，即如果Width输入10、Height输入20，会简化为1：2。
Width : Height建议取值在[1, 2.5]之间，超过这个范围可能会影响效果；
:type Height: int
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.Width = None
self.Height = None
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.Width = params.get("Width")
self.Height = params.get("Height")
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class CropImageResponse(AbstractModel):
"""CropImage返回参数结构体
"""
def __init__(self):
r"""
:param X: 裁剪区域左上角X坐标值
:type X: int
:param Y: 裁剪区域左上角Y坐标值
:type Y: int
:param Width: 裁剪区域的宽度，单位为像素
:type Width: int
:param Height: 裁剪区域的高度，单位为像素
:type Height: int
:param OriginalWidth: 原图宽度，单位为像素
:type OriginalWidth: int
:param OriginalHeight: 原图高度，单位为像素
:type OriginalHeight: int
:param CropResult: 0：抠图正常；
1：原图过长，指原图的高度是宽度的1.8倍以上；
2：原图过宽，指原图的宽度是高度的1.8倍以上；
3：抠图区域过长，指抠图的高度是主体备选框高度的1.6倍以上；
4：抠图区域过宽，指当没有检测到人脸时，抠图区域宽度是检测出的原图主体区域宽度的1.6倍以上；
5：纯色图，指裁剪区域视觉较为单一、缺乏主体部分 ；
6：宽高比异常，指Width : Height取值超出[1, 2.5]的范围；
以上是辅助决策的参考建议，可以根据业务需求选择采纳或忽视。
:type CropResult: int
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.X = None
self.Y = None
self.Width = None
self.Height = None
self.OriginalWidth = None
self.OriginalHeight = None
self.CropResult = None
self.RequestId = None
def _deserialize(self, params):
self.X = params.get("X")
self.Y = params.get("Y")
self.Width = params.get("Width")
self.Height = params.get("Height")
self.OriginalWidth = params.get("OriginalWidth")
self.OriginalHeight = params.get("OriginalHeight")
self.CropResult = params.get("CropResult")
self.RequestId = params.get("RequestId")
class DeleteImagesRequest(AbstractModel):
"""DeleteImages请求参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库名称。
:type GroupId: str
:param EntityId: 物品ID。
:type EntityId: str
:param PicName: 图片名称，如果不指定本参数，则删除EntityId下所有的图片；否则删除指定的图。
:type PicName: str
"""
self.GroupId = None
self.EntityId = None
self.PicName = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.EntityId = params.get("EntityId")
self.PicName = params.get("PicName")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DeleteImagesResponse(AbstractModel):
"""DeleteImages返回参数结构体
"""
def __init__(self):
r"""
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.RequestId = None
def _deserialize(self, params):
self.RequestId = params.get("RequestId")
class DescribeGroupsRequest(AbstractModel):
"""DescribeGroups请求参数结构体
"""
def __init__(self):
r"""
:param Offset: 起始序号，默认值为0。
:type Offset: int
:param Limit: 返回数量，默认值为10，最大值为100。
:type Limit: int
:param GroupId: 图库ID，如果不为空，则返回指定库信息。
:type GroupId: str
"""
self.Offset = None
self.Limit = None
self.GroupId = None
def _deserialize(self, params):
self.Offset = params.get("Offset")
self.Limit = params.get("Limit")
self.GroupId = params.get("GroupId")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DescribeGroupsResponse(AbstractModel):
"""DescribeGroups返回参数结构体
"""
def __init__(self):
r"""
:param Groups: 图库信息
注意：此字段可能返回 null，表示取不到有效值。
:type Groups: list of GroupInfo
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Groups = None
self.RequestId = None
def _deserialize(self, params):
if params.get("Groups") is not None:
self.Groups = []
for item in params.get("Groups"):
obj = GroupInfo()
obj._deserialize(item)
self.Groups.append(obj)
self.RequestId = params.get("RequestId")
class DescribeImagesRequest(AbstractModel):
"""DescribeImages请求参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库名称。
:type GroupId: str
:param EntityId: 物品ID。
:type EntityId: str
:param PicName: 图片名称。
:type PicName: str
"""
self.GroupId = None
self.EntityId = None
self.PicName = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.EntityId = params.get("EntityId")
self.PicName = params.get("PicName")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DescribeImagesResponse(AbstractModel):
"""DescribeImages返回参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库名称。
:type GroupId: str
:param EntityId: 物品ID。
:type EntityId: str
:param ImageInfos: 图片信息。
:type ImageInfos: list of ImageInfo
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.GroupId = None
self.EntityId = None
self.ImageInfos = None
self.RequestId = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.EntityId = params.get("EntityId")
if params.get("ImageInfos") is not None:
self.ImageInfos = []
for item in params.get("ImageInfos"):
obj = ImageInfo()
obj._deserialize(item)
self.ImageInfos.append(obj)
self.RequestId = params.get("RequestId")
class DetectCelebrityRequest(AbstractModel):
"""DetectCelebrity请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectCelebrityResponse(AbstractModel):
"""DetectCelebrity返回参数结构体
"""
def __init__(self):
r"""
:param Faces: 公众人物识别结果数组。如果检测不到人脸，返回为空；最多可以返回10个人脸识别结果。
:type Faces: list of Face
:param Threshold: 本服务在不同误识率水平下（将图片中的人物识别错误的比例）的推荐阈值，可以用于控制识别结果的精度。
FalseRate1Percent, FalseRate5Permil, FalseRate1Permil分别代表误识率在百分之一、千分之五、千分之一情况下的推荐阈值。
因为阈值会存在变动，请勿将此处输出的固定值处理，而是每次取值与confidence对比，来判断本次的识别结果是否可信。
例如，如果您业务中可以接受的误识率是1%，则可以将所有confidence>=FalseRate1Percent的结论认为是正确的。
注意：此字段可能返回 null，表示取不到有效值。
:type Threshold: :class:`tencentcloud.tiia.v20190529.models.Threshold`
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Faces = None
self.Threshold = None
self.RequestId = None
def _deserialize(self, params):
if params.get("Faces") is not None:
self.Faces = []
for item in params.get("Faces"):
obj = Face()
obj._deserialize(item)
self.Faces.append(obj)
if params.get("Threshold") is not None:
self.Threshold = Threshold()
self.Threshold._deserialize(params.get("Threshold"))
self.RequestId = params.get("RequestId")
class DetectDisgustRequest(AbstractModel):
"""DetectDisgust请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectDisgustResponse(AbstractModel):
"""DetectDisgust返回参数结构体
"""
def __init__(self):
r"""
:param Confidence: 对于图片中包含恶心内容的置信度，取值[0,1]，一般超过0.5则表明可能是恶心图片。
:type Confidence: float
:param Type: 与图像内容最相似的恶心内容的类别，包含腐烂、密集、畸形、血腥、蛇、虫子、牙齿等。
:type Type: str
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Confidence = None
self.Type = None
self.RequestId = None
def _deserialize(self, params):
self.Confidence = params.get("Confidence")
self.Type = params.get("Type")
self.RequestId = params.get("RequestId")
class DetectLabelBetaRequest(AbstractModel):
"""DetectLabelBeta请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
:param Scenes: 本次调用支持的识别场景，可选值如下：
WEB，针对网络图片优化;
CAMERA，针对手机摄像头拍摄图片优化;
ALBUM，针对手机相册、网盘产品优化;
NEWS，针对新闻、资讯、广电等行业优化；
NONECAM，非实拍图；
LOCATION，主体位置识别；
如果不传此参数，则默认为WEB。
支持多场景（Scenes）一起检测。例如，使用 Scenes=["WEB", "CAMERA"]，即对一张图片使用两个模型同时检测，输出两套识别结果。
:type Scenes: list of str
"""
self.ImageUrl = None
self.ImageBase64 = None
self.Scenes = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
self.Scenes = params.get("Scenes")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectLabelBetaResponse(AbstractModel):
"""DetectLabelBeta返回参数结构体
"""
def __init__(self):
r"""
:param Labels: Web网络版标签结果数组。如未选择WEB场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type Labels: list of DetectLabelItem
:param CameraLabels: Camera摄像头版标签结果数组。如未选择CAMERA场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type CameraLabels: list of DetectLabelItem
:param AlbumLabels: Album相册版标签结果数组。如未选择ALBUM场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type AlbumLabels: list of DetectLabelItem
:param NewsLabels: News新闻版标签结果数组。如未选择NEWS场景，则为空。
新闻版目前为测试阶段，暂不提供每个标签的一级、二级分类信息的输出。
注意：此字段可能返回 null，表示取不到有效值。
:type NewsLabels: list of DetectLabelItem
:param NoneCamLabels: 非实拍标签
注意：此字段可能返回 null，表示取不到有效值。
:type NoneCamLabels: list of DetectLabelItem
:param LocationLabels: 识别结果
注意：此字段可能返回 null，表示取不到有效值。
:type LocationLabels: list of Product
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Labels = None
self.CameraLabels = None
self.AlbumLabels = None
self.NewsLabels = None
self.NoneCamLabels = None
self.LocationLabels = None
self.RequestId = None
def _deserialize(self, params):
if params.get("Labels") is not None:
self.Labels = []
for item in params.get("Labels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.Labels.append(obj)
if params.get("CameraLabels") is not None:
self.CameraLabels = []
for item in params.get("CameraLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.CameraLabels.append(obj)
if params.get("AlbumLabels") is not None:
self.AlbumLabels = []
for item in params.get("AlbumLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.AlbumLabels.append(obj)
if params.get("NewsLabels") is not None:
self.NewsLabels = []
for item in params.get("NewsLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.NewsLabels.append(obj)
if params.get("NoneCamLabels") is not None:
self.NoneCamLabels = []
for item in params.get("NoneCamLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.NoneCamLabels.append(obj)
if params.get("LocationLabels") is not None:
self.LocationLabels = []
for item in params.get("LocationLabels"):
obj = Product()
obj._deserialize(item)
self.LocationLabels.append(obj)
self.RequestId = params.get("RequestId")
class DetectLabelItem(AbstractModel):
"""图像标签检测结果。
"""
def __init__(self):
r"""
:param Name: 图片中的物体名称。
:type Name: str
:param Confidence: 算法对于Name的置信度，0-100之间，值越高，表示对于Name越确定。
:type Confidence: int
:param FirstCategory: 标签的一级分类
:type FirstCategory: str
:param SecondCategory: 标签的二级分类
:type SecondCategory: str
"""
self.Name = None
self.Confidence = None
self.FirstCategory = None
self.SecondCategory = None
def _deserialize(self, params):
self.Name = params.get("Name")
self.Confidence = params.get("Confidence")
self.FirstCategory = params.get("FirstCategory")
self.SecondCategory = params.get("SecondCategory")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectLabelRequest(AbstractModel):
"""DetectLabel请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
:param Scenes: 本次调用支持的识别场景，可选值如下：
WEB，针对网络图片优化;
CAMERA，针对手机摄像头拍摄图片优化;
ALBUM，针对手机相册、网盘产品优化;
NEWS，针对新闻、资讯、广电等行业优化；
如果不传此参数，则默认为WEB。
支持多场景（Scenes）一起检测。例如，使用 Scenes=["WEB", "CAMERA"]，即对一张图片使用两个模型同时检测，输出两套识别结果。
:type Scenes: list of str
"""
self.ImageUrl = None
self.ImageBase64 = None
self.Scenes = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
self.Scenes = params.get("Scenes")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectLabelResponse(AbstractModel):
"""DetectLabel返回参数结构体
"""
def __init__(self):
r"""
:param Labels: Web网络版标签结果数组。如未选择WEB场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type Labels: list of DetectLabelItem
:param CameraLabels: Camera摄像头版标签结果数组。如未选择CAMERA场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type CameraLabels: list of DetectLabelItem
:param AlbumLabels: Album相册版标签结果数组。如未选择ALBUM场景，则为空。
注意：此字段可能返回 null，表示取不到有效值。
:type AlbumLabels: list of DetectLabelItem
:param NewsLabels: News新闻版标签结果数组。如未选择NEWS场景，则为空。
新闻版目前为测试阶段，暂不提供每个标签的一级、二级分类信息的输出。
注意：此字段可能返回 null，表示取不到有效值。
:type NewsLabels: list of DetectLabelItem
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Labels = None
self.CameraLabels = None
self.AlbumLabels = None
self.NewsLabels = None
self.RequestId = None
def _deserialize(self, params):
if params.get("Labels") is not None:
self.Labels = []
for item in params.get("Labels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.Labels.append(obj)
if params.get("CameraLabels") is not None:
self.CameraLabels = []
for item in params.get("CameraLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.CameraLabels.append(obj)
if params.get("AlbumLabels") is not None:
self.AlbumLabels = []
for item in params.get("AlbumLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.AlbumLabels.append(obj)
if params.get("NewsLabels") is not None:
self.NewsLabels = []
for item in params.get("NewsLabels"):
obj = DetectLabelItem()
obj._deserialize(item)
self.NewsLabels.append(obj)
self.RequestId = params.get("RequestId")
class DetectMisbehaviorRequest(AbstractModel):
"""DetectMisbehavior请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectMisbehaviorResponse(AbstractModel):
"""DetectMisbehavior返回参数结构体
"""
def __init__(self):
r"""
:param Confidence: 对于图片中包含不良行为的置信度，取值[0,1]，一般超过0.5则表明可能包含不良行为内容；
:type Confidence: float
:param Type: 图像中最可能包含的不良行为类别，包括赌博、打架斗殴、吸毒等。
:type Type: str
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Confidence = None
self.Type = None
self.RequestId = None
def _deserialize(self, params):
self.Confidence = params.get("Confidence")
self.Type = params.get("Type")
self.RequestId = params.get("RequestId")
class DetectProductBetaRequest(AbstractModel):
"""DetectProductBeta请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片限制：内测版仅支持jpg、jpeg，图片大小不超过1M，分辨率在25万到100万之间。
建议先对图片进行压缩，以便提升处理速度。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过1M，分辨率在25万到100万之间。
与ImageUrl同时存在时优先使用ImageUrl字段。
:type ImageBase64: str
:param NeedLemma: 是否需要百科信息 1：是，0: 否，默认是0
:type NeedLemma: int
"""
self.ImageUrl = None
self.ImageBase64 = None
self.NeedLemma = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
self.NeedLemma = params.get("NeedLemma")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectProductBetaResponse(AbstractModel):
"""DetectProductBeta返回参数结构体
"""
def __init__(self):
r"""
:param RegionDetected: 检测到的图片中的商品位置和品类预测。
当图片中存在多个商品时，输出多组坐标，按照__显著性__排序（综合考虑面积、是否在中心、检测算法置信度）。
最多可以输出__3组__检测结果。
:type RegionDetected: list of RegionDetected
:param ProductInfo: 图像识别出的商品的详细信息。
当图像中检测到多个物品时，会对显著性最高的进行识别。
:type ProductInfo: :class:`tencentcloud.tiia.v20190529.models.ProductInfo`
:param ProductInfoList: 相似商品信息列表
注意：此字段可能返回 null，表示取不到有效值。
:type ProductInfoList: list of ProductInfo
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.RegionDetected = None
self.ProductInfo = None
self.ProductInfoList = None
self.RequestId = None
def _deserialize(self, params):
if params.get("RegionDetected") is not None:
self.RegionDetected = []
for item in params.get("RegionDetected"):
obj = RegionDetected()
obj._deserialize(item)
self.RegionDetected.append(obj)
if params.get("ProductInfo") is not None:
self.ProductInfo = ProductInfo()
self.ProductInfo._deserialize(params.get("ProductInfo"))
if params.get("ProductInfoList") is not None:
self.ProductInfoList = []
for item in params.get("ProductInfoList"):
obj = ProductInfo()
obj._deserialize(item)
self.ProductInfoList.append(obj)
self.RequestId = params.get("RequestId")
class DetectProductRequest(AbstractModel):
"""DetectProduct请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class DetectProductResponse(AbstractModel):
"""DetectProduct返回参数结构体
"""
def __init__(self):
r"""
:param Products: 商品识别结果数组
:type Products: list of Product
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Products = None
self.RequestId = None
def _deserialize(self, params):
if params.get("Products") is not None:
self.Products = []
for item in params.get("Products"):
obj = Product()
obj._deserialize(item)
self.Products.append(obj)
self.RequestId = params.get("RequestId")
class EnhanceImageRequest(AbstractModel):
"""EnhanceImage请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，最大不超过250万像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 支持PNG、JPG、JPEG、BMP，不支持 GIF 图片。图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class EnhanceImageResponse(AbstractModel):
"""EnhanceImage返回参数结构体
"""
def __init__(self):
r"""
:param EnhancedImage: 增强后图片的base64编码。
:type EnhancedImage: str
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.EnhancedImage = None
self.RequestId = None
def _deserialize(self, params):
self.EnhancedImage = params.get("EnhancedImage")
self.RequestId = params.get("RequestId")
class Face(AbstractModel):
"""公众人物识别人脸信息
"""
def __init__(self):
r"""
:param Name: 与图片中人脸最相似的公众人物的名字。
:type Name: str
:param Labels: 公众人物身份标签的数组，一个公众人物可能有多个身份标签。
:type Labels: list of Labels
:param BasicInfo: 对人物的简介。
:type BasicInfo: str
:param Confidence: 算法对于Name的置信度（图像中人脸与公众人物的相似度），0-100之间，值越高，表示对于Name越确定。
:type Confidence: int
:param X: 人脸区域左上角横坐标。
:type X: int
:param Y: 人脸区域左上角纵坐标。
:type Y: int
:param Width: 人脸区域宽度。
:type Width: int
:param Height: 人脸区域高度。
:type Height: int
:param ID: 公众人物的唯一编号，可以用于区分同名人物、一个人物不同称呼等情况。唯一编号为8个字符构成的字符串。
注意：此字段可能返回 null，表示取不到有效值。
:type ID: str
"""
self.Name = None
self.Labels = None
self.BasicInfo = None
self.Confidence = None
self.X = None
self.Y = None
self.Width = None
self.Height = None
self.ID = None
def _deserialize(self, params):
self.Name = params.get("Name")
if params.get("Labels") is not None:
self.Labels = []
for item in params.get("Labels"):
obj = Labels()
obj._deserialize(item)
self.Labels.append(obj)
self.BasicInfo = params.get("BasicInfo")
self.Confidence = params.get("Confidence")
self.X = params.get("X")
self.Y = params.get("Y")
self.Width = params.get("Width")
self.Height = params.get("Height")
self.ID = params.get("ID")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class GroupInfo(AbstractModel):
"""图库信息。
"""
def __init__(self):
r"""
:param GroupId: 图库Id。
:type GroupId: str
:param GroupName: 图库名称。
:type GroupName: str
:param Brief: 图库简介。
:type Brief: str
:param MaxCapacity: 图库容量。
:type MaxCapacity: int
:param MaxQps: 该库的访问限频 。
:type MaxQps: int
:param GroupType: 图库类型：
1: 通用图库，以用户输入图提取特征。
2: 灰度图库，输入图和搜索图均转为灰度图提取特征。
:type GroupType: int
:param PicCount: 图库图片数量。
:type PicCount: int
:param CreateTime: 图库创建时间。
:type CreateTime: str
:param UpdateTime: 图库更新时间。
:type UpdateTime: str
"""
self.GroupId = None
self.GroupName = None
self.Brief = None
self.MaxCapacity = None
self.MaxQps = None
self.GroupType = None
self.PicCount = None
self.CreateTime = None
self.UpdateTime = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.GroupName = params.get("GroupName")
self.Brief = params.get("Brief")
self.MaxCapacity = params.get("MaxCapacity")
self.MaxQps = params.get("MaxQps")
self.GroupType = params.get("GroupType")
self.PicCount = params.get("PicCount")
self.CreateTime = params.get("CreateTime")
self.UpdateTime = params.get("UpdateTime")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class ImageInfo(AbstractModel):
"""图片信息
"""
def __init__(self):
r"""
:param EntityId: 图片名称。
:type EntityId: str
:param CustomContent: 用户自定义的内容。
:type CustomContent: str
:param Tags: 图片自定义标签，JSON格式。
:type Tags: str
:param PicName: 图片名称。
:type PicName: str
:param Score: 相似度。
:type Score: int
"""
self.EntityId = None
self.CustomContent = None
self.Tags = None
self.PicName = None
self.Score = None
def _deserialize(self, params):
self.EntityId = params.get("EntityId")
self.CustomContent = params.get("CustomContent")
self.Tags = params.get("Tags")
self.PicName = params.get("PicName")
self.Score = params.get("Score")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class Labels(AbstractModel):
"""名人识别的标签
"""
def __init__(self):
r"""
:param FirstLabel: 公众人物身份标签的一级分类，例如体育明星、娱乐明星、政治人物等；
注意：此字段可能返回 null，表示取不到有效值。
:type FirstLabel: str
:param SecondLabel: 公众人物身份标签的二级分类，例如歌手（对应一级标签为“娱乐明星”）；
注意：此字段可能返回 null，表示取不到有效值。
:type SecondLabel: str
"""
self.FirstLabel = None
self.SecondLabel = None
def _deserialize(self, params):
self.FirstLabel = params.get("FirstLabel")
self.SecondLabel = params.get("SecondLabel")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class LemmaInfo(AbstractModel):
"""百科词条信息
"""
def __init__(self):
r"""
:param LemmaTitle: 词条
注意：此字段可能返回 null，表示取不到有效值。
:type LemmaTitle: str
:param LemmaAbstract: 词条描述
注意：此字段可能返回 null，表示取不到有效值。
:type LemmaAbstract: str
:param Tag: 标签
注意：此字段可能返回 null，表示取不到有效值。
:type Tag: str
"""
self.LemmaTitle = None
self.LemmaAbstract = None
self.Tag = None
def _deserialize(self, params):
self.LemmaTitle = params.get("LemmaTitle")
self.LemmaAbstract = params.get("LemmaAbstract")
self.Tag = params.get("Tag")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class Location(AbstractModel):
"""检测到的主体在图片中的矩形框位置（四个顶点坐标）
"""
def __init__(self):
r"""
:param XMin: 位置矩形框的左上角横坐标
:type XMin: int
:param YMin: 位置矩形框的左上角纵坐标
:type YMin: int
:param XMax: 位置矩形框的右下角横坐标
:type XMax: int
:param YMax: 位置矩形框的右下角纵坐标
:type YMax: int
"""
self.XMin = None
self.YMin = None
self.XMax = None
self.YMax = None
def _deserialize(self, params):
self.XMin = params.get("XMin")
self.YMin = params.get("YMin")
self.XMax = params.get("XMax")
self.YMax = params.get("YMax")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class Product(AbstractModel):
"""检测到的单个商品结构体
"""
def __init__(self):
r"""
:param Name: 图片中商品的三级分类识别结果，选取所有三级分类中的置信度最大者
:type Name: str
:param Parents: 三级商品分类对应的一级分类和二级分类，两级之间用“-”（中划线）隔开，例如商品名称是“硬盘”，那么Parents输出为“电脑、办公-电脑配件”
:type Parents: str
:param Confidence: 算法对于Name的置信度，0-100之间，值越高，表示对于Name越确定
:type Confidence: int
:param XMin: 商品坐标X轴的最小值
:type XMin: int
:param YMin: 商品坐标Y轴的最小值
:type YMin: int
:param XMax: 商品坐标X轴的最大值
:type XMax: int
:param YMax: 商品坐标Y轴的最大值
:type YMax: int
"""
self.Name = None
self.Parents = None
self.Confidence = None
self.XMin = None
self.YMin = None
self.XMax = None
self.YMax = None
def _deserialize(self, params):
self.Name = params.get("Name")
self.Parents = params.get("Parents")
self.Confidence = params.get("Confidence")
self.XMin = params.get("XMin")
self.YMin = params.get("YMin")
self.XMax = params.get("XMax")
self.YMax = params.get("YMax")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class ProductInfo(AbstractModel):
"""图像识别出的商品的详细信息。
当图像中检测到多个物品时，会对显著性最高的物品进行识别。
"""
def __init__(self):
r"""
:param FindSKU: 1表示找到同款商品，以下字段为同款商品信息；
0表示未找到同款商品， 具体商品信息为空（参考价格、名称、品牌等），仅提供商品类目和参考图片（商品库中找到的最相似图片，供参考）。
是否找到同款的判断依据为Score分值，分值越大则同款的可能性越大。
:type FindSKU: int
:param Location: 本商品在图片中的坐标，表示为矩形框的四个顶点坐标。
:type Location: :class:`tencentcloud.tiia.v20190529.models.Location`
:param Name: 商品名称
:type Name: str
:param Brand: 商品品牌
:type Brand: str
:param Price: 参考价格，综合多个信息源，仅供参考。
:type Price: str
:param ProductCategory: 识别结果的商品类目。
包含：鞋、图书音像、箱包、美妆个护、服饰、家电数码、玩具乐器、食品饮料、珠宝、家居家装、药品、酒水、绿植园艺、其他商品、非商品等。
当类别为“非商品”时，除Location、Score和本字段之外的商品信息为空。
:type ProductCategory: str
:param Score: 输入图片中的主体物品和输出结果的相似度。分值越大，输出结果与输入图片是同款的可能性越高。
:type Score: float
:param Image: 搜索到的商品配图URL。
:type Image: str
:param LemmaInfoList: 百科词条列表
注意：此字段可能返回 null，表示取不到有效值。
:type LemmaInfoList: list of LemmaInfo
"""
self.FindSKU = None
self.Location = None
self.Name = None
self.Brand = None
self.Price = None
self.ProductCategory = None
self.Score = None
self.Image = None
self.LemmaInfoList = None
def _deserialize(self, params):
self.FindSKU = params.get("FindSKU")
if params.get("Location") is not None:
self.Location = Location()
self.Location._deserialize(params.get("Location"))
self.Name = params.get("Name")
self.Brand = params.get("Brand")
self.Price = params.get("Price")
self.ProductCategory = params.get("ProductCategory")
self.Score = params.get("Score")
self.Image = params.get("Image")
if params.get("LemmaInfoList") is not None:
self.LemmaInfoList = []
for item in params.get("LemmaInfoList"):
obj = LemmaInfo()
obj._deserialize(item)
self.LemmaInfoList.append(obj)
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class RecognizeCarRequest(AbstractModel):
"""RecognizeCar请求参数结构体
"""
def __init__(self):
r"""
:param ImageUrl: 图片URL地址。
图片限制：
• 图片格式：PNG、JPG、JPEG。
• 图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
建议：
• 图片像素：大于50*50像素，否则影响识别效果；
• 长宽比：长边：短边<5；
接口响应时间会受到图片下载时间的影响，建议使用更可靠的存储服务，推荐将图片存储在腾讯云COS。
:type ImageUrl: str
:param ImageBase64: 图片经过base64编码的内容。最大不超过4M。与ImageUrl同时存在时优先使用ImageUrl字段。
**注意：图片需要base64编码，并且要去掉编码头部。**
支持的图片格式：PNG、JPG、JPEG、BMP，暂不支持GIF格式。支持的图片大小：所下载图片经Base64编码后不超过4M。图片下载时间不超过3秒。
:type ImageBase64: str
"""
self.ImageUrl = None
self.ImageBase64 = None
def _deserialize(self, params):
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class RecognizeCarResponse(AbstractModel):
"""RecognizeCar返回参数结构体
"""
def __init__(self):
r"""
:param CarCoords: 汽车的四个矩形顶点坐标，如果图片中存在多辆车，则输出最大车辆的坐标。
:type CarCoords: list of Coord
:param CarTags: 车辆属性识别的结果数组，如果识别到多辆车，则会输出每辆车的top1结果。
:type CarTags: list of CarTagItem
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.CarCoords = None
self.CarTags = None
self.RequestId = None
def _deserialize(self, params):
if params.get("CarCoords") is not None:
self.CarCoords = []
for item in params.get("CarCoords"):
obj = Coord()
obj._deserialize(item)
self.CarCoords.append(obj)
if params.get("CarTags") is not None:
self.CarTags = []
for item in params.get("CarTags"):
obj = CarTagItem()
obj._deserialize(item)
self.CarTags.append(obj)
self.RequestId = params.get("RequestId")
class RegionDetected(AbstractModel):
"""检测到的图片中的商品位置和品类预测。
当图片中存在多个商品时，输出多组坐标，按照__显著性__排序（综合考虑面积、是否在中心、检测算法置信度）。
最多可以输出__3组__检测结果。
"""
def __init__(self):
r"""
:param Category: 商品的品类预测结果。
包含：鞋、图书音像、箱包、美妆个护、服饰、家电数码、玩具乐器、食品饮料、珠宝、家居家装、药品、酒水、绿植园艺、其他商品、非商品等。
:type Category: str
:param CategoryScore: 商品品类预测的置信度
:type CategoryScore: float
:param Location: 检测到的主体在图片中的坐标，表示为矩形框的四个顶点坐标
:type Location: :class:`tencentcloud.tiia.v20190529.models.Location`
"""
self.Category = None
self.CategoryScore = None
self.Location = None
def _deserialize(self, params):
self.Category = params.get("Category")
self.CategoryScore = params.get("CategoryScore")
if params.get("Location") is not None:
self.Location = Location()
self.Location._deserialize(params.get("Location"))
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class SearchImageRequest(AbstractModel):
"""SearchImage请求参数结构体
"""
def __init__(self):
r"""
:param GroupId: 图库名称。
:type GroupId: str
:param ImageUrl: 图片的 Url 。对应图片 base64 编码后大小不可超过2M。
图片分辨率不超过1920*1080。
Url、Image必须提供一个，如果都提供，只使用 Url。
图片存储于腾讯云的Url可保障更高下载速度和稳定性，建议图片存储于腾讯云。
非腾讯云存储的Url速度和稳定性可能受一定影响。
支持PNG、JPG、JPEG、BMP，不支持 GIF 图片。
:type ImageUrl: str
:param ImageBase64: 图片 base64 数据，base64 编码后大小不可超过2M。
图片分辨率不超过1920*1080。
支持PNG、JPG、JPEG、BMP，不支持 GIF 图片。
:type ImageBase64: str
:param MatchThreshold: 出参Score中，只有超过MatchThreshold值的结果才会返回。默认为0
:type MatchThreshold: int
:param Offset: 起始序号，默认值为0。
:type Offset: int
:param Limit: 返回数量，默认值为10，最大值为100。
:type Limit: int
:param Filter: 针对入库时提交的Tags信息进行条件过滤。支持>、>=、 <、 <=、=，!=，多个条件之间支持AND和OR进行连接。
:type Filter: str
"""
self.GroupId = None
self.ImageUrl = None
self.ImageBase64 = None
self.MatchThreshold = None
self.Offset = None
self.Limit = None
self.Filter = None
def _deserialize(self, params):
self.GroupId = params.get("GroupId")
self.ImageUrl = params.get("ImageUrl")
self.ImageBase64 = params.get("ImageBase64")
self.MatchThreshold = params.get("MatchThreshold")
self.Offset = params.get("Offset")
self.Limit = params.get("Limit")
self.Filter = params.get("Filter")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
class SearchImageResponse(AbstractModel):
"""SearchImage返回参数结构体
"""
def __init__(self):
r"""
:param Count: 返回结果数量。
:type Count: int
:param ImageInfos: 图片信息。
注意：此字段可能返回 null，表示取不到有效值。
:type ImageInfos: list of ImageInfo
:param RequestId: 唯一请求 ID，每次请求都会返回。定位问题时需要提供该次请求的 RequestId。
:type RequestId: str
"""
self.Count = None
self.ImageInfos = None
self.RequestId = None
def _deserialize(self, params):
self.Count = params.get("Count")
if params.get("ImageInfos") is not None:
self.ImageInfos = []
for item in params.get("ImageInfos"):
obj = ImageInfo()
obj._deserialize(item)
self.ImageInfos.append(obj)
self.RequestId = params.get("RequestId")
class Threshold(AbstractModel):
"""本服务在不同误识率水平下（将图片中的人物识别错误的比例）的推荐阈值，可以用于控制识别结果的精度。
{FalseRate1Percent, FalseRate5Permil, FalseRate1Permil}分别代表误识率在百分之一、千分之五、千分之一情况下的推荐阈值。
因为阈值会存在变动，请勿将此处输出的固定值处理，而是每次取值与confidence对比，来判断本次的识别结果是否可信。
例如，如果您业务中可以接受的误识率是1%，则可以将所有confidence>=FalseRate1Percent的结论认为是正确的。
"""
def __init__(self):
r"""
:param FalseRate1Percent: 误识率在百分之一时的推荐阈值。
:type FalseRate1Percent: int
:param FalseRate5Permil: 误识率在千分之五时的推荐阈值。
:type FalseRate5Permil: int
:param FalseRate1Permil: 误识率在千分之一时的推荐阈值。
:type FalseRate1Permil: int
"""
self.FalseRate1Percent = None
self.FalseRate5Permil = None
self.FalseRate1Permil = None
def _deserialize(self, params):
self.FalseRate1Percent = params.get("FalseRate1Percent")
self.FalseRate5Permil = params.get("FalseRate5Permil")
self.FalseRate1Permil = params.get("FalseRate1Permil")
memeber_set = set(params.keys())
for name, value in vars(self).items():
if name in memeber_set:
memeber_set.remove(name)
if len(memeber_set) > 0:
warnings.warn("%s fileds are useless." % ",".join(memeber_set))
| [
"[email protected]"
] | |
8d6abe2e2e1f83b0bb4a0f714216e5f73634d056 | 0930b6c994225d44818887716ce4e8771af86b81 | /exercisesDosCapitulos/12-umaEspaconaveQueAtira/12.4-teclas/main.py | dffb2fa5141878bac5fdfd98453c9d4e2f62cd2f | [] | no_license | jonasht/cursoIntesivoDePython | 44d81b08f1652c4fa7a6d14a0e3f62ee8e06944c | fb5f5c9884fb1a6062a7c4e7676e5cc3b13c0ebb | refs/heads/master | 2023-05-23T20:44:34.372825 | 2021-06-19T12:13:46 | 2021-06-19T12:13:46 | 293,325,804 | 4 | 2 | null | null | null | null | UTF-8 | Python | false | false | 526 | py | import pygame
def run_game():
pygame.init()
screen = pygame.display.set_mode((800, 600))
run = True
while run:
screen.fill((255, 255, 255))
for event in pygame.event.get():
if event.type == pygame.QUIT:
run = False
if event.type == pygame.KEYDOWN:
print(f'apertado:{event.key} ')
if event.key == pygame.K_ESCAPE or event.key == pygame.K_q:
run = False
pygame.display.update()
run_game()
| [
"[email protected]"
] | |
028f7254014e7380449a4821a74148ff30b6914b | a80874300e561174068bf510608465bb318a35f2 | /guhaisong/baidu_work/11.py | ce52aba82f1036003194ac91fb0a65e86908c384 | [] | no_license | lemonbiz/guhaisong | effa8af4b679511e4fa8017d71fe26ab2ce51392 | 029890f8e3c6954efdefb184fa077f2ce646d1df | refs/heads/master | 2022-12-13T08:21:37.911535 | 2020-09-15T16:15:10 | 2020-09-15T16:15:10 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 10,481 | py | # -*-coding: utf-8-*-
# **************************file desc*****************************
import threading
from concurrent.futures import ThreadPoolExecutor, ProcessPoolExecutor
from multiprocessing import Process, Pool
__author__ = 'yushanshan'
# createTime : 2019/7/18 15:07
# desc : this is new py file, please write your desc for this file
# ****************************************************************
from insert import getDatabase
from insert_redis import inser_redis
from requests_url import getXpath
import requests, pymysql, logging, redis
from urllib import parse
from queue import Queue
supervisory = ["jd.com", "1688.com", "b2b.baidu.com"]
from config_log import config_log
Header = {
"User-Agent": "Mozilla/5.0 (Windows NT 10.0; Win64; x64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/67.0.3396.79 Safari/537.36",
}
conn = getDatabase()
q = Queue(15)
def test_connection():
try:
global conn
conn.ping()
except:
conn = getDatabase()
return conn
def insert_db(dicts):
supervisory = {"jd.com": ["jd", "jd_title", "jd_url"], "1688.com": ["1688", "1688_title", "1688_url"],
"b2b.baidu.com": ["b2bbaidu", "b2bbaidu_title", "b2bbaidu_url"]}
if dicts.get("tag") == "jd":
print(dicts)
sql = "update baidu_ranking set jd=%d,jd_title='%s',jd_url='%s' where keyword='%s'" % (
dicts["index"], dicts["title"], dicts["url"], dicts["keyword"])
conn = test_connection()
cur = conn.cursor()
try:
cur.execute(sql)
conn.commit()
logging.info("jd--mysql:{}".format("插入成功"))
except Exception as e:
conn.rollback()
logging.info("jd--mysql:{}".format(e))
if dicts.get("tag") == "1688":
print(dicts)
sql = "update baidu_ranking set `1688`=%d,1688_title='%s',1688_url='%s' where keyword='%s'" % (
dicts["index"], dicts["title"], dicts["url"], dicts["keyword"])
conn = test_connection()
cur = conn.cursor()
conn.ping(reconnect=True)
try:
cur.execute(sql)
conn.commit()
logging.info("1688--mysql:{}".format("插入成功"))
except Exception as e:
conn.rollback()
logging.info("1688--mysql:{}".format(e))
if dicts.get("tag") == "b2b.baidu.com":
print(dicts)
sql = "update baidu_ranking set b2bbaidu=%d,b2bbaidu_title='%s',b2bbaidu_url='%s' where keyword='%s'" % (
dicts["index"], dicts["title"], dicts["url"], dicts["keyword"])
conn = test_connection()
cur = conn.cursor()
# conn.ping(reconnect=True)
try:
cur.execute(sql)
conn.commit()
logging.info("b2b.baidu.com--mysql:{}".format("插入成功"))
except Exception as e:
conn.rollback()
logging.info("b2b.baidu.com--mysql:{}".format(e))
def get_keyword(q):
conn = inser_redis()
num = conn.llen("keywordlist")
for k in range(557, num):
print(k),
result = conn.lindex("keywordlist", k)
q.put(result)
# requests_baidu_keyword(result)
def requests_keyword():
pass
def requests_baidu_keyword(q):
while True:
keyword = q.get()
flag_jd = False
flag_1688 = False
flag_b2bbaidu = False
url = "http://www.baidu.com/s?wd=" + keyword
r = requests.get(url, headers=Header)
if r:
logging.info("请求关键字成功：{}".format(url))
selector = getXpath(r.text)
node_list = selector.xpath('''//div[contains(@class,"c-container")]''')
for l in node_list:
url_baidu_detail = l.xpath('''h3/a[1]/@href''')
lingshi_title = l.xpath('''string(h3/a[1])''')
title = str(lingshi_title)
if len(url_baidu_detail) > 0:
url_baidu_detail = url_baidu_detail[0]
if url_baidu_detail == "" or len(url_baidu_detail) < 3:
continue
if str(url_baidu_detail).startswith("/sf/"):
continue
try:
r2 = requests.get(url_baidu_detail, headers=Header, verify=False, timeout=8)
except Exception as e:
logging.warning(e)
else:
if r2:
if r2.apparent_encoding == "utf-8" or r2.apparent_encoding.startswith(
"UTF-8") or r2.apparent_encoding == "utf8":
r2.encoding = "utf-8"
elif r2.apparent_encoding == "GB2312" or r2.apparent_encoding.startswith(
"ISO-8859") or r2.apparent_encoding.startswith("Windows"):
r2.encoding = "gbk"
if r2:
print(r2.url)
if supervisory[0] in r2.url and flag_jd == False:
flag_jd = True
index_id = 0
index_id = l.xpath("@id")
if len(index_id) > 0:
index_id = int(index_id[0])
logging.info("关键字{}-- jd 详情页url：{}".format(keyword, r2.url))
dicts = {}
dicts["tag"] = "jd"
dicts["keyword"] = keyword
if "..." in title:
html = getXpath(r2.text)
title = html.xpath('''//head/title/text()''')
if len(title) > 0:
title = title[0]
dicts["title"] = title
dicts["url"] = r2.url
dicts["index"] = index_id
insert_db(dicts)
if supervisory[1] in r2.url and flag_1688 == False:
flag_1688 = True
index_id = 0
index_id = l.xpath("@id")
if len(index_id) > 0:
index_id = int(index_id[0])
logging.info("关键字{}-- 1688 详情页url：{}".format(keyword, r2.url))
dicts = {}
dicts["tag"] = "1688"
dicts["keyword"] = keyword
if "..." in title:
html = getXpath(r2.text)
title = html.xpath('''//head/title/text()''')
if len(title) > 0:
title = title[0]
dicts["title"] = title
dicts["url"] = r2.url
dicts["index"] = index_id
insert_db(dicts)
if supervisory[2] in r2.url and flag_b2bbaidu == False:
flag_b2bbaidu = True
index_id = 0
index_id = l.xpath("@id")
if len(index_id) > 0:
index_id = int(index_id[0])
logging.info("关键字{}-- b2bbaidu 详情页url：{}".format(keyword, r2.url))
dicts = {}
dicts["tag"] = "b2b.baidu.com"
dicts["keyword"] = keyword
if "..." in title:
html = getXpath(r2.text)
title = html.xpath('''//head/title/text()''')
if len(title) > 0:
title = title[0]
dicts["title"] = title
dicts["url"] = r2.url
dicts["index"] = index_id
insert_db(dicts)
if __name__ == "__main__":
config_log()
t1 = threading.Thread(target=get_keyword, args=(q,))
t1.start()
t2 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t2.start()
t3 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t3.start()
t4 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t4.start()
t5 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t5.start()
t6 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t6.start()
t7 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t7.start()
t8 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t8.start()
t9 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t9.start()
t10 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t10.start()
t11 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t11.start()
t12 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t12.start()
t13 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t13.start()
t14 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t14.start()
t15 = threading.Thread(target=requests_baidu_keyword, args=(q,))
t15.start()
# pool = Pool()
# for k in range(1, 5):
# result = pool.apply_async(requests_baidu_keyword,(q,))
# # rl = pool.map(get_keyword, testFL)
# pool.close()
# pool.join()
# get_keyword()
# requests_baidu_keyword("儿童高跟鞋")
| [
"[email protected]"
] | |
cd8a85f4d3cb19cee8189a9236fd46799cf05160 | 1a166165ab8287d01cbb377a13efdb5eff5dfef0 | /sdk/storage/azure-mgmt-storage/azure/mgmt/storage/v2020_08_01_preview/aio/operations/_encryption_scopes_operations.py | ec7f73b145e34dc513345a0d1ef56fce85c51fc5 | [
"MIT",
"LicenseRef-scancode-generic-cla",
"LGPL-2.1-or-later"
] | permissive | manoj0806/azure-sdk-for-python | 7a14b202ff80f528abd068bf50334e91001a9686 | aab999792db1132232b2f297c76800590a901142 | refs/heads/master | 2023-04-19T16:11:31.984930 | 2021-04-29T23:19:49 | 2021-04-29T23:19:49 | 363,025,016 | 1 | 0 | MIT | 2021-04-30T04:23:35 | 2021-04-30T04:23:35 | null | UTF-8 | Python | false | false | 19,087 | py | # coding=utf-8
# --------------------------------------------------------------------------
# Copyright (c) Microsoft Corporation. All rights reserved.
# Licensed under the MIT License. See License.txt in the project root for license information.
# Code generated by Microsoft (R) AutoRest Code Generator.
# Changes may cause incorrect behavior and will be lost if the code is regenerated.
# --------------------------------------------------------------------------
from typing import Any, AsyncIterable, Callable, Dict, Generic, Optional, TypeVar, Union
import warnings
from azure.core.async_paging import AsyncItemPaged, AsyncList
from azure.core.exceptions import ClientAuthenticationError, HttpResponseError, ResourceExistsError, ResourceNotFoundError, map_error
from azure.core.pipeline import PipelineResponse
from azure.core.pipeline.transport import AsyncHttpResponse, HttpRequest
from azure.mgmt.core.exceptions import ARMErrorFormat
from ... import models as _models
T = TypeVar('T')
ClsType = Optional[Callable[[PipelineResponse[HttpRequest, AsyncHttpResponse], T, Dict[str, Any]], Any]]
class EncryptionScopesOperations:
"""EncryptionScopesOperations async operations.
You should not instantiate this class directly. Instead, you should create a Client instance that
instantiates it for you and attaches it as an attribute.
:ivar models: Alias to model classes used in this operation group.
:type models: ~azure.mgmt.storage.v2020_08_01_preview.models
:param client: Client for service requests.
:param config: Configuration of service client.
:param serializer: An object model serializer.
:param deserializer: An object model deserializer.
"""
models = _models
def __init__(self, client, config, serializer, deserializer) -> None:
self._client = client
self._serialize = serializer
self._deserialize = deserializer
self._config = config
async def put(
self,
resource_group_name: str,
account_name: str,
encryption_scope_name: str,
encryption_scope: "_models.EncryptionScope",
**kwargs
) -> "_models.EncryptionScope":
"""Synchronously creates or updates an encryption scope under the specified storage account. If an
encryption scope is already created and a subsequent request is issued with different
properties, the encryption scope properties will be updated per the specified request.
:param resource_group_name: The name of the resource group within the user's subscription. The
name is case insensitive.
:type resource_group_name: str
:param account_name: The name of the storage account within the specified resource group.
Storage account names must be between 3 and 24 characters in length and use numbers and lower-
case letters only.
:type account_name: str
:param encryption_scope_name: The name of the encryption scope within the specified storage
account. Encryption scope names must be between 3 and 63 characters in length and use numbers,
lower-case letters and dash (-) only. Every dash (-) character must be immediately preceded and
followed by a letter or number.
:type encryption_scope_name: str
:param encryption_scope: Encryption scope properties to be used for the create or update.
:type encryption_scope: ~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScope
:keyword callable cls: A custom type or function that will be passed the direct response
:return: EncryptionScope, or the result of cls(response)
:rtype: ~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScope
:raises: ~azure.core.exceptions.HttpResponseError
"""
cls = kwargs.pop('cls', None) # type: ClsType["_models.EncryptionScope"]
error_map = {
401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError
}
error_map.update(kwargs.pop('error_map', {}))
api_version = "2020-08-01-preview"
content_type = kwargs.pop("content_type", "application/json")
accept = "application/json"
# Construct URL
url = self.put.metadata['url'] # type: ignore
path_format_arguments = {
'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'),
'accountName': self._serialize.url("account_name", account_name, 'str', max_length=24, min_length=3),
'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str', min_length=1),
'encryptionScopeName': self._serialize.url("encryption_scope_name", encryption_scope_name, 'str', max_length=63, min_length=3),
}
url = self._client.format_url(url, **path_format_arguments)
# Construct parameters
query_parameters = {} # type: Dict[str, Any]
query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str')
# Construct headers
header_parameters = {} # type: Dict[str, Any]
header_parameters['Content-Type'] = self._serialize.header("content_type", content_type, 'str')
header_parameters['Accept'] = self._serialize.header("accept", accept, 'str')
body_content_kwargs = {} # type: Dict[str, Any]
body_content = self._serialize.body(encryption_scope, 'EncryptionScope')
body_content_kwargs['content'] = body_content
request = self._client.put(url, query_parameters, header_parameters, **body_content_kwargs)
pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs)
response = pipeline_response.http_response
if response.status_code not in [200, 201]:
map_error(status_code=response.status_code, response=response, error_map=error_map)
error = self._deserialize.failsafe_deserialize(_models.ErrorResponse, response)
raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat)
if response.status_code == 200:
deserialized = self._deserialize('EncryptionScope', pipeline_response)
if response.status_code == 201:
deserialized = self._deserialize('EncryptionScope', pipeline_response)
if cls:
return cls(pipeline_response, deserialized, {})
return deserialized
put.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Storage/storageAccounts/{accountName}/encryptionScopes/{encryptionScopeName}'} # type: ignore
async def patch(
self,
resource_group_name: str,
account_name: str,
encryption_scope_name: str,
encryption_scope: "_models.EncryptionScope",
**kwargs
) -> "_models.EncryptionScope":
"""Update encryption scope properties as specified in the request body. Update fails if the
specified encryption scope does not already exist.
:param resource_group_name: The name of the resource group within the user's subscription. The
name is case insensitive.
:type resource_group_name: str
:param account_name: The name of the storage account within the specified resource group.
Storage account names must be between 3 and 24 characters in length and use numbers and lower-
case letters only.
:type account_name: str
:param encryption_scope_name: The name of the encryption scope within the specified storage
account. Encryption scope names must be between 3 and 63 characters in length and use numbers,
lower-case letters and dash (-) only. Every dash (-) character must be immediately preceded and
followed by a letter or number.
:type encryption_scope_name: str
:param encryption_scope: Encryption scope properties to be used for the update.
:type encryption_scope: ~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScope
:keyword callable cls: A custom type or function that will be passed the direct response
:return: EncryptionScope, or the result of cls(response)
:rtype: ~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScope
:raises: ~azure.core.exceptions.HttpResponseError
"""
cls = kwargs.pop('cls', None) # type: ClsType["_models.EncryptionScope"]
error_map = {
401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError
}
error_map.update(kwargs.pop('error_map', {}))
api_version = "2020-08-01-preview"
content_type = kwargs.pop("content_type", "application/json")
accept = "application/json"
# Construct URL
url = self.patch.metadata['url'] # type: ignore
path_format_arguments = {
'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'),
'accountName': self._serialize.url("account_name", account_name, 'str', max_length=24, min_length=3),
'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str', min_length=1),
'encryptionScopeName': self._serialize.url("encryption_scope_name", encryption_scope_name, 'str', max_length=63, min_length=3),
}
url = self._client.format_url(url, **path_format_arguments)
# Construct parameters
query_parameters = {} # type: Dict[str, Any]
query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str')
# Construct headers
header_parameters = {} # type: Dict[str, Any]
header_parameters['Content-Type'] = self._serialize.header("content_type", content_type, 'str')
header_parameters['Accept'] = self._serialize.header("accept", accept, 'str')
body_content_kwargs = {} # type: Dict[str, Any]
body_content = self._serialize.body(encryption_scope, 'EncryptionScope')
body_content_kwargs['content'] = body_content
request = self._client.patch(url, query_parameters, header_parameters, **body_content_kwargs)
pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs)
response = pipeline_response.http_response
if response.status_code not in [200]:
map_error(status_code=response.status_code, response=response, error_map=error_map)
error = self._deserialize.failsafe_deserialize(_models.ErrorResponse, response)
raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat)
deserialized = self._deserialize('EncryptionScope', pipeline_response)
if cls:
return cls(pipeline_response, deserialized, {})
return deserialized
patch.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Storage/storageAccounts/{accountName}/encryptionScopes/{encryptionScopeName}'} # type: ignore
async def get(
self,
resource_group_name: str,
account_name: str,
encryption_scope_name: str,
**kwargs
) -> "_models.EncryptionScope":
"""Returns the properties for the specified encryption scope.
:param resource_group_name: The name of the resource group within the user's subscription. The
name is case insensitive.
:type resource_group_name: str
:param account_name: The name of the storage account within the specified resource group.
Storage account names must be between 3 and 24 characters in length and use numbers and lower-
case letters only.
:type account_name: str
:param encryption_scope_name: The name of the encryption scope within the specified storage
account. Encryption scope names must be between 3 and 63 characters in length and use numbers,
lower-case letters and dash (-) only. Every dash (-) character must be immediately preceded and
followed by a letter or number.
:type encryption_scope_name: str
:keyword callable cls: A custom type or function that will be passed the direct response
:return: EncryptionScope, or the result of cls(response)
:rtype: ~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScope
:raises: ~azure.core.exceptions.HttpResponseError
"""
cls = kwargs.pop('cls', None) # type: ClsType["_models.EncryptionScope"]
error_map = {
401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError
}
error_map.update(kwargs.pop('error_map', {}))
api_version = "2020-08-01-preview"
accept = "application/json"
# Construct URL
url = self.get.metadata['url'] # type: ignore
path_format_arguments = {
'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'),
'accountName': self._serialize.url("account_name", account_name, 'str', max_length=24, min_length=3),
'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str', min_length=1),
'encryptionScopeName': self._serialize.url("encryption_scope_name", encryption_scope_name, 'str', max_length=63, min_length=3),
}
url = self._client.format_url(url, **path_format_arguments)
# Construct parameters
query_parameters = {} # type: Dict[str, Any]
query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str')
# Construct headers
header_parameters = {} # type: Dict[str, Any]
header_parameters['Accept'] = self._serialize.header("accept", accept, 'str')
request = self._client.get(url, query_parameters, header_parameters)
pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs)
response = pipeline_response.http_response
if response.status_code not in [200]:
map_error(status_code=response.status_code, response=response, error_map=error_map)
error = self._deserialize.failsafe_deserialize(_models.ErrorResponse, response)
raise HttpResponseError(response=response, model=error, error_format=ARMErrorFormat)
deserialized = self._deserialize('EncryptionScope', pipeline_response)
if cls:
return cls(pipeline_response, deserialized, {})
return deserialized
get.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Storage/storageAccounts/{accountName}/encryptionScopes/{encryptionScopeName}'} # type: ignore
def list(
self,
resource_group_name: str,
account_name: str,
**kwargs
) -> AsyncIterable["_models.EncryptionScopeListResult"]:
"""Lists all the encryption scopes available under the specified storage account.
:param resource_group_name: The name of the resource group within the user's subscription. The
name is case insensitive.
:type resource_group_name: str
:param account_name: The name of the storage account within the specified resource group.
Storage account names must be between 3 and 24 characters in length and use numbers and lower-
case letters only.
:type account_name: str
:keyword callable cls: A custom type or function that will be passed the direct response
:return: An iterator like instance of either EncryptionScopeListResult or the result of cls(response)
:rtype: ~azure.core.async_paging.AsyncItemPaged[~azure.mgmt.storage.v2020_08_01_preview.models.EncryptionScopeListResult]
:raises: ~azure.core.exceptions.HttpResponseError
"""
cls = kwargs.pop('cls', None) # type: ClsType["_models.EncryptionScopeListResult"]
error_map = {
401: ClientAuthenticationError, 404: ResourceNotFoundError, 409: ResourceExistsError
}
error_map.update(kwargs.pop('error_map', {}))
api_version = "2020-08-01-preview"
accept = "application/json"
def prepare_request(next_link=None):
# Construct headers
header_parameters = {} # type: Dict[str, Any]
header_parameters['Accept'] = self._serialize.header("accept", accept, 'str')
if not next_link:
# Construct URL
url = self.list.metadata['url'] # type: ignore
path_format_arguments = {
'resourceGroupName': self._serialize.url("resource_group_name", resource_group_name, 'str', max_length=90, min_length=1, pattern=r'^[-\w\._\(\)]+$'),
'accountName': self._serialize.url("account_name", account_name, 'str', max_length=24, min_length=3),
'subscriptionId': self._serialize.url("self._config.subscription_id", self._config.subscription_id, 'str', min_length=1),
}
url = self._client.format_url(url, **path_format_arguments)
# Construct parameters
query_parameters = {} # type: Dict[str, Any]
query_parameters['api-version'] = self._serialize.query("api_version", api_version, 'str')
request = self._client.get(url, query_parameters, header_parameters)
else:
url = next_link
query_parameters = {} # type: Dict[str, Any]
request = self._client.get(url, query_parameters, header_parameters)
return request
async def extract_data(pipeline_response):
deserialized = self._deserialize('EncryptionScopeListResult', pipeline_response)
list_of_elem = deserialized.value
if cls:
list_of_elem = cls(list_of_elem)
return deserialized.next_link or None, AsyncList(list_of_elem)
async def get_next(next_link=None):
request = prepare_request(next_link)
pipeline_response = await self._client._pipeline.run(request, stream=False, **kwargs)
response = pipeline_response.http_response
if response.status_code not in [200]:
map_error(status_code=response.status_code, response=response, error_map=error_map)
raise HttpResponseError(response=response, error_format=ARMErrorFormat)
return pipeline_response
return AsyncItemPaged(
get_next, extract_data
)
list.metadata = {'url': '/subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.Storage/storageAccounts/{accountName}/encryptionScopes'} # type: ignore
| [
"[email protected]"
] | |
2fdcd0028c218f840341e29cb9bef90b16d5f6ca | e23a4f57ce5474d468258e5e63b9e23fb6011188 | /125_algorithms/_examples/_algorithms_challenges/pybites/intermediate/118_v4/duplicates.py | a35079d32510853e3a93f85e69ce3e56175d560c | [] | no_license | syurskyi/Python_Topics | 52851ecce000cb751a3b986408efe32f0b4c0835 | be331826b490b73f0a176e6abed86ef68ff2dd2b | refs/heads/master | 2023-06-08T19:29:16.214395 | 2023-05-29T17:09:11 | 2023-05-29T17:09:11 | 220,583,118 | 3 | 2 | null | 2023-02-16T03:08:10 | 2019-11-09T02:58:47 | Python | UTF-8 | Python | false | false | 668 | py | from collections import Counter
def get_duplicate_indices(words):
"""Given a list of words, loop through the words and check for each
word if it occurs more than once.
If so return the index of its first occurrence.
For example in the following list 'is' and 'it'
occur more than once, and they are at indices 0 and 1 so you would
return [0, 1]:
['is', 'it', 'true', 'or', 'is', 'it', 'not?'] => [0, 1]
Make sure the returning list is unique and sorted in ascending order."""
counts = Counter(words)
dupes = [k for k, v in counts.items() if v > 1]
return sorted([words.index(dupe) for dupe in dupes])
| [
"[email protected]"
] | |
4e09422ed00c845f9890abcf2e6c7a4f60011b78 | cca46f82bf14e744abe1a7094ed81891f815bcd9 | /todos/models.py | 63be73ddb48e2399c6fe2739cbc095ad0b889e66 | [] | no_license | rikicop/backend | 3e63c8a4801d7ac49feb3c5b1af566890911dd0f | 319e1860448884e96cfea63702fa562c49cb8fb6 | refs/heads/main | 2023-07-13T00:28:51.853790 | 2021-08-09T15:41:37 | 2021-08-09T15:41:37 | 394,348,970 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 323 | py | from django.db import models
class Todo(models.Model):
foto = models.CharField(max_length=1000)
author = models.CharField(max_length=200,blank=True)
title = models.CharField(max_length=200)
description = models.TextField()
body = models.TextField()
def __str__(self):
return self.title | [
"[email protected]"
] | |
6b58fdfc2af995a27d80ee920429edd60bc6315b | 9c88ee174f74a5a8352ec8cf487a302aa87053d0 | /pylark/api_service_attendance_group_get.py | d39b09c70b7d77a40eef03360673465f929b3684 | [
"Apache-2.0"
] | permissive | duzx1/pylark | bcf34231218ec5079b8f9820a77864fbcffa4426 | a54cce6b814935fd3c72668b262b54c8ee461484 | refs/heads/master | 2023-08-23T13:10:00.324018 | 2021-11-01T06:29:28 | 2021-11-01T06:29:28 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 11,402 | py | # Code generated by lark_sdk_gen. DO NOT EDIT.
from pylark.lark_request import RawRequestReq, _new_method_option
from pylark import lark_type, lark_type_sheet, lark_type_approval
import attr
import typing
import io
@attr.s
class GetAttendanceGroupReq(object):
employee_type: lark_type.EmployeeType = attr.ib(
factory=lambda: lark_type.EmployeeType(),
metadata={"req_type": "query", "key": "employee_type"},
) # 用户 ID 的类型，可用值：【employee_id（员工的 employeeId），employee_no（员工工号）】
dept_type: str = attr.ib(
default="", metadata={"req_type": "query", "key": "dept_type"}
) # 部门 ID 的类型，可用值：【open_id（暂时只支持部门的 openid）】，示例值：“od-fcb45c28a45311afd441b8869541ece8”
group_id: str = attr.ib(
default="", metadata={"req_type": "path", "key": "group_id"}
) # 考勤组的 ID，需要从获取打卡结果的接口中获取 group_id，示例值："6919358128597097404"
@attr.s
class GetAttendanceGroupRespGroupIDNoNeedPunchSpecialDay(object):
punch_day: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "punch_day"}
) # 打卡日期，格式 20190101
shift_id: str = attr.ib(
default="", metadata={"req_type": "json", "key": "shift_id"}
) # 班次 ID
@attr.s
class GetAttendanceGroupRespGroupIDNeedPunchSpecialDay(object):
punch_day: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "punch_day"}
) # 打卡日期，格式 20190101
shift_id: str = attr.ib(
default="", metadata={"req_type": "json", "key": "shift_id"}
) # 班次 ID
@attr.s
class GetAttendanceGroupRespGroupIDFreePunchCfg(object):
free_start_time: str = attr.ib(
default="", metadata={"req_type": "json", "key": "free_start_time"}
) # 自由班制的打卡开始时间
free_end_time: str = attr.ib(
default="", metadata={"req_type": "json", "key": "free_end_time"}
) # 自由班制的打卡结束时间
punch_day: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "punch_day"}
) # 打卡时间：7 位数字，从左到右依次代表周一到周日，0 为不上班，1 为上班。例如：周一到周五上班 1111100
work_day_no_punch_as_lack: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "work_day_no_punch_as_lack"},
) # 工作日不打卡是否记为缺卡
@attr.s
class GetAttendanceGroupRespGroupIDLocation(object):
location_id: str = attr.ib(
default="", metadata={"req_type": "json", "key": "location_id"}
) # 地址 ID
location_name: str = attr.ib(
default="", metadata={"req_type": "json", "key": "location_name"}
) # 地址名称
location_type: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "location_type"}
) # 地址类型，1：GPS，2：Wifi，8：IP
latitude: float = attr.ib(
default=None, metadata={"req_type": "json", "key": "latitude"}
) # 地址纬度
longitude: float = attr.ib(
default=None, metadata={"req_type": "json", "key": "longitude"}
) # 地址经度
ssid: str = attr.ib(
default="", metadata={"req_type": "json", "key": "ssid"}
) # Wi-Fi 名称
bssid: str = attr.ib(
default="", metadata={"req_type": "json", "key": "bssid"}
) # Wi-Fi 的 MAC 地址
map_type: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "map_type"}
) # 地图类型，1：高德，2：谷歌
address: str = attr.ib(
default="", metadata={"req_type": "json", "key": "address"}
) # 地址名称
ip: str = attr.ib(default="", metadata={"req_type": "json", "key": "ip"}) # IP 地址
feature: str = attr.ib(
default="", metadata={"req_type": "json", "key": "feature"}
) # 额外信息，例如运营商信息
gps_range: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "gps_range"}
) # GPS 打卡的有效范围
@attr.s
class GetAttendanceGroupRespGroupIDMachine(object):
machine_sn: str = attr.ib(
default="", metadata={"req_type": "json", "key": "machine_sn"}
) # 考勤机序列号
machine_name: str = attr.ib(
default="", metadata={"req_type": "json", "key": "machine_name"}
) # 考勤机名称
@attr.s
class GetAttendanceGroupRespGroupID(object):
group_name: str = attr.ib(
default="", metadata={"req_type": "json", "key": "group_name"}
) # 考勤组名称
time_zone: str = attr.ib(
default="", metadata={"req_type": "json", "key": "time_zone"}
) # 时区
bind_dept_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "bind_dept_ids"}
) # 绑定的部门 ID
except_dept_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "except_dept_ids"}
) # 排除的部门 ID
bind_user_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "bind_user_ids"}
) # 绑定的用户 ID
except_user_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "except_user_ids"}
) # 排除的用户 ID
group_leader_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "group_leader_ids"}
) # 考勤负责人 ID 列表，必选字段
punch_type: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "punch_type"}
) # 考勤方式，0：考勤组人员可在任意地点、任意网络环境下打卡，1：GPS 打卡，2：Wi-Fi 打卡，4：考勤机打卡，8：IP 打卡。位运算，累加可支持多种考勤方式，比如，3：支持 GPS 打卡和 Wi-Fi 打卡，7：支持 GPS 打卡、Wi-Fi 打卡和考勤机打卡
allow_out_punch: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "allow_out_punch"}
) # 是否允许外勤打卡
allow_pc_punch: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "allow_pc_punch"}
) # 是否允许 PC 端打卡
allow_remedy: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "allow_remedy"}
) # 是否允许补卡
remedy_limit: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "remedy_limit"}
) # 是否限制补卡次数
remedy_limit_count: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "remedy_limit_count"}
) # 补卡次数
remedy_period_type: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "remedy_period_type"}
) # 补卡次数周期类型，0：自然月，1：自定义周期
remedy_period_custom_date: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "remedy_period_custom_date"}
) # 补卡自定义周期每月起始日
remedy_date_limit: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "remedy_date_limit"},
) # 是否限制补卡时间
remedy_date_num: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "remedy_date_num"}
) # 补卡时间
show_cumulative_time: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "show_cumulative_time"},
) # 是否展示上班累计时长
show_over_time: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "show_over_time"}
) # 是否展示加班累计时长
hide_staff_punch_time: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "hide_staff_punch_time"},
) # 是否隐藏员工打卡具体时间
face_punch: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "face_punch"}
) # 是否开启人脸识别打卡
face_punch_cfg: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "face_punch_cfg"}
) # 人脸识别打卡规则，1：每次打卡均需人脸识别，2：疑似作弊打卡时需要人脸识别
face_downgrade: bool = attr.ib(
factory=lambda: bool(), metadata={"req_type": "json", "key": "face_downgrade"}
) # 人脸识别失败时是否允许普通拍照打卡
replace_basic_pic: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "replace_basic_pic"},
) # 人脸识别失败时是否允许替换基准图片
machines: typing.List[GetAttendanceGroupRespGroupIDMachine] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "machines"}
) # 考勤机列表
gps_range: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "gps_range"}
) # GPS 打卡的有效范围（不建议使用）
locations: typing.List[GetAttendanceGroupRespGroupIDLocation] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "locations"}
) # 地址列表
group_type: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "group_type"}
) # 考勤类型，0：固定班制，2：排班制，3：自由班制
punch_day_shift_ids: typing.List[str] = attr.ib(
factory=lambda: [], metadata={"req_type": "json", "key": "punch_day_shift_ids"}
) # 固定班制必须填
free_punch_cfg: GetAttendanceGroupRespGroupIDFreePunchCfg = attr.ib(
default=None, metadata={"req_type": "json", "key": "free_punch_cfg"}
) # 配置自由班制
calendar_id: int = attr.ib(
default=0, metadata={"req_type": "json", "key": "calendar_id"}
) # 国家法定节假日历 ID，0：不根据国家法定节假日历排休，1：中国，2：美国，3：日本，4：印度，5：新加坡，默认为 1
need_punch_special_days: typing.List[
GetAttendanceGroupRespGroupIDNeedPunchSpecialDay
] = attr.ib(
factory=lambda: [],
metadata={"req_type": "json", "key": "need_punch_special_days"},
) # 必须打卡的特殊日期
no_need_punch_special_days: typing.List[
GetAttendanceGroupRespGroupIDNoNeedPunchSpecialDay
] = attr.ib(
factory=lambda: [],
metadata={"req_type": "json", "key": "no_need_punch_special_days"},
) # 无需打卡的特殊日期
work_day_no_punch_as_lack: bool = attr.ib(
factory=lambda: bool(),
metadata={"req_type": "json", "key": "work_day_no_punch_as_lack"},
) # 自由班制下，工作日不打卡是否记为缺卡
@attr.s
class GetAttendanceGroupResp(object):
group_id: GetAttendanceGroupRespGroupID = attr.ib(
default=None, metadata={"req_type": "json", "key": "group_id"}
) # 考勤组的 ID，需要从获取用户打卡结果的接口中获取 groupId
def _gen_get_attendance_group_req(request, options) -> RawRequestReq:
return RawRequestReq(
dataclass=GetAttendanceGroupResp,
scope="Attendance",
api="GetAttendanceGroup",
method="GET",
url="https://open.feishu.cn/open-apis/attendance/v1/groups/:group_id",
body=request,
method_option=_new_method_option(options),
need_tenant_access_token=True,
)
| [
"[email protected]"
] | |
f741f8a504de7a76fb26c2d9679d86ace42029eb | f07a42f652f46106dee4749277d41c302e2b7406 | /Data Set/bug-fixing-5/44e2cbe7b7bf41703ef2eb45faa1f59962eb3b34-<post_request>-fix.py | a5cdb336f072dc6e6c5f2b037163bc23cb4ad5d7 | [] | no_license | wsgan001/PyFPattern | e0fe06341cc5d51b3ad0fe29b84098d140ed54d1 | cc347e32745f99c0cd95e79a18ddacc4574d7faa | refs/heads/main | 2023-08-25T23:48:26.112133 | 2021-10-23T14:11:22 | 2021-10-23T14:11:22 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 770 | py | def post_request(self, uri, pyld, hdrs):
try:
resp = open_url(uri, data=json.dumps(pyld), headers=hdrs, method='POST', url_username=self.creds['user'], url_password=self.creds['pswd'], force_basic_auth=True, validate_certs=False, follow_redirects='all', use_proxy=False)
except HTTPError as e:
return {
'ret': False,
'msg': ('HTTP Error: %s' % e.code),
}
except URLError as e:
return {
'ret': False,
'msg': ('URL Error: %s' % e.reason),
}
except Exception as e:
return {
'ret': False,
'msg': ('Failed POST operation against Redfish API server: %s' % to_text(e)),
}
return {
'ret': True,
'resp': resp,
} | [
"[email protected]"
] | |
a0e915805bc1495a3feee94402e47c3625cbb573 | 012837eafe45c8f7ee5fc77d4c4d7725d5314c5c | /workshops/4-day/5-clazz.py | 2430adc8f4fd3bcb3b6cae29f9b12514d85037c2 | [
"MIT"
] | permissive | ai-erorr404/opencv-practice | e9408cf006779a678cf3a30fc60e9dbeb3c8e493 | 60ef5e4aec61ee5f7e675fb919e8f612e59f664a | refs/heads/master | 2021-02-08T11:17:04.763522 | 2020-02-22T09:43:04 | 2020-02-22T09:43:04 | 244,146,060 | 1 | 1 | MIT | 2020-03-01T12:35:02 | 2020-03-01T12:35:01 | null | UTF-8 | Python | false | false | 1,056 | py | #!/usr/bin/env python3
# -*- coding=utf-8 -*-
import cv2 as cv
"""
Unsharpen Mask 方法(USM) - 锐化增强算法
(源图片 - w * 高斯模糊) / (1 - w)
* w -> 权重（0.1 ~ 0.9）, 默认为 0.6
# 原理函数 - 图像融合函数（图像的shape、dtype一定要相同）
cv.addWeighted(src1, alpha, src2, beta, gamma)
- alpha: 第一个输入参数的权重值，可为负数
- gamma: 类delta效果，色彩增强，总和超过255 就是白色
- beta: 第二个输入参数的权重值，可为负数
"""
def main():
# 1、 高斯模糊降噪
# 2、 权重叠加
src = cv.imread("../../pic/IMG_20191204_151110.jpg")
cv.imshow("src", src)
gauss = cv.GaussianBlur(src, (0, 0), 5)
# media = cv.medianBlur(src, 5) # 采用均值模糊（均值滤波）进行优化
usm = cv.addWeighted(src, 1.5, gauss, -0.5, 0)
cv.imshow("usm", usm)
cv.waitKey(0)
cv.destroyAllWindows()
if "__main__" == __name__:
main()
| [
"[email protected]"
] | |
a429cef7afd0f3e93c21162cd35eb468bda2f4b2 | ae5034ca18291d3f550990c482b9a539edff293c | /Rational/RationalType.py | 32af85dcb23499987bfabd144211a83869ea0ecd | [] | no_license | SymmetricChaos/SimpleCAS | 350e4102ce8d41493bb9566efa993e6a4c87cdb0 | d5107cc07bd017e7a180eb62271273e21d466850 | refs/heads/master | 2021-07-01T09:00:49.197213 | 2021-01-03T14:22:28 | 2021-01-03T14:22:28 | 209,987,606 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 8,234 | py | from Utility import gcd, first_where
class Rational:
def __init__(self,n,d=1):
if type(n) != int:
raise TypeError("Numerator must be int.")
if type(d) != int:
raise TypeError("Denominator must be int.")
if d == 0:
raise ZeroDivisionError
if d < 0:
d = abs(d)
n = -n
self.n = n
self.d = d
self.simplify()
def simplify(self):
"""Convert fraction to simplest form"""
g = abs(gcd(self.n,self.d))
self.n = self.n//g
self.d = self.d//g
def copy(self):
return Rational(self.n,self.d)
def __str__(self):
if self.d == 1:
return str(self.n)
return f"{self.n}/{self.d}"
def _pretty_name(self):
"""Format for LaTeX"""
if self.d == 1:
return f"${self.n}$"
else:
return f"$\dfrac{{{self.n}}}{{{self.d}}}$"
def __repr__(self):
if self.d == 1:
return str(self.n)
return f"{self.n}/{self.d}"
def inv(self):
return Rational(self.d,self.n)
def __neg__(self):
return Rational(-self.n,self.d)
def __add__(self,addend):
# If we're adding a Rational to any other object we will instead use
# the __radd__ method on that object.
if type(addend) not in [Rational,int]:
return NotImplemented
if type(addend) == int:
addend = Rational(addend)
n = self.n*addend.d + addend.n*self.d
d = self.d*addend.d
return Rational(n,d)
def __radd__(self,addend):
if type(addend) == int:
addend = Rational(addend)
return self + addend
def __sub__(self,addend):
if type(addend) not in [Rational,int]:
return NotImplemented
return self + -addend
def __rsub__(self,addend):
return addend + -self
def __mul__(self,multiplier):
if type(multiplier) not in [Rational,int]:
return NotImplemented
if type(multiplier) == int:
multiplier = Rational(multiplier)
n = self.n * multiplier.n
d = self.d * multiplier.d
return Rational(n,d)
def __rmul__(self,multiplier):
if type(multiplier) == int:
multiplier = Rational(multiplier)
return self*multiplier
def __truediv__(self,divisor):
if type(divisor) not in [Rational,int]:
return NotImplemented
if divisor == 0:
raise ZeroDivisionError
if type(divisor) == int:
divisor = Rational(divisor)
return self*divisor.inv()
def __rtruediv__(self,dividend):
if self == 0:
raise ZeroDivisionError
if type(dividend) == int:
dividend = Rational(dividend)
return self.inv()*dividend
def __floordiv__(self,divisor):
if type(divisor) not in [Rational,int]:
return NotImplemented
if divisor == 0:
raise ZeroDivisionError
if type(divisor) == int:
divisor = Rational(divisor)
q = self*divisor.inv()
v = q.n // q.d
return v
def __mod__(self,modulus):
if modulus == 0:
raise ZeroDivisionError
if type(modulus) == int:
modulus = Rational(modulus)
if modulus > self:
return self
else:
a = self.copy()
while a >= modulus:
a -= modulus
return a
def __eq__(self,other):
if type(other) == int:
other = Rational(other)
if self.n == other.n:
if self.d == other.d:
return True
return False
def __le__(self, other):
d = self-other
if d.n >= 0:
return False
return True
def __lt__(self, other):
d = self-other
if d.n > 0:
return False
return True
def __ge__(self, other):
d = self-other
if d.n >= 0:
return True
return False
def __gt__(self, other):
d = self-other
if d.n > 0:
return True
return False
def __pow__(self,pwr):
if type(pwr) != int:
raise TypeError(f"pwr must be an integer not {type(pwr)}")
# For negative powers invert then use recursion
if pwr < 0:
return self.inv()**abs(pwr)
elif pwr == 0:
return Rational(1)
elif pwr == 1:
return self
else:
n = self.n**pwr
d = self.d**pwr
return Rational(n,d)
def __hash__(self):
return hash(f"CustomRational{self}")
def __float__(self):
return self.n/self.d
def __abs__(self):
"""Absolute value"""
return Rational(abs(self.n),self.d)
def __floor__(self):
"""Greatest smaller integer"""
return self.n // self.d
def __ceil__(self):
"""Greatest smaller integer"""
if self.d == 1:
return self.n
else:
return (self.n // self.d)+1
def _whole_part(self):
"""The whole part of the fraction"""
return self.n // self.d
def _fractional_part(self):
"""The fractional part of the fraction"""
return Rational(self.n % self.d, self.d)
def mixed_form(self):
"""Whole and fractional part"""
w = self.whole_part
f = self.fractional_part
return w,f
def _mixed_name(self):
"""Format for LaTeX as a mixed fraction"""
if self.d == 1:
return str(self.n)
else:
w,f = self.mixed_form()
return f"${w}\dfrac{{{f.n}}}{{{f.d}}}$"
def digits(self,n):
"""Return the decimal representation of the fraction out to n digits past the decimal point"""
if n == 0:
return self.whole_part
N = abs(self.n)
D = self.d
sgn = "-" if N != self.n else ""
digits = []
for ctr in range(n+1):
digits.append(N//D)
N = (N % D)*10
x1 = str(digits[0])
x2 = "".join(str(e) for e in digits[1:])
out = f"{sgn}{x1}.{x2}"
return out
def _decimal_expansion(self):
"""The complete decimal expansion of the rational, with repeating part"""
# Quickly deal with integers
if self.d == 1:
return str(self.n)
N = abs(self.n)
D = self.d
sgn = "-" if N != self.n else ""
# Keep track of digits and remainders
digits = []
rems = []
# Get digits until a remainder repeats which means we've gotten to the
# end of repeating part of the decimal (if it exists) or the end of the
# decimal expansion (if it terminates)
while N not in rems:
rems.append(N)
digits.append(N//D)
N = (N % D)*10
# Locate the start of the repeating section
nonrep = first_where(rems,N)
x1 = str(digits[0])
x2 = "".join(str(e) for e in digits[1:nonrep])
x3 = "".join(str(e) for e in digits[nonrep:])
# If the repeating section is 0 ignore it
# Otherwise put it in parentheses to indicate it is repeating
if x3 == "0":
x3 = ""
else:
x3 = f"({x3})"
out = f"{sgn}{x1}.{x2}{x3}"
return out
pretty_name = property(_pretty_name)
whole_part = property(_whole_part)
fractional_part = property(_fractional_part)
mixed_name = property(_mixed_name)
decimal_expansion = property(_decimal_expansion)
if __name__ == '__main__':
# Explanation = open(r"Explanation.txt","r")
# for i in Explanation.readlines():
# print(i)
R = Rational(5,7)
print(R**2)
print(R**-3)
print(R)
print(R.digits(10)) | [
"[email protected]"
] | |
99e03c7a5ebab7b1c9c4e3402824052c450ba006 | c705b2620119df0d60e925e55228bfbb5de3f568 | /archives/tk/tk2_quitter.py | 3cca393ee1a4141db70198a64ebaa6da511c3297 | [
"Apache-2.0"
] | permissive | mcxiaoke/python-labs | 5aa63ce90de5da56d59ca2954f6b3aeae7833559 | 61c0a1f91008ba82fc2f5a5deb19e60aec9df960 | refs/heads/master | 2021-08-05T03:47:51.844979 | 2021-07-24T11:06:13 | 2021-07-24T11:06:13 | 21,690,171 | 7 | 7 | Apache-2.0 | 2020-08-07T01:52:32 | 2014-07-10T10:20:17 | Python | UTF-8 | Python | false | false | 515 | py | #!/usr/bin/env python
# -*- coding: utf-8 -*-
# @Author: mcxiaoke
# @Date: 2015-08-09 16:10:35
from tkMessageBox import askokcancel
from Tkinter import *
class Quitter(Frame):
def __init__(self, parent=None):
Frame.__init__(self, parent)
self.pack()
widget = Button(self, text='Quit', command=self.quit)
widget.pack(side=LEFT, expand=YES, fill=BOTH)
def quit(self):
ans = askokcancel('Verify exit', 'Really quit?')
if ans:
Frame.quit(self)
| [
"[email protected]"
] | |
e4492680d141de291d7465a651e77ead9ce69654 | ce76b3ef70b885d7c354b6ddb8447d111548e0f1 | /person/feel_child_at_point/company/important_eye/say_time_with_year/same_man_and_time.py | 2e1318a493eaec887d5816876828623ba3bfeaef | [] | no_license | JingkaiTang/github-play | 9bdca4115eee94a7b5e4ae9d3d6052514729ff21 | 51b550425a91a97480714fe9bc63cb5112f6f729 | refs/heads/master | 2021-01-20T20:18:21.249162 | 2016-08-19T07:20:12 | 2016-08-19T07:20:12 | 60,834,519 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 207 | py |
#! /usr/bin/env python
def number(str_arg):
point_or_group(str_arg)
print('company_or_number')
def point_or_group(str_arg):
print(str_arg)
if __name__ == '__main__':
number('first_work')
| [
"[email protected]"
] | |
1df3fe9bfaa423b8777c33c1b73fb67cb79c9162 | dd694c300d0380df35c62f7ab7667346214ea296 | /common/python/rift/mano/tosca_translator/rwmano/syntax/mano_template.py | d263e6f01cb1302a47517e08d092ad80e30a91fa | [] | no_license | RIFTIO/SO | 9412858132db0430217a2c5c55fb4b1db89290fa | 697160573011d47f45bd0b955a291a46063d3b15 | refs/heads/RIFT.ware-4.3.3 | 2021-06-22T13:42:40.860291 | 2016-12-29T21:47:25 | 2016-12-29T21:47:25 | 75,762,640 | 1 | 1 | null | 2017-02-08T19:31:28 | 2016-12-06T19:11:20 | Python | UTF-8 | Python | false | false | 8,848 | py | #
# Licensed under the Apache License, Version 2.0 (the "License"); you may
# not use this file except in compliance with the License. You may obtain
# a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS, WITHOUT
# WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the
# License for the specific language governing permissions and limitations
# under the License.
#
# Copyright 2016 RIFT.io Inc
import uuid
import yaml
from rift.mano.tosca_translator.common.utils import _
from rift.mano.tosca_translator.common.utils import dict_convert_values_to_str
try:
import gi
gi.require_version('RwYang', '1.0')
gi.require_version('RwNsdYang', '1.0')
gi.require_version('NsdYang', '1.0')
from gi.repository import NsdYang
from gi.repository import RwNsdYang
from gi.repository import RwYang
except ImportError:
pass
except ValueError as e:
pass
class ManoTemplate(object):
'''Container for full RIFT.io MANO template.'''
YANG_NS = (NSD, VNFD) = ('nsd', 'vnfd')
OUTPUT_FIELDS = (NAME, ID, YANG, FILES) = ('name', 'id', 'yang', 'files')
def __init__(self, log):
self.log = log
self.resources = []
self.outputs = []
self.parameters = []
self.description = "Translated from TOSCA"
self.metadata = None
self.policies = []
self.groups = []
def output_to_yang(self, use_gi=False, indent=4):
self.log.debug(_('Converting translated output to yang model.'))
nsd_cat = None
nsd_id = str(uuid.uuid1())
vnfds = []
if use_gi:
try:
nsd_cat = RwNsdYang.YangData_Nsd_NsdCatalog()
nsd = nsd_cat.nsd.add()
nsd.id = nsd_id
nsd.name = self.metadata['name']
nsd.description = self.description
nsd.vendor = self.metadata['vendor']
nsd.short_name = self.metadata['name']
nsd.version = self.metadata['version']
except Exception as e:
self.log.warning(_("Unable to use YANG GI to generate "
"descriptors, falling back to alternate "
"method: {}").format(e))
self.log.exception(e)
use_gi = False
if not use_gi:
nsd = {
'id': nsd_id,
'name': self.metadata['name'],
'description': self.description,
'vendor': self.metadata['vendor'],
'short-name': self.metadata['name'],
'version': self.metadata['version'],
}
for resource in self.resources:
# Do the vlds first
if resource.type == 'vld':
resource.generate_yang_model(nsd, vnfds, use_gi=use_gi)
for resource in self.resources:
# Do the vnfds next
if resource.type == 'vnfd':
resource.generate_yang_model(nsd, vnfds, use_gi=use_gi)
for resource in self.resources:
# Do the other nodes
if resource.type != 'vnfd' and resource.type != 'vld':
resource.generate_yang_model(nsd, vnfds, use_gi=use_gi)
for group in self.groups:
group.generate_yang_model(nsd, vnfds, use_gi=use_gi)
for policy in self.policies:
policy.generate_yang_model(nsd, vnfds, use_gi=use_gi)
# Add input params to nsd
if use_gi:
for param in self.parameters:
nsd.input_parameter_xpath.append(
NsdYang.YangData_Nsd_NsdCatalog_Nsd_InputParameterXpath(
xpath=param.get_xpath(),
)
)
else:
nsd['input-parameter-xpath'] = []
for param in self.parameters:
nsd['input-parameter-xpath'].append(
{'xpath': param.get_xpath()})
# Get list of supporting files referred in template
# Returned format is {desc_id: [{type: type, name: filename}]}
# TODO (pjoseph): Currently only images and scripts are retrieved.
# Need to add support to get script names, charms, etc.
other_files = {}
for resource in self.resources:
resource.get_supporting_files(other_files)
for policy in self.policies:
policy.get_supporting_files(other_files, desc_id=nsd_id)
self.log.debug(_("List of other files: {}".format(other_files)))
# Do the final processing and convert each descriptor to yaml string
tpl = {}
# Add the NSD
if use_gi:
nsd_pf = self.get_yaml(['nsd', 'rw-nsd'], nsd_cat)
nsd_id = nsd_cat.nsd[0].id
nsd_name = nsd_cat.nsd[0].name
else:
nsd_id = nsd['id']
nsd_name = nsd['name']
# In case of non gi proecssing,
# - convert all values to string
# - enclose in a catalog dict
# - prefix all keys with nsd or vnfd
# - Convert to YAML string
nsd_pf = yaml.dump(
self.prefix_dict(
self.add_cat(dict_convert_values_to_str(nsd),
self.NSD),
self.NSD),
default_flow_style=False)
nsd_out = {
self.NAME: nsd_name,
self.ID: nsd_id,
self.YANG: nsd_pf,
}
if nsd_id in other_files:
nsd_out[self.FILES] = other_files[nsd_id]
tpl[self.NSD] = [nsd_out]
# Add the VNFDs
tpl[self.VNFD] = []
for vnfd in vnfds:
if use_gi:
vnfd_pf = self.get_yaml(['vnfd', 'rw-vnfd'], vnfd)
vnfd_id = vnfd.vnfd[0].id
vnfd_name = vnfd.vnfd[0].name
else:
vnfd_id = vnfd['id']
vnfd_name = vnfd['name']
# In case of non gi proecssing,
# - convert all values to string
# - enclose in a catalog dict
# - prefix all keys with nsd or vnfd
# - Convert to YAML string
vnfd_pf = yaml.dump(
self.prefix_dict(
self.add_cat(dict_convert_values_to_str(vnfd),
self.VNFD),
self.VNFD),
default_flow_style=False)
vnfd_out = {
self.NAME: vnfd_name,
self.ID: vnfd_id,
self.YANG: vnfd_pf,
}
if vnfd_id in other_files:
vnfd_out[self.FILES] = other_files[vnfd_id]
tpl[self.VNFD].append(vnfd_out)
self.log.debug(_("NSD: {0}").format(tpl[self.NSD]))
self.log.debug(_("VNFDs:"))
for vnfd in tpl[self.VNFD]:
self.log.debug(_("{0}").format(vnfd))
return tpl
def _get_field(self, d, pf, field='name'):
'''Get the name given for the descriptor'''
# Search within the desc for a key pf:name
key = pf+':'+field
if isinstance(d, dict):
# If it is a dict, search for pf:name
if key in d:
return d[key]
else:
for k, v in d.items():
result = self._get_field(v, pf, field)
if result:
return result
elif isinstance(d, list):
for memb in d:
result = self._get_field(memb, pf, field)
if result:
return result
def prefix_dict(self, d, pf):
'''Prefix all keys of a dict with a specific prefix:'''
if isinstance(d, dict):
dic = {}
for key in d.keys():
# Only prefix keys without any prefix
# so later we can do custom prefixing
# which will not get overwritten here
if ':' not in key:
dic[pf+':'+key] = self.prefix_dict(d[key], pf)
else:
dic[key] = self.prefix_dict(d[key], pf)
return dic
elif isinstance(d, list):
arr = []
for memb in d:
arr.append(self.prefix_dict(memb, pf))
return arr
else:
return d
def add_cat(self, desc, pf):
return {pf+'-catalog': {pf: [desc]}}
def get_yaml(self, module_list, desc):
model = RwYang.Model.create_libncx()
for module in module_list:
model.load_module(module)
return desc.to_yaml(model)
| [
"[email protected]"
] | |
07a2335bfe239f189c83292b9a6e2991c0094dae | a27d5a16210fef310569c98b589307b54248f28a | /orders/views.py | 6657d5ea28e264de6e22d2da575e427300a6bf6f | [] | no_license | yashboura303/E-commerce_Django | fd4b5088c97cc9e8a6971eecb3637700a8bd2e6c | 8cc2aeb397056566186a4379b9eece56ac99a970 | refs/heads/master | 2020-09-22T07:43:09.118289 | 2019-12-01T10:58:47 | 2019-12-01T10:58:47 | 225,108,306 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 809 | py | from django.shortcuts import render
from products.models import Products
from cart.models import Cart
from .models import Orders
from django.core import serializers
import datetime
def orderPage(request):
orders, created = Orders.objects.get_or_create(customer=request.user)
cartProducts = Cart.objects.get(customer=request.user).products.all()
orders.products.set(cartProducts)
orders.save()
if orders.date_ordered == None:
orders.date_ordered = datetime.datetime.now()
orders.save()
else:
pass
#delete cart products after buying
cart = Cart.objects.get(customer=request.user)
for product in cartProducts:
cart.products.remove(product)
return render(request,'orders/order.html',{"products":orders.products.all(),"order":orders})
| [
"[email protected]"
] | |
672384e7ee2fe00f78ba8f0cae10fd9abc21ca41 | eaa43160aeeaa3cb4c7c9f52d8ed01f9abdf85e5 | /tests/rest/test_rest_view.py | 9ff9c33ab588473769c4b72a22918c34f7426d12 | [
"MIT"
] | permissive | furious-luke/polecat | 4fd2a2f859b9a77d9d004b32bc1bf8f907fea2ba | 7be5110f76dc42b15c922c1bb7d49220e916246d | refs/heads/master | 2022-07-31T16:38:45.791129 | 2021-05-06T01:05:03 | 2021-05-06T01:05:03 | 179,440,367 | 4 | 0 | MIT | 2022-07-05T21:28:34 | 2019-04-04T07:00:55 | Python | UTF-8 | Python | false | false | 593 | py | from polecat.rest.schema import RestView
from ..models import Authenticate
def test_rest_view(db, factory):
user = factory.User.create()
view = RestView(Authenticate)
request = type('Request', (), {
'path': '/a',
'session': None,
'json': {
'email': user.email,
'password': user.password
}
})
event = type('Event', (), {
'request': request
})
response = view.resolve(request, context_value={
'event': event
})
assert response is not None
assert response.get('token') is not None
| [
"[email protected]"
] | |
1fed40586b8a86779adfa038334fea05ee538612 | edfcd96f0010ea068a4c046bdcf7067ff92d3f9b | /Robot/Selenium/4.Auto-Login.py | 7787da558eff8cdfb6356e8519c9782480f7224f | [] | no_license | afsanehshu/python-project | a99ff558f375c1f5e17ea6ffc13af9216ec4733f | 48905cfd24df6d1f48460d421ed774f19403cf53 | refs/heads/main | 2023-08-03T01:53:32.812949 | 2021-09-22T19:36:25 | 2021-09-22T19:36:25 | 409,303,454 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 793 | py | from selenium import webdriver
from selenium.webdriver.support.ui import WebDriverWait
from selenium.webdriver.support import expected_conditions as EC
from selenium.webdriver.common.by import By
from selenium.webdriver.common.keys import Keys
import os
from password import username , password
addresss = os.path.abspath(__file__)
addresss = os.path.dirname(addresss)
addresss = os.path.join(addresss , 'chromedriver.exe')
driver = webdriver.Chrome(executable_path=addresss)
driver.get('https://instagram.com')
usr = WebDriverWait(driver,5).until(EC.presence_of_element_located((By.XPATH,'//*[@id="loginForm"]/div/div[1]/div/label/input')))
usr.send_keys(username)
pas = driver.find_element_by_xpath('//*[@id="loginForm"]/div/div[2]/div/label/input')
pas.send_keys(password + Keys.ENTER)
| [
"[email protected]"
] | |
686b706d30a24d127ee3cceccc35b6174e9af4ac | d34c3204b6a985a82e17dc82f455672660536517 | /703.py | 24e6ea591581514bc7d5dc52606fb072a9c2cab2 | [] | no_license | pzqkent/LeetCode | 34fe4af305c8db4e336ab095bba11e28a4f20ea5 | 48c0bda6f3163adf1709cb440a600fe36d4fb8ec | refs/heads/master | 2020-04-14T23:10:32.898699 | 2019-02-02T23:20:51 | 2019-02-02T23:20:51 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,546 | py | class KthLargest:
def __init__(self, k, nums):
import heapq
"""
:type k: int
:type nums: List[int]
"""
self.nums = nums
self.k = k
heapq.heapify(self.nums)
while len(self.nums) > self.k:
heapq.heappop(self.nums)
def add(self, val):
"""
:type val: int
:rtype: int
这道题要用堆来做。
从小到大排序后从右往左数第k大的数字。python的heap是小根堆，如果维持一个大小为k的heap的话，那么最小的数字（第一个数字）就是最终答案。
后续的数字只需要和最小的数字self.nums[0]比较大小就好。如果当前的堆的大小小于k，则将新元素入堆；否则，当前堆的大小一定是k（因为初始化的 时候如果nums的长度大于k，已经将堆裁剪为大小为k的堆了），此时需要比较当前的val和self.num[0]的关系，如果val<self.nums[0]，则保持堆不 变；如果val大，则弹出堆中的最小值，将val入堆。
python中可以直接用heapq.heapreplace(data,val)，比先heap.pop()再heapq.push()的速度要快得多。
"""
if len(self.nums) < self.k:
heapq.heappush(self.nums,val)
elif val > self.nums[0]:
heapq.heapreplace(self.nums,val)
return self.nums[0]
# Your KthLargest object will be instantiated and called as such:
# obj = KthLargest(k, nums)
# param_1 = obj.add(val) | [
"[email protected]"
] | |
7b1557e45e765345bdce5d280c50ca47853acb31 | 99b784550a6d306147c022c8d829800b0fbb8c68 | /Part_1_Basics/Chapter_6_Dictionaries/favorite_numbers.py | 9dd21d1fa775414e45ba499c76a968d7a33e6089 | [] | no_license | apuya/python_crash_course | 116d6598f656d8fed0b4184edbce8e996cd0f564 | 0b2e8a6e9849a198cfb251706500a919d6f51fe7 | refs/heads/main | 2023-06-03T22:41:03.203889 | 2021-06-16T04:07:28 | 2021-06-16T04:07:28 | 367,812,531 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,055 | py | # Python Crash Course: A Hands-On, Project-Based Introduction To Programming
#
# Name: Mark Lester Apuya
# Date: 05/28/2021
#
# Chapter 6: Dictionaries
#
# Exercise 6.2 Favorite Numbers:
# Use a dictionary to store people’s favorite numbers. Think of five names,
# and use them as keys in your dictionary. Think of a favorite number for each
# person, and store each as a value in your dictionary. Print each person’s
# name and their favorite number. For even more fun, poll a few friends and get
# some actual data for your program.
favorite_numbers = {
'mark': 22,
'jaxon': 20,
'alex': 2,
'sam': 30,
'troy': 12
}
number = favorite_numbers['mark']
print(f"Mark's favorite number is {number}.")
number = favorite_numbers['jaxon']
print(f"Jaxon's favorite number is {number}.")
number = favorite_numbers['alex']
print(f"Alex's favorite number is {number}.")
number = favorite_numbers['sam']
print(f"Sam's favorite number is {number}.")
number = favorite_numbers['troy']
print(f"Troy's favorite number is {number}.") | [
"[email protected]"
] | |
84ca014a01bea4b0f0ae8abbc8301ce9a76311f2 | a3e6c9f54193be74f7ee7d13113723db84b4859d | /read_images.py | cb12286eee3a8103829d454df1e85949841c2add | [] | no_license | Arrotech/openCV-python | b235748ed142b02e90cac644d445a6facf637413 | f5d6f056d2210f81aee5f3359d09080fc6e81482 | refs/heads/develop | 2023-05-03T08:34:50.302587 | 2021-05-21T13:57:35 | 2021-05-21T13:57:35 | 368,883,383 | 0 | 0 | null | 2021-05-21T13:57:36 | 2021-05-19T13:43:00 | Python | UTF-8 | Python | false | false | 1,310 | py | import cv2 as cv
img = cv.imread('images/ppic.jpg')
def resizeframe(frame, scale=0.75):
"""Resisze the frame of the image."""
width = int(frame.shape[1] * scale)
height = int(frame.shape[0] * scale)
dimensions = (width, height)
return cv.resize(frame, dimensions, interpolation=cv.INTER_AREA)
resized_img = resizeframe(img)
# gray scale image
gray_img = cv.cvtColor(img, cv.COLOR_BGR2GRAY)
# blur image - remove some of the noise i.e light
blur_img = cv.GaussianBlur(img, (5,5), cv.BORDER_DEFAULT)
# edge cascade
canny_img = cv.Canny(blur_img, 125, 175)
# dilating image edges
dilated_img = cv.dilate(canny_img, (3,3), iterations=3)
# eroding dilated images to get the original edges
eroded_img = cv.erode(dilated_img, (3,3), iterations=3)
# resizing the image
resized_img2 = cv.resize(img, (500,500), interpolation=cv.INTER_CUBIC)
# cropping
cropped_img = img[50:200, 200:400]
cv.imshow('Profile Picture', img)
# cv.imshow('Resized Profile Picture', resized_img)
# cv.imshow("Gray Scale Image", gray_img)
# cv.imshow("Blurred Image", blur_img)
# cv.imshow("Canny Edge Cascade Image", canny_img)
# cv.imshow("Dilated Image", dilated_img)
# cv.imshow("Eroded Image", eroded_img)
# cv.imshow("Resized Image", resized_img2)
cv.imshow("Cropped Image", cropped_img)
cv.waitKey(0)
| [
"[email protected]"
] | |
7bd7e86211b1662c856ec8daab7c699f54e68e8b | 9decd97f9dc0a66e238af018d42a72a152e95f06 | /pyopencl/reduction.py | 68562b1127838db6fcadf7a5f233b4c5d94543e5 | [] | no_license | stephenbalaban/pyopencl | dc3a557cd9a7eeabc044f7bf1ccbc35846d61481 | 51c736a81c8cc51a089dc7a3d1628c4e4742d61d | refs/heads/master | 2020-12-25T15:51:30.928572 | 2012-11-27T21:56:56 | 2012-11-27T21:56:56 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 16,715 | py | """Computation of reductions on vectors."""
from __future__ import division
__copyright__ = "Copyright (C) 2010 Andreas Kloeckner"
__license__ = """
Permission is hereby granted, free of charge, to any person
obtaining a copy of this software and associated documentation
files (the "Software"), to deal in the Software without
restriction, including without limitation the rights to use,
copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the
Software is furnished to do so, subject to the following
conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES
OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT
HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY,
WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING
FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR
OTHER DEALINGS IN THE SOFTWARE.
Based on code/ideas by Mark Harris <[email protected]>.
None of the original source code remains.
"""
import pyopencl as cl
from pyopencl.tools import (
context_dependent_memoize,
dtype_to_ctype)
import numpy as np
import pyopencl._mymako as mako
KERNEL = """//CL//
#define GROUP_SIZE ${group_size}
#define READ_AND_MAP(i) (${map_expr})
#define REDUCE(a, b) (${reduce_expr})
% if double_support:
#pragma OPENCL EXTENSION cl_khr_fp64: enable
#define PYOPENCL_DEFINE_CDOUBLE
% elif amd_double_support:
#pragma OPENCL EXTENSION cl_amd_fp64: enable
#define PYOPENCL_DEFINE_CDOUBLE
% endif
#include <pyopencl-complex.h>
${preamble}
typedef ${out_type} out_type;
__kernel void ${name}(
__global out_type *out, ${arguments},
unsigned int seq_count, unsigned int n)
{
__local out_type ldata[GROUP_SIZE];
unsigned int lid = get_local_id(0);
unsigned int i = get_group_id(0)*GROUP_SIZE*seq_count + lid;
out_type acc = ${neutral};
for (unsigned s = 0; s < seq_count; ++s)
{
if (i >= n)
break;
acc = REDUCE(acc, READ_AND_MAP(i));
i += GROUP_SIZE;
}
ldata[lid] = acc;
<%
cur_size = group_size
%>
% while cur_size > no_sync_size:
barrier(CLK_LOCAL_MEM_FENCE);
<%
new_size = cur_size // 2
assert new_size * 2 == cur_size
%>
if (lid < ${new_size})
{
ldata[lid] = REDUCE(
ldata[lid],
ldata[lid + ${new_size}]);
}
<% cur_size = new_size %>
% endwhile
% if cur_size > 1:
## we need to synchronize one last time for entry into the
## no-sync region.
barrier(CLK_LOCAL_MEM_FENCE);
if (lid < ${no_sync_size})
{
__local volatile out_type *lvdata = ldata;
% while cur_size > 1:
<%
new_size = cur_size // 2
assert new_size * 2 == cur_size
%>
lvdata[lid] = REDUCE(
lvdata[lid],
lvdata[lid + ${new_size}]);
<% cur_size = new_size %>
% endwhile
}
% endif
if (lid == 0) out[get_group_id(0)] = ldata[0];
}
"""
def get_reduction_source(
ctx, out_type, out_type_size,
neutral, reduce_expr, map_expr, arguments,
name="reduce_kernel", preamble="",
device=None, max_group_size=None):
if device is not None:
devices = [device]
else:
devices = ctx.devices
# {{{ compute group size
def get_dev_group_size(device):
# dirty fix for the RV770 boards
max_work_group_size = device.max_work_group_size
if "RV770" in device.name:
max_work_group_size = 64
# compute lmem limit
from pytools import div_ceil
lmem_wg_size = div_ceil(max_work_group_size, out_type_size)
result = min(max_work_group_size, lmem_wg_size)
# round down to power of 2
from pyopencl.tools import bitlog2
return 2**bitlog2(result)
group_size = min(get_dev_group_size(dev) for dev in devices)
if max_group_size is not None:
group_size = min(max_group_size, group_size)
# }}}
# {{{ compute synchronization-less group size
def get_dev_no_sync_size(device):
from pyopencl.characterize import get_simd_group_size
result = get_simd_group_size(device, out_type_size)
if result is None:
from warnings import warn
warn("Reduction might be unnecessarily slow: "
"can't query SIMD group size")
return 1
return result
no_sync_size = min(get_dev_no_sync_size(dev) for dev in devices)
# }}}
from mako.template import Template
from pytools import all
from pyopencl.characterize import has_double_support, has_amd_double_support
src = str(Template(KERNEL).render(
out_type=out_type,
arguments=arguments,
group_size=group_size,
no_sync_size=no_sync_size,
neutral=neutral,
reduce_expr=reduce_expr,
map_expr=map_expr,
name=name,
preamble=preamble,
double_support=all(
has_double_support(dev) for dev in devices),
amd_double_support=all(
has_amd_double_support(dev) for dev in devices)
))
from pytools import Record
class ReductionInfo(Record):
pass
return ReductionInfo(
context=ctx,
source=src,
group_size=group_size)
def get_reduction_kernel(stage,
ctx, out_type, out_type_size,
neutral, reduce_expr, map_expr=None, arguments=None,
name="reduce_kernel", preamble="",
device=None, options=[], max_group_size=None):
if map_expr is None:
if stage == 2:
map_expr = "pyopencl_reduction_inp[i]"
else:
map_expr = "in[i]"
if stage == 2:
in_arg = "__global const %s *pyopencl_reduction_inp" % out_type
if arguments:
arguments = in_arg + ", " + arguments
else:
arguments = in_arg
inf = get_reduction_source(
ctx, out_type, out_type_size,
neutral, reduce_expr, map_expr, arguments,
name, preamble, device, max_group_size)
inf.program = cl.Program(ctx, inf.source)
inf.program.build(options)
inf.kernel = getattr(inf.program, name)
from pyopencl.tools import parse_c_arg, ScalarArg
inf.arg_types = [parse_c_arg(arg) for arg in arguments.split(",")]
scalar_arg_dtypes = [None]
for arg_type in inf.arg_types:
if isinstance(arg_type, ScalarArg):
scalar_arg_dtypes.append(arg_type.dtype)
else:
scalar_arg_dtypes.append(None)
scalar_arg_dtypes.extend([np.uint32]*2)
inf.kernel.set_scalar_arg_dtypes(scalar_arg_dtypes)
return inf
class ReductionKernel:
def __init__(self, ctx, dtype_out,
neutral, reduce_expr, map_expr=None, arguments=None,
name="reduce_kernel", options=[], preamble=""):
dtype_out = self.dtype_out = np.dtype(dtype_out)
max_group_size = None
trip_count = 0
while True:
self.stage_1_inf = get_reduction_kernel(1, ctx,
dtype_to_ctype(dtype_out), dtype_out.itemsize,
neutral, reduce_expr, map_expr, arguments,
name=name+"_stage1", options=options, preamble=preamble,
max_group_size=max_group_size)
kernel_max_wg_size = self.stage_1_inf.kernel.get_work_group_info(
cl.kernel_work_group_info.WORK_GROUP_SIZE,
ctx.devices[0])
if self.stage_1_inf.group_size <= kernel_max_wg_size:
break
else:
max_group_size = kernel_max_wg_size
trip_count += 1
assert trip_count <= 2
self.stage_2_inf = get_reduction_kernel(2, ctx,
dtype_to_ctype(dtype_out), dtype_out.itemsize,
neutral, reduce_expr, arguments=arguments,
name=name+"_stage2", options=options, preamble=preamble,
max_group_size=max_group_size)
from pytools import any
from pyopencl.tools import VectorArg
assert any(
isinstance(arg_tp, VectorArg)
for arg_tp in self.stage_1_inf.arg_types), \
"ReductionKernel can only be used with functions that have at least one " \
"vector argument"
def __call__(self, *args, **kwargs):
MAX_GROUP_COUNT = 1024
SMALL_SEQ_COUNT = 4
from pyopencl.array import empty
stage_inf = self.stage_1_inf
queue = kwargs.pop("queue", None)
if kwargs:
raise TypeError("invalid keyword argument to reduction kernel")
stage1_args = args
while True:
invocation_args = []
vectors = []
from pyopencl.tools import VectorArg
for arg, arg_tp in zip(args, stage_inf.arg_types):
if isinstance(arg_tp, VectorArg):
if not arg.flags.forc:
raise RuntimeError("ReductionKernel cannot "
"deal with non-contiguous arrays")
vectors.append(arg)
invocation_args.append(arg.data)
else:
invocation_args.append(arg)
repr_vec = vectors[0]
sz = repr_vec.size
if queue is not None:
use_queue = queue
else:
use_queue = repr_vec.queue
if sz <= stage_inf.group_size*SMALL_SEQ_COUNT*MAX_GROUP_COUNT:
total_group_size = SMALL_SEQ_COUNT*stage_inf.group_size
group_count = (sz + total_group_size - 1) // total_group_size
seq_count = SMALL_SEQ_COUNT
else:
group_count = MAX_GROUP_COUNT
macrogroup_size = group_count*stage_inf.group_size
seq_count = (sz + macrogroup_size - 1) // macrogroup_size
if group_count == 1:
result = empty(use_queue,
(), self.dtype_out,
allocator=repr_vec.allocator)
else:
result = empty(use_queue,
(group_count,), self.dtype_out,
allocator=repr_vec.allocator)
stage_inf.kernel(
use_queue,
(group_count*stage_inf.group_size,),
(stage_inf.group_size,),
*([result.data]+invocation_args+[seq_count, sz]))
if group_count == 1:
return result
else:
stage_inf = self.stage_2_inf
args = (result,) + stage1_args
@context_dependent_memoize
def get_sum_kernel(ctx, dtype_out, dtype_in):
if dtype_out is None:
dtype_out = dtype_in
return ReductionKernel(ctx, dtype_out, "0", "a+b",
arguments="__global const %(tp)s *in"
% {"tp": dtype_to_ctype(dtype_in)})
@context_dependent_memoize
def get_dot_kernel(ctx, dtype_out, dtype_a=None, dtype_b=None):
if dtype_b is None:
if dtype_a is None:
dtype_b = dtype_out
else:
dtype_b = dtype_a
if dtype_out is None:
from pyopencl.compyte.array import get_common_dtype
from pyopencl.characterize import has_double_support
dtype_out = get_common_dtype(
dtype_a.type(0), dtype_b.type(0), has_double_support(ctx.devices[0]))
a_real_dtype = dtype_a.type(0).real.dtype
b_real_dtype = dtype_b.type(0).real.dtype
out_real_dtype = dtype_out.type(0).real.dtype
a_is_complex = dtype_a.kind == "c"
b_is_complex = dtype_b.kind == "c"
out_is_complex = dtype_out.kind == "c"
from pyopencl.elementwise import complex_dtype_to_name
if a_is_complex and b_is_complex:
a = "a[i]"
b = "b[i]"
if dtype_a != dtype_out:
a = "%s_cast(%s)" % (complex_dtype_to_name(dtype_out), a)
if dtype_b != dtype_out:
b = "%s_cast(%s)" % (complex_dtype_to_name(dtype_out), b)
map_expr = "%s_mul(%s, %s)" % (
complex_dtype_to_name(dtype_out), a, b)
else:
a = "a[i]"
b = "b[i]"
if out_is_complex:
if a_is_complex and dtype_a != dtype_out:
a = "%s_cast(%s)" % (complex_dtype_to_name(dtype_out), a)
if b_is_complex and dtype_b != dtype_out:
b = "%s_cast(%s)" % (complex_dtype_to_name(dtype_out), b)
if not a_is_complex and a_real_dtype != out_real_dtype:
a = "(%s) (%s)" % (dtype_to_ctype(out_real_dtype), a)
if not b_is_complex and b_real_dtype != out_real_dtype:
b = "(%s) (%s)" % (dtype_to_ctype(out_real_dtype), b)
map_expr = "%s*%s" % (a, b)
return ReductionKernel(ctx, dtype_out, neutral="0",
reduce_expr="a+b", map_expr=map_expr,
arguments=
"__global const %(tp_a)s *a, "
"__global const %(tp_b)s *b" % {
"tp_a": dtype_to_ctype(dtype_a),
"tp_b": dtype_to_ctype(dtype_b),
})
@context_dependent_memoize
def get_subset_dot_kernel(ctx, dtype_out, dtype_subset, dtype_a=None, dtype_b=None):
if dtype_out is None:
dtype_out = dtype_a
if dtype_b is None:
if dtype_a is None:
dtype_b = dtype_out
else:
dtype_b = dtype_a
if dtype_a is None:
dtype_a = dtype_out
# important: lookup_tbl must be first--it controls the length
return ReductionKernel(ctx, dtype_out, neutral="0",
reduce_expr="a+b", map_expr="a[lookup_tbl[i]]*b[lookup_tbl[i]]",
arguments=
"__global const %(tp_lut)s *lookup_tbl, "
"__global const %(tp_a)s *a, "
"__global const %(tp_b)s *b" % {
"tp_lut": dtype_to_ctype(dtype_subset),
"tp_a": dtype_to_ctype(dtype_a),
"tp_b": dtype_to_ctype(dtype_b),
})
def get_minmax_neutral(what, dtype):
dtype = np.dtype(dtype)
if issubclass(dtype.type, np.inexact):
if what == "min":
return "MY_INFINITY"
elif what == "max":
return "-MY_INFINITY"
else:
raise ValueError("what is not min or max.")
else:
if what == "min":
return str(np.iinfo(dtype).max)
elif what == "max":
return str(np.iinfo(dtype).min)
else:
raise ValueError("what is not min or max.")
@context_dependent_memoize
def get_minmax_kernel(ctx, what, dtype):
if dtype.kind == "f":
reduce_expr = "f%s(a,b)" % what
elif dtype.kind in "iu":
reduce_expr = "%s(a,b)" % what
else:
raise TypeError("unsupported dtype specified")
return ReductionKernel(ctx, dtype,
neutral=get_minmax_neutral(what, dtype),
reduce_expr="%(reduce_expr)s" % {"reduce_expr": reduce_expr},
arguments="__global const %(tp)s *in" % {
"tp": dtype_to_ctype(dtype),
}, preamble="#define MY_INFINITY (1./0)")
@context_dependent_memoize
def get_subset_minmax_kernel(ctx, what, dtype, dtype_subset):
if dtype.kind == "f":
reduce_expr = "f%s(a,b)" % what
elif dtype.kind in "iu":
reduce_expr = "%s(a,b)" % what
else:
raise TypeError("unsupported dtype specified")
return ReductionKernel(ctx, dtype,
neutral=get_minmax_neutral(what, dtype),
reduce_expr="%(reduce_expr)s" % {"reduce_expr": reduce_expr},
map_expr="in[lookup_tbl[i]]",
arguments=
"__global const %(tp_lut)s *lookup_tbl, "
"__global const %(tp)s *in" % {
"tp": dtype_to_ctype(dtype),
"tp_lut": dtype_to_ctype(dtype_subset),
}, preamble="#define MY_INFINITY (1./0)")
# vim: filetype=pyopencl:fdm=marker
| [
"[email protected]"
] | |
678b9e9f0f6989327d360b2083e0bf4434e0023d | 0e1e643e864bcb96cf06f14f4cb559b034e114d0 | /Exps_7_v3/doc3d/W_w_Mgt_to_Cx_Cy_focus_Z_ok/Sob_k25_s001_EroM/pyr_Tcrop256_pad20_jit15/pyr_6s/L5/step10_a.py | fab778e5987a75c6e7f5c3d29a6df640d3dca9e0 | [] | no_license | KongBOy/kong_model2 | 33a94a9d2be5b0f28f9d479b3744e1d0e0ebd307 | 1af20b168ffccf0d5293a393a40a9fa9519410b2 | refs/heads/master | 2022-10-14T03:09:22.543998 | 2022-10-06T11:33:42 | 2022-10-06T11:33:42 | 242,080,692 | 3 | 0 | null | null | null | null | UTF-8 | Python | false | false | 256,859 | py | #############################################################################################################################################################################################################
#############################################################################################################################################################################################################
### 把 kong_model2 加入 sys.path
import os
code_exe_path = os.path.realpath(__file__) ### 目前執行 step10_b.py 的 path
code_exe_path_element = code_exe_path.split("\\") ### 把 path 切分 等等 要找出 kong_model 在第幾層
code_dir = "\\".join(code_exe_path_element[:-1])
kong_layer = code_exe_path_element.index("kong_model2") ### 找出 kong_model2 在第幾層
kong_model2_dir = "\\".join(code_exe_path_element[:kong_layer + 1]) ### 定位出 kong_model2 的 dir
import sys ### 把 kong_model2 加入 sys.path
sys.path.append(kong_model2_dir)
sys.path.append(code_dir)
# print(__file__.split("\\")[-1])
# print(" code_exe_path:", code_exe_path)
# print(" code_exe_path_element:", code_exe_path_element)
# print(" code_dir:", code_dir)
# print(" kong_layer:", kong_layer)
# print(" kong_model2_dir:", kong_model2_dir)
#############################################################################################################################################################################################################
kong_to_py_layer = len(code_exe_path_element) - 1 - kong_layer ### 中間 -1 是為了長度轉index
# print(" kong_to_py_layer:", kong_to_py_layer)
if (kong_to_py_layer == 0): template_dir = ""
elif(kong_to_py_layer == 2): template_dir = code_exe_path_element[kong_layer + 1][0:] ### [7:] 是為了去掉 step1x_， 後來覺得好像改有意義的名字不去掉也行所以 改 0
elif(kong_to_py_layer == 3): template_dir = code_exe_path_element[kong_layer + 1][0:] + "/" + code_exe_path_element[kong_layer + 2][0:] ### [5:] 是為了去掉 mask_ ，前面的 mask_ 是為了python 的 module 不能 數字開頭， 隨便加的這樣子， 後來覺得 自動排的順序也可以接受， 所以 改0
elif(kong_to_py_layer > 3): template_dir = code_exe_path_element[kong_layer + 1][0:] + "/" + code_exe_path_element[kong_layer + 2][0:] + "/" + "/".join(code_exe_path_element[kong_layer + 3: -1])
# print(" template_dir:", template_dir) ### 舉例： template_dir: 7_mask_unet/5_os_book_and_paper_have_dtd_hdr_mix_bg_tv_s04_mae
#############################################################################################################################################################################################################
exp_dir = template_dir
#############################################################################################################################################################################################################
from step06_a_datas_obj import *
from step09_6side_L5 import *
from step10_a2_loss_info_obj import *
from step10_b2_exp_builder import Exp_builder
rm_paths = [path for path in sys.path if code_dir in path]
for rm_path in rm_paths: sys.path.remove(rm_path)
rm_moduless = [module for module in sys.modules if "step09" in module]
for rm_module in rm_moduless: del sys.modules[rm_module]
#############################################################################################################################################################################################################
'''
exp_dir 是 決定 result_dir 的 "上一層"資料夾 名字喔！ exp_dir要巢狀也沒問題～
比如：exp_dir = "6_mask_unet/自己命的名字"，那 result_dir 就都在：
6_mask_unet/自己命的名字/result_a
6_mask_unet/自己命的名字/result_b
6_mask_unet/自己命的名字/...
'''
use_db_obj = type8_blender_kong_doc3d_in_W_and_I_gt_F
use_loss_obj = [G_sobel_k25_erose_M_loss_info_builder.set_loss_target("UNet_Cx").copy(), G_sobel_k25_erose_M_loss_info_builder.set_loss_target("UNet_Cy").copy()] ### z, y, x 順序是看 step07_b_0b_Multi_UNet 來對應的喔
#############################################################
### 為了resul_analyze畫空白的圖，建一個empty的 Exp_builder
empty = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_1__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_1__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="為了resul_analyze畫空白的圖，建一個empty的 Exp_builder")
#############################################################
###################
############# 1s1
######### 2s1
##### 3s1
### 4s1
ch032_1side_1__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_1__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_1__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
###################
############# 1s2
######### 2s1
##### 3s1
### 4s1
ch032_1side_2__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s1
##### 3s1
### 4s1
ch032_1side_2__2side_2__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_2__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_2__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_2__2side_2__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_2__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_2__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_2__2side_2__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_2__2side_2__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_2__2side_2__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_2__2side_2__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
###################
############# 1s3
######### 2s1
##### 3s1
### 4s1
ch032_1side_3__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s2
##### 3s1
### 4s1
ch032_1side_3__2side_2__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_2__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_2__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_3__2side_2__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_2__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_2__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_3__2side_2__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_2__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_2__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_2__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s3
##### 3s1
### 4s1
ch032_1side_3__2side_3__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_3__2side_3__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_3__2side_3__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_3__2side_3__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_3__2side_3__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_3__2side_3__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_3__2side_3__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_3__2side_3__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
###################
############# 1s4
######### 2s1
##### 3s1
### 4s1
ch032_1side_4__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s2
##### 3s1
### 4s1
ch032_1side_4__2side_2__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_2__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_2__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_4__2side_2__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_2__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_2__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_2__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_2__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_2__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_2__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s3
##### 3s1
### 4s1
ch032_1side_4__2side_3__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_4__2side_3__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_3__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_4__2side_3__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_3__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_4__2side_3__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_3__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_3__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s4
##### 3s1
### 4s1
ch032_1side_4__2side_4__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_4__2side_4__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_4__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_4__2side_4__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_4__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_4__2side_4__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_4__2side_4__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_4__2side_4__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_4__2side_4__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_4__2side_4__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_4__2side_4__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_4__2side_4__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
###################
############# 1s5
######### 2s1
##### 3s1
### 4s1
ch032_1side_5__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s2
##### 3s1
### 4s1
ch032_1side_5__2side_2__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_2__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_2__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_5__2side_2__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_2__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_2__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_2__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_2__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_2__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_2__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s3
##### 3s1
### 4s1
ch032_1side_5__2side_3__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_5__2side_3__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_3__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_5__2side_3__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_3__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_3__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_3__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_3__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s4
##### 3s1
### 4s1
ch032_1side_5__2side_4__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_5__2side_4__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_4__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_5__2side_4__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_4__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_4__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_5__2side_4__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_4__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_4__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_5__2side_4__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_4__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_4__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s5
##### 3s1
### 4s1
ch032_1side_5__2side_5__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_5__2side_5__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_5__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_5__2side_5__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_5__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_5__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_5__2side_5__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_5__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_5__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_5__2side_5__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s5
### 4s1
ch032_1side_5__2side_5__3side_5_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_5__2side_5__3side_5_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_5__2side_5__3side_5_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_5__2side_5__3side_5_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s5
ch032_1side_5__2side_5__3side_5_4side_5_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s5_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s5_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s5_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s5_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_5__2side_5__3side_5_4side_5_5s5_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_5__2side_5__3side_5_4side_5_5s5_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
###################
############# 1s6
######### 2s1
##### 3s1
### 4s1
ch032_1side_6__2side_1__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_1__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_1__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s2
##### 3s1
### 4s1
ch032_1side_6__2side_2__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_2__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_2__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_6__2side_2__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_2__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_2__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_2__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_2__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_2__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_2__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s3
##### 3s1
### 4s1
ch032_1side_6__2side_3__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_6__2side_3__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_3__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_6__2side_3__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_3__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_3__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_3__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_3__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s4
##### 3s1
### 4s1
ch032_1side_6__2side_4__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_6__2side_4__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_4__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_6__2side_4__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_4__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_4__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_6__2side_4__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_4__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_4__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_4__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_4__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_4__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s5
##### 3s1
### 4s1
ch032_1side_6__2side_5__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_6__2side_5__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_5__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_6__2side_5__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_5__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_5__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_6__2side_5__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_5__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_5__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_5__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s5
### 4s1
ch032_1side_6__2side_5__3side_5_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_5__3side_5_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_5__3side_5_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_5__3side_5_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s5
ch032_1side_6__2side_5__3side_5_4side_5_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s5_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s5_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s5_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s5_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_5__3side_5_4side_5_5s5_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_5__3side_5_4side_5_5s5_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
######### 2s6
##### 3s1
### 4s1
ch032_1side_6__2side_6__3side_1_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_1_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_1_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s2
### 4s1
ch032_1side_6__2side_6__3side_2_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_2_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_2_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_6__3side_2_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_2_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_2_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_2_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s3
### 4s1
ch032_1side_6__2side_6__3side_3_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_6__3side_3_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_6__3side_3_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_3_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_3_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s4
### 4s1
ch032_1side_6__2side_6__3side_4_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_6__3side_4_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_6__3side_4_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_6__3side_4_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_4_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_4_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s5
### 4s1
ch032_1side_6__2side_6__3side_5_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_6__3side_5_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_6__3side_5_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_6__3side_5_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s5
ch032_1side_6__2side_6__3side_5_4side_5_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s5_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s5_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s5_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s5_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_5_4side_5_5s5_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_5_4side_5_5s5_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
##### 3s6
### 4s1
ch032_1side_6__2side_6__3side_6_4side_1_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_1_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_1_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s2
ch032_1side_6__2side_6__3side_6_4side_2_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_2_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_2_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_2_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s3
ch032_1side_6__2side_6__3side_6_4side_3_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_3_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_3_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_3_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_3_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_3_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_3_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s4
ch032_1side_6__2side_6__3side_6_4side_4_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_4_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_4_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s5
ch032_1side_6__2side_6__3side_6_4side_5_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s5_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s5_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s5_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s5_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_5_5s5_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_5_5s5_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
### 4s6
ch032_1side_6__2side_6__3side_6_4side_6_5s1_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s1_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s1_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s2_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s2_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s2_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s2_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s2_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s2_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s3_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s3_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s3_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s3_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s4_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s4_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s4_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s4_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s4_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s5_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s5_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s5_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s5_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s5_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s5_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s1 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s1, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s1.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s2 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s2, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s2.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s3 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s3, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s3.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s4 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s4, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s4.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s5 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s5, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s5.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
ch032_1side_6__2side_6__3side_6_4side_6_5s6_6s6 = Exp_builder().set_basic("train", use_db_obj, ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s6, use_loss_obj, exp_dir=exp_dir, code_exe_path=code_exe_path, describe_end=ch032_pyramid_1side_6__2side_6__3side_6_4side_6_5s6_6s6.kong_model.model_describe) .set_train_args(epochs= 1) .set_train_iter_args(it_see_fq=900, it_save_fq=900 * 2, it_down_step="half", it_down_fq=900).set_train_in_gt_use_range(use_in_range=Range(0, 1), use_gt_range=Range(0, 1)).set_result_name(result_name="")
#############################################################
if(__name__ == "__main__"):
print("build exps cost time:", time.time() - start_time)
if len(sys.argv) < 2:
############################################################################################################
### 直接按 F5 或打 python step10_b1_exp_obj_load_and_train_and_test.py，後面沒有接東西喔！才不會跑到下面給 step10_b_subprocss.py 用的程式碼~~~
ch032_1side_1__2side_1__3side_1_4side_1_5s1_6s1.build().run()
# print('no argument')
sys.exit()
### 以下是給 step10_b_subprocess.py 用的，相當於cmd打 python step10_b1_exp_obj_load_and_train_and_test.py 某個exp.build().run()
eval(sys.argv[1])
| [
"[email protected]"
] | |
5d51135e8bbed8efdb6c26ff33adf8488a8a911f | 6c543074f1d764af9701e5b55db9ab0220c1df93 | /prictice/mzitu_02.py | b9fa94a5ea6dc727418b8ebc4bc253f4cf809349 | [] | no_license | allenlgy/Django-project | 127e984e13f71d20e01df68ad42d00b977ac0105 | 9c4b9e6c67481a5f3cef58ea47e9fd62058036d8 | refs/heads/master | 2020-06-23T01:03:03.170674 | 2019-09-04T06:11:40 | 2019-09-04T06:11:40 | 198,453,709 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 3,039 | py | import requests
import os
import time
import threading
from bs4 import BeautifulSoup
# 下载界面的函数，利用requests就可以实现
def download_page(url):
'''
用于下载页面
:param url:
:return:
'''
headers = {"User-Agent":"Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:61.0) Gecko/20100101 Firefox/61.0"}
r = requests.get(url, headers=headers)
r.encoding = 'gb2312'
return r.text
# 获取图一所有套图列表，函数 link 表示套图的链接，text 表示套图的名字
def get_pic_list(html):
'''
获取每个页面的套图列表，之后循环用gei_pic函数获取图片
:param html:
:return:
'''
soup = BeautifulSoup(html,'html.parser')
pic_list = soup.find_all('li',class_='wp-item')
for i in pic_list:
a_tag = i.find('h3',class_='tit').find('a')
link = a_tag.get('href') # 套图链接
text = a_tag.get_text() #套图名字
get_pic(link,text)
# 传入上一步获取到的套图链接及套图名字，获取魅族套图里面的图片并保存
def get_pic(link,text):
'''
获取当前页面的图片，保存
:param link:
:param text:
:return:
'''
html = download_page(link) #下载界面
soup = BeautifulSoup(html,'html.parser')
pic_list = soup.find('div',id='picture'.find_all('img')) # 找到界面所有图片
headers = {"User-Agent":"Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:61.0) Geck0/20100101 Firefox/61.0"}
create_dir('pic/{}'.format(text))
for i in pic_list:
pic_link = i.get('src') # 拿到图片的具体 url
r= requests.get(pic_link,headers=headers) # 下载图片，之后保存图片
with open('pic/{}/{}'.format(text,link.split('/')[-1]),'wb') as f:
f.write(r.content)
time.sleep(1) # 休息一下，避免被封
def create_dir(name):
if not os.path.exests(name):
os.makedirs(name)
def execute(url):
page_html = download_page(url)
get_pic_list(page_html)
def main():
create_dir('pic')
queue = [i for i in range(1, 20)] # 构造 url 链接页码
threads = []
while len(queue) > 0:
for thread in threads:
if not thread.is_alive():
threads.remove(thread)
while len(threads) < 5 and len(queue) >0: # 最大线程设置5
cur_page = queue.pop(0)
url = 'http://mzitu.com/a/more_{}.html'.format(cur_page)
thread = threading.Thread(target=execute,args=(url,))
thread.setDaemon(True)
thread.start()
print('{}正在下载{}页'.format(threading.current_thread().name, cur_page))
threads.append(thread)
if __name__== '__main__':
main() | [
"[email protected]"
] | |
90621bfe3417cf74b3345694d425576bd0b9d17d | ccf94dcb6b1500fcbbd56964ae8c4832a496b8b3 | /python/baiduads-sdk-auto/test/test_word_count_dto.py | 14b46c84f966ab2bbefc1ec77a192bda0e3e6bcf | [
"Apache-2.0"
] | permissive | baidu/baiduads-sdk | 24c36b5cf3da9362ec5c8ecd417ff280421198ff | 176363de5e8a4e98aaca039e4300703c3964c1c7 | refs/heads/main | 2023-06-08T15:40:24.787863 | 2023-05-20T03:40:51 | 2023-05-20T03:40:51 | 446,718,177 | 16 | 11 | Apache-2.0 | 2023-06-02T05:19:40 | 2022-01-11T07:23:17 | Python | UTF-8 | Python | false | false | 649 | py | """
dev2 api schema
'dev2.baidu.com' api schema # noqa: E501
Generated by: https://openapi-generator.tech
"""
import sys
import unittest
import baiduads
from baiduads.materialproduct.model.word_count_dto import WordCountDto
class TestWordCountDto(unittest.TestCase):
"""WordCountDto unit test stubs"""
def setUp(self):
pass
def tearDown(self):
pass
def testWordCountDto(self):
"""Test WordCountDto"""
# FIXME: construct object with mandatory attributes with example values
# model = WordCountDto() # noqa: E501
pass
if __name__ == '__main__':
unittest.main()
| [
"[email protected]"
] | |
b90c9db4fa9a96c8814e0d5a68e38eb672171701 | 6fa7f99d3d3d9b177ef01ebf9a9da4982813b7d4 | /YjwJ6BfujKtmuTMqW_6.py | 1eb141206c4290eab340178e76daf41c58d99aec | [] | no_license | daniel-reich/ubiquitous-fiesta | 26e80f0082f8589e51d359ce7953117a3da7d38c | 9af2700dbe59284f5697e612491499841a6c126f | refs/heads/master | 2023-04-05T06:40:37.328213 | 2021-04-06T20:17:44 | 2021-04-06T20:17:44 | 355,318,759 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 372 | py |
def dice_game(scores):
players = ['p1', 'p2', 'p3', 'p4']
scores = scores[::-1]
while len(players) > 1:
turn = []
for player in players:
turn.append({'s':scores.pop(), 'p':player})
turn.sort(key = lambda t:(sum(t['s']), t['s'][0]))
last1, last2 = turn[:2]
if last1['s'] != last2['s']:
players.remove(last1['p'])
return players[0]
| [
"[email protected]"
] | |
a31a8ad29aa2aa3317182191c87dcbb5489883c1 | cb1fb3bf87b3f7006b564a0f2acd2d68e5d5ffaa | /pyram/misc/vispy_examples/flow_lines.py | a802abddd2174e35e85825563cb952f32bd1a21d | [
"MIT"
] | permissive | Hoseung/pyRamAn | 2778f8b12ca966e7586ebf077a964aecd1654223 | f9386fa5a9f045f98590039988d3cd50bc488dc2 | refs/heads/master | 2021-06-22T18:35:06.478492 | 2021-06-05T03:26:31 | 2021-06-05T03:26:31 | 227,741,934 | 1 | 1 | MIT | 2020-03-04T12:39:06 | 2019-12-13T02:49:30 | Jupyter Notebook | UTF-8 | Python | false | false | 6,690 | py | # -*- coding: utf-8 -*-
# -----------------------------------------------------------------------------
# Copyright (c) 2015, Vispy Development Team. All Rights Reserved.
# Distributed under the (new) BSD License. See LICENSE.txt for more info.
# -----------------------------------------------------------------------------
"""
Show vector field flow
"""
from __future__ import division
from vispy import app, scene, visuals, gloo
from vispy.util import ptime
import numpy as np
class VectorFieldVisual(visuals.Visual):
vertex = """
uniform sampler2D field;
attribute vec2 index;
uniform vec2 shape;
uniform vec2 field_shape;
uniform float spacing;
varying float dist; // distance along path for this vertex
varying vec2 ij;
uniform sampler2D offset;
uniform float seg_len;
uniform int n_iter; // iterations to integrate along field per vertex
uniform vec2 attractor;
varying vec4 base_color;
uniform sampler2D color;
void main() {
// distance along one line
dist = index.y * seg_len;
vec2 local;
ij = vec2(mod(index.x, shape.x), floor(index.x / shape.x));
// *off* is a random offset to the starting location, which prevents
// the appearance of combs in the field
vec2 off = texture2D(offset, ij / shape).xy - 0.5;
local = spacing * (ij + off);
vec2 uv;
vec2 dir;
vec2 da;
for( int i=0; i<index.y; i+=1 ) {
for ( int j=0; j<n_iter; j += 1 ) {
uv = local / field_shape;
dir = texture2D(field, uv).xy;
// add influence of variable attractor (mouse)
da = attractor - local;
float al = 0.1 * length(da);
da /= 0.5 * (1 + al*al);
dir += da;
// maybe pick a more accurate integration method?
local += seg_len * dir / n_iter;
}
}
base_color = texture2D(color, uv);
gl_Position = $transform(vec4(local, 0, 1));
}
"""
fragment = """
uniform float time;
uniform float speed;
varying float dist;
varying vec2 ij;
uniform sampler2D offset;
uniform vec2 shape;
uniform float nseg;
uniform float seg_len;
varying vec4 base_color;
void main() {
float totlen = nseg * seg_len;
float phase = texture2D(offset, ij / shape).b;
float alpha;
// vary alpha along the length of the line to give the appearance of
// motion
alpha = mod((dist / totlen) + phase - time * speed, 1);
// add a cosine envelope to fade in and out smoothly at the ends
alpha *= (1 - cos(2 * 3.141592 * dist / totlen)) * 0.5;
gl_FragColor = vec4(base_color.rgb, base_color.a * alpha);
}
"""
def __init__(self, field, spacing=10, segments=3, seg_len=0.5,
color=(1, 1, 1, 0.3)):
self._time = 0.0
self._last_time = ptime.time()
rows = field.shape[0] / spacing
cols = field.shape[1] / spacing
index = np.empty((rows * cols, segments * 2, 2), dtype=np.float32)
# encodes starting position within vector field
index[:, :, 0] = np.arange(rows * cols)[:, np.newaxis]
# encodes distance along length of line
index[:, ::2, 1] = np.arange(segments)[np.newaxis, :]
index[:, 1::2, 1] = np.arange(segments)[np.newaxis, :] + 1
self._index = gloo.VertexBuffer(index)
if not isinstance(color, np.ndarray):
color = np.array([[list(color)]], dtype='float32')
self._color = gloo.Texture2D(color)
offset = np.random.uniform(256, size=(rows, cols, 3)).astype(np.ubyte)
self._offset = gloo.Texture2D(offset, format='rgb')
self._field = gloo.Texture2D(field, format='rg',
internalformat='rg32f',
interpolation='linear')
self._field_shape = field.shape[:2]
visuals.Visual.__init__(self, vcode=self.vertex, fcode=self.fragment)
self.timer = app.Timer(interval='auto', connect=self.update_time,
start=False)
self.freeze()
self.shared_program['field'] = self._field
self.shared_program['field_shape'] = self._field.shape[:2]
self.shared_program['shape'] = (rows, cols)
self.shared_program['index'] = self._index
self.shared_program['spacing'] = spacing
self.shared_program['t'] = self._time
self.shared_program['offset'] = self._offset
self.shared_program['speed'] = 1
self.shared_program['color'] = self._color
self.shared_program['seg_len'] = seg_len
self.shared_program['nseg'] = segments
self.shared_program['n_iter'] = 1
self.shared_program['attractor'] = (0, 0)
self.shared_program['time'] = 0
self._draw_mode = 'lines'
self.set_gl_state('translucent', depth_test=False)
self.timer.start()
def _prepare_transforms(self, view):
view.view_program.vert['transform'] = view.get_transform()
def _prepare_draw(self, view):
pass
def _compute_bounds(self, axis, view):
if axis > 1:
return (0, 0)
return (0, self._field_shape[axis])
def update_time(self, ev):
t = ptime.time()
self._time += t - self._last_time
self._last_time = t
self.shared_program['time'] = self._time
self.update()
VectorField = scene.visuals.create_visual_node(VectorFieldVisual)
def fn(y, x):
dx = x-50
dy = y-30
l = (dx**2 + dy**2)**0.5 + 0.01
return np.array([100 * dy / l**1.7, -100 * dx / l**1.8])
field = np.fromfunction(fn, (100, 100)).transpose(1, 2, 0).astype('float32')
field[..., 0] += 10 * np.cos(np.linspace(0, 2 * 3.1415, 100))
color = np.zeros((100, 100, 4), dtype='float32')
color[..., :2] = (field + 5) / 10.
color[..., 2] = 0.5
color[..., 3] = 0.5
canvas = scene.SceneCanvas(keys='interactive', show=True)
view = canvas.central_widget.add_view(camera='panzoom')
vfield = VectorField(field[..., :2], spacing=0.5, segments=30, seg_len=0.05,
parent=view.scene, color=color)
view.camera.set_range()
@canvas.connect
def on_mouse_move(event):
if 3 in event.buttons:
tr = canvas.scene.node_transform(vfield)
vfield.shared_program['attractor'] = tr.map(event.pos)[:2]
if __name__ == '__main__':
app.run()
| [
"[email protected]"
] | |
f047f9775a3c47115ce51159634b7701faa2263c | 0b2f2a87a8acff0b3a4ae606c223ffe44a6fea2f | /scripts/matrix_to_vector.py | 88f8a51703ece5b7c5f8f6db2c57342206de025f | [
"MIT"
] | permissive | endrebak/ldetect | 25b19518de6fc97e41c3d290e711d9cfbf055520 | 620f60a6758b448c6f16bb529b8ac1afd6b88a6a | refs/heads/master | 2020-10-01T18:08:59.949249 | 2020-01-07T14:04:39 | 2020-01-07T14:04:39 | 227,595,162 | 3 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,432 | py | import pandas as pd
import numpy as np
from ldetect2.src.matrix_to_vector import mat2vec
from sys import argv
partitions = argv[1]
theta2 = argv[2]
covariances = argv[3:]
theta2 = float(open(theta2).readline().strip())
import sys
# print(partitions, file=sys.stderr)
# print(covariances, file=sys.stderr)
# partitions = snakemake.input["partitions"]
# covariances = snakemake.input["covariances"]
# dfs = []
# from time import time
# length = 0
# memory_use = 0
# for i, c in enumerate(covariances):
# start = time()
# df = pd.read_csv(c, sep=" ", usecols=[2, 3, 7], names="i j val".split(), dtype={"i": np.int32, "j": np.int32})
# length += len(df)
# memory_use += df.memory_usage(deep=True).sum()
# dfs.append(df)
# end = time()
# print(i, c, i/len(covariances), end - start, length, memory_use / 1e9, file=sys.stderr)
# covariances = sorted(covariances, key=lambda k: k.split("/"))
# df = pd.concat(dfs)
# print("Done concatenating!")
# print("df.memory_usage(deep=True).sum()", df.memory_usage(deep=True).sum())
s = pd.read_parquet(covariances[-1])
max_ = s.i.max()
ps = pd.read_table(partitions, sep=" ", header=None)
new_ends = ((ps[0] + ps[1].shift(-1).values)/2)
new_ends = new_ends.fillna(max_).astype(int)
ps.insert(ps.shape[1], 2, new_ends)
# assert len(ps) == len(covariances), "Number of partitions and covariance files are not the same!"
mat2vec(covariances, ps, theta2)
| [
"[email protected]"
] | |
fe26112695faaf8104bf70c2b794a31141f7a516 | 65381b8dffa1ade89746f6fc3a4979a7eb548d34 | /purchase_portal/controllers/portal.py | 37789ade0983d57e5d6b846a6a0fe04daa62ae59 | [] | no_license | ff4f/AISJ-13 | a4240d1952c3854dd5b21a62cf7dbfdebb16fde5 | a2f2183e0f753100842877efecc844bdc72f8bd4 | refs/heads/master | 2023-05-08T22:54:43.972954 | 2021-06-03T14:44:10 | 2021-06-03T14:48:59 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 12,953 | py | # -*- coding: utf-8 -*-
from collections import OrderedDict
from datetime import datetime, time
from dateutil import parser
from pytz import timezone, UTC
from odoo import fields, http, _, SUPERUSER_ID
from odoo.exceptions import AccessError, MissingError
from odoo.http import request
from odoo.addons.portal.controllers.portal import CustomerPortal, pager as portal_pager
from odoo.osv.expression import OR
class CustomerPortal(CustomerPortal):
def _prepare_home_portal_values(self):
values = super(CustomerPortal, self)._prepare_home_portal_values()
values["purchase_request_count"] = request.env["purchase.order"].search_count(
["|",("create_uid","=",request.env.user.id),("is_workflow_stage_user","=",True)])
return values
def _prepare_portal_layout_values(self):
values = super(CustomerPortal, self)._prepare_portal_layout_values()
return values
def _purchase_request_get_page_view_values(self, purchase_request, access_token, **kwargs):
values = {
"purchase_request": purchase_request,
"vendors": request.env["res.partner"].sudo().search([]),
"products": request.env["product.product"].sudo().search([("purchase_ok","=",True)]),
"budgets": request.env.user.purchase_budget_ids,
"budget_posts": purchase_request.order_line.mapped("budget_post_id"),
}
if purchase_request.order_line.mapped("product_id"):
values["products"] |= purchase_request.order_line.mapped("product_id")
res = self._get_page_view_values(purchase_request, access_token, values, "my_purchase_requests_history", True, **kwargs)
if res.get("prev_record"):
res["prev_record"] = res["prev_record"] and res["prev_record"].replace("/purchase/","/purchase_request/")
if res.get("next_record"):
res["next_record"] = res["next_record"] and res["next_record"].replace("/purchase/","/purchase_request/")
return res
@http.route(["/my/purchase_request/", "/my/purchase_request/page/<int:page>"], type="http", auth="user", website=True)
def portal_my_purchase_requet(self, page=1, date_begin=None, date_end=None, sortby=None, filterby=None, search=None, search_in="name", **kw):
values = self._prepare_portal_layout_values()
purchase_request_obj = request.env["purchase.order"]
domain = []
archive_groups = self._get_archive_groups("purchase.order", domain)
if date_begin and date_end:
domain += [("create_date",">",date_begin),("create_date","<=",date_end)]
searchbar_sortings = {
"date": {"label": _("Newest"), "order": "create_date desc"},
"name": {"label": _("Name"), "order": "name"},
}
if not sortby:
sortby = "date"
order = searchbar_sortings[sortby]["order"]
default_domain = ["|",("create_uid","=",request.env.user.id),("is_workflow_stage_user","=",True)]
searchbar_filters = {
"all": {"label": _("All"), "domain": default_domain},
"rfq": {"label": _("RFQ"), "domain": [("state","in",["draft","sent"])] + default_domain},
"to_approve": {"label": _("To Approve"), "domain": [("state","in",["to approve"])] + default_domain},
"confirmed": {"label": _("Confirmed"), "domain": [("state","in",["purchase","done"])] + default_domain},
"cancel": {"label": _("Cancelled"), "domain": [("state","in",["cancel"])] + default_domain},
}
if not filterby:
filterby = "all"
domain += searchbar_filters[filterby]['domain']
searchbar_inputs = {
"name": {"input": "name", "label": _("Search in Order #")},
"partner_id": {"input": "partner_id", "label": _("Search in Vendor")},
"workflow_stage_id": {"input": "workflow_stage_id", "label": _("Search in Stage")},
}
if search and search_in:
search_domain = []
if search_in in "name":
search_domain = OR([search_domain, [("name","ilike",search)]])
elif search_in == "partner_id":
partner_ids = request.env["res.partner"].sudo().search([("name","ilike",search)]).ids
search_domain = OR([search_domain, [("partner_id","in",partner_ids)]])
elif search_in == "workflow_stage_id":
stage_ids = request.env["workflow.stage"].sudo().search([("name","ilike",search)]).ids
search_domain = OR([search_domain, [("workflow_stage_id","in",stage_ids)]])
domain += search_domain
purchase_request_count = purchase_request_obj.search_count(domain)
pager = portal_pager(
url="/my/purchase_request",
url_args={"date_begin": date_begin, "date_end": date_end, "sortby": sortby},
total=purchase_request_count,
page=page,
step=self._items_per_page
)
purchase_requests = purchase_request_obj.search(domain, order=order, limit=self._items_per_page, offset=pager["offset"])
request.session["my_purchase_requests_history"] = purchase_requests.ids[:100]
values.update({
"date": date_begin,
"date_end": date_end,
"purchase_requests": purchase_requests,
"page_name": "purchase_request",
"archive_groups": archive_groups,
"default_url": "/my/purchase_request",
"pager": pager,
"searchbar_sortings": searchbar_sortings,
"sortby": sortby,
"searchbar_filters": OrderedDict(sorted(searchbar_filters.items())),
"filterby": filterby,
"searchbar_inputs": searchbar_inputs,
"search_in": search_in,
"search": search,
})
return request.render("purchase_portal.portal_my_purchase_requests", values)
@http.route(["/my/purchase_request/<int:purchase_request_id>"], type="http", auth="user", website="True")
def portal_my_purchase_request(self, purchase_request_id=None, access_token=None, **kw):
purchase_request = request.env["purchase.order"].browse(purchase_request_id)
values = self._purchase_request_get_page_view_values(purchase_request, access_token, **kw)
values["readonly"] = True
return request.render("purchase_portal.portal_my_purchase_request", values)
@http.route(["/my/purchase_request/<int:purchase_request_id>/edit"], type="http", auth="user", website="True")
def portal_my_purchase_request_edit(self, purchase_request_id=None, access_token=None, **kw):
purchase_request = request.env["purchase.order"].browse(purchase_request_id)
values = self._purchase_request_get_page_view_values(purchase_request, access_token, **kw)
return request.render("purchase_portal.portal_my_purchase_request", values)
@http.route(["/my/purchase_request/create"], type="http", auth="user", website="True")
def portal_my_purchase_request_create(self, access_token=None, **kw):
purchase_request = request.env["purchase.order"]
values = self._purchase_request_get_page_view_values(purchase_request, access_token, **kw)
values["create_purchase_request"] = True
return request.render("purchase_portal.portal_my_purchase_request", values)
@http.route(["/my/purchase_request/<int:purchase_request_id>/cancel"], type="http", auth="user", website="True")
def portal_my_purchase_request_cancel(self, purchase_request_id=None, access_token=None, **kw):
purchase_request = request.env["purchase.order"].browse(purchase_request_id)
purchase_request.sudo().button_cancel()
return request.redirect("/my/purchase_request/" + str(purchase_request.id))
@http.route(["/my/purchase_request/<int:purchase_request_id>/prev_stage"], type="http", auth="user", website="True")
def portal_my_purchase_request_prev_stage(self, purchase_request_id=None, access_token=None, **kw):
purchase_request = request.env["purchase.order"].browse(purchase_request_id)
purchase_request.sudo().action_prev_workflow_stage()
return request.redirect("/my/purchase_request")
@http.route(["/my/purchase_request/<int:purchase_request_id>/next_stage"], type="http", auth="user", website="True")
def portal_my_purchase_request_next_stage(self, purchase_request_id=None, access_token=None, **kw):
purchase_request = request.env["purchase.order"].browse(purchase_request_id)
purchase_request.sudo().action_next_workflow_stage()
return request.redirect("/my/purchase_request/")
@http.route(["/my/purchase_request/save"], type="http", auth="user", methods=["POST"], website="True")
def portal_my_purchase_request_save(self, access_token=None, **kw):
order_line = []
line_ids = []
partner_id = int(kw["partner_id"])
partner = request.env["res.partner"].sudo().browse(partner_id)
purchase_line_obj = request.env["purchase.order.line"]
vals = {
"partner_id": partner_id,
"budget_id": kw["budget_id"] and int(kw["budget_id"]) or False,
}
if not kw.get("id"): # create
vals["date_order"] = datetime.now()
res_obj = request.env["purchase.order"].sudo()
res = res_obj.create(dict(vals))
vals.pop("partner_id")
else:
res = request.env["purchase.order"].browse(int(kw.get("id"))).sudo()
for key, value in kw.items():
if "product_id_" in key:
number = key.replace("product_id_", "")
product_id = int(kw.get(key))
product = request.env["product.product"].sudo().browse(product_id)
seller = product._select_seller(partner_id=partner)
budget_post_id = kw.get("budget_post_id_" + number) and int(kw["budget_post_id_" + number]) or False
product_qty = float(kw.get("product_qty_" + number))
price_unit = float(kw.get("price_unit_" + number))
line_id = int(kw.get("line_id_" + number))
uom_id = product.uom_po_id.id
date_planned = purchase_line_obj._get_date_planned(seller, res)
if line_id:
line_ids.append(line_id)
line_vals = (1, line_id, {
"product_id": product_id,
"name": product.display_name,
"budget_post_id": budget_post_id,
"product_qty": product_qty,
"price_unit": price_unit,
"product_uom": uom_id,
"date_planned": date_planned,
})
else:
line_vals = (0, 0, {
"product_id": product_id,
"name": product.display_name,
"budget_post_id": budget_post_id,
"product_qty": product_qty,
"price_unit": price_unit,
"product_uom": uom_id,
"date_planned": date_planned,
})
order_line.append(line_vals)
vals["order_line"] = order_line
if kw.get("id"): # edit
deleted_line_ids = set(res.order_line.ids) - set(line_ids)
for line_id in deleted_line_ids:
vals["order_line"].append((2, line_id))
res.write(vals)
return request.redirect("/my/purchase_request/" + str(res.id))
@http.route(["/purchase_portal/get_product_details"], type="json", auth="user")
def portal_my_purchase_request_get_product_details(self, partner_id, product_id, budget_id):
vals = {
"price_unit": "-",
"budget_posts": [],
}
if product_id:
product = request.env["product.product"].sudo().browse(int(product_id))
partner = partner_id and request.env["res.partner"].sudo().browse(int(partner_id)) or request.env["res.partner"]
seller = product._select_seller(partner_id=partner)
taxes_obj = request.env["account.tax"]
price_unit = taxes_obj._fix_tax_included_price(seller.price, product.supplier_taxes_id, taxes_obj) if seller else 0.0
vals["price_unit"] = price_unit
if budget_id:
account = product.product_tmpl_id.get_product_accounts()["expense"]
budget = request.env["crossovered.budget"].browse(int(budget_id)).sudo()
budget_posts = budget.crossovered_budget_line.filtered(lambda x: x.general_budget_id).mapped("general_budget_id")
budget_posts = budget_posts.filtered(lambda x: account in x.account_ids)
vals["budget_posts"] = budget_posts.read(["id", "name"])
return vals
| [
"[email protected]"
] | |
8ea6243ca53dcdd617b9bc0fd4fc19042f716cf2 | 1e263d605d4eaf0fd20f90dd2aa4174574e3ebce | /components/ally-core-http/ally/core/http/impl/processor/parameter.py | daa374e7e51b69baa90131966fe02b3e46269120 | [] | no_license | galiminus/my_liveblog | 698f67174753ff30f8c9590935d6562a79ad2cbf | 550aa1d0a58fc30aa9faccbfd24c79a0ceb83352 | refs/heads/master | 2021-05-26T20:03:13.506295 | 2013-04-23T09:57:53 | 2013-04-23T09:57:53 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 31,856 | py | '''
Created on May 25, 2012
@package: ally core http
@copyright: 2011 Sourcefabric o.p.s.
@license: http://www.gnu.org/licenses/gpl-3.0.txt
@author: Gabriel Nistor
Provides the parameters handler.
'''
from ally.api.criteria import AsOrdered
from ally.api.operator.container import Criteria, Query
from ally.api.operator.type import TypeQuery, TypeCriteriaEntry, TypeCriteria
from ally.api.type import Input, Type, Iter, typeFor
from ally.container.ioc import injected
from ally.core.spec.codes import ILLEGAL_PARAM
from ally.core.spec.resources import Invoker, Path, Node, INodeInvokerListener, \
Normalizer, Converter
from ally.core.spec.transform.render import Object, List
from ally.core.spec.transform.support import obtainOnDict, setterOnDict, \
getterChain, getterOnObj, setterOnObj, setterWithGetter, obtainOnObj, \
getterOnDict, getterOnObjIfIn, SAMPLE
from ally.design.context import Context, requires, defines
from ally.design.processor import HandlerProcessorProceed
from collections import deque, Iterable, OrderedDict
from weakref import WeakKeyDictionary
import logging
import random
import re
# --------------------------------------------------------------------
log = logging.getLogger(__name__)
# --------------------------------------------------------------------
class Request(Context):
'''
The request context.
'''
# ---------------------------------------------------------------- Required
parameters = requires(list)
path = requires(Path)
invoker = requires(Invoker)
arguments = requires(dict)
converterParameters = requires(Converter)
normalizerParameters = requires(Normalizer)
class Response(Context):
'''
The response context.
'''
# ---------------------------------------------------------------- Defined
code = defines(int)
isSuccess = defines(bool)
text = defines(str)
errorMessage = defines(str)
errorDetails = defines(Object)
# --------------------------------------------------------------------
@injected
class ParameterHandler(HandlerProcessorProceed, INodeInvokerListener):
'''
Implementation for a processor that provides the transformation of parameters into arguments.
'''
separatorName = '.'
# The separator used for parameter names.
nameOrderAsc = 'asc'
# The name used for the ascending list of names.
nameOrderDesc = 'desc'
# The name used for the descending list of names.
regexSplitValues = '[\s]*(?<!\\\)\,[\s]*'
# The regex used for splitting list values.
separatorValue = ','
# The separator used for the list values.
regexNormalizeValue = '\\\(?=\,)'
# The regex used for normalizing the split values.
separatorValueEscape = '\,'
# The separator escape used for list values.
def __init__(self):
assert isinstance(self.separatorName, str), 'Invalid separator for names %s' % self.separatorName
assert isinstance(self.nameOrderAsc, str), 'Invalid name for ascending %s' % self.nameOrderAsc
assert isinstance(self.nameOrderDesc, str), 'Invalid name for descending %s' % self.nameOrderDesc
assert isinstance(self.regexSplitValues, str), 'Invalid regex for values split %s' % self.regexSplitValues
assert isinstance(self.separatorValue, str), 'Invalid separator for values %s' % self.separatorValue
assert isinstance(self.regexNormalizeValue, str), \
'Invalid regex for value normalize %s' % self.regexNormalizeValue
assert isinstance(self.separatorValueEscape, str), \
'Invalid separator escape for values %s' % self.separatorValueEscape
HandlerProcessorProceed.__init__(self)
self._reSplitValues = re.compile(self.regexSplitValues)
self._reNormalizeValue = re.compile(self.regexNormalizeValue)
self._cacheDecode = WeakKeyDictionary()
self._cacheEncode = WeakKeyDictionary()
def process(self, request:Request, response:Response, **keyargs):
'''
@see: HandlerProcessorProceed.process
Process the parameters into arguments.
'''
assert isinstance(request, Request), 'Invalid request %s' % request
assert isinstance(response, Response), 'Invalid response %s' % response
if response.isSuccess is False: return # Skip in case the response is in error
assert isinstance(request.path, Path), 'Invalid request %s has no resource path' % request
assert isinstance(request.path.node, Node), 'Invalid resource path %s has no node' % request.path
invoker = request.invoker
assert isinstance(invoker, Invoker), 'No invoker available for %s' % request
if request.parameters:
decode = self._cacheDecode.get(invoker)
if decode is None:
decode = self.decodeInvoker(invoker)
request.path.node.addNodeListener(self)
self._cacheDecode[invoker] = decode
illegal = []
context = dict(target=request.arguments,
normalizer=request.normalizerParameters, converter=request.converterParameters)
for name, value in request.parameters:
if not decode(path=name, value=value, **context): illegal.append((name, value))
if illegal:
encode = self._cacheEncode.get(invoker)
if encode is None:
encode = self.encodeInvoker(invoker)
request.path.node.addNodeListener(self)
self._cacheEncode[invoker] = encode
response.code, response.isSuccess = ILLEGAL_PARAM
response.text = 'Illegal parameter'
context = dict(normalizer=request.normalizerParameters, converter=request.converterParameters)
sample = encode(value=SAMPLE, **context)
errors = [List('illegal', *(Object('parameter', attributes={'name':name}) for name, _value in illegal))]
if sample:
assert isinstance(sample, deque), 'Invalid sample %s' % sample
response.errorMessage = 'Illegal parameter or value'
samples = (Object('parameter', attributes=OrderedDict((('name', name), ('expected', value))))
for name, value in sample)
errors.append(List('sample', *samples))
else:
response.errorMessage = 'No parameters are allowed on this URL'
response.errorDetails = Object('parameter', *errors)
# ----------------------------------------------------------------
def onInvokerChange(self, node, old, new):
'''
@see: INodeInvokerListener.onInvokerChange
'''
self._cacheDecode.pop(old, None)
self._cacheEncode.pop(old, None)
# ----------------------------------------------------------------
def decodePrimitive(self, setter, typeValue):
'''
Create a decode exploit for a primitive value.
@param setter: callable(object, object)
The setter used to set the value to the target object.
@param typeValue: Type
The type of the value to decode.
@return: callable(**data) -> boolean
The exploit that provides the primitive decoding.
'''
assert callable(setter), 'Invalid setter %s' % setter
assert isinstance(typeValue, Type), 'Invalid type %s' % typeValue
def exploit(path, target, value, converter, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
assert isinstance(converter, Converter), 'Invalid converter %s' % converter
if path: return False
# Only if there are no other elements in path we process the exploit
if not isinstance(value, str): return False
# If the value is not a string then is not valid
try: value = converter.asValue(value, typeValue)
except ValueError: return False
setter(target, value)
return True
return exploit
def decodePrimitiveList(self, setter, typeItem):
'''
Exploit to decode a primitive value list.
@param setter: callable(object, object)
The setter used to set the value to the target object.
@param typeItem: Type
The type represented by the list items.
@return: callable(**data) -> boolean
The exploit that provides the primitive list decoding.
'''
assert callable(setter), 'Invalid setter %s' % setter
assert isinstance(typeItem, Type), 'Invalid type %s' % typeItem
def exploit(path, target, value, converter, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
assert isinstance(converter, Converter), 'Invalid converter %s' % converter
if path: return False
# Only if there are no other elements in path we process the exploit
if not isinstance(value, str): return False
# If the value is not a string then is not valid
if isinstance(value, str):
value = self._reSplitValues.split(value)
for k in range(0, len(value)): value[k] = self._reNormalizeValue.sub('', value[k])
if not isinstance(value, (list, tuple)): value = (value,)
for item in value:
try: item = converter.asValue(item, typeItem)
except ValueError: return False
setter(target, item)
return True
return exploit
def decodePath(self, children):
'''
Exploit to locate a decoder in the provided children based on the exploit path.
@param children: dictionary{string, callable(**data)}
The children exploits to be identified based on the key.
@return: callable(**data) -> boolean
The exploit that provides the path decoding.
'''
assert isinstance(children, dict), 'Invalid children %s' % children
if __debug__:
for keyChild, exploitChild in children.items():
assert isinstance(keyChild, str), 'Invalid child key %s' % keyChild
assert callable(exploitChild), 'Invalid child exploit %s' % exploitChild
def exploit(path, normalizer, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
assert path, 'Invalid path, needs to have at least one entry'
assert isinstance(normalizer, Normalizer), 'Invalid normalizer %s' % normalizer
key = path.popleft()
if not isinstance(key, str): return False
assert isinstance(key, str), 'Invalid path element %s' % key
for keyChild, exploitChild in children.items():
assert isinstance(keyChild, str), 'Invalid child key %s' % keyChild
if normalizer.normalize(keyChild) == key: break
else: return False
return exploitChild(path=path, normalizer=normalizer, **data)
return exploit
def decodeCriteria(self, typeCriteria, getterCriteria):
'''
Exploit that provides the decoder for the criteria.
@param typeCriteria: TypeCriteria
The criteria type to decode.
@param getterCriteria: callable(object) -> object
The getter used to get the criteria from the target object.
@return: callable(**data) -> boolean
The exploit that provides the criteria decoding.
'''
assert isinstance(typeCriteria, TypeCriteria), 'Invalid criteria type %s' % typeCriteria
assert callable(getterCriteria), 'Invalid getter %s' % getterCriteria
criteria = typeCriteria.container
assert isinstance(criteria, Criteria)
if issubclass(typeCriteria.clazz, AsOrdered): exclude = ('ascending', 'priority')
else: exclude = ()
children = {}
for prop, typeProp in criteria.properties.items():
if prop in exclude: continue
if isinstance(typeProp, Iter):
assert isinstance(typeProp, Iter)
setter = setterWithGetter(obtainOnObj(prop, list), list.append)
propDecode = self.decodePrimitiveList(setter, typeProp.itemType)
else: propDecode = self.decodePrimitive(setterOnObj(prop), typeProp)
children[prop] = propDecode
exploitPath = self.decodePath(children)
def exploit(path, target, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
if path: return exploitPath(path=path, target=getterCriteria(target), **data)
if not criteria.main: return False
data.update(path=path, target=getterCriteria(target))
for prop in criteria.main:
if not children[prop](**data): return False
return True
return exploit
def decodeSetOrder(self, typeEntry, getterQuery):
'''
Create a decode exploit that sets the orderer.
@param typeEntry: TypeCriteriaEntry
The criteria entry type to set the order for.
@param getterQuery: callable(object) -> object
The getter used to get the query from the target object.
@return: callable(**data) -> boolean
The exploit that sets the ordering.
'''
assert isinstance(typeEntry, TypeCriteriaEntry), 'Invalid entry type %s' % typeEntry
assert callable(getterQuery), 'Invalid getter %s' % getterQuery
assert isinstance(typeEntry.parent, TypeQuery)
def exploit(path, target, value, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
if path: return False
# Only if there are no other elements in path we process the exploit
query = getterQuery(target)
assert typeEntry.parent.isValid(query), 'Invalid query object %s' % query
# We first find the biggest priority in the query
priority = 0
for etype in typeEntry.parent.childTypes():
assert isinstance(etype, TypeCriteriaEntry)
if etype == typeEntry: continue
if not etype.isOf(AsOrdered): continue
if etype in query:
criteria = getattr(query, etype.name)
assert isinstance(criteria, AsOrdered), 'Invalid criteria %s' % criteria
if AsOrdered.priority in criteria: priority = max(priority, criteria.priority)
criteria = getattr(query, typeEntry.name)
assert isinstance(criteria, AsOrdered), 'Invalid criteria %s' % criteria
criteria.ascending = value
criteria.priority = priority + 1
return True
return exploit
def decodeOrder(self, ascending, exploitOrder):
'''
Exploit to decode the order. Basically this exploit converts the ascending and descending parameter values to
paths that are processed by the provided children.
@param ascending: boolean
The value used for this order.
@param exploitOrder: callable(**data) -> boolean
The exploit to be used in the order decoding.
@return: callable(**data) -> boolean
The exploit that provides the ordering decoding.
'''
assert isinstance(ascending, bool), 'Invalid ascending flag %s' % ascending
assert callable(exploitOrder), 'Invalid order exploit %s' % exploitOrder
def exploit(path, value, **data):
assert isinstance(path, deque), 'Invalid path %s' % path
if path: return False
# Only if there are no other elements in path we process the exploit
if isinstance(value, (list, tuple)): values = value
else: values = (value,)
data.update(value=ascending)
for value in values:
if not isinstance(value, str): return False
else:
paths = self._reSplitValues.split(value)
for k in range(0, len(paths)): paths[k] = self._reNormalizeValue.sub('', paths[k])
for path in paths:
data.update(path=deque(path.split(self.separatorName)))
if not exploitOrder(**data): return False
return True
return exploit
def decodeInvoker(self, invoker):
'''
Create a decode exploit for the invoker.
@param invoker: Invoker
The invoker to create a parameters decoder for.
@return: callable(**data) -> boolean
The exploit that provides the invoker decoding.
'''
assert isinstance(invoker, Invoker), 'Invalid invoker %s' % invoker
children, ordered = {}, {}
for inp in invoker.inputs:
assert isinstance(inp, Input)
typeInp = inp.type
assert isinstance(typeInp, Type)
if typeInp.isPrimitive:
if isinstance(typeInp, Iter):
assert isinstance(typeInp, Iter)
setter = setterWithGetter(obtainOnDict(inp.name, list), list.append)
inpDecode = self.decodePrimitiveList(setter, typeInp.itemType)
else: inpDecode = self.decodePrimitive(setterOnDict(inp.name), typeInp)
children[inp.name] = inpDecode
elif isinstance(typeInp, TypeQuery):
assert isinstance(typeInp, TypeQuery)
assert isinstance(typeInp.query, Query)
childrenQuery, orderedQuery, getterQuery = {}, {}, obtainOnDict(inp.name, inp.type.clazz)
for nameEntry, classCriteria in typeInp.query.criterias.items():
getter = getterChain(getterQuery, getterOnObj(nameEntry))
childrenQuery[nameEntry] = self.decodeCriteria(typeFor(classCriteria), getter)
if issubclass(classCriteria, AsOrdered):
orderedQuery[nameEntry] = self.decodeSetOrder(typeInp.childTypeFor(nameEntry), getterQuery)
isUpdated = False
if invoker.output.isOf(typeInp.owner):
# If the query is a main query and also there is no name conflict then add the query children to
# the main children
if set(childrenQuery.keys()).isdisjoint(children.keys()) and set(orderedQuery).isdisjoint(ordered):
isUpdated = True
children.update(childrenQuery)
ordered.update(orderedQuery)
if not isUpdated:
children[inp.name] = self.decodePath(childrenQuery)
ordered[inp.name] = self.decodePath(orderedQuery)
if self.nameOrderAsc in children: log.error('Name conflict for \'%s\' in %s', self.nameOrderAsc, invoker)
elif self.nameOrderDesc in children: log.error('Name conflict for \'%s\' in %s', self.nameOrderDesc, invoker)
else:
exploitOrder = self.decodePath(ordered)
children[self.nameOrderAsc] = self.decodeOrder(True, exploitOrder)
children[self.nameOrderDesc] = self.decodeOrder(False, exploitOrder)
exploitPath = self.decodePath(children)
def exploit(path, **data):
assert isinstance(path, str), 'Invalid path %s' % path
path = deque(path.split(self.separatorName))
return exploitPath(path=path, **data)
return exploit
# ----------------------------------------------------------------
def encodePrimitive(self, typeValue, getterValue):
'''
Create a encode exploit for a primitive value also encodes primitive value list.
@param typeValue: Type
The type of the value to encode.
@param getterValue: callable(object) -> object
The getter used to get the value from the value object.
@return: callable(**data)
The exploit that provides the primitive encoding.
'''
assert isinstance(typeValue, Type), 'Invalid type %s' % typeValue
assert callable(getterValue), 'Invalid getter %s' % getterValue
def exploit(path, value, target, converter, **data):
assert isinstance(path, str), 'Invalid path %s' % path
assert isinstance(target, deque), 'Invalid target %s' % target
assert isinstance(converter, Converter), 'Invalid converter %s' % converter
if value is SAMPLE:
if isinstance(typeValue, Iter):
assert isinstance(typeValue, Iter)
target.append((path, 'a %s collection' % typeValue.itemType))
else:
target.append((path, 'a %s value' % typeValue))
else:
value = getterValue(value)
if value is None: return
if isinstance(typeValue, Iter):
assert isinstance(value, Iterable), 'Invalid value %s' % value
value = [converter.asString(item, typeValue.itemType) for item in value]
value = [item.replace(self.separatorValue, self.separatorValueEscape) for item in value]
value = self.separatorValue.join(value)
else:
value = converter.asString(value, typeValue)
target.append((path, value))
return exploit
def encodePath(self, children):
'''
Exploit to encode the path of the exploits by using the children keys.
@param children: dictionary{string, callable(**data)}
The children exploits to be identified based on the key.
@return: callable(**data)
The exploit that provides the path encoding.
'''
assert isinstance(children, dict), 'Invalid children %s' % children
if __debug__:
for keyChild, exploitChild in children.items():
assert isinstance(keyChild, str), 'Invalid child key %s' % keyChild
assert callable(exploitChild), 'Invalid child exploit %s' % exploitChild
def exploit(normalizer, path='', **data):
assert isinstance(path, str), 'Invalid path %s' % path
assert isinstance(normalizer, Normalizer), 'Invalid normalizer %s' % normalizer
data.update(normalizer=normalizer)
for keyChild, exploitChild in children.items():
assert isinstance(keyChild, str), 'Invalid child key %s' % keyChild
pathChild = normalizer.normalize(keyChild)
if path: pathChild = self.separatorName.join((path, pathChild))
exploitChild(path=pathChild, **data)
return exploit
def encodeCriteria(self, typeCriteria, getterCriteria):
'''
Exploit that provides the encoding for the criteria.
@param typeCriteria: TypeCriteria
The criteria type to encode.
@param getterCriteria: callable(object) -> object
The getter used to get the criteria from the value object.
@return: callable(**data)
The exploit that provides the criteria encoding.
'''
assert isinstance(typeCriteria, TypeCriteria), 'Invalid criteria type %s' % typeCriteria
assert callable(getterCriteria), 'Invalid getter %s' % getterCriteria
criteria = typeCriteria.container
assert isinstance(criteria, Criteria)
if issubclass(typeCriteria.clazz, AsOrdered): exclude = ('ascending', 'priority')
else: exclude = ()
children, childrenMain = OrderedDict(), OrderedDict()
for prop, typeProp in sorted(criteria.properties.items(), key=lambda item: item[0]):
if prop in exclude: continue
propEncode = self.encodePrimitive(typeProp, getterOnObjIfIn(prop, typeCriteria.childTypeFor(prop)))
if prop in criteria.main: childrenMain[prop] = propEncode
else: children[prop] = propEncode
exploitPath = self.encodePath(children) if children else None
exploitPathMain = self.encodePath(childrenMain) if childrenMain else None
def exploit(value, target, path='', **data):
assert isinstance(path, str), 'Invalid path %s' % path
assert isinstance(target, deque), 'Invalid target %s' % target
if value is not SAMPLE:
value = getterCriteria(value)
if value is None: return
data.update(path=path, value=value)
if exploitPathMain:
targetMain = deque()
exploitPathMain(target=targetMain, **data)
if targetMain:
targetMainIter = iter(targetMain)
_name, valueMain = next(targetMainIter)
for _name, val in targetMainIter:
if valueMain != val:
target.extend(targetMain)
break
else: target.append((path, valueMain))
if exploitPath: exploitPath(target=target, **data)
return exploit
def encodeGetOrder(self, typeEntry, getterQuery):
'''
Create a encode exploit that gets the orderer.
@param typeEntry: TypeCriteriaEntry
The criteria entry type to get the order for.
@param getterQuery: callable(object) -> object
The getter used to get the query from the value object.
@return: callable(**data)
The exploit that gets the ordering.
'''
assert isinstance(typeEntry, TypeCriteriaEntry), 'Invalid entry type %s' % typeEntry
assert callable(getterQuery), 'Invalid getter %s' % getterQuery
assert isinstance(typeEntry.parent, TypeQuery)
def exploit(path, value, target, **data):
assert isinstance(path, str), 'Invalid path %s' % path
assert isinstance(target, deque), 'Invalid target %s' % target
if value is SAMPLE:
target.append((path, random.choice((True, False)), random.randint(0, 10)))
else:
query = getterQuery(value)
if query is None: return
assert typeEntry.parent.isValid(query), 'Invalid query object %s' % query
if typeEntry in query:
criteria = getattr(query, typeEntry.name)
assert isinstance(criteria, AsOrdered), 'Invalid criteria %s' % criteria
if AsOrdered.ascending in criteria:
target.append((path, criteria.ascending, criteria.priority))
return exploit
def encodeOrder(self, exploitOrder):
'''
Exploit to encode the order.
@param exploitOrder: callable(**data) -> boolean
The exploit to be used in getting the order values.
@return: callable(**data) -> boolean
The exploit that provides the ordering encode.
'''
assert callable(exploitOrder), 'Invalid order exploit %s' % exploitOrder
def exploit(target, normalizer, **data):
assert isinstance(target, deque), 'Invalid target %s' % target
assert isinstance(normalizer, Normalizer), 'Invalid normalizer %s' % normalizer
targetOrdering = deque()
exploitOrder(target=targetOrdering, normalizer=normalizer, **data)
if targetOrdering:
ordering, priortized = [], []
for order in targetOrdering:
path, asscending, priority = order
if asscending is None: continue
if priority is None: ordering.append((path, asscending))
else: priortized.append(order)
priortized.sort(key=lambda order: not order[1]) # Order by asc/desc
priortized.sort(key=lambda order: order[2]) # Order by priority
ordering.sort(key=lambda order: not order[1]) # Order by asc/desc
priortized.extend(ordering)
ordering = iter(priortized)
order = next(ordering)
group, asscending = deque([order[0]]), order[1]
while True:
order = next(ordering, None)
if order and asscending == order[1]: group.append(order[0])
else:
if group:
path = self.nameOrderAsc if asscending else self.nameOrderDesc
path = normalizer.normalize(path)
target.append((path, self.separatorValue.join(group)))
if not order: break
group.clear()
group.append(order[0])
asscending = order[1]
return exploit
def encodeInvoker(self, invoker):
'''
Create an encode exploit for the invoker.
@param invoker: Invoker
The invoker to create a parameters encoder for.
@return: callable(**data)
The exploit that provides the invoker encoding.
'''
assert isinstance(invoker, Invoker), 'Invalid invoker %s' % invoker
children, ordered = OrderedDict(), OrderedDict()
for inp in invoker.inputs:
assert isinstance(inp, Input)
typeInp = inp.type
assert isinstance(typeInp, Type)
if typeInp.isPrimitive:
children[inp.name] = self.encodePrimitive(typeInp, getterOnDict(inp.name))
elif isinstance(typeInp, TypeQuery):
assert isinstance(typeInp, TypeQuery)
childrenQuery, orderedQuery, getterQuery = OrderedDict(), OrderedDict(), getterOnDict(inp.name)
for nameEntry, classCriteria in typeInp.query.criterias.items():
getter = getterChain(getterQuery, getterOnObjIfIn(nameEntry, typeInp.childTypeFor(nameEntry)))
childrenQuery[nameEntry] = self.encodeCriteria(typeFor(classCriteria), getter)
if issubclass(classCriteria, AsOrdered):
orderedQuery[nameEntry] = self.encodeGetOrder(typeInp.childTypeFor(nameEntry), getterQuery)
isUpdated = False
if invoker.output.isOf(typeInp.owner):
# If the query is a main query and also there is no name conflict then add the query children to
# the main children
if set(childrenQuery.keys()).isdisjoint(children.keys()) and set(orderedQuery).isdisjoint(ordered):
isUpdated = True
children.update(childrenQuery)
ordered.update(orderedQuery)
if not isUpdated:
children[inp.name] = self.encodePath(childrenQuery)
ordered[inp.name] = self.encodePath(orderedQuery)
exploitOrder = None
if ordered:
if self.nameOrderAsc in children: log.error('Name conflict for \'%s\' in %s', self.nameOrderAsc, invoker)
elif self.nameOrderDesc in children: log.error('Name conflict for \'%s\' in %s', self.nameOrderDesc, invoker)
else: exploitOrder = self.encodeOrder(self.encodePath(ordered))
exploitPath = self.encodePath(children)
def exploit(**data):
target = deque()
data.update(target=target)
exploitPath(**data)
if exploitOrder: exploitOrder(**data)
return target
return exploit
| [
"[email protected]"
] | |
60b80f4d5ce107ae58b4dd24df77289078e90ce9 | 82f67ea9fbf21d21f26b611cea5ad6047617e1ab | /cvs-projects/build_scripts/utils/logDB.py | 421fbdf39e5ac167b958fc4217ade79d842bee98 | [] | no_license | metalsky/mvst | 741a0e8ddc1c43ca28c7b26dc5720e965a70b764 | e1deb593f47c28e0142e66d11ca47fa4af247ed8 | refs/heads/master | 2020-03-19T09:42:59.923445 | 2018-03-02T00:38:58 | 2018-03-02T00:38:58 | null | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 10,378 | py | #! /usr/bin/env python
import server
import time
def _show(mytype,myvalue):
if myvalue == None:
return "NULL"
elif not (type(myvalue) == mytype):
raise Exception,"logDB error, wrong value type in _show(%s,%s)" % (mytype,myvalue)
elif mytype == long:
return "%d" % myvalue
elif mytype == str:
return "'%s'" % myvalue
else:
raise Exception,"logDB error, don't know how to _show(%s,%s)" % (mytype,myvalue)
def _extractFirstLong(answer,tag):
if not (type(answer) == tuple and len(answer) > 0 and type(answer[0]) == dict):
return None
else:
result = answer[0][tag]
if type(result) == long:
return result
else:
return None
def _extractFirstLongOrDie(answer,tag,calling_context):
result = _extractFirstLong(answer,tag)
if type(result) == long:
return result
else:
raise Exception,( "logDB: cmd failed to return an extractable long:\n"
+ " call was to: %s\n" % calling_context
+ " query result was: %s\n" % answer
)
class logDB:
def __init__(self,db):
self.DB = db
def getDB(self):
return self.DB
##mysql> DELETE FROM DynamicBuilds.Builds; ALTER TABLE DynamicBuilds.Builds AUTO_INCREMENT = 1;
##mysql> DELETE FROM DynamicBuilds.Applications; ALTER TABLE DynamicBuilds.Applications AUTO_INCREMENT = 1;
##mysql> DELETE FROM DynamicBuilds.Archs; ALTER TABLE DynamicBuilds.Archs AUTO_INCREMENT = 1;
##mysql> DELETE FROM DynamicBuilds.Hosts; ALTER TABLE DynamicBuilds.Hosts AUTO_INCREMENT = 1;
##mysql> DESCRIBE DynamicBuilds.Archs;
##+-----------+------------------+------+-----+---------+----------------+
##| Field | Type | Null | Key | Default | Extra |
##+-----------+------------------+------+-----+---------+----------------+
##| id | int(10) unsigned | NO | PRI | NULL | auto_increment |
##| name | varchar(255) | NO | | | |
##| builds_id | int(10) unsigned | NO | | | |
##+-----------+------------------+------+-----+---------+----------------+
##type(answer) = <type 'tuple'>
##type(answer[0]) = <type 'dict'>
##type(answer[0]['id']) = <type 'long'>
def _archID(self,name,builds_id):
calling_context = "_archID(self,%s,%s)" % (name,builds_id)
if name == None:
return None
answer = self.DB.Command("SELECT id from DynamicBuilds.Archs WHERE name='%s' && builds_id=%d;" % (name,builds_id))
result = _extractFirstLong(answer,'id')
if type(result) == long:
return result
else:
self.DB.Command("INSERT INTO DynamicBuilds.Archs (name,builds_id) VALUES ('%s',%d);" % (name,builds_id))
answer = self.DB.Command("SELECT last_insert_id();")
return _extractFirstLongOrDie(answer,'last_insert_id()',calling_context)
def _deleteArchByBuildsId(self,builds_id):
'''Removes a build from DynamicBuilds.Archs.'''
self.DB.Command("DELETE FROM DynamicBuilds.Archs WHERE builds_id='%s';" % builds_id)
return
##mysql> DESCRIBE DynamicBuilds.Hosts;
##+-----------+------------------+------+-----+---------+----------------+
##| Field | Type | Null | Key | Default | Extra |
##+-----------+------------------+------+-----+---------+----------------+
##| id | int(10) unsigned | NO | PRI | NULL | auto_increment |
##| name | varchar(255) | NO | | | |
##| builds_id | int(10) unsigned | NO | | | |
##+-----------+------------------+------+-----+---------+----------------+
def _hostID(self,name,builds_id):
calling_context = "_hostID(self,%s,%s)" % (name,builds_id)
if name == None:
return None
answer = self.DB.Command("SELECT id from DynamicBuilds.Hosts WHERE name='%s' && builds_id=%d;" % (name,builds_id))
result = _extractFirstLong(answer,'id')
if type(result) == long:
return result
else:
self.DB.Command("INSERT INTO DynamicBuilds.Hosts (name,builds_id) VALUES ('%s',%d);" % (name,builds_id))
answer = self.DB.Command("SELECT last_insert_id();")
return _extractFirstLongOrDie(answer,'last_insert_id()',calling_context)
def _deleteHostByBuildsId(self,builds_id):
'''Removes a build from DynamicBuilds.Hosts.'''
self.DB.Command("DELETE FROM DynamicBuilds.Hosts WHERE builds_id='%s';" % builds_id)
return
##mysql> DESCRIBE DynamicBuilds.Builds;
##+------------+------------------+------+-----+---------+----------------+
##| Field | Type | Null | Key | Default | Extra |
##+------------+------------------+------+-----+---------+----------------+
##| id | int(10) unsigned | NO | PRI | NULL | auto_increment |
##| buildtag | varchar(255) | NO | | | |
##| finished | tinyint(1) | YES | | 0 | |
##| start_time | datetime | NO | | | |
##| end_time | datetime | YES | | NULL | |
##+------------+------------------+------+-----+---------+----------------+
def addBuild(self,buildtag,date=None):
'''Adds a build to the database. Queries BuildCfg to get
released architectures for the product and populates the
Architectures table as well. Probably best to daisy-chain
this from the buildid rather than using tag_match'''
calling_context = "addBuild(self,%s,%s)" % (buildtag,date)
if date == None:
date = time.strftime("%Y-%m-%d %H:%M:%S")
self.DB.Command("INSERT INTO DynamicBuilds.Builds "
+ "(buildtag,start_time) VALUES ('%s','%s') " % (buildtag,date)
+ ";")
answer = self.DB.Command("SELECT last_insert_id();")
return _extractFirstLongOrDie(answer,'last_insert_id()',calling_context)
def finishBuild(self,builds_id,date=None):
'''Mark a build as finished.'''
if date == None:
date = time.strftime("%Y-%m-%d %H:%M:%S")
self.DB.Command("UPDATE DynamicBuilds.Builds "
+ "SET finished=1,end_time='%s' " % date
+ "WHERE id='%s' " % builds_id
+ ";")
return
def removeBuild(self,builds_id):
'''Removes a build from the database.'''
self.DB.Command("DELETE FROM DynamicBuilds.Builds WHERE id='%s';" % builds_id)
## oops, this is a diamond shaped DAG, so is unsafe
self._deleteAppByBuildsId(builds_id)
self._deleteTaskByBuildsId(builds_id)
self._deleteHostByBuildsId(builds_id)
self._deleteArchByBuildsId(builds_id)
return
def pruneBuilds(self,numDays):
'''Delete all builds older than numDays'''
return
##mysql> DESCRIBE DynamicBuilds.Applications;
##+-------------+------------------+------+-----+---------+----------------+
##| Field | Type | Null | Key | Default | Extra |
##+-------------+------------------+------+-----+---------+----------------+
##| id | int(10) unsigned | NO | PRI | NULL | auto_increment |
##| name | varchar(255) | NO | | | |
##| type | varchar(255) | NO | | | |
##| builds_id | int(10) unsigned | NO | | | |
##| archs_id | int(10) unsigned | YES | | NULL | |
##| hosts_id | int(10) unsigned | YES | | NULL | |
##| state | varchar(255) | NO | | | |
##| log_link | varchar(255) | NO | | | |
##| start_time | datetime | YES | | NULL | |
##| finish_time | datetime | YES | | NULL | |
##| buildhost | varchar(255) | YES | | NULL | | October 17, 2008
##+-------------+------------------+------+-----+---------+----------------+
def addApp(self,name,atype,builds_id,arch,host,buildhost,log_link=''):
'''Add an application with status "Pending"'''
calling_context = "addApp(self,%s,%s,%s,%s,%s)" % (name,atype,builds_id,arch,host)
archs_id = self._archID(arch,builds_id)
hosts_id = self._hostID(host,builds_id)
self.DB.Command("INSERT INTO DynamicBuilds.Applications "
+ "( state, name, type, builds_id, archs_id, hosts_id, log_link, buildhost) "
+ "VALUES ( '%s', '%s', '%s', %d, %s, %s, '%s', %s) "
% ( 'Pending', name, atype, builds_id, _show(long,archs_id), _show(long,hosts_id), log_link, _show(str,buildhost))
+ ";" )
answer = self.DB.Command("SELECT last_insert_id();")
return _extractFirstLongOrDie(answer,'last_insert_id()',calling_context)
def startApp(self,apps_id,date=None):
'''Given the buildid and the name of the arch, add a row to
to the Applications table with status "Building"'''
if date == None:
date = time.strftime("%Y-%m-%d %H:%M:%S")
status = "Building"
self.DB.Command("UPDATE DynamicBuilds.Applications "
+ "SET state='%s', start_time='%s' " % (status,date)
+ "WHERE id='%s' " % apps_id
+ ";" )
def finishApp(self,apps_id,status,date=None):
'''Update an application with status of Failed or Built, as
well as a URL to the log.'''
if date == None:
date = time.strftime("%Y-%m-%d %H:%M:%S")
self.DB.Command("UPDATE DynamicBuilds.Applications "
+ "SET state='%s', finish_time='%s' " % (status,date)
+ "WHERE id='%s' " % apps_id
+ ";" )
def _deleteAppByBuildsId(self,builds_id):
'''Removes a build from DynamicBuilds.Applications.'''
self.DB.Command("DELETE FROM DynamicBuilds.Applications WHERE builds_id='%s' AND type != 'task';" % builds_id)
def addTask(self,name,builds_id,arch,host,buildhost,log_link=''):
'''Add a task.'''
return self.addApp(name,'task',builds_id,arch,host,buildhost,log_link)
def startTask(self,tasks_id,date=None):
'''Set the starting timestamp of a task.'''
self.startApp(tasks_id,date)
def finishTask(self,tasks_id,status,date=None):
'''Mark a task with status of Failed or Built, and set its finishing timestamp'''
self.finishApp(tasks_id,date)
def _deleteTaskByBuildsId(self,builds_id):
'''Removes a task from DynamicBuilds.Applications.'''
self.DB.Command("DELETE FROM DynamicBuilds.Applications WHERE builds_id='%s' AND type = 'task';" % builds_id)
#end logDB
######################
# main FUNCTION #
######################
def main(argv):
import sys
sys.stderr.write("This module is not designed to be called directly\n")
sys.exit(1)
if __name__ == "__main__":
main(sys.argv)
| [
"[email protected]"
] | |
4ee5538c1d96b89789f7074b655659ea2fb72114 | bef7c41e7b51417f9cc5c3d30a7f94b59286e2b7 | /Algorithms/perceptron.py | f727c7bee8b28f15487193977601aafc100476bb | [] | no_license | algometrix/LeetCode | 40dd6ea93c370cabe57ba672d820f261e0595cae | 3dc885ac2a93781c36fbe2735061da29194caba4 | refs/heads/master | 2021-07-01T19:45:08.018784 | 2021-06-03T05:38:13 | 2021-06-03T05:38:13 | 235,496,179 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 71 | py |
def perceptron(X, W):
pass
if __name__ == "__main__":
pass | [
"[email protected]"
] | |
e50fff82db49c4d3e46c34330e69f157e49ccee0 | b6fc54cff7037f5e4ef26cb4a645d5ea5a6fecdf | /000000stepikProgBasKirFed/Stepik000000ProgBasKirFedсh02p01st04TASK04_20210206_conditional.py | f09ca9abe36d1c94d09c812d67fc9a1879b525cf | [
"Apache-2.0"
] | permissive | SafonovMikhail/python_000577 | 5483eaf2f7c73bc619ce1f5de67d8d689d2e7dd4 | f2dccac82a37df430c4eb7425b5d084d83520409 | refs/heads/master | 2022-12-08T10:53:57.202746 | 2022-12-07T09:09:51 | 2022-12-07T09:09:51 | 204,713,341 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 798 | py | '''
Вы уже умеете приветствовать человека по имени. Давайте добавим немного персонификации. Напишите программу, которая считывает пол ученика и приветствует его в соответствующем роде.
Формат входных данных
Пол ученика - "М" или "Ж"
Формат выходных данных
Приветствие в заданном роде
Sample Input 1:
М
Sample Output 1:
Привет, ученик!
Sample Input 2:
Ж
Sample Output 2:
Привет, ученица!
'''
gender = input()
if gender == 'М':
print('Привет, ученик!')
if gender == 'Ж':
print('Привет, ученица!')
| [
"[email protected]"
] | |
6f34755301941982cda1c8a2f816a6488ca3b94e | 76d08b580d16008cfdec11103d3a2ef3c5444185 | /python网络数据采集/my_爬虫_进阶_之路/scrapy框架/my_spiders/电商项目集合/阿里1688_淘宝_天猫_京东_折800_卷皮_拼多多_蜜芽_蘑菇街_楚楚街_唯品会_聚美优品/my_flask_server/pintuan_script/jumeiyoupin_pintuan.py | 66d163bed18e087018e29b0ff191e3954e4dedf9 | [] | no_license | lrygdh/python | c9794f75610a76a234105f11e93587336c4594c0 | a1bc3c384459f8a40c420c3d1a7e4233970c459c | refs/heads/master | 2020-03-25T07:53:30.141809 | 2018-08-04T11:02:13 | 2018-08-04T11:02:13 | 143,586,696 | 1 | 0 | null | 2018-08-05T05:41:45 | 2018-08-05T05:41:45 | null | UTF-8 | Python | false | false | 11,355 | py | # coding:utf-8
'''
@author = super_fazai
@File : jumeiyoupin_pintuan.py
@Time : 2018/3/25 11:32
@connect : [email protected]
'''
import sys
sys.path.append('..')
import json
import re
import time
from pprint import pprint
import gc
from time import sleep
from logging import INFO, ERROR
import asyncio, aiohttp
from settings import MY_SPIDER_LOGS_PATH
from my_pipeline import SqlServerMyPageInfoSaveItemPipeline
from settings import (
IS_BACKGROUND_RUNNING,
JUMEIYOUPIN_SLEEP_TIME,
JUMEIYOUPIN_PINTUAN_API_TIMEOUT,
PHANTOMJS_DRIVER_PATH,
)
import datetime
from jumeiyoupin_pintuan_parse import JuMeiYouPinPinTuanParse
from fzutils.log_utils import set_logger
from fzutils.time_utils import (
get_shanghai_time,
timestamp_to_regulartime,
)
from fzutils.linux_utils import (
daemon_init,
restart_program,
)
from fzutils.internet_utils import get_random_pc_ua
from fzutils.spider.fz_phantomjs import MyPhantomjs
class JuMeiYouPinPinTuan(object):
def __init__(self, logger=None):
self._set_headers()
self.msg = ''
self._set_logger(logger)
self.tab_dict = {
'母婴健康': 'coutuan_baby',
'家居': 'coutuan_furniture',
'饰品配饰': 'coutuan_jewellery',
'内衣': 'coutuan_underwear',
'食品保健': 'coutuan_food',
'美妆': 'coutuan_makeup',
'女装': 'coutuan_ladies',
'礼品箱包': 'coutuan_bag',
'数码家电': 'coutuan_3c',
'鞋类': 'coutuan_shose',
'下期预告': 'coutuan_pre',
}
def _set_headers(self):
self.headers = {
'Accept': 'text/html,application/xhtml+xml,application/xml;q=0.9,*/*;q=0.8',
# 'Accept-Encoding:': 'gzip',
'Accept-Language': 'zh-CN,zh;q=0.9',
'Cache-Control': 'max-age=0',
'Connection': 'keep-alive',
'Host': 's.h5.jumei.com',
'Referer': 'http://s.h5.jumei.com/yiqituan/list',
'User-Agent': get_random_pc_ua(), # 随机一个请求头
'X-Requested-With': 'XMLHttpRequest',
}
def _set_logger(self, logger):
if logger is None:
self.my_lg = set_logger(
log_file_name=MY_SPIDER_LOGS_PATH + '/聚美优品/拼团/' + str(get_shanghai_time())[0:10] + '.txt',
console_log_level=INFO,
file_log_level=ERROR
)
else:
self.my_lg = logger
async def get_pintuan_goods_info(self):
'''
模拟构造得到data的url，得到近期所有的限时拼团商品信息
:return:
'''
s_time = time.time()
goods_list = []
my_phantomjs = MyPhantomjs(executable_path=PHANTOMJS_DRIVER_PATH)
for key in self.tab_dict:
self.msg = '正在抓取的分类为: ' + key
self.my_lg.info(self.msg)
for index in range(1, 20):
item_list = await self.get_one_page_goods_list(my_phantomjs=my_phantomjs, key=key, tab=self.tab_dict[key], index=index)
all_goods_id = list(set([s.get('goods_id', '') for s in goods_list]))
for item in item_list:
if item.get('goods_id', '') not in all_goods_id:
goods_list.append(item)
# await asyncio.sleep(.5)
# break
# break
try: del my_phantomjs
except: pass
self.my_lg.info(str(goods_list))
self.my_lg.info('本次抓到所有拼团商品个数为: ' + str(len(goods_list)))
e_time = time.time()
self.my_lg.info('总用时:' + str(e_time-s_time))
await asyncio.sleep(3)
return goods_list
async def deal_with_data(self):
'''
处理并存储相关拼团商品的数据
:return:
'''
goods_list = await self.get_pintuan_goods_info()
my_pipeline = SqlServerMyPageInfoSaveItemPipeline()
if my_pipeline.is_connect_success:
db_goods_id_list = [item[0] for item in list(await my_pipeline.select_jumeiyoupin_pintuan_all_goods_id(logger=self.my_lg))]
# self.my_lg.info(str(db_goods_id_list))
index = 1
for item in goods_list:
if index % 20 == 0:
my_pipeline = SqlServerMyPageInfoSaveItemPipeline()
if item.get('goods_id', '') in db_goods_id_list:
self.my_lg.info('该goods_id已经存在于数据库中, 此处跳过')
pass
else:
goods_id = item.get('goods_id', '')
tmp_url = 'https://s.h5.jumei.com/yiqituan/detail?item_id={0}&type={1}'.format(goods_id, item.get('type', ''))
s_time = time.time()
jumeiyoupin = JuMeiYouPinPinTuanParse(logger=self.my_lg)
goods_data = await jumeiyoupin.deal_with_data(jumei_pintuan_url=tmp_url)
if goods_data == {} or goods_data.get('is_delete', 0) == 1:
pass
else:
# 规范化
goods_data['goods_id'] = goods_id
goods_data['pintuan_time'] = item.get('pintuan_time', {})
goods_data['pintuan_begin_time'], goods_data['pintuan_end_time'] = await self.get_pintuan_begin_time_and_pintuan_end_time(pintuan_time=item.get('pintuan_time', {}))
goods_data['sort'] = item.get('sort')
goods_data['page'] = item.get('page')
goods_data['tab'] = item.get('tab')
# pprint(goods_data)
# print(goods_data)
await jumeiyoupin.insert_into_jumeiyoupin_pintuan_table(data=goods_data, pipeline=my_pipeline, logger=self.my_lg)
e_time = time.time()
if e_time - s_time > JUMEIYOUPIN_SLEEP_TIME: # 使其更智能点
pass
else:
await asyncio.sleep(JUMEIYOUPIN_SLEEP_TIME - (e_time-s_time))
index += 1
else:
self.my_lg.error('数据库连接失败，此处跳过!')
pass
gc.collect()
return None
async def get_one_page_goods_list(self, **kwargs):
'''
获取单页面的goods_list
:param kwargs:
:return: item_list 类型list
'''
my_phantomjs = kwargs.get('my_phantomjs')
key = kwargs.get('key', '')
tab = kwargs.get('tab', '')
index = kwargs.get('index')
i_time = time.time()
tmp_url = 'http://s.h5.jumei.com/yiqituan/tab_list?tab={0}&page={1}&per_page=20'.format(
tab,
str(index)
)
# 常规requests被过滤, aiohttp成功, 测试发现：设置时间短抓取较快
# body = await MyAiohttp.aio_get_url_body(url=tmp_url, headers=self.headers, timeout=JUMEIYOUPIN_PINTUAN_API_TIMEOUT)
# 改用phantomjs，aiohttp太慢
body = my_phantomjs.use_phantomjs_to_get_url_body(url=tmp_url)
try: body = re.compile('<pre .*?>(.*)</pre>').findall(body)[0]
except: pass
await asyncio.sleep(1)
# self.my_lg.info(body)
self.msg = '正在抓取第' + str(index) + '页...' + ' ☭ 用时: ' + str(time.time() - i_time)
self.my_lg.info(self.msg)
item_list = []
if body == '':
self.msg = '获取到的body为空str!' + ' 出错地址: ' + tmp_url
self.my_lg.error(self.msg)
else:
one_data = await self.json_2_dict(json_str=body)
if one_data == {}:
self.msg = '出错地址: ' + tmp_url
self.my_lg.error(self.msg)
else:
if one_data.get('data', []) == []:
pass
else:
tmp_item_list = one_data.get('data', [])
for item in tmp_item_list: # 由于await 不能理解列表表达式，就采用常规做法
if item.get('status', '') != 'soldout':
item_list.append({
'goods_id': item.get('item_id', ''),
'pintuan_time': {
'begin_time': timestamp_to_regulartime(item.get('start_time', '0')),
'end_time': timestamp_to_regulartime(item.get('end_time', '0')),
},
'type': item.get('type', ''),
'sort': key,
'page': index,
'tab': tab,
})
# self.my_lg.info(str(item_list))
return item_list
async def json_2_dict(self, json_str):
'''
异步json_2_dict
:param json_str:
:return: {} | {...}
'''
try:
tmp = json.loads(json_str)
except Exception:
self.my_lg.error('json转换json_str时出错,请检查!')
tmp = {}
return tmp
async def get_pintuan_begin_time_and_pintuan_end_time(self, pintuan_time):
'''
返回拼团开始和结束时间
:param pintuan_time:
:return: tuple pintuan_begin_time, pintuan_end_time
'''
pintuan_begin_time = pintuan_time.get('begin_time')
pintuan_end_time = pintuan_time.get('end_time')
# 将字符串转换为datetime类型
pintuan_begin_time = datetime.datetime.strptime(pintuan_begin_time, '%Y-%m-%d %H:%M:%S')
pintuan_end_time = datetime.datetime.strptime(pintuan_end_time, '%Y-%m-%d %H:%M:%S')
return pintuan_begin_time, pintuan_end_time
def __del__(self):
try:
del self.my_lg
del self.msg
except:
pass
gc.collect()
def just_fuck_run():
while True:
print('一次大抓取即将开始'.center(30, '-'))
jumeiyoupin_pintuan = JuMeiYouPinPinTuan()
loop = asyncio.get_event_loop()
loop.run_until_complete(jumeiyoupin_pintuan.deal_with_data())
try:
del jumeiyoupin_pintuan
loop.close()
except: pass
gc.collect()
print('一次大抓取完毕, 即将重新开始'.center(30, '-'))
restart_program() # 通过这个重启环境, 避免log重复打印
def main():
'''
这里的思想是将其转换为孤儿进程，然后在后台运行
:return:
'''
print('========主函数开始========') # 在调用daemon_init函数前是可以使用print到标准输出的，调用之后就要用把提示信息通过stdout发送到日志系统中了
daemon_init() # 调用之后，你的程序已经成为了一个守护进程，可以执行自己的程序入口了
print('--->>>| 孤儿进程成功被init回收成为单独进程!')
# time.sleep(10) # daemon化自己的程序之后，sleep 10秒，模拟阻塞
just_fuck_run()
if __name__ == '__main__':
if IS_BACKGROUND_RUNNING:
main()
else:
just_fuck_run() | [
"[email protected]"
] | |
ca7f8c687c2ad6eac7c008eb15dbfde0026b8190 | 3056736f013b25d1e70adb355082c578e5091314 | /ml_quality/datasets/shit/practice.py | 2f86668552f950b2489f0e318e85746a42d243a5 | [] | no_license | flerchy/codestyle-core | dcad1385b76678e4473f0804d2ecfaa03866d124 | a009bcd2f17dadd440ea5ff24bd3167e38948bff | refs/heads/master | 2021-01-20T03:21:16.694322 | 2017-06-05T05:52:35 | 2017-06-05T05:52:35 | 89,524,181 | 0 | 1 | null | null | null | null | UTF-8 | Python | false | false | 10,684 | py | import re
def count_words(passage):
words = re.findall(r'[^ \n]+', passage)
return len(words)
passage ='''The number of orderings of the 52 cards in a deck of cards
is so great that if every one of the almost 7 billion people alive
today dealt one ordering of the cards per second, it would take
2.5 * 10**40 times the age of the universe to order the cards in every
possible way.'''
print count_words(passage)
speed_of_light = 300000. # km per second
def speed_fraction(time, distance):
return (distance*2.0*1000/time)/speed_of_light
print speed_fraction(50,5000)
#>>> 0.666666666667
print speed_fraction(50,10000)
def convert_seconds(t):
h = int(t)/3600
left = t%3600
m = int(left)/60
s = left%60
q = [str(h), 'hour,' if h == 1 else 'hours,', str(m), 'minute,' if m==1 else 'minutes,',str(s), 'second' if s==1 else 'seconds']
return ' '.join(q)
print convert_seconds(3661)
#>>> 1 hour, 1 minute, 1 second
print convert_seconds(7325)
#>>> 2 hours, 2 minutes, 5 seconds
print convert_seconds(7261.7)
#>>> 2 hours, 1 minute, 1.7 seconds
def download_time(fsize, funit, bwidth, bunit):
unit = {'kb': 2**10, 'kB': 2**10*8, 'Mb':2**20, 'MB':2**20*8, 'Gb': 2**30, 'GB': 2**30*8, 'Tb': 2**40, 'TB':2**40*8}
t = fsize*1.0*unit[funit] / (bwidth*unit[bunit])
return convert_seconds(t)
print download_time(1024,'kB', 1, 'MB')
#>>> 0 hours, 0 minutes, 1 second
print download_time(1024,'kB', 1, 'Mb')
#>>> 0 hours, 0 minutes, 8 seconds # 8.0 seconds is also acceptable
print download_time(13,'GB', 5.6, 'MB')
#>>> 0 hours, 39 minutes, 37.1428571429 seconds
print download_time(13,'GB', 5.6, 'Mb')
#>>> 5 hours, 16 minutes, 57.1428571429 seconds
print download_time(10,'MB', 2, 'kB')
#>>> 1 hour, 25 minutes, 20 seconds # 20.0 seconds is also acceptable
print download_time(10,'MB', 2, 'kb')
#>>> 11 hours, 22 minutes, 40 seconds # 40.0 seconds is also acceptable
# Introducing Your Web Browser
#
#
# Although we have not put our HTML interpreter and our JavaScript
# interpreter together yet, we can still render HTML-only web pages.
#
# A critical concept in interpreting HTML is proper tag nesting.
#
# In this exercise you will learn a bit of HTML on your own and construct
# properly nested, simple HTML that renders to match the reference image we
# have provided. You do not have to match the exact text shown, but you do
# have to match the order and nesting of the tags used.
#
# See the rendering image for reference output.
#
# In class we have discussed a few HTML tags, such as <b>, <i>,
# <a href="http://www.udacity.com">, and <p>. It turns out, there are many
# more. In this exercise you will reverse-engineer some HTML tags you may
# not have seen before. Explicitly teaching you the various HTML tags is
# not a focus of this course, but you now know enough to learn them
# easily on your own.
#
# Complete the webpage string below with HTML that renders an image similar
# to the reference. You must match the tag ordering and nesting, but you
# can change the text.
#
# The reference image explicitly names every HTML tag it uses (it puts them
# in parentheses instead of angle brackets). If you would like a bit of a
# challenge, you can infer everything from that image alone. However, you
# are also encouraged to use any external source or HTML tutorial you would
# like. For example, these may help you brush up:
#
# http://www.w3schools.com/html/html_primary.asp
# http://www.w3schools.com/html/html_elements.asp
# http://www.w3schools.com/html/html_headings.asp
# http://www.w3schools.com/html/html_lists.asp
# http://www.w3schools.com/html/html_images.asp
#
# Hint 1: The most common error is <b> opening one tag then </u> closing
# another. For our web browser, even tags like <p>, <li> and <img> must be
# properly closed! (Real-world web browsers are more forgiving, but one
# purpose of this exercise is to master properly nested tags.)
#
# Hint 2: Unlike <a href=...>my text</a>, do not put any text inside
# <img src=...></img>. Just close it immediately.
webpage = """<html>
<h1>Level One Headings Use (H1) Tags</h1>
<p>Paragraphs use (P) tags. Unordered lists use (UL) tags.
<ul>
<li> List items use (LI) tags. </li>
<!-- You should update this HTML until the order and nesting of
the tags match the reference image. -->
</ul>
</p>
</html>
"""
# Display the page!
import ply.lex as lex
import ply.yacc as yacc
import htmltokens
import htmlgrammar
import htmlinterp
import graphics as graphics
import jstokens
htmllexer = lex.lex(module=htmltokens)
htmlparser = yacc.yacc(module=htmlgrammar,tabmodule="parsetabhtml")
ast = htmlparser.parse(webpage,lexer=htmllexer)
jslexer = lex.lex(module=jstokens)
graphics.initialize() # Enables display of output.
htmlinterp.interpret(ast)
graphics.finalize() # Enables display of output.
# "I Could Wile Away The Hours"
#
#
# Although our HTML and JavaScript interpreters are not yet integrated into
# a single browser, we can still extend our JavaScript interpreter
# independently. We already have support for recursive functions and "if"
# statements, but it would be nice to add support for "while".
#
# Consider the following two JavaScript fragments:
#
# var i = 0;
# while (i <= 5) {
# document.write(i);
# i = i + 2;
# };
#
# And:
#
# function myloop(i) {
# if (i <= 5) {
# document.write(i);
# myloop(i + 2);
# } ;
# }
# myloop(0);
#
# They both have the same effect: they both write 0, 2 and 4 to the
# webpage. (In fact, while loops and recursion are equally powerful! You
# really only need one in your language, but it is very convenient to have
# them both.)
#
# We can extend our lexer to recognize 'while' as a keyword. We can extend
# our parser with a new statement rule like this:
#
# def p_stmt_while(p):
# 'stmt : WHILE exp compoundstmt'
# p[0] = ("while",p[2],p[3])
#
# Now we just need to extend our interpreter to handle while loops. The
# meaning of a while loop is:
#
# 1. First, evaluate the conditional expression in the current
# environment. If it evaluates to false, stop.
#
# 2. Evaluate the body statements in the current environment.
#
# 3. Go to step 1.
#
# Recall that our JavaScript interpreter might have functions like:
#
# eval_stmts(stmts,env)
# eval_stmt(stmt,env)
# eval_exp(exp,env)
#
# For this assignment, you should write a procedure:
#
# eval_while(while_stmt,evn)
#
# Your procedure can (and should!) call those other procedures. Here is
# how our interpreter will call your new eval_while():
#
# def eval_stmt(stmt,env):
# stype = stmt[0]
# if stype == "if-then":
# cexp = stmt[1]
# then_branch = stmt[2]
# if eval_exp(cexp,env):
# eval_stmts(then_branch,env)
# elif stype == "while":
# eval_while(stmt,env)
# elif stype == "if-then-else":
# ...
#
# Hint 1: We have structured this problem so that it is difficult for you
# to test (e.g., because we have not provided you the entire JavaScript
# interpreter framework). Thus, you should think carefully about how to
# write the code correctly. Part of the puzzle of this exercise is to
# reason to the correct answer without "guess and check" testing.
#
# Hint 2: It is totally legal to define JavaScript's while using a Python
# while statement. (Remember, an interpreter is like a translator.) You
# could also define JavaScript's while using recursion in Python.
#
# Hint 3: Extract the conditional expression and while loop body statements
# from while_stmt first.
def eval_while(while_stmt, exp):
# Fill in your own code here. Can be done in as few as 4 lines.
# Higher-Order Functions
#
# Back in Unit 3 we introduced Python List Comprehensions -- a concise
# syntax for specifying a new list in terms of a transformation of an old
# one.
#
# For exmaple:
#
# numbers = [1,2,3,4,5]
# odds = [n for n in numbers if n % 2 == 1]
# squares = [n * n for n in numbers]
#
# That code assigns [1,3,5] to odds and [1,4,9,16,25] to squares. The first
# operation is sometimes called "filter" (because we are filtering out
# unwanted elements) and the second operation is sometimes called "map"
# (because we are mapping, or transforming, all of the elements in a list).
#
# Python also has functions behave similarly:
#
# odds = filter(lambda n : n % 2 == 1, numbers)
# squares = map(lambda n : n * n, numbers)
#
# The filter() and map() definitions for odds and squares produce the same
# results as the list comprehension approaches. In other words, we can
# define (or implement) list comprehensions in terms of map and filter.
#
# In this exercise we take that notion one step beyond, by making
# specialized maps and filters. For example, suppose that we know that we
# will be filtering many lists down to only their odd elements. Then we
# might want something like this:
#
# filter_odds = filter_maker(lambda n : n % 2 == 1)
# odds = filter_odds(numbers)
#
# In this example, "filter_maker()" is a function that takes a function as
# an argument and returns a function as its result. We say that
# filter_maker is a *higher order function*.
#
# Complete the code below with definitions for filter_maker() and
# map_maker().
#
# Hint: You can use either "lambda" or nested Python function definitions.
# Both will work. The function you return from filter_maker(f) will have to
# reference f, so you'll want to think about nested environments.
def filter_maker(f):
# Fill in your code here. You must return a function.
def map_maker(f):
# Fill in your code here. You must return a function.
# We have included a few test cases. You will likely want to add your own.
numbers = [1,2,3,4,5,6,7]
filter_odds = filter_maker(lambda n : n % 2 == 1)
print filter_odds(numbers) == [1,3,5,7]
length_map = map_maker(len)
words = "Scholem Aleichem wrote Tevye the Milkman, which was adapted into the musical Fiddler on the Roof.".split()
print length_map(words) == [7, 8, 5, 5, 3, 8, 5, 3, 7, 4, 3, 7, 7, 2, 3, 5]
string_reverse_map = map_maker(lambda str : str[::-1])
# str[::-1] is cute use of the Python string slicing notation that
# reverses str. A hidden gem in the homework!
print string_reverse_map(words) == ['melohcS', 'mehcielA', 'etorw', 'eyveT', 'eht', ',namkliM', 'hcihw', 'saw', 'detpada', 'otni', 'eht', 'lacisum', 'relddiF', 'no', 'eht', '.fooR']
square_map = map_maker(lambda n : n * n)
print [n*n for n in numbers if n % 2 == 1] == square_map(filter_odds(numbers))
| [
"[email protected]"
] | |
0818baf769d8d948dd2bfb3eefca8dbaf7ca45fb | 52bdad813d9bf9b5e8436b87bcb9b86ecf14370a | /tests/test_graph_group.py | bffb15475e75e7e15d413000780e3a22f9288a61 | [
"MIT"
] | permissive | lsgd/Office365-REST-Python-Client | 8e1abfd78824caed04e0e5bdf7cef66f6331ac6a | 403a3e884e042e1d64012329713b76db133e9d5f | refs/heads/master | 2021-01-01T13:56:38.242662 | 2020-02-09T13:42:31 | 2020-02-09T13:42:31 | 239,308,985 | 0 | 0 | null | 2020-02-09T13:26:43 | 2020-02-09T13:26:42 | null | UTF-8 | Python | false | false | 1,257 | py | import unittest
import uuid
from office365.directory.groupCreationProperties import GroupCreationProperties
from office365.runtime.client_request_exception import ClientRequestException
from tests.graph_case import GraphTestCase
class TestGraphGroup(GraphTestCase):
"""Tests for Azure Active Directory (Azure AD) groups"""
target_group = None
def test1_create_group(self):
try:
grp_name = "Group_" + uuid.uuid4().hex
properties = GroupCreationProperties(grp_name)
properties.securityEnabled = False
properties.mailEnabled = True
properties.groupTypes = ["Unified"]
new_group = self.client.groups.add(properties)
self.client.execute_query()
self.assertIsNotNone(new_group.properties['id'])
self.__class__.target_group = new_group
except ClientRequestException as e:
if e.code == 'Directory_QuotaExceeded':
self.__class__.target_group = None
else:
raise
def test2_delete_group(self):
grp_to_delete = self.__class__.target_group
if grp_to_delete is not None:
grp_to_delete.delete_object()
self.client.execute_query()
| [
"[email protected]"
] | |
688470d41918e3865f9334327d904a306d8cd50c | 400e10dfd9e21ae5092f5184753faa91a9df9277 | /Programers_backup/LEVEL 2/땅따먹기.py | 9b6caaa3ab6b5d98d1a7de757610cbd8748dcaf9 | [] | no_license | MyaGya/Python_Practice | d4aff327a76010603f038bcf4491a14ea51de304 | 0391d1aa6d530f53715c968e5ea6a02cf745fde5 | refs/heads/master | 2023-06-14T07:48:19.998573 | 2021-07-12T05:50:52 | 2021-07-12T05:50:52 | 280,452,168 | 0 | 0 | null | 2021-06-23T13:37:56 | 2020-07-17T14:56:24 | Python | UTF-8 | Python | false | false | 602 | py | '''
def solution(land):
# init
pick = [[0 for _ in range(4)] for _ in range(len(land))]
pick[0] = land[0]
for i in range(1,len(land)):
for j in range(4):
pick[i][j] = max([pick[i-1][k] for k in range(4) if k != j]) + land[i][j]
pick[0][0] = 0
print(id(pick[0]))
print(id(land[0]))
return max(pick[i])
'''
def solution(land):
for i in range(1, len(land)):
for j in range(4):
land[i][j] += max(land[i-1][(j+1)%4],land[i-1][(j+2)%4],land[i-1][(j+3)%4])
return max(land[i])
print(solution([[1,2,3,5],[5,6,7,8],[4,3,2,1]])) | [
"[email protected]"
] | |
37b9ea83dc0b2cb3ef93c1ad2526a05d7262ba32 | eb40dce4039d528b9cd06dbeda75da09d09d7fc5 | /need_install/Django-1.8.17/django/__init__.py | cb9997a426a00b1d73b443fd2d3dc00e55446c10 | [
"BSD-3-Clause",
"Apache-2.0"
] | permissive | MulticsYin/MulticsSH | 39b62189446787c7f0f037b1640c9c780bd1dddd | 5837a0bff0e7da0e8535e4e0b31ef6baf24274b4 | refs/heads/master | 2021-08-28T07:53:51.759679 | 2017-12-11T15:31:03 | 2017-12-11T15:31:03 | 82,428,902 | 4 | 2 | null | null | null | null | UTF-8 | Python | false | false | 520 | py | from django.utils.version import get_version
VERSION = (1, 8, 17, 'final', 0)
__version__ = get_version(VERSION)
def setup():
"""
Configure the settings (this happens as a side effect of accessing the
first setting), configure logging and populate the app registry.
"""
from django.apps import apps
from django.conf import settings
from django.utils.log import configure_logging
configure_logging(settings.LOGGING_CONFIG, settings.LOGGING)
apps.populate(settings.INSTALLED_APPS)
| [
"[email protected]"
] | |
0140f30b8fe5d4f7d45eef45da0f4de62b13ecaa | f0d713996eb095bcdc701f3fab0a8110b8541cbb | /7RrPMoWifqRHPPqj2_6.py | 52a954c8cc7463202c8c110383489e5478d858be | [] | no_license | daniel-reich/turbo-robot | feda6c0523bb83ab8954b6d06302bfec5b16ebdf | a7a25c63097674c0a81675eed7e6b763785f1c41 | refs/heads/main | 2023-03-26T01:55:14.210264 | 2021-03-23T16:08:01 | 2021-03-23T16:08:01 | 350,773,815 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 1,666 | py | """
Traditional safes use a three-wheel locking mechanism, with the safe
combination entered using a dial on the door of the safe. The dial is marked
with clockwise increments between 0 and 99. The three-number combination is
entered by first dialling to the right (clockwise), then to the left (anti-
clockwise), and then to the right (clockwise) again. Combination numbers are
read from the top of the dial:
Given the starting (top) position of the dial and the increments used for each
turn of the dial, return a list containing the _combination_ of the safe.
### Step-By-Step Example
safecracker(0, [3, 10, 5]) ➞ [97, 7, 2]
Starting dial position of 0 (same as the diagram above).
First turn (rightward) of 3 increments:
0 -> 99, 98, 97
First number of combination = 97
Second turn (leftward) of 10 increments:
97 -> 98, 99, 0, 1, 2, 3, 4, 5, 6, 7
Second number of combination = 7
Third turn (rightward) of 5 increments:
7 -> 6, 5, 4, 3, 2
Third number of combination = 2
The final combination is [97, 7, 2]
### Other Examples
safecracker(96, [54, 48, 77]) ➞ [42, 90, 13]
safecracker(43, [51, 38, 46]) ➞ [92, 30, 84]
safecracker(4, [69, 88, 55]) ➞ [35, 23, 68]
### Notes
Each of the three combination numbers will be different.
"""
def safecracker(start, increments):
res=[]
for i in range(len(increments)):
if i == 0:
res += [(start+increments[i]*(-1)**(1+i))%100]
else:
res += [(res[-1]+increments[i]*(-1)**(1+i))%100]
return res
| [
"[email protected]"
] | |
fc8715d8e9b684fcb7dbbfd21562a3ee5201e77d | eb25b38b400425c91bcce4d2c1b3d4e75d8f59ee | /tests/test_parser.py | 7e20392076512563a715c081ebdbff6b6c22eabc | [
"MIT"
] | permissive | Citteny/cutadapt | f098201eebb3fc74dd38477043babc2b18a61a68 | c9573d295bc3382697a554e1d0e91047374ff7da | refs/heads/master | 2022-12-23T04:26:13.111725 | 2022-12-11T11:33:00 | 2022-12-11T11:33:00 | 229,545,869 | 0 | 0 | MIT | 2020-12-07T18:56:10 | 2019-12-22T09:35:31 | null | UTF-8 | Python | false | false | 15,010 | py | import os
from textwrap import dedent
import pytest
from dnaio import Sequence
from cutadapt.adapters import (
LinkedAdapter,
BackAdapter,
FrontAdapter,
InvalidCharacter,
PrefixAdapter,
RightmostFrontAdapter,
)
from cutadapt.parser import (
AdapterSpecification,
parse_search_parameters,
expand_braces,
make_adapters_from_specifications,
make_adapters_from_one_specification,
_make_not_linked_adapter,
make_adapter,
_normalize_ellipsis,
)
from cutadapt.modifiers import ModificationInfo
def test_expand_braces():
assert expand_braces("") == ""
assert expand_braces("A") == "A"
assert expand_braces("A{0}") == ""
assert expand_braces("A{1}") == "A"
assert expand_braces("A{2}") == "AA"
assert expand_braces("A{2}C") == "AAC"
assert expand_braces("ACGTN{3}TGACCC") == "ACGTNNNTGACCC"
assert expand_braces("ACGTN{10}TGACCC") == "ACGTNNNNNNNNNNTGACCC"
assert expand_braces("ACGTN{3}TGA{4}CCC") == "ACGTNNNTGAAAACCC"
assert expand_braces("ACGTN{0}TGA{4}CCC") == "ACGTTGAAAACCC"
def test_expand_braces_fail():
for expression in [
"{",
"}",
"{}",
"{5",
"{1}",
"A{-7}",
"A{",
"A{1",
"N{7",
"AN{7",
"A{4{}",
"A{4}{3}",
"A{b}",
"A{6X}",
"A{X6}",
"A}A",
]:
with pytest.raises(ValueError):
expand_braces(expression)
def test_parse_file_notation(tmp_path):
tmp = tmp_path / "adapters.fasta"
tmp.write_text(
dedent(
""">first_name
ADAPTER1
>second_name
ADAPTER2
"""
)
)
search_parameters = dict(
max_errors=0.2,
min_overlap=4,
read_wildcards=False,
adapter_wildcards=False,
indels=False,
)
adapters = list(
make_adapters_from_one_specification(
"file:" + os.fspath(tmp),
adapter_type="back",
search_parameters=search_parameters,
)
)
assert len(adapters) == 2
assert adapters[0].name == "first_name"
assert adapters[0].sequence == "ADAPTER1"
assert adapters[1].name == "second_name"
assert adapters[1].sequence == "ADAPTER2"
for a in adapters:
assert a.max_error_rate == 0.2
assert a.min_overlap == 4
assert not a.read_wildcards
assert not a.adapter_wildcards
assert not a.indels
def test_parse_not_linked():
p = AdapterSpecification.parse
assert p("A", "front") == AdapterSpecification(None, None, "A", {}, "front", False)
assert p("A", "back") == AdapterSpecification(None, None, "A", {}, "back", False)
assert p("A", "anywhere") == AdapterSpecification(
None, None, "A", {}, "anywhere", False
)
assert p("^A", "front") == AdapterSpecification(
None, "anchored", "A", {}, "front", False
)
assert p("XXXA", "front") == AdapterSpecification(
None, "noninternal", "A", {}, "front", False
)
assert p("A$", "back") == AdapterSpecification(
None, "anchored", "A", {}, "back", False
)
assert p("AXXXX", "back") == AdapterSpecification(
None, "noninternal", "A", {}, "back", False
)
assert p("a_name=ADAPT", "front") == AdapterSpecification(
"a_name", None, "ADAPT", {}, "front", False
)
@pytest.mark.parametrize("where", ("front", "back"))
@pytest.mark.parametrize("reqopt", ("required", "optional"))
def test_parse_invalid_adapter_specific_parameter(where, reqopt):
with pytest.raises(ValueError) as e:
_make_not_linked_adapter("A;{}".format(reqopt), "name", where, dict())
assert "can only be used within linked adapters" in e.value.args[0]
def test_parse_invalid_adapter_type():
with pytest.raises(ValueError) as e:
AdapterSpecification.parse("A", "invalid_type")
assert "adapter_type must be front, back or anywhere" in e.value.args[0]
@pytest.mark.parametrize(
"spec,adapter_type",
[
("^XA", "front"),
("^AX", "front"),
("XA$", "back"),
("AX$", "back"),
],
)
def test_parse_double_placement_restrictions(spec, adapter_type):
with pytest.raises(ValueError) as e:
AdapterSpecification.parse(spec, adapter_type)
assert "cannot use multiple placement restrictions" in e.value.args[0]
def test_parse_misplaced_placement_restrictions():
with pytest.raises(ValueError) as e:
AdapterSpecification.parse("A$", "front")
assert "Allowed placement restrictions for a 5' adapter" in e.value.args[0]
with pytest.raises(ValueError) as e:
AdapterSpecification.parse("^A", "back")
assert "Allowed placement restrictions for a 3' adapter" in e.value.args[0]
def test_restriction_to_class():
with pytest.raises(ValueError) as e:
AdapterSpecification._restriction_to_class("anywhere", "noninternal", False)
assert "No placement may be specified" in e.value.args[0]
def test_parse_search_parameters():
p = parse_search_parameters
assert p("e=0.1") == {"max_errors": 0.1}
assert p("error_rate=0.1") == {"max_errors": 0.1}
assert p("max_errors=2") == {"max_errors": 2}
assert p("o=5") == {"min_overlap": 5}
assert p("min_overlap=5") == {"min_overlap": 5}
assert p("o=7; e=0.4") == {"min_overlap": 7, "max_errors": 0.4}
assert p("anywhere") == {"anywhere": True}
assert p("required") == {"required": True}
assert p("optional") == {"required": False}
assert p("noindels") == {"indels": False}
assert p("indels") == {"indels": True}
assert p("rightmost") == {"rightmost": True}
with pytest.raises(ValueError):
p("e=hallo")
with pytest.raises(KeyError):
p("bla=0.1")
with pytest.raises(ValueError):
p("e=")
with pytest.raises(KeyError) as e:
p("e=0.1;e=0.1")
assert "specified twice" in e.value.args[0]
with pytest.raises(KeyError) as e:
p("e=0.1;max_errors=0.1")
assert "specified twice" in e.value.args[0]
with pytest.raises(ValueError) as e:
p("optional; required")
assert "cannot be specified at the same time" in e.value.args[0]
def test_make_adapter_front():
parameters = dict(
max_errors=0.2,
min_overlap=4,
read_wildcards=False,
adapter_wildcards=False,
indels=False,
)
a = make_adapter("ACGTACGT; e=0.15", "front", parameters)
assert isinstance(a, FrontAdapter)
assert a.max_error_rate == 0.15
assert a.min_overlap == 4
with pytest.raises(ValueError) as e:
make_adapter("A", "invalid-cmdline-type", parameters)
assert "adapter_type must be" in e.value.args[0]
with pytest.raises(ValueError) as e:
make_adapter("^ACGT;min_overlap=3", "front", parameters)
assert "not possible" in e.value.args[0]
def test_make_adapter_rightmost_front():
a = make_adapter("ACGT; rightmost", "front", dict())
assert isinstance(a, RightmostFrontAdapter)
with pytest.raises(ValueError) as e:
make_adapter("ACGT; rightmost", "back", dict())
assert "only allowed" in e.value.args[0]
def test_make_adapter_back():
parameters = dict(
max_errors=0.2,
min_overlap=4,
read_wildcards=False,
adapter_wildcards=False,
indels=False,
)
a = make_adapter("ACGTAAAA; o=5; e=0.11", "back", parameters)
assert isinstance(a, BackAdapter)
assert a.max_error_rate == 0.11
assert a.min_overlap == 5
a = make_adapter("ACGTAAAA; noindels", "back", parameters)
assert isinstance(a, BackAdapter)
assert a.indels is False
a = make_adapter("ACGTAAAA; indels", "back", parameters)
assert isinstance(a, BackAdapter)
assert a.indels is True
for spec in (
"thename=ACG;e=0.15 ... TGT;e=0.17",
"thename=ACG;e=0.15...TGT;e=0.17",
):
a = make_adapter(spec, "back", parameters)
assert isinstance(a, LinkedAdapter)
assert a.front_adapter.max_error_rate == 0.15
assert a.back_adapter.max_error_rate == 0.17
with pytest.raises(ValueError) as e:
make_adapter("ACGT$;min_overlap=3", "back", parameters)
assert "not possible" in e.value.args[0]
with pytest.raises(ValueError) as e:
make_adapter("ACGT;min_overlap=5", "back", parameters)
assert "exceeds" in e.value.args[0]
def test_parse_file_notation_with_parameters(tmp_path):
tmp = tmp_path / "adapters.fasta"
tmp.write_text(
dedent(
""">first_name
ADAPTER1;min_overlap=2
>second_name
ADAPTER2;max_errors=0.4
"""
)
)
parameters = dict(
max_errors=0.2,
min_overlap=4,
read_wildcards=False,
adapter_wildcards=False,
indels=False,
)
adapters = list(
make_adapters_from_one_specification(
"file:" + os.fspath(tmp) + ";max_errors=0.3;min_overlap=5;indels",
adapter_type="back",
search_parameters=parameters,
)
)
assert len(adapters) == 2
a = adapters[0]
assert isinstance(a, BackAdapter)
assert a.name == "first_name"
assert a.max_error_rate == 0.3
assert a.min_overlap == 2
assert a.indels is True
a = adapters[1]
assert isinstance(a, BackAdapter)
assert a.name == "second_name"
assert a.max_error_rate == 0.4
assert a.min_overlap == 5
assert a.indels is True
def test_parse_file_notation_with_anchoring(tmp_path):
tmp = tmp_path / "adapters.fasta"
tmp.write_text(
dedent(
""">first
ACCGGGTTTT
>second
AAAACCCGGT
"""
)
)
adapters = list(
make_adapters_from_one_specification(
"^file:" + os.fspath(tmp) + ";max_errors=0.3",
adapter_type="front",
search_parameters=dict(),
)
)
assert len(adapters) == 2
for a in adapters:
assert isinstance(a, PrefixAdapter)
assert a.max_error_rate == 0.3
def test_parse_with_adapter_sequence_as_a_path(tmp_path):
with pytest.raises(InvalidCharacter):
make_adapter("invalid.character", "back", dict())
# user forgot to write "file:"
path = tmp_path / "afile.fasta"
path.write_text(">abc\nACGT\n")
with pytest.raises(InvalidCharacter) as e:
list(make_adapters_from_one_specification(str(path), "back", dict()))
assert "A file exists named" in e.value.args[0]
def test_make_adapters_from_specifications():
with pytest.raises(ValueError) as e:
make_adapters_from_specifications([("invalid-type", "A")], dict())
assert "adapter_type must be" in e.value.args[0]
def test_normalize_ellipsis():
ne = _normalize_ellipsis
assert ne("ACGT", "", "back") == ("ACGT", "front") # -a ACGT...
assert ne("ACGT", "", "front") == ("ACGT", "front") # -g ACGT...
assert ne("", "ACGT", "back") == ("ACGT", "back") # -a ...ACGT
with pytest.raises(ValueError) as e:
# -g ...ACGT
ne("", "ACGT", "front")
assert "Invalid adapter specification" in e.value.args[0]
with pytest.raises(ValueError) as e:
ne("A", "C", "back")
assert "either" in e.value.args[0]
with pytest.raises(ValueError) as e:
ne("A", "", "anywhere")
assert "No ellipsis" in e.value.args[0]
@pytest.mark.parametrize(
"seq,req1,req2",
[
("ACG...TGT", False, False),
("ACG...TGT$", False, True),
("^ACG...TGT", True, False),
("^ACG...TGT$", True, True),
],
)
def test_anchoring_makes_front_linked_adapter_required(seq, req1, req2):
# -a X...Y
a = make_adapter(seq, "back", dict())
assert isinstance(a, LinkedAdapter)
assert a.front_required is req1
assert a.back_required is req2
@pytest.mark.parametrize(
"r1,r2,req1,req2",
[
("", "", False, False),
("", ";required", False, True),
(";required", "", True, False),
(";required", ";required", True, True),
("", ";optional", False, False),
(";optional", "", False, False),
(";optional", ";optional", False, False),
],
)
def test_linked_adapter_back_required_optional(r1, r2, req1, req2):
# -a X...Y
a = make_adapter("ACG" + r1 + "...TGT" + r2, "back", dict())
assert isinstance(a, LinkedAdapter)
assert a.front_required is req1
assert a.back_required is req2
@pytest.mark.parametrize(
"r1,r2,exp1,exp2",
[
("", "", True, True),
("", ";required", True, True),
(";required", "", True, True),
(";required", ";required", True, True),
("", ";optional", True, False),
(";optional", "", False, True),
(";optional", ";optional", False, False),
],
)
def test_linked_adapter_front_required_optional(r1, r2, exp1, exp2):
# -g X...Y
a = make_adapter("ACG" + r1 + "...TGT" + r2, "front", dict())
assert isinstance(a, LinkedAdapter)
assert a.front_required is exp1
assert a.back_required is exp2
def test_linked_adapter_parameters():
# issue #394
a = make_adapter("ACG...TGT", "back", dict(max_errors=0.17, indels=False))
assert isinstance(a, LinkedAdapter)
assert a.front_adapter.max_error_rate == 0.17
assert a.back_adapter.max_error_rate == 0.17
assert not a.front_adapter.indels
assert not a.back_adapter.indels
def test_linked_adapter_name():
# issue #414
a = make_adapter("the_name=^ACG...TGT", "back", dict())
assert isinstance(a, LinkedAdapter)
assert a.create_statistics().name == "the_name"
def test_anywhere_parameter_back():
adapter = make_adapter("CTGAAGTGAAGTACACGGTT;anywhere", "back", dict())
assert isinstance(adapter, BackAdapter)
assert adapter._force_anywhere
# TODO move the rest to a separate test
read = Sequence("foo1", "TGAAGTACACGGTTAAAAAAAAAA")
from cutadapt.modifiers import AdapterCutter
cutter = AdapterCutter([adapter])
trimmed_read = cutter(read, ModificationInfo(read))
assert trimmed_read.sequence == ""
def test_anywhere_parameter_rightmost_front():
adapter = make_adapter("ACGT; rightmost; anywhere", "front", dict())
assert isinstance(adapter, RightmostFrontAdapter)
assert adapter._force_anywhere
def test_anywhere_parameter_front():
adapter = make_adapter("CTGAAGTGAAGTACACGGTT;anywhere", "front", dict())
assert isinstance(adapter, FrontAdapter)
assert adapter._force_anywhere
# TODO move the rest to a separate test
read = Sequence("foo1", "AAAAAAAAAACTGAAGTGAA")
from cutadapt.modifiers import AdapterCutter
cutter = AdapterCutter([adapter])
trimmed_read = cutter(read, ModificationInfo(read))
assert trimmed_read.sequence == ""
def test_linked_adapter_rightmost():
a = make_adapter("ACG;rightmost...TGT", "back", dict())
assert isinstance(a, LinkedAdapter)
assert isinstance(a.front_adapter, RightmostFrontAdapter)
| [
"[email protected]"
] | |
f8145e407078fb63ba6739b24b35529c2ee5a505 | 089fc0ce61e8e433355b304c9ca7cf8a902cfa88 | /backend/test3_21903/settings.py | 35450e3626d2693990c3856199b4a2891c541c15 | [] | no_license | crowdbotics-apps/test3-21903 | 05248130c0c58b390223fd90d4e5e458ea97f303 | 4ec8947918dbce759e7ec7a7f421352768796a79 | refs/heads/master | 2023-01-06T05:56:43.992317 | 2020-10-23T22:38:28 | 2020-10-23T22:38:28 | 306,760,678 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 6,156 | py | """
Django settings for test3_21903 project.
Generated by 'django-admin startproject' using Django 2.2.2.
For more information on this file, see
https://docs.djangoproject.com/en/2.2/topics/settings/
For the full list of settings and their values, see
https://docs.djangoproject.com/en/2.2/ref/settings/
"""
import os
import environ
import logging
env = environ.Env()
# SECURITY WARNING: don't run with debug turned on in production!
DEBUG = env.bool("DEBUG", default=False)
# Build paths inside the project like this: os.path.join(BASE_DIR, ...)
BASE_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__)))
# Quick-start development settings - unsuitable for production
# See https://docs.djangoproject.com/en/2.2/howto/deployment/checklist/
# SECURITY WARNING: keep the secret key used in production secret!
SECRET_KEY = env.str("SECRET_KEY")
ALLOWED_HOSTS = env.list("HOST", default=["*"])
SITE_ID = 1
SECURE_PROXY_SSL_HEADER = ("HTTP_X_FORWARDED_PROTO", "https")
SECURE_SSL_REDIRECT = env.bool("SECURE_REDIRECT", default=False)
# Application definition
INSTALLED_APPS = [
"django.contrib.admin",
"django.contrib.auth",
"django.contrib.contenttypes",
"django.contrib.sessions",
"django.contrib.messages",
"django.contrib.staticfiles",
"django.contrib.sites",
"delivery_order",
"driver",
"menu",
"delivery_user_profile",
]
LOCAL_APPS = [
"home",
"users.apps.UsersConfig",
]
THIRD_PARTY_APPS = [
"rest_framework",
"rest_framework.authtoken",
"rest_auth",
"rest_auth.registration",
"bootstrap4",
"allauth",
"allauth.account",
"allauth.socialaccount",
"allauth.socialaccount.providers.google",
"django_extensions",
"drf_yasg",
# start fcm_django push notifications
"fcm_django",
# end fcm_django push notifications
]
INSTALLED_APPS += LOCAL_APPS + THIRD_PARTY_APPS
MIDDLEWARE = [
"django.middleware.security.SecurityMiddleware",
"django.contrib.sessions.middleware.SessionMiddleware",
"django.middleware.common.CommonMiddleware",
"django.middleware.csrf.CsrfViewMiddleware",
"django.contrib.auth.middleware.AuthenticationMiddleware",
"django.contrib.messages.middleware.MessageMiddleware",
"django.middleware.clickjacking.XFrameOptionsMiddleware",
]
ROOT_URLCONF = "test3_21903.urls"
TEMPLATES = [
{
"BACKEND": "django.template.backends.django.DjangoTemplates",
"DIRS": [],
"APP_DIRS": True,
"OPTIONS": {
"context_processors": [
"django.template.context_processors.debug",
"django.template.context_processors.request",
"django.contrib.auth.context_processors.auth",
"django.contrib.messages.context_processors.messages",
],
},
},
]
WSGI_APPLICATION = "test3_21903.wsgi.application"
# Database
# https://docs.djangoproject.com/en/2.2/ref/settings/#databases
DATABASES = {
"default": {
"ENGINE": "django.db.backends.sqlite3",
"NAME": os.path.join(BASE_DIR, "db.sqlite3"),
}
}
if env.str("DATABASE_URL", default=None):
DATABASES = {"default": env.db()}
# Password validation
# https://docs.djangoproject.com/en/2.2/ref/settings/#auth-password-validators
AUTH_PASSWORD_VALIDATORS = [
{
"NAME": "django.contrib.auth.password_validation.UserAttributeSimilarityValidator",
},
{
"NAME": "django.contrib.auth.password_validation.MinimumLengthValidator",
},
{
"NAME": "django.contrib.auth.password_validation.CommonPasswordValidator",
},
{
"NAME": "django.contrib.auth.password_validation.NumericPasswordValidator",
},
]
# Internationalization
# https://docs.djangoproject.com/en/2.2/topics/i18n/
LANGUAGE_CODE = "en-us"
TIME_ZONE = "UTC"
USE_I18N = True
USE_L10N = True
USE_TZ = True
# Static files (CSS, JavaScript, Images)
# https://docs.djangoproject.com/en/2.2/howto/static-files/
STATIC_URL = "/static/"
MIDDLEWARE += ["whitenoise.middleware.WhiteNoiseMiddleware"]
AUTHENTICATION_BACKENDS = (
"django.contrib.auth.backends.ModelBackend",
"allauth.account.auth_backends.AuthenticationBackend",
)
STATIC_ROOT = os.path.join(BASE_DIR, "staticfiles")
STATICFILES_DIRS = [os.path.join(BASE_DIR, "static")]
STATICFILES_STORAGE = "whitenoise.storage.CompressedManifestStaticFilesStorage"
# allauth / users
ACCOUNT_EMAIL_REQUIRED = True
ACCOUNT_AUTHENTICATION_METHOD = "email"
ACCOUNT_USERNAME_REQUIRED = False
ACCOUNT_EMAIL_VERIFICATION = "optional"
ACCOUNT_CONFIRM_EMAIL_ON_GET = True
ACCOUNT_LOGIN_ON_EMAIL_CONFIRMATION = True
ACCOUNT_UNIQUE_EMAIL = True
LOGIN_REDIRECT_URL = "users:redirect"
ACCOUNT_ADAPTER = "users.adapters.AccountAdapter"
SOCIALACCOUNT_ADAPTER = "users.adapters.SocialAccountAdapter"
ACCOUNT_ALLOW_REGISTRATION = env.bool("ACCOUNT_ALLOW_REGISTRATION", True)
SOCIALACCOUNT_ALLOW_REGISTRATION = env.bool("SOCIALACCOUNT_ALLOW_REGISTRATION", True)
REST_AUTH_SERIALIZERS = {
# Replace password reset serializer to fix 500 error
"PASSWORD_RESET_SERIALIZER": "home.api.v1.serializers.PasswordSerializer",
}
REST_AUTH_REGISTER_SERIALIZERS = {
# Use custom serializer that has no username and matches web signup
"REGISTER_SERIALIZER": "home.api.v1.serializers.SignupSerializer",
}
# Custom user model
AUTH_USER_MODEL = "users.User"
EMAIL_HOST = env.str("EMAIL_HOST", "smtp.sendgrid.net")
EMAIL_HOST_USER = env.str("SENDGRID_USERNAME", "")
EMAIL_HOST_PASSWORD = env.str("SENDGRID_PASSWORD", "")
EMAIL_PORT = 587
EMAIL_USE_TLS = True
# start fcm_django push notifications
FCM_DJANGO_SETTINGS = {"FCM_SERVER_KEY": env.str("FCM_SERVER_KEY", "")}
# end fcm_django push notifications
# Swagger settings for api docs
SWAGGER_SETTINGS = {
"DEFAULT_INFO": f"{ROOT_URLCONF}.api_info",
}
if DEBUG or not (EMAIL_HOST_USER and EMAIL_HOST_PASSWORD):
# output email to console instead of sending
if not DEBUG:
logging.warning(
"You should setup `SENDGRID_USERNAME` and `SENDGRID_PASSWORD` env vars to send emails."
)
EMAIL_BACKEND = "django.core.mail.backends.console.EmailBackend"
| [
"[email protected]"
] | |
3ecf6a1a9654381210ad1269dd4c356c791028b7 | 9fd0e9df52bff792b5b96f6dcd1fa03cc467c18d | /source/pages/admin.py | ff1ef520d4a6068150cb665ad217e8e17d4de802 | [] | no_license | mooja/ssip209 | 87d4385c7e5038bb0ecfb2a4a3faee7aa2a9cea1 | bfba4cddecff44057bd6d9da171b1ebfdb5148f3 | refs/heads/master | 2020-04-30T22:00:58.032859 | 2015-02-20T14:55:48 | 2015-02-20T14:55:48 | 24,278,046 | 0 | 0 | null | null | null | null | UTF-8 | Python | false | false | 223 | py | from django_summernote.admin import SummernoteModelAdmin
from django.contrib import admin
from .models import Page
class PageAdmin(SummernoteModelAdmin):
list_display = ['title']
admin.site.register(Page, PageAdmin)
| [
"[email protected]"
] |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.