text
stringlengths 205
677k
| id
stringlengths 47
47
| dump
stringclasses 1
value | url
stringlengths 15
2.02k
| file_path
stringlengths 125
126
| language
stringclasses 1
value | language_score
float64 0.65
1
| token_count
int64 47
152k
| score
float64 2.52
5.16
| int_score
int64 3
5
|
|---|---|---|---|---|---|---|---|---|---|
How to Make Good Soil for Your Vegetable Garden: A Simple Guide
Creating nutrient-rich soil is paramount for a thriving vegetable garden. Whether you’re an experienced gardener or just starting out, understanding the fundamentals of soil preparation can significantly impact your harvest. In this comprehensive guide, we will walk you through step-by-step instructions on how to make good soil for your vegetable garden.
Understanding Soil Components:
The Importance of Organic Matter:
Organic matter forms the backbone of fertile soil and provides essential nutrients to plants. Composed mainly of decomposed plant materials, such as leaves and compost, organic matter enhances soil structure, retains moisture, and promotes microbial activity – all vital factors in growing healthy vegetables.
Balancing Soil pH Levels:
Soil pH levels profoundly influence plant growth and nutrient availability. Most vegetables thrive in slightly acidic to neutral soils with a pH between 6.0 and 7.0. Testing your soil’s pH can be done using either DIY kits or by sending samples to a local agricultural extension office for analysis.
Adequate Drainage Is Key:
Proper drainage prevents waterlogging in the root zone while allowing oxygen flow – crucial elements necessary for healthy vegetable growth. Sandy loam soils generally provide excellent natural drainage properties; however, adding amendments like organic compost or vermiculite can improve drainage if needed.
Making Good Soil: Step-by-Step Process
1. Clearing and Preparing the Site:
Start by removing any existing vegetation from your chosen garden area using gardening tools like shovels or tillers. Ensure that no weeds are left behind as they compete with crops for nutrients.
– Covering the cleared area with a thick layer of mulch can suppress weed growth.
– Consider installing raised beds to control soil quality more efficiently.
2. Loosening the Soil:
Break up compacted soil by tilling or digging with a garden fork. This step facilitates air circulation, nutrient absorption, and root penetration.
– Avoid working on wet soil as it may lead to compaction.
– Remove any rocks, roots, or debris during this process for better planting conditions.
3. Adding Organic Matter:
Incorporate generous amounts of organic matter into your soil to enhance fertility and structure. Compost, well-aged manure, leaf mold, or peat moss are excellent choices that can be evenly mixed into the top 6-8 inches of soil.
– Ensure organic matter is completely decomposed before applying to avoid nitrogen depletion for plants.
– Aim for an incorporation ratio of around 30% organic matter in your native soil.
4. Testing and Adjusting pH Levels (if necessary):
Conduct a pH test using a reliable kit or professional analysis service if you suspect imbalanced levels. Based on the results obtained, adjust your pH by adding appropriate amendments like lime to raise acidity or sulfur to lower it gradually over time.
– Always follow recommended guidelines when adding amendments based on specific vegetable requirements.
– Retest the amended area periodically until desired pH levels are achieved.
With proper understanding and implementation of these steps, you can create fertile and nutrient-rich soil that promotes healthy vegetable growth in your garden. By balancing organic matter content while ensuring good drainage and appropriate pH levels for optimal plant development, you set yourself up for bountiful harvests year after year. Start investing in good quality soils today, and watch your vegetable garden flourish!
|
<urn:uuid:cd62d388-9596-4680-92a0-261ea03585f5>
|
CC-MAIN-2023-50
|
https://earthwildgardens.com/how-to-make-good-soil-for-vegetable-garden/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.871752 | 707 | 3.390625 | 3 |
LACEY – Hydrofluorocarbons, or HFCs, are potent greenhouse gases that contribute to climate change at rates thousands of times that of carbon dioxide. In May, Gov. Jay Inslee signed a bill cutting the use of HFCs in refrigeration, heating and cooling, foams, and aerosol products.
This week, the Washington Department of Ecology adopted reporting rules to begin that process, and also began a rulemaking process to guide the rest of the transition away from HFCs through 2024.
When the HFC law is fully implemented, it aims to cut Washington’s greenhouse gas emissions by the equivalent of 1 million metric tons of carbon dioxide a year. That’s equal to the annual emissions from 217,000 cars.
“Tackling climate change requires us to tackle every source of greenhouse gas emissions in our state,” Inslee said. “HFCs are among the most potent pollutants on the planet. Switching to safer, cleaner alternatives in equipment and products is a crucial step forward for our state.”
The law sets an aggressive timeline to end new uses of HFCs. The first step is for manufacturers, importers and distributors to report whether they use the chemicals in their products by the end of this year. Then, between 2020 and 2024, many major uses of HFCs will be phased out.
The Washington law implements rules adopted by the U.S. Environmental Protection Agency that were partially overturned in a 2017 court decision.
Because the law focuses on companies that manufacture or import HFC-containing products, users of these products – including consumers, retailers, and business owners – in most cases won’t have to do anything: When their existing equipment wears out, they can simply buy new, HFC-free replacement equipment. Equipment using environmentally safer HFC alternatives is already available and should not typically cost more than versions containing hydrofluorocarbons.
Department of Ecology News Release - August 1, 2019
|
<urn:uuid:a97bccad-4b46-4b25-a00b-7bac7dae5c2c>
|
CC-MAIN-2023-50
|
https://ecology.wa.gov/about-us/who-we-are/news/2019/aug-1-washington-begins-work-to-slash-hfcs
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.944268 | 412 | 2.8125 | 3 |
PostgreSQL is a powerful, open-source object-relational database system that uses and extends the SQL language combined with many features that safely store and scale the most complicated data workloads. The origins of PostgreSQL date back to 1986 as part of the POSTGRES project at the University of California at Berkeley and has more than 30 years of active development on the core platform.
Number Of Questions:60 Questions
Time Allocated:90 Minutes
Minimum Pass Requirement: 70%
Certification Renewal is required every two years.
|
<urn:uuid:d2305abd-512f-4545-869d-bbca036ec345>
|
CC-MAIN-2023-50
|
https://edurabh.com/index.php/introduction-to-postgresql/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.911974 | 109 | 2.921875 | 3 |
Research is beginning to paint a clearer picture of how regularly traumatic brain injuryies (TBI) occur. Reports produced by the Centers for Disease Control (CDC) estimate that about 2.8 million Americans suffer from some form of brain injury each year.
Traumatic brain injuries are dangerous and may result in lasting complications. Injuries may run from relatively mild to severe. Sadly, about 56,000 persons died as a result of traumatic brain injuries in 2010.
What Causes TBI?
Brain injury is most often associated with a significant blow to the victim’s head. These injuries often result from car accidents, sports injuries, or even falls. Surprising as it may seem, the CDC reports that falls are the leading cause of traumatic brain injuries.
Traumatic brain injury is not limited to blows to the head. An individual may suffer traumatic brain injury without physical contact.
A lack of oxygen, for example, can lead to traumatic brain injury. An oxygen-deprived brain will lose the ability to perform certain sensory, cognitive, and motor functions. If the areas of the brain controlling these functions are deprived of oxygen for an extended period of time, an individual may lose consciousness, suffer irreversible brain damage, or die.
Whiplash—which may stem from a rapid back-and-forth movement of the neck— can also cause brain injury. Severe whiplash can cause the brain to strike the inside of the cranium, which may result in injury to the brain.
The Signs and Symptoms of TBI
The ability to identify the common signs and symptoms associated with traumatic brain injuries can make a difference by helping TBI victims get quicker—perhaps lifesaving—treatment.
Symptoms associated with traumatic brain injury include:
- Loss of consciousness, even briefly
- Difficulty concentrating or remembering
- Nausea or vomiting
- Loss of balance
- Difficulty sleeping or sleeping more than usual
- Sensory problems such as blurred vision
- Slurred speech
- Dilated pupils
- Unusual behavior
Emotional and personality changes as well as changes in behavior are additional TBI symptoms that require a deeper look. Often, a person suffering from a brain injury will appear and behave like a completely different person than before the accident. The testimony of the loved ones and friends of someone suffering from a brain injury about the changes that person has endured can contitute powerful evidence of a brain injury.
Traumatic brain injury, however, will affect everyone differently. You may experience only one symptom or a combination of several, while others who suffer similar accidents may exhibit significantly different symptoms. Regardless, seek medical attention whenever you have reason to believe that you may have incurred a brain injury.
Lasting Complications from Traumatic Brain Injury
Traumatic brain injury can damage one or several of the brain’s motor and cognitive functions. A particularly severe injury can result in lasting complications. Complications caused by traumatic brain injury include:
- Impaired or lost vision
- Memory loss
- Cognitive disabilities
- Chronic traumatic encephalopathy (CTE)
- Persistent vegetative death
- Brain death
As a result of the above-listed complications, an injured individual may longer perform everyday tasks, may no longer work, or may require regular medical or in-home assistance.
Contact a Richmond Personal Injury Attorney Today
Virginia law may entitle traumatic brain injury victims to compensation. A victim may file a claim to recover damages from the person or business whose negligence caused the victim’s injuries.
If you or someone you love sustains a TBI that someone else’s negligence caused, retain the services of an experienced personal injury attorney. The skilled attorneys at Emroch & Kilduff have the experience and knowledge needed to handle your personal injury case. We will zealously advocate on your behalf, striving to help you recover the compensation you deserve. Contact our office by calling (804) 358-1568 or online to schedule your initial consultation.
|
<urn:uuid:0bb4a4e7-4915-4b36-9bad-d6710408f0d2>
|
CC-MAIN-2023-50
|
https://emrochandkilduff.com/information-about-brain-injuries/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.923208 | 810 | 3.21875 | 3 |
Louis XV's illness in Metz and Mailly-Nesle's scandal
In the 18th century, architect Blondel erected a Classical style portal in 1764, in harmony with the brand new place d'Armes he also raised the same year.
A portal celebrating king Louis XV's recovery, did you know?
He was in Metz at that time, in order to resolve the Austrian war of Succession.
Louis was very ill! Doctors even said he was dying... So he prayed. He prayed a lot, with his mistress by his side, the famous madame de Châteauroux. Outrageous!
A man called Fitz-James didn't want to give him the last rites: of course not!!
The duchess of Châteauroux must go! And the queen had to come immediately... This one came few days later.
Louis was forced to write a public confession in which he admitted his faults. But later, he recovered!
And surprise: the French had not a grudge against Louis, they even nicknamed him le Bien-Aimé ("the Beloving king")!
When the Revolution came, architect Lebrun destroyed several tombs, transformed the choir and the transept... then our cathedral was abandoned.
In the 19th century, Viollet-le-Duc redesigned furniture and demolished the Blondel façade in 1860. A fire damaged the roof 17 years later.
|
<urn:uuid:ce507a70-e8b3-41f0-975e-c6b32c1685c9>
|
CC-MAIN-2023-50
|
https://en.anecdotrip.com/louis-xvs-illness-in-metz-and-mailly-nesles-scandal-by-vinaigrette
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.972077 | 303 | 2.671875 | 3 |
After the suppression of the Commune by the French Army in May 1871, 43,000 Communards were taken prisoner, and 6,500 to 7,500 fled abroad. The number of Communard soldiers killed in combat or executed afterwards during the week has long been disputed—Prosper-Olivier Lissagaray put the number at 20,000, but estimates by more recent historians put the probable number between 10,000 and 15,000. 7,500 were jailed or deported under arrangements which continued until a general amnesty during the 1880s; this action by Adolphe Thiers forestalled the proto-communist movement in the French Third Republic (1871–1940).
The Franco-Prussian War and the Paris Commune edit
The working class of Paris were feeling ostracized after the decadence of the Second Empire and the Franco-Prussian War. The Prussians besieged Paris in September 1870, causing suffering among Parisians. The poor ate cat or rat meat or went hungry. Out of resentment from this situation grew radical and socialist political clubs and newspapers. While Paris was occupied, socialist groups tried twice to overthrow the provisional government.
In January 1871, Otto von Bismarck and the French minister of foreign affairs, Jules Favre, decided that France would hold national elections. Adolphe Thiers, who had been loyal to the Second Empire, was elected head of the new republic. During the war, the capital had moved from Paris to Bordeaux. When the war ended, the government moved temporarily to Versailles. In the early morning of March 18, the government stationed in Versailles sent military forces into Paris to collect a reserve of cannons. The detachment was gathering the guns when units of the Paris national guard surrounded them, and killed two French army generals. By the end of the day, the insurgent soldiers of the national guard controlled the city. They declared a new government called the Paris Commune, which lasted from March 18 to May 28, 1871.
Thiers refused to bargain with the Communards, despite their attempts to do so. He taught newly released French soldiers the "evils" of the Communards as the government prepared for a battle. The Commune responded by building barricades in the Paris streets. Starting on May 21 and continuing through May 28, the French army entered Paris and gradually recaptured the city. Around eighteen thousand communards were killed in combat, more were executed afterwards. The violence of The "Bloody Week" became a rallying cry for the working classes; some politicians would later proudly brag about their participation with the Commune.
After Bloody Week, the government asked for an inquest into the causes of the uprising. The inquest concluded that the main cause of the insurrection was a lack of belief in God, and that this problem had to be corrected immediately. It was decided that a moral revival was needed, and a key part of this was deporting 4,500 Communards to New Caledonia. There was a two-part goal in this, as the government also hoped that the Communards would civilize the native Kanak people on the island. The government hoped that being exposed to the order of nature would return the Communards to the side of "good."
New Caledonia had become a French colony in 1853, but just ten years later it still only had 350 European colonists. After 1863, New Caledonia became the principal destination of convicts transported from France after French Guiana was deemed too unhealthy for people of European descent. Thereafter, convicts from France made up the largest number of arriving residents. During the busiest time of deportation, there were estimated to be about 50,000 total people on the island. This included 30,000 Kanak, 2,750 civilian colonists, 3,030 military personnel, 4,000 déportés (political criminals, including the Communards), 6,000 transportés (common-law criminal convicts), and 1,280 criminal convicts who had served their sentences but were still living on the island. There were four main penitentiary sites on the island, one of which, Isle of Pines (1870–1880), was for the Communards deportees exclusively.
There were three sentences given out to the déportés: simple deportation, deportation to a fortified place, and deportation with forced labor. A simple deportation sentence was given to about two-thirds of the Communards. These people were sent to live in small villages on the Isle of Pines. Those sentenced to deportation to a fortified place were sent to the Ducos peninsula. About 300 Communards were sentenced to deportation with forced labor; these were the people convicted of crimes such as arson in addition to their political crimes. They were sent to be with the criminal convicts on the main island ('Grande Terre'). Some prisoners’ sentences were changed by the local penal administrators, and some were changed by the French government after petitions for leniency.
Life in New Caledonia edit
The government did not give out enough food, clothing, or shelter for all of the déportés. Some were assigned housing in rickety structures, but others had to find their own materials to build huts. Construction tools could be bought from the administration. Hunting for food became part of the daily routine. Some even traded their clothing for food with the Kanak. Not every part of life on the island was bad, however. Those living on the Isle of Pines and Ducos peninsula had freedom of movement, allowing them to live where they wanted and swim and fish at their leisure. They lived in simple wood huts that formed small, face-to-face communities that were intended to be self-governing.
Those sentenced to forced labor often endured abuse at the hands of their jailers. They were habitually mistreated while imprisoned, with whippings and the use of thumbscrews as common punishments for minor infractions.
The National Assembly passed legislation that gave the wives and children of déportés freedom to go to New Caledonia. It also gave wives a much greater right to property than they had in France, giving them half the property rights over any grant given to their husbands. Through this legislation, 174 families making up 601 people were reunited by 1877.
The relatively 'laid back' period of deportation ended when six déportés successfully escaped from the Ducos peninsula in 1874. François Jourde was the main planner of the escape, which he developed while living in the port town of Nouméa. He had developed connections with a ship's captain, John Law, who was paid for his participation. The escapees, who included Jourde, Henri Rochefort, Paschal Grousset, Olivier Pain, Achille Ballière, and Bastien Grandhille, boarded the boat under the cover of darkness and hid in the ship's hold until they cleared the harbor. Law dropped them off in Sydney, Australia, where crowds gathered to see them. Reports of their escape and the strict conditions they had lived under were printed in newspapers in Australia, the United States, and Europe. While the escapees attempted to publicize the plight of those still on the island, the déportés who remained had to deal with the repercussions of the escape. New rules forbade the prisoners from approaching the sea without permission, subjected them to daily roll calls, and banned them from entering the forests, even to collect firewood.
Relationships with the Kanak edit
There are clearly documented examples of friendships between the Communards and the Kanak. Achille Ballière and his friends visited the Kanak in their homes, shared meals with them, and played with their children. In the first few years of the deportation there were at least two marriages between the Kanak and Communards. However, the separation of the groups enforced after the 1874 escapes prevented any more such relationships from forming. During the eight-month-long Kanak insurrection in 1878, the Communards displayed a solidarity with their effort in the local press. This solidarity did not last long, however, as beliefs of racial differences soon took over.
Louise Michel looked to the Kanak youth for guidance and inspiration, and offered them moral support when they joined the 1878 insurrection. She ran a school for the Kanak and encouraged a local theater to perform a Kanak drama. She fully expected the achievements of the Kanak to match those of the French, though she wrote about them in very paternalistic terms that were common for her time period.
Famous Communards edit
Henri Rochefort gave a series of lectures that were published in the New York Herald Tribune while staying in the United States after his escape from New Caledonia. They were highly critical of the French government for denying its citizens liberty. His 1884 novel L’Évadé: roman canaque helped shape the legend of the deportation. It offered a portrayal of the deportation and the policies of the government in New Caledonia that was different from what the governmental propaganda was promoting.
George Pilotell (1845–1918) was the son of a Judge but pursued art and moved to Paris in 1862. As a prolific political caricaturist he was frequently imprisoned and became an active member of the commune in which he appointed himself 'Directeur des Beaux Arts' but later properly appointed a 'commissaire special'. In 1874 he escaped a death sentence by fleeing to London. While he was well known for his caricatures in France, he gained a reputation in England as a fashion designer, society portrait painter and theatre costume designer. He has work in the National Portrait Gallery, the British Museum and the Victoria and Albert Museum.
By the summer of 1878, the concern of amnesty for the Communards had become a significant political issue for France. In January 1879, the prime minister, Dufaure, granted mass pardons for the Communards in an attempt to stop the calls for amnesty. The pardons excused the convictions of the Communards. This was a problem for many people, however, who had never actually been convicted, only indicted. On January 16, the government published a list of déportés whose sentences were pardoned. These people were allowed to return to France. More than one thousand Communards, however, were not included in this list. Men who had been convicted of crimes other than political or whose political opinions were considered too dangerous were left behind.
After the announcement of the pardons, many people in France were hoping for a stronger declaration of total amnesty. Petitions were passed around in all Paris neighborhoods to try and influence the government. A bill calling for total amnesty was introduced into the Chamber of Deputies by Louis Blanc and into the senate by Victor Hugo. The legislation that was eventually pushed through ensured full civil rights to those not convicted of crimes beyond political, and officially ended the prosecution of Communards in military courts. In July 1880, parliament finally voted for total amnesty.
Nine ships brought the déportés back to France. The first arrived in August 1879 and the last arrived in July 1880. Large crowds greeted the ships with celebrations. Donations of money were collected for the Communards and festivals were held to raise money. A committee of aid, headed by Louis Blanc and Victor Hugo, planned a dinner at which they dispersed a small amount of money to all who attended. Offers of employment were made, overcoats were given out, and temporary housing was offered.
Some Communards chose never to come back to France after having built successful lives in New Caledonia or adopting other countries, such as Australia, as home. Many Communards who did come back returned to public life, such as Louise Michel. However, many found the adjustment to freedom difficult. Meetings between Communards and their former jailers occurred in the streets, at times leading to minor skirmishes. In December 1879, an investigative committee was formed to look into charges of torture in New Caledonia. The inquiry lasted two years, collecting the results of previous government studies, more than forty depositions, and testimonials to parliament by the Communards. The Communards’ memories of abuse then became public record, which helped to heal the relations between the former prisoners and the state.
See also edit
- Jean-Claude Farcy, La répression judiciaire de la Commune de Paris : des pontons à l’amnistie (1871-1880) [the judicial repression of the Paris Commune (1871-1880)], put online on 26 September 2019, URL : https://communards-1871.fr
- Milza, 2009a, pp. 431–432
- Audin, Michele, La Semaine Sanglante, Mai 1871, Legendes et Conmptes, Libertalia Publishers (2021) (in French)
- Bullard 2000, p. 68—69.
- Bullard 2000, p. 69—72.
- Bullard 2000, p. 71—72.
- Bullard 2000, p. 86.
- Bullard 2000, p. 93.
- Bullard 2000, p. 122—124.
- Toth 2006, p. 18.
- Bullard 2000, p. 124.
- Bullard 2000, p. 128.
- Toth 2006, p. 61.
- Bullard 2000, p. 130.
- Bullard 2000, p. 133—135.
- Bullard 2000, p. 200—201.
- Bullard 2000, p. 203.
- Bullard 2000, p. 201—202.
- Bullard 2000, p. 134.
- Bullard 2000, p. 202.
- Sãnchez, Gonzalo J. (January 1997). Organizing Independence, The Artists Federation Of The Paris Commune And Its Legacy, 1871-1889 by Gonzalo J Sanchez. U of Nebraska Press. ISBN 0803242557. Archived from the original on 2023-10-28. Retrieved 2020-11-05.
- "The British Museum, Portraits by George Pilotell". Archived from the original on 2012-10-22. Retrieved 2016-07-22.
- Black, David (11 March 2021). "Uses and Abuses of the Paris Commune: the Extraordinary Story of Adrien Lejeune, the Last Communard". The International Marxist-Humanist. Archived from the original on 19 July 2022. Retrieved 19 July 2022.
- Bullard 2000, p. 236—238.
- Bullard 2000, p. 239.
- Bullard 2000, p. 240—242.
- Bullard 2000, p. 242.
- Bullard 2000, p. 243.
- Bullard 2000, p. 245.
- Bullard, Alice (2000). Exile to Paradise: Savagery and Civilization in Paris and the South Pacific 1790-1900. Stanford: Stanford University Press.
- Toth, Stephen A. (2006). Beyond Papillon: The French Overseas Penal Colonies 1854-1952. Lincoln: University of Nebraska Press.
- Audin, Michele, "La Semaine Sanglante, Mai 1871, Legendes et Comptes", in French, Libertalia Publishers, Paris, (2021)
- Milza, Pierre (2009a). L'année terrible: La Commune (mars–juin 1871). Paris: Perrin. ISBN 978-2-262-03073-5.
- Media related to People of the Paris Commune (Communards) at Wikimedia Commons
|
<urn:uuid:4f98627d-b56b-4c29-8883-16a705b42dfc>
|
CC-MAIN-2023-50
|
https://en.m.wikipedia.org/wiki/Communards
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.965911 | 3,248 | 3.796875 | 4 |
Comparative is used when you want to compare two things. For example one person is tall and the other is short. So you will say: Person A is taller than person B. OR Person B is shorter than person A.
You can see some more examples below in the picture.
Grammar explanation – mind map
If the adjective has two or more syllables and it does not end with “Y” then it is a long adjective and you have to add “more” or “most” in front of the adjective.
You have to learn the following adjectives.
good – better – the best
bad – worse -the worst
far – futher / farther – the furthest / the farthest
little – less – the least
In the second game you have to complete the sentences with the correct form of the adjective.
|
<urn:uuid:6acd63b5-eddd-4cf1-949b-5757c2f20b20>
|
CC-MAIN-2023-50
|
https://engames.eu/tag/comparative/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.908374 | 180 | 4.09375 | 4 |
The present simple tense is the most important tense for elementary students of English to learn. To be able to communicate intelligibly they need to master at least the basic rules. If they don´t they will struggle with many other grammar rules. Therefore it is crucial that they learn this tense.
But what does it mean to master the present simple tense? What do the students need to learn? In this post, I will list all the things you need to teach to help them with this grammar.
Present Simple – Form
Many teachers and experts believe that the students will pick up the SVOMPT rule on their own. They believe that it is enough to provide the learners with enough input and this rule will take care of itself. They are wrong! It works in this way only with gifted students but not with the weaker ones. You need to teach this rule.
In my experience, this rule is best mastered by using drills. Of course, we shouldn´t drill for hours on end, but 5 minutes in several consecutive lessons would be nice. For drilling I love using the following Drill table:
I love using the following video based on the drill table:
And to give my students a visual support to learn the negative form, I use the following graphic organiser:
3. The -S ending
I personally don´t care much. If the students use English extensively, this will take care of itself in time. But there is no way to make the process any quicker. Of course, I would drill it and I would correct it but I wouldn´t worry about it too much.
Present Simple – Forming Questions
To form a question in the present simple tense, students need to use the auxiliary DO. It is not so difficult to explain. Once your students know the SVOMPT rule, just tell them to add DO at the beginning of the sentence. This “DO” informs the listener that the sentence is a question.
It isn´t difficult to understand. The problem is that in the third person singular they need to use the auxiliary DOES. To help my students I use the following drill table
and the following graphic organiser:
Or you could edit the following mind map. It contains the question words and their Czech translation.
And now you might think that you are done with teaching the present simple tense. You are wrong! There are the short answers. While students can understand that they need to use the auxiliary DO again, they often fail to use the correct pronoun. To help them I have created the following post to teach just the short answers in the present simple tense.
No, you can´t. Students need to know the verbs they could use the grammar with. The present simple tense is traditionally taught with the verbs for daily routines. But these verbs, though very useful, are not the most frequent ones in English. To teach our students real English it is necessary to introduce a batch of the really frequent verbs in English. The following list contains all the verbs that belong among the 250 most frequent words in English:
If you are looking for a way to teach the verbs, you can find some interesting methods for teaching vocabulary here.
Present Simple – Fluency
It is the verb LIKE. Students often fail to form the present simple tense correctly, but they produce the questions “What do you like?” and “Do you like One Direction?” correctly. How is this possible?
The answer is simple. The verb LIKE is used in many communicative exercises (sometimes the exercises do not contain any other verb) and students simply become fluent using this verb. Our goal is, however, to achive the same fluency with the other verbs too. But how? What can we do?
I have designed the following exercise to help my students become more fluent:
Moreover, when preparing communicative exercises, we need to use more verbs than just the verb LIKE.
Present Simple – Pronunciation
We cannot rely on the fact that our students will learn the present simple tense by ear. As the native speakers contract the pronunciation of the auxiliaries heavily, we cannot expect our students to pick them up just by listening. We need to teach the grammar.
Present simple – usage
If it is the first tense you teach, do not bother with explaining the usage. Teach the verbs, meaning and the form and explain the usage only once you introduce another tense.
You can use the following mind map to check that you taught everything:
Please, share your ideas in the comments section.
In this post I would like to share with you the best activities I know to teach the present simple tense.
To achieve this, I will recycle some of the materials I have already and shared here. However, there are several new materials (for example the infographic) which I designed just for this post.
<!– wp:more –>
I hope you find these materials useful and you will use them in your lessons.
Present simple – song
Here are the lyrics to complete:
Present simple – form
The aim of the following activity is to sensitize students to the forms of the present simple tense and to improve their pronunciation.
Play the following rhyme and ask the students to listen and then repeat it. In the last phase, students should read it on their own.
It is a good idea to ask your students to memorise the rhyme.
Present simple – infographic
Print the picture for everyone and explain that students should use the ending -s with the third person singular.
You might want to teach the correct spelling of the -s ending, but I do not think it is a good idea. I believe, it is better to expose the students to the language now.
Present simple – story
Print the worksheet, so that every student has a copy. It is best to print the cards on a stronger paper. Ask the students to cut the cards and go through the cards and translate the expressions into the students´ MT. Students write the translation on the other side of each card.
Then students learn the new words using the flashcards.
Once they learn the words, play the following British Council video and ask the students to do the accompanying tasks. I think that tasks 1 and 4 are especially important.
[showmyadsa] Collect the texts your students write and correct them to see what problems your students have.
Present simple – grammar exercises
It is a good idea to teach the most frequent verbs in English here. Here are the flashcards for the most frequent verbs in English:
|
<urn:uuid:cf747694-3ff6-435d-8662-fd14db6de7c0>
|
CC-MAIN-2023-50
|
https://engames.eu/tag/present-tense/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.952718 | 1,352 | 3.8125 | 4 |
The higher than the usual growth rate of abnormal cells in the oral tissues is the direct explanation for oral cancer. Generally, this type of cancer is repeatedly seen in the squamous cells present in the mouth, tongue, and lips of a patient. It’s very difficult to detect the formation of this cancer as its first set of symptoms mostly surface after cancer has spread to the lymph nodes present in the neck. But early detection is crucial for Oral Cancer Treatment.
Although it’s difficult, early detection of this malignant disease is possible. The disease’s discovery is marked by the various changes in your body. These changes are the signs and symptoms associated with oral cancer. You can also visit this site to get more info.
Here are some important signs and symptoms reflecting the growth of cancerous elements-
- Swelling or lumps in tongue, lip, or any other oral region
- Red or white velvety patches in the mouth
- Pain or numbness in the oral region, possibly in tongue and jaw movement
- Mysterious bleeding from gums or anywhere in the mouth
- Difficulty in chewing and swallowing certain types of food
- A sore throat and difficulty in breathing
- Mild or acute ear pain
- Unexpected weight loss
Oral cancer is painful and deadly and here are a few precautions for prevention:
- Cut down on your alcohol intake
- Quit consumption of tobacco products – they are considered the primary cause
- The harmful UV rays from the sun can trigger cancer of the lip. Use appropriate sunscreen when stepping out in the sun
- Conduct regular self-examination of lips, gums, roof and,d back of the mouth, etc. Look for signs like bumps or lumps and get them checked immediately
- Maintain good oral hygiene and go for regular dental checkups
Oral cancer treatment is largely dependent on the type of cancer, the stage of the disease, and your ailments. Your doctor’s approach will depend on the treatment best suited to your care. Some treatment options are:
Surgery is an effective treatment wherein the affected tissue area is surgically removed in combination with pre or post-surgery radiation and chemotherapy. Cosmetic reconstruction surgery may follow to overcome any deformity caused.
It uses high-intensity X rays to damage the cancer cells’ DNA and impair their reproductive power thereby shrinking the tumor to a more surgery-friendly size.
Chemotherapy uses medication to travel through the patient’s body destroying every rapidly growing cell in the patient’s body.
For further detail, you can find out more on this website.
|
<urn:uuid:79a718b5-b61c-4f20-85d6-9fb79524c1ef>
|
CC-MAIN-2023-50
|
https://entrepreneursbreak.com/how-to-detect-oral-cancer-at-early-stages-prevention-treatment.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.921124 | 533 | 3.03125 | 3 |
Among the most remarkable capacities of man is his ability to form visualizations without external stimuli. This skill reaches the highest level of comprehensibility in the depictions of visions and fantasies and symbolic characterization in the less remarkable depictions of the mind’s eye in everyday thoughts and emotions. In contrast to cognitive noise, which is a constituent of the default mode network (DMN), while we sleep, a significant piece of this neural circuitry is switched off. The anterior cingulate cortex (ACC) acts as a logic detector for an individual. Once deactivated, apparently ludicrous images can be perceived with the same degree of realism as real ones. Schizophrenic patients regularly report experiencing imagined voices condemning them, observing their behavior, instructing them to perform chores, or alerting them of impending disaster. Narcolepsy’s distinctive hypnagogic illusions are fleeting visions related to the present circumstances, which patients immediately recognize as illusory upon waking.
The capacity of man to construct visual representations in the absence of external things is one of his most fascinating abilities. This talent achieves great concreteness in the pictorializations of visions and delusions and figurative portrayal in the less spectacular pictorializations of the mind’s eye in daily emotions and experiences. The following is a conceptual description of perception in which the fundamental component of cognition is visual imagery rather than verbal interpretations. Dreams, hypnagogic and hypnopompic perspectives, mental confusion, distortions, and various cognitive functions are just a few of the numerous impulsive and subjective occurrences. This paper aims to provide a deeper insight into visual imagery (VI) and the similarities of VI to the actual processing of objects. Additionally, the research analyzes the ability of individuals to distinguish imagery from reality and how patients with disorders such as hypnagogic hallucinations in narcolepsy and schizophrenia differentiate imagery and reality.
Reality is regularly stated as a single psychological phenomenon, and numerous processes must be absorbed under reality. For example, the quality of the sensory perception determines whether it occurs internally or externally. Even if the interior picture appears to be exterior, a quick judgment of its reality may follow if portrayed as occurring in the external environment (Roldan, 2017). When the immediate evaluation system announces ostensible actuality, there appears to be a second, delayed mechanism for reviewing dubious conceptions that employ the technique of seeking to eliminate the cognize (Roldan, 2017). Thus, this strategy of visual inspection may be solely mental or may include physical modes such as the common endeavor to blink away an imaginary sensation.
When a portrayal of the form generated during the preliminary interpretation stages is prevalent, but the input signal is not being recognized, a psychological image is formed. Such depictions safeguard the stimulus’s detectable attributes and eventually give ascent to the conscious experience of awareness (Roldan, 2017). This principle highlights two characteristics of visual images that are critical for comprehending and assessing subjective imagery’s function in learning and memory. First, imagery is intrinsically linked to sensory systems; therefore, this alludes to the central nervous system selecting the vision information to build and sustain a mental picture in visual imagery (Roldan, 2017). Second, images are defined by their cognitive communications to the physical phenomena they depict. These imagery characteristics set it apart from other modes of expression, which are recommended to be amodal, unrelated to any specific visual receptors, and lacking any requisite similarity to the images or functions they symbolize.
Visual Imagery (VI)
Mental images are formed by subjective perceptions constructed from previously encoded data, not from details now received by the modalities. Therefore, visual imaging generates or recreates a sensory perception devoid of retinal information (Xie et al., 2020). According to Xie et al. (2020), such images occur when a description of the input produced during the earliest stages of awareness is maintained, but the information is not seen. Visual perception frequently incorporates information about emotions and fantasies not conveyed to the mind via spoken interpretations. In psychiatric consultations, patients who draw or articulate visual imagery can convey feelings and thoughts that could not be expressed verbally. The consequences of a single visual picture or a succession of visual cognitive images for attitude, imagination, or inhibited recollection are best explored during insight psychotherapies. Visual imaging experiences of varying types occur on these occasions.
Numerous spontaneous and intuitive visual phenomena are hypnagogic and hypnopompic encounters, delusions, fancies, sleep scintillations, memorization imagery, flickering shadows, and thought representations. These forms of VI can be classified and distinguished by the concreteness or severity with which they are mentally registered. Moreover, they still are categorized by the manner and amount to which they are subjected to self-observation and validity assessment, their longevity, and their seriatim structure. Visual imagery occurrences exist on a spectrum of different attributes and are not neatly classified into any particular typology.
Factors that Enhance Occurrence of Visual Imagery
The primary factors that promote the onset of visual imagery perceptions can be classified into five broad categories: directionless intellect, purposive imagination or sensory outcome expectations, and an increment in comparatively amorphous visual sensations. Other elements that enhance VI are word-blocking and changes in consciousness levels or their neurocognitive precursors. These components will be addressed independently, although they interact intricately in real-world situations.
The term “purposeless mind” alludes to a decrease in mental or physical energy than an attainable state. It is attempted through sensory deprivation tests, muscle relaxation, rigidity, and dismissing motivations to execute specific mental skills. Thus, this is similar to the goal of numerous religiophilosophical organizations’ contemplative procedures, psychoanalysis’s complementary methodology, and certain forms of hypnotic induction and sleep-inducing procedures. Specific individuals possess cognitive control that enables them to switch cognitive representations between verbal and sensory features at will. However, others are quite constrained in this skill, and some people exhibit significant anxiety when attempting aimless thought.
Purposeful imagination thinking, most notably daydreaming, amplifies sensorial, mental representations. As a result, this is most likely due to imagery’s unique aptitude for depicting need-satisfying actions, settings, and items, as well as the subjective arousal supplied by sensory-quality memory representations. Visual expectation also increases the likelihood of encountering visual mental representations. A good illustration of this occurs in a variety of discerning search settings. Indeed, the appearance of inner thoughts and the subsequent misunderstanding of what one anticipates seeing outwardly is a standard professional concern for watchtowers, aviation crews, radar technicians, and participants in subconscious perception research.
Improvement in Amorphous Visual Sensations
Reducing significant outward visual inputs and increasing amorphous sensory input improves mental imagery. While blindfolding lowers external stimulation, the retinae produce distinctive phosphenes or idioretinal brightness sensations. Complete darkness appears to induce excessive tiredness and results in the proportional deafferentation of mental perception pathways. It is possible to eliminate visual features and stimuli in research conditions by providing participants with a diffuse, lit, uniform visual cortex.
As a result, this can be accomplished by wearing ground sunglasses, halving plastic balls over the eyes, or projecting a lit curvilinear area outside the recipient’s peripheral vision. These methods provide a complete explanation of visual vision encounters in study participants experiencing hypnagogic daydreaming than obscurity or brightness through shut eyelids. Likewise, flickering brightness in quick on-off patterns creates a vague but stimulating visual sense without a great deal of object-meaningfulness.
Interruption of Cognition in Speech
Occasionally, during psychoanalytic treatment, a patient will not construct ideas in phrases and will experience powerful visual impressions on the awareness monitor. Occasionally, it appears as though highly emotional recollections or concepts are being searched for in the conceptual flow, which can only reach initial awareness manifestation in this mode. This type of conversion of the subsurface of thought from vocabulary to visual representations occurs in daily cognition and is driven by emotional thinking patterns. Subjects usually report a transition in subjective consciousness from language to imagery perception during this period.
Changes in Consciousness Levels
Every person experiences a modified state of awareness consistently in the manner of cyclic episodes of rapid eye movement (REM) associated with an activated electroencephalogram. These REM sleep cycles have been found to correspond to the conscious perception of dreaming, which is primarily a visual hallucination occurrence in most people. During waking, hallucinogenic substances have been proven to induce highly visual states. Additionally, direct activation of the cerebral cortex region produces isotropic visual information, such as mathematical objects and flashing lights that are hallucinatory. Thus, this enables assumptions about the anatomical, physiological, and psychological processes involved in the hallucination’s formation. However, most direct electrical activation investigations are conducted on patients with neurological dysfunction and do not always apply to regular brain activity.
Similarities of VI to the Actual Processing of an Object
One of the main objectives of object recognition analysis is to discover how a cognitive model constructed from the stimuli of processed and altered sensory data promotes appropriate viewer conduct. Given how closely mental imagery parallels perceptual processing in cortices and subjective visual attributes, one would reasonably ask if VI aids understanding in the same way that sensory gazing does: detecting and recognizing distinctive aspects. To operate dynamically and with improved functioning, biological creatures must have a capacity for cognition that extends beyond an instantaneous response to a practically input signal.
Humans accomplish this through visual memory, the skill to contrive a realistic subjective experience from the recollection that substitutes the stimulus’s perception. Intuitively though, elements resemble perceived ones, implying that imagery and perception use similar neural circuits. Xie et al. (2020) examined the rhythmic time courses of visual imagery and image awareness using multivariate trend assessment on human electroencephalography (EEG) information. They discovered that concepts common to vision and perception formed exclusively in the alpha wavelength region.
These projections were detected in downstream neurons but not upstream sensors, implying a parieto-occipital cortical origin. Comparing the shared representations to mathematical methods via symbolic correlation analyses connected later layers of deep neural networks instructed on object variants but not auditory configurations. Therefore, implying that the shared representations are based on approaches to sophisticated visual features. Together, their findings establish and quantify alpha rhythms as a cerebral characteristic of associated visual mental picture and perception concepts.
Saccades are consistent across subjective gazing and mental imagining states, reflecting critical cognitive functions. While saccadic eye patterns in either circumstance may emphasize a specific position more than on particular components, this link may be utilized to assist analytic feature research (Roldan, 2017). For example, image functionality can be satisfactorily associated with different geographical locations without altering the object’s efficient mechanism. In that case, saccadic eye motions may provide a more precise recognition indicator to salient object characteristics than a reference frame, which can then be evaluated for categorization.
Additionally, such a strategy may avert any confounds associated with covert concentration by demanding explicit visual stimuli to fixate specific features. This strategy might be used to investigate sensory visual recognition activities, the outcomes of which could be used to direct and correlate similar mental imagery experiments (Roldan, 2017). A simple comparison of diagnostic traits across perception and imagery situations may provide additional insight into the more extensive relationships between object attributes, sensory cognition, and visual imagery.
The most recognized science stream into internal visual representations is the brain’s electrical measurements collected via functional magnetic resonance imaging (fMRI). This method generates a direct assessment of the substance of visual memory without the difficulties inherent in visual interpretation of private mental encounters. Categorizations attained using blood-oxygen-level reliant variations as assessed by fMRI strongly suggest the availability of diagnostic component information in mental representations and its manifestation via brain activity (Roldan, 2017). Furthermore, distinct engagement patterns have been established related to specific types of imagined things and have been established to be stable across people.
Individuals’ Ability to Differentiate between Imagery and Reality
As it seems, actuality and fantasy are inextricably entwined in people’s brains. Their interior and outside worlds are not as distinct as they might believe. If individuals’ imaginations are vibrant enough, they will believe it is genuine and will use their creativity to develop their vision of reality, which implies they will view things differently than they are. When people perceive information through their senses, the way the brain interprets it is substantially different than when the brain generates material on its own. Afferent input is what the brain gets from people’s senses; it simply refers to data traveling towards the cortex.
The brain can self-generate or picture what is now occurring; this is referred to as an efference duplicate. When there is a disagreement between afferent and efferent signals, individuals are surprised (Roldan, 2017). Voluntary imaginations are distinct from delusions or mind-wondering, which are types of automatic continuing brain function that contribute to the visual cortex ambient noise. For some, this psychological cacophony or mental confusion can be quite intense, interfering with their ability to concentrate. On the other hand, hallucinations occur during the rapid eye movement (REM) sleep period (Roldan, 2017). Unlike cognitive noise, which happens as a component of the default mode network (DMN), while we sleep, a critical section of this brain network is turned off. The anterior cingulate cortex (ACC) is an individual’s reason filter (Roldan, 2017). Once disabled, seemingly absurd images can be viewed with the same vividness as if they were genuine. Occasionally, this enables people to correlate connections they cannot make when awake.
How the ability to differentiate Imagery and Reality Differs in Disorders
Mechanisms of imagery and reality tracking are required to distinguish between data derived internally and insights collected from the external world. They assist people in distinguishing their ideas, emotions, and fantasies from occurrences they may have witnessed or heard about from others. Misunderstandings between imagined and real encounters, which are natural results of ordinary cognition, to delusions are indicators of psychiatric conditions. Under this subtopic, the paper analyzes the ability of schizophrenia and hypnagogic hallucination in narcolepsy patients’ to differentiate between image and reality.
One implementation of the research to characterize the neural circuitry behind reality surveillance has improved the understanding of cognitive impairment exhibited in clinical diseases such as schizophrenia. Schizophrenia patients almost invariably have hallucinations or illusory experiences that happen without an actual impulse or are extreme abnormalities of a natural sensation (Simons et al., 2017). The most prevalent type of hallucination is auditory disturbances, which are experienced by the majority of patients (Simons et al., 2017). Schizophrenic clients frequently report encountering imagined voices cursing them, making observations about their conduct, commanding them to perform tasks, or warning them of catastrophe.
In healthy individuals who do not suffer from illusions, such perceptual action is characterized as being produced inwardly by reality monitoring systems mediated by the anterior and middle prefrontal cortex and interpreted as an imagined speech. Schizophrenia patients who encounter intrusive thoughts and sudden visual impulsiveness may be more assertive, supplemented by hypoactivation of proximal areas, culminating in a reality monitoring deficit that results in an inability to acknowledge the function as self-generated (Simons et al., 2017). In schizophrenia, delusions are caused by sensory integration area overstimulation and reality tracking impairment; hence, abnormal functional connections between downstream sensory cortical areas and the upstream prefrontal cortex should be evaluated.
Hypnagogic Hallucination in Narcolepsy
Narcolepsy is a brain disorder marked by numerous daytime sleepiness and tiredness, hallucinations, decreased focus, and a dysfunctional mind’s capacity to regulate sleep-wake cycles. These symptoms can have a detrimental effect on an individual’s capacity to work and overall quality of life. Narcolepsy has been linked to rapid eye movement (REM) rest and the visual cortex’s management of this stage of sleep. Therefore, differentiating complicated connections between the brain and peripheral areas is critical for evaluating and comprehending narcolepsy relationships.
The hallmark hypnagogic and hypnopompic delusions associated with narcolepsy are transient sights and feelings associated with the current surroundings, and patients instantly recognize the encounter as hallucinatory upon awakening. Son et al. (2021) highlighted an overlooked aspect of narcolepsy’s memory dysfunction, in which patients are prone to delude themselves into believing that envisioned occurrences happened. These dream hallucinations are a subtype of recollection source misunderstanding, a well-characterized condition in which the basis of a specific memory is incorrectly attributed.
Visual imaging encompasses a spectrum of experiences ranging from spectacular and seemingly genuine illusions to imprecise and transitory cognitive pictorializations. Differences in severity, cognitive distortions, length, and sequential structure explain the spectrum’s distribution of visual imagery encounters. Each of these characteristics is a composite of other aspects; for example, reality testing does not refer to a single activity but rather a collection of procedures.
Visual imagery’s prevalence and psychological applications suggest that there are systems of imagery cognition in which visual imagery serves as the essential component of cognition rather than verbal interpretations. Hypnagogic and hypnopompic viewpoints, mental confusion, distortions, and various cognitive functions are just some of the numerous impulsive and subjective events. In addition, the reality is frequently used to refer to a single psychological phenomenon, and numerous processes must be absorbed under the rubric of reality. For instance, the sensory perception’s quality dictates whether it occurs inside or externally.
Subjective impressions produce mental images based on previously encoded material, not the modalities’ specifics. As a result, visual imaging develops or recreates sensory perceptions that are empty of retinal information. Voluntary fantasies are separate from delusions or mind-wandering, both of which are continuous brain activation that leads to the visual cortex’s ambient noise. Imagery and reality monitoring techniques are necessary to discern between information generated internally and ideas gleaned from the external environment.
Roldan, S. M. (2017). Object recognition in mental representations: Directions for exploring diagnostic features through visual mental imagery. Frontiers in Psychology, 8, 1-15. Web.
Simons, J. S., Garrison, J. R., & Johnson, M. K. (2017). Brain mechanisms of reality monitoring. Trends in Cognitive Sciences, 21(6), 462-473. Web.
Son, D. Y., Kwon, H. B., Lee, D. S., Jin, H. W., Jeong, J. H., Kim, J., Choi, S. H., Yoon, H., Lee, M. H., Lee, Y. J., & Park, K. S. (2021). Changes in physiological network connectivity of body system in narcolepsy during REM sleep. Computers in Biology and Medicine, 136, 1-13. Web.
Xie, S., Kaiser, D., & Cichy, R. M. (2020). Visual imagery and perception share neural representations in the alpha frequency band. Current Biology, 30(13), 2621-2627. Web.
|
<urn:uuid:a5eabd7e-17a9-4d30-b40d-526461754973>
|
CC-MAIN-2023-50
|
https://essay4psychology.com/cognition-and-visual-imagery-vs-reality/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.90209 | 3,981 | 2.90625 | 3 |
Why Machine Learning Should Be Studied By Students?
Students should study machine learning because it's a crucial technology driving advancements in various fields. Learning ML enhances problem-solving skills, fosters innovation, and prepares students for future job roles in AI, data science, and automation. It equips them with valuable skills to tackle complex challenges and contribute to technological progress. BookMyEssay provides expert machine learning assignment help. Our professionals assist in understanding algorithms, data analysis, and application development, ensuring academic success and practical knowledge acquisition.
|
<urn:uuid:8cb5bf67-3882-400f-8a24-1170be28d683>
|
CC-MAIN-2023-50
|
https://feedback.mru.org/forums/256082-general-mru-feedback/suggestions/47152228-why-machine-learning-should-be-studied-by-students
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.903131 | 107 | 2.8125 | 3 |
An Original Reconstruction: Frank Chiche's "Je Vous Ai Compris"
This innovative historical film – the only animated film in competition this year – is a tribute to the Algerian combatants during the war of independence. Director Frank Chiche has chosen to make his film in an original manner, reconstructing events and giving them a new atmosphere. Everything is real and yet unreal in this drama. Actors become characters in animation.
The title quote, “Je vous ai compris,” refers to the pronouncement made by Charles de Gaulle on June 4, 1958, in Algiers. On the night of April 21, 1961, there is an attempt to overthrow the policy of De Gaulle. At the same time, three young people named Malika, Jacquot and Thomas are preparing to face their futures. The film is dedicated to young people; each loves Algeria, but in a different way. However, should they think of themselves as French or Algerian in order to love Algeria? Each character has a different position in regard to religion and identity, but each must defend his or her point of view. The film tells us about a human story during an incredible period of history.
The journey to independence is difficult – this is a tale and not a fairytale! Many attacks take place, death is always imminent. The film’s reconstruction of historical scenes is masterly. The cars, jeeps, songs, costumes and scenery show us the details of daily life in this period. The film invents new technological ways to tell historical stories; it changes the content of animation, in a way which is appropriate to the evolution of cinema. Today, French cinema is seeking to differentiate itself from other productions: with this film, history is depicted in an original fashion by using animation. The collective memory of the Algerian people is represented through animation, and why not?
Edited by Lesley Chow
© FIPRESCI 2012
|
<urn:uuid:b6080f04-1dcc-40bf-a2e0-30df11e32280>
|
CC-MAIN-2023-50
|
https://fipresci.org/report/an-original-reconstruction-frank-chiches-je-vous-ai-compris/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.953585 | 400 | 2.546875 | 3 |
If you have a suggestion or comment, please go here.
Within the watershed of White Clay Creek, some 27 species of reptiles and amphibians have been documented.
Amazing Amphibians: A class with FROGS, TOADS, NEWTS, and SALAMANDERS. They need water or a moist environment to survive. These fantastic creatures can breathe and absorb water through their thin skin. Because of this incredible ability and hypersensitivity to their environment, amphibians are indicators of a healthy environment.
Northern Red Salamander
Eastern American Toad
|
<urn:uuid:1960e110-adf4-416e-a595-5df229f63ed1>
|
CC-MAIN-2023-50
|
https://friendsofpawccp.org/natural-resources/amphibians/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.883357 | 111 | 3.203125 | 3 |
Parasite On Cats Eye
Parasite On Cats Eye - Cat Meme Stock Pictures and Photos
Eyeworms ( thelazia californiensis and thelazia callipaeda) are parasites found in cats, dogs, and other animals, including humans, in the western united states and asia.
Parasite on cats eye. In addition to the heart and lungs, other parts of the body, including the central nervous system and the eye, can be infected. The majority of cats, though, will be permanently infected with the parasite and show no outward signs of illness. Thelazia callipaeda has a long historical prevalence in russia and the far east.
Your veterinarian may find up to 100 eyeworms in the conjunctival sac, tear ducts, and the. Gastrointestinal (gi) parasitism is a common problem in cats, with prevalence rates as high as 45% in some populations. Our new research looked for signs of disease in otherwise healthy people and found a significant number bore the mark of toxoplasma.
Other symptoms of tapeworm in cats include: They only usually affect felines that are. Protozoa are usually carried by and live in water.
It knowing what the cause is. Cats catch the parasite when they eat infected prey. Joel navratik, ceo of mrvl pets.
Lice are very common parasites in humans, but they can also present in cats. A smaller number of cats might develop diarrhea, or respiratory problems, or even problems with their eyes. We don’t just get it from cats.
The disease caused by this parasite can scar the back of the eye. As with pink eye in humans, this condition is highly contagious,. Gondii by forming tissue cysts containing bradyzoites, which prevents the replication of the tachyzoites (growing life stage of t.
- Car Detailing Near Me Mobile
- Can Indoor Cats Get Fleas Or Mites
- Can You Rescue A Stray Cat
- Can Kittens Drink Lactose Free Milk
- Can You Kill A Feral Cat
- Car Seat Covers Baby
- Can I Give My Cat Children S Tylenol For A Fever
- Can Savannah Cats Kill You
- Can Puppies Get Parvo From Cats
- Can You Give A Cat Tylenol For Arthritis
- Can U Give A Cat Tylenol Or Motrin
- Car Detailing Near Me
- Can You Give A Cat Tylenol Pm
- Can Kittens Get Fevers
- Can You Build Immunity To Cat Allergies
- Canidae Cat Food Reddit
- Can Neutered Boy Cats Spray
- Can Indoor Cats Get Fleas Reddit
- Can You Give Liquid Tylenol To Cats
- Can You Use Waterless Dog Shampoo On Cats
|
<urn:uuid:e3a84438-f5f9-44fd-953f-0105dbc4d830>
|
CC-MAIN-2023-50
|
https://funnycatnames.github.io/parasite-on-cats-eye.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.891724 | 601 | 2.609375 | 3 |
If eating less meat is good for you and the planet, then recent research has some good news: meat consumption – particularly red meat – is slowly falling in the UK. But for diet changes to really pick up the pace, it needs to be easier for everyone to make more sustainable and healthy choices.
Surveys suggest that despite increasing support for the idea of eating less meat, the UK public has little appetite for interventions by the government to achieve this, whether that might be taxes, labelling or a media campaign.
So what if shops and restaurants took the lead by providing more meat-free options to choose from? Would this make people more likely to eschew meat? It’s not guaranteed – there are strong social influences and cultural norms that reinforce the appeal and habit of eating meat. For example, when asked why they eat meat, people often tend to describe meat as being “necessary, natural, normal and nice”.
Nonetheless, in three studies, my research team and I tested the effect of increasing meat-free options on the meals people choose.
First, we looked at sales in a university cafeteria that changed the menu to offer two plant-based and one meat option, instead of one plant-based and two meat options, for four months. When a third of the options were meat-free, around 40% of the meals diners bought were meat-free. This rose to around 60% when two-thirds were meat-free.
In the second study, a nationwide catering company put more plant-based options on their list of meals for cafeteria managers to create their menus with. We analysed sales in 18 worksite cafeterias supplied by this company for the eight weeks before and eight weeks after the new list of meal options was available. Where there was a small increase in the number of plant-based meal options, sales of plant-based meals overall increased by a small amount, but only around half of the chefs took up the new menu options.
In the third study, we recruited 2,205 UK adults to take part in an online questionnaire. We divided them into three groups, each having four main meals to choose from. Of these four options, either one, two or three were meat-free. Faced with three meat options, just 12% chose the meat-free meal, but when there were three meat-free options, 48% made that choice. Where options were equal, 28% opted for the meat-free choice.
Less meat or meat-less
To identify interventions that could help everyone eat less meat and not just those who already eat less than most, we looked at whether increasing meat-free options in our online study had a different effect on particular groups.
Regardless of their usual meat consumption, everyone ate less meat when there were more meat-free options. This is encouraging, as it’s possible to reduce meat consumption the most when everyone can cut back a bit, instead of a few people cutting back a lot or becoming vegetarian (though one person being vegan could potentially offset others taking no action).
Having more meat-free meals on menus or in stores may have other benefits too. Without a wide enough range of meat-free options in shops and restaurants, other measures such as ecolabels – labelling food with its environmental impact to help people buy more sustainable products – may lose their bite. After all, how much can we expect labelling to change food choices if all the options have low ratings? We have research on this topic in the pipeline.
Making plant-based options more prominent may also begin to reverse public perceptions of meat-eating as the norm. Increasing the number of vegetarian options may signal that choosing a vegetarian meal is more commonly done by others and subconsciously nudge people to follow the trend. If just one of four options is meat-free, this could be seen as an option just for vegetarians. If half are meat-free, people have a choice of dishes which suggests plant-based food is in demand more generally, rather than being a niche choice. Of course, there is also a greater chance of there being one they would like.
Meat the deadline
The National Food Strategy recommended that people in the UK eat 30% less meat by the end of the decade to reach net zero by 2050. People have ingrained habits, so it’s important to find ways to help them make more sustainable food choices and to keep making them.
Nearly three in four people believe it’s important to buy sustainable food. Simple changes, such as providing more plant-based options in shops and restaurants, could help people to meet this goal.
Adding appealing plant-based or vegetarian options to menus could get the ball rolling on the urgent changes needed, as well as enhance the impact of promising, but perhaps harder-to-implement measures, like ecolabels.
Don’t have time to read about climate change as much as you’d like?
Get a weekly roundup in your inbox instead. Every Wednesday, The Conversation’s environment editor writes Imagine, a short email that goes a little deeper into just one climate issue. Join the 10,000+ readers who’ve subscribed so far.
|
<urn:uuid:8d47cc08-4159-421b-9322-9d571f968b65>
|
CC-MAIN-2023-50
|
https://futurealternative.com.au/offering-more-plant-based-choices-on-menus-can-speed-up-diet-change/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.97407 | 1,068 | 2.609375 | 3 |
ARE YOU planning to grow tomatoes in Alabama? That’s a great idea, but succeeding in the process is more challenging than it seems. This vegetable may fail to survive if you plant it during the wrong period. So, the planting date is the most critical factor to consider in tomato production. Let’s discuss when to plant tomatoes in Alabama.
The best time to plant tomatoes in Alabama is between July 15 – August 15 (South Alabama) and early July – early August for North Alabama. The ideal date for planting tomatoes is when the state hasn’t experienced frost for at least two weeks. Also, for tomatoes to grow well, ensure the soil temperature is at least 55 or preferably 60 degrees during the day.
Best Time to Plant Tomatoes in Alabama
Here are two occasions to plant your tomatoes in Alabama:
1. Plant tomatoes depending on your zone’s last frost date
Tomatoes cannot survive cold weather below 50 degrees and frost. Therefore, check your zone’s previous spring frost date before planting tomatoes. Note the best time to carry out the process is when the state last experienced frost at least two weeks ago. You can also plant after the frost has passed.
Therefore, if you’re in South Alabama, plant tomatoes in the fall, between mid-July and mid-August. If you live in North Alabama, plant between early July and early August.
2. Check the soil and air temperatures
When planting tomatoes in Alabama, it’s important to consider soil and air temperatures. Remember, for these vegetables to grow properly, you should plant them when the soil temperature is at least 55 degrees.
However, most gardening professionals recommend planting when the day temperatures reach at least 60 degrees.
Best Tomatoes to Grow in Alabama
There could be over 100,000 tomato varieties in the world. With this vast number, not all types can do well for the Alabama climate. The following three tomato types thrive in Alabama:
i. Brandywine tomatoes
These mature in 80 days, and among all heirloom tomatoes, they are the tastiest, toughest, and easiest to grow. They also do well in Alabama’s hot summer.
ii. Roma tomatoes
These large tomatoes mature within 50 days and are perfect for cooking, drying, canning, and freezing. They thrive in garden beds, indoors, in gardening containers, or in any other garden and are resistant to diseases.
iii. Grape tomatoes
Their fruits mature in 60 days and handle humidity, heat, and dry climate better than other tomato types. Besides, they are the best disease-resistant tomatoes in Alabama.
Frequently Asked Questions (FAQs)
Q: What vegetables grow in winter in Alabama?
A: The ten best vegetables you can grow in winter in Alabama are lettuce, Swiss chard, peas, kale, arugula, spinach, and carrots. Others are radishes, kohlrabi, and cabbages. All these vegetables thrive in cold, heat, and drought and are resistant to pests and insects. You can also plant them in any garden.
Q: Can you plant tomatoes in the fall?
A: Fall is a perfect time for planting tomatoes in Alabama because the temperatures are still cool. This climate allows for better fruit development and insect problems reduce. Therefore, you can plant between mid-July and the end of August. However, read the Alabama fall planting guide to know the ideal time depending on your Hardiness zone.
Growing tomatoes in Alabama is more challenging than many gardeners think. They only survive if you time the tomato planting season in Alabama.
The best planting period is when the frost has passed, or the state hasn’t experienced frost for at least two weeks. The ideal tomato planting season for South Alabama gardeners is in the fall, between mid-July and mid-August.
If you live in North Alabama, the best time to plant is between early July and early August.
Hi, my name’s Wycliffe Magara, a professional landscaper, journalist, published author, photographer, and lawn attendant. Apart from this site, I also own LawnAffection, Grasstology, and TheScholarshipTipster. I specialize in creating informational content to help you grow a Lifelong Lush Lawn and find the ideal scholarship opportunities no one ever talks about.
|
<urn:uuid:6e174ce5-aefb-4a19-a940-9f0cf68c9ac7>
|
CC-MAIN-2023-50
|
https://gardenichome.com/when-to-plant-tomatoes-in-alabama/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.92129 | 896 | 2.65625 | 3 |
Mental health problems such as depression are most common in the hospitality and real estate sectors, but – at least prior to the COVID-19 pandemic – were on the increase across the board, according to new research.
Researchers from the University of Cambridge and University College London found significant gender disparities of common mental health problems against females in over half of the twenty industries studied, with the smallest gap being in the transport and storage industry and the highest gap being in the arts, entertainment and recreation industry.
In the UK, around one in seven people in the workplace experiences mental health problems, and women are nearly twice as likely to have mental health problems as men. More than half of all sickness absence days can be attributed to mental health conditions. It is estimated that economic losses caused by mental health problems account for about 4.1% of UK GDP, and that better mental health support in the workplace can save UK businesses up to £8 billion per year.
The researchers analysed data from almost 20,000 people aged between 16 and 65 across 20 industries. This data was collected as part of the Health Survey for England, a representative repeated cross-sectional survey of people in England, looking at changes in the health and lifestyles of people all over the country. The results are published in Frontiers in Public Health.
The team found an overall increase in the proportion of people reporting mental health problems, up from 16.0% in 2012-14 to 18.8% in 2016-2018. None of the industries studied experienced significant decreases in prevalence, but three industries – wholesale and retail trade, repair of motor vehicles and motorcycles; construction; and other service activities – saw significant increases.
Common mental health problems were most prevalent among those who were not working, with around one in three (33.7%) people reporting problems. In the hospitality sector (accommodation and food services) and real estate, just under one in four people (23.8% and 23.6, respectively) reported mental health problems.
The lowest prevalence was seen among professional, scientific and technical activities (15.0%), agriculture, forestry and fishing (9.6%) and mining and quarrying (6.2%).
Dr Shanquan Chen from the Department of Psychiatry, University of Cambridge, said: “Jobs that involve working face to face with the public, particularly where the employee has a degree of responsibility, and those that involve working irregular and long hours can all be emotionally demanding or even expose employees to violence and verbal aggression. This in turn could contribute to higher rates of mental health problems.”
“Nevertheless, we would still strongly encourage industry leaders – particularly in those sectors that fare worst, such as the hospitality and real estate sectors – to take an urgent look and try to identify and address the underlying issues.”
In the majority of industries (11 out of 20), mental health problems were more common among females than they were among males. This was highest in the arts, entertainment and recreation sector, where more than one in four women (26.0%) reported problems compared to around one in 20 (5.6%) of men. Not working also appeared to have a much bigger impact on females (45.0%) compared to males (21.7%).
From 2012-2014 to 2016-2018, gender disparities had widened in all but two sectors – human health and social work activities, and transport storage.
Previous studies have identified some risk factors that have gender-specific impacts on mental health. For example, working full-time decreases the risk of mental problems among males, but not among females; fixed-term contract only increases the risk of mental problems among females; males are more affected by changes in tasks at work, while lack of training, low motivation and weak social support are drivers of mental problems among females. However, the researchers say that the existing evidence cannot explain why there were disparities in some industries but not others.
|
<urn:uuid:75c3c110-056c-42a4-8ece-615f4141e9a0>
|
CC-MAIN-2023-50
|
https://globalhealthnewswire.com/neurology-and-mental-health/2023/02/14/hospitality-and-real-estate-sectors-have-highest-rates-of-common-mental-health-problems
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.968915 | 801 | 2.625 | 3 |
How to Write Scenes That Keep the Audience Interested
In the previous lesson, you found out how to structure your plot. The acts of a screenplay are made up of scenes, and in this lesson, you’ll discover how to write ones that keep the audience wanting to know what happens next.
What Is a Scene?
In a script, a scene is a unit of action. A new one starts each time you change locations or times. In a scene, a couple starts to argue in their living room. If they continue the argument in their car, that would be a new scene. Or if we cut to the same location two hours later, that would also start a new scene (in the ninth lesson, you’ll see what format to use to show you’re starting a new scene).
A more important distinction is that a scene is a unit of action in which something changes. Ideally, it’s a change that has some emotional impact. Let’s say you have a scene in which your protagonist is walking through a mall with her young son. She gets distracted, and when she turns back to the child, he’s gone.
Another example: The child asks his mother, “Who is that man?” She looks to where he’s pointing. There’s nobody there. “What man?” she asks. “The one with the skull face,” the boy says. There’s still nobody there and the mother is worried.
What Are the Purposes of a Scene?
A scene should do one or more of the following:
• Move the story forward. Whatever changed either moves your character closer or farther away from reaching their goal. The goal of the mother in the mall scenes is to protect her child; both scenes represent a setback.
• Reveal something new about one or more of the important characters. Sometimes what we learn will become relevant only later in the story. Maybe near the start, we find out the protagonist is scared of heights, and later, they will have to climb to the top of a building to get away from the antagonist.
• Be entertaining—funny if it’s a comedy, thrilling if it’s a thriller, and so on.
The best scenes accomplish all three. In the scene in which the boy disappears in the mall, how the mother deals with him before would reveal either that she’s not a very attentive parent or that she’s very attentive and there’s only a split second in which she allows herself to be distracted.
Characteristics of a Scene
When you think about a scene, try to think about the duration (how long it is), a conflict (whether it will have one), an ending (what’s next), and the subtext (what the scene is really about). Let’s explore each of these in more detail.
Duration. It can be from a quarter of a page to several pages. The average is about a page, but variations in scene length give variety to the pacing.
Conflict. Many scenes have conflict, i.e., the characters have different goals. A boss wants his secretary to agree to a date with him, while her goal is to turn him down without endangering her job. A police officer wants to get a suspect to confess, while the suspect wants to prove his innocence without revealing anything that would implicate his guilty friend. The intensity of the conflict should escalate as the story goes along; otherwise, the audience will be bored.
Open ending. Scenes should have an ending that raises a new question. What happened to the boy who disappeared? Was the boy who says he saw a man with a skull face pretending, or did he really see it? Is the boss willing to take no for an answer, or is he more sinister?
Subtext. Sometimes on the surface, a scene is about one thing, but in reality, it’s about something else, something hidden. The latter is the subtext. In a romance, a couple who just met might be talking about the weather, but the subtext is that they are very attracted to each other. Often, the subtext is revealed through actions, while the dialogue stays on the surface.
As you watch a film, notice what each scene reveals about the characters, how it moves the story along, whether it has a subtext, and how it makes you wonder what happens next. When you see a scene that doesn’t hold your interest, try to figure out why and how it could have been improved.
In the next lesson, you’ll discover how to write powerful dialogue that helps you create outstanding characters and scenes.
Share with friends
|
<urn:uuid:a5a93869-bb4d-47b9-b2b0-de61570621b5>
|
CC-MAIN-2023-50
|
https://gohighbrow.com/how-to-write-scenes-that-keep-the-audience-interested/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.960119 | 983 | 3.265625 | 3 |
Common citation styles are MLA, APA, or Chicago formats. You should choose one format and be consistent in using this format.
Below are citation guides from Penn State University Libraries, as well as the Purdue Online Writing Lab (Purdue OWL) which will be helpful in providing examples and guidance for creating your citations.
You can also find the citation manuals in book form at the Library.
NOTE: Many databases will provide pre-formatted citations with articles. It is in your best interest to verify the formatting of these citations before copying and pasting them into your paper. While the information in the citation is generally correct, the formatting will more often than not be somewhat incorrect.
University Libraries Citation Guides
Purdue OWL Guides
Citation Manuals at the Library
|
<urn:uuid:72476829-ac8d-4691-b8cb-0ae0eb95a544>
|
CC-MAIN-2023-50
|
https://guides.libraries.psu.edu/econhbg/citations
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.872235 | 158 | 2.65625 | 3 |
Every person has a goal; regardless of what areas of their lives it is being associated. A goal will remain a goal unless it was successfully achieved. Many would ask why some people are successful and some are not. Well, the answer lies on strategic planning.
Strategic planning is the process of developing strategies and defining objectives to reach a particular goal or set of goals. If you labeled your planning as “strategic” then you must expect that it would perfectly operate on a grand scale. It will achieve success in a broader field.
It is very different from “tactical” planning which focuses more on individual detailed tactics of activities. “Long range” planning however projects current programs and activities into a modified outlook of the outside world where it describes the phenomenon that will likely occur.
Strategic planning is creating more desirable results in the future through influencing the external world, and adapting current actions and programs to achieve a more favorable result in the outside environment.
There are different reasons why most people are doing strategic planning.
1. To acquire the capability in obtaining the desired objectives.
2. To fit well on both the organization’s core competencies and resources, and to the external world. Make sure that your plans are appropriate and feasible.
3. To acquire the capability in providing competitive advantage that is sustainable within the organization.
4. To prove that it is flexible, dynamic, and adaptable even to changeable situations.
5. To be sufficient in providing favorable results without cross-subsidization.
These advantages will not be realized without its methodologies. Strategic planning depends on STP (three-step process) process. “S” for situation where it was been thoroughly evaluated, “T” for Target where goals and objectives are defined, and “P” for path where the routes of goals and objectives are clearly mapped.
However another alternative approach can also be used. It is known as the Draw-See-Think-Plan procedures. “Draw” creates the desired image and achievements. “See” evaluates current situation and detects gaps between ideal situation and current situation. “Think” develops specific actions that must be done to bridge the gaps between ideal situation and current situation. “Plan” lists down required resources for the execution of activities.
Strategic planning is also considered a set of creative and logical steps.
1. It clarifies the objectives to be achieved. These objectives are ranked according to the level of its importance. It can either be TRO (Top Rank Objective), 2nd Rank Objective, 3rd Rank Objective and so on. The lower rank objectives answers the “How” question while higher rank objective answers the “why” question. However TRO is exempted because the objective here is defined.
2. It gathers and analyzes the information. It includes internal assessment on resources, and external assessment which include environmental scanning. Morphological analysis is used by both internal and external assessments. SWOT analysis can also be incorporated to assess the aspects of environments and organizations that are essential in achieving the strategic plan objectives.
3. It evaluates objective feasibility in the SWOT view. SWOT is the acronyms which stands fro Strengths, Opportunities, Weaknesses, and Threats.
4. It develops strategy involving SWOT.
5. It develops action programs creating a more attractive strategy.
To summarize everything, strategic planning provides overall strategic direction on the core management of the company. It gives a more specific direction in areas such as marketing strategy, financial strategy, human resource strategy, organizational development strategy, and deployment information technology strategy to achieve success.
|
<urn:uuid:60605e87-5516-466e-9486-c8ea825b36d9>
|
CC-MAIN-2023-50
|
https://gujratindia.com/important-facts-about-strategic-planning/115/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.946368 | 757 | 3.09375 | 3 |
The 90-Degree Trapezoid Loop Ladder is an exciting and extensive overhead climber which unique rungs. The rungs each have a trapezoid shape, which makes them lower and easier to reach, and also gives children a large bar to grab onto, since trapezoids are wider at their bases. The path of the climbing structure takes two gentle 45-degree turns, which allow a longer structure to fit in a shorter space. It also makes the climber slightly more challenging, since kids will have to adjust themselves and attempt to turn while swinging from the rungs. The turns also make the climbing experience more varied and different if children start from the other side. The structure has an additional vertical support post in the middle of its length to support the unconventional shape. Both entrances of the structure have small vertical ladders which make it easier for younger children to reach or get down from the rungs.
90-Degree Trapezoid Loop Ladder
|Age Range||5 – 12 years|
|Child Capacity||5 – 10|
|Safety Zone||19′ 10″ x 19′ 10″|
Meets National Standards for:
|
<urn:uuid:9715ca66-78e9-445f-9f82-e951ef6e08e5>
|
CC-MAIN-2023-50
|
https://gulfcoastrecreation.com/product/90-degree-trapezoid-loop-ladder/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.913437 | 239 | 3 | 3 |
Too Many Sugary Sodas Might Harm Your Kidneys
THURSDAY, May 14, 2020 (HealthDay News) -- Drinking lots of sweetened soda may increase the risk of developing chronic kidney disease, two new studies find.
"Consumption of 500 milliliters [16.9 fluid ounces] of a commercially available soft drink sweetened with high-fructose corn syrup increased vascular resistance in the kidneys within 30 minutes," the researchers found.
In a second study, the investigators found changes in blood flow in the kidneys was caused by the corn syrup, not the caffeine, in the soda.
The two studies included a total of 25 healthy men and women, with an average age of 22 to 24.
Christopher Chapman, of the University at Buffalo in New York, and colleagues explained that vascular resistance occurs when blood vessels constrict, reducing blood flow in the kidneys and increasing blood pressure and impairing kidney function.
"Collectively, our findings indicate that [high-fructose corn syrup]-sweetened soft drink consumption increased renal vasoconstrictor tone at rest and during sympathetic activation," the study authors said in a news release from the American Physiological Society.
The report was published online recently in the American Journal of Physiology--Renal Physiology.
Nearly 37 million Americans suffer from chronic kidney disease, according to the National Kidney Foundation. The foundation estimates kidney disease kills more people than breast cancer or prostate cancer.
For more on kidney disease, head to the U.S. National Institute of Diabetes and Digestive and Kidney Diseases.
SOURCE: American Physiological Society, news release, May 6, 2020
|
<urn:uuid:95bb3838-e354-4689-a798-8f7001387f9c>
|
CC-MAIN-2023-50
|
https://healthlibrary.vidanthealth.com/RelatedItems/6,757491
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.917199 | 336 | 2.984375 | 3 |
For many thousands of years, the Chinese have espoused the efficacy of acupuncture for pain relief. Surprisingly, an astonishing wealth of recently published investigations into all aspects of acupuncture and pain control provide scientific proof of the system.
Acupuncture also was found to be significantly more effective than either suggestion or sham acupuncture treatment in raising overall pain thresholds (Br Med J, 1977; 1 (6053): 67-70.)
In a long-term study, acupuncture so signicantly eased excruciating knee pain for patients while awaiting arthroplasty for osteoarthritic knee joints that 17 per cent of them felt they no longer needed the operation (Acta Anaesthesiol Scand, 1992; 36 (6): 519-25).
Acupuncture has also been found to help intractable pain caused by late cancer in all 17 patients of a trial involving low back stimulation through implanted electrodes at acupuncture points (Acupunct Electrother Res, 1982; 7 (4): 255-65.
Besides simple pain relief, acupuncture has a long, scientific history of successful use as an anesthetic. One study (Am Surg, 1975; 41 (1): 11-16) found that acupuncture can be used in conjunction with local anesthesia, nerve-block or alone with equal effectiveness for pain control.
In one study comparing ordinary chemical anesthesia with acupuncture anesthesia, acupuncture was found superior in terms of fewer illnesses, fewer demands for pain relief after surgery, restoration of urinary and bowel functions (often “frozen” after surgery), blood circulation and ability to regain normal functions (Anesthesia, 1990; 45 (6): 480-85 and 1991; 46 (2): 129-35.
Acupuncture has been used successfully in abdominal surgery (J R Soc Med, 1984; 77 (4): 295-98), biopsy of the large intestine (Dtsch Med Wochenschr,1 1991; 116 (10): 367-70), stomach surgery (Lancet, 1978; 1 (8057): 182-3), chest and heart surgery (Minerva Med, 1979; 70 (56): 3857-60), removal of the thymus gland (in myasthenia gravis) (Acupunct Electrother Res, 1988; 13 (1): 25-30), and general surgery (Anaesthesia 1976; 25 (5): 231-34.
It should be noted that some studies contradict these findings and show that success can depend on patient motivation.
Nothing in conventional medicine approaches the profound extent to which acupuncture has enabled science to understand how pain works. Thanks to exhaustive research, the exact analgesic pathway of acupuncture is now known.
On the way up from the point of needling, the stimulus travels via the nerve cells to the pituitary by way of precise locations in the brain (Brain Rees Bull, 1993; 30 (1-2): 53-67). The pathway of the stimulus which inhibits pain has also been tracked.
This astonishingly large volume of sound research on an alternative therapy gives lie to the widely held belief that research only gets done when large financial returns are the likely result.
Harald Gaier is a registered naturopath, osteopath and homeopath.
|
<urn:uuid:ce3725d7-08f7-44c8-bc75-cad0dd7c6c73>
|
CC-MAIN-2023-50
|
https://healthy.net/2006/07/02/alternatives-acupunctureacupuncture-and-pain-relief/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.881956 | 655 | 2.984375 | 3 |
The NIKH has established a systematic database and internet service network for the purpose of facilitating the investigation, collection, exhibition, and release of historical materials in cooperation with related institutions. The Korean history database (http://db.history.go.kr) provides original text of important historical materials. Basic historical materials are digitalized in a chronological order so that the general public can search out the needed information at http://sillok.history.go.kr and http://sjw.history.go.kr. For the special purpose of promoting the popularization of history, it has developed another website, Historynet (Wuriyeoksanet: http://contents.history.go.kr/). Furthermore, it operates another website, Korean History On-line (http://www.koreanhistory.or.kr), which functions as a meta-search engine relevant to the studies on Korean history.
The Korean history database (db.history.go.kr) services original text of important historical materials. Hanguksa Yeongu Hwibo (Bulletin of Korean Historical Research) organizes the trend of Korean history research in the academia and introduces the catalogue of literature titles on the internet.
The Annals of the Choson Dynasty(朝鮮王朝實錄) comprise 1,893 books covering 472 years (1392~1863) of the history of the Choson Dynasty, from the reign of King Taejo, the founder, to the end of the reign of King Cheoljong. Thick extensive set of records is considered to deal with the longest period of a single dynasty in the world. For their cultural and historic rarity, the Annals of the Choson Dynasty deserve world cultural preservation as an invaluable documentary heritage.
Seungjeongwon Ilgi is considered to be an administrative reference of historical rarity and value. It records important court affairs in great detail, the Seungjeongwon secretaries having closely assisted and observed the kings. Of all Korean cultural properties, it constitutes the most massive compilation of records. What is more,Seungjeongwon Ilgi provided primary reference sources for the compilation of Annals of the Joseon Dynasty,which are already listed as a documentary heritage on UNESCO's Memory of the World, testimony to their invaluable attributes
Korean History Contents (http://contents.history.go.kr/) are develops educational content for cultivation and education of Korean history.
Korean History On-line (http://www.koreanhistory.or.kr) is a meta-search engine for websites relevant to Korean history (studies)
|
<urn:uuid:74db4c24-eaf8-4057-9ef7-7df10eefd357>
|
CC-MAIN-2023-50
|
https://history.go.kr/en/contents/contentsPage.do;jsessionid=7842D0305F1CAABC354E50A46CF35606?groupId=000000000607&menuId=000000000871&pageId=000000000249
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.852259 | 544 | 2.9375 | 3 |
Historically, medical textbooks have presented Celiac disease patients as small, thin, anemic individuals–a depiction that still dominates many physicians’ views of gluten intolerance and the people who have it.
Recent research, however, is forcing a major re-thinking of that “classic” picture, and urging clinicians to be on the lookout for gluten sensitivity among people who are overweight or obese.
Described variously as an autoimmune disease or an allergy, Celiac disease affects the small intestine by reducing its total surface area. In sensitive individuals, presence of gluten in the gut instigates an inflammatory response, which over time destroys the fingerlike villi lining the inside of the small bowel.
Because the villi comprise most of the bowel’s surface area, damage caused by chronic inflammation can shrink the intestinal surface area–typically about the size of a major league baseball field, down to the size of an infield. This severely compromises the bowel’s ability to absorb nutrients. Micronutrient absorption is particularly compromised, meaning that gluten-sensitive people are usually deficient in iron, calcium, and other minerals absorbed via the gut.
Previously, problems with absorption were thought to result in the short stature, low body weight, and tendency towards anemia that characterize the classical description of Celiac disease.
A Surgeon’s View
A new understanding of gluten sensitivity suggests that the core issue is still one of malabsorption – but rather than inhibiting weight gain, the lack of nourishment instead motivates a drive to eat excessively.
One physician questioning the old image of gluten sensitivity is Phoenix, AZ-based bariatric surgeon, Terry Simpson, MD.
After years of working with gastric bypass surgery patients, Dr. Simpson noticed that many continued to suffer from chronic iron and calcium deficiencies following surgery. When no amount of iron or calcium supplementation seemed to help, he went back to take a closer look at the distal biopsy specimens he’d collected from their original surgeries.
He was struck when he found horribly flattened villi in most of these samples. Quickly he realized that this meant their ability to absorb nutrients had already been compromised long before undergoing surgery.
He said that many overweight individuals believe they have some type of intestinal disorder like irritable bowel syndrome or a “sensitive” stomach. They can tell from their own experience that something is not right with their digestive systems, but they don’t really know what.
Suspecting that undiagnosed gluten intolerance could be the true cause of their perceived bowel disorders, Dr. Simpson began putting his patients on a six-week gluten-free diet after surgery.
He finds that generally speaking, they feel better and have increased energy. The diet seems to positively impact their absorptive abilities; by doing nothing other than switching to gluten-free eating, his patients’ iron levels usually normalize and their anemia starts to resolve.
GF Diet Promotes Weight Loss
Surprised by these results, Dr. Simpson wondered how patients would fare if they adopted a gluten-free lifestyle before undergoing surgery.
He identified groups of morbidly obese patients whose preoperative labs indicated iron deficiency. Taking advantage of the six months during which insurance covers a pre-op, medically supervised diet, he asked them to go gluten-free.
In addition to resolving their anemia, those patients who eliminated gluten lost significantly more weight than those on the standard 1,800-calorie pre-surgery diet. Amazed by how much better they felt, the gluten-free patients also recovered from surgery more rapidly than those on the standard diet.
Increasingly, Dr. Simpson’s patients appeared to represent an important variant of the stereotypical image of gluten intolerance and celiac disease, so much so that he now recommends that all his bariatric patients get tested for gluten intolerance.
Even if the tests are negative, he still urges his patients to eat gluten-free for six weeks just to see how they feel. After six weeks, he asks them to eat a single Wheat Thin cracker. Among the gluten-sensitive, he says, “every one can tell you, that was the worst thing I ever ate.”
Dr. Simpson is not alone in advising gluten testing; the suggestion that “all patients candidate for bariatric restrictive or malabsorptive-combined surgery undergo Celiac disease screening tests prior to any surgical treatment” is becoming more widespread among obesity treatment providers (de’Angelis, et al. Obes Surg. 2012; 22: 995–996).
The Changing Shape of Gluten Sensitivity
When Celiac disease was first outlined in the medical tomes of the late 19th and early 20th century, the vast majority of people did not have access to the wide array of foodstuffs that we do today. During the Great Depression or World Wars I and II, food portions were much smaller and, consequently, obesity was rare.
“In those times,” Dr. Simpson explains, “if you ate a little plate of food and couldn’t absorb it, you were going to be thin.”
Contrast this to our modern food landscape of unlimited pasta bowls, where we can easily walk into most restaurants and order a salad with enough calories to fuel us for an entire day.
Even when the villi of the small bowel are damaged, as is the case in gluten-sensitive people, specialized cells in the large intestine can still absorb countless calories in the form of macronutrients like glucose. In order to take in adequate amounts of essential micronutrients, overweight individuals may have to consume a huge quantity of calories, which appears to be a potential cause of obesity.
Surrounded by mountains of cheap, processed foods, most people can now readily consume an unlimited amount of calories. Paradoxically, while many processed foods are fortified with vitamins and minerals, our bodies will absorb the macronutrients long before they absorb the micronutrients – leaving us overfed, yet undernourished.
In today’s food world, it’s not difficult for anemic individuals with uncontrolled gluten disease to acquire inexpensive double-decker hamburgers – from which they’ll take in plenty of calories, but won’t absorb the iron that their bodies so desperately need.
Cooking as Clinical Intervention
Dr. Simpson recommends a simple solution to the dual challenges of obesity and gluten sensitivity: teach people how to cook.
“When you get patients to cook,” he explains, “it takes a whole bunch of problems out of their diet.” Learning to prepare fresh, healthy, gluten-free meals at home eliminates potential allergens and reduces the amount of processed foods that one consumes. It also offers greater control over portion sizing, flavors, and food-related expenses.
Even for those who are profoundly impressed by their results, the transition to a gluten-free lifestyle can be challenging. Dr. Simpson has found that for most of his patients, the change is far easier to sustain when they avoid packaged products and favor home cooking over eating out.
While not everybody is gluten intolerant, and it’s certainly not the universal cause of obesity, we can all benefit from cooking our own food, Dr. Simpson believes. Rather than performing surgery, the most valuable service he offers to his patients is culinary education. “I spend more time teaching them how to cook than I do operating on them now.”
In some cases, surgery may still be necessary for patients who are really struggling to lose weight. But converting to a home cooked, gluten-free diet can ease the process – or perhaps even eliminate the need for surgery altogether.
Kristen Schepker holds a Master’s degree in Integrative Health Studies from the California Institute of Integral Studies. She is a certified yoga instructor and holistic health and wellness coach practicing in San Francisco, CA.
|
<urn:uuid:d862e8e1-993a-4b53-82ec-f465512bcdf7>
|
CC-MAIN-2023-50
|
https://holisticprimarycare.net/topics/digestive-health/link-between-gluten-and-obesity-challenges-classic-picture/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.960319 | 1,634 | 2.78125 | 3 |
The average American spends more than 10 hours a day interacting with a smartphone or computer screen, and too much screen time may wreak havoc on your eyes.
Digital eye strain, computer vision syndrome and visual fatigue are a group of eye and vision-related problems that result from prolonged computer or tablet and cellphone use.
People who spend an extended amount of time staring at screens experience eye discomfort, vision problems, dry eyes, eyestrain, headaches, blurred vision, and neck and shoulder pain.
According to The Vision Council, 59% of American adults report experiencing symptoms of digital eye strain.
Dehydration and Digital Eye Strain
Dryness and dehydration can cause painful red irritated dry eyes and make symptoms related to digital eye strain or computer vision syndrome even worse. Here’s why.
Our eyes weren’t designed for staring at a computer screen all day long. Tired eyes, blurred vision, headaches and double vision are all symptoms that occur due to lack of hydration in our body.
Our body hydrates our eyes by causing us to blink. We do it, so naturally, we often don’t even know when it is happening. But blinking is an essential function to hydrating our eyes and keeping them working properly.
Unfortunately, we blink a lot less (nearly 66% less) when staring at a screen compared to reading a magazine, looking into the distance, sewing and doing other tasks according to experts.
When we stare at a screen, we blink about five times per minute instead of 15, which is how many times we need to blink to keep our eyes lubricated.
That’s because most OLED and LED screens and devices emit a high-energy vision (HEV) blue light, which can wreak havoc on our eyes causing headaches, dizziness, imbalances in human circadian rhythms, and even age-related macular degeneration (AMD) or blindness.
Blue light in its natural form, emitted by the sky, is beneficial to the human body. It regulates sleep-wake cycles and improves alertness. But it can be disruptive in its artificial form (OLED and LED screens), especially at night.
And if you already have vision problems such as farsightedness, astigmatism, inadequate eye focusing or eye coordination abilities- prolonged screen time can make your dry eyes and headaches even worse.
But there is relief: proper hydration. The medical community is now starting to recognize the role proper hydration can play in improving physiological symptoms related to digital eye syndrome such as dry eyes, headaches, brain fog and fatigue.
And it’s a big game-changer for many people who suffer from digital eye strain and computer vision syndrome.
How Our Body Prioritizes Hydration
To fully grasp the role proper hydration can make in alleviating digital eye syndrome, we need to understand an essential concept.
Our body essentially prioritizes which biological processes it will use water and electrolytes for first. Our bodies are programmed to use water & electrolytes in the bloodstream and brain circulation processes first.
To meet these essential needs, our body will pull water and electrolytes from other areas such as eyes, joints and muscles, resulting in dry eyes, headaches, muscle aches, joint pain and brain fog.
And even mild dehydration can cause these symptoms to manifest and result in loss of focus and lack of productivity. That’s why rehydrating our body throughout the day makes A LOT of sense.
But drinking plain water alone isn’t the most efficient way of getting electrolytes and other nutrients directly into our bloodstream, lymphatic system and interstitial cavities.
Hydrus is The Perfect Hydration Delivery System
Proper cellular hydration is about “absorption” and “balancing the delivery of electrolytes” and “water into the cells” in our body.
Hydrus is a perfect hydration delivery system designed to boost absorption of liquids and electrolytes quickly and efficiently into the bloodstream.
Hydrus is formulated using Nanosomes™ technology, or tiny lipid-like particles that make it easier for our cells to absorb electrolytes and water. Nanosomes™ are especially good at targeting our cerebral ventricles, eyes, mouth, muscles and joints, which is why people who use Hydrus find results fast, usually within one to two days.
If you suffer from dry eyes, headaches, brain fog and other symptoms related to digital eye syndrome take the Hydrus Challenge Now and FEEL the results for yourself!
|
<urn:uuid:7a8ac9a6-9ac0-4078-95a8-959e42a034b1>
|
CC-MAIN-2023-50
|
https://hydrusedge.com/2020/06/30/digital-eye-strain-causing-your-dry-eyes-proper-hydration-can-help/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.913356 | 937 | 3.21875 | 3 |
As we journey through life, our bodies undergo numerous changes, and one intriguing aspect of this transformation is the potential for height loss with age. Height loss is a natural part of the aging process, and it can have various implications for our health and well-being. This article aims to delve into the mechanisms behind this phenomenon, specifically focusing on how aging affects our vertical stature. By gaining a deeper understanding of these processes, we can navigate the aging journey with knowledge and take proactive steps to maintain our health and well-being.
Does Height Decrease Over Time?
Without a doubt, height generally decreases over time as a natural consequence of aging. Several factors contribute to this height loss:
- Spinal Disc Compression: The intervertebral discs between the vertebrae in the spine undergo compression and degeneration over time, causing a decrease in their height. This compression gradually leads to a loss of overall height.
- Osteoporosis: Decreased bone density, often associated with aging and hormonal changes, can contribute to height loss. Weakening of the bones, especially in the vertebrae, may cause them to collapse or develop fractures.
- Posture and Alignment: Poor posture and spinal misalignment exacerbate height loss. Slouching, hunching, or other postural abnormalities compress the spine and contribute to a reduction in height over time.
- Joint Degeneration: Degenerative changes in the joints, such as osteoarthritis, can affect the cartilage and tissues supporting the joints. Especially in weight-bearing joints like the hips and knees, this can lead to a loss of joint space and reduce height.
- Muscle Loss and Weakness: Age-related muscle loss, known as sarcopenia, can result in weakened support for the spine and poor posture, leading to height loss.
- Vertebral Fractures: Fractures in the vertebrae, often caused by osteoporosis or injury, can lead to the collapse of the affected vertebrae and subsequent diminished height.
- Genetic Factors: Genetic factors play a role in determining a person’s potential maximum height and how their skeletal structure ages over time. These inherited traits can make certain individuals more prone to experiencing height loss as they age.
What Changes Can Occur When Someone Becomes Shorter in Height?
While height loss itself may not typically present with specific symptoms, it is often associated with certain conditions or changes in the body that may cause accompanying symptoms, such as:
- Back Pain: Spinal compression or changes in the vertebral discs may lead to back pain or discomfort, resulting in a reduction in height.
- Poor Posture: Height loss can affect posture, leading to rounded shoulders, a stooped back, or a hunched appearance.
- Reduced Flexibility: As height loss occurs, there may be a decrease in overall flexibility, making it difficult to perform certain movements or activities.
- Increased Risk of Fractures: Diminished height may indicate a loss of bone density, which can increase the risk of fractures or osteoporosis-related complications.
- Changes in Body Proportions: Stature reduction may lead to changes in body proportions, such as shorter limbs in relation to the trunk.
- Difficulty Reaching High Objects: With a decrease in height, individuals may experience difficulty reaching high shelves or objects that were easily accessible before.
- Decreased Lung Capacity: Height loss can affect the expansion of the chest cavity, potentially leading to decreased lung capacity and breathing difficulties.
- Changed Balance and Stability: Reduced stature impacts stability and balance, heightening the risk of falls or balance-related issues in individuals.
- Emotional or Psychological Impact: Height loss can impact a person’s self-image and confidence, potentially leading to emotional or psychological distress.
Does Height Loss Affect Men and Women Differently?
Yes, height loss can affect men and women differently due to various factors:
- Timing: Women generally experience height loss earlier than men. This is because women tend to reach their maximum height at an earlier age, and the natural process of declining height typically begins after reaching peak height.
- Rate of Height Loss: Research suggests that women may experience a slower rate of stature reduction compared to men. This may be attributed to factors such as differences in bone density, hormonal changes during menopause, and variations in the aging process.
- Osteoporosis: Height loss in women is often associated with the development of osteoporosis, a condition characterized by a decrease in bone density. Osteoporosis is more prevalent in women, particularly after menopause, due to hormonal changes that affect bone health.
- Estrogen Levels: Estrogen, a hormone that plays a crucial role in bone health, decreases significantly in women after menopause. The decline in estrogen levels contributes to accelerated bone loss and height reduction in postmenopausal women.
- Body Composition: Differences in body composition between men and women may also influence how declining height is perceived. Men tend to have a higher muscle mass, which can provide better support for the spine and help maintain height.
How to Avoid Losing Height as You Get Older?
While it is not possible to completely prevent height loss as you get older, there are steps you can take to minimize it and promote overall bone and spine health:
- Maintain Good Posture: Practicing good posture helps reduce strain on the spine and prevents spinal compression, which contributes to height loss. Maintain proper posture by sitting and standing up straight, keeping your shoulders back, and aligning your head with your spine.
- Engage in Regular Exercise: Regular physical activity, especially weight-bearing exercises such as walking, jogging, dancing, or strength training, can help improve bone density and maintain overall bone health. Strong bones are less likely to experience significant height loss.
- Eat a Balanced Diet: A nutrient-rich diet, particularly one that includes adequate amounts of calcium, vitamin D, vitamin K, and other essential nutrients, can support bone health and reduce the risk of osteoporosis-related height loss. Include foods such as dairy products, leafy greens, fish, nuts, and seeds in your diet.
- Avoid Smoking and Excessive Alcohol Consumption: Smoking and excessive alcohol consumption have been linked to decreased bone density and an increased risk of osteoporosis. Quitting smoking and moderating alcohol intake can help minimize the stature reduction associated with these habits.
- Get Regular Check-ups: Regular medical check-ups aid in identifying underlying health conditions that may contribute to height loss, such as osteoporosis or spinal issues. Timely treatment of these conditions helps minimize their impact on height.
- Practice Fall Prevention: Falls can increase the risk of fractures and stature reduction. Take steps to prevent falls by keeping your home well-lit and free of hazards, using assistive devices if needed, wearing proper footwear, and maintaining good balance through exercises like yoga or tai chi.
- Consider Bone Health Supplements: In consultation with a healthcare professional, you may consider supplements such as calcium, vitamin D, or other bone-supporting nutrients if your diet is lacking or if recommended by your healthcare provider.
Height loss is a natural part of the aging process, influenced by various factors such as spinal compression, osteoporosis, posture, joint degeneration, muscle loss, and genetics. While the extent and rate of height loss may vary among individuals, it is important to understand that some degree of height loss is normal with age. However, by maintaining a healthy lifestyle that includes regular exercise, proper nutrition, good posture, and seeking appropriate medical care, you can minimize the impact of height loss and focus on aging gracefully. Remember that aging is a journey, and prioritizing overall health and well-being is key to a fulfilling and healthy life.
|
<urn:uuid:b77f2f46-ae43-49cc-911d-21faa78a4911>
|
CC-MAIN-2023-50
|
https://ifcanet.com/does-height-decrease-over-time/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.932612 | 1,611 | 2.96875 | 3 |
All human beings are made in the image of God. Ethnic diversity is part of God’s wisdom, will and purpose. One pattern – the image of God, but an amazing diversity.
Science confirms what theology has always insisted. With all our distinctive, unique features, we are incredibly alike.
This means that the old theory of different races is out. There are not different races any more than there are different castes, where one caste is inferior to another.
If we are one race how are our differences to be explained? Is it our genes? Our environment? Different climates and therefore different skin colours, different foods and cuisines, different music and dance styles, different fashions and designs different Messengers and experiences of God, different scriptures, different responses to God and therefore different patterns of worship and prayer, and different religions.
Because we are different, we all have something of value to offer to each other and this enlarges us all. Fantastic! A cause for rejoicing and celebration. So we celebrate diversity and promote equality.
Of course there are those who feel threatened by diversity and see no reason to celebrate it. The politics of “race hate” are alive and spreading. Racism – an evil grounded in the theory of different races which has been used to justify white supremacy – continues to influence individuals and institutions.
As long as human diversity is feared, human relations across ethnic, religious and colour differences will be jeopardised. It is important therefore to protect, promote and celebrate diversity constantly.
The Biblical tools to resource this work include the insistence that we are all made “in the image of God” [Genesis 1:26]. Discrimination in Church is further challenged by the insistence that we are all members of “the Body of Christ” [1 Corinthians 12: 12-27]. These scriptural insights mean that Christians cannot give support to any ideology that discriminates against anyone on the basis of colour, gender, age, ability or sexuality.
We are called to do all we can in our communities, congregations and companies to ensure that equality and diversity will be embedded in our vision, structures and practice. Give no support to anyone or any view that discriminates against or shows disrespect to people.
The test of any nation, organisation, community or congregation is its capacity to accommodate diversity and promote equality without wanting to dominate, diminish or destroy those who are different. Constantly check your own attitudes and actions. Always ask the question: Will what is being planned enhance and maximise equality and diversity? Settle for nothing less than actions and attitudes that promote equality and diversity.
|
<urn:uuid:34c88e27-1015-4020-875d-9aaab158c69b>
|
CC-MAIN-2023-50
|
https://inderjitbhogal.co.uk/one-race-the-human-race/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.94588 | 536 | 2.75 | 3 |
Chip resistors that are smaller but which provide more advanced functions are now an important component in solving problems.
What is a resistor?
A resistor, like a capacitor or inductor, is a fundamental element in many electrical circuits. Many resistors are incorporated in all sorts of electric/electronic devices.
This knowledge is so common to electric engineers/technicians, etc., that they may often take resistors completely for granted in their daily work. Nevertheless, no electric circuit will works without them. They are absolutely crucial.
Roles of a resistor
A resistor plays four major roles: current control, voltage dividing, current detection, and biasing.
A resistor controls the current flowing through an electronic circuit, keeping it equal to or smaller than the rated current. In an LED circuit, for example, a resistor is connected in series to an LED to keep the circuit current equal to or smaller than the rated current, thereby preventing burnout of the LED.
Two or more resistors connected in series divides an applied voltage into voltages that are proportional to the resistance values of the resistors. Two or more resistors connected in parallel, on the other hand, divides the current.
:When a current flows through a resistor, a voltage that forces the current to flow through is applied across both ends of the resistor. Measuring this voltage tells you how much current is flowing through the circuit.
Applying a voltage that causes a semiconductor, such as transistor, to operate is referred to as "biasing." Biasing is carried out such that different voltages are applied to different terminals (the emitter, collector, and base) of a transistor, respectively.
In addition to resistors exerting the above functions, there also are damping resistance, terminal resistance, and pull-up/pull-down resistors.
The resistor operates according to Ohm's law: Voltage (V) = Current (I) × Resistance (R)" In current detection by a resistor, a current is given by substituting a known resistance value and a voltage value across both ends of the resistor in the equation: “Current (I) = Voltage (V)/Resistance (R).”
Principle of the resistor
A resistor's value is determined by the natural resistance, sectional area, and length of the resistance material.
As indicated by the equation, the resistance value is given by dividing the product of the natural resistance ρ (Ω·cm) and the length L by the sectional area S. The following is an example of the natural resistance of a metal.
Types of resistors
Resistors are roughly classified into fixed resistors, variable resistors, and semi-fixed resistors. Looking at these resistors from a materials perspective, we have carbon-based resistors and metallic resistors. Resistance materials are formed as films, linear patterns, or tabular shapes, among which metal films include thin films and thick films. The following chart shows resistance categories.
Structure of the resistor
The following diagram depicts the basic structure of a typical resistor. Various types of resistors are used for different purposes, but chip resistors are increasingly favored for use in small devices.
Panasonic's history of resistor manufacturing
Panasonic has an 85-year history of resistor manufacturing.
Following Konosuke Matsushita's motto, "Good parts create good products," in 1933, Panasonic started manufacturing a carbon film resistor for use in radio receivers. Resistor production grew in subsequent years, reaching 2 trillion units in total in 2013.
If the total number of ordinary 1608-size resistors manufactured by Panasonic were stacked up, they would reach to the moon and back, approximately 393 thousand kilometers.
Most of them would, however, be quite new. Production of chip resistors, which are a core product, increased explosively in the 1990s. This demonstrates the fact that the chip resistor is a component for which demand expanded sharply in response to the rapid development and popularity of digital household appliances.
Trends of chip resistors
Size trends of chip resistors
In response to the rising demand for miniaturization of electronic devices, Panasonic has been making efforts to reduce the sizes of chip resistors. In the 25 years since the 3216 size was developed, the company has reduced the chip area to 1/64 (0402 size) and is further pushing ahead with miniaturization. The following graph depicts the progress of miniaturization of chip resistors and yearly changes in composition ratio of their size. Currently, 1005 size chip resistors account for nearly half of all chip resistors. However, production of the 1005 size is already showing a downturn as the demand for even smaller types grows.
(Size name and dimensions)
A chip resistor's outer dimensions are usually expressed with four digits that represent "length (L) × width (W).
Example: 1.00 mm × 0.50 mm→1005
Chip resistors with improved features
There is a growing demand for chip resistors with improved features, with products using chip resistors showing ever-improving performance and with changes in the service environment.
To meet this market demand, Panasonic has developed a range of products with improved features.
(1) Anti-Sulfurated Chip Resistors
An ordinary chip resistor has an internal electrode made of silver. In a sulfur-containing atmosphere, the silver making up the internal electrode reacts with sulfur and produces silver sulfide, which is an insulating material. This may result in wire breakage.
For this reason, a chip resistor used in a sulfur-containing atmosphere or kept near materials containing sulfur must be provided with a means of ensuring resistance to sulfidation.
(2) Anti-Surge, Anti-pulse Chip Resistors
A chip resistor incorporated in a switching circuit or circuit exposed to the influence of static electricity, in which surge or pulse currents are applied frequently to the resistor, must be able to withstand them.
(3) High Precision Chip Resistors
A chip resistor incorporated in precision equipment, such as measuring devices and controllers, must be a high-precision type that shows little variation in resistance value (resistance allowance) or minimal temperature-dependent changes in resistance value (resistance temperature coefficient).
(4) Current Sensing Chip Resistors
A chip resistor for current detection is used to detect overcurrent or remaining battery capacity.
In recent years, electronic devices with higher functions have led to an increase in current flows in circuits. This has created a demand for a chip resistor capable of handling higher power levels.
Lower resistance for less power consumption in circuits is also required. High-precision resistors that retain a superior resistance temperature coefficient in harsh temperature environments are in high demand.
Technical terms for resistors
A resistor has parameters representing its specifications and ratings. Here is a list of technical terms for such parameters. The four parameters in bold font are basic parameters for resistors.
|Power Rating (W)||Maximum power that can be applied continuously to the resistor at the highest category temperature|
|Resistance value (Ω)||Resistance value standardized in conformance with public standards|
|Resistance tolerance (%)||Resistance tolerance value indicates the precision of the resistor|
|Temperature coefficient of resistance
|Change in resistance value that results in response to a change in ambient temperature|
|Maximum working voltage (V)||Maximum voltage that can be applied continuously to the resistor at the highest category temperature|
|Operating temperature range (˚C)||Ambient temperature range under which the resistor is operable|
|DC resistance value (Ω)||Resistance value that is measured when a DC voltage is applied to the resistor. This value represents the basic resistance of the resistor.|
|Withstand voltage (V)||Dielectric strength of a product protected with an insulating outer sheath|
|Insulation resistance (Ω)||Insulation property of a product protected with an insulating outer sheath|
|Solder heat resistance||Electrical/mechanical stability if immersed in solder|
|Moisture resistance||Time-dependent stability against moisture|
|Temperature cycling||Electrical/mechanical stability with temperature changes|
|Endurance (load)||Electrical/mechanical stability in the case of consecutive application of the rated voltage at the highest service temperature|
|Terminal strength||Mechanical strength achieved by mechanically reinforcing the terminal of a component with a lead|
|Vibration resistance||Electrical/mechanical stability against vibration|
|Fire resistance||Self-fire-extinguishing and non-ignition properties if overloaded|
Standards on expression of resistance values and resistance allowances
As mentioned in the above list of technical terms for resistance values, resistance values and allowances are expressed in conformity with the following standards.
IEC 60062：Marking codes for resistors and capacitors.
IEC 60063：Preferred number series for resistors and capacitors
Resistance values are expressed as standardized numerical sequences according to the above standards. They are expressed not as integers such as 1 Ω, 2 Ω, and 3 Ω but as numbers with fractions, such as 2.2 Ω or 4.7 Ω. This is because resistance values are labeled according to the Electronic Industries Association (EIA)'s "Preferred Value" system (E system). "E" in this notation system stands for exponent, and the number following "E", e.g., 24, is the number of logarithmic steps per decade. E24 thus represents the value given by dividing 1 into 10 by a geometric series (root of 10 to the 24th). Resistors' resistance values are often applied in terms of ratios or percentages in actual cases. Resistance values in the form of numerical sequences are often more convenient than integers. The following is a list of resistance values expressed according to the notation system.
|E12||±10%||1210 ≈ 1.21|
|E24||±5%||2410 ≈ 1.10|
|E96||±1%||9610 ≈ 1.02|
|
<urn:uuid:df7e71c0-38eb-4908-92bd-a6ce3907cabf>
|
CC-MAIN-2023-50
|
https://industrial.panasonic.com/sa/ss/technical/r1
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.907243 | 2,106 | 4.3125 | 4 |
Photo: Neal W. O'Connor via Greg VanWyngarden
Oblt. z. S. Gotthard Sachsenberg (second from right) in front of Fokker E.V. Second from left is Halberstadt's chief designer Karl Theis. The Fokker is probably Sachsenberg's personal machine with a yellow-black checkered fuselage. Notice the eyes painted on the engine cover. Camel pilot from No. 210 Sq. was attacked by four naval monoplanes on April
12, 1918. Two days later, the 17th Aero Squadron encountered this type. It is possible that Fokker was flown by Sachsenberg in this fight. During the encounter with seven German
planes was shot down 2.Lt. William H. Shearman. Same pilot had Sachsenberg in his gunsight two days earlier.
Photo: Bundesarchiv via Wikimedia Commons
At this point, our story needs to return to the Sachsenberg family business. This family has been registered as far back as 1620 in Wörlitz in the
Duchy of Anhalt in blacksmithing for the production of horseshoes and
weapons. Johann Gottlieb Sachsenberg (1784-1844) took over the business in 1809 from his father and got into, among other things, the manufacture of mechanical devices and several church carillons.
After the death of Johann, his three sons founded Machinenfabrik Gebrüder Sachsenberg in 1844. Gottfried (1818-1888) was entrusted with
coming up with manufacturing ideas. Friedrich (1819-1895), who became
a Privy Commercial Councillor, was in charge of production. Wilhelm
(1822-1875) was in charge of retail functions.
The firm started out in the repair of mechanical equipment in Rosslau
area. Soon, it was coming up with new technologies in the brick industry,
and produced its own pumps and gas equipment. The first steam powered
machine capable of 4hp was produced in 1849.
From 1866, the company began to repair ships and soon began to produce
their own. Their first was a transport steamship, the ‘Hermann’, launched
in 1869. Soon, the company had over seven hundred employees.
Junkers W 33b "Bremen" (c/n 2504, D-1167) in the spring of 1927 during preparations
for the transatlantic flight. One of the pilots who was preparing for the flight was
Gotthard Sachsenberg. Today you can see her at the Bremen Airport.
The Second Generation
In 1885, the sons of Gottfried and Friedrich became partners in the
company. Gottfried’s son Gotthard Sr. (1849-1914) got his doctorate
in engineering and as was noted earlier, also became a Privy Commercial Councillor. Friedrich’s son Georg (1850-1936) also received
a degree in engineering and also became a Commercial Councillor. In
1887, Wilhelm’s son Paul (1860-1935) also became a partner, and he
was a merchant and, unsurprisingly, a Commercial Councillor!
The company became the biggest river shipyard in Europe in 1890. It
exported its products throughout the world and gained a list of patents in various fields. Chain steamers was their specialty. By the
beginning of the 1890s, the firm had employed a third of the population
of Rosslau. The Sachsebergs opened up branches in other parts of
Germany, too. Among various types of transport and energy technologies, they also manufactured distillation units. In 1901, they were
the first German firm to export this technology to Japan. In 1908, the
firm became a joint-stock company, but the family retained majority
Gotthard Jr. in Civil Life
After his return to civilian life in
1920, Gotthard Jr. formed the aviation company of Ostdeutschen
Landwerkstätten GmbH (OLA) with
his wartime friends in the Eastern
Prussian area of Seerappen. At the
same time, he held the post of director of the company Lloyd Ostflug
GmbH in Königsberg. This company
was disbanded in 1921, but Gotthard
Jr. went into collaboration with Hugo
Junkers in the same year. He soon
became the head of its air transport
component and after the nationaliza-
Image of forty years old
Gotthard Sachsenberg as
a member of parliament
from the Reichstag's annual
INFO Eduard - April 2021
|
<urn:uuid:e3efafa1-a393-41b3-b22b-5b63b29f05db>
|
CC-MAIN-2023-50
|
https://info.eduard.com/en/04-2021-2/page-12
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.954709 | 1,005 | 2.859375 | 3 |
There are a variety of different knitting stitches that can be used to create unique patterns and designs. The most common stitches include the knit stitch, purl stitch, seed stitch, and ribbing. More advanced stitches include cables, lace, and colorwork.
There are endless possibilities when it comes to creating new and interesting knitting projects.
BEST KNIT STITCH PATTERNS for Beginners
There are a lot of different knitting stitches out there. Some are simple and some are more complicated. But how many different stitches are there?
Well, according to the Craft Yarn Council, there are over 200 different types of knitting stitches. That includes both basic and advanced stitches. So if you’re looking to learn more about knitting, or just want to try something new, you have a lot of options!
Of course, not all of these stitches will be right for every project. But it’s still fun to experiment and see what you can create. So grab your needles and get started!
List of All Knitting Stitches
There are a variety of different knitting stitches that can be used to create different textures and patterns in your projects. Here is a list of some of the most popular knitting stitches:
1. Stockinette stitch: This is the most basic knit stitch and creates a smooth, even surface.
2. Garter stitch: This stitch is created by alternating between knit and purl rows, which creates a ridged surface.
3. Seed stitch: This stitch is created by alternately knitting and purling stitches on both the right side and wrong side rows, which creates a textured, bumpy surface.
4. moss Stitch: This stitch is similar to seed stitch but uses onlyknit stitches on the right side rows and only purl stitches on the wrong side rows, which creates a smoother texture.
5 Ribbing: This is a very common type of knit stitch pattern that consists of alternating between knit and purl stitches in order to create stretchy fabric with vertical lines. It’s often used for things like cuffs or hems where you need some extra give. 6 Cable Stitch: This type of knitting involves crossing over sections of stitches in order to create intricate designs – it takes a bit more practice but can result in beautiful patterns!
7 Lace Knitting: Lace knitting involves creating delicate openwork patterns using yarnovers and decreases. It can take some time to get the hang of it but once you do you’ll be able to create stunning pieces!
Are There Different Knitting Stitches?
There are a variety of different knitting stitches that can be used to create different patterns and textures in your knitting projects. Some common stitches include the basic knit and purl stitches, as well as more advanced stitches such as cables and lace. By combining different stitches, you can create endless possibilities in your knitting!
How Many Stitches are There?
There are a lot of stitches! TheCountingStitch.com has a great stitch guide that lists over 100 different types of stitches, but that’s just the tip of the iceberg. A quick Google search will reveal all sorts of unique and interesting stitches, like the herringbone stitch, the grapevine stitch, and the cat’s eye stitch.
If you’re looking for something specific, or just want to explore all the possibilities, there are plenty of resources out there to help you find the perfect stitch for your project.
What is the Most Common Knitting Stitch?
There are a variety of different knitting stitches, but the most common stitch is the knit stitch. The knit stitch is created by inserting the needle into the front loop of the stitch on the left-hand needle, then wrapping the yarn around the needle and pulling it through to create a new loop on the right-hand needle. This process is then repeated until you have reached the end of your row or round.
What are the Main Types of Knitting?
There are two main types of knitting: hand knitting and machine knitting. Hand knitting is the most common type of knitting. It is done with two needles and yarn.
The yarn is wrapped around one needle, then inserted into the fabric through a loop on the other needle. The yarn is then pulled through the loop, tightening the stitch. Machine knitting is done with a sewing machine that has special attachments for holding the needles and feeding the yarn.
There are a variety of different knitting stitches that can be used to create unique patterns and textures in fabric. The most basic stitch is the knit stitch, which is created by inserting the needle into the stitch below and then drawing the yarn through to create a loop. The purl stitch is similar, but the needle is inserted from behind the fabric instead of from above.
There are also a number of more complicated stitches that can be used to create intricate designs. These include cables, lace, and colorwork. Each of these stitches creates a different effect and can be used to create a wide range of looks.
I’m Jane and I’m the editor of janesknittingkits.com! I am a long-time craft and clothing design fan who has been writing about these interests for years.
I have spent many hours studying knitting, weaving, sewing, embroidery, and quilting as well as learning about various brands and models of sewing gear and machines. In addition to this research, my work involves publishing information related to these topics in ways that will be informative for both amateur crafters like me and more experienced sewers!
|
<urn:uuid:399e7641-04b8-4a97-9582-a0248aaf8dcd>
|
CC-MAIN-2023-50
|
https://janesknittingkits.com/how-many-different-knitting-stitches-are-there/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.93122 | 1,143 | 2.734375 | 3 |
Going to English School in Quebec
Start at the British Conquest of 1760 – when Quebec fell to the rule of a British minority. Forward through the waves of migration from the British Isles. Arrive in the mid-20th century, when English prevalence within and surrounding Quebec caused concern of culture loss. By the 1960’s, the Quiet Revolution sparked linguistic assertion within…
Start at the British Conquest of 1760 – when Quebec fell to the rule of a British minority. Forward through the waves of migration from the British Isles. Arrive in the mid-20th century, when English prevalence within and surrounding Quebec caused concern of culture loss.
By the 1960’s, the Quiet Revolution sparked linguistic assertion within modern Quebec. A rise in Quebecois nationalism and the ground breaking election won by the Parti Quebecois all boiled up to the Charter of the French Language. A turning point in Quebec’s cultural preservation. Intensely controversial, “Bill 101” was passed in August, 1977. However, as the Charter nears its forty-second anniversary, a considerable portion of the population remains uninformed about its direct implications.
In its early years, many saw the law as discriminatory and unconstitutional. Today, fear of the law has abated and what was once a boiling pot has been reduced to a simmer; nonetheless, it has faced over 200 legal challenges and seven amendments.
Indeed, much of the tension can be linked to one of its most contentious sections: access to education. The law limits most Quebec citizens’ ability to enrol their children in English elementary and high schools. Owing to the recognition that French education is fundamental to future generations, the section hoped to ensure that Quebecois would remain connected and committed to the preservation of the French language. Here is how it works:
First and foremost, any student is granted the right to attend English, non-government funded private schools, or any English post-secondary establishment, based on certain legal stipulations. Otherwise, the child must meet one of the following:
- Children with a right under law: The child is entitled if he/she, or one of their siblings/parents attended school in English for a large portion of elementary schooling. Also, they can attend if their parents were eligible to attend English school after 1977 – in other words, when the enactment of the charter took place. Finally, the bill also respects the grandfather clause – meaning that it applies to all future generations of the possessor.
- Special authorization: If the child has serious learning disabilities or if he/she suffers from emotional/physical harm from detrimental family/humanitarian circumstances
*only eligible for this category if refused by one of the prior criteria. The child must also receive an examination by the Special Committee of Quebec Education Department.
- Temporarily in Quebec: Provided that one of the child’s parents is temporarily working or studying in Quebec, on a diplomatic mission, or temporarily relocated by the Canadian Armed Forces.
If eligible under these criteria, the parent/guardian must apply to the school board or private school in their area before the child be enrolled. In our area, it’s the Eastern Townships School Board.
|
<urn:uuid:9e83ed6d-e5a0-4df0-b53e-131305c23956>
|
CC-MAIN-2023-50
|
https://journalletour.com/english-school-in-quebec/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.957814 | 653 | 3.078125 | 3 |
Freedom wrapped up in a bow
The Dutch government still sends thousands of tulips to Ottawa as an ongoing thank you for the liberation and for providing sanctuary to the Dutch royal family who lived in Canada in exile. The little orange bow in the Missisquoi Museum’s collection represents the fact that freedom had, and still has, a price.
Before a small orange-coloured silk bow came into the collection of the Missisquoi Museum, it was kept under glass by its owner who cherished it as a gift from a beloved uncle, but who also recognized its significance in terms of Canadian history. Ernest Gordon Wilkins (1907-1991) born in Abercorn, Quebec and who served in the Canadian Infantry Division in WWII, gave the hair bow to his niece as a keepsake when he returned from his military service following the liberation of the Netherlands.
For five years during WWII, the German army brutalized and starved the people of the Netherlands. The Nazis sent almost three-quarters of the Netherlands’ Jewish population to concentration camps like Vught and Mauthausen-Gusen, Bergen-Belsen and Auschwitz-Birkenau ; approximately 500,000 Dutchmen were transported to Germany where they worked as slave labour in factories; they looted and destroyed homes and businesses; displaced hundreds of thousands of people from their communities and executed thousands of resistance fighters until the dying days of the war. In retaliation for a two-day general strike that was staged to disrupt the German war effort, Germany stopped food shipments to the western Netherlands, creating the “Hunger Winter” of 1944-1945. Cut off from already depleted provisions, millions of Dutch civilians faced starvation and resorted to eating tulip bulbs just to survive.
From September to November 1944, the First Canadian Army fought German forces on the Scheldt Estuary. Their victory at the Battle of the Scheldt allowed the liberation of the southern parts of the Netherlands and gave Allied ships access to the vital port of Antwerp, Belgium and allowed them to close in on the Reich from all sides.
The Christmas of 1944 saw the first signs of freedom for the Dutch, but it took until the spring for this to be realized throughout the country. Canadian Infantry Divisions were successful in providing both food and medical relief to reach desperate civilians even while the war raged around them. After holding out over the winter, reinforcements arrived in the Netherlands to support their fellow Canadians. When the new Allied offensives began in 1945, the First Canadian Army helped liberate the northeastern and western Netherlands, until the German resistance finally collapsed and the German Army officially surrendered in early May.
On April 16, 1945, during the final month of the war, Theo Polman recorded in his diary that the 2nd Canadian Infantry Division liberated the city of Groningen. The combat was significant for both the participants, as well as the citizens, who lived through four days of fierce street fighting until victory was finally achieved. He recorded that his family huddled in their home through the battle and noted their interactions with Canadian soldiers after the fighting stopped. One small detail proves poignant: After their midday meal Bep placed an orange bow in Nelly’s hair and a sash around the waists of both her children: “We have waited 5 long years for this moment and now it really is here!” (16 April, 1945). Many accounts from veterans express the profound happiness of the Dutch people with the liberation of their country from German occupation: And everybody had something orange on, for the House of Orange. You know, arm bands and little girls had hair ribbons and they sang their beautiful national anthem, they had their own flags. It was wonderful.
If one looks closely at the numerous images of Dutch people following the liberation, bows and ribbons can indeed be seen in girls’ hair and while the images are in black and white, we can imagine the colour orange helped to set a joyous mood in what came to be known as the “Sweetest Spring.”
More than 7,600 Canadian soldiers, sailors and airmen died in the nine dreadful months it took to liberate the Netherlands ; a tremendous sacrifice for the cause of freedom. They are buried in cemeteries from Adegem, Belgium, to Rheinberg, Germany. The largest, Groesbeek Canadian War Cemetery near the city of Nijmegen, holds the graves of more than 2,300 Canadians. Over 75 years later, the Dutch remember. The liberation of the Netherlands is studied by school children and it is commemorated annually by communities across the country. And the Dutch government still sends thousands of tulips to Ottawa as an ongoing thank you for the liberation and for providing sanctuary to the Dutch royal family who lived in Canada in exile. The little orange bow in the Missisquoi Museum’s collection represents the fact that freedom had, and still has, a price.
|
<urn:uuid:42e78b97-8ca0-435d-8ae8-76a726695d3c>
|
CC-MAIN-2023-50
|
https://journalletour.com/orange-liberation-bow/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.974013 | 1,006 | 3.453125 | 3 |
Lunar cycle-associated physiology has been found in a wide variety of organisms. Recent study has revealed that mRNA levels of Cryptochrome (Cry), one of the circadian clock genes, were significantly higher on a full moon night than on a new moon night in coral, implying the involvement of a photoreception system in the lunar-synchronized spawning. To better establish the generalities surrounding such a mechanism and explore the underlying molecular mechanism, we focused on the relationship between lunar phase, Cry gene expression, and the spawning behavior in a lunar-synchronized spawner, the goldlined spinefoot (Siganus guttatus), and we identified two kinds of Cry genes in this animal. Their mRNA levels showed lunar cycle-dependent expression in the medial part of the brain (mesencephalon and diencephalon) peaking at the first quarter moon. Since this lunar phase coincided with the reproductive phase of the goldlined spinefoot, Cry gene expression was considered a state variable in the lunar phase recognition system. Based on the expression profiles of SgCrys together with the moonlight's pattern of timing and duration during its nightly lunar cycle, we have further speculated on a model of lunar phase recognition for reproductive control in the goldlined spinefoot, which integrates both moonlight and circadian signals in a manner similar to photoperiodic response.
Citation: Fukushiro M, Takeuchi T, Takeuchi Y, Hur S-P, Sugama N, Takemura A, et al. (2011) Lunar Phase-Dependent Expression of Cryptochrome and a Photoperiodic Mechanism for Lunar Phase-Recognition in a Reef Fish, Goldlined Spinefoot. PLoS ONE 6(12): e28643. https://doi.org/10.1371/journal.pone.0028643
Editor: Shin Yamazaki, Vanderbilt University, United States of America
Received: September 12, 2011; Accepted: November 11, 2011; Published: December 7, 2011
Copyright: © 2011 Fukushiro et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was partially supported by the Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), and the Japanese Society for the Promotion of Science (JSPS) of Japan awarded to A.T. and T.O. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. No additional external funding was received for this study.
Competing interests: The authors have declared that no competing interests exist.
Synchronous reproductive behaviour is a phenomenon that occurs when all individuals within a population reproduce at a specific phase set by certain periodic changes in the environment. This is an important adaptive strategy in organisms that enables higher reproductive efficiency, decreased predation risk, and the prevention of interspecies mating . In addition to daily and annual cyclic changes in the terrestrial and aquatic environments, lunar cycle-dependent changes are used as cues for synchronous behavior in some species. The lunar- or semilunar-synchronized reproduction has been seen in a wide variety of living organisms in multiple phyla . Although lunar- or semilunar-synchronized spawning behaviors have been demonstrated in corals , , marine insects , certain groupers , spinefoots , and others, molecular mechanism(s) underlying this behavior remain elusive. Several factors combined have been suggested to determine the reproductive timing in corals. For example, the month of spawning is set by cycles in solar radiation and local weather pattern, the date of spawning is set by the lunar or tidal cycle, and the hour and minute of spawning is set by sunset time . Responsiveness to the amount of moonlight may also be a factor as shown by the coral mRNA levels of Cryptochrome (Cry) which were significantly higher on full moon nights than on new moon nights . Another well-studied organism is a marine midge Clunio marinus which shows (semi)lunar rhythms in reproductive behavior even in laboratory condition, and the rhythms are likely controlled by a combination of circadian clocks, moonlight, tidal fluctuations and temperature .
CRY proteins are highly related to (6–4) photolyases, enzymes repairing UV-induced DNA damage with photon energy , , and contain FAD chromophore , . The photosensory properties of cryptochromes (CRYs) have been investigated in a plant Arabidopsis thaliana and a fruit fly Drosophila melanogaster, and they are shown to play important roles in photomorphogenesis and circadian photoreception, respectively , , . In Drosophila circadian photoreception, illumination triggers interaction between dCRY and dTIMLESS , , both of which are important factors for circadian clock oscillation and resetting. This interaction results in the degradation of both factors, and consequently another critical factor dPER (Period) becomes destabilized . These events are crucial for phase-shift of the Drosophila circadian clock. In vertebrates, CRY1 and CRY2 are considered to lack the photosensitivity but instead constitute negative feedback loops in the circadian clock system together with PERIOD, CLOCK, and BMAL , . The moonlight-associated upregulation of Cry mRNA in coral does not necessarily establish coral CRY as a moonlight-sensitive photoreceptor, but it does imply the involvement of CRY in lunar-synchronized spawning. Because the corals spawn during a full moon, it is difficult to infer whether Cry mRNA levels are directly associated with a putative “circalunar clock” that contains oscillatory factors called state variables determining the phase of the oscillation or whether they are responsive only to the intensity and/or the duration of moonlight. In terms of other lunar-responding animals, there have yet to be any molecular observations of a potential gene involved in the lunar-dependent spawning.
Investigation of the relationship between lunar phase, Cry gene expression patterns, and the lunar-dependent spawning response in animal species other than corals could provide better understanding of a lunar phase-recognition mechanism as well as the generalities surrounding a lunar-associated change of Cry gene expression across animal species. In this study, we focused on the Cry genes of a lunar-synchronized spawner, the goldlined spinefoot (formerly referred to as the golden rabbitfish or orange-spotted spinefoot) (Siganus guttatus). The goldlined spinefoot is a reef fish with a lunar-dependent rhythmic spawning restricted to a species-specific lunar phase (around the first quarter moon) during spawning season , , , , . Two Cry genes, SgCry1 and SgCry3, were identified as showing lunar cycle-dependent expression that peaked at the first quarter moon in the goldlined spinefoot brain, leading us to a concept that SgCry genes do not simply respond to the intensity of moonlight, but they are state variables in a lunar phase-recognition system.
Cloning and phylogenetic analysis of SgCry1 and SgCry3
We identified two kinds of Cry genes in the juvenile goldlined spinefoot. Phylogenetic analysis (Figure 1) showed that they can be classified in vertebrate CRY1 and CRY3 groups, respectively, which led us to identify them as SgCRY1 (AB643455) and SgCRY3 (AB643456). In the Nighbor-Joining phylogenetic tree (Figure 1), Cry3 genes seem to form a monophyletic group with Cry2 genes, which strongly suggests that Cry3 genes are fish orthologs of Cry2 genes.
Goldlined spinefoot CRY sequences (SgCRY1 and SgCRY3; present study) and their related sequences obtained from NCBI Entrez database (accession nos. are shown in Table S1) were analyzed using the Neighbor-Joining method and CLUSTAL W (http://clustalw.ddbj.nig.ac.jp/top-e.html). Bootstrap probabilities (p) are represented by closed circles on the nodes (p>95%) or values near the nodes.
Weekly changes in female GSI
In order to evaluate the mRNA expression profiles of SgCry mRNA expression during sexual maturation of the female goldlined spinefoot, we focused on medial part of the brain (mesencephalon and diencephalon) and the ovary since these sites are closely associated with reproduction in vertebrates. We collected the medial part of the brain and ovary from mature fish for approximately 2 months at 7- or 8-day intervals during and just before the first spawning. Concomitantly, we measured the gonadosomatic index (GSI, Figure 2) to confirm that the fish had sexually matured during the study period. GSI did not significantly change from May 25th to June 15th, 2009, but did increase to a peak on June 29th, 2009 (first quarter moon) and significantly decreased (P < 0.01) on July 7th, 2009 (full moon), indicating that June 29th, 2009 was the first of the two spawning phases during this reproductive season.
Gonadosomatic index (GSI) was calculated as described in Materials and Methods. Numbers of fish sampled are indicated above the bars. An arrow and an arrowhead show the spawning and the summer solstice, respectively. Indicated by seven schematic images are lunar phases from new moon (May 25th, left) to full moon (July 7th, right).
Daily variations of SgCry1 and SgCry3 mRNA expression
We investigated daily variations in SgCry1 and SgCry3 mRNA expression and lunar phase-dependent change in the expression pattern using quantitative RT-PCR and cDNA synthesized from the brain and ovary RNA (Figure 3, and Figure S1). Abundances of SgCry1 mRNA in the brain fluctuated with peaks at dawn (ZT0 [Zeitgeber time 0]) and gradual decreases during the daytime (Figure 3A). Although the averaged SgCry1 mRNA expression levels diverged depending on lunar phase (see below), the expression patterns were similar (Figure 3A). On the other hand, mRNA levels of SgCry3 were almost constant in the brain throughout the day and during all lunar phases (Figure 3B). In the ovary, daily variation was not observed for SgCry1 and SgCry3 mRNA expression (Figure 3C, D) except that weak daily variations were observed for SgCry1 and SgCry3 mRNA expression at June 1st and May25th, respectively (p<0.05, Figure S1).
Each tissue (brain [mesencephalon and diencephalon]: n = 4, ovary: n = 3) was collected at ZT0, ZT6, ZT12, ZT18 from new moon to full moon over one and half lunar cycle. Each Cry mRNA level was calculated as a value relative to that of the Sgβ-actin gene. Error bars represent ± SD. Lunar phases are indicated by schematic moon images. Solid lines show the first lunar cycle, and broken lines show second lunar cycle. (A) Daily changes in the SgCry1 mRNA levels in the brain. p<0.01, Two-way ANOVA. (B) Daily changes in the SgCry3 mRNA levels in the brain. (C, D) Daily changes in the SgCry1 and SgCry3 mRNA levels in the ovary. The graphs are separated into single panels for each lunar phase in Figure S1.
Lunar variations of SgCry1 and SgCry3 mRNA expression
We reanalyzed the results of quantitative RT-PCR from the perspective of possible lunar phase-dependent variation in SgCry1 and SgCry3 mRNA levels (Figure 4). Both SgCry1 and SgCry3 mRNA expression in the brain showed significant lunar-dependency (p<0.01; Figure 4A, B). Expression was highest on June 1st (first quarter moon), showed decrease on June 8th (full moon), and the lowest expression around June 8th and June 15th (last quarter moon). There were also fluctuations in both expression levels with peaks on June 29th (first quarter moon). In contrast to the clear lunar phase-dependency in the brain, levels in the ovary did not show much significant variation (Figure 4C, D).
Each Cry mRNA was calculated as a value relative to that of the Sgβ-actin gene. For each lunar phase, mRNA levels at ZT0, ZT6, ZT12 and ZT18 are averaged except for SgCry1 mRNA levels in the brain (mesencephalon and diencephalon). Since SgCry1 showed diurnal variation in the brain, values were normalized to reduce the deviation due to the daily rhythmic changes as follows; values at each daily time point (ZT0, ZT6, ZT12, and ZT18) were divided by the mean values of all the data for the same time point (0.0340, 0.0242, 0.0109, and 0.0141 for ZT0, ZT6, ZT12, and ZT18, respectively). Error bars represent ± SD. Lunar phases are indicated by schematic moon images. (A) Lunar changes in the SgCry1 mRNA levels in the brain. p<0.01, One-way ANOVA. Post hoc test; p<0.05, 5/25 vs 6/8, 6/15; p<0.01, 6/1 vs 6/8, 6/15, 6/22, 6/29, 7/7). (B) Lunar changes in the SgCry3 mRNA levels in the brain. p<0.01, One-way ANOVA. Post hoc test; p<0.05, 6/15 vs 6/22, 7/7; p<0.01, 5/25 vs 6/8, 6/15; p<0.01, 6/1 vs 6/8, 6/15, 6/22, 6/29, 7/7; p<0.01, 6/15 vs 6/29. (C, D) SgCry mRNA levels in the ovary plotted against lunar phase.
In this study, we identified two cryptochrome genes in the goldlined spinefoot, SgCry1 and SgCry3, and investigated their mRNA levels in the brain (mesencephalon and diencephalon) and ovary over the two months comprising the reproductive season in this fish species. SgCry1 mRNA levels showed diurnal variation with a peak at dawn (ZT0, Figure 3A), indicating that SgCry1 mRNA expression was under circadian clock control and/or environmental light signals. In contrast to the brain, SgCry1 mRNA levels in the ovary did not show strong diurnal fluctuation (Figure 3C, and Figure S1). This finding is analogous to our previous observation that mRNA levels of Xenopus tropicalis Cry1 and Cry2 did not significantly differ between midday and midnight in the ovary . CRYs in the ovary might be involved in physiological mechanisms other than circadian function.
Reanalysis of SgCry mRNA expression in relation to lunar variation revealed that the expression of both Crys has strong lunar phase-dependency in the brain but not in the ovary (Figure 4A, B). SgCry1 mRNA expression demonstrated diurnal and lunar variation, while SgCry3 mRNA expression demonstrated only lunar phase-dependent variation. These SgCry mRNA variations were highest at the first quarter moon and then decreased before the full moon. Such rhythmic changes were observed in not only the lunar cycle in relation to spawning (June 29th) but also the preceding cycle (May 25th – June 15th), indicating that these changes are not simply associated with spawning. Because we reared the fish in this study under natural photoperiod and moonlight without exposure to the tidal cycle, which has an approximately two-week periodicity, it is highly probable that the environmental cue leading to the perception of lunar phase is not the tide but rather moonlight. In fact, some authors have previously revealed that the goldlined spinefoot is responsive to full moonlight such that there are affects on nocturnal melatonin and Period2 mRNA levels in the pineal gland . In addition to retinal photoreceptors, pineal or encephalic photoreceptors such as exorhodopsin , pinopsin , parapinopsin and encephalopsin may exist in the fish, and they may be coordinately involved in the system for discriminating strong solar light (∼1×105 Lux) and weak moonlight (less than 1 Lux).
SgCRY1 and SgCRY2 are classified into vertebrate CRY1 and CRY2 groups, respectively (Figure 1). CRYs in the CRY1 and CRY2 groups are called “mammalian type” CRYs and considered to be non-photoreceptive in contrast to photoreceptive “insect type” CRYs (insect CRYs, Figure 1). However, recent studies suggest the photoreceptive nature of the mammalian-type CRYs , , and therefore SgCRYs might also be candidate photoreceptors for moonlight perception in the goldlined spinefoot, as has been suggested for coral . This idea supports the present result that SgCry3 mRNA levels were highest at the first quarter moon.
Although a mechanism for the detection of moon phase has yet to be identified, the present results imply a general mechanism relevant to a lunar-associated change of Cry gene expression across animal species. The simplest possible mechanism for the detection of moon phase would utilize maximal moonlight intensity and/or the length of a light period that exceeds a certain light intensity. Such a mechanism, however, would be useful for detecting the full moonlight, as in the case of corals, but may be inappropriate for detecting the quarter moons. Therefore, alternative mechanism is likely used at least in the goldlined spinefoot. Another possible mechanism that could explain the recognition of specific lunar phase is a mechanism similar to that for photoperiodic reproductive control, which involves the circadian clock and photoreception. In fact, photoperiodic influences of the moon on the regulation of (semi)lunar-rhythm has been postulated and experimentally explored in a marine midge C. marinus .
In birds, there are photoreceptors in the deep brain that detect environmental light information , , which is then transmitted to the mediobasal hypothalamus (MBH), followed by the regulation of gonadal maturation. In the MBH of long-day responsive quails, day length is measured according to the light conditions surrounding a specific phase in the early night called the “photo-inducible phase” , . Previous studies have shown that photoperiodism also induces gonadal maturation in fish such as masu salmon (Oncorhynchus masou, ), rainbow trout (O. mykiss, ), and gilthead seabream (Sparus aurata, ). Moonlight is seen to periodically change both in intensity and duration (timing of moonrise and moonset) in accordance with the moon phase (Figure 5A). When comparing the moonlight patterns (Figure 5A) to the lunar-dependent change in SgCry mRNA expression (Figure 4A, B), we noted a decrease in SgCry mRNA levels from the first quarter moon to full moon that paralleled the increase in light intensity during ZT18–ZT21. Therefore, we are speculating that the mRNA expression of SgCry is controlled by the light conditions during ZT18–ZT21. That is, SgCry mRNA expression is repressed in moon phases with moonlight irradiation during ZT18–ZT21 (phase II and III, Figure 5A, B) and activated in moon phases without moonlight irradiation during ZT18–ZT21 (phase IV and I, Figure 5A, B). If so, the lunar phase-dependent gene expression could be regulated by a moonlight signal given during the “photo-repressive phase”, a specific circadian time similar to the photo-inducible phase in photoperiodism.
(A) Schematic of solar light phase in Okinawa, moonlight phase, and moonlight intensity during the experiments. A putative photo-repressive phase is indicated by white frame. (B) Lunar limit cycle model served by SgCry as a state-variable. SgCry mRNA level decreases from first lunar quarter to last lunar quarter when moonlight intensity is relatively high and exposed time of moonlight is relatively long (Phase II, Phase III. SgCry mRNA levels increase from last lunar quarter to first lunar quarter (Phase IV–Phase I).
The lunar phase-dependent expression of SgCrys, which has a cycle advanced by one fourth that of the lunar cycle, raises the possibility that SgCry could function as a state variable determining the lunar phase. In this system, SgCry expression and moonlight intensity (or another state variable reflecting the moonlight intensity) would form a hypothetical lunar limit cycle (Figure 5B), and the combination of these two factors might constitute a putative “circalunar clock” and enable the goldlined spinefoot to recognize any specific lunar phase as a point within this limit cycle.
In consideration of the expression patterns, SgCry genes are likely under a combined regulation of circadian clock- and moonlight-responsive element(s), or alternatively they are regulated by a novel cis-element, the activity of which changes with the peak seen around the first quarter moon (a lunar phase-responsive element). Further analyses of the transcriptional regulatory mechanisms of SgCry1 and SgCry3 genes in the brain would shed light on the precise mechanism(s) for the lunar phase-recognition system that serves the oocyte maturation processes and decides the timing of spawning through induced synthesis or secretion of GnRH in the brain.
Materials and Methods
Experimental animal care was conducted under permission from the Committee for Animal Experimentation of the School of Science and Engineering at Waseda University (permission # 09A03). Animal experiments including sampling in the field were conducted under permission from Sesoko Station Tropical Biosphere Research Center at University of the Ryukyus (permission # 090522–090707). Juvenile goldlined spinefoot fish (0.08–0.15 g) were originally collected by using a fish net at low tide around the new moon period from a mangrove swamp of the Manna River in Okinawa, Japan. The fish were reared in outdoor tanks (capacity: 10 metric tons) with aerated running seawater for three or four years under natural photoperiod, natural moonlight, and water temperature conditions at Sesoko Station, Tropical Biosphere Research Center, University of the Ryukyus, Japan. There are roofs and frames over the tanks to protect them from rain and wind, but the sunlight and moonlight reach to the tanks. There is no artificial light possibly reaching the fish inside the tanks. The feeding of commercial pellets (EP1, Marubeni Nisshin, Tokyo, Japan) took place daily at 10:00 h. Approximately 3-year-old or 4-year-old fish with body weights ranging from 200 to 700 g were collected by using a fish net weekly from May 25th to July 7th, 2009 and used in the present experiments. During the experiment, sunrise and sunset occurred at approx. 6:00 and 19:00, respectively. The fish were taken from the tanks at random and anesthetized with iced seawater in a bucket. The fish were brought to the laboratory within a few minutes under natural light condition (in daytime sampling [06:00–18:00]) or with covering the bucket to keep the fish in the dark (in nighttime sampling [24:00]). The brain (medial part of the brain, mesencephalon and diencephalon) (n = 4) and ovary (n = 3) were collected from the fish at 06:00 (∼ZT0 [Zeitgeber time 0]), 12:00 (∼ZT6), and 18:00 (∼ZT12) under fluorescent light or at 24:00 (∼ZT18) under dim red light (<0.1 mW/cm2,>640 nm). In the sampling at 24:00, the eyes of each fish were covered with aluminum foil during decapitation to minimize an effect of dim red light. Samples were kept in RNAlater (Ambion) at 4°C overnight and then stored at −80°C until RNA extraction. During the sampling, body mass and ovarian mass were recorded separately. Gonadosomatic index (GSI) was calculated using the following formula: GSI = (ovarian mass/body mass)×100.
Complementary DNA Cloning of SgCry1 and SgCry3 Genes Encoding Full-Length Coding Sequences
Total RNA was extracted from juvenile goldlined spinefoot using TRIzol reagent (Invitrogen). First-strand cDNAs were synthesized with SuperScript III reverse transcriptase (Invitrogen) using KSII(dT)21 primer (GAGGTCGACGGTATCGATAAGC(T)21). The SgCry1 and SgCry3 cDNA fragments were amplified using a pair of degenerate primers (5′-GTCCTSGAYCCBTGGTTYG-3′ and 5′-GTCATDATNGCRTCDATCC-3′) that were designed based on the conserved regions of Cry genes from some species (Acropora millepora, Gasterosteus aculeatus, Oryzias latipes, Takifugu rubripes, Xenopus tropicalis, and Gallus gallus). Complementary DNAs including the 5′ and 3′ UTRs were obtained using RACE. cDNAs that included the entire coding sequence for SgCry1 and SgCry3 were obtained by PCR with primers for their 5′ and 3′ UTRs using PfuUltra (Stratagene). The amplified fragments were inserted into the pENTR/D-TOPO vector (Invitrogen), and the inserts of at least three independent clones for each gene were sequenced. Finally, SgCry1 and SgCry3 cDNAs for the CDS without presumed PCR errors were isolated.
Quantitative RT-PCR Analysis
Total RNA was extracted from the tissues using TRIzol reagent (Invitrogen). Residual genomic DNA in the total RNA sample was eliminated by DNase I treatment (RNase-free recombinant DNase I, TaKaRa BIO). Quantitative RT-PCR analyses were performed using StepOnePlus (Applied Biosystems) along with a high capacity cDNA reverse transcription kit (Applied Biosystems). Each reaction included 1 µg of total RNA as a template. The primers for quantitative RT-PCR are shown in Table 1. In order to establish a consistently transcribed gene for reference, we isolated and sequenced partial cDNA from SgrpL13A (AB643457), SgPGK (AB643458), SgEF1α (AB643459), Sgβ-actin (AB643460), and Sgβ2M (AB643461) of the juvenile fish cDNA. We examined the performance of one or more pairs of the primer for each gene by amplification of the cDNA in the presence or absence of RTase, electrophoresis of the amplified fragments. Because we did not obtain primer sets giving specific amplification and a single band for two of the five genes (SgrpL13A and Sgβ2M), the other three genes with sufficient performance (SgPGK, SgEF1α, Sgβ-actin) were used in the further analysis. Among these genes, we selected Sgβ-actin as a reference control gene in the following measurements since the threshold cycles (Ct) for Sgβ-actin were relatively unchanged over the sampling time (Figure S2).
SgCry mRNA levels and their daily variation in the brain and ovary.Graphs shown in Fugure 3 were separated into single panels for each lunar phase. A hash mark denotes a data set in which one of the triplicate samples was missing due to a mistake in the experiment.
Threshold cylcles for control genes in quantitative RT-PCR analysis.Distribution of threshold cycles for three control genes (SgPGK, SgEF1α, Sgβ-actin) in the quantitative RT-PCR analysis (shown in Figure 3 and Figure 4) were shown by box plots. Outliers were omitted. Based on these plots and standard deviations of threshold cycles for SgPGK (brain 0.55; ovary, 1.23), SgEF1α (brain 0.46; ovary, 1.58), and Sgβ-actin (brain, 0.41; ovary, 1.32), we selected Sgβ-actin as a reference control gene.
Conceived and designed the experiments: MF AT TO. Performed the experiments: MF TT YT S-PH NS AT YK KO TO. Analyzed the data: MF TO. Contributed reagents/materials/analysis tools: AT TO. Wrote the paper: MF TO
- 1. Domeier ML, Colin PL (1997) Tropical reef fish spawning aggregations: Defined and reviewed. Bulletin of Marine Science 60: 698–726.
- 2. Neumann D (1976) Entrainment of a semilunar rhythms. In: DeCoursey PJ, editor. Biological Rhythms in the Marine Environment. Los Angeles: University of South Carolina Press. pp. 115–127.
- 3. Harrison PL, Babcock RC, Bull GD, Oliver JK, Wallace CC, et al. (1984) Mass spawning in tropical reef corals. Science 223: 1186–1189.
- 4. Jokiel PL, Ito RY, Liu PM (1985) Night irradiance and synchronization of lunar release of planula larvae in the reef coral Pocillopora damicornis. Marine Biology 88: 167–174.
- 5. Kaiser TS, Neumann D, Heckel DG (2011) Timing the tides: genetic control of diurnal and lunar emergence times is correlated in the marine midge Clunio marinus. BMC Genet 12: 49.
- 6. Colin PL, Shapiro DY, Weiler D (1987) Aspects of the reproduction of two groupers, Epinephelus guttatus and E. striatus in the West Indies. Bulletin of Marine Science 40: 220–230.
- 7. Rahman MD, Takemura A, Takano K (2000) Correlation between plasma steroid hormones and vitellogenin profiles and lunar periodicity in the female golden rabbitfish, Siganus guttatus (Bloch).Comp Biochem Physiol B Biochem Mol Biol. 127: 113–122.
- 8. Takemura A, Rahman MS, Nakamura S, Park YJ, Takano K (2004) Lunar cycles and reproductive activity in reef fishes with particular attention to rabbitfishes. Fish and Fisheries 5: 317–328.
- 9. Vize PD, Embesi JA, Nickell M, Brown DP, Hagman DK (2005) Tight temporal consistency of coral mass spawning at the Flower Garden Banks, Gulf of Mexico, from 1997-2003. Gulf of Mexico Science 23: 107–114.
- 10. Levy O, Appelbaum L, Leggat W, Gothlif Y, Hayward DC, et al. (2007) Light-responsive cryptochromes from a simple multicellular animal, the coral Acropora millepora. Science 318: 467–470.
- 11. Todo T, Ryo H, Yamamoto K, Toh H, Inui T, et al. (1996) Similarity among the Drosophila (6-4)photolyase, a human photolyase homolog, and the DNA photolyase-blue-light photoreceptor family. Science 272: 109–112.
- 12. Hsu DS, Zhao X, Zhao S, Kazantsev A, Wang RP, et al. (1996) Putative human blue-light photoreceptors hCRY1 and hCRY2 are flavoproteins. Biochemistry 35: 13871–13877.
- 13. Kanai S, Kikuno R, Toh H, Ryo H, Todo T (1997) Molecular evolution of the photolyase-blue-light photoreceptor family. J Mol Evol 45: 535–548.
- 14. Ozturk N, Selby CP, Song SH, Ye R, Tan C, et al. (2009) Comparative photochemistry of animal type 1 and type 4 cryptochromes. Biochemistry 48: 8585–8593.
- 15. Li QH, Yang HQ (2007) Cryptochrome signaling in plants. Photochem Photobiol 83: 94–101.
- 16. Emery P, So WV, Kaneko M, Hall JC, Rosbash M (1998) CRY, a Drosophila clock and light-regulated cryptochrome, is a major contributor to circadian rhythm resetting and photosensitivity. Cell 95: 669–679.
- 17. Stanewsky R, Kaneko M, Emery P, Beretta B, Wager-Smith K, et al. (1998) The cryb mutation identifies cryptochrome as a circadian photoreceptor in Drosophila. Cell 95: 681–692.
- 18. Ceriani MF, Darlington TK, Staknis D, Mas P, Petti AA, et al. (1999) Light-dependent sequestration of TIMELESS by CRYPTOCHROME. Science 285: 553–556.
- 19. Rosato E, Codd V, Mazzotta G, Piccin A, Zordan M, et al. (2001) Light-dependent interaction between Drosophila CRY and the clock protein PER mediated by the carboxy terminus of CRY. Curr Biol 11: 909–917.
- 20. Busza A, Emery-Le M, Rosbash M, Emery P (2004) Roles of the two Drosophila CRYPTOCHROME structural domains in circadian photoreception. Science 304: 1503–1506.
- 21. Liu AC, Lewis WG, Kay SA (2007) Mammalian circadian signaling networks and therapeutic targets. Nat Chem Biol 3: 630–639.
- 22. Ukai-Tadenuma M, Yamada RG, Xu H, Ripperger JA, Liu AC, et al. (2011) Delay in feedback repression by cryptochrome 1 is required for circadian clock function. Cell 144: 268–281.
- 23. Hoque MM, Takemura A, Matsuyama M, Matsuura S, Takano K (1999) Lunar spawning in Siganus canaliculatus. J Fish Biol 55: 1213–1222.
- 24. Harahap AP, Takemura A, Nakamura S, Rahman MS, Takano K (2001) Histological evidence of lunar-synchronized ovarian development and spawning in the spiny rabbitfish Siganus spinus (Linnaeus) around the Ryukyus. Fisheries Science 67: 888–893.
- 25. Rahman MS, Takemura A, Nakamura S, Takano K (2003) Rhythmic changes in testicular activity with lunar cycle in the forktail rabbitfish. J Fish Biol 62: 495–499.
- 26. Kubo Y, Takeuchi T, Okano K, Okano T (2010) Cryptochrome genes are highly expressed in the ovary of the African clawed frog, Xenopus tropicalis. PLoS One 5: e9273.
- 27. Takemura A, Susilo ES, Rahman MD, Morita M (2004) Perception and possible utilization of moonlight intensity for reproductive activities in a lunar-synchronized spawner, the golden rabbitfish.Journal of Experimental Zoology, Part A: Comparative Experimental Biology 301A: 844–851.
- 28. Sugama N, Park JG, Park YJ, Takeuchi Y, Kim SJ, et al. (2008) Moonlight affects nocturnal Period2 transcript levels in the pineal gland of the reef fish Siganus guttatus. J Pineal Res 45: 133–141.
- 29. Mano H, Kojima D, Fukada Y (1999) Exo-rhodopsin: a novel rhodopsin expressed in the zebrafish pineal gland. Brain Res Mol Brain Res 73: 110–118.
- 30. Okano T, Yoshizawa T, Fukada Y (1994) Pinopsin is a chicken pineal photoreceptive molecule. Nature 372: 94–97.
- 31. Blackshaw S, Snyder SH (1997) Parapinopsin, a novel catfish opsin localized to the parapineal organ, defines a new gene family. Journal of Neuroscience 17: 8083–8092.
- 32. Blackshaw S, Snyder SH (1999) Encephalopsin: a novel mammalian extraretinal opsin discretely localized in the brain. J Neurosci 19: 3681–3690.
- 33. Rubin EB, Shemesh Y, Cohen M, Elgavish S, Robertson HM, et al. (2006) Molecular and phylogenetic analyses reveal mammalian-like clockwork in the honey bee (Apis mellifera) and shed new light on the molecular evolution of the circadian clock. Genome Res 16: 1352–1365.
- 34. Griffin EA Jr, Staknis D, Weitz CJ (1999) Light-independent role of CRY1 and CRY2 in the mammalian circadian clock. Science 286: 768–771.
- 35. Tu DC, Batten ML, Palczewski K, Van Gelder RN (2004) Nonvisual photoreception in the chick iris. Science 306: 129–131.
- 36. Foley LE, Gegear RJ, Reppert SM (2011) Human cryptochrome exhibits light-dependent magnetosensitivity. Nat Commun 2: 356.
- 37. Wada Y, Okano T, Adachi A, Ebihara S, Fukada Y (1998) Identification of rhodopsin in the pigeon deep brain. FEBS Lett 424: 53–56.
- 38. Nakane Y, Ikegami K, Ono H, Yamamoto N, Yoshida S, et al. (2010) A mammalian neural tissue opsin (Opsin 5) is a deep brain photoreceptor in birds. Proc Natl Acad Sci U S A 107: 15264–15268.
- 39. Yasuo S, Watanabe M, Tsukada A, Takagi T, Iigo M, et al. (2004) Photoinducible phase-specific light induction of Cry1 gene in the pars tuberalis of Japanese quail. Endocrinology 145: 1612–1616.
- 40. Yoshimura T (2006) Molecular mechanism of the photoperiodic response of gonads in birds and mammals. Comp Biochem Physiol A Mol Integr Physiol 144: 345–350.
- 41. Amano M, Hyodo S, Kitamura S, Ikuta K, Suzuki Y, et al. (1995) Short photoperiod accelerates preoptic and ventral telencephalic salmon GnRH synthesis and precocious maturation in underyearling male masu salmon. Gen Comp Endocrinol 99: 22–27.
- 42. Choi S, Lee CH, Park W, Kim DJ, Sohn YC (2010) Effects of shortened photoperiod on gonadotropin-releasing hormone, gonadotropin, and vitellogenin gene expression associated with ovarian maturation in rainbow trout. Zoolog Sci 27: 24–32.
- 43. Meseguer C, Ramos J, Bayarri MJ, Oliveira C, Sanchez-Vazquez FJ (2008) Light synchronization of the daily spawning rhythms of gilthead sea bream (Sparus aurata L) kept under different photoperiod and after shifting the LD cycle. Chronobiol Int 25: 666–679.
- 44. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4: 406–425.
|
<urn:uuid:55890a61-507e-4ab8-b557-bce1ca94fc34>
|
CC-MAIN-2023-50
|
https://journals.plos.org:443/plosone/article?id=10.1371/journal.pone.0028643
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.887783 | 8,729 | 3.015625 | 3 |
As an inquisitive tech aficionado, a couple of days back, I was finding out about the popular expressions of this century, Artificial Intelligence and Machine Learning, it was totally interesting the way that these advances are changing and are probably going to change the approaching fate of human existence on the planet. That is the explanation, I have chosen to commit this article on Artificial Intelligence Future so together we can investigate the potential outcomes of another time with AI and computerized reasoning and what it holds for understudies who will learn at Mechatronics Engineering courses in Coimbatore.
Man-made reasoning Future-Less Artificial, More Intelligent
From driverless vehicles to voice robotization in homes, man-made consciousness has advanced quickly and is, as of now, not simply an idea from science fiction films and books. Computerized reasoning’s future is showing up quicker than the expectations displayed in the much lauded film “Minority Report”, set in 2054. As per an examination by researchers at the University of Oxford, Artificial Intelligence will be preferable to people at interpreting dialects by 2024, composing school papers by 2026, selling products by 2031, composing a bestselling book by 2049, and leading medical procedures by 2053. In the following many years, AI will become a necessary piece of our lives, arriving at the degree of ingenious machines to surpass human scholarly abilities.
How Might AI Change the Future?
Given the new innovative advances in AI, this is how artificial consciousness will change the future-
Computerized reasoning in healthcare
Almost 86% of the missteps can be forestalled in the medical services industry, and AI will play a fundamental part in this. The eventual fate of AI in medical services is a step towards democratising medical care to help patients and medical services experts the same, while simultaneously making it not so expensive but rather more precise through AI-controlled prescient consideration. Prescient examination combined with man-made brainpower can assist with obtaining different variables (spot of birth, dietary patterns, neighbourhood air contamination levels, and so on) that impact an individual’s wellbeing. In the future, we can expect AI-controlled medical services frameworks to guess when an individual is likely going to develop a constant illness and propose safeguard medicine to fix it before it declines.
Man-made reasoning Banking’s Future
The worldwide business worth of AI in banking is expected to reach $300 billion before the end of 2030, which you can be a piece of following your drop from a Best CSE college in Coimbatore. Man-made consciousness is good to go to become the dominant focal point in the next ten years in verticals like business knowledge and security, with diminished cost, expanded usefulness, and upgraded client encounters. Robo Advisors in abundance, the executives, will become a familiar sight and will have distinct advantages in the financial space, saving enormous amounts of time for abundance administrators and clients. The banks of things to come won’t simply customise their administrations and items, but will utilise AI to customise client encounters. An incredible example of such personalisation would be to eliminate the need to create an ID card when you stroll into the bank office, nevertheless keep on being welcomed with your name and complete information on your whole ledger history.
Millions of New Job Opportunities to be Created by Simulated Intelligence
“Computerized reasoning will take our positions!” is the most well-known dread encompassing man-made consciousness later on. With man-made reasoning, computerising a wide range of work, we can imagine a more agreeable future for ourselves that will create new positions and not uproot them. As indicated by a report on the future of jobs by the World Economic Forum, AI will create 58 million new man-made brainpower occupations by 2022, and it’s a once-in-a-lifetime chance for undergraduates dropping out. There is an incredible opportunity that by 2030, AI will beat people in the greater part of the psychological assignments. However, that doesn’t mean it will remove occupations.
|
<urn:uuid:6a2e71c3-457b-4c2a-8eb1-376fb1fe2983>
|
CC-MAIN-2023-50
|
https://kahedu.edu.in/how-data-science-and-artificial-intelligence-will-shape-the-world/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.936482 | 834 | 2.8125 | 3 |
In modern historiography, ancient Rome refers to Roman civilization from the founding of the city of Rome in the 8th century BC to the collapse of the Western Roman Empire in the 5th century AD. It encompasses the Roman Kingdom (753–509 BC), Roman Republic (509–27 BC) and Roman Empire (27 BC–476 AD) until the fall of the western empire.
|753 BC–476 AD|
|Capital||Rome (and others during the late Empire, notably Constantinople and Ravenna)|
|Government||Kingdom (753–509 BC)|
Republic (509–27 BC)
Empire (27 BC–476 AD)
|Historical era||Ancient history|
• Octavian proclaimed Augustus
|Precedent and law|
|Titles and honours|
Ancient Rome began as an Italic settlement, traditionally dated to 753 BC, beside the River Tiber in the Italian Peninsula. The settlement grew into the city and polity of Rome, and came to control its neighbours through a combination of treaties and military strength. It eventually dominated the Italian peninsula, and acquired an Empire that took in much of Europe and the nations surrounding the Mediterranean. It was among the largest empires in the ancient world, with an estimated 50 to 90 million inhabitants, roughly 20% of the world's population at the time. It covered around 5 million square kilometres (1.9 million square miles) at its height in AD 117.
The Roman state evolved from an elective monarchy to a democratic classical republic and then to an increasingly autocratic semi-elective military dictatorship during the Empire. Through conquest, cultural, and linguistic assimilation, at its height it controlled the North African coast, Egypt, Southern Europe, and most of Western Europe, the Balkans, Crimea and much of the Middle East, including Anatolia, Levant and parts of Mesopotamia and Arabia. It is often grouped into classical antiquity together with ancient Greece, and their similar cultures and societies are known as the Greco-Roman world.
Ancient Roman civilisation has contributed to modern language, religion, society, technology, law, politics, government, warfare, art, literature, architecture and engineering. Rome professionalised and expanded its military and created a system of government called res publica, the inspiration for modern republics such as the United States and France. It achieved impressive technological and architectural feats, such as the empire-wide construction of aqueducts and roads, as well as more grandiose monuments and facilities.
The Punic Wars with Carthage gave Rome supremacy in the Mediterranean. The Roman Empire emerged with the principate of Augustus (from 27 BC); Rome's imperial domain now extended from the Atlantic to Arabia and from the mouth of the Rhine to North Africa. In 92 AD, Rome came up against the resurgent Persian Empire and became involved in history's longest-running conflict, the Roman–Persian Wars, which would have lasting effects on both empires. Under Trajan, Rome's empire reached its territorial peak, encompassing the entire Mediterranean Basin, the southern margins of the North Sea, and the shores of the Red and Caspian Seas. Republican mores and traditions started to decline during the imperial period, with civil wars becoming a common prelude to the rise of a new emperor. Splinter states, such as the Palmyrene Empire, would temporarily divide the Empire during the crisis of the 3rd century before some stability was restored in the Tetrarchy phase of imperial rule.
Plagued by internal instability and attacked by various migrating peoples, the western part of the empire broke up into independent barbarian kingdoms in the 5th century. The eastern part of the empire remained a power through the Middle Ages until its fall in 1453 AD.
According to the founding myth of Rome, the city was founded on 21 April 753 BC on the banks of the river Tiber in central Italy, by the twin brothers Romulus and Remus, who descended from the Trojan prince Aeneas, and who were grandsons of the Latin King Numitor of Alba Longa. King Numitor was deposed by his brother, Amulius, while Numitor's daughter, Rhea Silvia, gave birth to the twins. Since Rhea Silvia had been raped and impregnated by Mars, the Roman god of war, the twins were considered half-divine.
The new king, Amulius, feared Romulus and Remus would take back the throne, so he ordered them to be drowned. A she-wolf (or a shepherd's wife in some accounts) saved and raised them, and when they were old enough, they returned the throne of Alba Longa to Numitor.
The twins then founded their own city, but Romulus killed Remus in a quarrel over the location of the Roman Kingdom, though some sources state the quarrel was about who was going to rule or give his name to the city. Romulus became the source of the city's name. In order to attract people to the city, Rome became a sanctuary for the indigent, exiled, and unwanted. This caused a problem, in that Rome came to have a large male population but was bereft of women. Romulus visited neighboring towns and tribes and attempted to secure marriage rights, but as Rome was so full of undesirables he was refused. Legend says that the Latins invited the Sabines to a festival and stole their unmarried maidens, leading to the integration of the Latins with the Sabines.
Another legend, recorded by Greek historian Dionysius of Halicarnassus, says that Prince Aeneas led a group of Trojans on a sea voyage to found a new Troy, since the original was destroyed at the end of the Trojan War. After a long time in rough seas, they landed on the banks of the Tiber River. Not long after they landed, the men wanted to take to the sea again, but the women who were traveling with them did not want to leave. One woman, named Roma, suggested that the women burn the ships out at sea to prevent their leaving. At first, the men were angry with Roma, but they soon realized that they were in the ideal place to settle. They named the settlement after the woman who torched their ships.
The Roman poet Virgil recounted this legend in his classical epic poem the Aeneid, where the Trojan prince Aeneas is destined by the gods to found a new Troy. In the epic, the women also refuse to go back to the sea, but they were not left on the Tiber. After reaching Italy, Aeneas, who wanted to marry Lavinia, was forced to wage war with her former suitor, Turnus. According to the poem, the Alban kings were descended from Aeneas, and thus Romulus, the founder of Rome, was his descendant.
The city of Rome grew from settlements around a ford on the river Tiber, a crossroads of traffic and trade. According to archaeological evidence, the village of Rome was probably founded some time in the 8th century BC, though it may go back as far as the 10th century BC, by members of the Latin tribe of Italy, on the top of the Palatine Hill.
The Etruscans, who had previously settled to the north in Etruria, seem to have established political control in the region by the late 7th century BC, forming an aristocratic and monarchical elite. The Etruscans apparently lost power by the late 6th century BC, and at this point, the original Latin and Sabine tribes reinvented their government by creating a republic, with much greater restraints on the ability of rulers to exercise power.
Roman tradition and archaeological evidence point to a complex within the Forum Romanum as the seat of power for the king and the beginnings of the religious center there as well. Numa Pompilius, the second king of Rome succeeding Romulus, began Rome's building projects with his royal palace, the Regia, and the complex of the Vestal virgins.
According to tradition and later writers such as Livy, the Roman Republic was established around 509 BC, when the last of the seven kings of Rome, Tarquin the Proud, was deposed by Lucius Junius Brutus and a system based on annually elected magistrates and various representative assemblies was established. A constitution set a series of checks and balances, and a separation of powers. The most important magistrates were the two consuls, who together exercised executive authority such as imperium, or military command. The consuls had to work with the Senate, which was initially an advisory council of the ranking nobility, or patricians, but grew in size and power.
Other magistrates of the Republic include tribunes, quaestors, aediles, praetors and censors. The magistracies were originally restricted to patricians, but were later opened to common people, or plebeians. Republican voting assemblies included the comitia centuriata (centuriate assembly), which voted on matters of war and peace and elected men to the most important offices, and the comitia tributa (tribal assembly), which elected less important offices.
In the 4th century BC, Rome had come under attack by the Gauls, who now extended their power in the Italian peninsula beyond the Po Valley and through Etruria. On 16 July 390 BC, a Gallic army under the leadership of tribal chieftain Brennus, met the Romans on the banks of the Allia River ten miles north of Rome. Brennus defeated the Romans, and the Gauls marched to Rome. Most Romans had fled the city, but some barricaded themselves upon the Capitoline Hill for a last stand. The Gauls looted and burned the city, then laid siege to the Capitoline Hill. The siege lasted seven months. The Gauls then agreed to give the Romans peace in exchange for 1000 pounds of gold. According to later legend, the Roman supervising the weighing noticed that the Gauls were using false scales. The Romans then took up arms and defeated the Gauls. Their victorious general Camillus remarked "With iron, not with gold, Rome buys her freedom."
The Romans gradually subdued the other peoples on the Italian peninsula, including the Etruscans. The last threat to Roman hegemony in Italy came when Tarentum, a major Greek colony, enlisted the aid of Pyrrhus of Epirus in 281 BC, but this effort failed as well. The Romans secured their conquests by founding Roman colonies in strategic areas, thereby establishing stable control over the region of Italy they had conquered.
In the 3rd century BC Rome faced a new and formidable opponent: Carthage. Carthage was a rich, flourishing Phoenician city-state that intended to dominate the Mediterranean area. The two cities were allies in the times of Pyrrhus, who was a menace to both, but with Rome's hegemony in mainland Italy and the Carthaginian thalassocracy, these cities became the two major powers in the Western Mediterranean and their contention over the Mediterranean led to conflict.
The First Punic War began in 264 BC, when the city of Messana asked for Carthage's help in their conflicts with Hiero II of Syracuse. After the Carthaginian intercession, Messana asked Rome to expel the Carthaginians. Rome entered this war because Syracuse and Messana were too close to the newly conquered Greek cities of Southern Italy and Carthage was now able to make an offensive through Roman territory; along with this, Rome could extend its domain over Sicily.
Although the Romans had experience in land battles, defeating this new enemy required naval battles. Carthage was a maritime power, and the Roman lack of ships and naval experience made the path to the victory a long and difficult one for the Roman Republic. Despite this, after more than 20 years of war, Rome defeated Carthage and a peace treaty was signed. Among the reasons for the Second Punic War was the subsequent war reparations Carthage acquiesced to at the end of the First Punic War.
The Second Punic War is famous for its brilliant generals: on the Punic side Hannibal and Hasdrubal; on the Roman, Marcus Claudius Marcellus, Quintus Fabius Maximus Verrucosus and Publius Cornelius Scipio. Rome fought this war simultaneously with the First Macedonian War. The war began with the audacious invasion of Hispania by Hannibal, son of Hamilcar Barca, a Carthaginian general who had led operations on Sicily towards the end of the First Punic War. Hannibal rapidly marched through Hispania to the Italian Alps, causing panic among Rome's Italian allies. The best way found to defeat Hannibal's purpose of causing the Italians to abandon Rome was to delay the Carthaginians with a guerrilla war of attrition, a strategy propounded by Quintus Fabius Maximus, who would be nicknamed Cunctator ("delayer" in Latin), and whose strategy would be forever after known as Fabian. Due to this, Hannibal's goal was unachieved: he could not bring enough Italian cities to revolt against Rome and replenish his diminishing army, and he thus lacked the machines and manpower to besiege Rome.
Still, Hannibal's invasion lasted over 16 years, ravaging Italy. Finally, when the Romans perceived the depletion of Hannibal's supplies, they sent Scipio, who had defeated Hannibal's brother Hasdrubal in modern-day Spain, to invade the unprotected Carthaginian hinterland and force Hannibal to return to defend Carthage itself. The result was the ending of the Second Punic War by the famously decisive Battle of Zama in October 202 BC, which gave to Scipio his agnomen Africanus. At great cost, Rome had made significant gains: the conquest of Hispania by Scipio, and of Syracuse, the last Greek realm in Sicily, by Marcellus.
More than a half century after these events, Carthage was humiliated and Rome was no more concerned about the African menace. The Republic's focus now was only to the Hellenistic kingdoms of Greece and revolts in Hispania. However, Carthage, after having paid the war indemnity, felt that its commitments and submission to Rome had ceased, a vision not shared by the Roman Senate. When in 151 BC Numidia invaded Carthage, Carthage asked for Roman intercession. Ambassadors were sent to Carthage, among them was Marcus Porcius Cato, who after seeing that Carthage could make a comeback and regain its importance, ended all his speeches, no matter what the subject was, by saying: "Ceterum censeo Carthaginem esse delendam" ("Furthermore, I think that Carthage must be destroyed").
As Carthage fought with Numidia without Roman consent, the Third Punic War began when Rome declared war against Carthage in 149 BC. Carthage resisted well at the first strike, with the participation of all the inhabitants of the city. However, Carthage could not withstand the attack of Scipio Aemilianus, who entirely destroyed the city and its walls, enslaved and sold all the citizens and gained control of that region, which became the province of Africa. Thus ended the Punic War period. All these wars resulted in Rome's first overseas conquests (Sicily, Hispania and Africa) and the rise of Rome as a significant imperial power and began the end of democracy.
After defeating the Macedonian and Seleucid Empires in the 2nd century BC, the Romans became the dominant people of the Mediterranean Sea. The conquest of the Hellenistic kingdoms brought the Roman and Greek cultures in closer contact and the Roman elite, once rural, became a luxurious and cosmopolitan one. At this time Rome was a consolidated empire—in the military view—and had no major enemies.
Foreign dominance led to internal strife. Senators became rich at the provinces' expense; soldiers, who were mostly small-scale farmers, were away from home longer and could not maintain their land; and the increased reliance on foreign slaves and the growth of latifundia reduced the availability of paid work.
Income from war booty, mercantilism in the new provinces, and tax farming created new economic opportunities for the wealthy, forming a new class of merchants, called the equestrians. The lex Claudia forbade members of the Senate from engaging in commerce, so while the equestrians could theoretically join the Senate, they were severely restricted in political power. The Senate squabbled perpetually, repeatedly blocked important land reforms and refused to give the equestrian class a larger say in the government.
Violent gangs of the urban unemployed, controlled by rival Senators, intimidated the electorate through violence. The situation came to a head in the late 2nd century BC under the Gracchi brothers, a pair of tribunes who attempted to pass land reform legislation that would redistribute the major patrician landholdings among the plebeians. Both brothers were killed and the Senate passed reforms reversing the Gracchi brother's actions. This led to the growing divide of the plebeian groups (populares) and equestrian classes (optimates).
Marius and Sulla
Gaius Marius, a novus homo, who started his political career with the help of the powerful Metelli family, soon become a leader of the Republic, holding the first of his seven consulships (an unprecedented number) in 107 BC by arguing that his former patron Quintus Caecilius Metellus Numidicus was not able to defeat and capture the Numidian king Jugurtha. Marius then started his military reform: in his recruitment to fight Jugurtha, he levied the very poor (an innovation), and many landless men entered the army; this was the seed of securing loyalty of the army to the General in command.
Lucius Cornelius Sulla was born into a poor family that used to be a patrician family. He had a good education but became poor when his father died and left none of his will. Sulla joined the theater and found many friends there, prior to becoming a general in the Jugurthine war.
At this time, Marius began his quarrel with Sulla: Marius, who wanted to capture Jugurtha, asked Bocchus, son-in-law of Jugurtha, to hand him over. As Marius failed, Sulla, a general of Marius at that time, in a dangerous enterprise, went himself to Bocchus and convinced Bocchus to hand Jugurtha over to him. This was very provocative to Marius, since many of his enemies were encouraging Sulla to oppose Marius. Despite this, Marius was elected for five consecutive consulships from 104 to 100 BC, as Rome needed a military leader to defeat the Cimbri and the Teutones, who were threatening Rome.
After Marius's retirement, Rome had a brief peace, during which the Italian socii ("allies" in Latin) requested Roman citizenship and voting rights. The reformist Marcus Livius Drusus supported their legal process but was assassinated, and the socii revolted against the Romans in the Social War. At one point both consuls were killed; Marius was appointed to command the army together with Lucius Julius Caesar and Sulla.
By the end of the Social War, Marius and Sulla were the premier military men in Rome and their partisans were in conflict, both sides jostling for power. In 88 BC, Sulla was elected for his first consulship and his first assignment was to defeat Mithridates VI of Pontus, whose intentions were to conquer the Eastern part of the Roman territories. However, Marius's partisans managed his installation to the military command, defying Sulla and the Senate, and this caused Sulla's wrath. To consolidate his own power, Sulla conducted a surprising and illegal action: he marched to Rome with his legions, killing all those who showed support to Marius's cause and impaling their heads in the Roman Forum. In the following year, 87 BC, Marius, who had fled at Sulla's march, returned to Rome while Sulla was campaigning in Greece. He seized power along with the consul Lucius Cornelius Cinna and killed the other consul, Gnaeus Octavius, achieving his seventh consulship. In an attempt to raise Sulla's anger, Marius and Cinna revenged their partisans by conducting a massacre.
Marius died in 86 BC, due to age and poor health, just a few months after seizing power. Cinna exercised absolute power until his death in 84 BC. After returning from his Eastern campaigns, Sulla had a free path to reestablish his own power. In 83 BC he made his second march in Rome and began a time of terror: thousands of nobles, knights and senators were executed. Sulla also held two dictatorships and one more consulship, which began the crisis and decline of Roman Republic.
Caesar and the First Triumvirate
In the mid-1st century BC, Roman politics were restless. Political divisions in Rome became identified with two groupings, populares (who hoped for the support of the people) and optimates (the "best", who wanted to maintain exclusive aristocratic control). Sulla overthrew all populist leaders and his constitutional reforms removed powers (such as those of the tribune of the plebs) that had supported populist approaches. Meanwhile, social and economic stresses continued to build; Rome had become a metropolis with a super-rich aristocracy, debt-ridden aspirants, and a large proletariat often of impoverished farmers. The latter groups supported the Catilinarian conspiracy—a resounding failure, since the consul Marcus Tullius Cicero quickly arrested and executed the main leaders of the conspiracy.
Onto this turbulent scene emerged Gaius Julius Caesar, from an aristocratic family of limited wealth. His aunt Julia was Marius' wife, and Caesar identified with the populares. To achieve power, Caesar reconciled the two most powerful men in Rome: Marcus Licinius Crassus, who had financed much of his earlier career, and Crassus' rival, Gnaeus Pompeius Magnus (anglicized as Pompey), to whom he married his daughter. He formed them into a new informal alliance including himself, the First Triumvirate ("three men"). This satisfied the interests of all three: Crassus, the richest man in Rome, became richer and ultimately achieved high military command; Pompey exerted more influence in the Senate; and Caesar obtained the consulship and military command in Gaul. So long as they could agree, the three were in effect the rulers of Rome.
In 54 BC, Caesar's daughter, Pompey's wife, died in childbirth, unraveling one link in the alliance. In 53 BC, Crassus invaded Parthia and was killed in the Battle of Carrhae. The Triumvirate disintegrated at Crassus' death. Crassus had acted as mediator between Caesar and Pompey, and, without him, the two generals manoeuvred against each other for power. Caesar conquered Gaul, obtaining immense wealth, respect in Rome and the loyalty of battle-hardened legions. He also became a clear menace to Pompey and was loathed by many optimates. Confident that Caesar could be stopped by legal means, Pompey's party tried to strip Caesar of his legions, a prelude to Caesar's trial, impoverishment, and exile.
To avoid this fate, Caesar crossed the Rubicon River and invaded Rome in 49 BC. Pompey and his party fled from Italy, pursued by Caesar. The Battle of Pharsalus was a brilliant victory for Caesar and in this and other campaigns he destroyed all of the optimates' leaders: Metellus Scipio, Cato the Younger, and Pompey's son, Gnaeus Pompeius. Pompey was murdered in Egypt in 48 BC. Caesar was now pre-eminent over Rome, attracting the bitter enmity of many aristocrats. He was granted many offices and honours. In just five years, he held four consulships, two ordinary dictatorships, and two special dictatorships: one for ten years and another for perpetuity. He was murdered in 44 BC, on the Ides of March by the Liberatores.
Octavian and the Second Triumvirate
Caesar's assassination caused political and social turmoil in Rome; without the dictator's leadership, the city was ruled by his friend and colleague, Marcus Antonius. Soon afterward, Octavius, whom Caesar adopted through his will, arrived in Rome. Octavian (historians regard Octavius as Octavian due to the Roman naming conventions) tried to align himself with the Caesarian faction. In 43 BC, along with Antony and Marcus Aemilius Lepidus, Caesar's best friend, he legally established the Second Triumvirate. This alliance would last for five years. Upon its formation, 130–300 senators were executed, and their property was confiscated, due to their supposed support for the Liberatores.
In 42 BC, the Senate deified Caesar as Divus Iulius; Octavian thus became Divi filius, the son of the deified. In the same year, Octavian and Antony defeated both Caesar's assassins and the leaders of the Liberatores, Marcus Junius Brutus and Gaius Cassius Longinus, in the Battle of Philippi. The Second Triumvirate was marked by the proscriptions of many senators and equites: after a revolt led by Antony's brother Lucius Antonius, more than 300 senators and equites involved were executed on the anniversary of the Ides of March, although Lucius was spared. The Triumvirate proscribed several important men, including Cicero, whom Antony hated; Quintus Tullius Cicero, the younger brother of the orator; and Lucius Julius Caesar, cousin and friend of the acclaimed general, for his support of Cicero. However, Lucius was pardoned, perhaps because his sister Julia had intervened for him.
The Triumvirate divided the Empire among the triumvirs: Lepidus was given charge of Africa, Antony, the eastern provinces, and Octavian remained in Italia and controlled Hispania and Gaul. The Second Triumvirate expired in 38 BC but was renewed for five more years. However, the relationship between Octavian and Antony had deteriorated, and Lepidus was forced to retire in 36 BC after betraying Octavian in Sicily. By the end of the Triumvirate, Antony was living in Ptolemaic Egypt, an independent and rich kingdom ruled by his lover, Cleopatra VII. Antony's affair with Cleopatra was seen as an act of treason, since she was queen of another country. Additionally, Antony adopted a lifestyle considered too extravagant and Hellenistic for a Roman statesman. Following Antony's Donations of Alexandria, which gave to Cleopatra the title of "Queen of Kings", and to Antony's and Cleopatra's children the regal titles to the newly conquered Eastern territories, war between Octavian and Antony broke out. Octavian annihilated Egyptian forces in the Battle of Actium in 31 BC. Antony and Cleopatra committed suicide. Now Egypt was conquered by the Roman Empire, and for the Romans, a new era had begun.
Empire – the Principate
In 27 BC and at the age of 36, Octavian was the sole Roman leader. In that year, he took the name Augustus. That event is usually taken by historians as the beginning of Roman Empire—although Rome was an "imperial" state since 146 BC, when Carthage was razed by Scipio Aemilianus and Greece was conquered by Lucius Mummius. Officially, the government was republican, but Augustus assumed absolute powers. His reform of the government brought about a two-century period colloquially referred to by Romans as the Pax Romana.
The Julio-Claudian dynasty was established by Augustus. The emperors of this dynasty were Augustus, Tiberius, Caligula, Claudius and Nero. The dynasty is so called due to the gens Julia, family of Augustus, and the gens Claudia, family of Tiberius. The Julio-Claudians started the destruction of republican values, but on the other hand, they boosted Rome's status as the central power in the Mediterranean region. While Caligula and Nero are usually remembered in popular culture as dysfunctional emperors, Augustus and Claudius are remembered as emperors who were successful in politics and the military. This dynasty instituted imperial tradition in Rome and frustrated any attempt to reestablish a Republic.
Augustus gathered almost all the republican powers under his official title, princeps: he had the powers of consul, princeps senatus, aedile, censor and tribune—including tribunician sacrosanctity. This was the base of an emperor's power. Augustus also styled himself as Imperator Gaius Julius Caesar divi filius, "Commander Gaius Julius Caesar, son of the deified one". With this title he not only boasted his familial link to deified Julius Caesar, but the use of Imperator signified a permanent link to the Roman tradition of victory.
He also diminished the political influence of the senatorial class by boosting the equestrian class. The senators lost their right to rule certain provinces, like Egypt, since the governor of that province was directly nominated by the emperor. The creation of the Praetorian Guard and his reforms in the military, creating a standing army with a fixed size of 28 legions, ensured his total control over the army. Compared with the Second Triumvirate's epoch, Augustus' reign as princeps was very peaceful. This peace and wealth (obtained from the agrarian province of Egypt) led the people and the nobles of Rome to support Augustus, increasing his strength in political affairs. Augustus was absent at battles. His generals were responsible for the field command; gaining such commanders as Marcus Vipsanius Agrippa, Nero Claudius Drusus and Germanicus much respect from the populace and the legions. Augustus intended to extend the Roman Empire to the whole known world, and in his reign, Rome conquered Cantabria, Aquitania, Raetia, Dalmatia, Illyricum and Pannonia.
Under Augustus' reign, Roman literature grew steadily in what is known as the Golden Age of Latin Literature. Poets like Virgil, Horace, Ovid and Rufus developed a rich literature, and were close friends of Augustus. Along with Maecenas, he sponsored patriotic poems, as Virgil's epic Aeneid and also historiographical works, like those of Livy. The works of this literary age lasted through Roman times, and are classics. Augustus also continued the changes to the calendar promoted by Caesar, and the month of August is named after him. Augustus brought a peaceful and thriving era to Rome, known as Pax Augusta or Pax Romana. Augustus died in 14 AD, but the empire's glory continued after his era.
From Tiberius to Nero
The Julio-Claudians continued to rule Rome after Augustus' death and remained in power until the death of Nero in 68 AD. Augustus' favorites to succeed him were already dead in his senescence: his nephew Marcellus died in 23 BC, his friend and military commander Agrippa in 12 BC and his grandson Gaius Caesar in 4 AD. Influenced by his wife, Livia Drusilla, Augustus appointed her son from another marriage, Tiberius, as his heir.
The Senate agreed with the succession, and granted to Tiberius the same titles and honors once granted to Augustus: the title of princeps and Pater patriae, and the Civic Crown. However, Tiberius was not an enthusiast for political affairs: after agreement with the Senate, he retired to Capri in 26 AD, and left control of the city of Rome in the hands of the praetorian prefect Sejanus (until 31 AD) and Macro (from 31 to 37 AD). Tiberius was regarded as an evil and melancholic man, who may have ordered the murder of his relatives, the popular general Germanicus in 19 AD, and his own son Drusus Julius Caesar in 23 AD.
Tiberius died (or was killed) in 37 AD. The male line of the Julio-Claudians was limited to Tiberius' nephew Claudius, his grandson Tiberius Gemellus and his grand-nephew Caligula. As Gemellus was still a child, Caligula was chosen to rule the empire. He was a popular leader in the first half of his reign, but became a crude and insane tyrant in his years controlling government. Suetonius states that he committed incest with his sisters, killed some men just for amusement and nominated a horse for a consulship. The Praetorian Guard murdered Caligula four years after the death of Tiberius, and, with belated support from the senators, proclaimed his uncle Claudius as the new emperor. Claudius was not as authoritarian as Tiberius and Caligula. Claudius conquered Lycia and Thrace; his most important deed was the beginning of the conquest of Britannia. Claudius was poisoned by his wife, Agrippina the Younger in 54 AD. His heir was Nero, son of Agrippina and her former husband, since Claudius' son Britannicus had not reached manhood upon his father's death.
Nero sent his general, Suetonius Paulinus, to invade modern-day Wales, where he encountered stiff resistance. The Celts there were independent, tough and resistant to tax collectors and fought Paulinus, as he battled his way across from east to west. It took him a long time to reach the north west coast, and in 60 AD he finally crossed the Menai Strait to the sacred island of Mona (Anglesey), the last stronghold of the druids. His soldiers attacked the island and massacred the druids: men, women and children, destroyed the shrine and the sacred groves and threw many of the sacred standing stones into the sea. While Paulinus and his troops were massacring druids in Mona, the tribes of modern-day East Anglia staged a revolt led by queen Boadicea of the Iceni. The rebels sacked and burned Camulodunum, Londinium and Verulamium (modern-day Colchester, London and St Albans respectively) before they were crushed by Paulinus. Boadicea, like Cleopatra before her, committed suicide to avoid the disgrace of being paraded in triumph in Rome. The fault of Nero in this rebellion is debatable but there was certainly an impact (both positive and negative) upon the prestige of his regime.
Nero is widely known as the first persecutor of Christians and for the Great Fire of Rome, rumoured to have been started by the emperor himself. In 59 AD he murdered his mother and in 62 AD, his wife Claudia Octavia. Never very stable, he allowed his advisers to run the government while he slid into debauchery, excess, and madness. He was married three times, and had numerous affairs with both men and women, and, according to some rumors, even his mother. A conspiracy against Nero in 65 AD under Calpurnius Piso failed, but in 68 AD the armies under Julius Vindex in Gaul and Servius Sulpicius Galba in modern-day Spain revolted. Deserted by the Praetorian Guards and condemned to death by the senate, Nero killed himself.
The Flavians were the second dynasty to rule Rome. By 68 AD, the year of Nero's death, there was no chance of a return to the Roman Republic, and so a new emperor had to arise. After the turmoil in the Year of the Four Emperors, Titus Flavius Vespasianus (anglicized as Vespasian) took control of the empire and established a new dynasty. Under the Flavians, Rome continued its expansion, and the state remained secure.
The most significant military campaign undertaken during the Flavian period was the siege and destruction of Jerusalem in 70 by Titus. The destruction of the city was the culmination of the Roman campaign in Judea following the Jewish uprising of 66. The Second Temple was completely demolished, after which Titus' soldiers proclaimed him imperator in honor of the victory. Jerusalem was sacked and much of the population killed or dispersed. Josephus claims that 1,100,000 people were killed during the siege, of whom a majority were Jewish. 97,000 were captured and enslaved, including Simon bar Giora and John of Giscala. Many fled to areas around the Mediterranean. Titus reportedly refused to accept a wreath of victory, as there was "no merit in vanquishing people forsaken by their own God".
Vespasian had been a general under Claudius and Nero. He fought as a commander in the First Jewish-Roman War along with his son Titus. Following the turmoil of the Year of the Four Emperors, in 69 AD, four emperors were enthroned in turn: Galba, Otho, Vitellius, and, lastly, Vespasian, who crushed Vitellius' forces and became emperor. He reconstructed many buildings which were uncompleted, like a statue of Apollo and the temple of Divus Claudius ("the deified Claudius"), both initiated by Nero. Buildings destroyed by the Great Fire of Rome were rebuilt, and he revitalized the Capitol. Vespasian also started the construction of the Flavian Amphitheater, more commonly known as the Colosseum. The historians Josephus and Pliny the Elder wrote their works during Vespasian's reign. Vespasian was Josephus' sponsor and Pliny dedicated his Naturalis Historia to Titus, son of Vespasian. Vespasian sent legions to defend the eastern frontier in Cappadocia, extended the occupation in Britannia (modern-day England, Wales and southern Scotland) and reformed the tax system. He died in 79 AD.
Titus and Domitian
Titus had a short-lived rule; he was emperor from 79 to 81 AD. He finished the Flavian Amphitheater, which was constructed with war spoils from the First Jewish-Roman War, and promoted games celebrating the victory over the Jews that lasted for a hundred days. These games included gladiatorial combats, chariot races and a sensational mock naval battle on the flooded grounds of the Colosseum. Titus died of fever in 81 AD, and was succeeded by his brother Domitian. As emperor, Domitian assumed totalitarian characteristics, thought he could be a new Augustus, and tried to make a personal cult of himself. Domitian ruled for fifteen years, and his reign was marked by his attempts to compare himself to the gods. He constructed at least two temples in honour of Jupiter, the supreme deity in Roman religion. He also liked to be called "Dominus et Deus" ("Master and God").
The Nerva–Antonine dynasty from 96 AD to 192 AD included the reigns of the emperors Nerva, Trajan, Hadrian, Antoninus Pius, Marcus Aurelius, Lucius Verus, and Commodus. During this time, Rome reached its greatest territorial and economic extent. This was a time of peace for Rome. The criteria for choosing an emperor were the qualities of the candidate and no longer ties of kinship; additionally, there were no civil wars or military defeats in this period. Following Domitian's murder, the Senate rapidly appointed Nerva to hold the imperial dignity. This was the first time that senators chose the emperor since Octavian had been honored with the titles of princeps and Augustus. Nerva had a noble ancestry, and he had served as an advisor to Nero and the Flavians. His rule restored many of the liberties once assumed by Domitian and started the last golden era of Rome.
Nerva died in 98 AD and his successor and heir was the general Trajan. Trajan was born in a non-patrician family from Hispania Baetica (modern-day Andalusia) and his preeminence emerged in the army, under Domitian. He is the second of the Five Good Emperors, the first being Nerva. Trajan was greeted by the people of Rome with enthusiasm, which he justified by governing well and without the bloodiness that had marked Domitian's reign. He freed many people who had been unjustly imprisoned by Domitian and returned private property that Domitian had confiscated; a process begun by Nerva before his death.
Trajan conquered Dacia (roughly modern-day Romania and Moldova), and defeated the king Decebalus, who had defeated Domitian's forces. In the First Dacian War (101–102), the defeated Dacia became a client kingdom; in the Second Dacian War (105–106), Trajan completely devastated the enemy's resistance and annexed Dacia to the Empire. Trajan also annexed the client state of Nabatea to form the province of Arabia Petraea, which included the lands of southern Syria and northwestern Arabia. He erected many buildings that survive to this day, such as Trajan's Forum, Trajan's Market and Trajan's Column. His main architect was Apollodorus of Damascus; Apollodorus made the project of the Forum and of the Column, and also reformed the Pantheon. Trajan's triumphal arches in Ancona and Beneventum are other constructions projected by him. In the Second Dacian War, Apollodorus made a great bridge over the Danube for Trajan.
Trajan's final war was against Parthia. When Parthia appointed a king for Armenia who was unacceptable to Rome (Parthia and Rome shared dominance over Armenia), he declared war. He probably wanted to be the first Roman leader to conquer Parthia, and repeat the glory of Alexander the Great, conqueror of Asia, whom Trajan next followed in the clash of Greek-Romans and the Persian cultures. In 113 he marched to Armenia and deposed the local king. In 115 Trajan turned south into the core of Parthian hegemony, took the Northern Mesopotamian cities of Nisibis and Batnae, organized a province of Mesopotamia (116), and issued coins announcing that Armenia and Mesopotamia were under the authority of the Roman people. In that same year, he captured Seleucia and the Parthian capital Ctesiphon (near modern Baghdad). After defeating a Parthian revolt and a Jewish revolt, he withdrew due to health issues. In 117, his illness grew and he died of edema. He nominated Hadrian as his heir. Under Trajan's leadership the Roman Empire reached the peak of its territorial expansion; Rome's dominion now spanned 5.0 million square kilometres (1.9 million square miles).
From Hadrian to Commodus
Many Romans emigrated to Hispania (modern-day Spain and Portugal) and stayed for generations, in some cases intermarrying with Iberians; one of these families produced the emperor Hadrian. Hadrian withdrew all the troops stationed in Parthia, Armenia and Mesopotamia (modern-day Iraq), abandoning Trajan's conquests. Hadrian's army crushed a revolt in Mauretania and the Bar Kokhba revolt in Judea. This was the last large-scale Jewish revolt against the Romans, and was suppressed with massive repercussions in Judea. Hundreds of thousands of Jews were killed. Hadrian renamed the province of Judea "Provincia Syria Palaestina," after one of Judea's most hated enemies. He constructed fortifications and walls, like the celebrated Hadrian's Wall which separated Roman Britannia and the tribes of modern-day Scotland. Hadrian promoted culture, especially the Greek. He also forbade torture and humanized the laws. His many building projects included aqueducts, baths, libraries and theaters; additionally, he travelled nearly every province in the Empire to check the military and infrastructural conditions. Following Hadrian's death in 138 AD, his successor Antoninus Pius built temples, theaters, and mausoleums, promoted the arts and sciences, and bestowed honours and financial rewards upon the teachers of rhetoric and philosophy. On becoming emperor, Antoninus made few initial changes, leaving intact as far as possible the arrangements instituted by his predecessor. Antoninus expanded Roman Britannia by invading what is now southern Scotland and building the Antonine Wall. He also continued Hadrian's policy of humanizing the laws. He died in 161 AD.
Marcus Aurelius, known as the Philosopher, was the last of the Five Good Emperors. He was a stoic philosopher and wrote the Meditations. He defeated barbarian tribes in the Marcomannic Wars as well as the Parthian Empire. His co-emperor, Lucius Verus, died in 169 AD, probably victim of the Antonine Plague, a pandemic that killed nearly five million people through the Empire in 165–180 AD.
From Nerva to Marcus Aurelius, the empire achieved an unprecedented status. The powerful influence of laws and manners had gradually cemented the union of the provinces. All the citizens enjoyed and abused the advantages of wealth. The image of a free constitution was preserved with decent reverence. The Roman senate appeared to possess the sovereign authority, and devolved on the emperors all the executive powers of government. The Five Good Emperors' rule is considered the golden era of the Empire.
Commodus, son of Marcus Aurelius, became emperor after his father's death. He is not counted as one of the Five Good Emperors. Firstly, this was due to his direct kinship with the latter emperor; in addition, he was militarily passive compared to his predecessors, who had frequently led their armies in person. Commodus usually participated in gladiatorial combats, which were frequently brutal and rough. He killed many citizens, and Cassius Dio identifies his reign as the beginning of Roman decadence: "(Rome has transformed) from a kingdom of gold to one of iron and rust."
Commodus was killed by a conspiracy involving Quintus Aemilius Laetus and his wife Marcia in late 192 AD. The following year is known as the Year of the Five Emperors, during which Helvius Pertinax, Didius Julianus, Pescennius Niger, Clodius Albinus and Septimius Severus held the imperial dignity. Pertinax, a member of the senate who had been one of Marcus Aurelius's right hand men, was the choice of Laetus, and he ruled vigorously and judiciously. Laetus soon became jealous and instigated Pertinax's murder by the Praetorian Guard, who then auctioned the empire to the highest bidder, Didius Julianus, for 25,000 sesterces per man. The people of Rome were appalled and appealed to the frontier legions to save them. The legions of three frontier provinces—Britannia, Pannonia Superior, and Syria—resented being excluded from the "donative" and replied by declaring their individual generals to be emperor. Lucius Septimius Severus Geta, the Pannonian commander, bribed the opposing forces, pardoned the Praetorian Guards and installed himself as emperor. He and his successors governed with the legions' support. The changes on coinage and military expenditures were the root of the financial crisis that marked the Crisis of the Third Century.
Severus was enthroned after invading Rome and having Didius Julianus killed. His two other rivals, Pescennius Niger and Clodius Albinus, were both hailed by other factions as Imperator. Severus quickly subdued Niger in Byzantium and promised to Albinus the title of Caesar (which meant he would be a co-emperor). However, Severus betrayed Albinus by blaming him for a plot against his life. Severus marched to Gaul and defeated Albinus. For these acts, Machiavelli said that Severus was "a ferocious lion and a clever fox".
Severus attempted to revive totalitarianism and, addressing the Roman people and Senate, praised the severity and cruelty of Marius and Sulla, which worried the senators. When Parthia invaded Roman territory, Severus waged war against that country and seized the cities of Nisibis, Babylon and Seleucia. Reaching Ctesiphon, the Parthian capital, he ordered plundering and his army slew and captured many people. Notwithstanding this military success, Severus failed in invading Hatra, a rich Arabian city. Severus killed his legate, who was gaining respect from the legions; and his soldiers fell victim to famine. After this disastrous campaign, he withdrew. Severus also intended to vanquish the whole of Britannia. To achieve this, he waged war against the Caledonians. After many casualties in the army due to the terrain and the barbarians' ambushes, Severus himself went to the field. However, he became ill and died in 211 AD, at the age of 65.
From Caracalla to Alexander Severus
Upon the death of Severus, his sons Caracalla and Geta were made emperors. During their youth, their squabbles had divided Rome. In that same year Caracalla had his brother, a youth, assassinated in his mother's arms, and may have murdered 20,000 of Geta's followers. Like his father, Caracalla was warlike. He continued Severus' policy and gained respect from the legions. A cruel man, Caracalla was pursued by the guilt of his brother's murder. He ordered the death of people of his own circle, like his tutor, Cilo, and a friend of his father, Papinian.
Knowing that the citizens of Alexandria disliked him and were denigrating his character, Caracalla served a banquet for its notable citizens, after which his soldiers killed all the guests. From the security of the temple of Sarapis, he then directed an indiscriminate slaughter of Alexandria's people. In 212, he issued the Edict of Caracalla, giving full Roman citizenship to all free men living in the Empire, with the exception of the dediticii, people who had become subject to Rome through surrender in war, and freed slaves. and at the same time raised the inheritance tax, levied only on Roman citizens, to ten percent. A report that a soothsayer had predicted that the Praetorian prefect Macrinus and his son were to rule over the empire was dutifully sent to Caracalla. But the report fell into the hands of Macrinus, who felt he must act or die. Macrinus conspired to have Caracalla assassinated by one of his soldiers during a pilgrimage to the Temple of the Moon in Carrhae, in 217 AD.
The incompetent Macrinus assumed power, but soon removed himself from Rome to the east and Antioch. His brief reign ended in 218, when the youngster Bassianus, high priest of the temple of the Sun at Emesa, and supposedly illegitimate son of Caracalla, was declared Emperor by the disaffected soldiers of Macrinus. Bribes gained Bassianus support from the legionaries and they fought against Macrinus and his Praetorian guards. He adopted the name of Antoninus but history has named him after his Sun god Elagabalus, represented on Earth in the form of a large black stone. An incompetent and lascivious ruler, Elagabalus offended all but his favourites. Cassius Dio, Herodian and the Historia Augusta give many accounts of his notorious extravagance. Elagabalus adopted his cousin Severus Alexander, as Caesar, but subsequently grew jealous and attempted to assassinate him. However, the Praetorian guard preferred Alexander, murdered Elagabalus, dragged his mutilated corpse through the streets of Rome, and threw it into the Tiber. Severus Alexander then succeeded him. Alexander waged war against many foes, including the revitalized Persia and also the Germanic peoples, who invaded Gaul. His losses generated dissatisfaction among his soldiers, and some of them murdered him during his Germanic campaign in 235 AD.
Crisis of the Third Century
A disastrous scenario emerged after the death of Alexander Severus: the Roman state was plagued by civil wars, external invasions, political chaos, pandemics and economic depression. The old Roman values had fallen, and Mithraism and Christianity had begun to spread through the populace. Emperors were no longer men linked with nobility; they usually were born in lower-classes of distant parts of the Empire. These men rose to prominence through military ranks, and became emperors through civil wars.
There were 26 emperors in a 49-year period, a signal of political instability. Maximinus Thrax was the first ruler of that time, governing for just three years. Others ruled just for a few months, like Gordian I, Gordian II, Balbinus and Hostilian. The population and the frontiers were abandoned, since the emperors were mostly concerned with defeating rivals and establishing their power. The economy also suffered during that epoch. The massive military expenditures from the Severi caused a devaluation of Roman coins. Hyperinflation came at this time as well. The Plague of Cyprian broke out in 250 and killed a huge portion of the population. In 260 AD, the provinces of Syria Palaestina, Asia Minor and Egypt separated from the rest of the Roman state to form the Palmyrene Empire, ruled by Queen Zenobia and centered on Palmyra. In that same year the Gallic Empire was created by Postumus, retaining Britannia and Gaul. These countries separated from Rome after the capture of emperor Valerian by the Sassanids of Persia, the first Roman ruler to be captured by his enemies; it was a humiliating fact for the Romans. The crisis began to recede during the reigns of Claudius Gothicus (268–270), who defeated the Gothic invaders, and Aurelian (271–275), who reconquered both the Gallic and Palmyrene Empires. The crisis was overcome during the reign of Diocletian.
Empire – The Tetrarchy
In 284 AD, Diocletian was hailed as Imperator by the eastern army. Diocletian healed the empire from the crisis, by political and economic shifts. A new form of government was established: the Tetrarchy. The Empire was divided among four emperors, two in the West and two in the East. The first tetrarchs were Diocletian (in the East), Maximian (in the West), and two junior emperors, Galerius (in the East) and Flavius Constantius (in the West). To adjust the economy, Diocletian made several tax reforms.
Diocletian expelled the Persians who plundered Syria and conquered some barbarian tribes with Maximian. He adopted many behaviors of Eastern monarchs, like wearing pearls and golden sandals and robes. Anyone in the presence of the emperor had now to prostrate himself—a common act in the East, but never practiced in Rome before. Diocletian did not use a disguised form of Republic, as the other emperors since Augustus had done. Between 290 and 330, half a dozen new capitals had been established by the members of the Tetrarchy, officially or not: Antioch, Nicomedia, Thessalonike, Sirmium, Milan, and Trier. Diocletian was also responsible for a significant Christian persecution. In 303 he and Galerius started the persecution and ordered the destruction of all the Christian churches and scripts and forbade Christian worship. Diocletian abdicated in 305 AD together with Maximian, thus, he was the first Roman emperor to resign. His reign ended the traditional form of imperial rule, the Principate (from princeps) and started the Tetrarchy.
Constantine and Christianity
Constantine assumed the empire as a tetrarch in 306. He conducted many wars against the other tetrarchs. Firstly he defeated Maxentius in 312. In 313, he issued the Edict of Milan, which granted liberty for Christians to profess their religion. Constantine was converted to Christianity, enforcing the Christian faith. He began the Christianization of the Empire and of Europe—a process concluded by the Catholic Church in the Middle Ages. He was defeated by the Franks and the Alamanni during 306–308. In 324 he defeated another tetrarch, Licinius, and controlled all the empire, as it was before Diocletian. To celebrate his victories and Christianity's relevance, he rebuilt Byzantium and renamed it Nova Roma ("New Rome"); but the city soon gained the informal name of Constantinople ("City of Constantine").
The reign of Julian, who under the influence of his adviser Mardonius attempted to restore Classical Roman and Hellenistic religion, only briefly interrupted the succession of Christian emperors. Constantinople served as a new capital for the Empire. In fact, Rome had lost its central importance since the Crisis of the Third Century—Mediolanum was the western capital from 286 to 330, until the reign of Honorius, when Ravenna was made capital, in the 5th century. Constantine's administrative and monetary reforms, that reunited the Empire under one emperor, and rebuilt the city of Byzantium changed the high period of the ancient world.
Fall of the Western Roman Empire
In the late 4th and 5th centuries the Western Empire entered a critical stage which terminated with the fall of the Western Roman Empire. Under the last emperors of the Constantinian dynasty and the Valentinianic dynasty, Rome lost decisive battles against the Sasanian Empire and Germanic barbarians: in 363, emperor Julian the Apostate was killed in the Battle of Samarra, against the Persians and the Battle of Adrianople cost the life of emperor Valens (364–378); the victorious Goths were never expelled from the Empire nor assimilated. The next emperor, Theodosius I (379–395), gave even more force to the Christian faith, and after his death, the Empire was divided into the Eastern Roman Empire, ruled by Arcadius and the Western Roman Empire, commanded by Honorius, both of which were Theodosius' sons.
The situation became more critical in 408, after the death of Stilicho, a general who tried to reunite the Empire and repel barbarian invasion in the early years of the 5th century. The professional field army collapsed. In 410, the Theodosian dynasty saw the Visigoths sack Rome. During the 5th century, the Western Empire experienced a significant reduction of its territory. The Vandals conquered North Africa, the Visigoths claimed the southern part of Gaul, Gallaecia was taken by the Suebi, Britannia was abandoned by the central government, and the Empire suffered further from the invasions of Attila, chief of the Huns. General Orestes refused to meet the demands of the barbarian "allies" who now formed the army, and tried to expel them from Italy. Unhappy with this, their chieftain Odoacer defeated and killed Orestes, invaded Ravenna and dethroned Romulus Augustus, son of Orestes. This event of 476, usually marks the end of Classical antiquity and beginning of the Middle Ages. The Roman noble and former emperor Julius Nepos continued to rule as emperor from Dalmatia even after the deposition of Romulus Augustus until his death in 480. Some historians consider him to be the last emperor of the Western Empire instead of Romulus Augustus.
After some 1200 years of independence and nearly 700 years as a great power, the rule of Rome in the West ended. Various reasons for Rome's fall have been proposed ever since, including loss of Republicanism, moral decay, military tyranny, class war, slavery, economic stagnation, environmental change, disease, the decline of the Roman race, as well as the inevitable ebb and flow that all civilizations experience. At the time many pagans argued that Christianity and the decline of traditional Roman religion were responsible; some rationalist thinkers of the modern era attribute the fall to a change from a martial to a more pacifist religion that lessened the number of available soldiers; while Christians such as Augustine of Hippo argued that the sinful nature of Roman society itself was to blame.
The Eastern Empire had a different fate. It survived for almost 1000 years after the fall of its Western counterpart and became the most stable Christian realm during the Middle Ages. During the 6th century, Justinian reconquered the Italian peninsula from the Ostrogoths, North Africa from the Vandals, and southern Hispania from the Visigoths. But within a few years of Justinian's death, Byzantine possessions in Italy were greatly reduced by the Lombards who settled in the peninsula. In the east, partially due to the weakening effect of the Plague of Justinian, the Byzantines were threatened by the rise of Islam. Its followers rapidly brought about the conquest of the Levant, the conquest of Armenia and the conquest of Egypt during the Arab–Byzantine wars, and soon presented a direct threat to Constantinople. In the following century, the Arabs also captured southern Italy and Sicily. On the west, Slavic populations were also able to penetrate deep into the Balkans.
The Byzantines, however, managed to stop further Islamic expansion into their lands during the 8th century and, beginning in the 9th century, reclaimed parts of the conquered lands. In 1000 AD, the Eastern Empire was at its height: Basil II reconquered Bulgaria and Armenia, and culture and trade flourished. However, soon after, this expansion was abruptly stopped in 1071 with the Byzantine defeat in the Battle of Manzikert. The aftermath of this battle sent the empire into a protracted period of decline. Two decades of internal strife and Turkic invasions ultimately led Emperor Alexios I Komnenos to send a call for help to the Western European kingdoms in 1095. The West responded with the Crusades, eventually resulting in the Sack of Constantinople by participants of the Fourth Crusade. The conquest of Constantinople in 1204 fragmented what remained of the Empire into successor states; the ultimate victor was the Empire of Nicaea. After the recapture of Constantinople by Imperial forces, the Empire was little more than a Greek state confined to the Aegean coast. The Byzantine Empire collapsed when Mehmed the Conqueror conquered Constantinople on 29 May, 1453.
The imperial city of Rome was the largest urban center in the empire, with a population variously estimated from 450,000 to close to one million. The public spaces in Rome resounded with such a din of hooves and clatter of iron chariot wheels that Julius Caesar had once proposed a ban on chariot traffic during the day. Historical estimates show that around 20 percent of the population under jurisdiction of ancient Rome (25–40%, depending on the standards used, in Roman Italy) lived in innumerable urban centers, with population of 10,000 and more and several military settlements, a very high rate of urbanization by pre-industrial standards. Most of those centers had a forum, temples, and other buildings similar to Rome's. Average life expectancy was about 28.
The roots of the legal principles and practices of the ancient Romans may be traced to the Law of the Twelve Tables promulgated in 449 BC and to the codification of law issued by order of Emperor Justinian I around 530 AD (see Corpus Juris Civilis). Roman law as preserved in Justinian's codes continued into the Byzantine Empire, and formed the basis of similar codifications in continental Western Europe. Roman law continued, in a broader sense, to be applied throughout most of Europe until the end of the 17th century.
The major divisions of the law of ancient Rome, as contained within the Justinian and Theodosian law codes, consisted of Jus civile, Jus gentium, and Jus naturale. The Jus civile ("Citizen Law") was the body of common laws that applied to Roman citizens. The praetores urbani (sg. Praetor Urbanus) were the people who had jurisdiction over cases involving citizens. The Jus gentium ("Law of nations") was the body of common laws that applied to foreigners, and their dealings with Roman citizens. The praetores peregrini (sg. Praetor Peregrinus) were the people who had jurisdiction over cases involving citizens and foreigners. Jus naturale encompassed natural law, the body of laws that were considered common to all beings.
Roman society is largely viewed as hierarchical, with slaves (servi) at the bottom, freedmen (liberti) above them, and free-born citizens (cives) at the top. Free citizens were also divided by class. The broadest, and earliest, division was between the patricians, who could trace their ancestry to one of the 100 patriarchs at the founding of the city, and the plebeians, who could not. This became less important in the later Republic, as some plebeian families became wealthy and entered politics, and some patrician families fell economically. Anyone, patrician or plebeian, who could count a consul as his ancestor was a noble (nobilis); a man who was the first of his family to hold the consulship, such as Marius or Cicero, was known as a novus homo ("new man") and ennobled his descendants. Patrician ancestry, however, still conferred considerable prestige, and many religious offices remained restricted to patricians.
A class division originally based on military service became more important. Membership of these classes was determined periodically by the censors, according to property. The wealthiest were the Senatorial class, who dominated politics and command of the army. Next came the equestrians (equites, sometimes translated "knights"), originally those who could afford a warhorse, and who formed a powerful mercantile class. Several further classes, originally based on the military equipment their members could afford, followed, with the proletarii, citizens who had no property other than their children, at the bottom. Before the reforms of Marius they were ineligible for military service and are often described as being just above freed slaves in wealth and prestige.
Voting power in the Republic depended on class. Citizens were enrolled in voting "tribes", but the tribes of the richer classes had fewer members than the poorer ones, all the proletarii being enrolled in a single tribe. Voting was done in class order, from top down, and stopped as soon as most of the tribes had been reached, so the poorer classes were often unable to cast their votes.
Women in ancient Rome shared some basic rights with their male counterparts, but were not fully regarded as citizens and were thus not allowed to vote or take part in politics. At the same time the limited rights of women were gradually expanded (due to emancipation) and women reached freedom from pater familias, gained property rights and even had more juridical rights than their husbands, but still no voting rights, and were absent from politics.
Allied foreign cities were often given the Latin Rights, an intermediary level between full citizens and foreigners (peregrini), which gave their citizens rights under Roman law and allowed their leading magistrates to become full Roman citizens. While there were varying degrees of Latin rights, the main division was between those cum suffragio ("with vote"; enrolled in a Roman tribe and able to take part in the comitia tributa) and sine suffragio ("without vote"; could not take part in Roman politics). Most of Rome's Italian allies were given full citizenship after the Social War of 91–88 BC, and full Roman citizenship was extended to all free-born men in the Empire by Caracalla in 212, with the exception of the dediticii, people who had become subject to Rome through surrender in war, and freed slaves.
In the early Republic, there were no public schools, so boys were taught to read and write by their parents, or by educated slaves, called paedagogi, usually of Greek origin. The primary aim of education during this period was to train young men in agriculture, warfare, Roman traditions, and public affairs. Young boys learned much about civic life by accompanying their fathers to religious and political functions, including the Senate for the sons of nobles. The sons of nobles were apprenticed to a prominent political figure at the age of 16, and campaigned with the army from the age of 17 (this system was still in use among some noble families into the imperial era). Educational practices were modified after the conquest of the Hellenistic kingdoms in the 3rd century BC and the resulting Greek influence, although Roman educational practices were still much different from Greek ones. If their parents could afford it, boys and some girls at the age of 7 were sent to a private school outside the home called a ludus, where a teacher (called a litterator or a magister ludi, and often of Greek origin) taught them basic reading, writing, arithmetic, and sometimes Greek, until the age of 11.
Beginning at age 12, students went to secondary schools, where the teacher (now called a grammaticus) taught them about Greek and Roman literature. At the age of 16, some students went on to rhetoric school (where the teacher, usually Greek, was called a rhetor). Education at this level prepared students for legal careers, and required that the students memorize the laws of Rome. Pupils went to school every day, except religious festivals and market days. There were also summer holidays.
Initially, Rome was ruled by kings, who were elected from each of Rome's major tribes in turn. The exact nature of the king's power is uncertain. He may have held near-absolute power, or may also have merely been the chief executive of the Senate and the people. At least in military matters, the king's authority (Imperium) was likely absolute. He was also the head of the state religion. In addition to the authority of the King, there were three administrative assemblies: the Senate, which acted as an advisory body for the King; the Comitia Curiata, which could endorse and ratify laws suggested by the King; and the Comitia Calata, which was an assembly of the priestly college that could assemble the people to bear witness to certain acts, hear proclamations, and declare the feast and holiday schedule for the next month.
The class struggles of the Roman Republic resulted in an unusual mixture of democracy and oligarchy. The word republic comes from the Latin res publica, which literally translates to "public business". Roman laws traditionally could only be passed by a vote of the Popular assembly (Comitia Tributa). Likewise, candidates for public positions had to run for election by the people. However, the Roman Senate represented an oligarchic institution, which acted as an advisory body.
In the Republic, the Senate held actual authority (auctoritas), but no real legislative power; it was technically only an advisory council. However, as the Senators were individually very influential, it was difficult to accomplish anything against the collective will of the Senate. New senators were chosen from among the most accomplished patricians by censors (Censura), who could also remove a senator from his office if he was found "morally corrupt"; a charge that could include bribery or, as under Cato the Elder, embracing one's wife in public. Later, under the reforms of the dictator Sulla, quaestors were made automatic members of the Senate, though most of his reforms did not survive.
The Republic had no fixed bureaucracy, and collected taxes through the practice of tax farming. Government positions such as quaestor, aedile, or praefect were funded by the office-holder. To prevent any citizen from gaining too much power, new magistrates were elected annually and had to share power with a colleague. For example, under normal conditions, the highest authority was held by two consuls. In an emergency, a temporary dictator could be appointed. Throughout the Republic, the administrative system was revised several times to comply with new demands. In the end, it proved inefficient for controlling the ever-expanding dominion of Rome, contributing to the establishment of the Roman Empire.
In the early Empire, the pretense of a republican form of government was maintained. The Roman Emperor was portrayed as only a princeps, or "first citizen", and the Senate gained legislative power and all legal authority previously held by the popular assemblies. However, the rule of the Emperors became increasingly autocratic, and the Senate was reduced to an advisory body appointed by the Emperor. The Empire did not inherit a set bureaucracy from the Republic, since the Republic did not have any permanent governmental structures apart from the Senate. The Emperor appointed assistants and advisers, but the state lacked many institutions, such as a centrally planned budget. Some historians have cited this as a significant reason for the decline of the Roman Empire.
|Part of a series on the|
|Military of ancient Rome|
|Ancient Rome portal • War portal|
The early Roman army (c. 500 BC) was, like those of other contemporary city-states influenced by Greek civilization, a citizen militia that practiced hoplite tactics. It was small (the population of free men of military age was then about 9,000) and organized in five classes (in parallel to the comitia centuriata, the body of citizens organized politically), with three providing hoplites and two providing light infantry. The early Roman army was tactically limited and its stance during this period was essentially defensive.
By the 3rd century BC, the Romans abandoned the hoplite formation in favor of a more flexible system in which smaller groups of 120 (or sometimes 60) men called maniples could maneuver more independently on the battlefield. Thirty maniples arranged in three lines with supporting troops constituted a legion, totalling between 4,000 and 5,000 men.
The early Republican legion consisted of five sections, each of which was equipped differently and had different places in formation: the three lines of manipular heavy infantry (hastati, principes and triarii), a force of light infantry (velites), and the cavalry (equites). With the new organization came a new orientation toward the offensive and a much more aggressive posture toward adjoining city-states.
At nominal full strength, an early Republican legion included 3,600 to 4,800 heavy infantry, several hundred light infantry, and several hundred cavalrymen. Legions were often significantly understrength from recruitment failures or following periods of active service due to accidents, battle casualties, disease and desertion. During the Civil War, Pompey's legions in the east were at full strength because they were recently recruited, while Caesar's legions were often well below nominal strength after long active service in Gaul. This pattern also held true for auxiliary forces.
Until the late Republican period, the typical legionary was a property-owning citizen farmer from a rural area (an adsiduus) who served for particular (often annual) campaigns, and who supplied his own equipment and, in the case of equites, his own mount. Harris suggests that down to 200 BC, the average rural farmer might participate in six or seven campaigns. Freedmen, slaves, and urban citizens served only in rare emergencies.
After 200 BC, economic conditions in rural areas deteriorated as manpower needs increased, so that the property qualifications for compulsory service were gradually reduced. Beginning with Gaius Marius in 107 BC, citizens without property and some urban-dwelling citizens (proletarii) were enlisted and provided with equipment, although most legionaries continued to come from rural areas. Terms of service became continuous and long—up to twenty years if emergencies required although six- or seven-year terms were more typical.
Beginning in the 3rd century BC, legionaries were paid a stipend (stipendium). The amounts are disputed; Caesar doubled his troop payments to 225 denarii a year. Troops could anticipate booty and donatives from their commanders to reward successful campaigns and, beginning at the time of Marius, could be granted allotments of land on retirement. The cavalry and light infantry attached to a legion (the auxilia) were often recruited from the areas where the legion served. Caesar formed a legion, the Fifth Alaudae, from non-citizens in Transalpine Gaul to serve in his campaigns in Gaul. By the time of Augustus, the ideal of the citizen-soldier had been abandoned and the legions had become fully professional. Ordinary legionaries received 900 sesterces a year and could expect 12,000 sesterces on retirement.
At the end of the Civil War, Augustus reorganized Roman military forces, discharging soldiers and disbanding legions. He retained 28 legions, distributed through the provinces of the Empire. During the Principate, the tactical organization of the Army continued to evolve. The auxilia remained independent cohorts, and legionary troops often operated as groups of cohorts rather than as full legions. A new and versatile type of unit, the cohortes equitatae, combined cavalry and legionaries in a single formation. They could be stationed at garrisons or outposts and could fight on their own as balanced small forces or combine with similar units as a larger, legion-sized force. This increase in organizational flexibility helped ensure the long-term success of Roman military forces.
The Emperor Gallienus (253–268 AD) began a reorganization that created the last military structure of the late Empire. Withdrawing some legionaries from the fixed bases on the border, Gallienus created mobile forces (the comitatenses or field armies) and stationed them behind and at some distance from the borders as a strategic reserve. The border troops (limitanei) stationed at fixed bases continued to be the first line of defense. The basic units of the field army were regimental; legiones or auxilia for infantry and vexillationes for cavalry. Nominal strengths may have been 1,200 men for infantry regiments and 600 for cavalry, but actual troop levels could have been much lower – 800 infantry and 400 cavalry.
Many infantry and cavalry regiments operated in pairs under the command of a comes. Field armies included regiments recruited from allied tribes and known as foederati. By 400 AD, foederati regiments had become permanently established units of the Roman army, paid and equipped by the Empire, led by a Roman tribune and used just as Roman units were used. The Empire also used groups of barbarians to fight along with the legions as allies without integration into the field armies, under overall command of a Roman general, but led by their own officers.
Military leadership evolved over the course of the history of Rome. Under the monarchy, the hoplite armies were led by the kings. During the early and middle Roman Republic, military forces were under the command of one of the two elected consuls for the year. During the later Republic, members of the Roman Senatorial elite, as part of the normal sequence of elected public offices known as the cursus honorum, would have served first as quaestor (often posted as deputies to field commanders), then as praetor. Julius Caesar's most talented, effective and reliable subordinate in Gaul, Titus Labienus, was recommended to him by Pompey.
Following the end of a term as praetor or consul, a Senator might be appointed by the Senate as a propraetor or proconsul (depending on the highest office held before) to govern a foreign province. More junior officers (down to but not including the level of centurion) were selected by their commanders from their own clientelae or those recommended by political allies among the Senatorial elite.
Under Augustus, whose most important political priority was to place the military under a permanent and unitary command, the Emperor was the legal commander of each legion but exercised that command through a legatus (legate) he appointed from the Senatorial elite. In a province with a single legion, the legate commanded the legion (legatus legionis) and also served as provincial governor, while in a province with more than one legion, each legion was commanded by a legate and the legates were commanded by the provincial governor (also a legate but of higher rank).
During the later stages of the Imperial period (beginning perhaps with Diocletian), the Augustan model was abandoned. Provincial governors were stripped of military authority, and command of the armies in a group of provinces was given to generals (duces) appointed by the Emperor. These were no longer members of the Roman elite but men who came up through the ranks and had seen much practical soldiering. With increasing frequency, these men attempted (sometimes successfully) to usurp the positions of the Emperors who had appointed them. Decreased resources, increasing political chaos and civil war eventually left the Western Empire vulnerable to attack and takeover by neighboring barbarian peoples.
Less is known about the Roman navy than the Roman army. Prior to the middle of the 3rd century BC, officials known as duumviri navales commanded a fleet of twenty ships used mainly to control piracy. This fleet was given up in 278 AD and replaced by allied forces. The First Punic War required that Rome build large fleets, and it did so largely with the assistance of and financing from allies. This reliance on allies continued to the end of the Roman Republic. The quinquereme was the main warship on both sides of the Punic Wars and remained the mainstay of Roman naval forces until replaced by the time of Caesar Augustus by lighter and more maneuverable vessels.
As compared with a trireme, the quinquereme permitted the use of a mix of experienced and inexperienced crewmen (an advantage for a primarily land-based power), and its lesser maneuverability permitted the Romans to adopt and perfect boarding tactics using a troop of about 40 marines in lieu of the ram. Ships were commanded by a navarch, a rank equal to a centurion, who was usually not a citizen. Potter suggests that because the fleet was dominated by non-Romans, the navy was considered non-Roman and allowed to atrophy in times of peace.
Information suggests that by the time of the late Empire (350 AD), the Roman navy comprised several fleets including warships and merchant vessels for transportation and supply. Warships were oared sailing galleys with three to five banks of oarsmen. Fleet bases included such ports as Ravenna, Arles, Aquilea, Misenum and the mouth of the Somme River in the West and Alexandria and Rhodes in the East. Flotillas of small river craft (classes) were part of the limitanei (border troops) during this period, based at fortified river harbors along the Rhine and the Danube. That prominent generals commanded both armies and fleets suggests that naval forces were treated as auxiliaries to the army and not as an independent service. The details of command structure and fleet strengths during this period are not well known, although fleets were commanded by prefects.
Ancient Rome commanded a vast area of land, with tremendous natural and human resources. As such, Rome's economy remained focused on farming and trade. Agricultural free trade changed the Italian landscape, and by the 1st century BC, vast grape and olive estates had supplanted the yeoman farmers, who were unable to match the imported grain price. The annexation of Egypt, Sicily and Tunisia in North Africa provided a continuous supply of grains. In turn, olive oil and wine were Italy's main exports. Two-tier crop rotation was practiced, but farm productivity was low, around 1 ton per hectare.
Industrial and manufacturing activities were small. The largest such activities were the mining and quarrying of stones, which provided basic construction materials for the buildings of that period. In manufacturing, production was on a relatively small scale, and generally consisted of workshops and small factories that employed at most dozens of workers. However, some brick factories employed hundreds of workers.
The economy of the early Republic was largely based on smallholding and paid labor. However, foreign wars and conquests made slaves increasingly cheap and plentiful, and by the late Republic, the economy was largely dependent on slave labor for both skilled and unskilled work. Slaves are estimated to have constituted around 20% of the Roman Empire's population at this time and 40% in the city of Rome. Only in the Roman Empire, when the conquests stopped and the prices of slaves increased, did hired labor become more economical than slave ownership.
Although barter was used in ancient Rome, and often used in tax collection, Rome had a very developed coinage system, with brass, bronze, and precious metal coins in circulation throughout the Empire and beyond—some have even been discovered in India. Before the 3rd century BC, copper was traded by weight, measured in unmarked lumps, across central Italy. The original copper coins (as) had a face value of one Roman pound of copper, but weighed less. Thus, Roman money's utility as a unit of exchange consistently exceeded its intrinsic value as metal. After Nero began debasing the silver denarius, its legal value was an estimated one-third greater than its intrinsic value.
Horses were expensive and other pack animals were slower. Mass trade on the Roman roads connected military posts, where Roman markets were centered. These roads were designed for wheels. As a result, there was transport of commodities between Roman regions, but increased with the rise of Roman maritime trade in the 2nd century BC. During that period, a trading vessel took less than a month to complete a trip from Gades to Alexandria via Ostia, spanning the entire length of the Mediterranean. Transport by sea was around 60 times cheaper than by land, so the volume for such trips was much larger.
Some economists consider the Roman Empire a market economy, similar in its degree of capitalistic practices to 17th century Netherlands and 18th century England.
The basic units of Roman society were households and families. Groups of households connected through the male line formed a family (gens), based on blood ties, a common ancestry or adoption. During the Roman Republic, some powerful families, or Gentes Maiores, came to dominate political life. Families were headed by their oldest male citizen, the pater familias (father of the family), who held lawful authority (patria potestas, "father's power") over wives, sons, daughters, and slaves of the household, and the family's wealth.
The extreme expressions of this power – the selling or killing of family members for moral or civil offenses, including simple disobedience – were very rarely exercised, and were forbidden in the Imperial era. A pater familias had moral and legal duties towards all family members. Even the most despotic pater familias was expected to consult senior members of his household and gens over matters that affected the family's well-being and reputation. Traditionally, such matters were regarded as outside the purview of the state and its magistrates; under the emperors, they were increasingly subject to state interference and legislation.
Once accepted into their birth family by their fathers, children were potential heirs. They could not be lawfully given away, or sold into slavery. If parents were unable to care for their child, or if its paternity was in doubt, they could resort to infant exposure (Boswell translates this as being "offered" up to care by the gods or strangers). If a deformed or sickly newborn was patently "unfit to live", killing it was a duty of the pater familias. A citizen father who exposed a healthy freeborn child was not punished, but automatically lost his potestas over that child. Abandoned children were sometimes adopted; some would have been sold into slavery. Slavery was near-ubiquitous and almost universally accepted. In the early Republic, citizens in debt were allowed to sell their labour, and perhaps their sons, to their debtor in a limited form of slavery called nexum, but this violated the fundamental conditions of citizenship and was abolished in the middle Republic. Freedom was considered a natural and proper state for citizens; slaves could be lawfully freed, with consent and support of their owners, and still serve their owners' family and financial interests, as freedmen or freed women. This was the basis of the client-patron relationship, one of the most important features of Rome's economy and society.
In law, a pater familias held potestas over his adult sons with their own households. This could give rise to legal anomalies, such as adult sons also having the status of minors. No man could be considered a pater familias, nor could he truly hold property under law, while his own father lived. During Rome's early history, married daughters came under the control (manus) of their husbands' pater familias. By the late Republic, most married women retained lawful connection to their birth family, though any children from the marriage belonged to her husband's family The mother or an elderly relative often raised both boys and girls. Roman moralists held that marriage and child-raising fulfilled a basic duty to family, gens, and the state. Marriage could help conserve or extend a family's wealth, bloodline and political connections. Multiple remarriages were not uncommon. Fathers usually began seeking husbands for their daughters when these reached an age between twelve and fourteen, but most commoner-class women stayed single until their twenties, and in general seem to have been far more independent than wives of the elite. Divorce required the consent of one party, along with the return of any dowry. Both parents had power over their children during their minority and adulthood, but husbands had much less control over their wives.
Roman citizen women held a restricted form of citizenship; they could not vote but were protected by law. They ran families, could own and run businesses, own and cultivate land, write their own wills, and plead in court on their own behalf, or on behalf of others, all under dispensation of the courts and the nominal supervision of a senior male relative. Throughout the late Republican and Imperial eras, a declining birthrate among the elite, and a corresponding increase among commoners was cause of concern for many gentes; Augustus tried to address this through state intervention, offering financial and other rewards to any woman who gave birth to three or more children, and penalising the childless. The latter was much resented, and the former had seemingly negligible results. Aristocratic women seem to have been increasingly disinclined to childbearing; it carried a high risk of mortality to mothers, and a deal of inconvenience thereafter for those who preferred an independent lifestyle.
Time and dates
Roman hours were counted ordinally from dawn to dawn. Thus, if sunrise was at 6 am, then 6 to 7 am was called the "first hour", 12 noon to 1 pm the "sixth hour" and so on. Midday was called meridies and it is from this word that the terms am (ante meridiem) and pm (post meridiem) stem. The English word "noon" comes from nona ("ninth (hour)"), which referred to 3 pm in Ancient Rome. The Romans had clocks (horologia), which included giant public sundials (solaria) and water clocks (clepsydrae).
The ancient Roman week originally had eight days, which were identified by letters A to H, with the eighth day being the nundinum or market day, a kind of weekend when farmers sold their produce on the streets. The seven-day week, first introduced from the East during the early Empire, was officially adopted during the reign of Constantine. Romans named week days after celestial bodies from at least the 1st century AD, a custom that was inherited by other peoples and is still found in many modern languages, including English.
Roman months had three important days: the calends (first day of each month, always in plural), the ides (13th or 15th of the month), and the nones (ninth day before the ides, inclusive, i.e. 5th or 7th of the month). Other days were counted backwards from the next one of these days. For example, what we call February 6, the Romans called ante diem VIII idus Februarias (inclusively the eighth day before the ides of February, which was February 13).
The Roman year originally had ten months from Martius (March) to December, with the winter period not included in the calendar. The first four months were named after gods (Martius, Aprilis, Maius, Junius) and the others were numbered (Quintilis, Sextilis, September, October, November, and December). Numa Pompilius, the second king of Rome (716–673 BC), is said to have introduced the months of January and February, both also named after gods, beginning the 12-month calendar still in use today. In 44 BC, the month Quintilis was renamed to Julius (July) after Julius Caesar and in 8 BC, Sextilis was renamed to Augustus (August) after Augustus Caesar.
The Romans had several ways of tracking years. One widespread way was the consular dating, which identified years by the two consuls who ruled each year (their term was limited to one year); it was introduced in the Republic and continued to be used in the Empire, even though the consular post was reduced to a ceremonial one during that latter period. Another way, introduced in the late 3rd century AD, was counting years from the indictio, a 15-year period based on the announcement of the delivery of food and other goods to the government. Another way, less popular but more similar to the way we currently count years, was ab urbe condita, which simply counted years from the mythical foundation of Rome in 753 BC. Thus, the year 653 BC would be 100 AUC, 1000 AD would be 1752 AUC (as there was no year 0 AD or BC) and so on.
Life in ancient Rome revolved around the city of Rome, located on seven hills. The city had a vast number of monumental structures like the Colosseum, the Trajan's Forum and the Pantheon. It had theatres, gymnasiums, marketplaces, functional sewers, bath complexes complete with libraries and shops, and fountains with fresh drinking water supplied by hundreds of miles of aqueducts. Throughout the territory under the control of ancient Rome, residential architecture ranged from modest houses to country villas.
In the capital city of Rome, there were imperial residences on the elegant Palatine Hill, from which the word palace derives. The low plebeian and middle equestrian classes lived in the city center, packed into apartments, or insulae, which were almost like modern ghettos. These areas, often built by upper class property owners to rent, were often centred upon collegia or taberna. These people, provided with a free supply of grain, and entertained by gladiatorial games, were enrolled as clients of patrons among the upper class patricians, whose assistance they sought and whose interests they upheld.
The native language of the Romans was Latin, an Italic language the grammar of which relies little on word order, conveying meaning through a system of affixes attached to word stems. Its alphabet was based on the Etruscan alphabet, which was in turn based on the Greek alphabet. Although surviving Latin literature consists almost entirely of Classical Latin, an artificial and highly stylized and polished literary language from the 1st century BC, the spoken language of the Roman Empire was Vulgar Latin, which significantly differed from Classical Latin in grammar and vocabulary, and eventually in pronunciation. Speakers of Latin could understand both until the 7th century when spoken Latin began to diverge so much that 'Classical' or 'Good Latin' had to be learned as a second language.
While Latin remained the main written language of the Roman Empire, Greek came to be the language spoken by the well-educated elite, as most of the literature studied by Romans was written in Greek. In the eastern half of the Roman Empire, which later became the Eastern Roman Empire, Latin was never able to replace Greek, and after the death of Justinian, Greek became the official language of the Eastern government. The expansion of the Roman Empire spread Latin throughout Europe, and Vulgar Latin evolved into dialects in different locations, gradually shifting into many distinct Romance languages.
Archaic Roman religion, at least concerning the gods, was made up not of written narratives, but rather of complex interrelations between gods and humans. Unlike in Greek mythology, the gods were not personified, but were vaguely defined sacred spirits called numina. Romans also believed that every person, place or thing had its own genius, or divine soul. During the Roman Republic, Roman religion was organized under a strict system of priestly offices, which were held by men of senatorial rank. The College of Pontifices was uppermost body in this hierarchy, and its chief priest, the Pontifex Maximus, was the head of the state religion. Flamens took care of the cults of various gods, while augurs were trusted with taking the auspices. The sacred king took on the religious responsibilities of the deposed kings. In the Roman Empire, deceased emperors who had ruled well were deified by their successors and the Senate. and the formalized imperial cult became increasingly prominent.
As contact with the Greeks increased, the old Roman gods became increasingly associated with Greek gods. Thus, Jupiter was perceived to be the same deity as Zeus, Mars became associated with Ares, and Neptune with Poseidon. The Roman gods also assumed the attributes and mythologies of these Greek gods. Under the Empire, the Romans absorbed the mythologies of their conquered subjects, often leading to situations in which the temples and priests of traditional Italian deities existed side by side with those of foreign gods.
Beginning with Emperor Nero in the 1st century AD, Roman official policy towards Christianity was negative, and at some points, simply being a Christian could be punishable by death. Under Emperor Diocletian, the persecution of Christians reached its peak. However, it became an officially supported religion in the Roman state under Diocletian's successor, Constantine I, with the signing of the Edict of Milan in 313, and quickly became dominant. All religions except Christianity were prohibited in 391 AD by an edict of Emperor Theodosius I.
Ethics and morality
Like many ancient cultures, concepts of ethics and morality, while sharing some commonalities with modern society, differed greatly in several important ways. Because ancient civilizations like Rome were under constant threat of attack from marauding tribes, their culture was necessarily militaristic with martial skills being a prized attribute. Whereas modern societies consider compassion a virtue, Roman society considered compassion a vice, a moral defect. Indeed, one of the primary purposes of the gladiatorial games was to inoculate Roman citizens from this weakness. Romans instead prized virtues such as courage and conviction (virtus), a sense of duty to one's people, moderation and avoiding excess (moderatio), forgiveness and understanding (clementia), fairness (severitas), and loyalty (pietas).
Contrary to popular descriptions, Roman society had well-established and restrictive norms related to sexuality, though as with many societies, the lion's share of the responsibilities fell on women. Women were generally expected to be monogamous having only a single husband during their life (univira), though this was much less regarded by the elite, especially under the empire. Women were expected to be modest in public avoiding any provocative appearance and to demonstrate absolute fidelity to their husbands (pudicitia). Indeed, wearing a veil was a common expectation to preserve modesty. Sex outside of marriage was generally frowned upon for men and women and indeed was made illegal during the imperial period. Nevertheless, prostitution was seen entirely differently and indeed was an accepted and regulated practice.
Art, music and literature
Roman painting styles show Greek influences, and surviving examples are primarily frescoes used to adorn the walls and ceilings of country villas, though Roman literature includes mentions of paintings on wood, ivory, and other materials. Several examples of Roman painting have been found at Pompeii, and from these art historians divide the history of Roman painting into four periods.
The first style of Roman painting was practiced from the early 2nd century BC to the early- or mid-1st century BC. It was mainly composed of imitations of marble and masonry, though sometimes including depictions of mythological characters. The second style began during the early 1st century BC and attempted to depict realistically three-dimensional architectural features and landscapes. The third style occurred during the reign of Augustus (27 BC – 14 AD), and rejected the realism of the second style in favor of simple ornamentation. A small architectural scene, landscape, or abstract design was placed in the center with a monochrome background. The fourth style, which began in the 1st century AD, depicted scenes from mythology, while retaining architectural details and abstract patterns.
Portrait sculpture during the period utilized youthful and classical proportions, evolving later into a mixture of realism and idealism. During the Antonine and Severan periods, ornate hair and bearding, with deep cutting and drilling, became popular. Advancements were also made in relief sculptures, usually depicting Roman victories.
Latin literature was, from its start, influenced heavily by Greek authors. Some of the earliest extant works are of historical epics telling the early military history of Rome. As the Republic expanded, authors began to produce poetry, comedy, history, and tragedy.
Roman music was largely based on Greek music, and played an important part in many aspects of Roman life. In the Roman military, musical instruments such as the tuba (a long trumpet) or the cornu were used to give various commands, while the buccina (possibly a trumpet or horn) and the lituus (probably an elongated J-shaped instrument), were used in ceremonial capacities. Music was used in the Roman amphitheatres between fights and in the odea, and in these settings is known to have featured the cornu and the hydraulis (a type of water organ).
Most religious rituals featured musical performances, with tibiae (double pipes) at sacrifices, cymbals and tambourines at orgiastic cults, and rattles and hymns across the spectrum. Some music historians believe that music was used at almost all public ceremonies. Music historians are not certain if Roman musicians made a significant contribution to the theory or practice of music.
Ancient Roman cuisine changed over the long duration of this ancient civilization. Dietary habits were affected by the influence of Greek culture, the political changes from Kingdom to Republic to Empire, and the Empire's enormous expansion, which exposed Romans to many new, provincial culinary habits and cooking techniques. In the beginning the differences between social classes were relatively small, but disparities evolved with the Empire's growth. Men and women drank wine with their meals, a tradition that has been carried through to the present day.
The ancient Roman diet included many items that are staples of modern Italian cooking. Pliny the Elder discussed more than 30 varieties of olive, 40 kinds of pear, figs (native and imported from Africa and the eastern provinces), and a wide variety of vegetables, including carrots (of different colors, but not orange) as well as celery, garlic, some flower bulbs, cabbage and other brassicas (such as kale and broccoli), lettuce, endive, onion, leek, asparagus, radishes, turnips, parsnips, beets, green peas, chard, cardoons, olives, and cucumber.
However, some foods now considered characteristic of modern Italian cuisine were not used. In particular, spinach and eggplant (aubergine) were introduced later from the Arab world, and tomatoes, potatoes, capsicum peppers, and maize (the modern source of polenta) only appeared in Europe following the discovery of the New World and the Columbian Exchange. The Romans knew of rice, but it was very rarely available to them. There were also few citrus fruits. Lemons were known in Italy from the second century AD but were not widely cultivated.
Butcher's meat such as beef was an uncommon luxury. The most popular meat was pork, especially sausages. Fish was more common than meat, with a sophisticated aquaculture and large-scale industries devoted to oyster farming. The Romans also engaged in snail farming and oak grub farming. Some fish were greatly esteemed and fetched high prices, such as mullet raised in the fishery at Cosa, and "elaborate means were invented to assure its freshness".
Traditionally, a breakfast called ientaculum was served at dawn. At mid-day to early afternoon, Romans ate cena, the main meal of the day, and at nightfall a light supper called vesperna. With the increased importation of foreign foods, the cena grew larger in size and included a wider range of foods. Thus, it gradually shifted to the evening, while the vesperna was abandoned completely over the course of the years. The mid-day meal prandium became a light meal to hold one over until cena. Among the lower classes of the Roman society, these changes were less pronounced as the traditional routines corresponded closely to the daily rhythms of manual labour.
Games and recreation
The youth of Rome had several forms of athletic play and exercise. Play for boys was supposed to prepare them for active military service, such as jumping, wrestling, boxing, and racing. In the countryside, pastimes for the wealthy also included fishing and hunting. The Romans also had several forms of ball playing, including one resembling handball. Dice games, board games, and gamble games were popular pastimes. For the wealthy, dinner parties presented an opportunity for entertainment, sometimes featuring music, dancing, and poetry readings. The majority, less well-off, sometimes enjoyed similar parties through clubs or associations, but for most Romans, recreational dining usually meant patronizing taverns. Children entertained themselves with toys and such games as leapfrog.
Public games and spectacles were sponsored by leading Romans who wished to advertise their generosity and court popular approval; in Rome or its provinces, this usually meant the emperor or his governors. Venues in Rome and the provinces were developed specifically for public games. Rome's Colisseum was built in the Imperial era to host, among other events, gladiatorial combats. These combats had begun as funeral games around the 4th century BC, and became popular spectator events in the late Republic and Empire. Gladiators had an exotic and inventive variety of arms and armour. They sometimes fought to the death, but more often to an adjudicated victory, dependent on a referee's decision. The outcome was usually in keeping with the mood of the watching crowd. Shows of exotic animals were popular in their own right; but sometimes animals were pitted against human beings, either armed professionals or unarmed criminals who had been condemned to a spectacular and theatrical public death in the arena. Some of these encounters were based on episodes from Roman or Greek mythology.
Chariot racing was extremely popular among all classes. In Rome, these races were usually held at the Circus Maximus, which had been purpose-built for chariot and horse-racing and, as Rome's largest public place, was also used for festivals and animal shows. It could seat around 150,000 people; The charioteers raced in teams, identified by their colours. The track was divided lengthwise by a barrier that contained obelisks, temples, statues and lap-counters. The best seats were at the track-side, close to the action; they were reserved for Senators. Behind them sat the equites (knights), and behind the knights were the plebs (commoners) and non-citizens. The donor of the games sat on a high platform in the stands alongside images of the gods, visible to all. Large sums were bet on the outcomes of races. Some Romans offered prayers and sacrifices on behalf of their favourites, or illegally laid curses on the opposing teams, and some aficionados were members of extremely, even violently partisan circus factions.
Ancient Rome boasted impressive technological feats, using many advancements that were lost in the Middle Ages and not rivaled again until the 19th and 20th centuries. An example of this is insulated glazing, which was not invented again until the 1930s. Many practical Roman innovations were adopted from earlier Greek designs. Advancements were often divided and based on craft. Artisans guarded technologies as trade secrets.
Roman civil engineering and military engineering constituted a large part of Rome's technological superiority and legacy, and contributed to the construction of hundreds of roads, bridgess, aqueducts, public baths, theatres and arenas. Many monuments, such as the Colosseum, Pont du Gard, and Pantheon, remain as testaments to Roman engineering and culture.
The Romans were renowned for their architecture, which is grouped with Greek traditions into "Classical architecture". Although there were many differences from Greek architecture, Rome borrowed heavily from Greece in adhering to strict, formulaic building designs and proportions. Aside from two new orders of columns, composite and Tuscan, and from the dome, which was derived from the Etruscan arch, Rome had relatively few architectural innovations until the end of the Republic.
In the 1st century BC, Romans started to use Roman concrete widely. Concrete was invented in the late 3rd century BC. It was a powerful cement derived from pozzolana, and soon supplanted marble as the chief Roman building material and allowed many daring architectural forms. Also in the 1st century BC, Vitruvius wrote De architectura, possibly the first complete treatise on architecture in history. In the late 1st century BC, Rome also began to use glassblowing soon after its invention in Syria about 50 BC. Mosaics took the Empire by storm after samples were retrieved during Lucius Cornelius Sulla's campaigns in Greece.
The Romans also largely built using timber, causing a rapid decline of the woodlands surrounding Rome and in much of the Apennine Mountains due to the demand for wood for construction, shipbuilding and fire. The first evidence of long-distance wood trading come from the discovery of wood planks, felled between A.D. 40 and 60, coming from the Jura mountains in northeastern France and ending up more than 1,055 miles away, in the foundations of a lavish portico that was part of a vast wealthy patrician villa, in Central Rome. It is suggested that timber, around 4 meters long, came up to Rome via the Tiber River via ships traveling across the Mediterranean Sea from the confluence of the Saône and Rhône rivers in what is now the city of Lyon in present-day France.
With solid foundations and good drainage, Roman roads were known for their durability and many segments of the Roman road system were still in use a thousand years after the fall of Rome. The construction of a vast and efficient travel network throughout the Empire dramatically increased Rome's power and influence. They allowed Roman legions to be deployed rapidly, with predictable marching times between key points of the empire, no matter the season. These highways also had enormous economic significance, solidifying Rome's role as a trading crossroads—the origin of the saying "all roads lead to Rome". The Roman government maintained a system of way stations, known as the cursus publicus, that provided refreshments to couriers at regular intervals along the roads and established a system of horse relays allowing a dispatch to travel up to 80 km (50 mi) a day.
The Romans constructed numerous aqueducts to supply water to cities and industrial sites and to aid in their agriculture. By the third century, the city of Rome was supplied by 11 aqueducts with a combined length of 450 km (280 mi). Most aqueducts were constructed below the surface, with only small portions above ground supported by arches. Sometimes, where valleys deeper than 500 m (1,640 ft) had to be crossed, inverted siphons were used to convey water across a valley.
The Romans also made major advancements in sanitation. Romans were particularly famous for their public baths, called thermae, which were used for both hygienic and social purposes. Many Roman houses came to have flush toilets and indoor plumbing, and a complex sewer system, the Cloaca Maxima, was used to drain the local marshes and carry waste into the Tiber river.
Some historians have speculated that lead pipes in the sewer and plumbing systems led to widespread lead poisoning, which contributed to the decline in birth rate and general decay of Roman society leading up to the fall of Rome. However, lead content would have been minimized because the flow of water from aqueducts could not be shut off; it ran continuously through public and private outlets into the drains, and only a few taps were in use. Other authors have raised similar objections to this theory, also pointing out that Roman water pipes were thickly coated with deposits that would have prevented lead from leaching into the water.
|Ancient Rome (13:47), Smarthistory at Khan Academy|
Ancient Rome is the progenitor of Western civilization. The customs, religion, law, technology, architecture, political system, military, literature, languages, alphabet, government and many factors and aspects of western civilization are all inherited from Roman advancements. The rediscovery of Roman culture revitalized Western civilization, playing a role in the Renaissance and the Age of Enlightenment.
A genetic study published in Science in November 2019 examined the genetic history of Rome from the Mesolithic up to modern times. The Mesolithic inhabitants of Rome were determined to be Western Hunter Gatherers (WHGs), who were almost entirely replaced by Early European Farmers (EEFs) around 6,000 BC coming from Anatolia and the Fertile Crescent. However, the authors observe that the EEFs studied carry a small amount of another component that is found at high levels in Neolithic Iranian farmers and Caucasus hunter-gatherers (CHG), suggesting different or additional population contributions from Near Eastern farmers during the Neolithic transition, according to the authors.
Between 2,900 BC and 900 BC, the EEF/WHG descended population of Rome was overwhelmed by peoples with steppe ancestry largely tracing their origin to the Pontic–Caspian steppe. The Iron Age Latin founding population of Rome which subsequently emerged overwhelmingly carried the paternal haplogroup R-M269, and were of about 30% steppe ancestry. However, two out of six individuals from Latin burials from Latium vetus were found to be a mixture of local Iron Age ancestry and a ancient Near Eastern population (best approximated by Bronze Age Armenian or Iron Age Anatolian population). In addition, one out of four individuals from Etruscan burials from Veio and Civitavecchia, a female, was found to be a mixture of local Iron Age ancestry and a North African population (best approximated by Late Neolithic Moroccan). Overall, the genetic differentiation between the Latins, Etruscans and the preceding proto-villanovan population of Italy was found to be insignificant.
Examined individuals from Rome during the time of the Roman Empire (27 BCE – 300 CE) bore almost no genetic resemblance to Rome's founding populations, and were instead shifted towards the Eastern Mediterranean and Near East, largely overlapping with modern such as Greeks, Maltese, Cypriot, and Syrian. The Imperial population of Rome was found to have been extremely diverse, with barely any of the examined individuals being of primarily western European ancestry. It was suggested that the large population size and the presence of megacities in the east, such as Athens, Antioch, and Alexandria, may have driven a net flow of people from east to west during antiquity; in addition, eastern ancestry could have reached Rome also through Greek, Phoenician, and Punic diasporas that were established through colonies across the Mediterranean prior to Roman Imperial expansion. During late antiquity, Rome's population was drastically reduced as a result of political instability, epidemics and economic changes. Repeated invasions of barbarians brought European ancestry back into Rome, resulting in the loss of genetic link to the Eastern Mediterranean and Middle East. By the Middle Ages, the people of Rome again genetically resembled European populations.
As regards to the data on the pigmentation of eyes, hair, and skin, the following results were obtained from the study on ancient DNA of 11 individuals of the Iron Age/Republican period, coming from Latium and Abruzzo, and 27 individuals of Medieval/Early Modern period, coming from Latium.
In the Iron Age/Republic period, the eye color is blue in 27% of those examined and dark in the remaining 73%. Hair color is 9% blond, or dark blond, and 91% dark brown or black. The skin color is intermediate for 82%, intermediate or dark for 9%, and dark or very dark for the remaining 9%.
By contrast, the following results were obtained for the Medieval/Early Modern period: the eye color is blue in 26% of those examined and dark in the remaining 74%. Hair color is 22% blond or dark blond, 11% red, and 67% dark brown or black. The skin color is pale for 15%, intermediate for 68%, intermediate or dark for 10%, and dark or very dark for the remaining 7%.
There is a number of individual misconceptions about the Roman period.
- Greek and Roman sculptures were originally painted with bright colors; they only appear white or grey today because the original pigments have deteriorated. Some well-preserved statues still bear traces of their original coloration.
- There is no evidence that the Roman salute, in which the arm is fully extended forwards or diagonally with fingers touching, was actually used in ancient Rome for greeting or any other purpose. The idea that the salute was popular in ancient times originated in the 1784 painting Oath of the Horatii by the French artist Jacques-Louis David, which inspired later salutes, most notably the Nazi salute.
- Vomiting was not a regular part of Roman dining customs. In ancient Rome, the architectural feature called a vomitorium was the entranceway through which crowds entered and exited a stadium, not a special room used for purging food during meals.
- Scipio Aemilianus did not plow over the city of Carthage and sow it with salt after defeating it in the Third Punic War.
- Julius Caesar was not born via caesarean section. Such a procedure would have been fatal to the mother at the time, and historical evidence indicates Caesar's mother being alive during his own lifetime. Although the names are similar, the caesarean section was not named after Caesar, as is commonly believed; it is more likely related to "cease" and derived from the Latin verb caedere, meaning "to cut."
- The death of the Greek philosopher Hypatia of Alexandria at the hands of a mob of Christian monks in 415 was mainly a result of her involvement in a bitter political feud between her close friend and student Orestes, the Roman prefect of Alexandria, and the bishop Cyril, not her religious views. Her death also had nothing to do with the destruction of the Library of Alexandria, which had likely already ceased to exist centuries before Hypatia was born.
Although there has been a diversity of works on ancient Roman history, many of them are lost. As a result of this loss, there are gaps in Roman history, which are filled by unreliable works, such as the Historia Augusta and other books from obscure authors. However, there remains a number of reliable accounts of Roman history.
In Roman times
The first historians used their works for the lauding of Roman culture and customs. By the end of Republic, some historians distorted their histories to flatter their patrons—especially at the time of Marius's and Sulla's clash. Caesar wrote his own histories to make a complete account of his military campaigns in Gaul and during the Civil War.
In the Empire, the biographies of famous men and early emperors flourished, examples being The Twelve Caesars of Suetonius, and Plutarch's Parallel Lives. Other major works of Imperial times were that of Livy and Tacitus.
- Polybius – The Histories
- Sallust – Bellum Catilinae and Bellum Jugurthinum
- Julius Caesar – De Bello Gallico and De Bello Civili
- Livy – Ab urbe condita
- Dionysius of Halicarnassus – Roman Antiquities
- Pliny the Elder – Naturalis Historia
- Josephus – The Jewish War
- Suetonius – The Twelve Caesars (De Vita Caesarum)
- Tacitus – Annales and Histories
- Plutarch – Parallel Lives (a series of biographies of famous Roman and Greek men)
- Cassius Dio – Historia Romana
- Herodian – History of the Roman Empire since Marcus Aurelius
- Ammianus Marcellinus – Res Gestae
In modern times
|History of Italy|
Interest in studying, and even idealizing, ancient Rome became prevalent during the Italian Renaissance, and continues until the present day. Charles Montesquieu wrote a work Reflections on the Causes of the Grandeur and Declension of the Romans. The first major work was The History of the Decline and Fall of the Roman Empire by Edward Gibbon, which encompassed the Roman civilization from the end of the 2nd century to the fall of the Byzantine Empire in 1453. Like Montesquieu, Gibbon paid tribute to the virtue of Roman citizens. Barthold Georg Niebuhr was a founder of the examination of ancient Roman history and wrote The Roman History, tracing the period until the First Punic war. Niebuhr tried to determine the way the Roman tradition evolved. According to him, Romans, like other people, had an historical ethos preserved mainly in the noble families.
During the Napoleonic period a work titled The History of Romans by Victor Duruy appeared. It highlighted the Caesarean period popular at the time. History of Rome, Roman constitutional law and Corpus Inscriptionum Latinarum, all by Theodor Mommsen, became very important milestones. Later the work Greatness and Decline of Rome by Guglielmo Ferrero was published. The Russian work Очерки по истории римского землевладения, преимущественно в эпоху Империи (The Outlines on Roman Landownership History, Mainly During the Empire) by Ivan Grevs contained information on the economy of Pomponius Atticus, one of the largest landowners at the end of the Republic.
- Edward Gibbon (1737–1794) – The History of the Decline and Fall of the Roman Empire
- John Bagnall Bury (1861–1927) – History of the Later Roman Empire
- Michael Grant (1914–2004) – The Roman World
- Barbara Levick (born 1932) – Claudius
- Barthold Georg Niebuhr (1776–1831)
- Michael Rostovtzeff (1870–1952)
- Howard Hayes Scullard (1903–1983) – The History of the Roman World
- Ronald Syme (1903–1989) – The Roman Revolution
- Adrian Goldsworthy (born 1969) – Caesar: The Life of a Colossus and How Rome fell
- This splintering is a landmark historians use to divide the ancient period of universal history from the pre-medieval "Dark Ages" of Europe.
- Although the citizens of the empire made no distinction, the empire is most commonly referred to as the "Byzantine Empire" by modern historians to differentiate between the state in antiquity and the state during the Middle Ages.
- Later in Christian liturgy, "noon" came to describe the nones, a time of prayer originally at 3 pm but later at midday, so "noon" became synonymous with midday.
- "ancient Rome | Facts, Maps, & History". Encyclopædia Britannica. Retrieved 5 September 2017.
- There are several different estimates for the population of the Roman Empire.
- Scheidel (2006, p. 2) estimates 60.
- Goldsmith (1984, p. 263) estimates 55.
- Beloch (1886, p. 507) estimates 54.
- Maddison (2006, pp. 51, 120) estimates 48.
- Roman Empire Population estimates 65 (while mentioning several other estimates between 55 and 120).
- McLynn, Frank (2011). Marcus Aurelius: Warrior, Philosopher, Emperor. Random House. p. 3. ISBN 9781446449332.
[T]he most likely estimate for the reign of Marcus Aurelius is somewhere between seventy and eighty million.
- McEvedy and Jones (1978).
- an average of figures from different sources as listed at the US Census Bureau's Historical Estimates of World Population Archived 13 October 2013 at the Wayback Machine
- Kremer, Michael (1993). "Population Growth and Technological Change: One Million B.C. to 1990" in The Quarterly Journal of Economics 108(3): 681–716.
- Taagepera, Rein (1979). "Size and Duration of Empires: Growth-Decline Curves, 600 B.C. to 600 A.D.". Social Science History. 3 (3/4): 125. doi:10.2307/1170959. JSTOR 1170959.
- Turchin, Peter; Adams, Jonathan M.; Hall, Thomas D (December 2006). "East-West Orientation of Historical Empires". Journal of World-Systems Research. 12 (2): 222. doi:10.5195/JWSR.2006.369. ISSN 1076-156X.
- Furet, François; Ozouf, Mona, eds. (1989). A Critical Dictionary of the French Revolution. Harvard University Press. p. 793. ISBN 978-0674177284.
- Luckham, Robin; White, Gordon (1996). Democratization in the South: The Jagged Wave. Manchester University Press. p. 11. ISBN 978-0719049422.
- Sellers, Mortimer N. (1994). American Republicanism: Roman Ideology in the United States Constitution. NYU Press. p. 90. ISBN 978-0814780053.
- Ferrero, Guglielmo (1909). The Greatness and Decline of Rome, Volume 2. Translated by Zimmern, Sir Alfred Eckhard; Chaytor, Henry John. G.P. Putnam's Sons. p. 215.
- Hadfield, Andrew Hadfield (2005). Shakespeare and Republicanism. Cambridge University Press. p. 68. ISBN 978-0521816076.
- Gray, Christopher B (1999). The Philosophy of Law: An Encyclopedia, Volume 1. Taylor & Francis. p. 741. ISBN 978-0815313441.
- Cartwright, Mark (19 September 2018). "Byzantine Empire". World History Encyclopedia.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 3. ISBN 978-0-19-512332-6.
- Cavazzi, F. "The Founding of Rome". Illustrated History of the Roman Empire. Retrieved 8 March 2007.
- Livius, Titus (Livy) (1998). The Rise of Rome, Books 1–5. Translated by Luce, T.J. Oxford: Oxford World's Classics. pp. 8–11. ISBN 978-0-19-282296-3.
- Durant, Will; Durant, Ariel (1944). The Story of Civilization – Volume III: Caesar and Christ. Simon and Schuster, Inc. pp. 12–14. ISBN 978-1567310238.
- Roggen, Hesse, Haastrup, Omnibus I, H. Aschehoug & Co 1996
- Myths and Legends- Rome, the Wolf, and Mars. Retrieved 8 March 2007.
- Mellor, Ronald and McGee Marni, The Ancient Roman World p. 15 (Cited 15 March 2009)
- Matyszak, Philip (2003). Chronicle of the Roman Republic. London: Thames & Hudson. p. 19. ISBN 978-0-500-05121-4.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 129. ISBN 978-0-534-57168-9.
- Ancient Rome and the Roman Empire by Michael Kerrigan. Dorling Kindersley, London: 2001. ISBN 0-7894-8153-7. p. 12.
- Langley, Andrew and Souza, de Philip, "The Roman Times", Candle Wick Press, Massachusetts
- Matyszak, Philip (2003). Chronicle of the Roman Republic. London: Thames & Hudson. pp. 43–44. ISBN 978-0-500-05121-4.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. pp. 41–42. ISBN 978-0-19-512332-6.
- Hooker, Richard (6 June 1999). "Rome: The Roman Republic". Washington State University. Archived from the original on 14 May 2011.
- Magistratus by George Long, M.A. Appearing on pp. 723–724 of A Dictionary of Greek and Roman Antiquities by William Smith, D.C.L., LL.D. Published by John Murray, London, 1875. Website, 8 December 2006. Retrieved 24 March 2007.
- Livius, Titus (Livy) (1998). "Book II". The Rise of Rome, Books 1–5. Translated by Luce, T.J. Oxford: Oxford World's Classics. ISBN 978-0-19-282296-3.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 39. ISBN 978-0-19-512332-6.
- These are literally Roman librae, from which the pound is derived.
- Plutarch, Parallel Lives, Life of Camillus, XXIX, 2.
- Haywood, Richard (1971). The Ancient World. United States: David McKay Company, Inc. pp. 350–358.
- Pyrrhus of Epirus (2) Archived 14 April 2016 at the Wayback Machine and Pyrrhus of Epirus (3) by Jona Lendering. Livius.org. Retrieved 21 March 2007.
- Bennett, Matthew; Dawson, Doyne; Field, Ron; Hawthornwaite, Philip; Loades, Mike (2016). The History of Warfare: The Ultimate Visual Guide to the History of Warfare from the Ancient World to the American Civil War. p. 61.
- Goldsworthy 2006, pp. 25–26.
- Miles 2011, pp. 175–176.
- Cassius Dio, Roman History, XI, XLIII.
- New historical atlas and general history By Robert Henlopen Labberton. p. 35.
- Caspari, Maximilian Otto Bismarck (1911). Encyclopædia Britannica. Vol. 22 (11th ed.). Cambridge University Press. p. 850.. In Chisholm, Hugh (ed.).
- AncientRome.ru. "The Database of Ancient Art." Retrieved 25 August 2016.
- AncientRome.ru. "Publius Cornelius Scipio Africanus." Retrieved 27 November 2021.
- Haywood, Richard (1971). The Ancient World. United States: David McKay Company, Inc. pp. 376–393.
- Rome: The Punic Wars by Richard Hooker. Washington State University. 6 June 1999. Retrieved 22 March 2007.
- Bury, John Bagnell (1889). History of the Later Roman Empire. London, New York: MacMillan and Co.
- Rome: The Conquest of the Hellenistic Empires Archived 1 May 2011 at the Wayback Machine by Richard Hooker. Washington State University. 6 June 1999. Retrieved 22 March 2007.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. pp. 136–137. ISBN 978-0-534-57168-9.
- Fall of the Roman Republic, 133–27 BC. Purdue University. Retrieved 24 March 2007.
- Eques (Knight) Archived 7 August 2014 at the Wayback Machine by Jona Lendering. Livius.org. Retrieved 24 March 2007.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 38. ISBN 978-0-19-512332-6.
- Tuma, Elias H. (1965). Twenty-six Centuries of Agrarian Reform: A Comparative Analysis. University of California Press. p. 34.
- Plutarch. Life of Sulla.
- William Harrison De Puy (1893). The Encyclopædia britannica: a dictionary of arts, sciences, and general literature; the R.S. Peale reprint, with new maps and original American articles. Werner Co. p. 760.
- Henry George Liddell (1855). A history of Rome, to the establishment of the empire. p. 305.
- Plutarch Parallel Lives, Life of Caesar, I,2
- Scullard, Howard Hayes (1982). From the Gracchi to Nero (5th ed.). Routledge. ISBN 978-0-415-02527-0. Chapters VI–VIII.
- Julius Caesar (100–44 BC). BBC. Retrieved 21 March 2007.
- Plutarch, Life of Caesar. Retrieved 1 October 2011
- Augustus (31 BC – 14 AD) by Garrett G. Fagan. De Imperatoribus Romanis. 5 July 2004. Retrieved 21 March 2007.
- Coins of the Emperor Augustus Archived 25 May 2009 at the Wayback Machine; examples are a coin of 38 BC inscribed "Divi Iuli filius", and another of 31 BC bearing the inscription "Divi filius" (Auguste vu par lui-même et par les autres by Juliette Reid Archived 19 March 2009 at the Wayback Machine).
- Suetonius, The Twelve Caesars, Augustus, XV.
- Plutarch, Parallel Lives, Life of Antony, II, 1.
- Ancient Library Archived 5 June 2011 at the Wayback Machine. Retrieved 9 September 2011
- Plutarch, Parallel Lives, Life of Antony, LXXI, 3–5.
- Augustus (63 BC – AD 14) from bbc.co.uk. Retrieved 12 March 2007.
- Langley, Andrew and Souza, de Philip: "The Roman Times" p.14, Candle Wick Press, 1996
- The Julio-Claudian Dynasty (27 BC – 68 AD). by the Department of Greek and Roman Art, The Metropolitan Museum of Art. October 2000. Retrieved 18 March 2007.
- James Orr (1915). The International Standard Bible Encyclopaedia. Howard-Severance Company. p. 2598.
- Charles Phineas Sherman (1917). Roman law in the modern world. The Boston book company. p. 50.
- Suetonius, The Twelve Caesars, Augustus, XXVII, 3.
- Werner Eck, The Age of Augustus
- Suetonius, The Twelve Caesars, Augustus, XVIII, 2.
- Pelham, Henry Francis (1911). . In Chisholm, Hugh (ed.). Encyclopædia Britannica. Vol. 2 (11th ed.). Cambridge University Press. p. 912.
- Suetonius, The Twelve Caesars, Augustus, XXI, 1.
- Suetonius, The Twelve Caesars, Augustus, XXI.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 140. ISBN 978-0-534-57168-9.
- Suetonius, The Twelve Caesars, Augustus, LXIII.
- Cassius Dio, Roman History, LVII, 12.
- John Charles Tarver (1902). Tiberius, the tyrant. A. Constable. pp. 342–428. Retrieved 31 May 2012.
- Johann Jakob Herzog; John Henry Augustus Bomberger (1858). The Protestant Theological and Ecclesiastical Encyclopedia: Being a Condensed Translation of Herzog's Real Encyclopedia. Lindsay & Blakiston. p. 99.
- The Chautauquan. M. Bailey. 1881. p. 445.
- Suetonius, The Twelve Caesars, Caligula, LV, 3.
- Compendium (1858). A compendium of universal history. Ancient and modern, by the author of 'Two thousand questions on the Old and New Testaments'. p. 109.
- Sir William Smith (1890). Abaeus-Dysponteus. J. Murray. p. 776.
- Suetonius, The Twelve Caesars, Claudius, XVII.
- Claudius By Barbara Levick. p. 77.
- Brief History: Brief History of Great Britain. Infobase Publishing. 2009. p. 34.
- England Invaded. Amberley Publishing Limited. 2014. p. 27.
- In the Name of Rome: The Men Who Won the Roman Empire. Hachette UK. 2010. p. 30.
- "Gaius Suetonius Paulinus". 27 September 2016.
- Making Europe: The Story of the West, Volume I to 1790. 2013. p. 162.
- Suetonius, The Twelve Caesars, Nero, XVI.
- Tacitus, Annales, XXXVIII.
- Nero (54–68 AD) by Herbert W. Benario. De Imperatoribus Romanis. 10 November 2006. Retrieved 18 March 2007.
- O'Connell, Robert (1989). Of Arms and Men: A History of War, Weapons, and Aggression. Oxford: Oxford University Press. p. 81. ISBN 978-0-19-505359-3.
- Kreis, Stephen. "Augustus Caesar and the Pax Romana". The History Guide. Retrieved 21 March 2007.
- Josephus, The Wars of the Jews VI.9.3
- Suetonius, The Twelve Caesars, Vespasian, I.
- Suetonius, The Twelve Caesars, Vespasian, IX.
- Cassius Dio, Roman History, LXVI.
- Suetonius, The Twelve Caesars, Titus, VII, 3.
- Suetonius, The Twelve Caesars, Domitian, X.
- Titus Flavius Domitianus. Retrieved 29 October 2011.
- Five Good Emperors from UNRV History. Retrieved 12 March 2007.
- Cassius Dio, Roman History, LXVIII, 1.
- Cassius Dio, Roman History, LXVIII, 6.
- Cassius Dio, Roman History, LXVIII, 14.
- Cassius Dio, Roman History, LXVIII, 13.
- Ferdinand Gregorovius (1898). The Emperor Hadrian: A Picture of the Graeco-Roman World in His Time. Macmillan. p. 16. ISBN 9780790552286.
- Cassius Dio, Roman History, LXVIII, 17–30.
- Emperors of Rome: The Story of Imperial Rome from Julius Caesar to the Last Emperor. Hachette UK. 2014. p. 64.
- Scarre, Chris (1995). The Penguin Historical Atlas of Ancient Rome. Penguin Books. ISBN 978-0-14-051329-5.
- Encyclopedia of European Peoples. Infobase Publishing. 2006. p. 406.
- The Encyclopedia of Christianity, Volume 4. Wm. B. Eerdmans Publishing. 2005. p. 15. ISBN 9780802824165.
- Historia Augusta, Life of Hadrian.
- Historia Augusta, Life of Antoninus Pius, V, 4.
- Cassius Dio, Roman History, LXXVII.
- Past pandemics that ravaged Europe by Verity Murphy. BBC News. 7 November 2005.
- Gibbon, Edward (1906). "Chapter I". In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Cassius Dio, Roman History, LXXII, 36, 4.
- Cary, Max (1967). A History of Rome Down to the Reign of Constantine (Second ed.). New York: St. Martin's Press. p. 704.
- Cassius Dio, Roman History, LXXV, 13.
- Machiavelli, Il Principe, XIX (in Italian).
- Cassius Dio, Roman History, LXXVI, 7.
- Cassius Dio, Roman History, LXXVI, 9–12.
- Cassius Dio, Roman History, LXXVIII, 22–23.
- Historia Augusta, The Life of Caracalla, VI.
- Giessen Papyrus, 40,7-9 "I grant to all the inhabitants of the Empire the Roman citizenship and no one remains outside a civitas, with the exception of the dediticii"
- Historia Augusta, The Life of Alexander Severus, LIX.
- Skip Knox, E.L. "Crisis of the Third Century (235–285)". History of Western Civilization. Boise State University. Archived from the original on 3 May 2007.
- Gibbon, Edward (1906). "Chapter X" (Online version). In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Historia Augusta, The Lives of the Thirty Pretenders, III et XXX.
- Historia Augusta, The Life of Aurelian, XXXII.
- Historia Augusta, The Life of Claudius, I.
- Lactantius, De Mortibus Persecutorum, VII.
- Joannes Zonaras, Epitome: From Diocletian to the death of Galerius
- Diocletian (284–305 AD) by Ralph W. Mathisen. De Imperatoribus Romanis. 17 March 1997. Retrieved 20 March 2007.
- Ward-Perkins, John Bryan (1994). Roman Imperial Architecture. New Haven, CT: Yale University Press. ISBN 978-0-300-05292-3.
- Lactantius, De Mortibus Persecutorum, X–XVI.
- Gibbon, Edward (1906). "Chapter XX". In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Gibbon, Edward (1906). "Chapter XVII" (Online version). In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Constantine I (306–337 AD) by Hans A. Pohlsander. De Imperatoribus Romanis. 8 January 2004. Retrieved 20 March 2007.
- Honorius (395–423 AD) by Ralph W. Mathisen. De Imperatoribus Romanis. 2 June 1999. Retrieved 21 March 2007.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 155. ISBN 978-0-534-57168-9.
- Gibbon, Edward (1906). "Chapter XXVI" (Online version). In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Lapham, Lewis (1997). The End of the World. New York: Thomas Dunne Books. ISBN 0-312-25264-1. pp. 47–50.
- Bury, J.B.: History of the Later Roman Empire, 8, §2.
- Bury, J.B.: History of the Later Roman Empire, 6, §4.
- Bury, J.B.: History of the Later Roman Empire, 6, §3.
- Bury, J.B.: History of the Later Roman Empire, 9.
- "The Germanic Invasions of Western Europe". University of Calgary. August 1996. Archived from the original on 12 August 2013. Retrieved 22 March 2007.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 157. ISBN 978-0-534-57168-9.
- "Roman Emperors – DIR Romulus Augustulus". www.roman-emperors.org.
- Romulus Augustulus (475–476 AD) – Two Views by Ralph W. Mathisen and Geoffrey S. Nathan. De Imperatoribus Romanis. 26 August 1997. Retrieved 22 March 2007.
- Mathisen, Ralph A. (8 February 1998). "Roman Emperors – DIR Nepos".
- Durant, Will; Durant, Ariel (1944). The Story of Civilization – Volume III: Caesar and Christ. United States: Simon and Schuster, Inc. p. 670. ISBN 978-1567310238.
- Morris Bishop, The Middle Ages, 1996. p. 8
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 347. ISBN 978-0-534-57168-9.
- Hooker, Richard (6 June 1999). "The Byzantine Empire". Washington State University. Archived from the original on 24 February 1999.
- Bray, R.S. (2004). Armies of Pestilence. Cambridge: James Clarke & Co. p. 26. ISBN 978-0-227-17240-7.
- Kreutz, Barbara M. (1996). Before the Normans: Southern Italy in the Ninth and Tenth Centuries. Philadelphia: University of Pennsylvania Press. ISBN 978-0-8122-1587-8.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 349. ISBN 978-0-534-57168-9.
- Basil II (AD 976–1025) by Catherine Holmes. De Imperatoribus Romanis. 1 April 2003. Retrieved 22 March 2007.
- Gibbon, Edward (1906). "Chapter LXI" (Online version). In Bury, J.B. (ed.). The History of the Decline and Fall of the Roman Empire. Fred de Fau and Co.
- Mehmet II by Korkut Ozgen. Theottomans.org. Retrieved 3 April 2007.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 149. ISBN 978-0-534-57168-9.
- Abstract of The population of ancient Rome. by Glenn R. Storey. HighBeam Research. 1 December 1997. Retrieved 22 April 2007.
- The Population of Rome by Whitney J. Oates. Originally published in Classical Philology. Vol. 29, No. 2 (April 1934), pp. 101–116. Retrieved 22 April 2007.
- N.Morley, Metropolis and Hinterland (Cambridge, 1996) 174–83
- Gawande, Atul (2014). Being Mortal. London: Profile Books. p. 32. ISBN 9781846685828.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 46. ISBN 978-0-19-512332-6.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 146. ISBN 978-0-534-57168-9.
- Frank Frost Abbott, Society and Politics in Ancient Rome, BiblioBazaar, LLC, 2009, p. 41
- Lecture 13: A Brief Social History of the Roman Empire by Steven Kreis. 11 October 2006. Retrieved 2 April 2007.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 211. ISBN 978-0-19-512332-6.
- Werner, Paul (1978). Life in Rome in Ancient Times. Geneva: Editions Minerva S.A. p. 31.
- Duiker, William; Spielvogel, Jackson (2001). World History (Third ed.). Wadsworth. p. 143. ISBN 978-0-534-57168-9.
- Roman Education. Latin ExCET Preparation. Texas Classical Association, by Ginny Lindzey, September 1998. Retrieved 27 March 2007.
- Matyszak, Philip (2003). Chronicle of the Roman Republic. London: Thames & Hudson. pp. 16–42. ISBN 978-0-500-05121-4.
- Keegan, John (1993). A History of Warfare. New York: Alfred A. Knopf. pp. 263–264. ISBN 978-0-394-58801-8.
- Potter, David (2004). "The Roman Army and Navy". In Flower, Harriet I. (ed.). The Cambridge Companion to the Roman Republic. Cambridge: Cambridge University Press. pp. 67–70. ISBN 978-0-521-00390-2.
- For a discussion of hoplite tactics and their sociocultural setting, see Victor Davis Hanson, The Western Way of War: Infantry Battle in Classical Greece, Alfred A. Knopf (New York 1989) ISBN 0-394-57188-6.
- Goldsworthy, Adrian (1996). The Roman Army at War 100 BC–AD 00. Oxford: Oxford University Press. p. 33. ISBN 978-0-19-815057-2.
- Jo-Ann Shelton, ed., As the Romans Did: A Sourcebook in Roman Social History, Oxford University Press (New York 1998)ISBN 0-19-508974-X, pp. 245–249.
- Goldsworthy, Adrian (2003). The Complete Roman Army. London: Thames and Hudson, Ltd. pp. 22–24, 37–38. ISBN 978-0-500-05124-5.
- Goldsworthy, Adrian (2008). Caesar: Life of a Colossus. Yale University Press. pp. 384, 410–411, 425–427. ISBN 978-0300126891. Another important factor discussed by Goldsworthy was absence of legionaries on detached duty.
- Between 343 BC and 241 BC, the Roman army fought in every year but five. Oakley, Stephen P. (2004). "The Early Republic". In Flower, Harriet I. (ed.). The Cambridge Companion to the Roman Republic. Cambridge: Cambridge University Press. p. 27. ISBN 978-0-521-00390-2.
- P.A. Brunt, "Army and Land in the Roman Republic," in The Fall of the Roman Republic and Related Essays, Oxford University Press (Oxford 1988) ISBN 0-19-814849-6, p. 253; William V. Harris, War and Imperialism in Republican Rome 327–70 BC, Oxford University Press (Oxford 1979) ISBN 0-19-814866-6, p. 44.
- Keegan, John (1993). A History of Warfare. New York: Alfred A. Knopf. pp. 273–274. ISBN 978-0-394-58801-8.
- Brunt, pp. 259–265; Potter, pp. 80–83.
- Goldsworthy, Adrian (2008). Caesar: Life of a Colossus. Yale University Press. p. 391. ISBN 978-0300126891.
- Karl Christ, The Romans, University of California Press (Berkeley, 1984)ISBN 0-520-04566-1, pp. 74–76.
- Mackay, Christopher S. (2004). Ancient Rome: A Military and Political History. Cambridge: Cambridge University Press. pp. 249–250. ISBN 978-0-521-80918-4. Mackay points out that the number of legions grew to 30 by 125 AD and 33 during the Severan period (200–235 AD).
- Goldsworthy, Adrian (1996). The Roman Army at War 100 BC – AD 200. Oxford: Oxford University Press. pp. 36–37. ISBN 978-0-19-815057-2.
- Elton, Hugh (1996). Warfare in Roman Europe AD 350–425. Oxford: Oxford University Press. pp. 89–96. ISBN 978-0-19-815241-5.
- Brennan, Correy T. (2004). "Power and Process Under the Republican 'Constitution'". In Flower, Harriet I. (ed.). The Cambridge Companion to the Roman Republic. Cambridge: Cambridge University Press. pp. 66–68. ISBN 978-0-521-00390-2.
- Goldsworthy, Adrian (1996). The Roman Army at War 100 BC – AD 200. Oxford: Oxford University Press. pp. 121–125. ISBN 978-0-19-815057-2.
- Goldsworthy, Adrian (1996). The Roman Army at War 100 BC – AD 200. Oxford: Oxford University Press. p. 124. ISBN 978-0-19-815057-2.
- Mackay, Christopher S. (2004). Ancient Rome: A Military and Political History. Cambridge: Cambridge University Press. pp. 245–252. ISBN 978-0-521-80918-4.
- Mackay, Christopher S. (2004). Ancient Rome: A Military and Political History. Cambridge: Cambridge University Press. pp. 295–296. ISBN 978-0-521-80918-4.. Also chapters 23–24.
- D.B. Saddington (2011) . "the Evolution of the Roman Imperial Fleets," in Paul Erdkamp (ed), A Companion to the Roman Army, 201–217. Malden, Oxford, Chichester: Wiley-Blackwell. ISBN 978-1-4051-2153-8. Plate 12.2 on p. 204.
- Coarelli, Filippo (1987), I Santuari del Lazio in età repubblicana. NIS, Rome, pp. 35–84.
- This paragraph is based upon Potter, pp. 76–78.
- Elton, Hugh (1996). Warfare in Roman Europe AD 350–425. Oxford: Oxford University Press. pp. 99–101. ISBN 978-0-19-815241-5.
- Sabin, Philip; van Wees, Hans; Whitby, Michael, eds. (2007). The Cambridge History of Greek and Roman Warfare. Cambridge University Press. p. 231. ISBN 978-0521782746.
- Heseltine, John (2005). Roads to Rome. J. Paul Getty Museum. p. 11. ISBN 978-0711225527.
- Temin, Peter (2001). "A Market Economy in the Early Roman Empire". Abstract Archives. Economy History Services. Archived from the original on 15 June 2010.
- See "Masterpieces. Desiderius' Cross". Fondazione Brescia Musei. Retrieved 2 October 2016.. For a description of scholarly research on the Brescia Medallion, see Daniel Thomas Howells (2015). "A Catalogue of the Late Antique Gold Glass in the British Museum (PDF)." London: the British Museum (Arts and Humanities Research Council), p. 7. Accessed 2 October 2016. gold glass portrait (most likely by an Alexandrian Greek due to the Egyptian dialect of the inscription), dated 3rd century AD; Beckwith, John, Early Christian and Byzantine Art, Penguin History of Art (now Yale), 2nd edn. 1979, ISBN 0140560335, p. 25; Boardman, John ed., The Oxford History of Classical Art, 1993, OUP, ISBN 0198143869, pp. 338–340; Grig, Lucy, "Portraits, Pontiffs and the Christianization of Fourth-Century Rome", Papers of the British School at Rome, Vol. 72, (2004), pp. 203–230, JSTOR 40311081, p. 207; Jás Elsner (2007). "The Changing Nature of Roman Art and the Art Historical Problem of Style," in Eva R. Hoffman (ed), Late Antique and Medieval Art of the Medieval World, 11–18. Oxford, Malden & Carlton: Blackwell Publishing. ISBN 978-1-4051-2071-5, p. 17, Figure 1.3 on p. 18.
- Parkin, Tim, & Pomeroy, Arthur, Roman Social History, a Sourcebook, Routledge, 2007, pp. 72. ISBN 978-0-415-42675-6
- Boswell, John Eastburn, "Expositio and Oblatio: The Abandonment of Children and the Ancient and Medieval Family," American Historical Review, 89, 1984, p. 12
- Casson, Lionel (1998). Everyday Life in Ancient Rome. Baltimore: The Johns Hopkins University Press. pp. 10–11 24-32. ISBN 978-0-8018-5992-2.
- Family Values in Ancient Rome by Richard Saller. The University of Chicago Library Digital Collections: Fathom Archive. 2001. Visited 14 April 2007.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. pp. 339–340. ISBN 978-0-19-512332-6.
- Rawson, Beryl (1987). The Family in Ancient Rome: New Perspectives. Cornell University Press. p. 7. ISBN 978-0801494604.
- Frier, Bruce W., and McGinn, Thomas A.J. A Casebook on Roman Family Law, Oxford University Press: American Philological Association, 2004, p. 20
- Rawson, Beryl, "The Roman Family," in The Family in Ancient Rome: New Perspectives, Cornell University Press, 1986, pp. 30, 40–41.
- Galinsky, Karl, Augustan Culture: An Interpretive Introduction, Princeton University Press, 1998, pp. 130-132, ISBN 9780691058900
- Latin Online: Series Introduction by Winfred P. Lehmann and Jonathan Slocum. Linguistics Research Center. The University of Texas at Austin. 15 February 2007. Retrieved 1 April 2007.
- Calvert, J.B. (8 August 1999). "The Latin Alphabet". University of Denver. Archived from the original on 3 April 2007.
- Classical Latin Supplement. p. 2. Retrieved 2 April 2007.
- József Herman, Vulgar Latin, English translation 2000, pp. 109–114 ISBN 978-0271020013
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 203. ISBN 978-0-19-512332-6.
- Matyszak, Philip (2003). Chronicle of the Roman Republic. London: Thames & Hudson. p. 24. ISBN 978-0-500-05121-4.
- Edward Gibbon (1787). The history of the decline and fall of the Roman Empire. printed for J.J. Tourneisen. p. 91.
- The Encyclopedia Americana: A Library of Universal Knowledge. Encyclopedia Americana Corporation. 1919. p. 644.
- Willis, Roy (2000). World Mythology: The Illustrated Guide. Victoria: Ken Fin Books. pp. 166–168. ISBN 978-1-86458-089-1.
- Theodosius I (379–395 AD) by David Woods. De Imperatoribus Romanis. 2 February 1999. Retrieved 4 April 2007.
- Astore, William. "Bread and Circuses in Rome and America". Retrieved 11 August 2017.
- Annual Editions: Western Civilization. Vol. 1 (12 ed.). McGraw-Hill/Dushkin. 2002. p. 68.
... where compassion was regarded as a moral defect ...
- Jackson, Michael Anthony (2004). Look Back to Get Ahead: Life Lessons from History's Heroes. Arcade Publishing. p. 174. ISBN 9781559707275.
Gladatorial games were popular because the Romans actually believed that compassion was a vice and a weakness
- Harvey, Brian K., ed. (2016). Daily Life in Ancient Rome: A Sourcebook. Hackett Publishing Company. pp. 21–28. ISBN 9781585107964.
- Langlands, Rebecca (2006). Sexual Morality in Ancient Rome. Cambridge University Press. pp. 3–20. ISBN 9780521859431.
- Mathew Dillon and Lynda Garland (2005). Ancient Rome: From the Early Republic to the Assassination of Julius Caesar. Taylor & Francis, 2005. p. 382. ISBN 9780415224598.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. pp. 350–352. ISBN 978-0-19-512332-6.
- Roman Painting from Timeline of Art History. Department of Greek and Roman Art, The Metropolitan Museum of Art. 2004–10. Retrieved 22 April 2007.
- Donald Jay Grout; Claude V. Palisca (June 1988). A history of western music. Norton. ISBN 9780393956276. Retrieved 31 May 2012.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 89. ISBN 978-0-19-512332-6.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. pp. 349–350. ISBN 978-0-19-512332-6.
- Adkins, Lesley; Adkins, Roy (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. p. 300. ISBN 978-0-19-512332-6.
- Grant, Michael (2005). Cities of Vesuvius: Pompeii and Herculaneum. London: Phoenix Press. pp. 130–134. ISBN 978-1-898800-45-3.
- J. Carson Webster, The Labors of the Months in Antique and Mediaeval Art to the End of the Twelfth Century, Studies in the Humanities 4 (Northwestern University Press, 1938), p. 128. In the collections of the Hermitage Museum.
- Civitello, Linda (29 March 2011). Cuisine and Culture: A History of Food and People. John Wiley & Sons. ISBN 9780470403716.
- Phyllis Pray Bober, Art, Culture, and Cuisine: Ancient and Medieval Gastronomy, University of Chicago Press (2001), p. 188.
- Patrick Faas, Around the Roman Table: Food and Feasting in Ancient Rome, University of Chicago Press (2005), p. 209.
- Phyllis Pray Bober, Art, Culture, and Cuisine: Ancient and Medieval Gastronomy, University of Chicago Press (2001), p. 187.
- Julia F. Morton, Lemon in Fruits of Warm Climates, 1987 pp. 160–168|url=http://www.hort.purdue.edu/newcrop/morton/lemon.html#Description%7Cpublisher=Purdue University
- Maguelonne Toussaint-Samat, A History of Food, John Wiley & Sons (2009), p. 93.
- John E. Stambaugh, The Ancient Roman City, JHU Press (1988), p. 148.
- Artman, John:"Ancient Rome- Independent Learning Unit", page 26, Good Apple, 1991.
- Artman, John::"Ancient Rome- Independent Learning Unit", page 26, Good Apple,1991.
- Casson, Lionel (1998). Everyday Life in Ancient Rome. Baltimore: The Johns Hopkins University Press. pp. 98–108. ISBN 978-0-8018-5992-2.
- "Daily Life: Entertainment". SPQR Online. 1998. Archived from the original on 30 April 2007.
- Circus Maximus. Encyclopedia Romana. University of Chicago. Retrieved 19 April 2007.
- John Humphrey, Roman circuses: arenas for chariot racing, University of California Press, 1986, p. 216.
- Ancient Roman laws protected against a person corrupting slaves to obtain secrets about the master's arts. Zeidman, Bob (2011). The Software IP Detective's Handbook: : Measurement, Comparison, and Infringement Detection (1st ed.). Prentice Hall. p. 103. ISBN 978-0137035335.
- Nelson, Winter, Thomas (1 January 1979). "Roman Concrete: The Ascent, Summit, and Decline of an Art". Faculty Publications, Classics and Religious Studies Department.
- Choi, Charles Q. (4 December 2019). "Muddy Find Shows How Foreign Timber Helped Build Ancient Rome." InsideScience.org. Retrieved 22 May 2020.
- "Roman road system". Encyclopaedia Britannica. Encyclopaedia Britannica, Inc. Retrieved 19 August 2017.
- Keegan, John (1993). A History of Warfare. New York: Alfred A. Knopf. p. 303. ISBN 978-0-394-58801-8.
- Peck, Harry Thurston, ed. (1963). "Aquae Ductus". Harper's Dictionary of Classical Literature and Antiquities. New York: Cooper Square Publishers. pp. 104–106.
- Murray, Alexander Stuart; Mitchell, John Malcolm (1911). . In Chisholm, Hugh (ed.). Encyclopædia Britannica. Vol. 2 (11th ed.). Cambridge University Press. pp. 240–244.
- Roman Aqueducts and Water Supply by A.T. Hodge (1992)
- Grout, James. "Lead Poisoning and Rome". University of Chicago. Archived from the original on 22 July 2011. Retrieved 22 July 2011.
- "Ancient Rome". Smarthistory at Khan Academy. Retrieved 16 April 2013.
- Jacob Dorsey Forrest (1906). The development of western civilization: a study in ethical, economic and political evolution. The University of Chicago Press.
- William Cunningham (1900). An Essay on Western Civilization in Its Economic Aspects: Mediaeval and modern times. University Press. Retrieved 31 May 2012.
- Andrew Fleming West, Value of the classics. 1917. p. 185
- Kuno Fischer (1887). History of modern philosophy. C. Scribner's Sons. p. 85.
- Michael Burger (2008). The Shaping of Western Civilization: From Antiquity To the Enlightenment. University of Toronto Press. p. 203. ISBN 978-1-55111-432-3.
- Antonio et al. 2019, p. 1.
- Antonio et al. 2019, pp. 1–2.
- Antonio, Margaret L.; Gao, Ziyue; Moots, Hannah M.; Lucci, Michaela; Candilio, Francesca; et al. (2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
- Antonio et al. 2019, Table 2 Sample Information.
- Antonio et al. 2019, p. 4. "[C]ompared to Iron Age individuals, the Imperial population shares more alleles with early Bronze Age Jordanians... Notably, only 2 out of 48 Imperial-era individuals fall in the European cluster (C7) to which 8 out of 11 Iron Age individuals belong... [F]ew Imperial individuals (n = 2) have strong genetic affinities to western Mediterranean populations."
- Wade 2019, p. 673. "People from the city's earliest eras and from after the Western empire's decline in the fourth century C.E. genetically resembled other Western Europeans. But during the imperial period most sampled residents had Eastern Mediterranean or Middle Eastern ancestry... The study suggests the vast majority of immigrants to Rome came from the East. Of 48 individuals sampled from this period, only two showed strong genetic ties to Europe... Invading barbarians brought in more European ancestry. Rome gradually lost its strong genetic link to the Eastern Mediterranean and Middle East. By medieval times, city residents again genetically resembled European populations."
- Antonio et al. 2019, pp. 3–6.
- Saupe, Tina; Montinaro, Francesco; Scaggion, Cinzia; Carrara, Nicola; Kivisild, Toomas; D’Atanasio, Eugenia; Hui, Ruoyun; Solnik, Anu; Lebrasseur, Ophélie; Larson, Greger; Alessandri, Luca (21 June 2021). "Ancient genomes reveal structural shifts after the arrival of Steppe-related ancestry in the Italian Peninsula, Supplemental information Data S6A–S6D". Current Biology. 31 (12): 2576–2591.e12. doi:10.1016/j.cub.2021.04.022. ISSN 0960-9822. PMID 33974848. S2CID 234471370.
- Brinkmann, Vinzenz; Jan Stubbe Ostergaard (2008). The Color of Life: Polychromy in Sculpture from Antiquity to the Present. J. Paul Getty Museum, Marco Collareta, Alex Potts.
- Talbot, Margaret. "The Myth of Whiteness in Classical Sculpture". The New Yorker. Retrieved 12 May 2020.
- Winkler, Martin M. (2009). The Roman Salute: Cinema, History, Ideology. Columbus: Ohio State University Press. ISBN 978-0814208649.
- Fass, Patrick (1994). Around the Roman Table. University of Chicago Press. pp. 66–67. ISBN 978-0226233475.
- McKeown, J.C. (2010). A Cabinet of Roman Curiosities: Strange Tales and Surprising Facts from the World's Greatest Empire. Oxford University Press. pp. 153–54. ISBN 978-0195393750.
a. Ridley, R.T. (1986). "To Be Taken with a Pinch of Salt: The Destruction of Carthage". Classical Philology. 81 (2): 140–46. doi:10.1086/366973. JSTOR 269786. S2CID 161696751.: "a tradition in Roman history well known to most students"
b. Stevens, Susan T. (1988). "A Legend of the Destruction of Carthage". Classical Philology. 83 (1): 39–41. doi:10.1086/367078. JSTOR 269635. S2CID 161764925.
c. Visona, Paolo (1988). "Passing the Salt: On the Destruction of Carthage Again". Classical Philology. 83 (1): 41–42. doi:10.1086/367079. JSTOR 269636. S2CID 162289604.: "this story... had already gained widespread currency"
d. Warmington, B.H. (1988). "The Destruction of Carthage: A Retractatio". Classical Philology. 83 (4): 308–10. doi:10.1086/367123. JSTOR 269510. S2CID 162850949.: "the frequently repeated story"
- "Bad Medicine: Misconceptions and Misuses Revealed," by Christopher Wanjek, p. 5 (John Wiley & Sons, 2003)
- "...could not survive the trauma of a Caesarean" Oxford Classical Dictionary, Third Edition, "Childbirth"
a. Wessel, Susan (2004). Cyril of Alexandria and the Nestorian Controversy: The Making of a Saint and of a Heretic. Oxford, England: Oxford University Press. pp. 36–38. ISBN 978-0199268467.
b. Watts, Edward J. (2008). City and School in Late Antique Athens and Alexandria. Berkeley and Los Angeles, California: University of California Press. pp. 195–200. ISBN 978-0520258167.
- Theodore, Jonathan (2016). The Modern Cultural Myth of the Decline and Fall of the Roman Empire. Manchester, England: Palgrave, Macmillan. ISBN 978-1137569974.
- Plutarch, Parallel Lives, Life of Marius, XI, 5–7.
- The History of the Decline and Fall of the Roman Empire, 12 vols.
- Liukkonen, Petri. "Theodor Mommsen". Books and Writers (kirjasto.sci.fi). Finland: Kuusankoski Public Library. Archived from the original on 24 August 2014.
- see excerpt and text search
- Levick, Barbara (1993). Claudius. Yale University Press. ISBN 978-0300058314.
- see online edition
- Syme, Ronald (2002). The Roman Revolution. Oxford University Press. ISBN 978-0192803207.
- "Dr Adrian Goldsworthy, the historian and author". Adriangoldsworthy.com. Retrieved 12 March 2013.
- Adkins, Lesley; Roy Adkins (1998). Handbook to Life in Ancient Rome. Oxford: Oxford University Press. ISBN 978-0-19-512332-6.
- Antonio, Margaret L.; et al. (8 November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. American Association for the Advancement of Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
- Cary, M. (1967). A History of Rome Down to the Reign of Constantine (2nd ed.). New York: St. Martin's Press.
- Casson, Lionel (1998). Everyday Life in Ancient Rome. Baltimore: The Johns Hopkins University Press. ISBN 978-0-8018-5992-2.
- Dio, Cassius (January 2004). Dio's Rome, Volume V., Books 61–76 (AD 54–211). Retrieved 17 December 2006.
- Duiker, William; Jackson Spielvogel (2001). World History (Third ed.). Wadsworth. ISBN 978-0-534-57168-9.
- Durant, Will (1944). The Story of Civilization, Volume III: Caesar and Christ. Simon and Schuster, Inc.
- Elton, Hugh (1996). Warfare in Roman Europe AD 350–425. Oxford: Oxford University Press. ISBN 978-0-19-815241-5.
- Flower (editor), Harriet I. (2004). The Cambridge Companion to the Roman Republic. Cambridge: Cambridge University Press. ISBN 978-0-521-00390-2.
|last=has generic name (help)
- Edward Gibbon, The History of the Decline and Fall of the Roman Empire
- Goldsworthy, Adrian Keith (2008). Caesar: Life of a Colossus. Yale University Press
- Goldsworthy, Adrian Keith (1996). The Roman Army at War 100 BC – AD 200. Oxford: Oxford University Press. ISBN 978-0-19-815057-2.
- Goldsworthy, Adrian Keith (2003). The Complete Roman Army. London: Thames and Hudson, Ltd. ISBN 978-0-500-05124-5.
- Goldsworthy, Adrian (2006). The Fall of Carthage: The Punic Wars 265–146 BC. London: Phoenix. ISBN 978-0-304-36642-2.
- Grant, Michael (2005). Cities of Vesuvius: Pompeii and Herculaneum. London: Phoenix Press. ISBN 978-1-898800-45-3.
- Haywood, Richard (1971). The Ancient World. David McKay Company, Inc.
- Keegan, John (1993). A History of Warfare. New York: Alfred A. Knopf. ISBN 978-0-394-58801-8.
- Livy. The Rise of Rome, Books 1–5, translated from Latin by T.J. Luce, 1998. Oxford World's Classics. Oxford: Oxford University Press. ISBN 0-19-282296-9.
- Mackay, Christopher S. (2004). Ancient Rome: A Military and Political History. Cambridge: Cambridge University Press. ISBN 978-0-521-80918-4.
- Matyszak, Philip (2003). Chronicle of the Roman Republic. London: Thames & Hudson, Ltd. ISBN 978-0-500-05121-4.
- Miles, Richard (2011). Carthage Must be Destroyed. London: Penguin. ISBN 978-0-14-101809-6.
- O'Connell, Robert (1989). Of Arms and Men: A History of War, Weapons, and Aggression. Oxford: Oxford University Press. ISBN 978-0-19-505359-3.
- Scarre, Chris (September 1995). The Penguin Historical Atlas of Ancient Rome. Penguin Books. ISBN 978-0-14-051329-5.
- Scullard, H.H. (1982). From the Gracchi to Nero. (5th edition). Routledge. ISBN 978-0-415-02527-0.
- Ward-Perkins, John Bryan (1994). Roman Imperial Architecture. Yale University Press. ISBN 978-0-300-05292-3.
- Wade, Lizzie (8 November 2019). "Immigrants from the Middle East shaped Rome". Science. American Association for the Advancement of Science. 366 (6466): 673. Bibcode:2019Sci...366..673W. doi:10.1126/science.366.6466.673. PMID 31699914.
- Werner, Paul (1978). Life in Rome in Ancient Times. translated by David Macrae. Geneva: Editions Minerva S.A.
- Willis, Roy (2000). World Mythology: The Illustrated Guide. Collingwood, Victoria: Ken Fin Books. ISBN 978-1-86458-089-1.
- Coarelli, Filippo. Rome and environs: An archaeological guide. Berkeley: Univ. of California Press, 2007.
- Cornell, Tim J. The beginnings of Rome: Italy and Rome from the Bronze Age to the Punic Wars (c. 1000–264 BC). London: Routledge, 1995.
- Coulston, J. C, and Hazel Dodge, editors. Ancient Rome: The archaeology of the eternal city. Oxford: Oxford University School of Archaeology, 2000.
- Forsythe, Gary. A critical history of early Rome. Berkeley: University of California Press, 2005.
- Fox, Matthew. Roman historical myths: The regal period in Augustan literature. Oxford: Oxford University Press, 1996.
- Gabba, Emilio. Dionysius and the history of Archaic Rome. Berkeley: University of California Press, 1991.
- Holloway, R. Ross. The archaeology of early Rome and Latium. London: Routledge, 1994.
- Keaveney, Arthur. Rome and the unification of Italy. 2nd edition. Bristol: Bristol Phoenix, 2005.
- Kraus, Christina Shuttleworth, and A.J. Woodman. Latin historians. Oxford: Oxford University Press, 1997.
- Mitchell, Richard E. Patricians and plebeians: The origin of the Roman state. Ithaca: Cornell University Press, 1990.
- Potter, T.W. Roman Italy. Berkeley: University of California Press, 1987.
- Raaflaub, Kurt A., editors. Social struggles in Archaic Rome: New perspectives on the conflict of the orders. 2nd edition. Oxford: Blackwell, 2004.
- Rosenstein, Nathan S., and Robert Morstein-Marx, editors. A companion to the Roman Republic. Oxford: Blackwell, 2006.
- Scheidel, Walter, Richard P Saller, and Ian Morris. The Cambridge Economic History of the Greco-Roman World. Cambridge: Cambridge University Press, 2007.
- Smith, Christopher J. Early Rome and Latium: Economy and society c. 1000–500 BC. Oxford: Oxford University Press, 1996.
- Stewart, Roberta. Public office in early Rome: Ritual procedure and political practice. Ann Arbor: University of Michigan Press, 1998.
- Woolf, Greg. Rome: An Empire's Story. Oxford: Oxford University Press, 2012.
- Wyke, Maria. Projecting the Past: Ancient Rome, Cinema, and History. New York: Routledge, 1997.
|Wikimedia Commons has media related to Ancient Rome.|
|Library resources about |
- Ancient Rome resources for students from the Courtenay Middle School Library.
- History of ancient Rome OpenCourseWare from the University of Notre Dame providing free resources including lectures, discussion questions, assignments, and exams.
- Gallery of the Ancient Art: Ancient Rome
- Lacus Curtius
- Livius.Org Archived 1 July 2017 at the Wayback Machine
- United Nations of Roma Victrix (UNRV) History
- Water and Wastewater Systems in Imperial Rome
- Roman DNA project
|
<urn:uuid:ea833ccf-baef-475b-81fc-abb67816d979>
|
CC-MAIN-2023-50
|
https://knowledge.beaconny.net/wikipedia_en_all_maxi_2022-05/A/Ancient_Rome
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.943741 | 38,571 | 3.796875 | 4 |
Lambert School is a successful place of learning that depends on harmonious relationships: Children should attend school with openness and readiness for learning, supported and encouraged by their parents, and be educated by highly qualified, enthusiastic, positive, creative and dedicated teachers. This three way bond of parents, teachers, students and the community is the basis of being an effective school.
- Builds a sense of community, identity and belonging that provides a positive, safe environment for quality learning at all times.
- Is an inclusive school where respect for each other. Dignity and compassion are fostered.
- Encourages difference while not allowing individual rights to dominate the rights of others.
- Is primarily a place of learning while acknowledging other needs such as health, sense of wellbeing and acceptance.
- Teachers adopt pedagogy to suit the learning needs of the student and adapt where students find learning more difficult.
- Students who are deliberately and persistently negative, destructive or jeopardizing the learning and well-being of others will be asked to leave the school.
- Learning is stimulating, rewarding and challenging with appropriate support to meet high standards.
- Learning is relevant and focuses on the needs and aspirations of students.
- Educators structure the curriculum so that students apply their learning in real world/authentic contexts.
- Educators ensure that the curriculum incorporates rich and varied ways of making and communicating understanding.
Our aim is to provide Quality Teaching and Learning opportunities for all children to become successful learners, confident & creative individuals and active & informed citizens.
|
<urn:uuid:b8739829-9ec9-4dbb-b8f2-895826054ecb>
|
CC-MAIN-2023-50
|
https://lambertschool.tas.edu.au/credo/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.943526 | 315 | 3.265625 | 3 |
Now that school is back in session, frustrations are rising in Aspie students and the people who care for them. Many Aspie parents struggle with motivating an Aspie child who sees no purpose in doing school work on topics they do not care about. This is tough, especially if the parent cannot see the purpose either. After all, may parents are settled into a life that does not require the use of a wide array of the topics they covered in school, which becomes more obvious when a parent sits down to help their kid do homework but can’t remember how.
As an Aspie that struggled through many late, long nights of homework, I feel a need to reach out to Aspie parents with things I wished I knew when I was in school.
1) Education in America was originally designed to prepare people for the workforce.
All the way back to Colonial times, we can see a trend in education in America – Socialization. For example, in 17th century New England, children were expected to learn reading, writing and arithmetic from the family at home. Schools were established to practice these skills, understand the structure of society and to aid children in socialization. For children that were to go on to more cerebral jobs such as politics or banking, they would go on to Latin schools or elite private high schools. After the Revolutionary War, America understood the value of literacy as it was the use of written periodicals that helped America learn of the Boston Tea Party even before the news reached England. By the late 1800‘s. most states and free public schools making America one of the most literate countries in the world. Over time, schools evolved to provide a more well rounded education including lessons on culture and language. Pre-Industrial America saw education as a way of becoming and maintaining as a world power. More education equaled more wealth, setting us apart from the class warfare that had existed in England before America’s independence.
In the 1890’s through the 1930s, American tried to take on a new perspective. John Dewey led America to the ideas of Progressive Education. Dewey wanted schools to teach a wide array of topics to help children explore their potential. He did not want schools to just provide a necessary set of skills for the workplace, but to create learned members of society who could produce social change and reform for the greater good. However, school administrators were reluctant to the change forcing Dewey’s ideas to be isolated to only a few elite schools. As the Industrial Era rose, schools began to shape their programs to set children on tracks based on their potential that is measured early on in the child’s school career. Children suited for cerebral work were placed on a college bound track and children suited for the workforce as laborers were placed on a less academic track.
2) Education serves a different purpose today.
Today, most American’s remain split on what schools should provide. However, in a society that is much more technologically and internationally connected than those previous, education must be valued, even on topics we don’t think we will ever use. Today, we often hear of news from across the globe minutes after it happens. In one hour of television, we can take in a myriad of opinions and statements without any written proof that such information is even true. The internet, now available to American’s of all economic levels, can spread information to millions before it is ever verified as true. I remember, just a few years ago, an email circulated about margarine. The email swore in avid detail that margarine was horrible for the human body. What reason did they use to support this? The email stated that margarine was only one molecule away from being plastic. This email spread like wildfire, panicking families across the nation. Most American’s bought into this fact as valid and enough to justify an opposition to margarine.
Now, I’m not here to argue whether or not margarine is good for you, but I can argue that margarine being one molecule away from plastic is not a valid reason. Why? Because of high school chemistry. One molecule may not seem like a big difference, but in the chemical world, it is a huge difference. For example, H2O is a compound better known as water. It has two hydrogen molecules and one Oxygen molecule. If I add just one more oxygen molecule, I get H2O2, a compound better known as hydrogen peroxide. Would it make any sense to stop drinking water because it is one molecule away from being hydrogen peroxide?Even though I may not use chemistry in my daily work as a musician, learning chemistry in high school helped me make a more informed decision about my diet.
In the “what about me” America of today, education today may not be framed by the school to meet everyone’s individual needs. However, the more we learn on various topics, the better equipped we are to make sound, well founded decisions in many areas of our lives.
3) Lack of education historically has led to mass hysteria, slavery, and even the holocaust.
I can remember countless stories in history class, and even at home from my parents, where poor and even savage decisions were excused with “we just didn’t know any better.” Women were burned at the stake for “witch craft” because the general population didn’t understand science. Slavery was supported by misinterpreted passages from the bible and lack of scientific knowledge. Hitler supported the holocaust stating that Jews were inferior to Arians and holding Arians back from reaching their potential. All of this was accepted because information that could have disproved these misnomers were withheld from the people. Need more examples of entire societies being misled by their lack on knowledge on a topic? Try the McCarthy trials or the Jonestown suicide. What about delicate topics like autism being cause by mercury or stem cell research? Do those in favor or opposed to such topics really understand the science involved or do they just quote what they hear on television or from friends?
4) Homework is an exercise.
Homework is an exercise for the brain and for the work ethic. Let’s face it, most kids come home from school and yearn to spend their time on computer games or posting on Facebook. We don’t even need to single kids out on this one. How many of you adults are reading this at a time when you should be doing something else that needs to be done? As a matter of fact, you may have gotten a hold of this article via a share on Facebook. The point is that the ability to focus on topic we don’t like, or to maintain working when not being directly observed by an authority figure, are great assets. We tend to look at homework as a negative aspect of childhood that takes away from play, but why? If we change our perspective to see homework as a piece of growing up that is just as essential to childhood as play, then perhaps our kids would be more motivated to work efficiently.
Aspie’s need to be shown that homework is a exercise in education, education is a necessary component for expanding the nations comprehension of truth and the acceptance of people who are born different or oppressed. Integers and the periodic table could lead our future society to open minds and to understanding the truth about autism.
5) Laziness or lack of motivation is not autism, it’s an easy coping mechanism.
I will admit that I was one of those Aspie’s that HATED homework. I didn’t have someone give me the first 4 points I just made, so therefore I was seeing the world through my own tunnel. I came up with a long list of reasons why I couldn’t do things. In the world of autism, activities are either super easy, or ridiculously difficult. We do not see the middle ground. As we encounter activities that are too hard, we often use our Asperger’s as a way of not doing the work. After all, if we exhaust mom and dad, then we don’t have to do it. We Aspie’s are also magicians when it comes to constructing reasons why we shouldn’t have to do it, which, most of the time, sounds pretty good to parents.
The bottom line? DO NOT GIVE IN. My grandmother used to tell me “I can’t means I won’t.” We Aspie’s get so used to hearing about all the things we can’t do, that we often lose our self-esteem. We need guidance through tasks we find difficult and we need to hear “can’t means won’t.” Are there things we can’t do? Yes, but this does not mean we should throw what we won’t do onto the pile of what we can’t do.
6) How do I tell the difference between can’t and won’t?
As an Aspie, I often took my cues from observations of people close to me. I so desperately wanted to blend into the crowd so kids would stop being cruel to me. If my mom hated modern art, then I was to hate it too, after all that must be “normal.” Therefore, if my mom were to hate homework or public schools, then my difficulties must be the schools fault and not because I don’t want to do the work.
Mimicking is another coping strategy for Aspie kids who are unable to understand social cues and trends. As a parent, you might not be able to see can’t in a sea of “won’ts” because our mimicking disguises it. Yet, what if the parent were to change his or her perspective on homework? What if parents approached homework as happily and positively as we approach a favorite treat? As a parent, display a positive attitude towards homework and explain its purpose to the Aspie child as I did above. See a purpose in each assignment, and then observe your Aspie. Do some of the cleverly disguised “can’ts” disappear? After a few months of the positive homework approach, the things your Aspie really can’t do should start to be distinguishable from what they won’t do.
7) Learn what autism really is.
The most common educational impact I hear about from parents in their Aspie is “executive functioning skills.” Did you know that executive function is a theory and that its exact role is hypothesized? Did you know there are several models and that psychologists do not agree on one in particular? Did you know that these cognitive functions are theorized to change during the various stages of human development?
As a parent faced with an overwhelming amount of re-interpreted information on autism, it is easy for us to accept what seems like a reasonable cause for an action in an Aspie child that otherwise cannot be explained. Before you accept such causes, be sure to gain satisfactory in-depth explanations from your psychologist. Ask questions, and lots of them, until you have a clear understanding of the proposed problem. Take time to learn the terminology associated with autism and perhaps even take a basic psychology course at a community college or online. After all, your child will have autism forever, so it is best to learn what you are dealing with in as much detail as possible. Many parents tell me they can’t understand the psychology or neurology behind autism. Is it they can’t or they won’t? After all, who wants to spend hours researching something they will never use in their personal life, right?
8) Don’t get the wrong idea.
I am not pushing parents to force Aspie kids to do things they are just not capable of doing. On the contrary, what I am asking parents to do is to carefully assess what their kids can’t do because they are probably more capable than you think. Dr. Temple Grandin was never supposed to speak and is now a professor because her mom carefully assessed and fought for Dr. Grandin’s right to try. Be the parent that helps us Aspie’s see our potential and how autism fuels us, not hinders us. Then when we are faced with the things we truly cannot do, we will have the resources to work around them and the education to build our futures.
|
<urn:uuid:89d67f51-5c51-4112-8630-c548cb9aa4e1>
|
CC-MAIN-2023-50
|
https://lauranadine.com/what-i-wish-i-knew-as-a-student-with-aspergers-about-homework-and-education/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.973671 | 2,579 | 2.84375 | 3 |
Breasts are a defining characteristic of the female form and are often associated with femininity, sexuality, and motherhood. However, many women are curious about why their breasts are the size they are. Breast size is influenced by a combination of factors, including genetics, hormones, age, and lifestyle.
Genetics plays a significant role in determining breast size. The amount of breast tissue a woman has is largely determined by her genes. Just as individuals inherit traits like eye color, hair color, and height from their parents, they also inherit genes that influence breast size. The distribution of fat in the breasts is also influenced by genetics, and this can affect the shape and overall appearance of the breasts.
Hormones are another key factor in breast size. Estrogen and progesterone, female hormones produced by the ovaries, play a critical role in breast development. During puberty, estrogen levels increase, leading to breast tissue growth and development. Hormonal changes during the menstrual cycle and pregnancy can also cause fluctuations in breast size.
Age is another factor that can affect breast size. As women age, their hormone levels decline, which can cause breast tissue to shrink and sag. This can lead to a decrease in breast size or a change in breast shape. The effects of gravity and skin elasticity also play a role in breast size as women get older.
Lifestyle factors, such as weight, diet, and exercise, can also influence breast size. Excessive weight gain or weight loss can cause fluctuations in breast size. A healthy diet and regular exercise can help maintain breast tissue health and shape.
It's essential to remember that breast size does not define a woman's beauty, femininity, or sexual attractiveness. Every woman's breasts are unique and beautiful in their way, regardless of their size. Women should focus on embracing and loving their bodies, regardless of their breast size. It's important to prioritize breast health by getting regular check-ups and maintaining a healthy lifestyle, regardless of breast size.
In conclusion, the size of a woman's breasts is determined by a combination of genetic, hormonal, age-related, and lifestyle factors. Every woman's breasts are unique and beautiful, regardless of their size. Women should focus on embracing and loving their bodies, prioritizing breast health, and recognizing that breast size does not define their worth or beauty. Show your boobs some love and support!
|
<urn:uuid:97c7afb2-972e-411c-813c-9f385bd7c896>
|
CC-MAIN-2023-50
|
https://lemonkini.com/blogs/news/why-your-breasts-are-the-size-that-they-are
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.965443 | 482 | 3.171875 | 3 |
Copyright infringement is a legal offense and is punishable under federal law. It involves the unauthorized use or distribution of someone else's creative work, which can include writings, songs, video clips, movies, visual art or other creative works. Taking a copyrighted work and making changes to it creates a “derivative work,” which would not be considered a unique work and also would not provide you with full copyright ownership. Exceptions included in the Canadian Copyright Act allow for limited copying of others’ works for specified purposes.
The University of Saskatchewan (USask) is committed to compliance in all copyright matters. The USask Use of Materials Protected by Copyright policy states that it is the responsibility of each individual to comply with copyright laws and respect copyright ownership and licensing. Honesty and integrity are expected of every student, and academic and/or non-academic misconduct penalties may apply in a case of copyright infringement.
Plagiarism is a breach of academic integrity, which includes use of someone else's work without providing proper attribution and passing it off as your own. Plagiarism does not necessarily include copyright infringement, although it can be used as the basis to charge someone with copyright infringement. For example, even though copying one sentence from a short story or article is legal under copyright law, it may still qualify as plagiarism if the source has not been adequately cited.
Honesty and integrity are expected of every student, and academic and/or non-academic misconduct penalties may apply in a case of plagiarism or copyright infringement.
|
<urn:uuid:4d29b4b3-4dd1-43d7-8f33-ad9ebb39481d>
|
CC-MAIN-2023-50
|
https://library.usask.ca/copyright/students/plagiarism-and-infringement.php
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.952653 | 314 | 2.5625 | 3 |
Time-lapse videos first intrigued me as a child when I watched a little seed grow into a beautiful flower in a matter of seconds. Now, illuminating time-lapse videos and tools are helping genealogists visualize our changing world.
Last month, animator Max Galka published a time-lapse map of the history of urbanization over nearly 6,000 years in just three minutes.
Mr. Galka mentions on his blog that tracking urbanization occuring before the mid-20th century was a difficult task – until recently. A team of Yale researchers published a collection of urban population data dating back to ancient times which helped Galka create his video. Their collection was quoted to be a “clean, accessible dataset of cities, their locations, and their populations over time.”
I was surprised how quickly things changed and found it amazing still how many places in the world are yet to be “urbanized.”
Time-lapse Video Covering Immigration to the U.S. Since 1820
Again, Max Galka presented an amazing animation of immigration to the United States. This creation shows the countries that sent the most people to the U.S. since 1820.
The U.S. is a nation of immigrants, says Galka. As each dot flies across the page, it represents 10,000 people who immigrated to the U.S. In the bottom left corner, Mr. Galka lists the three top countries where immigrants are coming from at any given time. I was stunned as the map lit up in Russia and Africa only fairly recently. It is clearly shown that the U.S. is indeed a nation of immigrants in this colorful time-lapse video.
Time-lapse Tools for Genealogy
As a genealogist, I am constantly in search of county records. So many times, county lines or boundaries changed. I even have one family that lived on the same farm, but technically resided in three different counties over a period of about 50 years. We can’t possibly know when each county of any given state was formed or created, until now that is.
One of my favorite tools for discovering county changes over time is the Map of US.org website. You can find a map of each of the 50 states and run the interactive formation sequence. For example, I can find the Ohio map.
The Ohio map begins in 1788. It indicates the one county in the Northwest Territory (today’s Ohio) at that time. Washington County was formed as the original county of the Northwest Territory and was created from part of Illinois County, Virginia. That’s another reason I love these interactive maps. With the creation of each county, the map indicates from which parent county or counties it was formed. This is a great help for genealogy research. When I can’t find my targeted ancestor in the county I thought they should be in, I can determine when the county was formed and from what parent county or counties it was formed from. Then, I can quickly determine the other locations that may have records I need.
In addition to the interactive time-lapse maps, each state has a list of other helpful maps that may be of interest to you. For example, the map links for Oregon include the Historical Maps of Oregon, a set of beautiful old maps that can be viewed or downloaded.
Maps can give us a bigger picture of our county, our state, our country, and even the world. These tools help us picture our ever-changing world. What impacted you the most while watching these videos? We would love to hear from you in the comments below!
If you feel inspired to learn more about map visualization, you will enjoy Lisa’s Google Earth video. Lisa was an early pioneer of genealogical data visualization and has been teaching genealogists how to use the free software for the last several years. You can watch the free Google Earth for Genealogy video here or check out her revised and updated e-book, The Genealogist’s Google Toolbox 2nd Editionto learn even more tips and tricks for Google genealogy research.
If you may fit the description of a “genealogy hoarder,” you should read this letter from Roland. He shares a powerful story about being generous with our genealogical treasures. (P.S. Sharing family history items can also help you declutter your genealogy files!) I...
Feeling frustrated by changing technology? Here’s a look back at a post I originally wrote in 2013 that addresses the mayhem tech changes can cause, and how a visit to a fast food restaurant changed my perspective on a particularly rough day.
The “Mayhem” commercials from Allstate are a riot, but of course all that mayhem isn’t all that funny when it’s happening to you.
Allstate Raccoon Mayhem Commercial
Sometimes it feels like technology companies are having a little mayhem fun with us when they get us up and running with their software program, or app, or phone, or tablet, or whatever, and then *BAM* they change it all up. Mayhem!
It’s not really that we don’t want new technology, it’s just that:
1. We sometimes get very little if any warning that it’s coming
2. The change requires investing time in learning all new ways to do something.
3. The change seems to be suspiciously benefiting the changer and not us – the “changee.”
4. We have to shift out of auto pilot into manual drive
…which means it takes longer to do tasks, and we tend to make mistakes more often because our brain, our eyes, and our fingers are all trained to quickly complete the task the old way.
I’m usually pretty excited about new technology and I love seeing what it can do for our genealogy efforts, but don’t think that I don’t have my moments when I just want to run screaming into the street and chuck my laptop in the gutter. We all have our moments. And I’m here to tell you that I feel your pain and have suffered myself, some mayhem this week, in fact, I call it:
See, the thing is, folks love their smart phones. Walt Mossberg,principal technology columnist for The Wall Street Journal just tweeted that according to an Experian marketing survey the average America spends an hour a day with his or her smartphone. And iPhone users spend more time than Android users.
Google, and specifically YouTube which they own, has definitely taken notice of all this smart phone savvy-ness, and they’ve decided to turn my world, and all the other YouTube Channel publisher’s worlds out there upside down.
I launched my YouTube channel way back in the stone-age, 2007, before Google even owned YouTube. And I have over 60 videos on the channel, and we’ve been diligently working on getting prepared for a while new phase of video production here at Genealogy Gems. So I have had my hands quite full on the video front.
YouTube has implemented a total redesign of YouTube channel pages. The goal is to make the channels mobile friendly, while still accommodating the wide range of full size computer screens that are out there. But in order to accomplish this, we as channel publishers have to scramble and get new artwork for our banner, produce a new introduction video and rearrange the video layout.
So how did I respond to this change you ask?
I ignored it, of course, until I had about a week left before they were set to flip the switch. And then this week all of a sudden it was an emergency to get my channel ready.
So I finally broke down and hired someone to create the new artwork, then I spent hours one morning trying to get all the changes made. My frustration level was growing a little because I just wasn’t happy with how the design of the new artwork was fitting the new layout. And there were so many other things I wanted and needed to be doing that week.
Then my sweet neighbor came to the door and my dogs, who think every knock on the door is a masked marauder, went totally ballistic, blasting through the room knocking over my morning coffee on their way to the door. So now I had coffee all over the carpet.
After my neighbor left I got the portable steam cleaner out to clean up the coffee stained carpet and it worked for a total of 45 seconds, then dribbled to nothing. So I went to the kitchen and set it on the counter to look at it and when I took the nozzle off it dribbled dirty water all over my freshly cleaned kitchen floor.
I spent the next two hours cleaning the kitchen floor, fixing the steam cleaner nozzle, and cleaning my carpet. And my YouTube channel was still not quite right, and I wasn’t sure how to fix it. Panic started to set in. All of a sudden I feared I would never figure it out, or get it done, and on top of that I was getting further behind on everything else I needed to do.
When my husband got home we went out for fast food because I hadn’t had a chance to do a thing about preparing dinner. So he listened to my day as we go through the line, and then I went to get my soda and I set my tray on the counter by the soda machine. Unfortunately I didn’t notice that the counter top was about six inches shorter than the tray, and my tray of shanghai beef and cream cheese won tons unceremoniously hit the floor.
At this point I was feeling pretty sorry for myself and pretty sure it was all YouTube’s fault.
Then, a woman my age came into the restaurant with her daughter and husband. She sat and waited while they ordered the food because she was in a wheel chair. And needless to say my perspective made a big course correction.
Maybe I don’t really know what frustration can be. And…get ready for it…maybe I over-reacted all day long.
She smiled at me and I smiled back and then I got to thinking back on my day. And I realized it’s so often not the change itself that causes the mayhem, but it’s our knee jerk response of fear to it.
If you have ever found yourself gritting your teeth as the next big technological roll out happens, or sometimes worse yet, the closing of a favorite tool like iGoogle or the Google News Timeline, here are some things to keep in mind:
First: Stay Calm and Carry On
Just like the famous saying from World War II Britain, we are much more effective in difficult times when we take a breath and stay calm, and then we continue moving forward to the best of our ability at our pace.
Often times it’s our lack of calm that causes us not carry on as usual, and in the end, brings more trouble down on our own heads.
The older I get the more I can see how human beings bring a lot of stuff on themselves. I didn’t start picking away at the new artwork and design until the last week before the change implementation because I was focusing on how they shouldn’t be changing it. And yea, that kind of thinking wasn’t hurting anyone but myself, because YouTube wasn’t about to call a halt to it because some channels didn’t like the idea.
And simple things, like I knew better than to set my coffee where I did, but I was so freaked out about the YouTube design I carelessly set it at dog level. And it was just silly to pull the nozzle off the steam cleaner over a clean floor rather than over the sink.
Second: The Technology Folks Probably Have a Good Reason for the Change
Sometimes it’s a financially driven change; they just can’t make it sustainable as is. And I would much rather see an inconvenient change than a complete disappearance of a Google or an Ancestry.
And sometimes it’s because the technology folks do have their eye on the future, and they see the big picture of how you and other users use your technology today. In the end the change will meet a pressing need, and they are striving to stay ahead of the game so we aren’t moaning down the road. YouTube’s change is a great example of that. They’ve made the case that a large percentage of users watch video from mobile devices and they challenged us as channel publishers to check our own analytics. And you know what, they’re right! I wasn’t keeping an eye on that but YouTube was.
Third: A Little Investment in Education can Go a Long Way
It’s OK if you have to slow down for a little while and spend some time getting re-educated. I decided to sign up for an online class YouTube offered channel publishers and in the first hour or so I came to better understand how my channel was going to benefit. And understanding the benefits will give you the motivation to take on the change.
I know, it’s hard to imagine that you can find even more time on education. But as I’ve said before on my Genealogy Gems Podcast, I think as genealogists we need to actually be budgeting a certain amount of time for education. Don’t leave it to be squeezed in in a panic. Allocate 10% of your research time for reading and education, and another 10% on staying organized, and I guarantee you remaining 80% will be much more productive!
The truth is, if my YouTube channel doesn’t look perfect yet, I trust that you guys will still be watching, and it certainly won’t stop me from publishing new videos.
And it’s sort of funny that this has been on my mind so much this week and I’ve been personally facing the YouTube change here at Genealogy Gems, because I just had the opportunity to sit in on a conference call with Ancestry.com where they provided a behind the scenes look at some of the changes they are working on for the upcoming months. Listen to Genealogy Gems Podcast episode 156 to hear the details.
After all I struggled with and all I learned from it last week, I found myself being much more open to the Ancestry changes. I was more focused on spotting the benefits to the genealogist, and I found myself admiring their commitment to continuous improvement. See the thing is, whether you are an individual genealogist or a big company like Ancestry, if you aren’t striving for continuous improvement you will fall behind, and the work will become more difficult because you are working harder than you have to.
Behind the Scenes at the Antiques Roadshow. And what you should and should not include in your family tree.
Genealogy Gems Podcast listeners who are blogging about their genealogy!
Hear how one man’s passion for geography and history were saved from destruction, and find out what a portable scanner can do for your genealogy research and mobility.
Get ready to get organized! We’re going to talk about how to digitize, organize and archive your family history with Denise Levenick.
Blast from the Past: Episodes 5 and 6. Gems: YouTube, Bring Back Sites from the Dead, Spice Up Your Genealogy Database, Cast a Shadow on Your Ancestors, US GenWeb
Episode 146 In this episode we discuss the latest genealogy news, one listener’s fabulous use of Google Alerts, and Maureen Taylor’s new history film project.
Jump on the sleigh and make the rounds with me to friends of the podcast. We’ll making surprise stops at listener’s homes, drinking hot cocoa with long time friends of the show and genealogy experts, visiting with the newest member to the Genealogy Gems team, and my Grandson Davy will even make a guest starring appearance!
Genealogy Quick Gems: New RootsMagic App, 5 reasons you need the new YouTube app for family history, new digitized records online, sound preservation, Ancestry search tips video, and more.
A Blast from the Past: Episodes 7 and 8. Civil War Research and the Civil War Soldiers and Sailors System Website, A Swedish-American genealogy podcast, The Great San Francisco Earthquake of 1906, and Shake Up Your Family History research strategies!
Episode 150 Lisa celebrates her 50th birthday and the 150th episode with 50 Fabulous Family History Favorites!
Part 2 of 50 Fabulous Family History Favorites.
Highlights from Who Do You Think You Are? Live 2013 in London including an interview with Dr. Turi King who confirmed the identity of the remains of King Richard III through DNA
Enjoy a blast from the past with episode #10 featuring Steve Morse and his One-Step website. Then delight in Darius Gray, a genealogist and storyteller who provides tips on sharing your family history stories with your family, (recorded at #RootsTech 2013.)
Travel back to #RootsTech – You’ll hear 10 Top Tips for How to Bust Through Your Genealogy Brick Wall, and get the scoop on the new partnership between OCLC / WorldCat and FamilySearch.
Catching Up on Everything Genealogy, and WikiTree Update
What to do when technological changes create mayhem in your life. Also, get a sneak peek at new changes coming in Ancestry search, and women in naturalization records.
Episode 157 Blast from the Past: First up is Genealogy Gems Episode #11, first published May 07, 2007, (How to Find Pictures from the Past with Google.com, and a Family History Decoupage Plate Project) and Episode #12 (Top 10 Tips for Finding the Graduation Gems in Your Family History.)
Exclusive interview with Allie Orton, Producer of the U.S. TV series Who Do You Think You Are? Also in this episode: the new Genealogy Gems Windows 8 App, Update on Fold3, OCLC and FamilySearch partnership, and British Research Resources.
Come along as we solve a family history mystery with high-tech and low-tech tools, discuss how to begin African-American research, explore newly available Canadian records, and contemplate the value of work as well as the values we want to pass on to our kids and grandkids.
In this episode you will meet other listeners who are getting the word out about their family history through blogging as well as give you some genealogy blogging pointers,and I will introduce you to my first “Favorite Genealogy Gems.”
Package Includes: How to Find Your Family History in Newspapers (paperback, retail $24.95) and the digital PDF ebook of the book for FREE! (emailed to the address you provide within 24 hours of payment.)
U.S. Shipping & Handling for paperback book: $2.95
Please email us for assistance or if you have questions. Hurry! Offer expires March 10, 2014
Save 20% off of a 1 year Genealogy Gems Premium Membership
(Retail $29.95) Coupon Code: SAVE20
and for a limited time get the bonus ebook gift: Lisa Louise Cooke’s 84 Best Tips, Tricks and Tools buy medication in spain from Family Tree Magazine Click Here to become a Member
Exclusive over 100 Premium Podcast Episodes, and over a dozen videos of some of Lisa’s most popular classes including:
Sign up for the free Genealogy Gems email newsletter:
Enter your email in the box in the column on the right and receive the free e-book: 5 Fabulous Google Search Strategies for the Family Historian by Lisa Louise Cooke
|
<urn:uuid:0aae54a2-715d-4879-899d-c35a75598560>
|
CC-MAIN-2023-50
|
https://lisalouisecooke.com/search/Google+Search/page/104/www.whowhere.com/page/158/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.945905 | 4,118 | 3.296875 | 3 |
Looking for new activities in the Elmhurst area to inspire your child outside of school?
Three words: Robotics for Kids!
Robotics for Kids uses fun, hands-on projects to get your child’s creative juices flowing. Your child will learn how to build and program robots with LEGO® bricks and software — all while making friends, developing new skills and having a great time with STEM. For many kids, robotics class is a highlight of their week.
We have several kids’ robotics programs available to fully engage and challenge your aspiring engineer, computer programmer or scientist. First timer? No problem! Your child is welcome at our center in Rego Park. He or she can jump into Robotics 101 or Robotics 201 without any prior experience.
How we teach kids robotics each week
In each Robotics for Kids class at Sylvan of Rego Park, your child and a buddy work together to plan and build a new robot using LEGO® bricks, letting their creativity and imaginations loose. Along the way, they learn science and engineering concepts, such as how pulleys, levers and motors work.
As the kids’ robots take shape, they experiment with LEGO® Education’s award-winning WeDo™ software. They discover how to apply computer programming concepts and find new ways to get their “bot” moving.
Then, the energy levels (and smiles) really reach a high point, as the kids challenge other teams to friendly games or take part in imaginative play.
At the end of each robotics class, your child enjoys a wrap-up activity to reinforce the STEM skills he or she learned in class. (You’ll hear all about it on the way home.)
|
<urn:uuid:6de40b54-10e8-4989-aebc-8989c803834c>
|
CC-MAIN-2023-50
|
https://locations.sylvanlearning.com/us/rego-park-ny/robotics-for-kids
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.918885 | 348 | 3.078125 | 3 |
Called the mountain kingdom, Lesotho is the only country in the world situated entirely at elevations above 5,000 feet. It is an enclave, a small island floating within South Africa, its more developed neighbor. Although its rocky perch isolates the nation in many ways, in at least one sense, Lesotho is not alone: Like far too many countries, it struggles to provide its people with access to health care.
“On the day we arrived to survey the clinic site,” says Jennifer Furin ’99, an HMS assistant professor of medicine, “there were at least 25 people waiting. Yet there was no physician or nurse. So the Ministry of Health doctor and I sat down and began seeing patients. I think at least five people would have died that day had we not been there.”
The clinic Furin describes can be reached only by airplane, usually a single-engine Cessna that begins its flight at Moshoeshoe military airfield in Maseru, Lesotho’s bustling capital, and ends it an hour later in the mountain village of Nohana. Medical teams that arrive on the unpaved airstrip must carry their bags and crates of supplies on the 20-minute trek to the clinic.
“It’s no exaggeration to say the clinics are remote,” says Furin, the former medical director for the Partners In Health (PIH) program in Lesotho. “It’s like being on another planet. There’s no electricity and no cell phone coverage. It’s like being transported back in time—not to a good time but to a time when life was very hard.”
According to a 2006 report by the World Health Organization, a global shortage of 4.3 million health workers has translated into a lack of access to care for more than a billion people. In addition, the UN Millennium Project estimates that 2 billion people, a third of the world’s population, lack access to essential medicines. In the poorest parts of Africa and Asia, that proportion climbs to half.
Lesotho is one of 57 countries considered by WHO to have a critical health worker shortage: There are, for instance, only about 80 physicians to care for 2 million people. In addition, nearly one quarter of the population is thought to be positive for HIV, ranking this nation third highest in HIV prevalence globally, according to the U.S. Agency for International Development. And Lesotho’s HIV epidemic permeates every corner, rural and urban, of the country. Says Furin, “Shepherds and subsistence farmers living in the countryside have the same rate of HIV infection found among people living in the capital.”
Lesotho also has one of the world’s highest rates of tuberculosis infection, with a majority of those infected also testing positive for HIV. To complicate matters further, nearly 1,000 people each year contract strains of tuberculosis that are resistant to all first-line drugs.
Salmaan Keshavjee, a tuberculosis specialist and an assistant professor of social medicine in the School’s Department of Global Health and Social Medicine, is no stranger to jumping on a plane to provide care to people in remote settings. “Where I work in Western Siberia,” he says, “there are parts of the region that remain unreachable by ground transportation for months each year.”
When Keshavjee joined Furin in Lesotho in 2006, the government had already set up seven clinics in isolated parts of the country and had partnered with a nonprofit group of pilots affiliated with Lesotho’s health service to deliver supplies to mountain clinics and to airlift the gravely ill to facilities better equipped to care for them. But the infrastructure needed to provide adequate, consistent health care, especially to severely ill patients in the most remote areas, was nonexistent.
Keshavjee found, for example, that the Nohana clinic had no full-time staff, and that there was no capacity for either speedy or sustained care of patients who were infected with HIV and multidrug-resistant tuberculosis.
Lawrence Shulman ’75, chief medical officer and senior vice president for medical affairs at Dana–Farber Cancer Institute, confronted similar difficulties during his travels to provide cancer care to remote populations in Haiti and Rwanda.
“There is little infrastructure in Haiti or Rwanda to provide cancer care,” says Shulman. “There are no trained oncologists, and there is little capacity to perform a biopsy. Without a biopsy, processed and read, you can’t know a patient’s definitive diagnosis. And without that diagnosis, you have no hope of successfully treating a patient.”
Shulman and colleagues at Dana–Farber, Brigham and Women’s Hospital, and Children’s Hospital Boston are working with PIH to build cancer care infrastructure in Haiti, Rwanda, and Malawi.
Shulman recently headed up a team of ten Dana–Farber oncologists and oncology nurses that will help run the first national cancer-care training program in Rwanda. The team will share basic knowledge in cancer care and, through remote connections with Boston-based colleagues, will establish ties to improve the delivery of cancer care in that country. Technology is playing a major role in this project, as it does for similar efforts aimed at improving access to health care.
“Paul Farmer, as only he could do, took a picture with his iPhone of a blood smear from a patient with leukemia and sent the picture to me,” says Shulman. Farmer ’90, the Kolokotrones University Professor of Global Health and Social Medicine, heads the School’s Department of Global Health and Social Medicine. “The quality wasn’t very good,” Shulman adds, “but we were able to make the diagnosis and begin treatment. There are, of course, better ways to do this sort of thing, and we’re in the process of trying to figure them out.”
Keshavjee too is searching for better ways of using technology to deliver care to populations in remote areas. He describes the work of a female colleague in Pakistan who is developing simple strategies to monitor wound infections and other “visible” conditions. She hopes, for instance, to help keep post-operative patients free of infection by monitoring the status of surgical wounds through photos taken with mobile phones and then shared with wound specialists who help assess the healing process.
“It’s very expensive for poor patients to visit a doctor for a surgical wound check,” says Keshavjee. “But if you train health workers to take pictures of the wounds and then send those pictures to a doctor, many patients whose wounds are healing well could be saved the expense of a trip. If, however, the wound shows redness or the patient reports pain, the picture could be directed to a surgeon who could decide whether the person should travel to see a doctor.”
When faced with basic problems such as how to share medical records with other clinics or with the main office in Maseru, the Lesotho PIH team began using technology creatively. By installing an array of battery-backed solar panels, they provided the clinic with consistent power and communications access without expensive infrastructure, such as the signal transmission towers required by cell phones. They also arranged for access to two small communications satellites, links that allowed personnel in remote clinics to email the main office with requests for medications or supplies. Clinic administrators were also able to communicate better with the patient airlift service to schedule flights or to provide pilots with weather updates. In short, these uses of technology allowed clinic personnel to serve their patients better.
What does the future hold? Keshavjee thinks the solution to improving access is to develop community-based, decentralized approaches that use technology tailored to help optimize care. And he sees this as a solution for all countries, not only developing nations.
Medical telecommuting would allow experts to consult on questions raised by health care workers traveling within rural or remote populations, says Keshavjee. And those populations could be in mountain clinics, or in inner cities. “In Boston,” he notes, “you see many people who are diabetic or who have high blood pressure. Often, they don’t see a doctor until they are hospitalized because of stroke or some other emergency.”
A combination of community-based health workers and advanced technology would be an alternative to hospital-centric care, one that could achieve better health outcomes, especially for long-term disease management among people living in poor urban and rural areas.
“What if we could give diabetic patients cell phones with an app that allows them to enter their blood sugar values?,” asks Keshavjee. “A computer could flag patients whose glucose levels were off, a physician could evaluate those cases and, as needed, have a nurse call or a community health worker visit.” This approach, he adds, would not only be more effective, it could also save money by helping people avoid hospital stays and the repercussions of untreated disease.
“How can we link patients with care that can help them?” asks Keshavjee. “We can start by imagining all the ways technology can make distances smaller—and medical care more accessible.”
|
<urn:uuid:e5e60a7d-f94b-4685-8ea6-6061b621e9b2>
|
CC-MAIN-2023-50
|
https://magazine.hms.harvard.edu/articles/wing-and-prayer
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.962069 | 1,954 | 2.859375 | 3 |
Malaria and urbanization in sub-Saharan Africa
Malaria Journal volume 4, Article number: 12 (2005)
There are already 40 cities in Africa with over 1 million inhabitants and the United Nations Environmental Programme estimates that by 2025 over 800 million people will live in urban areas. Recognizing that malaria control can improve the health of the vulnerable and remove a major obstacle to their economic development, the Malaria Knowledge Programme of the Liverpool School of Tropical Medicine and the Systemwide Initiative on Malaria and Agriculture convened a multi-sectoral technical consultation on urban malaria in Pretoria, South Africa from 2nd to 4th December, 2004. The aim of the meeting was to identify strategies for the assessment and control of urban malaria. This commentary reflects the discussions held during the meeting and aims to inform researchers and policy makers of the potential for containing and reversing the emerging problem of urban malaria.
Africa's population will almost triple by the year 2050. This expansion will occur primarily in urban areas and by 2025, 800 million people will live in urban communities. Especially affected will be West Africa, where the urban population annual growth rate of 6.3% is more than twice the rate of the total population growth. Today in the humid forest zone, more people live in cities than in rural areas and in twenty years time, two out of three West Africans will live in urban centres. While many of Africa's health problems are common to both urban and rural environments, recognizing and meeting the public health challenges in these growing cities is becoming increasingly urgent. Malaria has been considered a predominantly rural disease in Africa, primarily because suitable vector breeding sites are scarce in highly populated areas. Yet, although studies have shown that Anopheles mosquito breeding decreases with increasing proximity to the centre of urban areas [1–3], transmission of malaria still occurs. Clearly, the complex factors contributing to malaria risk in urban areas are not fully understood but evidence is rapidly accumulating that the urban poor are at far higher risk from malaria than previously acknowledged [4, 5].
The Malaria Knowledge Programme of the Liverpool School of Tropical Medicine and the International Water Management Institute/ Systemwide Initiative on Malaria and Agriculture convened a meeting in Pretoria 2nd-4th December 2004 to develop an evidence-based approach for evaluating and controlling urban malaria. Participants were drawn from seven sub-Saharan countries, Europe, North America and South Asia (see additional file). Recognizing the need for extensive cross-sectoral involvement and collaboration in dealing with the challenge of urban malaria, representatives from the research/ academic, NGO, development, policy-making and donor communities co-operated in the process to identify key knowledge gaps and opportunities for control. Included in the group were sociologists, clinical epidemiologists, entomologists and control specialists.
Identifying the populations at risk in urban areas
Urbanization is a recent phenomenon in Africa: in 1960 there were no African cities with one million inhabitants, today there are forty. Has malaria become a serious problem within these huge cities and their peri-urban environs? Data presented from studies in a number of sub-Saharan African cities (Brazzavile, Congo; Dakar, Senegal; Abidjan, Cote d'Ivoire; Cotonou, Benin; Ouagadougou, Burkina Faso; Dar es Salaam, Tanzania, and Accra and Kumasi, Ghana) showed clearly that malaria is a considerable urban health problem in Africa. The studies demonstrated great heterogeneities in malariometric indices both between and within cities. It was recognized that not only the major cities of Africa, but also many medium sized regional towns, home to a large proportion of the Africa population, have considerable levels of malaria . With malaria risk unevenly distributed across urban environments, interventions must be preceded by the identification and prioritization of the most vulnerable. Vulnerability is not simply the result of low socio-economic status , although this is often a major contributory factor, but reflects factors beyond the individual level such as the proximity of the household to sites of urban agriculture or environmental/cultural factors working at the community level. Discussion focussed on research to define this risk, to improve access to correct diagnosis and appropriate treatment and effective preventative measures, and to identify accurate monitoring and evaluation tools tailored to the urban context.
Prioritizing improved diagnosis and treatment for the vulnerable
Misdiagnosis of malaria is a serious problem everywhere, but in areas of low malaria endemicity presumptive treatment of all fevers as malaria can result in over 75% of cases being misdiagnosed as malaria . The effect of malaria misdiagnosis on the vulnerable will result in more ill health due to delayed diagnosis and repeat visits, overburdened health services, more severe malaria, loss of faith in health services, increase in real and perceived malaria resistance, chronic disease secondary to untreated infection, increased cost to patient and to health facilities and consistent misdiagnosis that will encourage detrimental health-seeking behaviour .
Effective provision of appropriate treatment also remains a serious challenge in urban settings. The Abuja Declaration stated that by 2005 "At least 60% of those suffering from malaria have prompt access to and are able to use correct, affordable and appropriate treatment within 24 hours of onset of symptoms." Despite the fact that access to quality health care is better on average in urban compared to rural zones, the formal public health facilities are often the last source of treatment used along the pathway to cure. Often malaria care initially involves leftover medicines from the home (from previously incomplete malaria or other treatment regimes), the purchase of cheaper herbal medicines or unprescribed conventional medicines. The problems of obtaining treatment from a health facility may be exacerbated by the need to obtain permission from an authority figure, absence from work and loss of income, the need to raise money to fund both the treatment and associated costs such as travel . As a result, in Africa over 70% of malaria episodes in rural and over 50% in urban areas are self-diagnosed and self-treated . With Home Management of Malaria proposed as an integral part of the Roll Back Malaria strategy, the consequences of presumptive treatment policies for malaria in the context of the introduction of newer and more expensive anti-malarial drug combinations urgently require further investigation .
Ensuring malaria prevention measures reach the vulnerable
The highly focal nature of urban malaria requires targeting of interventions to specific urban districts, and therefore, requires detailed information on each area in advance. However, relationships between administrative boundaries, environment and population distribution are complex in urban areas, which makes them difficult to sample and characterize in a representative way. Strategies for population-representative sampling must incorporate a range of environments and populations to identify accurately environmental and other risk factors. This may be further complicated as urban populations can be highly mobile and in peri-urban areas there may be a high rate of turnover in groups of lower socio-economic status. Presentations from South, East and West Africa clearly demonstrated that Geographic Information Systems (GIS)-based approaches are valuable tools for assessing heterogeneities in risk factors for urban malaria, and for subsequent implementation and monitoring of interventions.
Experienced researchers believe that the urban environment has advantages for the effective delivery of appropriate interventions. A number of studies have demonstrated that higher rates of coverage with insecticide-treated bednets can be achieved in urban areas [10, 11], although whether or not the most vulnerable groups benefit, remains to be confirmed. Moreover, there is a growing realization within the commercial sector of the need to engage in health and broader social issues. The management of malaria can bring economic benefits to both businesses and the communities in which they operate. This has been powerfully demonstrated in two public-private partnership programmes in southern Africa that utilised indoor residual spraying to control malaria [12, 13].
Larval control, achieved either by source reduction or larviciding, can be community directed and may be feasible in certain settings as part of a comprehensive, integrated vector management strategy. There is optimism in some communities about its efficacy and the results of further research into the costs and benefits of such interventions are awaited with interest. Environmental modifications may also be feasible if partners from the community and outside the health sector are engaged. Work from Sri Lanka has demonstrated how a very effective scheme to control malaria by modification of irrigation structures was accepted by the agricultural community because of the financial and water savings that the scheme introduced . However, it was clear that obvious benefits from the intervention must exist to attract the involvement of non-health sectors.
The conclusions of the meeting have been summarised in the Pretoria Statement on Urban Malaria (Figure 1). While it is clear that urban malaria represents a major challenge for public health in Africa, the statement highlights that the unique nature of the urban environment provides an opportunity for malaria control. There are a number of reasons for this: the high population density in urban areas may facilitate increased coverage and impact of both interventions and health education programmes; the activities of departments in urban municipal authorities are typically better resourced and more easily mobilized than in rural areas; the extensive private health sector found in urban settings can be engaged to improve diagnosis, treatment and prevention of malaria. Solutions to the urban malaria problem must include groups from outside the health sector. The disease burden in the most vulnerable communities is a major obstacle to the economic growth of sub-Saharan countries and the challenge is to engage stakeholders at all levels in effective and sustainable intersectoral collaboration . Urban malaria is uniquely amenable to prevention and control as the existing health, urban planning, agricultural and governance structures present opportunities for collaborative approaches that can include both the community and the substantial private sector.
Coene J: Malaria in urban and rural Kinshasa: the entomological input. Med Vet Entomol. 1993, 7: 127-37.
Warren M, Billig P, Bendahmane DB, Wijeyaratne P: Malaria in urban and peri – urban areas in sub -Sahara Africa. EHP activity report 71. 1999, [http://www.ehproject.org]
Robert V, Macintyre K, Keating J, Trape JF, Duchemin JB, Warren M, Beier JC: Malaria transmission in urban sub-Saharan Africa. Am J Trop Med Hyg. 2003, 68: 169-76.
Klinkenberg E, McCall PJ, Hastings IM, Wilson MD, Amerasinghe FP, Donnelly MJ: High malaria prevalence and irrigated urban agriculture in Accra, Ghana [abstract]. Am J Trop Med Hyg. 2004, 9-suppl 4
Keiser J, Utzinger J, de Castro MC, Smith TA, Tanner M, Singer BH: Urbanization in sub-saharan Africa and implication for malaria control. Am J Trop Med Hyg. 2004, 118-127. suppl 2
Bates I, Fenton C, Gruber J, Lalloo D, Lara AM, Squire SB, Theobald S, Thomson R, Tolhurst R: Vulnerability to malaria, tuberculosis, and HIV/AIDS infection and disease. Part 1: determinants operating at individual and household level. Lancet Infect Dis. 2004, 4: 267-277. 10.1016/S1473-3099(04)01002-3.
Amexo M, Tolhurst R, Barnish G, Bates I: Malaria misdiagnosis: effects on the poor and vulnerable. Lancet. 2004, 364: 1896-1898. 10.1016/S0140-6736(04)17446-1.
McCombie SC: Treatment seeking for malaria: a review of recent research. Soc Sci Med. 1996, 43: 933-945. 10.1016/0277-9536(95)00446-7.
D'Alessandro U, Talisuna A, Boelaert M: Should artemisinin-based combination treatment be used in the home-based management of malaria?. Trop Med Int Health. 2005, 10: 1-2. 10.1111/j.1365-3156.2004.01375.x.
Feilden RM: Experiences of implementation. in Net Gain: A New Method for Preventing Malaria Deaths. Edited by: Lengeler C, Cattani J, de Savigny D. 1996, IDRC
Holtz TH, Marum LH, Mkandala C, Chizani N, Roberts JM, Macheso A, Parise ME, Kachur SP: Insecticide-treated bednet use, anaemia, and malaria parasitaemia in Blantyre District, Malawi. Trop Med Int Health. 2002, 7: 220-230. 10.1046/j.1365-3156.2002.00846.x.
Conteh L, Sharp BL, Streat E, Barreto A, Konar S: The cost and cost-effectiveness of malaria vector control by residual insecticide house-spraying in southern Mozambique: a rural and urban analysis. Trop Med Int Health. 2004, 9: 125-132. 10.1046/j.1365-3156.2003.01150.x.
Sharp B, van Wyk P, Sikasote JB, Banda P, Kleinschmidt I: Malaria control by residual insecticide spraying in Chingola and Chililabombwe, Copperbelt Province, Zambia. Trop Med Int Health. 2002, 7: 732-736. 10.1046/j.1365-3156.2002.00928.x.
Konradsen F, Matsuno Y, Amerasinghe FP, Amerasinghe PH, van der Hoek W: Anopheles culicifacies breeding in Sri Lanka and options for control through water management. Acta Trop. 1998, 71: 131-138. 10.1016/S0001-706X(98)00060-6.
Macroeconomics and Health: Investing in Health for Economic Development. 2001, WHO, Geneva
We acknowledge the contribution of all workshop participants. The workshop was funded by the DfID-funded Malaria Knowledge Programme of the Liverpool School of Tropical Medicine, the Environmental Health Project (USAID) and the International Development Research Centre (Canada). However, The Department for International Development of the UK government can accept no responsibility for any information or views expressed herein and the content of the commentary is solely the responsibility of the authors.
All authors participated as session chairs in the technical workshop and were instrumental in producing the summary conclusions. All authors read and approved the final manuscript.
Electronic supplementary material
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
About this article
Cite this article
Donnelly, M.J., McCall, P., Lengeler, C. et al. Malaria and urbanization in sub-Saharan Africa. Malar J 4, 12 (2005). https://doi.org/10.1186/1475-2875-4-12
|
<urn:uuid:f1b323a6-3ff7-446a-8d0c-377373ee7f18>
|
CC-MAIN-2023-50
|
https://malariajournal.biomedcentral.com/articles/10.1186/1475-2875-4-12
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.899928 | 3,106 | 2.921875 | 3 |
The Indigenous worldview differs from a Western worldview, some of the differences influence the way we live in the world. One difference in the concept of time, time in a Western context is lineal. This is not the case for many Indigenous People as well as many other cultures worldwide. So what is it about time that differs so much? This short presentation will touch on how time from an Indigenous perspective can influence the ability to contribute to climate change scenarios and forward planning predictions.
When: Nov 25, from 3:15-4:45 pm
Where: CSIRO Auditorium, nipaluna/Hobart
Mibu Fischer is a Noonucal, Ngugi and Goenpul woman from Quandamooka Country in southeast Queensland, she is also a marine ethnoecologist with CSIROs Oceans & Atmosphere Business Unit. She is interested in understanding the impacts of climate change to Indigenous communities and ways in which these communities can be empowered to not only participate but lead decision making processes and adaptation strategies on Country.
|
<urn:uuid:a97bae79-a9b5-44d8-a8f9-f18770bc87c7>
|
CC-MAIN-2023-50
|
https://marinesocioecology.org/Events/cms-seminar-the-concept-of-time-and-language-from-an-indigenous-worldview-and-impacts-to-participation-in-research-by-mibu-fischer/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.927817 | 211 | 3.0625 | 3 |
The concept of smart communities is gaining significant traction in today’s digital age. These communities are built on advanced technologies and innovative solutions that enhance the quality of life for residents and promote sustainable development. Smart communities leverage the power of information and communication technologies (ICT) to create intelligent infrastructure, efficient services, and engaged citizen participation. With the rise of smart cities, the smart communities market is witnessing rapid growth and transformation.
Smart communities refer to urban areas that utilize technology, data, and connectivity to optimize various aspects of daily life. These communities leverage a wide range of technologies, including the Internet of Things (IoT), artificial intelligence (AI), cloud computing, and big data analytics, to improve the efficiency of public services, enhance sustainability, and create a better living environment. Smart communities focus on areas such as transportation, energy management, waste management, healthcare, education, safety, and governance.
|UNIT||Value (USD Million/Billion)|
The smart communities market is experiencing robust growth due to the increasing demand for sustainable and efficient urban infrastructure. Rapid urbanization, coupled with the need for resource optimization and improved quality of life, is driving the adoption of smart community solutions. Governments and organizations are investing heavily in smart city initiatives, which in turn fuel the growth of the smart communities market. The market is characterized by the presence of various stakeholders, including technology providers, government bodies, service providers, and community residents.
Key Market Insights
The smart communities market is poised for substantial growth in the coming years. Key market insights include:
- Rapid urbanization: The global urban population is increasing at an unprecedented rate, necessitating the development of smart communities to address the challenges associated with urbanization.
- Technological advancements: The evolution of advanced technologies, such as IoT, AI, and cloud computing, has enabled the development of smart community solutions that improve the quality of life for residents.
- Sustainable development: Smart communities focus on sustainability by optimizing resource utilization, reducing carbon footprint, and promoting renewable energy sources.
- Government initiatives: Governments across the world are launching smart city initiatives and providing funding and policy support to drive the adoption of smart community solutions.
The smart communities market is driven by several factors that contribute to its growth and expansion. Key market drivers include:
- Increasing urbanization: The world is witnessing rapid urbanization, with a significant proportion of the population residing in urban areas. This drives the need for efficient infrastructure and services, which can be achieved through smart community solutions.
- Rising demand for sustainable solutions: The growing awareness about environmental issues and the need for sustainable development is pushing governments and organizations to invest in smart community solutions that promote energy efficiency, waste management, and sustainable transportation.
- Technological advancements: The continuous advancements in technology, such as IoT, AI, and data analytics, enable the development of smart community solutions that can optimize resource utilization and improve service delivery.
- Government initiatives and funding: Governments around the world are actively promoting smart city initiatives and providing financial support and incentives to encourage the adoption of smart community solutions.
Despite the promising growth prospects, the smart communities market faces certain challenges that act as restraints. Key market restraints include:
- High implementation costs: The deployment of smart community infrastructure and technologies involves significant upfront costs, which can pose a challenge, especially for developing regions with limited financial resources.
- Security and privacy concerns: The increased reliance on technology and data sharing in smart communities raises concerns about data security and privacy. Protecting sensitive information and ensuring cybersecurity is crucial for the successful implementation of smart community solutions.
- Interoperability and integration challenges: Integrating various systems and technologies in smart communities can be complex, especially when different stakeholders and service providers are involved. Interoperability issues need to be addressed to ensure seamless communication and functionality.
- Lack of awareness and technical expertise: The successful implementation of smart community solutions requires a skilled workforce and awareness among community residents. In some regions, there may be a lack of technical expertise and awareness, which can hinder the adoption of smart community initiatives.
The smart communities market presents several opportunities for industry participants and stakeholders. Key market opportunities include:
- Collaboration and partnerships: Collaborative efforts between technology providers, government bodies, and service providers can unlock new opportunities and drive innovation in the smart communities market.
- Emerging markets: Developing regions with a growing urban population offer immense potential for the adoption of smart community solutions. These markets present opportunities for technology providers to offer tailored solutions and address specific challenges.
- Data-driven decision-making: The vast amount of data generated in smart communities provides an opportunity for data analytics and insights. By leveraging data, stakeholders can make informed decisions, improve service delivery, and optimize resource allocation.
- Citizen engagement and empowerment: Smart communities aim to engage citizens and empower them to actively participate in decision-making processes. This presents an opportunity for technology providers to develop user-friendly applications and platforms that facilitate citizen participation and enhance the overall community experience.
The smart communities market is characterized by dynamic factors that influence its growth and development. Key market dynamics include:
- Technological advancements: Rapid advancements in technologies such as IoT, AI, and cloud computing continue to shape the smart communities market. These technologies enable the development of innovative solutions that enhance the efficiency and sustainability of urban environments.
- Government regulations and policies: Government regulations and policies play a crucial role in driving the adoption of smart community solutions. Supportive policies, funding initiatives, and regulatory frameworks encourage stakeholders to invest in and implement smart community projects.
- Shift towards sustainable development: The global focus on sustainable development is driving the demand for smart community solutions that optimize resource utilization, reduce energy consumption, and promote sustainable practices.
- Changing consumer expectations: As technology becomes more pervasive, consumers expect a higher level of connectivity, convenience, and personalized services. Smart communities cater to these expectations by providing integrated and user-centric solutions.
The smart communities market exhibits regional variations in terms of adoption and growth. Regional analysis helps identify market trends and opportunities in specific geographic areas. Key regional insights include:
- North America: North America leads the smart communities market, driven by strong government support, advanced infrastructure, and high technology adoption rates. The United States and Canada are at the forefront of smart community initiatives, with several cities implementing innovative solutions.
- Europe: European countries are actively investing in smart city projects, making the region a significant player in the smart communities market. Initiatives such as the European Green Deal and smart city grants promote the adoption of sustainable and intelligent solutions.
- Asia Pacific: The Asia Pacific region presents substantial growth opportunities for the smart communities market due to rapid urbanization and increasing government initiatives. Countries such as China, Japan, and Singapore are investing heavily in smart city projects to address urban challenges and improve quality of life.
- Latin America: Latin American countries are embracing smart community solutions to overcome infrastructure challenges and enhance service delivery. Brazil, Mexico, and Colombia are witnessing increased investments in smart city projects, driven by government initiatives and private sector partnerships.
- Middle East and Africa: The Middle East and Africa region is witnessing significant growth in the smart communities market, driven by the need for sustainable infrastructure and efficient public services. Countries such as the United Arab Emirates and South Africa are leading the adoption of smart community solutions.
The smart communities market is highly competitive, with the presence of numerous players offering a wide range of solutions and services. Key players in the market include:
- IBM Corporation
- Cisco Systems, Inc.
- Siemens AG
- Schneider Electric SE
- Microsoft Corporation
- Oracle Corporation
- General Electric Company
- Honeywell International Inc.
- Huawei Technologies Co., Ltd.
- Amazon Web Services, Inc.
These companies compete based on their technological expertise, product portfolio, pricing, and partnerships. Strategic collaborations and acquisitions are common in the market as companies aim to expand their market share and offer comprehensive smart community solutions.
The smart communities market can be segmented based on various factors such as technology, application, and region. Common segmentation criteria include:
- By Technology:
- Internet of Things (IoT)
- Artificial Intelligence (AI)
- Cloud Computing
- Big Data Analytics
- By Application:
- Energy Management
- Waste Management
- Safety and Security
- By Region:
- North America
- Asia Pacific
- Latin America
- Middle East and Africa
Segmentation allows for a detailed analysis of specific market segments, enabling stakeholders to identify growth opportunities and tailor their strategies accordingly.
Smart communities encompass various categories, each offering unique insights and opportunities. Key category-wise insights include:
- Smart transportation solutions focus on optimizing traffic flow, reducing congestion, and enhancing public transportation systems through real-time data analytics and intelligent routing algorithms.
- Energy Management:
- Smart energy management solutions aim to optimize energy consumption, promote renewable energy sources, and enable grid management through smart meters, demand response systems, and energy monitoring devices.
- Waste Management:
- Smart waste management solutions leverage IoT and data analytics to optimize waste collection routes, reduce landfill waste, and promote recycling and composting.
- Smart healthcare solutions improve healthcare delivery through telemedicine, remote patient monitoring, electronic health records, and data-driven insights for preventive care.
- Smart education initiatives focus on digitizing classrooms, providing e-learning platforms, and leveraging technology to enhance teaching methods and student engagement.
- Safety and Security:
- Smart safety and security solutions encompass video surveillance, smart locks, emergency response systems, and predictive analytics to ensure the safety of residents and enhance emergency preparedness.
- Smart governance initiatives aim to improve public services, citizen engagement, and decision-making processes through e-governance platforms, open data initiatives, and participatory budgeting.
Understanding the specific insights and opportunities within each category enables stakeholders to align their strategies and investments accordingly.
Key Benefits for Industry Participants and Stakeholders
The smart communities market offers several benefits for industry participants and stakeholders. Key benefits include:
- Improved quality of life: Smart community solutions enhance the overall quality of life for residents by providing efficient public services, promoting sustainability, and enabling citizen engagement.
- Resource optimization: Smart communities optimize resource utilization, leading to reduced energy consumption, improved waste management, and more efficient transportation systems.
- Enhanced sustainability: By promoting renewable energy sources, sustainable practices, and eco-friendly initiatives, smart communities contribute to a more sustainable future.
- Economic growth: Smart community projects stimulate economic growth by attracting investments, creating job opportunities, and fostering innovation and entrepreneurship.
- Data-driven decision-making: Smart community solutions generate vast amounts of data that can be leveraged for informed decision-making, policy formulation, and service improvement.
- Improved safety and security: Smart safety and security solutions enhance public safety, emergency response times, and crime prevention through advanced surveillance systems and data analytics.
- Citizen empowerment: Smart communities empower citizens by providing platforms for active participation, collaboration, and transparent governance processes.
A SWOT (Strengths, Weaknesses, Opportunities, and Threats) analysis provides an overview of the internal and external factors influencing the smart communities market.
- Technological advancements and innovation
- Government support and funding
- Growing awareness and demand for sustainable solutions
- Strong collaboration among stakeholders
- High implementation costs
- Security and privacy concerns
- Interoperability challenges
- Lack of awareness and technical expertise
- Emerging markets and untapped potential
- Data-driven decision-making and insights
- Collaboration and partnerships
- Citizen engagement and empowerment
- Cybersecurity risks
- Regulatory and legal challenges
- Competition from established and emerging players
- Economic and political uncertainties
Understanding the internal strengths and weaknesses, as well as external opportunities and threats, helps stakeholders devise effective strategies and mitigate potential risks.
Market Key Trends
The smart communities market is influenced by several key trends that shape its growth and development. Key market trends include:
- Integration of technologies: Smart communities are increasingly integrating multiple technologies such as IoT, AI, cloud computing, and data analytics to create comprehensive and interconnected solutions.
- Focus on sustainability: The emphasis on sustainable development is driving the adoption of smart community solutions that promote energy efficiency, renewable energy, waste reduction, and green infrastructure.
- Data-driven decision-making: The proliferation of data in smart communities enables stakeholders to make informed decisions, optimize resource allocation, and improve service delivery based on data-driven insights.
- Citizen-centric approach: Smart communities are placing greater emphasis on citizen engagement, empowerment, and participation in decision-making processes. The focus is on creating user-centric solutions that cater to the needs and preferences of residents.
- Embracing mobility solutions: Smart communities are leveraging mobility solutions such as smart transportation, ride-sharing, electric vehicles, and bike-sharing to enhance connectivity, reduce traffic congestion, and promote sustainable transportation options.
- Emphasis on resilience and disaster management: Smart communities are incorporating resilience measures and disaster management systems to mitigate the impact of natural disasters, improve emergency response, and ensure the safety of residents.
The Covid-19 pandemic has had a significant impact on the smart communities market. The crisis highlighted the importance of technology and connectivity in addressing public health challenges and ensuring the resilience of communities. The key Covid-19 impact on the smart communities market includes:
- Accelerated digital transformation: The pandemic accelerated the adoption of digital technologies and solutions in various sectors, including healthcare, education, and governance. Remote working, telemedicine, online learning, and e-governance became essential in maintaining essential services.
- Increased focus on health and safety: The pandemic emphasized the importance of health and safety measures in communities. Smart community solutions, such as contactless technologies, temperature monitoring, and crowd management systems, gained prominence in ensuring public safety.
- Enhanced communication and connectivity: The need for efficient communication and connectivity became evident during the pandemic. Smart community solutions enabled remote communication, virtual meetings, and digital collaboration, ensuring continuity in service delivery and decision-making processes.
- Resilience and emergency response: The pandemic highlighted the importance of resilience and emergency preparedness in communities. Smart community solutions that aid in early detection, monitoring, and rapid response to crises gained significance.
- Economic challenges and funding constraints: The economic impact of the pandemic posed challenges in terms of funding and investments in smart community projects. Governments and organizations faced budgetary constraints, affecting the pace of implementation and expansion of smart community initiatives.
Key Industry Developments
The smart communities market has witnessed several key industry developments that shape its trajectory. Notable developments include:
- Government initiatives and policies: Governments worldwide have launched various smart city and smart community initiatives, providing funding, policy support, and regulatory frameworks to encourage adoption and implementation.
- Technological advancements: The continuous evolution and advancements in technologies such as IoT, AI, cloud computing, and data analytics have facilitated the development of more sophisticated and comprehensive smart community solutions.
- Strategic partnerships and collaborations: Companies in the smart communities market are forming strategic partnerships and collaborations to leverage complementary strengths, enhance product offerings, and expand market reach.
- Innovation and start-ups: The market has witnessed a surge in start-ups and innovation in the smart communities space. These companies are bringing disruptive solutions, new business models, and novel approaches to address urban challenges.
- International standards and interoperability: Efforts are being made to establish international standards and interoperability frameworks to ensure seamless integration and communication between various smart community systems and technologies.
Based on the market trends and developments, analysts suggest the following strategies for industry participants and stakeholders in the smart communities market:
- Collaboration and partnerships: Foster collaboration among technology providers, government bodies, service providers, and community residents to drive innovation, share best practices, and create comprehensive smart community solutions.
- Focus on user experience: Develop user-friendly applications, platforms, and services that prioritize ease of use and cater to the needs and preferences of community residents.
- Embrace sustainability: Incorporate sustainable practices, renewable energy sources, and eco-friendly initiatives in smart community solutions to align with the global focus on sustainability.
- Address security and privacy concerns: Invest in robust cybersecurity measures and ensure data protection and privacy to build trust among residents and stakeholders.
- Promote awareness and education: Educate community residents and stakeholders about the benefits and opportunities of smart communities, fostering greater acceptance and participation.
The future of the smart communities market looks promising, with continued growth and expansion anticipated. Key factors shaping the future outlook include:
- Increasing urbanization: The global urban population is projected to continue growing, driving the demand for smart community solutions to address urban challenges and enhance quality of life.
- Technological advancements: Ongoing technological advancements will unlock new opportunities and enable the development of more sophisticated and interconnected smart community solutions.
- Focus on sustainability: The emphasis on sustainability and the need for resource optimization will drive the adoption of smart community solutions that promote energy efficiency, waste reduction, and sustainable practices.
- Data-driven insights: The proliferation of data in smart communities will enable stakeholders to gain valuable insights, optimize resource allocation, and improve decision-making processes.
- Policy support and funding: Governments worldwide will continue to support smart city and smart community initiatives through policy frameworks, funding, and regulatory support.
- Citizen engagement and empowerment: The trend towards citizen-centric smart communities will intensify, with greater focus on citizen engagement, participation, and empowerment.
- Global collaborations: Cross-border collaborations and knowledge sharing will accelerate the development and implementation of smart community solutions, with international standards and interoperability frameworks playing a crucial role.
The smart communities market is witnessing significant growth and transformation, driven by factors such as rapid urbanization, technological advancements, sustainability needs, and government initiatives. The market offers numerous opportunities for industry participants and stakeholders, with the potential to improve quality of life, optimize resource utilization, and promote sustainable development. However, challenges such as high implementation costs, security concerns, and interoperability issues need to be addressed. By adopting collaborative approaches, focusing on user experience, and embracing sustainability, stakeholders can unlock the full potential of smart communities and create a better future for urban environments worldwide.
|
<urn:uuid:595b961d-87ca-4493-8323-5dae28c730cd>
|
CC-MAIN-2023-50
|
https://markwideresearch.com/smart-communities-market/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.900888 | 3,723 | 2.921875 | 3 |
- Conditions We Treat
- Treatment Options
Attention-deficit disorder or ADD ranks first as the most common behavioral diagnosis for children ages two to 11. Children diagnosed with ADHD are not only labeled but often placed on medications that can bring on a range of unwanted side effects. What if, in some cases, ADHD wasn’t the cause of a child’s behavior issues? What if an unidentified vision problem lies at the root of your child’s attention and behavior difficulties?
Learning-related vision problems and ADD bring on similar symptoms, so it may be worth taking a second look at your child’s diagnosis. Here an Annapolis, MD optometrist talks about how functional vision problems can interfere with your child’s behavior and ability to focus.
When a child starts to have problems in the classroom, a ripple effect, of sorts, can start to take shape. Frustration at not being able to grasp what’s being taught, feeling embarrassed, and even emotional distress often result when learning difficulties go untreated. ADD or attention-deficit disorder encompasses emotional, cognitive, and behavioral issues that interfere with your child’s ability to focus. However, functional vision problems can make focusing on tasks difficult, too.
Unlike nearsightedness, farsightedness, and astigmatisms, functional vision impairments have to do with how your child’s eyes work together to relay information to the brain. Since classroom environments rely heavily on visual aids to convey information to students, your child’s ability to receive and process visual information plays a central role in his ability to learn.
Tasks involving reading, writing, and even math, require your eyes to work as a team to receive information and send it to the brain. With learning-related or functional vision problems, the two eyes don’t move naturally inwards towards the nose. This makes it difficult to focus on near tasks, like tracking words across a page.
Children with learning-related vision difficulties tend to exhibit certain symptoms that indicate they’re struggling with near tasks, such as:
Each of the above symptoms can make it difficult for your child to learn. For these reasons, children who have attention-related problems in the classroom should receive a developmental vision evaluation before a behavior-based diagnosis, like ADD, is considered.
Once functional vision problems are eliminated, your child’s focus, attention, and even behavior can improve. If you have more questions or you think your child may have learning-related vision problems, please feel free to reach out to your local Annapolis, MD optometrist office today.
|
<urn:uuid:4cf1258e-6f2f-4b01-854b-94a14fa6f972>
|
CC-MAIN-2023-50
|
https://marylandvisiontherapy.com/2021/11/24/annapolis-md-eye-doctor-add-or-learning-related-vision-problems-taking-a-second-look/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.93633 | 539 | 3.390625 | 3 |
No matter how you slice it, an exceedingly small number of people would pay a proposed tax on the portion of annual income over $1 million – less than seven Massachusetts tax filers in a thousand would pay more if voters pass ballot Question 1 (Fair Share) to support education and transportation.
An examination of available data suggests that when a middle-class taxpayer sells their small business or home, they would be highly unlikely to have a taxable income over $1 million, the point at which additional income would be subject to the new tax.
“One-time” occurrences of $1 million income are relatively rare overall, and in fact much rarer for the middle-class. It is far more common for tax filers who exceed $1 million in annual income to do so year over year. This is what is referred to as “persistent millionaire income.” Even if not a persistent millionaire, those whose income crosses the $1 million threshold in only one year are also likely to have incomes in the top 1 percent during other years. The amount of capital gains from asset sales are not likely to be high enough to bring someone over the $1 million threshold unless they are very high income to begin with. Tax filers with income between $1 million to $1.5 million would likely still be in the top 1 percent without the income from those assets.
Most million-dollar incomes occur for several years
How common is it for tax filers to have income over $1 million and do so only once? The two studies which examine millions of tax filing records over many years demonstrate that one-time crossing of the million-dollar threshold is relatively rare.
The most comprehensive examination of million-dollar-plus incomes is a 2016 study undertaken by Stanford University professors Charles Varner and Cristobal Young with Ithai Lurie and Richard Prisinzano, financial economists at the U.S. Department of Treasury Office of Tax Analysis. They examined 45 million anonymized tax returns representing every federal personal income tax return over 13 years for all tax filers with an adjusted gross income over $1 million for any of those years. They noted, “one set of findings that stands out is the persistence of millionaire income over time” (italics in original). Only 15 percent of tax filers who reported income over $1 million at any point during this 13-year period could be described as “one-time millionaires.”1 In any given year the percent of filings over $1 million from these one-timers would be lower.
The other comprehensive study that sheds light on the persistence of million-dollar-plus income filings is a 2018 examination of California tax filings over a span of 25 years (1990-2014). The study focused on million-dollar-plus tax filings in the middle years which were each then compared to the tax filers’ returns during the previous six years and subsequent six years of their filings.2 Examining an average of 750,000 tax filings per year, the study found that a tax filer reporting a million-dollar-plus income at some point during the period would typically earn $1 million or more during seven of the 13 years.
There is an older and much smaller study that examined fewer years and found a different result. The 2010 paper by researcher Robert Carroll, from a conservative think tank based its conclusions on a subsample of 62,000 anonymized Internal Revenue Service (IRS) tax filings from around the nation over nine years.3 That paper is chiefly focused on arguing that income inequality should not be a major concern. It concluded that approximately one half of million-dollar income filers are “one time.” It is unclear why the finding was so out of step with more comprehensive studies. But in any case, it is clear that the finding would not mean that half of those paying the Fair Share tax in a given year would be one-timers.4
People who’d pay the Fair Share tax only some years typically receive very high incomes in the other years
The California study also examined the amount of income reported in other years for a tax filer who exceeded $1 million in at least one year. In the six years prior to million-dollar earnings, these tax filers had a median income of $740,000. During the six years afterwards, their income was $1,149,000.5 In other words, a typical million-dollar-plus income filer would typically also receive an average income in the top 1 percent during the dozen surrounding years.
The profile of somebody with an adjusted gross income over $1 million is far less likely to be a dentist or a florist making a one-time sale of a business or a home and far more likely be a corporate lawyer, hedge fund manager, CEO, or someone else with a persistently very high income.
Varner, Young, and Prohofsky (2018)
One reason extremely high incomes tend to be persistent is that households with the highest incomes tend to benefit from intergenerational wealth, privileges, and greater economic opportunities that reap returns year after year. High incomes also create their own advantages that make it easier to receive a very high income in other years.
Selling big assets isn’t pushing middle-class incomes above $1 million
Data provided by the IRS and other sources make it possible to further examine claims by some opponents of the “Fair Share” ballot question that middle-class earners could become “one-time millionaires” as the result of capital gains from selling their home or business. These claims can seem credible because people may confuse the price of a home or business with the taxable income from selling these assets. But as described below, the taxable income from an asset sale tends to be only a fraction of its sale price.
Among U.S. tax filers with income ranging between $1 million and $1.5 million who report capital gains from selling assets, these sales do not even comprise a majority of their taxable income. While income from the sale of assets such as a home or business averages $282,000 for this group, other sources of income such as salary and ongoing business profits represent 85 percent of their income, according to the most recent IRS data. Without the income from asset sales, many tax filers in this group would still have incomes over $1 million. They wouldn’t, on average, have ordinary middle-class incomes.6 Sales of assets such as might occur from a small business or a home do not appear to be a major factor in the income of those with incomes a bit over $1 million.
Looking more specifically at home sales, capital gains apply to only to the amount exceeding the prior sale price. Sellers also can deduct the cost of improvements made to the property, the brokerage fees and other costs of selling the home, and an additional $500,000 on a primary residence ($250,000 for single filers). Taxable gains in a home’s value are also reset to zero when it is passed down to inheritors. With all these reductions, it is no wonder that very few home sales would push income over $1 million. In a majority of Massachusetts cities and towns, zero homes sold for a net gain of $1 million or more, even before the deductions.
Furthermore, home sales tend to be a small component of capital gains incomes overall. According to IRS national data on the sources of capital gains income, less than 1 percent (0.6 percent) of total capital gains come from selling a principal residence.7
The story is broadly similar for small businesses. Only a small number of small businesses ever get sold; many – especially the majority that are sole proprietor businesses8 – simply shut down. Based on information about 1,400 sales of businesses in Massachusetts between 2017-2022, the median sales price over this period was about $290,000.9 There were sales over $1 million, but they were relatively rare. And the taxable income realized from such sales is far lower than the sales price. The seller can deduct the original investments they paid for the business, the cost of equipment, property, inventory, and as well as realtor and legal fees incurred from the sale. And the income is further divided if there are multiple owners or the sale was arranged in installments over multiple years.
* * *
America has long seen itself as a land of opportunity. It’s appealing to imagine that everyone could be on the brink of making over a million dollars some year in the not-too-distant future. Soaring briefly to such income heights, however, is exceedingly rare. The notion of middle-class earners becoming “one-time millionaires” as they sell their businesses or homes is far more myth than reality.
1 C. Young, C. Varner, I. Lurie, and R. Prisinzano, “Millionaire Migration and Taxation of the Elite: Evidence from Administrative Data”, Table 3 (2016), Table 3, p. 433 at https://cristobalyoung.com/development/wp-content/uploads/2018/11/Millionaire_migration_Jun16ASRFeature.pdf.
2 C. Varner, C. Young, A. Prohofsky, “Millionaire Migration in California: Administrative Data for Three Waves of Tax Reform,” Stanford Center on Poverty and Inequality (2018), p.32 at https://inequality.stanford.edu/publications/media/details/millionaire-migration-california-impact-top-tax-rates. .
4 By analogy, half of all the people who ride on the MBTA at some point during the year might be tourists. But that would not mean that half of MBTA boardings are tourists.
5 The income profile analysis focused on the eight years during 1996 to 2003 plus the six years prior and six years following. Page 33.
6 The average adjusted gross income for this income range is $1.202 million. Among all tax filers in this income range, regardless of whether they reported taxable net gains from asset sales, the average amount of those gains is $180,000. IRS, Individual Tax Returns Filed and Sources of Income (2019).
7 Based on a special IRS data series published in 2016. Statistics of Income – Sales of Capital Assets Reported on Individual Tax Returns. Download at https://www.irs.gov/pub/irs-soi/1201insoca.xls. Out of 844 billion in capital gains, only $5 billion came from sale of a primary residence.
8 According to the SBA Massachusetts 2022 Small Business Economic Profile, there are 718,467 small businesses, 576,528 of which have no employees (4 out of 5). Note that the SBA includes in their definition of small businesses as those with up to 499 employees. Most people do not think of such enterprises with that many employees as “small”.
9 Massachusetts Budget and Policy Center, “Very Few Small Businesses Sell for More Than $1 Million: Even Fewer Would be Subject to Fair Share,” (October 2022). On the separate issue of S-corporations and business pass-through income paid by individual tax filers, see also, “The Fair Share Amendment Helps Small Businesses: Public Investment, S-Corporations, and Million-Dollar Incomes in MA” (Nov. 2021).
|
<urn:uuid:4197ff11-4af1-4b5b-89eb-ab2db07b7edf>
|
CC-MAIN-2023-50
|
https://massbudget.org/2022/10/25/one-year-middle-class-millionaire-myth/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.959358 | 2,369 | 2.515625 | 3 |
Researchers in Switzerland have transmitted and received optical data at rates of more than 10 Tbit/s between an Alpine peak and an observatory at the University of Bern – a distance of 53 kilometres. This is more than five times further than would be needed to set up a satellite-to-ground communication link, and the team say the method could be used to create faster and more cost-effective Internet connections for satellite constellations in near-Earth orbit.
Satellite constellation systems such as SpaceX’s Starlink (a network of more than 2000 satellites orbiting close to the Earth) promise to bring Internet access to the world via space-based laser communications. The principle is that areas that do not have access to optical-fibre cable technology, which makes up the backbone of the modern Internet, could instead become connected to the optical network via satellites.
At present, data transmission between satellites and ground stations relies mainly on radiofrequency technologies, which operate in the microwave range of the electromagnetic spectrum and have wavelengths of centimetres. Laser optical systems, in contrast, operate in the near-infrared range, and their micron-scale wavelengths are about 10 000 times shorter than radio waves. This enables them to transport more data in the same amount of time. Indeed, several previous experiments have shown that free-space optical communication technologies can transmit data at rates of 100 Gbits/s over distances of up to 10 km and 1 Tbits/s over distances of up to 3 m in a single channel.
The downside is that such systems rely on advanced high-order modulation formats and therefore require high signal-to-noise ratios, which are only possible over relatively short distances. Future satellite links will also require even higher data rates, on the order of 500 Gbits/s or more.
A scenic experiment
In the new work, researchers led by Juerg Leuthold, the head of the Department of Information Technology and Electrical Engineering (D-ITET) at ETH Zurich, established a satellite optical communications link between the High Altitude Research Station on the Jungfraujoch and the Zimmerwald Observatory near Bern. In doing so, they showed that a laser beam could efficiently propagate through atmospheric turbulence that would normally adversely affect the movement of the light waves, and thus the transmission of data.
The researchers achieved this feat by modulating the laser’s light wave in a way that allowed the receiver to detect different states encoded into a single “symbol”. This means that each symbol can transmit more than one bit of information. For example, a scheme comprising 16 states can transmit four bits with each oscillation of the light wave, while one with 64 states can transmit six bits.
“Several key components enabled this success,” says study lead author Yannik Horst. On the transmitter side, he explains that the team encode the information in a power-efficient way by using a coherent modulation format such as a polarization-multiplexed 64-quadrature-amplitude-modulation (64-QAM). They then send it with very high precision (a few tens of micro-radians) in the direction of the receiver at the observatory. Finally, after the light passes through 53 km of turbulent atmosphere, an adaptive optics system at the receiving station corrects the phase front error of the electromagnetic wave.
“The adaptive optics leads to ~300 times stronger signal in the optical fibre,” Horst tells Physics World. “The improvement also comes thanks to the optical building block that has a high receiver sensitivity – only a few photons per bit are needed for error-free data transmission.”
Horst and colleagues say their new technique should bring us a step closer to satellite-Earth and inter-satellite communication links based on optical technologies that can achieve very high date-rates per channel – much higher than is possible for radiofrequency technologies. Such links could one day act as the backbone for the terrestrial fibre network and ultimately “connect the unconnected” in areas where the deployment of mainstream communications technologies such as optical fibre is not feasible.
The researchers, who report their work in Science, are now investigating a novel modulation format known as 4D-BPSK. “We believe this format could be applied to other optical applications thanks to its very high sensitivity too,” Horst says.
The post Alpine adaptive optics experiment paves the way for terabit-per-second satellite links appeared first on Physics World.
|
<urn:uuid:2fc06ba7-1dd1-4869-a79e-ff6bb68d3a2b>
|
CC-MAIN-2023-50
|
https://mathswithmatt.co.uk/2023/08/01/alpine-adaptive-optics-experiment-paves-the-way-for-terabit-per-second-satellite-links/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.922245 | 920 | 3.75 | 4 |
The day is celebrated on December 15 consistently to clarify the significance of tea in everybody's everyday life. Likewise, the day features the vital regions of the center at the worldwide level that can help in sustaining the tea business and make the worldwide beverage considerably more famous. The day additionally centers on the medical advantages of different teas like white, green, dark, natural, and oolong, to give some examples.
History of International Tea Day
The tea day was chosen at the World Social Forum in 2004 and was named International Tea Day and in 2005.
The principal International Tea Day was praised in New Delhi and later in 2006 Sri Lanka joined the alliance and began noticing International Tea Day.
In 2015, the worldwide extension of International Tea Day occurred, when the Indian government proposed the equivalent to the UN Food and Agriculture Organization. And afterward, in 2019, the United Nations joined tea days in a few nations into one.
Notwithstanding, you will be astounded to realize that the Intergovernmental Group on Tea proposed to notice this day on May 21, which additionally got its endorsement at the FAO Conference.
Significance of International Tea Day
The thought behind celebrating this day is to provoke mindfulness about the interest of this worldwide beverage, which is the second most burned-through refreshment after water on the planet. On this day networks and overseeing bodies arrange classes and occasions that discussion about the development and various difficulties that the business is looking for regarding the development of ranchers, and different issues like less compensation, no clinical consideration, and absence of clean water on the homestead, among others.
On a lighter note, the day via web-based media rotates around the International Tea Day where individuals show their inventiveness as far as styling, flavors and even stories of how they are associated with tea as a drink.
Advantages of teaDecreased danger of sicknesses
Green tea has fixings that have been demonstrated to decrease the danger of malignancy. EGCG, a compound found in green tea, is a cell reinforcement that can decrease the danger of specific tumors and improve states of those living with skin, lungs, colon, and different malignant growths. Utilization of unsweetened dark tea can likewise decrease glucose levels, as expanded levels lead to the chance of corpulence and heart infections. It likewise decreases the danger of stroke and diminishes pulse.
Wealthy in Antioxidants
Cancer prevention agents are known to decrease the danger of numerous infections and give a large number of medical advantages. Aside from decreasing the danger of constant illness and eliminating free revolutionaries, they likewise diminish the danger of diabetes, cholesterol and lessen muscle versus fat as per an exploration. This makes tea a sound option in contrast to many handled refreshments.
Psychological wellness benefits
Tea has assisted numerous with staying cool and some favor a warm cup of tea following an upsetting day. Standard tea shoppers have a lower danger of getting Alzheimer's and other neurodegenerative infections. It can forestall and diminish psychological decay and furthermore helps people in boosting their memory. The improved center can assist one with performing work and numerous parts of life, a sound advantage of tea utilization.
In contrast with espresso, a diuretic substance that dries out the body, tea is hydrating. An examination found that drinking six to eight cups of tea daily can give a similar measure of hydration as water. Moreover, drinking tea likewise advances better oral wellbeing and decreases the danger of periodontal sickness and holes.
For individuals in India, tea isn't only a beverage, but it is an emotion!
If you resonate with me please drop in your replies!
|
<urn:uuid:8b1ad6b6-e14b-4913-9eb6-c826a4dc2b89>
|
CC-MAIN-2023-50
|
https://medicircle.in/the-tale-of-international-tea-day
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.93989 | 744 | 2.609375 | 3 |
Do you have a loved one that has hearing loss? Do you struggle to communicate with that person? Below we give 5 communication tips on how to better converse with a person who has hearing loss.
1. Speak slower.
One of the most helpful things you can do when speaking to someone with hearing loss is to speak slowly. Speaking slower and focusing on enunciating your words can make a world of difference to someone with hearing loss. However, don’t over-exaggerate.
2. Keep your hands away from your face.
Many people with hearing loss rely on lipreading and facial expressions to assist with understanding speech. Keeping your hands away from your face ensures that this is visible to the listener.
3. Face the person head-on.
Hearing aids are most effective at picking up sounds that are directly in front of the wearer. If you stand to the side, or behind the person with hearing loss, they may struggle to understand you.
4. Say the person’s name before speaking.
Get the person’s attention before you begin speaking. You may choose to say their name, or touch them on the arm. This gives the listener a chance to focus their attention on you.
5. Maintain eye contact.
Maintaining eye contact is a way to help you convey that you are engaged in the conversation and paying attention. It also helps to ensure that you are facing the person with hearing loss, and that they can see your lip movements and facial expressions.
This was Part 1 of our Communication Tips blog series. Check back for Part 2 to learn additional tips on improving communication with your loved one with hearing loss.
If you enjoyed our visuals, follow Merit Hearing’s Instagram page!
|
<urn:uuid:69f81cc1-431b-40fb-b896-a8b6731783ce>
|
CC-MAIN-2023-50
|
https://merithearing.com/communication-tips-for-hearing-loss-part-i/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.949485 | 362 | 2.71875 | 3 |
There’s nothing quite like the feeling of hitting the open road or trail and feeling the wind in your hair as you go for a run. However, all too often, this feeling is followed by the pain of an injury. Running is a high-impact sport, which means that it puts a lot of stress on your body. This can lead to all sorts of injuries, from simple things like blisters and runner’s knees to more serious injuries like stress fractures.
While you can’t completely avoid injuries, there are some things you can do to reduce your risk. Here are five running practices that will help you avoid injuries:
1. Warm Up Properly
One of the best ways to avoid injuries is to warm up properly before you start running. A good warm-up will increase your heart rate and blood flow, loosen up your muscles, and prepare your body for the physical activity to come.
To warm up properly, start with some light aerobic activity, such as walking or slow jogging. Then, do some dynamic stretches, such as leg swings, lunges, and butt kicks. Finish up with some strides–running at about 80% of your max effort for 20-30 seconds.
2. Don’t Go Too Hard, Too Fast
One of the most common mistakes that runners make is starting out too hard and too fast. When you go all-out from the beginning, you put your body under a lot of stress, which can lead to injuries.
Instead of going all-out, start slow and gradually increase your pace as you warm up. And, when you’re planning your running workouts, make sure to include easy days, where you run at a comfortable pace. This will give your body a chance to recover and will reduce your risk of injuries.
3. Listen to Your Body
Your body is good at telling you when something is wrong. So, if you start to feel pain while you’re running, slow down and take a break. It’s better to take a few minutes to rest than to push through the pain and end up injured.
4. Vary Your Workouts
If you’re only running, you’re putting a lot of stress on your body. You need to give your body a break by varying your workouts. Try running one day, then biking or swimming the next. This will help your body recover and will make you a better runner in the long run.
5. Wear the Right Gear
Wearing the right gear is important for any sport, but it’s especially important for running. Wearing the wrong shoes can lead to injuries. Make sure you buy shoes that are designed for running and that fit well. Also, be sure to replace your shoes every few months to keep them from wearing out.
Bonus Tip: Schedule a Post-Workout Massage
Getting a massage after running can help your body recover. Massages help increase blood flow, which can help your body repair any damage that your run may have caused.
There are certain running practices that can help reduce the risk of injuries. These include warm-ups, cool-downs, stretching, cross-training, and paying attention to form. By incorporating these practices into your running routine, you can help minimize the chances of sustaining an injury.
Are you looking for the best therapeutic massage in Culver City to help with body pain? Look no further than MetaTouch. Here, we develop customized programs to meet your specific requirements. Schedule a session today.
|
<urn:uuid:d0a5a749-4c65-4652-a95a-78c4ce8ca3a2>
|
CC-MAIN-2023-50
|
https://metatouch.com/all-posts/advice/avoid-unnecessary-injuries-tips
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.94631 | 727 | 2.65625 | 3 |
Earth Science A is the first-semester in a two-course sequence designed to expose the student to the scientific study of the Earth. Students will learn how observation and experimentation are used to gain knowledge about the Earth’s past and present and used in making predictions about Earth’s future. Students will gain an understanding of the inner workings of Earth systems, including water and rock cycles, and how they influence the environments on the planet.
(23-24) Semester 1
(23-24) Semester 2
(23-24) Trimester 1
(23-24) Trimester 2
Next Generation Science Standards
|
<urn:uuid:301a6a28-a4bb-4d15-9ae5-1d062cb18e4f>
|
CC-MAIN-2023-50
|
https://michiganvirtual.org/course/earth-science-a/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.867593 | 132 | 3.328125 | 3 |
In this Mindfulness Guided Meditation for Children you will take a trip to your magical forest and whilst admiring the beautiful butterfly you will become the butterfly!
Take this opportunity to see life through the eyes of the butterfly, living in the present moment without any concern for the past or the future...just the now...
An idea may be to unwind with your child, listening to this peaceful Mindfulness Meditation together...bliss!
How to Promote Mindfulness in Children
There are numerous ways we can introduce the concept of mindfulness to our children. For young children, this free Mindfulness Meditations for Kids course can serve as an introduction to mindfulness practice, offering beautiful imagery and simple practices that young kids can follow and relate to.
The meditations in this course can be returned to again and again, being incorporated into regular practice. For adolescents, beginner mindfulness practices might be more suitable than kids practices, offering simple, straight-forward exercises that explore breath work, body scanning, self-compassion meditations, and a range of other topics.
Offline, some additional ways we can enhance mindfulness in children include:
1. Mindful Nature Walk
Taking children into the earth’s most natural playground – the great outdoors – is a great place to introduce them to the concept of mindfulness. Invite them to explore the world through all of their senses (aside from taste, of course, unless it’s safe to do so) and then through their emotional and intuitive bodies.
What does the air smell like? What colours do they notice? Where is there movement and where is there stillness? How do they feel inside? What energies do they notice – happy ones, playful ones, quiet ones? The opportunity for mindful exploration here is endless.
2. Gratitude Practice
Introducing children to gratitude practice is incredibly beneficial for enhancing their awareness of the blessings in their life. In a world that is now highly connected through social media, comparison to what others have has been made far too easy.
Engaging children in this type of practice can be as simple has having them name one thing about their day that went really well as you tuck them into bed; or, you can consider helping them to write a gratitude list, encouraging them to open their awareness to all the blessings within and around them – big and small, tangible and intangible.
3. Mindful Minute
Taking a mindful minute when a child’s emotions are rising high can help your child to better understand and express how they are feeling.
Tell them that you are really interested in learning more about what they are experiencing, encouraging them to tune mindfully into their body, heart, and mind for one minute before sharing their feelings.
This will help them to better communicate, and it will help you to listen more patiently and compassionately. Take that mindful minute yourself as well, tuning into your own experience of and reaction to their emotions.
|
<urn:uuid:09e7ab13-7f52-466a-8f6a-10e648f4c8ea>
|
CC-MAIN-2023-50
|
https://mindfulnessexercises.com/course/becoming-a-butterfly/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.947565 | 598 | 3.1875 | 3 |
By Michael P. Foley
As the coronavirus spreads across the globe and medical professionals struggle to contain it, there is one thing that the rest of us can do besides pray and use hand sanitizer: drink more.
Dr. Todor Kantardzhiev, director of Bulgaria’s Centre for Infectious and Parasitic Diseases, reportedly asserted that regular drinkers of hard liquor are at less risk of contracting the coronavirus because “alcohol kills the virus in a matter of seconds.” News of the claim spread quickly, followed with almost equal speed by denials of its authenticity. It turns out that the story was the result of a game of telephone. The good doctor had been quoted as saying that the virus is highly susceptible to disinfectants and dies very quickly from alcohol. From there some tipsy hopefuls apparently applied his observation to the inside of their gullets. Their scheme could have had a dash of merit were it not for the fact that a solution of 60 percent alcohol is required to kill the virus while most hard liquor only contains 40–45 percent.
This short-lived urban myth brings to mind a long and venerable association of alcohol with bodily health. Roman soldiers were given a daily ration of wine not in order to grow inebriated but in order to kill dangerous bacteria in the local water supply. A similar strategy was used in the Middle Ages and early modern period with beer. “Small beer” was defined as beer that was fit for women, children, and manual laborers, for it contained just enough alcohol to eliminate water-borne pathogens but not enough to affect one’s judgment or motor skills. Saint Arnold of Metz (580–640) is a patron of brewers because he saved his flock from a plague by admonishing them to drink beer instead of water.
As for the stronger stuff, one of the reasons why medieval monasteries were pioneers in the development of distillation is the conviction that alcohol had medicinal value. The first written reference to whiskey is in a medical document by Irish monks in which whiskey (I kid you not) is prescribed as a cure for “paralysis of the tongue.” Monks also developed herbal liqueurs as tonics for different ailments. The most famous of these is chartreuse, a magical elixir that has been made by the Carthusians from 130 hand-picked herbs in the French Alps for the past five hundred years. The formula is so tightly guarded that only two monks at a time know it.
In this spirit, why not ward off worries about coronavirus by sipping green chartreuse? At 110 proof or 55 percent alcohol, it comes awfully close to the 60 percent minimum necessary for becoming the virus’s mortal enemy. (There is also a rare Élixir Végétal de la Grande-Chartreuse that, at 138 proof or 69 percent, could kill the virus, at least outside the body.) But if this celestial nectar is too strong for your palate undiluted, try a Last Word. One of the greatest products to come out of Prohibition, the perfectly balanced cocktail fell into oblivion but more recently has made an impressive comeback.
Last WordPour all ingredients into a shaker filled with ice and shake forty times. Strain into a cocktail glass.
¾ oz. gin
¾ oz. green chartreuse
¾ oz. maraschino liqueur
¾ oz. lime juice
One final suggestion is to drink in honor of the saints invoked against contagious diseases. As it turns out, there is a Saint Corona, and believe it or not she is traditionally invoked against pandemics. Readers are welcome to participate in a contest I am sponsoring to honor Saint Corona by finding or inventing the most appropriate cocktail with which to toast her (simply go to the Facebook page of Drinking with the Saints).
In the meantime, turn to Saint Roch, who during his life helped victims of the Plague, sometimes curing them with the sign of the cross. There is a legend that upon Saint Roch’s death God promised that he who “calleth meekly” to the saint will not be hurt by any pestilence, and one way to call meekly to Saint Roch is to toast him with a stiff bracer. The Desert Healer is an apt choice for paying tribute to a refugee from the desert who healed diseases.
1½ oz. ginPour all ingredients except ginger beer into a shaker with ice and shake forty times. Strain into a highball glass filled with ice and top with ginger beer.
¾ oz. Cherry Heering
2½ oz. orange juice
Cocktails may not make the coronavirus go away, but used in moderation they can steel our courage and reduce a sense of panic. And that, too, is important to our overall health.
|
<urn:uuid:0db91f77-b15d-4fd5-92e8-c4a877a81a73>
|
CC-MAIN-2023-50
|
https://musingsofanoldcurmudgeon.blogspot.com/2020/03/prayers-and-cocktails-for-coronavirus.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.954311 | 1,010 | 2.703125 | 3 |
It’s October 20, the National Day on Writing, and a day we’ve been looking forward to all year! Check out #whyiwrite on Twitter to share in the celebration!
The word re-vision means to “look again.” When revising a piece of writing, what are some things to look for?
- Lesson Plan “Collaborative Stories 2: Revising”—Using a collaborative story written by students, the teacher leads a shared-revising activity to help students consider content when revising, with students participating in the marking of text revisions.
- Lesson Plan “Prompting Revision through Modeling and Written Conversations”—Students create a checklist outlining what effective writers do, revise his or her own writing, and engage in a written conversation to help peers with the revision process.
- Lesson Plan “Reciprocal Revision: Making Peer Feedback Meaningful”—Interpreting art is a subjective process. In this lesson, students write written responses analyzing a work of art and use feedback from their peers to revise or confirm their initial responses.
- Lesson Plan “Writing for Audience: The Revision Process in The Diary of Anne Frank”—After reading or viewing The Diary of Anne Frank, students will make connections between audience and purpose and revise a journal entry with an outside audience in mind.
- Lesson Plan “Once Upon a Fairy Tale: Teaching Revision as a Concept”—Students use fractured fairy tales to practice revision and editing as separate activities when they write their own versions of fairy tales.
What additional resources would you add to this list? Share on social media with #WhyIWrite!
|
<urn:uuid:9f23115b-9bc1-4be5-af20-fd5436e92fea>
|
CC-MAIN-2023-50
|
https://ncte.org/blog/2019/10/33491/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.913307 | 353 | 3.9375 | 4 |
The Ministry for the Environment’s recent freshwater report outlines the scale of the country’s pollution problem and makes many references to Māori ways of thinking, but what does it take to really understand an issue from another culture’s perspective? ask Emeritus Professor Lydia Wevers and Associate Professor Maria Bargh.
Take Lake Horowhenua, for example. One of New Zealand’s most polluted lakes, it is apparently so toxic that an unnamed scientist from the National Institute of Water and Atmospheric Research (NIWA) said in 2012 a child could die if enough of its water was swallowed.
It is also a significant taonga for Muaūpoko and Ngāti Raukawa iwi, and like all lakes, wetlands and waterways of Aotearoa, it was an important food basket and a place of outstanding beauty for Māori. Early maps show the lake and the coastal system it is part of thickly inscribed with Māori names revealing centuries-old use and knowledge. And yet there is now a proposal to exempt it from the new freshwater standards because there is “no feasible fix”.
For Māori, the heavily polluted lake could be described as nearing a state of wai-kino—meaning the mauri (life force) of the water has been altered and has the potential to harm all living things. The phrases for water in te reo Māori often have a metaphysical dimension and link back to the fundamental conception of whakapapa in which everything is connected and has its own being—something now recognised in the legal personhood of Te Awa Tupua (the Whanganui River). Personal health and the health of the iwi are also linked to the health of waterways, rivers, wetlands, and lakes.
Māori names for water bodies tell you about their properties and their being. Names such as Wai-rakei (the place where the pools were used as mirrors), Wai-rarapa (the glistening waters), Wai-whetu (the star waters), and Wai-taki (the tears of Aoraki). These phrases offer a glimpse of the pre-European world, where metaphorical names tell you about places and what people did there, constituting a web of knowledge sedimented in time.
European descriptive naming practices for water, on the other hand, tend to focus on physical properties or size, such as river, stream, creek, and pond. Or the movement of water: cascade, rapids, waterfall, bog, and flood. The difference in naming approaches is highly instructive about our different forms of cultural thinking, and how our cultures respond differently to the natural world.
Much of current ecological and environmental planning, such as the recent report from the Ministry for the Environment, Our Freshwater 2020, acknowledges the stake Māori have in water and refers to their ways of thinking about it. In order to improve understanding about how perspectives on landscape are cultural, we have created a bicultural series of free massive open online courses looking at landscape as an expression of culture, with the third and final course focused on water (wai). New Zealand Landscape as Culture: Wai (Water) is a bicultural conversation based on the structure of whakapapa and teases out the ways in which our two cultures collide, ignore and talk past each other.
The Ministry for the Environment report shows, graphically and in other ways, the scale of the problem we confront to restore both the resource and the mauri of our water. Europeans tend to think of water’s first role as providing benefit to people through irrigation, power, drinking water, sewage disposal, and recreation. What can a different cultural perspective offer as we look for solutions?
In the case of water, it means thinking of water bodies as living beings with histories and individual characteristics, populated by an immense diversity of flora and fauna, interconnected with surrounding biodiversity and for which we may all have obligations as kaitiaki. When you do that you start to see a different kind of loss, and the path to a different kind of gain.
It is not good enough to say there is no ‘feasible fix’ for Lake Horowhenua. Let’s start to talk properly about what a Treaty-based process might mean for all our waterways and all our people.
|
<urn:uuid:25a39268-8b76-4ff4-9b36-e2fb7fa3008c>
|
CC-MAIN-2023-50
|
https://newsroom.co.nz/2020/07/22/where-water-and-culture-collides/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.955485 | 903 | 3.234375 | 3 |
Scientists Say We May Have A 2nd Brain, And It’s Located Where?
We all heard and told the stories that someone's brain is in their...well you know. We may not have been that far of after all. Scientists in Australia now say that human beings have a second brain, and it's in our butt!
The Inquisitr says the research was originally done to find ways to treat constipation and irritable bowel syndrome. They found a nervous system that controls muscle movement in the colon independently of the central nervous system, and scientists say they think learning how this works could also lead to new ways to treat depression and anxiety.
By the way, they think this second brain was probably developed before the central nervous system so it may actually be our first brain.
|
<urn:uuid:860ce4e7-32b5-4807-bda0-29de39d6bbfe>
|
CC-MAIN-2023-50
|
https://nick975.com/scientists-say-we-may-have-a-2nd-brain-and-its-located-where/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.974537 | 160 | 3.015625 | 3 |
Rather than owning their servers, modern companies tend to rent storage and application access for a subscription fee. It makes perfect sense as it’s much cheaper to outsource infrastructure to cloud service providers. They’ll take care of maintenance with better flexibility if suddenly you’ll need to scale up your operations.
On the flip side, this also means that keeping your data stored externally means it’s much more susceptible to online attacks. Hackers are adapting to changing business preferences — cloud server misconfigurations were the cause of some of 2021 most significant data breaches.
In turn, most organizations are looking into balancing the benefits that cloud computing brings while trying to overcome risks associated with externally kept data. Over time, this has evolved into a separate discipline known as cloud data protection. Here’s what you should know about it.
What is Cloud Data Protection?
Cloud data protection is a collective term for policies, technologies, and applications to secure cloud-based data. Its practices should cover all stages of data moving in and out of a cloud environment encompassing long-term archiving and in-transit when uploaded from the user’s device.
Organizations use the cloud in various deployment and service models, and cloud data protection helps to put the proper controls in place to ensure data security. This framework is independent of whoever owns or supervises the network. The main goal is to safeguard any weaknesses that cloud infrastructure has, distinguishing several main types.
Deterrent — policies intended to ward off potential attackers. While most hackers ignore them anyway, it does help to repel those who are less experienced or are looking for easily exploitable networks.
Preventative — policies and applications directly contribute to the system’s resilience against unauthorized access. Firewall, endpoint protection, and two-factor authentication help minimize the attack surface that a hacker could use for its advantage.
Detective — controls intended to detect and monitor ongoing or past incidents. Usually, preventative and detective controls work in tandem, i.e., suspicious behavior will automatically trigger a system-wide lockdown to prevent data loss.
Corrective — various methods limit the damage after the incident has already happened. They could range from written post-mortem detailing how the attack occurred to regular data backup plans.
Why is data protection in the cloud important?
The majority of organizations have already digitized some of their day-to-day operations. During the worldwide Covid-19 pandemic, this accelerated a great deal, facilitating the adoption of cloud storage services.
Nowadays, it’s not uncommon for a company to store confidential customer data in public, private, and hybrid clouds. While this frees up the company’s internal IT department from maintenance and the requirement to set up a physical server, it also opens up a company to a lot of additional risks:
Cloud providers and companies usually share responsibilities to ensure data security. So, while a cloud provider provides some of its data protection in the cloud, the client may not always have a full view of its infrastructure.
The shared responsibility model doesn’t always mean that both parties clearly understand their responsibilities.
Organizations might not even know where their data is stored. The cloud provider can move it across the infrastructure without the organization ever finding out. Sometimes multiple clients can be using the same server.
Public clouds have a much larger volume of incoming and outgoing traffic, making it harder to pinpoint suspicious connections.
If an organization relies on multiple cloud providers, the security may be inconsistent, which hackers could exploit.
Some data may be subject to regulatory compliance, requiring appropriate security measures for its protection.
Address these risks by applying cloud data security practices. While some risks can be unavoidable, cloud data security ensures that the risks remain minimal.
Cloud Data Protection Best Practices
You can do a lot to make cloud-hosted data security higher. Here are the best industry practices that help to mitigate cloud data protection risks.
Have a clear division of responsibilities
The data center isn’t responsible for the server security. They are just providing a framework to build on. Usually, they only provide hardware and provide software for its management. The configurations, however, would usually fall on the client.
Your overall security status will depend on both parties sharing the responsibility of ensuring data security in the cloud. It will only work if both parties have clear responsibilities and each carries out its share.
Do your research
Before shaking hands with a provider, you should look into what tools for remote management of your data it offers. If compliance regulations apply to your industry, ensure that your cloud provider has the proper certificates. If you’re using an uncertified provider, you may not meet the compliance standards.
Don’t forget to find everything else to know about your provider — look for any previous data breach reports and see if your provider’s name pops up. The more you know beforehand, the easier it will be to decide.
Secure gaps between systems
The more cloud environments you’re relying on, the more gaps in your infrastructure that malicious individuals could exploit. It’s the organization’s responsibility to identify them and implement potential solutions.
It’s not enough to trust that the cloud provider vendor will take care of everything and that there’s no need to do anything else. Implementing additional measures, like Cloud VPN services will help you control the hosted data and ensure its security status.
As a general rule, data encryption should cover everything in the cloud. That way, even if someone managed to get a hold of the server, it would be impossible to access the server’s contents without its private key.
Encrypting files before transfer to cloud storage is also a good practice. In addition, it’s possible to fragment your data into shards and store them across multiple clouds. Even if a hacker could access a small amount of data, it would remain useless.
Strict access permissions
Make sure that only the users that need to access the data can access the data. Enforce strong credential policies and add additional IP allowlists to allow only specific IP ranges to connect to your network.
Audit your permissions and set your credential lifecycle terms. Avoid password reuse and keep refreshed constantly to avoid other database dumps affecting your database’s security.
Secure end-user devices
User-controlled endpoints are the most susceptible part of your network infrastructure. Private gadgets used at work or as a part of the bring your own device (BYOD) policy can be a severe threat. They can function as an attack vector to gain entry into your cloud environment.
To prevent this, you should engage in active traffic monitoring, restricting traffic on your network perimeter and restricting what data can exit or enter your systems.
Have an exit strategy
With your cloud-hosting vendor, it would help if you devised an incident response plan outlining the actions taken after the data breach. Having a written plan will help you react more quickly and bounce back from the initial shock.
Dedicate some sections to when a data breach occurs to give you additional insights into what should happen when the detection software finds an unauthorized agent on your internal network.
Main cloud data protection benefits
Taking appropriate cloud data security measures helps protect company data privacy and significantly affects your network security. Here are the main benefits that cloud data security brings.
Active security risk mitigation. Keeping data outside the company allows one to have a complete overview of what data is going in and out of the server—via active monitoring.
Govern data access. Partition cloud servers can allow specific users into specific servers with varying levels of access rights. Allow better control of who has access to what files and which files were downloaded by whom.
Data and security policies. Implementation of cloud network protection usually involves an action plan detailing many internal practices. Often, this can be a good starting point to develop fully-fledged data and security policies to prepare an organization better to withstand any cyber threats that it could experience in the future.
Data loss prevention. Cloud data protection connects to broader data loss prevention. It should have other benefits related to minimizing risks for accidental leaks from the employees, which could be further difficult with data access segmentation.
Protect your cloud data with NordLayer
Achieve cloud data security by implementing the Zero Trust security model. Not to mention that transitioning to SASE (Secure Access Service Edge) framework uses a cloud framework to deliver network security point solutions.
NordLayer provides an adaptive network security solution that easily integrates within your existing infrastructure to help your organization achieve greater data privacy and security and facilitate remote working.
Get in touch with our team and discover the easy route to increase your cloud data security wherever you’re hosting it.
|
<urn:uuid:8905ddb2-fcf4-4c44-939d-434d5fef3e03>
|
CC-MAIN-2023-50
|
https://nordlayer.com/blog/cloud-data-protection-best-practices/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.923306 | 1,792 | 2.78125 | 3 |
Electric vehicles (EVs) have emerged as a revolutionary force in the automotive industry, transforming the way we perceive and engage with transportation. Central to this transformation are the advancements in battery technology, specifically the integration of 12V lithium batteries. These small yet powerful energy storage units are playing a crucial role in enhancing the efficiency, range, and overall sustainability of electric vehicles, thus empowering mobility in an environmentally conscious manner. One of the key advantages of 12V lithium batteries in electric vehicles is their energy density. Lithium-ion technology offers a significantly higher energy density compared to traditional lead-acid batteries. This means that for a given volume and weight, lithium batteries can store and deliver more energy. As a result, EVs equipped with 12V lithium batteries can achieve greater ranges, reducing the range anxiety that has been a concern for many prospective EV buyers.
Moreover, 12V lithium batteries have a longer cycle life and better charge-discharge efficiency compared to conventional lead-acid batteries. They can endure more charge and discharge cycles without significant degradation, making them a cost-effective and sustainable choice for electric vehicle applications. This longevity ultimately contributes to reduced maintenance costs, further incentivizing consumers to transition to electric vehicles. In addition to the enhanced performance, 12V lithium batteries offer faster charging capabilities. The ability to charge quickly is crucial for the widespread adoption of EVs, as it allows for convenient and efficient charging experiences. With faster charging times, electric vehicle owners can top up their batteries more rapidly, making long-distance travel more accessible and convenient, thereby encouraging more people to switch to electric vehicles.
The reduced weight of 12V lithium batteries is another significant advantage. Lithium batteries are much lighter than their lead-acid counterparts, contributing to improved overall vehicle efficiency and handling. This reduction in weight enhances the electric vehicle’s acceleration, braking, and maneuverability, 12V Lithium Battery providing a more enjoyable driving experience to the users. Furthermore, 12V lithium batteries can integrate seamlessly with the EV’s advanced energy management systems. These batteries can be efficiently charged using regenerative braking and other energy-recapture mechanisms, optimizing the vehicle’s overall energy efficiency and promoting sustainability. In conclusion, the integration of 12V lithium batteries in electric vehicles is a pivotal step towards empowering mobility and accelerating the global transition to sustainable transportation. The advantages they bring in terms of energy density, longer cycle life, faster charging, reduced weight, and integration capabilities with energy management systems make them a vital component in the EV ecosystem. With continuous advancements in battery technology and growing environmental awareness, electric vehicles equipped with 12V lithium batteries are set to revolutionize the way we travel, promoting a cleaner and more sustainable future.
|
<urn:uuid:7345fdc4-3b72-44ed-8191-947a7ada25bc>
|
CC-MAIN-2023-50
|
https://nrelement.com/shopping/empowering-mobility-electric-vehicles-and-12v-lithium-batteries.html
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.916864 | 542 | 2.875 | 3 |
The most prominent feature of an Orthodox church is the Iconostasis, consisting of one or more rows of Icons and broken by a set of doors in the center (the Holy Doors) and a door at each side (the Deacon’s Doors). In ancient times, the Iconostasis was probably a screen placed at the extreme Eastern end of the church (a tradition still preserved by Russian Old-Believers), but quite early it was moved out from the wall as a sort of barrier between the Nave and the Altar, with the opening and closing of curtains making the Altar both visible and inaccessible.
The Holy Fathers envisioned the church building as consisting of three mystical parts. According to Patriarch Germanus of Constantinople, a Confessor of Orthodoxy during the iconoclastic controversies (7th-8th Centuries), the church is the earthly heaven where God, Who is above heaven, dwells and abides, and it is more glorious than the [Old Testament] tabernacle of witness. It is foreshadowed in the Patriarchs, is based on the Apostles…, it is foretold by the Prophets, adorned by the Hierarchs, sanctified by the Martyrs, and its high Altar stands firmly founded on their holy remains…. Thus, according to St. Simeon the New Theologian, the [Vestibule] corresponds to earth, the [Nave] to heaven, and the holy [Altar] to what is above heaven [Book on the House of God, Ch. 12].
Following these interpretations, the Iconostasis also has a symbolic meaning. It is seen as the boundary between two worlds: the Divine and the human, the permanent and the transitory. The Holy Icons denote that the Savior, His Mother and the Saints, whom they represent, abide both in Heaven and among men. Thus the Iconostasis both divides the Divine world from the human world, but also unites these same two worlds into one whole a place where all separation is overcome and where reconciliation between God and man is achieved. Standing on the boundary between the Divine and the human, the Iconostasis reveals, by means of its Icons, the ways to this reconciliation.
A typical Iconostasis consists of one or more tiers (rows) of Icons. At the center of the first, or lowest, tier, are the Holy Doors, on which are placed Icons of the four Evangelists who announced to the world the Good News the Gospel of the Savior. At the center of the Holy Doors is an Icon of the Annunciation to the Most-Holy Theotokos, since this event was the prelude or beginning of our salvation. Over the Holy Doors is placed an Icon of the Last Supper since, in the Altar beyond, the Mystery of the Holy Eucharist is celebrated in remembrance of the Savior Who instituted the Sacrament at the Last Supper.
At either side of the Holy Doors are always placed an Icon of the Savior (to the right) and of the Most-Holy Theotokos (to the left). In addition, next to the Icon of the Savior is placed that of the church, i.e., an Icon of the Saint or Event in whose honor the church has been named and dedicated. Other Icons of particular local significance are also placed in this first row, for which reason the lower tier is often called the Local Icons. On either side of the Holy Doors, beyond the Icons of the Lord and His Mother, are two doors Deacon’s Doors upon which are depicted either sainted Deacons or Angels who minister always at the heavenly Altar, just as do the earthly Deacons during the Divine services.
Ascending above the Local Icons are several more rows (or tiers) of Icons. The tier immediately above are those representing the principal Feasts of the Lord and the Theotokos. The next tier above that contains Icons of those Saints closest to the Savior, usually the Holy Apostles. Just above the Icon of the Last Supper is placed an Icon of the Savior in royal garments, flanked by His Mother and St. John the Baptist, called the Deisis (prayer), since the Theotokos and the Forerunner are turned to Him in supplication. As these Icons (Apostles, Theotokos, and Forerunner) are arranged in order on either side of the Savior the tier is usually called the Tchin (or rank). Often this tier was to be found just above the Local Icons and below the Feast Day Icons.
The next row usually contains the Old Testament Saints Prophets, Kings, etc. in the midst of which is the Birthgiver of God with the Divine Infant Who is from everlasting and Who was their hope, their consolation, and the subject of their prophecies. If there are more tiers, Icons of the Martyrs and Holy Bishops would be placed above the Old Testament Saints. At the very top of the Iconostasis is placed the Holy Cross, upon which the Lord was crucified, effecting thereby our salvation.
As pointed out, the central place of the Iconostasis is occupied by the Holy Doors, because the Mystery of the Holy Eucharist celebrated within the Altar, is brought forth through them to the faithful. They are also called the Royal Gates (or Doors), since the King of Glory passes through them in the Holy Eucharist. Behind the doors is placed a curtain which is opened or closed, depending on the solemnity or penitential aspect of a particular moment of the Divine services.
Excerpt taken from “These Truths We Hold – The Holy Orthodox Church: Her Life and Teachings”. Compiled and Edited by A Monk of St. Tikhon’s Monastery. Copyright 1986 by the St. Tikhon’s Seminary Press, South Canaan, Pennsylvania 18459.
|
<urn:uuid:95aa0813-ad79-4fab-bb90-695448a6475e>
|
CC-MAIN-2023-50
|
https://orthodoxmontgomery.org/about-orthodoxy/the-iconostasis/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.957017 | 1,224 | 2.953125 | 3 |
Today’s world heavily depends on data as the driving force behind the economy. It is estimated that we produce at least 2.5quintillion bytes of data every day, a number you probably didn’t know existed. Data helps us find essential insights about how to improve results and increase efficiency in various aspects of life, be it in manufacturing, transportation, education, or medicine. To think of this is exciting. But, like anything exciting, there are always a few facts and untold pieces of information that could surprise even the most enthusiastic big data followers.
Data science and machine learning are often used interchangeably in trying to make sense of data. However, although related, the terms mean different things and pursue different goals. Both concepts fall within the technology field and correspond with high-earning and in-demand career paths. Although data scientists in nearly every industry apply both ideas in their work, learning the differences can help define your career decision.
Data science is not to be confused with data analysis either.
Data science vs. machine learning: the differences?
When looking at a job description, trying to figure out what constitutes a data scientist and a machine learning engineer can be confusing. The two fields are similar in that squares are like rectangles, but rectangles are not squares. Data science is the rectangle, while machine learning is the square; creating something different requires a unique skill set. Data science involves researching, building, and interpreting a model you have built, while machine learning involves producing that model. Data science uses a scientific approach to obtain meaning from data, while machine learning deals with system programming to automate and improve learning from data.
What you need to keep in mind when distinguishing the two is that data is the main focus of data science, while learning is the focus of machine learning. Data science is about all the processes of collecting, cleaning, and filtering data for evaluation, then evaluating the filtered data and building a pattern or finding similar trends, then building a model for a recommendation of the same for other users, and finally optimizing. Machine learning comes into play at the data modeling phase of the data science lifecycle. It is dedicated to understanding and building data techniques to improve performance and inform predictions.
Machine learning cannot exist without data science since the data needs to be prepared before creating, training, and testing the model. While data science helps figure out new problems, machine learning already knows a current issue and applies the tools and techniques to determine an intelligent solution. Data science is in itself a complete process, while machine learning is one of the steps in data science.
What is data science?
Data science is the study of data to establish its origin, content matter, and how it can be of benefit. It is about equipping you with how to extract meaning from complex large amounts of data. The data either be structured or unstructured, and the goal is to obtain valuable insights about business or market patterns to help inform business decisions. Data scientists are specialists who work to convert raw data into meaningful business matters. They are usually trained and skilled in algorithmic coding, data mining, machine learning, and statistics. Data science also incorporates other fields like mathematics, statistics, and computation to understand and present data.
The importance of data science
Data science is buzzing in the technology field, and it’s for a good reason. By making sense of data, we can reduce uncertainty’s horrors, which is critical for helping businesses adapt and innovate.
- Data is the most important asset you can own today, and so is the science of decoding it. However, data needs to be read and analyzed for data to be valuable, and data science makes this possible.
- Data can inform companies and organizations on how to improve customer experiences. The science of data makes it possible to unveil intelligent solutions and decisions based on trends and patterns in data.
- Data science has the power to extract insights from large volumes of data within a short time, thus increasing efficiency.
- It simplifies report making and provides accurate and reliable details.
- Data science has numerous applications today. They include anomaly detection, classification, recognition, pattern detection, forecasting, optimization, and recommendation.
Data science careers
- Data scientist – Responsible for data collection, analysis, and visualization. They can also be involved in building machine learning models.
- Data analyst – Helps to collect, clean, analyze and report data. They sometimes also track and monitor web analytics.
- Business analysts – They use data to make actionable decisions for their organizations.
- Data engineers – They are responsible for building and maintaining data pipelines. They have to set up and test ecosystems used by data scientists to run algorithms.
- Machine learning engineer – Responsible for building machine learning systems.
What is machine learning?
Machine learning studies algorithms and statistical models to determine the best fit for a problem. The field focuses on equipping computers to learn new things without being manually programmed. Instead, it is a branch of artificial intelligence that relies on algorithms to extract data and inform future trends.
We interact with machine learning daily. For example, think of social media platforms like Instagram and Facebook that gather user information based on previous behavior, then attempt to predict your interests or desires and recommend products, services, or articles relevant to you.
Machine learning is part of the data science process as a tool and concept. It helps gather information from a large amount of data more quickly and assists in trend analysis. However, unlike data science, which is a complete process, machine learning is just a single part of the entire data science process.
Importance of machine learning
Machine learning is now being implemented across various industries. It helps cut costs by allowing algorithms to make decisions based on data trends and patterns. This increases efficiency and accuracy, which could be a solution to most problems experienced when it is a human making the decision.
The use cases for machine learning range from predicting customer behaviors to forming the operating systems of essential tools and devices. For example, customer relationship management and business intelligence are today influenced mainly by machine learning. These systems rely on machine learning to identify patterns in data, recommend solutions and even identify anomalies.
Machine learning careers
- Machine learning engineer – Uses programming languages like Python, Java, and Scala to run tests on machine learning libraries. Machine learning engineers design and develop scalable machine learning models by applying machine algorithms and tools.
- AI engineer – Help build artificial intelligence development and production infrastructure and assist in implementing it.
- Cloud engineer – Responsible for building and maintaining cloud infrastructure.
- Designer in human-centered machine learning – Responsible for developing human-like systems that machines can recognize and process. The goal is to significantly reduce the need for humans to design programs for every new piece of information manually.
Computational linguists help computer systems learn how to understand spoken languages while improving on the existing systems.
Skills that you need to become a professional in these fields
- Understanding of Statistics, mathematics, and probability
- Data mining and cleaning
- Understanding of SQL databases
- Ability to use data tools like Hadoop, Hive, and Pig
- In-depth knowledge of programming languages like Python, R, and SAS
- Ample knowledge of machine learning algorithms and models
- Familiarity with structured and Unstructured data management techniques
- Skills in data visualization and data wrangling
- Computer science knowledge, including data structures, algorithms, and architecture
- good understanding of statistics and probability
- programming knowledge
- skills in data modeling and analysis
- text representation techniques
These are some of the common technical skills required to pursue a career in either data science or machine learning. You will also have to invest in some soft skills, such as good communication skills, that are essential for any employee.
Choosing between data science and machine learning
When deciding on a career path, narrowing your focus and growing your skills in a single field is always the best. However, when it comes to data science and machine learning, you cannot separate the two. Machines cannot learn without data, and data can only be processed and analyzed within data science standards. It is, therefore, inevitable to learn about both fields and how they relate to each other. Even as a machine learning engineer, you still require a working understanding of data science to improve the quality of your work. In the end, you may choose to concentrate most of your skills on only one of the fields, but since the two overlap, you afford to ignore either completely.
Overall, you cannot say one is better than the other because the two have different vital applications in the big data world. For example, data science helps you make sense of data to make better decisions and anticipate the future. In contrast, machine learning enables you to automate and increase efficiency in tasks relating to analyzing, understanding, and identifying patterns in data.
While both machine learning and data science are great career paths, the end decision is determined by your interests. For example, suppose you are enthusiastic about data, automation, and algorithms. In that case, if you do not mind spending hours a day analyzing vast amounts of data, then a career in machine learning may suit you. On the other hand, suppose you are a multi-disciplinary individual who enjoys both the technical aspect and does not mind the less exciting bit like writing reports. In that case, you could thrive more in a data science career.
For more information, visit Pathstream.
Was this helpful?
Thanks! What made it helpful?
How could we improve this post?
|
<urn:uuid:b9c6679c-5519-4620-8e1e-0f5e86bd7d95>
|
CC-MAIN-2023-50
|
https://pathstream.com/data-science-vs-machine-learning/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.935164 | 1,949 | 3.34375 | 3 |
Did Shakespeare leave Stratford-upon-Avon after a run-in with the local authorities or did he leave to pursue a literary career?
It is a wonderful conceit to imagine Will Shakespeare, the boy from sleepy Stratford-upon-Avon, the glover’s son with at most a grammar school education, turning up in London with a folio of brilliant, finished plays under his arm and becoming instantly so popular that all the other playwrights in London were jealous of him. (See The Upstart Crow in Borrowed Feathers) However, even the Bardolaters must concede that Shakespeare could not have been an instant success.
Legend has it that Shakespeare left Stratford-upon-Avon after a run-in with the local magistrate and landowner, Sir Thomas Lucy of Charlecote. According to Shakespeare’s first biographer, Nicholas Rowe, writing in 1709:
He had, by a Misfortune common enough to young Fellows, fallen into ill Company; and amongst them, some that made a frequent practice of Deer-stealing, engag’d him with them more than once in robbing a Park that belong’d to Sir Thomas Lucy of Cherlecot, near Stratford. For this he was prosecuted by that Gentleman, as he thought somewhat too severely; and in order to revenge that ill Usage, he made a Ballad upon him. And tho’ this, probably the first Essay of his Poetry, be lost, yet it is said to have been so very bitter, that it redoubled the Prosecution against him to that degree, that he was oblig’d to leave his Business and Family in Warwickshire, for some time, and shelter himself in London.
Times were tough in the years after Shakespeare’s marriage. Not only were harvests failing and food prices rising, but persecution of Catholics, led in his parts by Lucy, had redoubled and targeted Shakespeare’s Arden relatives. In such times, one can indeed imagine that a young man, trying to feed a growing family, or rebelling against persecution, might fall foul of the local authorities, though it would be a very foolhardy young man indeed who would circulate a scurrilous ballad and invite even more trouble. Apart from the tales circulating a century after his death, there is no evidence that Rowe’s story is true, nor does it reflect well on Shakespeare, especially in the eyes of the Bardolaters, who prefer to find other reasons why he left Stratford.
Some biographers, for example, have claimed that he left to escape a loveless marriage. However, whatever Will might have felt for his wife, marriage in Elizabethan times was more about familial duty and economic security than love and passion. In marrying a pregnant Anne Hathaway, Shakespeare was living up to his responsibilities as he did when he returned to her in his retirement. It is therefore not likely that he would abandon her just because he had fallen out of love with her.
The more romantically inclined biographers would like to believe that he left in order to pursue a literary career, but the very concept of a literary career would have been totally foreign to him and his community. If any resident of Stratford-upon-Avon even thought of a writer, they would think of a rich and idle courtier writing sonnets as a pleasant pastime. The professional writer was only just beginning to emerge at that time and it was a profession generally restricted to university graduates who could barely eke out a living at best, much less support a family. It was certainly not an aspiration for the son of a struggling, small-town businessman with three children to feed. Nor is it likely that Shakespeare left Stratford simply to fulfil a long held ambition to become a wandering player, a profession that offered even less means for supporting a family.
However we might discount the details of Rowe’s story, one aspect does ring true, that Shakespeare left Stratford under extreme duress. Whether we think of Shakespeare as the secular saint of the Bardolaters, or a man like any other, it is unlikely that he would have left his wife and three small children on a whim. If Shakespeare was indeed attracting unwelcome attention, he would have been a liability to his family and it would have been in their best interests that he should go far away and somewhere he could remain anonymous, such as a big city like London.
Another popular legend about Shakespeare did not come from Rowe, but was first introduced by Samuel Johnson in the preface to his 1765 edition of Shakespeare’s Plays.
In the time of Elizabeth, coaches being yet uncommon, and hired coaches not at all in use, those who were too proud, too tender, or too idle to walk, went on horseback to any distant business or diversion. Many came on horse-back to the play, and when Shakespeare fled to London from the terror of a criminal prosecution, his first expedient was to wait at the door of the play-house, and hold the horses of those that had no servants, that they might be ready again after the performance. In this office he became so conspicuous for his care and readiness, that in a short time every man as he alighted called for Will Shakespeare, and scarcely any other waiter was trusted with a horse while Will Shakespeare could be had. This was the first dawn of better fortune.
This romantic legend sees Shakespeare arriving in London, poor and friendless, so desperate to get into the theatre he is prepared to carry out the menial task of holding the patrons’ horses outside the playhouse. Was his great genius somehow recognised by one of those theatre-goers, perhaps the young Earl of Southampton himself who became his patron? Or did the impresario, impressed by Will’s persistence and patience in holding those horses in all conditions, invite him into the playhouse and one day overheard him declaiming his own verse as he plied a broom? Such images might make for sweet children’s stories, but the truth would be much more prosaic.
There is one route between Stratford and The Globe that has been noted by some biographers but little explored, a route so direct that it might well have been overlooked as too unromantic. I would argue that Shakespeare went to London, not with a portfolio of plays under his arm, but clutching a letter of introduction to London’s pre-eminent theatrical entrepreneur, James Burbage, the father of Richard Burbage. (see The Burbages: First Family of Theatre)
James Burbage built The Theatre, the first London playhouse where the Lord Chamberlain’s Men, Shakespeare’s theatre company, first performed. His elder son Cuthbert would build and manage The Globe, while his younger son Richard performed Shakespeare’s greatest roles. Since Richard and Cuthbert were Shakespeare’s artistic as well as business partners for his entire known career, it is no great stretch to suggest that he began and ended that career with them.
James Burbage began his own theatrical career as a member of Lord Leicester’s Men, and there is evidence that the company played in Stratford-upon-Avon, which was only a dozen miles or so from the Earl of Leicester’s country seat of Kenilworth. As alderman it was John Shakespeare’s duty to view all plays before they could be shown to the public so it is possible that he met Burbage in that capacity. Given his later career, as a child Will must have loved seeing the plays so we can imagine John taking him along and introducing him to the players. There is also another connection. One of John Shakespeare’s business associates in Stratford was a William Burbage. He may have been related to James and could have facilitated a meeting.
So when the Shakespeares needed to get Will out of Stratford it is conceivable that William Burbage and John Shakespeare between them came up with the plan to send him to The Theatre to work for James Burbage and learn a trade that they may have had good reason to believe would suit him.
And there is one more link. Many biographers argue that as Shakespeare knew their plays so intimately, he must have spent some time with the Queen’s Men, the country’s premier playing company. (see The Elizabethan Playing Companies) James Burbage was in an ideal position to introduce Shakespeare to the company, for not only did they play at The Theatre, their leading sharers, namely John Laneham, William Johnson and Richard Wilson, had all been Lord Leicester’s Men with him.
If Shakespeare did go straight to The Theatre when he went to London, he could have had no better entrée into the world he would make his own.
© Pauline Montagna 2015
Read More about Shakespeare and his World
Herbert Berry (edited by) The First Public Playhouse: The Theatre in Shoreditch 1576–1598, McGill-Queen’s University Press (1979)
Germaine Greer, Shakespeare’s Wife, Bloomsbury Publishing (2007)
Michael Wood, In Search of Shakespeare, BBC Worldwide (2003)
|
<urn:uuid:7c0f9d00-4e70-4eae-98f2-fe6de43a78b6>
|
CC-MAIN-2023-50
|
https://paulinemontagna.medium.com/shakespeare-goes-to-london-40ddc2e5cb97?source=post_internal_links---------3----------------------------
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.98317 | 1,908 | 2.609375 | 3 |
The struggle of learning a foreign language is not necessarily the grammar, the verbs, the vocabulary, or the writing.
The real test is the ability to SPEAK it. Live. In front of a native speaker awaiting our message.
How many say, “I understand exactly what I’m reading or hearing but I’m not able to speak it!”
Speaking is the central difficulty for many.
So it is with singing.
As one can learn intimately particular nuances of tense, active and passive voice, and the subjunctive – and still not speak well, so can those who understand the voice from the anatomical, acoustic, and physiological perspectives – and still not sing well.
Why this disconnect?
Comprehension of a subject is wonderful for tests, but we must not lose sight of the fact that to be a singer is to SING.
We can have a vast knowledge of the voice on paper, but does it translate into actual words when you’re standing in the boulangerie and want to order your favorite pain au chocolat?
We learn to sing by singing.
We learn to speak a foreign language by speaking, warts and all. We WILL make mistakes. (Fear of perfection holds people back from speaking a foreign language more readily. People are afraid of looking and sounding foolish.)
Communication is messy. So is singing.
Speaking to another is a kind of verbal performance, n’est-ce pas?
Our audience wants to know what we have to say musically, not necessarily how much we know about every usage of the passé composé.
As language is about connection and communication from one human being to another, so, too, is singing.
We must never forget that.
|
<urn:uuid:bf65f823-9c4e-453a-90a9-8ba17a5bd388>
|
CC-MAIN-2023-50
|
https://petersenvoicestudio.com/2017/03/02/oui-vous-pouvez-lire-ceci-mais-est-ce-que-vous-parlez/?replytocom=5991
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.942747 | 367 | 2.859375 | 3 |
If you’re a proud owner of a bearded dragon, you know how important it is to provide them with a balanced and nutritious diet. With so many food options out there, it’s easy to get lost in the endless possibilities of what you can or cannot feed your beardies – from Snow Peas to Pothos to Marijuana.
However, today we’ll be focusing on a particular food item, or rather a particular question, that often sparks confusion in the mind of a bearded dragon owner – can my bearded dragon eat green onion?
So, let’s get started!
Can bearded dragons have green onion?
No, bearded dragons should not eat green onions. Green onions are high in oxalates, which can lead to health issues such as kidney stones and interfere with calcium absorption in your bearded dragon’s diet.
Additionally, green onions contain sulfurous compounds that can cause irritation and digestive problems. Instead, provide your bearded dragon with a variety of safe greens and vegetables, such as collard greens, dandelion greens, and squash.
Now, let’s dive into the benefits and potential risks of feeding green onion to bearded dragons in more detail.
Potential risks of feeding green onion to beardies
While green onion can offer some benefits to your bearded dragon, there are also some potential risks to keep in mind:
- Nutritional Deficiency: Green onions lack essential nutrients such as calcium, vitamin A, and proper fat content, which could lead to malnourishment in bearded dragons.
- Chemical Toxicity: Green onions contain organosulfur compounds (such as disulfides) that can be toxic to bearded dragons, leading to digestive issues and other health problems.
- Choking Hazard: The fibrous texture of green onions can pose a choking risk to bearded dragons, especially if they are not cut into small, easily digestible pieces.
Alternatives to green onion for bearded dragons
If you’re searching for alternatives to green onion, there are plenty of other fruits, vegetables and insects that your bearded dragon can enjoy. Here are five options to consider, along with their potential benefits and how to incorporate them into your beardie’s diet:
- Collard Greens: Rich in vitamins and minerals, collard greens offer essential nutrients for your bearded dragon’s overall health and can be included as a staple part of their diet.
- Dandelion Greens: Rich in vitamins A, C, and K, dandelion greens provide essential nutrients for your bearded dragon’s overall health, supporting bone strength and immune function; they can be fed occasionally in moderation.
- Bell Peppers: Rich in vitamins A and C, bell peppers are a colorful and nutritious treat that can support your bearded dragon’s immune system and eye health when fed occasionally.
- Squash: Rich in vitamins and minerals, squash provides essential nutrients for your bearded dragon’s growth and overall health, serving as a staple in their diet.
- Crickets: High in protein and essential nutrients, crickets are a staple food source for bearded dragons, providing energy and promoting growth and overall health. They should be offered daily to young dragons and 2-3 times a week for adults.
1. Can baby bearded dragons eat green onion?
No, baby bearded dragons should not eat green onions.
2. How often can bearded dragons eat green onion?
Bearded dragons should not eat green onions, as they are toxic for them.
3. Do bearded dragons like green onion?
No, bearded dragons should not eat green onions, as they can be harmful to their health.
Other foods for bearded dragons worth checking:
- Can Bearded Dragons Eat Snow Peas?
- Can Bearded Dragons Eat Pothos?
- Can Bearded Dragons Eat Marijuana?
You can check other interesting information about your beardies by clicking here.
Also, do you have any special recipes or food tips for feeding bearded dragons? I’d love to hear from you! Share with me your beardie’s favourite in the comments below!
|
<urn:uuid:4f91ae20-b006-4895-82b4-2b69ee1c2ff7>
|
CC-MAIN-2023-50
|
https://petshandle.com/bearded-dragon/can-eat-green-onion/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.936154 | 848 | 2.640625 | 3 |
There is no denying that the Raspberry Pi Pico made a big impact back in 2021. The $4 microcontroller was quickly adopted by many of the maker communities and groups and one of those was CircuitPython. CircuitPython, a fork of MicroPython which is a version of Python 3 for microcontrollers, is backed by Adafruit who are one of the partners that launched its own RP2040 range of boards. Since its creation back in 2018, CircuitPython has seen a massive investment from the community, with many projects and libraries being ported to the language.
CircuitPython is the best means to introduce Python on microcontrollers, because it’s easy to use with devices appearing in the host OS as USB flash drives. We write our code into the code.py file and we can enable external sensors, screens and inputs via a dazzling array of libraries.
So how can we work with the Raspberry Pi Pico and CircuitPython? Typically we connect up our Pico to a PC and start writing code, but we can also build projects with a Chromebook or other Chrome OS device. With an easy-to-use programming language, cheap microcontroller and an easy-to-use OS we have the perfect platform for creativity, no matter our age or ability.
In this how to we will show you how to set up your Raspberry Pi Pico for CircuitPython, install the software to write code and communicate with your Pico, and finally we shall build a temperature sensor project.
For this project you will need
Install CircuitPython onto the Raspberry Pi Pico
1. Download the latest version of CircuitPython for the Raspberry Pi Pico. At the time of writing the latest version was 7.3.0.
2. Press and hold the BOOTSEL button on the Raspberry Pi Pico, then connect your Pico to the Chromebook via a USB cable.
3. Copy the downloaded UF2 file from Downloads to the RPI-RP2 drive in files. The process will take under a minute and when complete a new drive CIRCUITPY will appear in the Files browser.
Ideally we would have just one application which could do everything, but for now, alas we need to install two. The first is a text editor, Caret, which we can use to write CircuitPython code directly to the CIRCUITPY drive. The second is Beagle Term, a serial terminal emulator for Chrome OS.
1. Install the Caret Text Editor via the Chrome Web Store.
2. Install Beagle Term via the Chrome Web Store.
Writing our Test CircuitPython Code on Chromebook
Before we start any electronics, let’s check that we can control and communicate with the Raspberry Pi Pico. Our demo code is a simple Hello World that prints to the Python shell every second.
1. Open the Caret text editor using the Search key (the spyglass where caps lock normally resides) and type Caret. Press Enter to open.
2. Click on File >> Open and select code.py found on your CIRCUITPY drive. This drive is your Raspberry Pi Pico running CircuitPython.
3. Delete any code in the file.
4. Import the time module. We will use this to control the speed at which our code loops.
5. Create a while True loop to continually run the code within.
6. Use a print function to print “Hello World”. Note that the code is indented by one TAB keypress or four spaces. Do not mix tabs and spaces as Python will throw an error. This is a classic example of testing code. It is a simple means that we can use to confirm that we have control of and communication with a device.
7. Add a one second pause
This gives us a second to read the Hello World message.
8. Save your code to code.py. CircuitPython will automatically run the code each time we save.
Test Code Listing
import time while True: print(“Hello World”) time.sleep(1)
Using the Beagle Term Serial Emulator
To see the output of our code we need to run the Beagle Term serial terminal emulator. This app will connect to the Python console, running over a USB to serial connection. CircuitPython has a REPL (Read, Eval, Print, Loop) Python console which can be used to interactively work with the board and it can output information directly to the console.
1. Open the Beagle Term application using the Search key (the spyglass where caps lock normally resides) and type Caret. Press Enter to open.
2. Set your Port to your Raspberry Pi Pico. This is a little bit of a trial and error approach as we do not know the name of the port. In our tests we saw /dev/ttyACM1 for our Raspberry Pi Pico.
3. Set the Bitrate to 9600. This is the speed at which our Chrome OS device and Raspberry Pi Pico will communicate.
4. Set the Data Bit to 8 bit, Parity to none, Stop Bit to 1 bit, and finally set Flow Control to none.
5. Click Connect to start the serial connection to your Raspberry Pi Pico. Hello World should be scrolling down the screen. If not, press CTRL+C to stop the code running, and then press CTRL+D to restart the code.
Building a Temperature Sensor Project
The DHT22 has four pins, but we shall only need to use three of them. The sensor is relatively easy to work with. It needs 3V to power it, and the data output pin is pulled high using a 10K Ohm resistor. By pulling the pin high we ensure that the data from the sensor is read, as the pin is always “on”.
1. Insert your Raspberry Pi Pico into the breadboard so that the microUSB port is on the left side of the board.
2. Run a jumper wire from the 3V3 out (red wire) to the + rail of the breadboard. This provides a connection to the 3.3V pin to the entire + rail. Run another wire from the GND pin to the – rail.
3. Insert the DHT22 into the breadboard.
4. Connect 3.3V (red wire) and GND (black wire) to pins 1 and 4 of the DHT22. The pin numbers go from left to right, as we face the plastic “frame” of the sensor.
5. Connect the 3.3V rail to pin 2 of the DHT22 using a 10K Ohm resistor. This is our pull-up resistor for the data pin.
6. Connect the data pin (pin 2) of the DHT22 to GP15 of the Raspberry Pi Pico. Your breadboard should look like this.
Coding the Project
1. Download the CircuitPython Libraries bundle for your version of CircuitPython.
2. Go to your Downloads folder. Right click and extract the ZIP file.
3. Open the adafruit-circuitpython-bundle folder and navigate to the lib sub-folder.
4. Copy adfafruit_dht.mpy to the /lib/ folder of your CIRCUITPY drive. This library enables our Raspberry Pi Pico to work with the DHT11 and DHT22 sensors.
5. Open code.py on your Raspberry Pi Pico using the Caret text editor. Delete the test code from the file.
6. Import three modules to enable our code to access the GPIO (board), use the temperature sensor(adafruit_dht) and to control the speed of the loop (time).
import board import adafruit_dht import time
7. Create an object, dht to connect the code to the DHT22 sensor connected to GP15 on the Raspberry Pi Pico.
dht = adafruit_dht.DHT22(board.GP15)
8. Create a loop to run the code.
9. Store the current temperature in a variable called temp. The temperature is saved in Celsius.
temp = dht.temperature
10. Create an object, text and in there store a string which will print “The temperature is Celsius”. You’ll notice :>8, this is a string format which will include eight spaces in the center of the sentence. This gives us a clear space to place the temperature data.
text = "The temperature is :>8 Celsius."
11. Use the print function along with the text format to insert the temperature data into the gap.
12. Finally add a one second pause. This enables the loop to slowly repeat.
13. Save the project to code.py on your CIRCUITPY drive.
14. Open Beagle Term and connect to your Raspberry Pi Pico. You should see the temperature data scroll across the screen. If not, press CTRL + C, then CTRL+D to restart the code.
Complete Code Listing
import board import adafruit_dht import time dht = adafruit_dht.DHT22(board.GP15) while True: temp = dht.temperature text = "The temperature is :>8 Celsius." print(text.format(temp)) time.sleep(1)
|
<urn:uuid:138d6b91-ae01-4449-b509-1b12c3c11203>
|
CC-MAIN-2023-50
|
https://pharmacz.com/2022/05/29/how-to-make-circuitpython-projects-on-a-chromebook/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.825065 | 1,965 | 2.671875 | 3 |
The Label-free Promise
CEO Peter Egelberg comments the scientific article by PHI, recently published in Cytometry Part A.
Lund, May 1 2017
According to a recent study in the Journal of Health Economic, the cost of developing a new pharmaceutical has risen by over 1 300 % to a staggering 2.5 billion USD during the past 40 years, after adjusting for inflation. The cost increase is well motivated. Drugs are today more thoroughly tested and are safer than ever before. However, the spiraling (swe: skenande) cost of developing new drugs pushes pharmaceutical companies into only developing drugs for the most lucrative diseases – common chronic diseases that require life-long medication, primarily associated with aging and lifestyle. As pointed out by The Swedish Childhood Cancer Foundation (swe: Barncancerfonden) in their annual report, this leaves children and other patients with less common diseases out in the cold.
We like to believe that a life is priceless, especially a life that just began. Child cancer is rare and require special treatment, making Nelson and other children that develop cancer victims of the spiraling drug development costs. Read more about Nelson’s fate here (in Swedish). Photo: Göran Lidén, SVT
9 in 10 drugs fail
What can be done to break this alarming cost trend without compromising patient safety? At least 9 in 10 drugs tested on humans fail and never reach the market, resulting in that over 90 % of the cost of developing a successful drug is spent on preceding failures. The purpose of pre-clinical research is to predict whether a new drug will work effectively and safely in humans, before it is tested on humans and costs increase. Needless to say, there is room for improvement.
The probability of a drug reaching the market when entering the successive phases of drug development. The column color represents the time-period the drug entered into the corresponding phase. Notice how the probability of a drug successfully reaching the market when entering human testing (Phase I) dropped from 10 to 5 % during 2002–2008.
Source: “A decade of change”, Nature Reviews Drug Discovery 2012
Conventional methods used in pre-clinical research are based on chemical reagents that “label” the studied cells. However, the reagents themselves may affect the cells and their response to a new drug. When possible, scientists therefore prefer to use methods that do not require reagents, i.e. label-free methods.
An additional advantage of label-free methods is that multiple cellular characteristics can be measured repeatedly over time, as nothing is added to the cells to create a characteristic specific signal that is measured at a given point in time. Through these advantages, label-free methods have the potential of lowering drug development costs by more efficiently providing more reliable and detailed pre-clinical results.
Drug toxicity, a central part of drug development, is traditionally determined by measuring deviations in cell proliferation – the growth rate of a cell culture. However, intoxicated cells also respond by changing their size and shape. In a scientific article that was recently published, “Label-Free High Temporal Resolution Assessment of Cell Proliferation Using Digital Holographic Microscopy”, we show that HoloMonitor can measure drug toxicity more efficiently and in greater detail than conventional methods.
The small and innovative
Considering that more than 90 % of the money spent on drug development is wasted due to unreliable pre-clinical results, it is astonishing that the problem is not addressed in a structured way:
- Public funding focus on academic research, not on developing and commercializing the scientific tools that scientific advancement depends on.
- Pharmaceutical companies are staffed to develop and market pharmaceuticals, not new technology.
- The major life science tools companies purchase rather than develop new technology.
Consequently, the hope of breaking the alarming cost trend of drug development and its tragic consequences fall on small innovative life science tools companies like PHI and our investors.
|
<urn:uuid:4cbadf5d-79be-4940-9d56-44d1df960005>
|
CC-MAIN-2023-50
|
https://phiab.com/commentary/the-label-free-promise/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.942031 | 803 | 2.8125 | 3 |
Kootenay National Park
Found in open coniferous forests
Eats flying insects
Winters in Central and South America
Status: Special Concern
The olive-sided flycatcher is known for its three note whistle: "Quick, three beers!"
Canada provides summer range for the olive-sided flycatcher. This bird favours open habitats, perching in tall or dead trees and darting off to hunt insects.
The olive-sided flycatcher migrates long distances. It flies over 8,000 kilometers to winter in the Andes Mountains of South America. This makes it vulnerable to threats along its route.
Like many other song birds, flycatcher numbers are dropping.
Where to see
Look for olive-sided flycatchers near avalanche paths or old burnt forests. These birds can be spotted in the summer near tree-line along the Stanley Glacier Trail.
Why is the olive-sided flycatcher in danger?
Exactly what is causing the decline of this species is unclear. Probable threats include:
- lack of insect prey, which can be impacted by chemicals, climate change and habitat conditions, and
- loss of open habitats due to fire suppression, deforestation and other human activities.
What are we doing to help this species?
In Kootenay National park we are working to protect the summer range of this bird by:
- monitoring for breeding birds in the park
- using prescribed fire to open up the forest and provide more nesting habitat
- Date modified :
|
<urn:uuid:ede00c66-7f2b-46a0-80a6-b6174dd40e74>
|
CC-MAIN-2023-50
|
https://pks-staging.pc.gc.ca/pn-np/bc/kootenay/nature/conservation/especes-species/moucherolle-olive-flycatcher
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.916376 | 313 | 3.25 | 3 |
The name Philodendron is derived from the Greek words 'philo' (love) and 'dendron' (tree). This classic plant is one of the most popular indoor plants.
Besides being easy to maintain, the Philodendron is an air purifier.
There are about 400 species of Philodendron, a member of the arum family (Araceae). Philodendron species originate mainly from the rainforests of South America and the Caribbean. The plant was first described in 1644, but did not receive an official name until 1829. The Philodendron family is a large one, with plants of different shapes, sizes and colours. Philodendrons can be divided into two basic categories: climbing and non-climbing plants. The non-climbing plants are sometimes found in nature high up in trees. If a seed germinates in the hollow of a high branch, the plant is able to supply itself with sufficient nutrients and water through its roots.
They are fairly fast growers that form a lot of leaves, especially in spring and summer. In one year, they can have twice as many leaves.
The Philodendron can be slightly poisonous to pets and small children, so make sure that they cannot reach the plant.
The Philodendron is particularly effective in helping to clean the air we breathe. The air-purifying abilities of a Philodendron are so strong that one Philodendron can purify a 10m² room. Of course, it is no problem to place several Philodendrons (or other plants) together in this area.
The Philodendron is sometimes confused with Pothos (Epipremnum aureum) plants, but you can tell the difference by the leaves. They are similar in shape, but the leaves of Pothos are usually variegated with yellow or white speckles.
The Philodendron polypodioides needs a temperature of 18 to 25°C during the day, which may drop to 10°C - 15°C at night. In the summer, when the plant is growing well, you can keep the soil slightly moist. Usually, water twice a week. Always check the soil to see if it is not too wet. If it is, then wait a little while before watering. At colder temperatures, the plant needs less water, otherwise it may start to rot. At a warm temperature, the water will dry up quicker. Give new water when the top layer of soil feels dry. If the leaves are brown and falling off, the plant is probably not getting enough water. Hanging leaves can mean that the plant is getting too much or too little water, but they should revive once the problem is solved.
Philodendrons polypodioides grow best in medium light and bright indirect sunlight. Older leaves will turn yellow naturally. However, if you see several yellow leaves at the same time, this may be an indication that the plant is getting too much direct sun. Philodendron tolerates lower light levels, but if longer stretches of stem grow between the leaves and the plant starts to look stretched, you may need to move the plant to a brighter location.
Philodendrons are tropical plants, so higher humidity will encourage lush growth and shiny foliage. It tolerates lower humidity levels, but watering the plant regularly will help it thrive. Brown leaf tips usually indicate that humidity levels are too low.
Om rekening mee te houden:
I ordered wee begonia and anthurium, and I'm very pleased with the quality of plants and the service. The Packing was the best ever, Protective Wood Sticks So The Plant Can't Break, Wrapped with Soft Foam and Bubble Wrap in A Very Stabile Cardboard Box. I ordered on Saturday Night and Delivery to France Tok Only Until Tuesday.
The Plants Look Healthy and I'm very pleased with my purchase. Customer Service is very responsive and helpful. Thank you Claessen Team for Providing Special Plants and Very Good Service!France
I'VE Already Purchased Twice in Their Website (Monstera Variegata, Philodendron Mamei and Monstera Epipremnoides '' Esqueleto '') and the plants are simply gorgeous !!!
The Special Care They have to costumers in Answering Questions and Packaging Reflects on the High Quality of the Plants They Are Selling!
It's A Gift Buying from You! I will definitely come back again!France
I have just recedived my second order. Very Fast Delivery: Beautifully and carefully packed and just amazing plants. I am really happy with the order and look forward to placing another one soon. I would recommend them to anybody interested in Purchasing Something Different and Exciting.Glass glow
|
<urn:uuid:56c3731f-f260-4914-815c-964e7c5e0833>
|
CC-MAIN-2023-50
|
https://plantique.shop/en/products/philodendron-polypodioides-brasilien
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.929029 | 997 | 3.109375 | 3 |
The Hill House is one of Charles Rennie Mackintosh’s most significant works, one of Scotland most acclaimed buildings, and a seminal part of early 20th century European architecture. Built in 1902 for the publisher Walter Blackie and his young family, it is sited in Helensburgh, 30km west of Glasgow, and commands panoramic views south over the River Clyde estuary.
Mackintosh’s domestic masterpiece sits like a 20th-century Scottish tower house, with its roughcast walls, slate roof, asymmetrical disposition of windows, picturesque roofline, and lack of historic ornament. The house proposed a radical layout and three-dimensional spatial progression, and although the architecture was embedded in the picturesque tradition of Scottish Baronial, Mackintosh was also clearly influenced by the contemporary technological advances of Modernism happening elsewhere in Europe. This unusual hybridisation of tradition and invention in the construction of the building has led to some fundamental long-term problems of prolonged water damage that require a major conservation project to help the house survive.
Rather than incarcerate the house away from view whilst the restoration is undertaken, a more radical approach to active conservation has been taken. As an integral part of this process of conservation, which it is thought could take up to 15 years, the project proposes a ‘big-box’ temporary museum to contain and protect the Hill House as an ‘artefact’, whilst also maintaining access to the house for visitors.
The new museum’s architectural identity will be a huge, abstracted garden pavilion whose walls are covered entirely with a stainless-steel chain-mail mesh. This semi-permanent enclosure provides a basic ‘drying-room’ shelter to the original house whilst its rain-soaked existing construction is slowly repaired. This delicate enclosure also allows uninterrupted views, night- and-day, to-and-from the landscape to Mackintosh’s architectural icon. The cross-braced steel frame is designed to be grounded with minimum impact on the existing terraced-garden landscape.
Within this safe, sheltered construction working territory, the “museum” will provide a remarkable public visitor experience of the conservation in progress, achieved by an elevated walkway which loops around and over the Hill House at high level. The museum’s enclosure will also contain visitor facilities in a standalone timber building.
|
<urn:uuid:a300ac51-525c-43eb-956e-262b88d9936f>
|
CC-MAIN-2023-50
|
https://platform-0.com/groarke-carmody-the-hill-house-box-2019/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.933246 | 490 | 3.015625 | 3 |
Most people are under the impression that Ayurveda takes a longer time to heal the damaged tissue parts and restore health and hence, it may not be effective for managing acute illnesses such as allergies, food sensitivities, or poisoning.
However, this is not true. Ayurvedic treatments also involve the use of antidotes that could neutralize the toxins in the body. Here is a brief discussion about the use of ayurvedic herbs as food antidotes.
According to Ayurveda, each individual is considered a unique person made up of 5 basic or primary elements including air, water, space, fire, and earth. We derive these elements from nature. The weather or climate we live in and the food we eat are examples of the presence of these elements in nature.
|
<urn:uuid:3267b798-8736-43ec-bb85-27fbbfb848a3>
|
CC-MAIN-2023-50
|
https://prekashi.com/blogs/ayurveda
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.955733 | 161 | 3 | 3 |
Eye Allergies | Eye Care Services - Cranberry Township, Pennsylvania
Allergic conjunctivitis is the scientific name for this condition. It is caused, like any allergic reaction, by a mistaken triggering of your body's immune system. Allergens cause your immune system “panic” causing it to react negatively to things that actually pose no harm to the body at all.
Allergens such as pet dander, pollen and dust can trigger this reaction. This allergic reaction releases a chemical called histamine, which makes your eyes dry out and produce more tears. This reaction is meant to flush out foreign objects. The blood vessels in your eyes also become inflamed, which is what gives your eyes their bloodshot look.
Symptoms of Allergies
Symptoms of an allergic reaction can be quite varied. You may find that your eyes are red and irritated or itchy, that your eyes are sensitive to light or that your eyelids are swollen. In more severe cases, you may even notice a painful, sore or burning feeling in your eyes or suffer from excessive tearing or a runny nose. You may also experience sneezing and stuffy nose.
Eye allergy symptoms appear when your immune system reacts to a specific substance as an allergen. Common allergens include pollen (which leads to seasonal allergies, like hay fever), dust, perfumes, cigarette smoke, mold, pet dander, and cosmetics. In response to the allergen, your body releases antibodies into your bloodstream. In turn, these antibodies then release chemicals into your cells that lead to all the uncomfortable symptoms of an allergic reaction. The symptoms of eye allergies typically emerge very soon after you are exposed to the allergen. While your vision is not in any danger, these symptoms can be painful.
- A: Many things may cause an allergic reaction. Grass, weed, and tree pollen, as well as dust and pet dander, are among the best-known allergens. Less well known is that it is also possible for a person to be allergic to everyday items such as makeup or perfume, and even contact lenses. Also not well known is that, while it is very common for allergic symptoms to come out immediately upon contact with the allergen, it is also possible for an allergic reaction to present itself as much as four days after original contact with an allergen.
Eye Allergies Treatment At Premier Eyecare of Cranberry, Inc
Treatments for Eye Allergies
Although allergies usually stop once the allergen is removed, and the eyes return to normal, this is not always possible with allergens such as dust and pollen, since they are just about everywhere. For these and other allergies, eye doctors recommend eye drops either over the counter or prescription.
These eye drops should help to minimize the effects of the allergens in your environment. Many of these eye drops are formulated as anti-histamines, meaning that they block histamine from the body. There are also a number of other ways that these eye drops will work to relieve or prevent allergic symptoms.
Artificial tears are also an excellent option to relieve dry eye symptoms caused by allergens. These eye drops are specially formulated to imitate the tears that the allergic reaction has dried up. Artificial tears are mostly by prescription and have proven to perform better in some cases than over the counter eye drops.
How to Get Relief From Eye Allergies
An effective way to relieve ocular symptoms due to allergies is to place a cold compress gently over the eyes. When that does not do the trick, mild antihistamine eye drops generally bring relief, followed by prescription eye drops for more severe symptoms. Eye allergies are highly individual and an eye doctor must perform a thorough eye exam to determine the best, most suitable treatment.
Several other ways to reduce or relieve symptoms exist as well. Wearing sunglasses when stepping outside helps block pollen, dust, and other outdoor allergens from getting in your eyes. Contact lenses may also irritate your eyes, so try taking those out if nothing else works. Finally, never rub your eyes while experiencing an allergic reaction. No matter how much they itch, rubbing will irritate your eyes further and make things worse.
|
<urn:uuid:ed168c45-ef07-43e8-909b-b00e84f73444>
|
CC-MAIN-2023-50
|
https://premiereyecareofcranberry.com/eye-care-services/eye-conditions/dry-eye-disease-and-treatment/eye-allergies-what-they-are-and-how-to-treat-them/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.944397 | 861 | 2.859375 | 3 |
Fill out this form and get access to your Case Studies
Contract Manufacturing Services
Design for Manufacturing (DFM)
An approved prototype is an important milestone, and while your product may look ready for manufacturing, it still has a way to go.
There’s another step involved called DFM, or Design for Manufacturing, or sometimes called Design for Manufacturability. You might also see it called Design for Manufacturing and Assembly, or DFMA.
DFM is the essential, but often overlooked, step in the process where we prepare your product for manufacturing on a larger scale.
What is Design for Manufacturing?
Building a prototype is one thing, but now you need to build 100 of them, or 1,000, or more.
The process your engineers used to build your prototype was painstakingly slow with lots of trial and error.
It is not the process you will need to build your product in larger quantities.
For that, you need a manufacturing process that emphasizes product consistencies, manufacturing efficiencies and cost reduction.
DFM is your bridge to manufacturing
When your product is ready for manufacturing, you will start asking different questions, like…
- how much variability will we see in production?
- how can we produce this product more efficiently?
- how can we reduce the cost of the product?
- what manufacturing methods will we use?
- how much of an investment will we need to make in tooling?
- will the product need to be changed after a period of time?
Know your risk before you build
DFM is in part an analysis of the risk you are willing to take before you invest significant dollars in manufacturing and tooling.
One key element in that calculation is quantity – how many units of this product are you planning to build?
Quantity will help you determine whether to make significant investments in tooling and parts production.
You will be asking yourself “how far can we go in manufacturing before we start to realize this process isn’t working?”
DFM will help you answer those questions.
Let’s talk about
Product Resources CEO John Erickson and Mechanical Engineer Michael Dragonas share their insights on topics related to Design for Manufacturing, or DFM.
Go to Manufacturing Documentation –>
|
<urn:uuid:0da3a7ee-4cc3-42b1-8ca0-fb7fd831a86d>
|
CC-MAIN-2023-50
|
https://prodres.com/services/design-for-manufacturing-dfm/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.944222 | 468 | 2.640625 | 3 |
Artistic charm of Partial Revelation
The concept of partial revelation in art refers to the intentional decision by artists to leave certain elements or details of a subject partially hidden or obscured. This artistic technique creates a sense of intrigue, mystery, and ambiguity, inviting the viewer to actively engage with the artwork and use their imagination to fill in the gaps.
One of the beauties of partial revelation in art is that it stimulates the viewer’s curiosity and invites them to contemplate and interpret the artwork in their own unique way. By withholding complete visual information, artists allow for multiple interpretations and encourage viewers to actively participate in the creative process. This engagement fosters a deeper connection between the artwork and the viewer, as it requires them to bring their own experiences, emotions, and perspectives into the interpretation.
Moreover, the deliberate act of concealing or partially revealing elements can enhance the visual impact of the artwork. It creates a sense of tension, anticipation, and drama, drawing the viewer’s attention to the focal points and emphasizing the significance of the revealed details. This technique can evoke a sense of wonder, capturing the viewer’s imagination and leaving room for exploration and discovery.
Abstraction and Art Nouveau
Abstraction in art refers to the depiction or representation of subjects in a simplified, distorted, or non-representational manner. It involves reducing or removing details from the visual representation of objects or subjects, focusing more on shapes, forms, colors, and emotions. Abstraction allows artists to convey their ideas and feelings in a more subjective and expressive way, often departing from literal or realistic depictions.
While abstraction is not the predominant characteristic of Art Nouveau, elements of abstraction can be found in certain artworks of the movement. Art Nouveau artists often incorporated stylized and decorative elements, organic and flowing lines, and imaginative forms that deviated from strict realism. They embraced fluidity and symbolism, infusing their works with a sense of abstraction and dreamlike qualities.
In some Art Nouveau pieces, figures and objects may be depicted in a stylized or abstracted manner, emphasizing the artist’s subjective interpretation rather than strict representational accuracy. The emphasis on graceful curves, ornamental motifs, and harmonious compositions often results in a departure from literal representation and a move towards more abstracted and symbolic imagery.
Create a new Art Nouveau artwork with prompt
In the world of art, the beauty and intricacy of a painting can transport us to a realm of wonder. In this prompt, we envision a picture of a woman adorned with flowers in her hair, captured in an ultrafine detailed painting inspired by the legendary artist Alphonse Mucha. This artwork embraces the essence of Art Nouveau, a movement characterized by its organic forms, intricate details, and harmonious compositions:
Drawing inspiration from Alphonse Mucha, a renowned artist associated with the movement, serves as a guiding influence, his distinct style and vision shaping the creation.
The central focus of the painting is the woman, her hair adorned with carefully placed flowers. The ultrafine detailing in the artwork brings forth a sense of delicacy and meticulous craftsmanship, highlighting the beauty of each petal and leaf. The flowers serve as a symbolic connection to nature, evoking themes of beauty, femininity, and the ephemeral qualities of life.
As we delve into the world of Art Nouveau, the surrounding plants create a lush and immersive environment. They intertwine with the woman’s presence, further enhancing the organic nature of the composition. The intricate details of the plants, their graceful curves and flowing forms, add depth and dimension to the overall painting.
This ultrafine detailed painting invites us to appreciate the beauty found in the smallest details. The precise brushstrokes and attention to intricacy capture the essence of Alphonse Mucha’s style while adding a contemporary touch. The blending of classic Art Nouveau elements with modern artistic sensibilities creates a harmonious fusion that breathes new life into the genre.
By utilizing AI image generators like DALL-E and Stable Diffusion, we can transform this vision into a tangible reality. It can then be shared and appreciated by others. Whether through exhibitions, online platforms, or personal collections, the artwork becomes a source of inspiration and delight for art enthusiasts. Additionally, with design tools like Visual Paradigm Online, further customization and creative exploration can be undertaken, allowing for endless possibilities to enhance and personalize the image.
|
<urn:uuid:c143b194-78af-4ab1-9b67-888f9354175a>
|
CC-MAIN-2023-50
|
https://promptify.cc/art/a-picture-of-a-woman-with-flowers-in-her-hair-5/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.907311 | 914 | 2.84375 | 3 |
New petrographic observations and stable isotope data help reinterpret the complex sedimentology of the Albian–Cenomanian boundary exposed in the famous red and white chalks of the cliff section at Hunstanton in Norfolk, UK. Thin-section analysis of a prominent crust at the top of the Hunstanton Red Chalk Formation reveals fossil microstructures attributable to the microbe Frutexites. These Red Chalk microstructures are less bushy that Frutexites sensu stricto, and poor preservation, in part caused by later diagenetic iron migration, means they are identified only tentatively as Frutexites. Stable oxygen isotope values from the crust are similar to those from early diagenetic nodular chalks immediately below the crust, and to partially altered chalks elsewhere in Norfolk. The δ18O data are interpreted as Albian seafloor depositional values albeit slightly altered by subsequent meteoric diagenesis. The microbial affinities of Frutexites are not yet proven; thus, the presence of Frutexites alone is not diagnostic of either photic zone or deep-water sedimentation. However, the presence of Frutexites(?) suggests that the red colour of the Hunstanton Red Chalk is due, at least in part, to the mediation of iron-fixing microbes in the accumulating chalk sediment at a dysoxic–anoxic interface. Centimetre-scale columnar and nodular structures above the ‘Frutexites crust’ that project upwards into the basal Paradoxica Bed of the overlying Ferriby Chalk Formation are sites of localized syndepositional iron staining. These nodules are not stromatolitic or microbial and are not evidence for deposition in shallow-water or intertidal settings.
|
<urn:uuid:b0dfd3b5-0c06-40f1-95e3-282dd14ce709>
|
CC-MAIN-2023-50
|
https://pubs.geoscienceworld.org/geolmag/article-abstract/152/1/1/261122/Microbial-crust-with-Frutexites-and-iron-staining?redirectedFrom=fulltext
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.87906 | 376 | 2.703125 | 3 |
While several important biochemical steps have been observed to occur in basophils and mast cells, there remain some very important links to be established. Notably, it is important to understand the exact role of the IgE receptor and the need for its aggregation. The description of the GTP-binding protein involved in IgE-mediated signal transduction is necessary, as is a description of the proteins involved in calcium movement. Control mechanisms remain unclear, and the length of the signal transduction pathway has yet to be defined. Much of the data points to multiple requisite pathways, and yet only calcium elevations have a relatively well-demonstrated pro-degranulatory role. Until some of these events are understood in detail, the means by which cell sensitivity is regulated may remain a mystery. Finally, it will be important to determine if mast cells and basophils use distinctive IgE-mediated signal transduction pathways.
|Original language||English (US)|
|Number of pages||27|
|State||Published - 1992|
|
<urn:uuid:5263d740-e3cb-4352-b6f2-6b56c04468c9>
|
CC-MAIN-2023-50
|
https://pure.johnshopkins.edu/en/publications/signal-mechanisms-in-the-activation-of-basophils-and-mast-cells-4
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.942913 | 208 | 2.53125 | 3 |
To explore the potential for nontoxic crop protection technologies based on the inhibition of fungal spore adhesion, we have tested the effect of synthetic zosteric acid (p-(sulfo-oxy) cinnamic acid), a naturally occurring phenolic acid in eelgrass (Zostera marina L.) plants, on spore adhesion and infection in two pathosystems: rice blast caused by Magnaporthe grisea and bean anthracnose caused by Colletotrichum lindemuthianum. We have shown that zosteric acid inhibits spore adhesion to model and host leaf surfaces and that any attached spores fail to develop appressoria, and consequently do not infect leaf cells, Low concentrations of zosteric acid that are effective in inhibiting adhesion are not toxic to either fungus or to the host. The inhibition of spore adhesion in the rice blast pathogen is fully reversible. On plants, zosteric acid reduced (rice) or delayed (bean) lesion development. These results suggest that there is potential for novel and environmentally benign crop protection technologies based on manipulating adhesion.
- Plant Sciences
|
<urn:uuid:109f3e7b-9ecd-4724-b6be-753601996f42>
|
CC-MAIN-2023-50
|
https://pure.uhi.ac.uk/en/publications/inhibition-of-fungal-spore-adhesion-by-zosteric-acid-as-the-basis
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.877169 | 239 | 2.65625 | 3 |
I was inspired to tackle this rather controversial topic of after reading the following CNN article.
One of the most important New Year’s resolutions every parent should make for 2019 is to ensure everyone in the family spends less time with screens. Since last year, a number of new studies have confirmed that the effects of technology on kids are even worse than many parents feared.
As a parent and primary classroom I do recognize the importance of being present in our kids lives and I do need to put my phone away more often.
How much screen time is OK for students?
We all know that kids are spending more time with screen media than ever before. But there
The answer is, Yes, it can be if there is
As screens and Information and Communication Technology in classrooms is novel phenomena and the recommendations are a-changing. The American Academy of Pediatrics (AAP) used to recommend no TV or screen
The AAP ‘s new guidelines, released in October 2016, allow for some screen time for children younger than 2 and emphasize parental involvement for all kids. In a nutshell:
- Avoid use of screen media other than video-chatting for children younger than 18 months.
- If you choose to introduce media to children 18-24 months, find high-quality programming and co-view and co-play.
- Limit screen use to 1 hour per day of high-quality programs for children age 2 to 5 years.
- Create a family media plan with consistent rules and enforce them for older kids.
The reality is that most families will go through periods of heavy and light media use, but, so long as there’s a balance, kids should be just fine.2016_csm_technology_addiction_executive_summary
What are the implications then for learning and especially the use of technology in the classroom? For myself the most important question is :
Are some types of screen time better than others?
Short answer: “Yes they are”
The Common Sense Census: Media Use by Tweens and Teens identifies four main categories of screen time.
- Passive consumption: watching TV, reading, and listening to music
- Interactive consumption: playing games and browsing the Internet
- Communication: video-chatting and using social media
- Content creation: using devices to make digital art or music
As an educator I am interested in the last two categories.
What New Research on Kids’ Media Use Means for Teachers
And, although there’s nothing wrong with a little mindless entertainment, we can maximize our
Communication. lets our students learn how to best convey their ideas
Critical thinking. is all about posing and solving problems
Creativity. teaches our students to think outside the box
Collaboration. shows our students how to work together to achieve a common goal
Here are some Common Sense guidelines
- Give kids meaningful things to do on their devices.
- Capitalize on tools that promote higher-order thinking and learning.
- Look for platforms that encourage digital creation, online collaboration, communication beyond the classroom, and new perspectives for critical thinking.
- Set appropriate boundaries for in-class device use.
- Find the right middle ground for you and your students, and make these boundaries clear.
- Consider the needs of your classroom as a whole, and differentiate boundaries for students with specific learning differences.
- Build lessons that have a predictable flow of tech and nontech activities.
- Incorporate both screen-based and traditional activities in your daily lessons.
- Consider taking “tech breaks” — a time when students can check their devices.
- Or if you’re using tech a lot, make sure to build in device-free activities.
Together we can create a balanced Media Plan that will benefit learning at school and Family time home
Family Media Plan
Media should work for you & work within your family values & parenting style. When media is used thoughtfully & appropriately, media can enhance daily life. But when used inappropriately or without thought, media can displace many important activities such as face-to-face interaction, family-time, outdoor-play, exercise, unplugged downtime & sleep.
By creating a Personalized Family Media Use Plan, you can be aware of when you are using media to achieve your purpose. This requires parents & users to think about what they want those purposes to be. The tool below will help you to think about media & create goals & rules that are in line with your family’s values.
|
<urn:uuid:8699ebf9-9128-4bbc-a598-c7fee851833f>
|
CC-MAIN-2023-50
|
https://pypcoordinator.the-ism.de/balancing-our-screen-time/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.92648 | 931 | 3.4375 | 3 |
Instructional design models are a systematic approach to designing and developing instructional materials. There are many different types of instructional design models, each with its own unique set of characteristics that make it appropriate for certain situations or contexts. The most common types include the ADDIE model (Analysis-Design-Development-Implementation-Evaluation), Dick & Carey Model (Systems Approach to Instruction Design) , Kemp’s Cognitive Task Analysis Model, Gagne’s Nine Events Of Instruction and Merrill’s First Principles Of Instruction .The ADDIE model is one of the oldest instruction designs in use today; it focuses on breaking down tasks into smaller components so they can be better understood by learners. This process involves analyzing learner needs, creating objectives based on those needs, designing activities around them and then evaluating their effectiveness after implementation has been completed. The Dick & Carey Systematic Approach To Instuction Design uses an organized problem solving strategy which emphasizes analysis before any development takes place as well as continual evaluation throughout all stages from start to finish; this helps ensure quality control over every step taken during course creation or revision processes..Kemp’s Cognitive Task Analysis Method looks at how people learn best through understanding cognitive structures such as goals strategies schemas etc.; this type of learning often requires more time but results in deeper knowledge acquisition due to increased comprehension levels achieved along the way..Gagne’s Nine Events Of Instructions outlines nine specific steps necessary when constructing effective lessons: gain attention provide relevant background present stimuli elicit performance give feedback assess performance enhance retention generalize transfer evaluate outcomes Each event must be carefully planned out ahead
of time if desired results are expected upon completion while also taking into account individual differences among students who may have varying levels skill sets prior experiences interests motivations etc…Merrill first principles focus heavily on behaviorism theory stating that behaviors should only change once new information is presented learned practiced reinforced applied evaluatedetc., making sure content remains engaging interesting meaningful applicable relatable memorable accessible contextualized motivational stimulating enjoyable entertaining creative interactive practical hands -on collaborative fun rewarding challenging productive innovative adaptive flexible customized user friendly comprehensive authentic timely realistic achievable purposeful worthwhile valuable holistic integrated dynamic transformative progressive inspiring successful insightful beneficial impactful positive life changing empowering motivating energizing liberating enlightening revolutionary expansive transformational thought provoking visionary encouraging inspirational groundbreaking remarkable ground shaking captivating eye opening powerful iconic legendary awe striking astonishing astounding incredible mind blowing miraculous majestic magical breathtaking stupendous prodigious unprecedented spectacular unbelievable extraordinary fabulous phenomenal superlative unrivaled unequaled unparalleled amazing sensational staggering splendid sublime marvelous wondrous peerless incomparable matchless unbeatable fantastic dazzling magnificent outstanding superb grand glorious divine tremendous awesome epic monumental
Instructional design models are frameworks used to organize and structure the process of creating effective instruction. The most common instructional design models include ADDIE, SAM, AGILE/Lean Development Model, Rapid Prototyping Design Model (RPDM), 4C-ID model and Backward Design. Each model has its own unique characteristics that make it suitable for different types of learning situations; however all have a few basic elements in common: analysis phase which involves identifying learners’ needs or goals; designing phase where objectives are developed based on those identified needs or goals; development stage when content is created according to the designed objectives from previous step ; implementation stage when materials produced during development phase get delivered using appropriate media tools such as online courses etc.; evaluation & revision cycle – this last part ensures continuous improvement by monitoring effectiveness of instruction through assessment data collected throughout delivery period . Depending upon specific project requirements any one can be chosen among these six popular ID Models but understanding their differences will help choose right one more efficiently thus ensuring successful completion within given time frame while meeting desired outcomes.
|
<urn:uuid:5c0edc26-b74c-448f-930e-fc86553ab3cf>
|
CC-MAIN-2023-50
|
https://ravindertulsiani.com/understanding-and-applying-different-instructional-design-models/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.88766 | 742 | 3.71875 | 4 |
Dental implants from an implant dentist in Framingham are designed to last for decades. That’s because they’re crafted from medical-grade materials that are not only strong but exceptionally lightweight. Modern dental implants are indistinguishable from natural teeth.
How Dental Implants Are Created
Dental implants are made up of three separate components. These include the fixture, the abutment, and the restoration itself. Here’s how they fit together:
- The fixture. This is what gives the implant its remarkable strength. It consists of a tiny titanium fixture that sits beneath the gum line and fuses to the bones in your jaw, just like the roots of a natural tooth. Dentists use titanium for this purpose, the same metal used to make airplane wings.
- The abutment. This is what joins the fixture to the restoration itself. It’s added after the fixture fuses to the underlying bone through a natural process called osseointegration.
- The restoration. Sometimes called the “prosthesis,” this is the artificial tooth, denture, or bridge that serves as the visible tooth. It’s made from a mixture of ceramic and other materials.
How Dental Implant Therapy Works
Dental implant therapy occurs in stages. The first step is to emplace the fixture. Like any other form of dental surgery, this is performed using anesthesia and sedatives for your comfort.
The dentist will place the fixture underneath the gum line and close the surrounding tissue over the area of treatment. A waiting period of 2-3 months normally follows this phase. This is to allow the surrounding bone to fuse with the fixture.
During your second visit, the dentist will place the abutment. He or she may also place the restoration itself at this time. Once it’s ready, you’ll be ready to show off your fully restored smile to the world.
Taking Care of Your Dental Implants
Dental implants require only the same care you should give to your natural teeth. This includes daily brushing and flossing, eating a nutritious diet, drinking alcohol only in moderation, and avoiding tobacco and vaping products of all kinds.
How Long Do Dental Implants Last?
Giving a precise answer to this question is difficult, since each patient is unique. A good rule of thumb, however, is to expect dental implants to last from 20 years to a lifetime with reasonable care. Some factors that can affect this estimate include the patient’s overall health and lifestyle choices.
Dental implants in Framingham are a chance at a new life. What happens after they’re in place is largely up to you. The better you take care of yourself, the more likely they are to go the distance.
Your dentist will be glad to give you helpful tips on making the most of the restoration. Talk to him or her about implants and other restoration options during your next appointment. Whichever option you ultimately choose, we wish you nothing but the best as you open a new chapter of your life.
About the Author
Dr. Marianna Gaitsgory earned her DMD degree from the Goldman School of Dental Medicine at Boston University. Her diverse range of training and experience gives her the ability to treat a wide array of dental problems. You can reach her office online or by calling (508) 875-0900.
Comments Off on An Implant Dentist in Framingham Explains How Dental Implants Are Put Together
|
<urn:uuid:6930a977-9f9c-4084-b49d-396727911ab3>
|
CC-MAIN-2023-50
|
https://rochesterdentiste.com/an-implant-dentist-in-framingham-explains-how-dental-implants-are-put-together/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.929725 | 720 | 2.703125 | 3 |
Looting has become an increasingly popular concept in South Africa as an unsophisticated interpretation of ownership by “force” of property during periods of mayhem. However, looting is a complex concept whose origin spans a long history that cuts across time and space. In The Afrocentricity Trajectories of Looting in South Africa, edited by Mfundo Masuku, Dalifa Ngobese, Mbulaheni Obert Maguvhe, and Sifiso Ndlovu, contributors provide sophisticated analysis on the concept of “looting” and address nuances in the concept of looting, looking at links to spiraling inequality and poverty, racialization of property ownership, and skewed access and benefits of economic policies. As shown in this collection, looting has taken on a variety of political meanings: a challenge to the violence of racial capitalism, an alternative and accelerated path to justice, and a way to call attention to the reality of racial violence that is often ignored by the media, to name a few. This volume provides a critical analysis of looting from a multi-disciplinary approach that focuses on a combination of themes to show that looting is deeply rooted in property “ownership” and spiraling poverty and inequality that is structural in nature.
Mfundo Mandla Masuku is associate professor of built environment and development studies at the University of KwaZulu-Natal.
Dalifa Ngobese is senior lecturer of culture and heritage studies and program leader at the University of Mpumalanga.
Mbulaheni Obert Maguvhe is professor of inclusive education at the University of South Africa.
Sifiso Ndlovu is lecturer of political science at the University of Mpumalanga.
Chapter 1: Alooter Continua! : Tracing Historical Trajectories of Looting from Pre-colonial, Colonial and Postcolonial in South Africa
Chapter 2: Looting of Indigenous Knowledge Systems through Patents and Intellectual
Dina Mokgadi Mashiyane
Chapter 3: The Nexus of Land Dispossession and Food Insecurity in Contemporary South Africa: The Vicarious Consequences of Land Looting Institutionalized through the Natives Land Act 27
Mfundo Mandla Masuku, Mbongeni Shadrack Sithole and Bhekani Ngwenya
Chapter 4: Criminalising Looting and the Quest for Social Justice in Post-colonial South Africa: Perspectives from Twitter data
Kemist Shumba, Kutenda Trinos and Nirmala, D. Gopal
Chapter 5: Unemployment as an Instigator of Looting
Tawanda Majoko and Annah Dudu
Chapter 6: An Appraisal of South Africa’s July Civil Unrest through the Lens of Frustration-Aggression Theory: The Case of KwaZulu-Natal Province
Chapter 7: Looting and Unrest after Former President Zuma’s Incarceration: Politics of Belonging and Entitlement to Property Ownership in South Africa
Chapter 8: A Critical Reflection on Inequalities and Poverty as an Instigator of Looting in South Africa
Mfaniseni Wiseman Mbatha, Mandla A. Mubecua, Victor H. Mlambo and Philangani Sibiya
Chapter 9: Ubuntu Philosophy: Understanding Inequalities, Poverty as an Instigator to Looting
Chapter 10: The Looting Culture and its Value in the Transformation of Higher Education
Primrose T. Sabela
Chapter 11: Looting, Wealth, Security, and Prestige: Detailed Modern Schemes for Education Oppression and Exclusion
Mbulaheni Obert Maguvhe
Chapter 12: The Impact of Looting in the South African Tourism Sector
Lombuso Precious Shabalala
"This book is informed about the ground-breaking issues which the majority of contemporary South Africans would like to hear. This much-sought information may give some of the answers to the questions that many South Africans want to know. It is my honest pleasure to articulate that this is one long-overdue book."
"This book is historically significant. It cannot be read outside the biggest and economically devastating 2021 July social unrest that took place since the founding of democracy in South Africa. At the time, media houses out-competed each other in showing massive looting that took place. Discerning coverage focused however on the root causes. For a country that had become a poster child of global inequality, rife with racial tension, communal mistrust, injustice, and corruption, this was a disaster waiting to happen. Unlike many descriptors that characterize looting as mere petty theft of and ransacking of goods, as was seen in the unrest, this book goes deeper by locating South Africa’s challenge to its colonial past. It is in this past that a grotesque form of looting took place in the form of land grab, slavery, and the uprooting of African communities, the continuing spiriting away of Africa’s minerals and precious minerals. To that extent, this book should serve as a shock therapy that should galvanize us to seek deeper and more sustainable solutions to the continental challenges of our time."
|
<urn:uuid:7b8f5109-7f61-4972-b8cb-479c990cf1e2>
|
CC-MAIN-2023-50
|
https://rowman.com/ISBN/9781666919912/The-Afrocentricity-Trajectories-of-Looting-in-South-Africa
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.927541 | 1,072 | 2.515625 | 3 |
The development of Communist rule in the Soviet Union
The Bolshevik Revolution of 1917 did not result in an instant switch to a Communist State in Russia. The system of Communist government developed over a period of time, and changed for a number of reasons. The developments are closely related to economic changes that were introduced. These are outlined below.
1917 – 1921: War Communism
Following the seizure of power in 1917, the Bolsheviks were engaged in a Bloody Civil War. In areas that they controlled, the Bolsheviks introduced ‘War Communism’ to meet the needs of the Red Army. War Communism was a system of centralising ordering, purchasing and the deployment of workers. It also prohibited profiteering and meant that the government was in control of the economy. This was necessary in order to make sure that the troops could be supplied with weapons and food, and it also made sure that the new Bolshevik government was firmly in control of areas that it had seized in the revolution.
However War Communism had many faults. It was a massive change from the pre-revolutionary system and the economy struggled to meet the demands of the Bolshevik leaders. In 1921 the Bolshevik leader, Lenin, introduced a New Economic Policy. This was a move away from Communism in many ways, but was felt to be neccessary for several reasons.
1921 – 1928: New Economic Policy
In 1921 Lenin said that Russia was not civilised enough for socialism to work. Russia was very large, had a massive peasant population and War Communism had struggled. If Socialism was to gained in the medium term, some elements of capitalism were required in the short term to ensure that the country was in an economic position where socialsm was viable.
The NEP allowed some private enterprise, particularly in the agricultural markets. Instead of the government taking surplus crops, farmers were allowed to sell it. This greatly increased production of food in the early years of the NEP. Many elments of the industrial sector remained under the control of the government under the NEP. Industrial growth was nowhere near as impressive as the improvements in Agricultural productivity though, and this led to price rises.
The NEP was criticised by many Bolsheviks. It allowed private enterprises and meant that the state was reliant on indivuduals or compaies making profits. This was very much against the ideology of Socialism. The NEP did however result in productivity levels rising back to levels similar to pre-war figures, increased economic stability in the country and ensured that there was food on the tables of city dwellers.
1928 – 1941: Five Year Plans and Collectivisation
In 1928 the New Economic Policy was replaced with a Five Year Plan. Stalin argued that ‘either we do it, or we are crushed,’ as Soviet industry lagged well behind the Western European states in terms of productivity and qality. The Five Year Plans created targets for all sectors of Industry. These were set and monitored by central government with a view to improving the industrial capacity of the Soviet Union. The Industrial targets involved heavy investment in mining and the extraction of raw materials from Russia’s vast interior. It required massive movement of workers to sites designated as being primae areas for production of specific items and it meant an end to profit based prodction in factories and on farms. Farming also changed as part of this policy. From 1928 onwards farming was collectivised. This involved closing small holdings and combining them into massive, mechanised farms that were state controled. These should be more efficient, would lead to better education, training and use of technology and were intended to increase productivity and efficiency. Ideologicaly they were also more in line with socialism as the benefits of the new system would be felt by all.
1941 – 1945: Great Patriotic War
The invasion of the USSR by Nazi Germany led to a return of war communism. Everything was geared to the successful defence of the Soviet Union and the eventual defeat of the Nazi enemy. Factories were transformed in order to produce the tanks, aircraft and ammunition required to fight and defeat the enemy. The use of local, regional and national party structures at this time is a very clear indication of how far communist rule had developed. Almost everything could be coordinated through party structures, from the transfer of men and women from factories t fighting units through to the passing on of information, changes in production orders and the enforcement of law.
The Party, military and society were purged on several occasions. The reasons vary but in general terms the purges were designed to strengthen the party leaderships position. Some of the purges were very large. They went as high up as members of the Politburo, with several being imprisoned, exiled or murdered. The purges of the military are widely seen as one of the reasons why the Red Army was overrun so quickly when Operation Barbarossa was launched. Stalin was planning further purges right up until his death.
Post-Stalin: Khrushchev’s ‘Thaw’
Stalinism had a mantra of Socialism in one country. When Khruschev became leader he reversed this. He argued that Leninism did not advocate that. He was quick to alter relations with other communist countries. Dissenters were freed from the gulags in their thousands. Communism under Khruschev was designed to be more open. An element of consumerism was brought into the economy. Trade with other nations developed. This did open a political rift between those who advocated the new approach (or old, if seen as a return to Leninism) and those who were supportive of Stalinism. Much of the collective ideal was abandoned. Housing was no longer constructed in a collective manner.
Khruschev was swept from power and replaced by Leonid Brezhnev. Brezhnev was ‘old school’. He did away with many of the reforms introduced by Khruschev. Yet, in many ways, not a lot actually changed. The Soviet Union was struggling to keep up with other major powers economically at the time. Rule was firm, change was minimal.
Gorbachev. Perestroika, Glasnost and open dissent
Mikhail Gorbachev attempted to energise the Soviet Union. His politburo was younger. His ideas aimed at securing the future of the USSR by adopting some western methods. The state and party needed to catch up. Technologies were advancing rapidly elsewhere. Threats to the party came from new sources. Gorbachev’s ideas were to promote discussion and debate. Censorship would be reduced. The press could report more freely. Dissidents were released from their internal exile. Gorbachev wanted to make elections more democratic. The old guard did not. A compromise was reached: Any Communist Party member could stand in elections. It heralded a one party democracy. The idea was short-lived. The Soviet Union was rocked by dissent and moves to leave the union from several member states within months of Gorbachev’s appointment. His term of office was 1985 to 1991. He became highly popular in the west. At home, he oversaw the final days of the Soviet Union.
Marxist Internet Archive – A History of the Communist Party to 1939. From the JV Stalin Library.
AlphaHistory – Narrative History of Communist Russia. Ends with Stalin which is a little disappointing but otherwise a very useful write up.
|
<urn:uuid:4206320b-7f33-433a-8216-2bae851e9cae>
|
CC-MAIN-2023-50
|
https://schoolshistory.org.uk/topics/european-history/russia-soviet-union/development-of-communist-rule/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.985443 | 1,505 | 3.453125 | 3 |
NASA’s Division of Biological and Physical Sciences (BPS) uses the spaceflight environment to study phenomena in ways that cannot be done on Earth. BPS research is focused on two priorities: quantum science and space biology investigations that enable us to Thrive In DEep Space (TIDES).
In 2020, NASA transferred administrative oversight of NASA’s biological and physical sciences research from the Space Life and Physical Sciences Research and Applications (SLPSRA) Division in the Human Exploration and Operations Mission Directorate into the Science Mission Directorate (SMD), a NASA directorate organization that pursues outstanding science and understands its potential application to future exploration missions.
The mission of BPS is two-pronged:
- Pioneer scientific discovery in and beyond low Earth orbit to drive advances in science, technology, and space exploration to enhance knowledge, education, innovation, and economic vitality
- Enable human spaceflight exploration to expand the frontiers of knowledge, capability, and opportunity in space
Execution of this mission requires both scientific research and technology development.
BPS administers NASA’s:
- Space Biology Program, which solicits and conducts research to use the space environment to advance our knowledge of how gravity affects the design and function of living organisms, and to understand how biological systems accommodate to spaceflight environments.
- Physical Sciences Program, which solicits and conducts research using the space environment as a tool to provide transformational insights in physics and engineering science, and to understand how physical systems respond to spaceflight environments, particularly weightlessness and the partial gravity of planetary bodies.
- Commercially Enabled Rapid Space Science project (CERISS), which will develop transformative research capabilities with commercial space industry to dramatically increase the pace of research.
BPS partners with the research community and a wide range of organizations to accomplish its mission. Grants to academic, commercial, and government laboratories are the core of BPS’s research and technology development efforts. All BPS solicitations are issued through NSPIRES and all awards are described and results tracked in the Task Book: Biological and Physical Sciences Division and Human Research Program. Partnerships with other NASA organizations, other government agencies, industry and international partners provide access to a broad range of experimental platforms, involvement of a diverse set of experts, and translation of results to a wide community.
BPS research and technology development is conducted on a wide range of experimental platforms including ground-based analogs for spaceflight, drop towers and aircraft that provide seconds of weightlessness, to free-flyer satellites. The International Space Station (ISS) is a critically important United States facility that provides researchers the ability to conduct long-duration experiments in low Earth orbit. ISS allows continuous and interactive research similar to Earth-based laboratories, enabling scientists to pursue innovations and discoveries not currently achievable by other means. BPS is also planning research and technology development to enable human spaceflight and scientific discovery beyond low Earth orbit.
BPS strives for broad involvement of the research and technology development communities in the formulation and dissemination of its work. BPS typically solicits for teams of investigators for spaceflight investigations to maximize the scientific benefit derived from the experiments. BPS also emphasizes the importance of archiving data, metadata, computational tools, and samples after spaceflight experiments to enable future experiments. The Life Sciences Data Archive, GeneLab, and Physical Sciences Informatics database are the principal repositories.
|
<urn:uuid:2f1beeca-3386-472a-813b-d5056d5587bb>
|
CC-MAIN-2023-50
|
https://science.nasa.gov/biological-physical/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.893543 | 690 | 2.96875 | 3 |
Sneaky parasitic weeds may steal genes from the plants they are attacking and use those genes against the host plant, according to a team of scientists.
In a study, researchers detected 52 incidences of the nonsexual transfer of DNA—known as horizontal gene transfer, or HGT—from a host plant to members of a parasitic plant family known as the broomrapes, said Claude dePamphilis, professor of biology, Penn State. The transferred genes then became functional in the parasitic species. Although considered rare in plants and other complex species, HGT may thus occur in some parasitic plants, an insight that could lead to better methods of controlling parasitic plants that threaten agriculture, he added.
“These parasitic plants that we study from the broomrape family include some of the world’s most devastating agricultural weeds,” said dePamphilis. “The HGT discovery is really part of our effort to try to better understand how parasitic plants work and how we can better control them. Our hope is that we can use this information to find the best strategies to generate, or breed, resistant host plants.”
The researchers, who released their findings Oct. 24, 2016, in the Proceedings of the National Academy of Sciences, suggest that the transfer could boost the parasitic plant’s ability to invade their hosts and overcome defenses the host creates to try to ward off attacks. HGT may also help reduce the risk of infection for the parasites.
While horizontal gene transfers in less complex species, such as bacteria, are common, most evolution in more complex organisms is driven by the sexual exchange of DNA, along with mutation and natural selection. However, the researchers suggest that the close feeding connections of parasitic plants with their hosts may increase the chances of intact genes traveling from the host to the parasite’s genome where it can quickly become functional.
“Parasitic plants seem to have a far greater rate of horizontal gene transfer than non-parasitic plants and we think this is because of their very intimate connection with their host,” said dePamphilis.
The roots of the parasite contact and enter the host, and then begin extracting water, sugars, mineral nutrients and even nucleic acids, including DNA and RNA, he added.
Farmers throughout the world struggle with these types of parasitic plants, which are so numerous in some areas of the world that they become a major source of crop loss. In Sub-Saharan Africa, for example, Striga—or witchweed—is one of the most damaging sources of agricultural loss, according to dePamphilis.
To detect HGT in the plants, the researchers used data generated by their collaborative research effort funded by the U.S. National Science Foundation—the Parasitic Plant Genome Project—to generate evolutionary histories for thousands of genes in the parasitic plants, said dePamphilis.
The researchers focused on transcriptomes—expressed gene sequences—of three parasitic plants: Triphysaria versicolor, also called yellowbeak owl’s-clover; Striga hermonthica, or giant witchweed; and Phelipanche aegyptiaca, called Egyptian broomrape, as well as the nonparasitic plant Lindenbergia philippensis, and genome sequences from 22 other nonparasitic plants.
Because the researchers considered mRNA, which can move between hosts and their parasites, as a possible source of the transfers, they tested and re-tested the data to rule out the experimental host as the source of the genetic material. Instead, they found that the foreign sequences had been derived from entire genes of past host plants and incorporated into the parasitic plant genomes.
Future research may investigate the mechanism of horizontal gene transfer to help engineer improved plant defenses against parasitic attacks, dePamphilis said.
Primary authors along with dePamphilis are Zhenzhen Yang, postdoctoral scholar in biology at Penn State and Yeting Zhang, former doctoral student in genetics at Penn State and now a postdoctoral fellow, Rutgers University. The researchers also worked with James H. Westwood, professor of plant pathology, physiology and weed science and Christopher R. Clarke, postdoctoral research fellow, both of Virginia Tech; John I. Yoder, professor of plant sciences and Siming Liu, postdoctoral scholar, both of University of California Davis; Michael P. Timko, professor of biology and Chun Su, graduate student in biology, both of University of Virginia; Eric Wafula, bioinformatics programmer, Loren A. Honaas, postdoctoral scholar in biology, now at the U.S. Department of Agriculture, Huiting Zhang, doctoral student in plant biology, Sam Jones, doctoral student, plant biology, Paula E. Ralph, technician, biology; Naomi S. Altman, professor of statistics and Stephan C. Schuster, professor of biochemistry and molecular biology, all of Penn State.
|
<urn:uuid:5b067cd7-ca35-45a2-b155-56965d171d8c>
|
CC-MAIN-2023-50
|
https://scienceblog.com/490355/parasitic-plants-found-steal-genes-victims-use-better-attack-targets/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.939934 | 1,010 | 3.390625 | 3 |
A newly published study uses the impact heat signatures in meteorites to date the Moon-forming impact between a large protoplanet and proto-Earth.
The inner Solar System’s biggest known collision was the moon-forming giant impact between a large protoplanet and the proto-Earth. Kilometer-sized fragments from this impact hit main belt asteroids at much higher velocities than typical main belt collisions, heating the surface and leaving behind a permanent record of the impact event. A team of NASA funded researchers modeled the evolution of giant impact debris and analyzed these ancient impact heat signatures in stony meteorites to conclude that pieces of the Giant Impact did indeed strike the asteroid belt. The team’s work appears in the April 2015 issue of the journal Science.
The team was led by Principal Investigator Bill Bottke, of the Institute for the Science of Exploring Targets team at the Southwest Research Institute, a U.S. team member of NASA’s Solar System Exploration Research Virtual Institute (SSERVI), which fosters research on Solar System science and exploration at NASA’s Ames Research Center in Moffett Field, California.
SSERVI Director Yvonne Pendleton, notes “This is an excellent example of the power of multidisciplinary science. By linking studies of the moon, of main belt asteroids, and of meteorites that fall to Earth, we gain a better understanding of the earliest history of our Solar System.”
High-velocity impacts leave impressive fingerprints. They do more than make craters, they break up, mix, heat, and melt rock, leaving telltale signs of heat-shock that are visible in an optical microscope. Impact signatures allow researchers to gain insights into the last stages of planet formation and deduce the earliest bombardment history of ancient bodies like Vesta, one of the targets of NASA’s Dawn mission and a main belt asteroid whose fragments were delivered to Earth in the form of meteorites. It is possible that tiny remnants of the moon-forming impactor or proto-Earth might be found within meteorites that show signs of heat-shock from giant impact debris. This would allow scientists to directly measure, for the first time, the unknown primordial nature of our home planet.
By modeling the evolution of giant impact debris over time, and fitting the results to ancient impact heat signatures in stony meteorites, the team was able to infer the moon formed approximately 4.47 billion years ago, in agreement with many previous estimates. The most ancient Solar System materials found in meteorites are about one hundred million years older.
“The importance of giant impact ejecta returning to strike the moon could also play an intriguing role in the earliest phase of lunar bombardment,” said Bottke. “This research is helping to refine our time scales for ‘what happened when’ on other worlds in the Solar System.”
Co-author Timothy Swindle, director of the University of Arizona’s Lunar and Planetary Laboratory, said: “It was Bill Bottke’s idea to look at the asteroid belt to see what effect a moon-forming giant impact might have had, after expecting a lot of collisions in the period shortly afterwards. We determined the ages of impact events that affected meteorites in laboratory analysis and found that our data matched his predictions. It’s a great example of taking advantage of groups that work in two different specialties – orbital dynamics and chronology – and combining their expertise.”
SSERVI is funded by the Science Mission Directorate and Human Exploration and Operations Mission Directorate at NASA Headquarters.
Reference: W. F. Bottke, et al., “Dating the Moon-forming impact event with asteroidal meteorites” by W. F. Bottke , D. Vokrouhlický, S. Marchi, T. Swindle, E. R. D. Scott, J. R. Weirich and H. Levison, 17 April 2015, Science.
|
<urn:uuid:41d2cafb-a4a4-439b-8276-d76907e3d2ef>
|
CC-MAIN-2023-50
|
https://scitechdaily.com/meteorites-reveal-evidence-of-moon-forming-impact/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.912363 | 821 | 4.25 | 4 |
By Alan Seow, Cyber Security Practitioner
Smart City – No doubt when one hears about this, it should be about technology which connects every nook and corner and provides intelligent solutions to its citizens. One prominent example that can be easily associated with is digital services. A secured digital service, apart from improving citizenry overall digital experience in terms of reliability and security, most important of all, the trust relationship among digital users or adopters. The growing confidence in people using digital services will spur the advancement of smart city, easing their lives with all information away by one digital touch, therefore provides the impetus to transform a nation into a digital country or state.
Today, digital services come in many forms, we have online selling platform, eBay/Amazon, movie providers, Disney+/Netflix, music providers, Spotify, ticketing services, Eventbrite, online dating services, digital newspapers, e-books subscriptions, Mobile App downloads to Microsoft (MS) Teams/Skype meeting and many more. In the Covid-19 global pandemic, in order to limit or contain the virus spread, work from home (WFH) is a common term for organization where employees are encouraged to WFH. As such, MS Teams/Skype business related meetings and video conferences have become more paramount. I-robots are deployed in hospitals to assist doctors and nurses who are dealing with Covid-19 patients. Hence, that minimizes healthcare workers’ exposure to Covid-19.
There is also a wide adoption of “algorithms driven” products that offer digital services. Artificial Intelligence/Machine Learning will be a part of our daily lives. Such a progressive move may eventually result in the acceleration of robots being widely deployed which could mean the birth of new job roles or opportunities and old or existing jobs being replaced. For instance, physical security guards of private properties that do not require a high level of security (i.e. guards for a low-to-medium end Condominium) could well be replaced by robots. The robots can do the prowling and having the gate gantry to be automated. The gantries for vehicle entry/exit can be controlled through the use of an Electronic Road Pricing (ERP) system. Take for another example; dish collectors at food centers can also be replaced by robots as well. Robots have the distinct capability of 24/7 and can be programmed to follow orders without defiance. One key advantage is that it eliminates human guards from falling asleep due to fatigue or having them taking “unofficial time off”. The Operation Manager (OM) in-charge, instead of managing humans, he/she will now manage robots. The OM role could be redefined as Operation Security Manager (OSM). OSMs will have to be retrained with Information Technology (IT) system security skillset on top of their surveillance system security know how. The maintenance crew of companies providing robotic security/robotic services will need to be upskilled as well. These circumstances will increase the demand for Robotic Operator/Engineer, IT System Security Engineer, Secure Coder and Cyber Threat Analyst.
The marriage of physical and cyber space will thus become more apparent overtime. It would not just only be security but safety and security. The situation where robot becomes malfunctioned and start attacking people via unauthorized access control is very real.
Digital service inevitably embraces digital automation. It would mean less to zero human intervention. Though automation brings about process efficiency. There are, however, the flip sides to note. For instance, a logistic supply chain being over reliance on digital automation where the automation process failed to present the desired outcome, long delays can be expected. This will result in a “painful experience” for customers expecting their goods to be delivered on time. Should digital automation being compromised, it could also be a platform for an efficient digital attack launch-pad.
The scope and value of digital services is potentially boundless, limited more by the imagination and service providers’ ability to identify, evaluate, partner for, deliver and manage them in an efficient, seamless manner. While city services are increasingly being digitized, it is important that the digital strategy has a simplified governance structure where users will not be frustrated trying to figure out how to use multiple digital tools. As the world turns digital, the complexity of integrating and managing digital services is growing.
In this article, we talked about the “algorithms driven” product and Artificial Intelligence/Machine Learning. These mechanism coupled with deep learning may prove to be a game changer when they are being deployed at perimeter defense. It can be configured to look at the codes and determine whether it is a malware as compared to the type of malware detection where it relies on code execution. In this way, more can be further explored when one navigates digital services within smart city with cybersecurity in mind.
|
<urn:uuid:0c64bf8c-0a57-4cd0-bbf5-d7d67ef3bafd>
|
CC-MAIN-2023-50
|
https://securingsmartcities.org/?p=793
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.936398 | 993 | 2.515625 | 3 |
Book sale: Save up to 25% on print and eBooks. No promo code needed.
Save up to 25% on print and eBooks.
Analysis and Synthesis of Chemical Process Systems
1st Edition - January 15, 1991
Authors: K. Hartmann, K. Kaplick
Editor: L.M. Rose
9 7 8 - 1 - 4 8 3 2 - 9 1 6 6 - 6
The methods used by chemists and chemical engineers for the conception, design and operation of chemical process systems have undergone significant changes in the last 10 years.… Read more
Save 50% on book bundles
Immediately download your ebook while waiting for your print delivery. No promo code is needed.
The methods used by chemists and chemical engineers for the conception, design and operation of chemical process systems have undergone significant changes in the last 10 years. The most important of modern computer-aided techniques are process analysis and process system synthesis, both of which are closely related. The first part of the book presents the principles of model building, simulation and model application. On the basis of an appropriate set of hierarchical levels of chemical systems, the general strategy of analysis by deterministic and statistical methods is treated. The second part deals with process system synthesis beginning with reaction path analysis. One of the major features of this part are new methods for the synthesis of reactor networks, separation sequences, heat-exchanger systems and entire chemical process systems by a combined procedure of heuristic rules and fuzzy set algorithms. This procedure, which is known as knowledge engineering, is an efficient combination of human creativity and theoretically based knowledge. This book, which is illustrated by examples, should prove extremely useful as a text for a senior/graduate course for students of chemistry and chemical engineering and will also be invaluable for chemists and chemical engineers in research and industry, and specialists dealing with the analysis and synthesis of process systems.
Purpose and Aims. Introduction - Survey of the Overall Problem. Hierarchic levels of objects of chemical technology. Strategy of system studies. Problems of synthesis and analysis. References. Analysis and Modelling of the Processes of Substance Transformation. Aims and methods of analysis and modelling. Process models. Structure analysis and calculation methods. Model adaptation and checking. Simplification of models. Digital simulation. Example 1: Boiler with steam-heated jacket. Example 2: Process analysis of a reforming plant. References. Process Synthesis. Problem formulation. Reaction path analysis. Synthesis of the reactor or reactor system. Synthesis of separation systems. Synthesis of heat exchanger systems. Synthesis of "heterogeneous" chemical process systems. References. Subject Index.
Published: January 15, 1991
Imprint: Elsevier Science
eBook ISBN: 9781483291666
Affiliations and expertise
Akademie der Wissenschaften der DDR, Institut für Chemische Technologie, Berlin, GDR
Affiliations and expertise
Technische Universität Dresden, Sektion Verfahrens- und Verarbeitungstechnik, Dresden, GDR
|
<urn:uuid:25250a50-4d4f-405a-a487-b1d947e4a899>
|
CC-MAIN-2023-50
|
https://shop.elsevier.com/books/analysis-and-synthesis-of-chemical-process-systems/hartmann/978-0-444-98745-7
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.87375 | 638 | 2.53125 | 3 |
Immigration DNA Testing
America’s immigration agencies use paternity, maternity, and kinship testing in their immigration decision-making practices. Immigration DNA testing is a paternity, maternity, or kinship test that is conducted at the request of the US Embassy or USCIS.
The intent of immigration testing is to identify that the relevant parties have a biological relationship with each other. Immigration DNA testing will provide that information.
The tests can be maternity, paternity, and siblingship. These tests are court-admissible as they relate to government regulations.
Maternity DNA Test
A Maternity DNA Test compares the DNA of a child to the DNA of an alleged mother.
- For legal purposes, a Maternity DNA Test is necessary when results will be used for issues such as adoption, custody, taxes or inheritance, etc.
- If more than one woman claims to be a child’s mother, this maternity test will determine which woman is the biological mother.
Paternity DNA Test
A Paternity DNA Test compares the DNA of a child to the DNA of an Alleged Father. The child’s mother is not required to participate in this test although the mothers participation is always encouraged to increase the probability of the results.
|
<urn:uuid:eeb978a6-2ddd-4baf-a6a0-bdcbe468f723>
|
CC-MAIN-2023-50
|
https://smartestlabs.com/immigration-dna/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.924249 | 252 | 3.015625 | 3 |
With several teaching duties and responsibilities to perform and complete, the most important one is class management which brings along maintaining discipline and the right behavioral qualities in a classroom.
To teach effectively and make students learn better, and make the most of the education being imparted to them, maintaining discipline in the classroom is very important. Let us discuss the do’s and don’ts that all teachers must follow to make their classes more managed and disciplined for learning.
Importance of discipline in the classroom
Before discussing the do and don’ts for teachers to maintain discipline in the classes, let us discuss the importance of disciplined classes and how it helps teachers and learners.
- Make classes more goal-oriented
- Ensures effective teaching and learning
- Foster interpersonal relationships
- Enrich moral values in students
- Increase in academic performance
- More organized, productive, and managed classes
Do’s to maintain discipline in classes
1. Do set a code of conduct for your classroom
To maintain discipline in the classes and to work better for school management the teachers and authorities must set a code of conduct. Code of conduct refers to a set of rules, regulations, and qualities that you expect from your students to follow to make the educational institution disciplined, more goal specific, and effective. By proper discussion and decision-making, all teachers can create this set of rules that all need to follow.
2. Do explain the rules on the first class itself
Only setting the rules and pasting them on the school’s boards won’t work that well. All teachers must ensure that after creating the disciplinary rules, you explain them to the students as well that too on the first day of the classes itself. When from day one, students will know what is expected from them they will tend to act accordingly only. Explain the rules in detail so that students follow the same from the first day of the educational institutes themselves.
3. Teach with the help of technology
One of the main reasons behind students being undisciplined and more mischievous in the class can be because of lack of interest and monotonous classes. When teachers keep on teaching and explaining from the textbooks, while students simply listen, learners lose interest in the classes and get diverted causing a disturbance in the whole class.
To overcome this problem, teaching with the help of technology will surely help. Whether hybrid learning, online teaching, or conventional classrooms, teaching with the help of technology always does wonders. With the help of audiovisual aids, students tend to understand better, concentrate more, and enjoy learning.
Don’ts to maintain discipline in classes
1. Don’t lose your temper
When we all know that students make mistakes and deal with students’ mistakes and discipline problems furthermore causing trouble in teaching, several times can become a little challenging mentally for the teachers. Getting angry and frustrated can be common during these situations.
But losing your temper and calm can make you yell or shout at the students. This can affect your interpersonal relationships with the learners furthermore making them more indisciplined. Hence try to stay composed and calm while dealing with mistakes and problems in the class.
2. Don’t be over strict with students
To make students more disciplined and learning-oriented, being strict with students is necessary. But excessive strictness can be harmful. If you won’t teach and deal with your students politely, they won’t understand that well too.
Strictness can either make them feel too afraid, reducing their class participation or being more undisciplined. To prevent these problems from arising in your class, teachers must avoid dealing with students with too much strictness. Deal with them with your care, patience, and affection. W
3. Don’t deal with such students in front of the whole class
In a classroom, some students are well disciplined while some are not. When teachers treat an undisciplined student in front of the whole classroom batchmates, he or she will surely feel insulted, embarrassed, and sad. And this will affect
the social, mental, and emotional growth and development of the students. All teachers must remember to teach such students personally and separately. In such a way students will understand you better.
Ensuring discipline is the foremost important duty of every teacher in a classroom. To do so a teacher must have to do something and also have to avoid doing some wrong steps. The above mentioned are the do’s and don’ts that teachers can follow and adapt to make their classes more disciplined. This will ensure effective teaching and learning in the classroom, also making students adapt the right learning and behavioral qualities.
|
<urn:uuid:694ea53a-677a-4ac1-86ad-7153658ee480>
|
CC-MAIN-2023-50
|
https://socotamega.com/dos-and-donts-for-teachers-to-maintain-discipline-in-the-classroom/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.948648 | 958 | 3.296875 | 3 |
Discovering Barnegat Bay is an educational tool developed for educators to include information about the local natural ecosystem into their curriculum.
Discovering Barnegat Bay is an interdisciplinary guide for the historical, cultural and natural resources of the Barnegat Bay watershed. The program was created by members of the Barnegat Bay Environmental Educators Steering Committee in 2003 to provide a unique activity guide that addresses locally significant topics and resources.
The discovering Barnegat Bay guidebook includes meaningful lesson plans, activities and resources for teachers and educators designed to support Language Arts, Science, Social Studies and Mathematics through the exploration of historical, cultural and natural resources of the Barnegat Bay watershed. The guidebook is accompanied by a discovering Barnegat Bay “Treasure Chest” containing a selection of resource materials.
The Discovering Barnegat Bay curriculum guide includes:
- Lesson plans and activities designed specifically about the Barnegat Bay watershed.
- Activities that incorporate locally significant topics and issues into existing curricula.
- Lessons that are interdisciplinary and offer opportunities in Language Arts, Science, Social Studies & Mathematics.
- Chapters that focus on various themes: Soil, Water’s Path, Natural Wonders, People and Places, and Boundaries of our Watershed. All are created to help make learning more meaningful for students by bringing it “closer to home.”
- A supplemental resource for teachers that meets New Jersey State Standards.
Download these lessons from the Discovering Barnegat Bay Curriculum Guide to use with your students in your classroom or your virtual learning space:
18 Agencies and Organizations partnered to bring all the collective educational resources together!
US Fish and Wildlife Service- Edwin B. Forsythe Wildlife Refuge
OCVTS-Marine Academy of Technology and Environmental Services
NJ Audubon Society
NJ Museum of Agriculture Pinelands Preservation Alliance
Ocean County Department of Solid Waste Management
Ocean County Parks Department
Natural Resource Foundation of New Jersey
Rutgers Cooperative Extension
Funding provided by NJDEP (319h – Clean Water Act) and Barnegat Bay Partnership for implementation
|
<urn:uuid:f02fbb76-601f-4500-9072-89de9ffddefa>
|
CC-MAIN-2023-50
|
https://soildistrict.org/educational-programs/discovering-barnegat-bay/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.883057 | 438 | 3.640625 | 4 |
How to avoid being doxxed: protecting your personal information online
How to protect your personal information online, and a few related internet survival tips.
Doxxing (also spelled doxing) is "the act of publicly revealing previously private personal information about an individual or organization" (wikipedia). Usually, it is done by someone other than the person being doxxed, often with malicious intent.
This article lists some tips for avoiding being doxxed. It's important to note that nothing is foolproof, and if an organisation or individual with resources really wants to find you, they probably will. However, you can take steps to make it more difficult, and hopefully too frustrating for the casual hateful individual to bother with. This article describes both easy steps (meaning ones that don't require any change in behaviour or internet usage), and more difficult ones (steps that may impact your online activity).
This article focuses on advice for people who need to protect their identity because they are vulnerable to specific targeting (for example, targets of hate groups or domestic violence), rather than people who need total online anonymity (such as people living under repressive regimes, or hackers). It assumes the main threat is from individuals, hate groups, and internet strangers, not large companies or government organisations. It is meant to be accessible to people with a range of tech knowledge levels.
For these reasons, I've left out some tools that can help you hide online activity, such as VPNs and Tor. Be aware that your IP address (basically, your computer's address on the internet) could be used to track down your location and identify you. It's unlikely a random person can get this. For example, it shouldn't be possible for someone to get your IP address from a tweet or forum post. However, webservers and website owners can access this information, along with anyone who can get their records. If you do investigate this further, please be aware that neither VPNs nor Tor are a total guarantee of privacy.
Really important warning
There are two basic principles of information on the internet:
- Nothing is private
- Everything is eternal
Those conversations in a private chatroom? What's stopping someone screenshotting them? That comment you made on a forum 15 years ago? May well still be out there. The adolescent blog you deleted? Could still be stored in the wayback machine.
This means the best practice of life online is to reveal as little as possible, and never say anything that you wouldn't want shown to a potential employer or your mother or the police, or whichever authority is likely to be the biggest threat to you.
However, this is easier for some people than others, and isn't enough to protect everyone. At least two groups face increased risk:
- Anyone with an identity that makes them a target of hate is faced with a choice between an offline life, or a degree of risk - even if they never write a controversial tweet or share a silly drunk photo, even if their lives are private.
- Some people have the sort of jobs that require putting their info out there: public figures, community organisers, small business owners, the self-employed, and so on.
This article is mainly for group 1. I don't know a solution for group 2. To give a personal example: I'm a low-profile freelancer with a tiny business, and have simply accepted that part of doing business means a lot of my info is out there. If someone gets really frustrated by one of my tutorials, I guess I'm in trouble.
On the one hand, we live in a privacy-invading dystopia and horrifying amounts of personal information are freely available. On the other hand, here's a cat sleeping in a sunbeam:
Figure out your safety level
Some of the steps in the following sections are easy, and should be used by everyone. Others will be time consuming to implement. And a few require ongoing changes to behaviour, and might limit the ways you can act online. Only you can decide how much you need to do. Take some time to really think this over. Weigh your sense of risk and need for privacy against your need to use the internet and your willingness to restrict your behaviour.
How much information is out there?
Start by finding out how much information about you is easily accessible.
- Search each of the following in a privacy-focused browser (such as Brave or Firefox) and search engine (such as DuckDuckGo). This is because Google likely has a profile of you, and may be smart enough not to show you results about yourself.
- Previous names (for example, your name before you married, or your dead name)
- Phone numbers
- Each email address you have
- Usernames, especially ones you use on several sites
- Now repeat the previous searches, using Google in incognito mode. Google is what most people will use, so it's worth seeing what they show, and incognito mode should reduce the profile problem mentioned above.
- Check if your online accounts are secure, using a hack checker like Avast Hack Check or have i been pwned (the latter also allows you to check phone numbers).
- Try to think of places where your info might be shared. Make a list. Examples include:
- CV upload sites / job sites
- Work websites (a company ‘About' page or professional profile, for instance)
- Personal blogs and hobby websites
- Social media: not just the ones you currently use, but any you've ever used. Yes, this includes your angst-ridden LiveJournal.
These are things you can do without altering your online behaviour or restricting your online presence. While they are 'easy' in that they don't impact your use of the internet, some of them may be time consuming or a bit of a faff (for non-British readers, you need to add faff to your vocabulary - an overcomplicated task, a nuisance).
You don't have to do everything at once. If you don't need to urgently vanish from the internet, you can work through the list gradually.
Anonymise social media and online community identities
- Choose usernames that don't identify you wherever possible. Don't include any personal information: name, birth year, city, and so on. Twitter and Reddit allow this. It's trickier with sites like Facebook and LinkedIn.
- If you want to use social media, take time to read up on the privacy settings, and lock your profile down as much as possible.
- Choose different usernames for each community or social media account. This prevents you being traced across multiple sites. For example, information about you on a hobby crochet site OR a regional walking club OR a forum discussing a professional training program might not be enough to identify you, but if someone can link all three, there's suddenly a very detailed picture. Pay attention to this one. I got a security professional to take a look at this article, and his comment was that this was one of the most important tips, but it's rare for people to implement it. In his words: "If you can link multiple accounts together, it gets much easier to gather info."
- Change any passwords revealed by the hack checker. Unfortunately, any information that was leaked is out there and can't be fixed.
- Start using a password manager such as 1Password. This allows you to use a complex and unique password for each account, without needing to memorise them. If a password is leaked, the damage is limited to that one account.
Delete what you can
- Delete any information that came up in your web searches, assuming you don't need it to be public.
- Delete your old social media and forum accounts, old blogs, and so on (if you no longer use them).
- Delete job site profiles, and delete your CV from anywhere you've uploaded it (assuming you're not job hunting of course!)
Secure your websites
- If you run any websites, review any documents you've uploaded to it. For example, if you have a site built with WordPress, someone might be able to get a lot of information by accessing your WordPress upload folder. Delete anything that doesn't need to be there, and check your website directory permissions.
- If you own any domain names, make sure the WHOIS record is private. Your domain registrar should be able to provide private registration. This does not offer complete protection: someone can still request the information.
Remove public records
- Make sure you are not on the public electoral roll (UK), or your country's equivalent (in the USA you may be able to request private voter registration from your local elections office)
Some information cannot be hidden. For example, if you own a home, information about you is likely available through the land registry (in the UK) or similar services in other countries.
Right to be forgotten
Make use of your right to erasure (also known as right to be forgotten), if you have it. This depends on your local laws. Citizens of the UK and EU are given the right to erasure as part of GDPR. This guide by the ICO explains the circumstances where you can ask for your data to be deleted, and how to make a request. Although formally contacting every organisation that has your data and doesn't need it would be a big undertaking, it could be worth doing if you really need privacy. It is a tool you can use to get data fully deleted if a company is failing to fully delete you when you try to delete an account.
More difficult steps
These steps may be more difficult, as they require behavioural changes, or involve other people. Not all of them will be possible for everyone.
- Get your family and friends onboard with privacy. If possible, get them to untag you from photos (especially ones that might reveal your location).
- Make sure your employer is taking steps to protect your privacy, such as limiting the detail in public profiles, and ensuring your work email isn't publicly associated with private information.
- Delete accounts regularly. For example, heavy Reddit users sometimes delete their account every few months. You lose karma and rewards (Reddit's points system), but it prevents a build up of information that could eventually allow someone to identify you. This one is particularly hard. If you have a Twitter following, deleting the account is the last thing you want to do. Some communities prevent constantly rejoining under new identities (to prevent trolls and sock puppets), so you may not be able to do this for all your online communities.
- Consider using a mailbox service, so that you minimise the use of your home address online.
- Reduce access: this isn't really about avoiding doxxing so much as reducing channels where people can harass you. Turn off Twitter DM's, try to limit things like Facebook messenger to friends only, and so on.
- Be mindful of what you share. Assume that anything you write online can be seen by anyone.
I've created a checklist for the tips in this article. You can save your own copy of the Google Doc version by following the link to the doc, then selecting File > Make a copy and saving it to your drive. You can also download it in various formats (not all formats will retain the checkbox behaviour).
Remember that even if you do everything on this list and more, a seriously determined person or organisation can still find you. This advice is about reducing the chance of petty trolls tracking you down.
Having given that rather alarming warning, I don't want to trigger horrible anxiety in my readers, so . . . here's another cat picture? That helps, right?
|
<urn:uuid:dc8835fa-5ec9-4c51-84c4-5cd29eda754d>
|
CC-MAIN-2023-50
|
https://starfallprojects.co.uk/blog/avoid-being-doxxed/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.948945 | 2,409 | 2.96875 | 3 |
Playing scavenger hunt as the starts of this unit is a good choice. Students were enthusiast to find all objects that the teachers have been prepared. They were assigned to find the objects related to story around 2nd floor, primary area.
After they got the objects, teachers and students discuss on the objects with the function. Then, the students tried to related that objects to a theme on what they are going to learn.
|
<urn:uuid:ade99cc0-84b8-4c76-88ba-2316f37c377d>
|
CC-MAIN-2023-50
|
https://svppyp.com/2018/04/18/tuning-in-activity-uoi-6/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.986785 | 85 | 3.125 | 3 |
Be The Best Hockey Player With The Right Equipment’s!
Hockey is one of the popular sports played across the globe. There are people in great numbers that come out to watch the hockey battle on the field. The following is humongous and players have earned a huge name for themselves playing the sports. The game of 11 members, 10 players, and a goalkeeper is a sport wherein the two teams battle out trying to guide a ball or a puck into the rival team’s goal with the means of a hockey stick.
So, if you want your child to indulge in a sports activity, hockey is one of the top choices. Moreover, if your child is good at sports, if said by his coaches and team, then you as a parent must encourage your child further to take up the sports seriously as a profession. And if you are the child has the attributes of being a good goalkeeper, then it is inarguably one of the best and the most crucial position for the hockey team.
Skills Required for a Good Goalkeeper
Here are some of the key factors needed in a goalkeeper:
- The goalkeeper should be fast enough to prevent the opponent from scoring.
- The goalkeeper should be good at his right and left foot, both.
- The goalkeeper should have the ability to track and close down the shooting angles.
- The goalkeeper should be proficient at saving straight shots at the goal.
- The goalkeeper should also be good at communication with the defenders in order to organize the defence strategy and thereby save a goal from the opponent’s team.
- The goalkeeper should also possess the skills to stay in standing position when required and go down with correct defensive moments as and when necessary.
The amalgamation of all the skills in hockey contributes to the overall success of the game. Therefore, it is advised to let go of the fear so that one can stand out of the crowd to be the best goalkeeper. Patience is always the key to success here!
The appropriate use of Goalie masks in Hockey!
The goalie masks are a huge necessity for any goalkeeper, playing at any level. The goalie masks are made with the purpose of preventing any injuries to the head. With time, the evolution of the goalie masks has served the aim of facilitating better visibility and protection. The most popular option is the full fiberglass mask with a birdcage facial protector. Thus, instead of serious head injuries or concussions and lacerations, goalie masks only cause slight temporary discomfort. With the different variations of hockey around the world, like brandy or ice hockey, the mask may change slightly depending on the game.
|
<urn:uuid:7e1be5d1-287e-45f2-be0a-368465594371>
|
CC-MAIN-2023-50
|
https://swfladrenaline.com/sports/be-the-best-hockey-player-with-the-right-equipments.htm
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.946519 | 538 | 2.578125 | 3 |
The word lottery comes from the Dutch noun lot, meaning “fate”. It is a game of chance in which participants pay a small amount for a chance to win a large prize. Traditionally, prizes were monetary, but some lotteries offer the opportunity to win property.
Lotteries are usually organized so that a percentage of the proceeds are donated to a good cause. This helps to alleviate the financial burden on governments. They are a popular way to raise funds for public projects and for poor people. Although it is generally considered a form of gambling, it is a relatively simple and easy game to play.
When the Roman Empire was in its heyday, there were a number of lotteries. Some were private, but others were organized by the government. Several towns held public lotteries to raise money for public buildings and defenses. In addition, private lotteries were used to sell products or real estate.
During the Roman Empire, many emperors used lotteries as a way to provide gifts to the population. A number of emperors gave away slaves and property. Even though lotteries were popular, they also caused bitter controversy. As a result, the use of lotteries was discouraged in the later part of the Roman Empire.
However, by the 16th century, some towns were still holding public lotteries. Towns such as Flanders and Modena in Italy were attempting to raise money to help poor people.
By the 17th century, the use of lotteries became widespread throughout the Netherlands. Lotteries were also common in England. Private lotteries were also very popular in the United States. Many people regarded lotteries as a hidden tax. Nonetheless, the Continental Congress voted to set up a lottery to raise funds for the colonial army. After thirty years, the scheme was abandoned.
Today, most states operate their own lotteries. Most of these lotteries are run by the state or city government. Unlike private lotteries, the majority of ticket sales come from players. The cost of tickets can add up over time. Also, a large jackpot can drive ticket sales. Therefore, it is important to find a balance between the odds of winning and the number of players.
Modern lotteries are often characterized by the use of computers. Computers are able to store a large number of tickets, record the stakes of each player, and generate random numbers. These numbers are then drawn in a drawing. Usually, a jackpot is won by a person who matches all of the winning numbers. If the bettor doesn’t match all of the numbers, the bettor can purchase a numbered receipt. He will know whether the ticket was among the winners.
There are several reasons to avoid the lottery. One reason is that it exposes players to an addiction. Another is that it makes players worse off. Lastly, the odds are very slim. While the possibility of winning is low, the possibility of losing is high.
Many people believe that lotteries are a waste of money. However, they were tolerated by the general population. Moreover, they were considered to be a painless form of taxation. Governments should not promote lotteries.
|
<urn:uuid:17bb230e-ae17-432a-8b0c-3688d5d2c548>
|
CC-MAIN-2023-50
|
https://techisay.com/2023/01/13/history-of-the-lottery/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.987585 | 660 | 3.359375 | 3 |
Importance of having a Creative Environment
There are many reasons why it is important to make a classroom a comfortable, creative environment. First, students will be able to express themselves better. Second, they can come up with better ideas to improve their problem-solving skills. Third, your students can learn faster. Altogether, they will contribute to a positive learning experience for both you and your students. The creative classroom must be supportive, high tolerance of mistakes and errors which supports risk taking, and encourages discussions and questioning.
Your role as a teacher in the Creative Classroom environment
As creativity is about exploring new ideas, you may encounter a situation that you will not understand what the student is saying. Students might make comparisons or have ideas that do not make sense. They might even say something completely random about something or even give the wrong answer, you response is everything. Your students might not make sense sometimes, however, you should not discourage or be critical of what your students say. Doing so may discourage them from participating in the lesson and explore their creativity in the process. Remember, creativity is a process and each student has their own. It is extremely important to defer judgement in your classroom as a whole and start moving to a place of curiosity. If you do not understand your student – ask clarifying questions. You are modeling the expectations in your class.
Signs of students demonstrating creative thinking skills
Students that demonstrate their creative thinking skills do the following:
Express unique ideas
Choose to demonstrate an idea in their own way
Asks silly or weird questions
Works on open-ended exercises with enthusiasm
Moves beyond facts and discusses ideas
Opts to find alternate ways in looking at the problem rather than well-established ones
Activities to encourage creative thinking
Here are five ways you can encourage creativity in your classroom.
Reward students for thinking creatively
As students come up with their own answers, encourage them by praising their willingness and drive to stick with a challenge. Encourage them to be ok with ambiguity and how problem solving can be exciting but frustrating. Give feedback such as “That’s a great way of putting it!” or “It’s an interesting idea, can you explain more?” will help your students think more while flexing their creativity. You want to consciously work beyond yes and no answers and strike discussions that involve higher order thinking skills. Provide your students with challenges and open-ended projects where they can practice critical thinking and creative. Check out my genius hour series for information on open-ended projects.
Develop skills that will bring forth creativity
Aside encouraging the creative mindset and praising their grit and tenacity, one other way to bring this skill out in students is by exploring a variety of activities in the classroom. It is preferred to have several open-ended activities that will let your students think independently and explore the lesson in their own way. Allowing expression of student creativity in their own way is beneficial.
Encourage out-of-the-box thinking
Letting your students be “out-of-the-box” is a simple way to exercise their creativity. This can be done in several ways. My suggestion is to ask open questions about what you are teaching. For example, while exploring the different forms of matter, you could ask them “What would happen if you mix two forms of matter together?” This will encourage them to imagine what would happen and get to the answer on their own before you introduce them to the subject material. Allowing their imagination to allow them to explore the material before getting into concrete information can help with student learning.
Give your students the chance to lead a classroom activity
Students learn best when they are part of the planning process. One great activity is have your students help you design a unit of inquiry. They can be part of the process of creating a learning unit and the activities that will help them learn. Co-creating is a good process to work through with your students. As a teacher, you can prepare the unit ahead of time because you probably have a good grasp of what students will ask. A great classroom tool to help students co-create the unit is the KWL tool. This is where students will list everything they know about a topic under K (Know), W (want to learn) under this section they would brainstorm all the questions they want to learn about — this is where you co-create together, and at the end of the unit or lesson students will list what they learned under the L. This is one of my favorite strategies!
Create time for self-reflection
Give students time to think for themselves. After letting your students watch a video on the lifecycle of butterflies, give them a few minutes to think about what they saw. Everyone has different processing times but we all have them. Be cognizant of your students processing times. During that time, they can think of what to say once you ask them about the video.
Inciting creativity in students may seem like a monumental task, however it is important to reassure them through the process. Doing this will not only boost their confidence in being creative but feel better about being who they are. When we are thinking about creativity, we need to think about the creative mindset (person) and support what each student needs to have the creative mindset. We need to examine the creative environment that we are creating and make sure that we positively support cognitive processes. We also need to think about what creative processes we have in place and how we approach our lessons.
There is so much to write about creativity which I will be doing – this blog post was to help you understand how creativity is important in the classroom and the basics of making your classroom environment creative.
Do you have any tips on inspiring creativity in the classroom that I didn’t mention? Comment them down below!
DOWNLOAD BRAINSTORMING LESSON FOR FREE
|
<urn:uuid:efcb09dc-45e8-4601-a621-6f901bfb0db0>
|
CC-MAIN-2023-50
|
https://thebluebrainteacher.com/creativity-in-the-classroom/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.965591 | 1,209 | 3.734375 | 4 |
World Bank reports 736 million people live in "extreme poverty" today, one-half in South Asia (Bangladesh and India), the other in Sub-Sahara Africa (Democratic Republic of Congo, Ethiopia, and Nigeria). Its 2018 "Poverty and Shared Poverty" report projects both Bangladesh and India will eradicate poverty by 2030: having come close to fulfilling the first Millennium Development Goal (MDG) of poverty-reduction target by 2015, they are on track to complying with the Sustainable Development Goal's (SDG's) "Leave no one behind" as well. Fuelling the economic fires, a simultaneous United Nations' ESCAP (Economic and Social Commission for Asia and the Pacific) report, finds South Asia (along with East Asia) as the planet's "most dynamic regions" in 2018. There is a caveat: the document's subtitle asserts "risks are increasing." South Asia's risks include "an abrupt tightening of the global financial conditions . . . setbacks in the implementation of reform, [and] political uncertainties." Between the lines, one cannot help but add invisible socio-cultural adjustments wreaking more damage.
Those socio-cultural adjustments cover the entire range of the sudden upward social climb, from the breakdown of traditional mores and norms that had kept a stable socio-cultural order to conspicuous consumption that chews progress away. Supplying education and appropriate infrastructures helps bridge such a spotty transient landscape.
Addressing these in reverse order, the availability of appropriate infrastructures may actually dictate the overall transformational tone: from physical infrastructures (residential, roads, ports, markets) to educational (schools, colleges, universities, and post-graduate institutions), social (civic groups at all levels, from the grassroots to those centralized ones at peak), health (hospitals and doctors), financial (house-building capacity, banks and insurance companies), and transactional (markets of all sorts), their capacity to let betterment efforts "sink in" softens resistance, supplying the kind of stability each upward climb any transformation seeks. For instance, prioritising university education before schools and colleges have absorbed a bulk of the population would be both awkward, extravagant, and imbalanced, a misstep that only replicates itself as more transformational steps enter the picture. The same with hospitals and social groups: in this case, more (rather than wrong) infrastructures (the skeleton) than people (flesh) predict irreversible wastage, ultimately breeding maladjustments and more complications than rewards. Commensurately constructed, infrastructures play the stabilising roles that the traditional family or clan once would. In countries like Bangladesh and India, parents feel relieved to release their children or wards to the safe hands of responsible institutions.
These become all the more necessary once classroom education is brought in. Just as education opens limitless windows to a wide range of outcomes, so too must infrastructures accompany or complement them to ensure the transformation's success. The growth of libraries or other accesses to higher learning is part and parcel of that transformation, and in this Internet age, the sensible availabilities of software knowledge in appropriate hardware (that is, institutions imparting software training at all levels), can help divert traffic from Internet-related abuses, while fulfilling its knowledge enhancement role. Any government should be able to chart present and future policy priorities from the education locally available, relating education to jobs and jobs to national needs: stability from acquiring a steady education without financial disruption logically extends to the job-market where an adequate employment must await the hardworking student for his/her entire work-life with a steady income. Supplying those jobs must presume the availability of proper educational opportunities, and building the proper infrastructures at the right time, remains the key. Many countries have planning commission charting this progression in advance, and once in place, both Bangladesh's and India's chances of averting bumps, challenges, even erosive development increase.
Banking and finances can (and must) be related to education. It is in the classroom that the youth learn about money management and investment, and infrastructures facilitating such training have tended to remain more viable than those built upon whims and sand: opening an account begins the process of helping students distinguish between savings and spending, and subsequently the various types of investment and market-related options (stocks, bonds, and so forth). Amid growing scarcities and competitiveness, learning to keep a balance under all circumstances paves the way for building the responsibility we need in future leaders. Without the appropriate training and relevant infrastructures (especially for banking and insurance), future leaders will never learn of the multiple options available, nor of why the legitimate pathways ultimately produce long-term gains only after enduring short-term pains.
All of this training, and learning from trials and errors, chips away at extravagance and conspicuous consumption, which silently eat away one aspect or another of traditional society's stability. For example, the habit of not paying taxes, indeed interpreting taxes as the "enemy," can be watered down immeasurably once the taxpayer sees the rewards of paying taxes through the various infrastructures built with that collection. The sense of being "civic" brings with it a sociability guided less by blood and inheritance than by the duties and responsibilities of another "collectivity," this time society's, and nurtured in classrooms (rather than exclusively at home or within the family): a sense of environmental protection, neighbourhood protection, or health-cultivating calisthenics will eventually demand every citizen's attention and sense of urgency; but with the proper training, ignoring, delegating, or haphazardly addressing them will diminish. That may be just the antidote needed to absorb the unavoidable extravagant habits of many of our quick-rich or illegitimately-enriched social climbers (as the recent arrest of a huge number of Yaba "kingpins" in Cox's Bazaar indicates). Familiar, accessible, and stable current behaviours function better as future pivots than upstart actions.
Society, and within it the norms, behaviours, and guidelines, change constantly, sometimes too glacially to be noticed, at other times too rapidly for comfort. 'Evolution' and 'revolution' respectively, describe those adjustments. Yet a stable future is possible only because familiar, accessible, and stable current behaviours acknowledge, accommodate, or adjust past norms, behaviours, and guidelines rather than displace them outright.
Returning to the elimination of poverty, Bangladesh reaching that goal by 2030 would mean a complete transformation from its basket-case origin. The journey was slow, and we were not always picture-perfect with our norms, behaviours, and guidelines: extended families became more nuclear, farmers could not but migrate to overloaded metropolitans, and low-wage migrants returned with more cash and a determination to change their own lot loudly, among other disruptive factors. Social spaces must open up to soften pressures like these without disrupting cultural conformity or complicating the 2030 poverty-elimination target. Adjustments and balances of this kind will be increasingly urgently needed for which no UN, MDG, or SDG collaboration can supply the full cure. We must look within ourselves.
It is in how smooth that transition that the seeds of sown democracy grow, get harvested, and ultimately institutionalised, much like the family before, this time in place of the family. Sincerely executed, democratisation opens up the proper space for economic liberalism, and with it a "collective" advancement reminiscent of the traditional family's stubborn sense of "clan" welfare enhancement, this time of society's. Appropriate infrastructures serving as both the catalyst and nurse of future welfare plans, like the family once did, become the truest confirmation that a poverty-free society prevails.
Dr. Imtiaz A. Hussain is Professor & Head of the Department of Global Studies & Governance at Independent University, Bangladesh.
|
<urn:uuid:cbf6e104-d268-4393-aa1a-40d47d3637ab>
|
CC-MAIN-2023-50
|
https://thefinancialexpress.com.bd/views/views/poverty-elimination-infrastructural-implications-1551195891
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.93221 | 1,626 | 2.59375 | 3 |
Bryan Acheampong, Ghana's Minister of Food and Agriculture, has issued a warning that the effects of climate change might lead to a reduction in food production and worsen food insecurity, poverty, and hunger. Speaking at a conference in Accra, Acheampong noted that the agriculture sector of the nation, which depends on rain-fed irrigation, is susceptible to extended dry spells, floods, and temperature increases, which may cause a drop in the sector's contribution to GDP of between one and 2.5 percent.
The International Water Management Institute and partners organized the two-day sub-Saharan knowledge exchange conference, which included options for funding farmer-led irrigation development in sub-Saharan Africa to meet new concerns, including the climate catastrophe.
While the government has put in place a variety of programs to improve the industry, Acheampong emphasized that further actions are required to meet new problems, notably the climate catastrophe. He emphasized the necessity of utilizing irrigation's ability to deal with the effects of the climate catastrophe and urged ongoing cooperation from companies, development partners, research, academia, and other stakeholders to transform the food system to be more climate resilient.
Dr. Olufunke Cofie, the Country Representative for Ghana and the Regional Representative for West Africa for IWMI, pushed for more funding for farmer-led irrigation systems to help smallholder farmers become more climatically tolerant and to change the food chain to promote nutritious diets.
According to Dr. Cofie, studies have shown that dry season irrigation may more than double farmers' output, but the percentage of land cultivated with irrigation on the continent is just 10%, thus actions should be done to raise it.
With only 2% of the nation's irrigation potential being used, Mr. Lorenzo Carrera, the Sustainable Development Sector Leader at the World Bank office in Ghana, reaffirmed how vulnerable the agricultural sector is to climate variability and change. This has serious productivity implications. The country's ability to withstand extreme weather, increase prospects for output, and improve the livelihoods of smallholder farmers, according to Mr. Carrera, would significantly benefit from investments in irrigation infrastructure and access to dependable water for agriculture.
Around 700,000 smallholder farmers are prepared to adopt small-scale irrigation over the next ten years in order to increase their resistance to the climate catastrophe, according to Ms. Amber Lily Kenny, coordinator for Feed the Future, who observed that the country has a great potential for irrigated vegetable production.
|
<urn:uuid:f626f6f8-c361-46df-a55c-2f47982f3867>
|
CC-MAIN-2023-50
|
https://theglobalheroes.com/due-to-the-climate-crisis-ghana-s-food-output-is-expected-to-decline
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.927684 | 503 | 2.84375 | 3 |
The game of dominoes belongs to a family of tile-based games. These tiles are rectangular with two square ends and a number of spots on each end. The object of the game is to match as many pieces as possible to win. To play dominoes, you will need at least eight tiles, which are known as “dominoes”.
Players take turns drawing a tile from a pile. They begin by laying a chosen tile face up in the center of the table. Then, the next player must match one end of the tile with a portion of the first tile. In some versions of the game, you can join tiles on all four sides, or to any line that is perpendicular to the line. If a player does not have a domino, he or she may draw from the remaining unused tiles.
Playing dominoes is not difficult. You can play against one opponent, three or four opponents, the CPU, or even a family member or friend. Several variations of the game are available, including different tables, tiles, and six-pip sets. You can even play dominoes against the computer! If you don’t feel like playing dominoes, consider playing these versions with your friends and family. These games are fun and addictive!
The game of dominoes was first recorded in France and Italy in the mid-18th century. French prisoners brought the game to England. It was most commonly used in positional games. Players place dominos edge-to-edge against each other. The first tile played is an “open” four-spot, while the next tile plays to a “double” is a five-five. In a game of dominoes, the player who places the lowest tile first is the winner.
In skillful dominoes, the goal is to score as many points as possible, typically 61. Each player gets a hand of dominoes, which they play in a pattern. A matching pair of dominoes counts as one point. Any domino with multiples of five dots counts as a trick. If all players have five-point tiles, they score a point. Similarly, if the game reaches the specified target score, the winner scores with the highest double-six.
Another interesting way to learn about neuron function is to study the falling dominoes. The falling dominoes simulate the flow of information from the nervous system to the brain. Nerve cells carry information in electrical impulses that travel through their long bodies. Falling dominoes simulate many aspects of signal transmission. To practice, you will need a ruler to measure the length of a domino. Connect the Domino to the ruler with a piece of tape. This tape will reinforce the hinge, so that it can withstand pressure from the ruler.
The game ends when one player places the last domino, or “domino.” Players score points based on the number of dots in their opponent’s hands. Team players do not add dots from their teammates. For the winning player, every count of five dots is worth one point. Counts higher than 5 do not count as additional points, but instead round up to the nearest five. This makes dominoes very fun to play.
The basic rule of dominoes is simple: each player takes turns placing one domino on the table. The player who places his or her domino first is called the “set”. After that, all players must place their dominoes on the table. Doubles must be played end-to-end, singles must cross, and triples must be placed side-by-side. If a player is blocked by three or more dominoes, they will lose the hand.
A single domino has five pips, while a double has the same number of pips on both halves. A single domino, which has all three pips, is known as a combination domino. When playing dominoes, it is important to remember to keep these tips in mind. You’ll be able to win more often and play with more friends. The game of dominoes is a great way to spend your evenings.
Domino apps are essential to running a business. They provide business value with minimal cost. The platform also supports the use of multiexperience low-code platforms. In addition, Domino apps are easy to extend. A single Domino app can be extended to dozens of different platforms with no programming knowledge. The only thing stopping you is your imagination! The possibilities are endless! Domino is the perfect solution for modern analytics. So, get started now! You’ll be glad you did!
|
<urn:uuid:dda70740-92f4-4a4c-92a9-38215ae141f5>
|
CC-MAIN-2023-50
|
https://themusculartherapycenter.com/the-game-of-dominoes-4/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.965094 | 972 | 3 | 3 |
https://www.cesmamil.org/ – Lotteries are a form of gambling in which people play for cash prizes. These prizes are usually given away by chance, but there is no guarantee that a person will win.
The term lottery derives from the Dutch word “lot” meaning “fate.” In ancient times, it was common practice to distribute property and slaves by lot. In the Old Testament, the Lord instructed Moses to take a census of Israel and divide the land by lot. In the Chinese Han Dynasty, a similar practice was used to help fund public projects like the Great Wall.
There are two types of lottery: simple and complex. The first type, called a “simple” lottery, is a system of prizes that relies on chance. The second type, called a “complex” lottery, is a more complicated system that awards a set of prizes according to some other process.
Many state lotteries are run by a special board or commission. These organizations select and license retailers, train employees to use lottery terminals, sell tickets, and pay high-tier prizes. They also ensure that retailers and players adhere to the state’s laws.
A significant part of the revenue from the lottery goes back to the state. These funds are typically used for public works projects, infrastructure improvements, and education initiatives. The states also allocate some of the money to support programs aimed at improving health, social welfare and addiction.
The number of people who play the lottery varies by age, gender and socio-economic status. For instance, in South Carolina, high-school educated men and middle-aged men in the middle income range were more likely to be “frequent players” than people in other demographic groups.
In addition, there are differences in the amount of money that people spend on lottery tickets by zip code. In Chicago, for example, average lottery sales per capita are much higher in predominantly African-American and Latino communities than they are in more affluent neighborhoods.
There are other factors that influence the amount of money that people spend on lottery prizes, such as their income level and family size. Women tend to spend more than men, blacks and Hispanics to a greater degree than whites, and those in the poorer parts of cities tend to spend more than their wealthier neighbors.
Moreover, many people purchase lottery tickets as a way to relax after a hard day at work or to indulge in a fantasy of becoming rich. While these purchases can be accounted for by decision models based on expected value maximization, they are often a result of risk-seeking behavior, rather than the usual monetary rationale.
Another factor that affects lottery purchases is the ability to group together and pool funds for a single ticket purchase. The leader of the group can either buy all of the tickets for the entire group or have each member of the group purchase a ticket separately, thereby increasing the probability of winning a prize.
The overall number of people who participate in the lottery has been steady since it was first introduced in New Hampshire in 1964. Today, there are over 37 states and the District of Columbia with operating lotteries. These lotteries have become an important source of revenue for state governments, and are used to enhance public infrastructure, promote education, and improve the lives of people in low-income communities.
|
<urn:uuid:01921573-73ff-4319-85e3-acce8b86bdba>
|
CC-MAIN-2023-50
|
https://thepaisanospizzeria.com/tag/hk-hari-ini/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.970162 | 682 | 3.015625 | 3 |
The benefits of insulation are undeniable, and the rule of thumb is that the more insulation there is, the more you will benefit. However, there is definitely a point at which installing more insulation will not be worth the cost.
There is also a point after this at which installing more insulation can start to cause problems, particularly in your attic, where you are less restricted in terms of how thick you can build up the layers.
Attic insulation should not touch the roof. If it does, there is no channel for air to flow between the insulation and the roof. This airflow is vital for maintaining proper thermal balance in a house and preventing a buildup of moisture. The reason the insulation is touching the roof should be addressed.
Ventilation Affected When Insulation Touches Roof
The space between the roof and insulation may not seem important, but it’s not simply “empty” space; it is the ventilation space. Filling it impedes ventilation, leading to a buildup of heat and moisture.
An attic has to be ventilated. This is achieved with ventilation openings that lead directly outside. Typically, there are openings in the upper part of the attic (ridge vents) and the lower part of the attic (soffit vents).
Hot air naturally rises and escapes to the outside through the ridge vents. However, it cannot do so effectively if the air is not replaced because the vacuum effect will prevent further heat loss. This is where the soffit vents come in.
The loss of air through ridge vents creates an area with pressure lower than the pressure outside of the attic. Air moves naturally down pressure gradients, and so air is drawn back into the attic.
The “new” air that enters the attic through the soffit vents is going to be cooler than the air that is pulled out through the ridge vents.
If the ventilation area is blocked off by insulation that is built all the way up to the roof, then there is limited to no airflow between the two sets of vents. The heat that builds up in the attic is trapped here by the vacuum effect.
Effects on the Areas Below the Insulation
Even with insulation, this buildup of heat can start to affect the temperature in the rest of the house, particularly the room underneath the attic.
The rise in temperature may make the upstairs rooms more comfortable in the winter, but in summer, you are not going to b enjoying it.
You’ll have to run your AC harder and longer, which wastes energy and money. Long-term, it can even cause premature wearing and breakdown of the AC system.
Even in winter, there will be negative repercussions. If you have heat building up on the top floor, you will not be benefiting from the stack effect, which usually helps to balance the temperature at different levels in your home. So, the upstairs will be extra warm, but the lower floors will be extra cold.
Furthermore, the airflow through your house is impeded, leading to stagnant air, which lowers the indoor air quality.
Effects on the Roof
There are also implications above the insulation layers.
If your area experiences snow at any point in the year, a roof that is kept at temperatures above 32 ℉ can lead to ice dams.
Ice dams form when a warm roof melts snow that lands on it. When this melted snow runs down the roof and reaches a part that is below 32 ℉, the water will freeze and begin to form an ice dam.
An ice dam can prevent melted snow from draining from your roof, which can cause water to build up and enter your home.
The built-up ice, snow, and water put a strain on the roof, causing damage.
Ice dams are a “maybe” problem for some people, depending on where you live. However, insulation that touches the roof and impedes ventilation causes other moisture issues, which are not dependent on the climate.
Why Moisture Builds Up
If you’ve ever had a cool glass of water on a hot day, you have definitely witnessed condensation in action.
When the cold temperature of the water comes in contact with the hot, moist air on the outside of the glass, it causes the water vapor in the air to condense and form droplets on your glass. This is because when air loses heat, it can no longer hold as much water.
The same process occurs in the home between the roof and insulation but on a much larger scale and in a much more destructive way.
When insulation is in contact with the roof, there is still a layer of air between the roof and the insulation. However, this air is going to be hot since the insulation is barring cool air from circulating in this space.
The roof itself is likely to be colder, especially during colder months, since it is in contact with the outside.
This means that when the warm attic air comes into contact with the cold roof, the moisture in the warm air will condense and form water on the roof’s surface, just like it does with the glass of water’s surface.
What This Means to the House
The condensed water will build up on the roof and may drip down onto the insulation and into the attic (if the insulation does not stop it fully).
Wet insulation is less effective, and some can start to degrade and/or grow mold.
The worst problem, however, comes when the wooden parts of the roof become wet with condensation.
Although the shingles of the roof are meant to withstand all sorts of weather, the inner wooden components are not as protected. When they get wet, they are likely to lose structural integrity.
In the worst-case scenario, a damp roof can sag and even cave in.
Because the attic is not often checked on, it is likely that this problem will not be identified until it is well on its way to being too late.
Not only will the repairs to your roof be expensive, but a caving-in roof is an acute danger to those living in the house.
Even if this doesn’t happen, the warm, moist conditions in between the roof and the insulation would be ideal for mold growth, which can spread to the rest of your home.
Mold in the home is not only ugly but can also lead to breathing difficulties, especially for those who have asthma or allergies.
Another issue is the weight exerted on the ceiling boards beneath the insulation.
If your insulation is touching your roof, it is most likely layered in really thickly. For many insulation types, this is going to result in a weight that the ceiling boards will not be able to handle, especially over longer periods of time.
Why Is the Insulation Touching the Roof?
If your insulation is piled so high that it is touching the roof, you must reassess the situation and address why this is the case.
Perhaps you or the previous owner simply installed too much insulation. Maybe it was a matter of not knowing how much insulation you should have, or perhaps you just thought that more was better.
There is a point where more insulation won’t be that much more effective than the recommended amount.
The weight of excessive insulation can also cause an increased rate of settling or even compression of the bottom layers, which reduces the R-value, defeating what you were trying to achieve with the extra insulation anyway.
If this is why the insulation is touching the roof, you will need to remove some of it. You can call a professional to help you scale down to the correct thickness.
Another problem may lie in the R-value of the insulation material you have chosen. If the R-value-per-inch is low for a type of insulation, it will have to be much thicker to achieve the desired R-value to optimize energy savings.
If you had to reach a high R-value like R60 for your attic, it might be difficult to do so with low R-value insulation unless you install insulation up to the roof.
In this case, it would be best to get insulation that has a higher inherent R-value so that you can install less but achieve the same R-value.
Try Installing Baffles
If you cannot avoid installing insulation that touches your roof (for example, if you have a low roof), there is a good way to reduce harm to your home and roof.
Installing baffles is a fairly simple way to restore ventilation in your attic.
Baffles do not take up much space, but they act as a route for air to flow from the soffit to the ridge vents, circulating just below the roof.
If instead of having insulation between and over ceiling joists on the floor of the attic, you may have batts, boards, or spray foam in between the rafters. While these will look like they are touching the roof, there may be baffles hidden under them, which is an acceptable practice.
If there are no baffles, then this is problematic, impeding ventilation.
|
<urn:uuid:23d9a0ee-0b54-4f3f-9948-32d7acb5443f>
|
CC-MAIN-2023-50
|
https://thetibble.com/attic-insulation-touching-roof-concern/
|
s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100603.33/warc/CC-MAIN-20231206194439-20231206224439-00200.warc.gz
|
en
| 0.956529 | 1,861 | 2.578125 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.