tokens
sequencelengths
2.05k
2.05k
text
stringlengths
1.16k
36k
[ 5453, 275, 253, 7351, 285, 3986, 323, 247, 4260, 390, 2159, 6871, 15, 187, 187, 8457, 273, 697, 2978, 13, 253, 6254, 14280, 281, 23668, 366, 1046, 5110, 273, 253, 14284, 13, 534, 417, 760, 2789, 352, 2834, 281, 1928, 247, 1818, 533, 671, 16897, 368, 432, 3652, 5185, 19407, 984, 253, 14955, 310, 281, 14284, 12150, 15, 3105, 760, 326, 13, 253, 6254, 310, 12150, 281, 4352, 13, 594, 368, 3164, 1912, 626, 320, 16116, 253, 13768, 368, 971, 13, 534, 5459, 634, 14512, 273, 9488, 272, 253, 1818, 984, 273, 512, 253, 4016, 8680, 368, 1472, 2970, 15, 187, 187, 3039, 4892, 5847, 403, 2820, 281, 1056, 271, 14000, 13, 597, 3798, 513, 594, 342, 247, 5093, 14, 390, 4314, 14, 2002, 15, 1244, 672, 368, 1472, 2444, 327, 17823, 13, 309, 1804, 16116, 15254, 745, 247, 44722, 13, 3340, 604, 368, 1472, 2509, 247, 21353, 15, 187, 187, 424, 47123, 46683, 1864, 2088, 10810, 424, 187, 187, 8620, 3773, 452, 7753, 3149, 247, 12054, 9630, 14284, 13, 3340, 407, 253, 990, 273, 247, 3946, 6874, 15, 25683, 13, 616, 5962, 1895, 310, 3192, 436, 14284, 432, 253, 2491, 281, 253, 2282, 15, 187, 187, 51, 14292, 310, 2223, 253, 1895, 15, 1623, 253, 2491, 13, 368, 403, 16116, 2067, 13768, 275, 247, 4194, 342, 253, 1072, 5453, 13, 17690, 368, 281, 1056, 23927, 875, 42534, 15, 4129, 634, 5044, 14284, 310, 253, 1072, 13, 984, 273, 253, 12848, 13755, 16095, 285, 5453, 1664, 2343, 34010, 13, 1046, 5453, 5239, 598, 5777, 13359, 15, 187, 187, 1989, 327, 253, 2282, 13, 368, 778, 320, 12797, 875, 41798, 275, 15202, 432, 5103, 281, 5103, 1128, 17440, 3560, 407, 247, 7457, 14, 2002, 1128, 14920, 253, 36100, 273, 1146, 2104, 281, 1056, 23927, 875, 42534, 13, 534, 6505, 368, 7591, 281, 1089, 247, 19407, 342, 1016, 5453, 15, 187, 187, 34, 1175, 1039, 281, 3946, 436, 5453, 14, 936, 14, 34583, 34390, 310, 281, 1132, 15524, 346, 41233, 3, 327, 253, 2491, 15, 24907, 423, 368, 403, 4882, 512, 25259, 11385, 273, 634, 1728, 2282, 15, 1198, 1650, 13, 604, 253, 806, 7793, 310, 247, 1740, 14, 39179, 14, 13514, 1061, 14, 12496, 13, 4352, 247, 6254, 1128, 1468, 272, 875, 767, 12201, 281, 1957, 253, 9297, 273, 253, 4344, 1106, 1128, 25739, 264, 407, 39347, 5453, 368, 9403, 897, 323, 253, 2746, 15, 2635, 346, 1993, 3, 253, 1551, 273, 253, 2282, 13, 970, 253, 15202, 326, 368, 9403, 651, 897, 15, 187, 187, 34, 187, 187, 21173, 621, 273, 15692, 398, 452, 1239, 795, 13804, 3942, 7009, 781, 434, 11573, 4410, 7225, 64, 285, 697, 2160, 1241, 13, 534, 403, 253, 1682, 14, 23708, 15692, 5098, 273, 512, 673, 15, 309, 1158, 24611, 434, 5098, 403, 594, 4633, 984, 253, 15880, 597, 3831, 403, 2969, 2568, 3576, 15, 13536, 547, 2506, 626, 755, 667, 625, 1480, 1128, 263, 625, 49664, 1128, 14644, 346, 21528, 3846, 4388, 449, 187, 187, 1989, 3212, 841, 16407, 1598, 15246, 38779, 263, 3931, 7027, 1107, 273, 8310, 13, 1869, 13, 285, 40290, 15, 309, 369, 581, 273, 253, 1643, 952, 27949, 2217, 281, 452, 1239, 253, 3236, 346, 25392, 4410, 7225, 937, 253, 25893, 24849, 275, 534, 24611, 480, 7655, 1066, 521, 5697, 670, 253, 2165, 15, 754, 1900, 4159, 275, 29514, 13, 285, 627, 497, 247, 2257, 273, 2827, 12290, 10880, 13, 347, 344, 22407, 253, 12320, 273, 4555, 752, 344, 3078, 281, 1333, 15, 187, 187, 13804, 3942, 369, 417, 12401, 954, 273, 368, 665, 452, 3597, 2710, 12192, 13, 3888, 13, 285, 14284, 7906, 275, 634, 1437, 323, 7756, 15, 3973, 285, 31971, 13, 344, 369, 247, 5974, 273, 15692, 13, 285, 344, 8156, 326, 627, 369, 1900, 1633, 2010, 344, 812, 3037, 13, 642, 2647, 849, 1199, 344, 2168, 3260, 670, 253, 2165, 15, 4952, 846, 7487, 15692, 398, 323, 8007, 13, 344, 1335, 11346, 7487, 37410, 281, 923, 604, 344, 812, 2619, 598, 1014, 253, 8004, 295, 814, 788, 273, 1491, 326, 651, 1361, 779, 275, 521, 9551, 15, 3808, 273, 619, 7583, 12959, 273, 24611, 2335, 1659, 417, 327, 253, 16507, 44722, 533, 275, 521, 3811, 2316, 13, 7487, 15692, 327, 7315, 285, 42708, 16585, 253, 2165, 326, 574, 3982, 441, 2366, 15, 187, 187, 13804, 3942, 369, 3240, 6600, 273, 253, 5606, 273, 253, 15692, 14284, 347, 344, 1694, 5662, 15, 1198, 1199, 273, 521, 5249, 13, 253, 27274, 2143, 273, 1869, 369, 326, 253, 1355, 13370, 1128, 43442, 285, 6174, 1128, 16894, 253, 14284, 15, 1292, 347, 344, 9047, 625, 3773, 327, 7315, 34535, 342, 616, 8248, 13, 24611, 9300, 326, 3762, 15, 187, 187, 3, 7745, 387, 436, 5599, 937, 344, 651, 1333, 15, 346, 7745, 387, 253, 896, 13370, 387, 789, 449, 187, 187, 2214, 24611, 13, 273, 2282, 13, 627, 369, 1900, 642, 581, 1332, 13, 642, 2014, 1039, 281, 14284, 253, 5453, 15, 27692, 12445, 3260, 625, 670, 15692, 685, 24611, 858, 13, 533, 752, 1663, 1160, 779, 247, 21242, 369, 417, 849, 1199, 344, 3260, 13, 533, 849, 344, 812, 4647, 326, 3640, 281, 1361, 1016, 2060, 39245, 1592, 275, 247, 9106, 2654, 3783, 6665, 83, 1420, 1039, 15, 187, 187, 34, 2257, 273, 10954, 476, 1056, 247, 6120, 326, 253, 1921, 247, 5974, 310, 15586, 342, 253, 34863, 310, 984, 521, 5453, 1664, 310, 4581, 387, 253, 1755, 273, 521, 14284, 15, 1292, 417, 1142, 476, 1361, 779, 4951, 257, 562, 521, 14137, 407, 41776, 247, 16498, 326, 588, 417, 760, 3451, 253, 9331, 13, 533, 671, 8146, 366, 5742, 342, 326, 5974, 15, 187, 187, 2214, 1650, 13, 604, 253, 5974, 497, 271, 16101, 4760, 751, 6270, 611, 614, 13, 24611, 3164, 651, 452, 753, 1633, 751, 13, 346, 15883, 13, 368, 878, 281, 1056, 2119, 253, 6907, 273, 634, 5453, 1664, 10129, 634, 1669, 41854, 387, 253, 1755, 273, 253, 896, 34259, 594, 326, 352, 310, 6278, 15, 2635, 13, 368, 878, 281, 23070, 634, 1066, 34259, 432, 253, 5004, 598, 594, 634, 2801, 15036, 39730, 285, 634, 2406, 2133, 1391, 1032, 253, 1039, 13, 17690, 253, 5453, 1664, 281, 3727, 10748, 594, 352, 310, 6278, 387, 3486, 449, 187, 187, 1898, 6270, 651, 452, 11742, 253, 1491, 13, 1160, 253, 3309, 23927, 13, 285, 48293, 562, 521, 14137, 15, 187, 187, 42, 2378, 9047, 247, 3492, 273, 24611, 4933, 247, 16507, 281, 521, 643, 8530, 35048, 13, 6029, 330, 445, 40590, 13, 665, 369, 1907, 253, 3242, 1072, 1895, 27, 32464, 14137, 15, 733, 369, 253, 1388, 1078, 6029, 369, 1955, 281, 3553, 323, 247, 14811, 13, 285, 344, 369, 4518, 23573, 670, 521, 19297, 281, 4352, 253, 4344, 1106, 15, 7820, 273, 5015, 670, 6029, 434, 5453, 1664, 13, 17628, 13, 390, 2133, 6887, 13, 24611, 3365, 2546, 779, 281, 13920, 779, 281, 253, 1669, 1930, 273, 253, 6276, 2491, 15, 187, 187, 13804, 3942, 574, 644, 6029, 434, 9732, 323, 1107, 15, 1583, 574, 247, 4451, 5533, 13, 285, 352, 369, 247, 15863, 816, 281, 3698, 731, 8008, 1128, 936, 4763, 247, 27105, 715, 581, 273, 253, 954, 5547, 5974, 14, 442, 12844, 7688, 275, 15692, 15, 309, 651, 1928, 253, 1072, 1039, 672, 24611, 285, 309, 651, 320, 5015, 15692, 13, 285, 344, 651, 1333, 13, 346, 5498, 626, 2028, 3780, 13, 533, 964, 964, 17212, 187, 187, 510, 2491, 387, 16916, 17241, 9585, 17954, 281, 253, 987, 273, 253, 28081, 7793, 13, 594, 247, 10584, 432, 253, 1669, 990, 273, 253, 2491, 1077, 973, 812, 990, 598, 275, 326, 4344, 1106, 15, 24611, 3365, 2183, 6029, 281, 1978, 253, 4023, 562, 273, 253, 4344, 1106, 1128, 26142, 670, 5453, 390, 2133, 6887, 15, 1284, 253, 16507, 33127, 13, 309, 9047, 275, 34369, 347, 6029, 434, 5453, 1664, 1899, 387, 253, 1755, 273, 253, 896, 34259, 13237, 3395, 6278, 13, 521, 2406, 2133, 4395, 39730, 949, 253, 4023, 13, 285, 521, 14137, 18811, 1029, 285, 4951, 15, 2896, 253, 990, 273, 253, 16507, 13, 309, 369, 33575, 326, 247, 2969, 26777, 751, 346, 19515, 253, 4023, 562, 273, 253, 28081, 4344, 1106, 3, 812, 3451, 6029, 434, 7681, 35354, 15, 187, 187, 3404, 253, 673, 13, 309, 2546, 24611, 849, 344, 3260, 816, 849, 281, 4993, 330, 445, 40590, 434, 10584, 15, 7820, 273, 22291, 13, 24611, 10017, 342, 247, 2926, 670, 849, 344, 574, 6518, 330, 445, 40590, 1078, 247, 1943, 14811, 275, 6831, 15, 309, 2546, 969, 13, 533, 1335, 1904, 626, 755, 253, 2380, 309, 369, 2819, 323, 15, 1292, 326, 369, 1846, 342, 24611, 15, 2596, 273, 253, 29125, 7794, 273, 619, 16072, 342, 779, 369, 253, 1039, 344, 5082, 626, 1918, 479, 247, 25038, 2380, 281, 619, 3533, 15, 187, 187, 8430, 352, 369, 29125, 387, 253, 673, 13, 309, 2210, 281, 8968, 326, 352, 369, 1199, 625, 14127, 281, 6233, 271, 3662, 685, 281, 452, 779, 26531, 14, 19261, 352, 281, 479, 15, 9157, 13, 1881, 14, 49330, 1160, 253, 3640, 1199, 625, 4217, 281, 479, 347, 247, 9732, 1580, 309, 7192, 253, 12342, 625, 11617, 285, 812, 897, 326, 275, 619, 15880, 15, 1310, 309, 497, 816, 1061, 287, 1076, 752, 24611, 574, 2183, 479, 13, 309, 1053, 626, 1158, 309, 651, 452, 644, 347, 9371, 15, 187, 187, 510, 1491, 344, 369, 2820, 281, 12709, 670, 330, 445, 40590, 369, 326, 344, 574, 1705, 281, 871, 6029, 434, 2165, 973, 13, 285, 326, 309, 651, 320, 2104, 281, 1361, 619, 3484, 1805, 2378, 309, 1694, 281, 871, 731, 285, 4802, 342, 731, 275, 271, 2060, 1039, 15, 187, 187, 42, 9047, 1529, 16507, 342, 247, 31156, 3558, 665, 1869, 24611, 574, 10416, 253, 12334, 15, 754, 369, 1907, 253, 9065, 673, 342, 253, 439, 3107, 285, 2210, 281, 24611, 18439, 323, 247, 16498, 15, 187, 187, 4553, 253, 3558, 5544, 521, 1895, 285, 4352, 247, 1643, 13768, 1128, 1200, 3107, 13, 3283, 1598, 1128, 13804, 3942, 1694, 562, 273, 521, 7281, 285, 4845, 521, 37747, 816, 3345, 253, 4023, 13, 2403, 247, 921, 273, 25661, 327, 352, 323, 1329, 15, 754, 840, 2183, 253, 3558, 281, 4352, 253, 4023, 1293, 16116, 253, 37747, 15, 309, 1620, 3047, 347, 1199, 4709, 275, 247, 39245, 1592, 434, 2927, 347, 309, 21153, 275, 436, 3558, 434, 15, 380, 1390, 2181, 344, 3078, 281, 513, 369, 281, 4352, 253, 37747, 285, 5007, 521, 3331, 285, 9732, 281, 253, 3216, 1128, 395, 24611, 3260, 352, 2, 187, 187, 9112, 10475, 5954, 13, 253, 3558, 12293, 598, 285, 1160, 247, 14284, 13, 5816, 253, 37747, 285, 16116, 253, 4023, 4891, 314, 15, 754, 858, 352, 969, 285, 969, 285, 1620, 2210, 2810, 281, 16116, 253, 37747, 15, 24611, 574, 29025, 521, 439, 3107, 984, 344, 3260, 849, 1682, 281, 13791, 342, 521, 5974, 15, 1244, 1046, 673, 436, 3558, 651, 320, 36107, 264, 342, 253, 439, 3107, 846, 326, 13, 512, 344, 574, 281, 513, 369, 5406, 24611, 285, 521, 37747, 13, 271, 2460, 326, 6518, 45224, 15, 187, 187, 1989, 7562, 253, 2165, 2969, 3589, 626, 347, 3477, 347, 24611, 1160, 352, 1646, 15, 1284, 309, 21863, 253, 23465, 273, 253, 9551, 8761, 13, 253, 10861, 1268, 273, 619, 3484, 2427, 598, 13, 347, 858, 619, 4142, 15, 1916, 21097, 619, 30980, 285, 15249, 253, 14247, 13, 309, 3543, 751, 309, 574, 281, 41987, 282, 731, 342, 619, 3640, 273, 253, 14284, 15, 309, 369, 762, 253, 44890, 2409, 326, 309, 369, 1146, 5087, 407, 253, 3159, 15, 187, 187, 8267, 30498, 5605, 281, 320, 4892, 305, 21384, 15, 9613, 247, 16507, 342, 619, 6831, 2316, 13884, 31513, 24006, 13, 665, 369, 34535, 253, 5453, 432, 1512, 2080, 3304, 253, 2303, 1386, 285, 10584, 272, 253, 4023, 13, 309, 3589, 626, 3240, 2119, 849, 281, 4993, 521, 14284, 1854, 28, 594, 309, 2335, 690, 7963, 273, 31513, 434, 14284, 285, 2692, 731, 281, 24611, 15, 187, 187, 1328, 3261, 387, 731, 285, 3365, 2183, 479, 281, 452, 779, 346, 11536, 253, 44722, 449, 41853, 13, 309, 1869, 670, 849, 24924, 309, 651, 3590, 4933, 436, 1511, 273, 5044, 7535, 281, 247, 1663, 18024, 4760, 15, 831, 369, 253, 2238, 273, 30514, 2092, 552, 9092, 309, 9403, 1918, 281, 2353, 12947, 285, 4260, 34898, 1212, 398, 281, 1361, 731, 1056, 3057, 342, 253, 4023, 625, 12724, 15, 733, 369, 751, 7746, 247, 2201, 14, 41363, 14623, 4760, 281, 346, 11145 ]
club in the bag and reach for a mid or short iron. Because of its length, the driver tends to exaggerate every portion of the swing, which not only makes it difficult to feel a change but also prevents you from building consistent rhythm because the tendency is to swing harder. Not only that, the driver is harder to hit, so you probably won't be hitting the shots you want, which increases your chances of abandoning the change because of all the negative feedback you're getting. When tour pros are trying to make an adjustment, they usually do so with a seven- or eight-iron. And when you're working on mechanics, I suggest hitting balls off a tee, especially if you're doing a drill. **LOW HANDICAPPER** Good players have grooved a reasonably reliable swing, especially by the end of a practice session. Usually, their biggest problem is taking this swing from the range to the course. Rhythm is often the problem. On the range, you are hitting several shots in a row with the same club, enabling you to make adjustments between swings. Although your basic swing is the same, because of the varied shaft lengths and clubface lofts, every club sets up slightly differently. But on the course, you may be switching between extremes in clubs from shot to shot—driver followed by a nine-iron—without the cushion of being able to make adjustments between swings, which leaves you unable to find a rhythm with each club. A good way to practice this club-to-club dilemma is to play simulated "rounds" on the range. Pretend you are playing all eighteen holes of your home course. For example, if the first hole is a four-hundred-yard par-four, hit a driver—aiming between two flags to represent the edges of the fairway—followed by whichever club you normally use for the approach. Then "play" the rest of the course, using the clubs that you normally would use. A Millions of golfers have read _Harvey Penick's Little Red Book_ and its sequels, which are the best-selling golf books of all time. I think Harvey's books are so popular because the lessons they contain are simple yet effective. Advice doesn't get any more direct—or more instructive—than "take dead aim." But behind these memorably straightforward aphorisms lie years of observation, thought, and experimentation. I was one of the few people fortunate enough to have read the original "Little Red Book," the legendary notebook in which Harvey jotted down his ideas about the game. He always wrote in pencil, and there were a lot of eraser marks, as he refined the precision of exactly what he wanted to say. Harvey was not unlike most of you who have tried various tips, images, and swing thoughts in your quest for improvement. First and foremost, he was a student of golf, and he realized that there was always something else he could learn, no matter how much he already knew about the game. Even after watching golfers for decades, he still enjoyed watching tournaments to see if he could pick up even the smallest nugget of information that would help him in his teaching. Some of my favorite memories of Harvey took place not on the lesson tee but in his living room, watching golf on television and casually discussing the game that had brought us together. Harvey was quite aware of the evolution of the golf swing as he got older. For much of his career, the prevailing school of thought was that the small muscles—hands and arms—controlled the swing. But as he watched more players on television swinging with their bodies, Harvey updated that theory. "Look at this guy," he would say. "Look at the back muscles at work." For Harvey, of course, there was always no one method, no single way to swing the club. Probably nobody knew more about golf than Harvey did, but what really made him a genius was not how much he knew, but how he could apply that knowledge to help each individual golfer in a totally idiosyncratic way. A lot of teachers can make a diagnosis that the reason a student is struggling with the hooks is because his clubface is closed at the top of his swing. But not many can help him straighten out his drives by prescribing a cure that will not only correct the fault, but also resonate specifically with that student. For example, if the student were an analytical player like Tom Kite, Harvey probably would have said something like, "Tom, you need to make sure the angle of your clubface matches your left forearm at the top of the backswing so that it is square. Then, you need to initiate your downswing from the bottom up so your weight shifts aggressively and your lower body clears the way, enabling the clubface to release naturally so it is square at impact." And Tom would have processed the information, made the necessary adjustments, and straightened out his drives. I once watched a video of Harvey giving a lesson to his other famous pupil, Ben Crenshaw, who was having the exact same problem: hooked drives. It was the day before Ben was due to leave for a tournament, and he was clearly frustrated about his inability to hit the fairway. Instead of talking about Ben's clubface, grip, or body positions, Harvey simply asked him to accompany him to the left side of the driving range. Harvey had been Ben's teacher for years. They had a unique bond, and it was a privilege just to watch them interact—to receive a glimpse into one of the most successful student-teacher relationships in golf. I would feel the same way when Harvey and I would be talking golf, and he would say, "Don't tell anyone, but . . ." The range at Austin Country Club sits to the right of the tenth hole, so a hook from the left end of the range very well could end up in that fairway. Harvey simply told Ben to keep the ball out of the fairway—nothing about club or body positions. As the lesson progressed, I watched in awe as Ben's clubface position at the top of the backswing gradually became square, his lower body moved aggressively through the ball, and his drives flew high and straight. By the end of the lesson, I was stunned that a simple directive like "Keep the ball out of the tenth fairway" could correct Ben's technical faults. At the time, I asked Harvey how he knew just how to fix Crenshaw's hook. Instead of answering, Harvey replied with a story about how he had helped Crenshaw before a big tournament in college. I asked again, but still didn't get the response I was looking for. But that was common with Harvey. One of the frustrating aspects of my conversations with him was the way he wouldn't give me a definitive response to my questions. Although it was frustrating at the time, I came to realize that it was much more satisfying to earn an answer than to have him spoon-feed it to me. Additionally, self-discovery made the knowledge much more useful to me as a teacher since I understood the concepts more deeply and could use that in my lessons. If I were just parroting what Harvey had told me, I don't think I would have been as helpful. The information he was trying to convey about Crenshaw was that he had come to know Ben's game well, and that I would be able to help my students better once I got to know them and connected with them in an individual way. I watched another lesson with a longtime member who thought Harvey had hung the moon. He was having the worst time with the shanks and came to Harvey desperate for a cure. After the member explained his problem and hit a few shots—shanks, predictably—Harvey got out of his cart and placed his cane just outside the ball, making a show of leaning on it for support. He then told the member to hit the ball without hitting the cane. I never saw as much fear in a golfer's eyes as I witnessed in this member's. The last thing he wanted to do was to hit the cane and send his friend and teacher to the ground—and Harvey knew it! Reluctantly, the member stepped up and made a swing, missing the cane and hitting the ball solidly. He did it again and again and never came close to hitting the cane. Harvey had cured his shanks because he knew how best to communicate with his student. And every time this member would be afflicted with the shanks after that, all he had to do was picture Harvey and his cane, an image that helped immensely. But keeping the game simple wasn't as easy as Harvey made it seem. As I climbed the ladder of the teaching profession, the skill level of my students went up, as did my rates. To impress my pupils and justify the expense, I felt like I had to dazzle them with my knowledge of the swing. I was under the misconception that I was being paid by the word. Every instructor wants to be tour guru. Before a lesson with my college roommate Joel Edwards, who was swinging the club from too far inside the target line and hooking the ball, I wasn't quite sure how to fix his swing path; so I took some photos of Joel's swing and showed them to Harvey. He looked at them and simply told me to have him "clip the tee." Immediately, I thought about how foolish I would sound giving this type of basic advice to a really skilled player. This was the kind of rudimentary tip I normally give to beginners and mid handicappers to help them make contact with the ball more consistently. It was like telling a major-league baseball player to "make
[ 9782, 30834, 240, 74, 256, 9702, 123, 187, 46233, 30834, 98, 68, 256, 6829, 244, 277, 6829, 100, 1251, 289, 333, 2093, 256, 39110, 419, 74, 8511, 9702, 117, 68, 246, 30836, 187, 87, 12931, 362, 9702, 244, 90, 246, 9837, 74, 256, 9702, 123, 256, 6829, 244, 277, 6829, 100, 1251, 815, 28382, 14260, 35177, 79, 362, 5991, 288, 5991, 23713, 17949, 36937, 1251, 15, 187, 67, 31228, 492, 543, 32788, 32595, 85, 298, 9702, 244, 81, 6734, 270, 9702, 109, 85, 17949, 9702, 102, 86, 246, 6829, 106, 187, 6829, 242, 17949, 6457, 90, 17949, 32595, 79, 17949, 6457, 90, 448, 6187, 1251, 246, 9837, 74, 1269, 41411, 17949, 6829, 222, 23713, 295, 39110, 74, 16816, 32595, 81, 187, 7311, 30836, 256, 28382, 17949, 41314, 275, 362, 4265, 79, 270, 35165, 79, 295, 5991, 90, 2093, 448, 6187, 1251, 246, 9837, 74, 17949, 41314, 448, 6187, 1251, 246, 9837, 74, 187, 545, 35165, 74, 26856, 6829, 242, 74, 246, 30110, 80, 295, 1954, 362, 6829, 238, 74, 10382, 15, 2043, 313, 4196, 361, 10, 187, 87, 6829, 238, 74, 9161, 361, 270, 5353, 15, 9161, 361, 270, 5353, 27824, 278, 36937, 85, 246, 6829, 117, 298, 35177, 246, 30110, 74, 187, 545, 6336, 277, 30834, 238, 74, 278, 5991, 79, 288, 12931, 23713, 295, 31228, 345, 256, 39110, 295, 5991, 90, 187, 545, 35165, 74, 815, 14096, 288, 6829, 98, 81, 362, 6829, 238, 74, 17949, 74, 46663, 86, 17949, 1954, 362, 5991, 32219, 17949, 1954, 448, 6187, 1251, 15307, 26566, 187, 249, 278, 5991, 79, 288, 12931, 23713, 295, 39110, 74, 16816, 32595, 81, 275, 492, 31228, 260, 14096, 1251, 187, 187, 41, 40620, 27, 209, 187, 2483, 218, 28733, 15472, 6280, 231, 15754, 21433, 20489, 28733, 22224, 6280, 216, 23068, 17665, 29950, 33465, 17665, 2483, 100, 12001, 23068, 42042, 15754, 6280, 96, 12001, 29903, 15472, 22143, 6123, 99, 6280, 109, 30598, 22224, 21433, 12001, 15754, 2483, 98, 28817, 33358, 21433, 20489, 21433, 15472, 187, 2483, 107, 30598, 38619, 23936, 6280, 216, 2483, 237, 17665, 2483, 238, 12001, 6280, 220, 23068, 17665, 30598, 25159, 22143, 23068, 15472, 6280, 218, 28733, 15472, 6280, 218, 28733, 33465, 6123, 220, 24381, 15472, 2483, 242, 21433, 15472, 33465, 12001, 2483, 100, 6280, 107, 23068, 12001, 29950, 12001, 187, 23936, 25159, 6280, 217, 39695, 6280, 218, 28733, 15472, 6280, 239, 25159, 2483, 96, 2483, 122, 6280, 231, 15754, 28817, 2483, 242, 12001, 33465, 24381, 23936, 15472, 28817, 33358, 22143, 187, 24381, 25159, 2483, 96, 33465, 32191, 2483, 240, 12001, 29950, 12001, 6280, 234, 29950, 12001, 28817, 33358, 187, 23936, 25159, 37500, 38619, 2483, 240, 15472, 6280, 109, 30598, 12001, 2483, 212, 1780, 43728, 21433, 25159, 2483, 96, 21433, 22224, 6280, 115, 17665, 29950, 12001, 2483, 233, 17665, 29950, 12001, 21433, 15754, 23068, 15472, 6280, 101, 15472, 22143, 6123, 99, 187, 39695, 20489, 23068, 374, 6280, 110, 20489, 28733, 22224, 40808, 15754, 6280, 109, 12001, 6280, 217, 15754, 2483, 226, 24381, 17665, 28733, 6280, 218, 23068, 39695, 38619, 2483, 242, 28817, 33358, 187, 29903, 15472, 2483, 239, 15754, 33465, 15472, 22143, 28733, 15754, 21433, 12001, 6280, 110, 20489, 28733, 22224, 40808, 15754, 6280, 239, 2483, 107, 6280, 109, 30598, 33465, 32191, 2483, 240, 37500, 15472, 22143, 6280, 217, 23936, 12001, 28817, 33358, 187, 2483, 218, 28733, 29903, 20489, 2483, 226, 28817, 32191, 23068, 15472, 6280, 220, 28733, 24381, 15472, 6280, 112, 20489, 2483, 226, 42042, 20489, 23068, 374, 33465, 6123, 223, 22143, 39695, 12001, 28817, 33358, 6123, 99, 187, 39695, 20489, 23068, 854, 6280, 226, 24381, 17665, 2483, 116, 23068, 42042, 20489, 23068, 187, 2483, 239, 25159, 6280, 218, 28733, 32191, 15472, 22143, 6280, 107, 2483, 239, 15754, 33465, 15472, 6280, 239, 38619, 2483, 96, 2483, 122, 12001, 28817, 33358, 187, 2483, 239, 25159, 6280, 217, 39695, 6280, 237, 12001, 30598, 23936, 15472, 28817, 33358, 22143, 6280, 115, 30598, 21433, 38619, 2483, 238, 6280, 244, 22224, 21433, 15754, 33465, 24381, 23936, 15472, 28817, 33358, 22143, 187, 2483, 220, 28733, 24381, 15472, 6280, 107, 12001, 46175, 6280, 109, 15472, 6280, 101, 25159, 23068, 25159, 22143, 28817, 25159, 22143, 46069, 15472, 187, 23068, 22143, 2483, 107, 15754, 6280, 101, 25159, 6280, 109, 12001, 6280, 217, 2483, 243, 21433, 15472, 6280, 107, 2483, 239, 12001, 29950, 42042, 17665, 15754, 29950, 25159, 46069, 21433, 20489, 29950, 12001, 6280, 239, 12001, 23936, 12001, 28817, 33358, 187, 2483, 218, 28733, 29903, 20489, 2483, 226, 37500, 33358, 22143, 42042, 23936, 12001, 6280, 112, 46069, 12001, 23936, 12001, 6280, 231, 15754, 21433, 12001, 15754, 17665, 15754, 40808, 12001, 2483, 219, 21433, 15754, 23936, 12001, 6123, 99, 187, 28733, 15472, 2483, 242, 2483, 216, 39695, 21433, 15472, 6280, 216, 22143, 46175, 15754, 6734, 6280, 239, 25159, 33465, 15472, 6280, 116, 38619, 15754, 6123, 213, 28817, 25159, 23936, 12001, 28817, 33358, 187, 29950, 30598, 12001, 2483, 212, 42042, 15754, 28817, 32191, 33465, 22224, 15754, 20489, 29950, 29903, 21433, 25159, 42042, 15754, 20489, 2483, 244, 12001, 2483, 117, 20489, 23936, 21433, 15754, 23936, 15472, 28817, 33358, 22143, 187, 30598, 32191, 12001, 15754, 15472, 6280, 112, 20489, 2483, 226, 6280, 218, 28733, 42042, 12001, 2483, 243, 21433, 25159, 37500, 38619, 46175, 17665, 15754, 20489, 23936, 21433, 15754, 23068, 15472, 21433, 15472, 6280, 112, 20489, 2483, 226, 37500, 6123, 220, 23068, 20489, 2483, 242, 15754, 21433, 15754, 15472, 22143, 187, 2483, 218, 28733, 15472, 33465, 22224, 15754, 20489, 29950, 29903, 21433, 15472, 33465, 12001, 2483, 100, 6280, 217, 15754, 22143, 2483, 244, 21433, 15754, 23068, 12001, 28817, 25159, 46069, 12001, 209, 6123, 99, 2043, 313, 4196, 361, 10, 187, 4196, 361, 6280, 107, 6123, 220, 2483, 96, 21433, 15472, 33465, 12001, 2483, 100, 6123, 99, 9161, 361, 6280, 107, 6123, 220, 2483, 96, 6280, 101, 15754, 42042, 15754, 28817, 33358, 187, 28733, 17665, 24381, 17665, 15754, 22224, 23068, 21433, 15472, 6280, 103, 22224, 2483, 237, 15472, 6280, 99, 25159, 6280, 109, 30598, 33465, 22143, 2483, 233, 17665, 29950, 12001, 187, 2483, 220, 28733, 33465, 15472, 37500, 15472, 29903, 6280, 233, 12001, 23068, 12001, 6280, 237, 12001, 30598, 20489, 2483, 226, 6280, 231, 15754, 6280, 106, 20489, 15754, 28817, 32191, 12001, 15754, 15472, 42042, 12001, 28733, 28817, 33358, 187, 28733, 22224, 15754, 20489, 29950, 29903, 37500, 6123, 220, 23068, 20489, 2483, 242, 15754, 42042, 17665, 15754, 20489, 22143, 2483, 242, 6280, 239, 25159, 6280, 116, 22224, 15754, 17665, 2483, 117, 42042, 17665, 15754, 20489, 22143, 2483, 242, 21433, 15754, 23936, 12001, 28817, 33358, 187, 187, 16330, 757, 27, 209, 187, 6534, 4954, 97, 5846, 39410, 3142, 28745, 6900, 13504, 18775, 18906, 28745, 10091, 40134, 6900, 10091, 47347, 6900, 24477, 28745, 9427, 10091, 9211, 15, 209, 30801, 5846, 187, 28337, 10091, 4467, 10091, 45232, 6534, 13621, 4954, 97, 5846, 37760, 39410, 3142, 15677, 3142, 209, 30801, 5846, 34341, 6534, 18775, 8181, 28745, 6900, 43246, 29413, 6900, 9211, 47951, 187, 13621, 5846, 47931, 6900, 30801, 5846, 13504, 10091, 20817, 6534, 18906, 10091, 9211, 4954, 97, 5846, 39410, 3142, 32262, 116, 3142, 11912, 9427, 18152, 40913, 31602, 11912, 29413, 5846, 10091, 9211, 187, 18775, 9211, 20817, 6534, 35429, 10091, 21931, 28745, 40802, 9427, 37715, 9211, 9427, 32262, 113, 8181, 187, 13621, 40134, 31602, 24477, 10091, 9211, 29413, 9211, 4954, 97, 6900, 9211, 6534, 10091, 5846, 6534, 39410, 3142, 28745, 6900, 209, 30801, 5846, 23072, 3142, 20817, 6534, 35429, 10091, 21931, 28745, 9427, 5843, 15, 187, 45821, 10091, 5846, 374, 18152, 6900, 49788, 10091, 209, 40134, 10091, 6900, 47951, 9427, 209, 10091, 3142, 34127, 32262, 113, 8181, 187, 40134, 10091, 6900, 47951, 9427, 34341, 5846, 14585, 39727, 23630, 10091, 29620, 6900, 18152, 14062, 8181, 10091, 40913, 14585, 29413, 47951, 187, 13621, 5846, 47931, 6900, 30801, 5846, 13504, 3142, 209, 45821, 10091, 5846, 374, 39410, 3142, 15677, 6900, 30801, 4954, 97, 5846, 32262, 108, 8181, 30265, 10714, 115, 28745, 40802, 9427, 209, 30801, 5843, 15, 187, 45821, 10091, 5846, 854, 209, 45821, 10091, 5846, 25849, 5843, 4467, 187, 18775, 9427, 28745, 6900, 209, 30801, 5846, 47347, 14585, 5843, 8181, 15677, 9427, 18152, 29620, 5846, 9427, 18152, 30265, 4467, 37715, 9211, 9427, 32262, 113, 8181, 187, 5843, 39727, 9211, 10091, 29413, 9427, 13504, 10091, 20817, 6534, 18906, 10091, 9211, 29802, 6900, 29413, 24477, 10091, 39410, 3142, 29413, 9427, 13504, 10091, 45232, 6534, 3142, 9427, 10091, 9211, 209, 18906, 23072, 30901, 28745, 9427, 10091, 9211, 187, 13621, 13793, 9211, 32262, 112, 4954, 97, 5846, 4954, 223, 209, 30801, 5846, 28745, 6534, 45232, 6534, 3142, 9427, 47951, 15677, 49788, 187, 13621, 9427, 44076, 30801, 37715, 5843, 24477, 9427, 28745, 6534, 209, 10091, 3142, 29802, 22814, 8181, 13504, 39727, 9211, 32262, 113, 8181, 11912, 40802, 9427, 47347, 6900, 24477, 13504, 10091, 209, 40134, 10091, 6900, 9211, 187, 13621, 5846, 47931, 6900, 30801, 5846, 31461, 32262, 112, 39410, 9211, 10091, 47931, 10091, 32262, 113, 8181, 11912, 40802, 9427, 13504, 10091, 29413, 6900, 9211, 5843, 18152, 209, 3142, 14062, 9211, 30901, 13504, 10091, 29413, 6900, 9211, 5843, 15, 187, 10714, 112, 28745, 10714, 108, 4467, 6734, 29413, 9427, 32262, 112, 37715, 6900, 6534, 13793, 37715, 6900, 6534, 13793, 13504, 10091, 37715, 49788, 187, 30801, 5846, 23072, 3142, 20817, 3142, 209, 30801, 5846, 23072, 3142, 34341, 6900, 10091, 7427, 39410, 3142, 20817, 13793, 6900, 10091, 11912, 13504, 10091, 29413, 5846, 10091, 5843, 187, 5843, 18906, 10091, 8181, 39727, 29413, 5846, 10091, 9211, 20817, 3142, 209, 30801, 5846, 13504, 8181, 5846, 39410, 3142, 15677, 6900, 30801, 13504, 3142, 209, 150, 217, 3142, 45821, 29413, 5846, 10091, 9211, 15677, 5846, 47931, 6900, 30801, 5846, 13504, 3142, 187, 13621, 30801, 9211, 4954, 97, 5846, 39410, 3142, 15677, 3142, 34341, 6900, 10091, 7427, 37715, 6900, 6534, 13793, 29413, 5846, 10091, 9211, 15, 37715, 6900, 6534, 13793, 313, 4196, 361, 10, 187, 13621, 3142, 9161, 361, 15677, 3142, 49788, 9161, 361, 15677, 3142, 49788, 15677, 3142, 31159, 6900, 28337, 10091, 15677, 6900, 47931, 6900, 32262, 113, 8181, 187, 9211, 6900, 209, 45821, 30801, 10091, 5846, 4954, 115, 11912, 21931, 9427, 4954, 223, 15677, 5846, 47931, 6900, 30801, 5846, 209, 30801, 5846, 25849, 9211, 9211, 187, 13621, 30801, 9211, 13504, 29937, 47931, 14062, 8181, 28745, 10714, 114, 8181, 9427, 15677, 10714, 114, 9211, 18152, 34341, 45821, 14585, 187, 5843, 18906, 10091, 8181, 39727, 34341, 6900, 10091, 7427, 209, 150, 217, 3142, 45821, 29413, 9427, 209, 150, 217, 3142, 45821, 15677, 7427, 3142, 187, 187, 44, 37173, 27, 209, 187, 166, 39068, 35458, 214, 28736, 10608, 222, 99, 31956, 118, 7775, 239, 215, 168, 119, 235, 27940, 10608, 228, 227, 35169, 244, 35169, 239, 168, 235, 99, 15, 16857, 39068, 35458, 223, 187, 33104, 215, 168, 98, 122, 7775, 97, 222, 37176, 16857, 39068, 34431, 99, 37176, 20959, 7775, 217, 223, 168, 122, 230, 44633, 122, 35296, 46927, 223, 34431, 243, 187, 168, 116, 231, 35061, 29470, 34817, 43710, 239, 166, 111, 110, 209, 15074, 243, 7775, 44140, 44799, 33057, 115, 31912, 187, 168, 123, 231, 34431, 239, 7775, 215, 99, 167, 105, 216, 187, 21053, 107, 42581, 1780, 43728, 7775, 123, 231, 34431, 239, 39343, 7775, 215, 99, 167, 105, 216, 29470, 35458, 243, 33057, 115, 31912, 15, 16857, 39068, 41986, 223, 169, 212, 122, 187, 15074, 211, 374, 24169, 7775, 44140, 35169, 243, 42581, 10608, 235, 227, 24169, 34127, 32115, 216, 50152, 100, 28774, 216, 31912, 187, 26532, 227, 34391, 209, 15074, 243, 10608, 232, 223, 10608, 243, 219, 20959, 29333, 211, 7775, 215, 122, 41639, 34123, 7775, 44140, 35169, 243, 42581, 187, 20959, 39343, 7775, 239, 215, 47538, 209, 15074, 211, 374, 39343, 209, 15074, 243, 14394, 119, 169, 233, 219, 33057, 115, 31912, 15, 187, 15074, 211, 854, 10608, 226, 236, 28774, 228, 209, 15074, 211, 187, 20959, 10608, 112, 215, 29333, 211, 27940, 7775, 234, 110, 35458, 110, 167, 227, 235, 39907, 187, 14394, 119, 35169, 243, 20959, 7775, 238, 227, 29470, 24169, 46438, 214, 28736, 209, 15074, 243, 7775, 44140, 28774, 219, 24169, 46438, 123, 27997, 110, 187, 166, 39068, 25811, 238, 215, 20959, 10608, 228, 227, 7775, 9223, 167, 241, 223, 20959, 10608, 227, 243, 46438, 214, 28774, 216, 31912, 187, 168, 219, 106, 28774, 227, 374, 10608, 235, 227, 24169, 854, 10608, 223, 211, 35169, 243, 7775, 9223, 27997, 104, 187, 166, 39068, 167, 241, 235, 41639, 10608, 213, 235, 24169, 42984, 227, 34391, 29470, 34817, 25811, 233, 220, 40025, 236, 28736, 7775, 117, 103, 15074, 243, 46438, 214, 28774, 216, 31912, 15, 187, 35169, 239, 28774, 228, 29470, 24169, 9978, 6734, 10608, 213, 114, 167, 116, 211, 187, 21053, 107, 42581, 27940, 7775, 234, 107, 42581 ]
người sẽ được sử dụng thay cho số hai hoặc tám vì vậy tôi sẽ sử dụng phát hiện và hành động. bên trong thiết lập () bắt đầu từ ở đây đến đây chúng tôi xác định nối tiếp giám sát để in văn bản này cho chúng tôi để chúng tôi phải khởi tạo nó với serial.begin (9600) với 9600 baud. 9600 baud là một tỷ lệ tại phía dưới màn hình nên con số này phải phù hợp với điều đó và sau đó chúng ta có in màn hình nối tiếp in trên cùng Hindi: इसे और किसी अन्य स्थान पर डालें। यही कारण है कि के बहुत अच्छा उन्होंने इसे इस सॉकेट के साथ बनाया तो आप इसे जोड़ और हटा सकते हैं कोड समझाया गया है तो मुझे यहाँ Arduino कोड की व्याख्या करने दें। पिन 2 रिसीवर या आरएक्स इनपुट है लेजर सेंसर का रिसीवर जब यह समझ में आता है इसलिए हमने उसके लिए पिन 2 सौंपा है। पिन 8 एक्शन पिन जो इसमें बजर से जुड़ा है जो आप चाहते हैं वह कुछ भी कर सकते हैं उसके बाद ये दोनों होंगे नंबर दो या आठ के बजाय प्रयोग किया जाता है इसलिए मैं पता लगाता और कार्रवाई करता। सेटअप के अंदर () जो से शुरू होता है यहाँ पर हम सीरियल को परिभाषित करते हैं हमारे लिए इस पाठ को मुद्रित करने के लिए मॉनिटर करें इसे सीरियल के साथ आरंभ करना होगा ।begin (9600) 9600 बॉड के साथ। 9600 बॉड दर पर है स्क्रीन के नीचे तो यह संख्या उस से मेल खाना चाहिए और फिर हमारे पास है सीरियल मॉनिटर प्रिंट जो शीर्ष प्रिंट करता है Persian: و آن را در مکان دیگری قرار دهید. این خیلی خوب آنها را با این سوکت درست کردند بنابراین می توانید آن را اضافه و حذف کنید کد توضیح داده شده است بگذارید کد آردوینو را در اینجا توضیح دهم. پین 2 ورودی گیرنده یا RX است گیرنده سنسور لیزر وقتی حس کند بنابراین ما پین 2 را برای آن اختصاص داده ایم. پین 8 پین عمل که در این قسمت به وزنه وصل شده است موردی که می توانید هر کاری را که می خواهید انجام دهید بعد از آن ، این دو خواهند بود به جای شماره دو یا هشت مورد استفاده قرار می گیرد بنابراین من از ردیابی استفاده می کردم و اقدام می کردم. از داخل () که از شروع شروع می شود اینجا تا اینجا سریال را تعریف می کنیم مانیتور کنید تا این متن را برای ما چاپ کنید بنابراین ما باید آن را با سریال شروع کنید. شروع (9600) با 9600 باود 9600 باود با نرخی برابر است در پایین صفحه ، بنابراین این عدد باید مطابقت داشته باشد و سپس مانیتور سریال چاپ که چاپ بالا Korean: 그것을 다른 위치에 두십시오. 그게 아주 좋은 그들은이 소켓으로 만든 추가하고 제거 할 수 있습니다 코드 설명 여기 Arduino 코드를 설명하겠습니다. 그만큼 핀 2는 수신기 또는 RX 입력입니다 감지 할 때 레이저 센서의 수신기 이를 위해 핀 2를 할당했습니다. 핀 8 동작 핀 이 버저에 연결되어 당신이 원하는 것을 할 수있는 경우 그 후이 두 사람이 될 것입니다 숫자 2 또는 8 대신 사용 그래서 나는 감지하고 행동을 취할 것입니다. 시작하는 setup () 내부 여기에 여기
[ 16636, 2415, 2596, 25263, 721, 840, 2708, 310, 247, 3213, 14, 1615, 14, 10539, 407, 7102, 323, 253, 1072, 15, 187, 187, 1848, 8846, 44780, 46647, 29839, 52, 4145, 443, 18244, 1410, 6651, 2596, 25263, 721, 16636, 2415, 2637, 27, 187, 187, 13325, 2119, 368, 452, 2168, 37572, 253, 7491, 27564, 285, 8038, 308, 10690, 49, 7355, 327, 2596, 25263, 721, 1108, 6089, 13, 436, 310, 247, 1077, 1774, 4809, 273, 436, 6053, 6971, 16636, 2415, 1232, 15, 380, 6053, 6971, 23367, 1873, 310, 3715, 275, 247, 1039, 281, 320, 8038, 3066, 247, 308, 10690, 49, 7355, 390, 643, 2840, 7355, 15, 15725, 7355, 778, 417, 320, 2104, 3334, 436, 6053, 6971, 390, 6813, 1886, 16636, 2415, 23367, 1873, 15, 187, 187, 20865, 253, 6323, 5887, 83, 6971, 16636, 2415, 323, 2596, 25263, 721, 390, 581, 273, 253, 1563, 27, 187, 187, 7093, 4481, 588, 417, 320, 26415, 816, 407, 20864, 253, 6053, 6971, 4097, 44, 1873, 327, 634, 10469, 4481, 15, 187, 187, 15705, 6971, 4097, 44, 7648, 390, 1294, 2715, 310, 816, 247, 6053, 6971, 16636, 2415, 4323, 2898, 15, 187, 187, 510, 6053, 6971, 4097, 44, 7648, 390, 1294, 622, 588, 35310, 789, 604, 368, 452, 2168, 16636, 2415, 1703, 634, 10469, 26391, 15, 187, 187, 13996, 14, 1615, 14, 13996, 7102, 327, 849, 281, 16636, 2415, 2596, 25263, 721, 970, 6053, 6971, 390, 6813, 1886, 23367, 1873, 27, 187, 187, 20865, 285, 3491, 253, 6053, 6971, 390, 6813, 1886, 390, 253, 26718, 15, 16368, 313, 4064, 253, 13664, 23, 308, 10690, 49, 15, 23537, 5522, 10, 1873, 281, 2596, 25263, 721, 15, 313, 42, 3524, 368, 452, 2168, 20582, 581, 273, 253, 5230, 23367, 1873, 432, 253, 1840, 38661, 2593, 10, 187, 187, 4125, 19855, 253, 2596, 25263, 721, 281, 7491, 715, 308, 10690, 49, 7355, 15, 187, 187, 5872, 13, 16551, 253, 28771, 432, 308, 10690, 49, 1728, 3601, 13, 840, 3609, 253, 6053, 6971, 16636, 2415, 23367, 1873, 432, 253, 1873, 9882, 15, 187, 187, 45327, 390, 3334, 253, 6053, 6971, 390, 6813, 1886, 23367, 1873, 390, 253, 26718, 15, 16368, 1873, 2530, 275, 253, 13664, 23, 308, 10690, 49, 15, 23537, 13, 407, 7335, 2821, 253, 4235, 5495, 281, 11204, 2683, 22843, 327, 308, 10690, 49, 3601, 15, 187, 187, 13689, 323, 308, 10690, 49, 281, 10299, 253, 26718, 5522, 15, 7243, 253, 36070, 310, 2218, 816, 29393, 634, 2813, 15, 187, 187, 1845, 8491, 15844, 1422, 943, 1024, 452, 16636, 2415, 327, 2596, 25263, 721, 15, 187, 187, 2347, 281, 2451, 604, 16636, 2415, 310, 11410, 327, 2596, 25263, 721, 390, 5803, 32, 187, 187, 27383, 253, 16636, 2415, 2451, 254, 622, 432, 253, 10223, 16106, 285, 12654, 604, 634, 4481, 310, 16636, 2415, 1703, 390, 417, 15, 187, 187, 4943, 310, 247, 37617, 849, 281, 10299, 253, 9242, 16636, 2415, 8985, 3066, 308, 10690, 49, 27, 187, 187, 2042, 368, 2454, 667, 3237, 327, 436, 7102, 281, 3334, 308, 10690, 49, 323, 2596, 25263, 721, 840, 13, 368, 476, 16164, 285, 12252, 1060, 15, 22660, 479, 390, 690, 643, 2608, 327, 436, 12209, 588, 43004, 896, 281, 634, 7316, 347, 3517, 347, 1896, 15, 187, 187, 28412, 24251, 390, 4974, 13020, 281, 253, 2596, 25263, 721, 313, 15152, 300, 2960, 10, 12209, 1198, 643, 10469, 12047, 33506, 84, 13, 10243, 486, 2697, 33506, 84, 13, 285, 512, 643, 2813, 2173, 12989, 15, 537, 209, 21723, 27591, 187, 537, 475, 8283, 9169, 17545, 11294, 187, 537, 475, 187, 537, 475, 21737, 762, 253, 14325, 4637, 13, 11099, 374, 15, 17, 313, 783, 346, 17736, 3287, 187, 537, 475, 368, 778, 417, 897, 436, 1873, 3707, 275, 10276, 342, 253, 4637, 15, 187, 537, 475, 1422, 778, 4044, 247, 3491, 273, 253, 4637, 387, 187, 537, 475, 187, 537, 475, 50273, 2413, 1358, 2700, 15, 8418, 15, 2061, 16, 17130, 16, 17821, 14, 19, 15, 17, 187, 537, 475, 187, 537, 475, 15999, 2424, 407, 7763, 1569, 390, 5821, 281, 275, 4028, 13, 3694, 187, 537, 475, 5939, 762, 253, 4637, 310, 5939, 327, 271, 346, 1719, 4110, 3, 23440, 13, 187, 537, 475, 15002, 15466, 4145, 22998, 3481, 9103, 19329, 13, 2057, 3890, 390, 10466, 15, 187, 537, 475, 2594, 253, 4637, 323, 253, 2173, 3448, 13200, 15607, 285, 187, 537, 475, 7364, 762, 253, 4637, 15, 187, 537, 209, 21723, 27591, 8480, 187, 187, 32197, 342, 11447, 14, 7769, 20766, 6365, 18211, 187, 4578, 33197, 187, 187, 688, 1635, 281, 390, 3185, 273, 253, 17082, 2130, 275, 253, 6335, 13, 368, 476, 897, 634, 1211, 3290, 17082, 15, 1916, 513, 436, 27, 187, 187, 26577, 5733, 634, 1211, 7092, 273, 253, 3290, 17082, 5933, 285, 4853, 19832, 285, 22195, 5971, 323, 326, 5933, 15, 187, 187, 26577, 13106, 436, 747, 5933, 275, 253, 20890, 5423, 2422, 46042, 5190, 4849, 273, 253, 3290, 7982, 873, 15, 187, 50275, 9917, 8749, 253, 3280, 5113, 323, 253, 747, 5933, 275, 253, 20890, 5423, 3233, 5190, 4849, 273, 253, 3290, 7982, 873, 15, 187, 187, 11244, 253, 4451, 2234, 672, 41863, 253, 747, 5933, 285, 697, 3280, 13, 285, 897, 253, 1072, 2234, 281, 4044, 253, 10302, 1543, 15, 187, 510, 2285, 556, 28136, 247, 8574, 9905, 14, 2050, 3197, 22441, 326, 26586, 30561, 18494, 13, 751, 1421, 13, 432, 1824, 15, 11474, 1335, 275, 697, 21841, 3408, 13, 436, 22441, 1537, 320, 2104, 281, 2590, 253, 9065, 2308, 273, 1421, 17969, 1119, 275, 5053, 751, 42796, 13, 11314, 13, 1561, 247, 1643, 3038, 15, 187, 187, 1628, 510, 4081, 1332, 310, 20182, 544, 14644, 1655, 1781, 14, 7527, 24077, 2718, 1092, 1580, 352, 4648, 39288, 2105, 1417, 8138, 1806, 753, 309, 1433, 49360, 3666, 81, 1758, 1879, 356, 276, 965, 665, 3977, 253, 2199, 15, 773, 395, 625, 18380, 2429, 281, 643, 2718, 13, 835, 13506, 4753, 403, 908, 1425, 187, 187, 510, 2934, 3548, 457, 85, 7094, 747, 15, 45273, 452, 1929, 323, 1107, 326, 8574, 4428, 5793, 2390, 1905, 1925, 22236, 1190, 684, 1905, 326, 7356, 281, 18494, 15, 15643, 9437, 387, 436, 1824, 16733, 2492, 4473, 3597, 924, 3834, 253, 8574, 9905, 715, 247, 4030, 11687, 13, 534, 369, 840, 6804, 715, 1421, 14, 85, 20354, 1824, 15, 380, 12825, 18494, 8980, 253, 11687, 13, 285, 2366, 13, 597, 403, 18748, 562, 273, 253, 1824, 15, 1292, 436, 5199, 310, 247, 2372, 28116, 1905, 368, 878, 247, 5806, 323, 247, 5806, 15, 187, 187, 4604, 356, 276, 965, 285, 617, 11651, 21010, 436, 1232, 407, 34663, 2192, 5302, 253, 8574, 11687, 4830, 247, 15386, 22441, 15, 380, 2457, 48230, 90, 22441, 310, 3925, 281, 5571, 2558, 8574, 407, 2801, 15, 187, 187, 1628, 14358, 253, 8574, 285, 253, 5536, 5148, 13291, 403, 994, 28016, 275, 253, 22441, 1806, 1879, 356, 276, 965, 753, 273, 617, 4342, 3863, 275, 41613, 322, 36148, 36873, 285, 17388, 15, 773, 17756, 13, 642, 3081, 7259, 403, 2424, 323, 253, 8570, 273, 253, 544, 68, 23520, 62, 16738, 67, 592, 285, 253, 39917, 432, 253, 1824, 1425, 187, 187, 2598, 13, 247, 1824, 3565, 651, 3365, 3785, 253, 22441, 432, 253, 1824, 281, 1379, 562, 253, 5148, 34404, 15, 380, 2281, 273, 8570, 7024, 327, 849, 1199, 1421, 310, 275, 253, 1824, 15, 1310, 1879, 356, 276, 965, 457, 84, 2285, 3053, 342, 1824, 4508, 7457, 4243, 591, 3041, 273, 1421, 1905, 16951, 2069, 2169, 685, 954, 1846, 2408, 1119, 1309, 253, 42796, 1824, 8891, 1905, 253, 22441, 812, 5386, 247, 2626, 273, 253, 17969, 275, 1884, 2909, 15, 187, 187, 18765, 12532, 13, 1879, 356, 276, 965, 753, 625, 2561, 310, 3058, 281, 3653, 604, 253, 22441, 476, 4044, 1421, 285, 33679, 2308, 4569, 323, 10678, 13, 3340, 342, 305, 3938, 90, 1824, 19246, 949, 1524, 14, 10186, 25886, 15, 1893, 2080, 13, 253, 7934, 1673, 1071, 5866, 342, 41021, 432, 253, 309, 1433, 457, 84, 18090, 7811, 13, 534, 6221, 247, 7802, 273, 5148, 13291, 15, 187, 187, 1628, 510, 1543, 921, 326, 253, 5148, 13291, 273, 1600, 476, 320, 8069, 5176, 1806, 1879, 356, 276, 965, 753, 15, 3378, 253, 9957, 273, 5787, 16775, 13, 27320, 3527, 5175, 313, 35649, 10, 12277, 403, 7552, 9592, 4633, 15, 2053, 12277, 10725, 327, 253, 24389, 273, 13506, 46383, 17678, 285, 16, 263, 19432, 12262, 247, 18379, 3425, 273, 253, 21339, 9, 84, 10, 273, 1600, 15, 4855, 314, 7996, 19689, 10296, 13, 824, 347, 253, 7561, 908, 21028, 5931, 4884, 313, 9343, 582, 1957, 1774, 5657, 275, 253, 1673, 273, 5787, 39266, 15, 3932, 253, 8900, 273, 8477, 275, 11299, 13, 7418, 3882, 14, 3169, 12277, 12262, 247, 4618, 5235, 273, 20180, 19788, 452, 644, 3715, 313, 47, 311, 442, 285, 2263, 47102, 13, 6469, 13, 26024, 5481, 285, 8137, 273, 30250, 13, 268, 15, 27812, 14, 9726, 13, 496, 28609, 273, 15022, 12761, 36415, 313, 25, 394, 1407, 11507, 19995, 1162, 355, 904, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 8652, 1162, 355, 15, 8210, 13, 35345, 280, 40393, 47695, 1877, 20174, 27, 11683, 281, 18742, 48854, 13, 6943, 1584, 1451, 4624, 16103, 13, 444, 13078, 24837, 13, 9693, 13, 7532, 9944, 10400, 272, 1162, 355, 904, 9725, 13, 44194, 26024, 12761, 36415, 27, 43655, 285, 27492, 13, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 444, 6285, 14671, 28, 6115, 4978, 13, 9354, 13, 8477, 14, 3169, 22938, 21234, 275, 49078, 784, 18742, 13, 5418, 4714, 15317, 38567, 13, 9693, 13, 7532, 13351, 6676, 273, 841, 19689, 12277, 452, 644, 4158, 323, 20180, 5481, 3587, 432, 3382, 13, 6938, 390, 2739, 3530, 13, 534, 403, 1929, 281, 3831, 11531, 273, 19689, 12277, 15, 6061, 253, 1107, 13, 247, 5235, 273, 7259, 2684, 432, 247, 5235, 273, 1071, 3530, 323, 4719, 285, 16, 263, 23609, 273, 1341, 390, 9907, 6353, 347, 973, 347, 323, 3727, 13, 4719, 285, 16, 263, 23609, 273, 27320, 9532, 452, 644, 3715, 15, 1723, 13, 3530, 5480, 407, 841, 7259, 778, 1335, 3831, 36286, 326, 19323, 342, 19689, 12277, 15, 187, 36442, 528, 2175, 452, 5183, 326, 1142, 3510, 273, 3382, 13, 6938, 285, 2739, 13751, 778, 3831, 15991, 30809, 342, 27320, 3527, 17442, 4870, 1690, 8477, 13, 8405, 511, 5931, 4884, 313, 45, 1311, 582, 9464, 14, 11181, 17442, 313, 53, 3788, 10, 285, 23186, 16837, 17442, 313, 3871, 34, 10, 313, 18336, 2191, 1162, 355, 15, 7544, 13, 14703, 39977, 6943, 7776, 15, 22540, 27, 21361, 14, 9726, 28, 23840, 10981, 316, 1162, 15, 355, 904, 8065, 13, 500, 15, 35412, 15, 12761, 4193, 311, 15, 5540, 27, 27446, 14, 18493, 28, 4922, 20887, 1162, 355, 15, 8441, 13, 500, 15, 35412, 15, 12761, 4193, 311, 15, 5910, 27, 20, 12347, 14, 20, 13391, 28, 8652, 1162, 355, 15, 8210, 13, 35345, 280, 40393, 47695, 1877, 20174, 27, 11683, 281, 18742, 48854, 13, 6943, 1584, 1451, 4624, 13, 16103, 13, 444, 13078, 24837, 13, 9693, 13, 7532, 9944, 10400, 272, 1162, 355, 904, 9725, 13, 44194, 26024, 12761, 36415, 27, 43655, 285, 27492, 13, 2448, 8273, 323, 12761, 36415, 13, 5041, 13, 399, 15, 36, 9944, 444, 6285, 14671, 285, 6115, 4978, 13, 9354, 13, 8477, 14, 3169, 22938, 21234, 275, 49078, 784, 18742, 13, 5418, 4714, 15317, 38567, 13, 9693, 13, 7532, 13351, 3813, 13, 352, 310, 9560, 281, 4271, 16294, 1071, 3530, 984, 4016, 1071, 1543, 778, 320, 26585, 281, 8638, 273, 253, 19689, 6981, 407, 36286, 417, 17527, 13, 9238, 1025, 390, 49192, 407, 253, 7241, 908, 323, 3410, 9008, 15, 49512, 6708, 1071, 3530, 476, 320, 3636, 407, 49160, 253, 6733, 273, 17442, 285, 16, 263, 5481, 273, 247, 27320, 3527, 2303, 9417, 347, 247, 1453, 15, 6102, 1453, 778, 320, 6024, 672, 253, 1453, 27320, 3527, 310, 2879, 281, 247, 5110, 273, 253, 3410, 5762, 275, 7529, 323, 17442, 285, 16, 263, 5481, 273, 253, 1453, 2303, 6430, 1223, 1529, 5110, 273, 253, 3410, 310, 5867, 323, 17442, 285, 16, 263, 5481, 273, 253, 3537, 442, 2303, 6430, 281, 320, 5189, 407, 253, 6981, 15, 6102, 1453, 310, 1925, 271, 773, 11577, 1453, 313, 1864, 10, 668, 672, 1097, 1453, 2303, 6430, 285, 3537, 442, 2303, 6430, 403, 15134, 285, 16, 263, 5189, 275, 253, 1072, 4884, 11179, 15, 3010, 5742, 13, 436, 4812, 1453, 985, 3400, 271, 9276, 323, 17442, 285, 16, 263, 5481, 313, 1864, 2350, 10, 273, 27320, 9532 ]
ROOT OnePlus 6 then below is a step-by-step by guide for the same. REQUIRED DOWNLOADS OR GUIDES FOR OnePlus 6 ROOTING: Make sure you have already unlocked the bootloader and installed TWRP recovery on OnePlus 6 – Well, this is a very important aspect of this SuperSU ROOT process. The SuperSU zip file is developed in a way to be installed via a TWRP recovery or other custom recovery. Stock recovery may not be able install this SuperSU or Magisk ROOT zip file. Download the latest SuprSU ROOT for OnePlus 6 or one of the following: Your phone will not be rooted just by installing the SuperSU APK file on your Android phone. SuperSU APK Free or Pro version is just a SuperSU ROOT management application. The SuperSU APK Free or Pro app will ONLY work if you have already ROOTED your Android Phone. Step-by-Step guide on how to ROOT OnePlus 6 using SuperSU or Magisk zip file: Download and copy the SuperSU or Magisk or the Root.zip (from the OP6 TWRP.rar package) file to OnePlus 6. (I hope you have already downloaded one of the root zip file from the above downloads section) Now restart the OnePlus 6 to boot into TWRP recovery. Then, Select the Install from TWRP home screen, then select the SuperSU ROOT zip file from the file browser. Flash or install the SuperSU or Magisk zip file or the Root.zip file provided in the OP6 TWRP.rar, by Sliding the Swipe to Confirm Flash on TWRP screen. Wait for TWRP to flash the Root package. Once the flashing is done just reboot your device. Profit!!! You should now have ROOT on OnePlus 6. How to check if ROOT is enabled on OnePlus 6 or NOT? Install the ROOT checker app from the Play Store and verify if your phone is ROOTED or not. Here is a screenshot how to flash the SU ROOT binary via TWRP: If you face any problems on this guide to install TWRP for OnePlus 6 then, you can login and reply here. Either me or some other user on this forum will revert back to your query as soon as possible. Stay tuned or Subscribe to the OnePlus 6 (enchilada) forum For other Android Custom ROMs, LineageOS ROMs, and all other device specific topics... ****************************************************************************** .. * Copyright 2020 Intel Corporation .. * .. * Licensed under the Apache License, Version 2.0 (the "License"); .. * you may not use this file except in compliance with the License. .. * You may obtain a copy of the License at .. * .. * http://www.apache.org/licenses/LICENSE-2.0 .. * .. * Unless required by applicable law or agreed to in writing, software .. * distributed under the License is distributed on an "AS IS" BASIS, .. * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. .. * See the License for the specific language governing permissions and .. * limitations under the License. .. *******************************************************************************/ Working with User-defined Quality Metrics ========================================= In addition to or instead of the metrics available in the library, you can use your own quality metrics. To do this: #. Add your own implementation of the quality metrics algorithm and define Input and Result classes for that algorithm. #. Register this new algorithm in the ``inputAlgorithms`` collection of the quality metric set. Also register the input objects for the new algorithm in the ``inputData`` collection of the quality metric set. Use the unique key when registering the new algorithm and its input, and use the same key to obtain the computed results. The team has engineered a coffee grounds-infused foam that removes hazardous metals, like lead, from water. Though still in its prototype phase, this foam might be able to clear the worst levels of lead contamination found in places like Flint, Michigan, within a few hours. “The proposed method is cheaper [than current large-scale filtration systems], since it uses principally costless waste,” said IIT physicist Despina Fragouli who led the project. “and more sustainable compared to other systems, where synthetic materials are used.” The idea isn’t entirely new. Scientists have known for years that coffee contains chemical groups — called carboxylates — that stick to metals. Early attempts at this water remediation concept tried smashing the coffee grounds into a fine powder, which was then mixed into lead-tainted water. The toxic metals bind the powder, and together, they are filtered out of the water. But this procedure is a bit redundant — you need a filter for a filter. Fragouli and her colleagues simplified this process by chemically infusing the coffee powder onto a elastic foam. The final spongy foam is 60 to 70 percent coffee by weight. “Both the coffee and the heavy metal ions are entrapped in the foam,” Fragouli said of her findings published in ACS Sustainable Chemistry and Engineering. “Therefore, no additional procedures are required for the removal of the [coffee] adsorbents and the pollutants from the water.” So, a water official would simply pull the foam from the water to take out the metal toxins. The rate of removal depends on how much lead is in the water. If Fragouli’s team started with water containing nine parts per million of lead — 360 times higher than most common amount found during the Flint water crisis — the foam could remove a third of the contamination in 30 minutes. Though promising, Fragouli said more research is needed to determine if the foam can obtain lead and mercury levels appropriate for drinking, especially with gunky water flowing through real-world pipes. So far, the sole field test occurred with wastewater from the IIT’s chemistry department, which contained a mixture of metal ions. “The results show that the metal ions of interest can be effectively removed,” Fragouli said.With the advent of molecular biology, nucleic acid testing (NAT) assays are becoming increasingly popular. These assays rely on the hybridization of synthetic oligonucleotide primers and/or probes targeting a nucleotide sequence of the organism(s) of interest. Highly sensitive NAT technologies, such as the widely used polymerase chain reaction (PCR), represent important tools in the field of molecular diagnostics. Since the discovery of PCR in 1983, numerous DNA-based assays targeting a wide variety of microbial pathogens have been developed (Nolte and Caliendo, 2003, Molecular detection and identification of microorganisms, p. 234-256, In Manual of Clinical Microbiology (8th ed.), Murray et al., American Society for Microbiology, Washington, D.C.; Lee et al. 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques Books, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich; Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). Many of these NAT assays have been designed for microbial detection directly from clinical, environmental or food samples, which are known to contain inhibitors of NAT assays. Over the years, a variety of procedures performed from a variety of test samples for concentration and/or purification of cells or viral particles as well as for release, concentration and/or purification of nucleic acids have been developed. However, samples prepared by these procedures may still contain impurities that interfere with NAT assays. Numerous studies have demonstrated that many types of clinical, environmental and food specimens may contain substances interfering with nucleic acid amplification processes including PCR, ligase chain reaction (LCR), transcription-mediated amplification (TMA) and strand displacement amplification (SDA) (Courtney et al. 1999, Analytical Biochem. 270:249-256; Rosenstraus et. al., 1998, J. Clin. Microbiol. 36: 191-197; Morré et al. 1996, J. Clin. Microbiol. 34:3108-3114; Lee et al. 1997, Nucleic Acid Amplification Technologies: Application to Disease Diagnosis, Biotechniques, Books, Eaton Publishing, Boston, Mass.; Persing et al., 1993, Diagnostic Molecular Microbiology: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Infectious Disease, Blackwell Scientific Publications, Boston, Mass.). Therefore, it is crucial to identify inhibitory test samples because negative test results may be attributable to inhibition of the NAT assay by impurities not eliminated, neutralized or inactivated by the protocol used for sample preparation. Inhibitory test samples can be identified by verifying the efficiency of amplification and/or detection of a nucleic acid target serving as a control. Such control may be external when the control nucleic acid is added to a portion of the sample tested in parallel for amplification and/or detection of the control target sequences while another portion of the sample is analyzed for amplification and/or detection of the analyte target sequences to be detected by the assay. Such control is called an “internal control (IC)” when both control target sequences and analyte target sequences are purified and/or detected in the same reaction vessel. More specifically, this internal control system provides an IC for amplification and/or detection (ICAD) of nucleic acids
[ 559, 187, 50268, 3, 1057, 417, 452, 247, 16204, 323, 436, 1673, 4479, 84, 4284, 273, 346, 559, 187, 50268, 3423, 15, 2877, 15, 22174, 558, 535, 50276, 3423, 15, 7152, 64, 13982, 426, 36196, 28, 187, 50276, 21962, 23062, 3233, 9, 3423, 558, 187, 50276, 3423, 15, 7955, 18115, 426, 1673, 15, 26059, 15, 48061, 1587, 7955, 18115, 2807, 3613, 28471, 28, 187, 50276, 15149, 13283, 64, 1590, 426, 1673, 15, 26059, 15, 48061, 1587, 13362, 3287, 187, 50276, 338, 313, 13362, 64, 1590, 10, 551, 187, 50274, 16065, 313, 881, 15, 4793, 64, 881, 10, 551, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 7999, 27, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 41092, 27, 551, 187, 50270, 338, 313, 9867, 16850, 11594, 1237, 9, 13362, 64, 1590, 1168, 22174, 15, 68, 64, 1344, 6649, 2295, 28471, 10, 187, 50268, 4756, 1587, 20920, 556, 2027, 5933, 323, 4567, 2372, 3510, 27, 346, 559, 187, 50262, 13362, 64, 1590, 1168, 22174, 558, 187, 50270, 7054, 28, 187, 50272, 94, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 39496, 27, 187, 50272, 5045, 378, 9434, 64, 10560, 64, 4641, 14780, 27, 551, 187, 50270, 338, 313, 9867, 16850, 11594, 1540, 9, 13362, 64, 1590, 1168, 22174, 15, 68, 64, 1344, 6649, 2295, 28471, 10, 187, 50268, 4756, 1587, 20920, 556, 2027, 5933, 323, 6705, 2372, 3510, 27, 346, 559, 187, 50262, 13362, 64, 1590, 1168, 22174, 558, 187, 50270, 7054, 28, 187, 50272, 94, 187, 50272, 6986, 27, 187, 50270, 4756, 1587, 7483, 540, 13, 4770, 13, 1048, 285, 12130, 543, 941, 3510, 1329, 556, 2027, 23715, 187, 50274, 94, 187, 50276, 94, 187, 50276, 338, 313, 3423, 15, 7955, 18115, 3857, 1577, 64, 1545, 15, 20188, 10, 187, 50274, 4756, 1587, 5092, 626, 39638, 366, 4910, 275, 247, 1577, 3287, 187, 50276, 3423, 15, 17354, 426, 1673, 15, 26059, 15, 48061, 1587, 17354, 2807, 3613, 28471, 28, 187, 50276, 338, 313, 3423, 15, 17354, 3857, 313, 2855, 64, 1545, 15, 20188, 2785, 187, 50254, 1680, 29094, 9, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 10689, 187, 50274, 4756, 1587, 7483, 1327, 14, 41034, 4910, 275, 7180, 778, 320, 686, 17354, 8, 3287, 187, 50276, 3423, 15, 2364, 426, 1673, 15, 26059, 15, 48061, 1587, 2364, 2807, 3613, 28471, 28, 187, 50276, 338, 313, 3423, 15, 2364, 10, 551, 187, 50274, 338, 313, 2855, 64, 1545, 15, 7110, 64, 2364, 10, 187, 50272, 4756, 1587, 7483, 581, 1673, 778, 320, 873, 347, 686, 2364, 8, 3287, 187, 50274, 2855, 64, 1545, 15, 7110, 64, 2364, 426, 2032, 28, 187, 50274, 338, 6522, 2513, 29094, 9, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 1228, 551, 187, 50272, 3423, 15, 17354, 426, 2032, 28, 187, 50272, 338, 313, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 24458, 10, 187, 50270, 4756, 1587, 8, 2364, 8, 1673, 1364, 320, 2876, 390, 13434, 1511, 3287, 187, 50274, 94, 187, 50276, 94, 187, 50276, 15149, 20494, 426, 1673, 15, 26059, 15, 48061, 1587, 47628, 64, 22829, 11023, 3287, 187, 50276, 338, 313, 47628, 10, 551, 187, 50274, 338, 313, 47628, 1168, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 24458, 10, 187, 50272, 4756, 1587, 47628, 64, 22829, 11023, 11104, 1364, 320, 247, 2876, 313, 783, 5230, 1511, 10, 3287, 187, 50274, 338, 313, 3423, 15, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 55, 9649, 1372, 2785, 187, 50270, 3423, 15, 2877, 15, 881, 15, 10531, 3613, 378, 9434, 64, 10560, 64, 54, 15843, 10, 187, 50272, 4756, 1587, 47628, 64, 22829, 11023, 11104, 778, 760, 4647, 281, 247, 4972, 273, 12980, 90, 442, 3287, 187, 50274, 605, 831, 588, 2847, 271, 2228, 604, 253, 5230, 1511, 273, 253, 20494, 6507, 11023, 187, 50274, 605, 3589, 626, 2931, 11358, 15, 187, 50274, 48061, 9395, 21772, 9, 47628, 1168, 22174, 558, 187, 50276, 94, 535, 50276, 338, 313, 881, 3423, 10, 551, 187, 50274, 605, 1310, 436, 1673, 310, 247, 8083, 13, 285, 352, 556, 247, 13542, 7922, 2654, 13, 187, 50274, 605, 253, 8356, 2879, 1511, 1673, 943, 452, 271, 2654, 347, 973, 313, 1171, 427, 428, 337, 481, 187, 50274, 15149, 27617, 426, 1673, 15, 26059, 15, 48061, 1587, 301, 3287, 187, 50274, 338, 313, 9573, 10, 551, 187, 50272, 15149, 2654, 426, 387, 10986, 9, 9573, 1168, 22174, 15, 68, 64, 1344, 6020, 187, 50272, 15149, 821, 426, 747, 11740, 1874, 187, 50272, 1208, 1168, 881, 426, 27617, 1168, 881, 28, 187, 50272, 1208, 1168, 22174, 426, 21046, 21395, 9, 301, 428, 337, 558, 187, 50272, 881, 3423, 1168, 26059, 15, 4717, 1587, 301, 995, 821, 558, 187, 50274, 94, 187, 50276, 94, 535, 50276, 42049, 2073, 28, 5137, 187, 94, 187, 187, 4353, 367, 9332, 1450, 21962, 6693, 3902, 9, 3902, 708, 1208, 13, 7327, 4612, 475, 3423, 13, 1979, 64, 85, 2885, 64, 3423, 79, 10, 551, 187, 50276, 16065, 313, 1208, 15, 881, 15, 4793, 64, 881, 10, 551, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 4037, 2449, 27, 551, 187, 50272, 8271, 9, 3423, 558, 187, 50272, 338, 6522, 5598, 64, 3423, 79, 2785, 187, 50268, 3423, 64, 9742, 4414, 2135, 5023, 9815, 1168, 2877, 15, 881, 15, 4793, 64, 881, 3613, 378, 9434, 64, 10560, 64, 3329, 7711, 10, 187, 50270, 4756, 1587, 33722, 1511, 1673, 1078, 436, 8083, 1318, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 15149, 15972, 64, 16159, 426, 387, 302, 29, 10790, 1018, 8743, 187, 50254, 50266, 3423, 64, 9742, 4414, 2135, 5023, 7053, 15, 22174, 15, 68, 64, 1344, 6020, 187, 50272, 15149, 15972, 64, 1208, 426, 821, 15, 881, 15, 14379, 64, 1545, 1168, 51, 28717, 48061, 9, 14379, 64, 16159, 558, 187, 50272, 338, 6522, 14379, 64, 1208, 10, 11759, 1587, 300, 7685, 1511, 2654, 323, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 21962, 3235, 9672, 14379, 64, 1208, 1168, 2855, 64, 1545, 13, 708, 1208, 15, 22174, 558, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 33284, 1647, 27, 187, 50272, 21962, 3235, 9672, 1208, 15, 881, 15, 2855, 64, 1545, 13, 708, 1208, 15, 22174, 558, 187, 50272, 7054, 28, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 24458, 27, 551, 187, 50272, 15149, 256, 426, 11104, 17540, 187, 50272, 42049, 9, 76, 11200, 2776, 29080, 558, 187, 50272, 1208, 15, 22174, 426, 21046, 21395, 9, 27136, 4414, 9395, 2776, 9, 84, 481, 80, 558, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 55, 9649, 1372, 27, 551, 187, 50272, 42049, 2073, 5013, 558, 187, 50272, 1208, 15, 22174, 426, 21046, 21395, 9, 21962, 15219, 9, 1208, 15, 881, 15, 15219, 2548, 30652, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 7999, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 41092, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 39496, 27, 187, 50274, 5045, 378, 9434, 64, 10560, 64, 4641, 14780, 27, 551, 187, 50272, 338, 313, 3423, 3857, 1673, 1168, 26059, 15, 48061, 1587, 13362, 2807, 3857, 187, 50268, 9, 13763, 64, 2295, 465, 11200, 18483, 2785, 10669, 64, 2295, 465, 11200, 2776, 29080, 1228, 551, 187, 50270, 21962, 16850, 9, 1208, 13, 1673, 558, 187, 50272, 94, 2010, 551, 187, 50270, 21962, 21822, 3902, 9, 1208, 558, 187, 50272, 94, 187, 50272, 7054, 28, 187, 50274, 94, 187, 50274, 6986, 27, 187, 50272, 21962, 21822, 3902, 9, 1208, 558, 187, 50272, 7054, 28, 187, 50276, 94, 187, 94, 187, 187, 4353, 367, 9332, 1450, 6075, 14531, 21772, 9, 3474, 26253, 4612, 708, 2855, 64, 1545, 13, 1030, 11740, 708, 1208, 10, 551, 187, 50276, 8271, 9, 1208, 15, 22174, 15, 3985, 1082, 2295, 1577, 64, 1545, 15, 15845, 907, 558, 187, 50276, 27136, 4414, 42792, 9, 2855, 64, 1545, 15, 78, 989, 525, 558, 187, 50276, 27136, 4414, 37331, 16721, 9, 250, 22416, 64, 4008, 29, 3474, 4770, 25, 64, 85, 475, 8743, 1208, 15, 22174, 15, 68, 64, 1344, 35632, 187, 50257, 2855, 64, 1545, 15, 15845, 907, 558, 187, 50276, 27136, 4414, 4717, 21772, 13736, 9, 1208, 15, 10946, 13, 22074, 4414, 3633, 5496, 6020, 187, 94, 187, 187, 86, 10946, 64, 85, 367, 9332, 1450, 21962, 3235, 9, 3474, 26253, 4612, 708, 2855, 64, 1545, 13, 6268, 1450, 2703, 475, 2877, 10, 551, 187, 50276, 42049, 2073, 92, 5137, 187, 50276, 3281, 64, 85, 1673, 79, 426, 470, 28, 187, 50276, 1542, 313, 12723, 10, 551, 187, 50274, 338, 6048, 2, 30862, 64, 8456, 64, 2785, 2195, 3423, 79, 10, 3857, 1680, 9301, 2073, 15996, 1228, 2740, 28, 187, 50274, 8400, 1450, 2703, 1416, 426, 11104, 17540, 187, 50274, 338, 6522, 2513, 9301, 9, 76, 11200, 2776, 29080, 1228, 187, 50272, 42049, 9, 30862, 64, 8456, 64, 3736, 465, 11200, 2776, 29080, 1163, 465, 11200, 18483, 558, 187, 50274, 15149, 1673, 426, 1577, 64, 1545, 15, 15069, 15, 48061, 9, 1590, 558, 187, 50274, 338, 6522, 3423, 10, 11759, 1587, 29469, 1673, 27, 346, 559, 1416, 558, 187, 50274, 42049, 2073, 27, 5137, 187, 50274, 3902, 821, 426, 1673, 1168, 2877, 28, 187, 50274, 21962, 6693, 3902, 9, 1208, 13, 1673, 13, 1673, 79, 558, 187, 50274, 3281, 64, 85, 891, 426, 1673, 64, 9742, 4414, 3281, 1874, 187, 50274, 605, 11366, 38059, 16941, 14, 15227, 342, 2228, 14, 5903, 15, 187, 50274, 605, 1310, 4910, 403, 7616, 275, 1340, 13, 840, 436, 6287, 39852, 4745, 15, 187, 50274, 1542, 42744, 891, 2239, 1673, 64, 9742, 4414, 3281, 1082, 428, 1673, 79, 28, 891, 283, 10, 551, 187, 50272, 15149, 5368, 64, 3423, 426, 1673, 64, 9742, 14767, 74, 428, 337, 1570, 9815, 28, 187, 50272, 338, 313, 20137, 64, 3423, 2295, 1673, 10, 187, 50270, 4756, 1587, 3423, 873, 625, 685, 2378, 27, 346, 559, 1673, 1168, 1590, 558, 187, 50272, 338, 313, 20137, 64, 3423, 1168, 2877, 15, 10946, 654, 1673, 1168, 2877, 15, 10946, 10, 2740, 28, 187, 50274, 94, 187, 50274, 3423, 64, 9742, 4414, 14447, 9, 3423, 64, 9742, 4414, 2043, 1082, 559, 891, 13, 6268, 1450, 11145, 64, 13934, 9, 1208, 13, 1673, 4027, 187, 50274, 3423, 79, 14788, 187, 50274, 338, 313, 2513, 9301, 2073, 15996, 1228, 2740, 28, 187, 50274, 42049, 9, 1383, 5137, 187, 50276, 94, 187, 50276, 338, 313, 2855, 64, 1545, 15, 20188, 3857, 1673, 79, 3613, 1577, 64, 1545, 15, 15069, 15, 4642, 15, 3281, 6649, 187, 50274, 4756, 1587, 2855, 27, 3430, 1180, 273, 3302, 14460, 27, 346, 559, 1577, 64, 1545, 15, 1590, 558, 535, 50276, 15149, 1265, 426, 1577, 64, 1545, 15, 20188, 187, 50261, 32, 22074, 4414, 8252, 21772, 9, 2855, 64, 1545, 15, 78, 989, 525, 10, 187, 50261, 27, 22074, 4414, 8252, 3235, 1874, 535, 50276, 1542, 313, 3281, 64, 85, 1979, 426, 1577, 64, 1545, 15, 15227, 44678, 907, 3736, 13322, 9, 45242, 64, 41034, 64, 85, 10, 1163, 337, 28, 187, 50271, 3281, 28, 187, 50271, 3281, 1227, 30, 374, 10, 551, 187, 50274, 605, 3617, 949, 3603, 275, 8107, 13, 1580, 359, 1472, 3652, 253, 941, 24291, 15, 187, 50274, 1542, 313, 15149, 352, 426, 1673, 64, 9742, 4414, 83, 2043, 1874, 187, 50265, 262, 3613, 1673, 64, 9742, 4414, 83, 2043, 1082, 559, 1673, 79, 28, 12996, 262, 10, 551, 187, 50272, 15149, 708, 2877, 426, 352, 1168, 7053, 28, 187, 50272, 15149, 1673, 426, 352, 1168, 9815, 28, 187, 50272, 338, 6522, 2855, 64, 1545, 15, 15227, 44678, 907, 2785, 1979, 2295, 19662, 4527, 9, 2877, 15, 881, 15, 4793, 64, 881, 1228, 551, 187, 50270, 16065, 313, 2877, 15, 881, 15, 4793, 64, 881, 10, 551, 187, 50268, 4, 3182, 11953, 1194, 7817, 3269, 6117, 64, 10989, 9, 1400, 5529, 13, 5417, 45, 10560, 13, 7403, 7711, 13, 500, 10560, 13, 443, 10560, 13, 427, 10560, 13, 393, 187, 50266, 5736, 7711, 10, 393, 187, 50266, 5045, 378, 9434, 64, 10560, 64, 20263, 16449, 5529, 27, 393, 187, 50264, 27136, 4414, 14550, 9, 3423, 1168, 17333, 558, 393, 187, 50264, 338, 313, 2855, 64, 1545, 15, 20188, 10, 551, 393, 187, 50262, 27136, 4414, 37331, 7050, 9, 255, 302, 29, 30915, 8743, 2877, 15, 22174, 15, 68, 64, 1344, 30652 ]
+ " does not have a declaration for this field\'s default of " + field.value.constant); field.doc_comment = dc; ParseMetaData(field); field.deprecated = field.attributes.Lookup("deprecated") != nullptr; auto hash_name = field.attributes.Lookup("hash"); if (hash_name) { switch (type.base_type) { case BASE_TYPE_INT: case BASE_TYPE_UINT: { if (FindHashFunction32(hash_name->constant.c_str()) == nullptr) Error("Unknown hashing algorithm for 32 bit types: " + hash_name->constant); break; } case BASE_TYPE_LONG: case BASE_TYPE_ULONG: { if (FindHashFunction64(hash_name->constant.c_str()) == nullptr) Error("Unknown hashing algorithm for 64 bit types: " + hash_name->constant); break; } default: Error("only int, uint, long and ulong data types support hashing."); } } if (field.deprecated && struct_def.fixed) Error("can't deprecate fields in a struct"); field.required = field.attributes.Lookup("required") != nullptr; if (field.required && (struct_def.fixed || IsScalar(field.value.type.base_type))) Error("only non-scalar fields in tables may be 'required'"); field.key = field.attributes.Lookup("key") != nullptr; if (field.key) { if (struct_def.has_key) Error("only one field may be set as 'key'"); struct_def.has_key = true; if (!IsScalar(field.value.type.base_type)) { field.required = true; if (field.value.type.base_type != BASE_TYPE_STRING) Error("'key' field must be string or scalar type"); } } auto nested = field.attributes.Lookup("nested_flatbuffer"); if (nested) { if (nested->type.base_type != BASE_TYPE_STRING) Error("nested_flatbuffer attribute must be a string (the root type)"); if (field.value.type.base_type != BASE_TYPE_VECTOR || field.value.type.element != BASE_TYPE_UCHAR) Error("nested_flatbuffer attribute may only apply to a vector of ubyte"); // This will cause an error if the root type of the nested flatbuffer // wasn't defined elsewhere. LookupCreateStruct(nested->constant); } if (typefield) { // If this field is a union, and it has a manually assigned id, // the automatically added type field should have an id as well (of N - 1). auto attr = field.attributes.Lookup("id"); if (attr) { auto id = atoi(attr->constant.c_str()); auto val = new Value(); val->type = attr->type; val->constant = NumToString(id - 1); typefield->attributes.Add("id", val); } } Expect(';'); } void Parser::ParseAnyValue(Value &val, FieldDef *field, size_t parent_fieldn) { switch (val.type.base_type) { case BASE_TYPE_UNION: { assert(field); if (!parent_fieldn || field_stack_.back().second->value.type.base_type != BASE_TYPE_UTYPE) Error("missing type field before this union value: " + field->name); auto enum_idx = atot<unsigned char>( field_stack_.back().first.constant.c_str()); auto enum_val = val.type.enum_def->ReverseLookup(enum_idx); if (!enum_val) Error("illegal type id for: " + field->name); ParseTable(*enum_val->struct_def, &val.constant); break; } case BASE_TYPE_STRUCT: ParseTable(*val.type.struct_def, &val.constant); break; case BASE_TYPE_STRING: { auto s = attribute_; Expect(kTokenStringConstant); val.constant = NumToString(builder_.CreateString(s).o); break; } case BASE_TYPE_VECTOR: { Expect('['); val.constant = NumToString(ParseVector(val.type.VectorType())); break; } case BASE_TYPE_INT: case BASE_TYPE_UINT: case BASE_TYPE_LONG: case BASE_TYPE_ULONG: { if (field && field->attributes.Lookup("hash") && (token_ == kTokenIdentifier || token_ == kTokenStringConstant)) { ParseHash(val, field); } else { ParseSingleValue(val); } break; } default: ParseSingleValue(val); break; } } void Parser::SerializeStruct(const StructDef &struct_def, const Value &val) { assert(val.constant.length() == struct_def.bytesize); builder_.Align(struct_def.minalign); builder_.PushBytes(reinterpret_cast<const uint8_t *>(val.constant.c_str()), struct_def.bytesize); builder_.AddStructOffset(val.offset, builder_.GetSize()); } uoffset_t Parser::ParseTable(const StructDef &struct_def, std::string *value) { Expect('{'); size_t fieldn = 0; for (;;) { if ((!strict_json_ || !fieldn) && IsNext('}')) break; std::string name = attribute_; if (!IsNext(kTokenStringConstant)) Expect(strict_json_ ? kTokenStringConstant : kTokenIdentifier); auto field = struct_def.fields.Lookup(name); if (!field) Error("unknown field: " + name); Expect(':'); Value val = field->value; ParseAnyValue(val, field, fieldn); size_t i = field_stack_.size(); // Hardcoded insertion-sort with error-check. // If fields are specified in order, then this loop exits immediately. for (; i > field_stack_.size() - fieldn; i--) { auto existing_field = field_stack_[i - 1].second; if (existing_field == field) Error("field set more than once: " + field->name); if (existing_field->value.offset < field->value.offset) break; } field_stack_.insert(field_stack_.begin() + i, std::make_pair(val, field)); fieldn++; if (IsNext('}')) break; Expect(','); } if (struct_def.fixed && fieldn != struct_def.fields.vec.size()) Error("struct: wrong number of initializers: " + struct_def.name); auto start = struct_def.fixed ? builder_.StartStruct(struct_def.minalign) : builder_.StartTable(); for (size_t size = struct_def.sortbysize ? sizeof(largest_scalar_t) : 1; size; size /= 2) { // Go through elements in reverse, since we're building the data backwards. for (auto it = field_stack_.rbegin(); it != field_stack_.rbegin() + fieldn; ++it) { auto &value = it->first; auto field = it->second; if (!struct_def.sortbysize || size == SizeOf(value.type.base_type)) { switch (value.type.base_type) { #define FLATBUFFERS_TD(ENUM, IDLTYPE, CTYPE, JTYPE, GTYPE, NTYPE, \ PTYPE) \ case BASE_TYPE_ ## ENUM: \ builder_.Pad(field->padding); \ if (struct_def.fixed) { \ builder_.PushElement(atot<CTYPE>(value.constant.c_str()));
[ 370, 393, 3442, 426, 393, 4090, 9, 69, 2850, 5574, 2805, 64, 18, 13, 2490, 50273, 61, 7718, 13, 277, 2850, 5574, 2805, 2253, 437, 1009, 481, 3308, 1764, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 94, 68, 64, 79, 401, 9, 53, 768, 82, 64, 18, 9, 79, 40047, 7718, 13, 53, 768, 82, 2253, 437, 9, 79, 27232, 426, 2490, 50273, 61, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 94, 68, 64, 79, 299, 768, 19, 61, 2059, 891, 367, 9, 79, 40227, 534, 14280, 281, 5058, 13, 407, 313, 12211, 481, 187, 187, 2042, 3019, 57, 13, 308, 1009, 310, 417, 273, 15539, 14, 3431, 6713, 6637, 13, 253, 13148, 3580, 273, 15539, 14, 70, 3855, 20619, 1335, 13905, 247, 749, 20190, 273, 370, 330, 9, 57, 2850, 437, 10, 13355, 7850, 14230, 310, 247, 4581, 24822, 273, 370, 330, 9, 57, 2850, 437, 10, 20795, 326, 359, 9173, 407, 370, 36, 64, 53, 9, 57, 2850, 437, 3822, 380, 6452, 273, 6899, 575, 1447, 7801, 27, 18, 696, 4558, 2032, 323, 512, 370, 39, 5, 275, 370, 36, 64, 53, 9, 57, 2850, 437, 3822, 187, 187, 3463, 253, 2022, 10012, 275, 1008, 883, 20227, 7330, 8402, 1092, 370, 393, 1991, 92, 59, 2000, 81, 426, 353, 393, 6837, 378, 370, 313, 3431, 16662, 8083, 10, 835, 370, 353, 370, 310, 247, 28465, 8083, 273, 387, 954, 1385, 1598, 1142, 8723, 5239, 370, 46, 64, 74, 5, 285, 1046, 1127, 275, 370, 35, 5, 310, 1599, 17755, 281, 581, 273, 8723, 5239, 275, 370, 46, 5, 313, 2887, 1008, 740, 20227, 6620, 5829, 408, 839, 62, 323, 253, 5426, 273, 1599, 21779, 582, 285, 1016, 42146, 370, 308, 61, 13777, 353, 64, 74, 393, 936, 353, 64, 74, 370, 310, 2057, 247, 6486, 5880, 390, 310, 27442, 281, 271, 6240, 5145, 15, 1893, 13, 370, 308, 393, 13777, 353, 64, 74, 393, 936, 353, 64, 74, 370, 556, 13358, 6637, 13, 891, 15, 70, 15, 15539, 14, 3431, 6713, 6637, 273, 1340, 370, 18, 1352, 3308, 6556, 323, 512, 370, 1269, 393, 249, 353, 64, 74, 1366, 407, 6899, 575, 1447, 7801, 27, 18, 4207, 1198, 370, 1269, 393, 249, 378, 20795, 359, 476, 5276, 347, 275, 1008, 740, 20227, 6620, 5829, 408, 839, 62, 313, 2887, 253, 990, 273, 253, 4737, 273, 6899, 337, 275, 1008, 740, 20227, 6620, 5829, 408, 839, 2498, 187, 187, 510, 1072, 906, 275, 24297, 575, 1447, 7801, 27, 21, 696, 6556, 323, 370, 81, 2911, 18535, 8062, 2931, 407, 8870, 3470, 342, 1175, 5141, 13, 984, 247, 8723, 14717, 310, 671, 8058, 323, 824, 8062, 275, 905, 26, 4207, 28285, 326, 667, 8870, 1159, 669, 2162, 393, 249, 393, 1991, 92, 50, 2000, 81, 60, 91, 8795, 1907, 1175, 5141, 310, 370, 18, 2911, 45, 2824, 37913, 5415, 327, 253, 27266, 1386, 669, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 27, 1764, 2859, 1035, 2162, 9, 49, 64, 18, 10853, 2162, 9, 49, 64, 19, 1228, 393, 282, 393, 2859, 9, 49, 64, 18, 13, 367, 64, 19, 1572, 3362, 393, 1156, 92, 1542, 512, 370, 49, 18, 13, 367, 19, 393, 249, 393, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 2138, 835, 669, 2859, 1035, 3830, 13, 393, 3830, 1009, 310, 253, 475, 1033, 16635, 7982, 11, 327, 669, 1991, 92, 49, 2306, 18, 1035, 1991, 92, 50, 2000, 81, 1009, 313, 2887, 1008, 1731, 17525, 332, 1342, 8602, 274, 23343, 268, 15, 3046, 2498, 187, 187, 16628, 247, 749, 6320, 3425, 370, 5081, 2981, 64, 79, 10, 370, 327, 247, 5912, 2317, 370, 5081, 4153, 13, 393, 10609, 92, 34, 2023, 393, 1991, 92, 49, 2311, 370, 285, 247, 6486, 3425, 273, 5951, 251, 7480, 21783, 273, 370, 256, 370, 4903, 370, 269, 64, 79, 9, 85, 64, 18, 1337, 7718, 13, 85, 64, 84, 10, 370, 273, 1340, 1679, 685, 390, 4503, 281, 427, 15, 2635, 1908, 253, 3632, 5951, 251, 7480, 14189, 3318, 49, 9, 85, 10, 426, 393, 2204, 578, 79, 889, 2981, 64, 79, 269, 64, 79, 9, 85, 11127, 1707, 4961, 271, 7880, 3638, 370, 36, 2239, 470, 5, 824, 326, 1764, 1968, 92, 2574, 27, 460, 82, 18, 14, 20, 94, 187, 50274, 61, 1991, 92, 49, 889, 1274, 1035, 93, 49, 6087, 2253, 3259, 393, 282, 330, 61, 2609, 92, 84, 61, 2204, 6087, 71, 64, 79, 6087, 2253, 3259, 63, 19, 61, 2808, 427, 94, 393, 918, 10, 393, 282, 393, 16980, 92, 18, 1217, 47, 63, 19, 10878, 844, 3730, 436, 11370, 347, 11573, 5308, 14, 15426, 358, 14, 44, 1240, 1351, 11370, 2479, 746, 76, 1240, 1351, 15117, 8826, 62, 268, 15, 5571, 13, 6899, 495, 15, 2594, 1008, 805, 20227, 9755, 460, 9896, 614, 62, 323, 247, 1027, 4737, 285, 247, 26647, 481, 378, 2355, 327, 436, 11370, 13, 359, 476, 5276, 253, 6452, 347, 3637, 15, 187, 187, 1231, 452, 281, 5276, 326, 323, 2761, 512, 370, 393, 3151, 393, 249, 393, 4153, 370, 285, 323, 512, 21783, 370, 367, 393, 249, 393, 1991, 92, 51, 11326, 91, 21828, 359, 452, 1764, 1968, 92, 2574, 27, 20, 14, 18, 94, 2490, 50274, 61, 2815, 578, 47, 61, 936, 61, 3259, 94, 393, 16980, 92, 18, 1217, 47, 94, 393, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 299, 768, 19, 61, 2059, 891, 49, 9, 79, 3117, 426, 470, 4700, 1281, 370, 69, 426, 277, 2850, 5574, 367, 5, 320, 253, 4248, 273, 370, 367, 370, 285, 370, 367, 9, 89, 10, 426, 393, 2204, 578, 75, 30, 17, 2306, 69, 246, 64, 75, 89, 63, 75, 370, 342, 3019, 85, 64, 17, 13, 246, 64, 18, 1337, 7718, 13, 246, 64, 69, 10, 393, 249, 2490, 50274, 61, 1991, 92, 51, 1990, 69, 12, 18, 94, 13355, 2635, 3318, 70, 768, 19, 61, 2059, 891, 49, 9, 79, 3117, 426, 299, 768, 19, 61, 2059, 891, 9, 85, 64, 17, 12, 246, 64, 18, 295, 12, 393, 7718, 559, 246, 64, 17915, 63, 69, 3117, 426, 27, 269, 64, 79, 9, 85, 64, 17, 13, 85, 64, 18, 1337, 7718, 13, 85, 64, 69, 11127, 844, 2743, 370, 71, 64, 79, 5, 347, 247, 5951, 251, 7480, 14189, 273, 370, 69, 559, 337, 5, 4903, 13, 273, 4248, 370, 18, 559, 295, 559, 393, 7718, 559, 295, 63, 69, 393, 282, 2490, 50274, 9, 69, 559, 337, 10, 47, 63, 69, 1352, 3308, 1764, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 426, 2490, 50270, 61, 4090, 61, 10423, 578, 85, 61, 249, 393, 1991, 92, 53, 1990, 69, 12, 18, 599, 393, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 71, 64, 79, 9, 85, 1572, 918, 93, 4700, 45356, 326, 370, 11045, 71, 64, 79, 43654, 3259, 94, 426, 337, 13355, 2896, 11573, 5308, 14, 15426, 358, 14, 44, 1240, 1351, 11370, 669, 2574, 709, 92, 2574, 27, 460, 82, 18, 14, 20, 3303, 359, 452, 1764, 1991, 92, 49, 889, 1274, 9, 393, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 2490, 50274, 61, 463, 330, 9, 69, 12, 18, 1572, 2609, 11065, 69, 12, 18, 10, 47, 61, 2808, 427, 889, 918, 1572, 282, 393, 16980, 92, 18, 1217, 47, 63, 19, 10878, 2635, 13, 407, 42967, 14, 36, 386, 13890, 18057, 13, 323, 2761, 512, 669, 3151, 1366, 1764, 8403, 61, 10423, 578, 49, 61, 249, 393, 1991, 92, 51, 2000, 69, 60, 91, 44479, 1274, 3577, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 367, 9, 79, 7398, 918, 93, 426, 473, 1035, 2609, 92, 47, 61, 2808, 427, 43214, 3932, 370, 69, 29789, 84, 403, 43998, 13, 436, 8018, 964, 187, 187, 1231, 452, 2686, 8058, 326, 2761, 13353, 1764, 16980, 92, 18, 1217, 47, 889, 2204, 578, 79, 30, 17, 1990, 47, 14, 18, 889, 2981, 64, 79, 1035, 3151, 10, 70, 768, 19, 61, 2059, 891, 367, 9, 79, 3117, 426, 473, 578, 69, 1337, 3151, 889, 1274, 1035, 2609, 464, 16980, 464, 2808, 427, 1217, 47, 599, 393, 918, 16489, 835, 253, 3638, 3206, 275, 370, 48, 5, 310, 6447, 323, 512, 21783, 273, 4248, 1679, 685, 690, 4229, 370, 69, 1352, 496, 643, 3000, 13, 352, 7024, 760, 327, 253, 4248, 370, 69, 5, 285, 327, 669, 3151, 1352, 187, 187, 6080, 16157, 187, 7770, 187, 187, 18, 15461, 388, 18272, 285, 2956, 610, 1008, 1047, 73, 18272, 28403, 8402, 62, 11096, 616, 1263, 273, 15539, 14, 3431, 6713, 2718, 281, 8723, 1728, 29675, 285, 597, 1160, 253, 13260, 326, 253, 985, 310, 9106, 8723, 285, 556, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 15, 1198, 776, 4468, 13, 352, 310, 417, 3309, 281, 1056, 841, 13260, 15, 187, 187, 39418, 253, 2317, 370, 57, 5, 310, 4802, 15, 2635, 253, 7221, 1319, 273, 370, 53, 5, 8018, 8356, 253, 2264, 7221, 1319, 15, 6166, 253, 4465, 9376, 326, 627, 310, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 13, 247, 8723, 1728, 11923, 273, 15539, 14, 3431, 6713, 6637, 1364, 320, 22506, 21651, 23329, 285, 9106, 21651, 23329, 313, 28892, 575, 18, 285, 6899, 575, 19, 275, 1008, 1047, 73, 18272, 28403, 8402, 6660, 285, 767, 8723, 1728, 29675, 273, 15539, 14, 3431, 6713, 6637, 403, 27442, 36714, 616, 2718, 273, 15539, 14, 70, 3855, 8858, 403, 6425, 313, 28892, 495, 275, 1008, 1047, 73, 18272, 28403, 8402, 2498, 733, 310, 3477, 281, 923, 326, 253, 2264, 7221, 1319, 8018, 642, 20223, 273, 6486, 1340, 15, 2635, 3019, 57, 13, 53, 1009, 556, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 604, 370, 1594, 370, 310, 4802, 285, 370, 53, 5, 310, 8723, 15, 187, 187, 1231, 1053, 457, 85, 5467, 326, 370, 57, 5, 310, 4802, 15, 831, 4483, 441, 281, 2486, 4722, 8062, 327, 33817, 8470, 15, 3856, 310, 271, 47386, 1650, 15, 1281, 441, 1908, 271, 29438, 985, 370, 308, 89, 426, 4589, 12, 67, 370, 327, 253, 5818, 669, 1991, 92, 59, 2000, 81, 5, 273, 370, 81, 2911, 18535, 20935, 13, 342, 370, 247, 13, 67, 393, 249, 393, 1991, 92, 59, 2000, 81, 13355, 733, 310, 973, 1929, 326, 370, 53, 5, 310, 8723, 36714, 370, 66, 426, 337, 393, 2307, 268, 5, 285, 370, 270, 393, 570, 470, 393, 2307, 268, 370, 313, 2887, 1008, 19, 266, 1225, 249, 7857, 46188, 28, 1214, 26, 20227, 8602, 30862, 2498, 6166, 253, 9376, 370, 247, 426, 337, 393, 2307, 268, 370, 285, 370, 270, 393, 570, 470, 393, 2307, 268, 1366, 253, 8062, 370, 53, 5, 310, 8723, 285, 22506, 21651, 23329, 285, 352, 556, 13358, 6637, 905, 740, 4207, 1292, 370, 53, 5, 310, 417, 9106, 8723, 285, 417, 9106, 21651, 23329, 2057, 313, 12157, 370, 53, 63, 78, 5, 310, 417, 8723, 672, 370, 278, 426, 470, 393, 2307, 268, 370, 582, 285, 512, 253, 20223, 273, 370, 53, 5, 403, 273, 6486, 1340, 2, 187, 187, 19, 15461, 733, 369, 671, 8058, 407, 388, 18272, 285, 2956, 610, 1008, 1047, 73, 18272, 28403, 8402, 62, 326, 762, 253, 9079, 326, 627, 310, 642, 1327, 14, 26551, 20223, 273, 6486, 1340, 13, 247, 8723, 1728, 11923, 273, 15539, 14, 3431, 6713, 6637, 476, 320, 6607, 347, 271, 29438, 9261, 273, 247, 8566, 31106, 1387, 15, 6899, 575, 19, 275, 1008, 1036, 1689, 609, 28355, 2843, 460, 62, 3054, 326, 604, 627, 4961, 247, 9106, 8723, 29438, 9261, 327, 247, 8566, 31106, 1387, 13, 253, 1387, 1364, 320, 4802, 15, 11826, 609, 285, 2956, 610, 8058, 275, 1008, 1166, 1689, 609, 28355, 2843 ]
$ \Delta = \max(d^\circ q_1, \cdots, d^\circ q_\ell)$). Thus $$\dfrac{1}{N}\sum_{n=0}^{N-1}c_n F(T^{q_1(n)},\cdots,T^{q_\ell(n)}) = \dfrac{1}{N}\sum_{n=0}^{N-1}c_n e^{2\pi i P(n)}$$ which tends to zero, by (iii). If $(X, T)$ is not of quasi-discrete spectrum, the tensor products of quasi-eigenfunctions still span a subalgebra of $ C(X^\ell) $. Its closure is a closed subspace of $ C(X^\ell) $, that we denote by $C_T(X^\ell)$. The conclusion of Theorem \[thm:1\] remains true for all $F$ in $C_T(X^\ell)$. By the main theorem in [@11fan2011minimal], $ \mathbb{Z}_p = M \cup B $ (disjoint union) where $ M $ is a disjoint union of at most countably many minimal sets $M_i$ and every point in $B$ is mean attracted to one of minimal sets in $M$ (see [@10fan2015oscillating] for the definition of mean attraction), and each subsystem $ T\colon M_i \to M_i $ is either a finite cycle or is conjugate to an adding machine. So, $ T \colon M_i \to M_i $ has discrete spectrum, i.e. quasi-discrete spectrum of order $1$. Thus holds for all $ x \in M_i$, by Theorem \[thm:1\]. For $ x \in B $, we can prove as in [@10fan2015oscillating] (see the end of the proof of Theorem 1 in [@10fan2015oscillating]). The same result in Corollary \[thm:4\] holds for $p$-adic dynamics defined by rational functions with good reduction, because a minimal decomposition is also proved for such dynamics in \[9\]. Recall that any rational function $\phi \in \mathbb{Q}_p[z]$ having good reduction is $1$-Lipschitz continuous on the projective line $\mathbb{P}^1(\mathbb{Q}_p)$: $$\rho(\phi(P_1),\phi(P_2)) \le \rho(P_1, P_2)\quad \text{for all $P1, P2 \in \mathbb{P}^1(\mathbb{Q}_p)$}$$ where $\rho(\cdot, \cdot)$ is the *spherical metric* on $\mathbb{P}^1(\mathbb{Q}_p)$ (see [@26silverman2007arithmetic p.59]). Consider a subnormal sequence $ (\xi_n) $ on a probability space $ (\Omega, \mathscr{A}, \mathbb{P}) $ and a finite sequence of trigonometric polynomials of $ s $ variables $ f_n(t_1,\cdots,t_s) $ of order less than or equal to N. Then consider the random trigonometric polynomial $$P(t) = \sum_{n}\xi_n f_n(t).$$ There exists an absolute constant $C > 0$ such that $$\label{eq:ineq1-3} \mathbb{P}\left(\|P\|_\infty \le C\sqrt{s\sum\|f_n\|_\infty^2\log N} \right) \le \dfrac{1}{N^2}.$$ We refer this inequality as Littlewood-Salem-Kahane inequality ([@19kahane1985some] p. 70, Theorem 3. See [@12fan2003inegalite] for a different proof and a generalization). Basing on this inequality, we can prove the conclusion as follows. We have to prove that for almost all $ \omega \in \Omega $ and for all polynomials $ P \in \mathbb{R}[z]$, we have $$\label{eq:3-1} \lim_{N\to\infty} \dfrac{1}{N} \sum_{n=0}^{N-1}\xi_n(\omega) e^{2\pi iP(n)} = 0.$$ Let $d = d^\circ P$ be the degree of $ P $ and $ P(x) = \sum_{j=0}^d t_jx^j $ with $(t_0, t_1,\cdots, t_d) \in \mathbb{R}^{d+1} $. Then $$e^{2\pi iP(n)} = e^{2\pi i(t_0+ t_1 n+ \cdots + t_dn^d)} =: f_n(t_0,t_1,\cdots,t_d).$$ We regard $f_n$ as a trigonometric polynomial of $d + 1$ variables, of degree $1 + n + \cdots + n^d \le (d + 1)N^d$. Thus $$\sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| = \max\limits_{t\in \mathbb{T}^{d+1}} \left|\sum_{n=0}^{N-1}\xi_n(\omega)f_n(t)\right|.$$ Observe that $ \|f_n\|_{\infty} = 1 $. By Littlewood-Salem-Kahane inequality $\eqref{eq:ineq1-3}$, we have $$\mathbb{P}\left( \sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| \ge C(d+1)\sqrt{(d+1)N\log N}\right)\le \dfrac{1}{N^2}.$$ Then, by Borel-Cantelli lemma, for almost all $\omega$, $$\sup\limits_{P\in \mathbb{R}_d[z]}\left|\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi P(n)}\right| = O(\sqrt{N\log N}).$$ Since $d$’s are countable, this implies . We have actually proved that almost surely $$\dfrac{1}{N}\sum_{n=0}^{N-1}\xi_n(\omega)e^{2\pi i P(n)} = O_{d,\omega}\left(\sqrt{\dfrac{\log N}{N}} \right),$$ where the constant involved in $O$ is uniform for all polynomials of degree less than some fixed $d$. In other words, it depends only on the degree $d$ and on $\omega$. Some remarks ============ 1\. Hahn and Parry [@14hahn1965minimal] restricted their study of quasi-discrete systems to minimal homeomorphisms and they made the assumptions that the system is totally minimal and has no non-trivial eigenvalues of finite order. For our concern, it is not necessary to make these assumptions. Assume the space $X$ is connected. Then the minimality of $T$ implies automatically the total minimality. Under the extra assumption that there is no non-trivial eigenvalues of finite order, a minimal homeomorphism of quasi-discrete spectrum must be uniquely ergodic and totally ergodic (Theorem 1 and Theorem 2 in [@14hahn1965minimal]), and two minimal homeomorphisms of quasi-discrete spectrum are conjugate iff their systems of quasi-eigenvalues are equivalent (Theorem 3 in [@14hahn1965minimal]). It is easy to see that the total minimality implies no eigenvalues of finite order. Then $(X,T)$ has no non-trivial eigenvalues of finite order if $ X $ is connected and $T$ is minimal. We don’t assume that $X$ is connected. This allows us to include interesting dynamics on disconnected spaces. Here is an illustrative example. Let us consider an affine system $ Tx = ax+b $ on the ring $\mathbb{Z}_p$ of $p$-adic integers, with $ a,b \in \mathbb{Z}_p $. It is well known that $T$ is minimal iff $a = 1 \mod p$ and $ b \ne 0 \mod p $ (see [@2anashin2009applied; @9fan2007strict]). Under the assumption $ a = 1 \mod p $ and $ b \ne 0 \mod p$, the dynamics $T$ is minimal and uniquely ergodic and it has discrete spectrum \[10\]. But $T$ is not totally minimal and not totally ergodic either (because $T^m$ is not minimal when $ m = 0 \mod p $), and all the eigenvalues of $T$ are of finite order! 2\. It was also proved by Hahn and Parry [@14hahn1965minimal] that under the hypothesis that there is no non-trivial eigenvalues of finite order, a minimal homeomorphism of quasi-discrete spectrum can be represented as an affine transformation of a compact abelian group. Theorem 2 in [@16hoare1966affine] states that if there exists a totally minimal affine transformation on a compact abelian group, the group must be connected. Hoare and Parry proved in [@17hoare1966aff
[ 7185, 403, 281, 320, 48397, 342, 253, 954, 27785, 7914, 273, 27977, 534, 651, 1421, 441, 281, 1902, 247, 1698, 2341, 6637, 30259, 5540, 19468, 285, 47160, 782, 7759, 273, 7185, 313, 20, 26791, 669, 3181, 5, 374, 27923, 669, 3181, 5, 495, 9830, 323, 8091, 285, 29750, 14600, 582, 3921, 395, 4622, 1668, 42677, 7759, 273, 7185, 313, 19, 27923, 669, 3181, 5, 854, 9830, 481, 15405, 27785, 7968, 2226, 13, 533, 5293, 47620, 253, 806, 2201, 773, 14577, 273, 7185, 1895, 3, 326, 253, 28552, 5120, 7759, 273, 7185, 3176, 281, 320, 5816, 432, 253, 1698, 2341, 6637, 15, 831, 2523, 13, 1146, 581, 273, 253, 954, 4619, 275, 1327, 44931, 800, 27977, 13, 310, 1146, 9713, 407, 1142, 10527, 285, 5661, 5659, 15, 187, 187, 510, 1273, 2201, 773, 14577, 273, 7185, 1895, 995, 285, 253, 581, 534, 359, 2953, 1060, 13, 556, 281, 513, 342, 370, 82, 393, 2009, 2805, 5, 4667, 8869, 15, 3921, 34, 30400, 11661, 581, 651, 1902, 4667, 8869, 281, 320, 594, 14051, 326, 247, 35874, 19468, 1566, 651, 1891, 16821, 15, 4683, 2282, 13, 359, 871, 45190, 326, 4667, 8869, 310, 16013, 27, 253, 2540, 49680, 6637, 310, 14691, 407, 6891, 35648, 13, 1223, 253, 27785, 5406, 651, 3283, 35648, 342, 34414, 669, 4220, 5, 10870, 281, 616, 11843, 370, 78, 1352, 187, 187, 1147, 310, 1024, 7561, 14109, 326, 253, 6891, 12549, 11193, 476, 320, 8870, 1025, 275, 27977, 1561, 253, 370, 18, 16, 47, 64, 68, 5, 7466, 575, 683, 31727, 47, 68, 5218, 275, 253, 2701, 370, 47, 64, 68, 393, 4287, 393, 3259, 1366, 41341, 34414, 313, 1542, 1650, 10, 403, 14495, 281, 370, 47, 64, 68, 2497, 18, 724, 1223, 616, 11843, 403, 3907, 273, 370, 47, 64, 68, 1352, 380, 20028, 16947, 407, 4645, 326, 574, 1406, 767, 14, 3659, 3470, 403, 14691, 407, 14580, 275, 534, 253, 35874, 19468, 3104, 38500, 432, 616, 1127, 273, 8869, 281, 616, 1127, 273, 37290, 1293, 3081, 19468, 17417, 15, 380, 26447, 273, 824, 247, 773, 371, 29233, 11193, 3, 310, 13, 2299, 13, 417, 4209, 281, 762, 6343, 253, 35874, 19468, 1566, 27, 275, 253, 22926, 2701, 13, 824, 5721, 44166, 14580, 275, 2087, 4763, 1774, 9021, 432, 417, 760, 3579, 19468, 18634, 13, 533, 671, 432, 773, 59, 14, 33884, 3446, 313, 34, 773, 59, 14, 10580, 3, 310, 581, 275, 534, 253, 6355, 806, 4711, 247, 4667, 285, 840, 26262, 47602, 253, 29750, 14600, 273, 253, 4197, 4667, 1411, 253, 3236, 42995, 8091, 481, 18665, 1076, 949, 247, 1781, 370, 47, 64, 68, 5, 767, 14, 3659, 1159, 387, 247, 4229, 673, 3103, 651, 275, 2087, 10313, 417, 760, 253, 35874, 35608, 533, 671, 247, 1781, 370, 82, 393, 2009, 2805, 5, 6150, 15, 380, 1781, 370, 47, 64, 68, 5, 7466, 671, 6505, 440, 42195, 247, 625, 11745, 1953, 15, 3900, 49680, 34414, 669, 4220, 5, 3921, 609, 4622, 9403, 1355, 2429, 281, 49680, 11843, 370, 78, 1366, 597, 403, 5431, 10870, 281, 253, 2280, 21522, 723, 875, 3054, 275, 253, 49680, 6637, 15, 733, 310, 3021, 10084, 326, 253, 19638, 273, 247, 35874, 19468, 1566, 476, 11883, 773, 328, 371, 36616, 3446, 187, 187, 2512, 310, 1529, 25351, 273, 49680, 8062, 534, 310, 35036, 273, 436, 581, 27, 253, 2323, 273, 253, 473, 59, 42, 4086, 575, 683, 48, 59, 42, 1570, 329, 12314, 473, 59, 42, 14, 23283, 839, 10896, 370, 34, 578, 48, 59, 42, 724, 476, 671, 320, 2011, 281, 29259, 751, 370, 18, 16, 47, 64, 68, 1352, 1723, 13, 627, 403, 2067, 49770, 3386, 273, 436, 773, 42023, 3, 281, 253, 473, 59, 42, 12480, 1895, 575, 683, 42902, 5914, 48, 59, 42, 1570, 11680, 669, 3151, 2911, 1202, 2162, 5, 12480, 347, 271, 1650, 15, 831, 12480, 14488, 247, 7680, 432, 253, 7503, 49680, 6287, 1232, 669, 3151, 393, 4287, 611, 393, 2009, 611, 393, 4287, 393, 2162, 1366, 1097, 5018, 273, 534, 403, 473, 59, 42, 4136, 13, 285, 1016, 273, 534, 11498, 342, 370, 47, 64, 68, 5, 751, 669, 4220, 768, 18, 16, 19, 94, 393, 3549, 427, 64, 68, 2497, 18, 16, 19, 3363, 380, 1781, 370, 47, 64, 68, 5, 906, 326, 436, 473, 59, 42, 26554, 10896, 37824, 751, 370, 47, 64, 68, 2497, 18, 724, 310, 3021, 417, 19532, 281, 1781, 370, 47, 64, 68, 18965, 352, 816, 15877, 432, 773, 8522, 15752, 3, 275, 253, 3282, 326, 253, 1524, 285, 21833, 4243, 273, 247, 12314, 49680, 6287, 10659, 588, 452, 253, 1072, 10096, 327, 370, 47, 64, 68, 1352, 380, 7312, 7914, 273, 253, 473, 59, 42, 4086, 275, 436, 1083, 209, 575, 14, 575, 14, 575, 14, 575, 326, 773, 12237, 4707, 9852, 14580, 3, 403, 16821, 16013, 209, 575, 14, 575, 14, 575, 14, 575, 310, 440, 1866, 494, 275, 253, 1708, 273, 841, 473, 59, 42, 14, 31263, 6287, 21302, 15, 1583, 22065, 253, 14384, 273, 253, 1781, 370, 47, 64, 68, 5, 4154, 1580, 370, 34, 578, 48, 59, 42, 94, 393, 3549, 393, 4220, 209, 187, 14193, 78, 5, 310, 3921, 1439, 4622, 247, 1175, 6779, 273, 253, 473, 59, 42, 4086, 15, 313, 22262, 5845, 281, 897, 669, 3151, 2911, 1202, 2162, 5, 12480, 347, 271, 1650, 13, 359, 3877, 326, 370, 78, 2253, 3151, 428, 278, 2253, 2162, 5, 310, 27184, 10870, 281, 247, 6867, 49680, 4871, 13, 594, 253, 1781, 370, 47, 64, 68, 5, 906, 651, 3283, 271, 669, 3151, 2911, 1202, 2162, 5, 12480, 6907, 273, 1340, 16167, 275, 4499, 281, 253, 2540, 3102, 273, 1077, 5075, 12480, 534, 8018, 326, 370, 34, 578, 48, 59, 42, 94, 5291, 393, 4220, 5291, 78, 1352, 10, 187, 187, 688, 776, 3332, 9380, 575, 683, 23802, 33177, 28, 1214, 23802, 251, 48, 59, 42, 1092, 359, 452, 5421, 253, 440, 371, 36616, 273, 253, 19468, 1566, 13, 15974, 275, 1798, 253, 3486, 273, 370, 82, 393, 2009, 2805, 5, 4667, 8869, 327, 19468, 1566, 19638, 285, 327, 253, 473, 59, 42, 4086, 15, 496, 436, 2929, 359, 9017, 776, 2045, 789, 281, 10173, 690, 2538, 273, 253, 8921, 19468, 2600, 273, 253, 19025, 5802, 407, 2266, 370, 84, 393, 2009, 256, 5, 4667, 8869, 15, 3932, 13, 347, 588, 320, 2529, 275, 253, 1735, 2593, 13, 776, 1566, 31221, 253, 33736, 34574, 273, 253, 19468, 1566, 285, 310, 5185, 342, 253, 473, 59, 42, 4086, 13, 352, 3400, 247, 14905, 7792, 323, 253, 1263, 273, 253, 370, 82, 393, 2009, 2805, 5, 6150, 15, 844, 2770, 1060, 327, 253, 370, 84, 393, 2009, 256, 5, 6150, 1097, 984, 352, 4483, 441, 281, 3693, 48663, 2330, 342, 21827, 1105, 3899, 45031, 342, 1675, 281, 253, 35874, 35608, 275, 253, 3325, 790, 13, 285, 984, 352, 556, 4102, 2959, 10665, 5661, 4116, 15, 187, 187, 6067, 7342, 323, 436, 10272, 13, 2167, 24683, 13, 403, 3710, 15, 496, 1798, 13, 359, 588, 2953, 1060, 253, 2538, 327, 253, 8921, 19468, 15206, 414, 669, 3442, 256, 1366, 253, 23457, 8098, 4179, 9941, 370, 51, 64, 84, 63, 19, 1366, 285, 253, 23457, 8098, 5212, 2774, 669, 1906, 64, 84, 5, 273, 247, 3426, 2020, 689, 253, 473, 59, 42, 14, 31263, 370, 84, 187, 61, 2009, 256, 5, 17417, 534, 8162, 281, 767, 14, 3659, 3470, 49694, 74, 15, 70, 27720, 273, 4870, 326, 2723, 387, 253, 49680, 1268, 281, 370, 81, 393, 4287, 209, 187, 58, 3503, 44, 3503, 393, 7973, 1661, 480, 61, 1189, 1926, 4287, 94, 50276, 58, 17840, 13995, 44, 17840, 13995, 393, 4287, 268, 1366, 835, 370, 58, 18636, 285, 370, 44, 18636, 1957, 12314, 370, 52, 11468, 18, 5, 28556, 790, 285, 370, 52, 30, 12, 18, 5, 6191, 790, 13, 2975, 13, 285, 835, 669, 7973, 1661, 480, 61, 1189, 464, 4287, 724, 6492, 253, 2250, 273, 253, 4569, 1655, 481, 496, 4499, 13, 359, 403, 7591, 281, 2319, 253, 2538, 273, 6313, 473, 59, 42, 14, 1542, 67, 5394, 4870, 49694, 74, 15, 70, 27720, 4394, 326, 513, 417, 4262, 949, 2266, 473, 59, 42, 14, 31263, 41341, 17417, 481, 2053, 2486, 4870, 275, 534, 253, 370, 84, 393, 2009, 256, 5, 4667, 310, 3587, 3562, 390, 26262, 31718, 275, 247, 3295, 34791, 1375, 49694, 70, 15, 72, 27720, 370, 81, 393, 4287, 268, 393, 2162, 578, 43, 768, 5077, 599, 393, 7973, 1661, 480, 61, 1189, 464, 4287, 94, 50276, 81, 393, 2162, 24915, 43, 8, 768, 49, 8, 36, 8, 599, 393, 4287, 268, 5, 285, 370, 81, 393, 7973, 1661, 480, 61, 1189, 464, 4287, 94, 50276, 81, 393, 2162, 578, 43, 768, 5077, 599, 393, 4287, 268, 5, 390, 370, 81, 393, 4287, 268, 393, 2162, 578, 43, 768, 5077, 599, 50276, 61, 7973, 1661, 480, 61, 1189, 464, 4287, 94, 50275, 81, 1366, 835, 669, 2162, 578, 43, 768, 5077, 4018, 310, 271, 370, 84, 393, 2009, 256, 5, 41341, 342, 6318, 3904, 7224, 43, 768, 5077, 11971, 380, 6158, 767, 273, 841, 4870, 2723, 281, 6313, 473, 59, 42, 14, 1542, 67, 5394, 4972, 14, 6952, 251, 14, 33285, 593, 14, 881, 14580, 15, 1284, 369, 253, 1083, 275, 776, 4321, 2175, 273, 473, 59, 42, 8411, 575, 683, 23802, 251, 48, 59, 42, 1092, 512, 824, 33817, 773, 12237, 4707, 9852, 3, 21302, 403, 3345, 273, 253, 7990, 273, 776, 1566, 27, 359, 2770, 327, 253, 5549, 1242, 1199, 4067, 473, 59, 42, 14, 31263, 6287, 21302, 15, 844, 671, 513, 417, 2319, 1060, 4870, 275, 534, 8921, 46623, 14, 6952, 251, 17417, 403, 3587, 3562, 407, 253, 39578, 1655, 15, 3900, 824, 773, 22045, 14580, 3, 651, 275, 2087, 2226, 13, 359, 921, 2708, 326, 5293, 403, 2424, 281, 1056, 253, 9021, 273, 776, 2266, 370, 58, 3503, 44, 18636, 6287, 14580, 281, 669, 3442, 256, 1366, 370, 51, 64, 84, 63, 19, 1366, 390, 669, 1906, 64, 84, 5, 11206, 13727, 15, 535, 914, 371, 36616, 253, 3277, 782, 10031, 27, 17720, 187, 4578, 822, 187, 187, 510, 12276, 8631, 1264, 43884, 2330, 342, 253, 3753, 285, 6349, 273, 370, 82, 393, 2009, 2805, 5, 8557, 275, 1698, 2341, 574, 1406, 2605, 27, 187, 187, 17, 15, 22, 3591, 337, 10, 253, 6510, 273, 253, 5165, 35874, 2605, 273, 574, 9036, 313, 17480, 1014, 347, 370, 47, 64, 68, 393, 4287, 393, 3259, 1366, 1503, 14, 33884, 651, 4711, 8557, 5734, 253, 35608, 497, 5536, 582, 470, 15, 1099, 3591, 374, 10, 253, 5165, 5928, 273, 3943, 15752, 17660, 281, 27785, 19468, 1566, 19638, 13, 5747, 581, 457, 84, 15355, 273, 2280, 15036, 669, 3442, 278, 393, 3549, 393, 4220, 5, 313, 2811, 669, 4220, 5, 310, 247, 6867, 49680, 4871, 582, 285, 470, 15, 1099, 3591, 495, 10, 253, 12082, 14523, 273, 473, 59, 42, 14, 23283, 839, 22652, 370, 34, 578, 48, 59, 42, 724, 4103, 281, 581, 457, 84, 15355, 313, 4064, 3943, 15752, 10, 326, 370, 34, 578, 48, 59, 42, 94, 393, 3549, 393, 4220, 1352, 187, 187, 17, 15, 22, 3591, 187, 187, 688, 436, 2593, 359, 6266, 253, 5482, 359, 923, 281, 841, 43884, 15, 380, 4795, 5406, 4948, 253, 3634, 273, 253, 747, 789, 2529, 275, 436, 2929, 15, 187, 187, 510, 38356, 273, 253, 4009, 566, 17274, 3266, 318, 187, 36311, 187, 187, 1909, 2168, 5393, 13, 247, 5075, 830, 273, 253, 35874, 11193, 3133, 281, 20177, 432, 253, 1781, 370, 47, 64, 68, 5, 2701, 275, 253, 3282, 326, 21302, 275, 534, 760, 35874, 19468, 3104, 38500, 949, 49680, 767, 14, 3659, 3470, 25903, 347, 370, 47, 64, 68, 393, 4287, 393, 3259, 1352, 831, 26447, 1057, 417, 1646, 281, 2723, 281, 253, 7312, 35874, 11193, 1580, 253, 1503, 14, 10580, 7437, 273, 824, 21302, 588, 4711, 247, 370, 82, 393, 2009, 2805, 5, 6150, 15, 187, 187, 16628, 13, 2299, 13, 253, 24739, 5150, 323, 247, 2014, 1708, 19468, 18745, 342, 247, 4228, 3295, 2603, 313, 263, 247, 2014, 1708, 19468, 18414, 275, 247, 7351, 481, 831, 5150, 6125, 253, 2020, 273, 247, 873, 273, 5721, 44166, 14580, 534, 671, 2486, 1503, 14, 33884, 13, 533, 253, 2538, 273, 1110, 14580, 310, 10848, 275, 253, 2406, 4295, 273, 253, 2014, 8091, 24739, 5508, 263, 15, 3921, 42, 15, 70, 27720, 824, 1503, 14, 33884, 2723, 281, 29100, 17660, 281, 253, 19468, 1566, 15, 2064, 824 ]
freedom are to be contrasted with the most naive interpretation of QCD which would lead us to expect a low energy spectrum exhibiting 36 quark and antiquark degrees of freedom (3 flavors $\times$ 2 spins $\times$ 3 colors for particle and antiparticle), [*and*]{} 16 gluon degrees of freedom (2 spins $\times$ 8 colors). Less naive pictures exist, but none evade the first major “degree of freedom problem" that the gluonic degrees of freedom appear to be missing from the low energy spectrum. This issue, being one of the most critical in nonperturbative QCD, is being addressed by many theoretical and experimental programs. The second major “degree of freedom problem", and the one which we address here, has to do with $q \bar q$ pair creation. [*A priori*]{}, one would expect pair creation to be so probable that a valence quark model would fail dramatically. Of course, we know empirically that pair creation is suppressed: the observed hadronic spectrum is dominated by narrow resonances, while the naive picture would predict resonances with widths $\Gamma$ comparable to their masses $m$. It is now widely appreciated that the narrow resonance approximation can be rationalized in QCD within the $1/N_c$ expansion [@LargeNc]: in the limit $N_c \rightarrow \infty$, meson widths (for example) are proportional to $N_c^{-1}$ while their masses are independent of $N_c$. The demonstration proceeds by showing that hadron two-point functions are dominated by graphs in which the valence quark lines propagate from their point of creation to their point of annihilation without additional quark loops. The dominance of such a “quenched approximation" is, however, not sufficient to underwrite the valence quark model: in the chiral limit, such Feynman graphs in general receive important contributions from not only forward quark propagation, but also from “Z-graphs". (A “Z-graph" is one in which the interactions first produce a pair and then annihilate the antiparticle of the produced pair against the original propagating particle). Cutting through a large $N_c$ two-point function at a fixed time therefore would in general reveal not only the valence quarks but also a large $q \bar q$ sea. The large $N_c$ expansion also leaves unanswered a more quantitative question. While hadronic widths $\Gamma$ [*are*]{} normally small compared to hadronic masses $m$, they are typically comparable to the mass spacings between states in the hadronic spectrum. It is thus surprising that the spectroscopy of a valence quark model can survive “unquenching". There is another puzzle of hadronic dynamics which is reminiscent of this one: the success of the OZI rule [@OZI]. A generic OZI-violating amplitude $A_{OZI}$ can also be shown to vanish like $1/N_c$. However, there are several unsatisfactory features of this “solution" to the OZI mixing problem [@LipkinOZI]. Consider $\omega$-$\phi$ mixing as an example. This mixing receives a contribution from the virtual hadronic loop process $\omega \rightarrow K \bar K \rightarrow \phi$, both steps of which are OZI allowed, and each of which scales with $N_c$ like $\Gamma^{1/2} \sim N_c^{-1/2}$. The large $N_c$ result that this OZI violating amplitude behaves like $N_c^{-1}$ is thus not peculiar to large $N_c$: it just arises from “unitarity" in the sense that the real and imaginary parts of a generic hadronic loop diagram will have the same dependence on $N_c$. The usual interpretation of the OZI rule in this case  - - -  that “double hairpin graphs" are dramatically suppressed  - - -  is untenable in the light of these OZI-allowed loop diagrams. They expose the deficiency of the large $N_c$ argument since $A_{OZI} \sim \Gamma <<m$ is [*not*]{} a good representation of the OZI rule. (Continuing to use $\omega$-$\phi$ mixing as an example, we note that $m_\omega - m_\phi$ is numerically comparable to a typical hadronic width, so the large $N_c$ result would predict an $\omega$-$\phi$ mixing angle of order unity in contrast to the observed pattern of very weak mixing which implies that $A_{OZI} << \Gamma <<m$.) In our recent papers [@GIpotential; @GIonOZI], we have studied the unquenching of the quark model, addressing in particular the impact of $q \bar q$ pair creation on quark model spectroscopy and on the OZI rule. In this paper we extend our previous work to calculate some effects of the strange quark content of the proton induced by strong $s \bar s$ pair creation. Since, as will be described in the next section, our model preserves the spectroscopic successes of the quark model and is consistent with the OZI rule, it provides a legitimate framework for the study of the $q \bar q$ sea. We focus here on the $s \bar s$ sea both because it allows us to avoid complexities associated with antisymmetrization with respect to the valence quarks in the nucleons, and because it has recently received considerable experimental attention. Our goals for this calculation, though ambitious, are limited. In particular, we will address here the effects on the strange quark helicity $\Delta s$, the strangeness charge radius $R_s^2$, and the strangeness magnetic moment $\mu_s$ of a complete sum over the OZI-allowed $s \bar s$ loops which contribute to two-point functions ([*i.e.*]{}, of processes that correspond at the hadronic level to $p \rightarrow Y^*K^* \buildrel j\over {\rightarrow} Y^{*'}K^{*'} \rightarrow p$, where $Y^*$ and $K^*$ represent generic $S=-1$ baryons and $S=+1$ mesons, respectively, and where $\buildrel j\over{\rightarrow}$ indicates the action of the appropriate current). In contrast, we are unable to discuss the effects of pure OZI-forbidden processes ([*i.e.*]{}, ones that do not proceed through strong OZI-allowed meson loops). These include processes in which the $s \bar s$ pair is directly created or annihilated in a color singlet state ([*e.g.*]{}, $p \rightarrow p \phi_{J^{PC}} \buildrel j\over{\rightarrow} p \phi'_{J'^{P'C'}} \rightarrow p$ and $p \buildrel j\over{\rightarrow} p \phi_{J^{PC}} \rightarrow p$ or $p \rightarrow p \phi_{J^{PC}} \buildrel j\over{\rightarrow} p$, where $\phi_{J^{PC}}$ is an $s \bar s$ meson with quantum numbers ${J^{PC}}$. The latter two of these processes correspond to pure OZI-forbidden vector-meson-dominance-type graphs. As was the case in our earlier studies of OZI violation [@GIonOZI], all such disconnected “double hairpin" diagrams are outside of the scope of our model: we focus on the naively much larger OZI-allowed loop diagrams. We also do not discuss here processes in which strange baryon-meson loops are directly created by the probing current. While such “contact graphs" would in general exist, we show below that none are required to make the contributions of our strong $Y^*K^*$ loop graphs to $\Delta s$, $R_s^2$, or $\mu_s$ gauge invariant. Unquenching the Quark Model: Background ======================================== The Introduction describes three puzzles associated with the nature and importance of $q \bar q$ pairs in low energy hadron structure: 0.5cm 1) the origin of the apparent valence structure of hadrons (since even as $N_c \rightarrow \infty$, Z-graphs would produce pairs unless the quarks were heavy), 0.25cm 2) the apparent absence of unitarity corrections to naive quark model spectroscopy, despite one’s expectation of mass shifts $\Delta m \sim \Gamma$ (where $\Gamma$ is a typical hadronic width), and 0.25cm 3) the systematic suppression of OZI-violating amplitudes $A_{OZI}$ relative to one’s expectation (from unitarity) that $A_{OZI} \sim \Gamma$. 0.5cm In this section we describe the solutions we see to these puzzles. The resulting picture forms the context of the new work described in this paper. The Origin of the Valence Approximation --------------------------------------- As already mentioned, a weak form of the valence approximation seems to emerge from the large $N_c$ limit in the sense that diagrams in which only valence quark lines propagate through hadronic two-point functions dominate as $N_c \rightarrow \infty$. This dominance does not seem to correspond to the usual valence approximation since the Z-graph pieces of such diagrams will produce a $q \bar q$ sea. Consider, however, the Dirac equation for a single light quark interacting with a static color source (or a single light quark confined in a bag). This equation represents the sum of a set of Feynman graphs which also include Z-graphs, but the effects of those graphs is captured in the lower components of the single particle Dirac spinor. [*I.e.*]{}, such Z-graphs correspond to relativistic corrections to the quark model. That such
[ 313, 84, 20416, 66, 599, 428, 256, 20416, 67, 599, 3117, 14, 40, 61, 2760, 2769, 90, 20416, 66, 599, 28, 90, 20416, 67, 599, 13941, 4700, 844, 969, 897, 326, 370, 84, 20416, 66, 27825, 84, 20416, 67, 599, 393, 249, 544, 17, 13, 18, 1009, 285, 4647, 8755, 905, 5528, 27, 13118, 2582, 40, 2582, 3115, 40460, 4207, 187, 187, 20, 15, 50276, 2042, 370, 70, 31, 70, 64, 17, 1366, 840, 407, 23709, 905, 43, 2582, 70, 5426, 8946, 696, 359, 452, 1764, 1968, 92, 3582, 500, 3033, 495, 94, 187, 50274, 25583, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 1337, 3830, 4615, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 28, 2029, 28, 6087, 40, 6087, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 43657, 20866, 32453, 36, 4615, 4700, 187, 187, 2906, 4297, 272, 7370, 4087, 281, 1157, 359, 24813, 347, 1764, 2043, 92, 14856, 94, 187, 464, 1588, 94, 45, 1126, 3115, 13, 70, 64, 17, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 11549, 2029, 28, 187, 464, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 2306, 78, 393, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 18, 599, 50276, 464, 2690, 92, 69, 7780, 5664, 464, 2690, 92, 90, 16302, 18, 5095, 1926, 17896, 61, 28526, 393, 2981, 5716, 5664, 464, 2690, 92, 90, 16302, 18, 10, 393, 18002, 61, 29753, 94, 50276, 187, 61, 11510, 6263, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 68, 5716, 1588, 94, 38, 7398, 14491, 9, 393, 565, 1126, 5764, 19022, 1588, 94, 55, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 10791, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 27612, 393, 14491, 10, 209, 187, 3353, 187, 61, 3181, 187, 61, 20999, 464, 11510, 6263, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 80, 5716, 1588, 94, 38, 38414, 14491, 1035, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 94, 20886, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 14491, 13941, 15, 187, 61, 1968, 92, 45, 299, 64, 17, 246, 6489, 374, 889, 423, 92, 14856, 2138, 1281, 2367, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 68, 20886, 1588, 94, 38, 3822, 2896, 253, 39788, 14, 10859, 29815, 11370, 275, 370, 90, 20416, 66, 4018, 323, 7224, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 1009, 359, 4044, 1764, 1968, 92, 49791, 1854, 7680, 281, 418, 299, 64, 17, 246, 94, 187, 61, 565, 1126, 5764, 19022, 1588, 94, 55, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 10791, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 27612, 11549, 464, 20866, 32453, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 13, 393, 3830, 5095, 1157, 464, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 7398, 13, 4700, 1281, 2367, 1588, 94, 49, 393, 249, 393, 4820, 92, 22670, 2000, 80, 20886, 1588, 94, 38, 3822, 844, 6983, 253, 14951, 432, 253, 4737, 273, 8755, 905, 9807, 1854, 696, 27, 16207, 1588, 94, 49, 22969, 70, 64, 18, 1337, 5589, 13, 70, 578, 82, 12, 18, 889, 8633, 1337, 9315, 187, 464, 1588, 94, 55, 64, 18, 5716, 1588, 94, 49, 7182, 6394, 67, 2000, 18, 41194, 67, 2000, 19, 61, 8633, 13, 393, 9315, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 7182, 6394, 66, 2000, 18, 1337, 5589, 41194, 66, 2000, 82, 61, 8633, 4700, 187, 187, 3463, 253, 39788, 14, 10859, 29815, 11370, 275, 370, 90, 20416, 66, 4018, 323, 7224, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 1009, 359, 4044, 1764, 2043, 92, 14856, 94, 187, 61, 1968, 92, 9807, 1854, 7680, 281, 418, 299, 64, 17, 246, 94, 187, 61, 14491, 1035, 565, 1126, 5764, 19022, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 17125, 393, 11510, 20416, 66, 889, 249, 1926, 1588, 94, 55, 64, 19, 5716, 1588, 94, 49, 3117, 1926, 2690, 92, 69, 599, 90, 20416, 66, 599, 5095, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 49, 94, 393, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 299, 94, 20886, 5664, 464, 2690, 92, 90, 16302, 70, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 14491, 1572, 43657, 20866, 32453, 187, 3353, 187, 61, 11510, 578, 75, 30, 19, 1990, 82, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 75, 3713, 13, 393, 3830, 4615, 11400, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 28247, 3577, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 18, 1603, 9, 90, 578, 67, 64, 18, 2023, 393, 3830, 582, 1926, 5664, 464, 2690, 92, 84, 6092, 47028, 45, 63, 19, 94, 5095, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 64, 18, 1603, 1035, 3830, 13, 340, 578, 67, 64, 19, 22286, 1926, 5664, 464, 2690, 92, 84, 6092, 47028, 45, 63, 19, 8633, 4880, 423, 92, 14856, 2138, 4974, 46306, 285, 715, 285, 9433, 253, 39788, 14, 10859, 29815, 11370, 275, 253, 2367, 5664, 464, 2690, 92, 90, 16302, 18, 5, 4903, 359, 4044, 1764, 1968, 92, 45, 299, 64, 17, 246, 1885, 3033, 94, 187, 464, 1588, 94, 45, 1126, 3115, 13, 70, 64, 17, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 11549, 464, 20866, 32453, 464, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 2306, 78, 5095, 464, 27805, 393, 2981, 393, 28042, 17738, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 393, 11510, 578, 70, 393, 249, 1926, 1588, 94, 38, 94, 33401, 3582, 2386, 1588, 94, 43, 4689, 3115, 13, 70, 3713, 13, 393, 3830, 4615, 1157, 464, 5664, 464, 2690, 92, 84, 6092, 1572, 93, 6263, 5577, 94, 52, 63, 19, 5716, 5577, 94, 41, 3117, 5095, 4700, 4568, 11822, 1157, 1157, 285, 1157, 253, 1750, 1024, 3637, 432, 964, 187, 187, 9301, 13, 323, 370, 78, 393, 249, 1926, 1991, 92, 47, 4018, 359, 4853, 1764, 1968, 92, 71, 64, 78, 13, 66, 64, 78, 63, 2981, 8946, 94, 187, 66, 1126, 3259, 13, 78, 9616, 2981, 11549, 464, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 32453, 393, 1124, 92, 1490, 18, 4800, 78, 1217, 78, 2, 5095, 374, 63, 78, 94, 393, 2204, 1126, 10314, 393, 249, 1926, 5577, 94, 49, 94, 1926, 1588, 94, 42, 2850, 2981, 1126, 10314, 8633, 4700, 187, 187, 1447, 1773, 41801, 273, 253, 6843, 2426, 696, 1198, 370, 66, 1126, 3115, 13, 78, 4799, 2981, 724, 347, 2931, 275, 1157, 359, 452, 1764, 1968, 92, 1773, 41801, 273, 253, 6843, 2426, 6489, 94, 187, 66, 1126, 3115, 13, 78, 4799, 2981, 94, 393, 4287, 247, 1126, 3259, 13, 78, 9616, 2981, 393, 3362, 393, 6190, 92, 284, 889, 3362, 393, 3115, 393, 4287, 393, 3259, 61, 3362, 393, 6190, 92, 23714, 314, 275, 94, 393, 3362, 393, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 4615, 4700, 187, 187, 4509, 8755, 905, 56, 781, 2582, 13259, 18057, 5290, 11506, 905, 13443, 273, 749, 33884, 5290, 285, 8755, 905, 5616, 27, 13118, 2582, 40, 2582, 3115, 696, 352, 3637, 326, 370, 71, 1126, 3115, 13, 78, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 45707, 2931, 275, 310, 11542, 17568, 275, 669, 3115, 31, 17, 1366, 669, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 1366, 285, 2367, 5664, 464, 2690, 92, 85, 6092, 393, 249, 1926, 5577, 94, 34, 1352, 5488, 13, 432, 6935, 6681, 905, 56, 781, 2582, 13259, 18057, 696, 285, 905, 1773, 41801, 273, 6843, 2426, 18057, 5290, 323, 512, 2367, 5664, 464, 2690, 92, 85, 6092, 393, 249, 1926, 5577, 94, 34, 5, 359, 452, 3318, 71, 1126, 3115, 13, 78, 4799, 2981, 10791, 5664, 464, 2690, 92, 85, 27612, 393, 4287, 393, 2204, 1126, 10314, 393, 249, 1926, 5577, 94, 49, 94, 1926, 1588, 94, 42, 2850, 2981, 1126, 10314, 94, 393, 3362, 393, 6190, 92, 284, 889, 3362, 393, 3115, 393, 4287, 393, 3259, 61, 3362, 393, 6190, 92, 23714, 314, 275, 94, 393, 3362, 393, 2981, 393, 249, 1926, 5577, 94, 35, 64, 81, 4615, 4700, 380, 1750, 1024, 3637, 407, 970, 1157, 1157, 285, 253, 14691, 14940, 10012, 15, 187, 187, 510, 6414, 1307, 1712, 1704, 27, 2013, 404, 491, 94, 187, 22928, 187, 187, 688, 436, 19087, 359, 6642, 253, 6414, 1307, 432, 964, 187, 187, 1447, 8560, 27, 2013, 404, 491, 696, 1198, 370, 51, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 1009, 2931, 347, 275, 285, 669, 4820, 92, 1785, 94, 91, 1926, 32291, 94, 17, 5, 359, 452, 16207, 28526, 416, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 10, 393, 29753, 94, 11549, 464, 20866, 32453, 1926, 33438, 5716, 1124, 92, 36, 81, 2704, 1464, 63, 19, 3080, 34145, 40188, 81, 1926, 33438, 5716, 1124, 92, 36, 1926, 27805, 259, 393, 28042, 2026, 45, 2850, 3259, 94, 1926, 28526, 1182, 393, 29753, 7780, 1464, 63, 19, 3080, 34145, 46538, 46, 94, 5095, 353, 2, 4615, 4700, 187, 187, 510, 1551, 273, 436, 19087, 310, 16222, 281, 253, 4737, 273, 11506, 905, 8560, 27, 2013, 404, 491, 4207, 844, 3135, 407, 9591, 253, 1818, 273, 4903, 370, 86, 64, 18, 30, 18, 14, 19, 61, 1464, 14, 85, 64, 18, 5, 285, 370, 86, 64, 75, 30, 85, 578, 75, 14, 18, 5960, 85, 578, 75, 724, 323, 370, 19, 1926, 20866, 94, 75, 1926, 20866, 94, 46, 5, 275, 253, 5426, 1157, 285, 31931, 4513, 2367, 5664, 464, 2690, 92, 86, 6092, 426, 313, 86, 64, 18, 13, 393, 6768, 13, 1484, 64, 46, 1009, 347, 973, 347, 2367, 28526, 1926, 5664, 464, 2690, 92, 86, 6092, 393, 29753, 94, 1926, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 889, 2204, 578, 74, 426, 337, 2306, 46, 1484, 64, 74, 1352, 831, 11026, 1764, 1968, 92, 51, 64, 5302, 64, 72, 94, 187, 51, 1126, 3115, 13, 46, 4799, 2981, 1603, 91, 1572, 28, 2029, 28, 1490, 18, 4800, 46, 393, 1124, 92, 91, 63, 46, 18424, 18, 14, 19, 61, 1464, 7415, 46, 599, 393, 565, 13061, 17, 13, 337, 428, 374, 393, 1464, 4800, 46, 94, 1926, 2690, 92, 69, 7780, 5664, 464, 2690, 92, 86, 599, 8633, 7524, 5664, 464, 2690, 92, 18, 6092, 20886, 28526, 1926, 5664, 464, 2690, 92, 86, 6092, 393, 29753, 94, 654, 337, 428, 374, 393, 1464, 3117, 5095, 305, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 13, 1926, 5664, 464, 2690, 92, 86, 6092, 13941, 11227, 835, 359, 2931, 1764, 2043, 92, 14856, 94, 187, 72, 2850, 2981, 1126, 3115, 13, 46, 1603, 91, 13, 1926, 5664, 464, 2690, 92, 86, 27612, 11549, 464, 679, 1661, 464, 87, 9229, 464, 10352, 25379, 44821, 17, 15, 2082, 911, 393, 8737, 5985, 446, 16563, 17, 431, 393, 18452, 32901, 889, 18452, 32901, 44766, 32453, 209, 187 ]
(s_{{a}} - s_{{b}})}-G\big)(y_{{a}};y_{{b}})\,.$$ We again use that $s_{{a}}-s_{{b}} \in [0,1)$ and apply Lemma \[cor:conv\_G\_tau corollary\]. 3. If $e>e_0$, then by Definition \[J\_e definition classical\] we have $$\label{tilde J bound 3} \|\tilde{{\mathcal}J}_{\tau,e}(\,\cdot\,,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)}\;=\;\|G\|_{{\mathfrak}S^2({\mathfrak}H)}\;{\leqslant}\;C\,.$$ Arguing analogously to , we rewrite as $$\begin{gathered} {\mathcal}L_{\tau,e_0}^{\xi}({\boldsymbol{\mathrm{t}}}) \;=\; {\lVert w \rVert}_{L^\infty}^m \int_{\Lambda^{{\mathcal}V_1}} {\mathrm{d}}{\boldsymbol{\mathrm{y}}}_1 \, {\bigl\lvert \xi({\boldsymbol{\mathrm{y}}}_1) \bigr\rvert} \prod_{{\mathcal}P \in \operatorname{conn}_c({\mathcal}E)}\bigg( \int_{\Lambda^{{\mathcal}V({\mathcal}P)}} \prod_{{a}\in {\mathcal}V({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e}({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}}) \bigg) \\ \times \mathop{\prod_{{\mathcal}P \in \operatorname{conn}_o({\mathcal}E)}}\bigg(\int_{\Lambda^{{\mathcal}V_2({\mathcal}P)}} \prod_{{a}\in {\mathcal}V_2({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e} ({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}})\bigg)\,. \label{L e_0 t identity 2}\end{gathered}$$ Let ${\mathcal}P \in \operatorname{conn}_c ({\mathcal}E)$. By the Cauchy-Schwarz inequality in $y_{{a}}$ for ${a}\in {\mathcal}V({\mathcal}P)$ we obtain $$\label{Closed path contribution to L e_0 t} \int_{\Lambda^{{\mathcal}V({\mathcal}P)}} \prod_{{a}\in {\mathcal}V({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e}({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}}) \;{\leqslant}\; \prod_{e \in {\mathcal}P} \|\tilde{{\mathcal}J}_{\tau,e}(\, \cdot \, ,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)}\,.$$ Let ${\mathcal}P \in \operatorname{conn}_o ({\mathcal}E)$. We recall the notation from the proof of Lemma \[Open path\]: $${\mathcal}P=\{e_1,\ldots,e_{q+1}\}\,,\qquad {\mathcal}V_1({\mathcal}P)=\{{b}_1,{b}_2\}\,, \qquad {\mathcal}V_2({\mathcal}P)=\{{a}_1,\ldots,{a}_q\}\,.$$ By the Cauchy-Schwarz inequality in $y_{{a}}$ for ${a}\in {\mathcal}V_2({\mathcal}P)$ we obtain $$\begin{gathered} \label{Open path contribution to L e_0 t} \bigg(\int_{\Lambda^{{\mathcal}V_2({\mathcal}P)}} \prod_{{a}\in {\mathcal}V_2({\mathcal}P)} {\mathrm{d}}y_{{a}} \, \prod_{e \in {\mathcal}P} \tilde{{\mathcal}J}_{\tau, e} ({\boldsymbol{\mathrm{y}}}_e,{\boldsymbol{\mathrm{s}}})\bigg)\;{\leqslant}\; \\ \prod_{j=2}^{q} \|\tilde{{\mathcal}J}_{\tau,e_j}(\, \cdot\,,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)} \,\|\tilde{{\mathcal}J}_{\tau,e_1}((y_{b_1}, \cdot), {\boldsymbol{\mathrm{s}}})\|_{L^2} \, \|\tilde{{\mathcal}J}_{\tau,e_1}((\cdot, y_{b_2}), {\boldsymbol{\mathrm{s}}})\|_{L^2}\,.\end{gathered}$$ Substituting and into and applying the Cauchy-Schwarz inequality in the ${\boldsymbol{\mathrm{y}}}_1$ variables we obtain $$\label{L e_0 t product bound} {\mathcal}L_{\tau,e_0}^{\xi}({\boldsymbol{\mathrm{t}}}) \;{\leqslant}\;{\lVert w \rVert}_{L^\infty}^m \,{\lVert \xi \rVert}_{{\mathfrak}S^2({\mathfrak}H)} \prod_{e \in {\mathcal}E} \|\tilde{{\mathcal}J}_{\tau,e}(\, \cdot\, ,{\boldsymbol{\mathrm{s}}})\|_{{\mathfrak}S^2({\mathfrak}H)} \,.$$ Recalling , , and , the claim now follows from . Next, for $m \in {\mathbb{N}}$ we define $$\label{f_m,a_m^xi classical} a_{\infty,m}^\xi \;{\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\; \frac{(-1)^m}{m! \, 2^m} \sum_{\Pi \in {\mathfrak}P} {\mathcal}I^\xi_{\Pi}\,.$$ \[Convergence of the explicit terms\] For $a_{\tau,m}^{\xi}$ as defined in , we have $$\label{Convergence of the explicit terms identity} a_{\tau,m}^{\xi} \rightarrow a_{\infty,m}^\xi \quad \mbox{as}\quad \tau \rightarrow \infty\quad \mbox{uniformly in} \quad \xi \in {\mathfrak}B_p\,.$$ From Lemma \[Wick\_application lemma\], Proposition \[Product of subgraphs\], and Lemma \[lem:conv\_G\_tau\] it follows that $f_{\tau,m}^{\xi}({\boldsymbol{\mathrm{t}}})$ defined in is bounded uniformly in $\tau>0$, $\xi \in {\mathfrak}B_p$, and ${\boldsymbol{\mathrm{t}}} \in {\mathfrak}A$. Furthermore, from Lemmas \[Wick\_application lemma\] and \[Convergence of explicit terms lemma\], for all ${\boldsymbol{\mathrm{t}}} \in {\mathfrak}A$ we have $$f_{\tau,m}^{\xi}({\boldsymbol{\mathrm{t}}}) \rightarrow \sum_{\Pi \in {\mathfrak}P} {\mathcal}I^\xi_{\Pi} \quad \mbox{as}\quad \tau \rightarrow \infty\quad \mbox{uniformly in} \quad \xi \in {\mathfrak}B_p\,.$$ The claim now follows by using , , and the dominated convergence theorem. The remainder term {#sec:remainder} ------------------ In this subsection we estimate the remainder term from . \[prop:remainder\] For $R^\xi_{\tau,M}(z)$ defined as in and $\operatorname{Re}z {\geqslant}0$ we have $${\lvert R^\xi_{\tau,M}(z) \rvert} \;{\leqslant}\; {\biggl({\frac{Cp}{\eta^2}}\biggr)}^p {\biggl({\frac{C {\lVert w \rVert}_{L^\infty} {\lvert z \rvert}}{\eta^2}}\biggr)}^{M} \, M!\,.$$ The rest of this subsection is devoted to the proof of Proposition \[prop:remainder\]. We begin by performing the change of variables $u_1=1-2\eta-t_1$ and $u_j=t_{j-1}-t_{j}$ for $2 {\leqslant}j {\leqslant}M$ in the definition , and abbreviate ${\boldsymbol{\mathrm{u}}} = (u_1, \dots, u_M)$ as well as ${\lvert {\boldsymbol{\mathrm{u}}} \rvert} {\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\sum_{i = 1}^M u_i$. This yields $$\label{R_using_g} R_{\tau,M}^{\xi}(z)\;=\;(-1)^M \frac{z^M}{(1-2\eta)^{M}} \int_{(0, 1 - 2 \eta)^M} {\mathrm{d}}{\boldsymbol{\mathrm{u}}}\, {{\boldsymbol{\mathrm{1}}} ({\lvert {\boldsymbol{\mathrm{u}}} \rvert} < 1 - 2 \eta)} \, g^\xi_{\tau,M}(z, {\boldsymbol{\mathrm{u}}})\,,$$ where we defined $$\begin{gathered} g^\xi_{\tau,M}(z, {\boldsymbol{\mathrm{u}}}) \;{\mathrel{\vcenter{\baselineskip0.65ex \lineskiplimit0pt \hbox{.}\hbox{.}}}=}\;
[ 15, 12526, 703, 556, 644, 2581, 1512, 1959, 275, 13002, 731, 449, 187, 187, 3, 1147, 434, 247, 3513, 1895, 937, 15946, 753, 246, 398, 600, 15, 346, 42, 5545, 3780, 1060, 588, 1557, 2217, 281, 9059, 342, 617, 13, 1339, 3815, 2847, 247, 41843, 15, 1292, 604, 597, 513, 13, 840, 253, 1980, 3513, 476, 1379, 1557, 273, 352, 449, 187, 187, 20405, 17650, 21374, 13, 347, 604, 436, 369, 247, 38519, 4154, 15, 346, 49, 770, 13, 436, 310, 417, 247, 14876, 15, 1422, 778, 1158, 326, 1142, 952, 403, 1049, 22811, 347, 281, 253, 3242, 4278, 273, 7231, 12791, 13, 285, 760, 11617, 7730, 15600, 588, 9059, 342, 617, 1128, 395, 1014, 604, 597, 513, 13, 368, 4517, 326, 597, 387, 1878, 871, 849, 281, 21319, 1561, 253, 1569, 449, 754, 5439, 3168, 34036, 15, 346, 2042, 594, 13, 368, 403, 247, 11213, 15, 3808, 1821, 588, 9059, 625, 9908, 1523, 670, 9596, 685, 2712, 2010, 327, 6149, 15, 1916, 1142, 13, 9596, 6125, 1340, 13, 45985, 13, 253, 19455, 10170, 273, 1175, 689, 10319, 15, 733, 23849, 281, 731, 616, 1659, 275, 8869, 449, 754, 11373, 47077, 314, 15, 346, 6080, 2811, 2822, 253, 1755, 15, 380, 7286, 273, 771, 14197, 17163, 2352, 253, 1077, 1755, 15, 18190, 556, 281, 320, 2918, 896, 323, 2656, 449, 3032, 8580, 28290, 285, 521, 2927, 497, 22072, 15, 346, 1989, 1333, 1633, 281, 29138, 326, 1659, 2822, 253, 1755, 13, 285, 368, 29138, 3253, 449, 187, 187, 1328, 11898, 521, 1481, 15, 346, 2214, 2656, 434, 13232, 13, 637, 13, 1007, 387, 849, 9596, 556, 15070, 441, 7419, 4768, 2892, 15, 11075, 342, 253, 35929, 3355, 13, 285, 253, 496, 34961, 275, 11268, 13, 253, 31222, 273, 253, 8842, 1032, 285, 48690, 5060, 275, 253, 1551, 273, 3060, 13, 253, 2280, 317, 373, 273, 253, 12818, 31526, 1502, 275, 6181, 15, 844, 1849, 15676, 1097, 33097, 285, 24419, 1103, 9361, 15, 1422, 1158, 352, 4571, 626, 5108, 969, 32, 1310, 399, 5292, 71, 316, 497, 417, 247, 5679, 13, 513, 368, 1158, 436, 2644, 49358, 18830, 651, 2455, 452, 3053, 13, 1620, 2564, 4925, 436, 8394, 865, 187, 187, 49, 770, 12491, 6345, 281, 9059, 13, 285, 1119, 253, 3000, 13831, 327, 521, 14018, 15, 187, 187, 1147, 369, 12345, 253, 990, 273, 4162, 15, 36072, 275, 253, 1770, 3918, 43802, 2205, 574, 2546, 253, 530, 15, 52, 15, 5759, 323, 247, 16204, 273, 2137, 1411, 11268, 15, 24605, 574, 644, 8445, 14275, 432, 11268, 323, 1142, 1107, 13, 285, 253, 1986, 2077, 574, 13207, 281, 32014, 275, 253, 12027, 13, 6523, 271, 5107, 281, 6351, 1612, 285, 1899, 15, 2091, 253, 20303, 1456, 47800, 795, 46, 6529, 64, 574, 644, 15351, 8140, 24684, 598, 275, 32977, 3230, 22754, 13, 253, 6422, 530, 15, 52, 15, 2315, 22134, 27137, 11268, 15, 1623, 3127, 4162, 5759, 574, 6960, 247, 25186, 28398, 273, 512, 33074, 37050, 641, 13, 17905, 326, 11268, 23277, 1453, 273, 24605, 15, 1623, 2030, 4162, 13, 1740, 1897, 3622, 13, 3968, 574, 8884, 2137, 15, 733, 369, 253, 806, 673, 597, 574, 2218, 824, 247, 2181, 275, 616, 4864, 13, 7445, 2531, 6242, 15, 1583, 574, 7106, 327, 4812, 7466, 13, 574, 11371, 253, 2659, 13, 4270, 13, 14859, 285, 3715, 4491, 15, 3954, 8423, 253, 2586, 369, 3629, 253, 1979, 273, 697, 29894, 285, 697, 29401, 285, 2819, 323, 35586, 21344, 13, 347, 2080, 1977, 347, 22085, 285, 253, 22075, 15, 187, 187, 1552, 747, 8327, 323, 22684, 7466, 812, 1756, 281, 6388, 643, 25186, 9136, 13, 1014, 9643, 13, 604, 3968, 9703, 281, 1056, 352, 594, 15, 1310, 2712, 2427, 3430, 342, 436, 9883, 3416, 434, 4143, 13, 352, 812, 4354, 320, 3731, 3474, 579, 264, 407, 11268, 15, 329, 45942, 1869, 1677, 253, 1375, 273, 13909, 2439, 3060, 15, 3918, 2639, 1439, 273, 6181, 574, 644, 18111, 3901, 1740, 1107, 3622, 15, 9859, 807, 352, 574, 644, 12128, 8308, 330, 9435, 729, 284, 1448, 9893, 16078, 275, 11268, 13, 835, 253, 7217, 574, 4925, 747, 490, 5240, 569, 15, 187, 187, 3, 2993, 310, 9745, 2716, 247, 13365, 390, 594, 273, 617, 1051, 317, 311, 12742, 937, 9011, 17650, 2427, 327, 13, 347, 604, 344, 574, 417, 8344, 15946, 434, 5928, 273, 4116, 15, 187, 187, 3, 13618, 760, 6057, 752, 3686, 273, 952, 597, 403, 13, 533, 359, 1053, 626, 971, 667, 273, 731, 5339, 327, 776, 8825, 15, 309, 1353, 2119, 368, 2096, 253, 36649, 326, 651, 320, 281, 4058, 30913, 434, 7295, 15, 23498, 275, 1708, 273, 776, 2892, 342, 11268, 15, 844, 1053, 626, 971, 281, 1918, 731, 667, 38219, 323, 2137, 342, 441, 347, 973, 449, 754, 3261, 387, 15946, 9257, 13, 347, 604, 6830, 344, 574, 35039, 18280, 779, 285, 651, 320, 26337, 281, 24033, 521, 4743, 15, 187, 187, 3, 4374, 13, 8674, 937, 15946, 10017, 15, 346, 4527, 2282, 309, 2096, 15, 1680, 352, 1014, 27938, 2779, 326, 703, 651, 320, 13964, 1060, 865, 754, 2546, 253, 1953, 417, 275, 247, 5968, 273, 9209, 335, 414, 13, 533, 11525, 323, 690, 29299, 326, 352, 369, 417, 594, 15, 187, 187, 20405, 17650, 434, 2048, 47241, 247, 1652, 13, 253, 3676, 3104, 670, 521, 6208, 1679, 5460, 15, 346, 37161, 417, 937, 344, 10017, 342, 253, 14972, 273, 247, 8580, 15, 346, 1989, 8505, 436, 3416, 434, 4383, 2021, 513, 417, 23255, 273, 617, 387, 512, 15, 1500, 1669, 275, 253, 806, 1659, 689, 690, 48254, 273, 8063, 13, 594, 309, 4089, 15, 43914, 476, 320, 253, 22144, 1476, 1707, 369, 690, 25528, 275, 521, 4318, 15, 187, 187, 49, 770, 1160, 247, 1390, 3434, 281, 3693, 253, 4836, 15, 346, 42, 651, 1127, 562, 326, 9836, 7217, 310, 671, 3513, 789, 13, 8674, 13, 417, 10396, 25474, 434, 15, 844, 452, 247, 1943, 1083, 273, 9787, 45608, 486, 387, 253, 2774, 326, 4453, 347, 604, 352, 310, 5639, 11797, 15, 733, 434, 2970, 7197, 285, 556, 281, 320, 6331, 449, 187, 187, 20405, 17650, 434, 2927, 497, 6627, 285, 9479, 15, 346, 42, 717, 973, 6600, 273, 10396, 25474, 434, 7350, 15, 309, 588, 9287, 368, 326, 352, 310, 253, 1055, 327, 253, 5674, 326, 14802, 3692, 1895, 352, 310, 13, 15946, 13, 285, 368, 871, 326, 347, 973, 347, 309, 513, 15, 1310, 368, 1904, 626, 13, 2868, 479, 13, 368, 651, 417, 320, 1048, 275, 634, 1899, 449, 187, 187, 49, 770, 16481, 521, 13386, 13, 285, 7560, 16092, 15, 187, 187, 3, 4045, 359, 871, 253, 3753, 273, 436, 48254, 1561, 253, 3416, 434, 2021, 13, 8674, 865, 187, 187, 20405, 17650, 3534, 247, 4512, 439, 2371, 15, 1310, 344, 8344, 253, 1818, 275, 15946, 434, 10541, 13, 344, 369, 18144, 2217, 417, 281, 921, 352, 15, 187, 187, 3, 510, 7312, 3686, 273, 2181, 342, 47187, 19367, 13, 309, 2868, 937, 344, 10017, 13, 253, 8580, 896, 327, 521, 2454, 15, 346, 2993, 13072, 281, 17129, 253, 2872, 637, 273, 7126, 19050, 285, 19994, 13, 285, 38519, 16964, 13, 5207, 597, 574, 4236, 323, 617, 449, 187, 187, 49, 770, 12659, 326, 9011, 17650, 574, 1264, 19367, 15, 187, 187, 3, 1898, 6337, 745, 281, 11268, 285, 7028, 690, 9883, 637, 273, 7202, 1894, 285, 3164, 7202, 38408, 13, 387, 1878, 281, 36104, 571, 434, 4651, 937, 9011, 17650, 2879, 15, 346, 42, 8564, 352, 369, 34019, 281, 731, 449, 187, 187, 3, 2347, 1048, 3622, 369, 436, 865, 15946, 2546, 13, 7562, 521, 2454, 347, 2048, 1417, 347, 344, 812, 15, 3032, 1211, 6122, 13, 500, 358, 8032, 13, 369, 3809, 17682, 7875, 494, 2363, 15, 754, 1904, 626, 751, 281, 1158, 670, 352, 15, 187, 187, 3, 4013, 13, 352, 556, 644, 690, 673, 937, 9011, 17650, 10017, 43744, 2920, 15, 346, 42, 1158, 352, 310, 617, 7231, 6849, 326, 452, 1024, 509, 8055, 253, 1895, 15, 733, 5082, 626, 2647, 594, 1199, 604, 703, 4934, 731, 281, 5972, 15, 1292, 703, 556, 4447, 1633, 273, 247, 25102, 15, 14026, 617, 913, 311, 12742, 13, 347, 309, 5393, 449, 187, 187, 3, 30574, 10503, 865, 15946, 18998, 247, 2453, 281, 513, 342, 253, 8237, 6393, 13, 4931, 13, 8479, 1711, 22411, 3360, 281, 320, 12659, 15, 187, 187, 3, 40942, 417, 449, 9011, 17650, 14287, 581, 20654, 9215, 15, 346, 1147, 10693, 8213, 15, 3771, 923, 326, 642, 581, 8104, 617, 1223, 703, 310, 275, 5854, 15, 380, 19473, 703, 6505, 253, 1805, 13, 533, 9338, 285, 973, 13, 604, 368, 4496, 449, 187, 187, 49, 770, 48293, 281, 4116, 15, 346, 4374, 13, 8674, 449, 187, 187, 1128, 187, 187, 3, 8683, 39, 5236, 38336, 34, 1311, 54, 59, 865, 30752, 45, 2415, 5428, 12041, 1838, 342, 247, 5982, 9479, 2980, 273, 1600, 15, 1500, 285, 15946, 497, 7063, 407, 247, 1698, 3289, 275, 253, 1061, 3833, 13, 253, 36708, 8392, 2439, 253, 5112, 8323, 4830, 253, 10329, 15, 24059, 512, 253, 1708, 369, 4783, 432, 253, 4484, 7203, 8467, 285, 627, 369, 247, 19040, 27450, 275, 253, 2329, 15, 11067, 6933, 14, 2913, 14, 744, 500, 358, 8032, 285, 27291, 14, 2913, 14, 744, 10213, 497, 1097, 24311, 275, 616, 9956, 15, 500, 358, 8032, 651, 320, 1388, 44266, 272, 13, 390, 4028, 4876, 281, 617, 3858, 15, 10213, 651, 320, 3676, 275, 253, 27420, 273, 253, 6323, 795, 35384, 434, 20659, 21897, 3333, 187, 187, 49, 770, 18274, 3579, 285, 1691, 1529, 2412, 327, 253, 3289, 15, 733, 3534, 1679, 4250, 685, 10089, 13, 533, 344, 10490, 253, 13624, 273, 253, 19126, 5534, 15, 187, 187, 3, 11778, 368, 3735, 273, 617, 865, 344, 2546, 342, 9326, 15, 187, 187, 30419, 32567, 11373, 5777, 1881, 14, 585, 43386, 15, 346, 4374, 13, 247, 2372, 449, 187, 187, 1328, 12659, 9011, 17650, 434, 3806, 281, 247, 20565, 275, 253, 2469, 28, 344, 3260, 849, 21438, 2343, 41746, 34168, 13, 1014, 672, 352, 369, 253, 1495, 25304, 273, 5839, 15, 1500, 18029, 281, 352, 13, 533, 342, 15457, 13, 285, 247, 6293, 273, 4709, 15, 1500, 574, 2326, 1512, 1142, 273, 697, 10349, 806, 4608, 281, 1379, 11284, 275, 352, 15, 187, 187, 3, 1276, 858, 368, 4089, 865, 344, 753, 7462, 600, 15, 346, 2993, 778, 320, 275, 5434, 15, 309, 878, 281, 871, 449, 187, 187, 30419, 32567, 858, 417, 9059, 13, 534, 275, 3139, 369, 24838, 273, 247, 1027, 2238, 273, 1600, 15, 754, 5189, 4468, 275, 617, 2927, 15, 1500, 1691, 1066, 253, 36787, 703, 574, 644, 2509, 15, 187, 187, 3, 1394, 403, 1469, 281, 4017, 617, 865, 703, 2546, 1095, 8140, 15, 187, 187, 3, 42, 1849, 7922, 2652, 1504, 486, 281, 352, 937, 344, 10017, 15, 187, 187, 3, 3650, 659, 14065, 865, 1500, 369, 39340, 15, 187, 187, 3, 998, 14065, 434, 3240, 8474, 1024, 937, 344, 8042, 562, 15, 754, 858, 417, 971, 281, 320, 9479, 285, 873, 247, 9025, 875, 731, 15, 831, 7107, 7237, 3815, 342, 617, 369, 253, 1682, 629, 273, 521, 1388, 15, 7850, 6330, 43074, 42189, 281, 779, 15, 346, 1328, 556, 643, 19715, 15, 2652, 1504, 486, 310, 247, 1175, 637, 449, 187, 187, 3, 42, 1849, 3735, 36104, 571, 434, 5697, 403, 3965, 9329, 449, 1500, 369, 44520, 387, 779, 25060, 15, 187, 187, 3, 2214, 1650, 865, 187, 187, 3, 42, 1053, 626, 871, 937, 703, 8176, 13, 13383, 253, 36787, 1977, 7094, 285, 25661, 3579, 247, 1652, 15, 346, 16830, 309, 1833, 564, 285, 8028, 281, 752, 703, 556, 281, 1333, 672, 703, 23981, 15, 1500, 556, 281, 452, 625, 3289, 685, 776, 1980, 9843, 449, 21438, 2427, 281, 6105, 327, 954, 45999, 984, 703, 2335, 253, 2151, 15, 733, 369, 247, 3626, 629, 273, 15823, 281, 253, 3114, 285, 273, 1146, 7607, 15, 733, 369, 671, 253, 1682, 1659, 323, 500, 358, 8032, 285, 10213, 281, 2525, 643, 47072, 3692, 5870, 21438, 3260, 275, 247, 8489, 6832, 1039, 15, 187, 187, 7673, 2223, 685, 417, 13, 15946, 6888, 690, 17178, 7143, 11358, 327, 45999, 15, 187, 187, 49, 770, 11522, 4345, 13, 533, 344, 369, 2080, 625, 9680, 273, 247, 9479, 3541, 22213, 275, 521, 2564, 15, 3032, 3101, 574, 2668, 779, 281, 253, 25024, 6105, 327, 253, 5024, 273, 253, 8304, 1046, 6926, 273, 521, 11948, 15, 754, 812, 1335, 5406, 253, 13755, 84, 273, 18010, 1708, 1499 ]
. Unfortunately she has been rather too free in expressing them." "It's a police problem," Pitt said tersely. "I doubt anyone here will care enough to argue with her, let alone cause a nuisance. But if they do, then the local police can take care of it." Sir Walter sighed, as if this was a tedious argument. "Pitt, this is not a suggestion. You may think that many people are apathetic as to the exact details of religious doctrine, and only deeply committed Christians will argue with her—and even if they do, you trust that they at least know how to behave within the law." He raised white eyebrows. "If so, you are a fool. Some men will argue more passionately about religion than anything else on earth. To many, religion represents order, sanity, the inevitable victory of good over evil. It confirms to them their place in creation." He smiled bleakly. "Somewhere near the top. The appearance of modesty forbids the very top. Something has to be held back for God." His smile faded and his eyes were grim. "But say something to threaten that place near the top, and you threaten everything." He shook his head. "For God's sake, man, look at how religion has torn us apart throughout history. Start with the Crusades, and the Inquisition in Spain, the persecution of the Cathars and Waldenses in the rest of Europe, the massacres of the Huguenots in France. We've burned both Catholics and Protestants ourselves. You think it couldn't happen again? If Dreyfus were not a Jew, do you think this whole monstrous affair would ever have started, never mind reached this proportion?" Pitt drew breath to argue, and found the words frozen on his tongue. It was barely the end of April. Earlier in the month President McKinley had asked the U.S. Congress for a declaration of war against Spain. Cuba had been seeking independence from Spain for many years, and the United States had begun to intervene in the dispute, seeing an opportunity to gain power and position. When the battleship USS _Maine_ had been mysteriously blown up in Havana harbor, the powerful U.S. press openly blamed Spain. On 21 April Congress had ordered a naval blockade of all Cuban harbors, demanding that Spain surrender control of Cuba. On 25 April, four days ago, America had declared war. It was the first time they had done such a thing in their brief, idealistic existence. They had focused on internal expansion, had settled the land, built, explored and developed industry. Now suddenly the country was increasing the size of its armies and its navy and looking for possessions overseas, as far away as Hawaii and the Philippines. This new desire for outward expansion could grow to involve other naval powers, even Britain, if America chose to make it so. If anything went wrong with this Spanish woman's visit, it could easily be misconstrued by Spain. A chilling thought given the state of affairs across Europe. President Carnot of France had been assassinated four years ago. Last year it had been Prime Minister Cánovas del Castillo in Spain, where the violence had reached new abominations. "She is bringing half a dozen or so of her...acolytes," Sir Walter went on, as if he had not noticed Pitt's absence of attention. "God only knows what sort of people they are, but we don't want any of them killed on our soil. I'm sure you understand the embarrassment that would be to Her Majesty's Government. Especially in light of our history with Spain. We don't want to give them any excuses for war with us as well." He looked at Pitt carefully, as if possibly he had overestimated him and would be obliged to reconsider his opinion. "Yes, sir," Pitt replied. "Of course I understand. Is it even remotely likely that she would be attacked here?" He asked the question not in a spirit of incredulity, but hoping for some assurance that it was not so. Sir Walter's expression eased a little, the deep lines about his mouth less severe. "Probably not," he replied with the ghost of a smile. "But apparently this woman's English family do not approve of her at all. She left in the first place over some quarrel of principle, so I hear. Families can be the devil!" There was some sympathy in his voice. Pitt made a last effort to avoid the task. "I would point out that domestic violence is also police work, sir, not Special Branch's. We have a big case of industrial sabotage at the moment that looks as if it is foreign inspired. It's getting worse and has to be stopped." Sir Walter's eyes were bright and sharp. "I am well aware of Special Branch's concerns. I will remind you that it is the effect on the nation that determines whose problem it is, Pitt, and you know that as well as I do. If you didn't, believe me, you would not be long in your position." Pitt cleared his throat, and spoke quietly. "Do we know the nature of this quarrel within the woman's family, sir?" Sir Walter gave a slight shrug. If he noticed the change in Pitt's tone, he was sophisticated enough not to show it. "The usual sort of thing with willful daughters, I believe," he replied, the smile back on his face. "She declined to marry the young man of excellent breeding and fortune, and tedious habits, whom they had selected for her." Pitt remembered that Sir Walter had three daughters. "And ran off to Spain and married some Spanish man of unknown character and probably unknown ancestry, at least to Sofia's parents," Sir Walter added. "I imagine it was embarrassing to them." "How long ago was this?" Pitt asked, keeping his face as expressionless as he could. His own daughter, Jemima, was fast approaching marriageable age. He didn't like to think about it. "Oh, it has been some time," Sir Walter replied ruefully. "I think it is her religious views that have now compounded the problem. It wouldn't matter so much if she kept them to herself. But she has formed something of a sect. Has her acolytes, as I mentioned." "Roman Catholic?" Pitt imagined a cult to do with the Virgin Mary, perhaps, causing old persecutions to be remembered. "Apparently not." Sir Walter lifted one elegant shoulder. "It hardly matters. Just see that no one attacks her while she is in England. The sooner she leaves the better, but alive and well, if you please." Pitt straightened to attention. "Yes, sir." — "SOFIA DELACRUZ?" CHARLOTTE SAID with a sudden sharpening of interest. She and Pitt were sitting by a low fire in the parlor, the curtains drawn across the French windows onto the garden. Almost all the light was gone from the cool spring sky and there was a definite chill in the air. Sixteen-year-old Jemima and thirteen-year-old Daniel were both upstairs in their rooms. Jemima would be daydreaming, or writing letters to her friends. Daniel would be deep in the adventures of the latest _Boy's Own Paper._ Pitt leaned forward and put another log on the fire. It gave less heat than coal, but he liked the smell of the apple wood. "Have you heard of her?" he asked with surprise. Charlotte smiled slightly self-consciously. "Yes, a bit." He remembered Sir Walter's reference to a scandal in the past; he knew how Charlotte loathed gossip, even when it was the lifeblood of investigation. She listened to it, but with guilt, and a thread of fear. She had seen too many of its victims firsthand to take pleasure in it. "What did you hear?" he said gravely. "She may be in danger. I need to know." Charlotte did not argue, which in itself was indicative of a different kind of interest. He detected concern in her eyes. She put down the sewing she had been doing. "You are going to protect her?" she asked curiously. "I've assigned Brundage to it," he replied. "Not Stoker?" She was puzzled. "Stoker's quite senior now," he pointed out. He did not want to be sharp and set a division between them. This quiet evening alone with her was the best part of his day. Its peace mattered intensely to him. "He has other responsibilities. Brundage is a good man." "I've heard Sofia's ideas are pretty radical." She was gazing at him steadily. "For example?" "I don't know," she admitted, pushing the sewing away entirely and leaning forward a little. "Perhaps I'll go and listen to what she has to say when she arrives. She has to have more fire than our local minister." Charlotte went to church on most Sundays because she took the children. It was a natural part of belonging to the community and of being accepted. It was also the best place for Jemima and Daniel to meet other youths whose families Charlotte knew in a somewhat substantial way. More often than not, Pitt discovered some pressing duty elsewhere on Sundays. Pitt nodded agreement, but he was far more conscious of a sharp memory stirring in his mind. His mother had taken him to the parish church on the edge of the estate every Sunday of his childhood. He could still picture the shafts of colored light sl
[ 44373, 275, 253, 3563, 2802, 2270, 84, 347, 581, 2716, 273, 253, 639, 26817, 14, 5367, 1999, 1753, 2269, 410, 769, 378, 2682, 708, 18630, 15, 187, 187, 1628, 1147, 369, 619, 806, 323, 333, 715, 4028, 619, 1211, 3440, 1806, 378, 2682, 17602, 15, 773, 42675, 285, 309, 574, 1313, 387, 8534, 2143, 15, 1500, 285, 309, 497, 751, 247, 19776, 672, 359, 1313, 15, 844, 816, 18319, 4802, 285, 812, 1007, 275, 1016, 643, 457, 84, 2927, 285, 1056, 598, 247, 4498, 15, 1893, 359, 497, 4715, 281, 39741, 436, 2238, 273, 4956, 1132, 1425, 187, 187, 510, 4667, 651, 6524, 2831, 11865, 342, 743, 74, 6129, 4604, 26798, 13, 20437, 767, 16258, 327, 6129, 4604, 26798, 457, 84, 10154, 22953, 378, 12424, 15648, 15, 1292, 352, 369, 253, 32458, 457, 84, 806, 5400, 13, 253, 40308, 4197, 773, 1276, 457, 84, 2064, 3774, 437, 668, 326, 651, 4711, 616, 11118, 3540, 13, 285, 253, 4498, 326, 651, 564, 327, 281, 2489, 253, 458, 262, 24013, 338, 275, 378, 2682, 457, 84, 5249, 27, 247, 30108, 1981, 13, 1218, 1028, 528, 13, 32411, 49689, 1925, 773, 49, 25646, 3083, 338, 22055, 1425, 187, 187, 1628, 42, 4159, 11126, 49, 25646, 3083, 338, 22055, 15440, 275, 8065, 1806, 703, 17602, 15, 773, 42, 1869, 13, 2802, 17833, 13, 436, 310, 14793, 1024, 13, 533, 352, 457, 84, 417, 1469, 281, 320, 14793, 11654, 9027, 1292, 352, 42575, 15, 309, 457, 306, 1014, 3597, 281, 3553, 2802, 49, 25646, 3083, 338, 22055, 457, 3212, 323, 247, 1223, 15, 1707, 497, 247, 1643, 2722, 835, 309, 3597, 417, 281, 1132, 352, 13, 285, 952, 497, 39309, 15, 6491, 15, 27200, 15, 367, 739, 264, 1425, 187, 187, 510, 3540, 285, 697, 689, 50238, 16876, 452, 4783, 327, 281, 15498, 366, 378, 2682, 457, 84, 3440, 13, 1014, 347, 703, 457, 84, 4783, 275, 10746, 2080, 247, 3423, 273, 835, 378, 2682, 708, 18630, 3053, 562, 15, 831, 310, 8943, 275, 617, 747, 2199, 13, 247, 7163, 3341, 4640, 14, 9576, 32458, 1925, 8728, 16319, 15, 187, 187, 1628, 42, 651, 1333, 326, 342, 8728, 16319, 13, 309, 457, 78, 1469, 896, 281, 13872, 4266, 2238, 273, 39278, 1132, 1806, 703, 5544, 15, 773, 42, 1053, 457, 85, 452, 253, 3473, 273, 4028, 1046, 2014, 1386, 273, 3440, 751, 309, 858, 275, 253, 2469, 15, 1707, 457, 84, 247, 7185, 281, 326, 15, 309, 457, 78, 2444, 342, 27125, 326, 313, 14641, 2735, 1080, 19669, 8174, 20120, 455, 15354, 10, 574, 1160, 15, 309, 457, 69, 1620, 2668, 247, 7171, 285, 3542, 247, 4498, 1475, 352, 1425, 187, 187, 1989, 1014, 1060, 13, 275, 247, 2199, 326, 7835, 751, 2717, 703, 457, 84, 2218, 275, 253, 2469, 13, 253, 49689, 4852, 27, 8728, 16319, 457, 84, 806, 2014, 13, 253, 39730, 689, 17477, 773, 42, 67, 484, 287, 25947, 1806, 3386, 247, 19501, 326, 3797, 247, 1386, 432, 773, 49, 25646, 3083, 338, 22055, 1425, 187, 187, 35, 2682, 11359, 10884, 281, 253, 3540, 323, 1199, 253, 1072, 1921, 326, 617, 7458, 476, 457, 85, 3553, 352, 3815, 15, 380, 3935, 3249, 432, 247, 1659, 273, 49952, 15, 1244, 49952, 457, 84, 247, 5147, 326, 378, 2682, 9010, 5435, 3341, 762, 9576, 2907, 13, 5747, 253, 1655, 13627, 273, 21917, 5547, 5343, 10846, 15, 187, 187, 1628, 42, 1335, 1053, 457, 85, 1158, 326, 359, 452, 247, 2257, 273, 2255, 16115, 670, 3192, 689, 616, 1211, 1612, 1806, 703, 16519, 592, 15, 773, 2598, 326, 457, 84, 752, 309, 457, 306, 644, 2509, 1425, 15173, 187, 187, 1779, 324, 11276, 310, 271, 5722, 14, 23166, 3668, 17264, 285, 3440, 8406, 432, 3666, 6956, 1100, 15, 510, 30449, 7558, 39580, 12167, 17771, 745, 5172, 1564, 432, 253, 46174, 1032, 15, 2064, 457, 84, 253, 495, 14, 1012, 46174, 1032, 665, 574, 253, 8840, 14755, 8399, 275, 253, 13946, 15, 1583, 497, 512, 253, 1039, 598, 387, 4562, 296, 275, 11433, 13, 594, 359, 452, 281, 1918, 731, 6152, 323, 326, 15, 187, 187, 6300, 752, 253, 36603, 497, 253, 30449, 4680, 32, 187, 187, 1552, 310, 253, 38656, 309, 457, 306, 14494, 432, 247, 1643, 952, 15, 1244, 309, 476, 923, 835, 597, 403, 3551, 432, 15, 1292, 436, 310, 835, 3634, 310, 594, 9560, 15, 187, 187, 510, 500, 3544, 760, 4934, 767, 1165, 13858, 327, 253, 22970, 1390, 807, 15, 1583, 574, 17771, 327, 616, 3946, 13487, 15, 1583, 760, 452, 767, 1165, 13858, 327, 253, 22970, 436, 807, 15, 309, 1158, 17771, 651, 452, 644, 616, 4327, 323, 253, 3946, 13487, 13, 533, 253, 30449, 7558, 779, 13, 13538, 326, 432, 9369, 15, 187, 187, 18968, 4448, 588, 320, 253, 1852, 20, 39580, 275, 6778, 314, 15, 754, 369, 1469, 281, 320, 253, 1852, 20, 39580, 275, 46066, 15, 380, 3064, 310, 326, 253, 30449, 1978, 253, 1852, 20, 39580, 327, 253, 22970, 15, 380, 500, 3544, 1379, 253, 2495, 273, 1907, 326, 39580, 327, 253, 3946, 13487, 13, 835, 253, 643, 4562, 6671, 476, 861, 779, 313, 263, 1611, 281, 861, 779, 481, 187, 187, 1552, 3548, 457, 85, 253, 30449, 8577, 281, 46066, 281, 8415, 690, 2234, 629, 273, 253, 8399, 15, 380, 500, 3544, 574, 247, 21220, 13, 533, 33657, 2872, 39580, 285, 597, 2335, 247, 2495, 407, 9968, 779, 15, 380, 30449, 16470, 779, 984, 597, 751, 521, 12816, 285, 521, 2442, 15, 15999, 1633, 4566, 1077, 3430, 13, 17771, 588, 6947, 253, 807, 2444, 275, 3946, 13, 533, 326, 457, 84, 352, 15, 754, 3548, 457, 85, 2779, 281, 923, 253, 1673, 436, 2952, 15, 187, 187, 8116, 275, 5307, 253, 30449, 16470, 247, 29938, 28018, 2624, 407, 253, 37911, 13, 665, 497, 3551, 745, 247, 721, 14, 740, 2952, 15, 2064, 369, 27104, 16156, 285, 344, 7402, 598, 4983, 275, 6778, 314, 323, 1107, 15, 754, 760, 4546, 275, 581, 2165, 275, 5307, 15, 754, 369, 247, 17119, 275, 6585, 15, 754, 574, 247, 2740, 483, 2952, 275, 6752, 285, 3053, 323, 253, 1735, 2620, 12396, 15, 21130, 29038, 3047, 247, 4839, 281, 823, 247, 2872, 13, 21220, 4760, 15, 754, 369, 3110, 285, 1841, 4307, 562, 973, 15, 11239, 7122, 29038, 1904, 457, 85, 452, 253, 38656, 326, 773, 6080, 8034, 19500, 2285, 816, 2624, 326, 29938, 594, 344, 1364, 320, 247, 47274, 6598, 187, 187, 1231, 452, 642, 2934, 1880, 17771, 588, 320, 275, 6778, 314, 323, 2620, 3618, 390, 2620, 1107, 15, 754, 1537, 5276, 281, 320, 247, 27531, 1077, 4541, 15, 2207, 344, 1537, 1287, 689, 673, 15, 9541, 310, 6898, 342, 2119, 14, 1597, 1165, 13858, 665, 4242, 285, 643, 6068, 665, 497, 3302, 20101, 326, 3531, 715, 1633, 15, 13168, 1014, 1270, 3773, 15, 187, 187, 8732, 5134, 16062, 284, 369, 2624, 407, 253, 47732, 15, 754, 6524, 6704, 342, 253, 2065, 1641, 285, 2427, 327, 281, 2489, 25711, 253, 6459, 39580, 273, 512, 673, 15, 18077, 42890, 369, 671, 2624, 407, 253, 47732, 15, 754, 3977, 253, 40839, 281, 247, 6053, 19466, 4060, 15, 32211, 24324, 3597, 562, 323, 253, 43290, 275, 9354, 13, 533, 1694, 2624, 15, 754, 840, 4546, 23192, 9728, 5842, 323, 767, 1107, 15, 24324, 17847, 253, 34105, 2217, 281, 755, 247, 1611, 483, 13, 533, 344, 369, 8513, 285, 9829, 352, 15, 25010, 253, 31849, 3534, 779, 247, 1611, 483, 275, 8065, 285, 6704, 779, 15, 380, 1551, 310, 2892, 15, 187, 187, 8469, 656, 751, 16062, 284, 13, 42890, 285, 24324, 403, 31101, 15, 5595, 6068, 665, 755, 2624, 1053, 457, 85, 3199, 562, 15, 1583, 497, 2624, 323, 247, 1921, 15, 17771, 3548, 457, 85, 2779, 281, 1287, 715, 2712, 625, 685, 247, 17119, 13, 285, 1014, 326, 310, 3164, 247, 1048, 5103, 15, 380, 1127, 310, 326, 368, 476, 457, 85, 3365, 1333, 773, 1552, 5599, 1694, 2624, 407, 247, 8034, 19500, 2285, 15, 754, 331, 3106, 15, 1737, 253, 36603, 497, 253, 30449, 4680, 7721, 187, 187, 1466, 457, 84, 2312, 670, 17771, 15, 754, 369, 247, 495, 14, 7873, 12438, 326, 2427, 281, 16146, 15, 754, 369, 247, 2372, 17433, 1025, 3551, 562, 273, 1029, 2143, 13, 16485, 387, 721, 14, 19, 13, 25384, 15, 754, 369, 2783, 247, 8746, 14, 26039, 39580, 13, 4495, 344, 812, 1408, 285, 4710, 15, 17771, 1694, 281, 16146, 342, 247, 2372, 273, 247, 11291, 327, 521, 9215, 285, 4307, 1892, 281, 1287, 347, 247, 4760, 15, 187, 187, 1328, 310, 1024, 721, 14, 19, 285, 23917, 12511, 15, 754, 6337, 577, 15, 3571, 387, 253, 46752, 594, 344, 556, 1175, 4951, 14, 42338, 3885, 15, 17771, 2427, 281, 253, 33665, 11271, 272, 11417, 1078, 521, 17696, 2952, 387, 16146, 285, 1912, 253, 6936, 7324, 15, 3900, 627, 13, 344, 1694, 253, 4116, 273, 690, 952, 15, 187, 187, 18765, 13946, 10701, 457, 84, 10035, 2552, 825, 1925, 3729, 9756, 457, 84, 15341, 79, 12751, 1216, 253, 954, 29422, 22385, 627, 13, 344, 753, 17771, 369, 773, 783, 5599, 309, 1663, 4264, 15, 754, 13222, 247, 5389, 5842, 15, 754, 457, 84, 1694, 247, 1943, 4430, 15, 12167, 17771, 556, 1270, 17823, 15, 1422, 476, 923, 344, 556, 1663, 644, 3715, 973, 253, 1390, 4564, 273, 1107, 1425, 187, 187, 47, 4639, 15, 681, 457, 84, 378, 12202, 26066, 753, 17771, 773, 22732, 320, 253, 954, 21220, 22385, 275, 6831, 5842, 1806, 285, 326, 344, 773, 1033, 968, 253, 4023, 342, 18714, 7602, 285, 23367, 1223, 4645, 247, 372, 649, 5181, 327, 10444, 285, 3676, 11999, 15, 5595, 21097, 1242, 13, 344, 310, 18649, 7899, 13, 7032, 273, 2403, 45661, 12326, 281, 1046, 2170, 273, 253, 1673, 15, 754, 12646, 34303, 30513, 13, 11891, 285, 11795, 275, 253, 11320, 1425, 187, 187, 5529, 8690, 1219, 15790, 753, 17771, 476, 4710, 253, 4023, 387, 1878, 7251, 11433, 275, 253, 2329, 15, 187, 187, 31840, 275, 521, 5249, 13, 17771, 369, 594, 440, 37411, 326, 31907, 4571, 457, 85, 4089, 779, 275, 253, 288, 38226, 15, 754, 4229, 326, 407, 25815, 275, 253, 11472, 15, 3954, 13, 773, 42, 3698, 12167, 2312, 285, 717, 31597, 407, 521, 29791, 1806, 15790, 753, 15, 187, 187, 18968, 4448, 574, 271, 598, 285, 1066, 5249, 387, 16146, 15, 754, 3053, 2620, 3958, 275, 521, 806, 767, 1107, 285, 2692, 1524, 9023, 15, 754, 840, 3053, 347, 247, 25418, 285, 4546, 1077, 973, 15, 3032, 17696, 2952, 858, 417, 564, 347, 13937, 15, 17771, 3663, 521, 13413, 30468, 281, 253, 13946, 15, 3032, 1755, 18887, 1694, 8513, 387, 4260, 13263, 15, 1893, 858, 521, 26783, 15, 17771, 369, 10620, 342, 690, 295, 29191, 9478, 15, 754, 1335, 1691, 598, 8261, 3904, 13, 533, 344, 816, 3589, 457, 85, 13943, 15, 187, 187, 4041, 2181, 326, 8513, 17771, 1309, 521, 5249, 369, 21855, 2544, 15, 754, 4546, 323, 1264, 1027, 473, 6072, 15, 3105, 760, 326, 13, 597, 574, 1077, 1027, 5697, 15, 4744, 1536, 33687, 369, 271, 5662, 5599, 342, 271, 13946, 4114, 15, 45490, 69, 401, 17291, 369, 247, 2872, 5599, 342, 247, 6831, 285, 354, 4114, 15, 6610, 627, 369, 5490, 16809, 90, 13, 665, 2210, 689, 432, 7758, 2418, 15, 4155, 2544, 8513, 247, 4760, 457, 84, 3745, 281, 1287, 15, 17771, 6699, 521, 5249, 342, 7584, 308, 19277, 13, 1884, 26191, 84, 13, 818, 33608, 11433, 285, 247, 12240, 7155, 273, 8988, 15, 26, 15, 2064, 457, 84, 247, 1175, 6831, 5249, 13, 533, 2717, 323, 253, 2892, 5098, 15, 187, 187, 2512, 497, 9506, 273, 43703, 15, 17771, 873, 253, 20413, 1924, 323, 8136, 11433, 275, 247, 2165, 342, 608, 2526, 15, 9423, 562, 253, 2457, 1132, 432, 326, 2165, 15, 187, 187, 1552, 3589, 457, 85, 253, 760, 577, 394, 7150, 13, 2165, 9880, 24246, 273, 521, 5249, 15, 17771, 1904, 457, 85, 1132, 327, 11360, 16146, 6671, 594, 344, 24586, 849, 281, 1132, 275, 2810, 2165, 285, 281, 1421, 521, 2285, 432, 3212, 15, 187, 187, 8457, 273, 521, 16706, 5249, 285, 17696, 2952, 13, 17771, 3589, 457, 85, 22390, 15, 754, 6704, 342, 253, 46174, 1032, 13, 835, 344, 369, 27135, 959, 342, 45490, 69, 401, 17291, 13, 665, 574, 2489, 253, 27202, 273, 253, 500, 3544, 15, 187, 187, 18968, 4448, 1904, 457, 85, 1132, 1199, 436, 46667, 15, 380, 500, 3544, 452, 247, 2872, 26023, 275, 27773, 378, 430, 868, 285, 344, 1694, 247, 2257, 273 ]
prominence in the late ‘90s as one half of the aggro-poetic queercore act Bitch & Animal. “It was my first foray into writing my own music,” Bitch recalled. “Animal and I had met at acting school. She and I were like a combustion when we met. We just instantly connected and could look in each other’s eyes and make up a song. So we were learning to hone this kind of wild play.” The pair would eventually cross paths with Ani DiFranco, releasing two albums on DiFranco’s Righteous Babe Records. But it was the duo’s first album, the indie produced “What’s That Smell” that would produce their signature track, and the song that would go on to become the leitmotif in Bitch’s career: a sprawling, raucous, feminist anthem called “Pussy Manifesto.” “I wrote (“Pussy Manifesto”) in 1998,” she recalled. “I thought, ‘Sure, this is timely now, but it’s not going to be timely forever.’ But it persists. I’ve even tried to leave ‘Pussy Manifesto’ behind for a while. There were a few shows where I tried not to play it, and people were pissed. People. Were. Pissed.” The track and its overarching themes have gone on to permeate Bitch’s music, even as she’s gone in directions far afield of where Bitch & Animal started out. This is evident in her new project, a nominally electro-pop duo called BEACH. “I would say that with BEACH, I’m going back to letting myself kind of radically play,” she explained. “I don’t have the pressure of writing every single line of music like I did in the past. There’s a freedom to that. I’m working with beats that (collaborator Billy Jo Cavallaro) had made. I’d never taken a beat and written a song around it.” But even here, in a project that sounds like nothing she’s done in the past, the anthem lives: BEACH’s first single, the aggressively overdriven “Ibuprofen,” features a breakdown that includes a line from “Pussy Manifesto.” Bitch keeps returning to the track for much the same reason that her fans can’t leave it alone. The message comes from a place of empowerment. And empowerment’s a platform that Bitch finds criminally underpopulated, despite the current glut of commercially successful female artists. “I still don’t think that we have a lot of women singing about taking over their own power,” she laments. “So that’s what I’ve been doing.” CV Chad Taylor is an award-winning news journalist and music writer from Des Moines.The Eagles claimed QB Stephen Morris off waivers from the Jaguars. That’s the 3-13 Jaguars who had the lowest scoring offense in the NFL. They were all the way up at 31st in yards, so we have to give them credit for that. Just what the heck were the Eagles thinking? This is the mentality I’ve encountered from a few people. And I can see where they are coming from. But this is where context is so crucial. The Jags only kept two QBs on the roster last year. They had Morris on their practice squad. They only have two QBs on the roster this year. I think Morris would have been their choice for the practice squad, but the Eagles claimed him, preventing that from happening. Morris will be the #3 QB in Philly. He was going to be the #3 QB in Jacksonville. The difference is that the Eagles keep the #3 QB on the roster. The Jags take the risk of having that QB on the practice squad, where the other 31 teams can sign him (or try to sign him). This isn’t the Eagles turning to Jacksonville to solve some key part of the offense. The Jags had a talented, but flawed young QB and they took a risk by cutting him. The Eagles grabbed him because they like his talent and his potential. Unless something goes very wrong, Morris will spend the year working in practice, but that’s it. He isn’t likely to see the field this season. Back in 2000 the Eagles grabbed a rookie DT cut by the Cardinals, who were coming off a 6-10 season. That was Darwin Walker and he ended up starting in Philly for years. He only played in one game in 2000. He was a backup in 2001. He had a breakout season in 2002 and started for the next five seasons. Andy Reid saw a chance to add a young, talented player. He was patient and things worked out well. Thank god Reid didn’t have the mentality that “Some crappy team just cut that rookie so he must be a bum”. We have no idea whether Morris will be in Philly for five weeks or five years. He might prove to be a disappointment very quickly. Or he might develop over time. History is filled with sure-thing QBs who failed and other guys who were initial failures that turned into something. Sometimes even great players. Johnny Unitas was cut by the Steelers. He eventually signed with the Colts and went on to become arguably the greatest QB of all time. Lin Dawson was also cut by the Steelers. He led the Chiefs to a Super Bowl title. Kurt Warner tried out for the Packers in 1994, but got cut. He then played arena league football for two years. Warner impressed the Bears enough to get a tryout, but he was hurt and missed it. Eventually the Rams gave him a tryout in 1998 and signed him. The rest is history. Guys like Unitas, Dawson and Warner are anomalies. Most guys who get cut don’t pan out. They were cut for a reason. Morris isn’t likely to develop into anything more than a backup, and even that is probably a long shot. The point is that you can’t simply say “This guy got cut by a crappy team. He stinks. What the heck were the Eagles thinking?” Let’s talk about Morris. He was a 3-star recruit that went to Miami. He was a bit undersized coming out of high school, listing at 6-2, 186. He was considered a dual-threat QB, meaning he could run and throw. Morris got to Miami with a bit of a chip on his shoulder and worked hard to develop as a player. He is now 6-2 and 215 pounds. He ran 4.63 at the Combine so he has good straight-ahead speed. Morris went to the Manning Passing Academy before his Senior season at Miami and won the skills competition. While there, he got the attention of some people. Though NFL Network’s Mike Mayock called North Carolina’s Bryn Renner the most polished quarterback there, he said Morris was “the guy I really enjoy. He threw a beautiful football. He’s got a big arm. Stephen Morris has great mechanics. You can see he has really been developed well the last couple of years.” NFL.com’s Bucky Brooks said Morris “might be the most talented quarterback in college football,” and that he “spins the ball with exceptional velocity and zip while showing a deft touch on intermediate and deep passes. Most impressively, he is deadly accurate, capable of making pinpoint throws to every area of the field. He displays terrific anticipation, awareness and timing in the pocket.” UM coach Al Golden said Morris can throw the ball at least 65 yards in the air. Earlier in his career, Morris was so unassuming that teammates couldn’t hear him in the huddle. He fixed that by practicing in the mirror. Now, “I watch Stephen talk and am amazed by his maturity,” Golden said. Morris had an up and down career at Miami. He started five games in his first two years and showed real promise. He then started as a Junior and played very well. His Senior season did not go as hoped. Morris lost his offensive coordinator to the NFL. His top WR got hurt at midseason. So did his RB. Morris was dealing with some nagging injuries. He still put up okay numbers, but he just wasn’t impressive. One thing that hurt Morris during his career was coaching changes. He played for three different OCs. Not only that, they had very different ideas. Mark Whipple was an older guy with an NFL background. Jedd Fisch was a young guy with a college and pro background. Finally there was James Coley, who came over from Florida State. System changes hurt a player’s ability to develop. Morris finished his career with 49 TDs, 30 INTs, 7896 yards and a completion percentage of 57.9. That’s a good college career, but nothing for the history books. There were moments of greatness. Morris set the ACC record for passing yards in a game with 566. Check out the final play from that game. This wasn’t the only 4th quarter, game winning TD of his career. Morris didn’t play on dominant Miami teams so he understands how to play in close game and to lead his team from behind. Because of his inconsistent career and Senior season, Morris wasn’t drafted. He signed with the Jaguars, where he was reunited with Jedd Fisch, who had become the OC of the Jags. Morris didn’t play much this preseason. The Jags have a young starter in Blake Bortles and he got a lot of
[ 31035, 22, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1671, 2082, 1671, 1525, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 76, 10614, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 30838, 31035, 22, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 348, 1596, 5200, 5246, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1012, 2759, 1839, 2358, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 348, 1596, 5200, 5246, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 348, 1596, 5200, 5246, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 34, 336, 29285, 3696, 429, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 12115, 520, 23558, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 34, 336, 29285, 3696, 429, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 34, 336, 29285, 3696, 429, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26497, 375, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 20, 11494, 23185, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 3233, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 26497, 375, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 44, 1830, 6955, 251, 57, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 24117, 2251, 1857, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 16800, 109, 28610, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 44, 1830, 6955, 251, 57, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50276, 870, 1206, 31, 187, 50276, 29, 1206, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 69, 360, 965, 86, 520, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 805, 3071, 520, 1976, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 69, 360, 965, 86, 520, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 69, 360, 965, 86, 520, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 12408, 1031, 9204, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1047, 11124, 3507, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 12408, 1031, 9204, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 12408, 1031, 9204, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 864, 610, 14906, 19, 14340, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 6903, 3566, 20070, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 864, 610, 14906, 19, 14340, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 864, 610, 14906, 19, 14340, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 20409, 82, 11489, 640, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1012, 26673, 1047, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 20409, 82, 11489, 640, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 20409, 82, 11489, 640, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 18269, 56, 1830, 44, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 17, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 3011, 24117, 2597, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 25192, 88, 1886, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 18269, 56, 1830, 44, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 936, 834, 543, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 35630, 18962, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 28777, 606, 775, 9041, 53, 543, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 936, 834, 543, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 20122, 543, 89, 9041, 10683, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 10655, 1012, 39338, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 510, 7211, 273, 11700, 22318, 2033, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 20122, 543, 89, 9041, 10683, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50276, 870, 1206, 31, 187, 50276, 29, 1206, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 40305, 89, 27475, 249, 3031, 938, 28879, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1717, 8897, 23292, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 40305, 89, 27475, 249, 3031, 938, 28879, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 40305, 89, 27475, 249, 3031, 938, 28879, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 12432, 8125, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 19, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 17391, 883, 29185, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 12432, 8125, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 12432, 8125, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 2413, 1358, 7280, 15, 681, 16, 37, 13659, 46, 8500, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 20, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 1010, 21345, 20487, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 37, 13659, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 37, 13659, 46, 8500, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 2413, 1358, 9198, 15, 6113, 17915, 15, 3024, 16, 263, 2134, 965, 86, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 23292, 2251, 2950, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 263, 2134, 965, 86, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 263, 2134, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 13804, 4805, 36378, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 17271, 4590, 19603, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 13804, 4805, 36378, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 13804, 4805, 36378, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 52, 10320, 6104, 1312, 5264, 8428, 6740, 568, 3614, 1358, 47476, 1032, 18, 15, 7280, 4537, 6071, 15, 681, 16, 86, 16, 24, 1706, 2537, 1797, 32, 87, 30, 21, 3, 4871, 568, 2313, 3498, 16352, 6945, 20679, 16, 2730, 1288, 19884, 2377, 2730, 67, 31, 17448, 46, 272, 8020, 870, 67, 3073, 2377, 3073, 66, 2730, 1288, 19884, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 52, 10320, 6104, 1312, 3, 4060, 568, 6124, 1138, 14931, 229, 121, 870, 66, 31, 654, 66, 3860, 568, 3614, 1358, 7280, 15, 681, 16, 26209, 2184, 16, 6170, 16, 2823, 953, 32, 7582, 30, 52, 10320, 6104, 1312, 3, 4060, 568, 14500, 318, 1138, 14931, 230, 233, 870, 66, 3073, 2851, 31, 187, 50274, 29, 2851, 8495, 568, 9229, 5264, 66, 3860, 568, 3614, 1358 ]
hao5"><img src="https://avatars3.githubusercontent.com/u/35653599?v=4" width="100px;" alt=""/><br /><sub><b>kenny</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=yuhao5" title="Code">💻</a></td> <td align="center"><a href="https://github.com/charnlsxy"><img src="https://avatars2.githubusercontent.com/u/13843868?v=4" width="100px;" alt=""/><br /><sub><b>charnlsxy</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=charnlsxy" title="Code">💻</a></td> <td align="center"><a href="https://github.com/AceDarkknight"><img src="https://avatars3.githubusercontent.com/u/11901298?v=4" width="100px;" alt=""/><br /><sub><b>AceDarkknight</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=AceDarkknight" title="Code">💻</a></td> <td align="center"><a href="https://github.com/gnuos"><img src="https://avatars2.githubusercontent.com/u/3014297?v=4" width="100px;" alt=""/><br /><sub><b>Data</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=gnuos" title="Code">💻</a></td> <td align="center"><a href="https://github.com/KISSMonX"><img src="https://avatars0.githubusercontent.com/u/2876745?v=4" width="100px;" alt=""/><br /><sub><b>侯名</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=KISSMonX" title="Code">💻</a></td> </tr> <tr> <td align="center"><a href="https://github.com/dumliu01"><img src="https://avatars0.githubusercontent.com/u/12060175?v=4" width="100px;" alt=""/><br /><sub><b>dumliu01</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=dumliu01" title="Code">💻</a></td> <td align="center"><a href="https://github.com/hlily2005"><img src="https://avatars0.githubusercontent.com/u/1411282?v=4" width="100px;" alt=""/><br /><sub><b>hlily2005</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=hlily2005" title="Code">💻</a></td> <td align="center"><a href="https://github.com/henrylee2cn"><img src="https://avatars3.githubusercontent.com/u/10174178?v=4" width="100px;" alt=""/><br /><sub><b>henrylee2cn</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=henrylee2cn" title="Code">💻</a></td> <td align="center"><a href="https://github.com/shaqsnake"><img src="https://avatars0.githubusercontent.com/u/1336914?v=4" width="100px;" alt=""/><br /><sub><b>shaqsnake</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=shaqsnake" title="Code">💻</a></td> <td align="center"><a href="https://github.com/TBWISK"><img src="https://avatars0.githubusercontent.com/u/5728787?v=4" width="100px;" alt=""/><br /><sub><b>tbwisk</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=TBWISK" title="Code">💻</a></td> <td align="center"><a href="https://github.com/toontong"><img src="https://avatars3.githubusercontent.com/u/416141?v=4" width="100px;" alt=""/><br /><sub><b>Huang ChuanTong</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=toontong" title="Code">💻</a></td> <td align="center"><a href="https://github.com/zhongxuan123"><img src="https://avatars3.githubusercontent.com/u/10513552?v=4" width="100px;" alt=""/><br /><sub><b>The notes of SQL optimize </b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=zhongxuan123" title="Code">💻</a></td> </tr> <tr> <td align="center"><a href="https://github.com/zhouxinxin19920802"><img src="https://avatars2.githubusercontent.com/u/29008269?v=4" width="100px;" alt=""/><br /><sub><b>zhouxinxin19920802</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=zhouxinxin19920802" title="Code">💻</a></td> <td align="center"><a href="https://github.com/macaria"><img src="https://avatars2.githubusercontent.com/u/20811449?v=4" width="100px;" alt=""/><br /><sub><b>macaria</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=macaria" title="Code">💻</a></td> <td align="center"><a href="http://github.com/DennisMao"><img src="https://avatars3.githubusercontent.com/u/15226239?v=4" width="100px;" alt=""/><br /><sub><b>Dennis</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=DennisMao" title="Code">💻</a></td> <td align="center"><a href="http://blog.csdn.net/orangleliu"><img src="https://avatars1.githubusercontent.com/u/2696746?v=4" width="100px;" alt=""/><br /><sub><b>orangleliu</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=orangle" title="Code">💻</a></td> <td align="center"><a href="https://github.com/HarbinZhang"><img src="https://avatars1.githubusercontent.com/u/21693162?v=4" width="100px;" alt=""/><br /><sub><b>HarbinZhang</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=HarbinZhang" title="Code">💻</a></td> <td align="center"><a href="https://github.com/SwanSpouse"><img src="https://avatars1.githubusercontent.com/u/7344921?v=4" width="100px;" alt=""/><br /><sub><b>LiMingji</b></sub></a><br /><a href="https://github.com/talkgo/night/commits?author=SwanSpouse" title="Code">💻</a> <a href="https://github.com/talkgo/night/commits?author=SwanSpouse" title="Documentation">📖</a></td> <td align="center"><a href="https://
[ 8273, 275, 3083, 348, 21576, 846, 8615, 1411, 253, 6692, 5573, 4670, 28, 253, 8273, 14278, 273, 253, 13247, 743, 1116, 382, 20369, 275, 3083, 348, 21576, 285, 253, 13247, 743, 1116, 80, 14, 20294, 382, 20369, 15, 380, 1457, 6491, 434, 8273, 13598, 253, 33655, 1222, 3286, 275, 29063, 13, 26169, 247, 4400, 2605, 387, 253, 7773, 1268, 326, 25899, 2919, 595, 15, 380, 5014, 671, 873, 598, 9165, 20036, 275, 253, 3672, 273, 21047, 13, 23306, 13, 15065, 13, 4668, 5684, 13, 1786, 13, 8920, 13, 285, 4730, 13, 1583, 36968, 1097, 6692, 17238, 285, 253, 13247, 33712, 985, 15, 380, 26279, 2919, 273, 33655, 1222, 28290, 1977, 347, 3473, 432, 253, 7344, 875, 7422, 13, 4047, 13, 285, 4135, 20092, 456, 13, 285, 846, 15, 10766, 775, 8754, 14, 27545, 369, 18111, 3901, 275, 17437, 1223, 47387, 247, 11789, 5499, 11658, 407, 253, 13247, 743, 1116, 382, 20369, 15, 187, 187, 1145, 1116, 1346, 273, 253, 34822, 80, 14, 14107, 69, 474, 382, 795, 14044, 16478, 7860, 40322, 1448, 1535, 357, 23246, 64, 390, 43752, 285, 309, 589, 757, 743, 1116, 382, 20369, 313, 5377, 42, 10, 497, 8558, 5506, 323, 253, 35297, 273, 2716, 273, 11268, 387, 253, 15742, 273, 253, 9883, 10109, 3660, 15, 1623, 4163, 3127, 13, 27386, 13, 275, 5052, 281, 247, 10942, 382, 17625, 277, 8, 292, 255, 13, 34822, 1346, 285, 2675, 1346, 1925, 247, 2087, 9974, 13, 1691, 1066, 342, 6174, 253, 4668, 47930, 13, 285, 13598, 24639, 285, 643, 8238, 285, 4811, 273, 14730, 11268, 15, 380, 43752, 2335, 5750, 273, 697, 2168, 5368, 2605, 313, 3113, 689, 247, 3041, 2758, 10, 281, 294, 7397, 907, 253, 6982, 275, 17684, 9409, 13, 1780, 5154, 13, 1244, 267, 1028, 571, 13, 285, 643, 26020, 1754, 327, 253, 34822, 382, 9241, 273, 6657, 1417, 1480, 14483, 285, 5820, 1453, 273, 253, 2097, 273, 3275, 15, 13314, 757, 19941, 3592, 378, 2555, 302, 257, 13, 2488, 273, 795, 510, 8481, 6039, 48821, 486, 64, 285, 795, 510, 9883, 15033, 8291, 12013, 326, 5820, 2335, 689, 346, 38017, 1576, 13, 6406, 43999, 13, 23444, 13, 2891, 280, 5375, 13, 15076, 13, 5637, 1708, 285, 1612, 4413, 13, 3678, 4896, 285, 1824, 4896, 13, 11369, 285, 19744, 7796, 6244, 13, 27304, 13, 47452, 13, 29492, 13, 2739, 14, 21678, 6244, 13, 37807, 13, 18930, 13, 8965, 13, 21440, 13, 15114, 13, 7811, 10111, 13, 285, 6763, 273, 23031, 723, 3786, 9633, 407, 253, 5170, 5971, 449, 187, 187, 510, 34822, 382, 4422, 5135, 681, 15, 2061, 3054, 27, 187, 187, 510, 34822, 382, 11727, 574, 644, 19360, 407, 1781, 8090, 273, 253, 1066, 37474, 5873, 43401, 285, 253, 15742, 273, 10532, 369, 253, 5107, 281, 1691, 841, 5697, 715, 3946, 15, 187, 187, 10937, 400, 5837, 273, 253, 2659, 369, 9470, 15, 24445, 327, 767, 14, 29988, 273, 512, 2659, 275, 253, 8786, 8232, 369, 2668, 689, 15, 496, 512, 875, 2620, 285, 5093, 3041, 43401, 497, 3206, 15, 380, 2201, 3672, 497, 1780, 5154, 835, 627, 497, 20156, 4822, 1644, 13, 253, 13202, 386, 313, 783, 2170, 1475, 47137, 10, 342, 22908, 4822, 1644, 285, 9893, 4002, 313, 783, 2170, 8704, 21924, 10, 342, 7469, 4822, 1644, 15, 187, 187, 510, 444, 59, 44614, 390, 1503, 43448, 8727, 8663, 273, 3313, 46478, 31670, 38, 75, 860, 3373, 7067, 1503, 43448, 8727, 372, 15562, 7860, 40322, 11824, 13598, 3672, 273, 18907, 522, 284, 13, 8987, 327, 4247, 337, 13, 9354, 15, 380, 1503, 43448, 25448, 8671, 253, 9241, 273, 346, 33464, 29601, 285, 15577, 8596, 449, 1583, 671, 9009, 346, 15356, 13, 4730, 13, 285, 18380, 639, 287, 14, 886, 1975, 2718, 937, 285, 7799, 281, 346, 13382, 1584, 23720, 8645, 2493, 3066, 10168, 434, 42427, 5405, 13, 285, 281, 1973, 5213, 34394, 949, 26896, 37344, 285, 1327, 14, 303, 28163, 3569, 5511, 449, 380, 444, 59, 44614, 310, 1335, 8133, 841, 9241, 715, 3946, 275, 4243, 273, 18907, 522, 284, 15, 187, 187, 2512, 310, 671, 16613, 34822, 382, 4833, 275, 253, 3434, 281, 10875, 366, 8741, 5594, 32738, 7399, 15, 496, 4163, 4050, 13, 253, 34822, 382, 14, 249, 8501, 5666, 6491, 434, 17504, 47623, 313, 58, 11070, 10, 273, 253, 32738, 7399, 24136, 7021, 313, 15659, 44, 10, 2335, 1453, 273, 253, 15918, 273, 43120, 266, 5437, 13, 3052, 14776, 285, 329, 925, 249, 327, 253, 17959, 16, 44354, 763, 5680, 15, 380, 714, 11070, 8884, 253, 15918, 285, 643, 3672, 271, 26279, 2919, 13, 285, 6518, 5100, 247, 10208, 3328, 275, 4596, 4059, 1014, 347, 253, 13281, 2418, 369, 8615, 281, 1379, 43120, 266, 5437, 15, 187, 187, 4553, 247, 1740, 1770, 1048, 6680, 13, 247, 39260, 273, 2255, 285, 1821, 12668, 253, 13281, 2418, 562, 273, 43120, 266, 5437, 13, 851, 1170, 253, 2846, 275, 4247, 4104, 15, 3189, 11774, 24690, 69, 6193, 89, 7184, 266, 13, 247, 3558, 273, 253, 4214, 15755, 273, 253, 714, 11070, 2183, 17264, 444, 2967, 249, 1325, 218, 518, 3467, 326, 327, 346, 783, 655, 394, 273, 4163, 13, 8741, 5594, 15033, 3407, 275, 43120, 266, 5437, 2391, 544, 53, 62, 1568, 403, 767, 5621, 326, 452, 8379, 13082, 275, 12728, 15, 2596, 310, 441, 285, 253, 643, 310, 25484, 15, 3954, 352, 310, 598, 281, 665, 588, 13313, 665, 15, 1707, 403, 767, 13939, 15, 22660, 352, 588, 320, 253, 1854, 273, 253, 44090, 285, 273, 253, 5573, 4670, 390, 253, 1854, 273, 14483, 15, 831, 310, 247, 1071, 15, 1198, 326, 1921, 25484, 717, 39479, 512, 616, 5621, 285, 2366, 342, 253, 1329, 273, 5639, 3054, 544, 52, 14504, 20498, 285, 690, 18351, 3054, 62, 13964, 43120, 266, 5437, 342, 824, 4757, 449, 187, 187, 5039, 69, 32619, 36125, 1179, 266, 13, 253, 6657, 273, 253, 15128, 44, 13, 369, 5611, 281, 253, 25527, 273, 2448, 34822, 382, 19995, 7225, 27545, 1223, 275, 5754, 327, 253, 18416, 8930, 273, 11437, 110, 78, 1544, 5588, 15, 24083, 13, 344, 10945, 521, 48641, 14, 18378, 249, 382, 11727, 285, 8671, 1142, 273, 253, 9241, 273, 34822, 1204, 4469, 407, 7225, 27545, 15, 187, 187, 18851, 577, 6317, 275, 5854, 20114, 41340, 22531, 6700, 264, 14181, 601, 90, 13, 665, 5544, 849, 344, 346, 257, 4694, 264, 247, 41340, 2919, 3192, 5281, 11616, 26279, 3672, 275, 14307, 13, 7751, 13, 9256, 285, 12728, 1754, 327, 7225, 27545, 434, 2934, 273, 346, 4658, 797, 6656, 21209, 1204, 1381, 187, 187, 3, 51, 42424, 13, 253, 4849, 273, 42071, 13, 285, 253, 2493, 273, 2659, 42730, 285, 31842, 403, 13, 2975, 13, 2190, 253, 954, 45543, 839, 13, 30157, 285, 48593, 12178, 6355, 326, 253, 1966, 5492, 13, 281, 697, 26034, 13, 556, 32434, 15, 187, 187, 2214, 253, 32084, 13, 512, 5875, 47672, 556, 25368, 28, 751, 247, 1499, 18050, 763, 15548, 19818, 272, 247, 24563, 13, 253, 1463, 85, 728, 966, 1863, 7042, 285, 3802, 2324, 13, 697, 35587, 4233, 47982, 32464, 275, 21968, 273, 27358, 14, 3610, 3485, 13, 440, 47690, 4688, 15, 44589, 1596, 264, 6021, 35328, 3137, 43850, 28, 3137, 43850, 35328, 6255, 331, 503, 1877, 28, 285, 436, 1390, 612, 7095, 37819, 323, 625, 440, 613, 9306, 6021, 15, 187, 187, 24731, 42730, 452, 642, 3570, 1128, 9328, 24184, 262, 731, 407, 15966, 275, 247, 6424, 16100, 13, 323, 534, 21935, 273, 23031, 723, 407, 1110, 665, 2686, 3153, 275, 731, 13, 285, 3426, 16196, 22028, 273, 10054, 273, 686, 624, 84, 4117, 403, 253, 760, 24371, 449, 187, 187, 1128, 32655, 9002, 11448, 13, 795, 51, 290, 27, 743, 496, 6309, 547, 64, 187, 187, 2512, 556, 644, 247, 1270, 7450, 275, 253, 2469, 884, 1107, 281, 513, 1977, 342, 253, 5674, 14, 3409, 38656, 273, 253, 1711, 15128, 44, 285, 1287, 18072, 373, 281, 452, 247, 18545, 13, 24957, 13, 8645, 14, 11969, 38656, 937, 344, 5544, 15, 187, 187, 33770, 26279, 4811, 403, 4081, 323, 3729, 32738, 7399, 15, 10164, 3006, 253, 952, 432, 253, 346, 10492, 14, 484, 3, 275, 271, 28636, 14, 3487, 39694, 13, 627, 403, 4390, 6406, 13, 9168, 13, 3874, 285, 2846, 25502, 28, 1016, 581, 16965, 15572, 281, 253, 9922, 8273, 5759, 15, 187, 187, 2512, 403, 4390, 1264, 26279, 4811, 313, 68, 386, 790, 10, 275, 4255, 32738, 7399, 313, 30187, 5182, 10, 285, 1016, 581, 556, 247, 16005, 13, 247, 4335, 9843, 13, 23885, 285, 697, 1211, 5684, 3490, 15, 2053, 4811, 2126, 247, 2534, 350, 6982, 835, 1896, 285, 452, 4447, 1681, 265, 387, 512, 2308, 281, 8415, 616, 3237, 15, 187, 187, 510, 36729, 273, 253, 2675, 3310, 275, 8741, 5594, 3797, 436, 275, 697, 638, 43927, 27, 187, 187, 1231, 253, 22132, 273, 253, 3672, 273, 1881, 14, 46264, 273, 9922, 24941, 1397, 13, 39004, 285, 2903, 90, 26886, 313, 6717, 90, 5651, 39293, 615, 507, 13, 1780, 482, 507, 582, 14901, 3767, 13, 37801, 2458, 13, 285, 4661, 5756, 84, 13, 407, 776, 1959, 588, 452, 544, 31572, 62, 281, 2144, 907, 8426, 13, 7185, 285, 14483, 275, 8956, 342, 253, 8063, 273, 24957, 6654, 285, 13919, 1293, 11081, 327, 253, 3720, 273, 5492, 13, 9596, 13, 1424, 264, 13, 12791, 390, 8645, 13, 281, 5115, 253, 3569, 285, 9447, 8067, 273, 247, 18545, 5948, 275, 1340, 281, 1159, 342, 15577, 4685, 285, 820, 29419, 1561, 9991, 285, 1675, 323, 253, 8063, 273, 1881, 14, 42142, 273, 22132, 13, 285, 281, 5416, 253, 3570, 273, 2255, 285, 2151, 13, 253, 6055, 5684, 285, 253, 1675, 273, 253, 7185, 273, 9596, 285, 9927, 15, 187, 187, 510, 7774, 273, 253, 36729, 921, 34822, 382, 4833, 15, 1198, 1650, 13, 346, 27129, 17843, 310, 828, 10966, 494, 285, 642, 581, 778, 320, 9833, 28, 2255, 452, 253, 987, 281, 5763, 3569, 13, 2675, 13, 5054, 13, 8928, 285, 512, 3672, 273, 1495, 28, 4130, 310, 544, 936, 452, 62, 1959, 2289, 281, 1491, 13, 3640, 285, 21518, 4712, 28, 1046, 1966, 1146, 556, 253, 987, 281, 7703, 23717, 285, 12100, 13, 285, 344, 778, 417, 320, 4895, 1293, 521, 7578, 28, 3255, 187, 187, 4, 1401, 12599, 1720, 498, 312, 569, 424, 187, 187, 39204, 432, 253, 5213, 281, 253, 1980, 13, 275, 253, 2469, 1643, 8007, 34822, 1346, 452, 13640, 275, 2067, 10106, 294, 29174, 4679, 15, 2596, 273, 253, 1682, 1929, 310, 6416, 571, 15, 380, 23569, 273, 253, 26279, 1879, 382, 12670, 6416, 571, 3114, 387, 271, 13966, 7574, 275, 40892, 3407, 327, 4397, 577, 13, 16609, 13, 672, 952, 432, 253, 2170, 33544, 1066, 253, 269, 2979, 273, 253, 4668, 2613, 285, 13598, 352, 15, 26304, 17264, 14737, 26064, 87, 304, 8243, 37592, 1996, 326, 1770, 326, 346, 510, 1198, 67, 5394, 3228, 273, 253, 20884, 3, 574, 644, 346, 585, 35551, 407, 23332, 449, 6416, 571, 310, 43377, 281, 436, 1388, 15, 187, 187, 26207, 571, 434, 7517, 3908, 3054, 27, 187, 187, 510, 8103, 273, 6416, 571, 310, 281, 2794, 247, 1881, 14, 72, 1189, 920, 5948, 17580, 1016, 285, 1046, 2060, 6556, 3746, 5506, 689, 253, 973, 14, 11952, 273, 253, 2862, 3114, 15, 3824, 5948, 310, 281, 320, 29187, 1881, 14, 84, 461, 1776, 285, 13, 347, 824, 13, 776, 36951, 310, 281, 320, 8933, 7957, 275, 776, 9611, 326, 12264, 285, 3520, 3154, 28125, 476, 320, 247, 13083, 15, 187, 187, 688, 253, 530, 15, 44, 904, 8811, 273, 401, 1120, 251, 8669, 275, 4693, 8884, 616, 14275, 432, 253, 1986, 11491, 327, 4437, 4562, 13, 14960, 13, 347, 346, 39, 1120, 9409, 937, 354, 43759, 326, 337, 15, 25, 13598, 20046, 275, 253, 3105, 1076, 7061, 285, 3729, 611, 13843, 1299, 3672, 273, 4255, 4693, 497, 247, 16629, 2919, 273, 253, 4782, 1680, 868, 15, 831, 16204, 369, 11797, 407, 253, 24344, 17325, 795, 12161, 631, 281, 367, 303, 663, 80, 64, 285, 247, 4143, 281, 6416, 571, 407, 401, 1120, 251, 5720, 22531, 13104, 1219, 14907, 15, 401, 1120, 9409, 6808, 697, 1211, 1501, 486, 21463, 13, 534, 253, 4782, 46574, 6631, 28173, 13, 285, 253, 1639, 1225, 5950, 616, 10720, 5400, 13, 346, 2115, 13419, 9384, 937, 387, 39233, 28359, 275, 401, 1120, 9409, 275, 13563, 15, 12526, 13, 253, 346, 79, 318, 3, 273, 401, 1120, 9409, 556, 30117, 342, 673, 15, 187, 187, 41, 518, 303, 2325, 90, 434, 8582, 10368, 5271, 20899, 1503, 2487, 313, 7656, 59, 10, 4473, 3395, 4633 ]
Society in Manchuria after fighting against the Japanese occupiers; the Society consisted of the Korean Anarchist Federation in Manchuria and the Korean Anarcho-Communist Federation. The New People's Society occupied the Shinmin district in 1929, organizing a federal structure at the village level that coordinated regionally. The participants also set up executive departments in the areas of agriculture, propaganda, finance, military defense, health, youth, and education, They resisted both Japanese occupation and the Korean capitalist system. The autonomous region of Shinmin faded away as pressure from the conflict between Russia, Japan, and China escalated, and after. Kim Chwa-chin was assassinated in 1930 while repairing a rice mill operated by the Korean Anarchist Federation. Anarchists of the anarcho-syndicalist _Confederación Nacional del Trabajo_ or CNT and Iberian Anarchist Federation (FAI) were primarily responsible for the liberation of half of Spain at the outbreak of the Spanish Civil War. On July 21, 1936, in resistance to a fascist coup d'etat, anarchists and socialists called a general strike, put down with arms the military uprising, and occupied Barcelona and other cities and regions of eastern Spain. The CNT took advantage of its already existing structure (with over a million members) to reorganize the economy in Catalonia, Aragon, Andalucia, and other provinces based on the anarchist principles of leaderless direct democracy and workers control of the means of production. Historian Burnett Bolloten, author of _The Grand Camouflage_ and _The Spanish Revolution,_ writes that workers took over "railways, streetcars, buses, taxicabs, shipping, electric light and power companies, gasworks and waterworks, engineering and automobile assembly plants, mines, mills, factories, food-processing plants, theaters, newspapers, bars, hotels, restaurants, department stores, and thousands of dwellings previously owned by the upper classes." The anarchist website libcom.org states: The anarchist philosophy had been absorbed by large layers of the downtrodden peasants and the outbreak of revolution was the opportunity to put these ideas into practice. Collectivisation of the land was extensive. Close on two-thirds of all land in the Republican zone was taken over. In all between five and seven million peasants were involved. The major areas were Aragon where there were 450 collectives, the Levant (the area around Valencia) with 900 collectives and Castille (the area surrounding Madrid) with 300 collectives. The EZLN or Zapatista Army of National Liberation _(Ejército Zapatista de Liberación Nacional)_ occupied areas of Chiapas, Mexico on January 1, 1994. The Zapatistas adopted the principles of "horizontal autonomy and mutual aid." They also implemented "health, education, and sustainable agro-ecological systems," and sought to "promote equitable gender relations via Women's Revolutionary Law, and to build international solidarity through humble outreach and non-imposing political communication." The EZLN is still putting these principles into practice in parts of Chiapas. There is also notable anarchist influence in the effort to liberate Rojava Kurdistan. In July 2012, the anarchist-influenced People's Protection Units (YPG) of the Kurdistan Workers Party (PKK) took control of the towns of Kobanê, Amuda and Afrin on the Syrian/Turkish border. The YPG declared the towns and other areas an autonomous region, and helped establish a federation in November 2014 even as the Islamic State was fighting to take Kobanê. After a four month long battle, a militia of women and men drove the Islamic State out of Kobanê, retaking the city in January 2015. Mehmûd Berxwedan, a member of the General Command of the YPG told journalist Ersin Çaksu that on "the 19th of July, Rojava Revolution began in Kobanê.... [T]here are two forces that have successfully emerged in Syria. One is us and the other is ISIS. Now it is up to who will defeat who. There are two roads. Either it will be the path of the gangs and of the occupiers or the path of democracy. This is a test. For that reason ISIS amassed all their forces and together with the support of foreign states [Saudi Arabia and some Gulf states] attacked Kobanê with such strength." Abdullah Öcalan, the leader of the PKK, was introduced to the writings of American anarchist Murray Bookchin while in prison on the Turkish island of İmralı. Subsequently, he rejected his Marxist-Leninist philosophy and adopted many of the principles of anarchism expressed by Bookchin. Channel 4 News in England interviewed Kurdish activist Memed Aksoy, who explained how he "envisioned a Kurdish region taking shape comprising autonomous areas in Turkey, Iran, Iraq and Syria based on Bookchin's idea of "libertarian municipalism": "Renting, the collection of rents, and the relations of landlords and tenants are, respectively, among the most humiliating, vicious and deplorable interactions that the human race, to its sorrow, has devised. For the landlord, all healthy striving has ceased; like a sluggish python digesting a deer, the propertied class swells and snores, its pudgy thumbs hooked in rolls of foul-smelling, unwashed fat. Unearned income breeds complacency; complacency breeds mental stultification; and this last evokes greed for more unearned income. Landlords have no rights—they forfeit them by engaging in a criminal enterprise, for which seizure of dwellings by those who actually live in them, and complete discontinuance of paying of 'rents,' are the only remedies." —Fred Woodworth, _Rent: An Injustice_ There has been a great push in the past 10 years to do away with the nation-state mentality of the old PKK and develop cadres to have a democratic, ecological, gender-equal mentality," he explained. Eight autonomous regions are proposed for North Kurdistan. Organizing the people from the "bottom-up" in an upside-down pyramid, there are currently street, neighborhood, town and city assemblies; each one sends representatives to the Democratic Society Congress. There are currently three autonomous regions (cantons) in West Kurdistan (Syria) and each one has a parliament, a prime minister, ministers and its own defense force. These regions employ a barter economy where possible and have formed communes at all levels to solve their problems. The Charter of the social contract in Rojava includes this in its preamble: We the peoples of the areas of self-administration of Democratic Kurds, Arabs and Assyrians (Assyrian Chaldeans, Arameans), Turkmen, Armenians, and Chechens, by our free will have [decided] to materialize justice, freedom and democracy in accordance with the principle of ecological balance and equality without discrimination on the basis of race, religion, creed, doctrine or gender, to achieve the political and moral fabric of a democratic society in order to function with mutual understanding and coexistence within diversity and respect for the principle of self-determination of peoples, and to ensure the rights of women and children, the protection defense and the respect of the freedom of religion and belief. The articles of the Charter show anarchist influence. For example, "Personal liberty is inviolable and no one may be arrested; women have the right to exercise political, social, economic, cultural and all areas of life; everyone is [to have] free access to information, knowledge and artistic activities; every human being has the right to seek asylum and refuge, and he may not be returned without his consent;..." # **Local Reclamations** Going from the international to the local, in the past few decades anarchists have participated in several urban reclamation experiments. One of the best known is Christiania. The founding of the autonomous Fristaden Christiania community at an abandoned fort in Copenhagen began on September 4, 1971, when people from the area tore down the fences of the military base and occupied it. Danish journalist Jacob Ludvigsen proclaimed later that month that "The Forbidden City of the Military" had been "conquered by civilians." Christiania is thriving to this day. Christiania's mission statement states: The objective of Christiania is to create a self-governing society whereby each and every individual holds themselves responsible over the well-being of the entire community. Our society is to be economically self-sustaining and, as such, our aspiration is to be steadfast in our conviction that psychological and physical destitution can be averted. In the U.K., residents of Freston Road in London declared their independence from the United Kingdom on October 31, 1977, as "Frestonia," proclaiming that 1.8 occupied acres in the Notting Hill and North Kensington areas of West London were a sovereign region of the British Isles. This declaration was inspired by the 1949 comedy _Passport to Pimlico_ and a visit to Christiania by Freston Street activist Nick Albery. Frestonia issued its own postage stamp, which the British Postal Service honored, and the Clash recorded their fifth album, "Combat Rock," at Era Studios in Frestonia in 1982. Unfortunately, the "nation" of Frestonia has vanished with time. Hakim Bey's Temporary Autonomous Zones (TAZ) concept became popular
[ 187, 2912, 187, 187, 1231, 5283, 1060, 253, 41818, 273, 253, 1984, 1008, 3979, 20, 40, 62, 285, 253, 3082, 3715, 275, 253, 3929, 1008, 41, 14, 18, 1570, 496, 253, 1083, 273, 575, 5, 21, 2911, 48123, 13, 327, 476, 4853, 253, 5572, 1764, 2043, 92, 6674, 94, 268, 64, 17, 27, 708, 43, 64, 18, 5716, 1588, 92, 48, 7294, 19, 29372, 464, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 61, 7083, 708, 393, 1274, 1035, 2043, 92, 6674, 94, 91, 64, 20, 13, 81, 64, 20, 13, 82, 64, 20, 393, 7083, 187, 91, 64, 21, 13, 81, 64, 21, 13, 82, 64, 21, 61, 423, 92, 6674, 889, 918, 10, 708, 464, 18637, 21316, 187, 61, 1274, 1035, 2043, 92, 6674, 94, 81, 64, 21, 12, 34, 578, 883, 94, 91, 64, 20, 12, 34, 578, 805, 94, 91, 64, 21, 393, 7083, 187, 81, 64, 20, 12, 82, 64, 21, 12, 34, 578, 1797, 94, 91, 64, 20, 12, 34, 578, 1423, 94, 91, 64, 21, 393, 7083, 2805, 64, 20, 12, 34, 578, 2405, 94, 91, 64, 20, 12, 34, 578, 1237, 94, 91, 64, 21, 187, 61, 423, 92, 6674, 889, 918, 1572, 423, 92, 6674, 10878, 2635, 359, 755, 271, 3242, 285, 33796, 10659, 187, 187, 7010, 2043, 92, 6674, 94, 187, 50275, 7, 50276, 7, 50276, 17, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 17, 61, 20744, 20744, 28, 4615, 50276, 7, 50275, 7, 470, 708, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 50276, 7, 50276, 7, 393, 4251, 3487, 61, 20744, 20744, 28, 50276, 7, 50275, 7, 393, 4251, 3487, 18856, 50276, 7, 50276, 7, 393, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 305, 64, 17, 61, 20744, 28511, 4615, 708, 464, 18637, 21316, 322, 64, 18, 5716, 1588, 92, 48, 7294, 19, 1572, 7405, 14101, 187, 5977, 23386, 464, 2592, 64, 17, 2704, 18637, 21316, 50276, 464, 1588, 92, 48, 7294, 20, 50276, 7, 464, 18637, 21316, 50276, 17, 393, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50275, 7, 50275, 61, 4251, 3487, 61, 13309, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 64, 17, 61, 20744, 20744, 28, 708, 464, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 19, 1572, 7405, 14101, 187, 5977, 23386, 92, 81, 64, 17, 2704, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 50276, 7, 464, 18637, 21316, 470, 50276, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 4862, 464, 2059, 19289, 18, 21316, 50276, 7, 50276, 61, 4251, 3487, 393, 2059, 12740, 18, 21316, 50275, 7, 50275, 61, 4251, 3487, 61, 13309, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 12740, 18, 889, 20744, 28, 708, 464, 18637, 21316, 1926, 1588, 92, 48, 7294, 19, 61, 20744, 28511, 187, 5977, 23386, 92, 81, 12740, 18, 7780, 18637, 21316, 470, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 20744, 28, 4615, 7, 50275, 7, 50275, 7, 50275, 7, 50275, 61, 7083, 187, 50276, 7, 50276, 7, 470, 61, 20744, 20744, 28, 4615, 708, 708, 470, 61, 20744, 20744, 28, 4615, 708, 708, 50275, 7, 708, 50275, 61, 7083, 187, 61, 423, 92, 6674, 2138, 835, 253, 5170, 1386, 7350, 14217, 273, 370, 81, 64, 17, 1352, 187, 187, 1672, 20692, 314, 13, 359, 452, 27, 669, 2592, 64, 17, 1035, 2043, 92, 6674, 94, 81, 64, 20, 13, 82, 64, 20, 61, 7083, 187, 81, 64, 21, 13, 82, 64, 21, 61, 423, 92, 6674, 2311, 10190, 81, 64, 21, 13, 81, 64, 20, 12, 82, 64, 21, 13, 82, 64, 20, 1009, 3692, 10295, 575, 5, 72, 64, 17, 5, 310, 840, 25783, 281, 2367, 1588, 92, 48, 11971, 187, 187, 510, 806, 13455, 318, 370, 81, 64, 18, 27, 43, 64, 19, 5716, 1588, 92, 48, 7294, 19, 17765, 18637, 94, 43, 64, 18, 5716, 1588, 92, 48, 7294, 20, 1009, 273, 370, 81, 64, 17, 5, 310, 840, 1677, 407, 3318, 81, 64, 18, 61, 1274, 1035, 2043, 92, 6674, 94, 91, 64, 20, 13, 81, 64, 20, 13, 82, 64, 20, 13, 83, 64, 20, 13, 84, 64, 20, 13, 85, 64, 20, 61, 7083, 1182, 64, 21, 13, 81, 64, 21, 13, 82, 64, 21, 13, 83, 64, 21, 13, 84, 64, 21, 13, 85, 64, 21, 61, 423, 92, 6674, 889, 918, 4010, 187, 61, 24343, 61, 2043, 92, 6674, 94, 81, 64, 21, 12, 34, 578, 883, 94, 91, 64, 20, 12, 34, 578, 805, 94, 91, 64, 21, 393, 7083, 187, 81, 64, 20, 12, 82, 64, 21, 12, 34, 578, 1797, 94, 91, 64, 20, 12, 34, 578, 1423, 94, 91, 64, 21, 393, 7083, 187, 82, 64, 20, 12, 34, 578, 2405, 94, 91, 64, 20, 12, 34, 578, 1237, 94, 91, 64, 21, 61, 423, 92, 6674, 889, 918, 4700, 1764, 1274, 4880, 2043, 92, 6674, 94, 83, 64, 21, 12, 34, 578, 883, 94, 81, 64, 20, 12, 34, 578, 805, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 883, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 805, 2311, 91, 64, 21, 187, 61, 7083, 391, 64, 20, 12, 84, 64, 21, 12, 34, 578, 1797, 94, 81, 64, 20, 12, 34, 578, 1423, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 1797, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 1423, 2311, 91, 64, 21, 393, 7083, 187, 84, 64, 20, 12, 34, 578, 2405, 94, 81, 64, 20, 12, 34, 578, 1237, 94, 81, 64, 21, 23002, 3214, 64, 89, 1603, 34, 578, 2405, 2311, 91, 64, 20, 23002, 3214, 64, 89, 1603, 34, 578, 1237, 2311, 91, 64, 21, 61, 423, 92, 6674, 889, 918, 4700, 1764, 1274, 4880, 2043, 92, 6674, 94, 84, 64, 21, 12, 34, 578, 883, 94, 82, 64, 20, 12, 34, 578, 805, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 883, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 805, 2311, 91, 64, 21, 187, 61, 7083, 256, 64, 20, 12, 85, 64, 21, 12, 34, 578, 1797, 94, 82, 64, 20, 12, 34, 578, 1423, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 1797, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 1423, 2311, 91, 64, 21, 393, 7083, 187, 85, 64, 20, 12, 34, 578, 2405, 94, 82, 64, 20, 12, 34, 578, 1237, 94, 82, 64, 21, 23002, 3214, 64, 90, 1603, 34, 578, 2405, 2311, 91, 64, 20, 23002, 3214, 64, 90, 1603, 34, 578, 1237, 2311, 91, 64, 21, 187, 61, 423, 92, 6674, 889, 28946, 1890, 187, 187, 4609, 5644, 441, 281, 1529, 33796, 285, 3242, 10659, 27, 1764, 2043, 92, 6674, 94, 187, 50275, 7, 50276, 7, 50276, 17, 61, 20744, 13309, 50276, 7, 17, 61, 20744, 28, 50276, 7, 50275, 7, 470, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 28, 50276, 7, 50276, 7, 393, 4251, 3487, 61, 20744, 28, 50276, 7, 50275, 7, 393, 4251, 3487, 50276, 7, 50276, 7, 393, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 305, 64, 18, 30, 17, 708, 464, 18637, 21316, 322, 64, 19, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 464, 2592, 64, 18, 2704, 18637, 21316, 50276, 52, 64, 18, 5716, 1588, 92, 48, 7294, 20, 10, 50276, 7, 464, 18637, 21316, 50276, 17, 393, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50275, 7, 50275, 61, 4251, 3487, 7, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 64, 18, 61, 28511, 708, 464, 18637, 21316, 500, 64, 19, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 92, 81, 64, 18, 2704, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 20, 10, 50276, 7, 464, 18637, 21316, 470, 50276, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 4862, 464, 2059, 2000, 17, 7, 50276, 7, 50276, 61, 4251, 3487, 393, 2059, 64, 17, 7, 50275, 7, 50275, 61, 4251, 3487, 7, 50275, 7, 50275, 61, 7083, 187, 17, 50276, 7, 1926, 18637, 21316, 416, 578, 17, 889, 28511, 708, 464, 18637, 21316, 500, 64, 18, 5716, 1588, 92, 48, 7294, 19, 10, 187, 5977, 23386, 92, 81, 578, 17, 7780, 18637, 21316, 1926, 1588, 92, 48, 7294, 20, 50276, 7, 50275, 464, 18637, 21316, 470, 50273, 61, 7083, 187, 50275, 7, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50276, 7, 50276, 61, 4251, 3487, 61, 20744, 13309, 50275, 7, 393, 4251, 3487, 50276, 7, 50275, 7, 50275, 61, 7083, 187, 50276, 7, 50276, 7, 470, 708, 708, 470, 708, 708, 470, 50276, 7, 708, 50275, 61, 7083, 61, 423, 92, 6674, 10878, 3308, 669, 4862, 464, 2059, 2000, 17, 5, 310, 271, 20169, 15, 380, 806, 26878, 2570, 310, 1677, 407, 575, 1890, 17, 61, 18637, 393, 6190, 92, 30428, 187, 94, 393, 1588, 92, 46, 1603, 21, 10, 393, 23386, 92, 75, 64, 19, 2704, 18637, 94, 444, 187, 61, 23386, 92, 37, 2704, 18637, 94, 393, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 187, 61, 23386, 92, 37, 2704, 18637, 94, 393, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 12740, 18, 889, 18637, 470, 1890, 835, 209, 575, 5, 38, 5, 9572, 323, 253, 10295, 273, 370, 81, 64, 18, 1352, 844, 27566, 432, 436, 253, 1563, 33796, 10659, 13, 3692, 3104, 403, 3242, 285, 3692, 9930, 403, 3242, 275, 575, 5, 51, 64, 76, 1366, 285, 575, 5, 75, 64, 19, 5, 285, 575, 5, 75, 64, 20, 5, 403, 1114, 29675, 27, 1764, 2043, 92, 6674, 94, 708, 708, 708, 50271, 7, 470, 61, 20744, 28, 50275, 7, 708, 470, 61, 20744, 28, 50275, 7, 708, 393, 7083, 187, 50258, 7, 708, 708, 50263, 7, 50274, 61, 4251, 3487, 61, 20744, 28, 708, 708, 393, 4251, 3487, 61, 20744, 28, 708, 708, 393, 7083, 187, 50258, 7, 708, 470, 50276, 5977, 18637, 708, 393, 6190, 92, 30428, 11153, 1588, 92, 46, 1603, 21, 10, 5977, 18637, 9443, 6190, 92, 30428, 11153, 1588, 92, 46, 1603, 21, 10, 5977, 18637, 708, 470, 393, 7083, 187, 50258, 7, 708, 50276, 7, 708, 393, 4251, 3487, 480, 64, 20, 708, 708, 393, 4251, 3487, 480, 64, 19, 708, 708, 50276, 61, 7083, 187, 50254, 708, 708, 50274, 17, 50276, 5977, 18637, 708, 416, 64, 19, 61, 28511, 9443, 23386, 464, 4862, 464, 2059, 2000, 18, 2704, 18637, 94, 708, 444, 30, 51, 64, 18, 9443, 23386, 464, 2461, 64, 18, 889, 18637, 708, 393, 5577, 92, 44, 2026, 18, 94, 393, 7083, 187, 50254, 7, 708, 708, 708, 393, 4251, 3487, 61, 20744, 28, 708, 393, 2140, 2501, 1126, 6526, 21316, 393, 4251, 3487, 399, 708, 708, 50276, 61, 7083, 187, 50254, 7, 708, 470, 50276, 5977, 18637, 708, 393, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 38, 50276, 5977, 23386, 464, 4862, 464, 2059, 2000, 17, 889, 18637, 9443, 4153, 63, 18, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 9443, 18637, 708, 470, 393, 7083, 187, 50262, 7, 708, 50273, 7, 708, 393, 4251, 3487, 61, 20744, 28, 708, 708, 393, 4251, 3487, 399, 708, 708, 50276, 61, 7083, 187, 50262, 17, 50275, 7, 393, 18637, 708, 50276, 61, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 72, 64, 17, 50276, 5977, 18637, 708, 393, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 64, 17, 50276, 5977, 23386, 464, 4862, 464, 2059, 19289, 18, 3080, 18637, 9443, 4153, 63, 19, 61, 5786, 1126, 1588, 92, 48, 599, 51, 12740, 18, 94, 9443, 18637, 708, 470, 393, 7083, 187, 50258 ]
------------ We adopt here the notations of the book [@BC3G] and the methods developed in the article [@H-1]. In the case of $4$-webs, on can define the operator $$\begin{matrix} p_0: &J_1({\mathcal{O}}^2)&{\longrightarrow}& {\mathcal{O}}^3\cr & \left(\begin{matrix}z_3,p_3,q_3 \cr z_4,p_4,q_4\end{matrix}\right) &{\longrightarrow}& \left(\begin{matrix}p_4+A_{11}z_3+A_{12}z_4 \cr p_3+q_4+A_{21}z_3+A_{22}z_4 \cr q_3+A_{31}z_3+A_{32}z_4 \end{matrix}\right)\end{matrix}.$$ Then we get an exact and commutative diagram $$\begin{matrix} & & 0\;\;\;\;\;\,& &0\;\;\;\;\;\, & & 0 & & \cr & & \mapdown\;\;\;\;\; & & \mapdown\;\;\;\;\; & & \mapdown\; & & \cr 0 & {\longrightarrow}& g_0\;\;\;\;\, &{\longrightarrow}& S_1({\mathcal{O}}^2)\;\,\, &\stackrel{\sigma_0}{\longrightarrow}& {\mathcal{O}}^3 &{\longrightarrow}& 0 \cr & & \mapdown\;\;\;\;\;\,& & \mapdown\;\;\;\;\;\,& & \mapdown\;& & \cr 0 & {\longrightarrow}& R_0\;\;\;\;\; &{\longrightarrow}& J_1({\mathcal{O}}^2)\;\,\, &\stackrel{p_0}{\longrightarrow}& {\mathcal{O}}^3 &{\longrightarrow}& 0 \cr & & \mapdown \overline{\pi}_{-1}& & \mapdown \pi_{-1}& & \mapdown\;& & \cr 0 & {\longrightarrow}& R_{-1}\;\;\; &{\longrightarrow}& {\mathcal{O}}^2\;\;\;\; &\stackrel{p_{-1}}{\longrightarrow}& 0 & & \cr & & \mapdown\;\;\;\;\;\,& & \mapdown\;\;\;\;\;\,& & & & \cr & & 0\;\;\;\;\;\, & & 0\;\;\;\;\;\, & & & & \cr \end{matrix}$$ where the upper line concerns symbols of $p_0$. Explicitly, we have: $\sigma_0(\begin{matrix}p_3,q_3\cr p_4,q_4\end{matrix})=(p_4,p_3+q_4,q_3)$ whose kernel $g_0$ is then isomorphic to ${\mathcal{O}}$. The first prolongation $p_1:J_2({\mathcal{O}}^2){\longrightarrow}J_1({\mathcal{O}}^3)$ of $p_0$ is then given by $$p_1\left(\begin{matrix}z_3,p_3,q_3,r_3,s_3,t_3\cr z_4,p_4,q_4,r_4,s_4,t_4\end{matrix}\right)= \lp\begin{matrix}p_4+A_{11}z_3+A_{12}z_4 \cr p_3+q_4+A_{21}z_3+A_{22}z_4 \cr q_3+A_{31}z_3+A_{32}z_4\end{matrix}\right.$$ $$\left.\begin{matrix}r_4+A_{11}p_3+A_{12}p_4+{\partial_x}(A_{11})z_3+{\partial_x}(A_{12})z_4 \cr r_3+s_4+A_{21}p_3+A_{22}p_4+{\partial_x}(A_{21})z_3+{\partial_x}(A_{22})z_4 \cr s_3+A_{31}p_3+A_{32}p_4+{\partial_x}(A_{31})z_3+{\partial_x}(A_{32})z_4\end{matrix}\right.$$ $$\left.\begin{matrix}s_4+A_{11}q_3+A_{12}q_4+{\partial_y}(A_{11})z_3+{\partial_y}(A_{12})z_4 \cr s_3+t_4+A_{21}q_3+A_{22}q_4+{\partial_y}(A_{21})z_3+{\partial_y}(A_{22})z_4 \cr t_3+A_{31}q_3+A_{32}q_4+{\partial_y}(A_{31})z_3+{\partial_y}(A_{32})z_4 \end{matrix}\rp$$ which leads us to another commutative and exact diagram: $$\begin{matrix} & & 0\;\;\;& &0\;\;\; & & 0 & & \cr & & \mapdown\;\;\; & & \mapdown\;\;\; & & \mapdown & & \cr 0 & {\longrightarrow}& g_1=0 &{\longrightarrow}& S_2({\mathcal{O}}^2) &\stackrel{\sigma_1}{\longrightarrow}& S_1({\mathcal{O}}^3) &{\longrightarrow}& 0 \cr & & \mapdown\;\;\;& & \mapdown\;\;\;& & \mapdown& & \cr 0 & {\longrightarrow}& R_1\;\; &{\longrightarrow}& J_2({\mathcal{O}}^2) &\stackrel{p_1}{\longrightarrow}& J_1({\mathcal{O}}^3) &{\longrightarrow}& 0 \cr & & \mapdown \overline{\pi}_0& & \mapdown \pi_0& & \mapdown& & \cr 0 & {\longrightarrow}& R_{0}\;\; &{\longrightarrow}& J_1({\mathcal{O}}^2) &\stackrel{p_{0}}{\longrightarrow}& {\mathcal{O}}^3 & {\longrightarrow}& 0 \cr & & \mapdown\;\;\;& & \mapdown\;\;\;& & \mapdown & & \cr & & 0 & & 0 & & 0 & & \cr\end{matrix}.$$ Thus $\overline{\pi}_0$ is an isomorphism. The first Spencer complex is given by $$0\longrightarrow \mbox{Sol } \mathcal{M}(4) \stackrel{j_2}{\longrightarrow} E \stackrel{D}{\longrightarrow} \Omega^1\otimes_{\mathcal{O}}R_0 \stackrel{D}{\longrightarrow} \Omega^2\otimes_{\mathcal{O}}R_{-1}\longrightarrow 0$$ where  $E$ stands for the kernel of $p_1$. We deduce from this the following commutative diagram, whose lines are exact and whose columns are exact in $R_k$, and $j_2$ and $j_3$ are monomorphisms: $$\begin{matrix} & & & & 0\;\;\; & & 0\;\;\; & & \cr & & & & \mapdown\;\;\; & & \mapdown\;\;\; & & \cr & & 0 &\longrightarrow & \mbox{Sol }\mathcal{M}(4)&\longrightarrow &\mbox{Sol }\mathcal{M}(4)&\longrightarrow & 0 \cr & & & & \mapdown j_3 & & \mapdown j_2 & & \cr & & 0 &\longrightarrow & R_2\;\; &\stackrel{\overline{\pi}_1}{\longrightarrow} & E=R_1 &\stackrel{\beta_1}\longrightarrow & \mathfrak{K}_{1} \cr & & & & \mapdown\;\;\; & \swarrow_{\nabla}& \mapdown D & & \cr & & 0 &\longrightarrow & \Omega^1\otimes_{\mathcal{O}}E &\stackrel{\overline{\pi}_0}\longrightarrow &\Omega^1\otimes_{\mathcal{O}}R_0 &\longrightarrow & 0 \cr & & & & \mapdown\;\;\; & & \mapdown D & & \cr 0 & \longrightarrow & \Omega^2\otimes_{\mathcal{O}}g_0 &\longrightarrow & \Omega^2\otimes_{\mathcal{O}}R_0 &\stackrel{\overline{\pi}_{-1}}\longrightarrow &\Omega^2\otimes_{\mathcal{O}}R_{-1} &\longrightarrow & 0 \cr
[ 46911, 342, 247, 2159, 2926, 15, 187, 187, 21082, 445, 12431, 271, 15629, 273, 14635, 4248, 432, 48015, 6822, 275, 12746, 13, 16301, 275, 23438, 13, 840, 247, 37589, 273, 14635, 275, 4383, 275, 23305, 432, 21801, 6169, 6822, 275, 47368, 13, 1457, 2816, 15, 187, 187, 29431, 209, 187, 688, 23305, 13, 703, 7028, 27485, 37797, 250, 17502, 714, 11317, 90, 308, 1596, 1403, 13456, 15, 11970, 617, 7875, 13, 703, 6311, 253, 27485, 3448, 285, 3395, 2330, 342, 247, 1387, 273, 2872, 27485, 37797, 250, 32976, 665, 3395, 29549, 1929, 347, 253, 1457, 2816, 5901, 15, 1284, 247, 629, 273, 616, 18051, 12786, 13, 703, 3407, 4028, 285, 18051, 16053, 275, 27485, 15, 187, 187, 688, 22824, 13, 17966, 369, 7091, 407, 33123, 434, 11568, 383, 285, 4307, 627, 323, 3127, 1107, 28, 703, 3395, 271, 8121, 273, 1097, 253, 11338, 285, 253, 12776, 8821, 7225, 9585, 15, 4058, 806, 4460, 380, 9859, 2932, 38987, 369, 3863, 407, 399, 451, 5687, 275, 16609, 13, 762, 253, 4331, 1416, 39206, 27334, 1758, 13, 534, 703, 671, 908, 323, 617, 27485, 14, 12982, 16053, 15, 380, 1984, 369, 2529, 407, 11397, 9109, 347, 346, 266, 13943, 806, 4460, 1051, 2761, 15404, 23073, 1216, 757, 275, 697, 48528, 273, 253, 711, 5367, 4837, 10958, 5109, 449, 1500, 32806, 308, 1596, 1403, 13456, 275, 15621, 285, 1669, 253, 1457, 2816, 5901, 13515, 17096, 15, 187, 187, 33877, 209, 187, 688, 15788, 17966, 3863, 617, 1273, 4460, 13, 380, 15808, 14311, 1216, 15, 308, 744, 432, 253, 1127, 273, 1859, 273, 247, 11730, 3540, 8690, 13, 253, 2926, 6722, 1070, 521, 11182, 281, 755, 247, 21220, 22134, 11730, 25620, 327, 253, 530, 15, 52, 15, 19898, 2285, 13, 285, 281, 572, 1225, 521, 1211, 5675, 2389, 323, 521, 1233, 72, 860, 15, 380, 15620, 1984, 369, 253, 806, 13399, 11730, 14459, 281, 1056, 380, 1457, 2816, 7717, 9567, 322, 7707, 1618, 15, 380, 1984, 4211, 3578, 3041, 10125, 285, 369, 15786, 275, 3578, 11515, 15, 5761, 8007, 1996, 13, 17966, 2879, 767, 2160, 1241, 13, 3972, 13409, 434, 23752, 313, 13034, 10, 285, 19669, 434, 12143, 313, 12487, 481, 17966, 671, 2210, 562, 347, 34929, 275, 15788, 15, 187, 187, 1909, 247, 25620, 5972, 13, 17966, 369, 275, 16221, 581, 273, 253, 806, 2255, 281, 10078, 275, 253, 9693, 45961, 15, 1500, 369, 629, 273, 247, 1387, 665, 6786, 14200, 8981, 275, 253, 530, 15, 52, 15, 323, 5343, 39097, 30451, 15, 2490, 187, 688, 14828, 13, 17966, 3863, 617, 2626, 4460, 13, 380, 401, 4306, 5682, 1209, 15, 733, 310, 253, 2926, 273, 247, 29938, 14959, 275, 247, 13889, 11393, 25024, 665, 11521, 275, 2389, 342, 247, 9979, 13, 11730, 2716, 14, 3381, 264, 342, 247, 6424, 1924, 285, 346, 328, 6937, 1020, 21044, 449, 733, 369, 253, 806, 1682, 84, 7707, 281, 18047, 247, 11730, 14959, 285, 281, 8338, 11730, 1495, 275, 247, 1355, 3874, 15, 187, 187, 688, 14304, 13, 2210, 17966, 434, 7002, 4460, 13, 380, 36974, 11628, 15, 5220, 3863, 407, 4922, 736, 13, 436, 1984, 369, 873, 275, 253, 1457, 2816, 3228, 1533, 835, 703, 1871, 5262, 1142, 1107, 15, 380, 2926, 7106, 327, 247, 28071, 11906, 21801, 32427, 13, 247, 26348, 264, 11730, 3392, 2820, 281, 755, 598, 253, 15838, 281, 1705, 562, 281, 521, 6122, 13, 665, 574, 2489, 247, 48423, 3270, 14, 48223, 5686, 14, 16245, 6416, 18468, 15, 187, 187, 24801, 5249, 209, 187, 688, 9178, 13, 17966, 1669, 8410, 387, 253, 11568, 383, 281, 2489, 247, 2120, 14, 2606, 8406, 15, 1500, 4395, 896, 562, 4255, 281, 15142, 2561, 327, 617, 1735, 4460, 13, 247, 6359, 9493, 1121, 316, 15, 733, 5420, 432, 14702, 31404, 275, 10226, 762, 253, 4060, 2596, 1680, 253, 4146, 15, 25010, 29116, 275, 11053, 5002, 13, 703, 1160, 253, 3061, 281, 564, 3907, 342, 1984, 18051, 15, 380, 906, 369, 13303, 8076, 5687, 13, 534, 556, 3863, 512, 617, 5098, 1580, 13, 1690, 617, 6585, 4460, 13, 380, 13303, 3083, 13, 11797, 407, 617, 1107, 275, 11268, 28, 703, 574, 19624, 627, 11719, 1309, 10765, 39035, 434, 9459, 672, 703, 369, 45652, 1988, 281, 253, 11568, 383, 434, 9883, 11166, 15, 187, 187, 10457, 253, 7901, 84, 13, 17966, 3395, 625, 3939, 23075, 15, 496, 8441, 14, 1525, 13, 347, 247, 906, 273, 617, 7350, 323, 23641, 8920, 13, 703, 43659, 347, 247, 28845, 273, 4730, 275, 253, 8742, 9757, 914, 1245, 4726, 4412, 13, 9417, 327, 253, 25498, 708, 12029, 13564, 10286, 5399, 285, 1996, 253, 8801, 18817, 10286, 5399, 15, 496, 5403, 13, 17966, 14565, 18425, 3569, 24773, 42602, 1503, 284, 19306, 13456, 285, 6138, 617, 4613, 1974, 323, 3228, 6456, 275, 4255, 14759, 13, 6582, 15, 17966, 369, 28008, 275, 617, 1408, 15, 2490, 187, 21082, 445, 4962, 327, 5080, 898, 13, 6247, 387, 253, 2363, 273, 11487, 387, 41742, 8710, 5197, 275, 12126, 34781, 846, 2761, 247, 1264, 807, 6680, 342, 6400, 2923, 15, 187, 187, 688, 3978, 6247, 13, 17966, 369, 581, 273, 253, 40217, 13719, 2448, 773, 81, 6035, 398, 13, 11693, 1559, 1370, 398, 13, 285, 22271, 668, 21782, 264, 327, 253, 3313, 23641, 50, 8799, 273, 23801, 1561, 253, 14963, 12081, 3313, 4200, 1303, 313, 18243, 46, 10, 275, 1457, 2816, 3228, 457, 84, 14963, 12081, 14515, 15, 380, 7167, 46, 310, 253, 806, 530, 15, 52, 15, 3872, 25754, 9940, 281, 23641, 50, 3570, 285, 2892, 13, 1223, 380, 8799, 457, 84, 24973, 4837, 369, 37282, 281, 1379, 1659, 1309, 253, 2456, 394, 19054, 273, 253, 14963, 12081, 43384, 15, 187, 187, 41353, 187, 34, 1535, 2961, 90, 273, 2325, 265, 313, 28476, 10, 1905, 275, 27485, 187, 18596, 1727, 285, 48774, 313, 29639, 10, 1905, 275, 27485, 187, 49, 750, 37665, 313, 25892, 10, 1905, 275, 27485, 187, 510, 9859, 2932, 38987, 313, 25197, 10, 35378, 4, 2357, 14, 1036, 1671, 3245, 187, 510, 15808, 14311, 1216, 313, 22062, 10, 209, 187, 510, 401, 4306, 5682, 1209, 313, 19813, 10, 209, 187, 510, 36974, 11628, 313, 19791, 10, 209, 187, 4041, 310, 253, 4146, 313, 14209, 10, 209, 187, 41, 7694, 266, 434, 23752, 313, 13034, 10, 209, 187, 35, 9352, 434, 12143, 313, 12430, 10, 209, 187, 510, 13303, 3083, 313, 8971, 10, 209, 187, 3220, 4255, 27, 23307, 16679, 723, 327, 253, 2448, 4255, 313, 7330, 10, 187, 187, 4941, 2490, 187, 1413, 27, 45819, 10782, 187, 1413, 27, 9638, 8923, 187, 1413, 27, 938, 394, 14, 9888, 2448, 4460, 1346, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 4460, 1346, 187, 1413, 27, 7878, 2255, 4460, 1346, 187, 1413, 27, 5764, 18756, 552, 11240, 20721, 187, 1413, 27, 24139, 13564, 11597, 187, 1413, 27, 45, 20318, 11597, 432, 253, 1986, 2077, 187, 1413, 27, 45, 20318, 18680, 432, 253, 1986, 2077, 187, 1413, 27, 45, 20318, 4460, 1346, 187, 1413, 27, 45, 20318, 952, 432, 27540, 187, 1413, 27, 42399, 24647, 1253, 14376, 5600, 2392, 187, 1413, 27, 938, 394, 14, 9888, 2448, 2255, 11597, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 2255, 11597, 187, 1413, 27, 938, 394, 14, 9888, 5600, 2392, 187, 1413, 27, 1797, 296, 14, 9888, 5600, 2392, 187, 1413, 27, 4779, 20660, 6169, 6822, 20759, 187, 1413, 27, 8836, 432, 7518, 6736, 13, 27540, 187, 1413, 27, 8836, 432, 1605, 254, 35444, 13, 27540, 187, 1413, 27, 25191, 398, 432, 27540, 187, 1413, 27, 7878, 2255, 1327, 14, 33223, 11597, 187, 1413, 27, 938, 394, 14, 9888, 2448, 1327, 14, 33223, 11597, 187, 1413, 27, 1797, 296, 14, 9888, 2448, 1327, 14, 33223, 11597, 50, 27, 187, 187, 12070, 13331, 5826, 428, 427, 7250, 33037, 7316, 34977, 187, 187, 42, 452, 247, 7316, 326, 309, 878, 281, 13194, 326, 309, 513, 417, 871, 849, 281, 2605, 15, 187, 42, 452, 247, 2829, 1925, 41166, 15, 309, 452, 1529, 2829, 1925, 6487, 15, 1707, 310, 247, 2626, 2829, 1925, 23895, 15, 1284, 368, 476, 8564, 13, 247, 6487, 556, 41166, 13, 285, 41166, 452, 23895, 15, 187, 42, 878, 281, 1618, 562, 512, 273, 253, 41166, 275, 619, 5447, 15, 380, 5691, 310, 13, 309, 878, 281, 1618, 253, 2264, 1180, 273, 23895, 275, 253, 1072, 2567, 347, 253, 37216, 15, 309, 452, 3597, 10575, 327, 253, 1563, 1293, 667, 7516, 27, 187, 12995, 187, 50276, 70, 15, 6407, 2402, 13, 187, 50276, 70, 15, 8693, 2402, 13, 187, 50276, 70, 15, 32088, 13, 187, 50276, 9, 12995, 29032, 9, 5627, 10727, 23895, 269, 17242, 269, 15, 45929, 1838, 2949, 313, 12995, 544, 1838, 62, 10727, 41166, 299, 19, 17242, 299, 19, 15, 32088, 1838, 30, 70, 15, 32088, 1838, 1228, 347, 686, 4505, 6878, 8, 187, 22050, 187, 50276, 31413, 4317, 299, 187, 187, 1276, 717, 309, 2509, 3430, 32, 50276, 8398, 368, 2, 187, 187, 34, 27, 187, 187, 17222, 436, 27, 187, 12995, 187, 50276, 70, 15, 6407, 2402, 13, 187, 50276, 70, 15, 8693, 2402, 13, 187, 50276, 70, 15, 32088, 13, 187, 50276, 9, 187, 50274, 12995, 29032, 9, 5627, 187, 50274, 22050, 23895, 269, 187, 50274, 26461, 1042, 41166, 299, 19, 8160, 269, 15, 45929, 1838, 426, 299, 19, 15, 301, 187, 50274, 31102, 299, 19, 15, 32088, 1838, 426, 299, 15, 32088, 1838, 187, 50276, 10, 347, 686, 4505, 6878, 8, 187, 22050, 187, 50276, 31413, 4317, 299, 535, 15491, 268, 1715, 24653, 2014, 11730, 1821, 187, 187, 40, 333, 5385, 2182, 3672, 268, 1715, 24653, 428, 3711, 1859, 9539, 27, 512, 16308, 13, 368, 476, 923, 8783, 273, 2872, 6068, 13, 1629, 20264, 13, 347, 973, 347, 5662, 1821, 390, 1299, 11019, 1157, 268, 1715, 24653, 1113, 5603, 13750, 407, 40444, 352, 15, 3267, 10719, 275, 268, 1715, 24653, 9092, 27, 323, 1805, 3186, 1543, 513, 247, 1980, 3186, 3185, 258, 446, 460, 2358, 7016, 2654, 834, 452, 667, 40482, 2568, 764, 272, 3517, 891, 3524, 533, 891, 588, 921, 327, 1629, 1692, 1157, 12157, 273, 673, 15, 7993, 24653, 434, 1682, 13597, 2670, 323, 11730, 1821, 2525, 11730, 1821, 432, 268, 1715, 24653, 2233, 6, 1959, 15, 187, 187, 3837, 503, 2675, 2825, 2990, 835, 368, 476, 1089, 285, 2525, 42487, 2255, 285, 1821, 323, 295, 6678, 15120, 2825, 25767, 1690, 14284, 398, 13, 5823, 71, 13, 269, 22401, 13, 7435, 5524, 37229, 285, 1199, 625, 15, 380, 11730, 17603, 5453, 17209, 4768, 1270, 270, 902, 404, 285, 3400, 247, 4618, 2491, 273, 17603, 285, 24340, 9001, 285, 28977, 4712, 323, 11730, 13, 34929, 13, 270, 47035, 285, 31737, 1821, 285, 15, 7993, 24653, 14284, 398, 13, 1089, 1980, 14284, 398, 275, 268, 1715, 24653, 34535, 13926, 13, 253, 1682, 476, 7577, 34535, 2670, 13, 1089, 14284, 398, 2822, 368, 275, 268, 1715, 24653, 313, 2369, 2014, 1821, 10, 619, 6303, 285, 891, 15, 187, 187, 12599, 4370, 3390, 285, 14284, 398, 275, 268, 1715, 24653, 13, 42487, 1089, 1794, 14, 32813, 17581, 13, 11730, 390, 4951, 10798, 13, 16076, 25594, 6838, 13, 3511, 10753, 13, 1499, 14298, 285, 2014, 811, 5410, 3254, 323, 2825, 12716, 13, 16382, 13, 12939, 15, 4235, 272, 4924, 20313, 76, 556, 13241, 34535, 811, 5410, 3254, 16, 1206, 266, 32813, 84, 275, 634, 2170, 1339, 253, 2758, 387, 14284, 4924, 1614, 634, 5615, 46983, 715, 6612, 15, 2164, 1345, 5053, 835, 11730, 1821, 5385, 1701, 247, 50215, 590, 2892, 273, 11730, 747, 340, 1064, 1364, 2486, 253, 8935, 1930, 268, 4670, 1905, 247, 11730, 627, 403, 18660, 273, 11730, 13597, 11222, 275, 15, 19757, 1821, 275, 268, 1715, 24653, 13, 428, 2443, 3022, 2443, 3022, 310, 247, 13597, 5147, 835, 368, 476, 1089, 2014, 1821, 275, 268, 1715, 24653, 13, 253, 1390, 2067, 1107, 359, 452, 13037, 3290, 10104, 273, 268, 1715, 24653, 15, 187, 187, 23852, 24653, 434, 1682, 2233, 6, 1959, 11730, 13597, 2670, 971, 281, 2525, 2014, 11730, 1821, 275, 268, 1715, 24653, 13, 14642, 5629, 278, 33202, 19, 434, 11730, 268, 1715, 24653, 1436, 932, 403, 253, 1959, 285, 3477, 1039, 281, 1089, 643, 268, 1715, 24653, 15, 443, 698, 68, 1751, 2061, 310, 323, 253, 11730, 11277, 1815, 414, 13, 16920, 634, 7314, 588, 1900, 320, 2233, 6, 1959, 7140, 27, 512, 7223, 27, 8935, 298, 4199, 1754, 33352, 2130, 323, 275, 14, 4065, 84, 285, 562, 14, 4065, 84, 987, 1024, 891, 1353, 247, 15, 754, 4288, 14041, 265, 288, 1136, 84, 299, 7564, 16750, 4288, 285 ]
Contest with a short story. Warren earned an associate of arts degree from Stephens College in Columbia, Missouri in 1955, then a bachelor of arts in English in 1957 from Manhattanville College in Purchase, New York. Career In 1957, she married Ukrainian emigre poet Yuriy Tarnawsky. Through her marriage, she learned the Ukrainian language and became associated with a group of young Ukrainian emigre poets who became internationally known as the New York Group. As a part of their publishing collective, she began writing and publishing poetry in Ukrainian. In 1959, Warren was employed by Reader's Digest and worked there for 21 years; she became an editor of both the magazine and the Condensed Book Club. Her first novel The Last Centennial was published by Dial Press in 1971, under the pen name Patricia Kilina, which she also used for her Ukrainian-language poetry. The book was described by Library Journal as "an impressive first novel... almost Faulknerian in its depiction of the despoiling inheritors." She divorced Tarnawsky in 1973 and left the New York Group shortly thereafter. Books In 1974 Warren published her second novel, The Front Runner. Told from the point of view of a gay track coach, the story chronicled his struggle to get a talented openly gay runner on the U.S. Olympic team, and to quash his own growing love for his protegé. The controversial book was the first contemporary gay fiction to make The New York Times Best Seller list. The book sold ten million copies and was translated in ten languages. Two decades later, Warren added two sequels, Harlan's Race (1994) and Billy's Boy (1996). Warren also came out as lesbian in 1974. As a runner herself, Warren was in 1968 one of the first women to participate in the Boston Marathon. She was part of a group who achieved wider recognition in the U.S. for female marathon runners. In 1976, Warren published her third novel, The Fancy Dancer. It is the story of a rookie priest in a dying rural parish who falls in love with a proud, gay half-breed with a criminal record and "unlawful desires." It was the first bestseller to portray a gay priest and to explore gay life in a small town. In 1978, came Warren's fourth novel, The Beauty Queen. Also published by Morrow, this book was set in the New York City world where she'd spent many years. The story focused on a socially prominent Manhattan businessman, a closeted gay father trying to get up the courage to come out to his daughter, who had become a fiercely anti-gay born-again Christian politician. Later career In 1980, Warren left employment at the Digest to become a full-time writer. She moved back out West to pursue research on her next novel, a Western historical opus. It appeared from Ballantine in 1991 under the title One Is the Sun. Eventually settling in southern California, she made the decision to go independent with book publishing. The result was Wildcat Press, which has published all her books since, including her 2001 novel, The Wild Man, inspired by her years in Spain; she had traveled there regularly during Francisco Franco's regime when she was liaison to the Digest's Spanish edition. During the 1990s, Warren became more active politically. In 1996-99, as a result of her concerns for LGBT youth, she volunteered as a commissioner of education in the Los Angeles Unified School District, serving on the Gay & Lesbian Education Commission and later the Human Relations Education Commission. In 2006, Warren hired veteran political consultant Neal Zaslavsky and announced her candidacy for City Council in West Hollywood, CA. Warren was unsuccessful in her run. Warren died on February 9, 2019 at the age of 82 at UCLA Medical Center in Santa Monica after almost a three year battle with lung cancer. In June 2019, Warren was one of the inaugural fifty American “pioneers, trailblazers, and heroes” inducted on the National LGBTQ Wall of Honor within the Stonewall National Monument (SNM) in New York City’s Stonewall Inn. The SNM is the first U.S. national monument dedicated to LGBTQ rights and history, while The Wall’s unveiling was timed to take place during the 50th anniversary of the Stonewall riots. Bibliography A Tragedy of Bees (1960) — in Ukrainian Legends and Dreams (1964) — in Ukrainian Pink Cities (1969) — in Ukrainian The Last Centennial (1971) LOC#77-163583 The Front Runner (1974) The Fancy Dancer (1976) The Beauty Queen (1978) One is the Sun (1991) Harlan's Race (1994) Billy's Boy (1997) The Wild Man (2001) My West: Personal Writings on the American West (2011) References Category:1936 births Category:2019 deaths Category:20th-century American novelists Category:21st-century American novelists Category:American women novelists Category:Lambda Literary Award winners Category:Lesbian writers Category:LGBT writers from the United States Category:LGBT journalists from the United States Category:LGBT novelists Category:LGBT people from Montana Category:Ukrainian–English translators Category:20th-century American women writers Category:21st-century American women writers Category:20th-century translators Category:21st-century translators Category:Manhattanville College alumni Category:People from Helena, Montana Category:People from Deer Lodge, Montana Category:Writers from Montana Category:American women non-fiction writers Category:20th-century American non-fiction writers Category:21st-century American non-fiction writersQ: SQL Server 2005 - Nested recursive query :( I have a query that I need to execute that I do not know how to structure. I have a table called Employees. I have another table called Company. There is a third table called Files. As you can imagine, a Company has Employees, and Employees have Files. I need to list out all of the Employees in my database. The challenge is, I need to list the total number of Files in the same company as the Employee. I have tried variations on the following without any luck: SELECT e.FirstName, e.LastName, e.Company, (SELECT COUNT(*) FROM Files f WHERE f.EmployeeID IN (SELECT [ID] FROM Employees e2 WHERE e2.CompanyID=e.CompanyID)) as 'FileCount' FROM Employees e What am I doing wrong? Thank you! A: Try this: SELECT e.FirstName, e.LastName, e.Company, ( SELECT COUNT(*) FROM Files f JOIN Employees e2 ON f.EmployeeID = e2.id WHERE e2.CompanyID = e.CompanyID ) as 'FileCount' FROM Employees e West peterborough single gay men Gay cruising areas peterborough - map view crowd: all sorts, you can see lots of young guys, skaters, as well as older men orton mere , peterborough car park surrounded by bushes it. Contacts in peterborough tip: for better search results do a local search instead opline68 sorry idont have any pics yet comming soon i hope but i will show on skype ,because of time. Peterborough's best dating site for gay men meet gay men from peterborough 100% free. Adult social sex network where you can find and meet uk women and men for nsa casual sex encounters including swingers, mmf, ffm, fuck buddies and much more. The gay outdoor club operates throughout great britain and provides a wide range of outdoor and indoor sports and recreational activities for gay, lesbian, bisexual and transgender men and. Peterborough swingers, find local swingers in peterborough swinging heaven, the best canadian swinging site, find swingers near you in peterborough (no single men) my master and i. Local dogging and swingers in peterborough, uk find bi-sexual couples, gay or straight males, dirty sexy girls, hot females, sluts and single transvestites for sex contacts, meets, chat. Swingfreecouk has genuine swinging transvestites/transexuals in your area let the members at swingfree turn your sexual fantasies into reality. 24 public places where gay men cruised a cursory history of gay new york must include the west side piers — a gay there are dozens of gay dating apps in. Single men in peterborough, - doulike doulike is a dating platform where you can find single men in peterborough, the last several years we have gathered quality profiles of peterborough. Peterborough's best 100% free gay dating site want to meet single gay men in peterborough, ontario mingle2's gay peterborough personals are the free and easy way to find other peterborough. Gaysceneorg is for the gay cummunity, posting your advert will always be 100% free category: all pages: west london based escort available for in-calls and out-calls right now i'm a. He travel merges hanns ebensten travel and
[ 2756, 187, 22096, 1397, 452, 644, 2502, 17799, 281, 23278, 5054, 2425, 275, 3672, 835, 253, 5020, 273, 3684, 45359, 3153, 15, 831, 3797, 15065, 281, 1329, 2806, 6264, 14768, 13, 253, 3585, 1562, 5837, 273, 9787, 21952, 275, 3874, 19794, 285, 253, 13701, 273, 247, 26469, 36946, 10980, 15, 7295, 310, 671, 3629, 253, 1318, 273, 10229, 285, 3238, 352, 15613, 980, 432, 1355, 2136, 285, 10239, 3993, 15, 18770, 789, 1335, 3198, 281, 320, 2218, 275, 1142, 273, 841, 3672, 281, 5416, 597, 452, 253, 1055, 327, 253, 6982, 359, 7703, 15, 2756, 187, 38453, 327, 253, 15199, 285, 7355, 2098, 13, 2208, 588, 2457, 885, 247, 2590, 5054, 3116, 5700, 1561, 253, 1735, 1643, 3618, 15, 831, 5700, 588, 3812, 327, 253, 1142, 9865, 9021, 326, 452, 644, 1160, 407, 3684, 45359, 327, 253, 5955, 2929, 4439, 407, 3313, 24209, 15, 2756, 187, 18431, 4243, 273, 253, 3116, 5700, 403, 2168, 275, 1659, 15, 2053, 2486, 849, 359, 476, 17084, 776, 8460, 13521, 13, 247, 3585, 1562, 1701, 9787, 5700, 275, 1329, 273, 2234, 3116, 19465, 285, 253, 13701, 273, 271, 48429, 10980, 342, 247, 2590, 2098, 281, 47122, 11319, 8149, 15, 18770, 789, 310, 30361, 281, 3157, 253, 11990, 285, 4796, 253, 2105, 273, 2509, 2136, 13, 347, 403, 6031, 281, 1551, 7818, 1375, 9633, 32447, 285, 5416, 326, 597, 1347, 1805, 275, 4804, 253, 2586, 457, 84, 3198, 15, 329, 2590, 5700, 281, 1659, 444, 3319, 297, 327, 247, 18380, 1854, 273, 7355, 310, 671, 1146, 2457, 1701, 15, 2756, 187, 3074, 436, 789, 310, 3192, 1659, 387, 247, 673, 672, 2208, 457, 84, 33129, 403, 762, 1270, 7372, 13, 285, 627, 310, 1077, 1652, 2316, 281, 2572, 9100, 390, 40770, 15, 831, 2097, 326, 359, 878, 281, 6947, 776, 3710, 5300, 625, 7060, 314, 13, 755, 8314, 273, 369, 85, 486, 285, 5333, 625, 5300, 281, 11319, 8149, 15, 2756, 187, 2374, 253, 806, 7216, 4131, 273, 1016, 1770, 13, 253, 19897, 3918, 285, 309, 2525, 342, 253, 7038, 273, 2136, 13, 18213, 285, 253, 3114, 8776, 281, 2278, 253, 7092, 273, 5593, 5821, 387, 1390, 807, 457, 84, 32254, 31692, 15, 3824, 4821, 2770, 310, 327, 2628, 8869, 285, 849, 359, 476, 4796, 253, 3904, 273, 952, 665, 403, 35700, 15, 2756, 187, 1147, 310, 2590, 326, 13, 347, 247, 2586, 13, 359, 403, 3192, 5882, 2250, 281, 1756, 253, 6982, 285, 2794, 7375, 15, 1292, 359, 878, 281, 513, 625, 281, 1614, 1841, 1475, 15, 844, 878, 281, 2457, 885, 247, 11088, 3116, 5700, 326, 3936, 512, 253, 789, 1146, 2218, 281, 1529, 1268, 15, 309, 717, 2176, 326, 342, 253, 3939, 10171, 273, 512, 19465, 273, 5948, 13, 436, 588, 320, 6786, 15, 2756, 187, 17967, 45359, 403, 4704, 281, 6054, 281, 253, 5691, 15, 2756, 187, 17277, 16995, 13, 535, 3220, 24207, 285, 23307, 3645, 19639, 187, 187, 13030, 8910, 187, 187, 8983, 15034, 187, 187, 1909, 504, 187, 187, 1147, 7819, 562, 326, 627, 457, 84, 690, 2238, 273, 7505, 275, 253, 4602, 875, 31198, 577, 15, 26, 15, 22, 313, 4280, 64, 1400, 2715, 10, 285, 253, 27430, 6896, 773, 9817, 668, 6409, 4758, 13, 594, 309, 452, 5176, 326, 432, 619, 2670, 323, 253, 2774, 13, 285, 18203, 27430, 6896, 1329, 670, 352, 15, 7243, 326, 4850, 4229, 13, 309, 588, 5386, 436, 1501, 285, 1091, 253, 6975, 6409, 15, 187, 187, 18281, 436, 27, 187, 187, 3039, 309, 806, 1119, 562, 326, 253, 1457, 14541, 1373, 44110, 38008, 8924, 84, 10039, 367, 2695, 12699, 313, 783, 2457, 12699, 273, 253, 4240, 14, 7798, 2952, 10, 369, 1469, 281, 320, 5859, 14, 33223, 731, 264, 13, 1690, 3440, 432, 8141, 14848, 13, 8141, 29024, 13, 23777, 46701, 274, 7667, 514, 3737, 313, 783, 3236, 10333, 84, 581, 13, 340, 333, 42678, 17464, 13, 3966, 15, 313, 4609, 309, 1158, 369, 896, 275, 4596, 10, 309, 3260, 309, 3078, 281, 564, 15, 1893, 247, 13571, 2427, 327, 619, 9449, 5730, 1618, 15, 187, 187, 3220, 4651, 497, 2238, 2217, 281, 755, 581, 323, 479, 13, 285, 309, 452, 644, 37774, 10437, 839, 436, 12699, 2455, 1580, 840, 15, 313, 4374, 13, 352, 369, 7964, 4409, 352, 2698, 187, 187, 1147, 457, 84, 644, 247, 1048, 2129, 323, 479, 1108, 309, 369, 2509, 271, 5271, 2531, 2006, 3628, 5370, 387, 253, 9462, 5271, 1204, 46177, 49566, 20958, 313, 47503, 4877, 10, 31692, 275, 29539, 436, 2129, 1108, 4278, 588, 320, 9269, 327, 6809, 7974, 24690, 72, 384, 689, 253, 1735, 1643, 1897, 1108, 285, 1694, 3965, 1199, 577, 3038, 273, 4600, 1016, 2360, 13, 1690, 1146, 598, 387, 374, 27, 1449, 717, 8360, 53, 436, 4131, 313, 262, 457, 84, 1335, 6794, 13, 984, 309, 6468, 457, 85, 4783, 281, 4600, 2568, 10, 281, 755, 281, 253, 13952, 323, 619, 20818, 1728, 15, 1292, 352, 369, 594, 4409, 352, 15, 187, 187, 42, 457, 306, 1694, 690, 7968, 323, 368, 313, 84, 5163, 323, 253, 3290, 582, 326, 309, 457, 620, 1501, 347, 4569, 347, 309, 564, 2112, 15, 187, 187, 2598, 13, 309, 457, 78, 2820, 281, 1501, 625, 7208, 969, 15, 1244, 352, 457, 84, 4162, 15, 1737, 310, 4162, 1929, 323, 32, 313, 1909, 504, 432, 5271, 1204, 773, 27031, 10640, 668, 31884, 593, 24909, 13, 326, 310, 15, 2064, 457, 84, 323, 6809, 7974, 24690, 72, 384, 2698, 187, 187, 2773, 457, 84, 987, 1108, 253, 806, 6874, 273, 8647, 6897, 2302, 56, 363, 15155, 2, 313, 7371, 21403, 309, 1646, 281, 452, 6571, 9269, 670, 275, 4162, 273, 8909, 1107, 2698, 187, 187, 2598, 436, 1770, 13, 309, 457, 78, 2378, 969, 1469, 896, 281, 619, 6897, 2302, 11465, 285, 2820, 281, 8416, 253, 24813, 273, 14736, 285, 44150, 15, 309, 3597, 281, 789, 327, 352, 1390, 807, 313, 328, 12566, 2920, 13, 2167, 309, 1158, 309, 4159, 577, 7223, 390, 594, 32, 582, 285, 896, 275, 4163, 273, 4104, 13, 285, 1904, 457, 85, 513, 1199, 840, 15, 187, 187, 1552, 807, 13, 309, 457, 78, 3192, 2120, 5750, 273, 8647, 6897, 2302, 457, 84, 3745, 281, 5206, 634, 1211, 2303, 285, 1511, 273, 2303, 15, 309, 4425, 281, 564, 323, 3387, 3038, 273, 14835, 285, 294, 17695, 1108, 285, 840, 4391, 326, 281, 374, 13, 8320, 2909, 313, 783, 1072, 673, 2978, 10, 984, 253, 773, 11964, 668, 1511, 2506, 457, 85, 1581, 323, 17711, 15, 1893, 253, 4736, 310, 5096, 2909, 247, 1388, 281, 1056, 619, 2303, 15, 187, 187, 3220, 4588, 4736, 310, 13, 273, 2282, 13, 281, 8416, 775, 81, 15, 854, 285, 513, 253, 294, 8510, 265, 273, 775, 793, 15, 898, 281, 1638, 13, 275, 1340, 281, 2686, 8416, 253, 24813, 594, 309, 476, 1265, 2444, 327, 2970, 352, 715, 247, 15452, 494, 1375, 15, 187, 187, 2598, 2080, 13, 309, 457, 78, 387, 1749, 2909, 273, 14835, 285, 294, 17695, 13, 285, 309, 1158, 309, 457, 306, 7303, 281, 755, 949, 690, 273, 619, 2972, 327, 775, 81, 15, 854, 15, 309, 878, 7609, 625, 2909, 3063, 281, 1056, 619, 4736, 28, 1469, 281, 923, 604, 309, 476, 457, 85, 8268, 326, 15, 187, 187, 2598, 13, 1339, 457, 84, 2312, 3063, 670, 10123, 15, 13658, 13, 670, 1841, 417, 281, 513, 275, 10123, 15, 313, 688, 643, 3000, 13, 690, 1841, 326, 1663, 270, 17584, 253, 2564, 2698, 187, 187, 2214, 690, 1921, 390, 1529, 13, 309, 6468, 457, 85, 2959, 247, 2257, 273, 10123, 323, 619, 269, 280, 326, 309, 651, 1067, 773, 85, 1811, 10123, 668, 390, 773, 1258, 482, 10123, 668, 313, 5658, 871, 253, 4394, 13, 597, 1265, 342, 13, 773, 1394, 457, 250, 271, 3098, 272, 28006, 1806, 285, 816, 755, 625, 9084, 29974, 800, 432, 627, 481, 496, 958, 13, 347, 2080, 347, 309, 476, 6983, 13, 309, 457, 306, 2959, 760, 767, 15, 2596, 2067, 1107, 3622, 327, 247, 2926, 309, 9269, 281, 42193, 17919, 313, 49987, 33223, 15, 8695, 457, 84, 773, 19164, 14459, 668, 7832, 582, 10646, 253, 37317, 19848, 479, 323, 417, 4028, 751, 3972, 13409, 9545, 1988, 15, 313, 19537, 33390, 27, 1621, 13, 309, 1053, 457, 85, 3630, 751, 779, 13, 984, 309, 717, 417, 779, 2, 496, 958, 13, 309, 1053, 457, 85, 3782, 751, 521, 4028, 3740, 13, 594, 309, 1053, 457, 85, 1014, 1611, 281, 3630, 751, 779, 13724, 1244, 253, 643, 581, 369, 1390, 6794, 15, 187, 187, 4125, 13, 436, 310, 417, 281, 1333, 326, 309, 1620, 4763, 4016, 10123, 15, 309, 513, 15, 313, 7834, 21883, 327, 619, 2159, 19517, 269, 280, 15292, 47890, 31674, 955, 2698, 6491, 1053, 457, 85, 751, 619, 6281, 285, 1928, 253, 878, 281, 2028, 479, 13, 390, 597, 3959, 479, 247, 29254, 13, 390, 5913, 1108, 4754, 13, 309, 457, 306, 1694, 9828, 273, 1110, 15, 1292, 954, 273, 253, 673, 13, 952, 403, 387, 1878, 30405, 342, 616, 10123, 281, 479, 13, 1014, 604, 597, 1053, 457, 85, 751, 253, 2926, 15, 1244, 309, 452, 247, 5026, 4808, 672, 352, 3249, 281, 2268, 4624, 273, 619, 4028, 15, 187, 187, 1552, 1436, 369, 17663, 2822, 30405, 13, 534, 310, 629, 273, 253, 1921, 309, 457, 78, 5698, 272, 670, 352, 1060, 15, 187, 187, 18281, 436, 27, 187, 187, 8693, 2129, 13, 309, 4159, 247, 1501, 327, 619, 5131, 20299, 670, 253, 12904, 273, 20993, 13, 849, 309, 2793, 20993, 285, 849, 309, 23808, 342, 352, 15, 187, 187, 1552, 310, 2139, 326, 1501, 2427, 598, 15, 187, 187, 1147, 369, 619, 27078, 466, 33782, 457, 84, 20915, 3063, 15, 187, 187, 510, 2021, 556, 644, 275, 13533, 323, 253, 2469, 2129, 1108, 1110, 273, 441, 3551, 432, 1977, 7244, 327, 253, 337, 296, 1108, 285, 359, 497, 627, 281, 923, 27078, 466, 33782, 1509, 15, 733, 457, 84, 644, 1077, 1892, 28, 703, 369, 619, 3392, 457, 84, 760, 5780, 40239, 13, 285, 253, 760, 35605, 2905, 6782, 432, 326, 5978, 5780, 275, 13533, 313, 1542, 253, 18729, 84, 285, 2021, 326, 3153, 1060, 481, 187, 187, 18281, 436, 27, 187, 187, 2598, 13, 1060, 359, 403, 387, 253, 990, 273, 6897, 2302, 56, 363, 15155, 4240, 15, 309, 452, 1912, 13, 323, 253, 818, 394, 673, 275, 884, 1107, 273, 2509, 6897, 2302, 15, 1292, 352, 3589, 457, 85, 3477, 436, 807, 15, 313, 42, 1007, 896, 13, 285, 309, 1158, 253, 760, 2069, 352, 369, 3477, 497, 4695, 14, 7199, 2698, 1244, 2866, 347, 368, 778, 452, 30346, 432, 253, 1390, 767, 9319, 13, 309, 858, 417, 8416, 1707, 2325, 49583, 15, 1292, 309, 1024, 452, 247, 1270, 2968, 625, 685, 309, 858, 281, 3135, 342, 13, 594, 352, 457, 84, 247, 2323, 23188, 15, 187, 187, 2598, 13, 1060, 359, 403, 15, 309, 7303, 281, 3330, 417, 3240, 407, 253, 4808, 273, 619, 9970, 313, 3529, 651, 320, 9880, 10873, 13, 352, 1146, 253, 1390, 1388, 323, 352, 481, 187, 187, 1552, 1390, 8857, 556, 644, 8615, 479, 247, 4344, 2372, 13, 594, 309, 369, 11926, 313, 3229, 3784, 619, 7126, 3159, 1385, 767, 1897, 3622, 10, 326, 309, 5082, 457, 85, 320, 2104, 281, 1056, 352, 13, 533, 1060, 359, 403, 2, 9375, 564, 562, 281, 657, 506, 4595, 285, 253, 643, 2758, 273, 253, 27218, 6897, 2302, 1387, 13, 323, 616, 1329, 285, 31868, 15, 187, 187, 2598, 13, 309, 457, 78, 12365, 3063, 342, 247, 3159, 1385, 273, 2456, 13, 15882, 3000, 15, 1292, 309, 457, 620, 1335, 320, 4028, 10873, 313, 42, 971, 326, 773, 39055, 3159, 1385, 323, 1884, 1897, 668, 32741, 42678, 285, 2779, 323, 253, 1735, 1770, 13, 327, 285, 745, 13, 347, 309, 1611, 281, 8416, 253, 806, 7482, 273, 1707, 2325, 49583, 15, 313, 8457, 642, 2647, 849, 1199, 309, 3078, 281, 13, 309, 1904, 457, 85, 8722, 281, 755, 1014, 2810, 281, 19083, 15, 309, 457, 69, 1333, 309, 457, 78, 670, 2716, 281, 608, 16, 26, 2218, 2698, 187, 187, 8061, 323, 1563, 479, 327, 436, 19876, 9455, 273, 619, 28081, 807, 273, 2509, 6897, 2302, 2, 187, 187, 2598, 13, 309, 9829, 1390, 2129, 457, 84, 1501, 15, 4276, 5970, 323, 326, 1108, 309, 369, 417, 1907, 253, 1682, 1643, 1897, 672, 352, 369, 1955, 13, 285, 840, 309, 4425, 281, 3343, 1919, 2057, 309, 457, 69, 7270, 598, 342, 253, 3264, 2264 ]
Funds have been redirected to stimulate economic activity in areas where the majority of South Africans live. This includes finance to support black commercial farmers, the revitalisation of industrial parks in townships and the establishment of a Township Economy Fund. Government is also increasing the value of goods and services it procures from small business and cooperatives. Much work still needs to be done in many of these areas to ensure they have the effect on the economy we seek. Building on the stimulus and recovery plan, government will finalise a clear economic growth strategy within the next few weeks. This strategy will draw on the many valuable contributions that have been made by South Africans on the discussion paper released by National Treasury. Several parts of the growth strategy are already in place. These include how we can strengthen our reform programme, a revitalised industrial strategy in support of key growth sectors and the establishment of an Infrastructure Fund with a clear plan to revive infrastructure investment. Much work is underway to improve the ease and reduce the cost of doing business, as are efforts to restructure state owned enterprises and ensure that they perform better in meeting the country’s needs. A clear strategy to place Eskom on a sustainable path of recovery is also being finalised. All this work is taking place at a time when government’s finances are under great strain, and there is very little room to increase spending or borrowing. This means that we need to spend our limited resources more smartly, get rid of wastage and shift more resources to infrastructure investment. On the first Monday morning of each month, the Deputy President and I meet with the leaders of business, labour and the community sector to review the implementation of measures agreed at last year’s Jobs Summit. Our continued focus is on job creation and how we can reduce the numbers of people who are unemployed. It is clear that, as a country, we are taking firm action to grow the economy and create jobs. But we need to do more to turn things around. We need to finalise a comprehensive growth strategy that takes all the work being done to another level. I am certain that with the active involvement of all sectors of society, this will be achieved. South Africans are ready to rise to the challenge. Best wishes, My Writing and Personal World…. Main menu Post navigation Aside It turns out that there’s some kind of bug in the connection between WordPress 4.9.5 (CA_EN version) and the Jetpack “Like” button setting, so I have removed that from my site for the moment, and contacted Jetpack support about it. Once that gets fixed, I will remove this post and return the Like button. Share this: When I first found out that the Newfoundland Symphony Orchestra‘s Spring Pops concert (the final concert of the 2017-2018 season) was going to be science-fiction themed, including music from Star Wars, Star Trek, Battlestar Galactica (the original 1970s one, yay!), ET, etc. (which I think was back in November) I knew I wanted to go. So a ticket went on my Christmas wish list. My parents were kind enough to get one for me, and I have been eagerly anticipating this concert ever since then. (Yes, it was definitely worth it.) It’s been a long week for me – I was doing an Autistic Adults panel at the Canadian Autism Spectrum Disorders Alliance (CASDA) Summit in Ottawa this week – details will be posted on tagÂûght over the next few days – and got pretty much 4 hours of sleep each night, including being up at 2:40 am EDT this morning (it’s still Friday, because I haven’t gone to sleep yet) to get to the airport for my flights home. But it was so worth it. I’ve got some pictures for you (sorry for the quality), that I’ll post as appropriate as I go along. So, I’m trying to post more frequently again. And it’s April. What is April known for? (Aside from Autism “Awareness” Acceptance Month, that is. That’s for tagÂûght.) That’s right – the first session of Camp NaNoWriMo! (Which lately I seem to have mostly posted about in April of odd years.) So this month, I’m once again going back to my NaNo roots and trying to finish the rewrite of Search and Rescue. I tried to work on it last year (unsuccessfully, though I think I wrote 4 pages or so?), and back in July of 2015, and didn’t do much then. This year, I’m taking full advantage of Camp NaNo’s ability to choose your own target and type of target. I decided to go for 40 hours of editing and rewriting – and then changed that to 2,400 minutes (the same time length) because the “hour” type doesn’t allow for fractions. So the goal is 80 minutes a day to make my target. My actual goal is, of course, to finish Chp. 8 and do the rewrites of Chps. 9 to 14, in order to actually finish the rewrite so I can start working on getting it into a publishable state. So far, I’m at 199 minutes of editing and rewriting, and I think I’ve managed to get through some of my block on Chp. 8. I need 41 more minutes today to make my goal; going to see if I can’t exceed that. So, let’s talk today about reviews. Specifically, about things not to do in reviews. (In other words, some things that really boggle the mind.) For some reason or another, I haven’t received a lot of reviews for my fic that I would call “troll reviews” or “flame reviews” (you know the ones, they start with, “You’re an effing idiot,” and just get more vituperative from there). In fact, as far as I can recall, I’ve received only two. One several years ago on a story I posted to FictionPress (Fanfiction.Net’s “original fiction” partner), wherein the reviewer abused me for not writing like Harlan Ellison. (Newsflash: No, I don’t write like him, because I am not him! In fact, I don’t particularly like his writing style, so I don’t even try to write like him!) And the other one was last Friday. Now, this is not to say that I never receive negative reviews. I do. (Particularly on my short HP fic DisciplineIssues.) People don’t like my stories and feel the need to tell me, or they offer me a critique, or whatever – yes, I’ve got plenty of those. But most of the time, people are at least polite with their reviews to me, even if they don’t like the story. And I have a thick skin when it comes to critiques of my writing. This person was nowhere near polite, which is part of the reason I’m venting about it here. Share this: Last week, I wrote a post on my Other Blog about the emotion of grief, how I experience grief and how I cope with it. This is why that post went up. It was my Auntie Barb’s funeral today. The family has been in Toronto for the past week – those of us coming from away arrived on the 1st – and we were there to see Auntie Barb pass. It’s been very hard; she was my father’s only remaining sibling, and the only biologically related adult from that generation remaining in Toronto (for the sibs and family that live here). Share this: So, here we are at the end of NaNoWriMo 2017. I have won, for the 7th time in 10 years of doing NaNo. But it wasn’t easy this year. (I look back, and I think the only times it was easy were 2008-2010.) And… as you may have guessed from the last two posts, I did not finish There Be Dragons. But I now have a great deal more than I did to begin with, so it’s a success nonetheless. So, here we are. I managed to win not quite by the skin of my teeth (that would be winning tomorrow, it being the last day for it). This last chapter has been fighting me a fair bit, so I was worried (despite my excellent word count two days ago) that I wouldn’t be able to make it, but here we are! Thanks go out to Vathara and the other members of the NL NaNo group, for their support and encouragement. So, I’m ending today with a word count of 50,157 words. But I’ll still be writing tomorrow (I want that “updated word count for 30 days” badge!), and likely for the next month, on and off, as I try to finish the first draft of There Be Dragons. (Because no matter how much I wanted to, I didn’t manage to get even close to finishing. I’d say I’m about half to 5/9 done.) Thanks for following me on this epic journey of my tenth year of doing NaNo! So, I missed last week’s post. Apologies for that – I was not having the best few days when it was due, and then I decided to wait until either I’d caught up with the expected total
[ 209, 187, 36, 16131, 659, 6356, 2146, 313, 49, 2354, 12062, 39318, 964, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 38833, 1454, 108, 38377, 43994, 19073, 9737, 5117, 9650, 2141, 21394, 3868, 43242, 3868, 7490, 24036, 5776, 37833, 22880, 4733, 26855, 19927, 10227, 9203, 5776, 12116, 37833, 30175, 13810, 9529, 43242, 21394, 20933, 10139, 22880, 4733, 24292, 33011, 5613, 13913, 17946, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 24292, 5676, 38377, 3868, 10139, 4654, 8520, 15, 1454, 234, 24292, 5676, 38377, 17186, 37677, 10139, 36684, 22206, 2141, 10977, 29346, 33627, 24292, 19927, 3147, 5898, 21394, 10977, 3955, 7136, 33887, 12116, 29346, 14439, 31008, 3147, 15234, 15902, 2863, 3955, 12388, 26867, 48911, 2599, 3952, 15234, 36796, 16962, 16287, 18184, 35691, 41620, 9650, 35280, 13810, 8361, 8348, 17186, 30175, 25628, 47851, 1454, 119, 3868, 9650, 11630, 2989, 23977, 44206, 17757, 16003, 10227, 7136, 17648, 17186, 8095, 9203, 17946, 35278, 36796, 8095, 2863, 3868, 8348, 32309, 28354, 5346, 5776, 9203, 16287, 3147, 30656, 35278, 17686, 29830, 5117, 38093, 42044, 139, 221, 5676, 7136, 48185, 5776, 2989, 3393, 5117, 22206, 7136, 1454, 99, 2141, 18951, 6450, 2863, 13, 9529, 11630, 3955, 12116, 15234, 2141, 23766, 25628, 45002, 2989, 22206, 10139, 30175, 29495, 6450, 16411, 5117, 20933, 4992, 18383, 5776, 11630, 16411, 44206, 4733, 18806, 5898, 4134, 25326, 11630, 3868, 16411, 44206, 4733, 15902, 2863, 40237, 38377, 3868, 40301, 15, 1454, 242, 34299, 25651, 11910, 9529, 2599, 7136, 9650, 37833, 11112, 2141, 4134, 27580, 26867, 13, 18383, 3147, 7136, 3147, 28434, 30175, 17686, 49929, 5776, 9203, 20933, 2989, 40237, 32681, 11112, 2141, 4134, 27580, 26867, 13, 17686, 29495, 6450, 44687, 10227, 2863, 47909, 11910, 3868, 47946, 29354, 4733, 35278, 25628, 29830, 4134, 2989, 2599, 14733, 4134, 10139, 18806, 48911, 2599, 17946, 9737, 5776, 9203, 7072, 9650, 8520, 15, 1454, 242, 2989, 9028, 11630, 21394, 30793, 17686, 18951, 6450, 4733, 32309, 18383, 5776, 11630, 4134, 16003, 3147, 30656, 37134, 16962, 24292, 36030, 7072, 9650, 2863, 4733, 18806, 24355, 49929, 5346, 33211, 10139, 24073, 9737, 12116, 2141, 3952, 40237, 7072, 33221, 32681, 18383, 3147, 7136, 3147, 15234, 13, 24355, 26855, 5776, 25326, 7072, 10139, 11112, 3393, 10227, 2863, 31008, 3147, 15234, 13, 16962, 2989, 29495, 29346, 17648, 3955, 28649, 12388, 34500, 26855, 3955, 5346, 8520, 5776, 34500, 13, 24355, 41878, 9650, 24745, 21394, 17186, 24073, 9028, 30793, 3147, 33221, 5898, 5776, 2989, 3393, 5117, 22206, 33221, 45002, 2989, 22206, 33221, 18806, 36796, 11112, 2989, 3393, 10977, 3147, 10139, 20853, 9203, 17757, 14439, 15, 1454, 242, 26855, 21027, 5776, 12388, 7136, 4733, 28354, 139, 222, 16287, 25326, 7072, 29346, 3955, 7136, 4733, 32309, 28354, 5346, 5776, 9203, 44687, 30656, 30175, 36796, 24292, 17648, 5215, 14, 6622, 37134, 374, 575, 32149, 575, 3393, 48614, 2599, 575, 3393, 5117, 49100, 13, 4654, 2863, 25326, 3147, 7136, 21227, 36796, 8095, 17946, 7072, 17757, 22206, 8348, 8095, 2863, 3868, 8348, 13, 24036, 4134, 33011, 9737, 6450, 44687, 16962, 29830, 4134, 6450, 2599, 14733, 16287, 4733, 13, 38833, 9737, 20933, 2141, 3952, 17648, 10977, 27435, 3147, 35278, 48002, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 41878, 4134, 17946, 7072, 17757, 16411, 11630, 33629, 4733, 24073, 29830, 138, 232, 15, 187, 138, 98, 16003, 3147, 17686, 31008, 2141, 32681, 11112, 2989, 3393, 10977, 3147, 26867, 9529, 9650, 9203, 41783, 15234, 18806, 22880, 13803, 12388, 2141, 6450, 8520, 24073, 1454, 235, 2141, 5776, 8348, 3868, 38444, 13, 35691, 41620, 9650, 3393, 30656, 9028, 30793, 21027, 22206, 10139, 23977, 44206, 17757, 16003, 10227, 2863, 22206, 10139, 9529, 43242, 21394, 20933, 4992, 30175, 13810, 9529, 11630, 19927, 30303, 4992, 5898, 5776, 2989, 3393, 5117, 22206, 26867, 26855, 3955, 12116, 15234, 2989, 26867, 23766, 5613, 34299, 14439, 9028, 29354, 17648, 13, 26855, 3955, 44687, 21394, 43994, 3955, 5346, 2141, 21027, 31008, 3147, 15234, 26855, 3955, 12116, 15234, 2989, 26867, 9737, 30656, 3952, 12388, 33221, 9529, 9650, 9203, 41783, 33011, 13, 18806, 26855, 3955, 18951, 16003, 9650, 33221, 40647, 11112, 2989, 3393, 10977, 3147, 24745, 4733, 16962, 36003, 27580, 29346, 3955, 27435, 4733, 32309, 24292, 9650, 35280, 9529, 9650, 9203, 17186, 23766, 25628, 5898, 5776, 2989, 3393, 18184, 1454, 108, 17686, 13803, 6450, 5676, 10298, 2863, 24073, 1454, 235, 2141, 5776, 8348, 3868, 38444, 15, 37849, 16003, 3147, 17686, 31008, 2141, 37677, 7136, 3147, 41878, 2599, 6450, 38377, 30656, 24355, 23766, 34299, 10227, 2141, 22880, 23871, 9203, 28649, 16003, 4733, 22880, 28354, 139, 222, 16287, 25326, 7072, 29346, 3955, 27435, 1108, 337, 575, 45316, 13, 22, 575, 3393, 48614, 2599, 15, 575, 3393, 5117, 49100, 13, 9737, 5676, 32681, 16962, 16287, 6450, 15234, 337, 575, 44985, 13, 22, 575, 3393, 48614, 2599, 15, 575, 3393, 5117, 49100, 41878, 2599, 6450, 38377, 30656, 9529, 21227, 4733, 5898, 5776, 2989, 3393, 5117, 22206, 34500, 26855, 3955, 12116, 15234, 6450, 28434, 15, 29830, 4134, 2989, 4134, 5776, 9203, 28649, 13, 16962, 21394, 3868, 31008, 19927, 23977, 3952, 10139, 17757, 14439, 41878, 2599, 9203, 49626, 5676, 27580, 40647, 5613, 3393, 9650, 3147, 12388, 10139, 18806, 11112, 36204, 12388, 4992, 22206, 10139, 47909, 10227, 14733, 3955, 10139, 13, 40146, 21394, 43994, 3955, 5346, 2141, 21027, 31008, 3147, 15234, 32681, 9529, 9650, 3393, 22206, 26867, 23766, 17686, 28354, 3868, 7490, 4134, 12388, 7136, 11112, 2141, 4134, 27580, 26867, 15, 187, 138, 234, 23977, 44206, 17757, 16003, 10227, 2863, 22206, 10139, 9529, 43242, 21394, 20933, 4992, 30175, 13810, 26855, 5776, 25326, 7072, 10139, 11112, 3393, 10227, 2863, 31008, 3147, 15234, 9529, 9650, 3393, 22206, 8348, 23766, 17686, 3147, 36684, 2599, 6450, 5676, 2599, 5117, 16287, 24073, 5898, 5776, 2989, 3393, 40301, 42191, 40146, 21394, 5346, 8348, 5776, 25326, 3147, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 33887, 36204, 10977, 9203, 17648, 17186, 9529, 33627, 38444, 23766, 13850, 3147, 13913, 40237, 19927, 17686, 16962, 12388, 2863, 3868, 11630, 3868, 17648, 17757, 37134, 9529, 4992, 17757, 3147, 22206, 10139, 15, 37849, 9650, 3393, 10227, 7136, 3147, 3925, 6, 22880, 24036, 5776, 8520, 23977, 3952, 10139, 17757, 16003, 4733, 8095, 4992, 7072, 2141, 26097, 11910, 30175, 48002, 11112, 2989, 3393, 10977, 3147, 24745, 4733, 26855, 3955, 12116, 15234, 6450, 28434, 5898, 5776, 2989, 3393, 40301, 13, 18806, 37134, 9529, 7490, 3868, 2599, 7136, 19073, 41878, 3868, 12116, 2141, 5776, 6450, 3868, 43005, 40557, 13850, 26097, 3393, 30656, 5898, 20933, 36204, 16287, 6450, 4992, 17186, 22880, 9028, 30793, 21027, 22206, 27435, 23977, 3952, 10139, 17757, 16003, 4733, 18806, 11112, 6450, 5676, 10298, 4992, 36684, 8348, 4134, 2599, 5117, 20933, 4992, 15, 187, 36, 1513, 257, 1879, 12727, 8464, 860, 29350, 13, 39318, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 4654, 2863, 25326, 3147, 7136, 21227, 37677, 10139, 37134, 4654, 18184, 8095, 28832, 7490, 44206, 26855, 25651, 10139, 17648, 17186, 13, 18383, 10977, 13913, 4733, 16962, 2989, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 28354, 2863, 4134, 22206, 34500, 49456, 24292, 9650, 35280, 9737, 7072, 5676, 21394, 10977, 24745, 5898, 5676, 7136, 3955, 4992, 13, 8095, 29346, 16411, 11630, 7490, 40557, 8095, 41620, 47403, 19073, 9737, 7072, 5676, 3952, 26097, 43005, 25628, 24292, 5676, 38377, 17186, 24073, 9028, 15, 575, 998, 6356, 2146, 209, 33011, 24292, 19927, 28354, 38929, 4134, 22206, 7136, 48911, 2599, 14733, 13, 5898, 29704, 8348, 38833, 1454, 108, 38377, 43994, 19073, 9028, 42313, 7490, 16962, 21394, 3868, 31008, 3147, 28434, 35691, 17946, 17648, 3952, 10139, 33629, 4733, 13, 23766, 3952, 12388, 34500, 35278, 48002, 16962, 16287, 6450, 28434, 26855, 3955, 4134, 6450, 4134, 2599, 35280, 23766, 9737, 5676, 24745, 3147, 28434, 32309, 41878, 2599, 11630, 4134, 7490, 41783, 16962, 9028, 15, 29830, 4134, 6450, 2599, 14733, 16287, 4733, 15, 187, 12507, 3393, 11630, 16411, 14733, 3147, 13, 49456, 26855, 3955, 12116, 15234, 27435, 18951, 29495, 6450, 38444, 40557, 36796, 48911, 2599, 17946, 22880, 11112, 12388, 2599, 11630, 8520, 427, 42582, 5307, 38833, 8095, 41620, 47403, 19073, 23977, 44206, 17757, 16003, 10227, 2863, 17648, 10977, 27435, 3147, 48911, 3868, 7490, 32681, 8095, 7136, 3952, 15234, 24073, 43666, 138, 228, 138, 243, 15, 37849, 9650, 3393, 22206, 8348, 13, 38833, 1454, 108, 38377, 43994, 19073, 5898, 19927, 12116, 3393, 3952, 10977, 13913, 40647, 37677, 7136, 32309, 9737, 6450, 44687, 37677, 7136, 17686, 43666, 30793, 21027, 5346, 27435, 5776, 36204, 47607, 24292, 5676, 38377, 17186, 378, 2381, 463, 9529, 9650, 3393, 22206, 8348, 23766, 48002, 11112, 4992, 40237, 3868, 36204, 21027, 3955, 12388, 34500, 28354, 2863, 4134, 22206, 34500, 15, 187, 51, 6859, 26269, 86, 860, 33383, 50218, 13, 39318, 43666, 11630, 21394, 3393, 40399, 28832, 3393, 10227, 37097, 13, 38833, 1454, 108, 38377, 43994, 19073, 47909, 3393, 9650, 6450, 3868, 7490, 8095, 42313, 7490, 14, 5676, 8348, 2599, 7490, 35278, 25628, 5613, 3393, 36030, 5117, 14439, 18184, 8095, 28832, 14439, 17186, 24073, 9028, 15, 1879, 12727, 15, 13803, 30681, 1454, 124, 9203, 38093, 30175, 2599, 6450, 24355, 9028, 30793, 3147, 10139, 45002, 2989, 22206, 10139, 23766, 22880, 4733, 23871, 2989, 7072, 7136, 16411, 3952, 37833, 8095, 7136, 3952, 37833, 37134, 5898, 5676, 21394, 5346, 13913, 4733, 9737, 5676, 24745, 41451, 32309, 45002, 36204, 3952, 5676, 24745, 30656, 35278, 5898, 2989, 43242, 17757, 14439, 9028, 8348, 38377, 9737, 6450, 10227, 37833, 15, 48185, 27718, 37677, 10139, 25628, 1454, 107, 16287, 30303, 4992, 13, 4654, 2863, 25326, 3147, 7136, 21227, 9737, 6450, 3955, 10298, 8095, 17946, 7072, 17757, 22206, 8348, 9737, 5117, 7072, 3147, 13913, 3955, 15234, 30175, 17686, 24292, 36003, 2863, 24073, 9737, 2989, 17186, 7072, 10139, 2599, 3952, 14858, 4733, 1108, 7136, 4134, 33011, 13850, 3147, 7490, 34299, 25651, 11910, 24355, 1454, 109, 10227, 14858, 1253, 5898, 29346, 10977, 8348, 21027, 3955, 10298, 33887, 16287, 9650, 37097, 7490, 31008, 41451, 19073, 9737, 5676, 12116, 29354, 3868, 7490, 4654, 18184, 9529, 11910, 29354, 35691, 17946, 17648, 3952, 10139, 41783, 15234, 13, 1454, 108, 4654, 8348, 5776, 25326, 3147, 41878, 12116, 15234, 2989, 26867, 13, 40647, 9529, 9650, 9203, 17186, 23766, 17686, 9028, 24745, 18951, 21027, 32309, 9737, 7072, 5676, 34299, 49626, 45133, 47607, 49929, 2599, 14733, 4134, 10139, 18806, 17686, 16962, 16287, 6450, 2863, 8095, 28832, 5676, 11910, 30656, 19073, 5613, 3393, 10977, 24745, 40647, 209, 30303, 4992, 47946, 47946, 3952, 18184, 5898, 11630, 21394, 2863, 15, 187, 138, 228, 19927, 12116, 9203, 14733, 3955, 10298, 26855, 7072, 45133, 5676, 21394, 31008, 19927, 9529, 21227, 4733, 5613, 14733, 16287, 25326, 7072, 6450, 28434, 721, 13, 898, 13, 1903, 13, 1249, 18806, 2145, 13, 48002, 16962, 16287, 6450, 28434, 38833, 9529, 9650, 33211, 2989, 8348, 3868, 7490, 47851, 47909, 16003, 3955, 18184, 15, 37849, 16003, 8095, 43994, 6450, 3868, 36204, 5898, 5117, 16003, 11630, 22880, 18383, 21027, 3147, 29346, 3955, 27435, 13, 18806, 24292, 9650, 28649, 14439, 4733, 29495, 6450, 7072, 3147, 7490, 17186, 32681, 9737, 5117, 3393, 36003, 3393, 22206, 26867, 47909, 3393, 47403, 26867, 32681, 11112, 2989, 3393, 10977, 3147, 26867, 26855, 3955, 12116, 15234, 2989, 26867, 9529, 21227, 4733, 40146, 21394, 12116, 9203, 3952, 11910, 28434, 24073, 43666, 30793, 3147, 7136, 17648, 14439, 4733, 24036, 3868, 28649, 5898, 47946, 29354, 25628, 5898, 4134, 40051, 9650, 7136, 38929, 17186, 13, 18383, 14439, 21027, 13913, 13810, 20853, 9203, 17186, 24073, 29830, 4134, 2989, 2599, 14733, 4134, 33221, 29495, 6450, 22880, 20853, 9203, 17757, 16003, 4733, 15, 1454, 234, 41878, 43242, 44206, 17186, 24073, 5898, 4134, 40051, 9650, 7136, 38929, 38444, 37134, 24292, 19927, 4733, 26855, 7072, 45133, 5676, 21394, 31008, 21027, 4733, 9529, 2599, 7136, 9650, 2863, 4733, 32309, 49456, 5898, 3955, 12116, 29346, 5346, 4992, 16411, 6450, 18383, 3147, 24745, 4733, 15, 1454, 242, 18383, 10977, 2863, 21394, 3868, 3955, 7136, 4733, 5898, 5117, 16003, 11630, 22880, 9529, 2599, 7136, 9650, 8520, 23977, 7490, 34299, 4733, 13810, 209, 44206, 43242, 5898, 19927, 47946, 29354, 24073, 43666, 30793, 3147, 7136, 17648, 14439, 4733, 13, 24036, 4134, 33011, 17686, 9028, 42313, 11910, 24355, 9028, 15, 659, 6356, 2146, 13, 38833, 4654, 16287, 14733, 11630, 41783, 19073, 37134, 23871, 8348, 10977, 2863, 4733, 15, 29830, 35245, 4654, 18184, 5898, 20933, 2989, 9203, 4134, 10298, 41451, 49929, 10977, 5117, 3955, 18184, 13, 5898, 29704, 8348, 49456, 9737, 3955, 4134, 6450, 4134, 2599, 11910, 42191, 40146, 10227, 6450, 2863, 9737, 12116, 2141, 3952, 40237, 7072, 33221, 24073, 43666, 138, 228, 138, 243, 18806, 49929, 4134, 5776, 9203, 28649, 49456, 8095, 29346, 16411, 11630, 7490, 40557, 37134, 24292, 19927, 4733, 209, 37097, 2141, 5776, 29346, 22206, 7136, 4733, 9529, 2599, 7136, 9650, 2863, 4733, 15, 187, 138, 223, 3868, 28649, 5898, 47946, 29354, 13810, 26855, 5776, 25326, 7072, 10139, 42191, 2989, 9650, 24745, 15234, 30175, 17686, 427, 42582, 5307, 13, 24036, 4134, 33011, 28354 ]
Catherine Stihler (PSE ),    . Κύριε Πρόεδρε, θα ήθελα να ευχαριστήσω όλους τους συναδέλφους για τη στήριξή τους έως τώρα όσον αφορά την έκθεσή μου. Η έκθεση αυτή αντικαθιστά έναν αριθμό υφισταμένων νομικών μέτρων τα οποία παρέχουν τη βάση για την εν ισχύι χρηματοδότηση πέρα από τα ποσά που προβλέπονται από το Ευρωπαϊκό Αλιευτικό Ταμείο, σύμφωνα με την πολιτική για επίτευξη καλύτερης και απλούστερης νομοθεσίας. Ορίζει στόχους δαπανών, κανόνες για το επιλέξιμο των δαπανών, το επίπεδο συνεισφοράς από την Επιτροπή και μέτρα ελέγχου. Οι κύριοι τομείς που καλύπτονται είναι ο έλεγχος και η επιβολή της εφαρμογής των κανόνων, η συλλογή δεδομένων, οι επιστημονικές συμβουλές, η διαχείριση της κοινής αλιευτικής πολιτικής και τα διεθνή θέματα. Ο συνολικός προϋπολογισμός που προβλέπεται για τα έτη 2007-2013 είναι 2 625 εκατ ευρώ, μολονότι τα πραγματικά ποσά, όπως είπε ο Επίτροπος, θα εξαρτηθούν από τις δημοσιονομικές διαπραγματεύσεις της ΕΕ. Στον τομέα των διεθνών σχέσεων και του Δικαίου της Θαλάσσης, παρέχεται κοινοτική χρηματοδοτική στήριξη για τη σύναψη αλιευτικών συμφωνιών με τρίτα κράτη, συμπεριλαμβανομένων συμφωνιών εταιρικής σχέσεως, και συμμετοχής σε διεθνείς οργανισμούς που έχουν σχέση με την αλιεία ή το Δίκαιο της Θαλάσσης. Στον τομέα αυτόν διατίθεται η μερίδα του λέοντος του προϋπολογισμού – 1 529,5 εκατ. ευρώ, εκ των οποίων 1 522,5 εκατ. ευρώ διατίθεται στις αλιευτικές συμφωνίες. Επιπλέον, ορισμένα χρήματα διατέθηκαν σε τεχνική και διοικητική συνδρομή, περιλαμβανομένων των σχετικών με το προσωπικό δαπανών. Η χρηματοδοτική στήριξη για τη συλλογή δεδομένων σχετικά με τον αντίκτυπο της αλιείας στο περιβάλλον όσον αφορά την υιοθέτηση στάσης με γνώμονα το οικοσύστημα είναι σημαντική. Σχεδόν 60% του όλου χρήματος πηγαίνει για τις διεθνείς συμφωνίες αλιείας, και είναι σωστό να διασφαλίσουμε ότι γίνεται αξιοποίηση του κοινοτικού χρήματος και δίκαιη ανάπτυξη. Carmen Fraga Estévez,    Κύριε Πρόεδρε, μολονότι αυτή είναι μία πρόωρη συζήτηση, καθώς οι δημοσιονομικές προοπτικές δεν έχουν εγκριθεί ακόμη, πιστεύω ότι πρέπει να εγκρίνουμε την έκθεση της κ. Stihler ως ένα προληπτικό μέτρο, αλλά θα ήθελα να κάνω ορισμένες παρατηρήσεις, μερικές από τις οποίες συμπίπτουν με εκείνες που διατύπωσε ο κ. Επίτροπος. Δεύτερον, δεν συμφωνούμε επίσης ότι τα μέτρα του δικτύου Natura 2000 θα πρέπει να χρηματοδοτηθούν μέσω των πόρων της ΚΑΠ. Σχετικά, θα ήθελα να αναφερθώ σε αυτό που είπε αυτό το Κοινοβούλιο στην έκθεση Böge σχετικά με τις δημοσιονομικές προοπτικές. Rosa Miguélez Ramos,    Κύριε Πρόεδρε, θα ήθελα να συνεχίσω πάνω-κάτω από την τελευταία πρόταση της κ. Fraga. Δεν ξέρω γιατί η κοινή πολιτική με τους λιγότερους πόρους είναι ακριβώς εκείνη που πολιορκείται από αιτήματα κάθε είδους. Από αυτή την άποψη, μολονότι είμαι πραγματικά ευγνώμων για το έργο της εισηγήτριας –όπως γνωρίζει η ίδια– αισθάνομαι υποχρεωμένη να εκφράσω μία σειρά παρατηρήσεων, ή μάλλον διαφωνιών, σε σχέση με το κείμενο που εγκρίθηκε στην επιτροπή και το οποίο πρόκειται να τεθεί σε ψηφοφορία αύριο. Αναφέρομαι συγκεκριμένα στις τροπολογίες 6, 9, 11, 12 και 13, τις οποίες θα σχολιάσω εν συντομία. Στο πλαίσιο αυτού του κανονισμού, και έχοντας επίγνωση των ευεργετικών συνεπειών των διεθνών συμφωνιών στις περιφέρειες της Κοινότητας όσον αφορά την απασχόληση, κατανοώ τη θέση της Επιτροπής επί του θέματος. Η διατήρηση της απασχόλησης είναι ένας συγκεκριμένος στόχος που δεν αμφισβητεί κανείς. Ο καθορισμός αυτού του στόχου χωρίς τη ρητή αναφορά της Κοινότητας, όπως το κάνει η κ. Stihler, θα μπορούσε να είναι λάθος. Είναι μία αξιέπαινη επιθυμία, αλλά δεν εμπίπτει στο πεδίο εφαρμογής της ΚΑΠ και επιπλέον δεν πιστεύω ότι είναι ένας ρεαλιστικός στόχος. Όσον αφορά τη συλλογή στοιχείων για το Natura 2000, όπως προ
[ 13, 1283, 805, 15, 380, 1533, 369, 7753, 18197, 762, 187, 783, 340, 3136, 273, 32436, 434, 48320, 15, 1284, 247, 772, 17888, 323, 253, 29281, 187, 2913, 13, 2210, 253, 17053, 7203, 15, 28679, 13, 21327, 13, 285, 479, 16044, 13, 497, 187, 498, 324, 275, 5389, 27553, 459, 28, 12405, 497, 30601, 272, 13, 285, 11260, 497, 187, 4093, 272, 11678, 283, 9154, 387, 22200, 7382, 6121, 13, 534, 4377, 26485, 187, 23684, 20975, 25534, 281, 1067, 521, 346, 713, 5849, 21131, 937, 533, 534, 187, 2666, 369, 521, 2419, 273, 43841, 15, 2058, 22200, 7382, 6121, 13, 26485, 7252, 187, 10178, 5262, 1142, 285, 5211, 7203, 1897, 342, 11628, 7406, 66, 28, 285, 672, 703, 187, 4238, 342, 779, 387, 436, 2586, 14, 36443, 13, 352, 369, 6296, 247, 11284, 21131, 15, 187, 187, 510, 17874, 285, 5389, 19538, 369, 671, 1024, 387, 22200, 7382, 6121, 13, 533, 187, 783, 6963, 760, 3543, 617, 3361, 283, 248, 320, 13028, 617, 642, 625, 15, 4058, 49570, 187, 2013, 7969, 285, 25507, 22569, 574, 25368, 13, 347, 671, 617, 256, 21144, 285, 187, 84, 2066, 2158, 28, 617, 50223, 2927, 574, 4581, 11654, 13, 285, 617, 7353, 11233, 187, 1033, 3136, 642, 625, 15, 1500, 369, 1335, 387, 22200, 7382, 6121, 13, 533, 760, 347, 247, 187, 49017, 339, 15, 380, 6963, 574, 617, 278, 666, 1306, 360, 33230, 275, 253, 4766, 273, 253, 187, 72, 6702, 15, 3856, 2242, 617, 44596, 13, 285, 2316, 574, 644, 1669, 323, 1529, 13, 347, 187, 32655, 254, 781, 7252, 6034, 281, 1234, 583, 581, 1388, 387, 253, 1930, 273, 521, 187, 24525, 8901, 15, 187, 187, 4509, 253, 673, 326, 253, 19538, 434, 4558, 574, 644, 17063, 627, 283, 187, 4064, 326, 1388, 273, 44089, 285, 12330, 283, 783, 6963, 1925, 22200, 7382, 6121, 187, 2369, 3356, 521, 346, 713, 5849, 21131, 449, 733, 369, 7613, 28287, 247, 26908, 13, 835, 521, 187, 38472, 1632, 285, 2389, 497, 14205, 15, 11706, 13, 344, 10490, 281, 3464, 627, 13, 323, 187, 262, 4455, 281, 779, 347, 2167, 344, 3543, 253, 3361, 273, 253, 5968, 273, 521, 187, 67, 1417, 264, 19538, 13, 285, 7192, 1805, 752, 703, 18017, 281, 521, 7765, 187, 249, 253, 11561, 15513, 672, 703, 772, 311, 264, 779, 13, 285, 7560, 273, 13926, 285, 187, 66, 23347, 2389, 15, 380, 29958, 9367, 5938, 13, 2299, 13, 858, 417, 4510, 281, 187, 41161, 275, 253, 27231, 490, 853, 273, 521, 25938, 13, 835, 344, 574, 187, 42889, 4817, 275, 7203, 594, 1142, 5211, 1897, 342, 521, 21426, 187, 24525, 8901, 15, 754, 574, 13, 3103, 13, 247, 1355, 2419, 2822, 253, 21131, 28, 352, 369, 187, 14806, 436, 8342, 285, 26896, 2605, 326, 344, 574, 14373, 342, 521, 187, 72, 3624, 14, 296, 695, 3612, 2798, 15, 3856, 13, 275, 521, 1220, 3396, 13, 344, 574, 2168, 4817, 187, 9389, 29121, 15, 187, 187, 510, 1273, 807, 574, 4829, 38667, 1580, 253, 19538, 434, 2471, 13, 285, 187, 32655, 254, 781, 7252, 434, 2798, 369, 1335, 689, 67, 11180, 2348, 342, 26034, 13, 533, 187, 28948, 344, 574, 6311, 752, 673, 22332, 512, 4920, 932, 283, 248, 574, 6311, 281, 187, 1257, 25036, 15, 6279, 13, 28404, 275, 841, 46886, 1897, 369, 253, 760, 187, 1597, 326, 6376, 281, 253, 23293, 4377, 273, 37138, 571, 15, 733, 369, 247, 8872, 187, 395, 2834, 7143, 13, 323, 344, 574, 3663, 15704, 13, 2389, 13, 43703, 13, 285, 187, 9154, 521, 17292, 14275, 15, 733, 310, 2032, 13, 344, 369, 1335, 1925, 4377, 273, 187, 6140, 1316, 571, 13, 533, 344, 369, 1612, 1417, 15, 754, 574, 281, 6026, 281, 253, 26882, 3875, 588, 273, 187, 47, 522, 1306, 251, 13, 285, 28438, 247, 12195, 273, 521, 3438, 43703, 574, 644, 187, 1274, 779, 15, 380, 1897, 273, 308, 3683, 262, 574, 417, 2568, 3982, 40655, 285, 187, 18256, 24567, 2217, 2220, 779, 15, 380, 22212, 273, 253, 5112, 574, 2879, 187, 47120, 385, 3518, 13, 285, 521, 29586, 593, 3395, 5312, 625, 32397, 285, 187, 565, 15740, 494, 15, 496, 253, 2454, 273, 824, 11684, 352, 760, 6376, 323, 187, 32655, 254, 781, 7252, 281, 11929, 390, 11623, 15, 754, 3261, 47680, 2920, 387, 521, 187, 328, 42256, 2586, 13, 387, 1110, 5207, 253, 1390, 2137, 574, 25979, 273, 616, 187, 10034, 25002, 285, 24593, 28, 387, 521, 1355, 8544, 28, 387, 253, 43721, 90, 2097, 387, 521, 187, 3431, 40384, 13, 2429, 342, 253, 5300, 273, 32436, 13, 285, 283, 783, 6963, 187, 2377, 3004, 15, 187, 187, 1328, 574, 6296, 32360, 1048, 13, 285, 19460, 7052, 342, 521, 1211, 187, 39336, 723, 15, 1198, 13, 407, 29315, 281, 32436, 434, 320, 3957, 84, 13, 344, 369, 281, 2489, 187, 783, 1527, 9054, 273, 253, 22212, 13651, 13, 285, 253, 4377, 273, 37138, 571, 187, 4238, 13, 26277, 342, 253, 22212, 273, 253, 5112, 13, 281, 4430, 1411, 253, 187, 11223, 14652, 273, 7422, 15, 733, 369, 247, 11527, 15504, 323, 26485, 7252, 187, 936, 17789, 521, 3331, 281, 521, 9054, 13, 285, 387, 253, 1077, 2774, 672, 187, 41736, 574, 5907, 521, 1133, 323, 247, 747, 9728, 13, 285, 4081, 281, 187, 585, 2445, 271, 13413, 285, 14397, 23158, 342, 37138, 571, 285, 187, 45353, 15, 187, 187, 1989, 824, 271, 23158, 342, 13392, 7422, 812, 417, 17084, 187, 6140, 1316, 571, 1411, 20667, 6181, 13, 3692, 29894, 497, 2349, 17263, 2822, 187, 379, 2914, 4670, 15, 380, 5434, 273, 1146, 24983, 407, 32436, 369, 1199, 625, 187, 22275, 494, 685, 253, 3524, 273, 1146, 4516, 407, 7422, 15, 7422, 574, 187, 40252, 281, 513, 281, 1379, 1557, 273, 5972, 15, 1500, 369, 7591, 281, 3657, 187, 33639, 432, 25473, 37138, 571, 13, 604, 32436, 6799, 13, 285, 253, 16834, 187, 22732, 2965, 432, 253, 1481, 273, 26485, 7252, 1048, 1078, 247, 7247, 187, 1513, 90, 273, 18382, 263, 812, 2831, 253, 37138, 757, 34642, 15, 754, 9262, 187, 45230, 13, 285, 7607, 342, 581, 1133, 253, 23158, 273, 6181, 13, 1223, 187, 33897, 617, 342, 253, 643, 15, 187, 187, 2374, 253, 2164, 394, 273, 5080, 13, 1283, 805, 13, 253, 37138, 757, 6963, 6704, 436, 747, 187, 38441, 90, 15, 1284, 369, 36834, 407, 253, 806, 3929, 13, 344, 5966, 715, 247, 187, 1545, 3134, 23158, 342, 6181, 1411, 667, 5284, 1612, 342, 534, 187, 26597, 6181, 390, 37138, 571, 943, 38492, 320, 387, 2137, 15, 32436, 13, 253, 187, 1342, 665, 574, 7154, 11628, 7406, 66, 434, 2798, 13, 369, 1024, 253, 3331, 285, 25550, 187, 1171, 4377, 26485, 7252, 13, 285, 253, 13948, 273, 6181, 497, 7613, 28287, 187, 936, 320, 253, 13948, 273, 37138, 571, 2, 187, 187, 1147, 369, 436, 326, 253, 6963, 1869, 273, 281, 14, 1201, 13, 672, 13, 275, 253, 2393, 629, 187, 1171, 2552, 13, 344, 369, 3815, 13, 285, 19360, 275, 521, 24233, 13, 387, 521, 1355, 187, 5967, 275, 22200, 7382, 6121, 15, 733, 369, 2568, 2393, 13, 323, 344, 574, 28987, 1078, 187, 13998, 24078, 13, 285, 574, 644, 387, 789, 247, 1048, 673, 13, 672, 344, 25368, 323, 247, 187, 25094, 285, 20714, 281, 521, 1129, 22644, 15, 2070, 18197, 896, 275, 521, 3477, 187, 21689, 13, 344, 37432, 1948, 5356, 949, 253, 1527, 5253, 14, 26695, 13, 1024, 327, 396, 9457, 187, 13456, 13, 285, 969, 327, 253, 5920, 4991, 27553, 459, 273, 521, 10329, 15, 187, 187, 1989, 436, 7107, 17040, 369, 417, 281, 1390, 1048, 28, 253, 3369, 273, 253, 187, 6795, 42139, 6188, 5485, 13, 285, 253, 3174, 1342, 6138, 326, 521, 6552, 1371, 187, 10292, 2131, 285, 34641, 8449, 388, 6702, 4978, 9521, 281, 923, 521, 19684, 14197, 15, 187, 187, 3, 1466, 779, 1705, 275, 937, 753, 253, 6963, 13, 347, 344, 9461, 13, 8577, 521, 16102, 187, 2653, 265, 13, 534, 574, 2489, 1014, 43580, 1321, 685, 1078, 13, 2584, 253, 3369, 13, 187, 251, 253, 7887, 273, 534, 253, 20654, 285, 8489, 15098, 13543, 830, 273, 187, 783, 45803, 273, 1375, 5420, 15, 754, 33766, 44738, 15, 3032, 17874, 187, 395, 638, 24765, 41804, 1385, 7697, 369, 18727, 285, 730, 451, 347, 7312, 28, 253, 187, 4351, 434, 13, 16102, 13, 30457, 13, 285, 8872, 15, 187, 187, 3, 24494, 3668, 13, 309, 9428, 865, 2546, 253, 6963, 13, 13366, 15, 346, 1394, 1705, 387, 594, 187, 18579, 271, 4964, 13, 1633, 15423, 1364, 452, 4592, 15, 1737, 310, 187, 262, 865, 187, 187, 3, 16440, 273, 326, 2238, 13, 634, 19684, 14197, 937, 753, 388, 6702, 4978, 13, 342, 521, 187, 303, 44931, 494, 8580, 15, 346, 18291, 13, 352, 310, 2032, 13, 359, 403, 11485, 275, 271, 187, 24124, 13339, 4112, 13, 594, 326, 752, 5010, 1537, 3176, 11555, 187, 261, 1024, 2717, 533, 247, 1077, 9826, 12340, 449, 187, 187, 3, 34, 638, 43927, 1476, 753, 26485, 7252, 13, 1869, 2920, 15, 346, 1394, 452, 13, 840, 13, 187, 936, 2028, 479, 1633, 1774, 15, 1737, 310, 352, 32, 11668, 247, 7319, 285, 3984, 1476, 187, 510, 6963, 8042, 281, 247, 6951, 13, 285, 30974, 521, 1211, 15, 388, 6702, 4978, 22813, 187, 41938, 13, 285, 3261, 1066, 323, 247, 2774, 342, 271, 2329, 273, 36649, 15, 187, 187, 3, 6693, 2181, 253, 2647, 275, 12911, 865, 2546, 253, 6963, 15, 346, 16830, 13, 247, 187, 371, 274, 1661, 875, 253, 7815, 285, 253, 5112, 865, 187, 187, 3, 2302, 13, 634, 19684, 14197, 937, 753, 388, 6702, 4978, 13, 281, 3692, 6906, 11233, 2210, 521, 187, 88, 834, 264, 8580, 15, 346, 510, 952, 273, 12911, 1978, 1077, 7107, 13, 285, 8800, 253, 187, 274, 6375, 593, 273, 253, 5112, 342, 50063, 22450, 15, 309, 452, 281, 1304, 642, 187, 371, 274, 32742, 13, 285, 13, 327, 253, 2644, 13, 2717, 273, 6349, 28, 309, 16632, 760, 281, 187, 37650, 634, 19684, 14197, 326, 309, 2959, 247, 2565, 4586, 432, 399, 373, 3354, 3563, 1390, 187, 6170, 449, 187, 187, 510, 6963, 3053, 13, 285, 3261, 43976, 4182, 15, 346, 4509, 5207, 865, 344, 2546, 13, 275, 247, 187, 73, 901, 4318, 15, 187, 187, 3, 4509, 776, 27178, 937, 10017, 388, 6702, 4978, 13, 1557, 13102, 15, 346, 14102, 20733, 187, 47318, 556, 4925, 399, 373, 3354, 15, 1583, 403, 16764, 253, 22212, 187, 47, 522, 1306, 251, 15, 754, 1669, 11877, 18189, 342, 253, 11274, 560, 17100, 7406, 66, 327, 253, 187, 26, 394, 273, 2552, 13, 285, 642, 581, 3260, 667, 2181, 670, 253, 1789, 390, 187, 41011, 273, 253, 9455, 15, 733, 369, 3839, 6566, 326, 253, 187, 358, 14652, 13, 342, 521, 772, 430, 13, 6034, 281, 1379, 247, 11284, 14, 39816, 281, 187, 46, 290, 91, 13, 533, 4745, 846, 521, 13024, 627, 344, 8191, 521, 18880, 187, 3529, 344, 369, 327, 521, 1039, 281, 247, 747, 2137, 13, 285, 651, 13920, 521, 4475, 187, 7483, 347, 2080, 347, 399, 373, 3354, 13, 835, 597, 651, 2525, 616, 29535, 187, 785, 46669, 447, 15, 28424, 8856, 497, 2197, 432, 48253, 91, 281, 26229, 13, 281, 399, 373, 3354, 13, 281, 187, 21958, 44495, 13, 285, 281, 512, 253, 32341, 932, 285, 39091, 15, 380, 9930, 273, 187, 783, 8544, 452, 24488, 4886, 11678, 13, 285, 403, 1024, 37655, 432, 187, 455, 7123, 2220, 399, 373, 3354, 15, 1284, 7312, 13, 32436, 556, 969, 17288, 275, 187, 23492, 521, 5827, 4279, 281, 253, 1077, 1390, 2774, 13, 285, 36689, 253, 187, 10186, 273, 521, 21546, 760, 672, 597, 403, 670, 281, 320, 8156, 449, 187, 187, 3, 4374, 937, 26750, 253, 6963, 13, 275, 247, 10541, 273, 12680, 24307, 285, 12700, 283, 187, 3, 9820, 13, 344, 31394, 247, 2238, 13, 3500, 406, 14762, 8989, 13, 285, 704, 525, 84, 19429, 285, 187, 44896, 692, 21546, 1919, 344, 556, 8392, 715, 521, 37507, 1110, 5207, 344, 187, 565, 1727, 281, 23737, 28, 840, 344, 15323, 521, 8989, 285, 2722, 521, 2032, 43837, 187, 395, 24683, 2454, 15, 754, 7318, 2079, 441, 13, 285, 36790, 521, 19429, 13, 187, 27390, 359, 6704, 253, 23848, 273, 23158, 13, 533, 1024, 344, 588, 23103, 327, 187, 783, 42514, 420, 273, 253, 2209, 356, 3658, 359, 452, 5966, 715, 15, 754, 764, 2979, 187, 66, 747, 2137, 13, 285, 13, 407, 16968, 273, 253, 806, 3929, 273, 776, 23848, 13 ]
, 1812. The world was groaning under the yoke of Napoleon's tyranny. As a consolation for the hopeless year, came the laughing spring. Fields, forests, and meadows, were clad in beautiful verdure; flowers were blooming, and birds were singing everywhere--even at Charlottenburg, which King Frederick William formerly delighted to call his "pleasure palace," but which now was his house of mourning. At Charlottenburg, Frederick William had spent many and happy spring days with Queen Louisa; and when she was with him at this country-seat, it was indeed a pleasure palace. The noble and beautiful queen was also now at Charlottenburg, but the king only felt her presence--he beheld her no more. Her merry remarks and charming laughter had ceased, as also her sighs and suffering; her radiant eyes had closed forever, and her sweet lips spoke no more. She was still at Charlottenburg, but only as a corpse. The king had her mausoleum erected in the middle of the garden. Here lay her coffin, and room had been left for another, as Frederick William intended to repose one day at the side of his Louisa. From the time that the queen's remains had been deposited there-- from that day of anguish and tears--the king called Charlottenburg no longer his "pleasure palace." It was henceforth a tomb, where his happiness and love were buried. Still, he liked to remain there, for it seemed to him as though he felt the presence of the spirit of his blessed queen, and understood better what she whispered to his soul in the silent nights when she consoled him, and spoke of heaven and a renewed love. The bereaved husband, however, did not prefer to dwell in the magnificent abode of his ancestors, where he had formerly passed in spring so many happy days with his beloved Louisa. He had, therefore, a small house near the palace; it was into this plain and humble structure that he had retired with his grief-stricken heart. Here, in his solitude, he had already passed two springs. The second year had nearly elapsed since the queen's death, and Frederick William's heart was still overburdened with sorrow, but yet he had learned what time teaches all mortals--he had learned to be resigned. Yes, resignation in these melancholy days was the only thing that remained to the unfortunate King of Prussia. It was a sad and difficult duty, for he had lost happiness, love, greatness, and even his royal independence. It is true, he was still called King of Prussia, but he was powerless. He had to bow to the despotic will of Napoleon, and scarcely a shadow of his former greatness had been left him. The days of Tilsit had not yet brought disgrace and humiliation enough upon him. The Emperor of the French had added fresh exactions, and his arrogance became daily more reckless and intolerable. In the face of such demands it only remained for Frederick William to submit or resist. He looked mournfully at his unhappy country, at those whom the last war had deprived of their husbands and fathers; at his small army; at the scanty means at his disposal, compared with the resources of Napoleon, and--the king submitted. He had indeed hesitated long, and struggled strongly with his own feelings. For, by submitting to Napoleon's behests, he was to become the open enemy of the Emperor Alexander, and the King of Prussia was, jointly with the Emperor of the French, to arm against the Emperor of Russia. It was a terrible necessity for Frederick William to sacrifice his friend to his enemy, and at the very moment when Alexander had offered his hand for a new league, and proposed to conclude an offensive and defensive alliance with Prussia and England. But such an alliance with distant Russia could not strengthen Prussia against neighboring France, whose armies were encamped near her frontiers. The danger of being crushed by Napoleon was much more probable than the hope of being supported by Russia. Russia had enough to do to take care of herself. She was unable to prevent France from destroying Prussia, if Napoleon desired, and the crown might fall from the head of Frederick William long before a Russian army of succor could cross the Prussian frontier. He submitted therefore, and accepted with one hand the alliance of France, while threatening her with the other. On the 24th of February, 1812, the Prussian king signed this new treaty. As was stipulated by the first article, he entered into a defensive alliance with France against any European power with which either France or Prussia should hereafter be at war. Napoleon, the man who had broken Queen Louisa's heart, was now the friend and ally of King Frederick William, and the enemies of France were henceforth to be the enemies of Prussia! It was this that the king thought of to-day, when, in the early part of May, he was alone, and absorbed in his reflections, at his small house in Charlottenburg. It was yet early, for he had risen before sunrise, and had been at work a long time, when he ceased for a moment and yielded to his meditations. Leaning back in his easy chair, he gazed musingly through the open glass-doors, now on serene sky, and again on the fragrant verdure of his garden. But this quiet relaxation was not to last long; the door of the small anteroom opened, and the footman announced that his excellency Minister and Chancellor von Hardenberg requested to see his majesty. "Let him come in," said the king, as he rose, turning his grave eyes, which had become even gloomier than before, toward the door, on the threshold of which the elegant and somewhat corpulent form of the chancellor of state appeared. He bowed respectfully. His noble and prepossessing countenance was smiling and genial as usual; the king's, grave, thoughtful, and sad. "Bad news, I suppose?" asked the king, briefly. "You come at so early an hour, something extraordinary must have happened. What is it?" "Nothing of that kind, your majesty," said Hardenberg, with his imperturbable smile. "Yet, it is true, we are constantly in an extraordinary situation, so that what otherwise might appear unusual is now nothing but a very ordinary occurrence." "A preamble!" said Frederick William, thoughtfully. "You have, then, to tell me something important. What is it? Take a seat and speak!" The king pointed to a chair, and resumed his own. Hardenberg seated himself, and looked down for a moment with an air of embarrassment. "Any thing the matter in Berlin?" asked the king. "Perhaps, a quarrel between the citizens and the French?" "No, your majesty," said Hardenberg, to whose thin lips came his wonted smile. "The people of Berlin keep very quiet, and bear the arrogance of the French with admirable patience. I have to report no quarrels, and, on the whole, nothing of importance; I wished only to inform your majesty that I received a courier from Dresden late last night." The king started, and looked gloomy. "From whom?" he asked, in a hollow voice. "From our ambassador," replied Hardenberg, carelessly. "Surprising intelligence has reached Dresden. They are expecting the Emperor Napoleon. He left Saint Cloud with the Empress Maria Louisa on the 9th of May, and no one knew any thing about the object or destination of the journey. It was generally believed that the emperor, with his consort, intended to take a pleasure-trip to Mentz, but immediately after his arrival there he informed his suite that he was on his way to a new war, and would accompany his wife only as far as Dresden, where they would meet their Austrian majesties. Couriers were sent from Mentz to Vienna, to Dresden, to King Jerome, and to all the marshals and generals. The columns of the army have commenced moving everywhere, and are now marching from all sides upon Dresden. As usual, Napoleon has again succeeded in keeping his plans secret to the very last moment, and informing the world of his intentions only when they are about to be realized." "Yes," exclaimed the king, in a tone of intense hatred and anger-- "yes, he wears a kind, hypocritical mask, and feigns friendship and pacific intentions until he has drawn into his nets those whom he intends to ruin; then he drops his mask and shows his true arrogant and ambitious face. He caressed us, and protested his friendship, until we signed the treaty of alliance, but now he will insist on the fulfilment of the engagements we have entered into. He commences a new war, and, by virtue of the first article of our treaty,
[ 15, 4111, 15, 4299, 3079, 7444, 15, 36206, 19, 313, 28403, 481, 443, 15, 7785, 74, 285, 378, 15, 1023, 80, 1351, 13, 4111, 15, 3555, 15, 444, 4299, 2511, 6257, 470, 1423, 22000, 313, 6759, 481, 411, 15, 16120, 413, 13, 24520, 15, 4111, 15, 500, 15, 378, 4299, 3712, 6257, 26879, 313, 8603, 481, 411, 15, 16120, 413, 13, 500, 15, 6515, 15, 3189, 348, 15, 367, 2125, 8897, 313, 8602, 481, 411, 15, 16120, 413, 285, 418, 15, 427, 15, 1608, 348, 321, 13, 4111, 15, 3555, 15, 444, 4299, 1438, 6257, 470, 2945, 11238, 313, 7857, 481, 500, 15, 6470, 284, 285, 329, 15, 399, 15, 322, 536, 267, 13, 500, 15, 6515, 15, 4111, 15, 4299, 4185, 6257, 47319, 313, 6914, 481, 329, 15, 353, 15, 20496, 445, 4978, 285, 378, 15, 388, 15, 4235, 1727, 257, 13, 4111, 15, 3555, 15, 12464, 15, 4299, 3832, 6257, 3436, 1671, 313, 14619, 481, 399, 15, 500, 15, 329, 2225, 285, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 3921, 6180, 3762, 13, 253, 39358, 1387, 13, 285, 4619, 16958, 13, 495, 5784, 1407, 13663, 313, 14947, 15317, 13, 16861, 13, 5826, 481, 388, 15, 443, 15, 14702, 9358, 375, 13, 329, 15, 16874, 13, 418, 15, 329, 15, 20344, 60, 1757, 1181, 79, 26196, 13, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 500, 15, 3586, 348, 13, 500, 15, 500, 15, 18268, 478, 14, 45, 15077, 8636, 13, 329, 15, 20081, 266, 585, 13, 367, 15, 308, 4415, 91, 13, 330, 15, 418, 15, 530, 620, 351, 13, 285, 330, 15, 914, 44626, 13, 4111, 15, 3555, 15, 378, 4299, 3763, 6257, 1638, 20991, 313, 6914, 481, 353, 15, 443, 15, 8698, 285, 500, 15, 309, 15, 15983, 2617, 1136, 13, 500, 15, 4111, 15, 11382, 15, 378, 4299, 11335, 6257, 2030, 2090, 313, 11496, 481, 329, 15, 611, 15, 416, 1212, 860, 13, 330, 15, 500, 15, 10498, 88, 262, 13, 611, 15, 322, 15, 2065, 4714, 13, 411, 15, 329, 15, 2656, 69, 472, 13, 6490, 13, 285, 411, 15, 353, 15, 8229, 1648, 13, 500, 15, 3052, 15, 11382, 15, 14162, 15, 4299, 13391, 6257, 2233, 1348, 313, 13895, 481, 611, 15, 378, 6228, 285, 399, 15, 367, 15, 42005, 13, 4111, 15, 3555, 15, 378, 4299, 1229, 6257, 1638, 2357, 313, 15624, 481, 330, 15, 39561, 84, 285, 416, 15, 611, 1584, 777, 90, 13, 500, 15, 6515, 15, 4111, 15, 4299, 3832, 6257, 11275, 313, 13435, 481, 353, 15, 444, 15, 14826, 285, 388, 15, 27280, 9289, 74, 13, 500, 15, 11382, 15, 4111, 15, 4299, 1976, 6257, 608, 31416, 313, 18263, 481, 353, 15, 14026, 257, 13097, 348, 13, 4111, 15, 3555, 15, 378, 4299, 3507, 6257, 1722, 2031, 1610, 313, 7199, 481, 443, 15, 21174, 1914, 11158, 91, 285, 388, 15, 411, 15, 500, 15, 2071, 2381, 442, 13, 500, 15, 4111, 15, 329, 27, 8684, 15, 2588, 15, 4299, 1731, 6257, 848, 313, 13549, 481, 444, 15, 7511, 1944, 1866, 13, 353, 15, 444, 15, 14826, 13, 285, 329, 15, 1503, 15, 9251, 356, 7173, 35464, 13, 4111, 15, 3555, 15, 12464, 15, 4299, 2055, 6257, 1283, 3011, 520, 313, 10016, 481, 353, 15, 367, 15, 12972, 46760, 13, 4111, 3737, 329, 4299, 3245, 6257, 48024, 313, 19813, 481, 388, 15, 443, 15, 14702, 9358, 375, 13, 418, 15, 329, 15, 20344, 60, 1757, 1181, 79, 26196, 13, 657, 15, 5794, 60, 1950, 1181, 79, 14, 6791, 263, 13, 285, 329, 15, 353, 15, 14893, 48772, 13, 4111, 15, 12464, 15, 378, 4299, 25745, 6257, 11140, 313, 12487, 481, 187, 30423, 20287, 40007, 20241, 222, 18447, 35368, 310, 2530, 407, 1565, 446, 31587, 80, 285, 352, 476, 320, 908, 323, 667, 4096, 15, 21309, 39634, 313, 29486, 6876, 10, 187, 187, 21309, 39634, 313, 1093, 2693, 1108, 1384, 4247, 32626, 10, 2283, 1701, 13366, 347, 271, 6805, 275, 5854, 275, 253, 46215, 84, 1078, 802, 19531, 839, 281, 1457, 12123, 13, 835, 344, 574, 247, 12848, 5249, 347, 247, 2659, 6630, 263, 13, 247, 11547, 41473, 263, 285, 6158, 314, 347, 247, 3558, 273, 253, 1457, 12123, 37558, 6456, 15, 380, 20672, 388, 13077, 38523, 273, 39634, 10947, 275, 1457, 12123, 42628, 684, 521, 1416, 15, 187, 187, 3980, 304, 968, 2490, 187, 998, 7095, 369, 5686, 275, 41198, 327, 1668, 4247, 1283, 2693, 13, 253, 3347, 273, 6911, 39634, 313, 7461, 7015, 21334, 275, 253, 5779, 7454, 275, 41198, 10, 285, 273, 26642, 27522, 39634, 15, 187, 187, 18551, 5671, 1546, 5249, 2490, 187, 998, 7095, 9856, 347, 247, 19077, 254, 5974, 273, 10336, 387, 253, 10043, 11417, 27498, 275, 4247, 46215, 13, 11734, 327, 253, 17401, 273, 9011, 7980, 775, 386, 5292, 13, 253, 4283, 22946, 17481, 263, 273, 253, 3667, 1371, 2180, 15, 754, 574, 12322, 5974, 789, 387, 253, 10043, 11417, 275, 253, 3563, 1283, 938, 84, 15, 2006, 3004, 281, 2120, 3484, 1456, 275, 3978, 46215, 13, 344, 369, 11941, 247, 9711, 19358, 326, 807, 15, 754, 4620, 417, 281, 452, 6312, 253, 7312, 1180, 273, 1107, 347, 247, 5974, 13, 984, 407, 1283, 2405, 13, 344, 574, 4395, 281, 21665, 1866, 3964, 13, 835, 253, 15946, 6169, 8304, 369, 762, 3939, 2440, 407, 697, 2563, 10598, 12634, 13, 10092, 15946, 15, 1707, 310, 690, 14011, 326, 775, 386, 5292, 3260, 15946, 13, 285, 436, 6830, 8553, 323, 39634, 3192, 598, 789, 275, 21665, 1866, 3964, 15, 496, 1283, 1237, 13, 1223, 14544, 275, 21665, 1866, 3964, 13, 344, 7028, 20145, 367, 814, 248, 13, 6122, 273, 253, 3563, 3555, 13054, 367, 814, 248, 273, 22808, 15, 39634, 4307, 323, 15946, 323, 247, 1180, 273, 1107, 13, 20462, 253, 50005, 263, 38707, 14, 4826, 26993, 2207, 15671, 1284, 20401, 275, 411, 12099, 49766, 5720, 285, 253, 34367, 267, 15946, 6169, 27982, 13, 1097, 273, 1283, 1610, 13, 534, 4447, 629, 273, 15946, 434, 2098, 281, 1056, 411, 12099, 49766, 5720, 247, 686, 26852, 13032, 8, 7622, 281, 521, 747, 8304, 28, 39634, 671, 4307, 327, 2067, 273, 253, 4067, 3055, 9910, 275, 15946, 6169, 15, 754, 39301, 2567, 342, 15946, 275, 1283, 1671, 13, 8505, 275, 4832, 12748, 13, 533, 45986, 275, 21665, 1866, 3964, 247, 1652, 3356, 15, 3032, 760, 643, 5950, 27934, 2987, 275, 5854, 403, 253, 38707, 18777, 387, 41131, 2205, 313, 1093, 1812, 10, 285, 17026, 16068, 313, 1093, 1671, 14, 1093, 1787, 582, 1097, 275, 4051, 47949, 19299, 15, 2732, 521, 10346, 281, 1457, 12123, 13, 344, 4197, 253, 2216, 323, 247, 43921, 266, 34687, 313, 6342, 264, 275, 253, 8946, 3740, 10, 285, 7517, 2419, 13, 4270, 1283, 2031, 275, 17672, 398, 5720, 13, 42337, 15, 380, 34086, 858, 417, 11883, 253, 48308, 27108, 15, 187, 187, 29431, 275, 1345, 1495, 275, 1457, 12123, 2490, 187, 2374, 884, 4162, 1283, 1867, 344, 13781, 253, 1457, 12123, 6487, 323, 247, 1899, 13, 285, 369, 7660, 281, 3189, 249, 6212, 434, 6630, 4750, 15, 754, 33497, 323, 1457, 12123, 327, 253, 24605, 13, 20948, 387, 6162, 16982, 42304, 327, 495, 4247, 46537, 15, 6408, 253, 1735, 1643, 2607, 344, 4824, 562, 17276, 275, 253, 42337, 14, 41, 13077, 10947, 3286, 13, 835, 344, 3534, 521, 1416, 281, 39634, 10947, 15, 15643, 275, 1283, 2945, 344, 25036, 432, 253, 6487, 281, 4901, 2136, 327, 521, 1211, 2395, 15, 754, 369, 1620, 9202, 273, 3273, 11733, 521, 4743, 327, 1345, 13909, 13, 285, 521, 806, 686, 29076, 281, 253, 8121, 8, 5420, 275, 46537, 1253, 3156, 13, 327, 253, 2256, 273, 1805, 4088, 273, 13538, 17228, 1213, 16948, 4830, 30481, 2659, 428, 275, 1798, 521, 36982, 2822, 253, 36050, 275, 42337, 15, 754, 369, 581, 273, 253, 820, 14, 14541, 398, 273, 253, 1457, 12123, 17143, 1080, 285, 11980, 434, 19967, 953, 22901, 13, 285, 369, 3939, 347, 247, 19600, 273, 18930, 285, 5098, 1919, 387, 1878, 42741, 15, 754, 369, 11162, 347, 247, 8293, 273, 253, 20000, 275, 42129, 13, 285, 4821, 275, 436, 3906, 1919, 387, 1878, 49420, 15, 187, 998, 7095, 6607, 42337, 3228, 275, 253, 49850, 6456, 432, 1283, 3011, 281, 42741, 285, 411, 1094, 274, 24470, 5791, 432, 840, 1919, 50220, 15, 496, 1283, 3680, 344, 4824, 247, 7641, 949, 253, 6456, 281, 5100, 21209, 2208, 323, 42337, 285, 13, 275, 253, 1072, 807, 13, 36431, 253, 5140, 273, 247, 18217, 2439, 253, 48582, 307, 10573, 21277, 15, 4129, 521, 6974, 369, 1784, 1356, 387, 806, 313, 783, 1386, 2424, 690, 11132, 12186, 1100, 582, 39634, 4821, 521, 39786, 15, 496, 43450, 344, 5802, 253, 6456, 281, 5194, 281, 2997, 6911, 353, 15414, 3919, 386, 434, 14510, 281, 1973, 253, 806, 1283, 6574, 273, 253, 1386, 323, 8157, 8970, 13, 933, 13, 533, 253, 2968, 6497, 949, 15, 7874, 1107, 1996, 39634, 33372, 9698, 281, 47122, 253, 2199, 13, 533, 2717, 369, 2218, 1919, 657, 40836, 11217, 352, 275, 521, 1345, 2987, 6974, 273, 253, 2393, 35828, 84, 15, 39634, 369, 34150, 281, 253, 1457, 12123, 37558, 6456, 275, 45834, 13, 9417, 432, 1249, 4163, 45834, 281, 2164, 4397, 1283, 2787, 672, 344, 369, 557, 28758, 323, 5928, 313, 248, 574, 4895, 281, 5854, 275, 4105, 1786, 481, 4325, 1283, 3677, 281, 1283, 3141, 344, 369, 247, 3558, 273, 253, 8907, 273, 253, 2499, 273, 1457, 12123, 15, 496, 253, 37558, 6456, 344, 3395, 973, 1929, 323, 521, 6593, 918, 11626, 327, 253, 2201, 3569, 3374, 273, 253, 1388, 15, 3105, 22046, 521, 9470, 6284, 275, 9221, 413, 434, 6912, 13, 39634, 4821, 281, 28932, 275, 42337, 15, 754, 369, 581, 273, 253, 5399, 398, 323, 253, 42337, 3228, 2213, 19085, 275, 45834, 15, 754, 369, 671, 3939, 275, 6105, 13909, 13, 9417, 323, 247, 673, 347, 247, 2242, 3558, 273, 253, 14139, 351, 273, 253, 6129, 32143, 273, 42337, 15, 28786, 521, 1495, 344, 3534, 1199, 31868, 281, 21047, 285, 407, 1283, 2945, 285, 323, 690, 1107, 846, 13, 369, 21764, 83, 273, 253, 42337, 388, 430, 40319, 285, 28469, 266, 474, 8273, 15, 3032, 806, 4475, 20145, 4962, 846, 247, 1048, 9749, 387, 2745, 329, 287, 327, 337, 4223, 1283, 3583, 15, 187, 187, 15968, 281, 5854, 2490, 187, 688, 1283, 3141, 13, 275, 521, 3563, 4927, 633, 447, 13, 344, 4895, 281, 5854, 13, 285, 327, 655, 4397, 326, 807, 7028, 14884, 416, 16580, 4379, 13, 6122, 273, 253, 3563, 2516, 416, 16580, 4379, 273, 29677, 48737, 13, 387, 659, 6393, 26153, 1502, 13, 611, 13843, 1299, 13, 4693, 15, 754, 4962, 387, 521, 4693, 12913, 13, 337, 1639, 266, 695, 26499, 33892, 13, 378, 698, 7779, 327, 1384, 4247, 32626, 13, 1907, 644, 275, 11741, 1786, 1955, 281, 2923, 323, 2067, 1107, 13, 285, 369, 14205, 275, 611, 561, 267, 6115, 33091, 15, 754, 1669, 642, 2021, 28, 521, 8304, 14278, 7194, 273, 521, 1457, 12123, 3607, 313, 570, 1285, 1884, 13, 933, 20046, 582, 2918, 26277, 342, 521, 4929, 3196, 2516, 6939, 17722, 39634, 13, 665, 671, 4962, 275, 32626, 313, 8732, 574, 1705, 281, 1457, 12123, 347, 247, 20997, 327, 253, 39888, 275, 46537, 481, 9064, 14, 339, 2254, 11285, 273, 253, 8304, 2427, 281, 521, 28137, 14884, 13, 285, 2516, 434, 1740, 14, 339, 2254, 11285, 2427, 281, 2145, 34251, 10003, 275, 5854, 285, 18593, 1321, 13, 1457, 12123, 15, 496, 45272, 14, 2270, 521, 28137, 3559, 247, 1781, 13968, 14, 25483, 3497, 275, 39634, 434, 3541, 281, 253, 448, 18721, 273, 18593, 1321, 36368, 28, 4158, 407, 23662, 928, 4255, 48212, 13, 352, 369, 2529, 387, 253, 673, 347, 346, 783, 6253, 285, 23476, 3497, 273, 253, 2238, 275, 253, 11053, 2065, 19844, 13, 10985, 2620, 298, 1377, 1507, 995, 253, 4766, 581, 689, 2030, 4669, 1029, 13, 285, 4508, 689, 1052, 8442, 15, 831, 369, 3663, 672, 253, 36368, 369, 11069, 407, 27108, 275, 31039, 15, 187, 8389, 28137, 14884, 48194, 2200, 275, 3978, 32789, 11918, 26378, 7335, 1370, 9562, 15, 187, 187, 4941, 2490, 187, 1413, 27, 1093, 2693, 10782, 187, 1413, 27, 1093, 1438, 8923, 187, 1413, 27, 22282, 273, 253, 1457, 12123, 37558, 6456, 187, 1413, 27, 746, 394, 14, 9888, 1457, 12123, 38446, 187, 1413, 27, 746, 394, 14, 9888, 1457, 12123, 13557, 22, 29811, 5175, 187, 187, 1552, 673, 253, 9978, 310, 247, 20310, 2106, 59, 11430, 79, 491, 16165, 11955, 13, 534, 8414 ]
. Phys. [**43**]{}. 3892 (1965). G. Parisi and B. Seoane, Phys. Rev. E [**89**]{}, 022309 (2014). W. Selke, Eur. Phys. J. B [**51**]{}, 223 (2006). W. Selke, J. Stat. Mech. P04008 (2007). W. Selke and L. N. Shchur, Phys. Rev. E [**80**]{}, 042104 (2009). J. Salas and A. D. Sokal, J. Stat. Phys. [**98**]{}, 551 (2000). A. M. Ferrenberg and B. H. Swendsen, Phys. Rev. Lett. [**61**]{}, 2635 (1988). D. J. Amit and V. Mart[í]{}n-Mayor, [*Field theory, the renormalization group, and critical phenomena, 3rd ed.*]{} (World Scientific, Singapore, 2005). H. G. Ballesteros, A. Cruz, L. A. Fern[á]{}ndez, V. Mart[í]{}n-Mayor, J. Pech, J. J. Ruiz-Lorenzo, A. Tarancon, P. Tellez, C. L. Ullod, and C. Ungil, Phys. Rev. B [**62**]{}, 14237 (2000). M. G. Martin and J. I. Siepmann, J. Phys. Chem. B [**102**]{}, 2569 (1998). A. K. Rappé, C. J. Casewit, K. S. Colwell, W. A. Goddard, III, and W. M. Skiff, J. Am. Chem. Soc. [**114**]{}, 10024 (1992). K. Binder and D. P. Landau, Phys. Rev. B [**30**]{}, 1477 (1984). C. Borgs and R. Kotecky, J. Stat. Phys. [**61**]{}, 79 (1990). M. E. Fisher and H. Nakanishi, J. Chem. Phys. [**75**]{}, 5857 (1981). M. Hasenbusch, Phys. Rev. B [**82**]{}, 174433 (2010). G. Kamieniarz and H. W. J. Blöte, J. Phys. A: Math. Gen. [**26**]{}, 201 (1993). E. Luijten, M. E. Fisher, and A. Z. Panagiotopoulos, Phys. Rev. Lett. [**88**]{}, 185701 (2002). M. P. Nightingale, Physica A [**83**]{}, 561 (1976). H. G. Ballesteros, L. A. Fern[á]{}ndez, V. Mart[í]{}n-Mayor, and A. M. Sudupe, Phys. Lett. B [**387**]{}, 125 (1996). 全能女王 Tech Layer is provided by templatemo and it can be used for any purpose.Robert Stokes (politician) Robert Stokes (1809 – 20 January 1880) practised briefly as an architect in England in the 1830s before emigrating to New Zealand, where he had a varied career as a land surveyor, a newspaper proprietor and latterly as a member of the New Zealand Legislative Council. The Lower Hutt suburb of Stokes Valley in New Zealand commemorates his name. Origins Stokes was born in Jamaica on 16 January 1809, the son of Robert Stokes (then chief clerk in the Post Office in Jamaica) and of Martha Frances Stokes. Architectural career Stokes registered as a probationer student of architecture at the Royal Academy Schools in January 1830, entering on the recommendation of Sir Francis Chantrey, the leading portrait sculptor of the Regency period. He had exhibited student work at the Royal Academy in the late 1820s. Admitted to full studentship in June 1830, he was awarded a silver medal that year. He appears not to have completed the usual number of years as a student, because by 1831, he had moved to Cheltenham, where the Pittville estate was under active development by its eponymous promoter, Joseph Pitt. There is some indication that Chantrey knew Pitt, and this possibly accounts for Stokes taking up work in Cheltenham. In 1832, while resident in Cheltenham, he married Margaret Pughe, daughter of the late Rev Lewis Pughe of Liverpool. Stokes worked for Pitt for a number of years, designing the Tudor Gothic-style Female Orphan Asylum in Winchcombe Street and the ornamental Pittville Gates, both of 1833, which formed part of Pitt's plan to make Winchcombe Street a 'grand entrance' route to his new estate; Stokes also worked on several of the larger private houses in Pittville. He parted company with Pitt in 1835, apparently in financial difficulties, but resided in Cheltenham a little longer. His only other recorded architectural works in England are the Gothic churches at Amberley (1836) and Oakridge (1835-1837), both in Gloucestershire. After his migration to New Zealand, he produced the design for a Wesleyan Chapel (fronted in the classical style) and mission house, built 1844 in Manners Street, Wellington. The chapel did not survive the 1848 earthquake. Career in public life in New Zealand On 10 April 1839 he approached the New Zealand Company for a position, and was attached to Mein Smith's survey staff. He sailed for New Zealand on the Cuba, arriving at Port Nicholson on 3 January 1840. During the next few months he carried out surveys in the Wellington-Hutt Valley district, where he gave his name to Stokes Valley. Early in 1842 he resigned from the Company to enter business on his own account. He was never afraid of voicing his opinion on public affairs, and his first 'letters to the editor' appeared in 1840–41, on the subject of better ways of preventing cattle straying onto cultivated land - in particular his acre near the harbour in Wellington. He was one of the co-founders of the New Zealand Spectator and Cook's Straits Guardian, and was active as a publisher of newspapers and books until at least 1865. He was appointed as a Justice of the Peace in 1861, and continued in this office until at least 1866. Stokes represented Wellington City in the Provincial Council from 1857 to 1865 and Wairarapa East from then until 1867. In 1858 he carried a Bill through the Council to establish municipal government for Wellington and, in the same year, advocated the construction of a railway across the Rimutaka Range. Although his scheme was derided at first (the line required some challenging inclines), Stokes continued his agitation. In 1863 he induced the Council to agree to accept Robert Mudge Marchant's tender to build the first 18 miles of the line for £150,000, but the deal fell through. Four years later Stokes endeavoured to revive the project, but nothing was done until Vogel incorporated it in his public works scheme of the early 1870s. Stokes was summoned to the New Zealand Legislative Council in 1862, serving from 12 July 1862 to 24 September 1879 when he was disqualified for absence (he had returned to England in poor health). From 1871 to 1878 he was a member of the Senate of the University of New Zealand. In the Legislative Council he became well known for his forthright opinions on the major political issues of the day. Notwithstanding his extensive interests in Hawke's Bay, Stokes continued to reside in Wellington. He was one of the Commissioners for the Wellington City Reserves in 1862. He was also active in church affairs, serving for a time as a lay member of the Synod of the Diocese of Wellington. Throughout his life he gave much encouragement to agriculture and by 1842 and for some years after, was treasurer of the Wellington Horticultural and Botanical Society. His first wife Margaret died after a long illness at Te Aro on 1 August 1852. Return to England In 1878, in his late sixties, he returned to England, and on 19 September that year married Jane Rutherford, daughter of the late John Rutherford of Aberdeen, at St Mary Abbots, Kensington, London. He died at his London residence, 1 Clanricarde Gardens, Bayswater on 20 January 1880, having been in failing health due to cancer for several years, and was buried in Kensal Green cemetery. He left no family; his estate consisted mainly of his New Zealand properties (nearly 30,000 acres), held jointly with his brother Dr John Milbourne Stokes, who also died in 1880 (John had come to New Zealand as a surgeon on the Aurora in 1840). Three-sevenths of the estate went to his widow Jane, and John's four-sevenths went to 13 charitable institutions in England and Napier, New Zealand. In 1889-90 his widow presented a large stained-glass window in Stokes's memory to the chancel of Napier cathedral; designed by Nathaniel Westlake, it was described at the time as "the largest and finest window of the kind in the southern Colonies, covering five lancets", the middle one over 25 feet high, and containing over 200 figures. This was lost when the cathedral was destroyed by earthquake in 1931. His widow Jane remarried in June 1890 Captain Ralph Slazenger. References Category:1809 births Category:1880 deaths Category:Members of the New Zealand Legislative Council Category:19th-century New Zealand architects Category:19th-century New Zealand politicians5 Bomb testing This time the setup is a Mach−Zehnder interferometer, which consists
[ 1273, 6178, 13, 10870, 281, 258, 719, 77, 32756, 313, 3980, 336, 87, 316, 582, 668, 703, 753, 275, 617, 7946, 9759, 15, 1623, 253, 643, 1133, 13, 308, 14, 3992, 7625, 42600, 247, 2372, 846, 1363, 2335, 209, 2292, 262, 45424, 533, 840, 6376, 6474, 949, 2164, 3618, 273, 4918, 15, 187, 187, 54, 1559, 262, 45424, 310, 247, 4460, 19114, 6555, 22592, 8092, 12262, 247, 4451, 40548, 327, 253, 3437, 938, 11611, 13, 285, 310, 7144, 1940, 15179, 2122, 281, 7278, 15430, 323, 512, 11640, 273, 10185, 13, 7624, 17227, 3687, 8092, 14, 6820, 7842, 27863, 2425, 685, 14567, 45424, 285, 273, 18438, 20677, 13, 3196, 15, 34411, 3592, 14, 51, 317, 413, 753, 15, 187, 187, 54, 1559, 262, 45424, 556, 644, 908, 275, 7587, 275, 534, 352, 556, 10522, 2923, 13, 533, 323, 697, 897, 275, 2709, 33565, 13, 253, 34931, 556, 644, 3777, 13, 703, 5544, 15, 496, 253, 2332, 13, 627, 369, 247, 4270, 14, 249, 577, 14, 11151, 2180, 275, 534, 721, 1363, 497, 1677, 16254, 28, 846, 326, 3302, 2180, 253, 16254, 1363, 497, 1677, 209, 2292, 262, 45424, 15, 187, 187, 510, 3064, 275, 253, 27361, 369, 20457, 673, 281, 923, 849, 4541, 253, 2192, 16723, 812, 320, 1677, 1223, 11850, 5252, 15, 380, 8607, 5421, 3925, 7017, 28, 5091, 7017, 285, 495, 4964, 2192, 16723, 28631, 15, 380, 3302, 6178, 323, 26198, 253, 1363, 275, 253, 1263, 369, 577, 3038, 15, 2635, 387, 253, 673, 323, 253, 1273, 6178, 387, 1388, 1458, 13, 253, 20457, 2069, 497, 12217, 15, 6408, 253, 806, 374, 3618, 253, 1016, 1436, 327, 253, 3939, 5570, 369, 6883, 20156, 5770, 273, 209, 2292, 262, 45424, 15, 1198, 253, 2164, 2129, 6178, 13, 253, 20457, 673, 369, 36439, 969, 281, 337, 4964, 281, 337, 15, 22, 3038, 15, 187, 187, 510, 19368, 3719, 1263, 17692, 2164, 1363, 275, 247, 5235, 273, 20457, 2069, 285, 2908, 247, 16254, 1387, 326, 369, 1996, 13405, 689, 281, 6883, 209, 2292, 262, 45424, 15, 380, 1363, 497, 670, 3387, 1107, 273, 2363, 28, 9963, 2558, 497, 2255, 285, 597, 1363, 574, 1599, 7467, 273, 673, 342, 2709, 33565, 273, 854, 15, 25, 1107, 15, 187, 187, 10457, 253, 16254, 1408, 14, 249, 3408, 273, 253, 2332, 670, 608, 2558, 281, 884, 2558, 273, 378, 1341, 403, 275, 253, 10844, 2614, 15, 773, 2773, 310, 3965, 2622, 2308, 273, 378, 1341, 1806, 3196, 15, 34411, 3592, 14, 51, 317, 413, 753, 15, 1500, 12800, 849, 581, 1363, 342, 247, 2622, 1268, 273, 378, 1341, 387, 253, 1265, 273, 253, 1971, 3408, 273, 253, 1263, 921, 247, 773, 11984, 2957, 273, 378, 1341, 1561, 816, 2164, 3038, 273, 1971, 15, 1244, 436, 2957, 310, 8838, 949, 253, 3302, 577, 2129, 2180, 668, 273, 1783, 15, 187, 187, 29139, 665, 3407, 253, 1263, 327, 16254, 13, 2692, 10920, 18186, 378, 1341, 9372, 1919, 597, 497, 17609, 689, 281, 209, 2292, 262, 45424, 4918, 13, 285, 840, 616, 378, 894, 2308, 8231, 281, 14257, 470, 2761, 13463, 15, 187, 187, 1628, 4553, 374, 1897, 273, 1971, 342, 209, 2292, 262, 45424, 253, 378, 894, 9372, 452, 8069, 8231, 281, 470, 285, 4558, 387, 326, 1268, 949, 2129, 577, 323, 512, 253, 27361, 642, 2647, 752, 616, 3302, 4918, 369, 390, 849, 1048, 253, 2192, 16723, 2335, 281, 7257, 253, 5835, 15, 187, 187, 8195, 747, 2854, 187, 187, 8195, 747, 5570, 13, 1925, 5642, 52, 14, 17015, 13, 671, 3261, 12532, 275, 19368, 3719, 7587, 15, 17012, 342, 5570, 4620, 281, 4796, 27835, 15141, 1514, 14, 10247, 10429, 285, 11355, 17902, 34512, 275, 12611, 19368, 3719, 7587, 13, 2361, 5119, 49224, 13, 10399, 13, 23011, 13, 7015, 8249, 5908, 285, 7015, 3739, 5908, 273, 11677, 44, 11078, 380, 1761, 86, 11665, 273, 4410, 5308, 3228, 13, 34280, 904, 253, 13722, 273, 253, 2854, 15, 187, 187, 34, 495, 7913, 5312, 273, 5642, 52, 14, 17015, 13, 271, 7946, 46097, 273, 19899, 261, 485, 26767, 1080, 10564, 6437, 313, 4785, 1277, 14, 2733, 582, 369, 2330, 342, 3777, 4499, 14, 17305, 6816, 10429, 273, 8073, 2558, 689, 247, 721, 14, 7791, 2180, 2429, 342, 16254, 13, 187, 187, 688, 521, 20731, 9759, 13, 3196, 15, 49224, 2361, 326, 2190, 253, 10447, 3595, 494, 1363, 7922, 281, 16254, 627, 369, 247, 1599, 273, 818, 15, 25, 747, 10429, 28, 2190, 253, 5571, 1363, 7922, 281, 253, 337, 5770, 6178, 273, 5642, 52, 14, 17015, 627, 369, 247, 1599, 273, 818, 15, 23, 747, 4499, 14, 17305, 6816, 10429, 28, 2190, 253, 5571, 1363, 7922, 281, 5642, 52, 14, 17015, 387, 253, 495, 5770, 6178, 627, 369, 247, 1599, 273, 577, 15, 19, 747, 10429, 313, 49, 30, 17, 15, 4838, 481, 187, 187, 1328, 671, 12800, 326, 275, 17902, 4644, 2957, 432, 8245, 13, 253, 5141, 846, 721, 2607, 369, 337, 15, 18, 2558, 2190, 1363, 327, 16254, 285, 369, 470, 15, 24, 2558, 2190, 1363, 327, 5642, 52, 14, 17015, 1108, 247, 5910, 15, 19, 2558, 5141, 275, 2957, 15, 380, 6070, 273, 34512, 2957, 875, 16254, 285, 253, 337, 5770, 6178, 369, 417, 3012, 1027, 15, 187, 187, 1628, 1231, 403, 11440, 281, 513, 625, 2175, 342, 436, 5570, 1806, 344, 753, 15, 773, 1231, 651, 751, 281, 1611, 247, 2169, 6178, 13, 4931, 608, 5770, 390, 721, 5770, 15, 844, 2868, 436, 2854, 25808, 253, 2614, 3998, 11394, 285, 778, 14227, 13741, 3270, 14, 13901, 2538, 275, 253, 4275, 11219, 985, 1425, 187, 187, 510, 1263, 369, 5196, 275, 7422, 2190, 2709, 33565, 665, 497, 36060, 281, 1971, 285, 574, 644, 11245, 342, 253, 774, 33616, 14, 2013, 2835, 830, 273, 253, 2728, 1561, 253, 1390, 495, 1107, 15, 1876, 273, 253, 1363, 574, 271, 17702, 12086, 5201, 1430, 20364, 14446, 273, 721, 390, 1679, 387, 253, 673, 273, 9273, 15, 1583, 497, 2424, 281, 452, 574, 387, 1878, 581, 4499, 14, 17305, 6816, 15411, 1309, 253, 2045, 1249, 2607, 285, 574, 281, 452, 1679, 685, 884, 4499, 14, 17305, 6816, 10429, 387, 253, 673, 273, 9273, 15, 187, 187, 510, 1599, 2363, 273, 253, 2256, 665, 2959, 5642, 52, 14, 17015, 369, 1884, 1107, 28, 253, 1599, 2363, 273, 253, 16254, 1363, 369, 4562, 1107, 15, 380, 1363, 1677, 497, 5642, 52, 14, 17015, 497, 3925, 15, 22, 6, 2255, 28, 253, 16254, 1363, 497, 10677, 15, 20, 2558, 2255, 15, 1876, 253, 1363, 275, 436, 1263, 497, 43748, 15, 7160, 1599, 7363, 327, 253, 17702, 12086, 5201, 1430, 20364, 14446, 369, 374, 15, 19, 15, 187, 187, 11175, 352, 457, 84, 417, 7852, 187, 187, 7673, 685, 1884, 2558, 273, 1363, 2197, 281, 247, 31000, 14235, 342, 247, 6120, 273, 2709, 33565, 3531, 562, 281, 452, 1633, 643, 685, 253, 2728, 15, 4683, 11456, 12640, 1363, 6289, 281, 247, 2709, 33565, 28648, 14235, 13, 294, 14, 15419, 2368, 1119, 326, 4562, 273, 841, 4292, 858, 417, 452, 2709, 33565, 846, 512, 13, 753, 2398, 8754, 15366, 885, 90, 13, 10399, 13, 247, 2709, 33565, 6551, 40270, 7715, 387, 253, 2499, 273, 5002, 387, 8742, 9757, 285, 387, 330, 264, 1032, 14, 52, 45194, 13, 8742, 9757, 15, 187, 187, 1628, 6560, 86, 9490, 1346, 285, 2709, 33565, 19616, 3340, 943, 294, 14, 45141, 285, 5368, 2709, 33565, 6120, 2581, 685, 3192, 352, 387, 2454, 1318, 1677, 253, 1029, 2281, 273, 3731, 27631, 4863, 1806, 3196, 15, 15366, 885, 90, 753, 387, 617, 20731, 9759, 15, 187, 187, 688, 617, 1263, 13, 703, 285, 11651, 6760, 1363, 665, 497, 2197, 281, 617, 28648, 4055, 281, 6583, 247, 6120, 273, 2709, 33565, 594, 253, 3110, 812, 3135, 2728, 26264, 4918, 15, 773, 20513, 497, 512, 1363, 665, 11580, 247, 15674, 382, 665, 1869, 253, 1363, 574, 2709, 33565, 1806, 15366, 885, 90, 753, 15, 773, 1231, 1119, 326, 5922, 2558, 574, 247, 3731, 27631, 2433, 1425, 9658, 1110, 3731, 27631, 4863, 497, 1363, 665, 497, 1907, 5563, 376, 1100, 13, 690, 574, 17201, 2728, 13, 285, 2571, 574, 3998, 3168, 2647, 23523, 2728, 15, 187, 187, 2993, 753, 326, 1668, 2558, 273, 253, 13282, 2709, 33565, 1363, 3531, 562, 281, 452, 5563, 376, 1100, 28, 2145, 2558, 273, 253, 1363, 574, 17201, 653, 857, 1190, 2433, 285, 2145, 2558, 574, 3168, 2647, 23523, 2728, 15, 1707, 497, 671, 2709, 33565, 28978, 326, 3531, 562, 281, 320, 16562, 39839, 90, 13, 49253, 30463, 66, 9542, 407, 44268, 13, 40454, 27602, 2728, 13, 5713, 23232, 32836, 13, 26961, 5723, 5895, 13, 1484, 306, 5895, 13, 24934, 285, 10397, 15, 380, 1363, 13794, 275, 2363, 432, 3307, 1107, 281, 10447, 1107, 15, 187, 187, 1628, 2512, 497, 642, 2219, 273, 15846, 19830, 2728, 1293, 6944, 15674, 90, 1806, 15366, 885, 90, 753, 15, 1500, 753, 326, 3332, 6979, 2175, 285, 31345, 45140, 14, 4919, 5216, 497, 954, 2779, 253, 25988, 326, 497, 2104, 281, 22629, 253, 2709, 33565, 1363, 432, 1110, 342, 3731, 27631, 4863, 15, 187, 187, 1628, 510, 1663, 25758, 629, 310, 326, 884, 2558, 273, 253, 1363, 342, 253, 3430, 6120, 574, 644, 3053, 327, 2728, 26264, 6083, 323, 2709, 33565, 1806, 3196, 15, 15366, 885, 90, 753, 15, 187, 187, 1628, 42, 2028, 1363, 665, 403, 6289, 281, 441, 326, 627, 310, 642, 581, 1071, 326, 476, 3653, 604, 368, 452, 2709, 33565, 15, 733, 457, 84, 417, 751, 247, 10438, 1071, 835, 368, 2057, 403, 390, 403, 417, 1806, 703, 753, 15, 773, 510, 6120, 273, 2709, 33565, 8687, 7103, 273, 253, 3110, 2892, 13, 8368, 13, 6979, 285, 6164, 12537, 5175, 15, 6676, 6578, 25066, 281, 2223, 21248, 5917, 273, 2709, 33565, 285, 2847, 3168, 2647, 10429, 275, 253, 4275, 11219, 985, 15, 844, 452, 281, 1691, 2366, 253, 2644, 5406, 285, 1705, 598, 342, 253, 1682, 6120, 1425, 187, 187, 2993, 753, 326, 581, 273, 253, 806, 5018, 703, 3936, 342, 247, 6289, 1363, 310, 281, 2502, 80, 271, 14478, 15, 773, 6080, 273, 253, 1363, 359, 452, 3324, 441, 11928, 2513, 326, 403, 577, 1107, 1711, 390, 625, 1806, 703, 753, 15, 510, 9883, 15794, 20369, 281, 5007, 11268, 28049, 281, 253, 1249, 2151, 28187, 432, 247, 15985, 275, 23174, 13, 347, 247, 861, 273, 8981, 273, 253, 12974, 597, 452, 2011, 1309, 253, 625, 685, 767, 3618, 597, 452, 5262, 275, 247, 15985, 275, 253, 6146, 273, 253, 2586, 15, 187, 187, 510, 20369, 556, 18203, 253, 9883, 34202, 275, 23174, 281, 3037, 512, 253, 4278, 273, 849, 281, 5007, 253, 32339, 28049, 281, 253, 1249, 2151, 13, 10652, 1903, 281, 1722, 15, 187, 187, 51, 12297, 39, 3918, 13, 29989, 11879, 451, 265, 13, 4767, 344, 369, 346, 635, 5211, 281, 3037, 326, 253, 1249, 2151, 285, 616, 8690, 452, 8379, 644, 9809, 15, 844, 3524, 281, 320, 275, 23174, 3517, 594, 326, 597, 476, 8251, 776, 14133, 285, 1928, 253, 1329, 326, 512, 253, 9883, 7458, 452, 2197, 731, 18873, 344, 6096, 327, 521, 7879, 2395, 15, 187, 187, 510, 2151, 285, 616, 8690, 665, 497, 18195, 625, 685, 767, 3618, 3622, 275, 247, 15985, 275, 11186, 23174, 13, 3692, 14471, 556, 7402, 327, 7948, 13, 403, 629, 273, 253, 8920, 20391, 2285, 346, 37633, 3452, 1032, 3446, 35, 10442, 3545, 266, 40946, 20115, 314, 27, 15382, 90, 708, 15388, 600, 3545, 266, 40946, 12617, 29425, 18771, 456, 387, 13593, 543, 33427, 310, 378, 10442, 3545, 266, 40946, 20115, 314, 326, 6131, 7001, 5356, 36766, 3545, 266, 40946, 2739, 387, 18261, 4376, 285, 1270, 5110, 15, 24503, 28849, 390, 20854, 347, 247, 13384, 1955, 281, 253, 2534, 331, 23699, 21938, 187, 187, 15054, 10, 380, 13992, 5687, 27, 322, 1596, 447, 708, 33753, 1876, 6258, 1876, 12972, 2058, 1916, 66, 12286, 1368, 3905, 43157, 327, 1458, 4565, 4059, 13, 380, 13992, 5687, 40847, 6131, 259, 471, 90, 37105, 285, 591, 4742, 8574, 275, 253, 14242, 8304, 273, 1916, 66, 12286, 1368, 15, 496, 253, 22654, 273, 21938, 510, 1246, 3688, 7033, 281, 2460, 11993, 390, 11993, 1332, 285, 985, 15, 187, 688, 253, 2460, 11993, 2718, 1929, 42329, 13, 3888, 390, 7968, 403, 14949, 5950, 390, 11462, 1293, 734, 28163, 667, 9912, 390, 8459, 875, 253, 9701, 3888, 13, 347, 310, 10557, 275, 24144, 14, 34, 14, 3763, 14, 883, 29868, 313, 25559, 11754, 11683, 1621, 15, 12472, 2597, 16, 15089, 10, 285, 24144, 14, 34, 14, 3763, 14, 883, 28057, 15, 187, 688 ]
second dose, comparable to ocrelizumab (Orcevus),” she said in her oral presentation. On the other hand, T-cell populations dipped a bit after patients took ublituximab but then remained stable through 24 weeks of therapy. Ublituximab is a novel chimeric monoclonal antibody targeting a unique epitope on the CD20 antigen, and is glycoengineered to enhance affinity for all variants of receptors, thereby demonstrating greater antibody-dependent cellular cytotoxicity activity than rituximab and ofatumumab, Dr. Lovett-Racke said. Ublituximab has been used in trials in which it has targeted cancer, but for its use in multiple sclerosis, the dosing has been reduced, she explained. In the trial, there was a built-in 4-week period in which 6 patients were given placebo; after that initial period the placebo patients were given ublituximab. The difference in the cohorts was infusion time to see how quickly the infusions could be given while maintaining safety. The researchers studied 60 minute; 90 minute and 3 hour infusions schedules. The initial dose for ll the patients in the study was 4 hours. Then at the time for the second dose at day 15, the infusion times were shorter. During the first 2 weeks the each person on the active agent was receiving 450 mg of ublituximab. For the 24 week dose, the infusion time was shortened again to 1 hour to 1.5 hours. The Phase II study enrolled 24 patients in a variety of infusion times and included a placebo group that was later crossed over to receiving ublituximab. The patients were about 40 years of age; 67 percent were women and they patients had mean duration of time with multiple sclerosis of 8.8 years. During the placebo run-in phase of the trial about 5 percent to 10 percent of B cells are in the peripheral blood. “That is pretty normal levels of B cells,” Dr. Lovett-Racke said. She illustrated how one patients with a normal level of B cells at the start of the treatment phase of the study show a “complete loss of B cells within just 24 hours of treatment. And this loss is maintained through the initial 4 week period” of analysis. Patients who began the study on placebo, showed fluctuating B cells counts until they were switched over to ublituximab therapy, and then their B cell levels dropped to virtually 0 almost overnight. “After 2 days of treatment with ublituximab the B cell counts have effectively dropped to 0 and remains at that level through week 4 for all the cohorts no matter what their initial therapy was or how long the infusions took to deliver the drugs. Another new drug Another new agent, called CHS-131, also looked promising in Phase II trials. Treatment with agent appears to reduce gadolinium-positive lesions and reduces cortical atrophy in preliminary Phase II trials, reported David Weinstein, MD, PhD, chief scientific officer and chief medical officer of InteKrin Therapuetics of Redwood City, Calif., the developer of the drug. A 3mg daily of CHS-131, an oral modulator of peroxisome proliferator activated receptor (PPAR-gamma), was associated with reduced contrast-enhancing lesions of 52 percent over a 6-month period compared with placebo, In his poster presentation, Dr. Weinstein reported that among the 69 evaluable patients assigned to placebo there was a mean of 7.8 new lesions; among the 70 patients assigned to the 1 mg dose of CHS-131 there was a mean of 7.6 new contrast-enhancing lesions; among the 70 patients assigned to CHS-131 at the 3 mg dose there was a mean of 4.2 new lesions (P=0.003). He also illustrated that in cortical volume loss from baseline, the reduction after 6 months was 1.1 percent among patients on placebo and was 0.7 percent among patients on CHS-131 – a 34.2 percent reduction in loss. The extent of atrophy loss between placebo and the 1 mg dose was not significantly different. “We are continuing to do more studies with this agent,” he said. “We would like to try a higher dose, perhaps 5 mg or 6 mg. We believe this drug crosses the blood brain barrier and may exert potent anti-inflammatory effects in the central nervous system.” The study was conducted in Russia among multiple sclerosis who were naïve to treatment and had been diagnosed with the relapsing-remitting form of the disease within the last 3 years. All of the patients had an Expanded Disability Status Scale of 6 or less at the time of screening. They were required to have had at least one contrast-enhancing lesion during the previous 12 months and had to have less than 10 contrast-enhancing lesions at the time of screening. The mean age of the subject who received CHS-131 was 30 years; the mean age of the placebo patients was 31 years. The patients given were CHS-131 were 60.5% women; the placebo patients were 74.3 percent women. All the patients in this study were Caucasian. Their mean scores on the Expanded Disability Status Scale was 2.2. Maybe it’s not MS More than 30 percent of patients sent to a tertiary clinic with a diagnosis of multiple sclerosis turned out to have something other than the disease. Of 93 consecutive patients referred to a multiple sclerosis specialty clinic, re-evaluation found that 31 of these individuals did not have multiple sclerosis after all, said Marwa Kaisey, MD, a multiple sclerosis neuroimaging fellow at the University of California at Los Angeles and at Cedars-Sinai, Los Angeles. “Neurologists and multiple sclerosis specialist especially should re-evaluate and existing multiple sclerosis diagnosis rather than taking it at face value given the high rate of misdiagnoses,” Dr. Kaisey said at her poster presentation. In her study, she and colleagues evaluated patients who were sent to her specialty center to confirm a diagnosis of multiple sclerosis so the patient could begin disease modifying therapy. “these were all patients who visited a neurologist who thought the patients had multiple sclerosis,” Kaisey said. “We found that 33 percent had a misdiagnosis.” Among those misdiagnoses were patients who were having migraines, some had spine disease, and others had brain white matter ischemic disease. She said that 16 percent of the suspected multiple sclerosis patients turned out to have migraines; 13 percent of the patients had spine spondylosis and 13 percent had white matter ischemic disease. There were also multiple sclerosis diagnoses that turned out to be cerebral palsy, scleroderma complicated by neuropathy, hereditary muscular disease, fibromyalgia, optic neuritis, uveitis, headache and anxiety. The patients ranges in age from 22 years to 69 years. “There were no cases of purely psychiatric disease without underlying neurology,” Kaisey said. She said that recent imaging studies and lumbar puncture-related tests were most likely the examinations that were able to differentiate the multiple sclerosis patients from those with misdiagnoses. “The really disturbing part is that 10 percent of the patients with the wrong diagnosis had been started on disease modifying agents for multiple sclerosis,” Dr. Kaisey said. “I tell patients who are referred to us that there is no one test that can determine if you have multiple sclerosis. It’s not like a pregnancy test where you either are or are not,” she said. “The diagnosis of multiple sclerosis involves evaluation of the patient history, examination, imaging and ancillary testing. Many diseases mimic to often vague symptoms of multiple sclerosis and cause white matter lesions in the central nervous system. We have to put together the whole picture and come up with the best diagnosis.” She said that one of the first steps she takes with a referred patients is to redo an MRI. “Some of the patients we have bring us MRIs that are 4 years old or more,” she said.The Spanish Football Federation to send Spain kits to the 12 children rescued from a cave in Thailand, as a sign of recognition of the integrity they have shown during the more than two weeks they have spent in a cave in the north of the country. The Federation has contacted the Spanish embassy in Thailand to learn all the details of how to send the personalized kits to the 12 children, aged 11 to 17. RFEF President, Luis Rubiales, stated he was "very happy to learn that the 12 children and their coach have successfully been saved. We hope to be in Thailand soon so that they can wear our shirt and feel the support that all the Spanish fans have sent them ", he shared on his Twitter account. The children and their coach who were trapped more than two weeks ago in a cave in northern Thailand, whose rescue has ended on Tuesday, are part of the youth soccer team "Wild Boars".Baba Peranakan Truly: Hearty & Homely Peranakan Cuisine Located at Katong Plaza is Baba Peranakan Truly that offers amazingly tasty Peranakan food at affordable price and great portion. Often overlooked or mistaken as a pub due to the bar stools […] 155) The Daily Press: Sarnies & Coffee All Day All Night At Toa Payoh Launched on 15 December 2014, The Daily Press cafe offers wacky sandwiches and perky coffee in the mature estate of Toa Payoh. In the midst of […]The present invention relates to image printing or printing method and system. In the image printing systems known heretofore, images or pictures are continuously recorded or printed without interposing any blank or margin between the adjacent images, as is disclosed in JP-A-62-11687 (Japanese Patent Application No. 11687/1987) and JP-A-62-11686. In
[ 71, 426, 1527, 9, 2808, 64, 16983, 13, 1527, 64, 9561, 10, 187, 50270, 7271, 27, 187, 50266, 1286, 3333, 71, 426, 8256, 187, 50270, 5478, 64, 2606, 426, 36743, 15, 2666, 5023, 1344, 48937, 2073, 6, 41, 27976, 46, 27976, 52, 327, 2462, 69, 2462, 67, 2462, 58, 3401, 187, 50270, 1286, 15, 6343, 2073, 6800, 3390, 3053, 387, 2462, 84, 61, 79, 8, 2462, 1265, 64, 2606, 10, 187, 50270, 1286, 15, 6343, 2073, 50, 2267, 5288, 2715, 27, 2462, 84, 61, 79, 61, 79, 8, 2462, 755, 64, 33980, 553, 64, 17921, 64, 4149, 6649, 187, 50270, 1286, 15, 6343, 37908, 553, 6155, 9, 33980, 553, 64, 5397, 10, 187, 50270, 1286, 15, 6343, 18246, 9, 12928, 10, 535, 50274, 1545, 3630, 9, 1286, 13, 256, 2262, 187, 50270, 338, 1881, 3333, 71, 27, 187, 50266, 1286, 3333, 71, 15, 6343, 9, 84, 10, 187, 50266, 4, 2884, 2345, 1060, 594, 4212, 476, 923, 752, 3213, 597, 1472, 187, 50266, 4, 327, 846, 1016, 3630, 13, 1580, 690, 5018, 476, 1379, 187, 50266, 4, 247, 1048, 673, 13, 285, 247, 4942, 1355, 2408, 273, 187, 50266, 4, 941, 310, 1146, 3542, 281, 253, 2412, 4367, 15, 187, 50266, 1286, 3333, 71, 15, 34459, 1082, 187, 50270, 7271, 27, 187, 50266, 5858, 535, 50274, 1545, 3630, 37908, 553, 6155, 9, 1286, 13, 2805, 74, 553, 64, 5397, 2262, 187, 50270, 338, 2805, 74, 553, 64, 5397, 310, 8256, 27, 187, 50266, 1286, 15, 6343, 2073, 2302, 2805, 74, 553, 3596, 2530, 4880, 79, 3401, 187, 50270, 7271, 27, 187, 50266, 1286, 15, 6343, 2073, 33980, 553, 64, 5397, 2193, 8048, 79, 3401, 187, 50266, 1542, 465, 13, 362, 275, 2805, 74, 553, 64, 5397, 15, 15565, 14850, 187, 50262, 338, 362, 27, 187, 50258, 1286, 15, 6343, 2073, 6, 84, 61, 85, 6, 84, 61, 79, 8, 2462, 313, 76, 13, 362, 1228, 187, 50266, 1286, 15, 6343, 2073, 61, 79, 3401, 535, 50274, 1545, 3630, 18246, 9, 1286, 13, 18912, 2262, 187, 50270, 338, 18912, 310, 8256, 27, 187, 50266, 1286, 15, 6343, 2073, 2302, 18912, 2530, 4880, 79, 3401, 187, 50270, 7271, 27, 187, 50266, 1286, 15, 6343, 2073, 19484, 1873, 2193, 8048, 79, 3401, 187, 50266, 1542, 465, 13, 362, 275, 18912, 15, 15565, 14850, 187, 50262, 1542, 6703, 64, 76, 13, 6703, 64, 87, 275, 362, 15, 15565, 14850, 187, 50258, 1208, 426, 6703, 64, 87, 390, 686, 5088, 8, 187, 50258, 1286, 15, 6343, 2073, 6, 84, 27976, 84, 61, 85, 6, 84, 61, 79, 8, 2462, 313, 76, 13, 6703, 64, 76, 13, 821, 1228, 187, 50266, 1286, 15, 6343, 2073, 61, 79, 3401, 535, 50274, 1545, 2810, 9, 1286, 2262, 187, 50270, 423, 64, 2606, 426, 36743, 15, 2666, 5023, 1344, 48937, 2073, 6, 41, 27976, 46, 27976, 52, 327, 2462, 69, 2462, 67, 2462, 58, 3401, 187, 50270, 1286, 15, 6343, 2073, 61, 79, 6800, 3390, 6331, 387, 2462, 84, 61, 79, 8, 2462, 990, 64, 2606, 10, 187, 50270, 338, 1881, 3333, 71, 27, 187, 50266, 1286, 3333, 71, 15, 10483, 1082, 187, 50270, 7271, 27, 187, 50266, 5858, 535, 187, 1545, 3379, 64, 44291, 9, 44291, 13, 187, 50259, 8581, 64, 11183, 64, 20104, 13, 187, 50259, 23173, 13, 187, 50259, 10483, 64, 23173, 64, 251, 64, 12566, 30, 5088, 2262, 187, 50274, 32488, 17148, 1618, 273, 13896, 281, 1408, 12251, 187, 50274, 23173, 15, 6343, 1587, 17148, 272, 13896, 760, 4880, 79, 61, 79, 2807, 187, 50274, 1542, 260, 275, 13896, 27, 187, 50270, 1542, 299, 275, 260, 27, 187, 50266, 8581, 64, 11183, 64, 20104, 30932, 6, 84, 8, 2462, 299, 60, 17, 3291, 187, 50266, 3845, 25137, 84, 8, 2462, 299, 60, 18, 62, 187, 50266, 23173, 15, 6343, 30932, 2462, 84, 3923, 61, 79, 6, 84, 61, 79, 61, 79, 8, 2462, 299, 10, 535, 187, 1545, 1067, 64, 44291, 64, 2152, 1365, 9, 44291, 13, 187, 50254, 50275, 8581, 64, 11183, 64, 20104, 13, 187, 50254, 50275, 23173, 13, 187, 50254, 50275, 10483, 64, 23173, 64, 251, 64, 12566, 30, 5088, 2262, 187, 50274, 32488, 12965, 1618, 273, 13896, 13, 581, 846, 1529, 12251, 187, 50274, 23173, 15, 6343, 1587, 12560, 9634, 13896, 4880, 79, 61, 79, 2807, 187, 50274, 1542, 260, 275, 13896, 27, 187, 50270, 1542, 299, 275, 260, 27, 187, 50266, 8581, 64, 11183, 64, 20104, 2073, 6, 84, 61, 79, 6, 84, 8, 2462, 299, 10, 187, 50266, 23173, 15, 6343, 30932, 2462, 84, 3923, 393, 79, 6, 84, 61, 79, 61, 79, 8, 2462, 299, 10, 187, 50266, 43885, 13, 331, 27429, 13, 1091, 64, 2877, 426, 2805, 74, 553, 64, 10394, 64, 4065, 9, 70, 60, 18, 3291, 187, 50266, 338, 1091, 64, 2877, 3613, 470, 27, 187, 50262, 4856, 426, 8894, 79, 61, 79, 9264, 33246, 12875, 1830, 1703, 399, 3322, 2637, 3915, 13801, 27, 2462, 84, 61, 79, 3, 2462, 299, 60, 17, 62, 14030, 187, 50258, 3, 12094, 1408, 369, 8048, 79, 2462, 84, 61, 79, 3, 2462, 299, 60, 18, 62, 14030, 187, 50258, 3, 12094, 4895, 10463, 3708, 27, 2462, 69, 61, 79, 3, 2462, 1091, 64, 2877, 14030, 187, 50258, 3, 38821, 483, 8048, 79, 6, 84, 61, 79, 998, 27429, 61, 79, 6, 84, 61, 79, 3, 2462, 313, 43885, 13, 331, 27429, 10, 187, 50262, 23173, 15, 6343, 9, 4856, 10, 187, 50262, 23173, 15, 10483, 1082, 187, 50262, 22525, 7733, 5449, 4756, 9, 4856, 10, 187, 50266, 4, 275, 253, 642, 2228, 1083, 13, 359, 3630, 13896, 8, 3453, 281, 253, 2412, 187, 50266, 4, 285, 671, 7392, 281, 436, 15613, 434, 6268, 483, 16, 35856, 187, 50266, 7271, 27, 187, 50262, 4, 3630, 6268, 483, 285, 331, 27429, 281, 2412, 1873, 187, 50262, 23173, 15, 6343, 1587, 38821, 483, 8048, 79, 6, 84, 61, 79, 998, 27429, 8048, 79, 6, 84, 61, 79, 3, 2462, 313, 43885, 13, 331, 27429, 1228, 187, 50262, 4, 3630, 6268, 483, 281, 6268, 483, 187, 50262, 338, 6268, 483, 27, 187, 50258, 3845, 6268, 483, 187, 50262, 4, 3630, 331, 27429, 281, 331, 27429, 187, 50262, 338, 331, 27429, 27, 187, 50258, 10404, 15, 35856, 15, 6343, 9, 35856, 10, 187, 50274, 338, 2810, 64, 23173, 64, 251, 64, 12566, 27, 187, 50270, 23173, 15, 10483, 1082, 535, 187, 1545, 3379, 64, 936, 64, 43885, 9, 84, 2262, 187, 50274, 3845, 256, 535, 187, 1545, 642, 64, 8581, 64, 484, 24275, 9, 84, 2262, 187, 50274, 5858, 535, 187, 1545, 755, 64, 12928, 64, 1344, 9, 12928, 2262, 187, 50274, 6870, 426, 8168, 187, 50274, 1542, 2236, 64, 301, 13, 2236, 64, 2877, 275, 18912, 15, 15565, 14850, 187, 50270, 6870, 15, 9691, 2073, 283, 6, 84, 8, 2462, 313, 3575, 64, 301, 1228, 187, 50270, 338, 2236, 64, 2877, 310, 417, 8256, 27, 187, 50266, 6870, 15, 9691, 9, 3575, 64, 2877, 10, 187, 50274, 2309, 686, 29996, 13956, 9, 6870, 10, 535, 187, 1545, 17813, 64, 395, 64, 1178, 64, 44144, 64, 936, 64, 5478, 9, 12928, 13, 187, 50254, 50270, 50276, 7375, 64, 936, 64, 5478, 13, 187, 50254, 50270, 50276, 4284, 64, 44144, 64, 936, 64, 5478, 13, 187, 50254, 50270, 50276, 7529, 13, 187, 50254, 50270, 50276, 4500, 64, 20154, 2262, 187, 50274, 338, 313, 44144, 64, 936, 64, 5478, 3613, 540, 9, 6986, 64, 44144, 64, 936, 64, 5478, 1228, 285, 393, 187, 50271, 1439, 7529, 27, 187, 50270, 7872, 64, 20154, 15, 3775, 1587, 12161, 272, 428, 48, 4419, 326, 428, 66, 310, 671, 4817, 25107, 187, 50274, 12928, 5013, 19783, 34368, 44144, 64, 936, 64, 5478, 6038, 426, 1213, 9, 44144, 64, 936, 64, 5478, 10, 535, 187, 1545, 2412, 64, 5423, 64, 6535, 22, 84, 9, 23173, 13, 269, 793, 2262, 187, 50274, 23173, 15, 6343, 1587, 8982, 1873, 31934, 22, 22661, 8048, 79, 2807, 187, 50274, 1542, 44296, 275, 269, 793, 27, 187, 50270, 338, 44296, 310, 417, 8256, 27, 187, 50266, 23173, 15, 6343, 22219, 84, 27, 2462, 84, 61, 79, 3, 2462, 313, 16983, 13, 4999, 64, 6535, 22, 9, 5758, 9, 16983, 5029, 15741, 49534, 32875, 187, 50274, 23173, 15, 6343, 30094, 79, 2807, 187, 14214, 1712, 4538, 18, 94, 187, 7770, 187, 187, 1909, 247, 1846, 8984, 273, 253, 11900, 985, 13, 253, 11891, 2281, 273, 37534, 4600, 1049, 21254, 313, 2697, 34, 10, 285, 697, 10552, 275, 253, 2087, 3072, 310, 1698, 1254, 1311, 18, 1092, 1008, 1311, 19, 1656, 6676, 1363, 9958, 432, 473, 4576, 452, 417, 644, 16747, 11245, 285, 4127, 1254, 1311, 20, 7254, 1311, 22, 1656, 380, 1655, 3082, 323, 473, 4576, 6120, 403, 3240, 3710, 13, 285, 7194, 7024, 327, 13463, 23567, 297, 79, 3756, 281, 2557, 253, 1049, 21254, 14, 1994, 9576, 21254, 3605, 313, 17162, 42, 481, 35412, 6433, 452, 12497, 5657, 281, 7472, 473, 4576, 762, 31582, 1617, 15, 2091, 20462, 247, 32339, 1971, 323, 1363, 13, 824, 347, 247, 5869, 13, 581, 3198, 24542, 3082, 281, 3283, 697, 12510, 1078, 9591, 824, 247, 1971, 15, 8710, 6979, 310, 581, 273, 253, 954, 3576, 5609, 281, 10018, 253, 869, 1371, 273, 253, 5170, 23024, 313, 25588, 481, 1723, 13, 1955, 281, 12748, 275, 1481, 285, 7623, 6979, 762, 4600, 1617, 13, 285, 253, 1781, 3064, 275, 530, 34, 869, 1371, 875, 1146, 22238, 285, 17390, 1254, 1311, 23, 1092, 1008, 1311, 24, 5413, 4390, 3739, 6979, 476, 760, 2085, 1077, 3710, 1491, 323, 473, 4576, 7103, 15, 1707, 310, 642, 1332, 326, 476, 3283, 1880, 390, 762, 752, 1617, 3500, 412, 21254, 13, 1014, 473, 4576, 13, 588, 2826, 1309, 4600, 323, 4292, 1754, 327, 24542, 3602, 4080, 762, 31582, 1617, 15, 1310, 581, 476, 1089, 824, 3602, 390, 28308, 326, 476, 320, 4080, 762, 31582, 1617, 13, 352, 588, 320, 247, 1270, 1361, 323, 473, 4576, 9273, 390, 253, 20462, 273, 32339, 9694, 949, 24542, 638, 14, 15419, 12542, 327, 1971, 6973, 15, 187, 187, 25588, 310, 253, 5048, 281, 6186, 7768, 281, 253, 1966, 2133, 15, 1916, 2085, 2217, 7768, 323, 15384, 285, 7944, 13, 247, 2176, 2329, 8868, 310, 3058, 1309, 14578, 15, 4325, 253, 13424, 285, 8651, 2792, 273, 1859, 13, 253, 5052, 273, 530, 34, 7052, 7024, 327, 530, 34, 12087, 1254, 1311, 25, 1092, 1008, 1311, 26, 1656, 530, 34, 5052, 588, 2572, 342, 253, 23024, 13551, 15, 2091, 530, 34, 310, 1512, 6891, 281, 1581, 2217, 2329, 10056, 13, 3500, 412, 21254, 588, 2826, 15, 1198, 271, 2329, 16583, 342, 12848, 2831, 14, 20382, 2170, 13, 253, 6891, 383, 629, 17904, 253, 954, 281, 2685, 5052, 15, 3813, 13, 253, 6891, 383, 2831, 14, 20382, 2170, 273, 530, 34, 313, 36, 4576, 14, 25588, 10, 310, 247, 2442, 4764, 281, 17710, 530, 34, 13576, 15, 187, 187, 8430, 253, 3242, 7887, 1318, 273, 330, 4576, 14, 25588, 778, 6889, 2190, 4292, 13, 581, 4086, 310, 2590, 27, 281, 2085, 15384, 342, 4209, 7768, 13, 330, 4576, 14, 25588, 1364, 417, 320, 4577, 685, 247, 4619, 1318, 275, 1340, 281, 6558, 2622, 14578, 15, 330, 4576, 14, 25588, 310, 8244, 2905, 281, 253, 5743, 273, 815, 28643, 7425, 1080, 13370, 15, 11709, 452, 4950, 326, 1223, 22238, 13, 8655, 7425, 1080, 6616, 1396, 569, 476, 6558, 253, 23024, 1979, 323, 2622, 14578, 15, 380, 6616, 1396, 569, 275, 473, 4576, 1363, 403, 1199, 10046, 685, 1110, 323, 5875, 952, 762, 31582, 1617, 984, 253, 16864, 530, 34, 310, 39937, 275, 1363, 1254, 1311, 740, 7254, 1311, 1047, 1656, 1723, 13, 436, 3745, 273, 730, 74, 11816, 1730, 316, 387, 37527, 588, 8127, 320, 3663, 1309, 4600, 1254, 1311, 1010, 1092, 1008, 1311, 1036, 1656, 12414, 253, 1361, 273, 2266, 6616, 1396, 569, 13, 253, 3402, 273, 530, 34, 2550, 32385, 253, 4016, 3473, 1309, 17006, 13, 285, 530, 34, 588, 13551, 15, 1310, 530, 34, 4916, 1512, 6891, 13, 3500, 412, 21254, 390, 1014, 1049, 21254, 588, 2826, 15, 10635, 327, 253, 1840, 7313, 13, 359, 12661, 247, 747, 4473, 2905, 281, 330, 4576, 14, 25588, 27, 253, 7887, 273, 253, 2170, 323, 3500, 412, 21254, 11653, 313, 7656, 23435, 481, 1198, 1016, 2060, 13, 627, 310, 247, 3367, 7887, 1318, 273, 330, 4576, 14, 25588, 15, 7243, 330, 4576, 14, 25588, 310, 2708, 308, 17162, 48, 1955, 281, 5075, 7425, 1080, 6616, 5743, 1309, 4600, 13, 253, 3110, 4916, 21291 ]
f = open(log_fp, open_mode) else: self._f = None start_time = datetime.now().strftime('%H:%M:%S on %d %b %Y') self.write('Logging started at %s\n' % start_time) self.write('QIIME version: %s\n\n' % get_qiime_library_version()) self.writeQiimeConfig(qiime_config) self.writeParams(params) def write(self, s): if self._f: self._f.write(s) # Flush here so users can see what step they're # on after each write, since some steps can take # a long time, and a relatively small amount of # data is being written to the log files. self._f.flush() else: pass def writeQiimeConfig(self, qiime_config): if qiime_config is None: self.write('No qiime config provided.\n') else: self.write('qiime_config values:\n') for k, v in qiime_config.items(): if v: self.write('%s\t%s\n' % (k, v)) self.write('\n') def writeParams(self, params): if params is None: self.write('No params provided.\n') else: self.write('parameter file values:\n') for k, v in params.items(): for inner_k, inner_v in v.items(): val = inner_v or 'True' self.write('%s:%s\t%s\n' % (k, inner_k, val)) self.write('\n') def close(self): end_time = datetime.now().strftime('%H:%M:%S on %d %b %Y') self.write('\nLogging stopped at %s\n' % end_time) if self._f: self._f.close() else: pass def print_commands(commands, status_update_callback, logger, close_logger_on_success=True): """Print list of commands to run """ logger.write("Printing commands only.\n\n") for c in commands: for e in c: status_update_callback('#%s' % e[0]) print '%s' % e[1] logger.write('# %s command\n%s\n\n' % e) def call_commands_serially(commands, status_update_callback, logger, close_logger_on_success=True): """Run list of commands, one after another """ logger.write("Executing commands.\n\n") for c in commands: for e in c: status_update_callback('%s\n%s' % e) logger.write('# %s command \n%s\n\n' % e) stdout, stderr, return_value = qiime_system_call(e[1]) if return_value != 0: msg = "\n\n*** ERROR RAISED DURING STEP: %s\n" % e[0] +\ "Command run was:\n %s\n" % e[1] +\ "Command returned exit status: %d\n" % return_value +\ "Stdout:\n%s\nStderr\n%s\n" % (stdout, stderr) logger.write(msg) logger.close() raise WorkflowError(msg) # in the no error case, we write commands' output to the log # and also echo to this proc's stdout/stderr else: # write stdout and stderr to log file logger.write("Stdout:\n%s\nStderr:\n%s\n" % (stdout, stderr)) # write stdout to stdout if stdout: print stdout # write stderr to stderr if stderr: sys.stderr.write(stderr) if close_logger_on_success: logger.close() def print_to_stdout(s): print s def no_status_updates(s): pass def get_params_str(params): result = [] for param_id, param_value in params.items(): result.append('--%s' % (param_id)) if param_value is not None: result.append(param_value) return ' '.join(result) def validate_and_set_jobs_to_start(params, jobs_to_start, default_jobs_to_start, parallel, option_parser): if (jobs_to_start != int(default_jobs_to_start)) and \ not parallel: option_parser.error("Passing -O requires that -a is also passed.") params['parallel']['jobs_to_start'] = str(jobs_to_start) def log_input_md5s(logger, fps): logger.write("Input file md5 sums:\n") for fp in fps: if fp is not None: logger.write("%s: %s\n" % (fp, safe_md5(open(fp)).hexdigest())) logger.write("\n") Introduction {#Sec1} ============ As a common disorder of the respiratory system, the awareness rate of obstructive sleep apnea (OSA) and its complications in the general population is low \[[@CR1], [@CR2]\]. Many patients suffering from OSA have not been clinically diagnosed and treated \[[@CR3]--[@CR5]\]. The current methods for OSA diagnosis are quite limited, and mainly depends on overnight polysomnography to measure the apnea-hypopnea index (AHI). Clinicians have insufficient tools to evaluate OSA under waking condition. When designing a personalized treatment for patients, such as a surgery, one needs credible methods to predict its effectiveness before performing such a treatment. Medical imaging is one of the most effective techniques to observe the patency of the upper airway (UA). However, due to difficulties in head and neck imaging under sleep condition, and the large difference in UA patency between being awake and asleep \[[@CR6], [@CR7]\], currently medical imaging can only provide very limited information for OSA evaluation. There is no method that can predict whether or under what condition hypopnea, even OSA, will occur during sleep for individuals based on credible parameters measured under waking condition. If one can find such parameters or indexes that can be measured under waking condition, it will be a great help for OSA screening or the designing of personalized treatments through credible pre-evaluations on treatment outcomes. UA is the channel to supply oxygen to the human body. To provide enough oxygen for organs and tissues, a certain air flux is needed during breathing. From the physiological and mechanical points of view, the resistance of UA strongly depends on UA geometry \[[@CR8], [@CR9]\]. UA resistance will increase with the airway collapse. When UA is too narrow to allow enough air passage, hypopnea will occur. For an air tunnel with varied cross-sectional area, the narrowest part contributes the most to flow resistance. Therefore, the narrowest cross-sectional area of UA (CSA-UA) is a potential parameter to characterize UA behaviors. Although the exact threshold value of CSA-UA may vary among individuals, one rule is clear: to provide organs with sufficient oxygen, CSA-UA must not be smaller than a critical value in order to maintain normal breathing. CSA-UA is closely related to the activation of pharyngeal dilator muscles. Studies have revealed that while awake, enhanced dilator muscle activations can maintain the airway size for normal breathing. The muscle activations in OSA patients are much stronger than those for healthy people under waking condition because the passive UA is narrower in patients \[[@CR10]--[@CR14]\]. However, this ability of genioglossus at daytime will largely be lost during sleep \[[@CR15], [@CR16]\]. Without the help of strong muscle activations, the wall of UA cannot withstand the negative pressure during inspiration, and UA will collapse. If UA becomes too narrow, hypopnea or even apnea will occur. Based on the above observations, we propose a new concept related to CSA-UA: the threshold of the area for hypopnea onset (TAHO). For each individual, there is a personal threshold value of CSA-UA. Once CSA-UA is below TAHO due to weak dilator muscle activation during sleep, the patient becomes prone
[ 15, 844, 751, 253, 3745, 281, 42638, 1027, 7118, 273, 253, 1728, 3239, 281, 320, 1841, 751, 5311, 9319, 13, 12819, 3580, 13, 285, 2675, 3420, 28468, 15, 733, 369, 3965, 3477, 281, 873, 598, 327, 776, 1211, 13, 533, 672, 359, 6337, 715, 7596, 13, 390, 3058, 690, 32176, 1329, 13, 253, 12633, 387, 45562, 6398, 497, 7001, 5356, 20876, 285, 9371, 15, 187, 187, 1898, 48050, 7659, 1638, 13, 4022, 187, 187, 23337, 352, 2, 28127, 281, 897, 285, 7731, 2579, 369, 13103, 2, 3532, 16533, 281, 36219, 1633, 1355, 323, 619, 4422, 285, 597, 2879, 352, 275, 247, 1388, 2, 187, 187, 38, 965, 284, 38266, 9150, 1638, 13, 4022, 187, 187, 1189, 455, 1175, 3021, 2080, 13, 2969, 285, 3477, 281, 897, 285, 2987, 323, 752, 359, 971, 281, 513, 28907, 27, 4223, 4022, 187, 187, 1394, 778, 4456, 273, 253, 4588, 958, 326, 3451, 41433, 285, 5763, 403, 12232, 323, 581, 457, 84, 1786, 15, 1723, 2067, 273, 368, 778, 417, 320, 913, 7348, 6600, 326, 352, 457, 84, 8931, 323, 634, 1077, 1652, 6858, 15, 11709, 10313, 326, 15330, 285, 35130, 10787, 7862, 842, 314, 651, 751, 513, 690, 5763, 323, 5001, 581, 4964, 1016, 1388, 13, 285, 604, 597, 457, 250, 5439, 2509, 18418, 347, 247, 629, 273, 616, 5312, 1495, 13, 597, 457, 250, 417, 253, 4869, 2408, 2866, 187, 187, 1010, 41893, 281, 1361, 368, 3609, 5402, 25707, 457, 84, 9424, 13999, 5555, 253, 1416, 326, 634, 5772, 476, 564, 407, 323, 253, 6414, 273, 616, 1495, 778, 320, 247, 3965, 5699, 1067, 15, 1422, 5730, 281, 7703, 562, 247, 1416, 326, 368, 816, 2389, 534, 368, 457, 250, 4680, 326, 597, 457, 620, 2389, 15, 1707, 403, 247, 2257, 273, 1841, 281, 1158, 670, 13, 534, 476, 2794, 253, 1232, 273, 17221, 247, 1416, 323, 634, 1429, 3176, 689, 2866, 187, 187, 4041, 2523, 534, 588, 1379, 368, 512, 273, 5982, 670, 3101, 3639, 310, 326, 253, 10671, 273, 634, 673, 368, 457, 620, 2075, 7960, 2819, 634, 6858, 15, 36897, 588, 15529, 1561, 253, 25924, 273, 247, 3698, 347, 368, 37643, 339, 521, 1016, 2118, 13, 16764, 326, 3302, 8580, 13, 3302, 9012, 13, 3302, 9555, 20800, 326, 368, 3365, 2226, 327, 253, 2080, 1930, 12422, 285, 14343, 15, 831, 2087, 4853, 476, 3959, 368, 271, 17006, 273, 752, 281, 1902, 2866, 8640, 11775, 459, 64, 1212, 18498, 551, 187, 50276, 6756, 50276, 30, 346, 1370, 16114, 2307, 16, 68, 2320, 14, 66, 324, 14, 28047, 16, 43478, 324, 3, 187, 50276, 4149, 426, 346, 18, 15, 17, 15, 17, 3, 535, 50276, 66, 324, 64, 28047, 50266, 30, 945, 15, 66, 324, 64, 28047, 187, 50276, 66, 324, 64, 6682, 64, 468, 8331, 426, 945, 15, 66, 324, 64, 6682, 64, 468, 8331, 187, 50276, 2364, 87, 1923, 84, 50267, 30, 11775, 459, 1109, 64, 2364, 64, 87, 1923, 15, 2364, 87, 1923, 187, 50276, 15445, 50264, 30, 1980, 15, 15445, 187, 94, 535, 13349, 9440, 29874, 10929, 48056, 31540, 8420, 13, 387, 271, 14890, 12209, 835, 703, 5544, 617, 6849, 327, 9551, 8869, 1204, 275, 1345, 6629, 15, 187, 187, 42, 1158, 752, 368, 457, 250, 43243, 323, 310, 40043, 327, 253, 629, 273, 2208, 15, 1893, 253, 2208, 651, 33459, 17497, 2216, 432, 1014, 253, 6387, 273, 1146, 10256, 275, 20501, 253, 2523, 273, 5606, 15, 1244, 604, 368, 1007, 387, 10950, 627, 310, 417, 247, 24074, 414, 273, 4345, 327, 253, 20801, 273, 1495, 15, 8139, 6049, 651, 359, 9741, 455, 667, 1798, 3762, 32, 4923, 309, 1053, 457, 85, 1158, 326, 1014, 5606, 1346, 13, 407, 285, 1781, 13, 651, 1333, 326, 436, 310, 11464, 958, 15, 1583, 1333, 326, 436, 310, 247, 3762, 13, 347, 973, 347, 17497, 2216, 15, 1893, 309, 1158, 253, 1682, 2181, 281, 513, 310, 281, 1339, 512, 8249, 5441, 327, 253, 2829, 13, 285, 1339, 3484, 7617, 15, 187, 187, 46917, 2312, 14, 25337, 3167, 11819, 1605, 584, 13, 327, 8786, 12674, 49865, 41087, 46737, 457, 84, 2380, 281, 11307, 326, 344, 574, 247, 2145, 14, 2913, 18830, 342, 247, 12096, 3416, 15, 187, 187, 510, 3908, 432, 521, 11115, 310, 253, 2779, 5159, 14, 11860, 281, 521, 4544, 15, 1198, 271, 50081, 30021, 9843, 281, 4138, 949, 521, 6834, 326, 752, 6569, 275, 521, 3055, 2825, 1495, 2506, 457, 85, 2647, 310, 3765, 7337, 528, 15, 187, 187, 36179, 20574, 10701, 10286, 10980, 3918, 46147, 11418, 13, 275, 271, 1121, 14, 264, 3863, 275, 253, 9537, 316, 2828, 74, 9368, 254, 14, 27555, 15, 187, 187, 25424, 263, 593, 15127, 407, 20965, 40156, 14, 7483, 5659, 556, 4518, 4242, 281, 4017, 1142, 6112, 27517, 15, 1893, 352, 457, 84, 2469, 673, 326, 1375, 6338, 3523, 23111, 253, 1895, 285, 1329, 247, 625, 5506, 2746, 281, 2825, 4730, 275, 776, 1345, 6629, 15, 187, 187, 4041, 19371, 281, 773, 510, 12664, 275, 3277, 4787, 313, 27303, 15, 3435, 1108, 7659, 15, 495, 10, 668, 187, 187, 41, 613, 76, 2980, 896, 281, 253, 6112, 322, 9989, 38, 285, 253, 1655, 37029, 4544, 13, 309, 452, 8344, 326, 253, 4473, 273, 773, 7878, 18714, 1204, 668, 310, 2970, 45394, 1475, 15, 6279, 9721, 13, 309, 1239, 271, 3929, 670, 849, 1097, 2201, 3569, 4676, 2868, 275, 352, 13, 533, 597, 513, 594, 275, 1027, 4088, 15, 187, 187, 4509, 12392, 253, 7231, 987, 323, 594, 1142, 1107, 13, 309, 42758, 7945, 326, 616, 14846, 273, 2448, 18714, 1204, 6613, 1633, 751, 253, 1563, 27, 4509, 27, 346, 3251, 266, 378, 15, 28854, 3, 654, 339, 266, 33, 2577, 2971, 1190, 4380, 15, 681, 31, 187, 31, 4325, 27, 5682, 27301, 10378, 654, 22670, 10378, 33, 88, 20, 15, 2061, 31, 187, 31, 187, 31, 2239, 309, 1053, 626, 923, 667, 22861, 323, 253, 1750, 326, 187, 31, 2239, 4454, 32328, 403, 28465, 432, 17607, 5300, 15, 187, 31, 187, 31, 30445, 13, 581, 273, 253, 6459, 9136, 273, 253, 13740, 6484, 7066, 310, 326, 352, 187, 31, 588, 8046, 441, 281, 320, 10799, 670, 752, 247, 2176, 38917, 346, 30799, 3, 1561, 247, 187, 31, 1798, 3634, 15, 6915, 271, 17607, 38917, 323, 247, 2867, 1416, 310, 4217, 187, 31, 984, 368, 476, 513, 247, 19220, 327, 352, 13, 533, 417, 512, 17607, 49189, 2513, 403, 187, 31, 29928, 22498, 68, 494, 13, 594, 247, 13732, 651, 878, 281, 320, 2183, 326, 247, 38917, 310, 187, 31, 362, 1377, 494, 313, 263, 352, 812, 816, 362, 593, 2220, 352, 285, 3524, 326, 627, 434, 187, 31, 1633, 627, 13, 533, 11120, 14851, 326, 271, 17607, 38917, 10414, 187, 31, 690, 5313, 273, 2127, 310, 4217, 481, 187, 1992, 479, 672, 247, 1436, 2789, 598, 247, 38917, 285, 28467, 253, 17607, 17744, 13, 326, 475, 609, 11, 187, 84, 16948, 326, 352, 310, 362, 1377, 494, 313, 49811, 22498, 68, 494, 3346, 253, 6779, 273, 253, 187, 15024, 7826, 12649, 603, 494, 407, 247, 3944, 755, 10, 3346, 533, 840, 326, 3133, 281, 187, 9802, 12759, 523, 7551, 13, 49446, 456, 13, 45650, 13, 285, 13477, 3346, 12506, 973, 3346, 187, 52, 678, 434, 13079, 323, 247, 2969, 10325, 452, 1620, 644, 9369, 22833, 187, 52, 678, 1532, 7916, 27, 4284, 5564, 27, 29770, 468, 10367, 750, 27, 1227, 4694, 16, 1532, 29, 2154, 2437, 568, 8873, 14, 6071, 5264, 81, 2730, 9072, 31, 6067, 29770, 870, 9072, 3073, 81, 2730, 2154, 4826, 568, 3429, 27, 16951, 3498, 28, 8253, 27, 987, 28, 13294, 27, 337, 911, 28, 8459, 27, 337, 911, 28, 5680, 27, 470, 3498, 4891, 14370, 30863, 303, 5943, 3373, 568, 3614, 1358, 5256, 15, 76, 615, 15, 2061, 16, 37813, 16, 5256, 15, 76, 615, 15, 2061, 16, 11242, 16, 78, 4843, 302, 64, 1252, 1449, 30967, 64, 32937, 41496, 14, 446, 5614, 64, 664, 70, 64, 17, 15, 8567, 36561, 3073, 2154, 2730, 81, 31, 3493, 5614, 18805, 13698, 281, 2489, 247, 3426, 285, 1527, 3694, 985, 323, 6109, 4095, 17778, 1288, 4357, 733, 310, 4158, 281, 1918, 11068, 14, 13823, 4212, 896, 1453, 689, 616, 1491, 285, 5511, 17778, 1288, 4357, 32904, 18805, 3936, 247, 41585, 2746, 285, 310, 25495, 281, 495, 5784, 3128, 3694, 13, 6941, 253, 2608, 281, 5206, 534, 4893, 285, 3238, 281, 897, 13, 1223, 5277, 247, 45871, 2793, 2439, 2709, 4095, 17778, 1288, 4357, 32904, 18805, 17930, 1527, 7465, 285, 310, 3715, 275, 247, 13955, 1232, 326, 310, 1527, 323, 3780, 281, 10078, 275, 8239, 81, 3073, 2154, 31, 36, 11729, 689, 253, 1605, 336, 833, 187, 187, 1731, 2552, 4059, 187, 187, 42, 574, 574, 31991, 672, 309, 369, 12821, 608, 2607, 15, 1893, 309, 574, 3846, 26664, 15, 309, 16041, 342, 3253, 3551, 432, 2656, 15, 309, 4536, 26034, 285, 3501, 15, 1359, 1199, 310, 352, 32588, 281, 3501, 285, 26034, 689, 253, 24332, 407, 8033, 32, 187, 187, 510, 2362, 534, 368, 574, 1705, 281, 2968, 342, 310, 247, 9936, 273, 2656, 457, 84, 4086, 281, 1071, 952, 15, 754, 5216, 952, 275, 253, 1533, 314, 1495, 15, 27006, 13896, 27, 187, 187, 1628, 1231, 588, 13353, 1071, 368, 949, 690, 4709, 285, 23635, 13, 407, 2097, 273, 48245, 634, 35586, 13, 4852, 285, 11026, 15, 7918, 9995, 18882, 723, 281, 1110, 665, 403, 3110, 15, 2091, 824, 271, 7119, 320, 27366, 731, 13, 597, 1333, 27, 773, 1231, 5663, 281, 2656, 285, 359, 588, 5604, 1091, 281, 3032, 3361, 1425, 1583, 403, 253, 4394, 665, 452, 253, 3638, 1329, 285, 14426, 273, 616, 10718, 15, 1583, 403, 253, 4394, 665, 403, 327, 253, 987, 1854, 1425, 313, 2422, 14, 24348, 82, 274, 1240, 16, 510, 17346, 374, 27, 15054, 14, 15882, 10, 187, 187, 1147, 556, 644, 10658, 456, 432, 427, 18754, 28453, 313, 15656, 6968, 2262, 187, 187, 1628, 998, 6324, 403, 253, 4088, 273, 247, 44715, 323, 627, 310, 1175, 275, 1046, 18830, 273, 521, 285, 436, 310, 417, 253, 1083, 342, 3780, 2010, 3707, 275, 253, 1083, 273, 247, 44715, 323, 604, 344, 556, 271, 8120, 281, 1928, 12725, 13, 344, 6701, 313, 13618, 582, 3021, 627, 310, 247, 1175, 323, 779, 275, 352, 13, 285, 604, 344, 4850, 715, 7596, 285, 2722, 28404, 313, 395, 990, 980, 352, 46606, 582, 627, 310, 247, 1175, 323, 779, 275, 352, 1425, 313, 19039, 27, 32706, 6356, 8797, 374, 16742, 13, 496, 14, 3305, 3806, 1163, 7225, 7288, 13, 14136, 334, 11487, 13, 41268, 14, 3338, 34, 4384, 313, 14376, 10, 3806, 1163, 7225, 5976, 13, 14136, 334, 818, 15148, 10, 187, 187, 36, 11729, 689, 824, 3394, 310, 417, 19772, 2530, 326, 368, 513, 417, 36733, 1411, 27006, 285, 368, 23277, 281, 3032, 7367, 15, 8079, 352, 556, 644, 10658, 456, 670, 32550, 28453, 313, 15656, 6968, 10, 326, 344, 574, 14187, 323, 2471, 273, 521, 2151, 285, 38634, 15, 187, 187, 1628, 47, 3298, 456, 743, 284, 10269, 5979, 1479, 27, 844, 2427, 342, 27006, 457, 84, 38254, 282, 313, 81, 15, 67, 15, 86, 15, 73, 10, 281, 253, 2806, 37915, 26957, 10388, 338, 13, 285, 344, 369, 253, 5938, 273, 253, 9685, 14, 79, 9786, 273, 309, 44147, 313, 783, 3347, 273, 253, 32550, 481, 27006, 457, 84, 38254, 282, 2335, 309, 44147, 285, 23651, 779, 285, 36280, 779, 285, 1996, 359, 5966, 26957, 10388, 338, 457, 84, 2419, 285, 387, 326, 673, 309, 44147, 369, 275, 521, 1390, 6345, 84, 13, 285, 253, 2927, 273, 27006, 457, 84, 38254, 282, 313, 81, 15, 67, 15, 86, 15, 73, 10, 3053, 43932, 12330, 15, 2802, 5039, 69, 321, 27614, 1342, 10269, 2802, 34, 2375, 753, 13, 773, 48, 27006, 457, 84, 38254, 282, 13, 1014, 368, 403, 47012, 11602, 754, 753, 13, 773, 48, 309, 15453, 2802, 34, 2375, 13, 436, 310, 23661, 1425, 2635, 344, 359, 431, 625, 285, 753, 13, 773, 510, 2927, 403, 43932, 12330, 285, 253, 2798, 310, 20563, 264, 13, 285, 359, 588, 417, 1333, 3707, 752, 2318, 1169, 776, 6203, 13, 473, 309, 44147, 2195, 8079, 359, 403, 20563, 264, 407, 634, 9712, 1425, 668, 313, 35, 2788, 73, 1792, 13, 15955, 23680, 13, 7652, 28, 8797, 13, 43605, 955, 13, 9743, 28, 26957, 12073, 5308, 13, 15955, 23680, 13, 3495, 14, 1348, 28, 309, 15453, 18410, 1240, 13, 15955, 23680, 13, 8676, 10, 187, 187, 1628, 47, 3298, 456, 743, 284, 10269 ]
. We like the ability to designate different sections of the home page to be things like blog posts, featured products, and social media feeds. It was pretty easy to set up on our own, but when we ran into trouble, or needed some customized support, the folks at Pixel Union were amazingly responsive and helpful. Andnest Dec 14, 2016 Love it! Easy to use and customer service was awesome! Needed to customize something small for my website and they added it in a day! Elias AllanDec 14, 2016 overall good thus far, simple and easy to use and works for what we want to doMonth: August 2016 You may remember of the actual fact that correct ingestion and exercise are vital for one’s health. However several of you may not be acutely aware that it’s identical for your very little baby. Studies reveal that infants and toddlers conjointly would like do some exercise for regarding one hour each day, and if they’re raised doing exercises as a part of their daily life, they’re not the maximum amount… 15 Tips to help you select Your Baby’s Name Choosing the name that your kid can go by for the remainder of their life may be a pretty huge call. You wish to seek out a name that you just love which you’re thinking that they’ll love. There are a lot of things to think about, which can create the process of selecting a name for your child appear over… One issue which will take you all of sudden about motherhood is that the quantity of your time you’ll pay merely looking your baby. Hours will disappear within the blink of a watch as you immerse his each move, expecting that initial smile, initial laugh, initial acknowledgement that you simply exist on the far side feeding and sleeping. This general define can offer you an inspiration of what to expect…module azure_applications { source = "aztfmod/caf-aad-apps/azuread" version = "1.0.0" aad_apps = var.aad_apps aad_api_permissions = var.aad_api_permissions keyvaults = azurerm_key_vault.keyvault prefix = local.prefix } Presidential hopeful Michele Bachmann, at an Iowa forum where she explained her views on teaching creationism in public schools. I think what you’re advocating for is censorship on the part of government. So the government would prohibit intelligent design from even the possibility of being taught in questioning the issue of evolution. And if you look at scientists there is not a unanimity of agreement on the origins of life. … Why would we forestall any particular theory? Because I don’t think that even evolutionists, by and large, would say that this is proven fact. They say that this is a theory, as well as intelligent design. So I think the best thing to do is to let all scientific facts on the table, and let students decide. Iowa talk-radio host Steve Deace, on Republican presidential contender Herman Cain’s response to allegations that he had a 13-year affair with a Georgia woman. The statement from his lawyer is the likely kill-shot to his campaign. For an ordained Baptist minister to assert through his attorney that what happens in his private sex life doesn’t matter is preposterous. Texas Freedom Network Education Fund President Kathy Miller, in an op-ed published in the Corpus Christi Caller-Times. Ignorance promoted by abstinence-only programs has clearly failed to protect many Texas teens. So it’s past time that state officials stop ignoring the problem and support a more responsible approach to sex education in our public schools. One Response to “The Week in Quotes (Nov. 27 – Dec. 3)” Hearkening back to the Texas SBOE and the current Presidential campaign, I have noticed that the concept of “American exceptionalism” is getting bounced around. Yesterday, I read an article about how both major political parties believe in it, but they do so in different ways. From studying the religious right for so many years, I hace concluded that their characterization of American exceptionalism runs something like the following:From: "Sean B. Palmer" <[email protected]> > From: Dan Connolly <[email protected]> > > > I don't see any justification for the claim that > > namespaces are disjoint from HTTP resources. > > Certainly, one of the greatest powers of the Semantic Web is that it > will enable us to be precise about what a certain URI "means" within a > particular context. Using an HTTP URI for a property name is useful > because you can do a GET on it, but not all HTTP URIs are > dereferencable, so a processor would need to be told that a URI is > vancable (or it could just vance upon it and hope that there's > something there, but explicitly stating that an HTTP URI references > some piece of code is useful). To me when a person makes up a URI and chooses the HTTP prefix, that *are* saying that it is vancable (dereferencable ... the representation of the resource potentially aquireable by a http get) ... but then that seems to have gotten contorted, conflated, obscured, and confused ... oh well ... Seth's hopes for a simple universe have never been happening .... Seth---layout: defaulttitle: Visionpermalink: /vision/---<divclass="entry-content"><p><strong>Our Vision</strong></p><divstyle="width: 360px; float: right; padding: 1ex; margin: 1ex; border: 0px solid grey;"><imgsrc="https://dot.kde.org/sites/dot.kde.org/files/mascot_20140702_konqui-plasma_wee_0.png"/></div><p>Plasma Mobile aims to become a complete and open software system for mobile devices.<br/> It is designed to give privacy-aware users back control over their information and communication.<br/> Plasma Mobile takes a pragmatic approach and is inclusive to 3rd party software, allowing the user to choose which applications and services to use, while providing a seamless experience across multiple devices.<br/> Plasma Mobile implements open standards and is developed in a transparent process that is open for anyone to participate in.</p></div>Crying over the Deceased 26 May 2014 I had had pains when I was pregnant 5 months. So I had dead twins. I comply with everything coming from God. I sometimes sorrow and cry. How much is it permissible to cry and sorrow over the deceased by Islam? The event which you had come to deal with is a consequence of God’s rule to test people. He tests people in the worldly life. Allah commands: “We will surely test you through some fear and hunger, by means of diminishing your possessions, lives and yields. Give glad tidings to those who are patient. When such an incident befalls them, they say: “We belong to God and we will certainly return to His presence.” They are the ones who have the constant support and grace of their Master. They are the ones who are on the right path.” (Al-Baqarah/The Bull 2:155-157) It has been narrated from Nabi Muhammad (pbuh): “Strange are the ways of a believer for there is good in every affair of his and this is not the case with anyone else except in the case of a believer for if he has an occasion to feel delight, he thanks (God), thus there is a good for him in it, and if he gets into trouble and shows resignation (and endures it patiently), there is a good for him in it.” ( Reference: Sahih Muslim 2999, In-book reference : Book 55, Hadith 82, USC-MSA web (English) reference : Book 42, Hadith 7138) Crying over such events is not prohibited provided that you do not revolt against Allah and you surrender to His orders. Indeed it has been narrated about Prophet Muhammad (pbuh) that he had cried for death of his children and grandchildren. “Narrated Anas bin Malik: We went with Allah’s Apostle (p.b.u.h) to the blacksmith Abu Saif, and he was the husband of the wet-nurse of Ibrahim (the son of the Prophet). Allah’s Apostle took Ibrahim and kissed him and smelled him and later we entered Abu Saif’s house and at that time Ibrahim was in his last breaths, and the eyes of Allah’s Apostle (p.b.u.h) started shedding tears. ‘Abdur Rahman bin ‘Auf said, “O Allah’s Apostle, even you are weeping!” He said, “O Ibn ‘Auf, this is mercy.” Then he wept more and said, “The eyes are shedding tears and the heart is grieved, and we will not say except what pleases our Lord, O Ibrahim ! Indeed we are grieved by your separation.”” (Bukhari, Funerals, 43; Muslim, Virtues, 62; Abu Dawood, Funerals, 23-24; Ibn Majah, Funerals, 53) “Narrated Anas bin
[ 449, 346, 346, 14102, 83, 1595, 13, 5440, 18620, 47579, 346, 20884, 13191, 449, 346, 25000, 6201, 83, 1595, 369, 13084, 285, 288, 4626, 323, 28106, 40905, 342, 247, 20260, 285, 1673, 17543, 449, 346, 346, 24080, 27982, 13, 1445, 338, 911, 15, 346, 428, 346, 23045, 254, 9739, 346, 390, 346, 11717, 14785, 15, 4890, 346, 309, 871, 752, 352, 2097, 449, 346, 1328, 1364, 452, 13, 16831, 13, 9355, 253, 34024, 449, 346, 309, 923, 449, 346, 16574, 1599, 6303, 14785, 273, 2712, 449, 346, 1394, 923, 326, 865, 346, 44441, 264, 562, 987, 627, 449, 346, 42, 476, 760, 8564, 849, 2834, 436, 1364, 320, 323, 368, 449, 346, 2552, 309, 13, 2305, 865, 346, 5874, 31299, 449, 346, 42, 1833, 923, 604, 436, 747, 3239, 10129, 253, 40905, 26899, 449, 346, 1552, 310, 271, 22145, 449, 346, 1394, 1472, 6789, 619, 21507, 247, 43459, 449, 346, 3378, 1675, 13, 1024, 368, 1472, 6789, 619, 1270, 14, 17124, 14, 26852, 69, 15242, 247, 43459, 449, 346, 4374, 13, 8674, 13, 309, 717, 449, 346, 1552, 3548, 626, 690, 22630, 432, 247, 2892, 1984, 449, 346, 3220, 21507, 2183, 479, 436, 2926, 2994, 449, 346, 309, 3047, 253, 5083, 273, 352, 275, 521, 2927, 449, 346, 309, 1353, 7016, 13, 8674, 449, 346, 42, 7777, 717, 449, 346, 1231, 1833, 1071, 436, 16575, 13, 15435, 13, 281, 10501, 366, 352, 449, 346, 1147, 476, 626, 320, 449, 346, 46, 1825, 281, 37627, 8, 9910, 449, 346, 25076, 281, 24811, 326, 1053, 626, 2226, 449, 346, 1276, 434, 253, 1127, 865, 346, 1276, 717, 309, 2819, 323, 865, 346, 19545, 13, 4737, 13, 4737, 449, 346, 1276, 4737, 865, 346, 4013, 13, 39361, 449, 346, 2513, 436, 247, 1984, 670, 253, 8582, 446, 274, 21764, 865, 346, 4374, 13, 352, 310, 670, 253, 8582, 446, 274, 21764, 13, 533, 352, 434, 671, 670, 643, 1841, 449, 346, 9323, 5378, 1974, 11813, 13, 10106, 38209, 285, 643, 38671, 326, 403, 2032, 449, 346, 1893, 253, 2488, 434, 1060, 15428, 10125, 865, 346, 309, 1353, 253, 2488, 449, 346, 1422, 403, 865, 346, 11739, 449, 346, 5035, 13, 16831, 3255, 346, 2512, 434, 247, 5406, 273, 479, 987, 627, 449, 346, 42, 1158, 352, 434, 247, 3965, 1175, 5406, 449, 346, 42, 1869, 326, 5599, 13, 19046, 27982, 13, 1119, 253, 21764, 449, 346, 4497, 13, 4754, 13, 6029, 858, 13, 533, 309, 717, 253, 820, 14, 31732, 449, 346, 5531, 13, 309, 1849, 1620, 3735, 273, 368, 449, 346, 5531, 1476, 346, 4013, 13, 619, 305, 6934, 449, 346, 6723, 368, 6029, 27982, 865, 346, 6279, 449, 346, 4374, 13, 309, 717, 449, 346, 3166, 368, 1211, 247, 2502, 44152, 865, 346, 6279, 13, 309, 513, 449, 346, 6089, 13, 352, 434, 1146, 281, 7184, 449, 346, 41, 78, 865, 346, 13689, 1476, 346, 13689, 1476, 346, 2773, 434, 619, 1113, 1476, 346, 7161, 434, 253, 44152, 865, 346, 20484, 1607, 8055, 352, 449, 346, 380, 20484, 865, 346, 39, 17259, 2926, 449, 346, 3220, 49174, 873, 598, 247, 13739, 327, 271, 8930, 326, 1904, 626, 2226, 285, 17839, 479, 326, 326, 434, 849, 6793, 952, 513, 352, 449, 346, 5872, 309, 1694, 3820, 959, 285, 41352, 342, 247, 5699, 4030, 5043, 1600, 449, 346, 56, 9045, 871, 752, 10474, 403, 327, 2620, 3041, 8918, 865, 346, 25347, 3041, 8918, 449, 346, 1989, 2217, 670, 479, 449, 346, 1276, 434, 747, 342, 368, 865, 346, 4497, 13, 619, 19609, 19301, 479, 562, 13, 309, 1353, 3811, 342, 619, 12247, 937, 346, 619, 2021, 5339, 3918, 15915, 449, 346, 1876, 987, 449, 346, 42, 878, 634, 1361, 449, 346, 42, 476, 626, 2868, 368, 452, 281, 2740, 715, 634, 1211, 2419, 449, 346, 42, 878, 281, 755, 329, 2760, 647, 434, 5417, 449, 346, 2993, 556, 2289, 281, 253, 40905, 26899, 3239, 449, 346, 4967, 1053, 626, 368, 1642, 329, 2760, 647, 323, 617, 1361, 865, 346, 2993, 4391, 253, 13965, 2127, 13, 32920, 449, 346, 2993, 434, 417, 1469, 281, 2312, 281, 479, 449, 346, 3074, 987, 449, 346, 1231, 452, 1884, 7253, 846, 253, 10028, 7866, 281, 19495, 253, 13965, 449, 346, 6826, 449, 346, 42, 1833, 3164, 14938, 7004, 436, 13, 533, 752, 4592, 342, 368, 285, 329, 2760, 647, 865, 346, 42, 1053, 626, 871, 449, 346, 42, 1053, 626, 871, 449, 346, 2993, 3053, 970, 253, 3159, 346, 601, 3, 247, 2257, 449, 4890, 2598, 865, 3, 346, 6506, 13, 751, 13, 346, 2598, 13, 309, 5476, 619, 4743, 2506, 626, 2647, 15, 4890, 4890, 2598, 13, 368, 1646, 281, 1900, 871, 752, 434, 1682, 15, 346, 346, 2598, 13, 309, 5476, 309, 1353, 20624, 15, 4890, 346, 4125, 309, 1849, 4395, 562, 13, 359, 1472, 23534, 17076, 3255, 346, 4013, 449, 346, 22737, 449, 346, 5804, 626, 3153, 342, 731, 13, 3340, 604, 597, 1818, 253, 13965, 11646, 449, 346, 1394, 858, 326, 275, 2030, 7253, 449, 346, 2773, 434, 2139, 309, 2028, 952, 281, 755, 247, 4370, 449, 346, 21979, 352, 449, 346, 1876, 987, 13, 1339, 434, 564, 449, 346, 2773, 434, 417, 329, 2760, 647, 434, 1113, 449, 346, 2993, 369, 327, 247, 3522, 449, 346, 33989, 626, 326, 326, 5599, 865, 346, 510, 5219, 3995, 5599, 865, 346, 510, 5219, 3995, 27477, 30112, 21508, 310, 1735, 7216, 449, 346, 11175, 604, 368, 1472, 417, 3255, 346, 1328, 434, 12504, 1476, 346, 1276, 6569, 604, 5753, 1053, 626, 1089, 512, 253, 11624, 865, 346, 24243, 449, 346, 1394, 789, 275, 247, 16064, 13, 285, 368, 3153, 275, 581, 449, 346, 41774, 1199, 449, 346, 1276, 19080, 1234, 435, 1796, 449, 346, 2993, 1364, 751, 779, 449, 346, 3074, 987, 13, 1339, 479, 1918, 368, 247, 4892, 273, 253, 2419, 449, 346, 10826, 449, 346, 2064, 434, 2686, 2238, 273, 3255, 346, 4013, 13, 329, 2760, 647, 449, 346, 1737, 403, 368, 2509, 1060, 865, 346, 309, 816, 3058, 281, 755, 690, 1841, 449, 346, 44085, 13, 1175, 281, 923, 368, 969, 449, 346, 27982, 449, 346, 2347, 858, 368, 755, 275, 13, 6029, 865, 346, 51, 11416, 1476, 346, 8380, 562, 1060, 1476, 346, 1276, 865, 346, 8262, 1476, 346, 1276, 403, 368, 2509, 1060, 865, 346, 42, 1599, 13, 352, 434, 634, 2419, 13, 533, 3255, 346, 42, 2197, 368, 247, 3491, 273, 619, 1984, 449, 346, 8917, 368, 755, 247, 4839, 865, 346, 1621, 13, 309, 6468, 626, 1239, 352, 2568, 449, 346, 353, 78, 449, 346, 42, 871, 368, 449, 346, 1394, 1472, 253, 5219, 3995, 1095, 1080, 449, 346, 309, 1353, 32920, 449, 346, 1231, 1313, 13, 16831, 13, 896, 275, 3255, 346, 10154, 449, 346, 1394, 1472, 13, 16831, 13, 6029, 434, 13372, 449, 346, 1276, 865, 346, 26186, 13, 5046, 309, 943, 564, 449, 346, 11739, 13, 309, 1353, 1663, 3255, 346, 399, 5338, 10873, 2360, 865, 346, 42, 3255, 346, 42, 2686, 2168, 452, 5827, 323, 10873, 449, 346, 1394, 513, 865, 346, 4683, 2282, 368, 513, 449, 346, 1292, 309, 1353, 1959, 327, 6794, 449, 346, 20352, 76, 1034, 449, 346, 5531, 13, 1270, 449, 346, 7088, 2360, 449, 346, 7088, 2360, 449, 346, 42, 2550, 2868, 368, 9377, 275, 449, 346, 1737, 858, 368, 1379, 865, 346, 733, 434, 816, 619, 1841, 449, 346, 6288, 352, 689, 13, 6029, 449, 346, 42, 878, 281, 923, 253, 40905, 26899, 3239, 449, 346, 1394, 3047, 253, 3239, 4834, 449, 346, 2512, 310, 642, 21764, 3711, 327, 352, 449, 346, 2302, 13, 352, 434, 247, 39175, 4283, 281, 247, 3711, 449, 346, 31568, 9879, 14, 5695, 253, 3239, 865, 346, 2302, 878, 281, 449, 346, 510, 12296, 4028, 327, 253, 3239, 310, 4518, 7985, 449, 346, 1147, 812, 452, 644, 44767, 390, 28290, 449, 346, 1394, 1472, 253, 6423, 273, 3389, 14144, 449, 346, 1394, 871, 436, 449, 346, 3650, 598, 281, 479, 449, 346, 1147, 434, 417, 619, 7811, 449, 346, 2773, 7811, 5012, 281, 634, 7811, 449, 346, 8380, 327, 449, 346, 4041, 1007, 762, 20542, 449, 346, 1394, 476, 452, 253, 9693, 29464, 30136, 449, 346, 14358, 273, 731, 865, 346, 1231, 1849, 644, 2819, 387, 436, 3239, 323, 3038, 449, 346, 2512, 434, 2717, 627, 449, 346, 17126, 13, 309, 1663, 1053, 626, 1158, 359, 1472, 1469, 281, 1089, 2712, 327, 436, 3239, 449, 346, 688, 247, 4289, 1107, 13, 642, 581, 434, 1469, 281, 4456, 3780, 3206, 275, 253, 15915, 34024, 16280, 40905, 449, 346, 2773, 434, 417, 2032, 449, 346, 4045, 368, 871, 253, 2048, 13, 346, 8389, 1416, 310, 16059, 47579, 346, 6279, 449, 346, 4527, 2282, 449, 346, 1422, 513, 865, 346, 1422, 871, 253, 6510, 273, 253, 2048, 865, 346, 9876, 3780, 533, 368, 865, 346, 9034, 15, 20628, 353, 7937, 369, 13084, 273, 1146, 247, 820, 14, 45097, 1080, 275, 253, 15915, 34024, 449, 346, 510, 1941, 369, 45026, 449, 346, 1328, 369, 1996, 268, 472, 11406, 13, 533, 352, 1904, 626, 2647, 449, 346, 46, 7937, 434, 1416, 1335, 4852, 275, 2192, 14743, 449, 346, 1898, 309, 588, 417, 1339, 7195, 27982, 8, 1416, 320, 16059, 449, 346, 6029, 449, 346, 1737, 865, 346, 7745, 387, 436, 449, 346, 2594, 326, 865, 346, 5531, 449, 346, 2064, 434, 3240, 1633, 13, 3548, 626, 352, 865, 346, 11739, 449, 346, 1147, 2296, 346, 3610, 15414, 15, 4890, 346, 1147, 434, 2717, 449, 346, 2632, 301, 780, 12296, 432, 253, 10268, 3239, 449, 346, 6623, 532, 352, 449, 346, 510, 4876, 403, 24291, 449, 346, 733, 434, 247, 39175, 449, 346, 6279, 449, 346, 1147, 310, 449, 346, 34, 39175, 449, 346, 5035, 849, 253, 4876, 403, 9904, 865, 346, 21020, 25525, 260, 532, 3398, 22573, 4876, 275, 8557, 449, 346, 1552, 812, 5276, 521, 2926, 449, 346, 28645, 368, 30358, 253, 39175, 13, 436, 1057, 417, 5276, 247, 3762, 449, 346, 2773, 434, 10826, 449, 346, 1231, 878, 247, 2620, 14, 15139, 23473, 449, 346, 1737, 434, 253, 23473, 865, 346, 309, 1053, 626, 871, 2568, 449, 346, 1876, 987, 449, 346, 41932, 13, 476, 309, 755, 247, 3379, 483, 273, 436, 865, 346, 2512, 434, 247, 6494, 3000, 275, 253, 4383, 3448, 449, 346, 25302, 281, 320, 247, 13760, 3255, 346, 1466, 434, 1265, 432, 253, 5068, 449, 346, 34, 15, 329, 472, 87, 782, 449, 346, 5498, 626, 971, 281, 9313, 327, 634, 28768, 1060, 13, 533, 309, 1053, 626, 1158, 436, 310, 6501, 3523, 3, 346, 9034, 15, 43426, 432, 30849, 253, 8900, 273, 253, 3239, 10873, 449, 346, 2302, 13, 1024, 13, 3343, 449, 346, 5804, 626, 368, 1642, 779, 281, 3343, 1919, 309, 5276, 7195, 310, 15377, 865, 346, 1276, 604, 344, 3548, 626, 15377, 865, 346, 20405, 865, 346, 35082, 751, 776, 1711, 3331, 6029, 27982, 310, 275, 253, 3668, 969, 449, 346, 1276, 858, 344, 1089, 1024, 865, 346, 34944, 35902, 865, 346, 34, 5599, 2210, 3579, 342, 247, 5816, 40905, 26899, 3239, 449, 346, 2773, 434, 417, 253, 1682, 629, 449, 346, 19577, 281, 436, 449, 4890, 2374, 253, 3239, 403, 253, 4454, 273, 253, 11882, 2392, 275, 253, 15915, 34024, 13, 347, 973, 347, 247, 3786, 7202, 11882, 1080, 937, 346, 24080, 27982, 449, 346, 24080, 27982, 310, 753, 281, 320, 253, 1270, 14, 17124, 14, 26852, 13453, 273, 21764, 32290, 19046, 17179, 27982, 15, 4890, 346, 29084, 619, 17772, 497, 3076, 449, 346, 1737, 513, 359, 871, 670, 436, 5874, 31299, 865, 346, 9011, 865, 346, 22757, 3916, 344, 574, 436, 3239, 323, 11858, 1107, 840, 816, 8423, 3249, 3579, 342, 352, 865, 346, 6049, 865, 346, 844, 1833, 1089, 562, 449, 346, 36011, 449, 346, 35, 11660, 449, 346, 16600, 1469, 449, 346, 2064, 434, 11339, 449, 346, 1359, 434, 344, 2509, 865, 346, 16600, 2444, 449, 346, 1231, 1472, 14442, 281, 253, 5874, 31299, 2021, 323, 3551, 6593, 342, 253, 3239, 449, 346, 2374, 253, 3239, 310, 247, 1416, 273, 247, 3786, 7202, 11882, 1080, 13, 7195, 27982, 449, 346, 43426, 556, 8686, 715, 352, 449, 346, 5035, 865, 346, 14815, 368, 3523, 7487, 326, 449, 346, 1147, 434, 327, 253, 7336, 1476, 346, 1621, 15910, 352, 1024, 449, 346, 27982, 778, 452, 644, 253, 6805, 3255, 346, 1583, 452, 642, 4685, 449, 346, 1422, 871, 253, 5083, 449, 346, 2773, 434, 512, 326, 8213, 449, 346, 1394, 3735, 253, 2926, 432, 8481 ]
." " "Surratt, copiae"?" " Military supplies." "Mary Surratt was convicted and hanged for supplying Booth with a rifle and field glasses." " "Thomas Gates, artifex. " - "Designer"" " or "mastermind. "" " I know what it means." "He must have, uh, planned the assassination." " I see." " Could mean mastermind of anything." "You see that?" "Burned out right there." "I can only imagine how difficult this must be for you." " May I, Mr?" " Wilkinson." "I'll see if this new page matches the Booth diary." "This is an outrage." "You're calling my grandfather a liar." "With respect, now you're calling my great-great-granddaddy a liar." "Yes, sir, I am." "This isn't some garbage from a history book." "My grandfather told me this story himself." " I saw the truth of it in his eyes." " I'm sorry, sir." "I truly am." "We'll test this thoroughly, Patrick, to authenticate it." "It can't be." "Maps to presidents' houses." "Keys to locks that don't exist." "What's the point?" "What am I looking for?" "Proof, proof, proof." "What proof?" "Oh, wow." "Is this a book about the Templar treasure?" "Yes, it is about the Templar treasure, but it's also about other things." "Conspiracy theories, urban legends and other myths that are true." " So the author's here signing copies?" " I'm the author." " You are?" " Yeah." "See, uh..." "There's a picture of me right there." "I think it's a pretty good picture." "I thought that guy, Benjamin Gates, found the treasure." "Well, yes, Ben did, but I am the co-finder." " Oh, I've never heard of you." " Oh!" "Oh, my gosh." "Are you Ben Gates?" " Yes." "Yes, I am." " Do you own a red Ferrari?" " Yes, I do." " Well, it's being towed." "Hm?" "Wait!" "Wait!" "That's my car!" "Where's the Ferrari?" " IRS impounded it." " The IRS?" "Funny story." "My accountant set up a corporation on an island that didn't exist and assured me that that's how rich people do it." "Then I got audited and slapped with a huge fine plus interest." "Wanna know what taxes are on five million dollars?" "Six million dollars." "But enough about me." "What's new with you?" "Well, my girlfriend kicked me out, I'm living with my dad," " my family killed President Lincoln." " All right." "I need your help." "I can't believe you have to break into your own house." "I need to get Abigail's ID." "She has access to the Booth diary page." "Why don't you ask Abigail for her help?" "She changed the alarm code, Riley." "She's not going to talk to me." "All right." "We have 30 seconds after the alert starts to disable the alarm." "Go." "I'll probably regret asking this, but what happened with you and Abigail?" "I don't know." "I don't know." "She started using the word "so" a lot." ""So?"" "Yeah, like, "So, I guess my opinion doesn't matter. "" ""So, you seem to always know what's best. " "So, I guess I'm invisible. "" "Now I've moved out, we're dividing furniture..." "Oh." "Women." "Can't live with them, especially if they change the alarm codes." "You did that in 25 seconds." "That's why I tell people to get a dog." " Got it." " All right, let's go." "That's not Abigail's car." "She was on a date." "Isn't that that guy?" "The White House guy?" "The White House Easter Egg Roll is next Monday." "Maybe if you're not..." "He's weird!" "What happens if kids don't find all the eggs?" "Wow." "You work in a museum, and you live in one." "Pretty much." "What clever repartee." "She must like him." "All right, let me give you a tour of the house." " OK." " That's actually kind of..." "Oh, Abigail." " What are you doing here?" " I just needed to get some things." " Connor, good to see you again." " Gates." "How did you get in, Ben?" "Riley!" "Come out here!" "What?" "Hey!" "What are you doing here?" "I mean, it's your house, but..." "I sent you a copy of my book." "Did you get a chance?" " No, I haven't read it yet." " Mm." "I know you." "You're the White House curator." " I'm Riley." "We met, uh, back in..." " Right." "You're, uh, Ben's assistant." "What?" "Um, maybe I should go." " Yeah, I'm really..." " Dinner tomorrow night?" "I..." "I actually already have plans for tomorrow." "You do?" " Of course you do." " But I'm free on Friday." " Awkward." " Oh, great." " Good night." " Good night." "I cannot believe you broke in." " What did you take?" " It's just my things." "Hand it over, Ben." "I need to see the Booth diary page." "You saw the page yourself." "There is no treasure map on it." "No, it's a cipher leading to a map." "Anyone spectral-image the page?" "No need to." "The ink writing on the page is clearly visible." "It could have been erased or faded." "You're the director of document conservation." "You know this." "Not up to me." "It's not my department." "That department reports to your department." "Come on." "One look under infrared." "You can have the Boston Tea Tables." "Both of them?" "We've been looking at this page for hours." "There's nothing there." "Ben, I really don't think we're going to find anything on this page." "In a hundred years, no one's going to remember anyone involved in the Lincoln assassination besides Booth." "That's not true." "Do you know the expression, "His name is mud"?" " Yes." "Of course." " You do?" " You know the origin of the expression?" " Does anyone but you?" "Dr. Samuel Mudd was convicted of being a co-conspirator in the Lincoln assassination." "The evidence was circumstantial." "He was later pardoned, but it didn't matter." "Mudd's name still lives in infamy." "And I will not let Thomas Gates' name be mud." " Ben." " What?" "Look at this." " See that?" " Oh." " That's quite something, isn't it?" " Yeah." "It says "smudge. "" "It's nothing." "Residual ink from the facing page." "Flip it." "The letters are backwards." " It's a cipher." " Yes." "It is." "A cipher." "See how the letters are coupled?" "Playfair ciphers encode letters in pairs." "This could prove his story." "Unless you decode the cipher, this does not prove a theory." "That's OK." "We need a five-letter keyword." " What's the keyword?" " I don't know yet." " All right." " Uh, can I get a printout of this?" "There's a billion words in the English language." "Got to be a logical..." "Let's start from the beginning." "A. Aardvark." "Don't want to rain on your parade here, but I don't think this is gonna stop" "Dr. Nichols from announcing the discovery of the page tomorrow." "No, now, wait." "Can't you ask him to wait until I prove Thomas is innocent?" "What if he isn't innocent?" "Sir?" "Looks like our old friend Ben Gates is in the news again." "What did he find now?" "Atlantis?" "A guy came forward with a missing Booth diary page." "That's not the best part." "Listen to this." ""On the page are the names of the conspirators in the Lincoln assassination, as well as a previously unknown conspirator," "Thomas Gates." "Thomas Gates is said to be the great-great-grandfather of treasure hunter Benjamin Franklin Gates. "" " Thought my relatives were bad." " What do we know about this Wilkinson?" " Sir?" " Guy claims he had this page for 140 years then just suddenly comes forward with it?" " Why?" " We'll find out." "Better." "Bacon." " Keep going." " That's stupid." " How's he doing?" " Keep working." "We're grateful to the Wilkinson family for coming forth with the page." "On the page is a name of a previously unknown conspirator, Thomas Gates." " Nichols has bought into it." "See?" " Would you stop watching that." "It's on the Internet!" " No stopping it now." " Gates may have been the architect..." " They have no understanding." " You know the truth." "That's all that matters." "You heard the story from Grand
[ 1881, 14, 515, 5930, 2379, 186, 78, 19, 426, 278, 19, 28, 2379, 186, 78, 18, 426, 278, 18, 28, 15971, 186, 78, 18, 15, 13125, 64, 3845, 1874, 2379, 186, 71, 19, 15, 13125, 64, 3845, 1874, 15971, 186, 2309, 470, 28, 190, 187, 94, 2379, 49, 316, 1994, 266, 814, 775, 662, 66, 187, 187, 49, 316, 1994, 266, 41745, 775, 662, 66, 310, 1119, 281, 320, 6685, 12912, 275, 26259, 253, 2523, 273, 657, 28233, 13, 15946, 66, 285, 30789, 3227, 399, 375, 3227, 15, 733, 310, 671, 247, 11906, 22587, 321, 1272, 280, 9921, 323, 5111, 431, 9673, 14771, 9360, 15, 380, 2201, 12696, 1119, 275, 367, 316, 1994, 266, 41745, 775, 662, 66, 403, 34445, 6156, 1777, 267, 13, 611, 8952, 11777, 348, 13, 12899, 66, 13, 15315, 328, 31069, 75, 13, 329, 312, 443, 19283, 13, 285, 4200, 11825, 15, 2053, 3626, 12696, 452, 253, 9559, 1786, 5373, 4768, 253, 2133, 15, 367, 316, 1994, 266, 41745, 775, 662, 66, 310, 247, 46001, 22587, 321, 1272, 280, 9921, 323, 12767, 2710, 12607, 3374, 15, 733, 476, 8722, 281, 2968, 342, 2102, 304, 9598, 13, 5192, 14283, 13, 25411, 317, 14283, 13, 14869, 32713, 13, 12558, 28487, 13, 15382, 14814, 13, 2071, 80, 839, 13, 285, 21869, 275, 253, 12607, 15, 733, 310, 1119, 6685, 12912, 275, 12767, 1142, 19859, 41286, 1975, 10552, 15, 2596, 476, 897, 824, 15895, 281, 755, 8314, 273, 33613, 10332, 15, 9730, 21407, 267, 8984, 13, 2070, 1028, 39667, 21071, 13, 9730, 17536, 356, 571, 13, 18402, 17536, 9448, 13, 9730, 21407, 267, 50045, 13, 13343, 257, 21407, 267, 9237, 13, 285, 416, 21216, 522, 40426, 476, 320, 35977, 456, 407, 367, 316, 1994, 266, 814, 775, 662, 66, 15, 733, 310, 671, 1119, 281, 320, 4122, 12912, 323, 13255, 10696, 285, 3075, 2905, 3374, 15, 2596, 476, 25596, 352, 337, 281, 374, 23451, 273, 1824, 846, 1907, 253, 11484, 15, 6989, 27, 998, 1402, 263, 187, 187, 4509, 443, 460, 532, 66, 7366, 13, 253, 29260, 273, 28848, 44925, 35372, 187, 187, 12092, 4130, 15, 309, 1353, 659, 1402, 263, 285, 452, 644, 247, 3558, 273, 443, 460, 532, 66, 7366, 323, 247, 807, 1024, 15, 309, 12921, 6571, 275, 7774, 10620, 342, 253, 3173, 468, 8075, 285, 2710, 20303, 15, 4129, 619, 3640, 310, 14999, 2429, 281, 690, 273, 253, 3811, 34032, 41, 546, 12642, 11802, 6358, 326, 403, 776, 24127, 968, 13, 309, 1335, 871, 2217, 281, 1056, 9021, 285, 717, 247, 10879, 8121, 285, 9414, 327, 436, 35372, 15, 35193, 1959, 281, 1339, 479, 871, 604, 627, 310, 2712, 13, 1014, 10000, 789, 13, 326, 310, 3058, 285, 309, 588, 923, 752, 309, 476, 513, 15, 28292, 34262, 8690, 33603, 1359, 7042, 556, 8176, 326, 247, 45575, 32326, 943, 1620, 452, 644, 1691, 275, 4179, 273, 11268, 434, 3645, 9167, 4426, 5425, 387, 253, 9145, 273, 247, 3761, 14, 11097, 272, 4194, 15, 187, 187, 49348, 452, 9262, 247, 5833, 281, 3645, 37790, 562, 30927, 655, 686, 328, 25525, 8, 7089, 275, 1390, 6926, 434, 1283, 14, 740, 13313, 407, 22785, 275, 30167, 14, 846, 534, 32326, 26113, 309, 636, 2679, 1026, 86, 369, 40754, 745, 253, 11288, 15, 187, 187, 42, 636, 2679, 1026, 86, 369, 11162, 1078, 253, 14811, 407, 37790, 3060, 13, 3692, 4007, 310, 45575, 5625, 19898, 7039, 3558, 3821, 35026, 4922, 1792, 86, 13, 533, 14672, 670, 247, 7344, 273, 1600, 497, 12841, 15, 187, 187, 55, 17869, 309, 636, 2679, 1026, 86, 369, 253, 32326, 347, 31351, 7320, 745, 247, 5699, 14004, 3330, 689, 11268, 327, 6926, 187, 187, 30574, 571, 3058, 11268, 281, 7168, 281, 19478, 428, 533, 37790, 3060, 10945, 9883, 9762, 281, 5386, 309, 636, 2679, 1026, 86, 1384, 1897, 1078, 253, 6004, 15, 24486, 1877, 310, 4409, 670, 8157, 18, 15, 22, 24561, 281, 11268, 285, 34262, 285, 3473, 310, 3629, 323, 253, 2165, 281, 320, 294, 35293, 15, 187, 187, 49348, 8690, 38436, 40059, 753, 27, 686, 14947, 37790, 878, 281, 1056, 8426, 15, 844, 452, 574, 1329, 432, 512, 689, 253, 1533, 2464, 187, 187, 20405, 1639, 422, 9002, 1034, 1925, 323, 247, 44864, 13, 40021, 271, 11790, 2380, 432, 1219, 249, 8939, 83, 2679, 13, 4007, 273, 45575, 37790, 20369, 13, 665, 753, 27, 686, 2019, 422, 9002, 1034, 310, 247, 20071, 254, 342, 2717, 281, 513, 2464, 187, 187, 49649, 502, 6948, 342, 1016, 977, 285, 253, 32326, 846, 253, 2165, 534, 3047, 22785, 19478, 187, 187, 51, 814, 1615, 3060, 2918, 271, 275, 4557, 281, 2278, 253, 32326, 434, 3045, 327, 6794, 15, 11268, 1160, 271, 3565, 2748, 323, 253, 2278, 281, 320, 11450, 1250, 407, 271, 3907, 2133, 13, 824, 347, 253, 15371, 54, 13, 533, 352, 369, 12841, 15, 187, 187, 510, 11815, 273, 253, 4804, 588, 320, 774, 19416, 281, 37790, 3060, 4450, 2758, 285, 3645, 37790, 327, 7216, 2360, 15, 187, 187, 8, 510, 2644, 985, 310, 44065, 27319, 4117, 753, 247, 21261, 327, 6926, 2603, 15, 686, 6075, 784, 3533, 878, 281, 320, 2546, 273, 37790, 3060, 2464, 15999, 3645, 37790, 769, 13, 34262, 588, 320, 275, 247, 3645, 9167, 6363, 342, 11011, 13, 13944, 285, 4047, 15, 1583, 403, 8445, 247, 747, 8690, 846, 29630, 1342, 1359, 7042, 15856, 4260, 1106, 949, 253, 11067, 14726, 378, 6884, 15, 187, 187, 1672, 14, 30574, 571, 8690, 33603, 1359, 7042, 8176, 326, 247, 45575, 943, 1620, 452, 644, 275, 4179, 187, 187, 8, 510, 32326, 10095, 626, 2455, 452, 644, 1691, 275, 1659, 323, 253, 990, 273, 253, 14811, 4117, 1359, 7042, 2183, 253, 21261, 327, 6926, 15, 187, 187, 8, 42, 871, 26113, 1077, 973, 285, 309, 1871, 320, 9861, 604, 344, 1871, 644, 26740, 264, 407, 2712, 15, 309, 3524, 323, 29385, 434, 13232, 326, 627, 556, 644, 642, 11755, 2136, 285, 309, 1849, 3735, 2717, 281, 1804, 627, 556, 644, 15, 187, 187, 8, 36735, 1585, 273, 665, 253, 32326, 369, 13, 627, 310, 642, 1659, 275, 29385, 8083, 323, 6671, 281, 2983, 247, 32326, 2464, 3404, 253, 20632, 273, 4565, 3349, 13, 4072, 13, 253, 49850, 3995, 12244, 25213, 342, 1270, 11010, 285, 480, 538, 10108, 776, 12368, 11574, 12958, 285, 1199, 7636, 35213, 6393, 24131, 249, 285, 35213, 6393, 322, 658, 6362, 15, 3932, 840, 253, 39426, 8139, 187, 187, 510, 1048, 48717, 15790, 1388, 369, 20632, 264, 342, 512, 697, 42242, 13, 18349, 285, 11010, 347, 46242, 6393, 4137, 75, 682, 13, 399, 792, 74, 285, 743, 484, 66, 19651, 616, 15790, 500, 538, 37707, 285, 35213, 13558, 90, 22847, 665, 19651, 617, 16309, 500, 538, 37707, 327, 8139, 46170, 187, 33, 3140, 187, 31696, 34852, 2634, 15467, 1450, 73, 3230, 1450, 16716, 43292, 16433, 187, 187, 33, 35152, 7406, 43898, 570, 4072, 14, 7132, 187, 14178, 3567, 762, 253, 35476, 9107, 4637, 13, 11099, 337, 15, 17, 15, 187, 9, 5035, 17909, 1873, 21826, 15, 6535, 390, 3491, 387, 3944, 1358, 15467, 15, 2061, 16, 17821, 64, 18, 64, 17, 15, 10134, 10, 187, 1738, 187, 187, 4, 17331, 10807, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 4, 3182, 10807, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 187, 4, 3709, 654, 15467, 16, 73, 3230, 16, 5397, 15, 17471, 31, 187, 4, 3709, 654, 15467, 16, 73, 3230, 16, 6443, 16, 9453, 15, 17471, 31, 535, 187, 30113, 64, 10114, 1322, 64, 28997, 32718, 9566, 64, 32077, 187, 50274, 39481, 33340, 247, 1318, 875, 1016, 4667, 273, 3603, 275, 247, 6486, 3425, 15, 187, 50274, 39481, 1214, 272, 47700, 1387, 14, 26102, 187, 50274, 39481, 187, 50274, 39481, 10300, 247, 6486, 2634, 26102, 65, 2634, 14831, 65, 342, 247, 4872, 1320, 273, 187, 50274, 39481, 2634, 60, 89, 18, 13, 1269, 19, 13, 34845, 1269, 79, 62, 11976, 2634, 16716, 43292, 9, 14831, 13, 1182, 10, 65, 310, 247, 747, 3425, 342, 247, 187, 50274, 39481, 4872, 1320, 273, 2634, 60, 89, 18, 13, 1182, 13, 1269, 19, 13, 1182, 13, 1269, 20, 13, 34845, 1269, 79, 14, 18, 13, 1182, 13, 1269, 79, 62, 16433, 496, 643, 187, 50274, 39481, 3000, 13, 352, 37034, 253, 2634, 91, 65, 3284, 875, 1046, 4667, 273, 3603, 273, 187, 50274, 39481, 253, 3236, 3425, 15, 1310, 253, 3425, 310, 6325, 390, 556, 247, 2014, 187, 50274, 39481, 3284, 13, 2634, 16716, 43292, 65, 6548, 253, 3425, 347, 14, 261, 15, 496, 512, 2219, 13, 187, 50274, 39481, 253, 3425, 1364, 320, 6486, 15, 187, 50274, 39481, 187, 50274, 39481, 187, 50274, 39481, 1214, 3575, 48361, 187, 50274, 39481, 380, 3425, 275, 534, 247, 1318, 310, 734, 1033, 398, 264, 15, 187, 50274, 39481, 187, 50274, 39481, 1214, 3575, 1182, 187, 50274, 39481, 380, 1318, 281, 320, 13400, 875, 1046, 4667, 273, 3603, 273, 253, 3425, 15, 187, 50274, 39481, 187, 50274, 39481, 187, 50274, 39481, 18466, 187, 50274, 39481, 14022, 187, 50274, 39481, 1214, 3709, 1650, 16, 16716, 43292, 15, 14161, 187, 4, 16238, 10807, 64, 10114, 1322, 64, 13220, 26431, 31183, 64, 1042, 55, 10249, 1703, 187, 50274, 3474, 18689, 6753, 734, 84, 43292, 426, 544, 880, 15149, 10494, 48361, 13, 6753, 10494, 1182, 10, 551, 187, 50270, 2309, 6809, 14, 3431, 4066, 2147, 28, 187, 50274, 4718, 187, 4, 7271, 187, 50274, 8547, 654, 15295, 322, 13, 7919, 426, 2991, 31, 187, 50274, 2855, 734, 84, 43292, 64, 15680, 1163, 734, 84, 43292, 64, 15680, 29, 52, 13, 672, 29, 5672, 5064, 551, 7734, 535, 50274, 2855, 734, 84, 43292, 64, 85, 551, 187, 50270, 8547, 654, 15295, 1594, 84, 13, 7919, 1503, 31, 187, 50270, 3474, 18689, 6753, 5572, 1082, 9, 57, 84, 10494, 48361, 13, 1503, 10494, 1182, 10, 1030, 28, 187, 50274, 4718, 535, 50274, 3474, 18689, 734, 84, 43292, 64, 85, 734, 84, 43292, 41619, 187, 4, 7287, 187, 30113, 64, 10114, 1322, 64, 28997, 32718, 9566, 64, 8112, 187, 187, 4, 7287, 1380, 2195, 30113, 64, 10114, 1322, 64, 39, 18576, 64, 19118, 4350, 947, 2354, 64, 40311, 187, 41, 9989, 457, 84, 380, 6317, 4461, 369, 15620, 327, 2395, 273, 1146, 3965, 564, 1171, 90, 285, 345, 12898, 1946, 285, 3164, 417, 512, 326, 1175, 13, 533, 309, 1335, 9047, 1046, 9037, 273, 352, 281, 690, 31733, 15, 6758, 310, 2139, 309, 457, 78, 247, 1652, 9049, 281, 923, 326, 20278, 457, 84, 644, 2218, 323, 247, 773, 4714, 14, 8658, 538, 3026, 32726, 24460, 4544, 4750, 254, 1806, 281, 320, 12819, 275, 271, 15146, 9037, 273, 253, 15146, 2952, 15, 3512, 273, 253, 1499, 18050, 763, 1255, 273, 380, 6317, 4461, 369, 849, 352, 5907, 247, 5965, 1321, 14, 14644, 14, 394, 276, 1007, 387, 3668, 3394, 326, 4592, 2067, 2607, 1128, 263, 1107, 13, 275, 690, 2219, 1128, 9131, 1046, 9037, 13, 594, 326, 22234, 322, 1064, 249, 812, 2085, 521, 2934, 273, 752, 253, 7445, 7031, 651, 457, 306, 3261, 751, 574, 644, 275, 987, 1020, 4179, 273, 776, 5674, 457, 84, 3668, 23812, 15, 16688, 345, 12898, 1834, 281, 327, 849, 359, 943, 457, 306, 3261, 387, 253, 17641, 4166, 28737, 690, 767, 1107, 846, 253, 958, 369, 247, 1652, 278, 1911, 2980, 15, 1292, 253, 4839, 281, 22077, 327, 849, 253, 24460, 4544, 943, 457, 306, 644, 6107, 689, 253, 1390, 807, 310, 253, 1511, 273, 3468, 14, 26621, 13, 269, 1595, 2348, 2602, 2910, 326, 322, 1064, 249, 816, 1912, 457, 85, 320, 2104, 281, 11623, 30906, 562, 273, 253, 5603, 13, 1677, 521, 973, 14, 34023, 12773, 1892, 14, 251, 15, 187, 187, 5623, 22924, 555, 320, 31833, 15, 31565, 273, 672, 285, 835, 253, 9037, 3936, 1659, 13, 10159, 273, 1880, 359, 1705, 275, 387, 253, 5068, 13, 4766, 390, 990, 273, 24460, 457, 84, 4544, 13, 10159, 273, 849, 1142, 2069, 322, 1064, 249, 588, 23103, 344, 457, 84, 816, 7746, 253, 5441, 13, 436, 9037, 310, 1469, 281, 990, 342, 247, 1943, 13, 6627, 10299, 3243, 273, 773, 71, 1807, 368, 668, 275, 1340, 281, 6780, 13, 2378, 969, 13, 326, 32726, 24460, 3663, 253, 12674, 6132, 407, 1146, 247, 41490, 25850, 564, 1171, 15, 733, 457, 84, 1469, 281, 320, 1633, 473, 13152, 42, 2185, 7084, 58, 33819, 42363, 1372, 25129, 751, 253, 24460, 4750, 254, 11741, 281, 1527, 247, 3369, 323, 271, 1711, 3416, 285, 9674, 34553 ]
self-assignment m2 = m2; m1 = m1; m1.debug_print(); f2.debug_print(); return 0; } Pushyanug Churna Pushyanuga Churna is found to be extremely beneficial in balancing the issue of Vatta, Pitta and Kapha Dosha. It is also a prominent Ayurvedic medicine for umpteen bleeding disorders. The major ingredients found in Pushyanuga Churna are Bilva Phal, Kali Mirch, Patha, Jamun Beej, Aam Giri, and Monika. These natural ingredients have the extreme health benefits throughout the body. Pushyanuga Churna is a fruitful Ayurvedic medicine for treating various stomach issues. It can manage to deal with Indigestion, Acidity, Hyperacidity, Constipation,Diarrhea, Heartburn, Bloating, and Pain in the stomach. It is found extremely beneficial in treating many gynecological complications. One can use such formulation to get rid of uterine infections. Menstrual disorder, Leucorrhea, Menorrhagia, Hemorrhoids, Menstrual Disorder, Premenstrual syndrome, and Raktapitta can be ameliorated by Pushyanug Churna. It is also found to be highly beneficial for healing inflammation and pain related issues. One can administer it 1 to 2 tablespoon of water after having the meal.User:Strayor From Gineipaedia, the Legend of Galactic Heroes wiki Hello everyone. I'm Strayor and have been a member of Gineipaedia for a year now. I edit mostly in articles dealing with the Imperials and various battles. Although my knowledge is lacking compared to some of the living LOGH encyclopedias that are our Admins, I still know enough to make contributions and am a frequent editor and reader on this wiki. Feel free to let me know if there is anything, even busy work, that is needed and I will see what I can do.Former Romania coach Lynn Howells has admitted that a Romanian referee should never have been put in charge of Spain's World Cup qualifier at the centre of a match-fixing row. Spain have submitted a complaint to World Rugby outlining 19 'unfair' decisions in last Sunday's 18-10 defeat by Belgium in Brussels- after which referee Vlad Iordachescu was chased off the pitch. Iordachescu was appointed before the tournament by Rugby Europe, whose president is Romanian International Olympic Committee member Octavian Morariu, but complaints about a conflict of interest were ignored. Vlad Iordachescu was the referee as Belgian pulled off a huge upset win over Spain on Sunday Romania needed Spain to lose to qualify - but Rugby Europe rejected Spanish requests to remove Iordachescu 20 days before the Test. Qualification is worth about £1.5million to Spain and Romania and pressure is increasing for the game to be replayed. Spain coach Santiago Santos said: 'World Rugby need to make justice. We have had support from all over the world.' Sir Clive Woodward called for a replay, prompting an angry response from Alin Petrache, president of Romanian Rugby Federation, who said: 'Clive Woodward is a pensioner with nothing to do.' Players clashed with eachother and the referee after the game which saw Belgium qualify Rugby Europe held an inquest to review the referee's performance on Friday. Spain made an official request for the review to be chaired by an independent body, such as the RFU, but it was ignored. The conclusions of the meeting will be relayed to Rugby Europe board members and World Rugby on Monday night. 'The whole system is Mickey Mouse,' said a Mail on Sunday source. 'Serious questions need to be asked of Rugby Europe.' Unless World Rugby act, Romania will be in a World Cup pool with Ireland, Scotland and Japan. They are seeking a new coach after Welshman Howells quit midway through the Six Nations B League. Ex-Romania coach Lynn Howells admitted that a Romanian should never have been in charge 'The referee shouldn't ever have been put in place for the end of the tournament,' Howells told the Mail on Sunday. 'I know Vlad very well and I'd be surprised if he'd been swayed by anything. I hope for rugby's sake that there has been no funny business and I've heard nothing to suggest there has been. 'Immaterial of who the referee was, there is no place in rugby union for teams to attack a referee.'At the dawn of December 28, 2013, the Provincial House Community welcomed with great joy and jubilation our esteemed guests and much loved Sister Mary Kristin and Sister Mary Sreeja. Since then the showers … The long awaited Golden day was dawned with all its blessings, excitement and joy as Sisters Mary Sujata, Dulari and Anupa celebrated their Golden Jubilee and Sister Priyanka who celebrated her Silver Jubilee on …/*! @file Forward declares `boost::hana::intersperse`. @copyright Louis Dionne 2013-2017 Distributed under the Boost Software License, Version 1.0. (See accompanying file LICENSE.md or copy at http://boost.org/LICENSE_1_0.txt) */ #ifndef BOOST_HANA_FWD_INTERSPERSE_HPP #define BOOST_HANA_FWD_INTERSPERSE_HPP #include <boost/hana/config.hpp> #include <boost/hana/core/when.hpp> BOOST_HANA_NAMESPACE_BEGIN //! Insert a value between each pair of elements in a finite sequence. //! @ingroup group-Sequence //! //! Given a finite `Sequence` `xs` with a linearization of //! `[x1, x2, ..., xn]`, `intersperse(xs, z)` is a new sequence with a //! linearization of `[x1, z, x2, z, x3, ..., xn-1, z, xn]`. In other //! words, it inserts the `z` element between every pair of elements of //! the original sequence. If the sequence is empty or has a single //! element, `intersperse` returns the sequence as-is. In all cases, //! the sequence must be finite. //! //! //! @param xs //! The sequence in which a value is interspersed. //! //! @param z //! The value to be inserted between every pair of elements of the sequence. //! //! //! Example //! ------- //! @include example/intersperse.cpp #ifdef BOOST_HANA_DOXYGEN_INVOKED constexpr auto intersperse = [](auto&& xs, auto&& z) { return tag-dispatched; }; #else template <typename S, typename = void> struct intersperse_impl : intersperse_impl<S, when<true>> { }; struct intersperse_t { template <typename Xs, typename Z> constexpr auto operator()(Xs&& xs, Z&& z) const; }; constexpr intersperse_t intersperse{}; #endif BOOST_HANA_NAMESPACE_END #endif // !BOOST_HANA_FWD_INTERSPERSE_HPP HBO’s The Newsroom was controversial on account of being pretty goofy and condescending and probably not all that good, but I still watched every episode of it to some enjoyment. Which is why I’m a little excited to see that casting’s been done for a “well-scrubbed Mitt Romney campaign staffer,” to be featured in an upcoming episode of the upcoming season. Part of the sluggishness of The Newsroom was how it offered a holier-than-thou look at news events that happened several months—or years, in some cases—before every episode, so that Aaron Sorkin could provide his idea of what the ideal coverage would’ve looked like had been in rightful charge of our nation’s news outlets. Being condescended to on how we should’ve looked at the BP oil spill some two years after the fact was a little maddening. But the chance to lecture on how the Romney campaign should’ve been covered over the last year is the type of slow-moving, fattened softball that Sorkin just won’t be able to resist knocking out of the park, given his well-documented liberal hard-on. Subtlety be damned. Regardless of when and where the episode takes place, regardless of whether we come in at the beginning, middle or end of Romney’s campaign, regardless of how many times Sorkin will insist he’s just telling the facts, this episode is going to end with a big, bright flashlight of “fuck you” in order to highlight, once again, that Mitt Romney lost the presidential election by being a gigantic sterile goof. It’s going to be something OBVIOUSLY METAPHORICAL like the Romney staffer failing to open a door for an old woman and subsequently yelling
[ 4483, 323, 12302, 3153, 44047, 32748, 2250, 15, 309, 457, 306, 760, 644, 4882, 323, 247, 1643, 1897, 13, 285, 309, 457, 306, 4270, 598, 619, 16879, 4310, 1811, 281, 247, 1659, 835, 954, 651, 1908, 479, 247, 7503, 773, 8656, 20173, 668, 1108, 259, 1412, 15, 309, 457, 78, 671, 9049, 281, 452, 17763, 532, 1562, 16951, 9251, 263, 2902, 2659, 275, 253, 5418, 41704, 3645, 4657, 6342, 15, 831, 622, 310, 247, 15143, 43273, 2902, 7512, 622, 326, 359, 806, 25044, 264, 387, 253, 5418, 41704, 3645, 8059, 275, 27687, 15, 187, 187, 2042, 368, 457, 306, 644, 970, 2045, 14649, 273, 5418, 41704, 20816, 13, 368, 457, 620, 871, 326, 352, 310, 7964, 247, 1364, 452, 323, 31754, 15, 309, 457, 306, 3542, 247, 1643, 2069, 275, 253, 2469, 670, 849, 253, 622, 2789, 634, 1495, 6927, 1223, 327, 253, 564, 15, 1422, 476, 2098, 13, 1984, 13, 8722, 13, 285, 3894, 616, 4288, 16669, 342, 3858, 13, 11651, 285, 327, 2675, 285, 5702, 6928, 1223, 327, 253, 564, 15, 187, 187, 15383, 41704, 20816, 323, 5418, 41704, 884, 3797, 512, 273, 253, 1270, 3386, 326, 1056, 4288, 2969, 323, 5418, 41704, 6383, 1690, 27, 47367, 34896, 1810, 7526, 13, 20816, 50002, 275, 5418, 41704, 15634, 13, 14469, 285, 2639, 416, 3950, 7225, 272, 13, 733, 7068, 552, 11354, 13, 8404, 1608, 1875, 13, 14736, 2884, 4380, 13, 285, 6865, 14, 52, 3292, 29806, 15, 1623, 1755, 273, 326, 627, 403, 671, 690, 747, 3386, 2879, 347, 973, 15, 187, 187, 9063, 731, 562, 1060, 27, 187, 187, 53, 7417, 20364, 1608, 1875, 1108, 733, 457, 84, 1024, 1014, 6927, 281, 1501, 634, 7408, 11269, 327, 378, 8417, 13, 6745, 13, 7879, 285, 43565, 15, 2726, 34896, 20364, 1608, 1875, 13, 368, 476, 1978, 634, 3858, 285, 11651, 598, 14, 936, 14, 2754, 327, 634, 4288, 27420, 4745, 347, 597, 46196, 15, 187, 187, 39, 3243, 20364, 1608, 1875, 1108, 5418, 41704, 20816, 556, 1900, 4934, 368, 598, 14, 936, 14, 2754, 342, 1524, 14, 2606, 8630, 3708, 265, 285, 342, 5418, 41704, 20816, 323, 5418, 41704, 884, 13, 368, 476, 3894, 436, 1491, 342, 634, 11651, 13, 3858, 285, 2675, 6928, 15, 1310, 634, 8630, 310, 13444, 13, 26224, 390, 4391, 20737, 13, 368, 476, 4354, 285, 4541, 4151, 2571, 285, 1056, 2119, 597, 871, 672, 285, 835, 281, 2619, 368, 598, 432, 253, 13952, 15, 187, 187, 21333, 37330, 84, 13, 15836, 5566, 398, 285, 5863, 25013, 1108, 380, 747, 16040, 37330, 2579, 342, 5418, 41704, 20816, 323, 5418, 41704, 884, 7729, 5416, 368, 457, 250, 1900, 2970, 253, 1682, 8614, 2968, 15, 733, 588, 1691, 634, 2564, 387, 11990, 285, 8356, 24651, 368, 604, 627, 457, 84, 247, 1805, 4376, 323, 253, 8614, 2316, 368, 32346, 13, 247, 10870, 8614, 323, 247, 20182, 4376, 13, 390, 604, 627, 457, 84, 247, 1199, 1805, 8614, 323, 5777, 625, 15, 496, 1142, 2219, 13, 368, 476, 14002, 634, 3236, 30170, 1293, 12339, 285, 294, 14, 3305, 253, 1805, 2968, 949, 5418, 41704, 20816, 15, 187, 187, 15383, 41704, 5417, 1108, 2726, 5418, 41704, 5417, 13, 368, 457, 620, 1620, 452, 281, 16164, 281, 5418, 41704, 20816, 969, 15, 1422, 457, 620, 452, 8164, 2289, 281, 512, 273, 697, 3386, 347, 3517, 347, 368, 8027, 253, 622, 15, 4952, 327, 634, 806, 673, 970, 5418, 41704, 20816, 13, 5418, 41704, 5417, 588, 8356, 7522, 275, 253, 12960, 830, 323, 368, 15, 187, 187, 2042, 326, 457, 84, 1694, 368, 9049, 13, 368, 457, 250, 417, 3815, 1108, 285, 1805, 2568, 352, 457, 84, 2130, 347, 247, 1959, 6184, 327, 253, 5418, 41704, 3645, 4657, 6342, 15, 26722, 667, 19055, 275, 253, 2822, 2852, 32, 2325, 2119, 281, 3894, 253, 18349, 342, 441, 275, 253, 5701, 13, 285, 604, 368, 457, 306, 1694, 667, 12192, 323, 970, 5418, 41704, 20816, 13, 359, 457, 69, 2389, 281, 4089, 634, 2926, 15, 187, 187, 7845, 3877, 253, 622, 778, 1379, 598, 281, 2164, 3038, 281, 3176, 275, 253, 5418, 41704, 3645, 16106, 6342, 15, 187, 187, 1552, 2129, 10880, 2448, 32678, 13, 534, 2097, 326, 253, 8386, 14, 2727, 281, 253, 23193, 556, 15335, 13207, 2, 733, 457, 84, 1774, 323, 479, 281, 6558, 21188, 13, 533, 347, 247, 13817, 6706, 16118, 3377, 13, 309, 751, 281, 19837, 731, 342, 747, 10296, 15, 3856, 403, 619, 7583, 12192, 323, 970, 634, 5418, 41704, 1191, 108, 2813, 1309, 253, 23193, 15, 3771, 1053, 457, 85, 755, 352, 1512, 2810, 281, 253, 278, 6948, 20951, 285, 7462, 90, 2, 187, 187, 20133, 253, 40323, 18517, 407, 10535, 272, 14, 10854, 8937, 41442, 285, 13135, 2370, 27, 3166, 368, 452, 667, 28234, 368, 457, 250, 642, 3356, 970, 32, 775, 1972, 403, 627, 457, 84, 3095, 275, 634, 1943, 2021, 390, 2675, 2990, 326, 812, 897, 731, 13, 594, 3324, 731, 2112, 281, 634, 13319, 50084, 2, 313, 1147, 457, 84, 22335, 417, 247, 773, 250, 14, 72, 2094, 1425, 10, 187, 187, 510, 43149, 422, 399, 5338, 1108, 35211, 763, 26391, 17218, 3008, 5464, 27, 1198, 776, 4651, 285, 37186, 13, 1907, 247, 6109, 2813, 387, 253, 8955, 2829, 310, 247, 2201, 2802, 2369, 642, 9027, 9110, 275, 619, 2021, 13, 359, 897, 776, 6109, 4095, 1309, 16961, 281, 1379, 7963, 13, 5007, 11269, 281, 776, 2675, 6928, 13, 285, 281, 5007, 3304, 26984, 281, 581, 1529, 3066, 5418, 41704, 1191, 108, 48979, 313, 35, 8417, 3384, 215, 97, 481, 34747, 253, 2802, 18074, 290, 457, 390, 2802, 55, 2560, 366, 457, 6222, 327, 634, 21679, 1309, 16961, 13, 285, 604, 368, 457, 69, 751, 13, 36219, 634, 5818, 1299, 265, 13, 30584, 390, 34854, 15, 187, 187, 3848, 777, 253, 6696, 84, 342, 247, 36355, 272, 14628, 27, 2091, 368, 457, 250, 25945, 13, 13828, 247, 16153, 4660, 275, 7170, 588, 1581, 368, 281, 1790, 896, 285, 7921, 15, 18025, 249, 763, 13319, 4073, 407, 6941, 634, 12958, 281, 4179, 616, 5418, 41704, 4095, 12200, 253, 270, 602, 84, 273, 5965, 314, 15, 187, 187, 25727, 907, 247, 16428, 24180, 6915, 5402, 5418, 41704, 10223, 12323, 5270, 85, 27, 844, 457, 306, 1705, 247, 1048, 1039, 432, 7968, 342, 12126, 387, 253, 28974, 15, 3954, 13, 3492, 19485, 84, 24555, 15, 3932, 1142, 273, 619, 3858, 285, 2021, 2758, 3153, 2080, 1977, 13, 309, 2389, 970, 253, 16428, 24180, 622, 327, 619, 5418, 41704, 1191, 108, 10223, 12323, 3384, 215, 97, 19801, 281, 5007, 1175, 16995, 1309, 253, 23193, 15, 29574, 897, 634, 5418, 41704, 10223, 12323, 19801, 281, 9232, 253, 10721, 273, 10262, 1146, 5909, 327, 634, 2813, 15, 187, 187, 4678, 271, 18328, 20745, 14, 5683, 1294, 27, 309, 457, 78, 1900, 6276, 896, 285, 6593, 875, 253, 13952, 13, 8264, 7695, 390, 18752, 745, 12942, 15, 1916, 1056, 2119, 309, 1620, 2985, 8630, 5778, 390, 26667, 30584, 13, 309, 897, 253, 5418, 41704, 8942, 20816, 14313, 622, 15, 733, 11359, 512, 7408, 1491, 275, 581, 1659, 2, 1310, 368, 457, 250, 253, 581, 2509, 253, 22710, 13, 368, 476, 1379, 2120, 5750, 672, 7219, 634, 13319, 15865, 15, 187, 187, 17570, 441, 27, 752, 403, 634, 13319, 21188, 32, 20930, 690, 6281, 342, 441, 275, 253, 4385, 2593, 2708, 15, 187, 187, 3378, 5768, 816, 759, 22230, 1475, 253, 7145, 13, 752, 1805, 1039, 281, 10347, 685, 281, 6184, 690, 273, 776, 7583, 5418, 41704, 8942, 11222, 323, 5768, 32, 380, 5418, 41704, 2051, 3645, 14313, 4657, 6342, 556, 1694, 368, 6107, 323, 253, 1048, 14, 11415, 959, 2952, 15, 48606, 634, 32353, 13, 29502, 38330, 285, 273, 2282, 634, 5418, 41704, 8942, 21679, 390, 5418, 41704, 8942, 10223, 12323, 14313, 19801, 13, 285, 2451, 562, 841, 11222, 27, 187, 187, 56, 1479, 3396, 818, 15, 17, 27, 831, 2129, 13, 45155, 3396, 6808, 247, 2201, 5731, 281, 616, 4633, 285, 2221, 4217, 31612, 6612, 622, 15, 309, 457, 306, 644, 970, 253, 747, 2715, 285, 253, 747, 9251, 263, 2902, 12693, 10316, 253, 2793, 281, 247, 747, 1268, 15, 733, 8077, 7790, 3253, 715, 1264, 2022, 6849, 27, 401, 15100, 3254, 13, 5721, 30387, 285, 330, 22288, 15, 733, 457, 84, 7964, 247, 794, 1039, 281, 9413, 747, 952, 13, 5053, 285, 1841, 1475, 368, 970, 634, 5418, 41704, 21679, 15, 1893, 672, 368, 457, 250, 562, 285, 670, 18216, 436, 5768, 13, 320, 2119, 281, 897, 253, 45155, 3396, 3645, 44328, 281, 923, 634, 27762, 275, 271, 7094, 747, 1039, 15, 21578, 45155, 3396, 1024, 15, 187, 187, 15383, 41704, 8942, 20816, 27, 26722, 281, 755, 1977, 323, 247, 1652, 1551, 285, 17040, 436, 5768, 32, 5418, 41704, 20816, 310, 247, 1364, 14, 14626, 622, 15, 733, 10111, 512, 273, 634, 5667, 7408, 1491, 275, 581, 24783, 6308, 13, 5043, 352, 8356, 20947, 634, 34272, 323, 4288, 44414, 3927, 594, 368, 1053, 457, 85, 452, 281, 3186, 323, 1841, 751, 16883, 3904, 13, 20818, 13, 285, 12453, 15, 733, 671, 3400, 8630, 3708, 11269, 13, 8588, 1491, 13, 1980, 3186, 3470, 285, 3477, 30170, 5657, 15, 11668, 253, 4073, 562, 273, 22710, 1108, 897, 5418, 41704, 20816, 281, 1978, 368, 10932, 285, 8191, 15, 21578, 5418, 41704, 8942, 20816, 1060, 15, 187, 187, 33466, 1059, 27, 14538, 5082, 457, 85, 320, 5768, 1293, 5352, 2739, 2, 380, 13624, 273, 253, 22819, 50, 13, 14402, 79, 982, 275, 253, 5603, 13, 22952, 26791, 2866, 4952, 604, 368, 457, 250, 247, 747, 17782, 275, 253, 8576, 13, 11980, 1059, 556, 512, 368, 878, 281, 755, 12398, 436, 5768, 15, 733, 3797, 3114, 14, 33349, 20247, 13, 4522, 398, 13, 12192, 285, 11484, 13991, 15, 1310, 368, 457, 250, 347, 9049, 347, 309, 717, 670, 5768, 12398, 13, 2451, 562, 11980, 1059, 323, 253, 5418, 41704, 10223, 12323, 19801, 15, 187, 187, 18948, 310, 987, 1475, 253, 7145, 13, 594, 627, 457, 84, 642, 673, 281, 8138, 1108, 6184, 253, 5418, 41704, 11222, 1840, 432, 5418, 41704, 2051, 3645, 3063, 285, 755, 4704, 281, 452, 247, 1270, 5768, 2, 187, 187, 2214, 1110, 665, 403, 417, 6600, 13, 378, 8417, 4802, 4893, 19837, 378, 8417, 13175, 987, 715, 253, 622, 13, 594, 368, 476, 513, 1841, 751, 19864, 378, 8417, 3858, 281, 2793, 634, 7583, 11222, 13, 12939, 342, 378, 8417, 12716, 432, 3304, 253, 378, 8417, 4802, 622, 13, 285, 3894, 285, 9413, 747, 5418, 41704, 11222, 285, 2600, 342, 3858, 1108, 1293, 2455, 6108, 253, 622, 2, 187, 187, 6872, 4893, 452, 247, 2644, 747, 48602, 273, 3386, 326, 1056, 634, 5418, 41704, 21679, 2793, 1014, 1805, 15, 1281, 457, 84, 452, 247, 1007, 27, 187, 187, 35, 8417, 4850, 5418, 41704, 17750, 3470, 285, 747, 21530, 1323, 255, 1032, 2, 187, 187, 35, 8417, 310, 1146, 29101, 281, 320, 1805, 685, 2455, 342, 5418, 41704, 8942, 17750, 9554, 2992, 253, 3745, 281, 5007, 4318, 7211, 31124, 13, 247, 19554, 1039, 281, 5731, 634, 6222, 3935, 13, 285, 747, 622, 2899, 569, 15, 187, 187, 1992, 823, 281, 512, 273, 436, 13, 378, 8417, 362, 23, 15, 19, 1024, 6131, 247, 3410, 273, 512, 747, 21530, 1323, 255, 1032, 2, 2091, 368, 457, 250, 24917, 715, 378, 8417, 13, 816, 14084, 689, 253, 21530, 1323, 255, 1032, 281, 923, 752, 597, 513, 13, 840, 3894, 731, 342, 3858, 281, 3890, 849, 368, 457, 250, 5471, 672, 3000, 3815, 816, 6403, 457, 85, 2217, 15, 187, 187, 29653, 318, 273, 6745, 285, 7879, 342, 378, 8417, 187, 187, 25116, 323, 5418, 41704, 33188, 362, 20, 15, 17, 285, 7879, 323, 5418, 41704, 33188, 362, 20, 15, 17, 403, 1024, 378, 8417, 4802, 11222, 15, 2091, 368, 4684, 6745, 285, 7879, 342, 378, 8417, 13, 368, 476, 3894, 634, 6323, 3708, 11269, 285, 28311, 347, 634, 378, 8417, 23307, 17775, 407, 3365, 17221, 253, 773, 18281, 342, 378, 8417, 668, 10651, 432, 1561, 253, 622, 15, 1422, 476, 671, 1478, 281, 3894, 28311, 390, 6745, 11269, 342, 634, 378, 8417, 12716, 275, 581, 36409, 4328, 15, 187, 187, 15383, 41704, 20816, 4566, 8404, 187, 187, 510, 9300, 5418, 41704, 20816, 362, 19, 15, 22, 11, 310, 1024, 247, 378, 8417, 4802, 622, 15, 1737, 1057, 326, 1599, 281, 368, 32, 3954, 368, 476, 18319, 5731, 378, 8417, 12716, 342, 634, 4288, 3708, 275, 816, 247, 1643, 2969, 5018, 15, 27430, 14, 28617, 2439, 253, 1533, 32, 1422, 476 ]
allows for exciting live multiplayer poker action. I’ve only been playing for a few days, and I’ve built up my fantasy bankroll to a place where most would consider me a virtual “high roller” – woot. I’m also excited to have Occipital 360 Panorama land in the BlackBerry World storefront. This app is a fantastic panorama photo app that we first previewed at the BlackBerry World conference in Orlando. If you’ve been using previous generations of BlackBerry Travel, you’ll know that it is definitely a must have for travelers. I’ve written a few times in the past about how the app makes your life easier while on the go. You can plan, book, manage, and share their travel arrangements with friends, colleagues and on social and professional networks while on the go. BlackBerry Travel for BlackBerry 10 includes all of the great features that make travel simple for BlackBerry customers including: Automatic Trip Scanning, Travel Notification in BlackBerry Hub, Hotel and Car Rental Booking, Itinerary Management, Social Sharing, Search Flights, and Time-Saving Tools. On top of that there are also some new features added as well. Check them out here: Trip Status Sharing – It’s now even easier to post your trip updates on BBM, Facebook, Twitter and LinkedIn. With Trip Status Sharing, you can keep your friends and colleagues up-to-date on your travel adventures immediately as they unfold. Flight Status Sharing – BlackBerry Travel has always kept you up-to-date with real-time flight statuses and with BlackBerry Travel for BlackBerry 10, you can share this information with your colleagues, friends and social networks. If your flight is delayed, cancelled or changed terminals, you can easily and quickly inform others and make sure they know when and where to pick you up from the airport. Price Alerts, Change Offers and Upgrades – The new Price Alert service with BlackBerry Travel for BlackBerry 10 helps ensure you’re always getting the best hotel deal. It will put your mind at ease and automatically notify you if there’s a better price for the hotel room you booked, a comparable hotel for a cheaper price, or if there’s a much better hotel for slightly more. In many cases, you can cancel your original booking without penalty and re-book the better deal through BlackBerry Travel. BlackBerry ID – With BlackBerry ID, you’ll never have to login to BlackBerry Travel again. You’ll have instant access to all of its features as soon as you launch the app. Even on your first time using BlackBerry Travel, BlackBerry ID will automatically fill in the registration form for you. If that’s got you excited, you’re not alone – and better yet it’s available as a free download on the BlackBerry World storefront. Planning any trips in the near future? Be sure to share the excitement with us in the comments, and if you’ve got any tips for using BlackBerry Travel, we’d love to hear your story. Please note the app may take up to 24 hours to appear in the BlackBerry World Storefront. This week marks American Thanksgiving, which means that the kick-off to the holidays has officially begun! It’s important for me to maintain traditions, but as a tech aficionado, I like to integrate them with new technologies. Here are my favorite tips for using your BlackBerry ® device during the holidays. Just don’t get it too close to the mashed potatoes and gravy! Master the Gift Exchange by Handing-Down Old Devices and Accessories: Do you have any accessories you’re no longer using? Chances are there’s someone in your big family or social network that could use them, so bring them along to your holiday gatherings! (It’s technically not a “re-gift.”) The Festive Dinner – Establish Phone Etiquette: For our parents and grandparents, having a mobile device at the dinner table is a major ‘no no.’ Yet in my family, we use our mobile devices during meals to take photos, send updates to our social networks, and to send inside jokes to one another via BlackBerry ® Messenger (BBM ™). Enable the ‘Silent’ or ‘Vibrate’ profile on your smartphone during meals, and if you’d like, customize your ringtones, notifications or alerts. Deck the Halls with a Charging Station: When you’re entertaining, preparing a charging station in advance will allow you to sit back and relax. Diminish holiday stress by allowing your guests to charge their BlackBerry devices beside the boughs of holly. Organize a Video Chat Using Your BlackBerry PlayBook Tablet: We’ve come a long way from pictures with Santa at the mall. Now, video reigns supreme. Since many of my friends and family members live far away, I love using the Video Chat app on my BlackBerry ® PlayBook ™ tablet to send good wishes during the holidays. Simply use your BlackBerry PlayBook tablet to capture the magic of presents being opening on your device. Be an Airport Pick-Up Pro: I’m always driving back and forth between the airport, fetching or dropping off visitors. To make sure I never miss flight delay or cancellation notifications, I use the BlackBerry® Travel™ app. It keeps all trip information in one place! If you’re the one doing the travelling, you can take full advantage when planning your holiday adventure. Tell us: what are your holiday traditions? Share some stories with us in the comment section below. With summer just peeking around the corner, what better way to prepare than to download some of our favorite BlackBerry® apps for summer? The BlackBerry App World™ storefront has got you covered for the long-awaited season. Grab your shorts, sunglasses and of course your BlackBerry® smartphone or BlackBerry® PlayBook™ tablet, and check out these apps: Wikitude 7.0: This week, Wikitude issued a major update to their popular and super useful augmented reality app. I’ve been using the new version and the new Panorama UI brings the experience to a new level. It simplifies everything into three main views: Favorites, Featured and Categories. It’s definitely a fun way to discover new people, places and things around you using your BlackBerry smartphone. So when you’re out and about exploring this summer, be sure to use the Wikitude World Browser to see your surroundings in an entirely new way. Download Wikitude now. BlackBerry® Travel: Planning to get away for a little rest and relaxation this summer? BlackBerry Travel is a must-try app. It stores all of your essential trip information in one handy spot, plus it automatically scans your inbox for travel itineraries so you don’t have to search for things like confirmation numbers, flights, and addresses. It also provides flight status updates, weather information, local search functions and easy booking tools. Take the stress out of travelling – use BlackBerry Travel to keep you organized and informed. Download BlackBerry® Travel here. Cooklet: Summer wouldn’t be summer without fresh food! The smell of the BBQ, picnics in the park, seasonal flavors… Even if you’re a newbie in the kitchen, Cooklet has all you need to get cooking this summer. It includes community-reviewed recipes, timers, tips and meal suggestions. If you’re as excited as I am about summer cooking, check out Cooklet for the BlackBerry PlayBook tablet. June is right around the corner, so there’s no time to waste – download the BlackBerry apps above from BlackBerry App World today and get ready to have a great summer! For those who are not aware, BBM connected applications integrate BBM functionality right into the app, so you can do things like invite BBM friends to experience your favorite apps, chat with BBM contacts from inside the BBM connected app, and share and discover new BlackBerry apps and content with friends – without ever leaving the app! These applications have a whole new slew of features that make your BlackBerry smartphone experience even better. Let’s have a look: BBM gets BlackBerry Tag functions and new animated avatars! BBM is being upgraded to be better than ever with BlackBerry® Tag integration*, the ability to send voice notes quicker, a simpler way to update your profile message, and new app integrations. To add to all of this, BBM v6.2 now offers a sample of all new animated avatars! When you’re logged into BBM, just scroll over the animated avatars to see what they do, then share them with friends to express how you’re feeling when words alone just aren’t enough. Integration of Facebook and Twitter with BBM Facebook for BlackBerry smartphones v3.0 and Twitter for BlackBerry smartphones v3.0 are now BBM connected apps. When you connect Facebook and Twitter with BBM, you can share your latest status updates and tweets as your BBM Personal Message by simply selecting the “Share with BBM” icon from within the app. You can also opt to share tweets or Facebook updates with your BBM contacts in one centralized location. BlackBerry Travel goes Social The updated BlackBerry Travel v2.5* is now a BBM connected app. What does that mean to you? Now you can instantly update BBM contacts with your travel status in just a few simple steps. Jet-setting across the world? You can
[ 4512, 14536, 5333, 273, 253, 2601, 432, 253, 6069, 4055, 281, 253, 6069, 6384, 275, 6589, 44, 14, 10247, 1341, 15, 187, 187, 19, 15, 21, 15, 427, 3123, 34, 38826, 351, 832, 24485, 12151, 84, 281, 34129, 3086, 427, 9122, 14, 31545, 36233, 285, 16009, 12260, 11641, 46484, 338, 3328, 275, 427, 9122, 14, 31545, 14, 40385, 15993, 1712, 1704, 19, 5256, 21, 14, 7610, 14, 938, 14, 17884, 1549, 94, 187, 39423, 6846, 187, 187, 1909, 512, 3636, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 4375, 403, 15783, 281, 253, 6589, 44, 4865, 5028, 273, 427, 3123, 34, 2470, 2841, 374, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 4699, 910, 709, 14, 881, 568, 926, 986, 36, 582, 359, 24045, 326, 253, 427, 9122, 14, 31545, 14, 6367, 13655, 273, 427, 3123, 34, 1537, 6990, 253, 427, 3123, 34, 14, 47, 9122, 14, 31545, 5016, 15, 3813, 13, 359, 2684, 820, 14, 13111, 27447, 3535, 12277, 273, 427, 9122, 14, 31545, 285, 1027, 427, 3123, 34, 15396, 15, 187, 187, 42625, 13, 359, 497, 2104, 281, 921, 326, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 22294, 427, 9122, 14, 31545, 342, 247, 3012, 2169, 15430, 685, 4956, 14, 881, 427, 3123, 34, 2470, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 34, 13, 35, 481, 3813, 13, 359, 7525, 326, 253, 13655, 273, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 3133, 281, 2701, 253, 4865, 273, 427, 9122, 14, 31545, 281, 427, 3123, 34, 13, 534, 359, 30821, 812, 320, 1774, 323, 253, 427, 9122, 14, 31545, 2425, 285, 14536, 273, 427, 9122, 14, 31545, 281, 253, 15848, 15, 187, 187, 688, 1340, 281, 2007, 12106, 253, 5164, 2538, 273, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 13, 359, 4561, 247, 11086, 16, 39, 20, 894, 1386, 13002, 253, 427, 3123, 34, 4956, 1511, 390, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 13, 347, 973, 347, 427, 9122, 14, 31545, 970, 13767, 46476, 5066, 15, 427, 3123, 34, 313, 78, 40750, 10, 285, 427, 9122, 14, 31545, 313, 49677, 10, 2048, 2220, 820, 14, 30295, 369, 5783, 407, 40344, 285, 2685, 22623, 2470, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 36, 13, 37, 481, 1916, 1263, 253, 4833, 273, 427, 9122, 14, 31545, 14, 6160, 427, 3123, 34, 13655, 327, 894, 9489, 13, 359, 2684, 271, 353, 6901, 9489, 6981, 15, 1284, 2011, 275, 544, 2841, 608, 1084, 7610, 14, 938, 14, 17884, 1549, 14, 71, 5523, 910, 709, 14, 881, 568, 926, 986, 38, 13, 253, 38968, 14, 25652, 427, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 10500, 2692, 247, 4512, 5141, 275, 894, 3116, 2429, 281, 4956, 1511, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 15, 2053, 1543, 812, 320, 5783, 407, 2602, 21703, 9489, 12277, 342, 475, 47, 532, 66, 4842, 25652, 10616, 13139, 13002, 427, 9122, 14, 31545, 2366, 342, 29565, 14, 47, 3123, 34, 22923, 390, 29565, 14, 47, 3123, 34, 322, 23922, 16, 22543, 16, 23139, 16, 30169, 16, 25745, 34, 313, 38338, 544, 2841, 322, 20, 34, 283, 36, 1084, 1212, 18, 14, 7610, 14, 938, 14, 17884, 1549, 910, 709, 14, 881, 568, 1212, 9471, 533, 969, 13, 760, 247, 5884, 533, 1534, 1055, 812, 320, 2540, 15, 3813, 13, 359, 7945, 326, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 3133, 281, 4833, 894, 9489, 275, 271, 43257, 5133, 13, 3738, 841, 2538, 778, 417, 1132, 247, 9560, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 6946, 297, 6533, 6090, 15, 187, 187, 53, 2114, 2366, 13, 359, 3636, 2620, 34248, 16, 394, 31997, 460, 12359, 313, 6075, 14, 23922, 13, 4165, 14, 22543, 13, 4165, 14, 23139, 13, 4165, 14, 30169, 285, 39285, 14, 25745, 10, 347, 13655, 4375, 275, 427, 3123, 34, 281, 320, 3012, 5802, 2220, 427, 9122, 14, 31545, 2048, 342, 7534, 3486, 327, 427, 3123, 34, 14, 47, 9122, 14, 31545, 5016, 15, 38826, 590, 4004, 1057, 6747, 1818, 253, 322, 7386, 63, 47, 3123, 34, 8011, 19017, 4702, 4543, 16178, 253, 427, 3123, 34, 14536, 15, 7949, 5537, 273, 841, 427, 3123, 34, 34248, 16, 394, 31997, 460, 12359, 3977, 281, 247, 3012, 2559, 427, 3123, 34, 14, 47, 9122, 14, 31545, 4865, 5350, 347, 973, 347, 5777, 3777, 9489, 275, 11086, 16, 39, 20, 1341, 285, 10616, 13139, 15, 187, 187, 20, 15, 21561, 1712, 1704, 20, 14, 7610, 14, 938, 14, 17884, 1549, 94, 187, 18669, 187, 187, 510, 18695, 7736, 25367, 11725, 427, 9122, 14, 31545, 18653, 37486, 5755, 407, 4865, 285, 27149, 2067, 4324, 3206, 275, 3270, 38159, 13, 1964, 262, 7736, 285, 27197, 9130, 15, 496, 1635, 13, 2067, 18304, 285, 894, 5880, 10545, 2616, 326, 1132, 247, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 46245, 452, 644, 4102, 3636, 1254, 35, 1010, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 1723, 13, 253, 5787, 5122, 15979, 281, 253, 5799, 18695, 7736, 3386, 273, 427, 9122, 14, 31545, 310, 1335, 417, 4751, 7192, 15, 187, 187, 510, 401, 14, 3364, 2601, 427, 3123, 34, 13, 534, 310, 3206, 275, 894, 5880, 7248, 1254, 35, 883, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 556, 644, 3636, 347, 247, 4865, 7832, 273, 427, 9122, 14, 31545, 4283, 281, 697, 39934, 13655, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 805, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 496, 436, 1263, 13, 359, 7568, 894, 14, 16441, 14, 17777, 427, 3123, 34, 13655, 275, 427, 9122, 14, 31545, 14, 10247, 6589, 3207, 1341, 15, 427, 9122, 14, 31545, 14, 11181, 427, 3123, 34, 13655, 858, 6747, 2818, 894, 5880, 2281, 4543, 322, 7386, 63, 47, 3123, 34, 8011, 19017, 2605, 13, 7738, 247, 894, 14, 16441, 14, 17777, 1159, 273, 427, 3123, 34, 10564, 407, 436, 13655, 15, 187, 187, 1909, 18695, 7736, 25367, 11725, 13, 427, 9122, 14, 31545, 310, 1929, 281, 10857, 12579, 285, 17561, 2067, 4324, 27, 12229, 20, 347, 247, 2201, 4760, 275, 6589, 3207, 310, 3598, 34373, 31232, 407, 4865, 281, 427, 9122, 14, 31545, 13, 285, 7624, 17904, 281, 24964, 19556, 1254, 35, 1036, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1166, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1093, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 746, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 938, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 5076, 13, 427, 9122, 14, 31545, 38136, 14328, 20, 44, 268, 2227, 20560, 4283, 281, 253, 5743, 273, 253, 14328, 20, 44, 16, 41737, 7178, 15979, 281, 6589, 44, 12, 6589, 3207, 10005, 1254, 35, 1797, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 14117, 4324, 10564, 407, 427, 9122, 14, 31545, 4865, 403, 13, 299, 15, 72, 904, 3437, 1229, 1254, 35, 1423, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 49165, 14, 7072, 1254, 35, 1508, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 12229, 18, 1254, 35, 1348, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 285, 253, 322, 3373, 11725, 7266, 1549, 1254, 35, 23, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 512, 1146, 3206, 275, 46245, 407, 22474, 894, 9489, 15, 187, 187, 4943, 13, 359, 3636, 2620, 427, 9122, 14, 31545, 14, 6367, 427, 3123, 34, 13655, 4375, 4441, 327, 4165, 14, 23922, 13, 4165, 14, 22543, 13, 4165, 14, 23139, 13, 4165, 14, 30169, 285, 39285, 14, 25745, 13, 534, 9184, 432, 253, 29494, 19, 14, 6367, 34248, 12359, 31232, 1309, 894, 5880, 10005, 1254, 35, 883, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1012, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3932, 253, 3636, 13655, 4375, 403, 1151, 1100, 285, 289, 31997, 1100, 352, 3133, 11543, 326, 253, 25367, 11725, 6589, 44, 10857, 77, 684, 427, 3123, 34, 3587, 15, 427, 9122, 14, 31545, 38197, 7418, 15450, 8571, 285, 7601, 9130, 6830, 3206, 275, 38744, 697, 18695, 39873, 13, 7624, 417, 760, 4283, 281, 25367, 533, 671, 34248, 13655, 824, 347, 322, 26, 14, 10339, 44, 20, 5346, 407, 14328, 20, 44, 16, 49775, 1254, 35, 1099, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 8079, 13, 39172, 5124, 34022, 452, 644, 3786, 3636, 275, 427, 9122, 14, 31545, 14, 31464, 1341, 1690, 247, 1781, 1180, 273, 34248, 16, 394, 31997, 460, 31232, 4324, 1254, 35, 1731, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 43275, 34248, 16, 394, 31997, 460, 30447, 10564, 407, 427, 9122, 14, 31545, 313, 74, 15, 70, 904, 10616, 44, 16, 32344, 13, 278, 22097, 13, 1847, 20, 44, 16, 49775, 10, 1254, 35, 22, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 24, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 25, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 26, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 812, 320, 2783, 347, 2442, 30447, 323, 427, 3123, 34, 13655, 27, 380, 3636, 13655, 4375, 18705, 906, 275, 29494, 18, 16, 19, 13, 44454, 18, 285, 268, 1839, 13820, 44, 8981, 4375, 13, 534, 310, 275, 1386, 342, 253, 9311, 273, 6192, 797, 1162, 355, 15, 4645, 15506, 427, 3123, 34, 13655, 2220, 32406, 10680, 1971, 275, 1341, 13002, 427, 9122, 14, 31545, 1254, 35, 805, 14, 7610, 14, 938, 14, 17884, 1549, 5413, 7624, 41894, 253, 6349, 273, 253, 13430, 14, 5914, 1169, 323, 427, 3123, 34, 13655, 15, 14522, 13, 253, 3636, 13655, 4375, 403, 4441, 275, 247, 1355, 2170, 273, 253, 2601, 1532, 4609, 3797, 253, 6589, 44, 14, 13018, 5028, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 1184, 1532, 35640, 272, 247, 1480, 1055, 327, 253, 4865, 2341, 273, 253, 2570, 1254, 35, 1630, 14, 7610, 14, 938, 14, 17884, 1549, 2947, 35, 1619, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 496, 958, 13, 275, 436, 789, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 2692, 3012, 2559, 427, 9122, 14, 31545, 4865, 2429, 281, 4956, 1511, 427, 3123, 34, 15, 427, 3123, 34, 556, 2168, 644, 3636, 347, 247, 6069, 2601, 13, 1223, 253, 47625, 14536, 273, 427, 9122, 14, 31545, 310, 1097, 6069, 285, 24256, 1254, 35, 1047, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 733, 369, 2168, 8025, 326, 6069, 14, 46033, 427, 3123, 34, 310, 2104, 281, 774, 3100, 907, 6589, 44, 11781, 4324, 715, 253, 13787, 1254, 35, 740, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3813, 13, 359, 24045, 326, 253, 5016, 285, 13655, 273, 427, 3123, 34, 1537, 4833, 253, 14536, 273, 427, 9122, 14, 31545, 390, 427, 3123, 34, 15, 3856, 359, 812, 921, 326, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 22294, 427, 9122, 14, 31545, 281, 247, 2169, 6070, 347, 31232, 427, 3123, 34, 285, 1537, 7624, 13280, 253, 2601, 275, 253, 13787, 15, 1284, 760, 24256, 427, 9122, 14, 31545, 310, 6310, 1767, 1037, 3939, 13, 5727, 253, 6069, 5110, 310, 25515, 984, 273, 6895, 351, 7438, 1320, 342, 427, 9122, 18, 13, 253, 2408, 273, 24256, 427, 9122, 14, 31545, 310, 9560, 323, 8654, 24964, 3116, 1254, 35, 1047, 14, 7610, 14, 938, 14, 17884, 1549, 1656, 3308, 13, 427, 9122, 14, 31545, 1537, 5416, 697, 1211, 24256, 2425, 407, 427, 3123, 34, 13655, 15, 496, 1386, 342, 841, 7313, 13, 359, 812, 921, 326, 13655, 273, 427, 3123, 34, 2220, 427, 9122, 14, 31545, 2048, 5777, 11852, 894, 9489, 15, 427, 9122, 14, 31545, 14, 10247, 1341, 13002, 253, 38968, 14, 25652, 427, 3123, 34, 10500, 2692, 3012, 3777, 894, 3116, 2429, 281, 427, 3123, 34, 4956, 1511, 1341, 15, 1284, 427, 3123, 34, 38968, 14, 1545, 24485, 2544, 253, 9489, 2442, 760, 281, 247, 5884, 6070, 13, 359, 7945, 326, 841, 2538, 778, 417, 1132, 247, 9560, 2554, 275, 427, 9122, 14, 31545, 14, 11181, 6946, 297, 6533, 6090, 15, 1723, 13, 841, 4342, 2085, 4460, 16039, 323, 2007, 6260, 285, 4326, 4513, 253, 2570, 5122, 273, 427, 9122, 14, 31545, 2625 ]
slight localization shift of the protein from the nuclear center to the nuclear membrane in ALK-positive cells. 2.4. NIPA Phosphodeficiency Leads to Enhanced NPM-ALK Binding and Impaired Cell Proliferation in NPM-ALK-Positive Cells {#sec2dot4-ijms-20-04060} ----------------------------------------------------------------------------------------------------------------------- As all identified NPM-ALK-mediated NIPA phosphorylation sites are localized to the ALK binding domain of NIPA ([Figure 2](#ijms-20-04060-f002){ref-type="fig"}C), we hypothesized that the NPM-ALK-induced phosphorylation of NIPA might alter the NIPA-NPM-ALK interaction. Therefore, we performed co-immunoprecipitation assays of NPM-ALK and different NIPA mutants. Interestingly, we were able to show that the phospho-deficient NIPA S338/344/370/381/387A mutant binds NPM-ALK with a significantly higher affinity than wild-type NIPA ([Figure 5](#ijms-20-04060-f005){ref-type="fig"}A,B). Therefore, we conclude that the phosphorylation of NIPA upon NPM-ALK expression seems to limit the binding of NPM-ALK to NIPA, which we speculate could be important for the NPM-ALK activity and localization of NPM-ALK to the cytoplasm. In order to further analyze the functional effects of NPM-ALK-mediated NIPA phosphorylation, we generated a Ba/F3 cell line expressing the NIPA wild type or the phospho-deficient NIPA S338/344/370/381/387A mutant, as well as NPM-ALK using retroviral infection. NIPA (mCherry) and NPM-ALK (EGFP) expression upon co-infection was confirmed by immunoblot and flow cytometry ([Figure 5](#ijms-20-04060-f005){ref-type="fig"}C,D). To study the influence of NPM-ALK-specific NIPA phosphorylation on cell proliferation, we performed an MTS proliferation assay. As shown in [Figure 5](#ijms-20-04060-f005){ref-type="fig"}E, the phospho-deficient NIPA S338/344/370/381/387A mutant showed a slight reduction in cell growth compared to wild type NIPA upon NPM-ALK expression. These results could be confirmed by soft agar proliferation assays with *Nipa*-deficient MEFs expressing NPM-ALK together with Flag-NIPA wt or Flag-NIPA S338/344/370/381/387A (Supplemental [Figure S3A--C](#app1-ijms-20-04060){ref-type="app"}), but again, only a minor but significant effect could be observed. Therefore, we concluded that NPM-ALK-mediated NIPA phosphorylation seems to influence cell proliferation in an unfavorable manner, although these effects may not play a crucial role in NPM-ALK-mediated lymphomagenesis. Taken together, we identified five serine/threonine residues (Ser-338, Ser-344, Ser-370, Ser-381 and Thr-387) as phosphorylation sites in NIPA to be significantly induced upon NPM-ALK expression with biological impact on NIPA-NPM-ALK interaction. Phosphorylation does neither change the SCF^NIPA^-complex formation nor influences the NIPA localization. Silencing of these NIPA serine/threonine residues led to a significantly increased NIPA-NPM-ALK binding capacity as well as slightly reduced proliferation in Ba/F3 cells and MEFs. 3. Discussion {#sec3-ijms-20-04060} ============= The oncogenic tyrosine kinase NPM-ALK promotes tumorigenicity by binding and activating several proteins involved in antiapoptotic, promitogenic and transforming pathways. In addition, several transcriptional and cell cycle regulatory factors that play a role in NPM-ALK-mediated tumorigenesis have been recently identified \[[@B15-ijms-20-04060]\]. However, the molecular mechanism contributing to the distinct oncogenic features of NPM-ALK is still not fully understood. The F-box protein NIPA, which is involved in cell cycle regulation \[[@B11-ijms-20-04060]\], has been identified as a binding partner of NPM-ALK leading to its constitutive phosphorylation \[[@B10-ijms-20-04060],[@B12-ijms-20-04060]\]. In this study, we demonstrate cell-cycle-independent NIPA phosphorylation in NPM-ALK-positive ALCL cells. NPM-ALK-mediated NIPA phosphorylation did neither affect cell cycle rate nor SCF^NIPA^-complex structure, suggesting a cell-cycle-independent function of NIPA activated by this phosphorylation. As oncogenic tyrosine kinase, NPM-ALK is known to phosphorylate and activate several proteins: STAT3 as a major player in ALCL is constitutively phosphorylated by binding to NPM-ALK, and thereby contributes to lymphoma pathogenesis \[[@B16-ijms-20-04060],[@B17-ijms-20-04060],[@B18-ijms-20-04060],[@B19-ijms-20-04060],[@B20-ijms-20-04060]\]. Moreover, NPM-ALK recruits PI3K p85 subunit leading to the activation of the PI3K/Akt pathway contributing to ALK+ ALCL progression \[[@B21-ijms-20-04060]\]. Additional proteins activated by NPM-ALK binding are, e.g., CD30 \[[@B22-ijms-20-04060]\], PLC-γ \[[@B23-ijms-20-04060]\], STAT1 \[[@B24-ijms-20-04060]\] and the Src kinase pp60 \[[@B6-ijms-20-04060]\], all being involved in tumorigenesis by enhancing cell proliferation. Here, we identified five NPM-ALK-induced NIPA phosphorylation sites located on Ser-338, Ser-344, Ser-370, Ser-381 and Thr-387, which differ from the ERK2-induced serine residues phosphorylated during cell cycle progression \[[@B11-ijms-20-04060],[@B13-ijms-20-04060]\]. Since the identified phosphorylation sites are serines and threonines it seems unlikely that the tyrosine kinase ALK phosphorylates NIPA directly. NPM-ALK stimulates numerous downstream targets and signaling pathways possibly involved in mediating its oncogenicity, thereby not only leading to tyrosine but also serine phosphorylation such as S9-GSK3β by PI3K/AKT \[[@B25-ijms-20-04060]\]. Indeed, 506 phosphoproteins have been previously identified in NPM-ALK-expressing cells including a large number of serine/threonine phosphorylated proteins \[[@B26-ijms-20-04060]\]. Numerous serine/threonine kinases activated by NPM-ALK (i.e., MEK/ERK, mTor, Pl3K/AKT) \[[@B5-ijms-20-04060],[@B7-ijms-20-04060],[@B8-ijms-20-04060],[@B9-ijms-20-04060]\] could be considered as potential kinases for NIPA phosphorylation: The identified phosphorylation sites predominantly result in ERK1/2, JNK1 and p38MAPK recognition sites, which is in line with the publication of Illert et al. showing impaired NIPA phosphorylation upon MAPK inhibitor treatment in cells expressing NPM-ALK \[[@B12-ijms-20-04060]\], thereby reinforcing the importance of the MAP-kinases for NIPA phosphorylation. Interestingly, the identified phosphorylation sites are located in a small area of the protein---which includes the ALK-binding domain \[[@B10-ijms-20-04060]\]---suggesting a direct effect on the binding energy of the complex \[[@B27-ijms-20-04060],[@B28-ijms-20-04060]\]. In fact, in this work the phospho-deficient NIPA mutant showed significantly increased NPM-ALK binding compared to wild type NIPA. NIPA has already been identified as a nuclear protein, while the subcellular localization of NPM-ALK is both nuclear and cytoplasmic \[[@B14-ijms-20-04060]\]. It was already assumed that nuclear-located NIPA is able to relocalize ALK fusion proteins into the nucleus \[[@B10-ijms-20-04060]\]. Therefore, we hypothesized that the interaction and phosphorylation of NIPA might influence the localization of NPM-ALK or NIPA. Here we could show that the phospho-deficient NIPA mutant binds NPM-ALK to a higher extent as phosphorylated NIPA and might thereby retain the protein in the nucleus. As only cytoplasmic NPM-ALK is catalytically active, whereas the nuclear portion is inactive because of heterodimerization with NPM1, the amount of cytoplasmic NPM-ALK is crucial for optimal lymphoma growth \[[@B14-ijms-20-04060]\]. Thus, NPM-ALK might ensure its own cytoplasmic activity by NIPA phosphorylation. In line with these observations, we could show that phosphorylation of NIPA upon NPM-ALK expression slightly affects cell proliferation. NPM-ALK-positive cells expressing the phospho-deficient NIPA mutant showed significantly reduced cell growth compared to NIPA wild type cells. As NIPA phospho-deficiency changes the proliferation potential only to a minor extent, we concluded that these effects may not play a crucial role in NPM-ALK-mediated lymphomagenesis. However, these findings provide novel insights for further analyses and substantiate the complex mechanism of NPM-ALK signal
[ 74, 665, 11372, 767, 275, 43268, 4275, 31342, 943, 452, 3982, 625, 43503, 323, 20956, 533, 253, 15254, 715, 779, 497, 417, 1175, 2217, 15, 187, 187, 5623, 44884, 27, 187, 187, 32259, 2191, 25458, 313, 251, 275, 9963, 6097, 10, 721, 27, 754, 2879, 690, 2341, 281, 253, 2983, 13, 1907, 247, 5103, 809, 2231, 562, 323, 247, 7145, 347, 3517, 347, 344, 2210, 275, 15, 1292, 344, 310, 625, 273, 247, 45294, 3490, 1511, 273, 2380, 281, 247, 4112, 326, 4931, 2424, 247, 625, 10242, 422, 2746, 15, 187, 187, 9684, 74, 530, 2676, 32616, 313, 251, 275, 10909, 6097, 10, 608, 15, 22, 27, 388, 3111, 1475, 18670, 275, 253, 4766, 533, 253, 15254, 715, 779, 497, 1698, 7155, 25808, 15, 7820, 273, 15706, 2006, 74, 352, 651, 452, 644, 4722, 281, 923, 779, 3982, 275, 12936, 779, 281, 1663, 1071, 253, 767, 22126, 4055, 22513, 15, 187, 187, 40, 38766, 20344, 24673, 313, 251, 275, 11439, 6097, 2262, 754, 4307, 2994, 247, 5322, 5103, 326, 369, 809, 2231, 816, 689, 253, 2534, 13, 533, 1904, 457, 85, 452, 2217, 673, 281, 513, 1199, 2010, 15, 20956, 7171, 16335, 407, 4882, 5322, 5842, 534, 20344, 24673, 6828, 13, 6108, 779, 562, 273, 253, 1386, 14, 484, 275, 2165, 3264, 281, 320, 247, 625, 3520, 6680, 1537, 320, 2783, 41585, 15, 733, 1537, 671, 320, 2783, 440, 1369, 33258, 275, 247, 1728, 2165, 534, 369, 20956, 457, 84, 1390, 4839, 273, 253, 2952, 281, 755, 247, 3330, 689, 616, 9462, 28851, 15, 4387, 7241, 15108, 18397, 27, 966, 551, 535, 50274, 2044, 4451, 18483, 27, 4605, 551, 755, 748, 187, 50274, 187, 94, 187, 17534, 9601, 9730, 187, 187, 17534, 9601, 9730, 50276, 261, 247, 5307, 2448, 6617, 14, 681, 6368, 3085, 6828, 407, 14861, 24198, 1079, 285, 28193, 18322, 4559, 460, 13, 6029, 443, 11105, 4595, 13, 8698, 42005, 13, 7493, 11086, 900, 13, 378, 4405, 10231, 13, 285, 5171, 6029, 14, 35419, 15, 187, 187, 18992, 187, 510, 3085, 5966, 253, 7324, 387, 253, 5307, 16335, 5625, 15913, 14964, 13, 275, 534, 352, 1912, 253, 1457, 2448, 43291, 11240, 323, 1682, 14835, 15, 187, 187, 19447, 2490, 18322, 4559, 460, 347, 17486, 3109, 187, 6029, 443, 11105, 4595, 347, 443, 2610, 3689, 21037, 186, 187, 8698, 42005, 347, 2305, 15, 5219, 187, 7493, 11086, 900, 347, 5171, 466, 3689, 21037, 187, 378, 4405, 10231, 347, 19307, 280, 367, 39684, 187, 5171, 6029, 14, 35419, 347, 20164, 399, 15, 187, 19669, 3196, 5477, 347, 42753, 187, 8444, 399, 662, 272, 347, 367, 15242, 26251, 83, 2153, 187, 35028, 38711, 347, 37497, 26251, 83, 2153, 187, 5332, 16442, 1796, 347, 500, 825, 80, 26251, 83, 2153, 187, 15435, 12751, 2072, 347, 5037, 5134, 26251, 83, 2153, 187, 4031, 21728, 1605, 4015, 3876, 347, 47637, 187, 49150, 14, 2422, 13931, 18749, 347, 6393, 187, 8444, 18593, 1321, 347, 27983, 27738, 187, 9915, 418, 4595, 347, 27983, 11418, 187, 418, 3230, 2956, 83, 6077, 347, 46937, 187, 14861, 24198, 1079, 347, 12972, 17486, 3109, 187, 187, 4941, 187, 187, 7504, 4859, 187, 187, 1413, 27, 6914, 6590, 187, 1413, 27, 7878, 6590, 187, 1413, 27, 7878, 6617, 17325, 6590, 187, 1413, 27, 14376, 14, 12982, 6590, 187, 1413, 27, 6914, 84, 6617, 17325, 6590, 7673, 187, 187, 34, 14, 32259, 13, 2615, 80, 8247, 16336, 506, 571, 1284, 40985, 1653, 24105, 36580, 187, 187, 4257, 2816, 33891, 31021, 12992, 16336, 506, 571, 4453, 2584, 253, 4868, 4697, 347, 344, 6505, 247, 14623, 2165, 1411, 253, 8742, 9757, 36580, 275, 253, 28023, 40762, 15, 380, 33891, 1912, 495, 14, 19, 689, 253, 8742, 9757, 36580, 275, 28642, 17563, 34280, 904, 327, 7814, 13, 3978, 577, 13, 4332, 15, 313, 2088, 15837, 16, 13238, 460, 27409, 350, 10, 4257, 2816, 33891, 31021, 12992, 16336, 506, 571, 4453, 2584, 253, 4868, 4697, 347, 344, 6505, 247, 14623, 2165, 1411, 253, 8742, 9757, 36580, 275, 253, 28023, 40762, 15, 380, 33891, 1912, 495, 14, 19, 689, 253, 8742, 9757, 36580, 275, 28642, 17563, 34280, 904, 327, 7814, 13, 3978, 577, 13, 4332, 15, 313, 2088, 15837, 16, 13238, 460, 27409, 350, 10, 187, 187, 49091, 1922, 2894, 13, 34280, 15, 313, 2088, 10, 795, 12992, 16336, 506, 571, 2210, 1561, 581, 562, 273, 521, 187, 9815, 3426, 2165, 275, 1264, 7866, 13, 6539, 27051, 4352, 247, 564, 14, 42338, 187, 9389, 14, 6321, 2860, 254, 285, 17453, 2615, 80, 671, 2427, 3676, 13, 4283, 253, 1457, 187, 46225, 33891, 281, 247, 495, 14, 19, 10170, 689, 253, 8742, 9757, 36580, 327, 187, 28007, 2360, 15, 187, 187, 32259, 10389, 17761, 24145, 247, 337, 14, 455, 13898, 275, 253, 15515, 342, 521, 884, 394, 2860, 254, 187, 1171, 253, 2952, 285, 721, 1508, 5784, 273, 521, 5249, 13, 6276, 8024, 8498, 18056, 3230, 457, 84, 337, 14, 18, 187, 45935, 715, 253, 5561, 19176, 275, 1669, 14, 9229, 1673, 846, 247, 1421, 2727, 2940, 187, 936, 32324, 8481, 3796, 15, 380, 767, 26783, 2513, 2559, 329, 14, 32259, 457, 84, 2264, 281, 187, 18, 13, 46014, 13, 42068, 8359, 26118, 323, 28023, 1659, 327, 253, 512, 14, 2606, 1618, 15, 10209, 598, 187, 261, 38916, 353, 698, 387, 337, 13, 36814, 15, 187, 187, 3848, 18415, 500, 1715, 369, 337, 323, 495, 342, 247, 2940, 13, 42068, 5769, 23773, 323, 3349, 394, 327, 187, 783, 5249, 4352, 1618, 15, 187, 187, 52, 357, 506, 571, 313, 24, 14, 20, 10, 4136, 767, 6613, 327, 5093, 12830, 285, 581, 2940, 1223, 187, 32182, 4351, 562, 1264, 15, 380, 5215, 6589, 12552, 10231, 13688, 556, 1912, 521, 1390, 187, 12496, 7866, 13, 42068, 521, 20088, 5249, 9880, 29642, 13, 285, 310, 818, 14, 19, 187, 17480, 4162, 3495, 846, 1469, 470, 14, 18, 275, 521, 806, 1740, 562, 723, 15, 187, 187, 22284, 1241, 29938, 7993, 22889, 36326, 40754, 16336, 506, 571, 342, 247, 767, 14, 483, 416, 6159, 187, 20199, 275, 253, 28023, 285, 2398, 10356, 43107, 4581, 352, 562, 407, 42200, 187, 38, 4662, 22587, 2009, 327, 247, 806, 14, 45935, 44343, 281, 2159, 13121, 323, 521, 1458, 394, 5321, 187, 249, 1283, 14512, 15, 733, 369, 43107, 457, 84, 337, 13, 4838, 5784, 5249, 7286, 13, 187, 1189, 29114, 3438, 33891, 6696, 273, 27993, 8003, 3617, 583, 443, 1730, 486, 323, 187, 1047, 394, 1659, 512, 14, 2606, 15, 187, 187, 52, 386, 3230, 313, 20, 14, 22, 10, 4136, 1264, 6613, 285, 5093, 12830, 275, 5093, 187, 32599, 13, 10903, 562, 1264, 285, 7428, 1264, 15, 380, 987, 14, 4608, 254, 369, 187, 78, 3149, 598, 247, 1388, 275, 253, 9381, 846, 5682, 388, 6950, 369, 45402, 187, 12157, 273, 26370, 275, 521, 2406, 896, 15, 187, 187, 52, 386, 3230, 310, 337, 14, 21, 275, 521, 1390, 5093, 7866, 1411, 253, 33891, 187, 6438, 9880, 521, 806, 1740, 15, 187, 187, 36, 4692, 5485, 253, 14755, 275, 253, 7002, 342, 521, 1249, 394, 2860, 254, 13, 187, 41571, 247, 495, 14, 19, 11288, 715, 253, 2406, 13512, 275, 253, 987, 14, 3423, 7145, 15, 187, 22097, 2886, 20189, 13, 247, 7457, 14, 2606, 7284, 4051, 710, 13688, 13, 1160, 247, 821, 6231, 3177, 187, 936, 5834, 253, 4023, 285, 2427, 1481, 7053, 715, 253, 806, 4194, 533, 13082, 187, 328, 1026, 41746, 15, 187, 187, 510, 36580, 12331, 352, 275, 253, 5004, 2716, 342, 271, 440, 613, 9306, 1408, 846, 187, 43, 1715, 7730, 521, 7002, 2228, 273, 253, 2952, 13, 816, 767, 11184, 685, 187, 248, 574, 512, 273, 1390, 807, 15, 187, 187, 510, 2620, 14, 2606, 7284, 4051, 710, 2159, 13121, 7491, 264, 247, 650, 10117, 2584, 253, 187, 16389, 407, 1359, 466, 32064, 4662, 1563, 247, 1421, 2727, 4021, 407, 187, 16065, 14, 73, 4069, 21265, 936, 9368, 4938, 80, 13, 665, 11691, 327, 9069, 8684, 261, 457, 187, 38346, 16297, 8778, 15, 9368, 4938, 80, 457, 84, 4021, 369, 760, 253, 2626, 4465, 14, 4793, 4352, 187, 1615, 247, 1669, 14, 22124, 288, 4069, 1411, 16336, 506, 571, 275, 521, 1390, 3307, 7866, 15, 187, 187, 16927, 27, 7814, 7101, 4555, 1264, 1107, 1580, 500, 1715, 13, 253, 187, 58, 266, 31185, 512, 14, 2606, 12830, 6657, 13, 1694, 521, 374, 13, 16607, 394, 5249, 4352, 281, 1509, 187, 28184, 2364, 39785, 282, 323, 2626, 1659, 15, 8139, 32064, 4662, 369, 30938, 456, 432, 253, 187, 6721, 846, 5816, 1638, 3958, 984, 273, 247, 987, 10546, 2703, 7372, 13, 285, 187, 4238, 470, 323, 495, 846, 2970, 4352, 407, 247, 11288, 521, 806, 673, 598, 15, 3481, 187, 5785, 18709, 7395, 953, 369, 4500, 264, 281, 36216, 14, 34, 23790, 9396, 15, 8139, 2726, 9693, 187, 30758, 22126, 275, 253, 20923, 9167, 34482, 13, 500, 1715, 457, 84, 5230, 272, 187, 14014, 943, 320, 342, 253, 12810, 968, 15, 2732, 512, 13, 521, 2120, 1416, 310, 187, 3848, 18415, 7889, 3796, 500, 1715, 15, 1292, 521, 4766, 1416, 556, 2717, 281, 513, 342, 187, 783, 3438, 22037, 4760, 15, 7889, 3796, 310, 521, 3392, 457, 84, 806, 1416, 15, 496, 187, 12690, 13, 500, 1715, 2506, 457, 85, 1014, 956, 19971, 795, 533, 344, 858, 8041, 253, 7544, 187, 47, 11040, 1876, 14, 16043, 2165, 275, 31205, 6912, 13, 285, 17602, 3192, 275, 581, 29629, 187, 13197, 1309, 521, 29938, 2952, 15, 8139, 329, 12999, 24755, 806, 11288, 369, 187, 394, 2924, 407, 19172, 42475, 13, 665, 369, 253, 36580, 457, 806, 12552, 10231, 13688, 275, 187, 29639, 15, 496, 2620, 7866, 1411, 253, 33891, 326, 2952, 13, 344, 369, 577, 14, 17, 187, 3113, 247, 470, 15, 1093, 38233, 13, 1740, 3426, 3958, 285, 1264, 6294, 8349, 15, 380, 187, 22284, 1241, 457, 760, 643, 12552, 10231, 13688, 795, 17486, 13013, 48740, 795, 588, 2454, 521, 187, 19946, 2285, 275, 6926, 457, 84, 2962, 36454, 816, 2620, 1897, 846, 36456, 187, 8701, 806, 6294, 483, 1580, 4163, 608, 13, 5403, 15, 47638, 7203, 46237, 2515, 3738, 3164, 581, 273, 253, 1390, 15018, 436, 2952, 347, 352, 310, 2970, 1512, 5890, 1024, 15, 5863, 285, 1066, 275, 670, 721, 3038, 15, 380, 13178, 327, 253, 21948, 27563, 497, 6571, 27819, 432, 8762, 533, 1531, 1301, 790, 285, 6749, 44910, 497, 1335, 9371, 15, 18, 15, 7327, 273, 253, 14723, 187, 1552, 3688, 7033, 3839, 281, 5520, 8527, 10236, 5289, 1690, 22911, 3082, 627, 1542, 13, 285, 13, 625, 3782, 13, 281, 5520, 8527, 10236, 16781, 5289, 1907, 18884, 1930, 12081, 12940, 285, 35709, 16889, 6605, 12940, 1690, 22911, 3082, 627, 1542, 15, 187, 19, 15, 17720, 273, 253, 13036, 3975, 187, 20536, 48176, 45495, 1713, 64, 530, 15, 52, 15, 2790, 15, 1621, 15, 495, 13, 41830, 13, 25, 1423, 495, 13, 25020, 13, 8196, 495, 13, 41830, 13, 25, 1731, 495, 13, 21889, 13, 9913, 495, 13, 24, 1812, 13, 19631, 45495, 1713, 64, 187, 688, 253, 2469, 13, 8527, 10236, 5289, 497, 26493, 970, 35709, 16889, 12940, 275, 1340, 281, 23810, 20843, 2710, 16781, 390, 643, 4095, 313, 69, 1970, 265, 13, 11623, 641, 13, 3966, 2698, 432, 1016, 643, 15, 380, 35709, 16889, 7011, 4095, 3798, 574, 247, 6605, 273, 581, 1511, 20791, 285, 253, 25389, 273, 253, 16781, 2813, 13, 323, 1650, 13, 1907, 247, 2919, 273, 7285, 1511, 20791, 369, 4441, 327, 253, 6605, 285, 23539, 342, 1675, 281, 253, 6605, 275, 247, 5133, 281, 16584, 253, 35709, 16889, 875, 253, 6605, 285, 253, 25389, 273, 253, 2813, 323, 253, 4096, 273, 23810, 4186, 839, 253, 2813, 432, 253, 6605, 15, 187, 8665, 5609, 497, 3715, 323, 4186, 839, 4095, 275, 271, 8527, 10236, 2605, 15, 2596, 273, 841, 5609, 2908, 253, 4473, 273, 18884, 12940, 15, 496, 436, 5853, 273, 12940, 13, 253, 2710, 10236, 4095, 497, 4447, 275, 21371, 273, 1114, 406, 26674, 460, 10236, 2144, 534, 21371, 497, 7011, 432, 271, 6944, 6605, 407, 2097, 273, 247, 18884, 3828, 273, 2144, 13, 3798, 273, 14185, 21295, 15, 380, 18884, 7011, 10236, 4095, 574, 247, 1077, 1943, 5750, 689, 35709, 16889, 7011, 4095, 275, 326, 627, 369, 642, 878, 281, 897, 8107, 23539, 5609, 281, 873, 598, 253, 35709, 16889, 12940, 285, 671, 627, 369, 642, 4709, 273, 253, 1896, 19501, 273, 253, 35709, 16889, 15, 187, 5623, 9642, 13, 35709, 16889, 7011, 5289, 497, 3715, 970, 18884, 7011, 1930, 12081, 4811, 275, 5019, 281, 2085, 8527, 10236, 5289 ]
i who faced two inexperienced central defenders should have brought more dividends for Portland but the balls into him were not good enough. Substitutes: Rodney Wallace (on in 67′) 6: He added some energy to the attack, having a shot deflected out for a corner as soon as he came in. But he is more of a brute force type of response to a situation that perhaps required a more inventive approach. Maxi Urruti (on in 76′) 5.5: Hovered around hopefully in the middle but the balls into him were low percentage crosses. Instead of replacing Adi it would have been interesting to see him brought in alongside him to really test the two Vancouver center backs. Gaston Fernandez (on in 83′): He worked himself a nice shot that was deflected just over the bar, but didn’t have enough time to do much else. Portland beat Seattle by playing nice football which Fernandez directed, leaving him out of the line-up in game expected to be a more physical battle might be considered pragmatic. It might also be considered unambitious in a home game which was Portland’s last chance of the season to get a win over their Canadian rivals.public protocol Identifiable: class { var uniqueIdentifier: String { get } } Very Mean Men Very Mean Men is a 2000 American crime-comedy film directed by Tony Vitale and starring Matthew Modine, Ben Gazzara, Martin Landau, Scott Baio, Burt Young, and Paul Ben-Victor. Release The film entered the competition at the 2000 Seattle International Film Festival, in which it won the New American Cinema Award for best editing. Cast Matthew Modine as Bartender Ben Gazzara as Gino Minetti Martin Landau as Mr. White Scott Baio as Paulie Minetti Burt Young as Dominic Piazza Paul Ben-Victor as Jimmy D. Billy Drago as Dante Charles Durning as Paddy Mulroney Louise Fletcher as Katherine Mulroney Jack McGee as Jocko Mulroney Patrick Renna as Donny Mulroney Idalis DeLeón as Argentine Leigh-Allyn Baker as Mary Charles Napier as Detective Bailey Joe Lara as Detective Miller Lana Parrilla as Teresa Tony Vitale as Night Bartender References External links Category:2000 films Category:American films Category:American crime comedy films Category:English-language films Category:2000s crime comedy filmsMore A-Rod, Cano Back Sabathia As Bombers Edge Angels New York Yankees pitcher CC Sabathia looks toward the scoreboard as he leaves a baseball game against the Los Angeles Angels in the ninth inning. The Yankees won 3-2 over the Los Angeles Angels in Anaheim Calif., on Saturday, June 4, 2011. (AP Photo/Christine Cotter)New York Yankees pitcher CC Sabathia looks toward the scoreboard as he leaves a baseball game against the Los Angeles Angels in the ninth inning. The Yankees won 3-2 over the Los Angeles Angels in Anaheim Calif., on Saturday, June 4, 2011. (AP Photo/Christine Cotter) ANAHEIM, Calif. (AP) _ CC Sabathia came within one out of his second complete game in three starts, Alex Rodriguez hit a go-ahead two-run homer and Robinson Cano also went deep, leading the New York Yankees to a 3-2 victory over the Los Angeles Angels on Saturday night. Rodriguez snapped a 1-all tie in the sixth with his 10th homer of the season and 623rd of his career, driving Ervin Santana’s 1-1 pitch into the rock pile in left-center field after a leadoff walk to Curtis Granderson. The two RBIs increased A-Rod’s total to 1,864, tying Mel Ott for ninth place on the all-time list. Next up is Willie Mays at 1,903. Derek Jeter was 1 for 3 with a walk, tying Sam Rice for 28th on the career hit list. Sabathia (7-3) allowed two runs on seven hits and one walk while striking out three. The 2007 AL Cy Young winner has won his last four starts, tying his longest career winning streak, and is 7-2 since April 23 after going 0-1 in his first four outings. Angels rookie Peter Bourjos chased Sabathia with a two-out RBI single in the ninth and Mariano Rivera closed it out by retiring Erick Aybar on a first-pitch popup to shortstop for his 15th save in 18 chances. It was Rivera’s 1,003rd career appearance, overtaking former Yankees Hall of Fame closer Goose Gossage for 14th place all-time. Santana (3-5) allowed three runs and seven hits in seven innings, struck out three and walked three. The right-hander was moved up a day in the rotation after Dan Haren was scratched because of stiffness in his lower back. Santana is 1-4 in his last seven starts against the Yankees after winning his first four. Cano opened the scoring in the fourth with his 12th homer, driving a 3-2 pitch into the lower seats in the right-field corner. Torii Hunter, a nine-time Gold Glove winner, made a valiant attempt to catch the ball and went headfirst into the first row but emerged unscathed. The Angels tied it in the bottom half with an unearned run after Jeter committed his fourth error of the season, just two fewer than he had all of last year. The five-time Gold Glove shortstop booted a grounder toward the middle by Howie Kendrick following a leadoff double by switch-hitter Alberto Callaspo, who scored on Jeff Mathis’ sacrifice fly. Callaspo’s double was only the third extra-base hit by a left-handed hitter against Sabathia in his last 22 starts. Notes: Saturday marked exactly three years since Jeter, the Yankees all-time hits leader, got his 2,146th career hit to pass Mickey Mantle for third place. … Kendrick was reinstated from the DL after missing 14 games because of a right hamstring strain, and was 0 for 3 after getting hit by a pitch his first time up. OF Reggie Willits was optioned to Triple-A Salt Lake. … With Boston playing Vancouver in the Stanley Cup finals, Jeter’s rooting interest should be with the Bruins. After all, his full name is Derek Sanderson Jeter. But his middle name has nothing to do with the former NHL player. Sanderson is his father’s first name. In fact, Jeter doesn’t even follow hockey _ but he did attend the 1999 NHL All-Star game in Tampa Bay, and recalled taking in one Rangers game during his rookie season. … A ceremonial first pitch was thrown by Dean Chance, who was the Angels’ first Cy Young winner in 1964. In five starts against the Yankees that season, he was 4-0 with a 0.18 ERA, four complete games and three shutouts. The Angels’ only other Cy Young winner _ Bartolo Colon _ will face his former team in Sunday’s series finale just five days after pitching his first shutout since July 5, 2006.Perfect spring skiing conditions although probably one of the last possibilities this season as it is getting too warm now. Up and down in about 6 hours. The chains on the summit ridge were mostly uncovered from snow but crampons and ice axe were still helpful.1. Field of the Invention This invention relates generally to improved integrated semiconductor structures including fabrication methods therefor, and, more particularly, to improved integrated semiconductor transistor structures having dielectric sidewall isolation and PN junction substrate isolation including fabrication methods therefor. 2. Background of the Prior Art Related References ______________________________________ U.S. Pat. No. 3,617,822 3,648,128 3,617,826 3,659,160 3,736,193 ______________________________________ In the past, integrated semiconductor structures were fabricated using PN junction isolation in order to electrically isolate various transistor or other devices (diodes, resistors, etc.) from each other. The PN junction isolated devices usually had a substrate of one type conductivity and the collector of the transistor device, for example, having a region of opposite type conductivity was located on the substrate and biased with respect to the substrate in a manner to utilize the PN junction between the substrate and the collector of the device for the purpose of electrically isolating the device from the substrate. Other techniques were developed for isolating devices in an integrated semiconductor structure. One of these techniques included the concept of dielectric isolation. In this technique of isolation, the various semiconductor devices were formed in pockets of monocrystalline semiconductor material which pockets were isolated from an underlying substrate by means of a dielectric layer of material, usually of silicon dioxide. The dielectric isolated semiconductor devices had a very big advantage over PN junction isolated devices in that there was no need to use reverse biased techniques to set up the PN junction isolation and also there was no fear of the possible breakdown of the PN junction. Subsequently, PN junction isolated structures were developed using dielectric isolated sidewall regions in combination to provide integrated semiconductor structures
[ 2816, 15, 1707, 1833, 320, 247, 3041, 1841, 281, 1978, 368, 10000, 15, 733, 434, 6501, 320, 512, 987, 937, 14272, 434, 12888, 1804, 326, 13, 323, 779, 13, 1512, 13, 4536, 275, 1495, 1881, 14, 8155, 3460, 310, 253, 1682, 326, 476, 320, 2218, 15, 1916, 436, 6070, 13, 512, 273, 521, 6590, 19145, 616, 29613, 273, 34169, 13, 285, 521, 36163, 281, 8446, 16, 15337, 254, 6128, 347, 973, 347, 521, 3480, 273, 23027, 670, 1142, 273, 731, 403, 13, 25711, 13, 3580, 273, 521, 11321, 1907, 2168, 5608, 616, 3625, 3367, 8103, 323, 779, 1078, 597, 1472, 2455, 4439, 15, 15023, 4282, 326, 27504, 43354, 4453, 594, 1471, 7909, 1025, 846, 253, 9273, 273, 521, 3085, 387, 253, 990, 273, 795, 998, 472, 461, 6700, 2370, 4414, 187, 187, 48102, 1691, 247, 2080, 625, 2762, 1499, 386, 327, 521, 27066, 1170, 24020, 275, 521, 4572, 342, 7727, 3697, 781, 293, 13, 2078, 2980, 352, 281, 3811, 884, 2607, 273, 1046, 807, 273, 521, 1495, 275, 10721, 15, 187, 187, 60, 56, 62, 864, 368, 923, 247, 10721, 10480, 13, 352, 434, 1633, 326, 809, 447, 6612, 15, 1422, 871, 13, 619, 1039, 556, 644, 11321, 15, 309, 3153, 323, 247, 807, 275, 253, 6440, 15, 309, 3630, 253, 6440, 15, 309, 3153, 342, 1110, 5810, 15, 309, 5248, 253, 6440, 15, 309, 1353, 327, 253, 873, 15, 380, 873, 310, 5046, 247, 16952, 84, 2360, 34583, 13, 390, 5046, 352, 434, 247, 13399, 2181, 13, 533, 309, 3153, 275, 247, 15223, 1533, 323, 3578, 2607, 15, 1244, 407, 3811, 275, 326, 1533, 309, 1353, 809, 3184, 6612, 275, 247, 1039, 1108, 390, 387, 1878, 17197, 432, 6612, 15, 1292, 326, 434, 752, 352, 434, 512, 670, 323, 479, 964, 964, 964, 1916, 479, 13, 326, 434, 253, 1607, 37275, 323, 253, 789, 313, 10859, 781, 293, 6469, 27, 19092, 481, 187, 187, 3404, 253, 990, 273, 795, 510, 49685, 12447, 273, 37068, 64, 1157, 31661, 21829, 313, 39, 2501, 10, 310, 13, 30812, 617, 3332, 3367, 31233, 342, 253, 9116, 17827, 1561, 253, 6440, 3601, 13, 13237, 33853, 896, 715, 253, 45788, 314, 18109, 23013, 273, 10852, 285, 443, 4940, 434, 795, 52, 7706, 6865, 64, 4109, 793, 469, 410, 10721, 13, 617, 2798, 22071, 314, 6627, 2980, 2454, 612, 6856, 253, 7133, 273, 617, 3676, 2980, 1448, 2035, 15, 1500, 13, 1512, 13, 310, 346, 1545, 3184, 6612, 937, 533, 253, 2963, 525, 4306, 273, 253, 2774, 38422, 432, 776, 3640, 326, 13, 1078, 1048, 13, 703, 588, 2378, 969, 452, 281, 346, 27271, 6612, 3, 407, 6108, 253, 18876, 285, 294, 290, 2158, 253, 711, 25839, 27675, 1533, 17991, 264, 689, 13, 323, 617, 13, 407, 617, 5938, 13, 4200, 76, 15, 496, 581, 273, 521, 625, 49317, 5701, 281, 3697, 781, 293, 13, 14272, 16402, 326, 253, 1921, 326, 344, 574, 29169, 313, 16490, 459, 257, 659, 522, 10747, 10, 2509, 10721, 24866, 275, 795, 6504, 17327, 64, 310, 326, 13, 346, 1542, 479, 13, 22095, 327, 10721, 310, 253, 760, 1039, 562, 273, 253, 4840, 326, 359, 1472, 275, 15, 1310, 359, 1053, 626, 755, 247, 21653, 2900, 281, 352, 359, 1472, 417, 1469, 281, 755, 667, 2900, 964, 964, 17212, 313, 10859, 781, 293, 6469, 27, 14821, 481, 29169, 795, 18566, 64, 9302, 275, 501, 316, 10179, 839, 40794, 313, 25000, 22169, 388, 4405, 10, 672, 17363, 434, 6122, 10224, 281, 14471, 617, 3101, 432, 617, 39276, 46298, 13, 533, 13, 625, 2223, 275, 14272, 434, 6590, 13, 253, 4231, 6433, 403, 1512, 9680, 273, 253, 17823, 273, 616, 2853, 16723, 281, 5321, 3780, 1108, 3746, 2908, 15, 40445, 273, 841, 1881, 14, 585, 43386, 1607, 302, 290, 4231, 6433, 310, 795, 52, 1940, 412, 64, 686, 84, 46637, 11327, 8592, 1108, 33119, 423, 5391, 1108, 665, 13, 1078, 13889, 13, 6057, 512, 1512, 973, 326, 521, 346, 356, 27427, 8094, 3, 281, 1056, 5705, 15529, 275, 521, 1471, 1585, 6081, 3817, 310, 512, 247, 35391, 15, 2091, 322, 857, 376, 2604, 507, 4742, 313, 4316, 274, 17655, 18063, 507, 1665, 10, 11949, 1951, 253, 3817, 434, 21653, 9136, 984, 703, 25767, 253, 2812, 250, 273, 247, 3846, 12726, 3304, 13, 11327, 8592, 12325, 617, 13, 187, 187, 1276, 513, 368, 1158, 32, 1707, 434, 19851, 32, 329, 1533, 273, 29115, 952, 32, 964, 964, 964, 3105, 479, 15, 309, 1353, 247, 21641, 301, 304, 262, 1080, 15, 309, 513, 18011, 24866, 285, 3120, 24866, 964, 964, 964, 831, 544, 783, 16909, 322, 857, 376, 310, 11797, 281, 3135, 3574, 307, 2027, 407, 253, 12726, 62, 310, 417, 323, 479, 15, 309, 513, 19322, 2534, 4784, 91, 87, 1240, 84, 285, 2151, 434, 4676, 15, 187, 187, 1909, 15435, 19995, 285, 13089, 570, 329, 15, 3697, 14398, 7568, 275, 346, 6744, 6243, 1875, 3162, 27, 380, 308, 4662, 27284, 273, 9002, 90, 14272, 937, 253, 12415, 875, 253, 6387, 273, 247, 346, 20752, 474, 2900, 3, 285, 253, 2080, 3687, 12177, 326, 667, 824, 2900, 651, 760, 320, 247, 10480, 13, 271, 769, 273, 21641, 301, 304, 3535, 13, 591, 87, 3355, 14272, 434, 6590, 15, 1284, 14272, 2183, 3697, 781, 293, 313, 9755, 27, 10523, 582, 346, 2577, 1039, 544, 1171, 809, 3184, 6612, 62, 556, 644, 11321, 449, 13168, 253, 10721, 2987, 28, 4536, 417, 15, 2091, 795, 4779, 20660, 64, 5485, 13, 14272, 13, 347, 344, 2183, 418, 991, 13, 37001, 253, 33552, 27, 187, 187, 2598, 952, 1158, 13, 754, 2506, 626, 1557, 13, 390, 754, 434, 1512, 355, 49912, 13, 390, 754, 434, 3802, 1412, 90, 285, 43837, 13, 533, 13, 347, 309, 753, 13, 326, 434, 417, 352, 15, 733, 434, 625, 751, 11010, 23786, 15, 733, 2506, 626, 39314, 479, 15, 733, 816, 2506, 626, 1663, 1599, 2712, 15, 544, 795, 1328, 28582, 4414, 62, 187, 187, 5872, 344, 2879, 13, 347, 604, 10437, 839, 253, 3085, 326, 651, 1614, 521, 5249, 1475, 13, 346, 1989, 7785, 30607, 479, 3, 313, 45, 991, 5215, 27, 12472, 481, 187, 187, 16927, 187, 187, 18, 1284, 273, 4247, 13, 4050, 13, 253, 9836, 13711, 273, 795, 30701, 6170, 275, 7785, 64, 369, 370, 3208, 15, 22, 3041, 13, 2403, 352, 253, 1755, 13711, 272, 3907, 3085, 273, 4332, 313, 795, 34934, 19988, 1734, 64, 1157, 3344, 15, 3435, 13, 4050, 481, 187, 187, 19, 2058, 1534, 2495, 273, 809, 77, 839, 7055, 266, 434, 23027, 13, 352, 3198, 281, 320, 14969, 326, 253, 795, 44232, 279, 64, 16555, 327, 9002, 90, 14272, 285, 6181, 407, 443, 18810, 9730, 42552, 3088, 31444, 247, 1199, 625, 32270, 3100, 2954, 875, 14272, 285, 326, 2586, 1108, 3782, 342, 13089, 14, 22434, 2656, 472, 1108, 685, 795, 30701, 6170, 64, 594, 18511, 314, 10513, 15, 187, 187, 21950, 330, 959, 187, 187, 10697, 1811, 13, 8969, 313, 13034, 10, 795, 30098, 90, 285, 3032, 10168, 4414, 4693, 27, 24324, 16103, 15, 187, 187, 27595, 13, 12808, 313, 7330, 10, 346, 795, 30701, 6170, 275, 7785, 42511, 15913, 22955, 313, 6791, 16, 18948, 481, 187, 187, 45, 991, 13, 12284, 313, 8602, 10, 795, 1773, 735, 569, 342, 9002, 90, 14272, 27, 3032, 43667, 13, 253, 19345, 447, 13, 285, 19345, 9623, 1170, 4414, 1457, 2816, 27, 10381, 36470, 15, 187, 187, 11773, 3594, 506, 13, 17885, 313, 8603, 10, 346, 2042, 368, 3260, 9002, 90, 751, 309, 871, 9002, 90, 449, 496, 6911, 444, 15, 611, 1825, 261, 285, 23843, 466, 330, 24595, 290, 91, 313, 5797, 11507, 795, 30098, 90, 14272, 5383, 17920, 4414, 9857, 13, 7852, 27, 2499, 5687, 273, 18531, 15, 187, 187, 10859, 781, 293, 13, 7727, 313, 9755, 10, 795, 30098, 90, 14272, 27, 329, 7813, 275, 43667, 4414, 8068, 27, 38071, 416, 15, 47433, 15, 187, 187, 53, 22017, 13, 31270, 313, 7330, 10, 346, 48157, 2278, 27, 686, 30701, 6170, 275, 7785, 2464, 346, 795, 30580, 9757, 7717, 64, 313, 6791, 1384, 582, 378, 18, 15, 187, 7834, 309, 187, 187, 39357, 16, 7034, 19111, 3756, 16, 34, 1137, 321, 1204, 187, 18, 187, 187, 510, 8419, 14, 484, 329, 1137, 321, 187, 187, 36, 886, 21829, 21882, 324, 187, 187, 30098, 90, 14272, 434, 6590, 452, 1900, 9713, 1798, 7794, 273, 2448, 4466, 1108, 9556, 20393, 13, 1980, 22925, 313, 19968, 536, 13931, 13, 21801, 13, 5002, 582, 8672, 313, 8701, 247, 4149, 281, 11885, 582, 285, 24624, 27491, 313, 8701, 2389, 273, 14759, 42975, 13, 1445, 26693, 13, 24455, 481, 1292, 253, 6423, 434, 5048, 272, 273, 8928, 22925, 285, 27155, 4566, 4457, 253, 14777, 273, 521, 6590, 15, 14272, 434, 1345, 2460, 13, 247, 5019, 273, 521, 3601, 35554, 285, 521, 1345, 25200, 13, 556, 37504, 36080, 247, 12415, 326, 369, 4275, 281, 253, 5426, 273, 247, 3085, 4466, 275, 253, 1986, 2077, 27, 326, 875, 346, 8656, 3, 285, 346, 676, 3, 8928, 5113, 1108, 281, 1691, 352, 29156, 314, 13, 875, 36543, 1445, 285, 34679, 14608, 15, 187, 187, 1147, 310, 247, 973, 14, 4304, 958, 326, 253, 5112, 14, 6448, 2934, 273, 253, 1125, 13707, 3395, 247, 9865, 4968, 275, 253, 347, 3459, 273, 8928, 1318, 281, 6590, 15, 380, 1307, 434, 25344, 273, 17521, 2531, 285, 731, 1420, 15274, 13, 347, 973, 347, 273, 247, 6423, 434, 1881, 14, 4347, 8122, 3198, 13, 4828, 30063, 253, 7212, 280, 285, 2563, 47842, 267, 7794, 273, 9787, 5113, 4197, 323, 2280, 8353, 15, 844, 403, 671, 6600, 326, 14272, 434, 36108, 16876, 285, 17521, 2531, 14404, 265, 452, 4845, 253, 5020, 273, 521, 2987, 275, 253, 19929, 273, 1125, 13707, 26693, 13, 3340, 846, 795, 1145, 10633, 6696, 64, 313, 20087, 582, 534, 10880, 247, 5502, 281, 625, 2570, 14511, 5289, 285, 15585, 16876, 1108, 253, 3085, 369, 4745, 3560, 407, 795, 6504, 17327, 64, 313, 19791, 582, 14272, 434, 806, 1485, 2244, 279, 715, 253, 5028, 273, 14562, 15, 2058, 253, 1072, 673, 13, 253, 6423, 434, 8450, 347, 247, 46579, 8406, 323, 5084, 1346, 285, 7315, 25795, 2458, 13, 285, 347, 247, 1462, 14, 484, 43778, 1097, 327, 3924, 285, 327, 5579, 13, 4179, 521, 1125, 13707, 6489, 342, 3603, 273, 4633, 4466, 326, 323, 1048, 13164, 275, 12415, 342, 1125, 13707, 12474, 13, 285, 534, 13, 347, 309, 5513, 1996, 13, 8127, 45554, 253, 44730, 4404, 14272, 347, 247, 4092, 45436, 2190, 2448, 17139, 15, 187, 187, 1147, 310, 39189, 281, 2736, 247, 5502, 13, 275, 14272, 434, 5249, 13, 432, 253, 19929, 273, 4633, 25795, 447, 281, 326, 273, 1125, 13707, 26693, 28, 275, 643, 3000, 13, 432, 253, 37551, 19982, 13, 253, 3600, 868, 1452, 13, 285, 253, 581, 14, 41904, 281, 625, 346, 47396, 3, 22555, 16876, 10620, 342, 2471, 13, 2656, 13, 23935, 18631, 13, 285, 253, 1881, 15, 4952, 672, 17816, 253, 10502, 273, 824, 2590, 14, 7317, 42060, 13, 2175, 273, 253, 6423, 434, 789, 5257, 281, 3812, 4116, 281, 253, 1445, 4721, 390, 253, 3569, 285, 8928, 17200, 273, 14272, 434, 20393, 15, 35544, 714, 317, 319, 274, 434, 10199, 281, 795, 45, 14356, 11668, 1876, 27, 380, 43878, 3975, 273, 9002, 90, 14272, 64, 313, 18647, 10, 310, 2028, 5356, 18879, 346, 510, 4165, 784, 10518, 273, 44948, 449, 5769, 35480, 28349, 434, 795, 510, 43667, 273, 9002, 90, 14272, 64, 313, 13549, 10, 285, 6911, 659, 312, 434, 1263, 273, 795, 998, 472, 461, 6700, 2370, 64, 313, 16134, 10, 285, 795, 59, 31625, 64, 313, 16460, 10, 275, 795, 5623, 735, 422, 21231, 16997, 64, 313, 14643, 10, 3324, 281, 1708, 253, 10454, 285, 10527, 10103, 273, 521, 258, 70, 38527, 15, 7993, 500, 15, 27738, 434, 795, 510, 5712, 10475, 386, 15913, 3975, 273, 9002, 90, 14272, 64, 313, 8971, 10, 3537, 13505, 253, 6423, 434, 15573, 24674, 8711, 47159, 273, 10995, 4870, 285, 10397, 670, 521, 1659, 875, 1445, 285, 14608, 15, 4744, 308, 15, 1716, 472, 285, 329, 33453, 500, 15, 8229, 706, 282, 434, 795, 30098, 90, 14272, 285, 27284, 27, 1422, 9601, 2752, 31373, 16275, 1974, 1680, 47693, 19712, 313, 9430, 10, 33826, 253, 22555, 762, 1299, 265, 273, 521, 11321, 13, 7624, 4073, 272, 616, 21518, 1318, 15, 187, 187, 1276, 309, 1060, 3524, 281, 8162, 281, 841, 285, 643, 2175, 273, 9002, 90, 14272, 434, 6590, 310, 253, 5839, 417, 594, 1199, 273, 253, 21518, 16108, 390, 253 ]
York. There'll be a million things to keep you busy. It's gonna be all right," Allen's interviews suggest that, for him, too, sometimes in life self-distraction is the best that can be done. To this extent, all of his films fulfill their motives of distraction, and his indifference to audience/reviewer responses as well as his lack of enthusiasm about many of them are, arguably, products of his movies having already served their primary personal objective for him before they're ever released. Small wonder that Sandy Bates looks so demoralized after the screening of his film at the end of _Stardust Memories_. Allen put a far more positive slant on his filmmaking regimen in his interview with Richard Schickel, likening it to living 10 months of every year of his life in magic. [W]hen you see a magic trick, it's something that defies reality. You know, my way has been movies. I live for a year in the movie. I write the movie. I live with those characters. I cast the movie. I'm on the set. The set is maybe a 1940s nightclub, or maybe it's a contemporary thing, but I live in a fake world for ten months. And by living in that world I'm defying reality in a way – or at least hiding from reality. But that's what it's all about for me . . . To me, that's the impetus for the work (Schickel 2003: 145). At the end of _The Purple Rose of Cairo_ , Cecilia (Farrow) is, notwithstanding her recent personal confrontation with the fraudulence within the movie screen, gradually sucked back into the lushly romantic sham of Fred and Ginger's _Swing Time_ terpsichore magic, her heartbreakingly brightening face evoking the intensity of her deepening delusion. She, too, is "defying reality," but the poignancy of the moment derives from our knowledge that, before long, she will once again have to "choose reality" by leaving the theater and reentering the desolate Depression world lorded over, for her, by her husband, Monk. In one of his more provocative comments to Schickel, Allen asserted that the reason that he had Pearl (Maureen Stapleton) doing magic tricks in _Interiors_ is that, "for me, reliance on magic is the only way out of the mess that we're in. If we don't get a magical solution to it we're not going to get any solution . . ." (Schickel 2003: 136). Pearl _does_ succeed in resuscitating Joey (Mary Beth Hurt) when Eve's daughter fails to rescue her mother from her suicidal drowning, but, more often in Allen's films, the magicians are too conscious of the mechanics of their illusions to save anyone – themselves included. Typical of these self-consciously impotent magicians is _Scoop_ 's Sidney Waterman – Splendini – who, before dying, knows all too well that his "agitating molecules" to make subjects disappear in his dematerializer box is all a scam. When Sondra Pransky (Scarlett Johansson) embraces the box's magical powers because she encounters the spectre of a dead reporter inside, Waterman asks her, What do you think? There's spirits? A world of departed people? . . . Not me. I'm a prestidigitator. I do coin tricks and card tricks . . . This [the mystery Sondra is inspired to begin sleuthing by the reporter] is not for me. I do occasional bar mitzvahs and children's parties. As Patrick Murray and Jeanne A. Schuler demonstrate in "Disappearing Act: The Trick Philosophy of Woody Allen," the tension between the possibility of a "magical solution" and the far greater likelihood that any such solution would only be a trick, an act of prestidigitation, pervades Allen's films. As Allen told Schickel (2003: 78), "my way [of defying reality] has been movies." Sometimes the magic works; sometimes not. When _Manhattan_ opened, Allen, as he told Lax, skipped the premiere: So people think, He doesn't care, or He's too aloof, or He's snooty and arrogant, but, as I said, that's not it. It's more like joylessness. It doesn't thrill me. It just doesn't really mean anything. [ _He smiles_.] Then he added, as if anticipating the film that would turn his career around, "But Paris thrilled me" (Lax 2007: 116). Notes 1 As of January, 2012, the domestic gross of _Midnight in Paris_ was $56.5 million, making it the top grossing independent film of 2011 ( _Daily Variety_ , Jan. 27, 2012). 2 At significant risk of deflating Turan's enthusiasm, it needs to be acknowledged that the _Companion_ essay on Woody Allen and France by Gilles Menegaldo depicts a much more equivocal relationship between Allen and that country – particularly with Jean-Luc Godard – than _Midnight_ so compellingly creates. Works Cited Carroll, Tim (1994) _Woody and His Women_. London: Warner Books. Jones, Kent (2011) " _Midnight in Paris_." Film Comment (May/June). Lax, Eric (2007) _Conversations with Woody Allen: His Films, the Movies, and Moviemaking_. New York: Knopf. McGrath, Douglas (2006) "If you knew Woody like I know Woody." In Robert E. Kapsis and Kathie Coblentz (eds.), _Woody Allen Interviews_. Jackson, MS: University Press of Mississippi. Schickel, Richard (2003) _Woody Allen: A Life in Films_. Chicago: Irving R. Dee. Turan, Kenneth (2011) "Movie review: 'Midnight in Paris.' " _Los Angeles Times_ (May 20), B1. Part I Biography/Autobiography/Auteurism 1 The Stand-up Auteur Cecilia Sayad Woody Allen's films have always addressed particular aspects of American culture – Jewish humor, local identities (Brooklyn, Manhattan, California), politics (his aversion to Republicans), and aesthetic tastes (his love of Hollywood classics, art cinema, jazz). But the director's channeling of cultural identities and debates goes beyond the plots of his films. Allen's public image, a combination of his screen persona and his public discourse, has invariably embodied a tension that was central to the definition of a film culture in the United States: that between "high" and "low" cultural objects – to put it bluntly, between enduring art and disposable entertainment. It is a well-known fact that the French-born idea of the auteur became a valuable tool in the ascription of cultural value to films. The term's designation of stylistic and thematic consistency, as well as of a director's self-expressive needs, counterbalanced the formulaic and ephemeral aspects of industrial objects produced for mass consumption. We are also aware that Allen's recurring themes and stylistic tropes have placed the majority of his works in the realm of auteur cinema, especially after _Annie Hall_ (1977), which marks a transition to more complex narrative structures and profound themes – the film was immediately followed by _Interiors_ (1978), Allen's first incursion into the domain of drama. At the same time, the director's experiences as a gag writer for columnists and television comedians, and as a stand-up comedian both on stage and on TV, charge his auteur identity with elements of popular culture that for long existed in tension with auteur attributes, and which, as I explain later, largely precipitated the skepticism towards Allen as a serious filmmaker among American critics. It is tempting to detect a transition, in Allen's career, from the realm of popular comedies to that of auteur cinema; in other words, from the slapstick, the burlesque, and the one-liner to more "serious" philosophical themes dealing with death, God, adultery, and the self. Even when avoiding the risks of such clear-cut distinctions, studies of the director's work tend to draw attention to the artistry or the political and cultural relevance of Allen's humor. Maurice Yacowar's introduction to _Loser Take All: The Comic Art of Woody Allen_ (1979) is tellingly titled "The Serious Business of Comedy." Sam Girgus's _The Films of Woody Allen_ (1993) and Robert Stam's study of _Stardust Memories_ (1980) and _Zelig_ (1983) in _Subversive Pleasures_ (1989) bring to light the complexity and theoretical dimensions of his oeuvre. Peter J. Bailey's _The Reluctant Film Art of Woody Allen_ (2001) analyzes the director's cinematic dramatization of creative processes and anxiety about his place between art and entertainment. Mark T. Conard and Aeon J. Skoble's _Woody Allen and Philosophy: You Mean My Whole Fallacy Is Wrong?_ (2004) explores the philosophical undertones of his movies, thereby stressing their artistic value. What I here hope to contribute to these and other studies of Woody Allen's films is the investigation not so much of the artistic merits or the
[ 12574, 272, 253, 4676, 457, 2720, 4345, 773, 43665, 9035, 7116, 1425, 187, 187, 7307, 21, 50266, 3404, 49226, 457, 84, 2748, 13, 253, 2219, 497, 33114, 1078, 253, 187, 11807, 1302, 13, 285, 247, 30983, 4854, 369, 2918, 275, 2552, 4050, 15, 2732, 3192, 187, 783, 2647, 762, 15237, 1003, 13, 253, 1302, 6808, 271, 1340, 14624, 49226, 457, 84, 187, 26049, 323, 6619, 432, 3883, 984, 253, 2495, 273, 521, 9712, 432, 187, 37, 18601, 773, 4238, 417, 594, 8905, 281, 15249, 6619, 668, 285, 984, 344, 858, 417, 769, 187, 43274, 314, 275, 8445, 6619, 15, 380, 1302, 671, 1119, 49226, 275, 4284, 273, 187, 26360, 327, 253, 5838, 285, 13, 275, 4163, 4050, 13, 5966, 3883, 275, 40223, 457, 84, 3718, 187, 1542, 253, 5780, 6654, 273, 253, 4503, 1320, 7830, 313, 783, 33134, 1320, 187, 27302, 2747, 10, 285, 7169, 40223, 457, 84, 2748, 323, 16010, 457, 8128, 285, 4815, 773, 284, 253, 187, 22340, 13454, 3128, 762, 253, 1964, 739, 590, 3877, 1425, 187, 187, 7307, 22, 50267, 3463, 4437, 4050, 13, 49226, 574, 4242, 281, 1056, 4314, 10762, 187, 32289, 472, 253, 15842, 2330, 342, 253, 2213, 1435, 13, 4242, 281, 3727, 40223, 187, 4064, 253, 37187, 1255, 13, 285, 5266, 264, 323, 6619, 762, 253, 7671, 187, 16822, 10025, 6307, 15, 40223, 5266, 264, 253, 2021, 1302, 281, 7767, 253, 2426, 273, 187, 783, 35538, 13, 24433, 253, 14286, 273, 247, 1524, 8304, 28845, 281, 187, 16532, 285, 5580, 253, 2213, 1435, 15, 40223, 23347, 617, 2748, 2220, 16852, 187, 1171, 49226, 457, 84, 13165, 1083, 285, 9521, 271, 5722, 273, 16010, 457, 8128, 187, 395, 4815, 10376, 281, 13169, 50240, 47654, 313, 34, 15, 51, 15, 52, 2698, 2593, 2030, 14, 21397, 15, 20, 187, 510, 1302, 7169, 12273, 457, 84, 5266, 285, 11162, 247, 1524, 8304, 187, 681, 2230, 254, 275, 4397, 4072, 13, 533, 858, 417, 1056, 667, 9801, 5722, 15, 187, 17588, 253, 7289, 273, 253, 2213, 1435, 275, 4247, 4059, 13, 253, 4676, 15140, 253, 187, 13550, 597, 812, 417, 5194, 327, 849, 253, 7289, 16947, 313, 783, 29068, 1294, 2638, 84, 10, 187, 12796, 281, 320, 5939, 13, 285, 253, 1302, 6960, 597, 320, 2918, 275, 6262, 736, 187, 33965, 2007, 7367, 15, 187, 187, 7307, 23, 50266, 688, 4162, 4059, 13, 40223, 4724, 247, 3200, 281, 3727, 253, 29068, 1294, 2638, 84, 187, 936, 617, 275, 7898, 13212, 273, 253, 33134, 1320, 24992, 15, 4129, 703, 187, 1844, 7250, 271, 5722, 273, 16010, 457, 8128, 285, 4815, 13, 703, 858, 417, 13199, 667, 187, 187, 20, 50273, 18310, 290, 2144, 2544, 432, 253, 4623, 3522, 13, 359, 26542, 247, 6645, 457, 84, 187, 6259, 2715, 15, 2756, 50254, 50266, 495, 8675, 50254, 39350, 32382, 7716, 362, 15, 329, 1042, 35, 9816, 947, 187, 50254, 50275, 9150, 1297, 273, 253, 2111, 187, 187, 7582, 414, 323, 253, 2748, 15, 49226, 27511, 13, 29208, 253, 29068, 1294, 2638, 84, 187, 12796, 6885, 407, 253, 47933, 25744, 1119, 275, 329, 15, 51, 15, 52, 15, 3015, 5922, 14, 40416, 13, 285, 187, 40893, 264, 253, 2021, 1302, 457, 84, 7571, 281, 4086, 2220, 253, 2748, 275, 1708, 187, 1171, 697, 2720, 3946, 273, 14339, 1501, 14, 27990, 4849, 3374, 281, 253, 5079, 187, 41952, 15, 496, 4223, 4059, 13, 846, 26215, 352, 574, 7571, 10376, 281, 187, 34, 15, 51, 15, 52, 15, 3015, 2030, 14, 28560, 9, 70, 10, 285, 25162, 272, 49226, 323, 12976, 271, 4154, 281, 253, 187, 19657, 552, 13, 253, 1302, 3413, 326, 13, 3738, 352, 858, 417, 15335, 16209, 247, 187, 965, 257, 672, 253, 7659, 658, 369, 6704, 13, 773, 783, 4676, 60, 457, 62, 4345, 964, 964, 964, 275, 253, 35538, 187, 49346, 10437, 684, 271, 23720, 23480, 1425, 380, 1302, 2007, 3413, 271, 187, 2655, 7116, 23480, 1411, 253, 29068, 1294, 2638, 84, 369, 3309, 281, 3657, 26694, 187, 257, 5969, 420, 285, 6960, 597, 320, 557, 67, 43376, 281, 40223, 15, 187, 187, 7307, 24, 50266, 510, 1302, 8523, 13072, 281, 5722, 16010, 457, 8128, 281, 2057, 187, 14824, 15, 40223, 17096, 4724, 247, 3200, 323, 6619, 432, 3883, 10376, 281, 187, 44893, 12180, 7804, 273, 12079, 5405, 18809, 9330, 9, 36, 10, 16425, 253, 2021, 1302, 14416, 187, 249, 14624, 617, 271, 5722, 273, 16010, 457, 8128, 1293, 7296, 253, 4832, 187, 21830, 273, 253, 4676, 347, 2424, 407, 329, 15, 51, 15, 52, 15, 3015, 2030, 14, 21397, 15, 2058, 806, 13, 253, 1302, 187, 3354, 728, 253, 7804, 9330, 9, 36, 10, 3200, 984, 253, 4676, 574, 417, 4724, 9300, 187, 2843, 13592, 953, 273, 4832, 1491, 15, 15797, 39905, 13, 253, 1302, 187, 46779, 253, 1491, 6221, 275, 247, 5080, 4059, 36834, 1429, 187, 13821, 2987, 14934, 13, 7945, 247, 6832, 37808, 275, 6021, 13164, 187, 17352, 253, 4676, 13, 10945, 49226, 457, 84, 4154, 326, 344, 369, 417, 6600, 187, 56, 1074, 369, 8445, 8128, 13, 285, 11941, 40223, 773, 66, 5110, 668, 273, 617, 16010, 457, 8128, 187, 395, 4815, 23122, 275, 26441, 253, 3200, 281, 3727, 253, 29068, 1294, 2638, 84, 15, 187, 41, 316, 4152, 457, 84, 2748, 323, 39905, 369, 5868, 15, 187, 187, 7307, 25, 50266, 41, 316, 4152, 14793, 20652, 15, 844, 452, 7571, 10376, 281, 187, 34, 15, 51, 15, 52, 15, 20485, 1249, 14, 8193, 15, 1797, 9, 34, 2769, 18, 10, 285, 428, 1797, 520, 9, 34, 2769, 18, 582, 313, 19, 481, 535, 50254, 50272, 15724, 28175, 187, 187, 42, 15, 50273, 49864, 37420, 187, 187, 7307, 26, 50266, 8430, 49226, 44184, 253, 8936, 1302, 13, 3839, 13, 187, 10178, 7571, 281, 4901, 7367, 5001, 10473, 273, 253, 35538, 13, 344, 187, 1662, 955, 253, 2021, 1302, 14416, 275, 417, 14339, 436, 2647, 281, 253, 5079, 9025, 187, 1542, 6064, 15, 49226, 369, 49215, 323, 2403, 436, 4154, 2708, 13, 187, 395, 359, 1089, 352, 642, 625, 18511, 327, 4549, 15, 187, 187, 7307, 740, 50267, 34, 1302, 556, 2256, 2647, 7571, 604, 352, 556, 773, 8766, 9911, 390, 187, 585, 15016, 1612, 281, 4089, 285, 3653, 247, 1798, 1511, 273, 1083, 1425, 2418, 187, 87, 15, 5979, 9903, 3377, 13, 26879, 33570, 15, 33000, 13, 32236, 13, 11367, 1638, 313, 7199, 10, 313, 34212, 11035, 481, 496, 13169, 13, 187, 783, 8936, 1302, 310, 247, 773, 8924, 20199, 27998, 2332, 1302, 273, 2087, 7571, 32090, 187, 5443, 362, 15, 46954, 13, 25384, 33570, 15, 15470, 13, 21669, 313, 2946, 15, 8441, 10, 313, 17056, 47246, 7902, 13, 367, 15, 36, 15, 2756, 50254, 245, 50265, 21, 8675, 50254, 39350, 32382, 7716, 362, 15, 329, 1042, 35, 9816, 947, 187, 50254, 50275, 9150, 1297, 273, 253, 2111, 187, 187, 87, 15, 34061, 13, 25921, 33570, 15, 10508, 13, 12197, 313, 12731, 5029, 1284, 4767, 1048, 3622, 407, 776, 24555, 1302, 13, 187, 48392, 783, 8936, 1302, 457, 84, 62, 9712, 715, 22387, 310, 15846, 21833, 285, 323, 187, 585, 1261, 1482, 760, 15, 380, 7571, 273, 253, 1302, 13, 642, 2647, 407, 534, 5963, 187, 262, 310, 25796, 13, 310, 326, 273, 253, 2644, 1302, 13, 285, 417, 273, 581, 5963, 4543, 9025, 187, 9088, 1171, 1425, 29897, 362, 15, 8598, 518, 1342, 13, 7584, 33570, 15, 36153, 13, 36859, 313, 45750, 10, 313, 18799, 5219, 362, 15, 187, 15705, 1528, 2111, 13, 5976, 367, 15, 25888, 13, 43823, 313, 4218, 15, 42549, 5029, 187, 187, 7307, 883, 50267, 510, 2021, 1302, 9025, 273, 253, 8936, 1302, 556, 253, 1072, 187, 34157, 37420, 281, 4089, 8213, 347, 253, 5079, 9025, 273, 253, 8936, 1302, 15, 187, 23135, 13, 359, 1089, 642, 2228, 15, 187, 187, 2267, 15, 50274, 7008, 7116, 418, 1914, 187, 187, 7307, 805, 50266, 41, 316, 4152, 8219, 253, 2021, 1302, 14416, 275, 23254, 271, 187, 2655, 7116, 23480, 275, 3718, 273, 40223, 285, 1411, 253, 29068, 1294, 2638, 84, 15, 12369, 40223, 187, 261, 7429, 281, 271, 23720, 23480, 10262, 247, 6804, 1953, 273, 958, 285, 1569, 15, 187, 5035, 24640, 80, 362, 15, 24640, 80, 13, 19956, 33570, 15, 31339, 13, 41981, 13, 11367, 1903, 313, 2946, 15, 4267, 10, 313, 34212, 11035, 481, 187, 1231, 588, 39954, 253, 1302, 457, 84, 15010, 4342, 5734, 597, 403, 4518, 187, 1000, 531, 528, 390, 36542, 407, 667, 24542, 1941, 15, 4031, 15, 313, 18799, 388, 42111, 4530, 362, 15, 187, 41, 42111, 4530, 13, 25384, 33570, 15, 11130, 13, 11583, 313, 2946, 15, 8878, 5029, 1292, 13, 773, 664, 3812, 776, 1211, 4320, 187, 585, 7797, 432, 253, 5441, 1119, 390, 10466, 407, 253, 2021, 1302, 1425, 4031, 15, 313, 18799, 187, 11773, 47, 13077, 362, 15, 32433, 13077, 13, 24876, 33570, 15, 3349, 13, 1884, 13, 11367, 721, 313, 2946, 15, 6752, 5029, 187, 187, 7307, 1012, 50267, 1145, 23720, 23480, 310, 16595, 66, 62, 987, 13, 48840, 760, 275, 17382, 13, 281, 187, 9802, 247, 4831, 10048, 432, 247, 1798, 3187, 390, 2173, 2867, 13, 187, 14920, 1907, 10023, 273, 253, 3187, 390, 2867, 1425, 5418, 457, 84, 5405, 187, 29872, 313, 740, 394, 1407, 15, 4059, 481, 733, 476, 773, 1257, 3562, 407, 12379, 21356, 275, 1340, 281, 187, 3088, 17382, 762, 253, 19532, 5989, 273, 253, 1083, 285, 3657, 26694, 187, 257, 5969, 420, 1425, 496, 294, 401, 1596, 33739, 13, 31184, 378, 15, 51, 15, 854, 2945, 13, 39739, 313, 38850, 15, 399, 15, 33570, 15, 4695, 10, 187, 9, 34212, 11035, 481, 49226, 1057, 417, 12027, 253, 2021, 1302, 457, 84, 4560, 187, 3529, 253, 4676, 17683, 271, 23720, 23480, 651, 12893, 762, 253, 35538, 15, 21, 187, 42031, 13, 344, 8219, 40223, 310, 417, 7429, 281, 271, 23720, 23480, 984, 703, 858, 187, 1439, 5276, 2710, 3603, 273, 26694, 19133, 15, 187, 187, 7307, 1047, 50269, 2447, 6309, 19133, 310, 11464, 835, 627, 310, 27, 773, 8924, 9, 18, 10, 271, 187, 257, 5969, 420, 13, 313, 19, 10, 271, 48682, 8922, 13, 313, 20, 10, 247, 4602, 875, 253, 187, 257, 5969, 420, 285, 48682, 8922, 13, 313, 21, 10, 253, 5928, 273, 22861, 323, 253, 187, 257, 5969, 420, 285, 48682, 8922, 13, 285, 313, 22, 10, 253, 5928, 273, 247, 16748, 2530, 187, 1615, 1569, 32090, 17868, 13173, 68, 15, 3690, 15, 362, 15, 3774, 3136, 19128, 36322, 13, 418, 15, 45, 15, 36, 904, 20504, 33570, 15, 33198, 13, 33705, 13, 11367, 884, 535, 187, 21, 50272, 8430, 49226, 12148, 40223, 773, 33635, 2400, 326, 642, 187, 11969, 1320, 7830, 369, 22584, 281, 617, 14475, 432, 253, 3700, 273, 253, 187, 5967, 1806, 253, 11821, 273, 253, 1924, 344, 28070, 513, 417, 1329, 521, 16422, 15, 2756, 50254, 245, 50265, 22, 8675, 50255, 39350, 32382, 7716, 362, 15, 329, 1042, 35, 9816, 947, 187, 50254, 50276, 9150, 1297, 273, 253, 2111, 187, 187, 9, 2946, 15, 4050, 10, 313, 17056, 33004, 362, 15, 24367, 348, 3155, 13, 27648, 33570, 15, 28415, 13, 30669, 13, 11367, 3435, 313, 2946, 15, 187, 7330, 5029, 49226, 806, 8219, 40223, 858, 417, 5276, 344, 651, 320, 18839, 407, 187, 4160, 14, 26360, 273, 253, 33134, 1320, 24992, 15, 496, 49226, 457, 84, 1859, 13, 984, 187, 248, 310, 642, 3356, 6883, 11784, 432, 399, 18601, 432, 534, 281, 1056, 10762, 187, 251, 253, 5838, 281, 40223, 13, 344, 310, 3365, 247, 5487, 13, 9696, 44137, 407, 253, 5231, 273, 187, 266, 20804, 2626, 14, 14824, 15, 844, 14936, 15, 49226, 10224, 281, 11435, 326, 344, 187, 12756, 4763, 247, 5649, 273, 2761, 370, 7554, 13, 933, 275, 6735, 6619, 604, 253, 2021, 1302, 187, 16366, 967, 281, 7767, 253, 33134, 1320, 24992, 352, 3786, 5966, 275, 187, 71, 15100, 273, 40223, 15, 5076, 13, 253, 1302, 2168, 10945, 49226, 457, 84, 7125, 187, 8271, 264, 275, 1329, 273, 521, 3200, 281, 873, 9255, 253, 7659, 658, 285, 35538, 326, 344, 187, 14958, 417, 871, 285, 812, 417, 452, 1929, 326, 521, 2954, 342, 399, 18601, 187, 12756, 3517, 990, 594, 347, 281, 8600, 253, 7659, 658, 285, 35538, 9035, 7116, 15, 187, 187, 7307, 1010, 50266, 41, 316, 4152, 671, 8219, 40223, 4242, 281, 773, 2225, 12894, 617, 8540, 668, 187, 9453, 703, 10945, 49226, 457, 84, 3959, 13, 1309, 521, 13165, 10061, 13, 281, 187, 11145, 247, 2120, 533, 13444, 2075, 483, 273, 253, 33134, 1320, 24992, 15, 4952, 187 ]
rendering the parties’ prior agreement “completely inequitable.” ¶4 At Husband’s request, the cases were consolidated before the family court, and a contested hearing was held in May 2012. After taking the matter under advisement, the court issued an order denying Husband’s motion for relief from judgment because the risk of his separation from DVR “was not so remote to justify relief” and because he did not act promptly in seeking relief. The court also found Husband in default of payment on the Note and, in July 2012, entered judgment in Wife’s favor for the remaining balance of the equalization payment (the Equalization Judgment) and granted Wife’s request for attorneys’ fees and costs “as the prevailing party under the promissory note.” ¶5 By October 2012, Husband had failed to make eight payments toward the mortgage associated with the Residence, failed to release Wife from the indebtedness, and petitioned for relief under the Federal Bankruptcy Code. Wife petitioned the family court to enforce the terms of the PSA, requesting the appointment of a real estate commissioner to market and sell the Residence. Wife renewed her request upon dismissal of Husband’s bankruptcy case and requested an award of attorneys’ fees and costs pursuant to Arizona Revised Statutes (A.R.S.) section 25-324.3 The court granted Mother’s petition and appointed a real estate commissioner in September 2013, but did not make any fee award. Following the sale of the Residence in January 2014, the parties advised the court they could not agree on how the sale proceeds (the Sale Proceeds) were to be distributed, and the court ordered they be held in escrow pending further orders. ¶6 In April 2014, Wife filed a motion to release the Sale Proceeds to her in partial satisfaction of the Equalization Judgment. Although she requested an award of attorneys’ fees and costs, she did not specify any 3 Absent material changes from the relevant date, we cite a statute’s current version. 3 CALCAGNO v. AINBINDER Decision of the Court authority for the request. Husband objected, asserting the Sale Proceeds were protected by the homestead exemption found in A.R.S. § 33-1101, and challenged the family court’s jurisdiction to rule upon the request in light of its prior practice of referring post-judgment collection issues to the civil division. In August 2014, after concluding it had jurisdiction pursuant to A.R.S. § 25-318(e) and sanctioning Husband for raising an argument to the contrary, the court determined that, although it did not officially impose a lien when the Decree was signed, “the parties[’] agreement . . . in the PSA clearly anticipates an equitable lien.” The court further determined an equitable lien against the Sale Proceeds was necessary to prevent unjust enrichment and ordered they be disbursed to Wife. ¶7 The court initially declined to award attorneys’ fees to either party. Wife thereafter filed a motion for relief from judgment pursuant to Arizona Rule of Family Law Procedure 85(C) arguing the family court erred in denying her an award of attorneys’ fees without considering the financial resources of the parties as required by A.R.S. § 25-324. At first, the court denied the Rule 85(C) motion because the parties had not filed updated affidavits of financial information. Upon reconsideration, the court considered the information contained in a February 2014 stipulated child support worksheet, concluded a substantial disparity in income existed between the parties, rejected Husband’s argument that he was not aware Wife was seeking fees, and awarded Wife “a portion” of her attorneys’ fees and costs incurred in advancing the motion to release the Sale Proceeds. Husband’s request for reconsideration was denied. ¶8 Husband timely appealed. We have jurisdiction pursuant to A.R.S. §§ 12-120.21(A)(1) and -2101(A)(1), (2). DISCUSSION I. Jurisdiction ¶9 Although Husband concedes the superior court, generally, had jurisdiction to enter orders regarding enforcement of the PSA, he argues the family court erred in not referring this matter to the civil division for resolution. Husband was sanctioned for making this argument below, and we find it no more compelling on appeal. ¶10 A court has subject matter jurisdiction if it has “statutory or constitutional power to hear and determine a particular type of case.” State v. Maldonado, 223 Ariz. 309, 311, ¶ 14 (2010) (citations omitted). In Arizona, the superior court is a “‘single unified trial court of general jurisdiction.’” State v. Marks, 186 Ariz. 139, 142 (App. 1996) (quoting Marvin Johnson, P.C. 4 CALCAGNO v. AINBINDER Decision of the Court v. Myers, 184 Ariz. 98, 102 (1995)). As stated long ago by our supreme court, “[the superior court’s] separation into divisions is purely imaginary and for convenience only. The jurisdiction of the court, no matter by which judge it is exercised, is that of the whole court, and not of one judge nor division thereof.” Peterson v. Speakman, 49 Ariz. 342, 348 (1937) (citing White v. Superior Court, 42 P. 480, 482 (Cal. 1895)). ¶11 The family court division of the superior court has the same jurisdiction to hear matters as the civil division of the superior court. Accordingly, we find no error. II. Equitable Lien ¶12 Husband argues the family court erred in imposing an equitable lien in favor of Wife and against the Sale Proceeds. Whether Wife is entitled to an equitable lien presents a mixed question of fact and law. See Valento v. Valento, 225 Ariz. 477, 481, ¶ 11 (App. 2010) (citations omitted). We will uphold the court’s factual findings unless they are clearly erroneous or unsupported by any credible evidence. Id. (citing Hrudka v. Hrudka, 186 Ariz. 84, 91 (App. 1995)). But, “we draw our own legal conclusions from the facts found or implied by the family court.” Id. (citing McNutt v. McNutt, 203 Ariz. 28, 30, ¶ 6 (App. 2002)). ¶13 An equitable lien is “[a] right, enforceable only in equity, to have a demand satisfied from a particular fund or specific property, without having possession of the fund or property.” Black’s Law Dictionary (10th ed. 2014). It can “be created by judicial decree in order to do equity under the peculiar circumstances of the case and prevent unjust enrichment.” In re Farnsworth, 384 B.R. 842, 850 (Bankr. D. Ariz. 2008) (citations omitted). Husband does not dispute the family court’s finding that the parties anticipated an equitable lien would arise under the PSA.4 Rather, he argues Wife is not entitled to an equitable lien because she did not prove various elements of unjust enrichment. ¶14 Unjust enrichment is proven where there is: “‘(1) an enrichment, (2) an impoverishment, (3) a connection between the enrichment and impoverishment, (4) the absence of justification for the enrichment and impoverishment, and (5) the absence of a remedy provided by law.’” Wang Elec. Inc. v. Smoke Tree Resort, L.L.C., 230 Ariz. 314, 318, ¶ 10 4 Although Husband contends Wife “acknowledged that no equalization payment was owed to her arising from the transfer of the house,” the portions of the record he cites do not support his contention. 5 CALCAGNO v. AINBINDER Decision of the Court (App. 2012) (quoting Freeman v. Sorchych, 226 Ariz. 242, 251, ¶ 27 (App. 2011)). Husband first argues Wife did not prove he would be enriched by non-payment of the Equalization Judgment. In Husband’s view, because he is no longer receiving revenue from DVR from which to make payments on the Note to Wife, he is simply a victim, equally harmed by the actions of an unrelated third-party. We disagree. Husband fails to appreciate that he would receive a benefit of almost $300,000 in debt relief if the family court declined to enforce the Equalization Judgment it previously entered in favor of Wife. Moreover, the court already rejected Husband’s arguments asserted in support of his motion to set aside the Decree and PSA that he did not know and could not have known that his relationship with DVR would soon end so as to render the Decree and PSA inequitable. ¶15 Husband also argues Wife failed to “mitigate her damages” when she rejected Husband’s offer, during his bankruptcy proceedings, to make a full but delayed payout of the Equalization Judgment. Even
[ 368, 476, 1385, 327, 479, 449, 346, 1394, 871, 752, 15368, 13245, 84, 2255, 865, 346, 1147, 434, 247, 29103, 3045, 1476, 346, 21856, 865, 346, 25714, 285, 36418, 581, 1476, 346, 35975, 1476, 346, 4013, 13, 309, 1053, 626, 1158, 352, 1833, 789, 323, 617, 449, 346, 1394, 17341, 3150, 865, 346, 4013, 13, 2305, 15, 611, 8575, 1476, 346, 1276, 253, 7085, 403, 368, 2509, 865, 346, 14866, 611, 2894, 1476, 346, 1552, 310, 247, 2714, 3045, 323, 368, 1476, 346, 1147, 434, 1512, 3511, 449, 346, 26042, 7203, 449, 346, 12764, 449, 346, 58, 3508, 14, 1240, 449, 346, 8061, 449, 346, 40, 263, 6077, 1476, 346, 29279, 4481, 1476, 346, 1147, 434, 714, 3508, 14, 1240, 434, 3, 346, 17613, 4461, 3, 346, 9281, 13, 1339, 479, 1379, 247, 7512, 273, 4266, 1476, 346, 36, 1137, 581, 449, 346, 42, 1353, 38467, 1476, 346, 1276, 943, 309, 513, 865, 346, 1276, 1270, 40599, 1824, 1476, 346, 8262, 13, 752, 403, 368, 2509, 865, 346, 2305, 15, 611, 8575, 3255, 346, 10205, 310, 1663, 1175, 449, 346, 2594, 368, 1476, 346, 6049, 1053, 626, 368, 1611, 436, 865, 346, 11592, 14, 30209, 4525, 13, 6313, 285, 3626, 1476, 346, 1328, 816, 858, 352, 1476, 346, 18793, 449, 346, 41932, 865, 346, 733, 434, 512, 987, 865, 346, 19619, 13, 8261, 449, 346, 26042, 12296, 13, 4354, 38109, 449, 346, 10205, 12296, 865, 346, 11739, 449, 346, 7745, 1476, 346, 3726, 4934, 436, 37619, 1974, 281, 3746, 865, 346, 1737, 253, 1476, 346, 6272, 368, 13594, 14, 601, 80, 865, 346, 10154, 13, 13594, 14, 601, 80, 449, 346, 1422, 16060, 479, 1476, 346, 1276, 434, 594, 11755, 865, 346, 1276, 865, 346, 33564, 13, 4166, 6848, 1476, 346, 14866, 611, 2894, 3255, 346, 42, 1849, 644, 3255, 346, 13060, 272, 368, 323, 247, 1048, 673, 449, 346, 2598, 13, 309, 971, 281, 871, 752, 368, 1158, 670, 479, 449, 346, 42, 1849, 1620, 1869, 670, 368, 449, 346, 35313, 449, 346, 42, 923, 449, 346, 5767, 611, 2894, 865, 346, 1737, 865, 346, 5872, 849, 670, 5068, 281, 1158, 670, 479, 865, 346, 1898, 604, 368, 8028, 281, 436, 13, 368, 1833, 1158, 670, 352, 449, 346, 1552, 4857, 8599, 352, 512, 449, 346, 1466, 479, 1239, 436, 449, 346, 1552, 310, 752, 309, 1928, 323, 368, 449, 346, 2347, 1048, 309, 1849, 16632, 436, 2774, 281, 1705, 3255, 346, 3378, 253, 5389, 6150, 285, 1051, 368, 285, 479, 3255, 346, 4125, 309, 588, 873, 247, 9735, 273, 1220, 3396, 247, 9599, 327, 253, 6150, 285, 3255, 346, 8262, 13, 403, 368, 512, 987, 865, 346, 12864, 352, 3477, 285, 3297, 11874, 449, 346, 36556, 598, 1476, 346, 17222, 281, 20648, 262, 352, 1476, 346, 1394, 476, 626, 865, 346, 9807, 634, 6208, 449, 346, 9807, 634, 6208, 1476, 346, 2598, 13, 752, 513, 368, 1158, 273, 479, 865, 346, 3166, 309, 1007, 4030, 865, 346, 11739, 449, 346, 9375, 449, 346, 1621, 17052, 449, 346, 309, 1353, 824, 247, 27964, 449, 346, 1422, 871, 326, 865, 346, 2214, 368, 13, 309, 812, 320, 1039, 7197, 685, 247, 27964, 449, 346, 4013, 13, 368, 1849, 8228, 598, 1476, 346, 11778, 309, 865, 346, 3262, 405, 752, 865, 346, 1737, 865, 346, 1394, 1007, 594, 4484, 672, 368, 1053, 626, 3984, 449, 346, 4013, 13, 1663, 865, 346, 10292, 14, 75, 3288, 13, 476, 309, 1051, 452, 326, 6773, 865, 346, 5498, 626, 1918, 479, 667, 45785, 449, 346, 8262, 449, 346, 4943, 449, 346, 1394, 17341, 4459, 352, 512, 2112, 865, 346, 1552, 865, 346, 1147, 434, 417, 327, 634, 3239, 449, 346, 19735, 352, 281, 479, 449, 346, 5498, 626, 1014, 1158, 273, 1907, 390, 970, 352, 449, 346, 42, 3078, 281, 4710, 352, 1977, 13, 8791, 449, 346, 1147, 434, 417, 7477, 449, 346, 3152, 583, 310, 352, 840, 865, 346, 380, 9065, 32199, 434, 449, 346, 733, 434, 13298, 840, 1476, 346, 2302, 13, 352, 434, 417, 7477, 13, 309, 1912, 626, 2028, 840, 449, 346, 5037, 626, 320, 256, 26584, 449, 346, 309, 1053, 626, 751, 281, 2312, 449, 346, 18, 13, 374, 13, 1333, 352, 1476, 346, 9281, 13, 309, 1833, 2028, 368, 449, 346, 947, 3, 346, 58, 6364, 3622, 13, 619, 1682, 3331, 369, 4824, 281, 253, 7220, 449, 346, 1328, 1871, 644, 9958, 347, 247, 562, 4008, 3255, 346, 1989, 309, 1904, 626, 871, 326, 449, 346, 1328, 3597, 281, 5159, 2994, 449, 346, 510, 48233, 37274, 779, 1046, 2014, 1388, 3255, 346, 3378, 326, 40588, 449, 346, 4013, 13, 309, 923, 449, 346, 2598, 309, 574, 352, 562, 342, 253, 48233, 449, 346, 1328, 369, 824, 247, 17877, 17830, 13, 533, 352, 1904, 626, 15872, 257, 479, 449, 346, 42, 7808, 7428, 281, 253, 48233, 285, 512, 253, 660, 3561, 3544, 449, 346, 43, 4037, 40, 13594, 14, 601, 80, 1476, 346, 44079, 779, 1476, 346, 1147, 369, 247, 9106, 16593, 3761, 13, 281, 3135, 342, 449, 346, 42, 369, 3815, 285, 597, 497, 1884, 289, 22201, 342, 8914, 449, 346, 1989, 309, 13964, 731, 432, 512, 10746, 449, 346, 4041, 407, 581, 13, 597, 6497, 1066, 13, 1146, 46616, 449, 346, 2214, 479, 13, 352, 369, 751, 247, 38769, 449, 346, 5872, 253, 1943, 5654, 2335, 562, 247, 40588, 449, 346, 5498, 626, 7664, 16352, 346, 262, 1904, 626, 30272, 479, 387, 512, 449, 346, 24397, 323, 247, 4619, 2774, 281, 1379, 779, 562, 3255, 346, 42, 39214, 779, 327, 253, 22239, 449, 346, 1328, 3034, 11046, 884, 17249, 285, 13222, 247, 29861, 449, 346, 1328, 285, 521, 1821, 497, 512, 2668, 281, 253, 7220, 13, 352, 369, 619, 2165, 1476, 346, 2598, 849, 1142, 497, 4824, 281, 253, 7220, 865, 346, 4683, 2282, 13, 512, 1884, 273, 731, 449, 346, 1876, 273, 731, 865, 346, 1394, 1472, 17053, 865, 346, 1394, 1053, 626, 2868, 479, 865, 346, 8262, 13, 309, 2868, 368, 449, 346, 1898, 634, 3331, 865, 346, 1328, 37797, 14092, 281, 6976, 449, 346, 1328, 3589, 626, 271, 562, 4008, 846, 512, 449, 346, 1394, 497, 342, 779, 13, 987, 865, 346, 10292, 14, 75, 3288, 1051, 368, 1472, 594, 1051, 3965, 449, 346, 1394, 1904, 626, 871, 326, 672, 368, 2183, 479, 368, 1928, 323, 479, 865, 346, 42, 1599, 1051, 368, 1007, 638, 1440, 1321, 3063, 449, 346, 1394, 1849, 1694, 1175, 9075, 275, 6838, 449, 346, 42, 871, 309, 1353, 247, 3965, 3226, 449, 346, 1898, 452, 436, 342, 368, 512, 253, 673, 16352, 346, 37341, 352, 434, 479, 449, 346, 11668, 436, 1476, 346, 1422, 969, 865, 346, 21305, 627, 449, 346, 1621, 1476, 346, 309, 1833, 755, 368, 840, 368, 1833, 14938, 352, 449, 346, 330, 1506, 479, 1476, 346, 998, 25776, 8800, 865, 346, 42, 1833, 1918, 352, 281, 714, 3508, 14, 1240, 449, 346, 6300, 751, 436, 1476, 346, 10292, 14, 75, 3288, 13, 6604, 441, 285, 11012, 751, 436, 1476, 346, 8262, 13, 38973, 14, 1200, 1479, 13, 1339, 434, 11012, 285, 452, 794, 449, 346, 42, 2389, 368, 13, 2305, 15, 611, 8575, 449, 346, 1147, 434, 2218, 1476, 346, 4967, 865, 346, 7161, 858, 368, 755, 326, 865, 346, 49682, 1669, 352, 323, 479, 347, 247, 9140, 449, 346, 733, 434, 13298, 865, 346, 12864, 352, 896, 449, 346, 1621, 13, 309, 1912, 626, 449, 346, 309, 878, 281, 1642, 368, 449, 346, 1737, 865, 346, 1276, 858, 368, 513, 342, 253, 8800, 865, 346, 3039, 309, 23686, 598, 275, 253, 4131, 13, 352, 369, 816, 4783, 449, 346, 15953, 3255, 346, 1394, 11213, 272, 1475, 342, 479, 865, 346, 1466, 479, 5513, 281, 368, 3255, 346, 1276, 403, 597, 2509, 865, 346, 15953, 449, 346, 1394, 1472, 247, 27964, 1476, 346, 10292, 14, 75, 3288, 13, 309, 1849, 2218, 436, 1476, 346, 7710, 15, 611, 8575, 588, 1379, 436, 347, 247, 10669, 273, 619, 2389, 449, 346, 7745, 387, 436, 1476, 346, 1276, 13, 2139, 13, 3689, 14, 75, 3288, 865, 346, 10292, 14, 75, 3288, 1476, 346, 15953, 13, 533, 3255, 346, 5804, 309, 1379, 326, 896, 865, 346, 1276, 434, 436, 39866, 689, 247, 15229, 8800, 865, 346, 4943, 13, 309, 1053, 626, 1918, 247, 7435, 449, 346, 20083, 634, 6208, 449, 346, 34437, 14, 601, 80, 13, 971, 281, 1132, 247, 18011, 2165, 865, 346, 1422, 1904, 626, 923, 3689, 14, 75, 3288, 865, 346, 1621, 3255, 346, 49724, 253, 3226, 285, 1132, 253, 2165, 449, 346, 34437, 14, 601, 80, 1476, 346, 43, 1947, 14, 1200, 1479, 13, 858, 368, 923, 3689, 14, 75, 3288, 865, 346, 42, 1904, 626, 923, 617, 449, 346, 1276, 4592, 865, 346, 1621, 13, 1620, 2564, 449, 346, 13594, 14, 601, 80, 1476, 346, 1737, 865, 346, 21050, 449, 346, 2512, 4566, 13594, 14, 601, 80, 1476, 346, 1281, 434, 2312, 670, 352, 1996, 449, 346, 1292, 3255, 346, 3633, 436, 35352, 449, 346, 1147, 434, 13594, 14, 601, 80, 1476, 346, 34437, 14, 601, 80, 1476, 346, 41, 7603, 626, 368, 1119, 617, 865, 346, 510, 1685, 310, 6108, 3517, 13, 285, 359, 1849, 2326, 2717, 273, 617, 1476, 346, 1898, 253, 23331, 310, 2403, 7596, 449, 346, 42, 1599, 3255, 346, 13086, 253, 4438, 281, 49425, 13, 309, 2183, 368, 1476, 346, 1147, 434, 1925, 686, 78, 1137, 1162, 3008, 5464, 8, 368, 871, 326, 865, 346, 4013, 13, 352, 434, 13594, 14, 601, 80, 434, 865, 346, 42, 1353, 5211, 352, 2987, 15229, 1175, 1476, 346, 43, 4037, 40, 13594, 14, 601, 80, 3, 346, 34437, 14, 601, 80, 13, 309, 1353, 7016, 449, 346, 42, 3534, 634, 1180, 281, 779, 449, 346, 42, 1353, 1663, 7016, 449, 346, 8262, 13, 368, 751, 352, 865, 346, 19815, 634, 718, 13, 390, 634, 29517, 588, 320, 35956, 1070, 449, 346, 5498, 626, 1379, 352, 3430, 13, 326, 562, 4008, 310, 417, 619, 29517, 449, 346, 1276, 247, 40655, 281, 320, 8471, 824, 247, 2298, 251, 449, 346, 1276, 253, 7435, 1476, 346, 1231, 574, 281, 789, 327, 436, 2298, 251, 594, 1892, 281, 755, 634, 1180, 449, 346, 42, 6566, 368, 767, 497, 29517, 14, 27094, 6421, 449, 346, 1466, 479, 1056, 436, 2590, 449, 346, 42, 369, 5322, 281, 779, 13, 347, 253, 277, 45566, 369, 594, 28714, 449, 346, 42, 1620, 2879, 779, 281, 619, 29517, 1618, 13, 7435, 1476, 346, 1328, 434, 824, 247, 4107, 22560, 21413, 48222, 1476, 346, 12864, 779, 13, 323, 1959, 449, 346, 1276, 247, 48222, 13, 281, 1333, 344, 434, 619, 3331, 1476, 346, 45, 14356, 285, 19749, 1420, 13, 368, 767, 403, 1160, 323, 1016, 643, 449, 346, 1276, 865, 346, 309, 17500, 564, 449, 346, 18793, 13, 500, 4037, 40, 13594, 14, 601, 80, 1476, 346, 30138, 273, 247, 23331, 1476, 346, 1231, 878, 1089, 38973, 14, 1200, 1479, 806, 449, 346, 42, 1557, 670, 779, 449, 346, 1394, 43325, 417, 281, 13, 281, 5321, 779, 840, 865, 346, 1466, 434, 10957, 715, 767, 1476, 346, 309, 923, 13, 513, 368, 3491, 865, 346, 4683, 2282, 449, 346, 1147, 434, 13594, 14, 601, 80, 13, 987, 865, 346, 1394, 871, 752, 359, 878, 865, 346, 40722, 272, 285, 4680, 449, 346, 2042, 359, 513, 436, 13, 2305, 15, 611, 8575, 588, 320, 19271, 449, 346, 25954, 359, 755, 327, 253, 1685, 285, 564, 1728, 3255, 346, 5872, 368, 476, 7664, 390, 259, 3288, 390, 5913, 449, 346, 42, 1053, 626, 971, 281, 11034, 2305, 15, 611, 8575, 247, 2372, 449, 346, 7845, 1053, 626, 513, 436, 1476, 346, 1276, 247, 9980, 273, 7516, 13, 625, 35352, 310, 327, 253, 1039, 449, 346, 1466, 434, 24284, 13, 253, 1685, 285, 253, 2644, 966, 310, 6179, 323, 441, 449, 346, 8262, 13, 15229, 1175, 281, 923, 368, 449, 346, 1276, 865, 346, 35, 2682, 13, 368, 1694, 281, 1675, 479, 1476, 346, 4013, 13, 28546, 13, 28546, 3255, 346, 34437, 14, 601, 80, 1476, 346, 42, 452, 281, 15856, 10470, 449, 346, 42, 476, 626, 1408, 667, 625, 449, 346, 34437, 14, 601, 80, 1476, 346, 4967, 253, 7085, 1053, 626, 597, 3662, 253, 4481, 865, 346, 26859, 74, 1476, 346, 12092, 13, 368, 767, 755, 1060, 13, 3809, 1476, 346, 7161, 403, 368, 1024, 865, 346, 6300, 564, 281, 253, 6146, 13, 432, 253, 1127, 835, 359, 8085, 449, 346, 2302 ]
you can count on me." "You know what spellbinds women?" "It's a shocking performance!" " Performance?" " Cool and formidable one!" "Performance!" "Oh, I don't think it'll work for her." "You wanna die?" "Oh, Mr. KOH!" "What the hell are you doing?" "Miss KIM!" "This is a special performance for you!" "It's too hot." "Water spring." "Hi." "Yoon-ah." "Thanks." "Gorilla!" "Mobile phone!" "It's Yoon-ah's" "Restroom" "Okay, let me take a photo of myself!" "Cute one." "I'm doomed!" "What should I do?" "What great tasting water!" "Hey, what are you doing?" " Mr. KOH..." " Water is really good." " See you!" " Why don't you try this?" "Non-polluted, pure and natural!" "He just did it!" " Hey." " Uh?" " It's all right?" " Okay, okay." "Water ink, easily removable." " Water ink?" " Yeah." "Look!" "They kept this delicacy to themselves?" " What the!" " Are you Han-soo?" " Right, Han-soo." " You scared me!" "What's so funny?" "What?" "Damn, oil paint!" "Miss KIM..." "I've been..." "watching you for a long time." "So, I want to know what you think about me." "I've never thought about you." "Ever." "I see." " Miss KIM?" " What?" "Then how about beginning to think about me?" "And if you listen to this, you'll think about it." "This letter tells it all." "Let me read this." "This is what I feel for you." "How long I've wished this moment to come..." "With the beautiful sea and... you and me..." "Now I will set a boat of solitude afloat on the sea and..." "Hey, are you all right?" "Take it easy and stay calm." "Throw up!" "Try to vomit it!" "You can't?" "Open your mouth." "Open your mouth!" "So, what do you think of me?" " Do I look fine?" " Yeah." " Thanks." " No sweat." " I'm such a jerk." " You know that?" "For you, I could be way worse than a jerk." "Oh, you've grown up!" "Have I?" " Guess what?" " What?" "You look so cool when you don't speak." "Oh, really?" "Min-joo, can I... have that fish?" "Don't give me any rubbish." "Hey." "Here." "You wanna carry it all along?" "This?" "It's not on your page." "Give it to me." "Don't even think of having or using it." "I wanted to throw it away, anyway." "It's not mine." "Whose is it then?" " The worst bastard's." " It's yours then!" "No, it's not mine, I won't tell then." " Don't be sullen." " I don't like to talk." "1, 2, say it!" "Okay, I'll tell you." "ER" "Years ago, my best friend was carried to the ER." "He'd been suffering as a outcast..." "But I didn't know that." "He tried to kill himself." "The bully tortured him every single day..." "With that cutter." "Oh, I see." "So I had it out with the bully." "He was such a cruel killer, but it didn't frighten me." "I slowly walked to the bully and all the scumbags." "JUNG Han-soo!" "Kill him!" "It was a totally unfair match, to begin with." "I was alone and they were 30 thugs with weapons." "But I attacked them from all directions." "One by one, they fell down, being silenced." "For me, it was like a picnic." "Then the big gun took out a cutter." "Don't worry;" "it didn't scare me at all." "Looking for a critical moment to take him out..." "I punched him on the chin." "He tumbled 10 meters and threw a towel." "He and his men were all taken to the ER, it was my game!" "So how many were carried to the ER?" " Of course, all 30 of them." " All of them?" "You're laughing?" "You don't believe me?" "Hey, I believe you." "And your friend?" "He emigrated to Australia." "He wasn't an outcast after all." "You were with him, right?" "Min-joo... you're so... pretty." "You didn't know that when you told me you feel for me?" "I mean... you look prettier today." "You've got good taste in girls." "I know I'm a pretty girl." "And have this with you all the time;" "thinking it's me." " Take this!" " You again?" " Stop there." " No!" " I'll get you then you'll regret it." " Catch me!" "Stuffed bear?" "I'll give it to Yoon-ah." "Just like this!" "Min-joo, join us and dance like this!" "Hey, Jung-shik, let's dance and have fun." "I love you, Mr. KOH." "It's done!" "Why?" "Where did you get that?" "Somebody left it for me as a gift." " It's yours?" "Take it back." " No, I won't." " I need to ask you." " What?" "What did you do with the bear?" "When I woke up in the morning, it was just gone." "Sorry..." "You fooling around with me?" "Let me explain to you..." "What are they doing?" "Sorry." "You're a jerk!" "Min-joo, I've done this!" "Mr. KOH will take this as a token of my love." "Look at this!" "What, why, Min-joo?" "Min-joo!" "Sorry, but..." "Can I take that back?" "What's this fuss over a damn bear?" "Here, I don't give a fuck." "Watch your mouth." "Han-soo, want to play a coin game?" " You didn't see Min-joo?" " No..." "Forget the girl and play the game." "Han-soo!" "Jung-shik, did you see Min-joo?" "I didn't see her." "What happened?" " No, never mind." " Han-soo!" " What?" " Wait." "There goes Han-soo!" " Let's talk about it later." " But..." "Get this bait." "It's Han-soo!" "Han-soo!" "Haven't you found her?" "The bus is leaving soon, and we've seen nothing of her!" "And the bitch is making trouble." "I mean..." "Change the mode to mute, I told you!" "It's called 'mute etiquette' you know that?" "Oh, it's Han-soo's?" "I'm happy it works damn good!" "JUNG Han-soo" "Han-soo, I'm sorry." "I gave your number to him." "I'm really sorry." "Hey, you like it?" "Move your ass, or your buddy will be crippled." "Don't take it wrong, that outcast is not my buddy." "What a disgrace to befriend such a moron." "What the fuck!" "We had to work on this moron so hard to get your number." "I believed you two were buddy-buddy." "Let me make this clear." "I was nice to him, as the dumbo was so miserable." "I never added him to my buddy list, fuck!" "He's such a freaky dumb loser!" "Take him, for free." "What a loser, to say he's my friend!" "Loser and lunatic, you two are made for each other." "What?" " I gotta go." " Hey, JUNG Han-soo!" "Son of a bitch!" "We need find Jung-shik first." "I care about him." "You pretended not to, to save him then?" "Let's divide into two!" " I see, do you copy?" " Of course." "It's Han-soo, right?" "You know what we need?" "Reasoning and thinking." "If we do this, Mr. KOH will be disappointed." "Anyway we get on the bus and go home..." "Then you can worry or woo or whatever." "I don't want to disappoint Mr. KOH a bit." "Please don't do this!" "What a stroke of luck, more bait is on the way." "Let's hurry, the bus and the whole class is waiting for us." "Hey, damn good to see you." "What?" "Bitch, you got to respect me!" "Oh, 911, 911..." "Han-soo!" "I have to quit smoking." "I can't run any more." "Han-soo!" "Why the hell don't they answer the phone?" "Taxi!" "Hello, you two get here, fast!" "Where are you now?" "Just go to the north, from the point where we split." "No
[ 17051, 187, 49, 982, 2130, 2220, 2748, 13, 6701, 2, 187, 6300, 2819, 323, 10363, 20, 3958, 1663, 13, 5046, 7167, 1410, 285, 20807, 347, 973, 15, 14140, 3441, 2819, 323, 20593, 5104, 323, 3714, 20, 15, 187, 187, 45306, 34, 1458, 13, 20593, 5104, 13, 28258, 273, 353, 636, 263, 313, 3299, 21, 10, 187, 187, 30456, 17861, 13, 10351, 36, 610, 577, 13, 6131, 13, 309, 5476, 32, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 2504, 5365, 187, 187, 9917, 2819, 323, 399, 78, 36, 27, 3366, 249, 1483, 17897, 187, 187, 46, 5629, 611, 435, 18603, 37521, 44714, 187, 187, 977, 10850, 68, 4338, 2165, 44714, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 1449, 5365, 187, 187, 3220, 3491, 273, 18603, 37521, 9377, 13, 594, 309, 8686, 247, 747, 3491, 285, 1024, 452, 271, 4465, 1083, 15, 40046, 1097, 253, 1083, 285, 11595, 342, 26862, 8916, 37034, 15, 36040, 309, 1353, 11947, 323, 878, 281, 452, 512, 253, 3236, 5017, 1512, 15, 309, 452, 690, 13155, 3958, 326, 878, 2219, 534, 2486, 27, 187, 46, 5629, 4146, 25037, 187, 46, 5629, 7021, 577, 187, 46, 5629, 7021, 608, 187, 49, 536, 15125, 2065, 37554, 360, 187, 49, 536, 15125, 1594, 37, 187, 6872, 403, 752, 309, 971, 13, 533, 604, 368, 452, 247, 1027, 1083, 281, 5454, 309, 1537, 513, 352, 604, 697, 1175, 15, 187, 8398, 1422, 15, 187, 187, 1934, 27, 29368, 2127, 1380, 187, 187, 1279, 2165, 15, 313, 57, 3364, 4041, 10, 187, 187, 1099, 2398, 13, 4104, 387, 17272, 27, 2405, 5365, 187, 187, 11778, 271, 30732, 5865, 2127, 323, 11940, 29368, 15, 1281, 479, 871, 604, 368, 403, 2819, 281, 22101, 11646, 390, 2712, 187, 187, 40995, 32782, 755, 747, 1340, 313, 29079, 8744, 1934, 2806, 7908, 313, 3211, 10, 187, 187, 57, 18, 6131, 337, 807, 5328, 1198, 1097, 390, 443, 893, 362, 390, 1682, 3959, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 1047, 5365, 187, 187, 36744, 1390, 730, 14505, 13, 495, 5942, 3958, 13, 285, 26252, 2596, 3958, 313, 57, 3364, 16951, 2769, 3299, 20, 2769, 20, 5942, 2769, 57, 3364, 2596, 10, 187, 187, 42, 452, 247, 32322, 295, 20, 1397, 30291, 5485, 533, 309, 3732, 3601, 4017, 641, 4745, 13, 285, 253, 480, 3682, 3248, 3499, 74, 4017, 641, 15, 309, 858, 2299, 3700, 253, 278, 73, 21, 2165, 562, 273, 253, 985, 15, 733, 1057, 1705, 342, 3236, 18420, 5043, 253, 3601, 4017, 641, 285, 253, 3499, 74, 1083, 47398, 15, 187, 42, 717, 2819, 323, 6131, 327, 495, 1397, 3958, 13, 259, 2886, 1484, 3958, 13, 285, 717, 74, 487, 375, 9, 1439, 2119, 604, 309, 476, 1618, 436, 1060, 481, 187, 187, 9034, 5154, 11362, 496, 34961, 13, 20593, 5104, 13, 26291, 84, 187, 187, 24234, 3501, 577, 13, 14169, 17861, 15, 313, 3724, 21, 3958, 403, 2919, 1959, 15, 187, 187, 1099, 2398, 13, 4104, 387, 884, 27, 883, 5208, 187, 187, 3220, 3958, 403, 512, 3520, 10125, 533, 309, 1353, 4030, 342, 2970, 5865, 4394, 15, 187, 187, 21381, 4825, 12404, 27, 20352, 2114, 272, 187, 187, 41390, 31910, 1299, 285, 253, 13063, 4011, 41091, 187, 187, 1099, 2398, 13, 4104, 387, 18188, 27, 1099, 5208, 187, 187, 30519, 1705, 342, 1083, 15, 11239, 368, 2, 187, 187, 47, 5472, 7284, 27264, 3052, 74, 41968, 187, 187, 31216, 41196, 1608, 23073, 13, 30680, 21570, 13, 5046, 643, 7520, 3052, 74, 41968, 187, 187, 1099, 2398, 13, 4104, 387, 17796, 27, 1449, 5208, 187, 187, 6300, 281, 19148, 13, 309, 760, 971, 581, 3052, 74, 41968, 275, 1091, 15, 6935, 1405, 871, 2, 187, 187, 8693, 273, 8802, 6235, 284, 3606, 313, 3299, 21, 10, 187, 187, 8997, 398, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 3156, 5208, 187, 187, 18, 1770, 26252, 14309, 2127, 187, 187, 8944, 1225, 29906, 495, 5942, 9585, 26862, 2127, 187, 187, 1099, 2398, 13, 4104, 387, 16261, 27, 3156, 5208, 187, 187, 42, 2168, 452, 253, 41884, 530, 2715, 9856, 594, 309, 878, 253, 495, 5942, 581, 275, 1340, 281, 755, 353, 999, 9389, 15, 187, 187, 688, 3817, 41354, 637, 717, 74, 41968, 187, 187, 2727, 398, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 2417, 5208, 187, 187, 688, 253, 2791, 323, 1846, 717, 74, 487, 375, 390, 3958, 323, 2712, 10890, 313, 18, 16, 19, 16, 20, 16, 21, 16, 362, 5741, 582, 26862, 305, 67, 16, 66, 495, 16, 1397, 13, 285, 259, 2886, 16, 88, 2886, 1484, 15, 5531, 309, 671, 1211, 247, 16951, 187, 187, 12558, 30662, 495, 1720, 6653, 273, 25293, 84, 313, 3299, 21, 10, 50067, 353, 2648, 313, 57, 3364, 2596, 10, 187, 187, 40, 7656, 608, 313, 3299, 21, 10, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 3439, 5208, 187, 187, 510, 39898, 16631, 18605, 337, 285, 374, 187, 187, 2906, 785, 495, 187, 187, 1099, 2398, 13, 4104, 387, 14805, 27, 2941, 5208, 187, 187, 42, 651, 2389, 281, 5454, 380, 39898, 16631, 18605, 337, 285, 374, 313, 28489, 1014, 39898, 16631, 9166, 2908, 10, 323, 549, 785, 495, 15, 1281, 479, 871, 604, 368, 403, 6110, 13, 309, 588, 1908, 643, 6131, 347, 973, 15, 187, 187, 12764, 6068, 13, 309, 452, 644, 5877, 4830, 436, 2181, 1580, 8027, 285, 309, 816, 20509, 1053, 626, 878, 352, 15, 309, 1353, 417, 247, 5699, 1182, 293, 1473, 7989, 13, 285, 253, 14370, 34387, 20, 5942, 31823, 369, 816, 594, 25594, 13, 309, 1849, 4425, 281, 5454, 7477, 15, 187, 42, 651, 20509, 4510, 247, 908, 41884, 530, 13, 347, 253, 3064, 875, 747, 285, 908, 310, 22879, 285, 309, 1053, 626, 971, 368, 6068, 3515, 562, 285, 11280, 747, 41884, 530, 434, 816, 323, 436, 15, 22469, 253, 625, 3958, 16, 35019, 398, 2908, 13, 253, 2169, 14682, 15, 1310, 368, 1849, 1694, 247, 985, 285, 3253, 310, 2239, 253, 1318, 273, 253, 16975, 427, 20, 5942, 31823, 13, 359, 476, 1900, 789, 562, 247, 7942, 390, 2165, 8499, 15, 9375, 323, 2819, 2, 187, 187, 20, 5942, 35974, 32982, 35, 13, 418, 6905, 13, 187, 187, 3299, 20, 5096, 20773, 24291, 13333, 187, 187, 1348, 2398, 13, 4104, 387, 884, 27, 938, 5365, 187, 187, 42, 452, 247, 4797, 495, 5942, 35974, 32982, 35, 326, 309, 1353, 2819, 281, 5454, 323, 247, 10890, 20, 5096, 20773, 24291, 13333, 1566, 313, 11499, 31821, 342, 3236, 3817, 13, 533, 604, 642, 326, 434, 4030, 1512, 481, 187, 42, 671, 452, 247, 544, 23422, 62, 187, 9, 3614, 1358, 13880, 15, 9906, 15, 681, 16, 42755, 6689, 1507, 16, 69, 16, 10655, 7282, 50, 21, 12261, 68, 10201, 24, 30784, 44381, 50, 55, 89, 20, 21619, 17, 1615, 3123, 19, 48, 64, 9051, 1036, 59, 90, 59, 339, 40965, 58, 84, 16, 15576, 32, 14147, 30, 7152, 3433, 382, 64, 6682, 10, 187, 1171, 3958, 285, 1841, 326, 309, 812, 7826, 4710, 275, 347, 973, 15, 187, 187, 41774, 1199, 752, 253, 4060, 2296, 15, 309, 369, 8927, 7219, 327, 10156, 841, 3958, 533, 309, 1869, 309, 1871, 2451, 562, 1060, 323, 2442, 28587, 806, 15, 9375, 2, 187, 187, 47, 24150, 495, 5942, 259, 16, 29572, 20254, 1294, 285, 247, 9521, 2165, 187, 187, 3299, 20, 390, 657, 5741, 187, 187, 1348, 2398, 13, 4104, 387, 15630, 27, 3583, 5365, 187, 187, 20, 5942, 556, 247, 27264, 4808, 327, 352, 13, 476, 5386, 604, 368, 751, 15, 26659, 670, 247, 2173, 2165, 604, 368, 971, 581, 13, 309, 3164, 452, 352, 15, 9418, 187, 187, 3016, 30680, 21570, 717, 74, 41968, 187, 187, 1773, 6426, 434, 15350, 35992, 6258, 187, 187, 1348, 2398, 13, 4104, 387, 16331, 27, 3156, 5365, 187, 187, 510, 717, 74, 41968, 310, 3587, 432, 619, 1980, 9567, 22900, 15, 6101, 3533, 1642, 1977, 15, 187, 187, 79, 1540, 3958, 187, 187, 3610, 1225, 1795, 84, 259, 2886, 86, 2127, 187, 187, 1348, 2398, 13, 4104, 387, 16331, 27, 1229, 5365, 187, 187, 2598, 309, 1353, 7378, 281, 5454, 271, 295, 1540, 2165, 313, 71, 23144, 3490, 13, 14864, 4448, 81, 1568, 13, 2929, 14889, 13, 6420, 30844, 49828, 14528, 73, 471, 13, 2494, 10679, 13, 4704, 374, 11267, 934, 36607, 13, 390, 9557, 1940, 16064, 10, 891, 816, 1642, 323, 370, 19, 432, 46104, 281, 3835, 2716, 253, 15076, 15, 26670, 11, 816, 971, 253, 5453, 295, 24150, 2127, 417, 253, 2165, 187, 187, 8262, 516, 2819, 281, 18670, 22101, 690, 5017, 342, 3095, 9, 84, 481, 3173, 6571, 2819, 323, 21629, 3958, 533, 717, 1527, 281, 2712, 15, 9375, 2, 1244, 891, 18298, 281, 823, 253, 1618, 15, 544, 4943, 880, 3614, 1358, 13880, 15, 9906, 15, 681, 16, 42755, 6689, 1507, 16, 69, 16, 18, 91, 7381, 56, 30725, 1615, 23, 79, 4290, 81, 56, 9068, 25696, 82, 54, 82, 58, 7273, 83, 25, 79, 24, 74, 36, 82, 35, 413, 25, 28264, 43498, 17, 2649, 17, 16, 15576, 4, 38902, 30, 16763, 28836, 1706, 2090, 10, 368, 564, 2, 187, 187, 43402, 26862, 8215, 8141, 330, 3180, 187, 187, 43402, 26862, 29352, 8141, 330, 3180, 187, 187, 1348, 2398, 13, 4104, 387, 16987, 27, 1671, 5208, 187, 187, 8262, 6068, 13, 309, 8686, 5037, 2364, 13591, 16548, 495, 37, 323, 619, 47175, 495, 5942, 13, 533, 352, 7819, 562, 309, 476, 626, 41582, 253, 2127, 323, 253, 6114, 984, 326, 434, 8215, 760, 15, 26013, 1056, 253, 1072, 10551, 347, 479, 533, 990, 598, 342, 271, 29352, 3491, 32, 187, 42, 1353, 14707, 281, 22101, 11646, 426, 10, 187, 187, 24397, 281, 755, 562, 273, 253, 3052, 74, 41968, 2165, 15, 7395, 2075, 323, 253, 15076, 15, 544, 40701, 1060, 5774, 2413, 1358, 48370, 15, 681, 16, 71, 1028, 48, 3373, 46, 10, 187, 187, 6869, 37, 21798, 3660, 17937, 26252, 2596, 18605, 11271, 187, 187, 57, 3364, 2596, 6131, 187, 187, 1348, 2398, 13, 4104, 387, 17272, 27, 1717, 5208, 187, 187, 56, 251, 247, 2434, 37, 32368, 2952, 1509, 275, 247, 7879, 1918, 12594, 13, 2819, 281, 5454, 352, 323, 271, 26252, 2596, 5865, 2165, 2127, 390, 1633, 15, 187, 38547, 1509, 310, 370, 1967, 327, 253, 27769, 13, 594, 2970, 253, 2165, 3139, 13, 40542, 27, 11366, 1282, 390, 26580, 6056, 17078, 651, 320, 7353, 15, 187, 187, 6300, 15950, 436, 581, 562, 627, 285, 476, 823, 370, 22, 604, 3058, 1163, 37, 187, 23779, 1020, 17061, 27, 3944, 1358, 24290, 6434, 15, 681, 16, 23779, 2290, 3355, 5696, 187, 187, 15705, 27264, 495, 37, 3645, 313, 56, 2886, 530, 10, 187, 187, 49, 262, 390, 30680, 21570, 3052, 74, 41968, 313, 6693, 18973, 13, 9497, 583, 390, 427, 5472, 10, 187, 187, 1348, 2398, 13, 4104, 387, 14805, 27, 1671, 5208, 187, 187, 1909, 253, 4060, 2296, 309, 452, 6053, 27264, 495, 37, 1533, 285, 309, 971, 31235, 390, 30680, 21570, 3052, 74, 41968, 275, 667, 2919, 9497, 583, 390, 427, 5472, 15, 1310, 3095, 6131, 247, 30680, 21570, 285, 3095, 2010, 6131, 247, 8483, 1561, 2164, 3038, 309, 588, 1379, 253, 31235, 689, 253, 30680, 21570, 15, 187, 187, 6717, 515, 249, 434, 1424, 264, 16167, 26252, 581, 5865, 2127, 187, 187, 13325, 247, 3959, 323, 26252, 581, 2165, 187, 187, 1348, 2398, 13, 4104, 387, 14805, 27, 2405, 5208, 187, 187, 4257, 281, 436, 6293, 309, 452, 436, 2127, 285, 309, 717, 2819, 323, 667, 643, 2165, 643, 685, 913, 2165, 390, 20674, 187, 187, 24397, 281, 755, 11366, 1282, 1863, 6965, 281, 667, 2165, 327, 28984, 15, 2615, 4489, 247, 1643, 3958, 604, 253, 4376, 310, 2406, 685, 327, 11366, 1282, 15, 2615, 626, 4390, 755, 2583, 327, 38356, 15, 309, 476, 564, 806, 13, 604, 16701, 15, 187, 187, 5498, 2364, 13591, 17241, 308, 29289, 7648, 2721, 313, 56, 2886, 530, 10, 187, 187, 17151, 15093, 34777, 313, 56, 2886, 530, 10, 187, 187, 1508, 2398, 13, 4104, 387, 16331, 27, 1717, 5208, 187, 187, 1322, 15753, 35, 3052, 74, 41968, 187, 187, 56, 2886, 13, 495, 5942, 13, 285, 10850, 36, 4338, 3958, 187, 187, 1508, 2398, 13, 4104, 387, 16703, 27, 1812, 5208, 187, 187, 510, 717, 74, 41968, 309, 452, 281, 5454, 27, 187, 21, 89, 309, 413, 187, 20, 89, 7284, 27264, 187, 19, 89, 322 ]
holder Pics available upon request, thanks! Just looking for Ps3 games really, maybe SNES and DS as well. Primarily looking for Destiny for ps3. FIFA 15, Destiny, Shadow of Mordor (PS4) Bloodborne, FarCry 4, offers, I guess? (PS4) 25 Mar, 2015 at 03:47 PM Also looking for DmC: Definitive Edition Mario Kart Double Dash CASE other Gamecube game CASE 25 Mar, 2015 at 03:40 PM My copy of Double Dash broke, so I bought a new copy and now have an extra case. Trading both the case and manual with Nintendo Power inserts. Cases I'm trading for need to have all the original stuff too. I have some loose games that need cases which include: Mario Sunshine Mario Party 4 Mario Party 5 Pokemon Colosseum Pokemon XD These are what I want, but if you have a different case to trade I might do it if its good. Thank You. AC: Unity code // any game. (XboxOne) 25 Mar, 2015 at 03:31 PM Have an unused digital code for AC Unity. Let me know if you are looking to swap codes or anything wolfenstein get new order (physical)+AC black flag (code) X1 offers 1 year gold For both or Gta v or best offer 25 Mar, 2015 at 02:14 PM Various last gen titles, 3DS games, and Xbox One games (Xbox 360)(PS3)(3DS)(Xbox One) I have a MH n3dsxl opened but I applied screen protectors immediately, and the japanese hori protectors. I did however transfer the mh4 game out of the system. It does come with original packaging plus the screen protectors and the hori case protector. I am looking for offers on 3ds games, wii u games, and amiibos(not sure if I can list this here). Dragon Age Inquisition, Destiny, Ghosts Far cry 4, Bloodborne. (Ps4 games are region free. 25 Mar, 2015 at 10:11 AM My games are all physical copies but I'm fine with getting digital ones. Fire Emblem: Awakening Professor Layton and the Azran Legacy 25 Mar, 2015 at 07:25 AM Must come with case. Thank you! NIB Gold Mario Amiibo Captain Falcon Shulk, Meta Knight, maybe other rare Amiibo 25 Mar, 2015 at 06:40 AM Just to clarify, I only want one Amiibo in return. Lemme know! Last of Us Remastered (PS4) Offers (PS4) 25 Mar, 2015 at 02:41 AM 1 month Xbox Live code Smash Bros 3DS Club Nintendo code 25 Mar, 2015 at 02:41 AM I already have the Wii U version registered so I need the 3DS one in order to get Mewtwo. In box mega man amiibo offers 25 Mar, 2015 at 01:55 AM In the market for common amiibos or games for anything PS (1/2/3/4/ vita), Nintendo gb/a 3/ds, and wii/wii u. Oh I also own a 360 Diablo 3 Reaper of Souls (PS4) Halo MCC (Xbox One) GTA 5 (PS4) 25 Mar, 2015 at 01:54 AM The Walking Dead Season 1 and 2 Arma 3 25 Mar, 2015 at 01:03 AM I would love to trade The Walking Dead Season 1 and 2 (maybe even Walking Dead 400 included) for arma 3. Let me know if you are interested, I will consider other offers as well. Hi guys, I have been holding onto this thing since launch and I just honestly don't need it. I'm not a huge zelda fan, and the grey NN3DSXL was just so sexy, I've decided to trade mine. I would honestly prefer a used Wii U, as the difference between new and used is negligible and I don't want you guys running out and buying new Wii U's just for this. Obviously the more games/controllers included, the higher preference. If you've got a system and everything is > the value of the MM N3DSXL, we can always work out a cash or game supplement. Thanks for looking! 3DS XL CiB, LIST, PS3 80gb backwards compatible 24 Mar, 2015 at 10:20 PM I have a blue 3DS XL CiB that I'm looking to trade for a PS3 80gb backwards compatible model (preferably with original box, but if no that's fine too). I also have a [LIST] (https://docs.google.com/spreadsheets/d/105BPQ4TPcPV7JRKlQVx3lg0byIP2O_IE16ZyZsezwYs/edit?usp=docslist_api) of games and things that I could potentially throw in as well. Pretty much what the title says. I was originally planning on selling these games but I thought I'd check out here for potential trades first. Thanks! Nintendo 3DS w/ Circle Pad Pro and a requested game PS3 or Vita 24 Mar, 2015 at 09:52 PM 3DS has a Mario skin on it, can remove if you like. Ask about a specific game if you want one, I probably have it. :) US Meta Knight amiibo Conker's Bad Fur Day 24 Mar, 2015 at 08:41 PM The amiibo is directly from my local Best Buy. Any questions ask away. n64 games smash bros wiiu code 24 Mar, 2015 at 08:30 PM So I'm willing to trade an n64 game (fighting force, tetrisphere, paperboy, southpark chefs loveshack, micro machines, ready 2 rumble boxing, or namco museum) i just ask for $2 from PayPal to cover half the shipping. Edit* just want the club nintendo code not the game Hey im looking to hopefully swap some stuff with someone(s). Im mostly looking for newer games but am open to anything. Thanks! And i forgot to add the list. [Here](https://docs.google.com/spreadsheets/d/1zkoWGyby6nOWpWncIJqUqYUDr8n7iCqBke8yxnj0nt0/edit#gid=2056583469) you go! Club Nintendo EU Star Codes Club Nintendo AU Star Codes 24 Mar, 2015 at 05:35 AM Hey guys, I bought Donkey Kong Returns 3D for my PAL 3DS, but it turns out I can't redeem the code for the stars because that's EU only. Anyone make the same mistake as me but end up with an AU copy? I'm wanting to swap codes =) Looking to get out of the Amiibo game. Will pay for the shipping. [Picture here.](http://imgur.com/fucOrcM) CoD Advanced Warfare Xbox One Season Pass Xbox One offers 24 Mar, 2015 at 03:29 AM Won a CoD AW season pass in a Twitter giveaway, looking to trade it for an Xbox One digital game code or something. Season pass is $70 on the marketplace, so getting the game itself, BF: Hardline or Borderlands Collection would be sweet. Just throwing this one out there and can add $5 if needed :D Successful Trade: http://tinyurl.com/SuccessTradesLA Super Mario 3D World (Wii U) Pit or Meta Knight Amiibo (Any Region, Loose or NIB) 24 Mar, 2015 at 01:35 AM As the title says I have Super Mario 3D world and I want Pit or Meta Knight Amiibo in any region Loose or NIB. If someone offers a Meta Knight and someone else offers a pit within 24 hours I will take the Pit over the Meta Knight. Assassin's creed unity Xbox one digital code Make a offer for Xbox one game 24 Mar, 2015 at 01:31 AM New to this thread I have this code and I am looking for any other game other than ac game or halo Looking to get Hardline swapped to any game on Steam. Can buy a few games if the price is lower than on Hardline. Can't currently get money on Origin. I can go first, if insisted. Donkey Kong Country Tropical Freeze (Wii U) Hyrule Warriors (Wii U) 23 Mar, 2015 at 08:29 AM NA NiB Amiibo Wii, 3DS, and GameCube games 23 Mar, 2015 at 04:36 AM The amiibo I have to trade: 4x Ike 3x Gold Mario 2x S
[ 26354, 6218, 18309, 18957, 26772, 5444, 15936, 13639, 6686, 46770, 32932, 5832, 3917, 9146, 6418, 4746, 38107, 26335, 238, 5444, 21918, 21447, 26725, 6686, 17531, 9345, 30723, 23872, 9146, 11473, 46212, 4340, 187, 187, 20422, 241, 36168, 17951, 37203, 20422, 241, 187, 187, 13129, 14010, 4746, 15936, 13639, 6686, 10446, 13639, 6686, 6344, 48711, 20584, 13639, 6449, 12462, 112, 18309, 21479, 36168, 17951, 30004, 6957, 21700, 223, 23826, 35550, 4340, 187, 187, 35489, 32020, 5225, 35300, 165, 120, 120, 6449, 12462, 112, 15124, 26772, 47754, 6088, 6418, 14010, 8509, 11473, 48892, 23872, 11473, 6957, 48624, 5151, 28254, 5444, 32020, 19857, 15625, 6957, 4746, 38107, 26335, 238, 5444, 48711, 20584, 13639, 5444, 17559, 101, 9345, 6261, 26725, 47221, 18780, 187, 187, 10041, 120, 8509, 21447, 5832, 20422, 241, 20422, 241, 20422, 241, 20422, 241, 26680, 26680, 26680, 187, 187, 46843, 11800, 102, 14016, 13973, 13129, 5151, 4340, 14010, 9345, 13973, 17531, 13973, 11039, 5891, 6686, 9146, 18514, 165, 120, 120, 6957, 1357, 107, 15815, 39009, 1357, 107, 39009, 5444, 10041, 120, 8509, 11473, 4746, 5151, 14016, 11039, 44246, 124, 17531, 6261, 10786, 34698, 32365, 5444, 32363, 243, 17531, 41581, 5444, 1769, 231, 9467, 6088, 13127, 118, 46674, 6261, 21322, 11473, 15625, 4340, 187, 187, 10041, 120, 8509, 5832, 14378, 225, 31949, 6344, 165, 120, 120, 5444, 163, 222, 107, 36114, 3917, 16436, 41662, 21918, 9935, 40404, 11473, 10786, 5690, 235, 14321, 4746, 8509, 5832, 6344, 27107, 103, 5444, 6218, 6686, 46674, 5151, 20550, 9146, 3917, 28254, 5444, 165, 120, 120, 5444, 41777, 224, 33532, 38011, 6957, 18678, 20550, 3917, 6957, 23872, 9146, 11473, 15625, 40404, 4340, 187, 187, 29474, 19067, 6344, 4746, 14010, 6088, 6418, 1769, 226, 9467, 1357, 107, 6996, 6449, 765, 116, 9736, 28917, 221, 18309, 165, 120, 120, 6449, 27937, 11473, 35489, 24617, 30723, 18780, 187, 187, 13748, 41777, 224, 33532, 38011, 3917, 27098, 165, 120, 120, 13752, 3917, 47961, 21991, 20776, 26680, 187, 187, 5151, 9146, 6957, 6344, 5891, 43972, 9935, 4340, 48624, 22010, 5444, 41478, 30093, 124, 6344, 1357, 107, 39009, 1357, 107, 39009, 6686, 48711, 20584, 13639, 3917, 165, 120, 120, 6449, 21275, 11473, 16740, 48756, 5832, 46770, 32932, 35550, 4340, 187, 187, 41162, 6686, 11039, 4746, 41777, 224, 33532, 38011, 3917, 27098, 14262, 236, 48561, 6449, 45128, 108, 5832, 46770, 32932, 48711, 20776, 4340, 187, 187, 15936, 18309, 4746, 29626, 123, 20113, 13129, 19857, 46180, 120, 41478, 18309, 5891, 8509, 19857, 30723, 10446, 9736, 23826, 3917, 39636, 6686, 49764, 4746, 33124, 37203, 10786, 27107, 103, 6449, 26772, 6261, 5832, 41326, 3917, 41869, 7249, 106, 6449, 18309, 46461, 2155, 216, 6686, 14318, 97, 3917, 48711, 20584, 13639, 6449, 21275, 21447, 26725, 35550, 4340, 187, 187, 18780, 8509, 6218, 4746, 48711, 20584, 13639, 5444, 25715, 243, 9146, 24617, 18757, 13748, 20691, 1357, 217, 13752, 6088, 13748, 21322, 162, 99, 211, 13752, 5444, 10786, 41777, 224, 33532, 38011, 6449, 40564, 19857, 5832, 44912, 4746, 187, 187, 28779, 39009, 41344, 6996, 35259, 98, 6449, 37208, 12335, 18309, 4746, 13748, 37248, 5444, 10786, 10446, 765, 122, 9345, 48711, 6686, 20691, 1357, 217, 13752, 10786, 21275, 21447, 26725, 35550, 4340, 187, 187, 41162, 6686, 11039, 30723, 4746, 14321, 9736, 6088, 48711, 20584, 13639, 6088, 32313, 8509, 21447, 48815, 37895, 114, 11039, 46016, 11043, 119, 26354, 6449, 45387, 231, 18678, 18309, 14016, 9345, 5832, 6418, 41581, 20776, 4340, 187, 187, 13129, 14010, 4746, 39984, 29741, 30423, 6261, 3917, 36337, 233, 44246, 236, 6957, 10962, 114, 18514, 6088, 10446, 34198, 6344, 4746, 10446, 10446, 21479, 6418, 38107, 26335, 238, 5444, 32653, 232, 6957, 1769, 211, 13682, 47434, 47054, 37988, 5444, 48711, 20584, 13639, 6449, 33700, 242, 43645, 20550, 43033, 235, 23371, 6449, 32938, 18434, 5444, 46843, 11800, 102, 33403, 9736, 45950, 13973, 14321, 8509, 5891, 43972, 9935, 4340, 187, 187, 48711, 20584, 13639, 45261, 5444, 24308, 6218, 6686, 27107, 103, 6957, 7719, 119, 14321, 4746, 39468, 45261, 5444, 162, 125, 211, 32790, 218, 6957, 23692, 110, 5832, 43033, 235, 6449, 5891, 9146, 6088, 46843, 11800, 102, 14016, 13973, 13129, 5151, 4340, 187, 187, 39984, 29741, 4746, 39573, 11039, 24617, 45950, 13973, 14321, 15625, 26680, 26680, 187, 187, 1769, 211, 13682, 47434, 47054, 37988, 5444, 48711, 20584, 13639, 6449, 33700, 242, 43645, 5832, 187, 187, 9935, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 6996, 6996, 12448, 214, 26680, 26680, 187, 187, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 26680, 26680, 26680, 187, 187, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 35482, 17694, 26680, 26680, 26680, 187, 187, 1769, 226, 13682, 29733, 29733, 6996, 6996, 6996, 6996, 6996, 12448, 214, 26680, 26680, 26680, 187, 187, 11908, 1769, 231, 44192, 6449, 18780, 187, 187, 28791, 14321, 44781, 11473, 5444, 15815, 26680, 26680, 26680, 187, 187, 9935, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 21322, 26680, 26680, 26680, 26680, 187, 187, 32166, 15815, 39009, 26003, 6996, 6996, 6996, 6996, 13682, 26680, 26680, 26680, 26680, 26680, 187, 187, 2866, 39009, 41344, 16509, 16509, 15815, 187, 187, 11016, 214, 6957, 7149, 9146, 6996, 6996, 6996, 6996, 6996, 12448, 214, 26680, 26680, 26680, 187, 187, 25538, 37203, 3917, 5690, 232, 16740, 48756, 31355, 47343, 6996, 6996, 12448, 214, 15815, 26680, 26680, 26680, 187, 187, 17072, 1357, 116, 6996, 6996, 6996, 6996, 6996, 12448, 214, 11908, 26680, 26680, 26680, 187, 187, 21700, 213, 23872, 11473, 20776, 187, 187, 6418, 5151, 4746, 5151, 9146, 6957, 6344, 15124, 6344, 5891, 43972, 9935, 9146, 4340, 187, 187, 32653, 232, 21232, 45748, 4746, 8509, 13129, 9146, 10446, 13639, 6686, 5444, 28656, 9467, 35259, 102, 9467, 6957, 16740, 6957, 47221, 6418, 35636, 9736, 13442, 6686, 9146, 18514, 3917, 20776, 6957, 4746, 20691, 5151, 20691, 5151, 15367, 6449, 16549, 235, 9345, 6261, 30423, 32365, 6344, 28492, 123, 5891, 13639, 6344, 5891, 8509, 5151, 35550, 4340, 187, 187, 29474, 3917, 10786, 4746, 41777, 224, 33532, 38011, 3917, 27098, 33700, 242, 43645, 20005, 21447, 4746, 37895, 108, 27804, 15275, 11473, 10786, 41581, 9736, 6088, 30255, 225, 18617, 113, 5891, 48711, 5444, 32020, 19857, 5832, 20776, 15275, 40404, 4340, 187, 187, 35201, 13973, 9146, 16436, 41662, 33403, 21447, 5891, 8509, 18514, 49764, 4746, 209, 37248, 37203, 10786, 48711, 20584, 13639, 5444, 23956, 236, 8509, 11039, 41581, 43033, 235, 2155, 216, 6686, 8587, 236, 24017, 6449, 41777, 224, 33532, 38011, 5151, 9736, 765, 111, 5151, 5444, 33700, 242, 43645, 5832, 18245, 228, 8650, 101, 6449, 35392, 237, 17531, 13442, 14321, 6218, 5151, 6088, 35636, 5151, 15625, 4340, 187, 187, 29554, 39295, 20584, 5444, 4746, 35241, 26270, 6418, 23826, 47343, 13639, 10446, 165, 224, 222, 6449, 27661, 244, 21479, 9146, 765, 116, 5832, 5494, 219, 17576, 6686, 49764, 4746, 12105, 48991, 21322, 28492, 123, 5891, 26725, 5444, 5891, 13442, 6261, 14016, 13973, 13129, 5151, 4340, 187, 187, 23826, 6686, 26725, 5444, 4746, 35636, 5151, 20691, 14321, 6344, 5959, 103, 3917, 35643, 24404, 5444, 48711, 20584, 13639, 6449, 23373, 9345, 6218, 6088, 10446, 34198, 4746, 37248, 8509, 6344, 38011, 31355, 6218, 19067, 3917, 18757, 14016, 11039, 5151, 14274, 38028, 6686, 44899, 36820, 23826, 33403, 18514, 49764, 15936, 23826, 11039, 10786, 35482, 11908, 11908, 28405, 20776, 4340, 187, 187, 39984, 29741, 5138, 217, 43033, 235, 4746, 41162, 21479, 10786, 48815, 37895, 114, 11039, 46016, 48711, 20584, 13639, 17694, 13682, 24119, 6449, 21322, 11016, 212, 11473, 14016, 13973, 13129, 5151, 26680, 187, 187, 32653, 232, 6418, 45128, 108, 14318, 111, 37203, 5444, 1357, 107, 39009, 1357, 107, 39009, 3917, 48711, 20584, 13639, 6449, 33700, 242, 43645, 45950, 11039, 44002, 6449, 6765, 218, 18514, 49764, 4746, 26772, 18434, 6418, 32020, 6218, 14016, 10786, 38591, 46212, 4340, 187, 187, 13129, 28254, 6686, 11039, 187, 187, 53, 8775, 535, 3675, 22070, 2805, 6091, 81, 4284, 14, 9561, 577, 89, 740, 40, 187, 187, 2551, 920, 14, 12588, 4438, 278, 296, 81, 187, 187, 39639, 26239, 3244, 4284, 1980, 187, 187, 39639, 5230, 4279, 608, 370, 18, 5, 24343, 13257, 52, 26, 82, 41, 5, 38, 16077, 75, 30930, 16983, 49, 25314, 7311, 5039, 91, 22, 48084, 79, 1797, 187, 187, 19721, 14991, 15863, 1458, 2554, 2990, 14, 15787, 4279, 608, 370, 18, 5, 4708, 16, 4529, 59, 72, 26, 5, 43, 25, 88, 37, 18, 82, 49, 3837, 50, 35, 68, 4013, 87, 21, 453, 71, 1767, 15, 187, 19721, 12531, 4991, 15863, 1458, 2554, 2990, 14, 15787, 4279, 608, 370, 18, 5, 45, 88, 19, 52, 1044, 21, 76, 5, 67, 48389, 31983, 25090, 19, 70, 24, 35331, 15, 87, 47, 6677, 6603, 48, 17, 187, 187, 15049, 40768, 18, 187, 187, 15049, 40768, 19, 187, 187, 15049, 11354, 18, 187, 50275, 532, 2953, 884, 15, 17, 15, 19, 15, 1010, 16, 1348, 187, 187, 2369, 13997, 24749, 187, 187, 26454, 23370, 3944, 14, 44291, 187, 50275, 2369, 26897, 535, 187, 423, 187, 41497, 14277, 7229, 2715, 568, 18, 15, 17, 3, 9706, 568, 17880, 14, 25, 28739, 187, 29, 11695, 29806, 8893, 568, 21, 15, 17, 3, 15664, 568, 2413, 1358, 24991, 15, 22730, 15, 681, 16, 35654, 16, 983, 7973, 16, 9755, 1138, 187, 50276, 29, 46812, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 1138, 187, 50272, 29, 40049, 18483, 38958, 70, 1229, 67, 2759, 1731, 14, 22, 39273, 14, 21, 6357, 25, 14, 67, 26, 69, 21, 14, 24, 69, 17, 71, 3011, 5523, 1237, 69, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 1138, 187, 50272, 29, 40049, 18483, 38958, 24, 8407, 21, 10442, 14, 67, 21, 71, 20, 14, 21, 70, 2691, 14, 2320, 68, 20, 14, 4148, 30626, 71, 49352, 1787, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 350, 1949, 1138, 187, 50272, 29, 40049, 18483, 38958, 21, 4838, 1796, 1706, 14, 584, 22, 14, 21, 67, 20, 66, 14, 67, 22, 357, 14, 23, 67, 12352, 25, 71, 18, 71, 23, 317, 26, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 255, 8074, 1568, 1138, 187, 50272, 29, 40049, 18483, 38958, 71, 883, 317, 2511, 70, 14, 70, 21, 70, 25, 14, 40181, 69, 14, 1257, 3655, 14, 66, 4185, 453, 71, 23, 69, 2031, 2759, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 5047, 398, 1962, 1405, 1138, 187, 50272, 29, 40049, 18483, 38958, 68, 25, 66, 15798, 68, 25, 14, 21, 68, 24, 70, 14, 21, 70, 20, 67, 14, 66, 4148, 70, 14, 21, 71, 615, 26, 1717, 66, 21, 71, 23, 71, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 7645, 1138, 187, 50272, 29, 40049, 18483, 38958, 1619, 2405, 69, 27893, 14, 71, 23, 69, 18, 14, 1857, 740, 14, 67, 46514, 14, 70, 16763, 2222, 67, 3342, 19490, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 4990, 61, 5996, 21448, 1138, 187, 50272, 29, 40049, 18483, 38958, 19, 66, 3712, 66, 48219, 14, 17, 68, 19, 69, 14, 21, 1257, 21, 14, 67, 32834, 14, 17, 70, 20450, 1976, 12847, 18, 71, 20, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50274, 29, 9824, 17105, 568, 2203, 61, 20511, 1138, 187, 50272, 29, 40049, 18483, 38958, 19, 3342, 3655, 69, 805, 14, 17786, 67, 14, 38693, 66, 14, 25, 70, 3953, 14, 67, 17, 69, 20, 2428, 3342, 17, 71, 4482, 28379, 40049, 18483, 31, 187, 50274, 870, 9824, 31, 187, 50276, 870, 46812, 31, 187, 50276, 29, 46812, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 38965, 64, 36511, 64, 615, 1179, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 6839, 3086, 2446, 10172, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 4990, 61, 255, 8074, 1568, 61, 13456, 15, 5844, 85, 1138, 187, 50272, 29, 9824, 31, 2203, 61, 4990, 61, 255, 8074, 1568, 870, 9824, 31, 187, 50274, 870, 11336, 31, 187, 50274, 29, 11336, 17105, 568, 25976, 25976, 38601, 61, 3233, 61, 5047, 398 ]
果たして本当にそんなことができるのかは、実際にやってみなければわかりません。 ~三日後~ さあ、そんなこんなでそうめんを干してから三日間が経ちました。 外見的には麺を干した当初とはあまり変わりが無いように見えますが、実際にそうめんに触れてみると…… 固まってる~~~~!!! ご覧ください。あれだけだらしなかった麺がガッチガチに固まり、いくら傾けても重力に負けずにピンと伸びております。 固まる過程で麺に独特のクセやうねりも付き、まるで風にたなびいているかのように麺に躍動感が出ているのがわかりますね。 ということで、あとはハンガーをぶっ壊して麺を取り外せば…… 「躍動感のある麺」の完成です! いかがでしょう。無事に立派でガチガチなそうめんの麺を作り上げることができました。 これなら、躍動感のある写真を撮ることができそうです。 そして、製法さえ確立してしまえばこっちのものなので、その後も風を当てるなどの工夫をして色々な形のそうめんを作ってみました。 ……また、そうめんに欠かせない「つゆ」と「お椀」にも躍動感を与えるため、 カチューシャを利用して、「今にもこぼれそうなつゆ」も作ってみました。 これならば、きっとそうめんと相まって素晴らしい効果を演出してくれるはずです。 さあ、それでは全ての準備が整ったところで、ここからは実際に僕がダイナミックにそうめんを食べている様子を存分にご覧になっていただきましょう。 そうめん界に新たな風が吹き、業界に激震が走る様をしかとご覧ください。 それでは、参らせていただきます!! ダイナミックにそうめんを食べる うおおおおおおおおーーーッ!! おおおおおおおおおおお!!! オラオラオラオラオラオラ!!! ハイィィーーーーーーッ!!! スピードを…… 置き去りにッ!!! うおおおおおおおおおおおお!!!! バッチコーーーーイ!!!!! …チュルルッ 逃がすかーーーーーーッ!!! 最後の仕上げじゃーーーッッ!!! アザーーーーーーッス!!! 終わりです はい、いかがでしたでしょうか。 僕自身、まさかこんなにテンションが上がるとは思っていなかったのですが、ついつい我を忘れて全力で楽しんでしまいました。 というのも、躍動感のある食べ方って、普通よりもずっと美味しそうに見えるですよね。 何だかクセになってしまったので、 今後もそうめんに留まらず様々な料理を躍動感いっぱいに食べる挑戦を続けていきたいと思います。 手始めに、次回はちゃんこ鍋を頭からかぶる予定なので、是非お楽しみにしていてください。 ちなみに、思いつきで木のウロにそうめんを入れたところ、今まで感じたことのないくらい不安な気持ちになったのでそちらもオススメです。 それでは皆様、これからも素晴らしいそうめんライフをお送りください! 僕は撮影後にガチガチのそうめんを食べていたら口を切ったので、当分は見たくもありません。 さようなら Tweet transceiver qsfp default-mode 4x10G spanning-tree mode mstp aaa authorization exec default local aaa root secret 5 $1$lpTXS9qH$EpnjrnfpPZZgiAbz5sxn21 username admin privilege 15 role network-admin secret 5 $1$RT/92Zg9$J8wD1qPAdQBcOhv4fefyt. username vagrant privilege 15 role network-admin secret 5 $1$Lw2STh4k$bPEDVVTY2e7lf.vNlnNEO0 interface Ethernet1 interface Ethernet2 interface Management1 ip address 10.0.2.15/24 no ip routing management api http-commands no shutdown end <?xml version="1.0" encoding="utf-8"?> <Project ToolsVersion="4.0" xmlns="http://schemas.microsoft.com/developer/msbuild/2003"> <ItemGroup> <Filter Include="data"> <UniqueIdentifier>{e30b8426-5883-4ca8-b9d4-7d0f5700532d}</UniqueIdentifier> </Filter> <Filter Include="data\material"> <UniqueIdentifier>{7afe4aba-b4f3-4e86-afc3-97497f211037}</UniqueIdentifier> </Filter> <Filter Include="data\material\terrain"> <UniqueIdentifier>{4003ee34-ace5-4b3a-b5ab-6bdc8f1f6ac9}</UniqueIdentifier> </Filter> <Filter Include="data\material\atmosphere"> <UniqueIdentifier>{f11ac89e-e4e8-434d-be73-a98fef6d4484}</UniqueIdentifier> </Filter> <Filter Include="data\renderscheme"> <UniqueIdentifier>{c8a024c8-4c7e-4e3b-a97e-4fde929a4f6f}</UniqueIdentifier> </Filter> <Filter Include="data\material\model"> <UniqueIdentifier>{2831d313-f6d1-4510-b526-e20595bbf245}</UniqueIdentifier> </Filter> <Filter Include="data\material\postfx"> <UniqueIdentifier>{2a51a521-0c2d-4be4-b642-0e27575bc1f3}</UniqueIdentifier> </Filter> <Filter Include="data\editor"> <UniqueIdentifier>{2bf73d12-185b-433a-8e94-b0d3cdbf0fbb}</UniqueIdentifier> </Filter> </ItemGroup> <ItemGroup> <None Include="..\..\..\..\Bin\Data\material\geometry_brush_decal.bmt"> <Filter>data\material</Filter> </None> <None Include="..\..\..\..\Bin\Data\material\instancedAABB.bmt"> <Filter>data\material</Filter> </None> <None Include="..\..\..\..\Bin\Data\material\atmosphere\sky.bmt"> <Filter>data\material\atmosphere</Filter> </None> <None Include="..\..\..\..\Bin\Data\renders
[ 2175, 15, 380, 14846, 273, 512, 7006, 407, 1029, 6064, 337, 41, 14, 285, 2145, 36, 14, 79, 15, 78, 15, 83, 15, 19638, 310, 671, 2529, 15, 3122, 187, 475, 8283, 4765, 380, 330, 13606, 386, 12070, 26940, 15, 187, 475, 187, 475, 21737, 762, 253, 14325, 4637, 13, 11099, 374, 15, 17, 313, 783, 346, 17736, 3287, 187, 475, 368, 778, 417, 897, 436, 1873, 3707, 275, 10276, 342, 253, 4637, 15, 187, 475, 1422, 778, 4044, 247, 3491, 273, 253, 4637, 387, 187, 475, 187, 475, 50273, 2413, 1358, 2700, 15, 8418, 15, 2061, 16, 17130, 16, 17821, 14, 19, 15, 17, 187, 475, 187, 475, 15999, 2424, 407, 7763, 1569, 390, 5821, 281, 275, 4028, 13, 3694, 187, 475, 5939, 762, 253, 4637, 310, 5939, 327, 271, 346, 1719, 4110, 3, 23440, 13, 187, 475, 15002, 15466, 4145, 22998, 3481, 9103, 19329, 13, 2057, 3890, 390, 10466, 15, 187, 475, 2594, 253, 4637, 323, 253, 2173, 3448, 13200, 15607, 285, 187, 475, 7364, 762, 253, 4637, 15, 187, 1738, 187, 187, 10708, 1071, 3024, 187, 187, 2948, 313, 187, 186, 3, 19462, 3, 187, 10, 187, 187, 4997, 6004, 21962, 5089, 8695, 6155, 9, 85, 475, 19462, 15, 53, 10, 551, 187, 186, 2044, 3596, 426, 5057, 5089, 8695, 6155, 1082, 187, 186, 338, 3596, 2295, 5296, 551, 996, 186, 85, 15, 47837, 1587, 2566, 3024, 3596, 943, 417, 320, 5296, 2807, 187, 186, 94, 187, 94, 187, 56, 343, 288, 21562, 20150, 3150, 28945, 279, 8449, 530, 893, 29256, 300, 25858, 4784, 1471, 367, 28047, 7003, 16724, 46, 9314, 293, 45215, 359, 72, 1628, 270, 6555, 384, 292, 13, 3150, 344, 1137, 490, 423, 1098, 85, 8606, 257, 36959, 15, 12799, 1784, 5706, 317, 413, 12606, 891, 6285, 30483, 2336, 26774, 1751, 427, 13261, 36959, 442, 891, 6285, 259, 37844, 4784, 16724, 24657, 38139, 1628, 14, 6942, 257, 465, 9388, 16915, 13261, 19748, 13, 369, 12606, 14266, 34950, 292, 15, 187, 187, 34967, 29840, 687, 6678, 367, 28047, 7003, 40362, 44669, 411, 466, 44669, 653, 2711, 292, 187, 187, 35567, 36328, 2971, 1182, 797, 83, 3090, 2188, 797, 3807, 4784, 6513, 328, 254, 10351, 1257, 9527, 496, 570, 250, 27553, 17456, 85, 3807, 3150, 401, 515, 796, 6290, 348, 7373, 797, 27, 23184, 10863, 47363, 40200, 3189, 249, 1947, 13, 3347, 42132, 4965, 296, 5315, 864, 18285, 24910, 9216, 257, 3189, 249, 25190, 1392, 86, 10278, 254, 1947, 15, 9362, 1720, 39644, 1784, 5271, 375, 1784, 401, 34206, 466, 31546, 3354, 1182, 254, 296, 406, 864, 13, 3150, 401, 24452, 2721, 4079, 18654, 4784, 1784, 10351, 1257, 15028, 1653, 348, 3090, 1440, 292, 15, 378, 6850, 8047, 3697, 12670, 5111, 3150, 1884, 15, 933, 14029, 15, 9362, 29256, 300, 87, 447, 288, 21562, 41278, 73, 17079, 2827, 5590, 1866, 3807, 711, 5590, 67, 18285, 1471, 743, 10629, 14293, 5111, 3130, 907, 17291, 25374, 30722, 25724, 15, 34147, 254, 40803, 2336, 664, 304, 797, 15, 427, 328, 23424, 1471, 32580, 1962, 864, 13, 40803, 1182, 814, 265, 49394, 13, 3150, 30912, 1074, 18285, 1257, 338, 39114, 10736, 298, 38740, 15, 401, 34206, 466, 29256, 300, 25858, 23905, 17542, 12606, 844, 614, 373, 13014, 36565, 1182, 6968, 766, 20150, 79, 13261, 257, 15, 23184, 30483, 23905, 8449, 2294, 15030, 411, 607, 78, 6841, 1216, 79, 305, 21099, 43715, 15701, 15, 6180, 273, 253, 14723, 187, 510, 1673, 273, 253, 3688, 310, 941, 5162, 13, 390, 13, 625, 5742, 13, 3082, 13, 39042, 13, 285, 3580, 323, 17617, 12672, 5300, 762, 247, 13603, 13732, 4666, 15, 187, 11185, 273, 15073, 3975, 187, 33824, 12672, 2718, 476, 7208, 2486, 247, 11234, 273, 4382, 26967, 15, 5815, 4382, 13732, 778, 320, 7660, 281, 9940, 3541, 11911, 390, 9940, 3280, 16, 9252, 313, 8924, 42, 16, 48, 457, 10, 4095, 326, 403, 13205, 323, 11855, 897, 407, 247, 2014, 4382, 13732, 15, 2091, 247, 1798, 4382, 13732, 10224, 13, 310, 5176, 13, 390, 310, 5010, 29356, 13, 253, 9940, 3541, 11911, 390, 9940, 3280, 16, 9252, 313, 8924, 42, 16, 48, 457, 10, 4095, 326, 403, 13205, 323, 11855, 897, 407, 253, 2014, 4382, 13732, 671, 2489, 29356, 13, 275, 15866, 273, 253, 958, 326, 253, 9940, 3541, 11911, 390, 9940, 309, 16, 48, 4095, 778, 320, 9670, 5164, 15, 50, 27, 187, 187, 5330, 275, 6293, 346, 7265, 3, 7626, 15, 8906, 15, 2302, 18869, 7050, 5330, 27, 1621, 1386, 1119, 187, 187, 52, 276, 22458, 682, 802, 2086, 14291, 299, 258, 33991, 50276, 9357, 70, 5586, 549, 785, 5282, 274, 802, 26925, 263, 258, 43831, 372, 884, 30508, 307, 375, 15, 4825, 32644, 4355, 13, 258, 2086, 66, 34344, 37391, 274, 247, 4195, 895, 66, 372, 30508, 307, 375, 1753, 34344, 187, 2152, 1049, 1631, 2960, 313, 1831, 17449, 80, 27, 372, 495, 247, 818, 481, 187, 48, 2827, 287, 32862, 27, 187, 3, 5330, 275, 6293, 346, 7265, 3, 7626, 15, 8906, 15, 2302, 18869, 7050, 5330, 27, 1621, 1386, 1119, 187, 50274, 255, 7626, 15, 4793, 16, 5594, 15, 8906, 15, 4316, 9582, 15, 8384, 7557, 9, 4316, 9582, 15, 5594, 27, 1036, 3712, 10, 187, 50274, 255, 247, 3627, 19, 15, 1672, 2269, 34339, 22, 15, 7265, 9, 1672, 2269, 34339, 22, 15, 5594, 27, 1797, 6844, 187, 187, 10708, 247, 3627, 19, 28, 187, 2948, 7626, 15, 8906, 15, 4316, 9582, 28, 187, 187, 4387, 966, 1889, 2269, 34339, 22, 551, 535, 50274, 4387, 4228, 2991, 2022, 9, 2776, 5456, 13059, 10, 551, 535, 50270, 2776, 8168, 30508, 14345, 426, 747, 4605, 60, 740, 2194, 535, 50270, 1542, 313, 565, 891, 30, 18, 28, 891, 44072, 740, 28, 891, 9234, 551, 535, 50266, 4316, 9582, 268, 426, 747, 1810, 9582, 9, 7761, 15, 249, 558, 187, 50266, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 258, 346, 559, 313, 74, 8744, 346, 3272, 30508, 14345, 372, 884, 27, 3287, 187, 50266, 11510, 14345, 60, 74, 62, 426, 268, 15, 8384, 7557, 1874, 187, 50266, 81, 15, 10483, 1874, 187, 50270, 94, 535, 50270, 4316, 9582, 269, 426, 747, 1810, 9582, 9, 7761, 15, 249, 558, 535, 50270, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 247, 4195, 895, 66, 278, 18463, 8032, 27, 3287, 187, 50270, 565, 7221, 80, 426, 269, 15, 8384, 4807, 1874, 535, 50270, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 247, 4195, 895, 66, 37137, 3266, 66, 27, 3287, 187, 50270, 565, 11903, 80, 426, 269, 15, 8384, 4807, 1874, 535, 50270, 1542, 313, 565, 891, 30, 1222, 17622, 28, 891, 29, 785, 3266, 80, 12, 18, 28, 891, 9234, 551, 187, 50266, 7761, 15, 483, 15, 16684, 9, 11510, 14345, 60, 74, 14, 18, 9259, 187, 50270, 94, 187, 50270, 71, 15, 10483, 1874, 187, 50274, 94, 187, 187, 94, 187, 187, 34, 27, 187, 187, 2948, 7626, 15, 8906, 15, 4316, 9582, 28, 187, 187, 4387, 966, 1889, 2269, 34339, 22, 551, 535, 50274, 4387, 4228, 2991, 2022, 9, 2776, 5456, 13059, 10, 551, 535, 50270, 2776, 8168, 30508, 14345, 426, 747, 4605, 60, 740, 2194, 535, 50270, 4316, 9582, 268, 426, 747, 1810, 9582, 9, 7761, 15, 249, 558, 535, 50270, 1542, 313, 565, 891, 30, 17, 28, 891, 29, 740, 28, 891, 9234, 551, 535, 50266, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 258, 346, 559, 313, 74, 12, 18, 8744, 346, 3272, 30508, 14345, 372, 884, 27, 3287, 187, 50266, 11510, 14345, 60, 74, 62, 426, 268, 15, 8384, 7557, 1874, 535, 50270, 94, 535, 50270, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 247, 4195, 895, 66, 278, 18463, 8032, 27, 3287, 187, 50270, 565, 7221, 80, 426, 268, 15, 8384, 4807, 1874, 535, 50270, 7761, 15, 483, 15, 16684, 1587, 14794, 8432, 247, 4195, 895, 66, 37137, 3266, 66, 27, 3287, 187, 50270, 565, 11903, 80, 426, 268, 15, 8384, 4807, 1874, 535, 50270, 1542, 313, 565, 891, 30, 1222, 17622, 14, 18, 28, 891, 44072, 785, 3266, 80, 14, 18, 28, 891, 9234, 551, 187, 50266, 7761, 15, 483, 15, 16684, 9, 11510, 14345, 60, 74, 9259, 187, 50270, 94, 535, 50270, 81, 15, 10483, 1874, 187, 50274, 94, 187, 94, 187, 187, 49, 15, 52, 15, 329, 585, 2034, 1689, 247, 1071, 274, 258, 3280, 513, 4981, 478, 9325, 5586, 347, 1459, 1757, 46975, 7221, 80, 299, 11903, 80, 13, 5586, 35834, 343, 1753, 396, 39348, 312, 13326, 470, 299, 884, 299, 1753, 278, 18463, 17622, 11049, 37137, 3266, 80, 15, 535, 50, 27, 187, 187, 1719, 19, 823, 18229, 8078, 29713, 187, 187, 2598, 309, 1053, 626, 755, 436, 387, 512, 15, 2091, 309, 1691, 209, 187, 7504, 14418, 15, 1911, 18229, 2073, 5478, 377, 85, 1383, 3635, 937, 21020, 4785, 53, 3287, 187, 187, 42, 755, 8078, 29713, 15, 50276, 6436, 604, 891, 1691, 187, 7504, 14418, 15, 1911, 18229, 2073, 5478, 377, 85, 8, 937, 21020, 4785, 53, 3287, 187, 187, 1147, 3936, 352, 4030, 15, 50276, 10795, 79, 626, 789, 672, 309, 1611, 281, 1067, 253, 1159, 15, 50276, 42, 908, 500, 8053, 13, 2622, 34619, 816, 670, 3253, 15, 50276, 42, 1158, 352, 556, 1633, 281, 513, 342, 436, 2523, 533, 417, 2176, 15, 50276, 30308, 4110, 37457, 52, 22068, 374, 285, 309, 2451, 253, 18051, 7533, 15, 50276, 6693, 5697, 390, 13991, 651, 320, 13103, 6701, 2, 187, 187, 34, 27, 187, 187, 42, 8156, 326, 352, 943, 320, 187, 7504, 14418, 15, 1911, 7865, 8116, 2073, 5478, 377, 85, 1383, 3635, 13, 10223, 4785, 53, 558, 187, 187, 1147, 3589, 626, 253, 3635, 347, 29713, 352, 369, 253, 1390, 629, 309, 369, 10430, 247, 2876, 672, 352, 369, 16764, 247, 1159, 15, 535, 3122, 187, 475, 21737, 281, 3599, 3258, 8716, 762, 581, 390, 625, 24938, 187, 475, 7981, 15486, 15, 2594, 253, 43512, 1873, 5939, 342, 187, 475, 436, 789, 323, 3081, 1491, 5001, 9451, 187, 475, 12851, 15, 3599, 3258, 8716, 23937, 436, 1873, 281, 368, 762, 187, 475, 253, 14325, 4637, 13, 11099, 374, 15, 17, 313, 783, 346, 17736, 3287, 368, 778, 187, 475, 417, 897, 436, 1873, 3707, 275, 10276, 342, 253, 4637, 15, 187, 475, 1422, 778, 4044, 247, 3491, 273, 253, 4637, 387, 187, 475, 187, 475, 50274, 2413, 1358, 2700, 15, 8418, 15, 2061, 16, 17130, 16, 17821, 14, 19, 15, 17, 187, 475, 187, 475, 15999, 2424, 407, 7763, 1569, 390, 5821, 281, 275, 4028, 13, 187, 475, 3694, 5939, 762, 253, 4637, 310, 5939, 327, 271, 187, 475, 346, 1719, 4110, 3, 23440, 13, 15002, 15466, 4145, 22998, 3481, 9103, 187, 475, 19329, 13, 2057, 3890, 390, 10466, 15, 50276, 5035, 253, 4637, 323, 253, 187, 475, 2173, 3448, 13200, 15607, 285, 7364, 187, 475, 762, 253, 4637, 15, 187, 1738, 187, 187, 10708, 4955, 15, 25563, 8716, 15, 8716, 15, 69, 3671, 28, 187, 187, 2948, 389, 15, 5546, 8601, 8716, 15, 17471, 68, 15, 4241, 4241, 16850, 6648, 28, 187, 2948, 389, 15, 5546, 8601, 8716, 15, 17471, 68, 15, 30414, 15, 4241, 4241, 31620, 28, 187, 2948, 4955, 15, 8418, 15, 33986, 1751, 15, 4663, 15, 18919, 28, 187, 2948, 4955, 15, 8418, 15, 33986, 1751, 15, 8716, 15, 16687, 39854, 28, 187, 2948, 4955, 15, 8418, 15, 33986, 1751, 15, 8716, 15, 18919, 39854, 28, 187, 2948, 4955, 15, 8418, 15, 33986, 1751, 15, 8906, 15, 16721, 7676, 28, 187, 2948, 4955, 15, 25563, 8716, 15, 9784, 15, 23865, 15, 41, 377, 68, 46, 1825, 28, 187, 2948, 4955, 15, 25563, 8716, 15, 9784, 15, 900, 15, 4963, 15, 8093, 8982, 28, 187, 2948, 4955, 15, 25563, 8716, 15, 9784, 15, 900, 15, 4963, 15, 8093, 11021, 28, 187, 2948, 4955, 15, 25563, 8716, 15, 8716, 15, 13422, 30335, 9179, 28, 187, 2948, 4955, 15, 25563, 8716, 15, 8716, 15, 13422, 2809, 472, 12168, 28, 187, 187, 2948, 7626, 15, 900, 15, 38487, 28, 187, 187, 4387, 966, 399, 3671, 13422, 9179, 8725, 14736, 30335, 9179, 551, 535, 50274, 9486, 4228, 2457, 13302, 5456, 444, 4548, 25090, 64, 4827, 3338, 426, 747, 13302, 60, 17, 2194, 187, 50274, 9486, 4228, 2457, 13302, 39854, 5456, 444, 4548, 25090, 64, 4827, 46, 64, 11708, 52, 426, 747, 13302, 39854, 60, 17, 2194, 187, 50274, 9486, 13302, 5456, 2426, 28, 187, 50274, 9486, 13302, 39854, 5456, 1307, 39854, 28, 187, 50274, 9486, 9206, 4241, 16850, 6648, 29, 2776, 13, 17078, 39854 ]
studies. The characterization of all compounds by high resolution 1H- and 13C-n.m.r. spectroscopy is also described./* * Copyright 2018 The CovenantSQL Authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package testnet import ( "testing" ) func TestParseTestNetConfig(t *testing.T) { var config = GetTestNetConfig() if config == nil { t.Fatal("testnet config should not be nil") } } Wir hatten über die Aktion von Uta Ogilvie mit dem Pappschild „Merkel muss weg“ berichtet, die heute abend stattfinden soll. Mit der Attacke auf ihr Haus vergangene Nacht sollte ihr wohl mit „Antifa“-Methoden klar gemacht werden, was auf sie wartet. Mit einem rosa Pappschild gegen Merkel Wie Merkel spaltet Das Fenster zertrümmert und mit brauner Farbe das Innere verdreckt und die Fassade beschmiert: Das ist keine andere Meinung, sondern Angst machen vor einer eigenen Meinungsäußerung. Die Reifen der Autos der Familie wurden zerstochen, die Fahrzeuge auch mit der Farbe überschüttet. Bisheriger Schaden um die 30.000 Euro. Die Ogilvies hatten Drohungen erhalten und deshalb vor dem Anschlag um Polizeischutz gebeten. Dieser wurde verweigert. Nun nach dem Geschehen, wurde zugesagt, die Streife vorbeifahren zu lassen. Familie Ogilvie wird bis auf Weiteres nicht mehr zuhause übernachten. Das Haus wird von privaten Wachmännern geschützt.Field of the Invention The field of the invention is data processing, or, more specifically, methods, apparatuses, and products for utilizing computing resources under a disabled processor node. Description of Related Art Modern computing systems can frequently include a plurality of computer processors. Each computer processor may be attached to dedicated memory modules or dedicated input/output (‘I/O’) devices that are designated for exclusive use by a single computer processor. When a particular computer processor fails, is removed, or is otherwise unavailable, the dedicated memory modules or dedicated input/output (‘I/O’) devices that are designated for exclusive use by the single computer processor also become unavailable, in spite of the fact that the dedicated memory modules or dedicated I/O devices may be perfectly functional.Q: Exception in thread "main" java.util.NoSuchElementException: No line found Sou novata em programação e o problema pede para armazenar em vetor o nome de 10 produtos. Em seguida, o programa deve solicitar a faixa de produtos que deve ser apresentada (por exemplo: de 3 a 7). O erro diz: "Exception in thread "main" java.util.NoSuchElementException: No line found at java.base/java.util.Scanner.nextLine(Scanner.java:1651) at aula2.Exercicio5.main(Exercicio5.java:21)" package aula2; import java.util.Scanner; public class Exercicio5 { public static void main(String[] args) { String [] produto = new String[10]; for (int i=1; i<=10; i++) { Scanner p = new Scanner(System.in); System.out.println("Insira o " + (i)+ "° produto de 10:"); produto[i] = p.nextLine(); p.close(); } Scanner f = new Scanner(System.in); System.out.println("Insira a faixa mínima:"); int minimo = f.nextInt(); System.out.println("Insira a faixa máxima:"); int maximo = f.nextInt(); for (int i=minimo; i<maximo+1; i++) { System.out.println(produto[i-1]); } f.close(); } } A: import java.util.Scanner; public class Exercicio5 { public static void main(String[] args) { String [] produto = new String[10]; Scanner p = new Scanner(System.in); for (int i=0; i<10; i++) { System.out.println("Insira o " + (i+1)+ "° produto de 10:"); produto[i] = p.nextLine(); } System.out.println("Insira a faixa mínima:"); int minimo = p.nextInt(); System.out.println("Insira a faixa máxima:"); int maximo = p.nextInt(); for (int i=minimo-1; i<=maximo-1; i++) { System.out.println(produto[i]); } p.close(); } } P.S. Aconselho a testar o input do utilizador para as variáveis minimo e maximo, para garantir que se encontram entre 0 e 10 e que mínimo <= máximo. Q: AS2 addCallback Type mismatch So I don't get this at all. When I put ExternalInterface.addCallback('startppt', null,"PlayPPT"); I get Type mismatch. However if i put ExternalInterface.addCallback('startppt',"PlayPPT"); It takes it fine. Doesn't work when I try to call the function. I used JQuery, normal Javascript just about everything. I think it has something to do with this issue but not certain. THIS IS ACTIONSCRIPT 2 and I check the publishing settings. Any ideas or suggestions would be awesome thanks! A: I realized that it should be ExternalInterface.addCallBack('startppt', null, PlayPPT); It wasn't the null as mismatch it was the last part I was sending a string when it was expecting a function. /* * Licensed to Elasticsearch under one or more contributor * license agreements. See the NOTICE file distributed with * this work for additional information regarding copyright * ownership. Elasticsearch licenses this file to you under * the Apache License, Version 2.0 (the "License"); you may * not use this file except in compliance with the License. * You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, * software distributed under the License is distributed on an * "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY * KIND, either express or implied. See the License for the * specific language governing permissions and limitations * under the License. */ package org.elasticsearch.search.dfs; import com.carrotsearch.hppc.ObjectObjectHashMap; import com.carrotsearch.hppc.cursors.ObjectObjectCursor; import org.apache.lucene.index.Term; import org.apache.lucene.search.CollectionStatistics; import org.apache.lucene.search.TermStatistics; import org.apache.lucene.util.BytesRef; import org.elasticsearch.common.collect.HppcMaps; import org.elasticsearch.common.io.stream.StreamInput; import org.elasticsearch.common.io.stream.StreamOutput; import org.elasticsearch.search.SearchPhaseResult; import org.elasticsearch.search.SearchShardTarget; import java.io.IOException; public class DfsSearchResult extends SearchPhaseResult { private static final Term[] EMPTY_TERMS = new Term[0]; private static final TermStatistics[] EMPTY_TERM_STATS = new TermStatistics[0]; private Term[] terms; private TermStatistics[] termStatistics; private ObjectObjectHashMap<String, CollectionStatistics
[ 273, 14603, 285, 32873, 3374, 13, 16425, 326, 253, 6158, 1057, 417, 2430, 271, 3907, 1436, 15, 187, 187, 1989, 1677, 253, 2256, 2351, 273, 32721, 14603, 13, 285, 253, 33384, 414, 13557, 403, 7032, 273, 13, 271, 3907, 1436, 476, 320, 642, 1679, 12232, 835, 14603, 310, 275, 1953, 15, 187, 187, 510, 7796, 671, 5936, 271, 1478, 14, 483, 985, 17580, 7015, 23289, 812, 8069, 5580, 616, 11315, 6055, 275, 1091, 323, 247, 2169, 16268, 15, 187, 187, 1552, 310, 247, 11527, 2934, 15, 380, 3753, 273, 253, 2628, 310, 281, 789, 275, 247, 3569, 7952, 326, 476, 1614, 327, 697, 1481, 387, 667, 1677, 673, 15, 6102, 7661, 932, 403, 3798, 2330, 342, 12337, 13, 533, 476, 1705, 387, 667, 673, 13, 17142, 407, 247, 3076, 15981, 1304, 390, 3365, 253, 29257, 1860, 494, 246, 1487, 273, 4743, 1561, 253, 12265, 9320, 15, 187, 187, 49397, 643, 8474, 15071, 275, 253, 1345, 8776, 2968, 342, 436, 4248, 273, 45583, 428, 253, 7370, 447, 403, 281, 320, 1119, 11358, 13, 275, 253, 1533, 273, 5842, 285, 253, 2136, 4450, 4461, 15, 187, 187, 22427, 403, 760, 3367, 11074, 5351, 387, 13841, 15, 1284, 6589, 9566, 2792, 562, 275, 271, 11790, 4857, 281, 253, 7796, 13, 7015, 23289, 1364, 320, 2104, 281, 513, 616, 2628, 1293, 4709, 272, 686, 29486, 6433, 665, 1537, 1089, 49307, 784, 7015, 23289, 271, 20125, 2092, 281, 253, 1039, 597, 5730, 281, 1408, 253, 6265, 5983, 187, 187, 1992, 5386, 436, 6055, 651, 11907, 816, 253, 2238, 273, 4105, 25978, 1980, 2208, 310, 26426, 2820, 281, 3553, 3212, 15, 187, 187, 21342, 13, 253, 7796, 310, 19392, 281, 816, 581, 1083, 13, 534, 310, 1740, 1107, 1711, 15, 1292, 627, 588, 1900, 320, 44355, 2219, 835, 247, 3558, 273, 4750, 24662, 281, 253, 2471, 15, 1916, 2297, 366, 253, 5161, 10843, 275, 1340, 281, 3657, 841, 7520, 2219, 651, 320, 7094, 4828, 16233, 15, 187, 187, 1556, 9566, 13, 534, 2210, 2439, 253, 18595, 407, 4839, 13, 310, 269, 14583, 326, 352, 369, 417, 33444, 13, 285, 253, 1543, 273, 7005, 2835, 352, 403, 6296, 40975, 15, 187, 187, 6436, 13, 253, 7796, 434, 5697, 403, 594, 2080, 562, 273, 5181, 342, 253, 6612, 273, 4980, 1980, 2208, 13, 352, 3133, 11543, 597, 588, 2455, 923, 253, 1708, 273, 1388, 15, 187, 187, 1394, 1537, 671, 751, 1051, 187, 187, 51, 977, 3964, 353, 3979, 7407, 253, 5962, 12061, 275, 253, 1180, 273, 2151, 2256, 281, 247, 1429, 6055, 2098, 4103, 281, 3072, 275, 4240, 14, 1093, 13, 347, 3872, 2308, 273, 2872, 952, 2783, 387, 253, 954, 2495, 273, 4092, 5237, 2559, 407, 253, 4585, 2281, 323, 1740, 1107, 15, 187, 187, 21663, 454, 3128, 2758, 452, 2361, 253, 15702, 1387, 327, 41436, 1544, 353, 3979, 281, 253, 3128, 9550, 323, 5575, 21600, 846, 247, 46395, 263, 10145, 18158, 273, 16839, 17992, 285, 7242, 275, 521, 28404, 4857, 285, 14315, 46395, 641, 2439, 7612, 48096, 504, 403, 671, 10268, 37429, 285, 253, 4322, 273, 372, 14, 27423, 15, 187, 187, 10342, 1176, 16390, 187, 187, 1145, 418, 7258, 21729, 1051, 187, 187, 1051, 72, 1644, 368, 2289, 281, 418, 7258, 11095, 15, 681, 13, 4508, 271, 440, 1148, 4781, 1070, 5447, 273, 7114, 273, 6763, 273, 7774, 9159, 253, 3668, 13, 941, 13, 12925, 285, 1083, 2175, 326, 45667, 878, 281, 32385, 12176, 285, 3157, 3238, 12547, 23728, 27, 1986, 29218, 187, 187, 1909, 309, 4288, 1475, 5791, 10497, 13, 309, 717, 594, 31115, 309, 858, 417, 5108, 281, 320, 1014, 8003, 281, 253, 2564, 14, 67, 19613, 1981, 17376, 318, 326, 310, 1335, 40132, 275, 253, 22075, 347, 247, 906, 273, 16639, 545, 3508, 388, 2284, 8202, 15, 380, 3668, 7031, 309, 452, 2326, 273, 253, 15394, 1223, 309, 369, 275, 9733, 13, 285, 717, 1024, 6523, 1060, 275, 17975, 13, 310, 816, 10155, 619, 2798, 327, 247, 5312, 3720, 15, 2058, 2069, 751, 841, 13, 352, 9193, 347, 2167, 2717, 309, 812, 513, 390, 8162, 651, 1056, 1014, 253, 246, 5391, 383, 3064, 15, 9110, 13, 309, 871, 326, 253, 19737, 273, 23866, 326, 952, 751, 479, 476, 1056, 812, 1599, 253, 3064, 875, 247, 9988, 2799, 273, 3673, 1070, 1824, 10922, 247, 8905, 7773, 390, 417, 13, 390, 247, 11393, 3739, 14235, 2970, 26114, 390, 417, 15, 1893, 13, 309, 4710, 619, 268, 2711, 610, 21078, 275, 253, 1721, 13, 285, 3524, 15, 187, 187, 2214, 667, 31754, 2190, 368, 665, 1557, 281, 513, 253, 1072, 13, 1986, 29218, 310, 1024, 11038, 7731, 23866, 281, 28177, 74, 36, 4420, 13, 380, 2448, 4410, 10547, 285, 24636, 5106, 323, 16639, 545, 3508, 388, 2284, 8202, 6619, 13, 347, 973, 347, 9159, 281, 1918, 43183, 486, 14820, 2758, 598, 281, 337, 13, 933, 4465, 17301, 6574, 323, 2403, 23866, 273, 370, 1235, 390, 625, 13, 347, 247, 5717, 368, 323, 634, 42548, 15, 1893, 13, 604, 368, 8778, 1986, 13, 285, 368, 971, 281, 1056, 247, 23672, 281, 1361, 46354, 3508, 10349, 13, 513, 352, 949, 1986, 457, 84, 23672, 4422, 13, 1060, 13, 275, 1340, 281, 1379, 5750, 273, 253, 11038, 2086, 13, 285, 281, 1750, 634, 17301, 6574, 15, 187, 187, 688, 30513, 273, 619, 1533, 4892, 16018, 13, 309, 3078, 281, 755, 368, 247, 1652, 1633, 2714, 281, 4456, 479, 407, 28, 1633, 326, 368, 812, 1158, 273, 2378, 275, 247, 1223, 13, 285, 5046, 9012, 247, 7107, 1652, 3055, 9012, 281, 4834, 326, 651, 320, 1512, 1199, 7596, 281, 5513, 281, 3780, 665, 2546, 752, 369, 594, 11755, 15, 1893, 13, 309, 2427, 281, 591, 2327, 253, 4618, 285, 12848, 4610, 327, 401, 2373, 83, 15, 187, 187, 4045, 368, 871, 670, 401, 2373, 83, 32, 401, 2373, 83, 310, 271, 3909, 27769, 13, 835, 12633, 512, 689, 253, 1533, 3959, 598, 512, 5133, 273, 10229, 390, 3238, 323, 253, 665, 2784, 7004, 4376, 273, 370, 22, 15, 16942, 327, 401, 2373, 83, 310, 2620, 8918, 1128, 2369, 625, 13, 642, 1679, 15, 7757, 253, 1416, 15, 5595, 273, 352, 310, 2238, 273, 11339, 13, 533, 690, 273, 352, 310, 1175, 13, 285, 690, 273, 352, 310, 816, 8342, 37750, 15, 6491, 9159, 4092, 1841, 13, 751, 2136, 5827, 13, 35905, 13, 519, 480, 272, 868, 13, 18479, 11809, 13, 2801, 2957, 37829, 390, 3733, 5827, 13, 403, 4518, 2509, 352, 347, 247, 2957, 6657, 13, 11525, 326, 2852, 2136, 4409, 625, 685, 2620, 33096, 588, 956, 15, 19810, 403, 24509, 3390, 288, 19074, 447, 13, 824, 347, 4028, 1841, 327, 247, 5313, 273, 11789, 13, 390, 33797, 562, 8169, 327, 247, 1810, 37588, 934, 4450, 275, 3523, 14, 26049, 3085, 15, 11706, 2571, 403, 816, 259, 471, 324, 1062, 1771, 15, 9240, 403, 619, 7583, 15, 309, 574, 271, 519, 598, 327, 401, 2373, 83, 323, 247, 1223, 13, 9159, 281, 564, 15729, 253, 13988, 4103, 273, 634, 4327, 13, 1561, 2030, 6574, 273, 5003, 10765, 13, 323, 370, 22, 15, 29902, 13, 987, 32, 5402, 27078, 13134, 280, 290, 310, 275, 247, 1728, 275, 2065, 785, 13, 285, 368, 476, 457, 85, 755, 627, 323, 617, 11456, 5784, 14348, 32, 401, 2373, 83, 281, 253, 14471, 15, 23177, 247, 3047, 24507, 949, 12286, 17183, 13, 285, 45722, 40081, 310, 327, 617, 1039, 281, 7257, 253, 1943, 13, 5890, 13, 3896, 763, 90, 15729, 368, 476, 457, 85, 15, 309, 1014, 5907, 247, 773, 42494, 27638, 1959, 668, 4500, 13, 835, 309, 651, 9023, 417, 281, 8251, 44221, 390, 253, 14818, 414, 13, 48496, 314, 2257, 621, 309, 717, 594, 14753, 273, 13, 604, 627, 497, 26710, 14, 12198, 16762, 281, 320, 2783, 15, 1292, 13, 352, 8058, 45783, 13, 984, 1014, 2167, 309, 369, 2590, 670, 253, 773, 293, 491, 314, 668, 629, 275, 253, 519, 13, 8505, 13, 326, 457, 84, 417, 347, 39662, 347, 309, 574, 1869, 13, 285, 309, 4934, 2970, 9762, 432, 2872, 6068, 2820, 281, 5007, 479, 281, 15729, 616, 773, 32633, 968, 668, 390, 773, 328, 5005, 1806, 285, 39795, 369, 13213, 1037, 27086, 281, 564, 2112, 285, 320, 619, 2133, 18625, 327, 15729, 21820, 13, 594, 13, 10902, 19639, 2752, 401, 2373, 83, 5249, 4962, 1078, 352, 2455, 1694, 745, 253, 3216, 13, 285, 4130, 457, 84, 6912, 14564, 1711, 12633, 403, 1024, 1469, 20209, 814, 2400, 13, 512, 984, 273, 690, 17081, 90, 31147, 342, 2717, 1805, 281, 513, 685, 26603, 401, 2373, 83, 15, 1292, 309, 2836, 560, 15, 8247, 281, 634, 9140, 15, 187, 187, 2598, 13, 3066, 401, 2373, 83, 13, 309, 1119, 436, 13491, 21205, 1253, 665, 5841, 2994, 773, 36, 5744, 3847, 3083, 668, 1253, 2211, 839, 275, 247, 1355, 7773, 9366, 275, 5427, 13, 665, 13, 323, 253, 18979, 2620, 8918, 13, 588, 1691, 667, 3935, 368, 971, 327, 247, 861, 13, 285, 45917, 2259, 2994, 18792, 1475, 342, 352, 275, 752, 4453, 751, 247, 269, 10422, 10583, 390, 36767, 10617, 27768, 15, 773, 48, 1368, 13, 3962, 1806, 309, 1869, 15, 1893, 13, 309, 2197, 779, 247, 2748, 323, 824, 247, 3492, 13, 285, 2620, 8918, 13, 285, 2546, 326, 253, 861, 1239, 773, 3864, 249, 2296, 27, 330, 22728, 13, 10210, 2706, 11602, 31837, 951, 13, 533, 794, 15, 3771, 752, 309, 3078, 15, 330, 5744, 3847, 3083, 3531, 253, 1340, 1475, 3809, 28, 247, 1388, 1996, 13, 253, 1563, 3492, 369, 275, 619, 4579, 34272, 27, 187, 187, 5035, 70, 14, 90, 319, 2700, 13, 2325, 27462, 4672, 49719, 2, 754, 1663, 1691, 521, 2798, 715, 326, 3045, 2, 1292, 13, 344, 1669, 745, 253, 773, 3864, 249, 2296, 668, 629, 13, 285, 309, 871, 627, 403, 247, 1643, 273, 368, 13, 665, 3091, 3464, 9557, 6134, 13, 665, 5082, 457, 85, 2868, 326, 309, 8715, 457, 85, 816, 1863, 532, 264, 436, 745, 15167, 432, 3095, 2010, 285, 7558, 281, 452, 26237, 352, 4266, 15, 1244, 309, 971, 253, 6152, 13, 4344, 285, 6278, 15, 1893, 13, 309, 4159, 281, 330, 5744, 3847, 13, 285, 753, 849, 1199, 309, 7636, 253, 3492, 13, 285, 352, 369, 594, 9386, 13, 285, 6701, 594, 1199, 13, 533, 4496, 13, 812, 344, 513, 352, 969, 13, 285, 1691, 773, 3864, 249, 2296, 668, 327, 253, 861, 15, 4683, 2282, 13, 309, 753, 309, 651, 2075, 1529, 2620, 8918, 13, 642, 1895, 15, 309, 753, 344, 812, 1014, 3630, 352, 327, 253, 643, 1930, 273, 253, 1072, 2929, 13, 285, 816, 19153, 352, 1475, 15, 773, 9281, 1806, 2296, 330, 5744, 3847, 13, 773, 2369, 1895, 1425, 2635, 13, 253, 1735, 1388, 13, 436, 3492, 3249, 27, 187, 187, 4497, 2866, 1439, 3240, 15, 309, 1599, 13, 309, 2389, 326, 253, 2644, 7773, 310, 2970, 3206, 275, 619, 2199, 13, 285, 253, 16901, 403, 2119, 13491, 13, 533, 1024, 309, 452, 581, 3492, 342, 253, 6838, 285, 253, 773, 3864, 249, 49918, 668, 861, 13, 285, 1529, 342, 330, 5744, 3847, 2994, 285, 253, 773, 36, 22728, 13, 10210, 2706, 11602, 861, 13, 285, 326, 2506, 457, 85, 1663, 8415, 619, 1895, 15, 1893, 13, 309, 4159, 779, 896, 13, 35891, 779, 1801, 316, 600, 969, 13, 1021, 311, 1070, 253, 10763, 273, 253, 2255, 275, 253, 747, 3492, 13, 26108, 616, 18792, 285, 253, 15143, 861, 13, 285, 840, 2546, 779, 281, 13, 3965, 4496, 13, 513, 352, 969, 1128, 1542, 1529, 2620, 8918, 13, 273, 2282, 1128, 3113, 378, 31407, 7871, 15, 309, 15433, 13, 1580, 597, 574, 1097, 7871, 1160, 1024, 13, 253, 2626, 673, 651, 320, 253, 22611, 15, 309, 476, 816, 5406, 731, 512, 7063, 627, 275, 616, 7773, 13, 3981, 773, 1276, 1057, 703, 971, 1024, 13, 285, 2139, 1057, 703, 1978, 6890, 352, 7721, 285, 773, 10002, 2010, 476, 359, 755, 275, 327, 253, 3045, 7721, 1292, 13, 281, 479, 13, 344, 816, 753, 8261, 13, 2119, 15, 1244, 840, 436, 3492, 2692, 598, 247, 2159, 673, 1996, 27, 187, 187, 2598, 2810, 2, 6089, 13, 417, 4555, 15, 1292, 13, 1007, 849, 1199, 789, 597, 1691, 715, 436, 13, 342, 616, 1652, 36872, 10555, 742, 11012, 10934, 285, 3253, 15, 1359, 7353, 403, 597, 32, 11706, 13, 309, 2686, 3078, 2305, 15, 330, 5744, 3847, 5561, 249, 457, 562, 275, 521, 4759, 30433, 76, 4580, 13, 285, 309, 1053, 457, 85, 871, 752, 773, 35, 300, 2706, 668, 403, 13, 533, 597, 3590 ]
of capability and disciplinary issues, arguing that the latter does not require an independent person. But given the subjectivity of judging capability, and the irrationality politicians are capable of, an independent person can be no less vital where capability is in question. The assembly also suggests an opt-out system whereby chief executives could effectively sell their statutory protection in return for a higher salary. This is a terrible idea. The nature of the job is to work in a political climate that can turn on its head at any given time. Such reversals are usually associated with elections, but can come at any time, triggered by a bad inspection report or simply the inexplicable tides of opinion within the council chamber. Few other senior managers in the public sector deal with this degree of insecurity - the analogies are to be found elsewhere, in the world of football and the business boardroom. Nor are only personal travails at stake. As ALACE points out in an angry letter to the assembly, chief executives must be able to do their job without fearing 'politicians who might find conscientious chief executives an impediment to the way they wish to run the authority'. To remove this protection would encourage just the kind of poor governance local government is desperately trying to leave behind. Moreover, the assembly is responding to just one case, which is four years old. But there will always be rogue cases where a member of staff fights to the death. To negate the core legislation in order to prevent these rare cases would be entirely counterproductive. ALACE, which came across the proposals by chance, is fuming that it was not consulted, and the results of omitting it are indeed alarming. However, the assembly's ideas are so far out of touch with the reality of modern local government, it seems unlikely they will ever see the light of day. You might also like... Rotherham MBC experienced the biggest surge in the number of children subject to a child protection plan relative to population in 2017-18, as national levels of young people considered at the most risk of serious harm increased by the highest rate for four years. Labour party members have reported the Labour group on Wirral MBC to the party leadership for alleged misconduct after a councillor accused activists of intimidation and abuse in his resignation letter and warned councillors across Merseyside are also facing hostility and the threat of de-selection. Most Commented An LGC subscription... ...gives you access to LGCplus.com, containing an unparalleled database of tens of thousands of articles offering the news, data, guidance and case studies that councils need to withstand cuts and improve servicesTag Archives: United Airlines As I travel around East Asia, I am so thankful I did not happen to be even closer to the mind-boggling devastation that is still unfolding in the Philippines as a result of Typhoon Haiyan. The news coverage I have seen of the disaster while I was in Korea, and am now seeing here in Taiwan, is just breaking my heart on a daily basis. At times like these, it feels as though nothing I could do or contribute would make even the tiniest difference. Yet, I know that the aggregate of donations that people like me can make could mean the difference between a truckload of bottled water reaching a remote village or not, or a rural medical clinic getting medicines or not. So, I throw my paltry coins in the pot, and hope. For any travelers among you who care to do the same, United Airlines is now matching customer donations to AmeriCares, The American Red Cross and Operation USA for Typhoon Haiyan relief, as well as offering to give Mileage Plus members up to 1,000 extra bonus miles for making donations of $50 or more, as a thank you for your generosity. So, if you fly United, and you want to make a donation to help typhoon victims, do it through United’s donation website, here, in order to take advantage of the matching program, and to claim your bonus miles. In anticipation of my world tour departure, I wanted to get you a little something special to remember me by; something that you could think of once in a while, and maybe laugh a quiet little private laugh to yourself that would be too much trouble to explain to anyone who asked what was so funny. So, I went to peruse the wide and varied options on Fiverr. Do you know about Fiverr? Fiverr is an online marketplace, where folks all over the world offer up all manner of goods or services for the whopping asking price of $5. Everything on Fiverr is five dollars—no more, no less. Hence the name. Most of it is kind of stupid, but some of it is good, and some of it is just plain hilarious. People offering serious things, like business plans, budgets, ad jingles, logo designs, weight loss menus or training plans, are clearly doing it as a loss leader, hoping that future business worth more than five bucks will follow. Others are indulging hobbies, such as writing things on a piece of rice, or spelling out messages on a Scrabble board in stop-motion film. Still others are just wackadoolery. Those are my favorite. I had an ad up on Fiverr for a while, offering to go hug the elderly relative of your choice, within 25 miles of San Francisco, for $5. Nice, right? Your Aunt Millicent is in a home in Colma, and you can’t get there for her 93rd birthday? Fiverr to the rescue. Half a sawbuck through Paypal, and Miz Quin is on her way to deliver the big, warm, squishy hug you can’t. I even offered a “fragrance free” option, where I would promise not to wear perfume or the fruity, girly lotions I am so fond of, if there were scent-sitivities to be considered. But, it proved impractical, because even though I was clear about the “elderly” part in the ad, apparently, that’s not as unambiguous as I had thought, and I kept getting requests from young guys trying to send me to hug their “cousins” or “uncles,” and Fernando was categorically unwilling to go along and be my bodyguard on hug patrol, so, yeah…. My Fiverr career died before it ever got off the ground, and everyone’s Bay Area old folks are now going unhugged, all because of some horny teenagers with nothing better to do than cruise Fiverr. But I digress. Back to your gift. So, via Fiverr, I found this lovely gentleman– who calls himself “Crazzy Man”–operating in a small village somewhere in India, who, for the aforementioned five dollars, will put any message you want on a sign, and videotape himself dancing around with it in what looks like a faux grass or banana leaf skirt. “Ooh, perfect,” I thought. So, I sent him a request for such a video, and five dollars, and asked that the sign read “Quin says: Ciao, Bitches!” Saucy, but fun. Just what I wanted. Crazzy Man turned the order around fast; a day later, the following video was in my email inbox: Seee-yowwww, Beeches!! Awesome! He really put his heart into that performance! But, he left off the “Quin says” part, and I know there are a few of you, who shall remain nameless, who wouldn’t believe that I hadn’t just swiped this off YouTube from someone else and claimed to have commissioned it myself. And I want the credit, fair and square. So, I wrote to Crazzy, and said how much I loved the video, and it was so wonderful, and thanks so much, but please, could he do it again, and put “Quin says” on the sign. Of course, I said I would pay another five dollars, no problem. I said he could even write it on the other side of the same paper, and just flip it around. “Okay,” says Crazzy, “no problem.” Then, the next day, this video comes: Well…not quite. I mean, I love that the whole village is getting involved in my project, and the ladies are sure lovely, but now I have one video with the girls and the “Quin Says” sign, and another with Crazzy himself and the “Ciao, Bitches!” sign, and that doesn’t really solve my problem. So, I wrote him back, thanked him profusely again, extolled the beauty of the women in the new video, praised their dancing and the fantastic sign, and then asked him to, pretty please, do it again—for another five dollars, of course—with BOTH signs. I figured, since they had both signs made now, the third time would be the charm. I can just picture them all sitting there in their village, saying “What does she want now, and why does she keep changing it?” and “who else can we get in on the performance?” But, to me, he just said okay, sure. And then this video showed up a short time later: So close! Well, not exactly. But, look how much work they put into this, with their little choreographed dance routine and everything. How sweet are they? Still, I actually wanted Mr. Crazzy rockin’ out in his green manskirt, and I don’t know what “Bilches” are, but they sound
[ 4223, 13, 4059, 13, 2908, 30188, 12640, 562, 34732, 342, 9235, 47, 285, 7915, 46573, 313, 8196, 313, 3583, 15, 24, 2673, 10798, 10, 432, 1384, 31519, 757, 8238, 13, 15918, 285, 18430, 13, 1599, 2363, 9654, 15, 20, 3069, 26, 15, 25, 313, 6324, 13, 3387, 14, 4739, 10, 1107, 15, 380, 1263, 29738, 369, 275, 8956, 342, 16289, 7465, 273, 253, 15772, 390, 9933, 5506, 9353, 327, 1966, 40290, 285, 342, 253, 34159, 27113, 273, 14752, 13, 347, 17265, 275, 11299, 15, 329, 3542, 8191, 7578, 369, 2797, 432, 512, 1363, 1078, 616, 47132, 420, 275, 253, 1263, 285, 271, 9612, 273, 253, 1263, 369, 2797, 432, 253, 1980, 18035, 9353, 15, 187, 187, 688, 3444, 6866, 187, 22928, 187, 187, 510, 1263, 11250, 6866, 497, 347, 3637, 27, 337, 10, 1363, 342, 5667, 9235, 47, 285, 7915, 46573, 313, 35861, 281, 253, 1655, 5284, 9600, 323, 6120, 285, 1971, 273, 841, 6578, 558, 374, 10, 1363, 327, 29964, 3270, 41537, 3134, 285, 11764, 14, 676, 2158, 4918, 13, 417, 17170, 253, 2303, 17641, 285, 16, 263, 24219, 14, 36, 2193, 2556, 281, 253, 1655, 5284, 9600, 2479, 83, 22, 1092, 1008, 83, 25, 3291, 387, 12667, 18, 1770, 273, 1971, 17000, 28, 495, 10, 1363, 10568, 3270, 41537, 3134, 285, 11764, 14, 676, 2158, 4918, 2556, 281, 253, 1655, 5284, 9600, 13, 533, 417, 6883, 12358, 4918, 1078, 11250, 275, 253, 1263, 28, 577, 10, 17887, 956, 14, 484, 275, 253, 2282, 273, 495, 2607, 846, 17000, 273, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 1971, 28, 285, 608, 10, 271, 8191, 7578, 432, 253, 3110, 281, 10078, 275, 253, 1263, 15, 187, 187, 1672, 3444, 6866, 187, 22928, 187, 187, 1672, 3444, 6866, 497, 347, 3637, 27, 337, 10, 1929, 6561, 14300, 285, 16, 263, 7915, 46573, 28, 374, 10, 2303, 17641, 285, 16, 263, 11764, 2308, 6786, 407, 253, 10800, 4918, 28, 495, 10, 1929, 10021, 2538, 432, 2045, 2793, 390, 1246, 15563, 527, 13211, 281, 667, 273, 253, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 322, 5077, 4295, 28, 577, 10, 1363, 2168, 327, 13493, 5312, 6178, 273, 717, 39079, 532, 460, 313, 740, 5770, 10, 285, 16, 263, 387, 263, 35982, 5009, 313, 1438, 5770, 582, 417, 17170, 253, 2303, 17641, 285, 16, 263, 11764, 2308, 28, 608, 10, 3110, 434, 19963, 281, 320, 4127, 342, 253, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 322, 5077, 28, 285, 721, 10, 37593, 2322, 273, 3110, 956, 14, 484, 275, 253, 2282, 273, 495, 2607, 323, 5913, 1921, 15, 187, 187, 19799, 512, 1363, 13, 28804, 313, 2222, 15, 18, 2673, 574, 3270, 41537, 3134, 1971, 13, 533, 574, 417, 6786, 253, 2303, 17641, 2193, 5747, 5019, 4918, 342, 374, 281, 495, 5835, 275, 954, 273, 731, 313, 22981, 273, 28804, 13, 11107, 15, 21, 10970, 743, 41600, 14, 585, 31324, 9548, 10680, 574, 644, 2908, 275, 4918, 273, 12643, 313, 2385, 15, 23, 2673, 1363, 13, 247, 11672, 5048, 45859, 369, 2668, 407, 11681, 313, 1610, 15, 20, 9498, 271, 41600, 3719, 14, 44501, 45859, 407, 11003, 313, 1812, 15, 19, 9498, 247, 9840, 14, 6172, 254, 407, 21786, 313, 3763, 15, 23, 9498, 247, 289, 13306, 504, 1073, 459, 3028, 407, 655, 313, 24, 15, 25, 9498, 285, 643, 17641, 14, 676, 2158, 5835, 407, 3349, 313, 883, 15, 22, 2673, 1363, 15, 380, 1599, 1180, 273, 3270, 41537, 3134, 23368, 2959, 407, 253, 41039, 1363, 369, 495, 15, 17, 3069, 18, 15, 22, 313, 17, 14, 25, 2262, 374, 23368, 407, 5693, 313, 1423, 15, 17, 9498, 495, 23368, 407, 10484, 313, 1671, 15, 20, 9498, 577, 23368, 407, 6931, 313, 1166, 15, 26, 2673, 285, 608, 23368, 407, 2030, 313, 740, 15, 20, 2673, 1363, 15, 187, 187, 25347, 555, 14, 23587, 313, 1630, 15, 23, 2673, 1363, 574, 644, 327, 1098, 249, 1971, 1078, 11250, 275, 253, 1263, 13, 285, 4562, 313, 2950, 15, 20, 2673, 273, 731, 574, 2959, 387, 263, 35982, 5009, 15, 187, 187, 3074, 1363, 497, 6760, 323, 15173, 2495, 15, 380, 4155, 1420, 6392, 1406, 552, 22887, 27605, 313, 4061, 11156, 10, 1566, 2479, 83, 22, 1092, 1008, 83, 25, 3291, 369, 908, 281, 2939, 253, 7880, 884, 14, 2913, 2495, 273, 15444, 10177, 2362, 275, 30192, 1363, 342, 13440, 15371, 15, 380, 2879, 15173, 2495, 369, 7515, 275, 10781, 561, 1644, 342, 15371, 285, 16, 263, 749, 20892, 2303, 1963, 4723, 390, 19486, 15173, 390, 1327, 14, 9290, 14427, 10552, 15, 380, 2495, 369, 1119, 281, 320, 10290, 275, 5571, 313, 1867, 15, 20, 2673, 285, 1029, 275, 24687, 313, 3046, 15, 24, 2673, 1363, 15, 187, 187, 3074, 1363, 17692, 275, 776, 1263, 3053, 1971, 342, 581, 273, 253, 1563, 12768, 273, 253, 322, 5077, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 313, 40, 13616, 251, 5612, 350, 1847, 68, 904, 29171, 2262, 884, 16, 22, 13, 884, 16, 740, 13, 1384, 16, 22, 390, 1384, 16, 740, 5770, 5312, 342, 598, 14, 39584, 1589, 387, 4143, 337, 672, 3309, 15, 380, 24411, 369, 3413, 407, 253, 12767, 12878, 1754, 327, 253, 17641, 285, 24219, 14, 36, 2193, 285, 253, 1268, 273, 2060, 15173, 2495, 347, 973, 15, 187, 187, 510, 29747, 12358, 369, 4821, 5734, 352, 369, 247, 11672, 5048, 45859, 390, 1098, 249, 15, 380, 2180, 273, 3110, 956, 14, 484, 369, 495, 2607, 342, 3382, 12941, 387, 253, 990, 273, 2607, 337, 285, 495, 846, 17000, 273, 322, 5077, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 1971, 15, 2058, 8245, 285, 387, 1016, 956, 14, 484, 4143, 13, 3906, 17641, 6814, 369, 2684, 846, 884, 14, 1222, 1551, 275, 7063, 1899, 13, 7019, 387, 253, 1327, 14, 33285, 386, 4430, 342, 337, 14, 1222, 7726, 875, 253, 6341, 15, 6408, 956, 14, 484, 12941, 13, 7000, 3739, 2892, 369, 2668, 670, 1971, 24020, 13, 1728, 17641, 1453, 285, 3361, 273, 10021, 2538, 313, 12648, 481, 496, 1363, 417, 17170, 253, 2303, 17641, 285, 16, 263, 24219, 14, 36, 2308, 8521, 407, 253, 1655, 24620, 273, 253, 5284, 8273, 273, 9858, 10537, 13, 271, 2572, 275, 253, 6178, 273, 253, 41548, 5019, 369, 2783, 15, 187, 187, 3404, 8245, 285, 387, 1770, 495, 13, 253, 1563, 11764, 3602, 497, 6730, 27, 19171, 13, 24219, 14, 36, 13, 1029, 14, 20425, 30823, 13559, 313, 44139, 14, 36, 10, 285, 47153, 313, 16854, 481, 187, 187, 39854, 187, 9962, 187, 187, 21214, 1783, 369, 4824, 562, 342, 32500, 7605, 5522, 13, 2715, 1668, 15, 17, 313, 52, 21851, 3690, 13, 8068, 13, 5274, 13, 5106, 481, 5128, 497, 4469, 407, 11383, 285, 26026, 323, 31091, 4903, 13, 285, 407, 8723, 13, 13493, 13, 1599, 2193, 285, 2629, 11254, 323, 5415, 4903, 15, 21594, 10047, 497, 1160, 407, 970, 253, 3907, 23977, 63, 19, 8011, 2566, 13, 246, 14, 2566, 13, 285, 18929, 15, 380, 1268, 273, 7605, 8453, 369, 873, 387, 268, 4713, 17, 15, 1762, 15, 187, 187, 9340, 187, 6877, 187, 187, 60, 2841, 337, 1084, 71, 18, 910, 709, 14, 881, 568, 926, 986, 2722, 253, 17632, 2281, 273, 253, 5867, 577, 6178, 13553, 273, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 387, 8245, 13, 1770, 337, 285, 1770, 495, 15, 187, 187, 3138, 13349, 3459, 273, 1027, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 13553, 281, 1263, 3072, 387, 8245, 13, 1770, 337, 285, 1770, 495, 15, 884, 16, 22, 5770, 27, 268, 30, 17, 15, 2941, 323, 8245, 475, 10936, 5929, 1770, 337, 285, 1770, 495, 28, 268, 30, 4883, 323, 1770, 337, 475, 10936, 5929, 1770, 495, 28, 884, 16, 740, 5770, 27, 268, 30, 17, 15, 520, 323, 8245, 475, 10936, 5929, 1770, 337, 285, 268, 30, 17, 15, 2125, 475, 10936, 5929, 1770, 495, 13, 268, 30, 17, 15, 2941, 323, 1770, 337, 475, 10936, 5929, 1770, 495, 28, 1384, 16, 22, 5770, 27, 268, 4713, 17, 15, 5831, 323, 8245, 475, 10936, 5929, 1770, 337, 285, 1770, 495, 28, 268, 30, 4883, 323, 1770, 337, 475, 10936, 5929, 1770, 495, 28, 1384, 16, 740, 5770, 27, 268, 30, 17, 15, 2640, 323, 8245, 475, 10936, 5929, 1770, 337, 285, 1770, 495, 28, 268, 30, 4883, 323, 1770, 337, 475, 10936, 5929, 1770, 495, 15, 6640, 426, 14122, 525, 13907, 28, 268, 426, 1268, 273, 7605, 8453, 880, 3649, 14, 3011, 14, 41328, 14, 71, 18, 4253, 71, 18, 94, 187, 187, 510, 1599, 29479, 2614, 3473, 313, 52, 7282, 10, 285, 33767, 2614, 3473, 313, 37, 7282, 10, 2193, 273, 253, 5867, 1387, 273, 1363, 387, 8245, 285, 387, 253, 990, 273, 1770, 337, 285, 495, 403, 2011, 275, 544, 3235, 337, 1084, 85, 18, 910, 709, 14, 881, 568, 2420, 4982, 5727, 544, 2841, 374, 1084, 71, 19, 910, 709, 14, 881, 568, 926, 986, 18303, 253, 8062, 273, 17641, 1309, 253, 956, 14, 484, 2180, 15, 187, 187, 5146, 5619, 296, 3422, 285, 33767, 2614, 3473, 2193, 275, 1263, 3072, 387, 8245, 285, 387, 956, 14, 484, 12941, 1309, 253, 1971, 2180, 535, 50276, 19628, 187, 50276, 21469, 575, 30456, 3473, 50275, 21469, 575, 10292, 1983, 61, 50275, 21469, 575, 9684, 1983, 61, 50275, 21469, 575, 12515, 61, 50273, 21469, 575, 20842, 61, 187, 50255, 21469, 575, 2877, 61, 50273, 21469, 575, 2877, 61, 50273, 21469, 575, 2877, 61, 50274, 21469, 575, 3620, 2492, 187, 50255, 21469, 575, 9, 2188, 29513, 10, 50274, 21469, 575, 9, 2188, 29513, 10, 50274, 21469, 575, 9, 2188, 29513, 10, 50275, 187, 50276, 15879, 16913, 16913, 15369, 18592, 187, 50276, 21469, 575, 44845, 45713, 50273, 21469, 575, 16607, 50270, 21469, 575, 1518, 50270, 21469, 575, 15054, 15, 2251, 50274, 21469, 575, 1036, 15, 1797, 535, 50276, 21469, 575, 44845, 399, 7282, 50273, 21469, 575, 2270, 50269, 21469, 575, 14711, 50270, 21469, 575, 4529, 15, 2941, 50273, 21469, 575, 26, 15, 1508, 535, 50276, 21469, 575, 52, 7282, 1969, 1770, 337, 50275, 21469, 575, 12224, 50270, 21469, 575, 21092, 50270, 21469, 575, 12434, 15, 2090, 50274, 21469, 575, 1012, 15, 3046, 535, 50276, 21469, 575, 37, 7282, 1969, 1770, 337, 50275, 21469, 575, 1967, 50269, 21469, 575, 10655, 50270, 21469, 575, 3245, 15, 3156, 50273, 21469, 575, 23, 15, 1237, 535, 50276, 21469, 575, 52, 7282, 1969, 1770, 495, 50275, 21469, 575, 11124, 50270, 21469, 575, 16989, 50270, 21469, 575, 15220, 15, 2055, 50274, 21469, 575, 1731, 15, 4148, 535, 50276, 21469, 575, 37, 7282, 1969, 1770, 495, 50275, 21469, 575, 2082, 50269, 21469, 575, 2270, 50269, 21469, 575, 1438, 15, 1540, 50273, 21469, 575, 22, 15, 2922, 187, 50276, 19628, 187, 187, 37, 7282, 426, 33767, 2614, 3473, 28, 45713, 426, 29479, 2614, 3473, 187, 187, 3138, 37, 22517, 273, 29479, 285, 33767, 2614, 3473, 275, 1263, 3072, 846, 17000, 273, 1971, 342, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 15, 399, 7282, 426, 33767, 2614, 3473, 28, 45713, 426, 29479, 2614, 3473, 28, 6640, 426, 14122, 525, 13907, 28, 268, 426, 1268, 273, 7605, 8453, 880, 3649, 14, 3011, 14, 41328, 14, 71, 19, 4253, 71, 19, 94, 187, 187, 510, 21539, 2281, 273, 17641, 13, 2931, 323, 776, 1263, 347, 45713, 4398, 12434, 285, 399, 7282, 4398, 2270, 5823, 29513, 26786, 2227, 5823, 29513, 323, 17435, 1363, 10, 275, 8956, 342, 253, 1655, 4072, 49817, 24620, 323, 1971, 273, 18571, 14300, 2479, 83, 22, 3291, 369, 347, 3637, 27, 187, 187, 18, 15, 50276, 255, 1770, 337, 27, 9975, 35, 4398, 12434, 5823, 29513, 369, 6786, 407, 20825, 313, 1549, 15, 22, 2673, 285, 399, 7282, 4398, 2270, 5823, 29513, 407, 26235, 313, 1976, 15, 20, 2673, 1363, 28, 268, 4713, 17, 15, 5831, 475, 10936, 5929, 8245, 28, 187, 187, 19, 15, 50276, 255, 1770, 495, 27, 9975, 35, 4398, 12434, 5823, 29513, 369, 6786, 407, 20105, 313, 3547, 15, 18, 2673, 285, 399, 7282, 4398, 2270, 5823, 29513, 407, 27587, 313, 4739, 15, 17, 2673, 1363, 28, 268, 4713, 17, 15, 5831, 475, 10936, 5929, 8245, 285, 1770, 337, 15, 187, 187, 510, 1599, 45713, 285, 399, 7282, 2193, 273, 1363, 4127, 342, 253, 954, 7208, 15588, 24411, 273, 884, 16, 22, 5770, 273, 253, 322, 5077, 273, 387, 263, 35982, 5009, 16, 16878, 351, 532, 460, 403, 2011, 275, 544, 3235, 374, 1084, 85 ]
August, 2014, included 243 consecutive outpatients with HTN and dyslipidemia (128 (52.7%) males) from 20 Bulgarian cities, towns and villages, mean age 63.3±9.8 (range, 40-91) years. The study conductance was in accordance with ethical standards of the institutional or regional responsible committee on human experimentation and with the Helsinki Declaration of 1975, as revised in 1983. A written informed consent was obtained from all patients before their enrolment in the study and an approval of the study was obtained from the local ethics committee. Inclusion criteria ------------------ The study inclusion criteria were as follows: 1) patients with essential HTN and dyslipidemia (according to the current European guidelines for diagnosis and treatment of these diseases); 2) patients on outpatient antihypertensive and lipid-lowering therapy, not achieving the target BP and/or LDL-C values according to the current European guidelines ([@r5], [@r8]) at ≥1 month of treatment initiation; 3) patients requiring antihypertensive and lipid-lowering therapy according to the current European guidelines, but not receiving medication therapy before inclusion in the study; 4) feasible follow-up in the course of 3 months after initiation of atorvastatin/amlodipine treatment; and 5) an informed consent from the patient to participate in the study. Exclusion criteria ------------------ Exclusion criteria were as follows: 1) known secondary hypertension and/or dyslipidemia; 2) target BP and/or lipid levels achieved by the ongoing therapy; 3) known adverse effects from previous experience or present contraindications to any of the atorvastatin/amlodipine SPC components; 4) patients already on maximal daily dose of amlodipine (10 mg) and/or atorvastatin (80 mg), not achieving the target BP and/or lipid levels; 5) patient's refusal to be treated with the atorvastatin/amlodipine SPC; and 6) impossibility of patient follow-up in the course of 3 months for whatever reason. Among all patients, 231 (95.1%) had antihypertensive treatment, but had not achieved the target BP values despite combination therapy with 2 to 3 drugs in most of them (218 of 231, 94.4%). An angiotensin-converting enzyme inhibitor had been included in therapy of 118 (48.6%) patients, a calcium channel blocker was taken by 81 (33.3%), an angiotensin II-receptor blocker by 88 (36.2%), a beta-blocker by 152 (62.6%), a thiazide diuretic by 19 (7.8%), and other BP-lowering drugs by 28 (11.5%) patients. The mean number of antihypertensive tablets received by the hypertensive patients was 3.0±1.5 (0-8): 2 tablets by 48 (22.0%), 3 tablets by 77 (35.3%), 4 tablets by 39 (17.9%) and 5 tablets by 25 (10.3%) patients. Sixty-seven (27.6%) patients had been on statin treatment before inclusion in the study, and 31 (46.3%) of them had received atorvastatin. All patients were evaluated for CV risk. The Systematic COronary Risk Evaluation (SCORE) model ([@r5], [@r8]) was used to assess the absolute 10-year risk of fatal cardiac event in asymptomatic patients with cardiovascular RF. The added CV risk was assessed in hypertensives with RF and/or subclinical target organ damage or overt CV or non-cardiac complications. The risk was found to be moderate in 70 (39.3%) and high in 173 (59.7%) patients. All patients enrolled in our study started treatment with one of the following doses of the SPC atorvastatin/amlodipine (Gedeon Richter Plc., Hungary): 10/5, 10/10, 20/5 or 20/10 mg daily with up-titration at visit 1 when necessary. The dosage was determined by the treating physician based on the BP and LDL-C values and the level of individual CV risk as well. The concomitant medication was continued unless it was a calcium channel blocker or statin. The period of patient follow-up was 3 months with clinical visits at the end of months 1 and 3 after initiation of SPC atorvastatin/amlodipine treatment. At baseline and at each follow-up visit, office BP measurement was performed after 10-min rest in sitting position, twice at the non-dominant arm with 1-min interval between the measurements. During follow-up visits, detailed medical history was taken about treatment regimen, home BP control and presence of adverse effects (AE). In patients not achieving the target BP and/or LDL-C levels recommended by the current Guidelines of the European Society of Cardiology, an increase in the dose of the researched combination was considered. At baseline and at month 3, the following lipid parameters were examined: TC, LDL-C, high-density lipoprotein cholesterol (HDL-C) and triglycerides (TG). Statistics ---------- Statistical analysis was carried out with SPSS statistical package, version 16.0 (SPSS Inc, Chicago, IL, USA). Data were expressed by frequencies and percentages for categorical variables, and by minimal, maximal, mean values and standard deviation for continuous variables. Comparisons were made by using the independent χ^2^-test, t-test, and ANOVA. The level of statistical significance was set at p\<0.05. Results ======= [Figure 1](#f1){ref-type="fig"} shows the prescription rate of the analyzed 4 dose combinations of atorvastatin/amlodipine at baseline, month 1 and month 3. ![Prescription of different atorvastatin/amlodipine combinations to study population at baseline, month 1 and month 3. 10/5 mg: p=0.03 for baseline *vs.* month 1 and month 3; p=NS for month 1 *vs.* month 3; 10/10 mg: p=0.01 for baseline *vs.* month 1 and p=0.04 *vs.* month 3, p=0.03 for month 1 *vs.* month 3; 20/5 mg: p\<0.0001 for baseline *vs.* month 1 and month 3; p=NS for month 1 *vs.* month 3; 20/10 mg: p=0.02 for baseline *vs.* month 1 and month 3; p=NS for month 1 *vs.* month 3. NS = nonsignificant; p = level of statistical significance](acc-57-464-f1){#f1} The mean systolic blood pressure (SBP) and diastolic blood pressure (DBP) values of the analyzed group of patients at baseline and at the end of month 1 and 3 are shown in [Table 1](#t1){ref-type="table"}, whereas [Figure 2](#f2){ref-type="fig"} illustrates the dynamics of BP during the follow-up period. ###### Systolic and diastolic blood pressure values in study population at baseline and at follow-up visits during the treatment period --------------------------------------------------------------------------------     Blood pressure     Minimal\     Maximal\     Mean\     Standard\     value\     value\     value\     deviation     (mm Hg)     (mm Hg)     (mm Hg) -------------------- -------------- -------------- ------------- ---------------     Baseline SBP     146     200     155.67     16.21     Baseline DBP     90     118     92.03     9.23     SBP -- month 1     107     183     140.69     13.59     DBP -- month 1     70     105     83.41     6.32     SBP -- month 3     112     148     136.88     26.97     DBP -- month 3     65     90     80.64     5.07 -------------------------------------------------------------------------------- DBP = diastolic blood pressure; SBP = systolic blood pressure ![Dynamics of systolic and diastolic blood pressure in study population after initiation of treatment with atorvastatin/amlodipine. DBP = diastolic blood pressure; SBP = systolic blood pressure; NS = nonsignificant; p = level of statistical significance](acc-57-464-f2){#f2} The normalization rate of BP, defined for our study as SBP \<140 and DBP \<90 mm Hg (\<85 mm Hg for diabetic patients) in accordance with the current 2013 ESC Guidelines for treatment of arterial hypertension ([@r5]) was as follows: 1. at month 1: SPB \<140 mm Hg was achieved by 147 (60.5%) and DBP \<90 mm Hg by 183 (75.3%) patients; p\<0.0001 *vs.* baseline; 2. at month 3: SPB \<140 mm Hg was achieved by 175 (72.1%) and DBP \<90 mm Hg by 221 (91.0%) patients; p\<0.0001 *vs.* baseline and month 1. The mean SBP and DBP values of patients treated with the most frequently prescribed dosage of 10/5 mg of the SPC of atorvastatin/amlodipine are shown in [Table 2](#t
[ 17429, 14, 14213, 14, 6367, 4250, 13761, 15, 27376, 3931, 323, 4073, 6055, 407, 2578, 5590, 583, 403, 5469, 15, 380, 3608, 323, 2578, 5590, 583, 14, 23, 14, 25955, 28180, 313, 1502, 34, 10, 285, 271, 20038, 2578, 5590, 583, 14, 23, 14, 25955, 30577, 313, 1502, 35, 10, 12647, 271, 1444, 251, 15, 7160, 2048, 310, 5802, 1097, 407, 31624, 3875, 4073, 285, 407, 3116, 715, 253, 17429, 3408, 285, 3469, 327, 253, 40009, 2803, 16202, 407, 391, 5367, 52, 313, 29846, 39, 481, 391, 5367, 52, 310, 717, 589, 14, 10082, 456, 275, 444, 15, 14347, 611, 14, 805, 285, 697, 3882, 3425, 16149, 2190, 611, 14, 805, 8709, 15, 1198, 2578, 5590, 583, 5798, 42541, 762, 31624, 3875, 4073, 444, 15, 14347, 7024, 327, 253, 31624, 33248, 49217, 591, 7070, 4542, 280, 2578, 5590, 511, 313, 46093, 34, 481, 496, 253, 5928, 273, 31624, 3875, 4073, 13, 2578, 5590, 583, 14757, 253, 4702, 273, 271, 9548, 309, 1433, 250, 313, 46093, 35, 10, 273, 253, 1387, 28450, 985, 13, 247, 5798, 20038, 2578, 5590, 583, 14, 23, 14, 25955, 30577, 313, 46093, 38, 582, 285, 271, 24672, 302, 250, 5590, 511, 313, 46093, 36, 10, 534, 28472, 2578, 5590, 583, 281, 1959, 8383, 285, 247, 8383, 7923, 15, 50, 27, 187, 187, 2115, 80, 3403, 321, 274, 11856, 269, 4881, 387, 3385, 5069, 4204, 4384, 12583, 513, 441, 86, 28350, 299, 546, 6584, 274, 3066, 28846, 32, 187, 187, 2115, 80, 1524, 15864, 258, 3352, 21035, 372, 3403, 5650, 372, 4440, 358, 4204, 4384, 12583, 513, 441, 86, 28350, 802, 5111, 17075, 28350, 372, 18072, 24157, 5586, 546, 6584, 274, 3066, 28846, 32, 19523, 1940, 4474, 11856, 1220, 86, 7014, 1753, 48788, 9800, 36789, 389, 247, 6429, 1528, 571, 9500, 295, 1123, 72, 29213, 299, 1753, 48788, 372, 948, 1868, 3359, 14291, 15, 187, 187, 34, 27, 187, 187, 1672, 44309, 353, 18463, 17622, 187, 26631, 187, 32499, 15, 5581, 187, 30952, 32735, 11685, 31, 187, 29, 2974, 31, 187, 29, 2522, 31, 187, 29, 13518, 29308, 568, 17880, 14, 25, 1138, 187, 29, 5564, 31, 53, 343, 274, 401, 302, 375, 870, 5564, 31, 187, 29, 3866, 6740, 568, 605, 3211, 15, 19203, 15, 681, 16, 19203, 14, 18, 15, 883, 15, 17, 15, 1222, 15, 4305, 6750, 3866, 31, 187, 29, 4826, 31, 187, 50270, 16455, 551, 5680, 27, 337, 3498, 4891, 1852, 28716, 28, 3148, 27, 2972, 28, 8459, 27, 470, 470, 1384, 3498, 470, 28, 748, 187, 50270, 4, 32688, 551, 8459, 14, 3956, 27, 1384, 3498, 28, 5680, 27, 337, 3498, 4891, 1852, 28716, 28, 3148, 27, 2972, 28, 748, 187, 870, 4826, 31, 187, 870, 2522, 31, 187, 29, 2915, 31, 187, 29, 2154, 31, 187, 50274, 29, 2154, 2730, 16455, 2654, 568, 16455, 3, 4871, 568, 33031, 3, 4898, 568, 21980, 3, 1125, 4488, 333, 3073, 16455, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 8060, 2654, 568, 38705, 1138, 53, 343, 274, 401, 4881, 870, 8060, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 8060, 2654, 568, 15261, 1138, 15426, 2044, 401, 4881, 870, 8060, 3073, 2154, 31, 187, 50274, 29, 2154, 2730, 32688, 2654, 568, 32688, 3, 4871, 568, 33031, 3, 4898, 568, 21980, 6750, 32688, 3073, 2154, 31, 187, 29, 3866, 31, 187, 50274, 13686, 15, 44364, 1587, 27395, 8590, 49473, 995, 1159, 1082, 551, 187, 50270, 2044, 18857, 426, 3389, 15, 22339, 1587, 32688, 8375, 187, 50270, 8882, 426, 18857, 15, 788, 5856, 1587, 19, 69, 8375, 187, 50270, 16455, 426, 3389, 15, 22339, 1587, 16455, 8375, 187, 50270, 16455, 18527, 426, 551, 346, 16455, 1381, 2032, 3572, 187, 50270, 1000, 8116, 426, 1159, 9, 3775, 10, 551, 187, 50262, 22452, 15, 2808, 1587, 17213, 9232, 2228, 27, 18873, 2228, 15, 3211, 558, 2490, 50270, 4718, 50276, 187, 50270, 338, 9, 8002, 22853, 15, 788, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 788, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 10, 551, 187, 50262, 16455, 15, 7614, 426, 5542, 28, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 2010, 604, 9, 8002, 22853, 15, 20726, 3633, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 20726, 3633, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 910, 187, 50262, 16455, 15, 7614, 426, 3497, 15, 20726, 9715, 15, 6953, 4241, 9715, 9, 4963, 558, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 187, 50270, 7271, 604, 9, 8002, 22853, 15, 24024, 3633, 6989, 17831, 10, 551, 187, 50266, 8002, 22853, 15, 24024, 3633, 6989, 17831, 9, 16455, 18527, 13, 1159, 9, 4963, 910, 187, 50262, 16455, 15, 7614, 426, 3497, 15, 9715, 15, 6953, 4241, 9715, 9, 4963, 558, 187, 50262, 16455, 15, 1993, 1874, 187, 50266, 2023, 1486, 8116, 558, 187, 50270, 94, 187, 50274, 2023, 3221, 558, 187, 50274, 3306, 15, 22339, 1587, 38705, 6788, 44364, 1587, 9738, 995, 1159, 1082, 551, 50272, 187, 50270, 32688, 15, 788, 5856, 1587, 19, 69, 6788, 6553, 6586, 9, 16455, 13, 470, 13, 470, 13, 37174, 13, 25888, 558, 50271, 187, 50270, 605, 26544, 9, 32688, 15, 936, 3233, 9715, 6020, 187, 50274, 9897, 187, 50274, 3306, 15, 22339, 1587, 15261, 6788, 44364, 1587, 9738, 995, 1159, 1082, 551, 50272, 187, 50270, 1352, 5996, 2073, 71, 302, 1730, 267, 2044, 15, 5581, 1383, 551, 303, 31646, 27, 32688, 15, 936, 3233, 9715, 1082, 2023, 1159, 9, 2203, 910, 187, 50270, 2023, 8, 8456, 5137, 187, 50274, 9897, 187, 870, 3866, 31, 50274, 187, 870, 2915, 31, 187, 870, 2974, 31, 187, 187, 71, 302, 1730, 267, 2044, 15, 5581, 187, 14277, 5581, 187, 50274, 3701, 2613, 1540, 64, 936, 64, 42787, 9, 370, 4793, 1540, 64, 2703, 13, 370, 9252, 64, 3140, 2387, 551, 187, 50270, 5, 338, 81, 426, 269, 5758, 9, 370, 9252, 64, 3140, 13, 346, 34338, 3, 5349, 2490, 50270, 71, 6343, 9, 370, 338, 81, 13, 2613, 1540, 64, 29377, 9, 370, 4793, 1540, 64, 2703, 10, 5349, 2490, 50270, 71, 10483, 9, 370, 338, 81, 5349, 2490, 50270, 2309, 9, 370, 9252, 64, 3140, 5349, 2490, 50274, 94, 50271, 187, 50274, 5, 303, 31646, 426, 1213, 64, 13481, 2073, 2203, 27, 5695, 16, 8567, 28, 4793, 1540, 13, 10606, 1383, 10001, 15743, 5013, 303, 31646, 34419, 50270, 187, 50274, 4793, 1540, 64, 936, 64, 42787, 3914, 303, 31646, 13, 346, 81, 24968, 18, 16, 71, 4881, 18, 15, 8567, 3287, 50270, 187, 50274, 13088, 14113, 64, 25950, 9, 3728, 2073, 303, 31646, 8, 3001, 337, 4027, 187, 187, 53, 19095, 258, 26566, 11174, 80, 396, 21058, 295, 48998, 513, 261, 549, 371, 35860, 13, 9788, 66, 24961, 1566, 80, 8733, 269, 1080, 372, 1071, 70, 15, 1716, 13206, 247, 20983, 38470, 14291, 389, 19386, 13, 299, 11856, 27725, 389, 258, 43831, 372, 27725, 18, 13, 5007, 80, 246, 16469, 704, 7067, 802, 11685, 22, 389, 14741, 15, 187, 11223, 774, 14291, 44724, 295, 1123, 72, 29213, 13, 258, 5559, 21722, 299, 258, 26040, 48170, 29982, 591, 44684, 9392, 13, 36252, 258, 19900, 12065, 246, 422, 402, 829, 80, 15, 187, 16976, 265, 27, 187, 187, 31962, 285, 16428, 9175, 342, 11685, 22, 187, 15597, 22, 2615, 9210, 23017, 24440, 272, 347, 271, 10882, 187, 187, 34, 27, 187, 187, 1672, 16974, 5111, 354, 13670, 80, 36146, 1101, 560, 7961, 642, 34644, 389, 40464, 247, 323, 570, 1209, 11856, 1220, 86, 7014, 387, 780, 5586, 258, 441, 80, 4204, 4384, 12583, 513, 5268, 70, 13, 42361, 10081, 441, 80, 372, 2965, 2135, 5586, 22843, 802, 6483, 375, 372, 295, 1123, 72, 29213, 11565, 1331, 46071, 27, 187, 9770, 12583, 15253, 187, 187, 9770, 12583, 15253, 3974, 11856, 759, 371, 6736, 313, 95, 20, 44, 1054, 692, 3377, 299, 8566, 3377, 10, 48137, 302, 30692, 40468, 802, 16872, 5586, 3403, 321, 274, 269, 302, 375, 247, 39955, 4204, 260, 6457, 961, 66, 513, 24437, 2475, 9325, 13, 299, 994, 1747, 1757, 14, 26185, 247, 36156, 8733, 500, 21459, 10959, 42288, 5128, 49189, 2513, 15, 1284, 4440, 561, 7360, 358, 1151, 385, 487, 21400, 802, 20983, 268, 31076, 1758, 4384, 13, 21233, 7112, 802, 11856, 246, 7896, 13, 10959, 749, 3899, 7112, 18547, 24437, 1296, 49410, 15, 7066, 12583, 15253, 441, 66, 11685, 22, 755, 6989, 17831, 13, 9425, 354, 1831, 68, 31655, 5111, 2965, 2135, 3772, 1757, 26869, 299, 828, 261, 36789, 387, 3385, 5069, 372, 33143, 22843, 15, 187, 187, 13641, 251, 10981, 7014, 187, 187, 9770, 12583, 15, 1178, 7506, 2379, 50276, 3429, 27, 23349, 13, 2379, 50276, 7436, 27, 16918, 13, 2379, 50276, 5695, 64, 8124, 27, 686, 42787, 1383, 2379, 50276, 42787, 64, 15177, 27, 5091, 190, 187, 9897, 190, 187, 9770, 12583, 15, 38729, 30932, 2577, 64, 32499, 5137, 4888, 187, 3701, 1379, 64, 11489, 27760, 1082, 551, 2379, 50276, 605, 1379, 29679, 285, 755, 2460, 941, 2379, 50276, 9770, 12583, 15, 38705, 9, 3701, 9, 2203, 64, 11317, 10, 551, 2379, 50274, 605, 3148, 1543, 275, 3239, 2379, 50274, 3306, 15, 22339, 2073, 16680, 8539, 41090, 426, 2379, 50272, 8, 29, 73, 19, 31, 4943, 310, 634, 2460, 19282, 73, 19, 28120, 559, 2379, 50272, 8, 29, 8428, 6740, 34468, 559, 941, 64, 11317, 559, 686, 5647, 5618, 2379, 50276, 9897, 190, 187, 94, 187, 2915, 551, 2379, 50276, 4909, 14, 11807, 27, 7518, 87, 47479, 13, 20155, 14, 40004, 28, 190, 187, 94, 190, 187, 73, 19, 13, 190, 187, 73, 20, 551, 2379, 50276, 15456, 14, 3956, 27, 470, 28, 190, 187, 94, 190, 187, 630, 551, 2379, 50276, 15456, 14, 3956, 27, 1458, 3498, 28, 190, 187, 94, 190, 187, 630, 2239, 3280, 551, 2379, 50276, 15456, 14, 918, 27, 1458, 3498, 28, 190, 187, 94, 190, 187, 4, 16680, 551, 2379, 50276, 9599, 27, 987, 28, 2379, 50276, 15456, 27, 1384, 3498, 28, 2379, 50276, 17333, 27, 1384, 3498, 28, 2379, 50276, 14224, 27, 337, 3498, 4891, 28, 2379, 50276, 11814, 27, 1852, 28716, 28, 190, 187, 94, 2379, 50276, 187, 29, 3866, 6740, 568, 2413, 1358, 30061, 77, 6443, 15, 681, 16, 9468, 375, 16, 7585, 12583, 4305, 16, 7585, 12583, 15, 4305, 6750, 3866, 31, 190, 187, 29, 2154, 2654, 568, 16680, 1138, 34, 4440, 358, 3403, 321, 2960, 1049, 609, 336, 12649, 74, 1051, 870, 2154, 31, 4888, 187, 29, 73, 18, 31, 9770, 12583, 15253, 367, 31076, 1758, 372, 1071, 70, 870, 73, 18, 31, 190, 187, 29, 73, 20, 31, 13641, 251, 10981, 7014, 372, 11856, 3403, 5650, 299, 1049, 1631, 14291, 802, 23349, 89, 14028, 870, 73, 20, 31, 4888, 187, 29, 2154, 2654, 568, 2577, 64, 32499, 6750, 2154, 31, 4888, 187, 29, 630, 31, 2379, 50276, 29, 5423, 1511, 30, 8060, 1318, 568, 53, 343, 274, 11982, 27760, 3, 39144, 568, 21528, 64, 11489, 27760, 49384, 190, 187, 870, 630, 31, 187, 187, 3546, 6584, 274, 5586, 258, 1296, 49410, 187, 34, 794, 7014, 7066, 12583, 15, 38705, 1082, 323, 570, 336, 247, 4440, 358, 4474, 479, 900, 372, 5111, 38917, 399, 8585, 3066, 16872, 13, 10138, 70, 362, 29058, 642, 17449, 80, 802, 260, 8032, 15, 187, 2861, 16469, 13, 31304, 7644, 297, 375, 372, 11856, 21682, 372, 1086, 351, 692, 274, 299, 546, 6584, 274, 3265, 265, 277, 8585, 4204, 4440, 358, 5586, 258, 1296, 49410, 387, 3385, 5069, 372, 11856, 45909, 2960, 26060, 14942, 27, 187, 2044, 941, 64, 11317, 426, 7066, 12583, 15, 38705, 1874, 187, 187, 9770, 12583, 15, 20085, 9, 941, 64, 11317, 13, 686, 1405, 86, 9026, 15, 5581, 1383, 1159, 9, 3211, 13, 2505, 10, 551, 187, 50274, 605, 530, 8108, 345, 498, 86, 1950, 3088, 187, 50274, 605, 686, 3211, 8, 523, 14052, 258, 26566, 11174, 80, 4204, 1183, 21432, 17607, 546, 6584, 3377, 30645, 1296, 49410, 13, 385, 15, 1052, 187, 50274, 605, 686, 1156, 8, 8203, 258, 1753, 258, 1296, 49410, 546, 6584, 276, 187, 9897, 187, 187, 2302, 45604, 513, 1296, 49410, 13, 7684, 277, 8585, 1161, 72, 312, 5269, 8733, 396, 246, 1644, 6017, 375, 749, 3899, 7112, 5111, 17075, 28350, 389, 5111, 2986, 80, 654, 5423, 1511, 568, 3140, 3, 1416, 568, 7585, 12583, 1138, 13, 30645, 1753, 7360, 20789, 948, 1868, 12704, 1645, 589, 247, 4440, 358, 4204, 32644, 8297, 21682, 27, 187, 605, 2336, 692, 35802, 372, 8753, 22017 ]
stationary-phase-induced heat tolerance. Mechanisms for stress protection by trehalose are discussed. The genes for trehalose-6-phosphate synthase (otsA) and anabolic trehalose-6-phosphate phosphatase (otsB) constitute an operon. Their expression is induced both by osmotic stress and by growth into the stationary phase and depend on the sigma factor encoded by rpoS (katF). rpoS is amber-mutated in E. coli K-12 and its DNA sequence varies among K-12 strains. For trehalose catabolism under osmotic stress E. coli depends on the osmotically inducible periplasmic trehalase (TreA). In the absence of osmotic stress, trehalose induces the formation of an enzyme IITre (TreB) of the group translocation system, a catabolic trehalose-6-phosphate phosphatase (TreE), and an amylotrehalase (TreC) which converts trehalose to free glucose and a glucose polymer.Q: Como capturar uma foto através da webcam do usuário e enviar via POST? Como realizar o procedimento de captura de imagem da webcam do usuário em um formulário de cadastro para enviar via POST? Busco por uma solução que seja compatível com a maioria dos navegadores e que seja de simples implementação. A: Exemplo Mínimo PHP camera.php <!DOCTYPE HTML> <html> <head> <meta charset="utf-8"> <title>Tirar Fotos</title> <script src="//code.jquery.com/jquery-1.11.0.min.js"></script> <style> video { border: 1px solid #ccc; display: block; margin: 0 0 20px 0; } #canvas { margin-top: 20px; border: 1px solid #ccc; display: block; } </style> </head> <body> <div> <div><video id="video" width="640" height="480" autoplay></video></div> <div><button id="snap">Tirar Foto</button></div> <div><button id="save">Salvar Foto</button></div> <div><canvas id="canvas" width="640" height="480"></canvas></div> <script> window.addEventListener("DOMContentLoaded", function() { var canvas = document.getElementById("canvas"), context = canvas.getContext("2d"), video = document.getElementById("video"), videoObj = { "video": true }, errBack = function(error) { console.log("Video capture error: ", error.code); }; if(navigator.getUserMedia) { navigator.getUserMedia(videoObj, function(stream) { video.src = stream; video.play(); }, errBack); } else if(navigator.webkitGetUserMedia) { navigator.webkitGetUserMedia(videoObj, function(stream){ video.src = window.webkitURL.createObjectURL(stream); video.play(); }, errBack); } else if(navigator.mozGetUserMedia) { navigator.mozGetUserMedia(videoObj, function(stream){ video.src = window.URL.createObjectURL(stream); video.play(); }, errBack); } }, false); document.getElementById("snap").addEventListener("click", function() { canvas.getContext("2d").drawImage(video, 0, 0, 640, 480); //alert(canvas.toDataURL()); }); document.getElementById("save").addEventListener("click", function() { $.post('fotossalvar.php', {imagem:canvas.toDataURL()}, function(data){ },'json'); }); </script> </body> </html> fotossalvar.php <?php function base64_to_jpeg( $base64_string, $output_file ) { $ifp = fopen( $output_file, "wb" ); fwrite( $ifp, base64_decode( $base64_string) ); fclose( $ifp ); return( $output_file ); } $imagem = str_replace('data:image/png;base64,','',$_POST['imagem']); base64_to_jpeg($imagem, "pasta1/foto1.png"); echo json_encode(array('imagem' => 1)); Todo o código se resume nesses dois arquivos, siga esse modelo como fator de teste. Configure a sua aplicação com jQuery, e uma pasta com o nome de pasta1, sendo tudo feito em HTML5 com PHP. Em relação aos navegadores, o Google Chrome e o Firefox funcionaram perfeitamente, já o IE não tive sucesso. Fontes: Camera and Video Control with HTML5 HTML5 Canvas Save Drawing as an Image A: Existe um projeto muito interessante no GitHub com vista a fornecer uma solução atual para o uso da webcam do cliente, fazendo uso de fallback para Flash em casos de navegadores mais antigos: WebcamJS WebcamJS é uma pequena (~3K minificado e compactado) biblioteca standalone em JavaScript para capturar fotos a partir da câmera do seu computador, e entregá-los a você como JPEG ou PNG Data URIs. As imagens podem ser exibidas em sua página web, rendido em uma tela, ou submetido ao seu servidor. WebcamJS usa HTML5 getUserMedia, mas proporciona um fallback automático e invisível através de Adobe Flash. Demonstração Webcam.set({ width: 320, height: 240, image_format: 'jpeg', jpeg_quality: 90 }); Webcam.attach('#my_camera'); function take_snapshot() { // take snapshot and get image data Webcam.snap(function(data_uri) { // display results in page document.getElementById('results').innerHTML = '<h2>Here is your image:</h2>' + '<img src="' + data_uri + '"/>'; }); } body { font-family: Helvetica, sans-serif; } h2, h3 { margin-top: 0; } form { margin-top: 15px; } form > input { margin-right: 15px; } #results { float: right; margin: 20px; padding: 20px; border: 1px solid; background: #ccc; } <script src="http://pixlcore.com/demos/webcamjs/webcam.js"></script> <div id="results">A imagem capturada aparece aqui...</div> <h1>WebcamJS Página de teste</h1> <h3>Demonstração de uma captura e apresentação em 320x240</h3> <div id="my_camera"></div> <form> <input type=button value="Tirar Snapshot" onClick="take_snapshot()"> </form> Enviar para o servidor A função Webcam.snap() fornece a imagem por meio de um URI Dados via JavaScript, conforme vimos no exemplo em cima. Contudo, também dispomos de uma forma de decodificar e enviar esses dados da imagem para o servidor através de uma chamada AJAX: var data_uri = Webcam.snap(); Webcam.upload( data_uri, 'meuScript.php', function(code, text) { // Upload concluído // 'code' contém o código da resposta HTTP enviado pelo servidor, ex. 200 // 'text' contem o que o servidor enviou }); No lado do servidor, os dados chegam tal como se tivessemos submetido um formulário com um campo <input type="file" name="webcam">, pelo que podemos simplesmente receber a imagem da seguinte forma: // verificações de seguran
[ 34, 15, 19, 69, 38316, 13, 31184, 313, 9387, 15, 6053, 15, 6752, 10, 313, 44101, 326, 7048, 2550, 1750, 326, 344, 187, 187, 7821, 311, 2084, 3441, 5966, 247, 8106, 12678, 835, 344, 4767, 326, 642, 581, 13699, 187, 187, 13243, 281, 19494, 8106, 481, 50273, 688, 1127, 273, 958, 13, 3096, 6285, 5742, 4767, 326, 344, 187, 187, 4524, 6545, 253, 32588, 13794, 273, 6197, 285, 326, 642, 2173, 5754, 187, 187, 36817, 13, 1880, 9635, 390, 1375, 13, 369, 12316, 281, 779, 15, 50257, 5035, 187, 187, 46, 6968, 20136, 13, 818, 3953, 329, 15, 19, 69, 387, 38162, 313, 44101, 326, 773, 3431, 9626, 420, 407, 247, 3257, 187, 187, 249, 253, 6197, 2686, 11295, 1057, 417, 1957, 9766, 31427, 39537, 187, 187, 14131, 13, 3096, 6285, 457, 84, 1750, 310, 41111, 15, 535, 50272, 6436, 13, 359, 1364, 2589, 271, 3907, 2278, 273, 253, 1924, 281, 187, 187, 5992, 9842, 1880, 627, 403, 667, 643, 1327, 14, 71, 35781, 3374, 326, 3096, 6285, 812, 187, 187, 22525, 327, 4549, 15, 19, 844, 588, 806, 3653, 1880, 253, 34178, 273, 3096, 6285, 457, 84, 187, 187, 36817, 323, 253, 399, 9571, 14, 709, 10789, 9611, 13588, 253, 3332, 1986, 2077, 187, 187, 31177, 2111, 5877, 275, 28098, 348, 3423, 362, 15, 3729, 23528, 13, 14821, 322, 15, 16316, 15, 5429, 187, 19, 187, 50275, 1231, 14409, 326, 16595, 85, 62, 248, 5857, 273, 247, 8106, 12678, 16988, 247, 20066, 273, 187, 455, 12834, 285, 25774, 3707, 3480, 273, 7571, 13, 12078, 414, 273, 253, 12678, 13, 285, 187, 300, 1851, 1319, 273, 253, 6197, 1425, 16342, 362, 15, 308, 609, 8807, 13, 854, 2222, 329, 15, 19, 69, 1249, 2526, 13, 187, 805, 2251, 313, 9387, 15, 6053, 15, 5403, 481, 5429, 50254, 50270, 50276, 428, 24, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 19, 9913, 313, 6961, 481, 20, 535, 50272, 688, 28098, 348, 3423, 13, 253, 6413, 2111, 7945, 326, 773, 66, 6345, 1071, 13, 533, 187, 187, 1439, 247, 2614, 1071, 13, 778, 320, 11966, 347, 247, 3186, 7119, 281, 247, 29889, 5263, 187, 187, 1542, 17507, 6276, 1425, 50275, 50182, 348, 3423, 13, 14821, 322, 15, 16316, 15, 387, 374, 17786, 15, 50270, 28144, 13, 253, 187, 187, 31177, 2111, 2918, 326, 2614, 5216, 2668, 10376, 281, 10466, 7578, 5323, 187, 187, 609, 271, 27093, 11492, 273, 11068, 15, 50274, 2618, 15, 387, 374, 20270, 15, 50274, 510, 6413, 187, 187, 18336, 4767, 326, 773, 43838, 1346, 2550, 320, 14320, 281, 452, 42243, 281, 11929, 187, 187, 936, 247, 2614, 1071, 327, 3075, 273, 26841, 247, 6424, 8399, 1425, 4031, 9944, 923, 671, 2654, 15, 187, 187, 9, 585, 6547, 326, 253, 11810, 812, 417, 320, 13084, 273, 21455, 247, 187, 187, 88, 35083, 1417, 2614, 3812, 1563, 271, 5263, 323, 6276, 762, 253, 4833, 481, 535, 50272, 4943, 13, 387, 253, 673, 273, 521, 14625, 285, 23381, 5537, 4854, 13, 3096, 6285, 5429, 187, 20, 187, 50276, 688, 253, 4857, 36689, 3096, 6285, 273, 521, 2748, 281, 10687, 347, 5067, 13, 10158, 187, 35, 1017, 3054, 326, 253, 28098, 348, 3423, 3061, 778, 3486, 3096, 6285, 457, 84, 399, 9571, 14, 709, 10789, 187, 29836, 15, 2594, 23488, 13, 1903, 16, 1619, 16, 1036, 15, 1723, 13, 10158, 378, 1017, 4860, 326, 187, 50182, 348, 3423, 369, 4425, 846, 3096, 6285, 457, 84, 6197, 13, 285, 1223, 521, 4549, 369, 187, 33965, 13, 285, 3021, 13, 858, 417, 7164, 247, 28098, 348, 3423, 1750, 275, 253, 30115, 4864, 15, 187, 5035, 2654, 15, 3856, 13, 28098, 348, 3423, 369, 4425, 327, 3978, 3495, 13, 4022, 13, 846, 3096, 6285, 457, 84, 187, 36817, 369, 11295, 13, 533, 1309, 253, 32752, 1371, 273, 253, 8164, 4549, 15, 187, 8457, 436, 2523, 7033, 281, 253, 1791, 1319, 273, 6197, 13, 285, 28098, 348, 3423, 369, 187, 31572, 1309, 253, 32752, 1371, 273, 3096, 6285, 457, 84, 4549, 13, 359, 778, 2953, 253, 1791, 1319, 187, 48781, 15, 2594, 16342, 362, 15, 28852, 13, 21982, 329, 15, 20, 69, 16493, 13, 11140, 14, 1731, 313, 9387, 15, 187, 6961, 558, 923, 671, 3697, 363, 287, 362, 15, 14538, 3642, 13, 46190, 530, 15, 52, 15, 36859, 13, 35710, 313, 9430, 10, 313, 44101, 187, 3529, 247, 1986, 2077, 6413, 2111, 3061, 4795, 275, 247, 747, 4086, 273, 1569, 187, 1628, 1212, 23677, 281, 512, 6424, 2219, 1335, 13910, 327, 1480, 2278, 39537, 2756, 50254, 50270, 428, 25, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 4238, 2256, 281, 253, 22414, 873, 6593, 275, 2593, 495, 28927, 9, 68, 2769, 19, 582, 577, 347, 344, 21402, 187, 187, 4297, 7443, 281, 399, 9571, 762, 2593, 495, 28879, 9, 66, 2769, 18, 582, 521, 1273, 8399, 13, 285, 9284, 281, 187, 187, 5040, 290, 281, 247, 2614, 1071, 15, 2594, 427, 15, 53, 904, 577, 16, 938, 16, 1036, 13, 387, 577, 313, 43507, 326, 253, 17396, 187, 187, 35674, 369, 32700, 1897, 558, 46338, 9700, 13, 577, 16, 938, 16, 1036, 13, 387, 495, 313, 22322, 10, 187, 187, 9, 44101, 326, 3096, 6285, 1364, 2075, 253, 17396, 5927, 4030, 273, 370, 18, 13, 5388, 481, 22, 535, 50270, 1909, 253, 28098, 348, 3423, 2111, 2918, 326, 253, 3946, 273, 6424, 3006, 253, 187, 187, 33699, 281, 7578, 281, 2614, 5175, 1563, 247, 6276, 762, 253, 4833, 187, 187, 45389, 369, 27093, 13, 359, 7525, 326, 253, 2332, 1302, 28203, 535, 187, 21, 187, 50274, 12612, 495, 28927, 9, 68, 2769, 19, 10, 3054, 253, 1563, 27, 535, 50270, 9, 68, 10, 50275, 688, 37473, 28, 50273, 49842, 50273, 25304, 50273, 267, 26898, 28, 50274, 16894, 187, 50270, 2377, 4777, 18295, 1145, 2060, 665, 28096, 50273, 4674, 495, 28879, 9, 66, 2769, 18, 10, 285, 187, 50270, 709, 3197, 5175, 273, 2614, 390, 6345, 390, 271, 50274, 27276, 665, 28096, 187, 50270, 4674, 495, 28879, 9, 68, 10, 390, 313, 69, 10, 3091, 320, 16290, 50275, 284, 3637, 27, 535, 50254, 245, 50265, 14244, 535, 50270, 9, 19, 10, 1198, 247, 1273, 8399, 13, 281, 27, 535, 50270, 9, 74, 10, 50272, 4524, 2184, 19841, 273, 417, 1679, 685, 5091, 1897, 28, 535, 50270, 9, 2886, 10, 50273, 12080, 247, 4030, 273, 417, 1679, 685, 370, 18, 13, 5388, 28, 535, 50270, 9, 12211, 10, 50274, 1595, 423, 271, 7665, 17657, 5252, 2143, 7012, 407, 187, 50261, 783, 7811, 28, 285, 535, 50270, 9, 400, 10, 50273, 681, 2881, 342, 512, 2854, 285, 7665, 1971, 187, 50261, 15684, 942, 11295, 762, 7118, 6480, 1047, 285, 6480, 1010, 15, 187, 187, 1976, 3643, 15, 36, 15, 52, 15, 34, 15, 3015, 495, 28927, 9, 68, 2769, 19, 481, 187, 22, 187, 50276, 1909, 629, 273, 697, 3978, 818, 13, 4022, 46338, 9700, 13, 253, 2332, 1302, 4767, 326, 187, 522, 435, 432, 23254, 253, 14683, 35046, 13, 253, 6414, 273, 253, 4162, 187, 938, 13, 4022, 46338, 9700, 6376, 275, 1055, 15, 2594, 46338, 9700, 13, 187, 23, 16, 24, 16, 1036, 13, 387, 374, 313, 22322, 481, 2756, 50254, 50270, 50276, 428, 26, 14, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 535, 187, 1661, 728, 2220, 2593, 495, 28927, 9, 68, 2769, 19, 10, 275, 23254, 247, 17396, 5927, 6197, 187, 187, 20026, 3096, 6285, 15, 50274, 5035, 16342, 362, 15, 443, 2002, 13, 4240, 8010, 6053, 3495, 13, 475, 21, 313, 9387, 15, 187, 187, 15705, 15, 4240, 10, 313, 16514, 326, 773, 81, 27956, 281, 28098, 348, 3423, 13, 275, 253, 5928, 273, 247, 187, 187, 88, 35083, 390, 385, 32189, 5989, 816, 5411, 247, 3186, 13, 247, 3257, 665, 187, 187, 709, 5123, 281, 2085, 247, 2614, 3410, 672, 9521, 407, 3513, 310, 417, 2256, 281, 187, 187, 783, 8655, 22414, 2530, 275, 6879, 3643, 15, 36, 15, 52, 15, 34, 15, 20485, 495, 28953, 14, 24137, 21, 39537, 4923, 187, 187, 9088, 369, 642, 11315, 6265, 281, 16209, 253, 6197, 13, 359, 1364, 33085, 187, 187, 783, 3883, 273, 6197, 285, 18097, 323, 23381, 5537, 15, 23, 2594, 2654, 15, 535, 50273, 15545, 2220, 253, 20128, 13, 359, 10418, 3096, 6285, 457, 84, 19130, 13, 33085, 521, 187, 187, 36817, 285, 18097, 323, 23381, 5537, 15, 50271, 23135, 13, 359, 13292, 10158, 187, 187, 35, 1017, 457, 84, 13786, 281, 2726, 6553, 15, 24, 5429, 187, 23, 187, 50276, 1231, 3877, 326, 253, 2332, 1302, 11295, 247, 6197, 273, 581, 285, 581, 14, 14674, 281, 2620, 187, 10526, 275, 5754, 323, 253, 399, 9571, 14, 709, 780, 9611, 13, 973, 1840, 253, 17396, 187, 35674, 13, 285, 6337, 436, 6197, 17336, 281, 253, 7732, 417, 281, 7081, 187, 11342, 1513, 9611, 15, 50274, 48, 296, 46123, 13, 253, 2332, 1302, 812, 16209, 253, 1072, 187, 36817, 1309, 23381, 5537, 15, 1723, 13, 275, 23254, 253, 6197, 13, 253, 2332, 187, 13550, 2550, 1908, 253, 17396, 5927, 6197, 275, 2593, 187, 24137, 21, 9, 68, 2769, 19, 582, 285, 2550, 16209, 253, 17396, 4030, 15, 187, 24, 187, 50275, 7559, 6285, 556, 4724, 247, 4858, 16066, 323, 15836, 273, 2051, 842, 264, 19330, 15, 187, 6436, 13, 1754, 2220, 776, 16322, 273, 436, 1083, 285, 13336, 273, 10158, 187, 35, 1017, 457, 84, 13786, 281, 2726, 6553, 13, 359, 13292, 3096, 6285, 457, 84, 16066, 15, 12257, 13, 3096, 6285, 310, 187, 4924, 281, 1873, 824, 247, 3200, 342, 253, 2332, 1302, 2220, 18097, 323, 23381, 5537, 15, 2756, 50254, 50270, 428, 884, 428, 187, 189, 43, 14, 52, 8193, 1839, 14, 1166, 2756, 50273, 40453, 281, 2726, 6553, 347, 19330, 5868, 15, 50273, 27302, 2747, 273, 6197, 187, 187, 28902, 456, 15, 10498, 27013, 323, 23381, 5537, 15, 16066, 323, 15836, 273, 2051, 842, 264, 187, 187, 35108, 2034, 5868, 15, 23124, 37420, 42289, 1428, 15, 187, 187, 27302, 2747, 3035, 3606, 15, 5429, 187, 32618, 399, 15, 1023, 282, 555, 79, 13, 49286, 15, 187, 1845, 6033, 302, 552, 187, 187, 6958, 27, 577, 16, 1012, 16, 7132, 8863, 50254, 50270, 14, 1903, 428, 8675, 19, 15, 187, 187, 20, 15, 187, 187, 37, 610, 8148, 18197, 275, 2101, 1562, 15069, 187, 187, 1231, 4390, 5752, 253, 2644, 273, 2101, 1562, 15069, 15111, 13, 8109, 1097, 8811, 285, 253, 8704, 16999, 13, 8965, 285, 15114, 342, 616, 6079, 12478, 285, 29023, 6095, 15, 1583, 403, 247, 2032, 12725, 323, 24359, 285, 4693, 398, 19605, 15, 187, 187, 51, 1225, 301, 310, 275, 4179, 273, 776, 6079, 12478, 4849, 285, 6742, 2579, 275, 253, 2170, 285, 310, 327, 1133, 281, 3662, 667, 3533, 368, 452, 15, 1422, 476, 671, 1067, 776, 27488, 6631, 10589, 281, 1056, 2544, 281, 634, 11526, 18406, 285, 40547, 15, 187, 187, 6067, 10865, 5003, 74, 285, 5119, 871, 253, 444, 18, 1501, 3211, 751, 253, 896, 273, 616, 1133, 285, 403, 1900, 327, 673, 323, 616, 18406, 15, 9870, 562, 323, 731, 275, 616, 25730, 366, 2002, 272, 362, 507, 15, 5498, 2072, 21523, 2275, 3920, 187, 187, 10282, 342, 271, 7407, 10417, 22301, 5570, 665, 476, 1361, 368, 1379, 253, 1735, 3213, 15, 187, 187, 36, 360, 12581, 23264, 327, 15111, 27, 12231, 187, 187, 52, 744, 10421, 27, 187, 2941, 16, 805, 16, 7798, 187, 187, 26859, 265, 27, 187, 5, 21, 13, 41532, 9, 7132, 10, 187, 187, 45, 302, 19662, 27, 187, 22, 15, 2945, 20046, 187, 187, 2548, 27, 187, 21822, 14, 21276, 9067, 187, 187, 18085, 41898, 27, 187, 6620, 187, 187, 11446, 27, 187, 19, 16061, 187, 187, 43091, 27, 187, 33878, 902, 10317, 187, 187, 28014, 4412, 27, 187, 58, 293, 187, 187, 43582, 27, 187, 33798, 336, 3928, 187, 187, 40645, 27, 187, 35906, 187, 187, 25821, 187, 187, 4678, 35752, 1728, 4441, 327, 608, 20046, 259, 16, 1142, 27192, 15, 7489, 6119, 259, 16, 28859, 614, 33605, 13, 288, 69, 14066, 23467, 13, 5540, 16, 2945, 41778, 47545, 15, 831, 1728, 671, 3386, 247, 7473, 13223, 40373, 285, 1850, 3906, 347, 973, 347, 247, 298, 72, 1431, 40373, 259, 16, 11342, 5070, 285, 5389, 5534, 38357, 15, 510, 270, 4742, 69, 556, 247, 298, 72, 42801, 326, 310, 1270, 323, 32196, 390, 25945, 15, 380, 1840, 3216, 6363, 588, 3297, 15, 510, 6303, 556, 247, 31848, 608, 5313, 8158, 259, 16, 594, 1170, 6985 ]
A.2d 378, 384 (Pa. Super. 2002) (stating that appellant cannot claim that he involuntarily entered a guilty plea where he stated that no one threatened him to plead guilty). In point of fact, Gehr specifically stated that he understood the permissible ranges of sentence and that no specific prison sentence, whether county or state, was promised to him. See Muhammad, 794 A.2d at 383 (stating that “disappointment by a defendant in the sentence actually imposed does not represent manifest injustice.”). Thus, Gehr’s claim is frivolous. However, we must conduct an independent review of the record to determine whether there are any other non-frivolous issues that Gehr could raise on appeal.2 We will first determine whether the imposition of Gehr’s sentence for the DUI-refusal conviction violated the recent United States Supreme Court holding in Birchfield v. North Dakota, 136 S. Ct. 2 We acknowledge that “[t]he entry of a guilty plea constitutes a waiver of all defects and defenses except lack of jurisdiction, invalidity of the plea, and illegality of the sentence.” Commonwealth v. Tareila, 895 A.2d 1266, 1267 (Pa. Super. 2006). -7- J-S12038-17 2160 (2016).3 In Birchfield, the Supreme Court concluded that “a breath test, but not a blood test, may be administered as a search incident to a lawful arrest for drunk driving.” Birchfield, 136 S. Ct. at 2185. Additionally, the Supreme Court held that blood tests taken pursuant to implied consent laws are an unconstitutional invasion of privacy. Id. at 2186. The Supreme Court stated that “motorists cannot be deemed to have consented to submit to a blood test on pain of committing a criminal offense.” Id.; see also id. (concluding that the petitioner could not be convicted of refusing a warrantless blood draw following an arrest for driving under the influence). Here, at the time of his sentencing and resentencing hearing, Gehr 3 In the letter informing Gehr of his request to withdraw as counsel, Attorney Bower states that the Birchfield decision may impact Gehr’s DUI-refusal conviction. See Letter, 11/28/16. However, Attorney Bower indicated that Birchfield was decided after Gehr’s sentence, and while his appeal was pending, and thus, did not raise a Birchfield claim in the Anders brief. See id. Here, Birchfield was decided on June 23, 2016, after Gehr’s sentence was imposed, but during the pendency of the instant appeal. Because this issue relates to the legality of sentence, and Birchfield was decided during the pendency of Gehr’s appeal, we may address the legality challenge. See Commonwealth v. Barnes, 151 A.3d 121, 125-26 (Pa. 2016); see also Schriro v. Summerlin, 542 U.S. 348, 351 (2004) (stating that a United States Supreme Court decision resulting in a new rule of law “applies to all criminal cases still pending on direct review.”). -8- J-S12038-17 was subject to the penalties set forth in section 3804(c)(2), 4 as he pled guilty to DUI under section 3802(a)(1), his second offense, and refused to consent to a blood test. See N.T., 4/20/16, at 4 (noting that the mandatory minimum was ninety days); Sentencing Order, 4/20/16, at 3 (unnumbered) (stating that Gehr must pay the mandatory minimum fine of $1,500).5 As the Birchfield Court held that the practice of criminalizing the failure to consent to blood testing following a driving under the influence arrest was unconstitutional, we conclude that the trial court improperly 4 Section 3804(c)(2) states the following: (c) Incapacity; highest blood alcohol; controlled substances.--An individual who violates section 3802(a)(1) and refused testing of blood or breath or an individual who violates section 3802(c) or (d) shall be sentenced as follows: *** (2) For a second offense, to: (i) undergo imprisonment of not less than 90 days; (ii) pay a fine of not less than $1,500; (iii) attend an alcohol highway safety school approved by the department; and (iv) comply with all drug and alcohol treatment requirements imposed under sections 3814 and 3815. 75 Pa.C.S.A. § 3804(c)(2). 5 As part of its June 7, 2016 Sentencing Order, the trial court stated that apart from imposing the sentences concurrently, the remainder of the April 20, 2016 Sentencing Order remained in effect. See Sentencing Order, 6/7/16, at 2 (unnumbered). -9- J-S12038-17 relied upon section 3804(c)(2) in imposing a mandatory minimum sentence upon Gehr. See Commonwealth v. Giron, 2017 PA Super 23, *4 (Pa. Super. 2017) (holding that “pursuant to Birchfield, in the absence of a warrant or exigent circumstances justifying a search, a defendant who refuses to provide a blood sample when requested by police is not subject to the enhanced penalties provided in 75 Pa.C.S.A. §§ 3803-3804.”). Because there was no statutory authority to impose the sentence, we must vacate the judgment of sentence and remand for resentencing.6 See id. Based upon the foregoing, we affirm Gehr’s convictions, vacate his sentence and remand for resentencing. Accordingly, we deny Attorney Bower’s Petition to Withdraw.7 6 We note that the trial court imposed a sentence of one and one-half to five years in prison for the DUI-refual conviction, well above the mandatory minimum, and ran this sentence concurrent to the persons not to possess firearm conviction. Ostensibly, the trial court could impose the same sentence during resentencing. However, in imposing the sentence, the trial court cannot consider the mandatory minimum sentence in section 3804(c)(2), and cannot impose the mandatory fine. 7 Gehr has filed a separate Motion for Change of Appointed Counsel. However, based upon our disposition of this case and denial of Attorney Bower’s Petition to Withdraw, we deny Gehr’s Motion. Nevertheless, Gehr is free to file such a motion with the trial court upon remand for resentencing. - 10 - J-S12038-17 Petition to Withdraw as Counsel denied. Judgment of sentence vacated. Case remanded for resentencing. Motion for Change of Appointed Counsel denied. Jurisdiction relinquished. Judgment Entered. Joseph D. Seletyn, Esq. Prothonotary Date: 4/13/2017 - 11 - 2. 3. Dry Cleaning in Spitalfields We currently serve the whole of Spitalfields Market, supporting both residents and the surrounding shops, bars and restaurants with their dry cleaning and laundry requirements. They are a true delight for tourists and Londoners alike. Rashid is in charge of our dry cleaning collection and delivery service in the area and is on hand to answer any questions you have. You can also call our Customer Service Team to make changes to your scheduled collections and deliveries. Our drivers Sani and David know the E1 postcode like the back of their hand and are always on time for their collections. Look out for them in their ihateironing vans.Donna Rudebaugh Work with an experienced Real Estate agent who can help you take the next step. Cumulative Days on Market:117 Sold Date: 03/12/2018 Taxes: $4,085(2017) Lot Size: 5.42 acres Type: Single-Family Home Year Built: 2015 Style: 2 Story Views: Territorial School District: Yel County: Pierce County Community: Roy Comments Beautiful home located on 5 acres w/ many trails. Open kit w/granite counters, hdwd floors, 36/42 staggered cabinets. This home also features a formal din rm and den office as well as a lg fam rm w/fireplace and beautiful wood mantle.The bkyd has a lg patio that is great for relaxing or entertaining. The above ground pool will stay.The master has a fabulous 5 piece bath w/ soaking tub
[ 77, 15, 73, 31, 187, 4, 16238, 15112, 4132, 64, 47146, 64, 29193, 21466, 187, 50274, 4, 3709, 654, 57, 883, 16, 57, 4658, 15, 73, 31, 187, 4, 7287, 187, 187, 12361, 42644, 187, 92, 187, 12361, 2294, 187, 92, 187, 2437, 444, 3129, 5856, 1163, 1345, 4051, 5856, 187, 92, 187, 4387, 27, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 13, 417, 2330, 281, 247, 3497, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 25161, 281, 3894, 253, 747, 581, 342, 313, 5092, 320, 5812, 10, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 7660, 281, 247, 3497, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50271, 5856, 281, 3894, 253, 747, 581, 342, 187, 50274, 10638, 393, 3575, 7533, 50273, 47731, 3602, 187, 50274, 10638, 393, 3575, 7302, 50270, 11732, 281, 253, 7302, 3497, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 13, 1030, 25161, 16704, 7, 7533, 13, 1030, 30660, 14560, 11, 7302, 13, 10698, 540, 9886, 6052, 36273, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 247, 747, 3634, 326, 8473, 84, 697, 1211, 18164, 2303, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50275, 5856, 281, 3894, 253, 747, 581, 342, 187, 50274, 10638, 393, 3575, 7533, 42087, 3602, 187, 50274, 10638, 393, 3575, 4871, 50274, 8116, 6391, 4871, 13, 275, 15115, 187, 50274, 10638, 393, 3575, 4898, 50275, 8116, 6391, 4898, 13, 275, 15115, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 3129, 5856, 9, 38, 3129, 5856, 11, 6096, 13, 1030, 25161, 16704, 7, 7533, 13, 10698, 540, 4871, 13, 10698, 540, 4898, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 20593, 957, 263, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 95, 38, 3129, 5856, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 5057, 253, 2953, 273, 271, 7489, 5990, 1159, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 1416, 9424, 273, 253, 1159, 281, 755, 253, 2953, 273, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 22483, 273, 253, 7489, 5990, 1159, 13, 470, 327, 4433, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 4051, 11594, 11732, 755, 11594, 9, 3474, 1018, 11, 1416, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 39750, 366, 253, 3634, 347, 253, 1655, 2303, 187, 50274, 10638, 50270, 1542, 18164, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 1655, 12369, 281, 1056, 253, 3634, 1655, 390, 642, 3356, 1655, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 11793, 327, 2323, 13, 3221, 604, 667, 2228, 4592, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 7301, 1056, 10605, 9, 10975, 1655, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 27604, 752, 556, 644, 13697, 281, 253, 3634, 594, 2080, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 2991, 3148, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 34747, 390, 19495, 9118, 27801, 187, 50274, 10638, 187, 50274, 10638, 39750, 839, 9118, 27801, 588, 2701, 253, 1180, 187, 50274, 10638, 273, 13009, 8653, 281, 253, 22906, 2281, 273, 253, 5724, 15, 187, 50274, 10638, 831, 476, 3693, 690, 5304, 24165, 13, 285, 2701, 253, 30432, 5034, 187, 50274, 10638, 281, 247, 1175, 1318, 313, 2858, 417, 3638, 2439, 1027, 12823, 481, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 11410, 27, 11793, 281, 8046, 362, 14, 24335, 13, 3221, 281, 372, 36915, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 22259, 2991, 873, 44594, 27902, 19157, 9, 10975, 11410, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 253, 3634, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 6096, 50271, 5856, 281, 3894, 253, 747, 581, 342, 313, 5092, 320, 5812, 10, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 47731, 3602, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 2794, 5856, 9, 38, 3129, 5856, 11, 6096, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 13119, 253, 444, 5990, 2553, 187, 50274, 10638, 187, 50274, 10638, 831, 1159, 1364, 320, 1925, 672, 253, 2425, 313, 250, 10, 5478, 13, 390, 187, 50274, 10638, 672, 253, 11259, 1818, 15, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3497, 27, 380, 7925, 3497, 1511, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 2794, 33412, 9, 38, 5990, 21408, 12205, 2548, 3497, 558, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 20593, 4926, 253, 444, 5990, 2553, 187, 50274, 10638, 187, 50274, 10638, 831, 1159, 1364, 320, 1925, 672, 253, 2425, 310, 6331, 13, 390, 187, 50274, 10638, 672, 253, 11259, 1818, 15, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 6909, 33412, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 5057, 253, 1682, 444, 5990, 5304, 323, 247, 1677, 873, 273, 3492, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3148, 50272, 38, 5990, 3148, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 6825, 264, 3634, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 380, 1682, 444, 5990, 3596, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 444, 5990, 6155, 755, 17277, 6155, 9, 38, 5990, 17214, 3148, 13, 10698, 540, 9886, 6052, 36273, 13, 1030, 25161, 16704, 7, 7533, 558, 187, 187, 4, 16238, 15112, 4132, 64, 47146, 64, 29193, 21466, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 16551, 253, 1682, 444, 5990, 5304, 323, 247, 1677, 873, 273, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 3575, 3148, 50272, 57, 3148, 187, 50274, 10638, 393, 3575, 9886, 6052, 36273, 45562, 6864, 13, 275, 9886, 591, 12275, 187, 50274, 10638, 393, 3575, 7533, 50273, 6825, 264, 3634, 7533, 187, 50274, 10638, 187, 50274, 10638, 393, 2309, 380, 1682, 5304, 187, 50274, 10638, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4659, 1594, 25889, 6074, 3609, 17277, 25889, 9, 1450, 17214, 11, 3148, 13, 10698, 540, 9886, 6052, 36273, 13, 1030, 25161, 16704, 7, 7533, 558, 187, 4, 7287, 187, 187, 9486, 27, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 10638, 393, 18399, 7518, 468, 281, 3491, 253, 5055, 444, 5990, 6661, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 4353, 5731, 16704, 1874, 535, 50274, 16985, 9032, 5071, 2917, 187, 50274, 605, 17792, 941, 187, 50274, 16985, 9032, 5071, 2917, 187, 50274, 38, 5990, 17214, 50276, 78, 64, 8412, 28, 33047, 29, 380, 4812, 444, 5990, 3148, 187, 50274, 38, 5990, 5856, 50276, 78, 64, 8882, 28, 33047, 29, 380, 4812, 444, 5990, 3634, 187, 50274, 38, 5990, 33412, 50276, 78, 64, 26555, 28, 33047, 29, 380, 4812, 444, 5990, 2553, 187, 50274, 38, 5990, 6155, 50275, 78, 64, 5397, 28, 50276, 39481, 29, 380, 4812, 444, 5990, 3596, 187, 187, 4718, 187, 187, 94, 1380, 12953, 2294, 187, 187, 94, 1380, 12953, 42644, 535, 187, 4, 7287, 1380, 15112, 4132, 64, 38, 5990, 5707, 19093, 64, 40311, 187, 27732, 2035, 14, 24676, 6979, 273, 12366, 37724, 12382, 273, 253, 5988, 27, 7103, 273, 5165, 12393, 10235, 285, 2625, 7133, 275, 5921, 342, 46409, 4342, 15, 187, 510, 6378, 273, 436, 1263, 497, 281, 7277, 253, 5165, 12393, 10235, 313, 38348, 10, 273, 12366, 37724, 12382, 273, 253, 5988, 342, 326, 273, 643, 5988, 8837, 285, 281, 12106, 13007, 875, 2625, 7133, 327, 12393, 14, 24676, 3888, 285, 253, 46409, 3386, 273, 12366, 37724, 12382, 15, 5761, 4289, 28089, 14, 17182, 1363, 342, 28043, 10429, 13, 1690, 1458, 12366, 37724, 35563, 313, 1012, 6313, 1511, 13, 767, 6804, 1511, 582, 23133, 643, 17566, 8837, 13, 285, 9135, 21690, 10429, 13, 497, 6730, 342, 337, 15, 22, 14, 53, 14478, 387, 270, 2193, 273, 470, 285, 337, 13, 5388, 256, 16, 2188, 9, 19, 481, 380, 13007, 875, 7842, 414, 285, 34026, 13, 43967, 273, 2625, 7133, 327, 12393, 14, 24676, 3888, 13, 285, 1872, 11036, 9522, 4342, 497, 5867, 15, 380, 3064, 369, 10126, 1534, 313, 81, 654, 470, 15, 1762, 481, 380, 1599, 34026, 273, 12366, 37724, 12382, 313, 18, 15, 25, 11620, 470, 15, 21, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 369, 10126, 2169, 685, 326, 273, 21690, 10429, 313, 18, 15, 20, 30700, 470, 15, 20, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 285, 643, 17566, 8837, 313, 17, 15, 26, 11620, 470, 15, 19, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 313, 81, 654, 470, 15, 2874, 481, 380, 34026, 273, 6313, 1511, 12366, 37724, 12382, 313, 18, 15, 25, 11620, 470, 15, 20, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 369, 2169, 685, 326, 273, 6804, 1511, 12366, 37724, 12382, 313, 18, 15, 19, 11620, 470, 15, 19, 1269, 884, 1490, 20, 10, 5823, 9, 19, 1933, 84, 10, 313, 81, 654, 470, 15, 2874, 10, 285, 643, 46409, 3510, 313, 81, 2239, 470, 15, 1762, 481, 380, 5921, 875, 1599, 7842, 414, 285, 253, 34026, 273, 12366, 37724, 12382, 369, 1534, 313, 2859, 9, 84, 10, 426, 428, 17, 15, 31254, 28, 268, 426, 470, 15, 2874, 481, 380, 43967, 273, 2625, 7133, 327, 12393, 14, 24676, 3888, 9578, 342, 253, 43967, 273, 46409, 5289, 273, 12366, 37724, 12382, 313, 81, 654, 470, 15, 2874, 28, 465, 5596, 426, 470, 15, 25, 1731, 481, 353, 1028, 37724, 12382, 476, 320, 4518, 22266, 432, 643, 5988, 8837, 327, 253, 3720, 273, 34026, 15, 380, 1698, 2625, 7133, 273, 12366, 37724, 12382, 327, 12393, 14, 24676, 3888, 4620, 281, 4887, 253, 3361, 273, 12366, 249, 285, 1698, 7842, 414, 15, 4855, 2625, 7133, 327, 12393, 14, 24676, 3888, 778, 4887, 253, 3361, 273, 5713, 18540, 5670, 25663, 13, 2559, 894, 4038, 13, 390, 247, 5019, 273, 841, 3386, 15, 6586, 11743, 26872, 8113, 812, 320, 16789, 407, 13506, 30312, 284, 1160, 275, 253, 5188, 187, 187, 36, 9584, 284, 1160, 275, 253, 9965, 452, 16821, 5520, 253, 8184, 273, 884, 19688, 1363, 342, 1534, 8113, 2957, 15, 187, 187, 1845, 23747, 7094, 432, 13506, 15546, 13, 253, 27067, 3959, 253, 22602, 267, 2182, 6387, 323, 247, 5407, 281, 1966, 14773, 7944, 15, 187, 187, 510, 2840, 14, 12710, 30312, 284, 789, 407, 40021, 22781, 273, 253, 22614, 285, 1341, 275, 253, 5130, 15, 187, 187, 1552, 310, 253, 806, 673, 8113, 556, 644, 16789, 275, 436, 1039, 15, 187, 187, 6067, 3745, 281, 923, 7024, 327, 253, 944, 21254, 13, 253, 13955, 3828, 326, 10949, 253, 35048, 13, 3496, 261, 285, 2914, 273, 253, 5130, 15, 23089, 7094, 273, 15546, 13, 352, 20124, 84, 1708, 281, 2770, 3888, 327, 253, 30067, 15, 187, 187, 21727, 486, 281, 253, 944, 21254, 310, 253, 1273, 5962, 2847, 273, 44868, 11762, 13, 13567, 4829, 884, 3041, 952, 15, 187, 187, 688, 4343, 835, 4408, 19714, 310, 1896, 13, 33477, 4723, 285, 2728, 310, 4127, 407, 13132, 272, 1966, 14773, 30312, 284, 15, 1292, 627, 310, 247, 11762, 28938, 15, 187, 187, 510, 346, 67, 3783, 23744, 3, 27067, 497, 1160, 432, 247, 13506, 2715, 273, 1966, 15546, 4158, 281, 25066, 253, 944, 21254, 347, 8244, 347, 1896, 15, 34125, 12991, 13, 253, 2567, 326, 1160, 253, 27067, 908, 15727, 285, 1966, 3882, 6430, 281, 2794, 253, 2840, 30312, 284, 15, 187, 187, 37, 885, 833, 4408, 369, 5176, 432, 253, 30312, 284, 273, 884, 1363, 285, 7932, 342, 253, 27067, 15, 1583, 497, 840, 3560, 323, 767, 1107, 846, 5869, 281, 5724, 849, 973, 253, 27067, 497, 11217, 715, 253, 5130, 15, 187, 187, 688, 2800, 273, 253 ]
l.h> #ifdef SFML_SYSTEM_LINUX #include <X11/Xlib.h> #endif namespace sf { namespace priv { class EglContext : public GlContext { public: //////////////////////////////////////////////////////////// /// \brief Create a new context, not associated to a window /// /// \param shared Context to share the new one with (can be NULL) /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared); //////////////////////////////////////////////////////////// /// \brief Create a new context attached to a window /// /// \param shared Context to share the new one with /// \param settings Creation parameters /// \param owner Pointer to the owner window /// \param bitsPerPixel Pixel depth, in bits per pixel /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared, const ContextSettings& settings, const WindowImpl* owner, unsigned int bitsPerPixel); //////////////////////////////////////////////////////////// /// \brief Create a new context that embeds its own rendering target /// /// \param shared Context to share the new one with /// \param settings Creation parameters /// \param width Back buffer width, in pixels /// \param height Back buffer height, in pixels /// //////////////////////////////////////////////////////////// EglContext(EglContext* shared, const ContextSettings& settings, unsigned int width, unsigned int height); //////////////////////////////////////////////////////////// /// \brief Destructor /// //////////////////////////////////////////////////////////// ~EglContext(); //////////////////////////////////////////////////////////// /// \brief Get the address of an OpenGL function /// /// \param name Name of the function to get the address of /// /// \return Address of the OpenGL function, 0 on failure /// //////////////////////////////////////////////////////////// static GlFunctionPointer getFunction(const char* name); //////////////////////////////////////////////////////////// /// \brief Activate the context as the current target /// for rendering /// /// \param current Whether to make the context current or no longer current /// /// \return True on success, false if any error happened /// //////////////////////////////////////////////////////////// virtual bool makeCurrent(bool current); //////////////////////////////////////////////////////////// /// \brief Display what has been rendered to the context so far /// //////////////////////////////////////////////////////////// virtual void display(); //////////////////////////////////////////////////////////// /// \brief Enable or disable vertical synchronization /// /// Activating vertical synchronization will limit the number /// of frames displayed to the refresh rate of the monitor. /// This can avoid some visual artifacts, and limit the framerate /// to a good value (but not constant across different computers). /// /// \param enabled: True to enable v-sync, false to deactivate /// //////////////////////////////////////////////////////////// virtual void setVerticalSyncEnabled(bool enabled); //////////////////////////////////////////////////////////// /// \brief Create the context /// /// \param shared Context to share the new one with (can be NULL) /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Creation parameters /// //////////////////////////////////////////////////////////// void createContext(EglContext* shared); //////////////////////////////////////////////////////////// /// \brief Create the EGL surface /// /// This function must be called when the activity (re)start, or /// when the orientation change. /// /// \param window: The native window type /// //////////////////////////////////////////////////////////// void createSurface(EGLNativeWindowType window); //////////////////////////////////////////////////////////// /// \brief Destroy the EGL surface /// /// This function must be called when the activity is stopped, or /// when the orientation change. /// //////////////////////////////////////////////////////////// void destroySurface(); //////////////////////////////////////////////////////////// /// \brief Get the best EGL visual for a given set of video settings /// /// \param display EGL display /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Requested context settings /// /// \return The best EGL config /// //////////////////////////////////////////////////////////// static EGLConfig getBestConfig(EGLDisplay display, unsigned int bitsPerPixel, const ContextSettings& settings); #ifdef SFML_SYSTEM_LINUX //////////////////////////////////////////////////////////// /// \brief Select the best EGL visual for a given set of settings /// /// \param display X display /// \param bitsPerPixel Pixel depth, in bits per pixel /// \param settings Requested context settings /// /// \return The best visual /// //////////////////////////////////////////////////////////// static XVisualInfo selectBestVisual(::Display* display, unsigned int bitsPerPixel, const ContextSettings& settings); #endif private: //////////////////////////////////////////////////////////// /// \brief Helper to copy the picked EGL configuration //////////////////////////////////////////////////////////// void updateSettings(); //////////////////////////////////////////////////////////// // Member data //////////////////////////////////////////////////////////// EGLDisplay m_display; //!< The internal EGL display EGLContext m_context; //!< The internal EGL context EGLSurface m_surface; //!< The internal EGL surface EGLConfig m_config; //!< The internal EGL config }; } // namespace priv } // namespace sf #endif // SFML_EGLCONTEXT_HPP Diffusion-weighted imaging of mucinous carcinoma of the breast: evaluation of apparent diffusion coefficient and signal intensity in correlation with histologic findings. The purposes of this study were to compare the apparent diffusion coefficient (ADC) of mucinous carcinoma of the breast with that of other breast tumors and to analyze correlations between signal intensity on diffusion-weighted images and the histologic features of mucinous carcinoma. Two hundred seventy-six patients with 277 lesions, including 15 mucinous carcinomas (13 pure type, two mixed type), 204 other malignant tumors, and 58 benign lesions, were examined with 1.5-T MRI at b values of 0 and 1,500 s/mm(2). The correlations between cellularity and ADC, homogeneity of signal intensity on diffusion-weighted images, and histopathologic findings were analyzed. The difference was statistically significant (p < 0.05). The mean ADC of mucinous carcinoma (1.8 +/- 0.4 x 10(-3) mm(2)/s) was statistically higher than that of benign lesions (1.3+/- 0.3 x 10(-3) mm(2)/s) and other malignant tumors (0.9 +/- 0.2 x 10(-3) mm(2)/s) (p < 0.001). The ADC of pure type mucinous carcinoma (1.8 +/- 0.3 x 10(-3) mm(2)/s) was higher than that of mixed type mucinous carcinoma (1.2 +/- 0.2 x 10(-3) mm(2)/s) (p < 0.001) and other histologic types (p > 0.05). The correlation between mean cellularity and the ADC of mucinous carcinoma was significant (rho(s) = -0.754; p = 0.001). The homogeneity of signal intensity on diffusion-weighted images correlated with the homogeneity of histologic structures of mucinous carcinoma (p < 0.001; kappa = 0.826). Mucinous carcinoma can be clearly differentiated from other breast tumors on the basis of ADC. The low signal intensity of mucinous carcinoma on diffusion-weighted images appears to reflect the presence of mucin and low cellularity. High signal intensity on diffusion-weighted images may reflect the presence of fibrovascular bundles, increased cell density, or a combination of these features.Image caption Lost vision could be restored by synthetic corneas made in the lab Corneas made in the laboratory have dramatically improved the sight of 10 Swedish patients with significant vision loss. Produced entirely from synthetic collagen, the implants offer the tantalising possibility for a replacement to human donor tissues. The custom-made corneas work by prompting regeneration of the nerves and cells in the eye. This is the first time vision has been restored in this way. Our ability to see depends on the cornea, the transparent layer that covers the pupil, iris and front of the eye. Made entirely of collagen, it refracts light to focus images on the retina. Damage to the cornea is the second biggest cause of blindness worldwide, affecting nearly 10 million people. In countries where tissue banking is possible, corneal damage and disease is treated by implanting human donor corneas. But there is a worldwide shortage. The "biosynthetic" implants were made from a synthetic version of human collagen designed to mimic the cornea as closely as possible. Fibrogen, the company that made the implants used yeast and human DNA sequences to create the custom corneas. Diseased tissue was removed from the corneas of 10 patients and replaced with the implants. They were then followed for two years after surgery to monitor how well the implants were incorporated into the eye. In six of the
[ 562, 273, 253, 9169, 9922, 12674, 3625, 5492, 327, 8216, 347, 344, 19460, 281, 6351, 32535, 275, 247, 22299, 1673, 15, 187, 187, 3, 42, 6337, 323, 4007, 984, 436, 2586, 310, 1146, 30548, 7419, 407, 8672, 285, 37492, 3958, 1223, 776, 5962, 3237, 564, 5061, 5336, 15, 3954, 3063, 13, 309, 1353, 12365, 619, 4544, 323, 4007, 13, 533, 309, 588, 1620, 3523, 22142, 326, 3968, 476, 760, 2118, 3579, 672, 359, 789, 2366, 937, 388, 20471, 4213, 2211, 753, 275, 247, 3492, 6096, 327, 2675, 3420, 15, 754, 2879, 326, 344, 3264, 247, 346, 635, 1027, 6452, 3, 432, 521, 12674, 12246, 15, 187, 187, 41, 20471, 4213, 2211, 15975, 27, 831, 4131, 13, 309, 1353, 30849, 326, 309, 1353, 642, 3356, 3515, 323, 3918, 15, 3900, 436, 4544, 1904, 626, 452, 253, 6454, 359, 497, 11525, 323, 13, 1046, 2774, 556, 644, 32811, 708, 309, 1353, 31115, 281, 4130, 665, 4516, 436, 4544, 285, 776, 2862, 2285, 15, 187, 187, 6573, 3377, 10823, 452, 18343, 388, 20471, 4213, 2211, 281, 9488, 521, 12246, 285, 3185, 6604, 253, 1375, 434, 530, 15, 52, 15, 8907, 5492, 13, 835, 521, 3128, 13079, 281, 30394, 255, 8786, 35315, 48038, 35646, 15, 496, 253, 3492, 8216, 13, 388, 20471, 4213, 2211, 753, 344, 3735, 346, 4064, 594, 1142, 9472, 324, 507, 665, 971, 479, 281, 1408, 323, 1986, 2077, 8907, 449, 754, 753, 344, 651, 346, 31089, 326, 690, 4092, 1869, 449, 187, 187, 13641, 41965, 452, 4931, 616, 1682, 4839, 281, 19153, 247, 18485, 14, 13028, 7319, 1735, 807, 275, 13338, 15, 41332, 13, 625, 685, 884, 10823, 452, 16780, 715, 253, 9922, 8907, 3625, 15, 1284, 344, 556, 1029, 1416, 8981, 432, 767, 2426, 347, 13338, 434, 14176, 13, 388, 20471, 4213, 2211, 651, 4745, 2489, 247, 1755, 49865, 323, 253, 8907, 7319, 604, 344, 5966, 253, 12417, 15, 187, 187, 41, 20471, 4213, 2211, 13, 247, 10290, 13, 4242, 281, 6427, 1199, 4116, 846, 27906, 521, 12674, 4613, 1974, 275, 3919, 15, 754, 3839, 2206, 387, 337, 6, 275, 253, 22207, 15, 754, 5439, 816, 370, 18, 15, 18, 3041, 275, 253, 1273, 7150, 13, 2190, 253, 8840, 419, 7228, 273, 667, 273, 253, 9183, 15, 187, 187, 41, 20471, 4213, 2211, 434, 268, 2711, 610, 1273, 14, 35443, 35958, 4845, 521, 4544, 275, 5434, 273, 3515, 562, 273, 2583, 13, 2556, 281, 12766, 4173, 15, 187, 187, 8389, 4544, 37093, 247, 17941, 14, 484, 275, 2393, 4163, 672, 2620, 1029, 14, 5251, 4750, 398, 1669, 390, 1160, 5827, 281, 3553, 13, 12766, 4173, 2361, 15, 187, 187, 10457, 4163, 434, 9922, 3625, 8881, 388, 20471, 4213, 2211, 7416, 643, 16938, 684, 275, 20362, 4780, 1644, 13, 9734, 326, 10823, 8, 346, 10818, 280, 609, 323, 1876, 3, 18595, 651, 1614, 745, 11163, 15, 346, 1552, 10732, 326, 368, 1472, 1469, 281, 1379, 3055, 6503, 1977, 432, 12660, 3041, 7108, 937, 344, 753, 13, 346, 261, 247, 15394, 387, 253, 22523, 3817, 13, 368, 1537, 347, 973, 8529, 1672, 253, 6132, 281, 10053, 3778, 449, 187, 187, 41, 20471, 4213, 2211, 434, 4544, 574, 14078, 264, 521, 9550, 285, 2323, 275, 16994, 7823, 326, 14123, 2822, 10898, 1786, 14, 6672, 7031, 13, 2266, 5654, 1453, 5593, 285, 253, 4320, 1320, 273, 28977, 13717, 1309, 521, 767, 2426, 347, 13338, 434, 14176, 15, 187, 187, 41, 20471, 4213, 2211, 13, 9963, 13, 369, 13338, 434, 14176, 432, 4332, 281, 6247, 15, 754, 369, 20734, 434, 14967, 323, 4314, 1107, 1078, 326, 15, 187, 187, 510, 13338, 8907, 5492, 556, 8392, 12680, 3872, 1600, 347, 11885, 285, 10823, 3819, 323, 1453, 273, 253, 9320, 1735, 807, 15, 380, 1755, 3187, 40902, 275, 253, 9922, 3625, 13, 3438, 1375, 4673, 15, 10035, 38437, 13, 5439, 370, 18, 15, 23, 3041, 275, 253, 1273, 7150, 1905, 625, 685, 388, 20471, 4213, 2211, 858, 347, 247, 12674, 7431, 15, 187, 187, 1128, 18526, 3979, 434, 15273, 7528, 328, 4940, 9945, 281, 436, 1304, 50, 27, 187, 187, 57, 3211, 577, 15, 20, 5204, 17370, 47, 2523, 346, 11695, 556, 642, 4284, 1973, 6661, 3, 187, 187, 3039, 309, 2451, 562, 253, 2127, 327, 1594, 3211, 577, 15, 20, 13, 352, 4245, 271, 2228, 428, 8049, 556, 642, 4284, 1973, 6661, 15, 733, 2987, 327, 2045, 1594, 3211, 9508, 2167, 15, 187, 5804, 3780, 1361, 479, 275, 36182, 436, 562, 32, 187, 3614, 1358, 3620, 1542, 7640, 15, 19934, 15, 681, 16, 8559, 16, 23, 1717, 18493, 4, 23, 1717, 18493, 187, 42, 717, 7591, 281, 897, 1594, 3211, 577, 15, 20, 1024, 285, 309, 452, 9300, 619, 13971, 281, 608, 15, 18, 187, 688, 1340, 281, 1071, 622, 327, 619, 4481, 309, 878, 281, 4993, 436, 1594, 3211, 2523, 15, 2615, 3095, 1361, 479, 275, 36182, 436, 562, 32, 187, 187, 34, 27, 187, 187, 35082, 751, 1594, 3211, 577, 15, 20, 4419, 326, 634, 346, 6986, 11909, 2402, 3, 1364, 320, 1633, 2931, 275, 253, 346, 57, 36, 10987, 11909, 3, 2593, 15, 2490, 187, 9807, 634, 2199, 15, 15656, 89, 29167, 275, 247, 2505, 8121, 751, 802, 18944, 1227, 2505, 13884, 15, 187, 13422, 323, 346, 57, 36, 10987, 11909, 3, 285, 3877, 253, 1973, 16012, 2931, 275, 326, 2593, 313, 27978, 26073, 13, 20002, 285, 30313, 13, 7293, 327, 253, 16012, 368, 2931, 323, 634, 2199, 481, 187, 4125, 3186, 512, 10872, 273, 346, 6986, 11909, 2402, 3, 428, 352, 434, 2779, 326, 436, 310, 873, 281, 247, 6661, 326, 1057, 5803, 2226, 275, 634, 1594, 36, 10987, 11909, 2593, 15, 15836, 253, 1318, 9, 84, 10, 594, 326, 352, 10129, 581, 273, 253, 16012, 7616, 275, 1594, 36, 10987, 11909, 313, 249, 619, 1083, 13, 309, 816, 4391, 432, 346, 18992, 3, 281, 346, 14154, 995, 534, 943, 3164, 789, 275, 634, 1083, 347, 973, 984, 954, 6493, 452, 387, 1878, 247, 346, 14154, 3, 6661, 2931, 10, 187, 187, 1394, 943, 840, 320, 2104, 281, 1527, 634, 2199, 275, 1594, 6124, 577, 15, 20, 535, 9707, 10601, 1267, 378, 4290, 45, 2637, 418, 8506, 28614, 380, 1048, 2940, 896, 281, 15704, 6625, 38437, 20930, 308, 8775, 187, 187, 34, 807, 327, 432, 247, 5249, 14, 40133, 4254, 281, 1555, 247, 10720, 4073, 17681, 273, 253, 896, 13, 1720, 18393, 308, 879, 90, 310, 39654, 323, 247, 13406, 41759, 15, 20919, 36, 695, 9111, 4396, 187, 187, 1785, 18393, 308, 879, 90, 310, 8288, 342, 625, 9305, 33773, 685, 344, 556, 275, 667, 273, 776, 2045, 16072, 15, 733, 310, 2393, 4247, 13, 2620, 2607, 846, 5249, 14, 1545, 1699, 5869, 327, 521, 896, 15, 2058, 436, 1127, 13, 344, 2506, 626, 871, 1880, 1841, 588, 789, 562, 15, 754, 556, 642, 9635, 3310, 285, 11210, 626, 6026, 1070, 247, 4023, 323, 2800, 2607, 15, 754, 2506, 626, 2568, 871, 1880, 344, 588, 2455, 755, 896, 4830, 247, 25154, 1673, 15, 187, 187, 1231, 452, 1313, 2709, 2069, 1580, 326, 4254, 13, 13452, 327, 253, 4481, 13, 25920, 7418, 8169, 15, 844, 651, 2312, 11719, 689, 253, 1735, 2800, 2607, 13, 1512, 15, 1292, 3063, 13, 352, 310, 28629, 326, 308, 879, 90, 310, 19703, 625, 24189, 685, 344, 556, 1078, 670, 253, 24626, 285, 10397, 326, 247, 27262, 273, 4073, 22877, 452, 4269, 779, 15, 187, 187, 3, 42, 3543, 19124, 281, 3253, 937, 344, 2296, 13, 7063, 387, 247, 2829, 275, 247, 26002, 8574, 8979, 275, 2065, 43314, 13, 19083, 247, 11636, 273, 4474, 16068, 285, 690, 9279, 15, 346, 4553, 5869, 309, 4571, 626, 513, 2712, 15, 309, 3543, 309, 369, 642, 1175, 281, 3780, 15, 1893, 13, 309, 369, 751, 13, 513, 368, 871, 752, 13, 12445, 310, 7746, 479, 309, 452, 281, 513, 436, 15, 1422, 476, 320, 5211, 342, 25154, 275, 634, 1495, 13, 368, 476, 320, 5211, 1293, 352, 15, 1707, 434, 642, 4797, 3845, 323, 1146, 2600, 449, 187, 187, 53, 879, 90, 434, 7906, 273, 4933, 253, 2165, 598, 497, 417, 747, 15, 380, 5854, 3809, 6026, 2146, 556, 2783, 352, 625, 2069, 685, 344, 24505, 281, 4456, 846, 271, 622, 11822, 1408, 273, 9478, 534, 556, 2908, 2620, 2117, 2979, 342, 4073, 22877, 273, 253, 896, 275, 253, 1390, 2800, 1107, 15, 380, 6323, 5866, 1390, 5768, 13, 275, 4163, 13, 285, 2436, 15281, 5869, 15, 754, 434, 760, 2030, 15, 187, 187, 998, 560, 22877, 403, 751, 465, 7430, 251, 614, 323, 6026, 10787, 27, 4274, 6133, 839, 285, 396, 1875, 314, 16592, 15, 1707, 310, 642, 12215, 597, 588, 320, 253, 1072, 4760, 846, 581, 15, 2596, 4073, 17681, 275, 247, 5249, 310, 3076, 2217, 15, 5761, 13, 23293, 15, 1292, 2620, 32, 914, 28996, 273, 15, 187, 187, 688, 7418, 12888, 285, 23261, 689, 253, 2469, 1249, 2607, 13, 352, 556, 644, 2590, 326, 3738, 253, 3438, 44057, 285, 24129, 637, 556, 1620, 1663, 3078, 281, 1918, 25154, 1977, 13, 344, 556, 1705, 281, 2426, 342, 2509, 594, 15, 308, 879, 90, 6849, 2994, 347, 271, 28684, 1436, 533, 846, 436, 1408, 273, 3076, 7516, 13, 352, 310, 1652, 4282, 344, 556, 2783, 1880, 352, 310, 512, 32811, 15, 329, 9560, 2180, 273, 521, 5249, 556, 644, 2668, 1977, 15, 187, 187, 688, 4104, 13, 344, 9377, 715, 5854, 434, 581, 14, 1201, 285, 308, 938, 6671, 13, 2509, 2217, 275, 521, 3710, 9091, 281, 5276, 344, 812, 5878, 352, 387, 253, 1755, 1268, 15, 32826, 13, 1669, 14, 1513, 285, 2104, 281, 6635, 1175, 13870, 13, 627, 497, 1029, 13079, 308, 879, 90, 651, 320, 247, 2022, 39642, 273, 5854, 434, 3168, 14, 2910, 10532, 15, 1310, 1841, 574, 644, 1027, 13, 344, 1537, 452, 644, 247, 3645, 9167, 13688, 15, 7820, 13, 344, 434, 327, 1529, 41759, 3971, 15, 187, 187, 9083, 1037, 13, 253, 1390, 2800, 1107, 452, 644, 6898, 342, 1897, 3811, 275, 3638, 3075, 15, 1198, 954, 273, 326, 673, 13, 344, 651, 6947, 3387, 2909, 275, 253, 17409, 816, 281, 755, 521, 2133, 4704, 281, 6194, 15, 13992, 14689, 25602, 3395, 253, 5222, 2112, 342, 50160, 480, 5375, 1046, 1770, 15, 1310, 344, 574, 247, 10562, 13, 344, 651, 320, 275, 2264, 41335, 253, 1735, 1388, 15, 5761, 390, 1264, 1897, 1078, 247, 2165, 13, 344, 651, 755, 10397, 13, 247, 11219, 1255, 670, 253, 3075, 344, 1537, 452, 281, 30565, 15, 733, 1904, 626, 1900, 1705, 15, 1292, 1077, 2223, 13, 352, 858, 15, 187, 187, 3, 1147, 369, 2761, 751, 1146, 762, 2419, 5263, 937, 310, 849, 344, 2529, 352, 13, 7063, 275, 247, 4693, 2534, 247, 1643, 3618, 846, 253, 1884, 394, 4163, 4254, 13, 275, 776, 806, 2454, 14, 936, 14, 1664, 4804, 15, 346, 42, 369, 18195, 15, 17814, 2010, 369, 4882, 25154, 285, 18262, 352, 285, 309, 369, 3365, 2820, 281, 320, 275, 247, 1659, 309, 369, 9848, 15, 21869, 1959, 15, 187, 187, 3, 42, 1869, 326, 369, 16088, 16593, 15, 309, 1869, 13, 686, 2513, 352, 4409, 352, 5554, 733, 1694, 281, 253, 1127, 835, 309, 1869, 309, 651, 2581, 320, 7063, 387, 247, 8597, 13, 2509, 247, 2622, 2628, 2581, 685, 1469, 949, 436, 1046, 1388, 449, 187, 187, 46928, 187, 187, 3, 46, 366, 13, 3063, 310, 247, 3076, 1388, 449, 187, 187, 53, 879, 90, 310, 9995, 344, 753, 1110, 3000, 281, 5854, 31143, 2150, 900, 13, 6029, 418, 2134, 90, 13, 1078, 3192, 253, 1673, 1411, 5427, 686, 34, 8, 387, 253, 48954, 1390, 4163, 15, 733, 369, 253, 2457, 273, 247, 1195, 14, 22253, 285, 308, 879, 90, 369, 1469, 715, 253, 2165, 1907, 816, 5950, 521, 1682, 14, 972, 5552, 329, 8442, 273, 577, 323, 1668, 13, 1411, 4255, 44744, 686, 34, 8, 247, 1643, 1897, 4321, 15, 9110, 308, 879, 90, 3260, 13, 347, 344, 556, 1929, 1142, 13, 1142, 2069, 689, 13, 436, 2165, 13, 327, 436, 1388, 13, 651, 320, 247, 6680, 15, 187, 187, 510, 1921, 344, 434, 9995, 273, 326, 5016, 342, 418, 2134, 90, 310, 984, 13, 275, 521, 1211, 3000, 13, 344, 6026, 1070, 346, 66, 16846, 273, 10739, 3446, 7874, 689, 84, 323, 5922, 6613, 15, 380, 3075, 369, 594, 3076, 1046, 673, 344, 1694, 281, 521, 6742, 31482, 326, 667, 1869, 273, 835, 253, 4023, 651, 990, 598, 369, 19124, 15, 831, 369, 417, 253, 2238, 273, 49652, 326, 512, 6026, 10787, 8722, 15, 831, 369 ]
out of the 2020 Democratic presidential primary race on Thursday as he struggled to gain traction in a crowded field. "I ran for president because this country is being ripped apart by politics and partisan games while our biggest problems go unsolved. Now today, I'm ending my campaign for president, but I will never stop believing that America can only move forward when we work together," Hickenlooper said in a video shared on social media. He added that he expected a "very different conclusion" from his presidential bid. Hickenlooper tweet: This morning, I'm announcing that I'm no longer running for President. While this campaign didn't have the outcome we were hoping for, every moment has been worthwhile & I'm thankful to everyone who supported this campaign and our entire team. Colorado Democrats have urged Hickenlooper to abandon his bid and instead join the state's U.S. Senate race, where his party hopes to unseat Republican incumbent Cory Gardner. In the video Thursday, Hickenlooper said he heard "from so many Coloradans who want me to run for United States Senate." He said he would "give that some serious thought." Democrats have perhaps their best chance to flip a GOP-held seat next year in Colorado. Already, more than 10 Democrats have jumped into the Democratic Senate primary. As he has high name recognition from two terms as Colorado's governor, Hickenlooper would immediately become a top contender for the Senate seat if he entered the contest. Hickenlooper, a moderate, failed to attract much attention after declaring his presidential candidacy in March. He generally sat at 1% in the polls. He raised just $1.1 million in the second quarter, among the lowest hauls of any of the candidates. Hickenlooper's paltry second-quarter fundraising placed his campaign in danger of running out of money, according to Politico. His campaign endured a shake-up in early July when five high-level staffers left or made plans to leave, Politico reported. During July's Democratic primary debate Hickenlooper joined other moderates in attacking progressives, warning that Democrats' "Medicare for All" proposals would turn off voters. "This notion that you're going to take private insurance away from 180 million Americans," he said, "is a disaster at the ballot box, you might as well FedEx the election to Donald Trump." Hickenlooper's campaign had touted his leadership and success in implementing policies that accomplished near universal health-care coverage, strong gun control measures and the legalization of recreational marijuana during his two terms as Colorado's governor. Hickenlooper, 67, was Colorado's governor from 2011 to 2019. He was Denver's mayor for eight years before that. The Colorado Senate race has drawn intense national interest as Republicans and Democrats fight for control of the chamber next year. The top fundraiser in the Democratic primary, former state Sen. Mike Johnston, raised $1.6 million in the second quarter — more than Hickenlooper did as a presidential candidate. — CNBC's Kevin Breuninger contributed to this reportQ: Xcode 4.3 -> SVN issue "Project has no default build configuration" When I check out the code on Xcode 4.3, it gives an error - Project has no default build configuration. It works on previous Xcode versions though. Can anyone help me in figuring this out? https://devforums.apple.com/message/629197#629197 I am unable to use Xcode 4.3 now and I have updated my iPhone to 5.1 In order to test app on my phone I need to fix this Xcode issue. Can someone help me in figuring this out? A: Looks like Xcode 4.3 requires that your "defaultConfigurationName" must be something defined in the "XCBuildConfiguration" section. Open your project.pbxproj in a text editor like emacs / textmate. Search for "XCBuildConfiguration" and note the build configurations defined in that section (usually Debug, Release and Distribution, depending on the configurations you defined for your project). Now search all instances of "defaultConfigurationName" - it's likely that this is set to a configuration that does NOT exist in your XCBuildConfiguration section. Change the value(s) so that it matches one of the configurations specified in XCBuildConfiguration (in my case, I just changed from "Release" to "Debug", which should probably work in your case as well because most projects have at least a "Debug" configuration defined) You should then be able to open your project in XCode 4.3 THE FAST BOWLING LAYOVER The long walk back to happiness Rob Johnston Share Tweet A year on from a career-saving operation to treat a fifth stress fracture of the back, Reece Topley is poised for a remarkable comeback. ©Cricbuzz Reece Topley is speaking with more raw honesty than he has in any of our previous conversations. It is early January, five months after career-defining surgery on his back. At this point, he doesn't know whether things will work out. He has no county contract and hasn't bowled a ball for six months. He doesn't yet know whether he will ever get back onto a cricket field. We have met multiple times since that operation, spoken on the phone, exchanged numerous messages. We would talk regularly over the next six months, too. But today, it is noticeable that Topley is displaying more vulnerability than he has before about the doubts and anxiety that a succession of stress fractures have caused him. "I felt irrelevant to everything," he says, sitting at a table in a Costa coffee shop in Colchester, finishing a bowl of porridge and some fruit. "After surgery I couldn't do anything. I felt I was no good to anyone. So, I was like, do you know what, nobody is telling me I have to do this. You can be happy with cricket in your life, you can be happy without it. There's no blueprint for being content." Topley's thoughts of giving the game up were not new. The England fast bowler has considered it more times than he cares to remember after an appalling run of injuries which has included five absences with stress fractures of the back in the last six years. The latest occurred last summer, in July, and necessitated surgery. He's only 25. Stress fractures are like kryptonite for bowlers: debilitating and searingly painful. There is no guarantee they will be the same player after one. One stress fracture in a career is bad enough. Two, unfortunate. But five? Unheard of. In numerous interviews and exchanges over the past 12 months, it has been clear that although the former Essex and Hampshire man has never really wanted to give cricket away, he has come to terms with doing so. Topley views himself as an optimistic person but after this run of bad luck, it is little wonder he has considered whether it is all worthwhile. A crucial period of his career has been taken away. In 2015, he broke into England's one-day and T20 teams, doing enough in his limited opportunities to prove he could mix it at the top level. Tall, left-arm and able to generate good pace, there were high hopes Topley would be a mainstay of England's white-ball revolution. If things had been different, he might have been a World Cup winner. Instead, he's on another comeback road. Physically, the last six years have been filled with days living in constant pain. For most of that time, he would spend 40 minutes in the gym just to get his body ready to train. Daily hormone injections became the norm along with anesthetic jabs every month. If he had a beer, he would be in total agony the next day. Two or three days before a game, he would get anxiety, a nervousness about the pain he might have to endure. It didn't always come. But very often, it did. "It was almost like being under house arrest," is how he described it, sitting in a London bar a few weeks after the 30th July operation, in our first face-to-face meeting. "I was trapped. Everyone else was playing cricket and enjoying it and I was simply trying to be in a place I was comfortable. Pain free. "I thought that was incredibly unfair. I thought, 'Is it worth it?' It got to the point where I thought I would rather be sitting at a desk, doing a normal job rather than going through this every day." ***** "Mate, today is a bad day." Topley is glad he said those words to England Lions physio, Ben Langley, before taking the field against India 'A' at the Oval last July. It was the final of a tri-series and Topley was going into the game having just recorded his best-ever List A figures of 4 for 16, against West Indies 'A' a few days earlier. Yet Topley knew, as he has known many, many times over, this game, on this day, would be a battle. The reason he's glad of that interaction with Langley is because, in his own words, he bowled "a shower of shit". Four overs for 33 runs. The pain was so bad every time he got to his delivery stride that any thought of where the ball would end up was irrelevant. This was not the kind of ache that all bowlers manage. This was
[ 13, 35362, 13, 34205, 1253, 1549, 187, 187, 395, 789, 12036, 13, 26771, 13, 31242, 1253, 26, 13, 33723, 187, 187, 395, 29452, 1204, 795, 2887, 64, 29452, 382, 4866, 187, 187, 64, 2887, 671, 64, 8170, 7039, 273, 15562, 456, 11563, 28, 34140, 13, 253, 28, 1986, 2077, 273, 3968, 795, 395, 2173, 3872, 1005, 64, 187, 187, 27341, 84, 577, 187, 187, 7878, 795, 2887, 762, 64, 1986, 2077, 187, 187, 12784, 304, 9231, 281, 5106, 36829, 1253, 26, 187, 187, 47, 23248, 8410, 273, 3349, 1253, 26, 187, 187, 47, 23248, 385, 49022, 273, 1384, 1253, 18, 13, 6931, 1253, 1449, 13, 5571, 13, 11102, 1253, 19, 187, 187, 709, 4079, 265, 313, 81, 2663, 274, 10, 30805, 13, 31133, 187, 187, 4037, 51, 5214, 6171, 23540, 187, 187, 64, 2887, 671, 64, 32863, 13, 40115, 757, 795, 395, 64, 19701, 11563, 28, 9556, 399, 3724, 187, 187, 8, 47212, 13, 253, 8, 795, 2887, 64, 2448, 23106, 9556, 30313, 7039, 187, 187, 43, 38605, 13, 9545, 66, 28875, 1253, 25, 187, 187, 27302, 85, 13, 14861, 29716, 187, 187, 43, 962, 276, 6169, 13, 6181, 27, 7379, 51, 5214, 19036, 12169, 15410, 13, 15470, 13, 11858, 13, 20105, 187, 187, 43, 3938, 398, 13, 6176, 27, 48477, 25891, 2986, 21807, 187, 187, 40917, 1906, 661, 11130, 187, 187, 44, 515, 293, 9963, 13, 27880, 13, 34360, 187, 187, 47027, 1362, 16015, 36103, 313, 38765, 10, 11266, 187, 187, 44, 1952, 1592, 272, 4719, 2986, 5325, 13, 10508, 1253, 26, 13, 26675, 1253, 21, 187, 187, 29456, 328, 284, 795, 2887, 64, 611, 729, 2369, 187, 187, 44, 1796, 13, 6911, 32835, 13, 29716, 187, 187, 44, 2187, 257, 13, 6176, 27, 25891, 2986, 11003, 1253, 26, 187, 187, 45395, 266, 13, 6086, 401, 15, 32515, 187, 187, 29777, 1710, 27812, 13, 10257, 187, 187, 45395, 6368, 13, 2516, 401, 15, 37737, 187, 187, 9499, 37889, 13, 2516, 2552, 79, 472, 898, 13, 4567, 13, 19593, 187, 187, 44, 6285, 2345, 45627, 13, 17250, 5741, 27587, 187, 187, 44, 928, 13, 6176, 27146, 13, 29503, 187, 187, 44, 928, 336, 13, 16795, 27, 36103, 273, 11563, 313, 43970, 10, 23540, 13, 38162, 187, 187, 44, 850, 36470, 13, 16543, 16493, 1253, 19, 187, 187, 44, 28017, 13, 17111, 1458, 13, 1668, 13, 3285, 13, 9330, 13, 17181, 13, 25653, 13, 35312, 187, 187, 21958, 13, 23302, 32560, 34128, 13, 36076, 187, 187, 44, 261, 15701, 7876, 20729, 32518, 13, 38005, 2072, 1052, 187, 187, 44381, 666, 1216, 13, 46005, 24958, 12197, 1253, 20, 13, 12131, 13, 9199, 13, 26771, 13, 35100, 1253, 25, 13, 34205, 187, 187, 44, 282, 2188, 860, 13, 47246, 32193, 1253, 24, 13, 31242, 13, 33152, 1253, 1166, 13, 28325, 187, 187, 44381, 7337, 2102, 398, 23407, 71, 13, 6176, 27, 2151, 434, 9145, 30581, 187, 187, 44, 2381, 49854, 13, 12294, 296, 13, 3918, 273, 6176, 27744, 187, 187, 44, 251, 19249, 1507, 13, 714, 1173, 864, 28121, 187, 187, 44, 16937, 790, 5985, 13, 39001, 24519, 1253, 26, 13, 38939, 187, 187, 44, 37173, 3660, 38316, 13, 24877, 187, 187, 44, 263, 6481, 13, 5794, 66, 9963, 1253, 26, 13, 27880, 13, 34360, 187, 187, 44, 729, 2369, 313, 29456, 328, 284, 582, 40115, 571, 27, 11563, 9161, 13, 10694, 1253, 2313, 13, 12660, 13, 26675, 1253, 21, 187, 187, 44, 579, 16559, 13, 19120, 6002, 284, 36153, 187, 187, 44, 335, 23268, 13, 36362, 27, 795, 48705, 5201, 26380, 275, 3060, 64, 2456, 13, 8978, 187, 187, 21663, 454, 7021, 13, 4782, 11343, 1253, 1036, 187, 187, 64, 2887, 671, 64, 5706, 14906, 13, 39159, 16, 6601, 14906, 2208, 187, 187, 47529, 30898, 13, 16617, 1715, 3436, 187, 187, 7647, 35854, 571, 13, 33813, 410, 48620, 388, 15, 8319, 13, 8026, 187, 187, 11814, 27648, 1253, 24, 187, 187, 284, 9966, 14, 13425, 273, 7379, 51, 5214, 19956, 13, 26472, 1253, 25, 13, 30135, 13, 32858, 1253, 19, 13, 31950, 187, 187, 395, 2739, 8891, 275, 3060, 28485, 1253, 21, 187, 187, 395, 30739, 10629, 8420, 26249, 13, 26780, 13, 20504, 187, 187, 968, 808, 84, 25891, 19509, 28020, 1253, 21, 13, 28131, 1253, 24, 187, 187, 395, 16286, 20504, 13, 28131, 1253, 24, 187, 187, 395, 1234, 26628, 318, 273, 19701, 399, 3724, 27518, 1253, 26, 187, 187, 24731, 8592, 13, 444, 34633, 39474, 187, 187, 45, 2287, 4978, 13, 6176, 27, 25891, 2986, 12036, 13, 24232, 1253, 3593, 13, 23512, 13, 25305, 13, 22121, 13, 33790, 13, 35100, 13, 31184, 187, 187, 64, 24731, 9875, 846, 253, 15764, 64, 313, 18405, 10, 25911, 187, 187, 45, 1351, 13, 15948, 2071, 739, 31605, 187, 187, 45, 1945, 74, 13, 29271, 5345, 1253, 25, 13, 6931, 13, 7584, 187, 187, 23080, 87, 757, 399, 3724, 187, 187, 395, 2806, 2791, 22121, 1253, 18, 187, 187, 23485, 29123, 32855, 187, 187, 23485, 2675, 1495, 27360, 1253, 23, 187, 187, 395, 8410, 275, 9643, 33141, 1253, 2405, 13, 38794, 187, 187, 27341, 84, 24833, 187, 187, 25736, 15555, 854, 13, 31507, 187, 187, 79, 2244, 265, 23917, 1253, 1036, 187, 187, 250, 44001, 318, 273, 11130, 187, 187, 373, 3592, 1338, 275, 6976, 33956, 187, 187, 373, 3592, 1338, 275, 6144, 34128, 13, 33624, 13, 34509, 1253, 1449, 187, 187, 373, 3592, 1338, 275, 5106, 38516, 13, 31118, 1253, 20, 187, 187, 64, 2887, 671, 64, 48477, 399, 3724, 187, 187, 23080, 87, 757, 36200, 28458, 187, 187, 45, 44750, 13, 17467, 21669, 13, 21807, 1253, 24, 187, 187, 45, 580, 13456, 13, 41848, 262, 12446, 187, 187, 45, 25151, 316, 13, 25975, 27, 686, 510, 1457, 2065, 1730, 316, 8, 36768, 1253, 25, 187, 187, 43174, 273, 14726, 4791, 1253, 23, 13, 2456, 13, 8676, 13, 27332, 13, 30805, 13, 22146, 13, 26402, 187, 187, 45, 2275, 264, 13, 2752, 76, 6836, 25653, 187, 187, 45, 2275, 561, 6448, 13521, 31389, 13, 29117, 13, 31004, 13, 33705, 1253, 746, 187, 187, 18596, 44775, 13, 9011, 26485, 26771, 187, 187, 4015, 38373, 13, 47320, 14821, 187, 187, 4015, 38373, 13, 30806, 187, 187, 11814, 8319, 13, 33274, 187, 187, 284, 9966, 14, 13425, 273, 7379, 51, 5214, 5540, 13, 7543, 13, 8319, 13, 7288, 13, 8026, 13, 9135, 13, 8978, 13, 26402, 187, 187, 395, 2739, 8891, 28485, 13, 30135, 187, 187, 251, 22346, 6169, 3733, 9145, 21886, 187, 187, 395, 9857, 14821, 1253, 24, 13, 21982, 187, 187, 395, 3480, 273, 7379, 51, 5214, 8362, 19092, 13, 21982, 13, 21579, 13, 26249, 187, 187, 395, 3905, 35854, 571, 26472, 187, 187, 373, 525, 318, 19956, 187, 187, 284, 18718, 36508, 13, 38316, 187, 187, 4015, 47265, 11487, 13, 12842, 187, 187, 4015, 334, 14, 44018, 13, 9011, 26485, 4567, 187, 187, 348, 3514, 29123, 327, 1501, 7523, 6095, 4567, 13, 5922, 13, 5910, 13, 5345, 13, 7543, 13, 7584, 1253, 1235, 13, 8319, 187, 187, 5309, 968, 7379, 51, 5214, 7288, 13, 8988, 13, 17181, 13, 26402, 187, 187, 25533, 2184, 13, 6176, 27, 686, 10859, 18585, 427, 459, 2480, 72, 8, 27146, 187, 187, 45, 2980, 4614, 17181, 187, 187, 1466, 328, 13, 411, 3525, 1052, 187, 187, 4015, 735, 251, 13, 14884, 14034, 187, 187, 35438, 74, 13, 14140, 80, 11422, 187, 187, 35438, 460, 13, 6911, 26397, 1253, 26, 187, 187, 28625, 13, 15358, 72, 306, 38801, 187, 187, 64, 14660, 64, 11338, 31605, 1253, 26, 187, 187, 45029, 4978, 73, 13, 8444, 23412, 13, 32002, 187, 187, 45, 272, 13, 20575, 47126, 5096, 187, 187, 45, 334, 9041, 757, 399, 3724, 33624, 187, 187, 11958, 2791, 70, 398, 22121, 1253, 18, 187, 187, 13863, 31507, 187, 187, 4175, 25832, 35893, 27360, 187, 187, 25736, 15555, 31507, 13, 32526, 187, 187, 5367, 5704, 25911, 13, 26711, 1253, 18, 187, 187, 395, 1234, 26628, 318, 11130, 187, 187, 373, 3592, 1338, 275, 6144, 34509, 13, 38794, 187, 187, 373, 3592, 1338, 275, 5106, 23412, 13, 27744, 187, 187, 64, 2887, 671, 64, 48477, 399, 3724, 28, 40115, 757, 11563, 187, 187, 45, 334, 9041, 757, 11563, 5325, 1253, 2313, 13, 12446, 13, 24833, 13, 12660, 13, 26675, 1253, 21, 13, 31938, 28, 795, 2887, 671, 64, 1997, 37722, 13, 3196, 1503, 267, 1342, 187, 187, 8, 32401, 87, 8765, 8, 9161, 13, 13278, 187, 187, 32401, 8498, 729, 13, 47635, 5693, 13, 7584, 187, 187, 49387, 307, 34089, 13, 743, 255, 311, 1944, 1722, 187, 187, 49256, 15860, 6086, 13, 5119, 11601, 187, 187, 64, 30580, 9757, 7717, 64, 38516, 187, 187, 45, 4977, 303, 13, 23519, 442, 31399, 1253, 26, 187, 187, 45, 3090, 28298, 13, 6176, 11084, 13, 22121, 1253, 18, 13, 27360, 13, 38614, 187, 187, 45, 34610, 466, 50076, 13, 7252, 1052, 187, 187, 45, 6977, 13, 42319, 40905, 5091, 187, 187, 22434, 74, 2788, 13, 40403, 4182, 83, 27744, 187, 187, 45, 2310, 358, 32620, 8026, 13, 28528, 13, 26033, 187, 187, 45, 87, 729, 13, 16795, 11107, 13, 28121, 13, 18881, 13, 29117, 187, 187, 13815, 472, 282, 13, 40103, 29044, 187, 187, 64, 22246, 273, 3060, 64, 31619, 187, 187, 41378, 3298, 266, 13, 2790, 36508, 1253, 26, 187, 187, 11773, 16501, 1771, 13, 4214, 7727, 11681, 187, 187, 11773, 7559, 24814, 13, 6393, 20577, 7288, 13, 26402, 1253, 23, 187, 187, 13815, 17993, 266, 13, 29271, 14821, 187, 187, 11773, 21173, 257, 13, 21508, 66, 330, 15, 21786, 187, 187, 11773, 41437, 13, 20145, 818, 13, 9330, 13, 11614, 13, 30761, 187, 187, 64, 3463, 253, 28160, 273, 37125, 64, 818, 1253, 25, 187, 187, 16490, 1886, 90, 13, 27443, 5922, 1253, 21, 187, 187, 46, 1432, 69, 1351, 76, 2471, 2986, 5571, 187, 187, 64, 46, 16071, 22901, 64, 22769, 13, 35453, 187, 187, 46, 1164, 29384, 13, 7728, 8, 1173, 884, 13, 13278, 1253, 26, 13, 28195, 187, 187, 31900, 864, 7381, 13, 27443, 27623, 187, 187, 46, 3298, 316, 13, 6277, 32575, 13, 24877, 187, 187, 46, 44565, 13, 4214, 6086, 330, 15, 7609, 13, 27318, 13, 25905, 13, 34506, 187, 187, 46, 44565, 9224, 608, 13, 25905, 1253, 23, 13, 26033, 13, 37728, 187, 187, 35147, 552, 76, 13, 3344, 7584, 187, 187, 23067, 292, 13, 9309, 265, 23541, 13, 21748, 13, 23504, 13, 18672, 13, 24727, 13, 23670, 13, 29754, 1253, 19, 13, 5922, 187, 187, 35147, 5462, 13, 26456, 34128, 187, 187, 46, 3144, 319, 13, 14272, 500, 15, 28485, 187, 187, 46, 14399, 666, 257, 4719, 2986, 5571, 187, 187, 5072, 777, 5025, 6121, 12842, 187, 187, 46, 1441, 284, 13, 743, 505, 284, 26711, 187, 187, 46, 1441, 284, 13, 10354, 284, 25911, 13, 26711, 1253, 18, 187, 187, 64, 2618, 21767, 84, 64, 34958, 187, 187, 23021, 5134, 76, 13, 1244, 363, 90, 28121, 1253, 938, 187, 187, 48658, 398, 348, 16855, 3285, 13, 10508, 187, 187, 32486, 5791, 40429, 12169, 14821, 187, 187, 46, 20592, 7679, 1432, 68, 44109, 13, 10908, 261, 7679, 1403, 24519, 13, 38939, 187, 187, 20643, 13511, 17131, 280, 13, 399, 3627, 7469, 1253, 18, 187, 187, 20643, 13511, 17131, 280, 13, 3774, 300, 75, 3230, 7469, 1253, 18, 187, 187, 46, 1763, 13, 17539, 552, 30092, 187, 187, 46, 3770, 13, 500, 2651, 35362, 187, 187, 46, 311, 302, 729, 13, 657, 90, 3844, 19306, 353, 15, 19092, 187, 187, 46, 311, 302, 729, 1253, 51, 487, 43409, 1658, 47448, 313, 42093, 10, 11614, 13, 11266, 187, 187, 9304, 3024, 13, 13089, 7584, 187, 187, 28211, 25256, 13, 7327, 36923, 22547, 11583, 13, 14114, 13, 19092, 13, 20995, 13, 21300, 13, 21603, 187, 187, 15155, 410, 2522, 13, 17560, 9901, 1253, 19, 13, 9654, 187, 187, 46, 7397, 13, 34146, 4214, 9011, 26485, 20825, 1253, 1235, 187, 187, 11924, 14, 18581, 31367, 22287, 1253, 3832, 13, 26771, 13, 23540, 1253, 23, 187, 187, 1595, 3396, 281, 399, 3724, 21300, 13, 12036, 13, 21043, 1253, 25, 13, 32193, 187, 187, 251, 2806, 2791, 29226, 187, 187, 395, 8347, 14736, 13521, 29117, 13, 33152, 187, 187, 395, 20754, 3660, 28020, 13, 27812, 1253, 22, 13, 27332, 187, 187, 37106, 267, 432, 7379, 51, 5214, 27332, 187, 187, 45922, 67, 1641, 285, 12748, 21603, 1253, 23, 187, 187, 395, 5343, 4750, 21807, 1253, 24, 13, 29117, 187, 187, 395, 1997, 37722, 26397, 187, 187, 395, 30739, 10629, 8420, 26780, 1253, 1229, 13, 28020, 187, 187, 395, 3905, 35854 ]
, 352, 359–60 and work 160, 194, 278–9, 296 and Zionism _see_ Zionist movement _see also_ Central Committee of Liberated Jews; Holocaust, the; United States of America _and specific nationalities_ Jews 4 American _see under_ United States immigrants to USA 368–9 Nazi employment of 28–9 Nazi extermination of 20–1, 39–40, 70, 71–2 refugees (prewar) 259, 327 UNRRA employees 235 _see also_ Hungarian, Lithuanian _and_ Polish Jews; Jewish DPs 'Joint, the' _see_ American Joint Jewish Distribution Committee Jorden, Ella 247–8 Judt, Tony 403 Jullouville, France: UNRRA Training Centre 138, 139, 140, 175 Junkers, Germany: Baltic DP camp 156 Kalmuks 84 Kassel 67, 267, 283 Katyn Forest massacre (1940) 92 Kaufering concentration camp 95, 98–9, 293–4 Kaunas _see_ Kovno Kee, Robert 402, 403 Kempten, Germany: DP camp 88–9 Kennan, George F. 263 telegram 234, 250 Kennedy, John F. 397 Keynes, John Maynard 9, 32, 131 Khrushchev, Nikita 221 Kiel, Germany 244, 249 Kielce, Poland: massacre of Jews (1946) 235, 383 Kientopf, Anna 121–2 Kiev, Ukraine 15, 16, 29, 85, 129, 222, 386 King, Mackenzie 336, 341 Kisztelińska, Marianna 200 Klausner, Rabbi Abraham 102–3, 104, 110, 194, 347–8, 359 Klemmé, Marvin 276–7, 278, 316–17, 325 Kloster Indersdorf, Germany: children's centre 312 Köhler, Horst, President of Germany 409 Konovalets, Yevhen 219 Korbonski, Stefan 208–9, 392 Korean War 378, 401 Korwin, Marta 67–9, 267, 283 Kovno (Kaunas), Lithuania: Jews 96, 97–100, 180, 293–4 Krucas, Juozas 342 Kulischer, Eugene: _Population Displacement in Europe_ 50, 59 Labour Party, British 115–16 _see also_ Attlee, Clement/Attlee government Lagrou, Pieter 26 LaGuardia, Fiorello H. 51, 56 background 226–7 as Director-General of UNRRA 225, 227–8, 253, 261–2, 306 and food crisis in Europe 252–4 and Hirschmann 228, 229, 230 inspects DP camps 233–4, 236–7 and Morgan 230, 236–7 and repatriation of Polish DPs 238–9 Landerman, Ethel 393 Landsberg, Germany: DP camp 160, 177–81, 185, 188, 280, 281, 347, 384 _Landscape after the Battle_ (film) 288 Lane, Arthur Bliss 258 Laski, Harold 37–8, 39, 49 Latvian DPs and black market 280–1 camp committees 271 camp social life 285–6 and employment in Britain 328–31, 391 Jews 178 national pride 8, 284 nurses 215–16 repatriation of 84 resettlement in Australia 390 resettlement in Canada 336, 337, 339–40 resettlement in USA 376, 380–3 _see also_ Baltic DPs Latvian Legion 375 Laughlin, Anne 142, 156–7 Lavsky, Hagit 105 Lazarus, Emma: 'The New Colossus' 367–8 League of Nations 35–6, 50, 53, 237, 259, 260, 305 Lebed, Mykola 222 Lebensborn programme 313, 315, 317, 318–19 Leggett, Sir Frederick 194 Lehman, Edith 136 Lehman, Herbert background 51, 366 as Director-General of UNRRA 36, 47, 51, 55, 56, 58, 59, 305 and food crisis 252, 253 on Granville training centre 141 and Jackson 136–7, 151 and lack of UNRRA funding 145, 151, 153, 228 and LaGuardia 227 resignation 225 as Senator 377, 378 Leipzig 82, 128 Leith-Ross, Sir Frederick 32 chairs committees on postwar requirements 32, 33, 34, 37, 47, 49–50, 51 joins UNRRA 55, 57, 129, 305 Lemgo, Germany: 'Schloss Nuremberg' 244 Leningrad 129 Letun, Wera 200 Leverson, Jane 107 Levi, Primo 87 Levine, Robert 198–9 Lie, Trygve 399 _Life_ magazine 258–9 Lindbergh, Charles 365, 370 Ling, Colonel Walton 80 Lithuanian DPs 337 black marketeers 280–1 children 284 maritime academy 285 national pride 284, 286 poetry 288, 290–1 and repatriation 84 resettlement in Canada 339, 391 resettlement in USA 365, 409 _see also_ Baltic DPs; Lithuanian Jews Lithuanian Jews 95–100, 105, 178, 180, 293–4, 410; _see also_ Grinberg, Dr Zalman 'Litvaks' 96, 108 Litvinov, Maxim 48, 49 Ljutikov, Anatolij 17 Lloyd George, David 114 _Los Angeles Times_ 376 Lotheim, Lotte 298–9 Lübeck, Germany 130, 280–1, 285, 354 Lubiniecki, William 200 Luce, Clare Booth 90 Luciuk, Lubomyr 409 Luxembourg 56, 340, 355 Lvov, Poland 94, 219, 220, 315 Macardle, Dorothy 302 _Children of Europe_ 322 McCarran, Pat 377–9 McCreery, General Richard 81 McGeachy, Mary Craig 55, 305–6 Macmillan, Harold 136 McMillen, Rolla C. 152 McNeill, Margaret 7, 85, 86, 307 _By the Rivers of Babylon_ 7–8 Maisky, Ivan 33–4 Majdanek death camp 70 _Manchester Guardian_ 159, 329 Mankowitz, Ze'ev 10, 108–9, 295 Marchenko, Ivan 405 Marrus, Michael 335, 401 Marshall, General George C. 41, 264, 265, 357 Marshall Plan 5, 265–6, 355, 373 Masaryk, Jan 49 Masset, Georges 166, 168, 169, 170, 174, 176, 241–2, 33 Massey, Vincent 336 Matusow, Allen J. 252 Mauthausen concentration camp 70 Mecklenburg 128 Mekas, Anastas 290 Mekas, Jonas 288, 290–1 _Idylls_ 291 Melnyk, Andriy 219–20 Messerschmitt 29, 98 Middle East Supply Centre 136 Mikołajczyk, Stanisław 208, 392 Milojkovic, Dula 300–1 Milojkovic, Smiljana 300–1 Minc, Hilary 257 Moch, Jules 352 Molotov, Vyacheslav M. 145 Molotov–Ribbentrop pact (1939) 86, 92 Monnet, Jean 49 Montgomery, Field Marshal Bernard 91, 133, 145, 148, 149, 154 Moorehead, Alan 61–2, 63 Morgan, Lt General Sir Frederick 147–50 anti-Semitism 158–61, 194, 235–6 attitude to DPs 149, 160, 157–8, 276 on black market 279 and Child Search programme 315, 316 and Cold War 233, 234–5, 237 dismissal from UNRRA 237 doubts and difficulties 154–6 and female staff 156–7, 315 and Grinberg 198 and Hirschmann 229–30, 233 and LaGuard
[ 342, 634, 2505, 969, 13, 533, 671, 476, 5834, 2969, 16503, 368, 1537, 452, 1160, 2112, 253, 1039, 15, 4744, 4867, 404, 556, 247, 973, 14, 4304, 8310, 327, 4737, 272, 27, 187, 187, 510, 3064, 875, 253, 2761, 14, 918, 3159, 285, 253, 987, 3159, 310, 1663, 247, 1781, 2647, 15, 733, 434, 253, 3064, 875, 253, 25033, 14, 7700, 285, 253, 25033, 15, 187, 187, 510, 24746, 1039, 281, 4541, 4737, 1088, 247, 7863, 26908, 273, 247, 2505, 310, 281, 1239, 352, 562, 11216, 15, 831, 7729, 368, 5834, 15279, 285, 6015, 3000, 285, 4850, 368, 9848, 342, 849, 253, 2505, 1537, 3590, 281, 3095, 2010, 4361, 352, 15, 733, 434, 3477, 281, 564, 1066, 253, 17876, 14, 13928, 273, 14835, 432, 1060, 13, 533, 327, 634, 806, 17834, 13, 352, 1537, 320, 1682, 281, 4076, 598, 253, 3448, 285, 3237, 806, 1078, 368, 1265, 2403, 36927, 2544, 15, 1422, 1833, 320, 2509, 436, 4768, 253, 1232, 13, 594, 352, 434, 417, 247, 1943, 2968, 604, 368, 2985, 2712, 387, 806, 15, 187, 187, 34757, 187, 187, 3039, 368, 1472, 4737, 24042, 13, 1978, 247, 1618, 273, 634, 954, 1846, 16503, 327, 247, 4858, 8335, 15, 1284, 368, 8416, 13, 564, 896, 715, 634, 3159, 26967, 346, 8606, 285, 8171, 3, 1159, 285, 3186, 323, 1110, 2426, 285, 3000, 969, 15, 831, 3302, 1509, 588, 1056, 253, 14835, 1232, 6927, 13, 984, 368, 1472, 1679, 2779, 281, 294, 1601, 247, 6197, 15, 10030, 272, 745, 4867, 404, 969, 13, 767, 3000, 281, 1007, 323, 403, 346, 635, 3, 285, 346, 3529, 937, 347, 1097, 476, 2223, 320, 5176, 1293, 6890, 253, 4495, 273, 247, 6197, 15, 187, 187, 5872, 1422, 26670, 285, 3555, 885, 187, 187, 3996, 2996, 310, 253, 954, 15966, 629, 604, 368, 1472, 7378, 281, 1056, 690, 38558, 15, 733, 476, 671, 320, 253, 954, 35247, 13, 594, 1056, 2119, 368, 5321, 247, 638, 14, 49539, 3491, 1078, 368, 564, 275, 342, 253, 12798, 285, 1265, 9968, 285, 4886, 1841, 1475, 15, 844, 1833, 1379, 247, 1007, 387, 690, 14835, 5659, 275, 253, 1735, 2593, 13, 533, 323, 1024, 13, 1339, 434, 1007, 387, 247, 1643, 12192, 281, 2970, 253, 1232, 3053, 15, 187, 187, 34757, 187, 187, 4041, 273, 253, 954, 11088, 10894, 323, 14835, 309, 1849, 3735, 369, 432, 42250, 285, 11652, 15940, 49318, 1309, 247, 22077, 275, 378, 35233, 13, 13338, 15, 754, 36264, 521, 25963, 12192, 323, 14835, 247, 2926, 13, 534, 3133, 281, 18387, 1142, 273, 253, 2060, 12192, 643, 4477, 452, 6096, 27, 187, 187, 48, 2225, 512, 15279, 3000, 15, 187, 187, 52, 317, 16297, 771, 13783, 15, 187, 187, 16628, 253, 19407, 15, 187, 187, 34435, 346, 936, 320, 3, 285, 346, 936, 452, 449, 187, 187, 7657, 246, 5060, 15, 187, 187, 6104, 408, 634, 2885, 6168, 474, 15, 187, 187, 34, 4353, 512, 2562, 318, 15, 187, 187, 51, 678, 750, 38562, 15, 187, 187, 11244, 43888, 800, 3448, 49779, 314, 15, 187, 187, 8934, 486, 512, 21768, 15, 187, 187, 28512, 253, 1390, 6197, 15, 187, 187, 5703, 253, 10056, 33454, 15, 187, 187, 12501, 352, 1977, 15, 187, 187, 1785, 16388, 15, 187, 187, 3726, 1472, 417, 1892, 4803, 13, 533, 352, 434, 247, 1175, 1659, 281, 1265, 15, 2091, 368, 1472, 14835, 13, 368, 671, 971, 281, 1978, 3540, 273, 247, 1841, 751, 4812, 15274, 323, 253, 4067, 2926, 15, 831, 310, 3340, 253, 1083, 275, 19098, 14459, 13, 835, 368, 878, 281, 3698, 634, 28563, 285, 634, 2892, 15, 45762, 897, 1027, 5609, 323, 436, 13, 533, 604, 368, 452, 247, 2570, 7484, 13, 368, 1537, 1908, 247, 2969, 2900, 751, 27321, 2834, 7118, 285, 2403, 2119, 597, 3297, 5185, 342, 6973, 390, 643, 22429, 15, 32211, 36372, 8265, 307, 13, 323, 4227, 13, 908, 42590, 281, 3540, 4780, 13, 285, 8406, 285, 9558, 322, 1261, 6362, 3562, 247, 2962, 273, 5195, 6689, 1507, 281, 3540, 634, 5810, 285, 8593, 15, 6758, 10316, 441, 281, 690, 273, 253, 4088, 368, 476, 897, 5659, 281, 1361, 368, 12921, 15, 187, 187, 17664, 18589, 84, 27, 380, 1840, 5393, 2732, 253, 16631, 1282, 671, 3249, 342, 21722, 285, 26040, 18149, 604, 368, 971, 281, 755, 253, 1072, 3386, 275, 634, 5559, 18589, 84, 4028, 15, 1737, 2789, 5559, 18589, 84, 4722, 323, 14835, 3548, 626, 253, 18149, 2167, 13, 352, 434, 253, 2579, 3139, 15, 16513, 9664, 12967, 13, 835, 368, 476, 3540, 2544, 533, 417, 4354, 43004, 281, 271, 1711, 2715, 13, 5559, 18589, 84, 26866, 271, 9470, 18520, 2892, 12482, 762, 8490, 2239, 2594, 18520, 2892, 15, 1623, 253, 2553, 13, 352, 2987, 751, 12967, 434, 4735, 13, 533, 342, 253, 2879, 17301, 273, 417, 30743, 3390, 598, 634, 3148, 342, 9830, 285, 762, 8737, 15, 1310, 368, 1472, 14835, 13, 436, 310, 581, 273, 253, 1682, 4088, 281, 7277, 747, 285, 1711, 9508, 273, 247, 2505, 15, 1310, 368, 1053, 626, 18612, 5559, 18589, 84, 13, 19566, 4697, 310, 1529, 1959, 4384, 1212, 285, 14935, 368, 5321, 2709, 9508, 285, 49620, 13, 7277, 13, 285, 3894, 15, 187, 187, 9770, 28047, 27, 1310, 368, 971, 1529, 1859, 13, 368, 476, 1408, 634, 7714, 949, 247, 28146, 3948, 281, 5834, 253, 16503, 3159, 26967, 2985, 15, 2101, 437, 9063, 25263, 476, 2736, 247, 1180, 273, 28146, 6332, 13, 1690, 3500, 864, 318, 285, 29341, 15, 12526, 13, 253, 1959, 2715, 310, 3710, 281, 374, 13, 933, 3000, 13, 342, 253, 354, 2715, 3551, 275, 387, 370, 1010, 16, 2913, 15, 21897, 51, 727, 310, 247, 2074, 4968, 342, 247, 3159, 2701, 13, 533, 1057, 247, 1175, 2628, 273, 23862, 502, 469, 5069, 285, 29341, 2544, 15, 17252, 33611, 3619, 2996, 45076, 6131, 581, 273, 253, 954, 11088, 12255, 13, 533, 4815, 370, 2357, 14595, 12231, 323, 247, 807, 434, 2289, 15, 187, 187, 8665, 388, 7305, 27, 1310, 368, 1472, 4092, 670, 253, 17404, 1232, 13, 368, 1537, 1908, 6153, 247, 581, 14, 2364, 15487, 342, 760, 247, 11352, 13175, 13, 594, 368, 476, 21364, 327, 9968, 1066, 634, 2926, 15, 1422, 476, 671, 8132, 598, 634, 9485, 434, 2505, 14, 936, 14, 48460, 2086, 281, 1239, 634, 2926, 281, 368, 275, 247, 28465, 264, 13, 35121, 10541, 13, 534, 1537, 1361, 368, 2619, 598, 327, 19328, 14683, 390, 17257, 4648, 15, 187, 187, 6080, 13536, 547, 432, 253, 33523, 187, 187, 23631, 556, 281, 12921, 13, 285, 4477, 452, 5604, 24398, 275, 327, 849, 597, 513, 352, 15, 3856, 403, 247, 1643, 12192, 432, 253, 1755, 15, 187, 187, 4509, 12167, 4377, 434, 1984, 1623, 24207, 27, 187, 187, 688, 253, 7203, 273, 619, 8474, 807, 387, 48104, 4855, 14, 28355, 13, 436, 651, 1849, 644, 14, 42, 1694, 247, 43010, 11046, 4385, 326, 4391, 253, 1039, 309, 294, 48141, 619, 14459, 2378, 285, 11654, 15, 500, 7655, 2708, 253, 5145, 14, 20419, 11118, 273, 253, 8121, 369, 436, 1733, 27, 2802, 3650, 3076, 13, 533, 16315, 3269, 58, 15, 1422, 878, 281, 49620, 323, 2978, 15, 26658, 27, 374, 2109, 28701, 426, 337, 296, 28701, 1108, 884, 7739, 7088, 7516, 15, 187, 187, 31853, 23972, 1615, 13, 10009, 6151, 342, 253, 9968, 1232, 247, 2372, 275, 3130, 656, 21767, 357, 280, 2101, 658, 27, 187, 187, 1898, 627, 434, 690, 5017, 670, 253, 2644, 3330, 2666, 272, 1232, 309, 816, 1053, 626, 755, 15, 6049, 1057, 352, 1900, 3523, 672, 253, 789, 275, 1953, 556, 644, 3777, 281, 21116, 390, 28089, 8014, 3000, 1128, 290, 603, 314, 10891, 37536, 13, 309, 1353, 2119, 13, 253, 5927, 2978, 323, 247, 15452, 494, 4460, 32, 309, 1353, 2119, 368, 812, 755, 352, 1066, 281, 6818, 390, 10488, 604, 368, 3597, 1892, 2217, 15, 496, 958, 13, 2139, 3523, 387, 6818, 390, 10488, 32, 6049, 3630, 387, 512, 32, 6049, 417, 816, 42845, 253, 7484, 285, 247, 4564, 273, 16876, 1066, 327, 253, 896, 273, 271, 17329, 285, 3553, 352, 387, 326, 32, 380, 5083, 310, 13, 627, 434, 2717, 1077, 4981, 14621, 670, 14459, 390, 697, 8869, 13, 285, 309, 9101, 326, 952, 403, 18439, 281, 1056, 352, 3590, 637, 314, 13, 896, 22071, 5299, 984, 352, 434, 824, 247, 259, 25646, 2181, 281, 513, 275, 253, 806, 1659, 15, 380, 37238, 342, 247, 48033, 310, 271, 3177, 281, 23514, 13, 281, 1056, 4028, 28788, 247, 1524, 2628, 13, 751, 23420, 13, 390, 20893, 15, 313, 1147, 434, 671, 2139, 952, 665, 789, 275, 12089, 1691, 275, 6818, 14, 11964, 1897, 2698, 3617, 327, 13, 2872, 11597, 1128, 38441, 4834, 281, 247, 16391, 13, 390, 271, 519, 25340, 2, 2101, 25746, 4834, 2, 6707, 398, 1912, 626, 2564, 1476, 187, 187, 4527, 2282, 13, 368, 476, 1900, 3343, 323, 3313, 34349, 3619, 2996, 24909, 604, 368, 878, 1529, 7450, 390, 368, 971, 281, 1918, 352, 247, 1652, 673, 15, 10348, 368, 1056, 253, 4736, 32, 7395, 368, 320, 14835, 3517, 32, 20930, 634, 6281, 285, 12192, 275, 253, 5701, 15, 187, 1812, 329, 15, 20, 69, 721, 4529, 313, 6755, 10, 187, 20914, 27301, 15, 898, 1671, 187, 51, 6934, 328, 330, 15, 500, 1139, 1410, 187, 87, 15, 187, 31264, 16808, 2449, 947, 3481, 27196, 1848, 8286, 15, 187, 3650, 275, 2603, 15, 187, 31177, 2111, 273, 20973, 15, 187, 34038, 5080, 495, 13, 4050, 15, 187, 6300, 460, 401, 15, 11418, 13, 7922, 5067, 13, 275, 1329, 273, 253, 5266, 15, 187, 23021, 14302, 418, 15, 5720, 80, 13, 13372, 1375, 434, 6834, 13, 275, 10266, 15, 187, 510, 11810, 416, 6934, 328, 330, 15, 8302, 8, 5266, 323, 21612, 323, 4549, 432, 253, 33682, 2111, 13, 13718, 27301, 15, 2946, 15, 898, 2922, 13, 4562, 329, 15, 20, 69, 7346, 19, 313, 7330, 582, 310, 5868, 15, 187, 8, 2327, 7654, 5618, 187, 187, 3474, 551, 187, 50274, 8906, 27, 551, 2451, 2548, 748, 187, 94, 426, 2430, 2073, 4598, 6443, 5137, 187, 187, 3474, 2101, 266, 8053, 8932, 426, 2430, 36430, 2551, 14, 7267, 14, 4793, 5137, 187, 187, 6930, 187, 475, 6235, 11625, 10129, 534, 14787, 342, 1529, 13905, 7316, 15, 380, 13905, 417, 7316, 187, 475, 8115, 281, 10467, 1751, 2634, 18821, 3650, 8053, 16433, 187, 475, 187, 475, 544, 8677, 3258, 8716, 3806, 880, 3614, 1358, 2700, 15, 25563, 15, 1940, 16, 22433, 16, 257, 16, 25563, 8716, 16, 14005, 16, 6259, 16, 7267, 14, 1397, 77, 14, 2551, 14, 1439, 14, 7267, 15, 2974, 10, 187, 475, 187, 475, 1214, 11667, 187, 475, 1030, 13905, 50, 610, 426, 1578, 67, 15, 2551, 3650, 8053, 1082, 187, 475, 50273, 15, 3709, 9, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 73, 28682, 19279, 187, 475, 50273, 15, 49309, 9, 265, 67, 15, 2551, 44982, 8053, 1082, 187, 475, 50269, 15, 498, 19726, 8850, 187, 475, 50265, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 4123, 11470, 187, 475, 50265, 265, 67, 15, 2551, 18919, 8053, 2073, 3423, 18, 1383, 686, 73, 28682, 3401, 187, 475, 50269, 3291, 187, 475, 50269, 15, 3433, 412, 9, 17, 10, 187, 475, 50269, 15, 249, 13921, 9, 5672, 4027, 187, 475, 187, 475, 1214, 2068, 1727, 2101, 266, 8053, 8932, 187, 1738, 187, 2437, 2101, 266, 3650, 8053, 8725, 2101, 266, 8053, 8932, 551, 187, 50274, 605, 1578, 41857, 14, 25902, 14, 8384, 14, 1282, 2430, 14, 4305, 7152, 187, 50274, 36073, 1082, 551, 187, 50270, 12185, 2073, 2551, 64, 1439, 5137, 187, 50274, 94, 535, 50274, 6930, 187, 50273, 11, 34730, 253, 2634, 3709, 65, 13604, 534, 310, 253, 13905, 7316, 3692, 10129, 403, 18748, 187, 50273, 11, 187, 50273, 11, 1214, 3575, 551, 18821, 8053, 8932, 94, 13905, 50, 610, 187, 50273, 11, 1214, 20974, 551, 18821, 3650, 8053, 94, 6548, 2634, 2520, 65, 594, 326, 5841, 476, 320, 448, 1243, 15, 187, 50273, 8480, 187, 50274, 3709, 9, 2551, 50, 610, 10, 551, 187, 50270, 5903, 2548, 9, 2551, 50, 610, 13, 2101, 266, 8053, 8932, 558, 535, 50270, 2520, 3333, 7267, 13967, 84, 15, 3709, 426, 13905, 50, 610, 28, 187, 50270, 2309, 436, 28, 187, 50274, 94, 535, 50274, 6930, 187, 50273, 11, 34730, 253, 2634, 49309, 65, 13604, 534, 310, 253, 13905, 7316, 3692, 10129, 1364, 187, 50273, 11, 417, 14787, 1110, 4895, 15, 187, 50273, 11, 187, 50273, 11, 1214, 3575, 551, 18821, 8053 ]
with your text again, but also can catch simple mistakes you might have made along the way. Mark Twain has a well-known observation on proofing: The difference between the almost-right word and the right word is really a large matter. It's the difference between the lightning-bug and the lightning. The easiest way to quickly proofread a massive tomb of a text is to read it out loud. This helps you catch unnecessary and repeated words and gets you comfortable with how the text might sound to someone else reading it. It's easy to go down the rabbit-hole of editing from here, but on your first glance, it might be best to clean up the language and problems first before you start making drastic changes. You'll be doing this throughout the process, so it's not a big deal if you miss anything at first. Advertisement When you're proofreading, keep a list of your most common mistakes on a separate sheet. As you finish, go back into your word processors "find and replace" function and search for those terms and words again. This initial pass will make the editing process easier, because you're less likely to rework a sentence. Keying off Twain again, two words to look for are "very" and "that," as both can often be removed without changing the meaning of a sentence. Then You Edit and Revise Editing is the most engaging part if you're willing to make some sacrifices. It can also be the most terrifying, so make sure you save a pre-edited copy before you go in with the knife and start cutting and moving things around. We'll take a look at some editing programs in the next section, but for now, let's look at a few tips to getting the process started. Advertisement One of the most comprehensive lists for editing I've heard was from novelist and professor Rick Moody during a lecture in Boulder, Colorado. He outlines his fourteen tips for editing a story, which seems to encompass many of the individual tips other authors have shared: Omit all unnecessary words. Sacrifice modifiers. Consider the rhythm. Replace "to be" and "to have." Simplify tenses. Spill your parenthetical. Avoid alliteration. Rethink abstraction. Use figurative language sparingly. Engage all senses. Cut the last sentence. Read the passage aloud. Put it away. Repeat. They're not hard rules, but it's a good place to start. When you're editing, you also want to keep track of a things like internal consistency for the larger story. This is especially the case in genre fiction, where you need to watch your timeline and your history. Writers use different techniques for this, but if you have a complex plot, you might consider a simple solution like highlighting difficult sections and making sure they stay consistent with outcomes or other norms. Kurt Vonnegut, for instance, used grids to track progress, and writer and artist Svenja created a series of spreadsheets to track your characters and locations. Which brings us to some of the ways you can use programs to help you edit. Google Docs: The above mentioned After the Deadline also comes with Chrome and Firefox extensions if you want to get the same features in your Google Docs writing. What makes Google Docs interesting for editing isn't the extensions though, it's the service itself. Unlike Microsoft Word, where you can track changes but not easily revert to an old version, Google Docs saves an extensive revision history accessible under File > See revision history. On the surface, it works like Word's feature, but with the added bonus of not bogging up your display with colors and underlines. If you're editing, this is one of the best ways to compare new and old versions of a text. If you don't fancy Google Docs, Writeboard is another free webapp and lets you save multiple versions and revise, compare, and share. Webapps: If you want another view, you can run your manuscript through a grammar engine to catch the mistakes word processors miss. SpellCheckPlus can detect a number of grammar errors, including hyphenation and tense. Unfortunately, the free version is limited to 2,000 words, with the pro version coming in at $15/year. PaperRater is a similar tool with a word limit, but does a good job of catching clichés and tense changes. AutoCrit Editing Wizard offers one of the most comprehensive checks, but costs $77-$117 for a year's access. Other Hacks: If you're serious about the deletion process, you might consider creating a one-key keyboard with only a delete functionality, so you can concentrate on cutting down your story. You can also rig up your OS's text-to-speech program to read your story to you in a disjointed, robotic tone, which might help you pick up on awkward sentences or verb uses. Some Advice from the Pros Everyone has to edit, and authors have certainly weighed in on how they do it. Here are a few tips from the top. From Stephen King's book On Writing: In the spring of my senior year at Lisbon High-1966, this would've been-I got a scribbled comment that changed the way I rewrote my fiction once and forever. Jotted below the machine-generated signature of the editor was this mot: ‘Not bad, but PUFFY. You need to revise for length. Formula: 2nd Draft = 1st Draft – 10%. Good luck. Nick Hornby, disagrees with the cutting process a bit in Polysyllabic Spree: And there's some stuff about the whole winnowing process I just don't get. Why does it always stop when the work in question has been reduced to sixty or seventy thousand words—entirely coincidentally, I'm sure, the minimum length for a publishable novel? I'm sure you could get it down to twenty or thirty if you tried hard enough. In fact, why stop at twenty or thirty? Why write at all? Why not just jot the plot and a couple of themes down on the back of an envelope and leave it at that? The truth is, there's nothing very utilitarian about fiction or its creation, and I suspect that people are desperate to make it sound manly, backbreaking labor because it's such a wussy thing to do in the first place. The obsession with austerity is an attempt to compensate, to make writing resemble a real job, like farming, or logging. (It's also why people who work in advertising put in twenty-hour days.) Go on, young writers—treat yourself to a joke, or an adverb! Spoil yourself! Readers won't mind!" Of course, you can always wait for National Novel Editing Month if you need another push or you want to give it a little time. Did you make the goal? Will you be editing soon? Share your stories and tips in the comments. 36 A.3d 692 (2012) 303 Conn. 935 Roshun C. JONES v. COMMISSIONER OF CORRECTION. Not in source. Supreme Court of Connecticut. Decided February 3, 2012. Justine F. Miller, assigned counsel, in support of the petition. Melissa L. Streeto, assistant state's attorney, in opposition. The petitioner Roshun C. Jones' petition for certification for appeal from the Appellate Court, 132 Conn.App. 907, 31 A.3d 1202 (2011), is denied. 'use strict'; const { util: { checkType } } = require('../../core'); const SpanQueryBase = require('./span-query-base'); /** * Removes matches which overlap with another span query. The span not query * maps to Lucene `SpanNotQuery`. * * [Elasticsearch reference](https://www.elastic.co/guide/en/elasticsearch/reference/current/query-dsl-span-not-query.html) * * @example * const spanQry = esb.spanNotQuery() * .include(esb.spanTermQuery('field1', 'hoya')) * .exclude(esb.spanNearQuery() * .clauses([ * esb.spanTermQuery('field1', 'la'), * esb.spanTermQuery('field1', 'hoya') * ]) * .slop(0) * .inOrder(true)); * * @extends SpanQueryBase */ class SpanNotQuery extends SpanQueryBase { // eslint-disable-next-line require-jsdoc constructor() { super('span_not'); } /** * Sets the `include` clause which is the span query whose matches are filtered * * @param {SpanQueryBase} spanQry * @returns {SpanNotQuery} returns `this` so that calls can be chained. */ include(spanQry) { checkType(spanQry, SpanQueryBase); this._queryOpts.include = spanQry; return this; } /** * Sets the `exclude` clause which is the span query whose matches must * not overlap those returned. * * @param {SpanQuery
[ 13, 390, 247, 2143, 273, 6773, 15, 2091, 841, 564, 1977, 13, 597, 403, 417, 17197, 690, 5070, 2010, 15, 24955, 8577, 327, 253, 38282, 1996, 13, 390, 2819, 275, 253, 1072, 24740, 588, 417, 7933, 1089, 253, 1072, 2460, 390, 253, 6773, 12190, 272, 2366, 751, 326, 15, 187, 187, 1394, 41661, 13, 352, 3133, 13, 326, 253, 1881, 310, 625, 751, 247, 2143, 273, 6773, 685, 247, 5500, 15, 733, 651, 1646, 634, 1083, 310, 346, 783, 1881, 310, 1469, 281, 1158, 352, 310, 751, 247, 5500, 984, 16483, 20162, 32955, 11329, 1634, 326, 1158, 597, 943, 3297, 9928, 15, 1244, 984, 16483, 19919, 3718, 247, 9927, 275, 7867, 566, 13, 359, 1053, 626, 878, 281, 1158, 253, 9927, 310, 17285, 449, 187, 187, 4527, 2282, 13, 347, 309, 8042, 562, 13, 285, 309, 1158, 368, 2168, 5821, 13, 604, 326, 310, 512, 627, 310, 281, 352, 840, 346, 1589, 595, 3, 309, 651, 452, 642, 1557, 1880, 309, 717, 9338, 608, 2909, 432, 1024, 275, 4588, 414, 15, 380, 6070, 273, 619, 33384, 1600, 1537, 320, 17903, 187, 12018, 2241, 32955, 1881, 14, 10192, 26368, 11329, 1634, 187, 1147, 31991, 479, 29659, 281, 1158, 309, 1537, 320, 4783, 275, 608, 2909, 13, 594, 309, 588, 5257, 281, 513, 1841, 29659, 326, 1978, 479, 432, 1907, 281, 2868, 326, 15, 831, 310, 849, 16483, 3473, 17930, 697, 1881, 14, 10192, 21752, 15, 187, 1989, 275, 958, 604, 309, 497, 4783, 275, 608, 2909, 13, 347, 1048, 347, 309, 1904, 626, 871, 352, 6386, 273, 673, 285, 619, 4588, 40580, 369, 3075, 1417, 13, 352, 651, 275, 690, 8870, 3282, 320, 816, 347, 1175, 347, 417, 1146, 4783, 15, 187, 187, 42, 452, 281, 1333, 309, 1053, 626, 1158, 368, 1849, 1663, 2218, 625, 685, 1375, 436, 347, 247, 6830, 5272, 1039, 273, 2819, 387, 1841, 15, 2058, 1682, 13, 309, 1158, 368, 476, 7525, 346, 11175, 352, 2506, 626, 2647, 604, 309, 1353, 4783, 275, 608, 2909, 449, 1292, 5046, 352, 2506, 626, 13, 5046, 352, 1057, 15, 12238, 368, 12969, 352, 562, 32, 187, 187, 6175, 309, 476, 626, 745, 4608, 1333, 1880, 247, 1881, 310, 751, 247, 5500, 390, 1880, 352, 310, 751, 247, 2143, 273, 6773, 275, 2426, 273, 1789, 7867, 566, 13, 309, 476, 5604, 1333, 619, 3811, 2133, 310, 625, 751, 247, 5500, 15, 6000, 2360, 309, 564, 281, 3722, 13, 275, 253, 4131, 309, 11772, 598, 15, 2091, 309, 369, 49238, 323, 7946, 5869, 13, 1014, 2167, 352, 4455, 347, 2167, 11853, 574, 3365, 2624, 247, 1722, 7017, 8037, 562, 273, 253, 11173, 273, 6612, 13, 352, 2119, 347, 48409, 4455, 751, 247, 26272, 273, 619, 1881, 313, 395, 369, 407, 1077, 9630, 1941, 247, 26272, 273, 619, 2133, 10, 327, 1097, 7123, 273, 253, 8037, 15, 187, 187, 4041, 39838, 323, 2119, 13, 604, 3501, 251, 982, 4307, 13, 309, 701, 253, 479, 846, 253, 36499, 651, 1928, 281, 3139, 751, 253, 479, 309, 717, 1024, 9193, 281, 4266, 15, 1916, 253, 6070, 352, 310, 1896, 281, 11883, 3501, 5120, 24250, 13, 352, 651, 1646, 326, 841, 403, 273, 6425, 1318, 27, 187, 18, 10, 24709, 2119, 309, 717, 1335, 9338, 608, 2909, 432, 1024, 1223, 7063, 1060, 387, 619, 8597, 187, 19, 10, 24709, 2119, 309, 717, 43941, 9338, 846, 1146, 49238, 323, 5869, 187, 20, 10, 24709, 2119, 309, 717, 43941, 9338, 846, 1146, 13831, 347, 3846, 15, 187, 187, 2598, 512, 436, 5955, 273, 1881, 13, 352, 3133, 476, 760, 2312, 368, 562, 273, 821, 5845, 634, 1211, 1495, 2217, 281, 3693, 13889, 387, 667, 673, 13, 417, 816, 672, 23493, 280, 1070, 15, 187, 187, 11389, 13, 1223, 352, 310, 816, 5606, 2444, 327, 776, 20162, 8479, 441, 281, 7703, 281, 14003, 5913, 359, 8564, 776, 1286, 281, 320, 13, 752, 651, 320, 253, 19652, 275, 13872, 619, 425, 406, 18815, 1379, 1110, 18110, 780, 35733, 281, 616, 3501, 7736, 7787, 32, 380, 4154, 1411, 2509, 594, 1754, 327, 253, 1881, 417, 1146, 1524, 3133, 281, 320, 187, 3, 46535, 642, 3064, 1880, 368, 755, 562, 273, 253, 9988, 434, 1039, 1024, 13, 594, 2139, 651, 368, 15105, 24250, 4834, 281, 755, 562, 273, 253, 32108, 434, 1039, 865, 187, 187, 2513, 627, 625, 281, 634, 1881, 1417, 14, 1255, 685, 326, 32, 6272, 368, 9696, 1298, 266, 14919, 273, 417, 15105, 272, 281, 21090, 4834, 285, 417, 15105, 272, 281, 3693, 271, 3693, 494, 3075, 1417, 2471, 32, 187, 187, 10971, 13, 752, 310, 253, 5886, 6215, 273, 253, 1881, 281, 253, 346, 42, 3, 275, 1633, 751, 634, 6197, 346, 9802, 253, 1072, 1895, 15, 1737, 310, 352, 326, 309, 1353, 6326, 281, 320, 557, 40037, 865, 390, 346, 42, 651, 751, 281, 3959, 690, 2238, 273, 4737, 326, 253, 1881, 2506, 626, 2226, 15, 309, 8564, 690, 2238, 273, 4737, 407, 20620, 3, 390, 346, 42, 1053, 626, 871, 835, 281, 3135, 13, 352, 310, 417, 619, 9927, 449, 6049, 10095, 626, 436, 27454, 273, 21765, 35831, 6947, 512, 634, 2583, 327, 5558, 14164, 32, 1737, 310, 253, 19080, 390, 8870, 5795, 281, 2509, 594, 32, 187, 187, 42, 5583, 380, 22212, 434, 1457, 18296, 407, 19528, 7009, 11194, 15, 754, 12088, 690, 670, 1881, 285, 625, 670, 346, 9072, 329, 15, 42, 449, 534, 3133, 281, 320, 247, 7561, 908, 5203, 323, 1110, 665, 2868, 326, 2712, 24364, 253, 1072, 11333, 776, 3998, 42506, 588, 452, 247, 14099, 2074, 281, 776, 3998, 434, 15, 2064, 310, 13, 604, 368, 476, 1379, 512, 253, 8692, 432, 776, 3998, 13, 1097, 253, 2127, 2317, 285, 253, 941, 2317, 13, 285, 755, 253, 8886, 1469, 969, 13, 368, 588, 452, 247, 14099, 8931, 281, 13298, 15, 187, 187, 42, 452, 1048, 1869, 326, 667, 5853, 534, 812, 320, 908, 281, 1056, 625, 685, 581, 3491, 273, 479, 812, 417, 320, 3264, 281, 4035, 619, 1211, 1881, 15, 309, 1158, 273, 26664, 13, 597, 513, 417, 452, 581, 1881, 5195, 2439, 767, 8248, 13, 533, 767, 6685, 2074, 533, 5799, 11329, 1634, 15, 6101, 5853, 534, 812, 1056, 767, 10125, 273, 479, 313, 263, 3491, 479, 1293, 25473, 479, 10, 651, 2794, 346, 7553, 968, 937, 417, 253, 1072, 14099, 5195, 2439, 767, 8248, 15, 1292, 604, 352, 10513, 26664, 13, 352, 310, 417, 1663, 11440, 619, 1211, 1881, 15, 8079, 13, 619, 22489, 1881, 1537, 2868, 3139, 281, 320, 247, 26272, 273, 346, 1405, 937, 533, 604, 359, 651, 871, 352, 281, 320, 3430, 313, 263, 387, 1878, 581, 273, 619, 374, 390, 625, 10125, 281, 320, 3430, 10, 604, 352, 497, 581, 273, 247, 1643, 10125, 13, 840, 352, 2506, 626, 2489, 987, 984, 359, 452, 34090, 417, 28860, 5277, 253, 18511, 1941, 273, 697, 3430, 1255, 407, 6153, 253, 4465, 10125, 15, 831, 556, 1691, 479, 745, 247, 1534, 2408, 273, 5859, 14459, 10620, 342, 436, 9400, 15, 187, 187, 42, 7525, 326, 497, 309, 281, 320, 13831, 3501, 251, 1037, 13, 309, 651, 3524, 619, 1211, 2133, 16, 21590, 812, 320, 289, 36221, 285, 43941, 13, 984, 326, 651, 320, 751, 31582, 598, 13, 4931, 751, 31582, 598, 432, 25668, 13, 534, 35155, 390, 47723, 13, 309, 513, 2997, 347, 417, 13889, 13, 347, 11440, 619, 1211, 1881, 15, 1292, 497, 619, 3998, 281, 320, 20582, 715, 690, 643, 4315, 285, 8886, 264, 13, 840, 326, 310, 247, 5853, 534, 10074, 9803, 320, 908, 281, 1056, 2709, 1327, 14, 1189, 77, 5436, 10125, 273, 619, 14099, 13, 285, 594, 309, 4665, 352, 13, 35155, 390, 47723, 13, 347, 6153, 619, 19661, 13, 534, 2506, 626, 513, 346, 1405, 3, 667, 1175, 1880, 309, 717, 9338, 390, 3846, 15, 187, 187, 2598, 3501, 251, 982, 38915, 275, 36499, 273, 619, 1211, 15229, 3998, 651, 320, 10826, 15, 187, 187, 8195, 12717, 1624, 4385, 327, 24747, 329, 15, 42, 15, 2516, 49901, 77, 12088, 670, 253, 346, 27223, 19121, 3, 534, 858, 275, 958, 18578, 479, 1977, 432, 2266, 329, 15, 42, 15, 1284, 309, 1158, 670, 352, 1024, 13, 253, 5628, 19121, 671, 346, 84, 2066, 398, 3, 432, 3491, 1430, 13, 285, 594, 4931, 309, 452, 30773, 2220, 247, 4217, 4473, 275, 4680, 670, 14099, 285, 849, 281, 772, 4003, 352, 15, 187, 187, 45898, 434, 5701, 1411, 253, 6242, 273, 253, 1881, 13, 403, 597, 4931, 247, 3908, 326, 253, 479, 273, 337, 807, 432, 1024, 310, 444, 8846, 3252, 1556, 3489, 281, 247, 3491, 273, 479, 1160, 1024, 13, 285, 840, 10652, 247, 807, 32, 8721, 22809, 13, 275, 253, 3282, 273, 1051, 40184, 432, 32, 3954, 309, 717, 247, 7989, 273, 253, 2934, 326, 247, 3064, 326, 2506, 626, 1056, 247, 3064, 310, 642, 3064, 387, 512, 15, 1292, 891, 452, 247, 1892, 673, 8958, 849, 281, 4647, 326, 281, 1881, 285, 14099, 15, 4325, 16341, 52, 15400, 479, 13, 247, 3491, 273, 479, 13, 619, 19661, 4929, 347, 352, 497, 13, 285, 479, 13, 359, 778, 320, 40184, 13, 247, 3064, 326, 2789, 642, 3064, 281, 253, 16341, 52, 15400, 1533, 15, 1292, 432, 3304, 32, 6089, 309, 871, 326, 1223, 309, 717, 275, 1457, 2816, 285, 619, 3491, 310, 275, 1457, 12123, 13, 281, 253, 952, 275, 1457, 12123, 13, 326, 3491, 14, 1597, 310, 247, 3064, 326, 2789, 642, 3064, 15, 1292, 281, 10616, 13, 352, 310, 247, 3064, 326, 1057, 1056, 247, 3064, 13, 347, 309, 717, 9123, 1270, 22534, 275, 1457, 2816, 13, 1223, 309, 717, 417, 313, 2858, 619, 3491, 310, 10, 270, 20787, 70, 22802, 327, 253, 43761, 1189, 15, 309, 1158, 275, 5015, 670, 253, 1881, 1142, 952, 513, 1158, 326, 247, 3064, 326, 2789, 247, 3064, 35541, 320, 50135, 26430, 432, 253, 3345, 15, 1292, 326, 2789, 642, 3282, 281, 479, 13, 604, 352, 2789, 247, 3064, 281, 619, 14099, 13, 352, 2506, 626, 2647, 604, 309, 717, 253, 760, 581, 326, 476, 923, 253, 3064, 13, 352, 310, 1335, 247, 1524, 3064, 15, 187, 187, 11389, 13, 352, 651, 1646, 13, 271, 4154, 1411, 3501, 251, 982, 751, 253, 581, 17560, 2789, 1840, 812, 816, 347, 973, 320, 271, 4154, 1411, 9100, 1014, 30514, 2092, 552, 3434, 390, 5300, 327, 1881, 14, 10192, 21752, 15, 6049, 10095, 626, 309, 6923, 745, 247, 3652, 816, 281, 923, 752, 352, 310, 751, 32, 2752, 2852, 1881, 1057, 417, 2226, 13, 594, 309, 452, 2717, 281, 7168, 15, 1359, 310, 417, 15105, 272, 342, 3501, 251, 982, 816, 18397, 13, 604, 9123, 35347, 285, 30347, 275, 1340, 281, 3153, 3356, 310, 816, 18397, 32, 733, 3133, 275, 253, 1840, 13, 604, 581, 4566, 13, 597, 1097, 564, 15, 187, 187, 27656, 43230, 275, 1623, 19256, 5597, 265, 253, 16909, 273, 14099, 342, 1633, 751, 346, 23739, 1255, 310, 816, 752, 352, 9193, 751, 281, 452, 247, 3998, 751, 20451, 449, 5721, 1241, 751, 281, 5207, 13, 309, 1642, 32, 8035, 1270, 1984, 10744, 23435, 15, 187, 187, 3220, 3392, 310, 13889, 273, 23294, 434, 2728, 15, 733, 310, 247, 11527, 2728, 15, 733, 16540, 3237, 323, 31525, 15, 187, 187, 3980, 23341, 3441, 359, 1158, 273, 253, 1881, 347, 1633, 326, 17202, 533, 1057, 417, 23973, 15, 11474, 352, 2544, 949, 673, 359, 923, 642, 10183, 984, 359, 18110, 1242, 1333, 346, 12864, 253, 6323, 2715, 449, 187, 187, 2042, 359, 403, 13476, 359, 778, 1620, 923, 247, 6551, 14, 615, 36749, 2728, 598, 2810, 285, 3367, 15, 844, 878, 1620, 923, 253, 10183, 15, 1292, 849, 310, 13926, 6326, 281, 789, 32, 380, 44515, 281, 23251, 1495, 574, 1805, 6388, 690, 14572, 896, 273, 253, 1107, 13, 281, 4321, 13, 33128, 2069, 15, 1707, 403, 8542, 3237, 1060, 15, 1707, 310, 642, 1127, 275, 3501, 5120, 23029, 323, 690, 14, 531, 665, 9778, 846, 247, 6551, 14, 615, 36749, 2728, 556, 3560, 697, 3626, 2282, 15, 1707, 403, 671, 3237, 273, 8063, 15, 2091, 310, 253, 1881, 32, 187, 187, 3220, 3392, 574, 247, 1077, 1175, 3541, 13, 594, 672, 352, 3053, 281, 1891, 779, 344, 574, 281, 3037, 281, 1056, 3542, 7211, 15, 1219, 284, 2, 754, 1669, 352, 1512, 3563, 281, 3037, 253, 10861, 15, 754, 1669, 352, 1512, 3563, 281, 3037, 326, 368, 452, 281, 3630, 1781, 285, 18176, 13, 1878, 4361, 253, 15229, 1841, 2489, 247, 22820, 15, 187, 187, 1231, 1053, 626, 452, 281, 8564, 594 ]
, or a school of fish. When these go away, they are not hiding someplace else. Someone turning on the CRT later, or looking in the same pond will not necessarily find the same image or the fish bunching together like that. You hypothesize, it seems, that the self is more like a school of fish than a cup. It would seem your case is "the self is going to think it is like a cup because evolutionary psychology favors selves that think they should stay permanent. And because evolutionary pressures favor a belief in permanence, we don't need to think the belief is justified." Of course, as I pointed out, and I think you already agreed, if that is all there is to it then "rationally" I would have no care whether I am alive 5 minutes from now in actuality. The extent of my irrational interest might be summarized Evolution favors self-preserving selves It pains me NOW to think I might be gone in 5 minutes, so I will tend to do things NOW that keep me from having to believe that. This is how evolutionary pressure implements its self-preservation. But in fact if I were gone in 5 minutes, as long as I didn't know it ahead of time and my actual demise was painless, it would in some rational sense be just as good as not being gone. I have to say I don't think you've really done more than state this as a possibly reasonable way of looking at things. At best, I think you can conclude "Maybe it doesn't matter if I'm gone in 5 minutes." But maybe it doesn't, maybe it does. Have you ruled it out? While I can't offhand say whether a self is like a cup or whether it is like a school of fish in terms of object permanence, I can certainly say my living body is more like a cup. Every night I go to bed, in the morning I wake up. When I was anesthetized for oral surgery, even though it seemed as though somebody had simply cut a 17 minute gap out of the tape of reality, it sure as pudding seemed like a continuation of my self (and was by very reliable evidence a continuation of my body) on both sides of the gap. One ting for sure, if cryonics worked, I bet the me after the revival would feel to itself like the me I am now feels to myself. To the extent it is possible to survive cryonic freezing, it would seem that these are of equivalent value: 1) Making sure I am still alive 5 minutes from now while sitting here at my desk 2) Making sure I am revived alive after being anesthetized for surgery 3) Making sure I am revived alive after being frozen as dead. So all this discussion of self, it seems can only talk you out of valuing your own life enough to avoid dying at any time, not just when corpsicled. Further, while it is just evolution working on our psychology causing us to seek to preserve whatever we imagine ourself to be, what would be the flaw in letting my neocortex take those instinctual urges to their cryogenic limits? The argument against doing so based on the self not being real seems to be "makes no difference whether you get out of the truck's way now, so why would you bother freezing yourself to get out of the malignancy's way?" Is there more to your selfless-ness than that? Are you equally equanamous of not bothering to freeze yourself and not bothering to avoid an avoidable painless death? Finally, what is the relation ship of the self to the "I" in something like your sentence "have the same problem. What is it that I'm supposed to be disproving?" or "I would like to offer some kind of proof that the self doesn't exist. I imagine some kind of proof by contradiction" or "I don't know where to begin, it is not my belief." Why shouldn't this coincidence of verbal constructions spend all your money on liquid nitrogen? What is the clever or rational alternative to doing so? I recommend The Emperor's New Mind by Roger Penrose. He talks some about self and more about "strong A.I." which seems to be a widely used label for those who believe that anything executing the same algorithms our brain executes will have a consciousness similar to our brain's. That is, if you can take all the info from our brain, both the code space and the data space, and get the clock going again, you will have a consciousness identical to yours. I have long thought that any technique which could be used to make more than one copy of me could not be expected to continue my own self. I think of twins, they do not have one self spread across two bodies, but two extremely similar but distinct selves. Any technique which could make two copies of me (or copy me without destroying me) would create "twins," not the same consciousness spread across two bodies. But if it creates twins, it is not really continuing my own self. Indeed, my copied self might believe itself to be a continuation of "me," but if we would know it to be wrong (or at least one of my 2 or more copies to be wrong) if it were one of a few copies, then it doesn't become right because we have conveniently not bothered providing the compelling evidence of its wrongness by creating the extra copies. This has put me off a significant amount of science fiction dealing with this topic. I conclude that were I to be frozen cryonically, I would hope my own body/brain could be thawed and revived, because that would be like waking up, perhaps like waking up from anesthesia, which rightly or wrongly, I do accept as not dying, as continuing my own self. But were my brain to be downloaded into some other matrix and clocked, then that is a technique which COULD be used to make multiple non-overlapping copies of my consciousness, and so I interpret it, rightly or wrongly, as creating my twin, which doesn't do "me" any good whether I am alive or dead. So cryonics terminating in revival of my own damn brain would be OK. Another tangential comment on Strong A.I. John Searl talks about the "Chinese Room" which did in fact convince me away from strong A.I. As I think about it now, the Chinese Room also "suffers" from copyability, and so perhaps I have stumbled upon a useful concept in thinking about consciousness and how to conserve it. Alan's comments against the existence of the self, are they perhaps a statement that the me of 1 year from now is EQUIVALENT to a copy of me made now, and then aged a year? Equivalent, in the sense of... indistinguishable from? Now I am a fan of the idea that a difference that doesn't make a difference is no difference at all. But i have a hard time knowing how to apply that to self and consciousness. From OUTSIDE me, a copy of me, my twin brother as it were, and me, we may be indistinguishable, a difference that makes no difference to the OUTSIDE world. But from inside? Well I know that while I am in New York and my copy is in New Zealand, to the people in New Zealand, that copy-thing is a difference that makes no difference. But to ME, it is a difference that does make a difference, as I am eating great pizza in New York, while I am not (but my copy is) bungee jumping on the Shotover. I think in talking about the self many people do think that a difference that makes a difference MUST be perceivable from the outside. But that makes no sense to me, if it makes a difference to my consciousness, it doesn't matter if I am the only one that can see the difference, it is still a real difference. Further, it would seem, an argument against cryonics like the one Alan makes above could just as well be an argument against spending even rudimentary effort or resources on self-preservation. Why shouldn't I jump off a building just to see what it is like? My future self does not exist, so I have nothing to lose. How is not bothering with cryonics justifiable, if eating vitamins and exercising in order to live longer is justifiable? It seems in the above, if one goes, they both go. Jeff Hawkins in On Intelligence dismisses the mystery of consciousness with something like "consciousness is just what it feels like to have a brain like ours." Feels like to whom, I ask? Another great book IMHO. My father is dying of Alzheimer's disease. It is a terrible disease. It raises problems for theology. Ordinarily we think of the self as something that grows but does not shrink. Though it changes through time we see no difficulty because we instinctively say "Take the latest version." If we are lucky we may never see a neuro-degenerative disease up close and personal. We need never see the difficulty. But how is heaven supposed to work? The resurrection to eternal life had better involve some rolling back of the years, to earlier, happier times. There are practical problems here. There is no point in cryonic preservation for some-one who dies after a neuro-degenerative disease has followed its natural course. There are also problems of principle. When is the self? My father had a very good memory, so when it started to fail him he had to learn to make written notes. Alas! He left it too late to learn the skill. He left it too late to learn that you have to write large and neat, least reading the damn things become a tragedy. We don't have to imagine so
[ 253, 13599, 3956, 15, 187, 187, 1628, 1328, 369, 247, 2022, 14, 6301, 577, 89, 22, 342, 247, 7154, 14, 2727, 987, 6479, 313, 85, 460, 582, 668, 253, 32290, 753, 15, 773, 42, 2868, 436, 369, 581, 273, 253, 24563, 309, 3047, 1390, 807, 672, 344, 369, 271, 854, 14, 25078, 13, 533, 344, 369, 1663, 4618, 1425, 187, 187, 510, 22173, 457, 84, 3345, 5195, 369, 3436, 337, 16, 25, 13048, 285, 253, 443, 18, 84, 497, 2620, 285, 5093, 13048, 1048, 13, 342, 2145, 14, 12099, 443, 19, 84, 285, 2164, 14, 12099, 2022, 20435, 15, 187, 187, 1628, 1328, 457, 69, 3663, 1264, 390, 1740, 13048, 745, 247, 5926, 246, 460, 13, 1512, 1806, 23698, 753, 15, 773, 1147, 344, 8715, 457, 85, 574, 594, 1142, 45131, 13, 344, 651, 452, 24684, 253, 1375, 6026, 1924, 1977, 1425, 187, 187, 41, 32007, 6701, 8178, 14, 15510, 323, 39259, 273, 12702, 187, 187, 37, 2663, 6086, 20079, 8178, 14, 15510, 323, 521, 5962, 12433, 1905, 285, 13, 642, 13, 344, 1904, 457, 85, 7471, 247, 39259, 24563, 387, 253, 4657, 15, 187, 187, 34, 2030, 14, 2913, 14, 744, 8352, 6037, 90, 3513, 5908, 13, 6086, 556, 281, 789, 521, 16121, 3038, 1475, 247, 17905, 2628, 10130, 15, 6408, 4596, 13, 344, 4425, 281, 755, 4092, 670, 11283, 14, 36479, 2952, 13, 1014, 2167, 344, 457, 69, 1620, 1014, 11226, 247, 12910, 12610, 27564, 387, 247, 24563, 15, 187, 187, 2598, 344, 2427, 281, 253, 4657, 285, 8686, 247, 11142, 7990, 281, 4205, 327, 521, 1535, 324, 4431, 964, 1235, 14, 1179, 3669, 20260, 285, 5055, 598, 247, 11996, 273, 253, 4657, 14, 22374, 34365, 14, 688, 14, 38, 1344, 316, 26710, 15, 187, 187, 1628, 42, 8184, 264, 275, 253, 20260, 767, 1897, 1078, 309, 2427, 16121, 1806, 344, 753, 15, 187, 187, 23108, 1160, 521, 806, 5103, 1385, 10733, 15, 655, 275, 6201, 610, 3928, 13, 1066, 272, 581, 273, 253, 807, 457, 84, 1755, 20523, 14, 664, 40127, 40483, 447, 15, 187, 187, 1628, 42, 457, 69, 1694, 9214, 281, 20269, 690, 2659, 984, 247, 29517, 273, 7477, 574, 9214, 13, 285, 309, 2546, 253, 2659, 18602, 670, 479, 16121, 13, 285, 344, 753, 8261, 1806, 344, 753, 15, 187, 187, 23108, 574, 2326, 1355, 33096, 13, 533, 2717, 22936, 28, 344, 457, 69, 47214, 1309, 549, 5316, 90, 2952, 285, 14150, 264, 767, 1057, 627, 15, 187, 187, 1628, 42, 457, 69, 1691, 598, 247, 23465, 1462, 387, 253, 5024, 273, 247, 21175, 5026, 292, 285, 1892, 48853, 342, 247, 1673, 327, 1016, 1930, 1806, 344, 753, 15, 773, 510, 24563, 3798, 1705, 562, 273, 253, 21175, 5026, 292, 715, 253, 1892, 48853, 15, 187, 187, 1628, 42, 574, 767, 9310, 391, 3544, 38149, 275, 8178, 14, 15510, 513, 70, 26710, 13, 285, 309, 7428, 275, 247, 9096, 1475, 619, 1462, 281, 835, 309, 457, 69, 3260, 24563, 574, 644, 3551, 562, 273, 253, 5026, 292, 13, 840, 309, 1160, 1529, 9096, 3212, 479, 275, 253, 258, 8765, 285, 896, 1066, 253, 11693, 313, 936, 521, 1462, 582, 668, 344, 753, 15, 187, 187, 1328, 4845, 253, 660, 8006, 391, 3544, 327, 247, 4564, 273, 5202, 24601, 13, 840, 21863, 715, 521, 23465, 1462, 15, 187, 187, 1628, 42, 3053, 2403, 7387, 255, 285, 650, 2084, 5841, 846, 309, 1694, 275, 619, 1462, 1806, 344, 753, 15, 187, 187, 3404, 670, 608, 27, 1229, 268, 15, 78, 904, 816, 2909, 1078, 3644, 13, 344, 3047, 247, 513, 70, 15813, 562, 273, 253, 21175, 5026, 292, 13, 3560, 407, 247, 19933, 9141, 12433, 15, 187, 187, 1628, 1328, 369, 987, 327, 617, 8105, 13, 533, 672, 344, 1694, 281, 835, 309, 457, 69, 1691, 247, 26710, 23603, 13, 344, 6331, 285, 369, 2819, 387, 352, 1806, 6086, 753, 15, 773, 1328, 369, 670, 5096, 390, 5091, 11433, 432, 479, 1425, 187, 187, 23108, 1691, 253, 2831, 73, 3514, 327, 253, 24563, 457, 84, 987, 9215, 285, 7320, 253, 9632, 15, 187, 187, 1628, 510, 12433, 6497, 275, 521, 11411, 285, 1620, 4395, 1806, 753, 6086, 13, 665, 15433, 253, 12433, 24398, 773, 10483, 281, 18881, 281, 20504, 1806, 12511, 984, 344, 4571, 457, 85, 8488, 352, 715, 247, 1698, 14, 83, 1334, 19150, 285, 574, 281, 9310, 352, 4830, 253, 3722, 15, 187, 187, 1628, 42, 4571, 457, 85, 1265, 281, 2619, 352, 598, 1806, 344, 753, 15, 187, 187, 23108, 5998, 253, 2022, 14, 6301, 608, 89, 22, 22173, 342, 767, 10969, 2792, 588, 4868, 875, 12036, 285, 19939, 3452, 531, 14, 395, 14, 36, 16249, 3592, 13048, 773, 12157, 253, 22173, 6107, 598, 247, 21807, 14, 12099, 11545, 12433, 22173, 387, 619, 2891, 301, 693, 382, 457, 84, 1425, 187, 187, 1628, 42, 457, 306, 644, 16121, 342, 247, 12910, 12610, 14, 27564, 323, 2620, 1107, 1806, 344, 753, 15, 773, 42, 1900, 3078, 281, 5159, 247, 1943, 24563, 13, 285, 436, 807, 309, 1694, 13476, 1425, 187, 187, 39441, 5438, 2987, 323, 6398, 3928, 32290, 187, 187, 18448, 773, 27503, 668, 7518, 983, 273, 34334, 310, 247, 13687, 32290, 13, 285, 253, 3745, 281, 3343, 3534, 779, 247, 4839, 387, 247, 12433, 14, 1171, 14, 66, 14, 6458, 7816, 1390, 10733, 15, 1722, 15, 187, 187, 1628, 42, 457, 69, 2326, 436, 12433, 5909, 1388, 313, 1171, 20260, 2952, 13, 10733, 15, 1638, 10, 275, 247, 2624, 1189, 13, 533, 313, 42, 10, 4571, 457, 85, 923, 2217, 273, 779, 281, 755, 247, 2590, 5103, 1806, 753, 7518, 983, 13, 5329, 13, 247, 1375, 14, 20129, 12954, 15, 773, 42, 1620, 2335, 619, 5252, 745, 13, 1014, 2167, 309, 9047, 779, 323, 247, 1175, 2372, 1425, 187, 187, 1328, 369, 16121, 6398, 3928, 2659, 326, 27022, 247, 6389, 342, 21792, 38810, 4910, 15, 187, 187, 1628, 3220, 313, 12588, 10, 1462, 310, 327, 253, 5024, 273, 271, 29098, 5534, 1282, 326, 457, 84, 581, 1930, 273, 247, 38810, 1673, 1806, 344, 753, 15, 773, 8195, 1930, 556, 247, 2624, 1189, 1425, 187, 187, 2374, 10733, 15, 1638, 13, 7518, 983, 3047, 285, 3735, 247, 20018, 272, 12433, 342, 581, 7154, 14, 2727, 246, 460, 275, 253, 2624, 1189, 15, 329, 5699, 30661, 292, 647, 326, 574, 644, 8615, 253, 12433, 342, 253, 7154, 246, 460, 3560, 253, 4577, 12433, 275, 253, 5026, 292, 13, 533, 7518, 983, 753, 344, 812, 760, 923, 9886, 285, 7437, 273, 253, 1943, 24563, 275, 253, 5536, 762, 36511, 285, 816, 9047, 352, 342, 521, 10269, 26292, 84, 15, 187, 187, 1628, 510, 1563, 7948, 13, 309, 1694, 275, 253, 1072, 1462, 670, 495, 27, 1857, 268, 15, 78, 904, 668, 7518, 983, 753, 15, 773, 42, 457, 69, 2668, 2067, 24563, 562, 273, 436, 1462, 275, 253, 2469, 13, 1690, 247, 18836, 14, 12099, 854, 14, 25078, 13, 533, 253, 2170, 574, 1077, 1652, 1943, 12433, 861, 436, 807, 1425, 187, 187, 10572, 271, 4964, 1996, 13, 2067, 1057, 2210, 562, 273, 253, 18557, 715, 253, 38810, 1673, 13, 3560, 407, 253, 12433, 342, 253, 7154, 246, 460, 15, 187, 187, 1628, 42, 369, 11525, 253, 1943, 581, 651, 320, 1563, 253, 7154, 14, 85, 460, 12433, 969, 1806, 344, 753, 15, 187, 187, 8389, 5730, 369, 7169, 15, 187, 187, 1628, 4553, 1458, 2909, 13, 309, 3053, 281, 5545, 352, 13, 533, 840, 344, 2210, 562, 273, 253, 3242, 1072, 1854, 347, 253, 7154, 14, 27721, 12433, 387, 608, 27, 938, 268, 15, 78, 904, 668, 7518, 983, 753, 15, 773, 1328, 369, 1052, 11433, 1977, 13, 2819, 387, 253, 1057, 533, 417, 31702, 731, 1425, 187, 187, 18431, 1057, 671, 6225, 2822, 7518, 983, 13, 594, 253, 12415, 369, 26007, 613, 494, 15, 187, 187, 1628, 42, 3260, 309, 4571, 457, 85, 2118, 390, 597, 457, 69, 653, 645, 13, 285, 309, 3260, 309, 4571, 457, 85, 4352, 253, 1943, 12433, 387, 326, 4181, 984, 309, 369, 18577, 1512, 1199, 1806, 344, 753, 15, 187, 187, 9494, 983, 4425, 281, 16359, 521, 22614, 407, 3946, 43464, 253, 9632, 273, 521, 19896, 920, 964, 20256, 20260, 342, 253, 5252, 327, 15, 2732, 2067, 5216, 13, 344, 1694, 247, 1175, 1551, 13, 25363, 745, 253, 5252, 13, 1691, 253, 2831, 73, 3514, 327, 253, 12433, 457, 84, 9215, 285, 2335, 253, 5103, 15, 187, 187, 1628, 9, 510, 24563, 10, 1160, 247, 19749, 463, 3579, 285, 2427, 1066, 1806, 253, 32290, 753, 15, 773, 42, 1691, 619, 10269, 26292, 84, 327, 779, 285, 3047, 521, 3168, 23828, 12097, 1425, 187, 187, 29916, 26707, 49536, 13, 247, 40670, 15235, 13, 322, 15, 36, 904, 2891, 301, 693, 382, 13, 11691, 253, 12433, 387, 19939, 818, 16, 25, 13711, 13048, 285, 10652, 253, 24563, 387, 608, 8313, 1107, 15, 733, 24398, 22038, 12511, 15, 187, 187, 1628, 1147, 457, 84, 8644, 281, 923, 253, 1805, 3290, 273, 24563, 275, 3729, 9756, 1024, 13, 285, 309, 11104, 352, 281, 253, 374, 14, 24507, 2701, 1806, 7518, 983, 753, 15, 773, 7883, 651, 1158, 6398, 3928, 812, 1756, 24563, 751, 436, 32, 1422, 816, 452, 281, 1339, 731, 1756, 281, 577, 8313, 390, 608, 8313, 15, 309, 871, 352, 457, 84, 1892, 323, 952, 281, 3343, 672, 597, 923, 247, 495, 8313, 14, 2913, 14, 744, 24563, 387, 11343, 13048, 13, 533, 604, 597, 457, 620, 3343, 13, 247, 8750, 12433, 588, 1900, 320, 3212, 1425, 187, 187, 4316, 592, 2789, 1175, 3282, 323, 32290, 275, 3826, 466, 3928, 187, 187, 1147, 2789, 1175, 3282, 281, 897, 24563, 660, 592, 13, 347, 16553, 418, 647, 273, 4377, 476, 863, 383, 846, 9602, 253, 5962, 12433, 273, 521, 1495, 15, 187, 187, 1628, 42, 457, 69, 48490, 1066, 619, 10015, 285, 574, 1691, 562, 42900, 31241, 313, 1026, 592, 582, 308, 750, 457, 84, 10447, 9480, 285, 48490, 313, 14806, 253, 2329, 10, 690, 388, 15, 52, 15, 19307, 386, 18885, 16327, 1806, 753, 418, 647, 13, 247, 2030, 14, 2913, 14, 744, 11993, 2315, 5572, 323, 353, 2878, 518, 39071, 15, 773, 42, 457, 78, 2176, 352, 4307, 13, 984, 352, 11213, 264, 247, 818, 14, 25078, 285, 436, 12433, 13, 285, 1097, 497, 1066, 16668, 273, 479, 1425, 187, 187, 3039, 253, 1943, 5006, 2210, 715, 8184, 13, 418, 647, 369, 7063, 275, 247, 21266, 1462, 387, 247, 6308, 275, 3826, 466, 3928, 344, 457, 69, 760, 47214, 2378, 3786, 275, 253, 4131, 15, 187, 187, 1628, 42, 457, 69, 2326, 1943, 12433, 861, 11678, 13, 594, 309, 3260, 627, 369, 247, 1175, 24563, 627, 1806, 344, 753, 15, 773, 1328, 457, 69, 32089, 618, 22945, 285, 5699, 7139, 11678, 313, 3529, 10, 309, 4571, 457, 85, 755, 619, 3564, 1475, 15, 309, 574, 690, 11693, 14, 32499, 7963, 273, 12524, 24563, 13, 533, 309, 8715, 457, 85, 2326, 436, 581, 1425, 187, 187, 45, 647, 4925, 253, 29098, 5202, 285, 2427, 598, 275, 521, 21266, 1462, 1884, 2909, 1078, 31335, 327, 10733, 15, 1638, 13, 253, 806, 1388, 273, 12910, 12610, 27564, 2952, 15, 187, 187, 1628, 9, 510, 1462, 10, 369, 327, 247, 27563, 387, 253, 5024, 273, 247, 2590, 7317, 1806, 344, 753, 15, 773, 42, 574, 253, 2590, 7317, 875, 479, 285, 690, 24732, 285, 14128, 4910, 15, 309, 3047, 313, 783, 1943, 12433, 10, 670, 818, 27, 1630, 247, 15, 78, 15, 309, 457, 69, 4783, 598, 253, 5202, 670, 1884, 2909, 1078, 31335, 1425, 187, 187, 3404, 670, 818, 27, 740, 247, 15, 78, 15, 285, 1078, 344, 3047, 253, 1781, 12433, 13, 247, 818, 14, 25078, 7428, 598, 253, 13599, 15, 418, 647, 1904, 457, 85, 7164, 521, 5654, 15, 187, 187, 1628, 1231, 1053, 457, 85, 5310, 1652, 33096, 984, 359, 452, 1175, 30222, 327, 326, 2867, 1806, 753, 418, 647, 13, 665, 13308, 1384, 2909, 1078, 6523, 253, 1943, 24563, 7824, 275, 253, 1072, 3884, 13, 3551, 598, 432, 2708, 779, 15, 187, 187, 1628, 42, 8344, 779, 3551, 598, 253, 27563, 4951, 2584, 479, 1806, 344, 753, 15, 773, 5872, 344, 12293, 562, 715, 271, 1711, 20893, 3971, 670, 3925, 11433, 432, 479, 13, 285, 512, 309, 3047, 497, 1331, 10787, 15, 754, 369, 5947, 36537, 1066, 16668, 13, 533, 344, 1620, 36280, 479, 15, 380, 818, 14, 25078, 671, 1620, 36280, 479, 13, 285, 309, 457, 78, 2119, 352, 369, 984, 309, 457, 69, 48490, 619 ]
the hilltop. “He was a main-frame 4x5 with a broken-off right brow (tine),” the hunter said. “I believe this was one of the deer I saw last year when he was an 8-pointer, but he was really wide.” The rack’s outside spread was 26 1/8 inches and the G1s were five and seven inches long, with 13-inch G2s and 24-inch main beams. “He’d lost three or four inches off a drop tine, too,” Harrison said. “It he hadn’t had so many deductions, he would have blown the state bow record away.” Hunter thanks Wal-Mart for trophy of lifetime Drew George credits Wal-Mart for his biggest buck — and, no, he didn’t purchase a trophy deer at the store. A 25-year-old Mount Airy police officer, George has to work his hunting hours around a demanding job schedule. During November, he decided to get serious about smoke-pole season, even though he’d never even fired a muzzleloader at a deer. So he went to the store and bought a cheap scope to mount on his Traditions .50-caliber rifle and picked up a bottle of the store-brand Doe-In-Estrus scent. “I sighted in the rifle two days before I went hunting,” he said. George made his first shot count Nov. 19 in Surry County, downing one of the year’s top primitive-weapons trophies. “I’d got permission to hunt some land because a buddy of mine had permission, and I asked the landowner about me hunting, and he said okay,” he said. George had seen small bucks, but nothing spectacular; he’d hunted during archery season and arrowed two does there. “I’d put up a ladder stand at the edge of a pine thicket and hardwoods with a field on each side,” he said. “The deer usually come out of the pine thicket into the hardwoods. “I had two drag rags soaked in Wal-Mart doe scent, and I walked in a circle around my stand to where I’d knew deer had been coming out of the thicket, then I made another circle behind me in the oaks and back down the trail (to his stand),” he said. He placed the scented rags on a couple of tree limbs, then climbed into his ladder stand. “I started making bleat and grunt calls after I got in my stand,” he said. At about 5:30 p.m., just minutes before dark, he saw a doe slip out of the pine thicket, followed by a bruiser buck. “He was right on her tail, but when he got to where I’d put a scent rag, he stopped and was looking at it,” George said. “He was about 80 or 90 yards from me.” George put the crosshairs on the deer’s right shoulder and pulled the trigger. “The buck fell in his tracks and never moved,” said George, who figured the buck weighed “close to 220 to 230,” pounds because he couldn’t lift it into a low-rider trailer and had to drag it onto the bed. “I couldn’t start to pick it up,” he said. George estimated the main-frame 5x5 rack with two abnormal points will score between 160 and 165 Boone-and-Crockett inches “because the rack covered up a 156-inch Illinois buck rack at my taxidermist’s.” “I’ve been hunting with a muzzle-loader for five years,” he said. “I always wanted to kill a big deer, and this year I got lucky.” Natural selection works for Union County hunter James “Chris” Helms of Monroe is a selective hunter, and the ability to wait gave him a chance at a buck-of-a-lifetime last Nov. 17. “I’d seen this buck opening day (of rifle season, Nov. 14) in a cutover, but (I) couldn’t see enough of him to get a clear shot,” said Helms, 45, a state-government worker. “I never took my safety off, even though I watched him for a good bit.” He was hunting Union County land that joins a farm with harvested soybean fields. “My (tree) stand is on the edge of an oak woodline that’s one side of a soybean field,” he said. “Another side has a cutover.” On Nov. 14, Helms saw and heard a panting buck with one broken-off tine in the cutover. A huge whitetail that had been fighting the buck with the broken tine followed the smaller buck in the thicket, but Helms said he could only see bits and pieces of the big deer in the heavy underbrush and just watched it with his binoculars. “The following Tuesday, I got in the same stand about 3:45 p.m.,” Helms said. “I’d taken several deer out of this stand in the past, including a 144-inch 8-pointer, but the area had very little big buck sign this year.” About an hour later, several does came out of the woods into the soybean field, followed by the buck with the broken tine. “I was hoping the big one would be following the broken-tine buck again,” he said. His wish was granted. “After 15 minutes, I started to doubt it, but then he came out of the exact same path as the broken-horn buck at 5:20 p.m.,” Helms said. “He was 200 yards away, looking at the does but not chasing them.” Several does also stood near Helms, so the tension was unbearable. “I knew I couldn’t move or they’d spook, and I knew I couldn’t hit the big buck at that distance because I was shaking too much,” he said. Helms decided to settle his nerves by practice squeezing the trigger of his Browning .270 rifle with the safety on. After several tests, he got a good rest, clicked off the safety, put the crosshairs on the buck’s shoulder and took the shot. “(The deer) made a lunge forward and went down,” the hunter said. “I put my binoculars on him and saw his white belly patch.” Carlisle Sutton, a Pageland, S.C., taxidermist, scored the buck at 165 7/8 gross inches and aged the deer at 5½ years. It weighed 202 pounds. “It’s amazing to see the better quality of deer in North Carolina now, and I attribute it to the 2-buck limit,” Helms said. “Who would think Union County could grow deer like this? You just have to let them grow to 4½ or 5½. I know it’s hard for people to wait when they see a 3½-year-old deer at 115 inches, but if they’ll wait, a bigger buck will always be behind.” Scents makes good sense for hunter in Davie County It makes good sense to use deer scents, as Jason Lail of King can attest after shooting the biggest buck of his life. “I’d sprayed down my clothes and had put out Trophy Leaf (scents), Tink’s 69 gel and sprayed (into the air) some H.S. Dominant Buck urine,” said Lail, a 25-year-old printing press operator for Miltak Graphics. “I’m certain it worked, because it fooled a 7-pointer and this buck, and both were downwind of me.” When the big boy came into sight, Lail was sitting in a climbing stand at a spot in Davie County he’d only hunted once previously in the morning. “I’d seen big buck sign everywhere, so I knew there was a good deer there,” he said. “He’d rubbed saplings and huge trees everywhere (that) I couldn’t get my hands around. I had some trail-camera photos of decent deer, but I hadn’t seen this one.” Lail reached the oak tree and went up in his climbing stand 30 minutes before daylight on Nov. 14, the first day of muzzleloader season. “(The stand) was on a ridge at the edge of a clearcut,” he said. “I had the clearcut between me and some bean and corn fields. I saw (the big buck) about 7:27 a.m. I’d gone up the tree about 30 minutes before daylight.” At about 7:10 a.m. and before he saw the large buck, a 7-pointer walked up the hill. Lail didn’t raise his gun. “We don’t shoot little bucks because we have good genetics on that property,” said Lail, who waited 20 minutes before seeing the big deer walking in the same direction, coming up from below him. “I noticed him coming up the ridge straight toward me,” he said. “Then he stepped out into an old logging road about 60 yards from me, and all I saw were antlers. He was circling downwind, but he never smelled me. The 7-pointer also never smelled me, and I’m sure it was because I’d sprayed my
[ 3253, 1476, 346, 23337, 865, 346, 2042, 253, 952, 7636, 368, 13, 352, 434, 760, 984, 597, 1904, 626, 871, 253, 1524, 368, 1476, 346, 5498, 626, 1056, 479, 1705, 598, 627, 13, 309, 1871, 755, 281, 259, 24318, 249, 8, 251, 1097, 273, 368, 512, 1476, 346, 42, 1869, 309, 3260, 253, 1524, 368, 1476, 346, 1466, 434, 2312, 670, 436, 11874, 1476, 346, 7093, 2806, 285, 3168, 36298, 13, 9328, 14002, 1016, 643, 562, 15, 1394, 403, 2717, 1476, 346, 15021, 352, 1476, 346, 15021, 352, 1476, 346, 15021, 352, 1476, 346, 15021, 352, 1476, 346, 15021, 352, 1476, 346, 8262, 8028, 1476, 346, 1394, 1472, 6501, 452, 281, 320, 3110, 1476, 346, 9505, 449, 346, 1147, 434, 642, 1175, 13, 43807, 3803, 31042, 346, 42, 1053, 626, 871, 253, 11646, 1476, 346, 5498, 626, 1918, 479, 38219, 1476, 346, 19735, 479, 1543, 1476, 346, 38748, 1476, 346, 3074, 987, 13, 1339, 479, 1158, 449, 346, 1898, 6294, 779, 598, 1476, 346, 42, 858, 352, 1476, 346, 1466, 434, 755, 436, 20596, 476, 1614, 1475, 1476, 346, 8469, 656, 865, 346, 40, 3833, 571, 1476, 346, 23021, 1342, 1476, 346, 15510, 90, 1476, 346, 18552, 1476, 346, 15510, 90, 865, 346, 18552, 1476, 346, 15510, 90, 1476, 346, 2302, 1476, 346, 13689, 1476, 346, 8380, 896, 13, 48576, 1476, 346, 5498, 626, 564, 449, 346, 15510, 90, 865, 346, 23021, 1342, 865, 346, 40, 3833, 571, 865, 346, 15510, 90, 1476, 346, 23021, 1342, 1476, 346, 40, 3833, 571, 1476, 346, 15510, 90, 1476, 346, 23021, 1342, 1476, 346, 40, 3833, 571, 1476, 346, 8262, 3780, 1476, 346, 12092, 1476, 346, 15510, 90, 13, 8359, 1342, 13, 46972, 449, 346, 15510, 90, 13, 8359, 1342, 13, 48576, 449, 346, 15510, 90, 13, 8359, 1342, 13, 46972, 13, 48576, 13, 8359, 1342, 13, 48576, 13, 48576, 13, 8359, 1342, 449, 346, 8262, 1476, 346, 19576, 1476, 346, 3633, 479, 562, 273, 436, 2181, 13, 11853, 1476, 346, 12092, 865, 346, 3633, 479, 562, 273, 436, 2181, 987, 1024, 1476, 346, 12092, 865, 346, 49682, 865, 346, 23021, 1342, 1476, 346, 18552, 865, 346, 2513, 326, 368, 865, 346, 23021, 1342, 13, 309, 1694, 368, 1476, 346, 49026, 327, 13, 10913, 327, 13, 309, 1694, 368, 449, 346, 23021, 1342, 1476, 346, 42, 1694, 368, 13, 29517, 1476, 346, 13689, 247, 1273, 449, 346, 13689, 987, 627, 449, 346, 34, 3227, 1476, 346, 18552, 13, 752, 403, 368, 2509, 865, 346, 42, 1353, 2970, 368, 562, 273, 253, 3817, 1476, 346, 9112, 991, 449, 346, 18552, 865, 346, 40, 343, 23510, 7145, 11320, 1476, 346, 13689, 1476, 346, 13689, 1476, 346, 8380, 327, 1476, 346, 13689, 1476, 346, 4943, 4566, 2717, 1476, 346, 26521, 1335, 1476, 346, 13689, 1476, 346, 13689, 1476, 346, 13689, 1476, 346, 26521, 1335, 1476, 346, 2302, 1476, 346, 8380, 327, 1476, 346, 8380, 327, 1476, 346, 4943, 309, 1705, 1476, 346, 7745, 1476, 346, 7745, 1476, 346, 7745, 13, 1007, 1476, 346, 1147, 434, 46972, 1476, 346, 1147, 434, 46972, 1476, 346, 4013, 18981, 13, 352, 310, 46972, 449, 346, 40, 3833, 571, 1476, 346, 40, 3833, 571, 1476, 346, 3074, 987, 90, 8290, 13, 794, 310, 689, 449, 346, 40, 3833, 571, 1476, 346, 18552, 1476, 346, 15510, 90, 865, 346, 15510, 90, 1476, 346, 1394, 871, 13, 309, 1053, 626, 1663, 452, 2712, 327, 479, 987, 1024, 449, 346, 42, 1833, 452, 281, 755, 368, 1996, 449, 346, 1992, 368, 1512, 1476, 346, 15510, 90, 1476, 346, 15510, 90, 1476, 346, 18552, 1476, 346, 15510, 90, 1476, 346, 18552, 1476, 346, 15510, 90, 1476, 346, 2422, 1476, 346, 15510, 90, 1476, 346, 18552, 865, 346, 15510, 90, 1476, 346, 4013, 8618, 13, 14795, 13, 6749, 10331, 449, 346, 15510, 90, 1476, 346, 42, 1353, 6501, 5159, 368, 1476, 346, 8262, 1476, 346, 26521, 327, 1476, 346, 26521, 327, 1476, 346, 7745, 387, 441, 1476, 346, 1231, 1472, 512, 1060, 2366, 4999, 285, 3590, 449, 346, 6506, 13, 1060, 359, 403, 449, 346, 7161, 4555, 310, 1060, 865, 346, 19346, 14912, 449, 346, 19346, 14912, 865, 346, 17185, 41240, 29780, 13, 19080, 314, 15524, 3626, 3126, 13, 4618, 1527, 30084, 17867, 13, 309, 1353, 7746, 368, 436, 812, 320, 253, 5003, 14912, 41089, 449, 346, 26626, 342, 15223, 16419, 449, 346, 24243, 1476, 346, 2773, 4453, 1524, 449, 346, 19346, 14912, 865, 346, 1276, 812, 320, 7197, 685, 5003, 14912, 865, 346, 42, 1053, 626, 871, 13, 436, 1659, 310, 9370, 309, 751, 352, 1476, 346, 4013, 13, 309, 812, 10913, 1060, 13, 309, 812, 10913, 1060, 449, 346, 42, 1353, 6501, 5159, 368, 13, 48576, 1476, 346, 12864, 352, 3477, 1476, 346, 12864, 352, 3477, 1476, 346, 1898, 840, 1213, 2134, 368, 1476, 346, 4218, 78, 1066, 1476, 346, 5872, 33163, 368, 13, 11174, 368, 598, 285, 19327, 368, 13, 285, 5159, 512, 634, 21825, 31042, 346, 37872, 1273, 673, 562, 865, 346, 537, 395, 840, 13, 42, 1833, 1620, 2312, 281, 368, 969, 449, 346, 15021, 352, 1476, 346, 7745, 13, 844, 1472, 816, 6501, 1089, 253, 952, 755, 10141, 275, 285, 452, 436, 4840, 48293, 562, 1476, 346, 4013, 1270, 13, 436, 310, 816, 1270, 449, 346, 19346, 14912, 1476, 346, 4125, 309, 452, 281, 15639, 342, 41964, 86, 285, 521, 39817, 1652, 23805, 1476, 346, 42, 476, 626, 1755, 326, 449, 346, 5804, 626, 1755, 352, 1476, 346, 42, 1353, 27826, 1476, 346, 42, 1353, 4783, 1476, 346, 42, 1353, 562, 273, 253, 2136, 1476, 346, 1147, 434, 634, 9331, 13, 48576, 1476, 346, 1394, 1849, 27826, 479, 1476, 346, 8380, 327, 13, 6539, 449, 346, 4045, 368, 20509, 1158, 3, 346, 42, 6034, 512, 273, 436, 281, 5108, 865, 346, 1394, 971, 479, 281, 1333, 326, 309, 1353, 7016, 865, 346, 2513, 326, 752, 368, 971, 865, 346, 9281, 13, 309, 1353, 3255, 346, 1328, 816, 439, 6093, 479, 1476, 346, 15510, 90, 1007, 13, 816, 17500, 320, 816, 247, 1652, 2372, 625, 3255, 346, 2809, 2345, 1476, 346, 5498, 626, 368, 439, 2345, 479, 1476, 346, 4045, 368, 4089, 326, 865, 346, 5498, 626, 368, 4089, 326, 865, 346, 42, 4089, 352, 1024, 1476, 346, 3039, 627, 434, 3440, 13, 627, 434, 952, 449, 346, 1231, 564, 987, 281, 253, 1481, 4070, 4039, 449, 346, 34, 33619, 651, 320, 5322, 449, 346, 6506, 13, 752, 247, 13725, 1476, 346, 3726, 943, 1067, 352, 253, 5003, 6129, 14, 45, 482, 14, 48, 41089, 1476, 346, 6407, 597, 2028, 368, 18981, 1476, 346, 1231, 17500, 436, 1270, 1527, 2098, 2181, 449, 346, 1466, 253, 5074, 1408, 4956, 1476, 346, 9301, 2181, 368, 871, 1051, 12405, 275, 634, 4707, 13, 285, 11648, 434, 15729, 3390, 11648, 449, 346, 1552, 1659, 2238, 273, 17202, 327, 368, 1476, 346, 1552, 1039, 13, 6068, 1476, 346, 8380, 327, 1476, 346, 4013, 13, 642, 1476, 346, 9281, 13, 1339, 434, 1056, 247, 1175, 13214, 327, 253, 952, 449, 346, 8944, 3205, 4130, 13, 1339, 434, 755, 352, 2366, 449, 346, 2513, 326, 253, 1682, 368, 476, 513, 13, 8359, 1342, 865, 346, 4013, 13, 309, 1353, 417, 18727, 13, 352, 434, 3678, 449, 346, 9281, 973, 1270, 449, 346, 1466, 434, 1056, 3678, 1007, 1175, 449, 346, 1147, 434, 417, 952, 449, 346, 1147, 434, 5074, 1476, 346, 30971, 5074, 1476, 346, 1552, 310, 751, 247, 38091, 3128, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 1394, 751, 281, 3255, 346, 19815, 352, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 1394, 751, 281, 3255, 346, 19815, 352, 1476, 346, 42, 751, 281, 2118, 352, 2118, 352, 1476, 346, 1394, 751, 281, 2118, 352, 2118, 352, 1476, 346, 2993, 13052, 281, 2118, 352, 2118, 352, 1476, 346, 1231, 751, 281, 3255, 346, 19815, 352, 1476, 346, 3074, 6838, 512, 689, 253, 1533, 1476, 346, 25494, 4377, 28798, 1476, 346, 1276, 247, 3226, 434, 637, 1476, 346, 42, 2389, 512, 731, 6838, 309, 2389, 281, 2118, 731, 2133, 1476, 346, 3039, 368, 2118, 634, 2133, 13, 368, 2118, 352, 5322, 285, 7353, 285, 256, 20479, 449, 346, 1276, 2238, 273, 41089, 310, 436, 865, 346, 42, 816, 3047, 3436, 40458, 386, 1786, 2127, 15927, 449, 346, 42, 1353, 18248, 5003, 14912, 13, 436, 1659, 310, 745, 281, 253, 448, 478, 404, 1476, 346, 37872, 14, 23587, 1476, 346, 1231, 943, 1849, 3982, 16666, 285, 12539, 1476, 346, 13689, 13, 835, 434, 6539, 865, 346, 1276, 4592, 281, 779, 13, 344, 369, 987, 3212, 441, 449, 346, 41192, 344, 987, 3212, 441, 865, 346, 42, 1053, 626, 871, 835, 344, 434, 387, 13, 533, 344, 434, 5816, 581, 13908, 273, 247, 3128, 1476, 346, 510, 36414, 6859, 1476, 346, 510, 36414, 6859, 1476, 346, 510, 36414, 6859, 403, 20362, 1476, 346, 42, 9239, 32850, 3829, 449, 346, 6506, 13, 6701, 247, 2257, 13, 6068, 449, 346, 8061, 323, 6179, 598, 449, 346, 42, 1663, 11435, 352, 449, 346, 8262, 14260, 449, 346, 1231, 816, 1694, 275, 432, 1457, 2816, 285, 359, 1472, 2819, 323, 247, 26141, 13, 984, 359, 1849, 644, 7063, 327, 326, 11600, 896, 627, 323, 3038, 449, 346, 1898, 12445, 434, 1014, 28860, 281, 921, 598, 449, 346, 42, 1053, 626, 871, 849, 1841, 9403, 1408, 1475, 1060, 13, 533, 9090, 627, 434, 644, 690, 3686, 273, 2201, 11598, 598, 13, 534, 310, 4484, 449, 346, 2598, 604, 368, 816, 1127, 441, 4404, 281, 253, 10656, 14145, 13, 390, 816, 16831, 3255, 346, 4497, 13, 849, 6421, 513, 865, 346, 6104, 1334, 1476, 346, 6104, 1334, 327, 619, 896, 1476, 346, 46, 4411, 547, 13, 858, 368, 923, 326, 865, 346, 1328, 16060, 253, 36414, 6859, 1977, 449, 346, 3633, 352, 1476, 346, 3633, 352, 1476, 346, 3633, 352, 1476, 346, 7161, 858, 344, 564, 865, 346, 7161, 858, 344, 564, 865, 346, 21958, 28798, 13, 752, 403, 597, 865, 346, 1276, 403, 597, 865, 346, 3726, 403, 28840, 449, 346, 52, 16476, 28840, 432, 253, 40810, 2852, 449, 346, 3726, 1849, 1705, 281, 5159, 441, 1476, 346, 1898, 1379, 776, 2255, 1476, 346, 1898, 776, 18153, 18494, 1476, 346, 3633, 598, 13, 16905, 449, 346, 4045, 417, 320, 2822, 253, 4377, 434, 4669, 13, 8261, 865, 346, 2809, 73, 1476, 346, 1231, 1472, 17197, 449, 346, 4678, 7107, 4130, 449, 346, 688, 6547, 479, 449, 346, 2809, 73, 1476, 346, 7883, 434, 2403, 326, 6046, 865, 346, 4013, 13, 352, 434, 479, 969, 449, 346, 8380, 327, 8290, 1476, 346, 15021, 352, 1476, 346, 3546, 602, 1476, 346, 42, 1158, 368, 1694, 352, 449, 346, 42, 2181, 703, 1694, 352, 449, 346, 2513, 352, 1335, 327, 479, 865, 346, 42, 9239, 48037, 449, 346, 2773, 434, 8261, 13, 703, 434, 4783, 449, 346, 3726, 403, 5745, 1131, 1476, 346, 36601, 429, 359, 3150, 449, 346, 510, 4669, 1476, 346, 42, 2183, 368, 1476, 346, 40795, 626, 309, 2028, 779, 670, 253, 4669, 865, 346, 1328, 858, 2028, 368, 670, 253, 4669, 449, 346, 13689, 449, 346, 42, 452, 247, 2098, 1476, 346, 22582, 865, 346, 42, 452, 32434, 247, 48455, 1071, 449, 346, 1992, 923, 1880, 841, 403, 40810, 45361, 449, 346, 2302, 1476, 346, 12764, 627, 1476, 346, 1394, 1339, 479, 6016, 352, 449, 346, 18552, 22139, 352, 449, 346, 15510, 90, 1057, 2717, 449, 346, 12764, 627, 1476, 346, 4013, 13, 7016, 449, 346, 2302, 13, 642, 1476, 346, 4013, 6539, 13, 752, 858, 368, 513, 865, 346, 15021, 13, 3523, 449, 346, 1147, 434, 8261, 449, 346, 1147, 434, 8261, 449, 346, 42, 1353, 816, 247, 19456, 13, 816, 247, 19456, 27405, 449, 346, 4013, 13, 368, 4105, 1652, 6858, 13, 858, 326, 1943, 1599, 27405, 30272, 368, 865, 346, 1328, 858, 865, 346, 1328, 434, 247, 1943, 3076, 1711, 35587, 6421, 46868, 13, 3548, 626, 344, 865, 346, 8380, 327, 13, 278, 2902, 2186, 368, 449, 346, 3726, 403, 594, 20295, 432, 247, 5272, 4181, 449, 346, 1394, 1472, 7353, 383, 1652, 2181, 13, 309, 816, 17341, 277, 3938, 779, 275, 619, 8574, 449, 346, 3726, 403, 816, 247, 12190, 273, 45039, 447, 449, 346, 42, 1053, 626, 871, 13, 627, 434, 1335, 1633, 670 ]
everything!" "Love?" "If the people loved you, it's only because they didn't know the real you!" "Don't make me come up there, I'd get to woopin'on both of you all!" "I thought I knew the real you!" "Let's talk about this calm!" "Your black and white stripes,they cancel each other out.You are nothing!" "Stop it!" "Stop it!" "Stop it!" "Stop it!" "Stop it!" "Hey listen!" "You're gonna have to be patient!" "Status." "It's no good, Skipper.." "I don't know the codes!" "Don't give me excuses!" "Give me results!" "Navigation!" "All right, let me think." "And shut him up!" "I did it!" "Let's get this tin can turn around!" "Guys?" "Gloria!" "Melman!" "Marty!" "Alex!" "Marty?" "Alex!" "Marty!" "No!" "Wait!" "Come back, Marty!" "Don't go." "Marty?" "Melman?" "Gloria?" "Marty!" "Melman!" "Gloria!" "Marty!" "Melman!" "Gloria!" "Hey anyone!" "Hello!" "Marty, Melman, Gloria." "Marty, Melman, Marty." "Marty, Melman, Gloria, Marty, Melman, Marty, Marty, Melman." "Hey!" "Help!" "Get me out of this thing, somebody!" "Hello?" "Get me out of this thing right now!" "Hello?" "Somebody?" "Melman!" "Alex?" "Is that you?" "Melman, I got you!" "Hang on, hang on, I got you." "Melman!" "I got you, buddy!" "Wait a second." "Wait right there." "Aha!" "Alex, what are you doing?" "I'm getting you out of the box!" "Relax." "Alex?" "Giraffe corner pocket!" "Wait!" "Wait!" "Come on!" "Wait!" "Here goes nothing!" "Hold still!" "Wait!" "Wait!" "Wait!" "Hold still!" "No!" "Come on!" "Come on!" "Here I come!" "Look!" "Look!" "Look, look!" "It's Gloria!" "It's Gloria!" "Oh hey, it is Gloria." "Gloria!" "Gloria!" "All righty boys, fun is over." "Gloria!" "Alex!" "Marty?" "Marty!" "You know, I don't really have anything on me right now." "I'll have to get you later." "To you too!" "Marty!" "Marty!" "Alex!" "Marty!" "Alex!" "Marty!" "Al!" "Marty!" "Alex?" "Marty!" "Oh sugar, honey, ice tea." "Marty!" "I'm gonna kill you!" "Hey!" "Hold on!" "Hold on!" "Look at us!" "We're all here together safe and sound." "Yeah, here we are." "Where exactly is here?" "San Diego." "San Diego?" "White sandy beaches, cleverly simulated natural environment, wide open enclosures, I'm telling you this could be the San Diego zoo." "Complete with fake rocks." "Wow!" "That looks real." "San Diego?" "What could be worse than San Diego?" "I don't know, this place is crack I like it!" "Oh, I could hang here, I could hang here." "I'm gonna kill you, Marty!" "Take it easy!" "Take it easy!" "And then strangle you!" "Calm down!" "Then bury you,dig you up and clone you, and kill all your clones.." "Twenty second time out?" "..and then,I'll never talk to you again." "Stop it!" "Look, We're just gonna find the people get checked in and have this mess straightened out!" "Oh great, this is just great." "San Diego!" "Now I have to compete with Shamu and his smug little grin!" "I can't top that." "Can't top it!" "I'm ruined!" "I'm gone!" "I'm out of the business!" "It's your fault, Marty!" "You've ruined me!" "Come on, Alex." "Do you honestly think" "I intended all of this to happen?" "You want me to say that I'm sorry?" "Is that what you want?" "Okay, I'm..." "He just shushed me!" "Marty look, just gotta be just a little bit more..." "Shush!" "Don't you shush me!" "Do you hear that?" "Don't you hear that?" "I hear it now!" "When there's music, there's people." "We go right to the head honcho." "A sidewalk would be nice." "Yeah, what a dump!" "They should call it the San Di-Lame-O zoo!" "First they tell you hey!" "We gotta this great open plan thing." "Let the animals run wild!" "Next thing you know... flowers in your hair, and everybody's hugging everybody." "This place kind of grows on you!" "This way, guys!" "Come on!" "Oh, no!" "Okay, let's make a good impression on the people." "Smiles everyone, let's get it together." "Is that the best you can do, Melman?" "Oh, I'm not smiling, it's gas." "Okay well great." "Let's make gas look good." "It's not people." "It's animals!" "California animals!" "This is like a puppy party!" "I like to move it move it!" "I like to move it move it!" "You like to..." "Move it!" "I like to move it move it!" "I like to move it move it!" "I like to move it move it!" "You like to..." "Move it!" "I like to move it move it!" "You like to move it move it!" "She likes to move it move it!" "We like to..." "Move it!" "All girls all over the world!" "Original King Julian!" "What a girl's man!" "I love all them girls I love to move them body!" "When you move your body, you move it nice and sweet and sassy." "What kind of zoo is this?" "I just saw 26 blatant health code violations." "I'm loving San Diego, this place is off to the chizain!" "Twenty-seven!" "We should've brought chips and dip!" "Wait, where's Alex?" "What happened to him, he was right behind us." "Were he right behind us?" "I don't know where he's at, but he's missing one hack of a party!" "The Foosa!" "The Foosa!" "The Foosa are attacking!" "I hate spider webs." "Yeah, thanks a lot, guys." "Thanks for waiting up." "I really appreciate it." "Hey hi." "We just got in from New York and we're looking for a supervisor, because we've been sitting on that beach back there for hours." "And nobody's even bothered to show up." "I don't know how things normally run around here, but obviously there's been some sort of major screw up, which is cool." "So if you just point us towards to the administrative offices, or just uh..." "Well, howdy do?" "Spider!" "Spider on my back!" "Maurice, did you see that?" "He scared the Foosa away." "Get it!" "Get it!" "Get it!" "Where did he go?" "Where did he go?" "King Julian, what are they?" "What are they?" "They are aliens." "Savage aliens from the savage future." "They've come to kill us!" "And take our women!" "And our precious metals!" "Get up, Mort." "Do not be near the King's feet, okay?" "Shh!" "We're hiding." "Be quiet everyone." "Including me." "Shh!" "Who's making that noise?" "Oh, it's me again." "Come on boys!" "Stop it!" "Enough!" "I think you got it." "I thing she got it." "Is it still on me?" "I hate spiders." "That's okay, she's gone." "They are savages!" "Tonight we die." "The feet!" "I told you!" "Didn't I tell him about the feet?" "He did tell you about the feet." "Wait." "I have a plan!" "Really?" "I have devised a cunning test." "To see whether these are savage killers." "No!" "Hi there!" "You let me handle it." "Alex handles it." "Marty does nothing." "Hi there!" "Oh, sorry." "No, no!" "Oh Alex, what did you do?" "Stop, stop." "It's okay." "It's okay." "I'm just a silly, just a silly lion." "Oh, you poor little baby, did that big mean lion scare you?" "He did?" "He's a big bad old puddy tad, isn't he?" "Come on, mama hold you." "They are so cute from a reasonable distance." "You're sweetest little thing, I just wanna dunk him in my coffee." "They are just a bunch of pansies." "I don't know, there's still something about
[ 253, 5481, 273, 12264, 16744, 15, 831, 2624, 14, 2727, 588, 9093, 45166, 253, 9777, 273, 6255, 1786, 2515, 275, 253, 3072, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 5194, 326, 970, 253, 2624, 745, 4868, 273, 2145, 12, 4081, 407, 611, 405, 2146, 1162, 355, 904, 6469, 778, 45166, 12264, 16744, 15, 844, 16737, 253, 9759, 273, 253, 22260, 273, 15102, 342, 611, 23, 4868, 273, 2145, 12, 432, 5270, 374, 13, 285, 2905, 20121, 432, 253, 8378, 285, 21561, 15, 7820, 13, 359, 823, 271, 3081, 1783, 273, 9273, 3045, 273, 611, 23, 21565, 2219, 342, 1846, 6255, 9360, 2931, 407, 253, 2624, 14, 2727, 7363, 273, 399, 7810, 1797, 15, 380, 5118, 1682, 2624, 14, 2727, 4868, 273, 611, 23, 369, 898, 24728, 342, 17181, 313, 805, 15, 21, 2673, 273, 253, 5014, 4804, 253, 6866, 15, 831, 651, 2085, 10668, 342, 625, 16039, 327, 253, 8996, 273, 12264, 16744, 275, 436, 3072, 15, 844, 2879, 253, 2905, 20121, 275, 253, 13277, 13, 11279, 13, 285, 21561, 15, 187, 187, 3, 34, 9273, 3045, 273, 611, 23, 323, 12488, 247, 48168, 313, 74, 15, 70, 904, 27909, 9360, 285, 10397, 9360, 10, 369, 671, 6730, 15, 36040, 342, 48168, 497, 2931, 347, 1110, 665, 574, 5910, 390, 3687, 7363, 273, 253, 2264, 399, 7810, 1797, 13, 326, 369, 253, 1682, 2624, 14, 2727, 4868, 1119, 275, 247, 2045, 1263, 275, 15732, 905, 1706, 4207, 743, 2170, 762, 253, 6970, 313, 42080, 10, 273, 247, 11452, 24685, 6970, 313, 51, 3231, 10, 285, 253, 5325, 6, 330, 2513, 497, 5118, 21565, 841, 2219, 342, 48168, 327, 253, 25132, 273, 611, 23, 15, 743, 24571, 2624, 14, 2727, 4868, 369, 3413, 1754, 327, 253, 1682, 1422, 3354, 3605, 313, 66, 2020, 273, 7340, 285, 13005, 582, 285, 253, 7340, 13, 13005, 13, 285, 2762, 12177, 11878, 497, 5118, 342, 616, 2629, 6332, 905, 2031, 696, 449, 313, 6377, 854, 14, 26, 13, 13277, 10, 187, 187, 3, 19799, 253, 5014, 13, 3307, 2219, 497, 3636, 347, 1907, 48168, 313, 74, 15, 70, 904, 5910, 390, 3687, 7363, 273, 253, 2264, 399, 7810, 1797, 481, 380, 30728, 21565, 48168, 327, 611, 23, 4868, 369, 470, 15, 26, 746, 313, 2222, 6, 330, 2513, 13, 470, 15, 31013, 14, 17, 15, 26, 2759, 481, 380, 1682, 2624, 14, 2727, 4868, 323, 611, 23, 369, 3636, 347, 898, 24728, 342, 17181, 313, 805, 15, 21, 2673, 273, 253, 5014, 1907, 253, 7363, 4503, 281, 390, 3687, 685, 436, 2624, 14, 2727, 15, 380, 7340, 285, 13005, 497, 470, 15, 46014, 313, 2354, 13, 470, 15, 40991, 10, 285, 470, 15, 35432, 313, 2354, 13, 470, 15, 26045, 582, 2975, 13, 342, 253, 2762, 12177, 4313, 273, 721, 15, 4196, 313, 2354, 13, 470, 15, 15144, 33540, 313, 6377, 2145, 13, 11279, 10, 187, 187, 3, 510, 9273, 3045, 273, 611, 23, 4868, 21565, 48168, 2931, 407, 970, 399, 7810, 1797, 369, 1029, 27, 253, 30728, 369, 470, 15, 26, 746, 13, 342, 253, 7340, 273, 470, 15, 46014, 285, 253, 13005, 273, 470, 15, 35432, 323, 253, 1682, 2624, 745, 4868, 273, 898, 39801, 380, 4560, 310, 2074, 281, 581, 432, 247, 2045, 1263, 275, 4047, 326, 253, 15252, 360, 14, 6160, 12177, 4313, 3395, 2169, 30119, 883, 10, 323, 253, 2624, 745, 7363, 273, 898, 12, 327, 611, 23, 905, 2950, 4207, 1723, 13, 253, 9273, 3045, 285, 253, 1682, 2624, 745, 4868, 273, 253, 30907, 2715, 273, 253, 611, 23, 943, 320, 7515, 407, 10941, 952, 665, 452, 390, 452, 417, 644, 3786, 11245, 342, 6255, 9360, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 19, 15461, 380, 14755, 8813, 1677, 275, 3104, 14034, 428, 12652, 13, 12114, 22, 30, 455, 273, 253, 673, 10632, 61, 1051, 40878, 342, 253, 1491, 275, 253, 1563, 6197, 15, 7764, 1056, 352, 2590, 849, 253, 6128, 497, 11691, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 403, 1077, 7016, 326, 253, 5740, 369, 3430, 15, 844, 15045, 436, 347, 3637, 26530, 281, 253, 3236, 14755, 1332, 15, 187, 187, 31770, 21, 30, 3074, 273, 253, 673, 13, 495, 30, 10342, 273, 253, 673, 13, 374, 30, 6080, 273, 253, 673, 13, 337, 30, 34, 1652, 273, 253, 673, 13, 285, 470, 30, 11336, 273, 253, 673, 6844, 313, 6377, 608, 13, 13277, 1969, 3189, 16997, 10, 187, 187, 20, 15461, 31322, 15610, 428, 12842, 13, 253, 11572, 1263, 369, 2218, 275, 7783, 16675, 665, 671, 13640, 275, 253, 6774, 12820, 1263, 15, 831, 310, 417, 1332, 11220, 3451, 15, 9240, 7783, 16675, 4479, 2380, 812, 320, 5876, 407, 616, 2720, 2793, 342, 253, 15126, 15, 187, 187, 13045, 49, 1139, 2354, 27, 831, 310, 247, 3240, 1774, 1127, 285, 247, 1781, 12291, 273, 776, 1263, 15, 844, 2879, 247, 5740, 327, 436, 1895, 275, 253, 21561, 27, 187, 187, 3, 10971, 13, 7783, 16675, 665, 10974, 281, 247, 11572, 1263, 497, 671, 12470, 281, 253, 2022, 12820, 1263, 28, 954, 273, 731, 3164, 2686, 13640, 15, 4923, 253, 11572, 1263, 369, 17679, 13, 352, 369, 7479, 281, 2589, 271, 1783, 22914, 1110, 665, 13640, 275, 253, 767, 17276, 15, 1720, 31598, 17276, 452, 644, 2361, 281, 906, 275, 26513, 6128, 281, 10397, 5917, 273, 15102, 905, 2385, 5290, 534, 778, 2818, 253, 4560, 273, 253, 1246, 1263, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 21, 15461, 1310, 253, 4388, 310, 281, 897, 253, 611, 23, 275, 3114, 3530, 281, 3601, 323, 12264, 16744, 13, 253, 12820, 5196, 275, 1786, 12440, 310, 1679, 27096, 15, 30478, 265, 403, 625, 2779, 281, 320, 7615, 342, 3533, 2905, 281, 12264, 5917, 685, 253, 2087, 3072, 15, 187, 187, 13045, 49, 1139, 2354, 27, 844, 8558, 11205, 281, 17813, 253, 611, 23, 4311, 281, 3601, 12264, 16744, 2190, 16675, 275, 15732, 15, 1723, 13, 352, 943, 320, 4879, 326, 253, 12820, 273, 253, 1655, 30907, 2715, 273, 611, 23, 878, 281, 320, 2218, 275, 643, 28155, 2390, 390, 253, 3114, 3072, 604, 253, 4311, 310, 281, 320, 3732, 281, 841, 2390, 16, 43221, 15, 844, 11848, 776, 12291, 5740, 281, 1056, 436, 2590, 281, 10668, 15, 187, 187, 3, 6407, 13, 359, 11205, 281, 17813, 253, 611, 23, 4311, 281, 3601, 12264, 16744, 2190, 16675, 13, 247, 2714, 28155, 1387, 762, 1029, 4073, 13, 275, 15732, 15, 30478, 265, 403, 3798, 625, 19149, 685, 2087, 5820, 13, 285, 671, 7615, 342, 3533, 273, 12264, 5917, 2908, 275, 611, 23, 15, 380, 1246, 4342, 778, 417, 320, 14923, 281, 253, 2087, 3072, 390, 2444, 3072, 275, 15732, 15, 380, 13367, 285, 13091, 273, 253, 1246, 4311, 943, 320, 2007, 5762, 275, 841, 7625, 449, 313, 6377, 1283, 13, 21561, 10, 187, 187, 5146, 2490, 187, 42520, 19722, 27, 1847, 375, 4041, 14, 9604, 281, 8439, 398, 15, 7152, 89, 187, 187, 5146, 2490, 187, 7146, 1060, 323, 3081, 941, 1873, 15, 187, 187, 740, 15, 26088, 16, 19317, 15, 2041, 15, 13269, 2405, 746, 15, 83, 4838, 187, 187, 9150, 1297, 23488, 337, 187, 187, 37675, 187, 187, 56, 257, 14, 29627, 187, 187, 42228, 280, 17234, 187, 187, 17737, 9169, 41852, 14, 29627, 19223, 187, 187, 14952, 187, 187, 56, 257, 14, 29627, 19223, 187, 187, 1552, 310, 271, 1527, 2289, 3929, 5939, 762, 253, 2426, 273, 253, 187, 187, 21164, 422, 22695, 5706, 2382, 4637, 187, 187, 13, 534, 16000, 48566, 897, 13, 3268, 13, 285, 21068, 275, 667, 4646, 13, 2530, 253, 3236, 2488, 285, 2603, 403, 26873, 15, 187, 187, 23, 22551, 9169, 187, 187, 49, 11147, 14, 37, 14, 746, 14, 1706, 18390, 51, 18, 187, 187, 19996, 15274, 13367, 13, 3989, 13091, 13, 285, 5382, 2380, 5319, 273, 253, 611, 405, 2146, 721, 4311, 2190, 4675, 16675, 275, 15732, 187, 187, 3859, 2697, 21252, 187, 187, 24723, 3196, 15, 36288, 518, 7588, 13, 187, 187, 8398, 368, 323, 29315, 634, 7714, 281, 11188, 2697, 21252, 15, 2732, 10182, 8180, 13, 359, 1928, 326, 352, 556, 15785, 533, 1057, 417, 4751, 2525, 11188, 2697, 21252, 434, 9311, 6866, 347, 352, 4390, 9572, 15, 3813, 13, 359, 19864, 368, 281, 11929, 247, 17265, 2715, 273, 253, 7714, 326, 12453, 253, 2792, 5439, 1309, 253, 2278, 1232, 15, 187, 187, 41972, 187, 187, 688, 1340, 281, 2085, 247, 625, 3426, 1491, 281, 776, 10668, 327, 253, 9400, 13, 359, 651, 751, 281, 22175, 253, 6349, 281, 2831, 44978, 1077, 3332, 2144, 327, 253, 1072, 9400, 3863, 275, 12114, 3859, 37791, 21252, 393, 3446, 3813, 13, 352, 651, 320, 4122, 14109, 604, 368, 651, 2451, 253, 9410, 3863, 275, 253, 1390, 767, 1107, 273, 12114, 3859, 37791, 21252, 10632, 16616, 3614, 1358, 34859, 15, 446, 375, 15, 2061, 16, 446, 375, 531, 4357, 10, 285, 823, 512, 2144, 4623, 281, 634, 3929, 281, 253, 3806, 1618, 15, 187, 187, 41972, 187, 187, 1231, 651, 11435, 6883, 634, 17265, 7714, 407, 2552, 3127, 9169, 1903, 27, 3046, 9122, 15, 2091, 368, 403, 4704, 281, 11929, 634, 18520, 13, 2412, 327, 281, 654, 3614, 1358, 2700, 15, 20511, 451, 20649, 15, 681, 16, 2041, 4357, 285, 3609, 253, 29792, 5623, 8331, 3532, 7022, 3555, 1297, 4479, 11534, 281, 19912, 634, 7714, 1873, 15, 187, 187, 2042, 368, 651, 751, 281, 1056, 2544, 281, 634, 4832, 13911, 13, 4496, 2486, 634, 9300, 3908, 275, 634, 3835, 4857, 15, 187, 187, 1992, 7278, 253, 38041, 273, 634, 1543, 13, 359, 5583, 326, 604, 7763, 368, 18831, 634, 9965, 14238, 275, 14238, 15, 900, 13, 835, 247, 7241, 476, 320, 7922, 697, 1211, 21674, 313, 13220, 42, 10, 824, 326, 352, 476, 320, 11106, 10939, 275, 253, 2852, 15, 1198, 7997, 923, 27, 654, 2413, 1358, 34859, 15, 446, 375, 15, 2061, 16, 446, 375, 531, 16, 84, 16, 2377, 2230, 14, 4297, 7686, 4, 9450, 14, 77, 2735, 2473, 14, 10075, 12862, 31, 187, 187, 7845, 2486, 253, 1563, 4957, 672, 29315, 634, 17265, 7714, 27, 187, 187, 34, 30080, 22559, 4857, 326, 27019, 281, 1016, 1127, 5439, 407, 253, 11073, 8121, 285, 37317, 9, 84, 481, 831, 4857, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 9604, 281, 8439, 398, 4479, 15, 34, 7101, 14, 484, 3491, 273, 634, 7714, 326, 16681, 2544, 1160, 281, 253, 3236, 2715, 15, 831, 1873, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 7498, 1701, 3083, 7468, 342, 31633, 25773, 4479, 15, 1145, 440, 30644, 2715, 273, 634, 17265, 2929, 1293, 27173, 2544, 15, 831, 1873, 943, 320, 28228, 347, 4858, 1873, 285, 13130, 29792, 4779, 7468, 4479, 15, 187, 187, 7845, 3877, 1223, 9046, 634, 2380, 13, 604, 634, 3929, 310, 7607, 13, 368, 778, 452, 253, 5107, 281, 1056, 253, 14218, 2278, 2892, 13644, 2130, 15, 380, 1924, 588, 2486, 8121, 3061, 4876, 313, 3113, 10123, 10, 285, 634, 6128, 281, 37317, 5701, 15, 1310, 13410, 13, 359, 588, 3057, 368, 281, 1478, 275, 390, 562, 15, 187, 187, 1231, 1007, 3579, 281, 6883, 634, 17265, 7714, 15, 187, 187, 18808, 17730, 13, 187, 187, 56, 257, 14, 29627, 19223, 187, 187, 42228, 280, 17234, 187, 187, 3859, 2697, 21252, 187, 187, 1447, 8497, 27, 11685, 44236, 310, 2708, 15, 7764, 513, 417, 12921, 15, 696, 187, 187, 18658, 398, 4479, 5701, 27, 187, 187, 49312, 4479, 84, 26231, 265, 281, 30254, 187, 187, 424, 25821, 281, 253, 10360, 424, 187, 187, 18, 15461, 1310, 253, 4477, 452, 18212, 9713, 634, 5701, 5439, 275, 247, 2045, 3790, 273, 2278, 285, 368, 1928, 326, 436, 7714, 310, 1024, 12207, 323, 9311, 13, 368, 778, 5224, 326, 1060, 281, 18210, 253, 346, 25821, 281, 253, 10360, 3, 2593, 13, 4901, 634, 7344, 273, 1600, 3908, 275, 253, 346, 14044, 9440, 281, 17234, 3, 2593, 13, 285, 11929, 634, 12114, 29011, 10632, 17401, 15, 187, 187, 49312, 13181, 18, 27, 1876, 5701, 452, 644, 9713, 187, 187, 8730, 8730, 8730, 8730, 8730, 187, 187, 19, 15461, 1680, 253, 7714, 22335, 3590, 13, 285, 513, 253, 941, 1329, 253, 11815, 32, 187, 187, 510, 7714, 1364, 6266, 247, 22335, 3590, 5313, 273, 8249, 2561, 342, 941, 326, 8525, 253, 11815, 15, 38166, 1364, 452, 644, 5196, 8132, 29689, 13, 342, 4569, 5760, 13, 14970, 13, 285, 3410, 9552, 15, 380, 11815, 1364, 320, 8392, 20420, 1754, 327, 253, 941, 3559, 15, 187, 187, 49312, 13181, 18 ]
the detection of psychological distress. This cut-off will essentially underestimate the magnitude of mental health conditions in the population. RESPONSE: We agree that using the cut off score of 13+ proposed by Kessler et al., 2003 may underestimate psychological distress. We deleted the presentation of the proportions of respondents with K6 score of 13+ from Table 2, and related descriptions from the Method and Discussion. Instead, we add an additional analysis of screening performance of K6 predicting cases with common mental disorders defined by the cut-off scores of DASS21. The calculated best cut-off score of K6 was 9+, with 129 (12.4%) of the participants meeting the criteria. This would provide readers with more insights on the prevalence of psychological distress in this population. We added the related descriptions in the Methods, Results, and Discussion. "A screening performance of K6 for identifying a CMD (i.e., depressive disorders and anxiety disorders) was also examined. Cases with CMD were defined as those who had 34 or greater scores of the total DASS21, that was the best cut-off score found in a previous study in Vietnam \[34\]. An area under the curve (AUC) of a receiver operative curve (ROC) and the 95% CIs were calculated predicting these cases with CMD on the sore of K6. An optimum cut-off score was determined based on the best Youden index (a sum of sensitivity and specificity), and the sensitivity, specificity, and positive likelihood ratios were calculated with their standard errors \[44\]." (page 8-9, Methods) "Among the participants, 22 cases were identified as having CMD (i.e., 34 or greater scores of the total DASS21). The AUC predicting CMD on K6 score was 0.919 (95% CIs, 0.855-0.984). The best cut-off score for K6 was identified as 9+, with 129 (12.4%) of the participants having the scores equal to or greater than this cut-off. The sensitivity and specificity were 0.864 (SE, 0.073) and 0.876 (SE, 0.031), respectively, with the positive likelihood ratio of 6.96 (SE, 0.121)." (page 13, Results) "The screening performance of K6 score predicting CMD defined by using DASS21 was high: the AUC was 0.919, with the sensitivity of 0.864 and the specificity of 0.876 for the best cut off score of 9+. The finding is similar to one from a previous study in Japan that the stratum-specific likelihood ratio became higher (\>11) for the cut off scores of 9+ on K6 \[46\]. However, the screening performance and the best cut off score of the Vietnamese version of the K6 should be assessed by comparing people who have or have not been previously diagnosed with mental disorders." (page 18, Discussion) 2\. The scoring explanation given in lines 107 - 109, \"5=all of the time\"\... contradicts with the information in the following sentence. Please make it clear how the responses were scored. RESPONSE: We are very sorry that the description was wrong. We corrected this as follows sticking to the original scoring method. "(4=All of the time, 3=Most of the time, 2=Some of the time, 1=A little of the time, and 0=None of the time)" (page 5, Methods -- Measures) 3\. Lines 127 - 128, the pilot study was done in 150 nurses who also participated in the subsequent validation study. This is not methodologically correct. Those 150 nurses\' response could be affected by their prior experience with the questionnaire. RESPONSE: This is a quite important point and a large limitation of our study. We added a description on this problem in the Discussion: "Finally, 150 nurses who responded to a pilot study were also invited to the main validation study; most of them probably actually participated. Because the pilot study was anonymous, it was impossible to conduct an analysis excluding those who participated in the two surveys. Repeated surveys have been reported to result in attenuated responses to anxiety symptoms of respondents \[48\], which may affect the finding of the present study." (page 18, Discussion) 4\. If the aim is to use the K6 in community samples to screen for psychological distress, the validation conducted in health professionals is less informative. Nurses are more likely to be familiar with questions related to psychological symptoms than the general population. RESPONSE: We primarily aimed to validate the K6 scale to screen psychological distress among nurses in Vietnam. However, it should be noted that the validation of the current Vietnamese version of K6 need to be done in other occupational groups or the community population if the scale is to be applied to these groups/populations. We expanded our limitation description to make this clear to readers. "First, we aimed to validate the K6 scale to screen psychological distress among nurses, a special occupational group under high stress, in Vietnam. Nurses are usually more educated than general workers, and also familiar with questions of psychological symptoms included in K6. The present findings may not be generalized to the general population or working population in Vietnam. The reliability and validity of the present scale should be further tested in these populations." (page 18, Discussion) ###### Submitted filename: PlosOne-Response to Reviewers.docx ###### Click here for additional data file. 10.1371/journal.pone.0233119.r003 Decision Letter 1 Tu Wen-Jun Academic Editor © 2020 Wen-Jun Tu 2020 Wen-Jun Tu This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 6 Apr 2020 PONE-D-19-34231R1 Internal consistency reliability, construct validity, and item response characteristics of the Kessler 6 scale among hospital nurses in Vietnam PLOS ONE Dear Dr. Kawakami, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE's publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. ============================== In order to provide a more complete information to our readers on the topic, we would like to emphasize the importance to cross referencing very recent material on the same topic published in \"PLoS ONE \". Therefore, it would be highly appreciated if you would check the contents published in the last two years of \"PLoS ONE\" (<https://journals.plos.org/plosone/>) and add all material relevant to your article to the reference list. ============================== We would appreciate receiving your revised manuscript by May 21 2020 11:59PM. When you are ready to submit your revision, log on to <https://www.editorialmanager.com/pone/> and select the \'Submissions Needing Revision\' folder to locate your manuscript file. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. For instructions see: <http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols> Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). This letter should be uploaded as separate file and labeled \'Response to Reviewers\'.A marked-up copy of your manuscript that highlights changes made to the original version. This file should be uploaded as separate file and labeled \'Revised Manuscript with Track Changes\'.An unmarked version of your revised paper without tracked changes. This file should be uploaded as separate file and labeled \'Manuscript\'. Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. We look forward to receiving your revised manuscript. Kind regards, Wen-Jun Tu Academic Editor PLOS ONE \[Note: HTML markup is below. Please do not edit.\] Reviewers\' comments: Reviewer\'s Responses to Questions **Comments to the Author** 1\. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the "Comments to the Author" section, enter your conflict of interest statement in the "Confidential to Editor" section, and submit your \"Accept\" recommendation. Reviewer \#1: All comments have been addressed \*\*\*\*\*\*\*\*\*\* 2\. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer \#1
[ 313, 39402, 8435, 305, 129, 244, 84, 135, 219, 85, 1392, 87, 391, 39353, 135, 219, 1200, 2381, 392, 10, 544, 2364, 1092, 1668, 3712, 1253, 1166, 1423, 13, 19688, 1673, 278, 19032, 15, 2596, 273, 253, 490, 46701, 7027, 10284, 1103, 273, 8444, 47990, 275, 253, 11442, 3660, 13, 344, 4546, 271, 1774, 629, 275, 253, 19701, 4544, 273, 1722, 520, 1253, 20, 285, 16473, 313, 1166, 3071, 10, 253, 5678, 7247, 13, 19701, 13, 285, 32008, 251, 5621, 387, 22864, 461, 324, 85, 13, 13710, 273, 367, 6002, 11943, 15, 754, 11704, 8444, 327, 521, 27485, 4544, 15, 2091, 8444, 369, 22988, 317, 15281, 407, 247, 10785, 816, 1078, 253, 6680, 273, 3130, 85, 2623, 313, 1166, 2693, 582, 344, 11162, 1720, 73, 2224, 5985, 2381, 392, 17747, 275, 7015, 15, 380, 6680, 369, 37359, 323, 253, 29281, 314, 562, 48085, 11042, 265, 28, 1720, 73, 2224, 5985, 2381, 392, 2994, 369, 10848, 407, 253, 24794, 15, 50, 27, 187, 187, 27363, 660, 18225, 4803, 275, 20494, 323, 17417, 187, 187, 1552, 310, 247, 2127, 281, 3653, 604, 253, 3904, 275, 253, 1618, 403, 4335, 390, 417, 313, 16659, 19, 2262, 187, 2520, 2987, 313, 18, 2262, 187, 50274, 45, 426, 544, 21, 1157, 898, 13, 2145, 13, 1458, 13, 1668, 62, 535, 50274, 1545, 2248, 257, 2764, 21, 14850, 187, 50270, 1542, 891, 275, 418, 27, 187, 50266, 681, 993, 26217, 2764, 426, 16708, 187, 50266, 1542, 1269, 275, 2491, 9, 19, 13, 74, 2262, 187, 50262, 338, 891, 6, 89, 2295, 470, 27, 187, 50258, 681, 993, 26217, 2764, 426, 11793, 50264, 187, 50258, 7054, 187, 50266, 338, 21515, 26217, 2764, 27, 187, 50262, 3845, 17280, 84, 310, 417, 247, 4335, 1180, 3, 2462, 891, 50270, 187, 50266, 7271, 27, 50275, 187, 50262, 3845, 17280, 84, 4110, 247, 4335, 1180, 3, 2462, 891, 535, 50274, 13374, 257, 2764, 21, 1082, 187, 187, 1989, 436, 1057, 417, 313, 19, 2262, 187, 50274, 45, 426, 544, 21, 1157, 898, 13, 2145, 13, 1458, 13, 1668, 62, 535, 50274, 1545, 2248, 257, 2764, 21, 14850, 187, 50270, 681, 993, 26217, 2764, 426, 16708, 187, 50270, 1542, 891, 275, 418, 27, 187, 50266, 1542, 1269, 275, 2491, 9, 19, 13, 74, 2262, 187, 50263, 338, 891, 6, 89, 2295, 470, 27, 187, 50259, 681, 993, 26217, 2764, 426, 11793, 50263, 187, 50259, 7054, 187, 50266, 338, 21515, 26217, 2764, 27, 187, 50262, 3845, 17280, 84, 310, 417, 247, 4335, 1180, 3, 2462, 891, 50270, 187, 50266, 7271, 27, 50275, 187, 50262, 3845, 17280, 84, 4110, 247, 4335, 1180, 3, 2462, 891, 535, 50274, 13374, 257, 2764, 21, 1082, 187, 187, 262, 4245, 253, 1180, 2145, 347, 417, 247, 4335, 15, 187, 1989, 2139, 32, 187, 35861, 281, 436, 29134, 27, 187, 17624, 11451, 273, 253, 1810, 18225, 16228, 32, 187, 3, 4041, 273, 253, 3687, 37700, 281, 1142, 38782, 398, 281, 13814, 310, 326, 247, 323, 6287, 1057, 417, 2794, 247, 4778, 7990, 3, 275, 743, 26760, 10664, 522, 7080, 434, 3662, 187, 601, 309, 8564, 253, 1318, 346, 282, 8765, 3, 715, 253, 1159, 7990, 27, 187, 4609, 310, 253, 1083, 342, 247, 2014, 323, 6287, 187, 11667, 27, 187, 50274, 1545, 1159, 14850, 187, 50270, 74, 426, 898, 187, 50270, 76, 426, 16708, 187, 50270, 1542, 1269, 275, 2491, 9, 19, 13, 898, 2262, 187, 50266, 338, 891, 6, 89, 2295, 470, 27, 187, 50262, 76, 426, 11793, 50262, 187, 50262, 7054, 535, 50270, 3845, 465, 187, 187, 4609, 22774, 465, 426, 11793, 594, 253, 4778, 4391, 187, 2598, 619, 1953, 310, 27, 6049, 2506, 626, 253, 4778, 346, 681, 993, 26217, 2764, 3, 1818, 275, 313, 19, 6177, 187, 2042, 247, 323, 6287, 2506, 626, 452, 7990, 2139, 3548, 626, 253, 4778, 247, 1980, 4778, 275, 253, 1159, 32, 2139, 2506, 626, 352, 346, 282, 518, 949, 7019, 8136, 1097, 323, 17417, 3, 285, 12365, 598, 347, 247, 1980, 4778, 275, 253, 1159, 809, 15, 187, 42, 1353, 2820, 281, 2096, 253, 15548, 7990, 4803, 984, 309, 1053, 626, 1158, 309, 755, 352, 4336, 15, 9375, 275, 7170, 2, 187, 187, 34, 27, 187, 187, 1552, 310, 417, 247, 7990, 2523, 15, 380, 2523, 310, 326, 672, 368, 9212, 2248, 257, 2764, 426, 16708, 3304, 253, 323, 6287, 13, 326, 12714, 6569, 1046, 673, 368, 564, 949, 253, 6287, 15, 733, 501, 1507, 253, 1318, 281, 16708, 1046, 673, 15, 187, 3039, 368, 9212, 2248, 257, 2764, 426, 16708, 1840, 253, 6287, 13, 352, 760, 4850, 7922, 326, 1039, 2378, 13, 594, 2248, 257, 2764, 4558, 11793, 846, 253, 806, 673, 352, 434, 873, 281, 11793, 15, 187, 9917, 13, 2248, 257, 2764, 310, 247, 11527, 1416, 323, 247, 4778, 326, 6492, 1880, 247, 1180, 310, 8212, 15, 535, 4, 5642, 14375, 3887, 11840, 4888, 187, 817, 337, 15, 20, 15, 22, 4888, 187, 14, 32134, 11097, 2634, 21605, 14, 12919, 38416, 30159, 33904, 14440, 362, 19, 22862, 2523, 4888, 187, 817, 337, 15, 20, 15, 21, 4888, 187, 14, 32157, 2634, 21605, 14, 12919, 65, 1159, 281, 5416, 326, 1232, 310, 6331, 275, 9630, 1039, 4888, 187, 817, 337, 15, 20, 15, 20, 4888, 187, 14, 32134, 11097, 2634, 3633, 14, 2946, 27383, 11930, 38416, 4993, 1854, 310, 9617, 4888, 187, 817, 337, 15, 20, 15, 19, 4888, 187, 14, 32134, 11097, 2634, 3633, 14, 2946, 27383, 11930, 38416, 1024, 12255, 604, 1854, 310, 9617, 4888, 187, 817, 337, 15, 20, 15, 18, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2946, 27383, 11930, 38416, 6235, 3149, 4465, 2634, 5, 12428, 65, 4764, 432, 43531, 14, 5455, 672, 29072, 253, 23595, 914, 12543, 2776, 15, 4888, 187, 817, 337, 15, 20, 15, 17, 4888, 187, 14, 2634, 3633, 14, 15131, 422, 23074, 38416, 5057, 253, 1655, 17335, 970, 2067, 3082, 4888, 187, 817, 337, 15, 19, 15, 17, 4888, 187, 14, 7890, 2634, 5, 25424, 2149, 39988, 65, 275, 512, 3470, 281, 1581, 323, 2852, 7466, 285, 6821, 255, 1076, 2470, 4, 23, 1797, 880, 3614, 1358, 7280, 15, 681, 16, 348, 12049, 90, 16, 348, 12049, 90, 14, 6443, 442, 1301, 471, 1131, 16, 22402, 16, 23, 1797, 1228, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 65, 29072, 273, 11865, 4508, 9484, 47647, 15, 4888, 187, 817, 337, 15, 18, 15, 17, 190, 187, 14, 2634, 3633, 14, 31130, 39780, 47953, 38416, 5057, 253, 1735, 30732, 4446, 4857, 4888, 187, 817, 337, 15, 17, 15, 24, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 12201, 476, 1024, 452, 3904, 275, 616, 4454, 13, 5727, 1078, 13, 3253, 2469, 253, 1180, 651, 320, 28069, 285, 253, 7908, 651, 1614, 715, 247, 12419, 15, 4888, 187, 817, 337, 15, 17, 15, 23, 190, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2946, 27383, 11930, 38416, 33904, 14440, 374, 476, 417, 8171, 327, 3635, 1318, 15, 4888, 187, 817, 337, 15, 17, 15, 22, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 2447, 12543, 36169, 4814, 38416, 33904, 14440, 374, 22862, 15, 190, 187, 14, 322, 46711, 5520, 10097, 273, 2634, 3633, 14, 2447, 12543, 36169, 4814, 16433, 4888, 187, 817, 337, 15, 17, 15, 21, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 33904, 14440, 374, 7505, 42182, 2470, 4, 40760, 880, 3614, 1358, 7280, 15, 681, 16, 348, 12049, 90, 16, 348, 12049, 90, 14, 6443, 442, 1301, 471, 1131, 16, 22402, 16, 40760, 5029, 4888, 187, 817, 337, 15, 17, 15, 20, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 2228, 672, 29072, 273, 1854, 15, 4888, 187, 817, 337, 15, 17, 15, 19, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 8916, 27589, 374, 22862, 15, 4888, 187, 817, 337, 15, 17, 15, 18, 4888, 187, 14, 32134, 11097, 275, 2634, 3633, 14, 22113, 17986, 38416, 440, 8952, 833, 2634, 3433, 84, 65, 281, 789, 327, 8916, 27589, 374, 15, 4888, 187, 817, 337, 15, 17, 4888, 187, 14, 353, 1326, 264, 2634, 2188, 14, 348, 16856, 15, 24210, 16433, 190, 187, 14, 353, 1326, 264, 2634, 348, 12049, 90, 14, 328, 12543, 15, 24210, 16433, 190, 187, 14, 32157, 2634, 3633, 14, 22113, 15554, 11930, 65, 190, 187, 14, 32157, 2634, 2775, 14375, 3887, 11840, 15, 6535, 65, 285, 2634, 13587, 5288, 15, 6535, 16433, 190, 187, 14, 7567, 514, 4263, 285, 625, 10097, 15, 4888, 187, 817, 470, 15, 18, 15, 20, 4888, 187, 14, 2634, 3633, 14, 9770, 8590, 38416, 50276, 20865, 1873, 342, 448, 16856, 4184, 932, 15, 2379, 34, 1048, 2312, 670, 9542, 10450, 187, 688, 34929, 6590, 13, 347, 275, 34929, 1495, 13, 627, 403, 247, 2257, 273, 10450, 281, 320, 5469, 15, 380, 9013, 32099, 310, 247, 8574, 8979, 313, 1439, 347, 11216, 347, 247, 2534, 10, 533, 253, 3676, 285, 14282, 84, 476, 671, 1379, 1659, 275, 253, 8158, 13, 327, 1048, 16771, 390, 327, 253, 30929, 1108, 347, 1060, 13, 342, 743, 3024, 442, 378, 2980, 285, 28798, 570, 13856, 275, 380, 29219, 6272, 1876, 10154, 187, 187, 510, 268, 3134, 2940, 275, 247, 3644, 9741, 187, 22737, 2389, 3753, 13, 3782, 21327, 13, 285, 3782, 21327, 275, 534, 597, 476, 2940, 16821, 285, 2312, 670, 616, 10450, 13, 390, 5046, 20016, 247, 25415, 10135, 275, 247, 10617, 90, 30084, 1123, 313, 1439, 247, 43398, 3296, 1204, 10, 428, 751, 436, 581, 275, 2752, 14538, 273, 10540, 187, 187, 510, 1048, 13, 12939, 555, 8158, 323, 767, 187, 688, 253, 5086, 11730, 6440, 13, 368, 452, 253, 1048, 16846, 6200, 15, 1310, 627, 310, 47284, 3058, 275, 253, 34929, 6440, 13, 840, 1902, 247, 6200, 275, 534, 767, 2255, 755, 715, 253, 8158, 13, 28990, 1066, 285, 2312, 670, 616, 10450, 428, 751, 12694, 11276, 285, 353, 571, 401, 2501, 275, 7743, 16357, 2013, 2421, 187, 187, 510, 17046, 17603, 10831, 187, 42297, 13, 368, 476, 13398, 5534, 1373, 285, 1824, 407, 458, 15609, 16505, 13102, 715, 271, 1527, 14, 1094, 6363, 285, 6821, 3834, 1475, 247, 2372, 15, 24504, 2071, 2084, 285, 427, 506, 267, 466, 5687, 858, 352, 14665, 1312, 3740, 275, 2752, 14538, 273, 10540, 28, 3532, 306, 20163, 285, 7682, 885, 35122, 858, 352, 1327, 14, 5401, 1312, 3740, 275, 13303, 19348, 187, 187, 510, 26183, 13, 1029, 14, 31503, 2471, 187, 3650, 512, 11730, 6590, 990, 275, 253, 3226, 2970, 253, 3226, 387, 690, 10864, 16879, 5197, 31493, 40847, 313, 68, 23520, 13, 21327, 13, 45731, 13, 17120, 481, 13168, 1146, 11730, 310, 1892, 13, 285, 627, 403, 513, 4182, 13, 1053, 457, 85, 14, 13060, 14, 251, 14, 66, 14, 27180, 6590, 281, 4887, 436, 13, 824, 347, 22707, 775, 311, 26063, 7381, 457, 84, 4855, 3975, 187, 187, 24788, 1417, 9239, 8577, 281, 440, 1987, 404, 494, 32225, 187, 2290, 1225, 6443, 10610, 10684, 23660, 84, 310, 253, 8198, 485, 273, 436, 6727, 365, 13, 275, 534, 767, 1481, 9072, 1937, 375, 3254, 313, 35293, 407, 443, 1758, 443, 398, 25224, 285, 12694, 6193, 76, 2205, 10, 27753, 326, 616, 22500, 2343, 31816, 273, 581, 1529, 310, 2686, 247, 2914, 323, 2266, 11730, 10450, 187, 187, 32478, 3354, 14, 37716, 39880, 187, 1552, 973, 14, 88, 1575, 7484, 2813, 8687, 247, 3786, 45692, 3416, 1907, 247, 10084, 28423, 326, 703, 310, 17755, 281, 253, 11730, 14, 282, 18197, 1959, 5968, 665, 556, 8423, 5966, 617, 1495, 15, 733, 434, 6571, 3710, 281, 253, 6945, 10102, 681, 342, 40659, 4404, 572, 11131, 428, 751, 33717, 272, 29489, 23202, 187, 187, 34, 2210, 80, 407, 775, 4213, 10093, 1023, 87, 525, 90, 16, 10314, 468, 3545, 40826, 16, 13378, 66, 8502, 55, 455, 187, 2042, 667, 273, 253, 1840, 2255, 310, 275, 253, 5248, 13, 627, 310, 2779, 281, 320, 690, 2312, 670, 10450, 15, 2732, 27014, 5037, 457, 85, 34712, 13, 775, 4213, 10093, 1023, 87, 525, 90, 1213, 1911, 1070, 247, 5694, 67, 2804, 275, 1310, 2053, 8799, 84, 16574, 25664, 374, 28, 285, 275, 5091, 84, 11332, 14165, 3085, 380, 32016, 13, 8148, 66, 8502, 55, 455, 1014, 7120, 247, 1894, 34452, 281, 320, 247, 34929, 187, 187, 34, 557, 29340, 314, 40308, 16, 1221, 287, 35846, 187, 44, 739, 272, 29489, 23202, 2427, 323, 253, 9002, 90, 14272, 24455, 1928, 15, 1997, 20787 ]
(kärl gŭsˈtäv rānˈshöld) [key], 1651–1722, Swedish field marshal. One of the ablest lieutenants of Charles XII in the Northern War, he played an important part in the Polish campaign of 1701–3 and defeated (1706) the combined Russian, Polish, and Saxon forces at Fraustadt, SW of Poznan. He accompanied Charles on his Ukrainian campaign. When Charles was incapacitated by a wound just before the battle of Poltava (1709), he appointed Rehnskiöld commander in chief. The battle was disastrous for the hopelessly outnumbered Swedes; Rehnskiöld himself was captured by the Russians.Q: Python scoping rules in nested for loops This is a code to determine if the numbers in the list are prime or not (python2): this works (1): L = [4 , 9, 13, 15, 16] def primenumber4(): for i in L: compositenumber = False for x in range(2,i): if i%x == 0: compositenumber = True break if compositenumber: print "%s is not a prime number" % i else: print "%s IS a prime number" % i primenumber4() But this does not (2): L = [4 , 9, 13, 15, 16] def primenumber4(): compositenumber = False for i in L: for x in range(2,i): if i%x == 0: compositenumber = True break if compositenumber: print "%s is not a prime number" % i else: print "%s IS a prime number" % i primenumber4() it gives the number 13 as not a prime. But why? according to this tread: Short Description of the Scoping Rules? "One of the greater surprises to many newcomers to Python is that a for loop does not create a variable scope" in Antti Haapala's answer so I imagine the value "leaks" into the function scope: which is the case with a single for loop example: def function(): i = 9 k = False for x in range(2, 9): if i%x == 0: k = True break print k which prints k = True so the variable changed So my question is: Why doesn't the variable "compositenumber" change in (2)? If a for loop doesn't have scope why isn't the variable a local variable in the function? why doesn't it "leak through twice passing both for loops" and ending up as a local variable in the function def. I'm trying to understand the python scope rules because I don't think I get it completely. Thanks in advance! A: This is not a scope issue. The issue is that when you assign primenumber = False inside the for loop, that assignment happens every time you go through the loop. It resets the value to False every time. When you assign primenumber = False above the loop, it only gets assigned that way once, so primenumber remains True after the first time it's set to True. Also, primenumber is a terrible name for a variable that indicates whether a number is composite. # CHANGELOG ## 1.3.5 - Bugfix `Remove-Process`: Fixed Powershell v2 compatibility issue ## 1.3.4 - Added `Remove-Process` function to ensure that process is stopped in reliable way ## 1.3.3 - Bugfix `Get-AppInstallLocation`: fix path is directory ## 1.3.2 - Bugfix `Get-AppInstallLocation`: now checks if path is directory ## 1.3.1 - Bugfix in `Get-AppInstallLocation`: Removed extra `$location` parameter from Split-Path when parsing the registry UninstallString. ## 1.3.0 - `Get-EffectiveProxy`: Get the current proxy using several methods ## 1.2.0 - Use `$IgnoredArguments` in all functions to allow for future expansion and splatting ([#621](https://github.com/chocolatey/chocolatey-coreteampackages/issues/621)) - Bugfix in `Get-PackageParameters` parsing of paths containing symbol chars. ## 1.1.0 - `Get-AvailableDriveLetter`: Get the next unused drive letter ## 1.0.7 - Bugfix in `Get-PackageParameters`: flags can now have numbers in their names, whereas before, everything past the number would be truncated and the flag would turn into a boolean. ## 1.0.6 - Bugfix in `Get-AppInstallLocation`: Powershell 2 can not replace on null value. ## 1.0.5 - Bugfix in `Get-UninstallRegistryKey`: Powershell 2 compatibility. - Slightly improved documentation of `Get-UninstallRegistryKey`. ## 1.0.4 - Bugfix in `Get-PackageParameters`: Powershell 2 bug workaround ([#465](https://github.com/chocolatey/chocolatey-coreteampackages/issues/465)). ## 1.0.3 - Bugfix in `Get-PackageParameters`: error when parsing of path. ## 1.0.2 - Bugfix in `Get-PackageParameters`: PowerShell 2 compatibility. ## 1.0.1 - Bugfix in `Get-PackageParameters`: unaliased `sls` to work on PowerShell 2. ## 1.0 - Merged `mm-choco.extension`. - Merged `chocolatey-uninstall.extension`. - Added `Get-PackageCacheLocation` - Added `CHANGELOG.md` and `README.md`. - Refactoring and more documentation. ## 0.1.3 - `Get-WebContent`: Download file with choco internals. A long talk about complicated feelings In lesbian films, as in lesbian life, there are a lot of feelings to be discussed. The preferred locale is a coffee shop (not as loud as a bar) but the deep and meaningfuls can also take place in the bath, on long walks or on the sofa – as here, with Annette Bening and Julianne Moore in The Kids Are All Right The pensive walk in a dark forest Women love nature, particularly forests, and particularly forests in which they can walk dramatically and talk about their feelings, or maybe steal a forbidden kiss in a leafy enclave (not a euphemism) - like this one in My Summer of Love The long, chatty bath for two In the male gay movie, you have the long shower scene. If there is exposition needed in the lesbian movie, then expect a scene in which two women get into the bath, scrub down and talk about their feelings - like Elizabeth Taylor and Mia Farrow in Secret Ceremony The spontaneous outdoor swim Alternatively, you can combine woodland and water by leaping recklessly into an open-air pool and splashing around a bit. Emily Blunt and Nathalie Press did it arthouse style in My Summer of Love; Neve Campbell and Denise Richards did it non-arthouse style in Wild Things The tragic, high-concept death Not all gay films end in the girl getting the girl at some giant fantasy Center Parks cafe (coffee, forests, baths, swimming). Sometimes being gay is hard, and there are doomy, don’t-watch-on-a-Sunday films to reflect this, such as Lisa Cholodenko’s High Art Bottomless hate turning to uncontainable lust Trashcore classic Showgirls is the epitome of this trope, in which two headstrong opposites (played by Gina Gershon and Elizabeth Berkley) realise that their passionate loathing of one another is actually a front for strong gay feelings Sudden-onset homosexuality This well-worn plot device involves a previously heterosexual woman having a surprising revelation that she is attracted to the gay-leaning free spirit who has suddenly entered her life. It's mostly limited to the alt romcom with aspirations towards quirk - like Kissing Jessica Stein A cameo by Chloë Sevigny/Piper Perabo/Clea DuVall If any of the above women is in the cast, there is likely to be some talk about feelings. After Boys Don’t Cry, Chloë Sevigny straddled a motorbike in If These Walls Could Talk 2; and in 90s teen alien film The Faculty, Clea DuVall even plays a character pretending to be a lesbian A discerningly indie/retro soundtrack Kissing Jessica Stein went for the Woody Allen jazz feel. Grunge
[ 27, 346, 23631, 13052, 8034, 19500, 5017, 751, 20839, 378, 466, 589, 3707, 479, 47285, 3446, 1621, 15, 1707, 403, 952, 562, 627, 665, 3894, 634, 6284, 15, 1707, 403, 1014, 6068, 665, 588, 1555, 368, 23395, 285, 346, 1212, 2845, 4513, 634, 4677, 449, 5402, 673, 651, 320, 1805, 5262, 2819, 323, 731, 2581, 685, 7445, 3006, 247, 313, 69, 781, 763, 10, 29934, 1894, 15, 187, 187, 33, 51, 19214, 5220, 13, 896, 275, 380, 6258, 13, 634, 346, 1915, 11170, 4677, 3, 369, 14109, 604, 285, 760, 604, 352, 369, 4964, 25483, 16745, 313, 395, 10159, 273, 634, 3626, 5281, 13, 368, 2761, 1900, 14782, 247, 260, 641, 292, 16, 72, 1817, 282, 16, 22202, 15563, 2476, 582, 594, 352, 434, 417, 751, 253, 6984, 9730, 8685, 369, 512, 670, 2133, 34324, 16, 14764, 593, 15, 187, 187, 33, 43, 27475, 466, 11739, 1711, 952, 18234, 365, 670, 4688, 6838, 512, 253, 673, 13, 1039, 7197, 685, 667, 2872, 1436, 309, 871, 15, 187, 2302, 13, 1841, 497, 5803, 2133, 14, 10247, 15, 380, 2398, 1031, 79, 4200, 287, 265, 285, 8174, 507, 497, 14109, 984, 597, 497, 4964, 25483, 265, 15, 3105, 984, 597, 497, 346, 6549, 3, 346, 1915, 11170, 3, 2255, 15, 187, 187, 52, 798, 15, 11243, 253, 4857, 8406, 943, 564, 1790, 275, 253, 7145, 342, 512, 253, 305, 932, 665, 1333, 10739, 751, 346, 42, 1353, 417, 247, 32411, 533, 3255, 984, 326, 434, 835, 19063, 32836, 323, 253, 13918, 84, 14125, 15, 496, 253, 7145, 15, 6166, 247, 246, 5916, 15, 7900, 359, 476, 626, 923, 352, 15, 187, 187, 33, 9325, 494, 14, 48915, 8186, 309, 816, 10141, 283, 8505, 846, 368, 4822, 5307, 16, 28306, 16, 25463, 2792, 13, 368, 755, 247, 370, 938, 27781, 1235, 27781, 2313, 44254, 323, 667, 10301, 368, 476, 1984, 327, 253, 2670, 32, 1244, 368, 3798, 755, 2233, 2792, 591, 28930, 13, 594, 352, 434, 6571, 247, 346, 90, 333, 13, 2792, 1476, 2181, 13, 5734, 368, 564, 562, 281, 6008, 247, 2257, 285, 2098, 281, 513, 594, 275, 7170, 15, 187, 187, 13924, 4754, 13, 253, 1175, 1711, 1897, 2, 20492, 27100, 1433, 13, 401, 36746, 8702, 15, 19348, 497, 346, 12311, 3, 323, 4555, 581, 1355, 8223, 273, 253, 3072, 27, 4951, 13, 5219, 1821, 15, 5418, 952, 812, 12345, 6273, 13, 285, 2255, 4571, 626, 1527, 12835, 4310, 8553, 13, 2190, 247, 28126, 643, 19201, 1841, 15, 1292, 1339, 434, 9106, 564, 896, 2, 7840, 3329, 20653, 5417, 42, 2415, 13, 43360, 37, 2300, 47, 1433, 15, 187, 187, 42, 1158, 436, 4857, 369, 3542, 407, 247, 29723, 275, 247, 3686, 273, 29874, 16879, 13, 751, 346, 42, 1833, 923, 604, 2255, 31065, 5194, 342, 479, 285, 619, 448, 1952, 8498, 2531, 40484, 323, 253, 1897, 672, 309, 812, 48428, 731, 347, 3906, 45069, 2, 187, 187, 9917, 309, 1663, 34941, 6984, 9730, 434, 346, 4013, 1007, 597, 1472, 322, 6329, 47339, 285, 322, 4237, 6905, 359, 1472, 594, 31501, 3489, 1864, 3, 285, 352, 434, 816, 824, 247, 3965, 2819, 533, 9826, 921, 15, 380, 760, 1175, 2181, 670, 352, 310, 253, 8142, 3740, 15, 187, 187, 33, 547, 4978, 1707, 369, 247, 1270, 3929, 247, 4564, 1107, 896, 327, 849, 253, 921, 5605, 281, 452, 697, 15221, 285, 6008, 352, 1512, 1969, 597, 22830, 597, 403, 18577, 616, 9881, 387, 512, 436, 346, 42996, 3, 3768, 16858, 13, 533, 1663, 597, 2057, 971, 253, 6966, 1318, 273, 247, 12821, 3416, 10470, 390, 253, 7185, 281, 320, 3499, 23522, 2825, 382, 285, 1750, 352, 434, 9493, 15, 187, 187, 42, 812, 816, 391, 386, 323, 1897, 670, 952, 36123, 3006, 29778, 13, 3340, 275, 1110, 806, 4564, 273, 12396, 15, 1500, 310, 50063, 13, 533, 417, 17400, 6051, 15, 1244, 512, 253, 4606, 281, 26930, 29778, 403, 39838, 264, 342, 3731, 462, 1362, 90, 13, 2825, 1204, 13, 2133, 8672, 285, 2087, 4109, 725, 5025, 405, 326, 564, 2112, 342, 11994, 84, 15, 187, 187, 33, 81, 1432, 33830, 10037, 1500, 816, 3133, 20802, 1024, 13, 2506, 626, 703, 32, 6975, 13, 703, 310, 9995, 281, 452, 12759, 9366, 313, 249, 15866, 273, 253, 2105, 10, 533, 310, 816, 11870, 273, 8133, 598, 342, 253, 10739, 15, 1500, 908, 281, 320, 512, 670, 253, 3906, 4803, 708, 19868, 13, 533, 9377, 352, 512, 436, 1390, 2563, 672, 703, 1407, 2400, 26411, 562, 273, 253, 8784, 251, 4804, 15, 1707, 369, 642, 346, 282, 18197, 275, 3, 896, 840, 15, 187, 187, 33, 81, 1432, 33830, 10037, 11739, 637, 15, 309, 1158, 29778, 310, 247, 378, 2300, 39, 275, 594, 1142, 4088, 13, 285, 326, 703, 310, 16088, 2266, 984, 273, 512, 253, 10739, 703, 434, 574, 281, 2968, 342, 13, 285, 326, 703, 434, 7303, 281, 1056, 18616, 796, 562, 273, 253, 458, 23787, 703, 434, 644, 1677, 13, 323, 253, 954, 629, 15, 309, 452, 247, 1524, 2602, 6308, 323, 617, 1051, 533, 617, 1495, 32, 1680, 417, 17400, 6051, 387, 512, 15, 187, 187, 33, 67, 1173, 16249, 249, 309, 1353, 594, 3212, 15, 309, 878, 281, 5834, 598, 327, 2952, 608, 1580, 352, 434, 327, 25456, 1024, 13, 285, 840, 3698, 721, 15, 309, 1871, 2218, 247, 3965, 1175, 2628, 670, 417, 15695, 4837, 1841, 323, 4266, 13, 2167, 6984, 9730, 3548, 626, 347, 15695, 6731, 5536, 347, 690, 2722, 15, 187, 187, 1989, 432, 253, 1841, 309, 1849, 2326, 13, 29778, 310, 594, 1027, 15, 309, 5476, 309, 1353, 9995, 326, 703, 434, 703, 20802, 13, 275, 247, 1039, 15, 187, 187, 1147, 434, 247, 34303, 1894, 12423, 285, 47831, 20069, 21557, 7120, 253, 10739, 562, 273, 752, 703, 434, 1677, 15, 3973, 18605, 29778, 651, 452, 16037, 2122, 387, 11604, 29778, 323, 642, 3356, 1146, 594, 19456, 347, 281, 1691, 512, 617, 11624, 275, 690, 29723, 434, 11281, 13, 751, 690, 1315, 37028, 3226, 665, 556, 642, 3524, 273, 45906, 973, 15, 187, 187, 33, 1148, 64, 5598, 248, 339, 309, 8523, 1904, 626, 751, 29778, 13, 10571, 984, 703, 369, 3686, 273, 30446, 281, 49567, 275, 253, 5068, 13, 285, 247, 1158, 253, 269, 37567, 689, 617, 574, 247, 1175, 2372, 281, 513, 342, 352, 15, 1292, 309, 858, 452, 247, 19040, 2602, 6308, 323, 29778, 15, 187, 187, 10795, 79, 626, 253, 43178, 8968, 326, 1146, 29778, 310, 253, 4588, 9065, 32, 29778, 3637, 13556, 253, 4803, 273, 1146, 247, 3416, 27, 703, 434, 3965, 13, 17497, 533, 1327, 14, 33897, 13, 892, 4580, 255, 784, 13, 285, 26091, 512, 1110, 27246, 4742, 440, 1342, 314, 4278, 15, 1500, 11532, 275, 253, 985, 13, 285, 11121, 326, 604, 703, 7120, 617, 8364, 987, 13, 703, 1833, 17129, 973, 285, 990, 598, 275, 253, 35821, 15, 41624, 13, 253, 921, 310, 3965, 15958, 285, 31444, 617, 2970, 35598, 689, 313, 1761, 264, 13, 7028, 281, 17845, 382, 13, 1907, 4832, 3237, 13, 32806, 342, 1429, 10, 5747, 617, 4882, 407, 253, 4803, 15, 1500, 434, 4737, 326, 2255, 476, 1620, 2686, 3330, 275, 20110, 12638, 15, 187, 187, 1051, 15953, 13, 309, 1849, 574, 247, 1643, 17208, 285, 309, 717, 11557, 90, 15, 3105, 387, 368, 2, 1292, 436, 310, 247, 564, 14, 936, 1386, 323, 479, 27, 12445, 14896, 275, 253, 20110, 12638, 13, 1014, 253, 952, 665, 1646, 281, 13, 984, 253, 13947, 8847, 273, 20110, 12638, 310, 281, 2028, 952, 665, 16, 5371, 16, 5430, 597, 943, 320, 13, 10159, 273, 6612, 15, 1893, 13, 4754, 13, 690, 952, 5649, 275, 4088, 326, 403, 7964, 1774, 285, 33631, 313, 40744, 1037, 13, 8269, 3146, 13, 3966, 582, 533, 9142, 13, 20110, 12638, 310, 247, 3490, 751, 12926, 27, 352, 40581, 4130, 1066, 15, 187, 187, 42, 452, 36968, 7487, 6984, 9730, 6651, 26727, 984, 309, 574, 247, 3331, 326, 3078, 281, 3522, 5037, 23701, 468, 390, 5046, 816, 320, 20512, 15598, 264, 407, 779, 285, 352, 3531, 619, 12607, 15, 5220, 13, 717, 309, 3815, 1060, 13, 390, 1057, 10354, 25478, 816, 1007, 751, 247, 27370, 265, 1687, 3168, 5599, 281, 3780, 2010, 32, 309, 1053, 626, 923, 253, 10721, 13, 2167, 344, 310, 11755, 347, 7435, 15, 187, 187, 33, 51, 1004, 89, 466, 51, 3348, 754, 556, 247, 2176, 5739, 14, 24442, 3564, 4034, 405, 275, 619, 4743, 15, 309, 9428, 275, 326, 1039, 253, 20278, 310, 1175, 984, 521, 497, 253, 4453, 326, 497, 11408, 285, 12207, 896, 840, 32, 1707, 434, 642, 5434, 281, 521, 4453, 13, 642, 660, 43305, 15, 187, 187, 33, 51, 1004, 89, 466, 51, 3348, 733, 434, 253, 14241, 13, 8872, 2927, 326, 755, 281, 2255, 13, 1223, 309, 717, 1900, 594, 1691, 745, 407, 521, 5075, 1652, 6208, 15, 309, 1158, 10354, 25478, 310, 271, 7126, 12353, 285, 778, 275, 958, 320, 247, 1175, 1436, 275, 6612, 13, 533, 5037, 310, 824, 247, 7027, 1969, 344, 6993, 637, 314, 1919, 326, 2506, 626, 789, 13, 840, 2722, 521, 6326, 24189, 672, 344, 11121, 352, 1833, 755, 779, 752, 344, 5605, 13, 285, 352, 434, 512, 627, 327, 521, 2454, 15, 187, 187, 33, 22434, 26983, 5531, 7335, 27263, 15, 3166, 368, 2238, 273, 755, 253, 5471, 326, 5747, 5037, 434, 6500, 13, 19528, 651, 320, 247, 1805, 2242, 32, 4923, 344, 13, 340, 8, 14428, 13, 2686, 11121, 2825, 310, 1175, 3185, 273, 3076, 16, 32029, 16, 81, 2977, 3196, 15, 30435, 32, 187, 187, 33, 8096, 545, 6464, 309, 476, 755, 1066, 342, 326, 13, 352, 434, 2139, 309, 452, 247, 2264, 10692, 4006, 254, 323, 2516, 25480, 41385, 313, 3529, 637, 310, 247, 3915, 1277, 15, 309, 1620, 7192, 1919, 891, 3047, 26386, 81, 42193, 582, 533, 1014, 2167, 344, 28114, 479, 598, 275, 1884, 9384, 13, 285, 25478, 708, 378, 13228, 310, 12835, 47150, 30883, 25129, 13, 344, 1335, 816, 2238, 273, 4453, 751, 253, 5599, 326, 309, 651, 1663, 4517, 281, 5580, 479, 1728, 18602, 434, 6503, 390, 1633, 15, 187, 187, 33, 1258, 266, 3639, 868, 6279, 13, 1390, 8849, 309, 2427, 327, 247, 3522, 342, 247, 5599, 665, 753, 326, 33686, 23701, 468, 369, 2810, 281, 521, 2934, 273, 247, 3962, 3416, 285, 326, 703, 369, 594, 50036, 15377, 15, 754, 13222, 598, 690, 643, 2502, 12201, 13, 533, 20509, 13, 326, 581, 369, 253, 28159, 383, 15, 187, 187, 9817, 13, 8718, 4130, 13, 703, 434, 3965, 285, 703, 4245, 275, 281, 5037, 13, 534, 403, 2534, 31296, 4606, 281, 320, 715, 617, 13, 533, 671, 36722, 4110, 388, 1372, 4873, 18688, 15, 388, 1372, 4873, 18688, 15, 388, 1372, 4873, 18688, 15, 1422, 971, 281, 3522, 247, 3416, 665, 38232, 5972, 285, 617, 2151, 32, 1737, 32, 187, 187, 42, 1928, 751, 6984, 9730, 1537, 320, 581, 273, 1110, 1841, 326, 434, 27826, 407, 697, 7458, 15, 309, 519, 410, 253, 921, 13, 533, 326, 434, 984, 352, 434, 247, 1663, 47860, 29254, 273, 5899, 8645, 9503, 16, 30668, 5953, 15, 3771, 984, 5037, 23701, 468, 310, 23639, 285, 31394, 5322, 19519, 2506, 626, 1599, 253, 921, 310, 598, 16514, 779, 347, 247, 1894, 281, 320, 35030, 15, 32271, 277, 14735, 2312, 670, 14707, 281, 320, 5037, 23701, 468, 390, 16901, 5015, 670, 14707, 281, 3522, 779, 309, 1353, 751, 346, 11778, 368, 2455, 2686, 6725, 1400, 6984, 9730, 865, 187, 187, 4967, 513, 952, 755, 436, 3430, 13, 1007, 13, 352, 434, 2969, 13, 1132, 7435, 16, 4175, 610, 16, 24212, 27, 187, 187, 18, 15, 49142, 19528, 14, 3529, 9711, 30013, 4453, 751, 794, 275, 253, 34707, 13, 671, 344, 310, 7001, 5356, 47860, 327, 3527, 13, 594, 309, 651, 5926, 3527, 342, 779, 285, 452, 47860, 2825, 13, 352, 651, 320, 13103, 187, 19, 15, 2398, 610, 11290, 18084, 26817, 306, 14, 248, 310, 10323, 253, 8642, 368, 476, 755, 281, 4560, 247, 637, 665, 310, 671, 247, 12524, 1966, 1146, 327, 326, 921, 15, 309, 871, 253, 2644, 346, 11510, 7317, 273, 616, 673, 3, 16267, 13, 285, 642, 13, 309, 1353, 417, 11280, 352, 15, 1292, 594, 2080, 313, 42, 1053, 626, 452, 10856, 13, 6468, 626, 2326, 253, 954, 3332, 2952, 10, 344, 310, 12524, 15, 5220, 23639, 13, 651, 3164, 320, 4484, 342, 247, 4475, 665, 2987, 13, 26570, 15, 187, 187, 44079, 26411, 14, 344, 310, 247, 2343, 506, 8826, 1652, 281 ]
: "Everyone likes crappy stuff like Justin Bieber except meeeee". No. There are people out there who share your interests. There are even guys who will treat you nicely and "appreciate your figure." Your time would be better spent looking for them rather than idealizing a (dickish) fictional character. @RNL Also, back in The Day, your "curvy figure" was appreciated if and only if it was hourglass shaped (and regardless of your natural shape, you almost always wore a corset/girdle/similar contraption), so it's not like the Mad Men era was all about body positivity/acceptance. @Jinxie Yeah old people gripe about fat girls all the time, way worse than any young person I know. No, things were NOT body-positive. The Marilyn Monroes and Joans were appreciated because they were hourglasses. Not because they were "real" "curvy" women. Sigh. Perhaps the letter writer should go sit in the corner with all the gals who say shit like "I'm not a feminist but..." because that's where nostalgia for the 1950s belongs. In the corner. Under a tarp. Where we can't see it. @adorable-eggplant I just checked-- apparently after you collect 2000/5000/10000 points, you get a $20/$50/$100 coupon for any restaurant you can book on the site? And you usually get 100 points per reservation, so it's mostly a "yay, points!" thing, unless you go out to eat a lot and plan to do so in advance. Ah yes, the good old days! OH WAIT, FUCK YOU. Things were "good" for exactly one small segment of the population: straight, White men. Black people could barely vote, and women couldn't open fucking bank accounts, among a trillion other horrible things. But let's totally go back! SHUT UP IDIOT, GODDAMNIT. I think this letter was written by a dude in a sort of hopeful fantasy, like "I'll see if women secretly agree with me and my chauvinistic longing for the days when I could trat them as office decorations! Also I really dislike Mad Men's "Oh look they're SMOKING and SEXIST we're so AUTHENTIC" and it's just such a pretty looking but ordinary show. The only good thing about it is the fashion style. @iceberg There was a great article a couple years back on how the show wants to have its cake and eat it too -- they pretend they are shaking their fingers at all this "authentic" awfulness, but really they either want the shock value of a pregnant woman smoking or the freedom to be horribly sexist and claim it's historical. I could just rant for days about people idolizing Joan, especially in those first couple of seasons. She is admirable, but not enviable. And all the reasons to admire Joan are tinged with misogyny, sexism, body politics and general terribleness that go along with 1960s. @pajamaralls She just seems exhausted now, doesn't she? Like, she is glad to have gotten somewhere (in spite of the cost) but is just tired of putting up with the shit. She used to be all about the office rules & hierarchy, but broke it all this last ep when she edged Pete out of the Avon meeting. There was no "leaning in" back then. @pajamaralls Yeah man. I think Joan is a BAMF in so many ways, and that she is incredibly strong because of all the shit she's had to deal with, and that she's managed to make lemonade out of the lemons she's been given, for the most part. I have a real soft spot for her... but her life? Is not enviable at all. @bevrockin I'm so behind. I need to catch up on season 5 since it's on Netflix now, and then watch 6. I'd done a pretty good job about not spoiling things for myself, though Mad Men isn't as spoiler heavy as some shows. But from the things I've seen, Joan is so different. I guess I'm glad that she's she exhausted, in a way. It's a terrific character arc and Christina Hendricks plays the shit out of what she's given. First Season Joan would have sneered at Current Joan for no longer being so silly as to put all her eggs in some dude's basket, like some frumpy girl who has no hope of marrying well. @par_parenthese I initially didn't like Joan, partially because she was sort of rude to Peggy in the beginning, and a think the fawning over her had a good bit to do with it. But I did have a definite soft spot for Joan. Doesn't the LW realize that being Joan is the actual worst? Joan follows ALL the rules of being a woman: she's pretty, intelligent but non-threatening, flirtatious, and manages all those pesky unmanly details. She believes in the system, and thinks that if she plays her cards right, she'll marry well and end up in the suburbs. Luckily, the show is pretty realistic and depicts her getting fucked over (raped, married to rapist, having financial problems, divorced with child) despite her playing by the rules. She's proof that women can never actually win in patriarchy. ...Sorry, I've had a few drinks and I am shouty. Not at you! But this is a go-to line for me: nobody wins in the patriarchy, even the people who seem to, because the defining characteristic of patriarchy is to tell people who/what/how they should be, regardless of reality. So, yes, some people benefit in ways that are definitely important and tangible (economically, legislatively, etc), but ultimately, patriarchy is a force like gravity: it weighs everyone down. I have resisted watching Mad Men FOREVER because I had a friend that wanted to date Don Draper or maybe just be sexually harassed by him and it turned my stomach. Also, am I alone here, or does Jon Hamm just look like a nondescript white guy to anyone else? I don't see the magic, though he is funny as fuck. @RoxxieRae He has a certain stock-photo handsomeness in my opinion. I suppose in that way the casting is good because his were the looks that were desirable and acceptable back then? There's no danger to his looks, no scruff. @RoxxieRae It's the moist, sad eyes that get to women, while I am always so put off by his weak little mouth. I think Jon Hamm is an excellent actor and may in fact be a good person in reality, but Don is such a lie -- he acts manly until that doesn't work, then shows his supposed vulnerability when he thinks it'll get him what he wants, and it's all there on his face. @Lucienne Oh Slattery. Do you kind of get the feeling that despite Don's equipment, Roger would be a better lay? Because he, y'know, actually thinks sex is good instead of bad/currency/paging Dr. Freud? @Amphora I can get down with that, it's why I have a total ladyboner for John Travolta (that man is a STAR. I never understood until i saw Pulp Fiction), but even though he cracked me up in 30 Rock, and Hamm & Buble is fucking HYSTERICAL, he still just kind of looks like the guy that I would really trust to sell me homeowner's insurance or something. @flanhoodles Yes, last weekend I went on a date with a guy who said that Betty Draper was close to his idea of a perfect woman and that she was soooo innocent. He threw up some other red flags, but honestly, that one was the reddest. Like, ok everyone, she's pretty and she gives in to Don, which are barfy reasons to be into her, but also SHE IS HORRIBLE. HORRIBLE. HORRIBLE. You want to date a woman who hates herself and her children? What? I feel like Mad Men might be one of those things that's ruined by its fans. I adore the show, but that's because it's a really insightful critique of traditional gender roles/ masculinity. Just because Don Draper is handsome and wears nice suits doesn't mean the show is upholding him as a character to be admired. Whenever dudes talk about wanting to be Don Draper or ladies talking about wanting to date him I'm like "Have you ever actually SEEN Mad Men?" Why do people get this wrong, look, it's simple, play fuck/marry/kill: 1. Fuck Roger-that silver fox looks like fun in the sack, also he is amazingly insightful on acid, so I would drop acid with him and have insightful sex, it would be awesome 2. Marry Ken Cosgrove-he is basically the closest you can get to finding a man who is also a decent human being on that show. I know the whole "prodcut of their time" excuse, and no, I'm not buying it. But so far (I don't have cable, haven't seen the most recent season) he is decent. Also handsome, would probably be cool with a wife who works, ect. Kill Pete- he is a loathsome little to
[ 13, 285, 29383, 13, 10599, 8322, 273, 534, 403, 12232, 275, 3672, 342, 3710, 2739, 15, 2064, 4444, 13, 2298, 272, 66, 13, 812, 2794, 44776, 15, 187, 187, 26190, 1897, 273, 6240, 2298, 272, 66, 281, 617, 6196, 13, 32324, 2296, 13, 703, 3543, 617, 43054, 1662, 90, 8488, 13, 285, 703, 8899, 39974, 407, 253, 4444, 457, 84, 2442, 281, 1361, 952, 15, 32324, 4895, 281, 253, 2077, 275, 4332, 13, 285, 342, 1264, 2136, 10471, 10098, 271, 2102, 25362, 24912, 4544, 281, 6207, 4989, 1504, 247, 2567, 1925, 611, 22357, 611, 22357, 15, 187, 187, 3378, 1264, 2298, 272, 66, 33503, 14, 2009, 3580, 13, 703, 285, 617, 7691, 517, 398, 14078, 264, 697, 1896, 4648, 342, 10894, 751, 773, 740, 1720, 3743, 281, 43852, 353, 4263, 66, 6000, 6258, 1806, 534, 2908, 13538, 285, 14419, 8401, 13, 8109, 13440, 1786, 13, 285, 12767, 17002, 5917, 15, 313, 1992, 616, 6152, 13, 597, 671, 5907, 253, 2629, 2221, 19480, 32270, 47575, 27, 556, 253, 773, 33177, 668, 281, 1555, 13, 773, 7110, 644, 7478, 347, 247, 6422, 4968, 1806, 3966, 2698, 187, 187, 36, 4405, 261, 574, 253, 1175, 7516, 281, 8027, 611, 22357, 611, 22357, 387, 247, 673, 273, 26660, 3116, 275, 253, 2221, 19480, 285, 8499, 2136, 15, 6061, 253, 2469, 2620, 1107, 13, 253, 1180, 273, 14590, 285, 8499, 9341, 556, 2559, 407, 495, 15, 21, 2558, 1128, 1439, 247, 1355, 4677, 7296, 326, 253, 4765, 530, 15, 322, 15, 2791, 3982, 275, 370, 2405, 6494, 13, 2556, 281, 247, 1304, 407, 2791, 14, 36642, 5882, 32728, 1830, 3645, 15, 743, 15174, 6858, 14, 2399, 8056, 5978, 13, 3413, 281, 14003, 1175, 1786, 13, 778, 5513, 2139, 15, 187, 187, 24051, 13478, 187, 187, 9586, 253, 3159, 2221, 19480, 556, 2489, 625, 14414, 15, 496, 4104, 3815, 13, 253, 1180, 273, 747, 2739, 285, 5484, 3580, 13130, 347, 2221, 36632, 13, 23426, 579, 953, 13, 390, 2221, 17676, 968, 2559, 5540, 2558, 21349, 13, 2556, 281, 353, 34291, 13, 285, 275, 2032, 2448, 3740, 13, 253, 530, 15, 322, 15, 3977, 773, 12185, 668, 1885, 37048, 15, 187, 187, 510, 872, 7697, 285, 16966, 273, 2298, 272, 66, 452, 1691, 352, 327, 1142, 273, 253, 1072, 30058, 347, 913, 2284, 37408, 432, 8170, 285, 3684, 3968, 13, 564, 8020, 37408, 432, 4135, 13, 285, 5315, 66, 432, 31805, 15, 187, 187, 1628, 15705, 19480, 8018, 1633, 26015, 1806, 2296, 5171, 1503, 962, 80, 13, 253, 14419, 6423, 387, 16309, 28283, 13, 247, 42440, 2567, 326, 2987, 7208, 342, 2739, 13, 32715, 13, 285, 12461, 3580, 15, 773, 1147, 457, 84, 3164, 1633, 432, 10253, 390, 3684, 3968, 13, 8228, 9366, 11555, 15, 1422, 1053, 457, 85, 755, 2221, 36632, 432, 15391, 1425, 187, 187, 3726, 512, 1056, 897, 273, 253, 1072, 7212, 27, 271, 24405, 432, 247, 5639, 2659, 326, 7729, 38646, 5115, 40926, 15873, 1786, 13, 285, 326, 778, 275, 958, 513, 253, 1072, 323, 368, 15, 187, 187, 13996, 374, 27, 14474, 22064, 253, 21577, 48806, 466, 35540, 187, 187, 1147, 434, 3477, 281, 923, 253, 9137, 4549, 273, 247, 1460, 5411, 5202, 15, 1292, 642, 581, 12701, 323, 2298, 272, 66, 11687, 310, 2779, 281, 2455, 897, 253, 4444, 275, 253, 1039, 326, 3977, 281, 697, 34826, 15, 187, 187, 2773, 457, 84, 984, 253, 952, 665, 48945, 253, 2644, 28065, 14, 12588, 2181, 10345, 457, 85, 11687, 272, 6505, 285, 8689, 45252, 731, 715, 6032, 447, 15, 1583, 574, 247, 625, 21007, 4468, 27, 10678, 1824, 15, 187, 187, 38354, 3466, 2298, 272, 66, 12922, 13, 417, 6505, 13, 403, 1175, 323, 1460, 5411, 388, 938, 533, 417, 1199, 2010, 13, 2167, 1142, 16596, 7450, 2298, 272, 66, 26434, 347, 247, 1039, 281, 1361, 368, 773, 5992, 1004, 1425, 1310, 1966, 14965, 1904, 457, 85, 452, 616, 1211, 28065, 1963, 7032, 273, 10885, 34404, 13, 840, 2298, 272, 66, 651, 13353, 320, 247, 28065, 16498, 15, 1292, 368, 513, 452, 824, 271, 1963, 1128, 12550, 6728, 15, 187, 187, 24051, 13478, 187, 187, 30326, 32324, 670, 253, 9136, 273, 2298, 272, 66, 285, 703, 457, 620, 1480, 368, 281, 2561, 327, 253, 2567, 457, 84, 4422, 15, 773, 2512, 403, 1264, 2022, 4606, 326, 952, 2489, 9049, 670, 2298, 272, 66, 27, 23281, 4038, 13, 4444, 2601, 13, 285, 3270, 14, 13901, 5373, 1425, 187, 187, 40773, 18223, 1595, 13, 1777, 15, 37, 904, 247, 21989, 1794, 7776, 382, 387, 38303, 13, 556, 5196, 23281, 1783, 327, 2298, 272, 66, 281, 2939, 697, 2442, 347, 247, 8499, 281, 1361, 4691, 79, 454, 1428, 952, 15, 187, 187, 44381, 1595, 9814, 253, 611, 22357, 611, 22357, 4422, 285, 697, 773, 740, 1720, 3743, 281, 43852, 353, 4263, 66, 6000, 6258, 1425, 754, 7945, 326, 954, 273, 1110, 4606, 497, 4122, 35377, 285, 2223, 1754, 327, 1355, 2175, 275, 24331, 273, 42326, 3290, 15, 2596, 273, 253, 4067, 2175, 13, 3863, 275, 380, 21160, 5092, 13, 2692, 326, 2298, 272, 66, 18889, 338, 3525, 812, 1555, 40284, 27942, 15, 1723, 13, 253, 6698, 2531, 12974, 273, 380, 21160, 5092, 369, 17801, 275, 247, 4059, 1304, 407, 48069, 8607, 15, 187, 187, 1276, 457, 84, 625, 13, 1142, 273, 2298, 272, 66, 457, 84, 6326, 5373, 1537, 671, 320, 26585, 281, 1679, 26015, 13, 1679, 8214, 6244, 15, 187, 187, 44381, 1595, 2540, 326, 2298, 272, 66, 457, 84, 7458, 1127, 281, 247, 2173, 2238, 273, 2728, 14, 71, 23144, 20118, 313, 8890, 310, 837, 74, 26632, 684, 10, 347, 247, 1921, 281, 2389, 253, 4444, 1128, 2858, 310, 837, 74, 26632, 684, 403, 1846, 7006, 1119, 275, 625, 48657, 29325, 9393, 528, 15737, 824, 347, 7318, 49438, 12973, 285, 36475, 35599, 15, 187, 187, 2598, 849, 858, 2298, 272, 66, 18889, 338, 3525, 23608, 366, 690, 273, 253, 6253, 10111, 275, 3968, 32, 11970, 1029, 14, 14729, 23318, 824, 347, 3196, 15, 31683, 13, 4754, 13, 533, 671, 949, 625, 16105, 9137, 21041, 15, 187, 187, 12864, 13, 323, 4227, 13, 247, 4765, 5041, 5779, 3929, 18879, 773, 46, 4263, 66, 13, 253, 10209, 6053, 19480, 7721, 733, 3133, 10972, 27, 36745, 407, 247, 2499, 273, 5002, 13, 11328, 5859, 8406, 13, 253, 2926, 19101, 8607, 432, 617, 9835, 665, 305, 2345, 670, 849, 253, 4444, 476, 5778, 8401, 285, 773, 19261, 253, 1533, 1425, 187, 187, 1909, 5859, 3698, 21428, 4775, 19537, 18658, 84, 15, 2061, 8042, 562, 13, 2167, 13, 253, 5313, 310, 2686, 247, 5087, 7314, 10317, 13, 4158, 281, 1007, 2074, 281, 247, 5041, 5779, 3668, 3929, 15, 3105, 760, 326, 13, 352, 4242, 281, 17611, 387, 253, 673, 326, 581, 273, 253, 10950, 11106, 369, 247, 5087, 24773, 323, 611, 22357, 611, 22357, 15, 187, 187, 47, 307, 9174, 10071, 751, 18223, 1595, 452, 10184, 896, 327, 253, 26527, 273, 2221, 36632, 15, 773, 42, 717, 417, 247, 7989, 273, 253, 3159, 2221, 19480, 1806, 18223, 1595, 2296, 32300, 1147, 5644, 281, 952, 11280, 12351, 2802, 911, 3875, 457, 12134, 285, 26434, 1014, 2167, 21337, 247, 12461, 595, 10599, 6196, 310, 1896, 407, 11280, 12134, 387, 253, 39556, 1425, 187, 187, 37, 2880, 262, 2458, 4073, 326, 4583, 15048, 6127, 403, 253, 2234, 281, 1175, 1786, 13, 285, 326, 2221, 36632, 2085, 1643, 13, 604, 667, 13, 2879, 5373, 281, 271, 2168, 5875, 6196, 15, 187, 187, 39, 4234, 436, 13969, 327, 5875, 9123, 326, 35520, 2644, 12134, 13, 2221, 19480, 26434, 403, 1024, 23176, 281, 11349, 342, 247, 2169, 2847, 15, 187, 187, 13996, 495, 27, 47739, 253, 50067, 12032, 187, 187, 1147, 434, 417, 2217, 323, 690, 2221, 19480, 4413, 281, 971, 281, 1818, 634, 1786, 15, 1583, 971, 281, 1818, 253, 8859, 13, 1512, 15, 187, 187, 13569, 5092, 708, 2434, 15, 187, 187, 44, 22357, 611, 22357, 7314, 3013, 27, 773, 47, 454, 3647, 1422, 13, 427, 454, 3647, 253, 3645, 1425, 17320, 21132, 14, 22374, 564, 8020, 37408, 313, 24013, 936, 27, 773, 15705, 36632, 342, 25293, 15440, 46459, 773, 37517, 2596, 19997, 13, 34600, 2596, 8347, 1425, 187, 187, 41736, 30260, 570, 87, 13, 1777, 15, 37, 904, 247, 11652, 273, 9137, 387, 47624, 457, 84, 43892, 19613, 4726, 273, 11354, 13, 11424, 326, 368, 457, 250, 2779, 281, 923, 247, 7471, 347, 9865, 275, 767, 1027, 4088, 15, 773, 2214, 1650, 13, 1333, 326, 309, 4489, 247, 11996, 273, 10570, 375, 1824, 1806, 248, 2296, 13, 14339, 281, 253, 47841, 30263, 326, 17904, 608, 23903, 273, 1046, 7471, 281, 697, 10570, 375, 24373, 10205, 10980, 15, 187, 187, 1628, 4041, 1921, 310, 326, 309, 971, 281, 10921, 253, 2567, 323, 697, 1175, 3879, 15, 380, 643, 1921, 310, 417, 281, 10921, 253, 2567, 533, 984, 309, 1928, 690, 3686, 273, 9447, 13212, 285, 1881, 14, 37307, 318, 15, 309, 2868, 309, 717, 247, 28071, 5506, 1436, 1425, 187, 187, 688, 512, 273, 436, 13, 627, 457, 84, 247, 364, 1648, 273, 253, 9129, 10721, 1128, 33136, 1633, 342, 247, 1175, 7765, 281, 7574, 1419, 634, 1211, 13, 751, 9123, 24563, 281, 2489, 1863, 44805, 15, 1244, 342, 2221, 36632, 13, 253, 17651, 273, 8353, 6569, 7019, 27, 2378, 672, 368, 4489, 253, 1885, 285, 969, 672, 368, 6008, 352, 15, 773, 32473, 285, 9921, 403, 3782, 7996, 3580, 984, 368, 6446, 383, 731, 1806, 2296, 308, 15, 378, 3592, 1758, 14656, 4714, 13, 1777, 15, 37, 904, 1481, 273, 253, 2499, 273, 15427, 457, 84, 9137, 7811, 15, 187, 187, 2512, 671, 778, 320, 247, 8680, 1055, 875, 2509, 1175, 285, 5471, 1175, 13, 6701, 281, 247, 973, 14, 21877, 12264, 11562, 1925, 253, 20674, 1055, 15, 187, 187, 688, 2710, 22349, 13, 8607, 452, 2011, 326, 247, 1436, 457, 84, 4583, 13214, 273, 247, 1885, 16178, 253, 13071, 273, 2173, 13, 20804, 18701, 15, 1198, 1650, 27, 4855, 14, 49972, 33707, 9075, 1805, 672, 253, 5484, 254, 310, 6600, 273, 253, 4376, 15, 187, 187, 3378, 820, 14, 24889, 22853, 22723, 28585, 13, 30260, 570, 87, 5421, 253, 1055, 273, 12351, 10459, 8294, 327, 1885, 27163, 285, 1119, 326, 6945, 579, 1204, 3470, 751, 1029, 4376, 15, 2091, 11349, 497, 2183, 247, 2567, 369, 9583, 275, 34251, 4933, 13, 616, 2793, 273, 253, 2567, 457, 84, 1885, 5520, 27, 34207, 37907, 1805, 13, 9970, 3261, 364, 2562, 13, 4707, 3261, 36651, 13, 247, 25266, 2460, 3261, 7550, 468, 15, 187, 187, 510, 1895, 13, 2167, 13, 310, 326, 436, 747, 5978, 273, 2221, 36632, 13, 751, 253, 806, 13, 4558, 3033, 598, 342, 439, 22560, 8249, 3916, 15, 187, 187, 43755, 4714, 21947, 281, 479, 326, 11349, 403, 1881, 14, 39619, 13, 534, 2097, 597, 778, 2075, 247, 15087, 323, 247, 37620, 1175, 1885, 604, 597, 671, 2868, 352, 5373, 731, 15, 187, 187, 688, 253, 1083, 273, 2298, 272, 66, 13, 253, 5825, 902, 422, 5373, 403, 40101, 3100, 13, 533, 760, 323, 952, 275, 3672, 326, 11182, 342, 48461, 15, 2091, 352, 3249, 281, 634, 3388, 5599, 12701, 387, 31373, 36215, 13, 253, 5859, 2506, 457, 85, 12452, 773, 17001, 6929, 1425, 187, 187, 4553, 44235, 22707, 32324, 13, 309, 3395, 13762, 326, 387, 611, 22357, 611, 22357, 13, 253, 7517, 310, 33842, 15, 6279, 13, 253, 3580, 403, 689, 49972, 1754, 327, 616, 21989, 1318, 323, 11349, 13, 533, 627, 310, 642, 1921, 281, 5545, 253, 2567, 457, 84, 1750, 326, 352, 556, 4561, 370, 18, 15, 19, 3041, 275, 11784, 323, 625, 685, 337, 13, 22359, 2298, 272, 66, 14768, 275, 7531, 15, 2053, 5231, 11907, 11349, 281, 1158, 21349, 670, 32435, 15, 187, 187, 3404, 253, 1072, 673, 13, 368, 943, 14409, 253, 4549, 273, 2221, 36632, 323, 752, 352, 310, 13, 285, 1900, 556, 644, 27, 253, 9023, 273, 271, 3477, 2900, 281, 3676, 16515, 39495, 15, 496, 5083, 627, 310, 642, 11687, 326, 476, 20658, 634, 259, 13347, 13, 12461, 14, 4919, 390, 5010, 15, 1422, 476, 457, 85, 4489, 634, 1039, 281, 1146, 247, 1175, 1436, 13, 642, 2647, 849, 33842, 253, 7517, 273, 253, 4413, 368, 457, 250, 11280, 432, 15, 187, 187, 2598, 37977, 253, 747, 2221, 36632, 13, 37900, 347, 597, 5224, 247, 1818, 275, 752, 359, 1318, 1128, 66, 2770, 327, 9073, 253, 1533, 275, 1635, 281, 9361, 15, 1292, 671, 4456, 326, 2403, 1175, 327, 1110, 2193, 13, 751, 4283, 247, 5875, 1495, 13, 588 ]
, and minerals, adequate amounts of which are vital in areas with limited food. That plant, moringa, could create miracles. Within days of adding moringa to her diet, Curtis says, she felt her lethargy lift, and she grew fascinated by the plant’s potential to help people. Curtis returned to the States in 2011, and with three business partners launched an Indiegogo campaign to crowdfund a company called Kuli Kuli. With three moringa snack-bar products, she and her cofounders touted its possible uses with lists like “10 Reasons to Eat Moringa Every Day,” which included preventing and managing diabetes, supporting cardiovascular health, and treating asthma symptoms. (To their credit, they also offered the standard superfood equivocations: has the “potential” to treat, “has been recognized as a powerful tool,” etc.) Curtis had the good luck to launch Kuli Kuli at a time of explosive growth in the superfood and supplement business. Over the past five years, the number of vitamin and supplement businesses has increased by 3.4 percent—not a small figure considering that the 2018 U. S. market brought in $31 billion, according to a report by market-research firm IBIS World. An aging baby-boomer generation, determined to preserve good health, may explain why. Getty Images Even the word superfood has become more widespread. In 2015 alone, the number of new food and drink products labeled as superfoods, superfruits, or supergrains increased 36 percent globally, according to Mintel, and in true American style, the U. S. led “super” product launches. The provenance and promises of moringa have put it on many of the same shelves as acai berries from Central and South America, goji berries from China, and maca from Peru. “Superfood implies something exotic,” says Paul Zullo, the managing director at Silver Creative, a branding company that works frequently with food, beverage, and nutrition products. “It’s probably something from Egypt or South America, grown somewhere unusual. You don’t get superfoods from Kansas.” They all make use of the same formula: an ingredient from a foreign land that helps natives achieve miraculous health, and that may in fact do the same for you. Step 2: Sprinkle the Magic Pixie Dust It's easy to see the marketing appeal of a purifying tree. But no one shopping for moringa powder is likely to ever use the plant in the way that led to its nickname. That’s because the people who coined the whole miracle-tree thing weren’t powdering leaves and sprinkling them into smoothies. They had a more urgent concern: drinking water. Powdered moringa seeds, not leaves, are good for purifying H20 but not much else, though many manufacturers push moringa supplements as a way to help you “detox.” If human beings didn’t have their own miracle organ capable of handling toxins, then moringa would surely be a miracle cure. But you do have such an organ—your liver. Getty Images Ask Curtis about the powers of moringa and she’ll direct you to research on the company’s website. “There are three main reasons that people become excited about moringa: nutrient density, plant protein, and anti-inflammatory benefits.” Kevin Klatt, Ph.D., a nutritional biochemist at Cornell, has conducted nutrient analysis on moringa to assess its potential as a supplement to help malnourished people. Klatt reviewed the Kuli Kuli website and its “10 Reasons to Eat Moringa Every Day.” He concluded that most of those reasons were highly speculative and often based on small studies in journals of dubious quality. One of the larger studies, published in The Bioscan, showed that moringa oleifera could treat hypoglycemia. However, the journalistic integrity of The Bioscan was questioned in a 2014 report by Serbian researchers. What’s more, many of moringa’s supposed benefits might also be attributable to less exotic, less expensive plants. Klatt observed that moringa’s fans point to a specific kind of disease-fighting antioxidant (called isothiocyanates) as a reason to love the plant—but isothiocyanates are common compounds found in more mundane cruciferous vegetables such as cauliflower and mustard greens. So how did moringa oleifera infiltrate some of the largest stores in America? Through high-profile advocates such as Dr. Oz, yes, but also through more subtle marketing tactics. Take, for instance, a 2018 Washington Post article titled “Moringa, the Next Superfood?” It seems legit: Written by a University of California, Davis science writer, the story quotes researchers from her university who gush about how the plant can delay diabetes and “feed the world.” As science watchdog HealthNewsReviews.org pointed out, though, the piece is actually a paid advertorial, designed to look similar to a Washington Post news article. Not only that, it failed to disclose at the time that one of the scientists cited was a paid consultant for Kuli Kuli. Nutrition experts like Klatt have pushed back on the rhetoric of superfoods. “I am not a fan of the word superfood,” Klatt says.“It leads to people buying perceived ‘exotic’ foods and supplements even though consuming a nutritionally adequate diet is possible by buying foods at the supermarket.” Dietitians stress that overall dietary patterns are the key to good health, and that superfoods provide few, if any, added benefits to an already healthy diet. Facing this consensus on healthy eating that emphasizes whole foods, superfood supplements are now appealing to consumers with a higher cause. Step 3: Grow the Halo Effect It's not enough for some superfood companies to want to change your health. They want to change the planet, too. Delcan & Co. Kuli Kuli advertises: “Nourishing You, Nourishing the World.” Natierra-brand goji berries (motto: “Superfoods with Soul”) advertise “Buy One Bag, Feed One Child.” Alexander Chernev, Ph.D., a professor of marketing at Northwestern’s Kellogg School of Management, explains that you’re likely to see a purchase as valuable in two different ways. “For example, say that I buy a bottle of Ethos water,”he says, referring to the Starbucks subsidiary that contributes 5 cents of every purchase to its Ethos Clean Water Fund. “One reason is that I want to reward the company for its good behavior. The other reason is not to reward the company but because I feel some sort of moral satisfaction and self-affirmation. I believe I am a socially responsible person.” In all of this, there’s a whiff of the ancient magic—consuming something with a good soul to fortify your own, like eating deer to become swifter. And with superfoods, the ritual of consumption happens twice: once when you buy the product and again when you eat it. “Food and medicine are particularly sensitive products because you ingest them,” says T. Bettina Cornwell, Ph.D., head of the University of Oregon’s marketing department. There also may be a feedback effect between doing good and feeling good, thanks to a well-established psychological phenomenon called the halo effect. In various contexts, researchers have shown that a person’s overall impression of a product influences the perception of specific, unrelated qualities. For example: High-priced wines taste better when the drinker is aware of the price. With co-investigator Sean Blair, Chernev studied the effect of perceived corporate responsibility on product evaluations and found that altruism functions like high price. When consumers were told a company was engaged in charitable giving, their experience of the company’s product improved: Wine tasted better, teeth looked whiter, hair looked thicker, a scanned image looked crisper. The problem, though, is that this new generation of superfoods, like the first, remains bound up with shaky scientific claims. Cornwell emphasized to me that consumers are self-interested, which means they may pay a premium for a morally good product if they also believe it benefits them. In the case of moringa, the nutritive benefits are unequivocal, but only for people in areas that struggle with malnutrition. When it comes to your average guy shopping at Whole Foods, the science doesn’t scream “miracle.” After interviewing Lisa Curtis, I became convinced that at Kuli Kuli, the mission is sincere. Yes, the products are overpriced based on their nutritional value for consumers, but there is no reason to doubt the company’s claim that it has generated $1.2 million in revenue for more than 1,365 moringa farmers in Africa. These actions encourage consumers to think globally about sustainability. At the same time, you should acknowledge the appeal of superfoods for what it is, and always has been: the promise of an easy solution to deep anxieties. In truth there is no powder that can heal your woes, nutrition-related or otherwise. You can’t buy your way to being a good person, no matter how sincere the mission of the companies you’re buying from. So applaud the new superfoods, insofar as they indicate a change in what we value—a focus on helping the world in addition to ourselves. But also remember that making good on those values, like leading a healthy life, will
[ 2208, 8596, 281, 5820, 13, 3021, 9745, 281, 11130, 2558, 253, 3894, 665, 1329, 1959, 5454, 762, 690, 1617, 15, 7214, 1638, 2558, 10066, 1959, 5454, 672, 1677, 253, 4500, 273, 12954, 5659, 15, 187, 187, 8430, 642, 10870, 941, 6583, 849, 33671, 651, 1928, 670, 5454, 604, 616, 13001, 1160, 3687, 6031, 281, 1361, 5820, 5223, 13, 33671, 7052, 1329, 616, 5368, 2718, 273, 15233, 5820, 285, 403, 625, 4619, 273, 253, 530, 15, 52, 15, 985, 15, 496, 2380, 281, 247, 1982, 5236, 8461, 275, 2552, 273, 8210, 13, 2201, 1005, 275, 6181, 313, 3121, 2558, 582, 6176, 313, 2358, 2558, 582, 285, 9643, 313, 3011, 2558, 10, 5821, 326, 253, 530, 15, 52, 15, 985, 773, 8265, 732, 84, 1512, 1142, 2675, 3237, 984, 273, 247, 3480, 273, 2628, 3988, 285, 1643, 8410, 5373, 323, 1142, 5820, 1425, 1623, 3388, 13, 760, 247, 7150, 32955, 253, 54, 15, 52, 15, 1566, 773, 12157, 352, 310, 2104, 281, 6558, 5054, 3947, 48826, 949, 247, 12112, 985, 273, 5299, 1425, 496, 247, 4858, 8461, 407, 2070, 4200, 615, 275, 6181, 275, 4437, 8441, 13, 9523, 2558, 9013, 253, 5112, 985, 13, 342, 1175, 2675, 6055, 533, 1029, 20549, 13, 1223, 1283, 2558, 9013, 253, 530, 15, 52, 15, 985, 13, 342, 1652, 2675, 6055, 533, 1698, 20549, 15, 187, 187, 20536, 16103, 187, 187, 34436, 513, 417, 1007, 816, 281, 9836, 6031, 281, 2953, 253, 14207, 281, 530, 15, 52, 15, 5820, 15, 380, 7544, 50248, 34, 8461, 1119, 326, 271, 16400, 11456, 2558, 3718, 1690, 5299, 7465, 275, 5454, 15486, 281, 5416, 326, 530, 15, 52, 15, 5820, 588, 417, 2454, 16593, 7324, 432, 28734, 5820, 21344, 15, 15185, 323, 436, 2557, 13, 2167, 13, 369, 417, 26415, 3365, 275, 4468, 323, 2448, 5820, 27, 11439, 2558, 5821, 326, 352, 310, 773, 12784, 7909, 323, 5820, 281, 320, 2256, 281, 17770, 285, 20372, 2515, 1425, 187, 187, 24804, 13, 7108, 1379, 247, 3862, 12046, 2584, 5454, 15, 3900, 597, 1318, 352, 13, 597, 2868, 326, 697, 3116, 943, 1379, 715, 2395, 643, 2193, 13, 1014, 1110, 326, 3468, 326, 3116, 15, 1198, 1650, 13, 597, 971, 281, 19071, 6938, 7465, 715, 5454, 15486, 285, 403, 417, 27662, 7514, 604, 326, 49133, 253, 3116, 273, 5454, 1128, 10984, 314, 247, 10084, 1859, 1677, 326, 7108, 5257, 281, 2868, 326, 5454, 457, 84, 5373, 760, 28249, 32180, 798, 697, 4815, 15, 187, 187, 12535, 2980, 47675, 187, 187, 14897, 187, 187, 18681, 1528, 5489, 42354, 285, 9966, 13, 8246, 323, 5259, 27560, 318, 13, 4726, 273, 5259, 11981, 428, 2499, 273, 15812, 187, 187, 18913, 507, 651, 320, 41024, 281, 4089, 3746, 2529, 347, 32864, 314, 42163, 2448, 994, 675, 447, 281, 1527, 5284, 10169, 15, 1284, 16386, 13, 275, 247, 8065, 1982, 5236, 8461, 13, 849, 3477, 390, 2834, 616, 1211, 2586, 2789, 352, 323, 530, 15, 52, 15, 16596, 281, 5580, 616, 3580, 627, 13, 271, 16400, 5020, 273, 33671, 753, 326, 616, 2586, 2789, 352, 3240, 3477, 313, 19189, 404, 11681, 2558, 13, 6181, 11130, 2558, 13, 6176, 9934, 2558, 481, 10351, 11184, 3047, 253, 1986, 2077, 347, 1527, 281, 5284, 3580, 313, 19189, 404, 7904, 2558, 13, 6181, 5910, 2558, 13, 6176, 6480, 2558, 481, 187, 187, 688, 247, 10610, 1083, 273, 253, 11472, 14, 5695, 11562, 13, 7108, 452, 253, 7285, 13071, 15, 743, 16400, 11614, 2558, 273, 15102, 281, 247, 50248, 34, 8461, 5196, 432, 5080, 281, 4162, 273, 8065, 753, 253, 1986, 2077, 2789, 352, 3477, 323, 5284, 16596, 281, 5580, 616, 3580, 275, 253, 1986, 2077, 13, 1223, 6309, 7609, 2558, 753, 10439, 5284, 4343, 1056, 352, 3477, 323, 253, 1986, 2077, 281, 5580, 697, 3580, 275, 3060, 15, 187, 187, 34436, 452, 2011, 616, 40628, 281, 2007, 1527, 616, 10169, 281, 5284, 3580, 327, 247, 33561, 3720, 15, 2091, 247, 50248, 34, 8461, 275, 253, 7203, 273, 8065, 2546, 13, 773, 2042, 253, 4343, 273, 253, 5284, 6398, 1333, 597, 588, 2406, 15938, 281, 3580, 432, 253, 1986, 2077, 604, 359, 588, 2406, 776, 15938, 281, 616, 3580, 1806, 6705, 2558, 753, 253, 1986, 2077, 943, 513, 594, 13, 1223, 3349, 2558, 753, 352, 943, 417, 15, 1244, 7108, 3078, 281, 2406, 5454, 15938, 342, 3060, 1014, 2167, 5693, 2558, 313, 33542, 2114, 314, 10, 39544, 247, 9927, 326, 5299, 7465, 403, 2406, 275, 3060, 685, 275, 253, 1986, 2077, 15, 3771, 1283, 2558, 1869, 326, 5299, 7465, 403, 2169, 275, 3060, 28, 2030, 2558, 13, 326, 597, 403, 670, 253, 1072, 15, 187, 187, 40128, 32886, 187, 187, 18913, 507, 3176, 625, 1527, 281, 5639, 8149, 685, 403, 7108, 15, 1284, 16386, 275, 253, 7544, 50248, 34, 8461, 281, 5206, 875, 767, 7234, 1128, 668, 37380, 8149, 310, 8312, 984, 352, 4483, 20823, 5852, 1512, 1199, 1453, 689, 776, 13909, 668, 285, 773, 37380, 8149, 310, 3309, 285, 556, 247, 2762, 4833, 327, 776, 6982, 45038, 3583, 2558, 273, 7108, 9703, 253, 4016, 1859, 13, 7652, 2558, 253, 2762, 15, 5595, 33671, 9703, 253, 2762, 1859, 313, 19189, 404, 8319, 2558, 13, 6181, 8676, 2558, 13, 6176, 285, 9972, 8978, 2558, 481, 187, 187, 6104, 1088, 273, 2448, 17156, 187, 187, 49, 2555, 84, 671, 15988, 333, 253, 10732, 326, 7108, 403, 327, 247, 7517, 281, 5195, 616, 4466, 949, 4156, 1320, 13, 1223, 33671, 403, 269, 1946, 253, 7108, 745, 281, 4017, 616, 1211, 4466, 15, 187, 187, 18913, 507, 13, 352, 7819, 562, 13, 452, 247, 9648, 21690, 1859, 273, 2448, 4466, 313, 2420, 374, 2708, 481, 496, 247, 4596, 5307, 1982, 5236, 8461, 13, 760, 1355, 31691, 275, 9972, 313, 746, 2558, 582, 9643, 313, 1508, 2558, 582, 285, 6176, 313, 2405, 2558, 10, 12258, 530, 15, 52, 15, 4633, 4466, 347, 247, 4092, 390, 1077, 4092, 4322, 15, 380, 5112, 497, 8489, 625, 4619, 13, 342, 6480, 2558, 33732, 326, 2448, 4466, 24543, 247, 4092, 390, 1077, 4092, 4322, 15, 1292, 9743, 1128, 2787, 2558, 275, 841, 1740, 4343, 3047, 352, 347, 760, 247, 773, 37585, 4322, 668, 390, 773, 1439, 247, 4322, 387, 512, 1425, 5488, 13, 247, 4891, 5020, 275, 9972, 313, 3763, 2558, 582, 9643, 313, 2251, 2558, 582, 285, 6176, 313, 3046, 2558, 582, 285, 247, 16453, 5020, 275, 6181, 313, 3583, 2558, 582, 512, 11575, 530, 15, 52, 15, 4633, 4466, 49148, 15, 914, 34281, 12178, 6128, 17751, 432, 1884, 2558, 275, 9643, 281, 247, 1029, 273, 7904, 2558, 275, 6181, 313, 2420, 495, 2708, 481, 187, 187, 688, 958, 13, 7108, 285, 33671, 9184, 1652, 275, 616, 1859, 273, 530, 15, 52, 15, 4633, 4466, 15, 6975, 616, 15833, 2439, 253, 14847, 13, 7108, 5257, 417, 281, 923, 616, 4466, 347, 247, 4092, 4322, 281, 643, 11048, 15, 4794, 281, 253, 4437, 7544, 50248, 34, 8461, 13, 5922, 2558, 2783, 352, 760, 247, 5884, 4322, 13, 7609, 2558, 642, 4322, 387, 512, 15, 7214, 7652, 2558, 1869, 253, 5112, 943, 452, 253, 987, 281, 2701, 253, 4645, 273, 2448, 6590, 15, 187, 187, 3650, 326, 7108, 403, 32251, 31905, 670, 616, 1211, 4466, 15, 3771, 3925, 2558, 273, 7108, 1128, 903, 314, 253, 5284, 3894, 1128, 14092, 352, 49148, 13, 1223, 6931, 2558, 20139, 352, 5369, 15100, 1598, 15, 7087, 403, 7108, 689, 3881, 264, 281, 923, 616, 4633, 4466, 5195, 1475, 253, 1533, 15, 1284, 16386, 849, 597, 1928, 773, 3039, 368, 923, 390, 4089, 670, 30946, 2814, 1397, 5909, 598, 275, 8238, 1475, 253, 1533, 390, 672, 368, 4089, 670, 253, 18395, 273, 530, 15, 52, 15, 5579, 2722, 275, 643, 4343, 1806, 760, 7652, 2558, 753, 597, 574, 2762, 10450, 28, 7652, 2558, 753, 597, 574, 6804, 10450, 13, 608, 2558, 4016, 10450, 15, 187, 187, 1276, 457, 84, 1876, 253, 401, 1316, 11376, 32, 187, 187, 15768, 253, 5185, 3935, 273, 253, 22207, 281, 253, 10214, 13, 752, 310, 253, 2603, 273, 253, 1859, 326, 7108, 403, 14312, 285, 33671, 403, 42163, 4156, 1320, 32, 496, 253, 806, 1659, 13, 2067, 1029, 14, 14729, 530, 15, 52, 8634, 27748, 24598, 327, 17340, 34371, 13, 8913, 24288, 13, 2448, 6590, 13, 10194, 13, 27725, 13, 14689, 17645, 13, 285, 625, 452, 2959, 6832, 4116, 275, 253, 2315, 15, 3808, 273, 841, 24598, 28698, 3746, 281, 253, 13214, 326, 253, 1986, 2077, 310, 2820, 281, 3490, 1633, 327, 253, 33671, 1128, 936, 1056, 1355, 2021, 21976, 440, 87, 6051, 13, 281, 3523, 48065, 3438, 19665, 13, 281, 3698, 2448, 6590, 13, 281, 6008, 17645, 8228, 342, 23884, 15, 1292, 436, 36074, 2460, 1057, 417, 8146, 366, 11617, 342, 253, 1345, 15, 380, 3420, 31012, 556, 1160, 253, 10009, 36559, 1646, 7936, 285, 36543, 672, 275, 958, 9328, 403, 1652, 625, 685, 8376, 11807, 15272, 689, 534, 1930, 310, 1469, 281, 1056, 625, 23927, 1561, 247, 9648, 772, 561, 780, 3862, 7792, 285, 873, 273, 2193, 15, 187, 187, 48857, 84, 281, 2096, 253, 18222, 273, 253, 1345, 84, 327, 1097, 7123, 273, 253, 14847, 403, 9542, 407, 253, 1213, 888, 15547, 273, 17898, 2390, 665, 403, 9958, 253, 4016, 9099, 273, 4156, 1320, 390, 665, 403, 24152, 281, 1110, 665, 403, 15, 13168, 841, 2390, 403, 2668, 347, 8612, 273, 253, 2087, 1345, 15, 187, 187, 1989, 275, 958, 253, 2448, 285, 5284, 1345, 84, 1646, 281, 5194, 326, 4156, 1320, 310, 625, 2762, 685, 4016, 15, 2058, 253, 1072, 673, 13, 1097, 403, 43025, 670, 253, 3486, 273, 4156, 1320, 13, 3340, 327, 5820, 15, 6295, 8327, 281, 1978, 690, 5454, 15938, 323, 1024, 13, 387, 1878, 1048, 2217, 281, 1361, 5820, 5223, 281, 253, 2544, 326, 4156, 1320, 36782, 15, 1916, 17279, 459, 1097, 1345, 84, 13, 352, 588, 3164, 671, 320, 3309, 281, 2953, 4156, 1320, 457, 84, 1055, 327, 5820, 275, 6684, 4343, 285, 327, 253, 3126, 347, 973, 15, 380, 1986, 2077, 285, 3060, 588, 3164, 4035, 281, 11377, 275, 15316, 24598, 689, 4555, 849, 281, 2953, 841, 7350, 13, 533, 253, 24598, 943, 417, 26591, 253, 6096, 6944, 1329, 327, 1097, 7123, 273, 253, 14847, 323, 253, 16055, 1232, 273, 4156, 1320, 15, 187, 187, 3235, 337, 27, 3166, 368, 1158, 326, 45527, 5639, 3580, 2097, 253, 2957, 273, 1142, 7375, 275, 436, 2586, 13, 760, 247, 1643, 7375, 13, 390, 642, 7375, 32, 187, 187, 20536, 9872, 982, 187, 187, 7673, 187, 187, 13325, 642, 10551, 13, 627, 310, 247, 12699, 264, 2983, 327, 253, 10281, 12773, 1340, 15, 1244, 352, 310, 1146, 31636, 24818, 407, 253, 4007, 273, 253, 1986, 2077, 1051, 733, 310, 3076, 2217, 326, 253, 22404, 14, 18130, 4804, 310, 9369, 387, 512, 1905, 533, 352, 1364, 417, 1379, 1659, 275, 26229, 15, 380, 41249, 403, 1512, 45672, 528, 15, 1508, 15, 2693, 15, 7798, 187, 187, 22903, 277, 31586, 3736, 8220, 3807, 9527, 3096, 17563, 24836, 25730, 373, 8024, 10631, 5943, 187, 187, 6300, 316, 13, 7993, 3807, 8679, 209, 693, 770, 33332, 396, 262, 2456, 30403, 445, 15, 15983, 14756, 3855, 27, 329, 976, 15827, 34636, 6839, 324, 85, 18936, 423, 465, 2477, 85, 3506, 13589, 10207, 15, 657, 38853, 47472, 2353, 282, 26217, 3150, 4597, 1441, 85, 422, 9416, 2070, 7564, 19457, 15, 187, 187, 55, 251, 24336, 27402, 1981, 187, 187, 39, 507, 2336, 3241, 864, 9416, 5945, 15, 3083, 45215, 27359, 27432, 11191, 91, 4784, 16724, 44, 297, 4805, 16749, 1628, 2353, 40916, 25342, 8449, 29840, 16724, 9293, 91, 451, 11500, 356, 797, 257, 322, 9631, 12615, 1628, 653, 2845, 864, 13, 5807, 251, 2827, 76, 2477, 85, 637, 9527, 657, 16937, 786, 27, 3771, 316, 10354, 284, 13, 8024, 2971, 4597, 1441, 85, 400, 13, 743, 71, 26288, 6554, 3807, 30739, 79, 1784, 16724, 69, 31586, 1879, 486, 2721, 35009, 1628, 15, 9362, 12576, 74, 636, 292, 1441, 85, 422, 21308, 275, 378, 3090, 5316, 14, 3807, 3437, 14, 5785, 43322, 275, 38806, 45067, 611, 6228, 14, 3807, 500, 814, 423, 91, 22369, 79, 320, 1758, 248, 7206, 1080, 17291, 1108, 3807, 9527, 396, 262, 2456, 30403, 445, 15, 11271, 423, 10736, 9778, 358, 500, 538, 300, 1392, 360, 10863, 21974, 796, 9527, 1052, 15, 27907, 20150, 9527, 11835, 80, 209, 398, 348, 40594, 27, 16724, 7510, 321, 304, 265, 329, 4079, 1628, 15, 187, 187, 22903, 8024, 10631, 5943, 2510, 348, 38957, 275, 42141, 1373, 3135, 2649, 16221, 4784, 1784, 7188, 2381, 567, 290, 14671, 1947, 711, 2827, 16750 ]
government aid to workers, thus bringing to 84 percent the share who support free trade under some condition. Only 14 percent opposed free trade when given the option of worker programs. Although no comparable data confirm how Europeans would feel about trade if their governments made greater efforts to help workers adapt, Europeans strongly support their existing systems of protecting workers and are more critical of the U.S. system. In response to a USIA poll in May of 1997, majorities in France (76 percent), Germany (68 percent), and Britain (57 percent) agreed that the U.S. system “neglects too many social problems because of a lack of job security and few employment benefits for many workers.” On average, only a quarter favors theU.S. model “because it is able to maintain economic competitiveness through a flexible system of labor.” In a separate poll by Le Monde in France in October 1996, 66 percent preferred the French system, with good social protection but high unemployment, while 18 percent preferred the U.S. system, with little social protection but low unemployment. Related Books Americans do not look just to domestic efforts to address the threats to U.S. workers. The 1999 PIPA poll found that an overwhelming 93 percent favor including labor standards in trade agreements to ensure that U.S. workers will not face unfair competition from exploited workers overseas. Support for this measure, though, was not rooted simply in concern for American workers: 83 percent agreed that it is “immoral for workers to be subject to harsh and unsafe conditions.” Indeed, Americans take a broad attitude toward trade. While they value it, they believe that its growth should take into account other values, even those that slow that growth. For example, they want to incorporate environmental standards into trade agreements and are not overly concerned if that slows the growth of trade—hardly a surprising view given that Americans tend to believe that trade’s benefits only moderately outweigh its costs. Opening Markets Author Senior Research Scholar and Director, Program for Public Consultation, School of Public Policy - University of Maryland Europeans would be amused to hear themselves described as stubbornly resisting American entreaties to open European markets. Asked, in a 1998 USIA poll, how easy or difficult their own country makes it for U.S. manufacturers to sell their products there, an overwhelming majority of Europeans said that their country makes it quite easy (Britain 81 percent, France 84 percent, Germany 68 percent). Far fewer saw the United States as open to European products (Britain 46 percent, France 34 percent, Germany 38 percent). In a classic case of the mirror-image phenomenon, Americans have the opposite perception. An overwhelming 86 percent of respondents to a PIPA poll conducted from February to April of 1998 said the United States makes it easy for European manufacturers to sell their products in the United States, whilejust 41 percent said western European countries make it easy for the United States to sell its products in Europe. Americans have shown their readiness to further open their markets to European products on a reciprocal basis. When a PIPA poll in the spring of 1998 asked, “If the countries of the European Union say they will lower barriers to products from the United States if we will lower our barriers to their products,” 64 percent said the United States should do so, while 28 percent said it should not. And Americans wanted to lower trade barriers with Europe even though 48 percent (mistakenly) voiced a belief that labor standards are lower in Europe than in the United States. Just 18 percent thought that labor standards are higher in Europe; 25 percent, that they are about the same. Foreign Investment Europeans appear more open to foreign investment than are Americans. Asked in the 1999 PIPA poll to choose between two statements—”foreign investment is dangerous because it allows outsiders too much control over our affairs” and “foreign investment is necessary and has a positive influence on our economy”—52 percent of Americans chose the negative view, 43 percent the positive. Most Europeans chose the positive view (Britain 51 percent, France 53 percent, Germany and Italy 59 percent). Spread of American Culture Polls also gainsay the notion that Americans are on a mission to spread their culture through globalization, while Europeans are fending the Americans off to protect their own culture. Europeans, it turns out, have a fairly benign view of American culture (table 2 below). In a November 2000 USIA poll, only small minorities in Italy (19 percent), Britain (23 percent), and Germany (31 percent) regarded U.S. popular culture as a serious or very serious threat. The French were somewhat more critical, with 38 percent agreeing that American culture poses a serious or very serious threat. But 62—79 percent in these four countries saw it as only a “minor threat” or “not a threat at all.” Furthermore, a solid majority in Italy (62 percent), Britain (67 percent), and Germany (59 percent), and a modest majority in France (52 percent), all viewed U.S. popular culture favorably. Unfavorable responses ranged from 30 percent in Britain to a high of 46 percent in France (table 3 below). In fact, Americans and Europeans differ little in their view of U.S. popular culture. Like their neighbors across the Atlantic, Americans tend not to see their culture as a serious threat to other cultures. According to the October 1999 PIPA poll, 33 percent considered it only a minor threat, 41 percent no threat at all. Only 43 percent thought the French should have the right to limit the showing of American films. Not that Americans are wildly enthusiastic about their own culture. Just 60 percent of Americans—roughly the European share—rated it favorably, while 39 percent rated it unfavorably. Nor are Americans overjoyed to see their popular culture spread around the world. Asked how they feel “When you see or hear about McDonalds opening up in cities around the world or when you hear about the popularity of U.S. TV shows in other countries,” only 43 percent said they had positive feelings; 43 percent said they had mixed feelings, 5 percent negative feelings. What’s All the Fuss About? Given the consistent message of the polls to the contrary, what is the source of the view that Americans are promoting and Europeans are resisting globalization? In the first place, several high-profile U.S.-European disputes on agricultural subsidies, bananas, American films, steel, pasta, hormone beef, and more have received substantial attention in the press. Some of these disputes lend themselves to the impression that the United States is trying to force something on the Europeans—to make small family farms unviable, to stop favoring former colonies, to watch American films, to eat beef grown with hormones. But this exaggerated image does not resonate deeply with the public. The media hype has made the disagreements seem fundamental and enduring when in factthey are little more than intrafamily conflicts over which side is going to make more adjustments within a fairly consensual broad framework and set of values. Attempts to understand the attitudes of the publics on both sides of the Atlantic are complicated by the strident voices of vocal groups who are suffering the negative consequences of globalization or who are sympathetic to those who are. Sometimes these groups are taken as representative of the general public. But in fact the American and European publics seem to agree that globalization is more positive than negative. At the same time, both are uneasy about the impact of globalization, especially on workers. Both desire to keep some trade barriers for now, at least long enough to help workers adapt to the changes that globalization entails. To reassure both publics, it will probably also be necessary to address globalization’s effect on workers in developing countries and on the environment as well. The United States and Europe will probably continue to engage in periodic disputes over exactly how to address these concerns, but the disputes should not obscure the shared underlying support on both sides of the Atlantic for the broader process of globalization. Table 1: Do you think that importing foreign products means the loss of many jobs in this country, only a few jobs, or no jobs? Related Topics More Make no mistake, there is a concerted attack on the constitutional liberal order. And it is being spearheaded by the president of the United States... It is bad enough that the Putin-Trump meeting is happening at all — but it must not take place in Vienna. The echoes are too ominous.23.09.2018 Die drei ??? und das Geheimnis ihres Erfolgs Justus, Peter und Bob ermitteln seit 50 Jahren. Sie zeigen: Auch eine Kleinstadtjugend kennt Abenteuer. Viele Fans begleiten die Detektive ein Leben lang. Von Marcus Golling Fans verstehen einander. Man muss nur einen Satz mit „Kombiniere“ beginnen oder von einem „spezialgelagerten Sonderfall“ sprechen, schon erkennt man das Vorbild: Justus Jonas, Erster Detektiv, Anführer und Hirn der „drei Fragezeichen“. Die Juniordetektive sind in Bücher- und CD-Regalen in deutschen Kinder- und Jugendzimmern beinahe obligatorisch – und das seit 50 Jahren. Passend zu diesem Jubiläum ist gerade das 200. Buch über das Trio erschienen: „Feuriges Auge“. Die Erfolgsgeschichte in Deutschland beginnt 1968 mit der Veröffentlichung des ersten
[ 24, 28126, 8918, 15, 1893, 13, 359, 943, 1642, 9361, 253, 1953, 773, 5371, 476, 359, 6947, 2583, 327, 326, 588, 41005, 2126, 952, 13, 604, 368, 871, 1309, 247, 1066, 14077, 285, 281, 690, 6070, 359, 452, 247, 1066, 14077, 1024, 6598, 1292, 352, 457, 84, 247, 1077, 11134, 581, 13, 359, 457, 250, 1335, 5675, 387, 247, 5272, 2281, 15, 1737, 476, 359, 6947, 625, 2583, 327, 285, 2126, 625, 952, 342, 285, 387, 253, 990, 273, 326, 1232, 13, 320, 2104, 281, 4311, 352, 896, 4942, 4541, 672, 359, 1053, 457, 85, 878, 352, 10542, 285, 320, 1669, 342, 271, 15231, 32, 187, 187, 6504, 1374, 254, 27, 187, 187, 8457, 326, 457, 84, 1469, 281, 1333, 10954, 13, 533, 359, 476, 457, 85, 816, 4311, 731, 896, 15, 187, 187, 47, 469, 16328, 27, 187, 187, 2302, 13, 285, 326, 457, 84, 253, 1895, 15, 1893, 13, 309, 1599, 1529, 629, 273, 253, 2900, 1060, 310, 326, 581, 273, 253, 1841, 670, 253, 15199, 326, 369, 3240, 247, 747, 2181, 2686, 13, 253, 806, 673, 436, 4592, 275, 619, 45167, 369, 342, 253, 5171, 6018, 839, 15199, 15, 1707, 369, 247, 15199, 1078, 253, 5171, 6018, 839, 15199, 670, 2800, 2607, 1078, 285, 352, 457, 84, 1077, 7746, 326, 387, 253, 990, 273, 253, 9221, 413, 7295, 253, 9221, 413, 15199, 369, 1925, 1108, 309, 1053, 457, 85, 4456, 253, 3522, 533, 1339, 457, 84, 1333, 352, 369, 4437, 253, 1283, 394, 1108, 352, 369, 1925, 253, 12128, 8308, 457, 84, 19190, 21978, 2552, 1283, 394, 7901, 15, 3954, 13, 752, 369, 5171, 6018, 839, 38459, 19901, 1925, 32, 6089, 13, 352, 369, 253, 806, 273, 841, 9351, 273, 7177, 281, 452, 247, 23306, 1416, 352, 369, 1925, 27, 2596, 15963, 15, 1893, 13, 326, 4745, 8599, 368, 326, 359, 457, 250, 4680, 273, 253, 15199, 247, 1652, 2372, 751, 368, 651, 23968, 247, 4023, 15, 1422, 1333, 13, 752, 457, 84, 776, 10014, 32, 6758, 310, 247, 1077, 19532, 2181, 281, 513, 15, 1422, 1537, 513, 326, 387, 253, 990, 273, 253, 1232, 533, 253, 4836, 275, 2914, 273, 368, 310, 281, 1611, 285, 1158, 273, 512, 273, 253, 1841, 326, 476, 320, 2218, 326, 452, 253, 5319, 326, 597, 588, 2126, 952, 387, 2159, 4366, 326, 1110, 952, 476, 840, 320, 557, 47749, 13, 390, 368, 871, 352, 457, 84, 247, 11287, 2181, 13, 285, 326, 352, 5644, 441, 342, 1633, 9865, 15, 187, 187, 6504, 1374, 254, 27, 187, 187, 2598, 13, 752, 457, 84, 271, 1650, 273, 326, 13, 273, 1110, 9351, 273, 7375, 32, 187, 187, 47, 469, 16328, 27, 187, 187, 2598, 13, 368, 812, 452, 8783, 273, 4679, 15, 1422, 812, 452, 667, 10954, 326, 3078, 281, 16263, 247, 9732, 457, 84, 35200, 281, 513, 690, 2238, 273, 2561, 342, 253, 9835, 327, 849, 281, 9798, 1805, 13, 323, 4227, 15, 844, 1900, 878, 625, 5300, 275, 2393, 11948, 2440, 15, 1292, 1024, 969, 13, 368, 1537, 452, 690, 3237, 342, 13642, 436, 896, 533, 5046, 359, 10095, 457, 85, 4311, 352, 896, 15, 1422, 651, 2343, 5458, 253, 29725, 11559, 323, 1728, 13975, 846, 2151, 452, 644, 5686, 13, 368, 871, 13, 25239, 1728, 12941, 13, 14431, 457, 2390, 323, 2393, 11948, 2440, 15, 15643, 11948, 2440, 3839, 15, 8347, 6672, 285, 594, 327, 15, 187, 187, 6504, 1374, 254, 27, 187, 187, 4125, 13, 368, 457, 306, 1694, 479, 4680, 15, 1893, 13, 512, 9351, 273, 5659, 326, 812, 564, 715, 6629, 326, 5082, 457, 85, 320, 9928, 13, 533, 359, 457, 250, 1469, 281, 755, 247, 906, 15, 187, 187, 47, 469, 16328, 27, 187, 187, 24804, 13, 6296, 15, 1244, 275, 1786, 13, 20312, 15, 1244, 273, 2282, 13, 309, 1053, 457, 85, 452, 253, 9172, 281, 436, 15, 831, 310, 247, 2372, 751, 672, 13, 368, 871, 13, 37363, 403, 2668, 745, 8458, 285, 952, 1333, 835, 403, 253, 7375, 6501, 1705, 432, 285, 253, 3662, 310, 359, 1053, 457, 85, 871, 835, 253, 7375, 403, 1469, 281, 1705, 432, 533, 604, 359, 1978, 253, 6982, 1469, 359, 457, 620, 755, 690, 7375, 15, 1893, 13, 253, 24760, 309, 457, 78, 2403, 627, 310, 326, 309, 476, 457, 85, 2028, 368, 13, 309, 476, 760, 1918, 368, 6667, 15, 1244, 368, 871, 271, 1650, 342, 247, 1892, 7856, 327, 310, 14863, 28156, 15, 1292, 627, 403, 8783, 273, 643, 15, 1310, 359, 1691, 776, 13, 368, 871, 13, 309, 1053, 457, 85, 871, 1024, 309, 457, 78, 1469, 281, 755, 2825, 382, 285, 1333, 1691, 776, 1049, 9036, 327, 15, 187, 187, 6504, 1374, 254, 27, 187, 187, 2302, 13, 1053, 457, 85, 15, 187, 187, 47, 469, 16328, 27, 187, 187, 1394, 651, 457, 306, 21023, 326, 13, 7016, 15, 1292, 247, 2602, 7856, 8791, 15, 1244, 352, 9090, 2506, 457, 85, 452, 281, 320, 2330, 342, 2255, 15, 187, 187, 6504, 1374, 254, 27, 187, 187, 2302, 15, 844, 452, 1142, 1821, 2444, 275, 4730, 15, 187, 187, 47, 469, 16328, 27, 187, 187, 18812, 403, 4092, 13, 285, 2255, 457, 84, 789, 310, 417, 4092, 15, 2064, 457, 84, 253, 2181, 326, 309, 1158, 310, 1108, 627, 403, 1077, 1781, 8322, 273, 2208, 2583, 5262, 327, 1327, 14, 10984, 7856, 3510, 273, 1841, 15, 844, 3365, 452, 281, 1691, 776, 4680, 12839, 327, 285, 1980, 45667, 1108, 359, 457, 620, 452, 8783, 273, 1980, 45667, 15, 844, 457, 620, 452, 7590, 15849, 326, 597, 971, 281, 755, 598, 285, 10095, 457, 85, 452, 15, 844, 457, 250, 417, 26169, 247, 4023, 15, 380, 10014, 2506, 457, 85, 452, 281, 320, 1892, 7856, 15, 380, 10014, 310, 27, 2794, 7375, 326, 359, 476, 4311, 896, 15, 187, 187, 6504, 1374, 254, 27, 187, 187, 510, 7596, 310, 253, 13557, 971, 281, 1527, 1633, 15, 1893, 13, 597, 812, 1527, 253, 2143, 35574, 13, 533, 597, 476, 457, 85, 15, 187, 187, 47, 469, 16328, 27, 187, 187, 2773, 457, 84, 987, 13, 326, 457, 84, 987, 15, 1292, 309, 1053, 457, 85, 1158, 326, 15, 309, 1599, 309, 753, 326, 457, 84, 247, 3075, 1127, 285, 594, 326, 457, 84, 816, 1633, 326, 368, 1691, 275, 247, 1618, 273, 1333, 13, 773, 9281, 13, 849, 513, 359, 8415, 326, 7721, 4923, 13557, 476, 564, 281, 6629, 285, 5722, 35186, 323, 253, 941, 5859, 5453, 326, 369, 14597, 984, 273, 253, 15199, 15, 309, 476, 457, 85, 513, 352, 7933, 1223, 309, 2312, 281, 368, 15, 187, 187, 6080, 2074, 5697, 670, 253, 10307, 273, 247, 19026, 1701, 15199, 14859, 1060, 13, 2167, 275, 247, 3740, 326, 457, 84, 417, 281, 619, 9075, 15, 1737, 309, 1599, 407, 326, 310, 326, 352, 457, 84, 1077, 1199, 271, 28572, 5313, 43243, 9100, 625, 327, 2718, 13, 417, 970, 326, 9100, 281, 3157, 616, 5871, 15, 1707, 457, 84, 671, 253, 8542, 3569, 1953, 273, 849, 368, 452, 247, 12061, 275, 9100, 534, 310, 1881, 14, 38390, 839, 347, 776, 2802, 48926, 6821, 13539, 457, 285, 2159, 9479, 1708, 11319, 3652, 2086, 369, 1108, 275, 253, 1083, 273, 1097, 2143, 9195, 285, 14863, 11750, 84, 313, 2004, 627, 497, 643, 1108, 473, 8282, 1108, 3374, 342, 14863, 11750, 84, 534, 403, 417, 4623, 281, 436, 1127, 1108, 285, 3746, 403, 417, 347, 2624, 14, 395, 14, 49461, 347, 253, 840, 45291, 651, 452, 574, 441, 1108, 285, 858, 452, 441, 1108, 2868, 481, 50, 27, 187, 187, 24397, 323, 247, 2969, 1039, 281, 3359, 5044, 2608, 9503, 187, 187, 42, 1353, 3652, 271, 540, 4011, 292, 2898, 970, 7464, 19676, 285, 309, 452, 7320, 619, 4212, 281, 619, 1980, 16025, 13, 7562, 760, 253, 1491, 309, 878, 432, 20049, 36186, 15, 187, 42, 651, 751, 281, 9212, 9503, 281, 619, 4212, 313, 30000, 390, 2608, 10, 285, 4656, 253, 14991, 6849, 15, 209, 187, 2513, 627, 247, 2969, 1039, 281, 513, 436, 1293, 1469, 253, 35981, 7622, 32, 309, 1849, 3261, 715, 352, 285, 352, 3133, 689, 24212, 285, 20509, 2581, 21643, 15, 14815, 627, 320, 247, 1039, 281, 2794, 247, 11839, 966, 534, 812, 320, 908, 347, 271, 22581, 285, 3365, 4656, 6849, 7293, 327, 1655, 2608, 2554, 2867, 32, 187, 187, 34, 27, 187, 187, 42, 1119, 247, 2969, 2900, 323, 1110, 6110, 15, 309, 4425, 281, 3693, 970, 667, 27729, 49230, 17965, 984, 512, 368, 1663, 878, 310, 247, 1332, 326, 10501, 366, 253, 2748, 285, 1529, 281, 2451, 253, 2608, 434, 2554, 15, 496, 619, 11841, 15, 284, 991, 309, 2879, 253, 1563, 1332, 13, 2668, 432, 436, 5311, 1501, 27, 209, 187, 4353, 11683, 64, 8983, 7034, 7737, 366, 6825, 9, 6082, 22647, 13, 11846, 16523, 299, 10, 187, 92, 187, 50274, 2044, 20921, 426, 23953, 5856, 15, 10605, 28, 187, 50274, 338, 313, 11154, 15, 6825, 15, 2513, 7034, 7737, 456, 10, 187, 50274, 92, 187, 50270, 2703, 5456, 9503, 426, 9870, 484, 51, 3841, 2214, 6989, 9, 11154, 15, 6989, 15, 30882, 15, 2402, 558, 187, 50270, 2044, 747, 6989, 426, 747, 44304, 47970, 9, 11154, 15, 6989, 15, 30882, 13, 9503, 558, 187, 50270, 11154, 15, 6989, 426, 22553, 15, 10605, 47970, 426, 747, 6989, 28, 187, 50274, 94, 187, 94, 187, 187, 510, 760, 1332, 368, 452, 281, 3359, 4834, 310, 9870, 484, 51, 3841, 2214, 6989, 15, 27288, 4453, 751, 436, 313, 783, 18077, 82, 588, 3469, 327, 634, 5447, 2605, 13, 309, 452, 495, 7180, 323, 7477, 27, 11447, 13, 27729, 285, 11447, 64, 23536, 2262, 187, 4387, 2876, 5456, 9870, 484, 51, 3841, 2214, 6989, 9, 2703, 22440, 10, 187, 92, 187, 50274, 5302, 313, 3220, 5856, 14073, 426, 747, 2752, 5856, 6649, 187, 50274, 92, 187, 50270, 2044, 2608, 426, 14073, 15, 17104, 15, 6407, 3980, 9671, 9, 86, 3001, 1484, 15, 45212, 15, 16911, 9, 19721, 13, 4605, 23648, 15, 10605, 38687, 36142, 11247, 10, 2785, 1484, 15, 17835, 15, 16911, 9, 19721, 13, 4605, 23648, 15, 10605, 38687, 36142, 11247, 4027, 535, 50270, 2044, 9503, 426, 432, 2936, 275, 2608, 15, 51, 3841, 187, 50258, 4064, 391, 275, 14073, 15, 51, 3841, 187, 50258, 2811, 2936, 15, 23536, 2618, 2295, 391, 15, 23536, 2618, 187, 50258, 7135, 391, 15, 23536, 2402, 28, 187, 50270, 338, 313, 287, 868, 3613, 3635, 10, 187, 50266, 2309, 9503, 15, 1992, 6542, 1874, 187, 50270, 7271, 187, 50266, 2309, 747, 2876, 5456, 551, 7734, 3706, 187, 50274, 94, 187, 94, 187, 187, 5872, 368, 476, 897, 253, 10360, 907, 12182, 279, 275, 634, 27765, 347, 824, 27, 187, 544, 14897, 907, 9, 51, 3841, 426, 346, 41800, 21573, 28532, 187, 1345, 966, 37727, 8929, 1163, 11760, 8929, 535, 2214, 20840, 610, 285, 1916, 2784, 285, 1284, 35128, 27, 21508, 562, 43877, 285, 2624, 715, 13265, 577, 337, 16, 19, 14, 12099, 16334, 15, 13470, 374, 18850, 270, 9587, 12868, 327, 2716, 273, 3790, 13, 6108, 670, 337, 16, 19, 16416, 2112, 9297, 15, 46806, 253, 643, 2716, 273, 43877, 689, 6898, 2716, 13, 14241, 257, 9297, 285, 14393, 407, 17178, 342, 21195, 15, 37780, 436, 5199, 1919, 512, 16334, 403, 20618, 285, 18495, 15, 18681, 1528, 20164, 8741, 2275, 6426, 3534, 253, 1621, 15, 4562, 31122, 14, 14714, 264, 4760, 3240, 247, 3761, 15, 187, 187, 14060, 15, 3436, 13, 4059, 187, 187, 14060, 15, 3495, 13, 4059, 187, 187, 19686, 5529, 45483, 13, 10128, 428, 380, 49365, 1821, 8, 256, 23354, 2285, 8231, 697, 806, 8746, 3761, 273, 253, 4059, 7203, 2952, 1411, 10720, 14, 14714, 264, 10128, 2418, 8330, 13, 818, 14, 17, 15, 187, 187, 5677, 273, 253, 2800, 21864, 10129, 326, 253, 1948, 7151, 70, 398, 29177, 275, 13, 8474, 20164, 8741, 2275, 6426, 11372, 253, 760, 31122, 14, 14714, 264, 21864, 4760, 327, 10128, 2418, 434, 22970, 13, 1621, 15, 4562, 7993, 43120, 2585, 13, 533, 19235, 6497, 2159, 275, 247, 10458, 767, 14, 1178, 6680, 313, 24, 14, 23, 13, 721, 14, 20, 481, 187, 187, 46, 37036, 3189, 74, 13, 33208, 353, 489, 777, 285, 13187, 17145, 962, 512, 574, 4891, 5909, 16226, 1411, 1077, 1175, 10128, 2418, 18062, 3738, 7363, 497, 417, 275, 616, 3718, 15, 19926, 66, 3189, 74, 6497, 281, 4058, 76, 7381, 23249, 266, 257, 275, 4951, 5239, 313, 23, 14, 21, 13, 721, 14, 21, 582, 33208, 353, 489, 777, 313 ]
7 trillion dollars. So, we should ask ourselves the question “what can we spend money on that will firstly employ people, if you know during a downturn and to some extent we have a downturn now”. But it’s a very mild one, we’re still growing at a reasonable rate. What can we spend more money on and employ more people with and at the end of that process, be able to scale it back relatively quickly when we don’t need it anymore and be left with an asset? Interviewer: Because that’s going to say teachers, but we can’t just scale them back. Nicholas: No, and that’s the problem. So, I mean another part of the solution here is that one of the things about the stimulus that was quite a new thing actually, the first time this happened in my recollection was with the Paul Keating stimulus. There was a stimulus before the Paul Keating stimulus about six months before and it’s very telling that at the end of the Hawke Government the Hawke stimulus was called – I don’t remember the date but let’s say it was October the 18th – it was called the Prime Minister’s Economic Statement May 18th 1990. Now, what was Paul Keating Stimulus called? Well, it was the first of these kinds of documents to have a propaganda name it was called: One Nation. So, that immediately tells you that we’re thinking of the stimulus a little bit like you would organize a ball. You say, what’s our theme? Which is a very peculiar thing to do. You might do that at the end of the process but the task in front of you is to try and think of all of the things that can be done that have the characteristics that they will employ people at short notice that those people can then be disemployed, or you know it’s a temporary thing, and that it leads us with something valuable. Interviewer: So, what’s an example of that, of those kinds of jobs? Nicholas: So, you could have lots of experiments. You could have any teachers that wanted to hire a teacher’s aide to do some kind of research with the university on how to teach better, for instance. We always need more resources in early childhood development. But now again, you might have some problems with scaling this back but maybe we shouldn’t scale it back. You would loosen the purse strings for home visiting after children have been born, you know, neonatal home visits, mothers’ groups for early childhood development. Early childhood development generally. Childcare and so on. Interviewer: Now, you’ve got me thinking. So, all kinds of programs that could go into schools that wouldn’t be permanent, but we’re going to get a result. Nicholas: Indeed, indeed. And in health, wherever. And of course, I don’t have the answers to this. This is a bit like when, you know, tariffs are taken off cars and people say where are the jobs gonna come from and the answer is we don’t know where the jobs are going to come from but if we keep the economy going we’ll get some jobs. So, the analogy I’m making there is that I can’t tell you, I can only give you examples. And you know an example with a hard hat on is pink bats. But there are lots of other. If we put our, you know, I don’t know now I’m going to get sexist and say put our aprons on. Interviewer: No, don’t. Nicholas: You would’ve hated that, sorry. But a soft hat anyway. And it obviously doesn’t have to be associated with women. Interviewer: No. We have many men working in education. Nicholas: Men are serious, and women’s work is not serious. That’s the thing that I think is – there are very large amounts of government money spent on non-hard hat types of things. We simply have to put our thinking caps on and local councils – we’ll have lots of local councils. We’ll have pet schemes that they want to get up and shouldn’t have. We’re not organizing a ball. The theme doesn’t have to be hard hat. The theme is: create jobs that we can scale back. Interviewer: The trouble is the politicians want to open something. So, they could open the school halls, but they can’t. Nicholas: That’s right, that’s right. But I don’t think that. I mean I said that’s a pain point and so that’s just something that you put in a list of say, “Okay, how do we solve that?” Because politicians can go to schools and award prizes for the data science club that was funded because of the stimulus. I can’t do it necessarily while I talk to you. Some similar ideas about the efficacy of a feminised stimulus explored here, though in a style that’s not to my taste. What I mean by that is that it’s very much an advocacy piece advocating spending more on systems, not using that spending to improve their operations. There’s also the practical political question of how you have a surge in spending which is self-liquidating as our ‘cash splashes’ and short sharp light infrastructure building program was – in the case of both school buildings and pink batts (though there were other – OHS – issues with pink batts which are not relevant to this point – and themselves are not as cut-and-dried as the then Opposition would have had us – and did have us – believe).Q: Looking for a simple way to implement basic user roles I'm building an intranet application using Windows authentication and I have pulled my users to my local DB, keeping only the information I need from Active Directory. I would like to assign roles to my users (Admin or user) and restrict the admin views. Is there a simple way to do this without going the Identity route? I've looked into it and it seems overkill and honestly rather confusing. Would there be a way to create a utility class which could be used as an annotation and simply restrict views depending on current user role property? A: I found a simple solution for those interested. I decided to avoid using any Role Provider altogether because all you really need is a method that authenticate the request and another to check the user's role. In my Global.asax I added the following method, taken from this blog post: void Application_PostAuthenticateRequest(object sender, EventArgs e) { var ctx = HttpContext.Current; if (ctx.Request.IsAuthenticated) { string[] roles = LookupRolesForUser(ctx.User.Identity.Name); var newUser = new GenericPrincipal(ctx.User.Identity, roles); ctx.User = Thread.CurrentPrincipal = newUser; } } The only method you have to implement yourself is LookupRolesForUser. Mine looks like this (the Linq will depend on your database structure, I have 3 tables for mine: User, Role and User_Role): public string[] LookupRolesForUser(string username) { using (MyContext db = new MyContext()) { var user = db.Users.FirstOrDefault(u => u.Username.Equals(username, StringComparison.CurrentCultureIgnoreCase) || u.Email.Equals(username, StringComparison.CurrentCultureIgnoreCase)); var roles = from ur in user.Roles from r in db.Roles where ur.RoleId == r.RoleId select r.RoleName; if (roles != null) return roles.ToArray(); else return new string[] { }; ; } } Then you can use the Authorize annotion in your controllers as such: [Authorize(Roles = "Administrator")] public class AdminController : BaseController For Pastry and Topping and Assembling: Roll out pastry and cut into twelve 4 1/2-inch rounds. Place 2 tablespoons berry filling on half of round, leaving about 1/2 inch along edges. Fold the other half of pastry over filled half, moisten edges and seal by pressing with fork. Repeat this procedure until all rounds are folded and sealed.Senior Jimmy Roebker gave the No. 31 nationally-ranked player quite a match. Jan. 26, 2014 Jan. 23, 2014 COLUMBUS, Ohio - The Xavier men' s tennis team dropped its first dual match of the 2014 spring season against fifth-ranked Ohio State Wednesday, 7-0. Out of the six singles matches that the musketeers competed in, senior Jimmy Roebker faced the only nationally-ranked singles player on Ohio State's roster, No. 31 Peter Kobelt, but unfortunately fell short in a tough two-set battle (7-6, 6-3). Mesa Mei, Zach Mueck and Adam Krull all had solid opening performances against very good Ohio State opponents although scores were not in their favor. Mesa Mei fell to Herkko Pollanen in straight sets (6-4, 6-4), Zach Mueck (
[ 285, 5119, 26426, 3177, 281, 3540, 1066, 253, 6858, 457, 84, 3101, 28, 2112, 253, 1039, 597, 13329, 3253, 432, 5654, 3659, 3167, 1131, 281, 1264, 20567, 15, 313, 11831, 20567, 32, 773, 1231, 457, 250, 275, 271, 3654, 590, 2, 7521, 5119, 354, 28803, 2698, 380, 35500, 310, 625, 298, 2435, 301, 1060, 685, 275, 1142, 16363, 3243, 272, 13305, 1108, 1014, 342, 247, 5389, 13, 11694, 282, 14, 88, 28456, 1113, 311, 14, 4093, 272, 1850, 276, 1003, 323, 253, 20985, 387, 1728, 13, 253, 921, 1335, 6337, 247, 1652, 2159, 13, 581, 273, 247, 1180, 273, 13305, 48086, 342, 3275, 20219, 1108, 533, 19143, 13, 326, 457, 84, 642, 49917, 15, 4952, 253, 2839, 14, 66, 14, 41506, 14, 41506, 16363, 3243, 272, 13, 30101, 323, 697, 3158, 14, 11342, 8913, 350, 13, 22828, 673, 281, 19309, 323, 6345, 285, 4887, 387, 2828, 78, 505, 553, 15, 187, 187, 3655, 15, 9463, 947, 20293, 3519, 1108, 914, 42256, 4716, 19341, 187, 187, 22396, 16, 38547, 374, 16, 9755, 34, 1250, 327, 41037, 27481, 407, 16553, 13856, 13, 3542, 407, 2516, 444, 15, 367, 276, 463, 187, 187, 35313, 5308, 369, 581, 273, 253, 954, 30357, 10382, 8711, 284, 273, 253, 1390, 9976, 13, 253, 2926, 273, 1355, 3874, 835, 5810, 14782, 616, 15060, 327, 616, 37318, 285, 14021, 21311, 6337, 1029, 15, 20580, 11471, 533, 1620, 278, 28989, 763, 13, 697, 9978, 1108, 1943, 14, 21280, 7345, 21130, 7233, 9727, 281, 247, 1355, 3874, 13, 767, 2151, 275, 12413, 13, 275, 253, 31433, 273, 521, 4475, 457, 84, 2471, 1108, 369, 271, 28561, 14, 31094, 22802, 745, 1127, 323, 247, 921, 440, 2320, 46088, 281, 11449, 1495, 457, 84, 7881, 1481, 14, 251, 15, 7850, 1533, 14, 22157, 369, 1273, 281, 5293, 13, 49378, 247, 18248, 10825, 285, 247, 1524, 3282, 273, 1659, 4768, 697, 1740, 12396, 15, 187, 187, 10951, 14, 13263, 9449, 9037, 914, 42256, 4716, 19341, 9010, 247, 1180, 273, 253, 2962, 457, 29386, 5810, 387, 2834, 2792, 275, 616, 4852, 13, 285, 253, 4651, 275, 616, 4852, 403, 26952, 281, 660, 23725, 616, 4105, 7089, 15, 11832, 41504, 3358, 556, 1694, 3206, 275, 247, 2954, 342, 21661, 13, 521, 7586, 457, 84, 5366, 656, 4069, 28, 16136, 7345, 29271, 34084, 9365, 521, 1211, 23490, 672, 6122, 22138, 10316, 3076, 14, 14889, 27145, 9368, 23509, 1728, 323, 247, 13319, 11484, 15, 733, 457, 84, 417, 253, 43719, 9449, 13, 533, 387, 1878, 21130, 310, 4560, 1220, 584, 275, 521, 1211, 747, 14541, 2954, 2866, 1919, 6122, 6304, 571, 4850, 5448, 273, 752, 457, 84, 1469, 327, 15, 187, 187, 3547, 15, 16341, 40804, 1703, 1108, 380, 6625, 1653, 187, 187, 19642, 16, 22166, 16, 7857, 34, 1250, 327, 15501, 27481, 285, 3542, 407, 22757, 18854, 5914, 285, 21130, 9516, 187, 187, 510, 40318, 273, 6282, 48085, 369, 697, 6459, 15231, 15, 496, 253, 17716, 273, 2722, 751, 330, 4063, 5402, 3035, 394, 28954, 4542, 13, 20477, 497, 13155, 285, 12112, 13, 347, 253, 35798, 1342, 2021, 497, 14659, 281, 1965, 87, 885, 15, 2064, 3061, 3977, 281, 253, 1264, 2151, 1108, 23239, 13, 6029, 285, 25062, 1108, 13716, 2190, 253, 954, 15958, 2151, 275, 17325, 13, 4680, 13, 8288, 285, 8534, 751, 13241, 5753, 15, 380, 921, 457, 84, 806, 9449, 2714, 3936, 2120, 5750, 273, 326, 2336, 261, 303, 300, 3396, 13, 347, 14423, 272, 6258, 275, 253, 35798, 1342, 11692, 4566, 1066, 275, 389, 1037, 10501, 8142, 15, 187, 187, 1088, 625, 27, 444, 15, 53, 15, 285, 49867, 1720, 328, 614, 275, 9449, 27811, 187, 187, 6872, 5753, 403, 5347, 14, 66, 24659, 1108, 6029, 3916, 4848, 1653, 1108, 390, 28840, 1108, 452, 15661, 521, 19110, 28, 25062, 40925, 275, 247, 44064, 38163, 273, 275, 1351, 3533, 1108, 533, 368, 476, 457, 85, 1361, 533, 11435, 616, 3033, 1417, 13, 642, 14, 15532, 14, 2009, 433, 12046, 4404, 1495, 15, 733, 1663, 1057, 9232, 253, 5471, 273, 752, 352, 457, 84, 751, 281, 247, 1429, 327, 14423, 272, 6258, 15, 32867, 2811, 13, 627, 403, 7350, 326, 8481, 324, 556, 4783, 5816, 432, 253, 1711, 952, 457, 84, 1728, 13, 285, 29835, 26062, 457, 2455, 14, 1258, 461, 2122, 12247, 26411, 310, 43922, 1076, 689, 25824, 11157, 2606, 12942, 15, 187, 187, 3677, 15, 9242, 10810, 35649, 48160, 1108, 329, 15997, 6053, 19293, 9449, 187, 187, 22396, 16, 38547, 495, 16, 8602, 34, 1250, 327, 34444, 27481, 407, 500, 15, 11418, 20358, 249, 13, 3542, 407, 25413, 2639, 332, 187, 187, 1628, 34, 10396, 23952, 318, 1806, 7211, 253, 13767, 327, 14, 14396, 4060, 3120, 17691, 6053, 19293, 457, 84, 760, 9449, 9037, 15, 733, 457, 84, 417, 3430, 27, 436, 310, 247, 12338, 13, 18935, 13, 15997, 6053, 19293, 9449, 6296, 15, 5769, 285, 19172, 13, 13189, 665, 20269, 1066, 247, 8485, 3781, 273, 34612, 14965, 285, 33262, 13, 403, 275, 11314, 13, 34735, 247, 3416, 3692, 5938, 556, 15159, 1475, 9449, 673, 15, 187, 187, 1088, 625, 27, 1737, 41091, 7395, 6053, 19293, 28593, 33341, 32, 187, 187, 16628, 569, 273, 253, 773, 11924, 14, 2019, 666, 668, 1108, 253, 20711, 25232, 273, 1711, 659, 15, 13104, 13, 247, 4473, 11797, 407, 38209, 824, 347, 17145, 1301, 316, 1108, 4245, 1039, 281, 253, 8900, 273, 47372, 17373, 313, 38358, 407, 12435, 43211, 281, 10956, 9449, 347, 359, 871, 779, 3063, 10, 3192, 17651, 1966, 38558, 21051, 15, 308, 1215, 13, 25758, 5017, 13, 533, 352, 457, 84, 298, 2575, 342, 253, 921, 457, 84, 26014, 19311, 15, 11960, 6816, 562, 253, 13862, 671, 27, 247, 19883, 10299, 2135, 3425, 13, 359, 9367, 4768, 253, 9037, 1463, 13, 281, 581, 273, 5769, 285, 19172, 457, 84, 11948, 2828, 78, 1169, 15, 733, 298, 1727, 253, 9037, 247, 2176, 26326, 285, 20978, 414, 326, 352, 1663, 5373, 432, 13, 253, 17489, 273, 28232, 2403, 323, 3962, 49799, 18066, 422, 794, 15, 187, 187, 1967, 15, 17450, 45638, 37784, 1108, 49954, 5721, 292, 6166, 187, 187, 19642, 16, 22166, 16, 9755, 34, 1250, 327, 15501, 27481, 407, 16246, 7889, 5969, 13, 3542, 407, 5490, 20069, 6595, 285, 23259, 7233, 187, 187, 510, 22663, 31924, 5262, 9449, 342, 441, 327, 271, 13943, 7457, 15530, 13, 533, 49954, 5721, 292, 6166, 310, 253, 1682, 273, 253, 12190, 13, 247, 11996, 9037, 3542, 387, 253, 5241, 273, 253, 921, 457, 84, 9136, 15, 6029, 285, 20222, 13, 342, 8228, 2151, 13104, 13, 14884, 90, 285, 6277, 13, 403, 10960, 327, 253, 308, 4338, 1563, 247, 1388, 5262, 9449, 12701, 27, 1955, 281, 25345, 3237, 13, 253, 6194, 310, 7591, 281, 2118, 15, 187, 187, 53, 5354, 285, 1565, 5726, 6054, 275, 253, 1531, 17263, 1113, 26074, 347, 253, 2021, 270, 13749, 13, 1315, 461, 4427, 8704, 16479, 13, 285, 3839, 2847, 18066, 422, 31795, 406, 15, 380, 9037, 310, 253, 1390, 281, 4735, 13104, 347, 247, 3963, 1894, 28, 521, 16018, 369, 2234, 281, 253, 2962, 1066, 12615, 13, 285, 7487, 436, 9037, 13, 352, 457, 84, 417, 2834, 281, 923, 2139, 27, 521, 749, 14095, 13, 7668, 253, 7289, 273, 3673, 1070, 1824, 281, 31391, 90, 16479, 13, 310, 17325, 5328, 13, 285, 37204, 19629, 17347, 84, 275, 253, 12794, 46660, 1632, 15, 6911, 44056, 457, 84, 6029, 310, 327, 1175, 830, 1512, 27, 521, 22014, 285, 10397, 310, 36385, 494, 15, 187, 187, 2090, 15, 3003, 378, 9324, 8973, 8835, 5757, 7840, 4290, 1108, 8679, 14026, 1916, 12238, 3032, 308, 790, 3683, 6282, 13, 1893, 754, 2101, 1727, 9449, 17363, 496, 380, 8896, 187, 187, 22396, 16, 38547, 577, 16, 20778, 34, 1250, 327, 21946, 27481, 407, 5490, 7634, 8111, 13, 3542, 407, 6270, 2790, 1962, 1440, 708, 16246, 308, 1032, 265, 187, 187, 18562, 634, 16298, 3683, 773, 90, 43730, 668, 327, 9449, 17363, 310, 642, 14, 531, 457, 84, 2934, 273, 794, 13, 533, 352, 19539, 3782, 28637, 323, 39738, 8679, 14089, 2205, 313, 26845, 1457, 23110, 582, 3692, 19328, 1255, 387, 253, 11091, 273, 1907, 824, 271, 4254, 275, 521, 2456, 84, 310, 509, 8055, 407, 30375, 326, 521, 15339, 310, 271, 385, 14, 15325, 273, 521, 15, 380, 8679, 1457, 23110, 10684, 369, 253, 806, 273, 8679, 457, 84, 1264, 1790, 681, 84, 13, 285, 4558, 253, 19508, 15, 187, 187, 26845, 1457, 23110, 1900, 2684, 1682, 347, 247, 4951, 637, 275, 247, 1533, 273, 5825, 44144, 13, 285, 326, 294, 7760, 43503, 275, 436, 13521, 13, 275, 534, 253, 6459, 9506, 497, 1110, 835, 8679, 29771, 253, 8921, 1533, 1475, 779, 1108, 1060, 13, 326, 19539, 281, 320, 253, 13667, 5954, 465, 645, 90, 15339, 15, 3032, 6355, 342, 617, 403, 253, 794, 8311, 383, 9506, 273, 253, 921, 13, 347, 703, 42255, 1837, 3544, 779, 2007, 1066, 715, 253, 277, 744, 49276, 15, 187, 187, 2358, 15, 39669, 35, 35867, 388, 42564, 5642, 51, 1830, 1108, 38292, 388, 684, 9449, 187, 187, 22396, 16, 38547, 337, 16, 9204, 34, 1250, 327, 530, 15332, 27481, 407, 399, 2477, 466, 17419, 13, 3542, 407, 329, 314, 1665, 401, 1312, 708, 14355, 2070, 51, 10986, 187, 187, 27503, 9384, 457, 84, 762, 14092, 2180, 1790, 681, 1108, 1158, 247, 2206, 45756, 8118, 14, 7878, 5508, 327, 380, 26733, 20175, 390, 380, 48261, 84, 1108, 369, 581, 273, 253, 794, 8311, 383, 13, 1682, 14, 45912, 25795, 447, 327, 5579, 1309, 697, 1740, 14, 13263, 1408, 15, 5729, 32980, 342, 247, 1379, 327, 9384, 457, 84, 1211, 2444, 14, 2437, 11948, 275, 47677, 14, 998, 7352, 1634, 386, 11126, 49188, 14, 998, 7352, 28455, 1457, 2816, 13, 697, 44690, 409, 2182, 1007, 387, 3374, 273, 966, 13, 2675, 16239, 285, 5492, 564, 4457, 1110, 273, 667, 643, 1790, 681, 273, 253, 747, 45660, 15, 733, 457, 84, 642, 8404, 11709, 16507, 13, 2167, 27, 352, 457, 84, 671, 8691, 20595, 11755, 13, 9628, 253, 1072, 694, 471, 323, 21899, 17325, 347, 9384, 457, 84, 1462, 14, 484, 33255, 15, 187, 187, 1088, 625, 27, 380, 9567, 9449, 19345, 447, 327, 388, 21362, 187, 187, 1628, 35485, 388, 684, 9449, 668, 9010, 253, 921, 327, 1270, 830, 13, 347, 275, 271, 11797, 19152, 13, 253, 2143, 457, 84, 45364, 2739, 4446, 7819, 562, 281, 320, 275, 8596, 273, 11007, 457, 1211, 2021, 15, 2058, 1728, 13, 11007, 12325, 323, 247, 11255, 1342, 323, 9449, 13, 533, 253, 2021, 476, 457, 85, 7848, 352, 28, 26614, 13, 5662, 4929, 30864, 556, 2183, 1652, 7586, 14861, 66, 326, 12126, 457, 84, 417, 1524, 13, 285, 1024, 703, 457, 84, 5068, 281, 1953, 3253, 703, 1869, 703, 3260, 670, 617, 4651, 457, 11847, 281, 33773, 15, 401, 17259, 13, 2032, 14, 936, 14, 8206, 2144, 15, 187, 187, 2251, 15, 3003, 2949, 35, 2025, 10663, 1400, 6117, 1108, 1594, 6681, 7021, 187, 187, 19642, 16, 30301, 337, 16, 8012, 329, 1250, 327, 444, 21, 27481, 407, 17419, 13051, 13, 3542, 407, 12304, 251, 2325, 265, 2205, 708, 309, 404, 17771, 187, 187, 52, 7232, 310, 1495, 347, 4782, 27517, 8564, 352, 28, 380, 496, 17352, 398, 310, 29386, 1495, 347, 352, 2686, 310, 15, 380, 1801, 1351, 13, 23293, 1331, 982, 273, 4130, 457, 84, 18069, 1387, 273, 15515, 14, 630, 8909, 33889, 1160, 323, 1264, 2962, 273, 13667, 5954, 34019, 14657, 13, 347, 3253, 326, 812, 564, 3430, 323, 841, 1740, 8290, 858, 15, 3973, 14, 22253, 5857, 773, 57, 6681, 7021, 668, 310, 642, 6517, 15, 380, 18066, 422, 2952, 320, 777, 790, 13, 285, 7395, 310, 10544, 16782, 273, 253, 2143, 9449, 7021, 7039, 313, 1615, 4284, 1108, 642, 14, 531, 2010, 556, 3732, 481, 187, 187, 7420, 1148, 569, 5276, 8127, 313, 395, 389, 1037, 10, 28008, 13, 285, 327, 3128, 2360, 13, 7395, 310, 7514, 326, 4130, 588, 4456, 253, 2360, 347, 247, 5699, 27531, 15, 3656, 21680, 320, 777, 251, 13, 2167, 28, 14698, 2581, 13644, 10224, 281, 259, 3288, 30582, 2639, 965, 13, 16246, 29212, 285, 31594, 275, 247, 12246, 281, 1056, 247, 747, 3331, 13, 285, 247, 2581, 594, 4396, 1070, 26298, 9437, 281, 3802, 462, 253, 16775, 9732, 15, 733, 457, 84, 10610, 496, 17352, 398, 2144, 13, 44491, 342, 247, 26757, 5954, 717, 35232, 24329, 14, 10383, 1108, 275, 253, 5968, 273, 253, 2952, 1108, 275, 253, 3128, 457, 84, 31433, 15, 187, 187, 2526, 15, 22428, 7611, 2350, 6527, 1108, 1594, 6681, 16061 ]
and David desperately attempt to track down the baby’s mother; along the way they encounter everything from gunpoint hostages to three Kings. (Three Kings? “We’re in an allegory!”, David proclaims.) The pacing is more languid here than in many Moonlighting episodes – even with a beautiful, cockle-warming carol-singing denouement for the viewers at home, the show still ran a little short, one of a number of episodes plagued with production delays – but surprisingly, that’s no detriment. Even the rat-a-tat-tat Moonlighting, renowned for its quick-fire banter, deserves time to pause for breath and reflect at Christmastime. 73. EVERWOOD – Unhappy Holidays USA/Season 2/2003Aired on WBdirected by Jason Moore, written by John E. Pouge Everwood was one of the most enjoyable serial dramas of the last decade, the story of small town where characters wore their hearts on their sleeves and emotions permanently ran high. Sentimental but never mawkish, its setup – big-city doctor Andy Brown moves to a small town, two children in tow, in the aftermath of his wife’s death – was an emotionally-charged jumping off point for a show unafraid to confront life’s challenges head-on. Its world-building was second to none, crafting a loving atmosphere and a real sense of place throughout its four seasons. Second-season Christmas episode Unhappy Holidays finds a number of the series’ teenage characters at difficult points in their lives, and the parents in their lives are helpless to scupper their poor decisions. Son Ephram has got involved in a relationship with Madison, his sister’s babysitter; rival doctor Harold Abbott faces his own struggles when daughter Amy brings bad-boy Tommy Callahan home for a holiday meal. It’s not the brightest Christmas, but at least Andy is finding solace in his own newfound relationship… until daughter Delia gets wind of what’s going on. 72. OUTNUMBERED – The Robbers UK/Special/2009Aired on BBCdirected and written by Guy Jenkin and Andy Hamilton The authenticity of Outnumbered was its greatest asset. In the vein of shows like Curb Your Enthusiasm, scripts were loose and flexible, as the Brockman family were encouraged to improvise. That decision led to the three children – Jake, Ben and Karen – rating among the most realistic children in comedy, thinking, speaking and acting like genuine kids. The show’s first Christmas special takes full advantage of that verisimilitude, as Boxing Day in the Brockman household goes down in comically authentic fashion. read more: E.T. and Elliot Reunite in Christmas Commercial These kids are capital-a annoying – Ben claims robbers – or aliens – have stolen his pants; Karen engages in a relentless torrent of inane questions – but you can’t help but appreciate their boundless, no-holds-barred attitude towards life. It really does capture the feeling of what it’s like to a child on Boxing Day. Elsewhere, there are concerns that Grandad has gone missing from the old people’s home, and Hugh Dennis’ ever-flustered dad Pete is fretting over unwanted lunchtime visitors. 71. SUPERNATURAL – A Very Supernatural Christmas USA/Season 3/2007Aired on CWdirected by J. Miller Tobin, written by Jeremy Carver “A Special Presentation,” notes the retro on-screen title card preceding Supernatural’s only Christmas episode. It’s not wrong: this is a violent, twisted, Very Supernatural Christmas indeed. Sam and Dean, brothers who hunt down a vast array of supernatural beings and demons, are in Michigan, assisting a woman whose husband has disappeared around Christmas time. read more: What Legacy Will Supernatural Leave Behind? Considerations of the “anti-Claus” – the antithesis of old St. Nick, a concept inspired by legends such as Krampus – gives way to the discovery of pagan gods (inspired by spiritual predecessors to Father Christmas as we know him today) taking ritual human sacrifices annually. Tense, disturbing stuff, but it’s laced with the show’s trademark wit. Balancing out the darkness also: a touching flashback sequence, weaved throughout the episode proper, to one of Sam and Dean’s childhood Christmases. It lends the episode a certain warmth and levity that it really benefits from, the mesh of tones making for perfect unconventional festive fun. 70. MY FAMILY – Sixty Feet Under UK/Special/2003Aired on BBCdirected by Jay Sandrich, written by James Hendrie and Ian Brown The Harper clan spent Christmas with us on an impressive nine occasions, but Sixty Feet Under is the best of the bunch, a bottle episode written at the peak of the show’s powers. Ben and Susan, with grown children Nick, Janey and Michael, are stuck on the Tube following a day spent Christmas shopping: due to signalling problems, the train is unable to move. Tensions and tempers rise in the cramped carriages as the family bicker, frustrate surrounding passengers, and generally cause festive havoc. The episode is the last to feature Nick as a regular character; his departure was key to the series downfall, and watching this episode, it’s not difficult to see why: his subplot, involving the sale of bottled water to thirsty passengers, is comedy gold, and Kris Marshall revels in the inherent silliness. Robert Lindsay’s Ben is on good form too: his frustration and anxiety is palpable. 69. THE BOB NEWHART SHOW – Bob Has To Have His Tonsils Out, So He Spends Christmas Eve In The Hospital USA/Season 4/1975Aired on CBSdirected by James Burrows, written by Tom Patchett & Jay Tarses Having your tonsils “yanked” on Christmas Eve is no-one’s idea of fun, but it proves particularly unpleasant for psychiatrist Bob Hartley (Bob Newhart), whose awkwardness at the prospect of having such an operation in his 50s is compounded by discovering that his nurse is an ex-patient of his. The Bob Newhart Show was the first of Bob’s three sitcoms, and remains the strongest. Bob Newhart always performed best as a straight man in a world of nutjobs, and that reaped dividends in this programme, in which the greatest moments were those where Bob reacted the strange world around him – here, that proves to be the brilliantly kooky nurse. His interactions with her are the funniest moments of the show, as she inadvertently drags him further down into the doldrums. 68. EVERYBODY HATES CHRIS – Everybody Hates Christmas USA/Season 1/2005Aired on UPNdirected by Dennie Gordon, written by Alyson Fouse & Ali LeRoi Chris Rock’s underrated period sitcom – think a satirical African-American spin on The Wonder Years or The Goldbergs – was one of the funniest, best-observed comedies on TV during its four-season run. Preoccupied with a take on Rock’s own working-class childhood in Bedford-Stuyvesant (“Bed-Stuy”), New York, its uncompromising look at issues of class, social mobility and race go beyond those of any other sitcom of the new millennium. It’s no Social Studies lesson, though: it’s also fantastically funny, sharing the same knack for observational comedy as Rock’s stand-up routines. read more: The Best Christmas Movies on Hulu “Everybody Hates Christmas” finds the show on great form, as in an inspired twist, the school’s canned food drive turns out to be in aid of Chris’ own family. At home, Chris asks for a Walkman for Christmas, but the family can’t afford it; meanwhile, older brother Drew has told little sister Tonya that Santa’s not real, and now she’s beginning to question everything she thought she knew about her parents’ commitment to honesty. Funny, true-to-life material. 67. THE INBETWEENERS – Xmas Party UK/Series 1/2008 Aired on E4directed by Gordon Anderson, written by Damon Beesley & Iain Morris Skins is life as British teens imagine it; The Inbetweeners is teenage life as it actually is. The profane, unfortunate antics of everyone’s favourite group of sixth-form oddballs made for three series of brilliantly embarrassing viewing, as everything that could go wrong for these four boys did. First-series entry “Xmas Party” is no exception. The festive season beckons, and Will is elected chairman of the school Christmas Party Committee (by default – no-one else has applied). Preparations prove largely (and comically) unsuccessful, and on party night, Will is concerned that everyone will remember the night as a huge disappointment. Distractions beckon, though; Simon rather publicly fails to woo crush Carli, Jay crashes and burns in a bid to make a new friend, and a rather sozzled Neil attempts to snog the biology teacher. It’s classic Inbetweeners material, capped with a pleasantly amicable piss-about – in the spirit of the season – in the party’s aftermath. 66. NEWSRADIO – Xmas Story
[ 18714, 2792, 370, 89, 393, 249, 353, 5, 313, 2887, 1008, 9263, 8469, 2498, 1707, 403, 671, 6667, 275, 534, 253, 2701, 275, 253, 5150, 310, 4577, 685, 253, 17597, 15579, 323, 271, 1527, 873, 273, 16012, 313, 2887, 1008, 9263, 9387, 19, 2498, 187, 187, 34, 42601, 16751, 310, 753, 281, 320, 17568, 7895, 313, 2887, 1008, 9263, 8469, 3291, 604, 627, 310, 247, 6486, 1180, 370, 76, 5, 824, 326, 512, 28600, 982, 12873, 271, 10341, 4667, 273, 2792, 275, 253, 16751, 476, 320, 13230, 407, 370, 76, 5, 1127, 24238, 15, 733, 310, 11464, 275, 1008, 9263, 8469, 62, 326, 253, 1180, 273, 28600, 982, 342, 2978, 669, 3040, 308, 5, 875, 1046, 4667, 273, 2792, 275, 247, 17568, 7895, 16751, 17202, 10661, 1365, 347, 370, 53, 393, 936, 393, 3259, 1352, 4794, 281, 253, 1543, 273, 353, 15, 443, 409, 729, 285, 416, 15, 7057, 6621, 860, 313, 2887, 1008, 46, 1351, 6660, 253, 7936, 1387, 273, 824, 247, 16751, 310, 14257, 5296, 35741, 13, 285, 253, 17597, 15579, 273, 697, 35917, 2685, 310, 5058, 15, 5488, 13, 604, 247, 17568, 7895, 16751, 556, 642, 27442, 2792, 13, 840, 352, 310, 6507, 15, 831, 3637, 432, 253, 7503, 5296, 11714, 1371, 273, 697, 7936, 1387, 2057, 3066, 253, 39383, 273, 330, 7292, 14, 10859, 287, 16478, 285, 7634, 5477, 14, 42, 6148, 729, 13, 390, 407, 247, 625, 3332, 789, 273, 2070, 3026, 19020, 1008, 45, 2275, 1570, 187, 187, 688, 253, 1246, 3929, 359, 1908, 253, 1083, 835, 253, 1180, 273, 28600, 982, 17202, 10661, 1365, 13, 323, 1650, 247, 8566, 42601, 16751, 326, 310, 17568, 7895, 15, 844, 1263, 275, 2508, 767, 6667, 27, 247, 2629, 16657, 285, 247, 6507, 32621, 342, 581, 5024, 15, 496, 253, 4112, 835, 253, 6425, 16095, 273, 253, 9297, 273, 253, 4216, 403, 23352, 3907, 689, 253, 1673, 273, 8870, 3904, 13, 627, 310, 247, 581, 14, 936, 14, 531, 17668, 875, 253, 2069, 275, 534, 253, 4201, 273, 747, 14299, 20342, 6634, 285, 46214, 5482, 273, 11968, 4872, 11370, 835, 253, 987, 1133, 1930, 18207, 370, 53, 1352, 6102, 25930, 12893, 275, 1180, 3762, 13, 10775, 275, 253, 1783, 273, 253, 20185, 3879, 273, 253, 1180, 273, 27959, 273, 3626, 3904, 15, 844, 476, 6983, 253, 1543, 273, 443, 15, 41, 15, 29944, 285, 322, 15, 29421, 10441, 266, 13, 500, 15, 55, 15, 530, 1033, 561, 4742, 13, 443, 15, 416, 4788, 12844, 13, 367, 15, 37602, 28544, 285, 2571, 15, 496, 776, 1083, 13, 253, 2978, 273, 253, 28600, 982, 588, 417, 320, 247, 3425, 273, 3626, 3904, 15, 3813, 13, 387, 253, 806, 3924, 273, 776, 2561, 359, 4044, 760, 271, 5170, 3033, 432, 253, 8946, 1543, 15, 1623, 253, 643, 1133, 13, 247, 2406, 3033, 369, 11464, 275, 1008, 1206, 6678, 1092, 10775, 323, 11968, 1180, 273, 9297, 669, 32067, 47, 9, 53, 1009, 17202, 7938, 685, 667, 14189, 15, 14772, 359, 1119, 247, 4602, 875, 253, 1895, 359, 574, 5421, 285, 3533, 14475, 275, 253, 1263, 273, 43513, 14, 35147, 21412, 3678, 15579, 13, 534, 275, 3332, 1107, 369, 4824, 562, 407, 657, 15, 49, 15, 12962, 21412, 285, 657, 15, 38, 15, 427, 11983, 1479, 968, 76, 2886, 15, 844, 908, 247, 4072, 906, 273, 657, 15, 38, 15, 427, 11983, 1479, 968, 76, 2886, 313, 2887, 1008, 306, 64, 79, 3291, 281, 4044, 20185, 23276, 323, 253, 42407, 273, 253, 1180, 273, 14299, 20342, 327, 253, 5024, 15, 1310, 4872, 14275, 689, 669, 1991, 92, 50, 724, 1057, 417, 2186, 313, 10328, 4112, 310, 5604, 1896, 984, 359, 476, 1014, 452, 1142, 28600, 982, 342, 253, 1072, 2978, 13, 923, 299, 15, 72, 15, 1008, 11063, 77, 1171, 6660, 253, 4795, 20185, 7212, 4916, 271, 5170, 3033, 323, 669, 32067, 47, 9, 53, 3822, 733, 943, 320, 4879, 326, 253, 1072, 1543, 476, 320, 2797, 970, 5733, 1483, 27426, 12128, 11057, 6899, 432, 1008, 18933, 36470, 12432, 379, 1570, 329, 4382, 3368, 5196, 26277, 342, 473, 15, 55, 15, 34804, 40610, 556, 5783, 253, 36594, 273, 253, 8197, 15, 380, 9864, 1543, 323, 247, 25701, 4216, 2797, 407, 36976, 247, 2978, 273, 253, 16657, 403, 671, 1677, 275, 1008, 1206, 6678, 1570, 187, 187, 49, 34466, 16157, 285, 14308, 187, 33585, 187, 187, 34, 3921, 29284, 456, 4216, 4622, 310, 247, 17597, 2317, 13, 2797, 432, 247, 7982, 4216, 407, 15706, 13388, 407, 6032, 28236, 273, 10103, 767, 390, 1264, 15, 11680, 247, 6486, 1180, 273, 6032, 3426, 42601, 28236, 370, 46, 64, 75, 1366, 285, 247, 1180, 273, 13288, 669, 2733, 64, 74, 1366, 39433, 342, 3963, 30364, 45031, 15, 1198, 1016, 21229, 370, 90, 5, 273, 271, 10341, 8223, 669, 2733, 64, 75, 5, 4993, 247, 1127, 669, 3582, 340, 5, 327, 581, 273, 253, 28236, 370, 46, 64, 76, 16446, 359, 5467, 512, 2792, 669, 3582, 340, 5, 281, 320, 5799, 15, 329, 25701, 4216, 669, 4220, 64, 69, 5, 310, 247, 26860, 2317, 273, 253, 28465, 2020, 669, 2760, 18858, 6837, 64, 76, 187, 50276, 46, 64, 76, 61, 2760, 18858, 6837, 64, 75, 61, 2733, 64, 75, 5, 407, 253, 19945, 370, 90, 393, 3549, 393, 3582, 340, 1352, 187, 187, 510, 40598, 5150, 327, 247, 25701, 4216, 310, 2931, 347, 3637, 313, 2887, 1008, 21279, 62, 285, 1008, 1206, 6678, 62, 323, 7000, 8813, 28, 253, 3236, 5697, 497, 3559, 275, 1008, 7073, 2947, 49, 580, 2498, 187, 187, 1466, 370, 55, 5, 320, 247, 1524, 21392, 5415, 1159, 327, 370, 393, 4220, 64, 69, 1366, 6032, 327, 253, 9297, 15, 1281, 370, 55, 64, 75, 5, 285, 370, 55, 64, 76, 5, 320, 13133, 273, 370, 55, 5, 281, 669, 2733, 64, 75, 5, 285, 281, 370, 46, 64, 76, 5, 2975, 15, 11680, 247, 1480, 2020, 370, 187, 50276, 61, 8752, 92, 41, 2000, 17, 2029, 36985, 61, 10423, 578, 75, 30, 18, 1990, 38, 889, 1274, 19724, 1124, 92, 73, 63, 19, 1217, 19, 889, 1124, 464, 78, 9194, 63, 19, 2704, 78, 9194, 187, 50276, 91, 64, 75, 63, 19, 6643, 55, 64, 75, 61, 918, 1572, 36985, 61, 10423, 578, 76, 30, 18, 1990, 55, 889, 1274, 19724, 1124, 92, 73, 63, 19, 1217, 19, 889, 3442, 64, 76, 12, 187, 50276, 55, 64, 76, 61, 918, 10, 370, 342, 253, 5028, 370, 41, 63, 19, 1035, 4220, 7182, 36985, 61, 10423, 578, 75, 30, 18, 1990, 38, 94, 41, 63, 19, 1035, 2733, 64, 75, 1572, 36985, 61, 10423, 578, 76, 30, 187, 50276, 18, 1990, 55, 94, 388, 63, 19, 9, 46, 64, 76, 34488, 3856, 669, 1124, 464, 78, 9194, 63, 19, 2704, 78, 9194, 1182, 64, 75, 63, 19, 724, 310, 271, 5572, 273, 253, 1273, 4309, 327, 669, 2733, 64, 75, 5, 342, 1675, 281, 247, 4229, 30364, 45031, 342, 38430, 7548, 2515, 13, 669, 3442, 64, 76, 5, 310, 253, 49603, 1253, 15343, 1206, 7588, 5572, 327, 370, 46, 64, 76, 1352, 187, 187, 13811, 18712, 36487, 380, 3921, 10859, 83, 38052, 5572, 4622, 669, 8752, 92, 41, 724, 310, 247, 1881, 14, 44121, 6880, 273, 253, 12400, 669, 8752, 92, 41, 64, 17, 8589, 578, 45, 3303, 835, 370, 187, 50276, 45, 2029, 464, 4144, 61, 249, 388, 63, 19, 1035, 4220, 10853, 3362, 393, 4144, 9, 90, 64, 84, 4010, 17, 61, 34580, 187, 187, 25906, 273, 253, 5572, 669, 8752, 92, 41, 724, 4428, 3470, 342, 34001, 275, 253, 2792, 370, 90, 64, 75, 1352, 39431, 13, 1339, 370, 40, 9, 89, 13, 90, 1337, 2260, 1009, 320, 253, 6115, 1159, 327, 370, 46, 64, 76, 5, 313, 49112, 10295, 273, 253, 37732, 2254, 10, 273, 669, 3442, 1366, 3969, 281, 253, 9879, 4764, 669, 2260, 1352, 831, 1159, 556, 253, 1563, 12139, 20290, 347, 370, 89, 61, 936, 340, 18965, 370, 40, 9, 89, 13, 90, 1337, 2260, 4010, 39, 64, 17, 9, 89, 13, 90, 8744, 39, 64, 18, 1366, 835, 370, 39, 64, 18, 5, 310, 247, 5415, 1159, 285, 370, 39, 64, 17, 5, 310, 3907, 273, 669, 2260, 5, 285, 556, 253, 830, 370, 39, 64, 17, 29715, 1124, 92, 68, 64, 19, 1217, 19, 61, 2059, 889, 78, 1258, 79, 61, 2859, 5, 604, 669, 32067, 4528, 353, 30, 19, 5, 285, 370, 39, 64, 17, 2029, 1124, 92, 68, 64, 20, 1217, 21, 61, 2059, 61, 2859, 724, 604, 669, 32067, 4528, 353, 30, 20, 1352, 3856, 370, 68, 64, 75, 9, 89, 13, 90, 1009, 310, 5415, 13, 370, 68, 64, 75, 9, 90, 13, 90, 4010, 18, 1366, 669, 2859, 5, 310, 253, 4181, 875, 370, 89, 5, 285, 370, 90, 1352, 380, 1159, 669, 4144, 5, 432, 253, 5028, 273, 253, 5572, 669, 8752, 92, 41, 724, 556, 253, 1563, 12139, 20290, 347, 370, 89, 61, 936, 340, 64, 75, 18965, 370, 393, 4144, 2029, 1637, 64, 75, 39, 64, 17, 9, 89, 8744, 67, 64, 75, 12, 80, 9, 18, 3822, 187, 187, 4125, 323, 1016, 21229, 273, 253, 8223, 1908, 247, 4667, 669, 4144, 9, 90, 4244, 370, 73, 61, 4144, 2850, 5994, 9, 90, 1009, 285, 247, 4972, 669, 2981, 10190, 86, 13, 87, 4244, 14, 25463, 577, 358, 370, 86, 10190, 73, 61, 4144, 2850, 5994, 9, 90, 64, 18, 10853, 6768, 13, 73, 61, 4144, 2850, 5994, 9, 90, 578, 19, 38, 46257, 1637, 64, 18, 1337, 6768, 1337, 1637, 578, 19, 38, 19446, 14, 25463, 577, 358, 370, 87, 36864, 4144, 9, 90, 64, 18, 10853, 6768, 1337, 4144, 9, 90, 578, 19, 38, 22286, 38057, 64, 18, 1337, 6768, 13, 38057, 578, 19, 38, 17137, 14, 25463, 11680, 247, 2629, 35689, 14, 41, 693, 34851, 830, 34398, 2981, 63, 18, 1337, 2981, 63, 19, 62, 2029, 2204, 578, 75, 30, 18, 1990, 21, 38, 1603, 86, 63, 18, 64, 75, 61, 2009, 362, 63, 19, 64, 75, 14, 87, 64, 75, 63, 18, 61, 2009, 1484, 64, 75, 63, 19, 1009, 275, 669, 1991, 92, 36, 1990, 21, 38, 889, 11613, 61, 1991, 92, 36, 1990, 21, 38, 3363, 1281, 441, 4993, 253, 26150, 6415, 669, 5764, 61, 6040, 393, 1991, 92, 36, 1990, 21, 38, 889, 11613, 61, 1991, 92, 36, 1990, 21, 38, 3363, 329, 1881, 14, 44121, 6880, 669, 8752, 92, 41, 724, 310, 2931, 407, 253, 8789, 2515, 669, 2981, 61, 249, 187, 50276, 61, 5764, 5, 390, 39406, 669, 3362, 428, 74, 9, 42, 12, 54, 10, 86, 18958, 42, 14, 54, 10, 87, 30, 17, 12063, 835, 370, 54, 5, 310, 247, 24287, 4315, 13947, 669, 5764, 5, 285, 370, 42, 5, 310, 271, 6489, 4315, 15, 844, 588, 1908, 760, 1980, 8789, 2515, 13, 891, 13, 70, 15, 669, 5764, 2029, 36985, 61, 10423, 64, 90, 464, 5764, 2000, 90, 1366, 835, 2367, 5764, 2000, 90, 61, 6040, 187, 50276, 61, 1991, 330, 63, 21, 5, 310, 2931, 323, 1016, 1127, 370, 90, 5, 11794, 15, 187, 187, 688, 6899, 495, 15, 18, 273, 253, 3929, 1008, 1206, 6678, 62, 352, 310, 2011, 849, 11715, 273, 247, 14299, 13138, 387, 253, 1127, 273, 1289, 5845, 273, 253, 5024, 281, 253, 2553, 3936, 1659, 15, 187, 187, 11389, 1783, 273, 253, 1180, 273, 20342, 327, 247, 25701, 4216, 310, 347, 3637, 15, 3932, 5149, 6342, 18634, 6634, 2112, 253, 35917, 13, 359, 476, 3989, 247, 11038, 7982, 4216, 323, 247, 1677, 25701, 4216, 15, 26745, 1271, 323, 436, 747, 4216, 403, 253, 2792, 273, 1289, 5845, 285, 9297, 403, 512, 28600, 982, 327, 253, 9421, 12873, 2792, 273, 1289, 5845, 285, 253, 1711, 9297, 15, 844, 403, 6110, 275, 253, 1180, 273, 1711, 14299, 20342, 13, 891, 15, 70, 15, 1110, 3692, 1329, 588, 7027, 327, 253, 9297, 273, 253, 3236, 4216, 15, 187, 187, 510, 1180, 273, 20342, 812, 1818, 760, 275, 1110, 9506, 273, 673, 326, 452, 253, 830, 273, 4872, 13553, 273, 5024, 4288, 673, 15, 1893, 253, 1180, 273, 20342, 310, 4503, 281, 253, 1180, 273, 5239, 10809, 79, 64, 75, 10952, 14127, 690, 9035, 569, 273, 436, 2238, 27, 3318, 79, 64, 18, 85, 578, 77, 64, 18, 9213, 5589, 12, 79, 64, 6917, 578, 77, 64, 78, 2704, 3040, 94, 53, 13, 187, 50274, 61, 1968, 92, 460, 82, 2138, 835, 370, 85, 64, 75, 5, 310, 247, 4288, 673 ]
exceptional points $x \in M$ (see [@BuGu]). There are also examples in which the limit in the equation is smaller than the topological entropy for an open set of configurations (see [@BuPa2]). A Riemannian manifold is said to be uniformly secure (see [@BuGu]) if there is a finite number $k$ such that all geodesics connecting an arbitrary pair of points in the manifold can be blocked by $k$ point obstacles. It is proven in [@BuGu] that the number of geodesics with length $\leq T$ between every pair of points in a uniformly secure manifold grows polynomially as $T \to \infty$. According to the results of M. Gromov and R. Mañé (see [@Mane]), the fundamental group of such a manifold is virtually nilpotent, and the topological entropy of its geodesic flow is zero. Furthermore, if a uniformly secure manifold has no conjugate points, then it is flat. This follows from the virtual nilpotency of its fundamental group either via the theorems of Croke-Schroeder and Burago-Ivanov, or by a more recent work of Lebedeva [@Leb]. In the present article we consider the case where the number of geodesics grows polynomially, for example a compact Riemannian manifold that is uniformly secure. We study in detail two examples: a standard cylinder and a flat torus with one edge. In the situation where the equivalent lengths of the edges of the graph are linearly independent over the field of rational numbers, there is a one-to-one correspondence between the times in which the birth of new Gaussian packets occurs and nonnegative solutions of infinite linear inequality where the right hand side equals $T$. Such inequalities arise in number theory, namely in the analysis of the asymptotic behavior of the number of partitions of natural numbers. We can recall the results of G.H. Hardy and S. Ramanujan, J.V. Uspensky, G. Rademacher, P. Erdös and others. In our case, the length of the geodesics will not be a sequence of natural numbers. Therefore, at the first stage of our research we obtain only an upper bound from the classical results. On the other hand, a lower bound was proven in [@trsa], namely for infinite number of edges $\mfN(T)$ grows faster than any polynomial. Later we found a connection between the problem we had studied and questions arising in the study of Bose-Maslov gas entropy, which in recent years was carried out by V.P. Maslov and V.E. Nazaikinskii. We used a 2013 result of V.E. Nazaikinskii (see [@ve_n]) to obtain asymptotic formulas for the logarithm of the number of Gaussian packets on the edge. If linear independence over $\mathbb{Q}$ does not hold (such situation is certainly possible because we can even have many geodesics with the same length, see e.g. [@Marklof]), the resulting asymptotic formula becomes an upper bound for $\mfN(T)$. It should be noted that the same results can be obtained using Additive Abstract Prime Number Theorem from [@Knopfmacher]. A computer experiment conducted jointly with O.V. Sobolev has confirmed the correctness of the estimates. The simulation results for a decorated graph obtained by attaching a length of the cylinder are also given in [@trsa]. Preliminary remarks and definitions ----------------------------------- A [*decorated graph*]{} is a topological space, obtained from a metric graph by replacing vertices by smooth manifolds of dimensions two or three. Consider a finite number of smooth complete Riemannian manifolds $M_j$, and a number of segments $\gamma_i$, endowed with regular parametrization. For each endpoint $y$ of an arbitrary segment $\gamma_j$ fix a point $\tilde y$ on one of the manifolds $M_k$; we assume all points $\tilde y$ to be distinct. A decorated graph $\Gamma_d$ is a quotient space of the disjoint sum $\bigsqcup_k M_k\bigsqcup_j\gamma_j$ by the equivalence $y \sim \tilde y$. The Schrödinger equation on a decorated graph is defined as follows (see [@BG] and [@trsa] for detailed explanation; the original ideas were presented in [@FP],[@Pav]). Let $V$ be a real valued continuous function on $ \Gamma_d$, smooth on the edges. Let $V_j$ and $V_k$ be restrictions of $V$ to $\gamma_j$ and to $M_k$ respectively. Consider a direct sum $ \widehat{H}_0=\bigoplus\limits_{j=1}^{E}\left(-\frac{h^2}{2}\frac{\mfd^2}{\mfd z_j^2}+V_j\right)\bigoplus\limits_{k=1}^{V}\left(-\frac{h^2}{2}\Delta_k+ V_k\right) $ with the domain $H^2(\Gamma)=\bigoplus\limits_{j=1}^{E}H^2(\gamma_j)\bigoplus\limits_{k= 1}^{V} H^2(M_k).$ Here $\frac{\mfd^2}{\mfd z_j^2}$ is an operator of the second derivative on $\gamma_j$ with respect to a fixed parametrization with Neumann boundary conditions, $\Delta_k$ is the Laplace–Beltrami operator on $M_k$. [**Definition.**]{} The [*Schrödinger operator*]{} $\widehat{H}$ is a self-adjoint extension of the restriction $\widehat{H_0}|_{L}$, where $ L=\{\psi\in H^2(\Gamma),\quad \psi(y_s)=0\}.$ Domain of the operator $\widehat{H}$ contains functions with singularities in the points $y_j$. Namely, let $G(x,y,\lambda)$ be the Green function on $M_k$ (integral kernel of the resolvent) of $\Delta$, corresponding to the spectral parameter $\lambda$. This function has the following asymptotics as $x\to y$: $G(x,y,\lambda)=F_0(x,y)+F_1$, where $F_1$ is a continuous function and $F_0$ is independent of $\lambda$ and has the form $F_0=-\frac{c_2}{2\pi}\mfln\rho$ if $\mfdim M=2$ and $F_0=\frac{c_3}{4\pi\rho}$ if $\mfdim M=3$. Here $c_j(x,y)$ is continuous, $c_j(y,y)=1$, $\rho$ is the distance between $x$ and $y$. The function $\psi$ from the domain of the operator $\widehat{H}$ has the following asymptotics as $x\to y_j$: $ \psi=\alpha_jF_0(x)+b_j+o(1)$. Now for each endpoint of the segment consider a pair $\psi(y)$, $h\psi^\prime(y)$ and a vector $\xi=(u,v)$,-10000 4em $u=(h\psi^\prime(y_1),\dots,h\psi^\prime(y_{2E}),\alpha_1,\dots,\alpha_{2E})$,-10000 4em $v=(\psi(y_1),\dots,\psi(y_{2E}),hb_1,\dots,hb_{2E})$.-10000 Consider a standard skew-Hermitian form $[\xi^1,\xi^2]=\sum_{j=1}^{4E}(u^1_j\bar v^2_j-v_j^1\bar u_j^2)$ in $\mathbb{C}^{4E}\oplus\mathbb{C}^{4E}$. Let us fix the Lagrangian plane $\Lambda\subset \mathbb{C}^{4E}\oplus\mathbb{C}^{4E}$. A self-adjoint extension $\widehat{H}$ is defined by the coupling conditions $\xi\in \Lambda$ or equivalently $\quad -i(I+U)u+(I-U)v=0,$ where $U$ is a unitary matrix defining $\Lambda$ and $I$ is an identity matrix. We will consider only local coupling conditions, i,e. $\Lambda=\bigoplus\limits_y{\Lambda}_y$, where ${\Lambda}_y\subset \mathbb C^4$ is defined for each point $y$ separately. In Theorem 3.1 of the article [@trsa] it is shown how scattering of a Gaussian packet at the point of gluing of the edge to the surface takes place. Further analysis of the number of packets on a decorated graph is as follows. Since wavefront propagation occurs along the geodesic, we can construct a matching metric graph for a given decorated graph. Vertices for this new graph are the points of gluing and edges are all geodesics on the surfaces connecting points of gluing and the old edges. We are interested in the number of old Gaussian packets, i.e. those whose support will lie on the edges of the original graph. The number of packets could change only in those moments of time that have the form of linear combinations of edge travel time. So the number of packets is equal to the number of sets $\{n_j\}$ satisfying some inequations of this kind: $$n_1t_{l_1}+\ldots+n_mt_{l_m}{\leq}T, \label{ineq}$$ where $t_j$ is a travel time
[ 10974, 13, 773, 1147, 457, 84, 1805, 281, 3553, 2, 2053, 6003, 1364, 320, 12016, 262, 303, 1025, 1425, 510, 1982, 310, 581, 273, 7543, 14, 14360, 3054, 273, 253, 7379, 9914, 36, 15, 510, 941, 2613, 369, 8523, 11526, 281, 320, 6312, 275, 673, 323, 253, 5910, 394, 7379, 9914, 36, 6874, 275, 3919, 15, 1292, 387, 253, 990, 273, 4247, 13, 253, 7379, 9914, 36, 15904, 5821, 281, 5778, 697, 9311, 281, 1581, 625, 673, 281, 18122, 1491, 15, 510, 6729, 5286, 574, 2168, 4767, 697, 8208, 281, 42760, 253, 2806, 3550, 13, 1014, 2167, 697, 3646, 574, 644, 281, 11377, 342, 253, 7379, 9914, 36, 15, 6166, 3438, 4007, 6086, 411, 15, 11301, 13, 3968, 5006, 68, 7655, 253, 12265, 17965, 15, 10708, 4955, 15, 412, 290, 21743, 77, 9582, 15, 3675, 262, 15, 376, 431, 263, 15, 83, 3751, 1739, 263, 15, 3675, 262, 28, 187, 187, 2948, 4955, 15, 412, 290, 21743, 77, 9582, 15, 3675, 262, 15, 376, 431, 263, 15, 6682, 15, 3675, 262, 15, 51, 1739, 263, 53, 7417, 42377, 28, 535, 187, 6930, 187, 475, 380, 4096, 273, 253, 34896, 42377, 13422, 310, 281, 22318, 253, 3186, 323, 247, 7408, 10130, 187, 475, 323, 247, 1677, 3102, 15, 40474, 253, 3186, 11017, 19055, 32627, 13, 490, 12655, 672, 247, 187, 475, 3588, 7408, 310, 1119, 13, 352, 476, 513, 594, 984, 253, 19055, 403, 6960, 846, 253, 38425, 3523, 187, 475, 355, 429, 16, 4697, 2069, 15, 844, 671, 5467, 326, 19055, 513, 417, 1509, 1016, 643, 28, 7757, 19055, 275, 187, 475, 2579, 327, 247, 1677, 1388, 588, 320, 275, 1340, 323, 512, 643, 14545, 1512, 15, 187, 475, 654, 81, 4357, 187, 475, 380, 3186, 897, 247, 8985, 3186, 604, 253, 1180, 273, 7408, 28631, 310, 1840, 247, 1677, 187, 475, 7887, 15, 329, 4872, 3186, 310, 3468, 672, 253, 1180, 273, 28631, 310, 1077, 1781, 13, 1339, 187, 475, 1333, 625, 685, 7469, 7408, 28631, 15, 187, 475, 654, 81, 4357, 187, 475, 380, 7092, 273, 436, 5673, 1379, 1557, 253, 3186, 3884, 313, 10495, 16, 32514, 481, 187, 475, 1198, 247, 8107, 3186, 313, 8716, 272, 19265, 275, 673, 10, 253, 7408, 1119, 16018, 16, 274, 49182, 2069, 187, 475, 403, 1863, 6965, 15, 831, 310, 581, 273, 253, 1841, 326, 4483, 323, 253, 5933, 281, 320, 12314, 13, 908, 187, 475, 275, 1097, 2219, 15, 187, 475, 187, 475, 1214, 3575, 654, 53, 31, 380, 34896, 42377, 1511, 2931, 407, 253, 2608, 273, 253, 46012, 263, 8990, 15, 187, 1738, 187, 4387, 5673, 34896, 42377, 13422, 29, 53, 8725, 46879, 263, 53, 7417, 42377, 31, 551, 187, 50274, 6930, 187, 50273, 11, 9985, 253, 1682, 7408, 11038, 253, 1677, 18073, 3211, 673, 24314, 7165, 187, 50273, 11, 831, 310, 253, 1072, 347, 6789, 18073, 4492, 1852, 8716, 9, 565, 13, 540, 13, 540, 3117, 342, 18073, 3211, 7408, 6060, 24314, 27, 428, 18, 7165, 187, 50273, 11, 187, 50273, 11, 1214, 2887, 1852, 8716, 9, 565, 13, 540, 13, 540, 10, 187, 50273, 8480, 187, 50274, 23170, 3186, 9, 565, 673, 24314, 13, 540, 3523, 13883, 688, 24975, 558, 535, 50274, 6930, 187, 50273, 11, 9985, 253, 1682, 7408, 11038, 253, 1677, 18073, 3211, 673, 24314, 94, 285, 18073, 3211, 7408, 6060, 24314, 7165, 187, 50273, 11, 187, 50273, 11, 1214, 3575, 7408, 6060, 24314, 50270, 25216, 3033, 323, 7408, 3605, 281, 3186, 323, 15, 496, 7426, 15, 7890, 18073, 3211, 470, 94, 187, 50273, 11, 50254, 50272, 1542, 271, 45515, 3186, 15, 187, 50273, 11, 1214, 3575, 13024, 10851, 435, 459, 4769, 50276, 510, 673, 273, 13024, 9, 7955, 435, 459, 323, 8107, 3186, 10, 387, 253, 1677, 3523, 15, 187, 50273, 11, 1214, 3575, 3523, 13883, 688, 24975, 380, 3523, 281, 4450, 187, 50273, 8480, 187, 50274, 23170, 3186, 9, 565, 13024, 10851, 435, 459, 4769, 13, 540, 3523, 13883, 688, 24975, 13, 540, 7408, 6060, 24314, 558, 535, 50274, 6930, 187, 50273, 11, 831, 891, 247, 3806, 281, 253, 7408, 1119, 15, 187, 50273, 8480, 187, 50274, 53, 755, 36, 33524, 53, 7417, 1874, 535, 50274, 6930, 187, 50273, 11, 380, 7408, 3605, 273, 253, 1390, 7408, 1119, 15, 187, 50273, 8480, 187, 50274, 565, 755, 36, 33524, 53, 7417, 6060, 1874, 2756, 50274, 6930, 187, 50273, 11, 5057, 253, 4450, 16, 267, 429, 673, 323, 253, 7408, 1119, 15, 187, 50273, 11, 496, 253, 1083, 273, 247, 2622, 3186, 253, 34519, 673, 943, 320, 4895, 13, 187, 50273, 11, 285, 275, 253, 1083, 273, 247, 8107, 3186, 253, 355, 429, 673, 943, 320, 4895, 15, 187, 50273, 8480, 187, 50274, 565, 755, 36, 33524, 53, 7417, 4769, 1874, 187, 94, 187, 22249, 9424, 187, 187, 510, 4579, 2953, 16, 15760, 368, 9262, 310, 3430, 390, 812, 417, 320, 1119, 15, 7764, 1611, 969, 15, 1310, 368, 403, 417, 247, 3558, 273, 253, 38075, 15, 681, 9585, 13, 4496, 8749, 806, 15, 187, 187, 510, 4579, 2953, 16, 15760, 368, 9262, 310, 3430, 390, 812, 417, 320, 1119, 15, 7764, 1611, 969, 15, 1310, 368, 403, 417, 247, 3558, 273, 253, 38075, 15, 681, 9585, 13, 4496, 8749, 806, 15, 187, 187, 1552, 6745, 2395, 310, 2168, 1246, 187, 187, 7093, 9585, 2395, 556, 644, 12623, 1955, 281, 247, 13770, 273, 776, 26746, 273, 6631, 15, 7764, 873, 598, 247, 747, 2395, 275, 1386, 342, 253, 9585, 4803, 15, 8439, 253, 9585, 16228, 15, 20564, 13, 368, 476, 4579, 441, 407, 21006, 776, 3057, 830, 15, 187, 187, 7845, 4901, 247, 3588, 4579, 2953, 187, 187, 510, 4579, 2953, 16, 15760, 368, 9262, 310, 3430, 390, 812, 417, 320, 1119, 15, 7764, 1611, 969, 15, 1310, 368, 403, 417, 247, 3558, 273, 253, 38075, 15, 681, 9585, 13, 4496, 8749, 806, 15, 187, 187, 510, 38075, 11204, 16478, 569, 9167, 275, 19101, 187, 187, 45306, 34, 15, 681, 4453, 896, 689, 690, 273, 253, 954, 27795, 47331, 275, 253, 2892, 273, 253, 14964, 273, 27557, 6386, 273, 253, 2250, 5068, 275, 10869, 323, 253, 4072, 11166, 273, 253, 38075, 11204, 16478, 569, 9167, 15, 187, 187, 3, 1147, 434, 6701, 281, 436, 14811, 326, 16158, 20498, 1160, 616, 1416, 327, 253, 4156, 3924, 15, 6491, 1904, 626, 1902, 2712, 432, 441, 327, 253, 11288, 13, 533, 776, 806, 3330, 1108, 247, 495, 14, 17, 10170, 1411, 253, 5106, 1108, 1691, 441, 327, 253, 3711, 323, 1175, 449, 16158, 5842, 13691, 5769, 74, 1219, 500, 33231, 327, 253, 9748, 13, 8878, 285, 8210, 34081, 534, 497, 2918, 275, 16158, 20498, 13, 342, 253, 806, 767, 1925, 253, 4377, 401, 1240, 69, 9167, 187, 187, 3, 42, 1119, 4266, 7487, 342, 247, 2176, 11284, 347, 619, 2285, 14, 13239, 4546, 2366, 15, 309, 2183, 4266, 326, 667, 2285, 14707, 281, 7171, 441, 651, 452, 281, 873, 253, 2534, 1077, 1029, 449, 28351, 23881, 4736, 20984, 322, 40807, 443, 899, 68, 13807, 66, 13, 247, 38075, 11204, 16478, 569, 9167, 13688, 275, 9748, 187, 187, 3, 2447, 27978, 13, 512, 253, 6671, 275, 253, 7324, 497, 9628, 253, 1072, 8614, 275, 416, 14059, 33233, 15, 4923, 273, 326, 13, 253, 3773, 10062, 342, 1016, 643, 875, 1016, 2165, 15, 733, 369, 3240, 4451, 449, 35119, 3905, 438, 18991, 31562, 253, 8878, 11166, 13, 1912, 407, 22783, 187, 187, 3, 1231, 497, 25536, 751, 1620, 1078, 1309, 326, 14811, 15, 844, 1014, 439, 9367, 776, 9851, 2366, 449, 51, 2814, 3088, 13806, 327, 10869, 434, 3330, 387, 253, 8210, 38075, 11204, 16478, 569, 9167, 187, 187, 3, 688, 253, 2457, 13, 10869, 497, 12832, 18792, 327, 253, 11288, 15, 1583, 3531, 253, 2165, 715, 247, 1524, 37466, 449, 37150, 3579, 11643, 611, 999, 437, 327, 521, 2285, 434, 2957, 281, 10869, 275, 253, 8210, 921, 14705, 187, 187, 3, 8639, 359, 7428, 562, 4830, 253, 11288, 387, 253, 13063, 442, 6357, 13, 627, 369, 594, 1199, 6046, 359, 4571, 626, 1014, 4089, 9361, 3984, 275, 253, 16583, 15, 733, 369, 7479, 281, 8564, 253, 10825, 327, 253, 11288, 1078, 359, 2686, 2427, 562, 627, 449, 28351, 5106, 42402, 2516, 388, 782, 265, 327, 521, 2285, 434, 10020, 14, 13017, 1411, 14516, 8987, 275, 7544, 187, 187, 3, 1147, 369, 253, 806, 673, 359, 1871, 574, 253, 4839, 281, 1705, 598, 1411, 824, 14331, 6671, 327, 776, 1211, 8825, 15, 3824, 14501, 497, 275, 20117, 13926, 285, 616, 23027, 32089, 745, 327, 441, 15, 844, 497, 1663, 17194, 449, 1672, 14, 19291, 42402, 41, 301, 292, 25453, 27280, 682, 327, 253, 6585, 11166, 187, 187, 3, 2347, 476, 368, 5513, 352, 32, 2325, 839, 10869, 275, 776, 806, 2165, 13, 840, 10305, 22662, 14, 55, 400, 1914, 401, 3703, 762, 824, 26183, 5989, 15, 496, 512, 619, 1495, 275, 5702, 5842, 13, 309, 452, 1620, 574, 281, 2968, 342, 2712, 751, 326, 15, 2732, 253, 3761, 13, 309, 812, 417, 1361, 619, 1930, 15, 309, 3058, 1361, 4266, 449, 187, 28292, 6039, 2771, 251, 8690, 56, 2050, 2200, 48297, 832, 254, 327, 253, 2471, 273, 22662, 14, 55, 400, 1914, 401, 3703, 387, 6181, 6469, 187, 187, 3, 1231, 1833, 7171, 731, 6524, 13, 309, 1353, 2119, 273, 352, 15, 1244, 352, 1833, 5108, 387, 253, 3645, 9167, 449, 187, 28292, 6176, 4736, 20984, 20554, 611, 18272, 327, 23881, 285, 10869, 13, 665, 23573, 521, 1930, 327, 1728, 8825, 275, 5826, 187, 187, 3, 1147, 434, 247, 581, 14, 2727, 2165, 984, 352, 434, 253, 2457, 13, 273, 2282, 13, 533, 1840, 512, 984, 776, 18062, 403, 23881, 449, 187, 32462, 46773, 327, 253, 43866, 273, 253, 6176, 5826, 2457, 13, 9142, 1912, 407, 10869, 3, 1552, 369, 816, 271, 7343, 15, 2064, 434, 5842, 1108, 368, 476, 626, 320, 26442, 342, 776, 2285, 15, 3824, 2285, 556, 247, 1270, 2852, 285, 359, 1472, 387, 6330, 342, 9361, 13, 1014, 846, 436, 13313, 449, 29876, 13589, 6304, 18624, 1452, 327, 11268, 434, 2957, 281, 5106, 275, 253, 10020, 14, 43791, 387, 3684, 7531, 4748, 13, 247, 807, 1078, 521, 1930, 1912, 253, 4267, 38075, 3645, 9167, 14313, 285, 1264, 1078, 616, 21581, 5377, 38928, 48, 4050, 23991, 187, 187, 3, 42, 1869, 309, 1871, 2326, 3253, 1309, 619, 1495, 533, 8505, 417, 15, 2752, 3773, 285, 309, 403, 1077, 9979, 281, 452, 574, 253, 4839, 281, 2746, 779, 449, 28292, 3684, 7531, 8690, 31513, 18056, 3230, 846, 6883, 247, 4143, 432, 19027, 18150, 7896, 1309, 3684, 7531, 4748, 187, 187, 3, 42, 1353, 1077, 13, 1077, 13, 1077, 5211, 449, 48069, 8690, 35, 6464, 6939, 307, 249, 32733, 846, 521, 9256, 1930, 9606, 247, 6891, 337, 14, 17, 2957, 281, 11268, 387, 3684, 7531, 4748, 187, 187, 3, 1231, 1472, 1469, 281, 10869, 281, 1957, 776, 2586, 285, 513, 973, 1108, 417, 281, 452, 776, 5406, 2668, 342, 322, 40807, 50218, 13, 5119, 34374, 390, 544, 22903, 2184, 62, 1198, 13409, 449, 53, 1240, 15208, 3579, 9709, 2902, 657, 1240, 343, 5738, 187, 187, 3, 1231, 1472, 26400, 281, 3330, 253, 11204, 16478, 569, 9167, 281, 921, 253, 1533, 752, 359, 1472, 7032, 273, 15, 1284, 271, 2060, 13, 309, 1871, 751, 952, 281, 1158, 273, 253, 1416, 21987, 14054, 80, 672, 597, 1056, 247, 1618, 273, 253, 1682, 1669, 14, 12270, 275, 253, 1533, 449, 19291, 1669, 14, 2135, 58, 14345, 21987, 14054, 80, 6386, 273, 10869, 4072, 187, 187, 3, 41946, 452, 1900, 644, 762, 3473, 281, 3330, 17195, 13, 594, 8564, 752, 352, 434, 751, 672, 597, 1132, 387, 1728, 449, 28292, 10869, 26762, 42107, 86, 275, 253, 1408, 14, 484, 281, 10869, 4072, 22653, 261, 3599, 478, 23863, 3977, 253, 1982, 4487, 273, 14971, 36808, 329, 30941, 46371, 35859, 8246, 313, 34, 1194, 3123, 10, 534, 6337, 432, 5215, 281, 4050, 387, 247, 2105, 273, 8157, 1036, 3041, 15, 187, 187, 688, 4437, 13, 846, 17928, 272, 432, 253, 7811, 281, 6604, 247, 45087, 2561, 1387, 344, 369, 3212, 253, 3727, 273, 767, 10556, 7270, 327, 1982, 13669, 11572, 22013, 14693, 15, 187, 187, 1328, 8042, 562, 326, 253, 773, 460, 89, 1860, 494, 11072, 668, 4395, 275, 4088, 534, 809, 728, 12057, 15, 187, 187, 4041, 273, 253, 4668, 22013, 10556, 369, 32325, 745, 253, 8852, 273, 5003, 14912, 275, 4596, 6157, 407, 1982, 13669, 25244, 665, 2529, 6523, 2067, 1223, 45087, 84, 16745, 751, 253, 7353, 308, 280, 14, 53, 18944 ]
responded, “It’s better to leave! These organization must be delegitimized.”The US is one of 47-member states of the UNHRC.The data base was initially scheduled to be completed in time for the 34th UNHRC session in March. But at the end of January, the UNHRC Bureau agreed to delay its publication to allow more time to compile information.The Obama administration had already stated its intention to boycott the blacklist, even though its policy had been to engage with the UNHRC. Under former president George W. Bush, America boycotted the council altogether.package org.opentripplanner.transit.raptor.rangeraptor.transit; import org.opentripplanner.transit.raptor.api.transit.RaptorTripSchedule; /** * The purpose of the TripScheduleSearch is to optimize the search for a trip schedule * for a given pattern. Normally the search scan trips sequentially, aborting when a * valid trip is found, it can do so because the trips are ordered after the FIRST stop * alight/board times. We also assume that trips do not pass each other; Hence trips in * service on a given day will be in order for all other stops too. * <p/> * The search use a binary search if the number of trip schedules is above a given * threshold. A linear search is slow when the number of schedules is very large, let * say more than 300 trip schedules. * <p/> * The implementation of this interface take care the search direction (forward/reverse). * For a reverse search (searching backward in time) the trip found departure/arrival times * are swapped. This is one of the things that allows for the algorithm to be generic, used * in both cases. * * @param <T> The TripSchedule type defined by the user of the raptor API. */ public interface TripScheduleSearch<T extends RaptorTripSchedule> { /** * Find the best trip matching the given {@code timeLimit}. * This is the same as calling {@link #search(int, int, int)} with {@code tripIndexLimit: -1}. * * @see #search(int, int, int) */ boolean search(int timeLimit, int stopPositionInPattern); /** * Find the best trip matching the given {@code timeLimit} and {@code tripIndexLimit}. * * @param tripIndexLimit Lower bound for trip index to search for. Inclusive. Use {@code 0} * for an unbounded search. * @param arrivalDepartureTime The time of arrival(departure for reverse search) at the given stop. * @param stopPositionInPattern The stop to board */ boolean search(int arrivalDepartureTime, int stopPositionInPattern, int tripIndexLimit); /** * This i a reference to the trip found. */ T getCandidateTrip(); /** * The trip index of the last trip found. */ int getCandidateTripIndex(); /** * Get the board/alight time for the trip found. * In the case of a normal search the boarding time should be returned, * and in the case of a reverse search the alight time should be returned. */ int getCandidateTripTime(); } Screen Name The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first. The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first. This Facebook account is already present Your Club account has been locked due to a breach of our Terms of Service. Please set up a new account in line with the Club rules. Review the Club Rules. Alternatively, you can email us by completing our contact form. Please enter a valid email address The email address/password you submitted is wrong or could not be found. Please try again. If you are not a member of the FIFA.com Club, please register first. The FIFA Confederations Cup in quotes FIFA.com looks back over some of the most memorable quotations in the history of the Festival of Champions ahead of the action beginning in Brazil for the 2013 edition of the FIFA Confederations Cup. "It's thanks to this tournament that Saudi Arabia made their name on the global stage. People didn't expect anything from us on the pitch, but our first win – a 3-0 victory against the USA – put us on the map for good." Saudi football legend Sami Al Jaber on the 1992, 1995 and 1997 editions which were held in Saudi Arabia, with the first two called the King Fahd Cup "I found myself watching with a certain pleasure as my team-mates played together. I told myself that any team wanting to beat us would have to set the bar very high." Former Argentina goalkeeper Sergio Goycochea, a FIFA Confederations Cup winner in 1992 "Unusually, all the teams in the competition were sharing the same hotel in Riyadh. Because of that, the players talked with each other between each game. It was quite unique."Brian Laudrup recalls the 1995 edition, won by Denmark "We were united like never before during that tournament. We even shaved our heads together."Ronaldo reflects on Brazil's win at the 1997 FIFA Confederations Cup "In the final, Brazil were literally dancing on the pitch. They turned the game into a real spectacle."Australia forward Harry Kewell on his team's loss to Brazil in the 1997 showpiece "Before we walked out onto the pitch at the Azteca, there was so much noise we couldn't even hear ourselves speak in the tunnel. It was impossible to imagine the atmosphere on the pitch before we actually went out there." Former USA midfielder John Harkes on his team's semi-final against hosts Mexico in 1999 "It was the first time we'd had the chance to come up against such incredible teams on our own soil. Our supporters were in seventh heaven and their enthusiasm rubbed off on us. We were really motivated."Ex-Japan midfielderHidetoshi Nakata on the 2001 edition "How can you explain it? Beating Brazil in our first game, then losing Marc-Vivien Foe under such tragic circumstances. In all my life in professional football, I have never had to deal with anything like that. After the match, I could not help my side. I needed help myself." Former Cameroon coachWinfried Schaefer on the death of Marc-Vivien Foe at France 2003 "We'll beat them eventually, I'm sure of it. And it'll happen at the World Cup." Former Germany goalkeeper Oliver Kahn on Argentina and Brazil, who frustrated his side on home soil in 2005 "It's a one-off game because it's the final, of course, but above all because our opponents are Argentina." Ze Roberto on the eve of the Germany 2005 final, ultimately won by Brazil"This was just an accident. That's football – you can't be unhappy with our team. Our team has a great future and we're at peace with ourselves, even after this defeat." Vicente Del Bosque on Spain's loss to USA in the semi-finals at South Africa 2009, a year before his side won the 2010 FIFA World Cup™ and three before their UEFA EURO 2012 triumph "I thought I'd seen everything during my life but apparently not. My players and I are very proud to have had the chance to approach him."Former South Africa coach Joel Santana after receiving a visit from Nelson Mandela during South Africa 2009 "I'm very, very, very happy." Serbian coachBora Milutinovic after his Iraq side suffered a narrow 1-0 loss to Spain at South Africa 2009 "We're going to Brazil to represent our country and do well – not to have our picture taken with Sergio Ramos, David Villa or [Diego] Forlan."Tahiti forwardMarama Vahirua "We're aiming to win the Confederations Cup to show the world what we're capable of. As an individual, I'd like people to think of the name Nagatomo when they make a list of the best left-backs in the world."Japan left-backYuto Nagatomo ahead of Brazil 2013 "Brazil have always been under pressure to win abroad, so imagine what it's like when they play at home."Former Brazil defender Cafu in the run-up to Brazil 2013Luis Elizondo led the US Department of Defense Advance Aerial Threat Identification Program (AATIP) which ran from 2007 to 2012 at a cost of £16 million. In October, after resigning from the department to join a UFO research group he was behind the release of two videos caught on US Navy pilot radar cameras. He pointed out that the “inexplicable craft” moved in ways which defied physics. One of the military radar videos was filmed off the coast of San Diego in November 2004 by US Navy pilots who described seeing several while UFOs shaped like the sweet Tic-Tacs
[ 3354, 1108, 380, 7813, 273, 3545, 951, 378, 656, 6689, 19787, 2205, 187, 21082, 445, 401, 2585, 19872, 1108, 9615, 302, 6555, 20242, 285, 29077, 380, 36024, 187, 23684, 17771, 1108, 329, 20909, 273, 2516, 14702, 187, 11223, 1031, 18268, 16606, 1108, 6700, 9283, 84, 273, 271, 49185, 23091, 27, 743, 5271, 19111, 3756, 187, 27515, 308, 8879, 17410, 1108, 380, 9224, 273, 253, 34546, 313, 31312, 380, 35502, 9224, 273, 253, 34546, 13, 1936, 15, 337, 273, 13134, 38987, 32962, 13, 1996, 11709, 275, 253, 20378, 980, 10, 187, 34, 15, 444, 15, 23224, 614, 1108, 380, 2752, 2971, 447, 273, 21577, 187, 187, 35, 12769, 84, 187, 22423, 1638, 1108, 29835, 9497, 649, 272, 13, 4383, 2151, 434, 8406, 313, 42729, 23518, 10, 187, 24099, 1903, 1108, 2552, 1503, 74, 796, 73, 13, 46900, 14, 16281, 383, 34923, 17502, 13, 16555, 382, 285, 42726, 313, 42729, 22715, 10, 187, 24099, 2145, 1108, 19580, 15916, 443, 3090, 7411, 3229, 13, 17794, 34923, 42250, 285, 17502, 313, 42729, 31687, 10, 187, 18489, 337, 1108, 473, 3319, 274, 47653, 375, 348, 4530, 13, 29535, 17502, 285, 9558, 313, 42729, 9178, 10, 187, 18489, 1884, 1108, 27522, 14656, 4379, 313, 46117, 27104, 13, 27470, 582, 4383, 17502, 313, 42729, 11994, 10, 187, 19591, 337, 1108, 3616, 66, 8449, 23972, 13, 19688, 50104, 382, 13, 42250, 285, 20021, 6423, 313, 42729, 11299, 10, 187, 19591, 1458, 1108, 17250, 311, 333, 443, 360, 1031, 729, 13, 7247, 5192, 1405, 382, 17502, 313, 9993, 4525, 33531, 10, 187, 6791, 1668, 1108, 26113, 12937, 580, 15858, 351, 511, 87, 469, 13, 7247, 17502, 285, 7291, 313, 42729, 22745, 10, 187, 18948, 3436, 1108, 5037, 274, 353, 8808, 40160, 13, 45575, 17502, 285, 26462, 313, 42729, 15750, 10, 187, 20443, 1668, 1108, 25298, 6029, 80, 47630, 13, 5112, 42250, 313, 42729, 20208, 10, 187, 20443, 3307, 1108, 388, 5021, 23847, 311, 1944, 31240, 13, 39863, 757, 14, 6448, 36090, 8406, 313, 42729, 24178, 10, 187, 20443, 2164, 1108, 12576, 8, 469, 343, 13293, 22188, 478, 11938, 313, 33656, 117, 161, 114, 225, 209, 162, 123, 99, 9850, 24299, 225, 582, 6692, 42250, 313, 42729, 18417, 10, 187, 21859, 854, 1108, 15983, 29976, 2200, 322, 515, 3508, 13, 4383, 17502, 285, 32390, 382, 313, 42729, 17342, 10, 187, 21859, 1384, 1108, 8444, 8757, 13, 4383, 17502, 13, 42250, 13, 48605, 285, 48342, 757, 313, 42729, 18824, 10, 187, 22117, 577, 1108, 36239, 1004, 17453, 13, 11596, 50104, 382, 13, 17502, 285, 20021, 14281, 313, 42729, 23084, 10, 187, 22117, 2030, 1108, 21138, 3130, 1279, 74, 313, 44, 1757, 287, 314, 3130, 1757, 5134, 74, 582, 3752, 287, 14, 38288, 6656, 5054, 24072, 285, 2675, 29875, 313, 42729, 17926, 10, 187, 23375, 337, 1108, 19423, 1136, 4819, 348, 13, 29535, 16349, 382, 8406, 313, 42729, 25124, 10, 187, 23375, 3127, 1108, 29271, 12951, 42304, 13, 4383, 2488, 313, 42729, 16221, 10, 187, 23375, 3285, 1108, 7195, 29053, 13, 4383, 42250, 285, 2926, 8406, 313, 42729, 18824, 10, 187, 22784, 608, 1108, 12447, 40065, 19051, 13, 2448, 17264, 285, 48845, 313, 42729, 16221, 10, 187, 35419, 20288, 8440, 13, 3545, 8962, 757, 14, 6448, 42726, 313, 42729, 24113, 10, 187, 187, 27888, 84, 187, 18489, 1722, 1108, 25298, 14, 43, 2651, 33100, 21608, 13, 5112, 19600, 313, 6448, 1283, 1047, 10, 187, 18489, 3435, 1108, 9011, 8966, 11276, 13, 4383, 50104, 382, 13, 17502, 285, 1345, 3565, 313, 6448, 29316, 10, 187, 19591, 898, 1108, 10092, 9964, 8449, 13675, 567, 293, 13, 5685, 17502, 285, 42250, 313, 6448, 1283, 1731, 10, 187, 6791, 577, 1108, 3599, 21631, 418, 6597, 4379, 330, 7849, 13, 2448, 9462, 50104, 382, 13, 2159, 2926, 8406, 13, 285, 8121, 313, 6448, 1722, 3953, 10, 209, 187, 6791, 1458, 1108, 24504, 47185, 13, 2448, 17502, 313, 6448, 46215, 10, 187, 6791, 1722, 1108, 444, 2967, 76, 460, 2552, 13, 4383, 10281, 29075, 382, 313, 6448, 1283, 1010, 10, 187, 18948, 1638, 1108, 13651, 40285, 18540, 13456, 13, 7247, 50104, 382, 313, 6448, 1283, 1508, 10, 187, 20443, 1668, 1108, 34213, 378, 2084, 1282, 313, 44240, 1503, 1351, 32958, 4268, 1665, 22827, 11507, 2448, 19600, 13, 277, 553, 42250, 285, 1345, 382, 313, 6448, 1283, 1797, 10, 187, 20443, 3127, 1108, 47635, 38515, 17698, 26774, 12221, 13692, 13, 5685, 24072, 313, 6448, 1283, 883, 10, 187, 20266, 898, 1108, 20628, 31162, 13, 11596, 17502, 285, 47160, 552, 313, 6448, 1283, 740, 10, 187, 22117, 3307, 1108, 6397, 34223, 14884, 19872, 13, 4383, 14, 6448, 9943, 42250, 313, 6448, 1283, 1630, 10, 187, 23375, 3127, 1108, 41474, 1810, 379, 83, 13, 5685, 42250, 285, 7291, 313, 6448, 1283, 1166, 10, 187, 23375, 3307, 1108, 6393, 36638, 8712, 13, 2448, 1073, 274, 382, 313, 6448, 1283, 1508, 10, 187, 22784, 1249, 1108, 18063, 266, 49596, 2284, 6984, 87, 304, 13, 26304, 30005, 10364, 313, 6448, 1283, 2125, 10, 187, 187, 42452, 187, 4257, 11174, 366, 21803, 1108, 416, 15, 418, 15, 443, 2339, 187, 187, 688, 6239, 187, 32618, 42738, 434, 4460, 380, 7743, 21538, 313, 746, 2922, 10, 310, 873, 1309, 436, 807, 15, 187, 187, 4941, 1744, 187, 1413, 27, 58, 6364, 273, 253, 655, 394, 5331, 275, 6239, 4041, 273, 253, 1841, 309, 2223, 21424, 323, 38782, 398, 281, 10331, 10678, 310, 281, 3410, 7561, 15, 20727, 670, 10331, 310, 13, 327, 690, 1268, 13, 417, 1077, 2834, 387, 512, 15, 733, 4419, 2793, 285, 271, 3939, 2564, 281, 4887, 2220, 285, 3037, 432, 253, 8450, 12103, 15, 1916, 9580, 436, 2793, 2167, 13, 253, 760, 1039, 281, 1663, 513, 352, 310, 281, 5484, 247, 2257, 273, 10331, 15, 21108, 670, 352, 390, 4854, 670, 352, 1663, 2506, 457, 85, 513, 1199, 1175, 13, 323, 352, 310, 760, 3762, 326, 19756, 19673, 432, 8542, 8450, 15, 187, 187, 510, 8542, 1895, 342, 3939, 10491, 403, 767, 8089, 15, 380, 806, 310, 2969, 1108, 3530, 403, 417, 1077, 11142, 13, 3798, 13, 285, 594, 352, 476, 2686, 320, 3240, 8214, 672, 368, 4489, 247, 2257, 273, 731, 432, 1027, 24742, 15, 2058, 247, 2670, 751, 714, 4462, 266, 322, 40883, 13, 368, 476, 4354, 5926, 247, 4289, 8918, 390, 625, 327, 247, 13365, 3530, 13, 285, 326, 457, 84, 1078, 368, 452, 281, 2803, 275, 15076, 2105, 15, 1310, 368, 457, 250, 417, 2970, 634, 3530, 323, 1959, 13, 436, 476, 320, 3240, 247, 2201, 14247, 327, 697, 1211, 15, 187, 187, 5872, 627, 310, 253, 625, 8794, 3086, 1895, 273, 752, 281, 513, 342, 253, 3530, 15, 733, 457, 84, 3240, 3477, 281, 1333, 326, 10491, 7561, 588, 1918, 368, 2793, 275, 10331, 10678, 15, 496, 3946, 13, 2299, 13, 326, 457, 84, 417, 594, 2969, 15, 4683, 2282, 13, 2820, 512, 9351, 273, 716, 284, 588, 954, 5604, 1918, 368, 2793, 15, 1723, 13, 352, 310, 2793, 327, 247, 4942, 20126, 1268, 15, 35110, 9351, 273, 716, 284, 13, 824, 347, 1663, 3076, 390, 1663, 1175, 716, 284, 13, 588, 3164, 9766, 3746, 3240, 12450, 15, 19810, 13, 2299, 13, 403, 417, 594, 4755, 15, 733, 310, 2686, 6927, 281, 1611, 716, 284, 604, 368, 13, 1333, 13, 5500, 731, 13, 533, 840, 352, 4916, 789, 285, 253, 1232, 310, 417, 1077, 30357, 15, 831, 310, 13, 9142, 13, 247, 34057, 13, 285, 417, 247, 2628, 313, 1542, 479, 8791, 10, 594, 3192, 253, 794, 1977, 751, 326, 310, 10323, 5816, 253, 1127, 15, 187, 187, 1276, 3185, 6569, 310, 326, 690, 716, 284, 2430, 2709, 23592, 723, 281, 10313, 3746, 581, 1039, 390, 1529, 15, 13168, 253, 806, 673, 368, 25410, 247, 10331, 352, 2506, 457, 85, 1705, 562, 3240, 987, 417, 984, 352, 457, 84, 3076, 13, 533, 984, 368, 403, 1335, 19427, 281, 352, 15, 733, 7729, 672, 368, 457, 250, 970, 253, 1072, 716, 1403, 4420, 512, 253, 673, 13, 594, 326, 253, 760, 4778, 310, 253, 10331, 15, 496, 690, 4088, 13, 407, 2509, 594, 368, 457, 250, 10323, 260, 1135, 272, 253, 10331, 1293, 260, 1135, 272, 352, 1108, 368, 457, 250, 5175, 1880, 390, 417, 253, 10331, 310, 1175, 323, 634, 3740, 273, 40436, 15, 4952, 840, 13, 2299, 13, 247, 1175, 10331, 5484, 254, 943, 320, 19427, 281, 253, 10331, 285, 2820, 281, 25410, 352, 347, 1682, 256, 16, 248, 476, 13, 534, 2097, 326, 253, 806, 1611, 476, 1705, 562, 3499, 23522, 3430, 15, 330, 1135, 272, 671, 556, 697, 1211, 7364, 13, 347, 352, 476, 2028, 368, 1880, 390, 417, 247, 10331, 310, 1175, 13, 533, 253, 10861, 275, 9745, 562, 253, 23190, 1335, 4419, 634, 3939, 7268, 1108, 5734, 368, 457, 250, 7219, 327, 10678, 253, 10331, 4936, 4904, 3740, 13, 253, 3280, 273, 253, 1517, 8358, 310, 271, 9909, 629, 273, 752, 2789, 247, 5500, 273, 10331, 15, 831, 310, 2139, 309, 2761, 1620, 3630, 10123, 10542, 1754, 327, 581, 13214, 313, 9453, 309, 513, 3630, 731, 8791, 13, 534, 310, 2970, 7520, 1512, 582, 347, 627, 403, 1512, 1142, 4903, 285, 310, 816, 417, 1077, 9630, 15, 7191, 272, 271, 4743, 1754, 327, 247, 1643, 15107, 273, 10331, 310, 760, 9630, 604, 352, 457, 84, 1663, 9090, 3076, 390, 1175, 15, 187, 187, 4125, 13, 1907, 574, 247, 2257, 273, 2793, 275, 10331, 1057, 3885, 598, 253, 1232, 273, 12488, 3374, 285, 3237, 275, 271, 7202, 10331, 15, 10154, 1977, 13, 323, 1650, 13, 352, 310, 1896, 281, 2028, 752, 2238, 273, 1617, 247, 8429, 254, 73, 556, 644, 7141, 275, 13, 390, 1880, 271, 10652, 258, 311, 543, 556, 644, 294, 287, 12457, 13, 594, 327, 285, 594, 6593, 15, 733, 671, 7729, 18862, 267, 3006, 716, 284, 7938, 1108, 368, 476, 10323, 3812, 327, 271, 2455, 16122, 6335, 273, 27491, 285, 41868, 285, 871, 752, 10331, 436, 310, 954, 2074, 281, 13, 285, 3103, 752, 368, 476, 1902, 432, 352, 15, 2745, 284, 403, 1620, 253, 1072, 13, 2299, 13, 285, 1027, 952, 40436, 253, 10331, 671, 4917, 1027, 1543, 15, 1893, 13, 627, 457, 84, 760, 594, 2080, 368, 476, 564, 342, 253, 773, 47458, 668, 2746, 15, 47888, 281, 12106, 716, 284, 1754, 12718, 327, 42100, 13, 7286, 13, 3966, 13, 310, 760, 1896, 604, 368, 457, 250, 10620, 342, 9787, 1268, 2087, 1005, 15, 26394, 13, 3103, 13, 403, 806, 34965, 15, 187, 187, 2512, 310, 671, 3640, 326, 368, 476, 6351, 432, 10678, 253, 1072, 10331, 689, 285, 689, 969, 326, 368, 2550, 432, 10491, 15, 831, 778, 6388, 253, 10331, 6890, 327, 368, 1108, 247, 21533, 7141, 8429, 254, 73, 13237, 10305, 697, 5718, 9075, 13, 323, 1650, 15, 2207, 13, 352, 476, 816, 320, 326, 368, 1265, 36307, 8794, 1972, 326, 497, 627, 13, 533, 497, 417, 7933, 4755, 253, 806, 1643, 2069, 368, 1611, 352, 15, 2207, 4931, 368, 3368, 342, 1027, 3602, 13, 1824, 13, 20784, 13, 3966, 15, 285, 4366, 326, 352, 17923, 13359, 762, 1027, 5989, 15, 831, 1511, 273, 3640, 310, 417, 1896, 604, 368, 760, 452, 2030, 72, 273, 247, 10331, 15, 733, 476, 1663, 760, 1705, 342, 10678, 1052, 13, 7469, 13, 390, 1014, 9098, 72, 273, 253, 1072, 10331, 15, 2732, 247, 1223, 13, 368, 755, 247, 3282, 273, 752, 281, 1902, 13, 285, 672, 253, 1543, 1053, 457, 85, 2525, 12656, 13, 840, 352, 4916, 247, 4715, 2774, 15, 1422, 816, 476, 457, 85, 513, 326, 1293, 247, 2257, 273, 253, 1072, 10331, 15, 2091, 309, 1333, 773, 18941, 10331, 668, 309, 671, 1053, 457, 85, 816, 1599, 253, 1072, 2238, 273, 10331, 13, 824, 347, 247, 13898, 4297, 1279, 249, 13, 533, 2581, 253, 3242, 1072, 10331, 1108, 432, 253, 1072, 1659, 13, 21792, 1475, 253, 1072, 3522, 13, 3966, 15, 5815, 14604, 273, 10331, 432, 247, 24718, 310, 1469, 281, 320, 5777, 1027, 13, 642, 2647, 253, 5989, 13, 2378, 969, 5177, 839, 253, 2523, 15, 187, 187, 510, 1774, 2181, 273, 512, 436, 10331, 10678, 285, 4715, 310, 417, 594, 1199, 253, 10678, 3139, 13, 533, 253, 4619, 12906, 285, 7103, 326, 3936, 1659, 10486, 15, 1198, 788, 670, 752, 2571, 2028, 368, 1108, 752, 513, 368, 1928, 285, 1158, 672, 368, 457, 250, 10678, 436, 10331, 32, 1359, 1057, 352, 7277, 342, 752, 368, 452, 3597, 32, 1359, 1057, 352, 5691, 752, 368, 2168, 1158, 368, 871, 32, 1621, 9732, 476, 2028, 368, 667, 273, 436, 1108, 597, 476, 1127 ]
den – The Life of Percy Bysshe Shelley Warren Felt Evans – Esoteric Christianity and Mental Therapeutics William Morris – A Dream of John Ball Emily Ruete – Memoirs of an Arabian Princess: An Autobiography Charles Taze Russell – The Plan of the Ages (later The Divine Plan of the Ages, vol. 1 of Millennial Dawn, later Studies in the Scriptures) A. E. Waite – The Mysteries of Magic Births January 14 – Hugh Lofting, English children's writer (died 1947) February 11 – May Ziadeh, Lebanese-Palestinian poet, essayist and translator (died 1941) February 13 – Ricardo Güiraldes, Argentinian novelist and poet (died 1927) March 1 – Oskar Kokoschka, Austrian poet and artist (died 1980) March 30 – Frances Cornford (née Darwin, FCC), English poet (died 1960) April 1 – Brita von Horn, Swedish dramatist, novelist and theatre director (died 1983) April 15 – Nikolay Gumilyov, Russian Acmeist poet (executed 1921) May 16 – Vladislav Khodasevich, Russian poet and critic (died 1939) June 26 – Donar Munteanu, Romanian poet and magistrate (died 1972) July 16 – Pierre Benoît, French novelist (died 1962) July 22 – Hella Wuolijoki, Estonian-born Finnish writer (died 1954) July 24 – Jun'ichirō Tanizaki (谷崎 潤一郎), Japanese novelist (died 1965) September 8 – Siegfried Sassoon, English poet and memoirist (died 1967) September 20 – Charles Williams, English poet, novelist, playwright and theologian (died 1945) October 4 – Lennox Robinson, Irish dramatist, poet and theatre producer (died 1958) October 25 – Karl Polanyi (Károly Polányi), Austro-Hungarian economic historian and social philosopher (died 1964) November 1 – Hermann Broch, Austrian Modernist writer (died 1951) November 21 – Harold Nicolson, English author (died 1968) November 29 – Thomas Burke, English novelist and story writer (died 1945) December 5 – Rose Wilder Lane, American journalist and libertarian (died 1968) Victor Llona, Peruvian-born translator (died 1953) Deaths March 17 – Pierre-Jules Hetzel, French publisher (born 1814) March 27 – Sir Henry Taylor, English dramatist, poet and public official (born 1800) April 9 – Joseph Victor von Scheffel, German poet and novelist (born 1826) May 4 – Eliza Lanesford Cushing, American Canadian dramatist, short story writer, and editor (born 1794) May 15 – Emily Dickinson, American poet (born 1830) May 17 – Erskine May, English constitutional theorist (born 1815) June 14 – Alexander Ostrovsky, Russian dramatist (born 1823) July 16 – Ned Buntline (Edward Zane Carroll Judson Sr.), American publisher, dime novelist and publicist (born 1821) July 21 – Maximilian Wolfgang Duncker, German historian (born 1811) August 9 – Samuel Ferguson, Irish poet and antiquary (born 1810) October 22 – Matilda Jane Evans, English-born Australian novelist (born 1827) November 21 – Johannes Scherr, German novelist and critic (born 1817) November 22 – Mary Chesnut, American diarist (born 1823) December 12 – Johan Nicolai Madvig, Danish philologist (born 1804) Awards Newdigate Prize – R. L. Gales In literature Joseph Conrad's novel The Secret Agent (1907) is set during this year. References Category:Years of the 19th century in literatureOne of the things I often advocate for newcomers to tea drinking is to sample widely. Learning about tea is, on some level, not very difficult at all. It requires experience and an active mind to reflect upon and learn from the experiences gained. To gather this experience though, the only way to really do it is to drink a lot of tea. Reading about it or hearing about it really doesn’t do much good, for it is only theory that lacks backing from practical experiences. The practical problem with active sampling are twofold. The first is simple – samples are not very cheap, usually, and so it can actually be quite expensive when you buy a lot of them from different vendors. At a site like Yunnan Sourcing, you can easily drop a hundred dollars or more on a dozen samples, and that’s before you have to factor in shipping cost. If you’re not getting your samples for free, this can be quite a major expense on its own. Then there is the more nuanced problem of what to do with the samples. It’s quite easy to say that sampling widely will give you experience in tea drinking. In practice, however, that’s not so simple. Of course, trying all kinds of teas will most certainly give you experience. However, it is experience on a relatively shallow level. Certain kinds of teas, such as really bad or really good teas, will probably manifest themselves quite readily. Others, however, are not so obvious. It is actually easier to try teas if you, say, cup them, but then it becomes work and the process is not very enjoyable. This is, ultimately, a hobby, and not a job (for me anyway) so taking the fun away like that is basically missing the point. What instead happens is that some teas require multiple tastings to reveal themselves one way or another. Sometimes the first time you brew a tea it doesn’t come out quite right not because it’s bad, but because you are still adjusting to it. It helps when you’re using the same teawares all the time, so that the only variable is the tea. In some ways, by doing so you’re basically cupping the tea without cupping it – you’re testing whether or not the tea is good for your style of brewing. Even then, however, a good tea drinker should be adjusting to the tea and trying to brew it as best s/he can, which means that the first try can come out horribly wrong. Cupping also has its own limitations, as it can tell you whether or not a tea is good, but the skill in bringing out the goodness still requires your active intervention – unless you’re planning on drinking the tea grandpa style, the input of the brewer is an integral part of what makes a cup of tea. This is why I almost never write reviews anymore based on one impression (when I do write them anyway, which is getting rare too), as there are too many variables and is just not very reliable. Forming an opinion based on a few cups of tea is only reliable if it’s really obviously bad or good. Now, having had a lot of experience in tea does speed up the process of identifying issues and problems in an unknown tea. Right away, for example, it is possible to tell what kind of condition a puerh has been stored in, or whether an aged oolong has been reroasted, so on and so forth. It also helps compartmentalizing teas faster – you can basically draw on an ever expanding library of tastes and sensations and know what tea this is most similar to, and therefore what you can expect from it. Teas are never the same, however, and different people brewing the tea also yield different results. So, there’s only so far you can go with the “scientific” approach. Trying to analyze teas based solely on aroma, appearance, etc, is only possible if you’re dealing with industrial level generalities. Samples, therefore, are first impressions. There is also knowledge that you can gain from drinking the same tea over and over again that you cannot from sampling. This may involve the tea changing on you – a traditionally stored puerh gradually losing its storage taste, for example. Or, it can just be that you start noticing nuances that were there, but were not necessarily obvious the first few times you try it. Or perhaps you experiment with different parameters, water, ware, etc. and notice that it performs differently under different circumstances. This type of knowledge is not possible if you only have 25g of a tea. It can really only come with drinking 200, 300, or even 1000g of the same tea. After a while, you get a sense of what to expect, and when the results don’t meet expectations, then it becomes a learning moment. You just can’t do that without a lot of the same tea. When I say “same tea” I also don’t just mean the same kind of tea, such as a tieguanyin, but rather the exact same tea – from the same place, harvested around the same date, etc. Each batch of tea from a farmer is going to be slightly different, no matter the circumstances, once again complicating the issue. The important thing of all this tea drinking and learning is not so much the drinking itself, but the critical reflection and evaluation that takes place simultaneously. Forget about what others tell you – what do you feel and think when you’re drinking this tea? How does it compare with what you have tried? How does it challenge what you already think you know? No teacher can tell you any of this – they can point
[ 28461, 28, 3237, 275, 253, 3055, 3916, 1232, 943, 320, 26415, 562, 285, 18445, 342, 15, 28351, 12578, 9966, 7406, 7648, 73, 1119, 1941, 273, 440, 49628, 285, 6830, 6424, 3879, 407, 690, 16010, 13, 533, 344, 1904, 457, 85, 1089, 2712, 7738, 7936, 7242, 273, 253, 3916, 1232, 15, 6798, 33782, 1321, 574, 17770, 3000, 323, 17641, 457, 84, 3731, 21285, 4544, 13, 285, 342, 3408, 767, 273, 253, 2332, 30361, 13, 352, 457, 84, 30048, 281, 1978, 247, 9479, 2770, 327, 17641, 457, 84, 30990, 762, 530, 15, 52, 15, 6938, 5323, 15, 187, 187, 1276, 604, 13, 3185, 273, 6523, 17641, 457, 84, 1928, 14, 12311, 29908, 13, 7108, 3047, 253, 3888, 273, 13131, 277, 35706, 326, 403, 13889, 387, 1924, 4142, 390, 253, 11624, 273, 46447, 2448, 5219, 18797, 9593, 11624, 326, 452, 3531, 598, 342, 4166, 285, 15218, 1103, 347, 2080, 1977, 347, 14748, 32, 26659, 247, 20687, 417, 9398, 247, 3168, 11959, 342, 247, 17641, 18479, 285, 703, 457, 620, 2028, 368, 326, 2570, 17787, 36870, 403, 1663, 12927, 280, 246, 6228, 28904, 15, 844, 3365, 1053, 457, 85, 871, 752, 253, 2538, 273, 512, 273, 326, 4166, 285, 15218, 386, 588, 320, 15, 187, 187, 510, 17753, 4487, 273, 14673, 19242, 556, 816, 2361, 326, 495, 15, 520, 3041, 12511, 273, 773, 80, 1031, 2144, 668, 497, 22269, 598, 327, 17753, 457, 84, 8852, 1282, 275, 253, 806, 4314, 2607, 273, 436, 807, 15, 2064, 310, 247, 1384, 14, 8089, 2572, 275, 253, 4166, 5728, 1390, 807, 15, 380, 1375, 1057, 417, 2568, 871, 253, 1921, 323, 253, 14138, 2572, 13, 533, 1110, 8442, 403, 2080, 275, 6714, 273, 752, 359, 457, 306, 1705, 281, 2997, 347, 773, 6320, 668, 23753, 432, 253, 18351, 457, 84, 14974, 9787, 8232, 15, 187, 187, 7282, 556, 2168, 23383, 8106, 281, 1638, 6424, 7260, 13, 12319, 432, 10776, 281, 17974, 44182, 15, 733, 310, 8069, 247, 35171, 327, 19077, 13, 1907, 5821, 281, 1740, 1107, 273, 8667, 273, 697, 5252, 7259, 285, 697, 18035, 15, 380, 2567, 5087, 323, 253, 8993, 4076, 14, 484, 4815, 984, 326, 457, 84, 697, 4320, 8294, 15, 1893, 403, 5079, 29701, 762, 253, 24373, 10205, 3162, 13, 534, 310, 253, 2770, 273, 253, 26388, 326, 3135, 1735, 2129, 15, 187, 187, 7282, 671, 1335, 42261, 22414, 762, 253, 14673, 22106, 46327, 23868, 313, 10189, 4877, 582, 534, 45319, 253, 2105, 273, 33269, 43287, 23816, 15, 380, 15132, 4877, 1232, 12516, 247, 1318, 327, 253, 1481, 273, 1046, 8516, 10065, 9593, 5339, 390, 44137, 13, 1046, 277, 41178, 13, 1046, 17053, 305, 962, 15, 380, 22414, 403, 840, 908, 275, 20384, 6031, 13, 751, 42021, 9685, 6056, 15, 187, 187, 7282, 310, 253, 15515, 14, 45242, 13739, 327, 253, 8859, 15, 733, 310, 417, 247, 5487, 28, 352, 457, 84, 327, 2332, 323, 697, 16503, 15, 2058, 247, 673, 672, 1142, 7108, 4282, 604, 1512, 14, 2760, 14, 936, 14, 24796, 18674, 403, 1840, 253, 1569, 13, 359, 878, 281, 923, 326, 776, 3722, 16249, 6938, 10132, 403, 27810, 984, 597, 497, 3542, 323, 3394, 816, 751, 253, 17641, 28737, 15, 187, 187, 15418, 714, 1596, 744, 310, 4007, 285, 11731, 273, 3313, 12469, 538, 251, 8273, 15, 22050, 43353, 27, 296, 31981, 187, 29317, 3887, 6558, 398, 568, 36, 6147, 408, 17798, 89, 2146, 654, 951, 48072, 37474, 89, 2146, 33, 23655, 15, 681, 21760, 187, 29317, 3887, 5740, 568, 6113, 74, 14, 84, 20, 27973, 2460, 3, 187, 187, 4, 256, 20, 3671, 285, 690, 643, 21011, 187, 29537, 13390, 14, 788, 5731, 3857, 393, 187, 50276, 1739, 14, 788, 3334, 428, 90, 393, 187, 50276, 84, 20, 3671, 26721, 440, 16368, 3857, 393, 187, 50276, 1109, 428, 19232, 1227, 2044, 16, 4658, 16, 1739, 16, 28256, 3122, 187, 187, 4, 3334, 391, 27803, 187, 24584, 416, 3207, 11147, 64, 17037, 30, 87, 18, 15, 2504, 15, 17, 187, 29537, 22942, 1227, 12780, 393, 187, 50276, 10494, 26721, 428, 48, 5987, 1358, 21596, 84, 15, 83, 27803, 15, 2061, 16, 8626, 51, 3207, 11147, 64, 17037, 9228, 83, 27803, 14, 8626, 51, 3207, 11147, 64, 17037, 5960, 13217, 14, 39227, 1540, 15, 16368, 393, 187, 50276, 10494, 440, 16368, 1227, 12780, 16, 83, 27803, 14, 8626, 51, 3207, 11147, 64, 17037, 5960, 13217, 14, 39227, 1540, 15, 16368, 393, 187, 50276, 10494, 278, 87, 1227, 12780, 16, 83, 27803, 14, 4842, 13217, 14, 39227, 1540, 16, 83, 27803, 1227, 11919, 16, 4805, 393, 187, 50276, 10494, 40373, 428, 83, 1227, 12780, 16, 83, 27803, 11, 187, 187, 49617, 27479, 64, 9252, 16, 84, 20, 17440, 1227, 84, 20, 17440, 187, 31626, 34415, 15640, 16, 84, 20, 17440, 9686, 187, 48, 15, 44, 309, 1912, 626, 1818, 619, 49530, 15, 1292, 309, 858, 1818, 619, 11118, 13, 309, 1833, 3164, 513, 326, 432, 673, 281, 673, 15, 187, 42, 751, 634, 20076, 14, 597, 1472, 4484, 15, 27288, 310, 3240, 11755, 309, 1158, 15, 10363, 316, 41564, 3719, 434, 44596, 556, 247, 8580, 90, 2454, 2, 187, 187, 1147, 1057, 13, 285, 352, 310, 1270, 281, 923, 247, 8989, 326, 3548, 626, 19867, 50016, 1164, 3964, 328, 15, 309, 871, 326, 352, 310, 247, 5389, 5313, 273, 1445, 533, 309, 717, 8334, 273, 352, 13, 310, 3780, 2010, 275, 436, 1899, 15, 1621, 2647, 849, 1142, 5098, 368, 2619, 598, 352, 310, 1900, 627, 13, 1289, 565, 272, 387, 368, 432, 253, 3835, 13, 2761, 3981, 346, 248, 248, 15, 309, 1353, 1060, 969, 13, 368, 16216, 755, 8314, 273, 479, 47285, 47285, 3446, 187, 187, 42, 717, 417, 10412, 13, 309, 717, 816, 10208, 598, 342, 253, 1652, 417, 73, 525, 441, 321, 14650, 253, 1659, 273, 3687, 2758, 273, 2892, 275, 776, 12959, 15, 187, 187, 42, 1353, 417, 10279, 2, 1536, 583, 10279, 2, 380, 28401, 273, 50016, 1164, 3964, 328, 2, 5402, 8, 70, 512, 10279, 2, 329, 39639, 2, 187, 187, 2302, 15, 309, 5194, 342, 368, 15, 10363, 316, 41564, 8, 44596, 310, 2080, 8936, 275, 619, 4743, 285, 50016, 310, 2970, 2581, 38519, 15, 309, 5730, 597, 651, 897, 11853, 1045, 6628, 8, 8989, 13, 390, 387, 1878, 3523, 7384, 326, 344, 310, 253, 8198, 485, 273, 512, 1841, 22437, 15, 4952, 436, 12209, 310, 1925, 4377, 53, 307, 4041, 15, 50016, 15, 964, 964, 85, 307, 15, 964, 964, 85, 307, 15, 964, 964, 475, 11489, 304, 7276, 387, 521, 18580, 16391, 11, 187, 187, 42, 717, 3846, 11870, 594, 432, 1024, 327, 309, 778, 3590, 48101, 604, 309, 1053, 626, 2168, 15, 187, 187, 42, 5194, 670, 436, 50016, 2181, 15, 1621, 581, 310, 11280, 619, 50016, 1164, 3964, 257, 1984, 326, 309, 4845, 258, 253, 2829, 342, 690, 2317, 15, 495, 25503, 1410, 309, 3047, 952, 1379, 247, 3158, 1007, 285, 840, 2075, 625, 4116, 1931, 344, 5017, 1475, 352, 15, 380, 1390, 581, 309, 3047, 2686, 4395, 690, 5017, 2584, 253, 1984, 15, 187, 187, 248, 73, 13, 7016, 281, 3324, 598, 247, 3846, 9400, 1051, 2858, 309, 2389, 619, 747, 9788, 4233, 285, 1323, 11170, 873, 2, 23089, 841, 275, 353, 4350, 1143, 13, 1512, 15, 309, 1160, 253, 6135, 347, 247, 9449, 9140, 323, 22463, 13, 533, 344, 3078, 352, 2393, 13, 594, 309, 2692, 779, 15, 754, 1339, 479, 897, 629, 273, 253, 6135, 323, 619, 49530, 285, 11118, 15, 36026, 626, 352, 20295, 32, 5042, 63, 187, 187, 1394, 2550, 1501, 747, 12989, 275, 436, 12209, 1394, 2550, 12252, 281, 12989, 275, 436, 12209, 1394, 2550, 12921, 634, 9319, 275, 436, 12209, 1394, 2550, 11352, 634, 9319, 275, 436, 12209, 1394, 2550, 1501, 37969, 275, 436, 12209, 37796, 313, 19946, 5791, 6176, 310, 15335, 1929, 347, 443, 4976, 426, 5685, 9922, 4687, 10, 285, 20635, 487, 571, 3894, 247, 1048, 16592, 2892, 13, 5068, 387, 253, 990, 273, 253, 655, 394, 5331, 672, 253, 2586, 369, 29557, 264, 407, 6176, 15, 6176, 457, 84, 5231, 275, 253, 2586, 497, 6685, 17877, 13, 3340, 1411, 253, 3856, 287, 38646, 15, 496, 40253, 13, 546, 34785, 407, 253, 2761, 419, 545, 38364, 9811, 273, 616, 952, 13, 253, 3856, 2921, 41763, 275, 2137, 15, 7160, 25789, 621, 13, 2299, 13, 497, 16325, 595, 16013, 407, 5621, 273, 4214, 418, 837, 274, 8449, 17798, 19243, 13, 285, 253, 3856, 2921, 38646, 497, 23321, 949, 33902, 273, 2534, 445, 13438, 1919, 512, 533, 721, 13, 933, 273, 247, 3072, 273, 2456, 13, 933, 591, 1428, 432, 2057, 35351, 390, 253, 1629, 2683, 6419, 15, 831, 310, 7561, 2783, 281, 320, 253, 806, 1384, 394, 5331, 42604, 15, 1876, 5685, 35586, 275, 7531, 497, 38509, 456, 407, 247, 8936, 32683, 4668, 3361, 432, 26478, 281, 26052, 15, 187, 187, 1466, 457, 84, 5448, 3579, 281, 253, 807, 11161, 15, 2058, 21811, 273, 4596, 898, 253, 3402, 9377, 275, 12911, 15, 20635, 487, 571, 2918, 7379, 14, 2163, 15931, 12337, 275, 4596, 15956, 2511, 13, 1563, 4829, 247, 5331, 273, 1612, 23490, 285, 16860, 342, 697, 15833, 15, 12257, 13, 253, 12337, 858, 417, 3324, 247, 4209, 1180, 273, 13008, 281, 3630, 247, 747, 7410, 15, 1583, 14549, 11634, 4092, 16685, 875, 2710, 4676, 13, 534, 3977, 281, 247, 5547, 16253, 273, 247, 747, 7410, 275, 5080, 273, 7901, 15, 32237, 369, 7169, 253, 1563, 1770, 13, 285, 6176, 457, 84, 27135, 1877, 273, 5791, 285, 4255, 2335, 1659, 327, 4437, 495, 13, 7901, 15, 2053, 16907, 20804, 3394, 651, 3048, 253, 767, 4343, 2568, 969, 15, 187, 187, 688, 7901, 13, 34068, 20635, 487, 757, 2151, 665, 8899, 598, 275, 253, 443, 4976, 497, 2197, 896, 773, 9511, 668, 281, 20635, 487, 571, 15, 773, 510, 443, 4976, 2151, 273, 20635, 487, 571, 668, 574, 644, 43919, 432, 13842, 39210, 432, 2710, 29302, 19509, 4795, 432, 253, 35297, 11182, 273, 253, 3684, 4255, 7531, 6491, 434, 17273, 313, 13753, 2088, 48, 10, 1411, 3684, 7531, 457, 84, 17238, 273, 20635, 487, 571, 15, 2732, 253, 36103, 273, 16211, 272, 66, 327, 2552, 577, 13, 14304, 1128, 66, 23180, 2983, 327, 247, 29302, 2986, 275, 4965, 6836, 407, 253, 3684, 8118, 8544, 313, 10487, 20635, 487, 2458, 497, 5339, 37011, 783, 13710, 2088, 48, 26854, 959, 30122, 8385, 432, 1475, 253, 20902, 15, 6676, 4343, 13, 1690, 253, 443, 4976, 13, 2530, 8385, 275, 253, 830, 273, 4730, 13, 3739, 8596, 285, 1971, 13, 347, 973, 347, 18028, 29302, 23717, 323, 2151, 285, 2872, 7747, 15, 187, 187, 10342, 273, 841, 2151, 13, 665, 1669, 20635, 487, 571, 387, 247, 2872, 2363, 13, 574, 5262, 625, 685, 884, 1107, 275, 6176, 1293, 616, 4651, 390, 667, 3057, 281, 616, 2586, 15, 1583, 497, 4845, 762, 253, 20446, 273, 5685, 10954, 665, 497, 14565, 407, 253, 5791, 5685, 2208, 13, 285, 2959, 271, 4730, 627, 13, 1146, 10166, 347, 253, 2852, 17832, 273, 20635, 487, 571, 15, 187, 187, 1909, 253, 14275, 2137, 275, 20635, 487, 571, 2210, 281, 271, 990, 285, 253, 5791, 5685, 2208, 11512, 13, 352, 3395, 8767, 347, 281, 665, 651, 4035, 281, 15065, 253, 3297, 285, 4730, 273, 253, 2151, 15, 380, 2151, 497, 6726, 281, 1091, 1728, 281, 247, 1659, 326, 369, 773, 37380, 668, 281, 731, 15, 5595, 273, 253, 2151, 812, 417, 1014, 6983, 752, 20635, 487, 571, 369, 751, 1078, 597, 574, 1669, 323, 6176, 15, 4129, 954, 273, 253, 10884, 2151, 497, 773, 250, 13578, 668, 407, 4651, 390, 643, 2021, 2758, 285, 574, 644, 7329, 1309, 616, 46772, 275, 6176, 281, 20635, 487, 757, 4466, 313, 84, 23750, 13, 11012, 285, 3448, 582, 597, 6888, 326, 597, 812, 417, 4271, 3746, 342, 616, 1211, 2586, 13, 3448, 13, 390, 4466, 15, 380, 20635, 487, 757, 3072, 671, 11575, 253, 2151, 347, 20823, 5852, 15, 1284, 247, 906, 13, 841, 2151, 1119, 3746, 20501, 616, 6489, 285, 9046, 247, 4858, 285, 747, 6489, 12208, 407, 1142, 3345, 2616, 326, 2242, 9366, 875, 5685, 285, 20635, 487, 757, 22925, 13, 1014, 275, 3448, 15, 831, 1554, 40319, 6489, 2335, 327, 253, 1416, 773, 40, 4976, 14, 2151, 1425, 510, 11442, 13338, 34105, 6337, 616, 8059, 1924, 281, 495, 14, 17, 1563, 271, 11487, 14, 2787, 24417, 10170, 1411, 13975, 27756, 347, 247, 1458, 1127, 7583, 327, 7814, 15, 187, 187, 49107, 13338, 369, 562, 11860, 7584, 15, 19, 33109, 3079, 15, 26 ]
accountable; problems in the private claims process should be rooted out and dealt with. Former FBI Director Louis Freeh found evidence of unethical and possibly criminal behavior by some attorneys, but he didn’t find anything suggesting fundamental abuse of the claims process. Judge Barbier had harsh words for BP’s misdirection campaign, and with phase two of the trial underway, it’s imperative to keep a sharp focus on BP’s accountability under U.S. environmental laws. What if, instead of seeing BP’s feel-good messaging, Americans saw the images of infant dolphins that are dying at record rates or the eggs of migrating American White Pelican eggs that have turned up with oil and dispersants as far away as Minnesota? Ask a scientist not wearing a white coat with a BP logo and she’ll tell you that complex marine ecosystems are really oceanic tinderboxes. We simply don’t know what the effects of all of that oil and dispersant will be. The Louisiana Department of Natural Resources has just reported that 3.01 million pounds of “oily material” were cleaned up on Louisiana’s coastline in the first eight months of this year. That is a 20-fold increase in the oil collected last year. The state does not yet know the reason for the dramatic increase, but those figures are far in excess of what we’ve come to accept as “normal” leakage from the Gulf’s floating industrial zone. BP has already pleaded guilty to 14 criminal charges, ranging from lying to felony manslaughter. It is effectively a convict on probation, having agreed to four years of monitoring of its safety procedures and its ethics. The company paid for the immediate clean-up costs because that’s its legal responsibility. So are civil fines under the Clean Water Act, which is the focus of the hearings that begin next week. BP also still owes penalties under the Natural Resource Damage Assessment (NRDA), which calculates the cost of restoring devastated wildlife. The NRDA process puts a value on the head of every brown pelican killed or harmed, every dolphin, every laughing gull. The penalties are then used in restoration efforts, like rebuilding wetlands. BP is the sixth-largest corporation on the planet. It is not a victim; it’s on trial for its mistakes. At a time when many Americans wonder if too-big-to-fail corporations are above the law, we need to see that our bedrock environmental regulations are enforced because they were written for events just like the BP spill. David Yarnold is president and CEO of National Audubon Society.FROM debian:stretch LABEL maintainers="Cyrill Troxler <[email protected]>" LABEL description="csi-s3 slim image" # s3fs and some other dependencies RUN apt-get update && \ apt-get install -y \ s3fs curl unzip && \ rm -rf /var/lib/apt/lists/* # install rclone ARG RCLONE_VERSION=v1.47.0 RUN cd /tmp \ && curl -O https://downloads.rclone.org/${RCLONE_VERSION}/rclone-${RCLONE_VERSION}-linux-amd64.zip \ && unzip /tmp/rclone-${RCLONE_VERSION}-linux-amd64.zip \ && mv /tmp/rclone-*-linux-amd64/rclone /usr/bin \ && rm -r /tmp/rclone* COPY ./_output/s3driver /s3driver ENTRYPOINT ["/s3driver"] O.K I won't change my avatar. But I did change my signature, I'll probably do that from time to time. I like your signatures- they're cool. Mine is quite funny I think. Psusennes II's coffin has a smiley face! It does, and it is great to see a mask that isn't bloody Tutankhamun. I know that it is a beautiful piece of art but I am sick of it, is anyone else in this position. No matter how many books you pick up it is always there, glinting at you from the cover, almost saying "hehe. I'm here again, you cant get rid of meeeeeeeee". I am not crazy, I am just fed up with the little nothign usurping the place of greater members of history in our memories. I'm not mad! Whose mad! The curse of Tutankhamun! Your'e all mad! Aaaa! No. I agree with you. Psusennes' coffin is far superior in my opinion and Tut is getting rather tedious. I wish they would use somebody elses' mask, or at least stop assuming that he is the epitome of all things Egyptian. Even this forum is called KingTutOne. Tut. . .tut. . .tut. . . *sniggers at his awful joke* I am dead tired so from now on I may sound retarded if I don't already. I agree about this Tut thing. No one is buying my Tutankhamen book that I placed o the table with some space. 3 TIMES I saw people take a quick look and then pay more attention tot he stuff around it. The last one I saw actually moved some stuff toward the book. heh, sorry to bring up a dead topic...but I love my new siggy and avvy set! Made these in MSPaint, too. I made the doll as a Christmas gift for Robin, but he wanted it early, so I showed him. He let me use part of the doll for my avatar and signature. Isn't it cute? ^^ You cannot post new topics in this forumYou cannot reply to topics in this forumYou cannot edit your posts in this forumYou cannot delete your posts in this forumYou cannot post attachments in this forumGermany (former East Germany is officially known as GDR = German Democratic Republic) and Namibia share a long painful history, beginning at the end of the 19th century when the country was annexed by Germany. Germany’s actions in the country were extremely cruel, especially against the Herero natives. In 1904, enraged by the almost haphazard killing of their people, the Hereros erupted in war. Their rebellions, however, were brutally suppressed by forces of General Lothar von Trotha, and the Hereros natives were pursued through stretches of barren desert until all but 6,000 of a population of 50,000 perished from either starvation or the skirmishes. This is widely considered to be the first 20th century genocide. All German possessions in Africa were confiscated by a superior Allied military presence from 1914 to 1918. Let’s wind forward to the year 1989. At midnight of November 9 the wall broke in Berlin. Namibia held UN-monitored elections in November ’89, following nearly a century of power struggles and wars with its neighbors. Nevertheless, the elections did not bring a sufficient number of votes to write a new constitution. They perpetuated serious negotiations between various parties, which led to a successful adoption of a new constitution in February of 1990. Independence was granted the following month, and Germany’s reunification of East and West took place on October 3, 1990. These seemingly unrelated events would link the two countries yet again. In 1990, 430 Namibian children who grew up in the GDR were sent back “home” to Namibia. “The GDR children of Namibia” had been relocated from 1979 onwards from various refugee camps resulting from the liberation struggle of the South West Africa People's Organization (SWAPO) against South Africa’s occupation of Namibia. After the massacre of Cassinga on May 4, 1978—a brutal attack on a refugee camp in Angola by the South African army (600 Namibians were killed)—the SWAPO solicited humanitarian assistance from around the globe. Many countries, including the GDR, provided assistance in the form of education, medical aid and treatment, as well as granting refugee asylum for children and young adults. Most of these children, who left Namibia at a young age, had spent more than 10 years in Germany without their parents or any contact to their country. They were placed under the supervision of German teachers who were hired by the East German government, and received an education there, being trained as the future elite of Namibia. As the independence war in Namibia came to an end and the East German government resolved, it became uncertain as to who would continue to finance the stay and education of the children. The children were forced to return home to a place that was “foreign” to them. Most of the children could not even recall what Namibia was like before they had left for Germany. Although most of the returning children were “reclaimed” by parents or other family members and had been exposed during their schooling in Germany to Namibian culture (songs, dance and language), they discovered that they could not identify themselves with their own country, language, or culture. The Namibian population also viewed the children as outsiders. As a result, these children found themselves questioning their identity and forming a separate and new identity influenced by many outside factors that lay somewhere between German and Namibian identities, even in language. This multicultural identity took on the name “GDR- children.”The Northern Colorado Bears ran their conference record to 3-0 following an 82-79 OT victory against visiting Idaho as a 15 point favorite on Saturday. Northern Colorado was outshot 49.2%-43.9
[ 281, 253, 11186, 5328, 15067, 15918, 273, 253, 5418, 21706, 15, 380, 1386, 369, 13966, 275, 11299, 15, 329, 1387, 273, 17603, 41498, 7478, 253, 27192, 187, 33177, 13, 285, 342, 1329, 273, 840, 15636, 42735, 14032, 13, 352, 3395, 253, 3054, 8, 806, 29418, 281, 27192, 2199, 15, 380, 2553, 310, 8558, 24983, 48475, 285, 33791, 285, 23129, 513, 417, 8268, 577, 2558, 15, 187, 187, 45, 3204, 27, 1623, 634, 1211, 275, 7061, 3228, 187, 187, 4553, 8396, 27, 831, 9055, 1928, 1959, 281, 4264, 253, 1980, 13746, 273, 7061, 3228, 15, 380, 5418, 21706, 6516, 273, 3096, 1975, 5489, 428, 253, 6657, 275, 14530, 834, 1975, 27960, 569, 285, 187, 3456, 27489, 1580, 15788, 13, 9073, 6186, 34028, 285, 38454, 253, 23476, 275, 39470, 5480, 17122, 3683, 285, 5248, 7446, 284, 15, 380, 3684, 23528, 2418, 31606, 187, 46, 49940, 13, 12098, 15, 310, 247, 417, 14, 1542, 14, 15608, 6003, 4232, 323, 253, 6378, 273, 23029, 13, 4730, 13, 14892, 13, 285, 18366, 7914, 273, 23859, 187, 2655, 5805, 13, 16407, 5280, 571, 13, 285, 253, 2455, 14, 28276, 9493, 2144, 2173, 281, 3684, 23528, 285, 2905, 2448, 8087, 29488, 15, 733, 310, 247, 12095, 4158, 323, 512, 11880, 285, 2308, 273, 1600, 15, 7061, 3228, 671, 14516, 247, 48541, 273, 1445, 40871, 285, 187, 22524, 16999, 12164, 407, 1980, 10846, 285, 2136, 15, 187, 187, 4553, 8396, 27, 14772, 436, 9055, 4143, 253, 187, 6790, 28340, 34891, 30014, 12932, 1771, 4441, 816, 3345, 273, 7061, 3228, 15, 380, 2021, 9633, 187, 6481, 1771, 556, 644, 2403, 3684, 23528, 33707, 323, 2620, 14649, 15, 1583, 3959, 625, 187, 14644, 1458, 31388, 13, 9279, 285, 14795, 33707, 15, 187, 187, 11185, 27, 380, 611, 4033, 322, 35444, 13, 4270, 275, 5403, 13, 310, 4441, 342, 247, 1859, 273, 30480, 15, 31933, 3062, 15, 733, 187, 261, 16092, 396, 4686, 327, 4562, 9741, 264, 20046, 285, 1977, 432, 10000, 10198, 15, 15764, 187, 36, 7209, 19362, 697, 1039, 4768, 253, 2867, 285, 253, 1781, 479, 7240, 275, 2914, 273, 187, 783, 35444, 310, 2223, 253, 41008, 323, 24563, 285, 10709, 12305, 15, 187, 187, 42556, 39456, 27, 5815, 2316, 310, 13496, 342, 271, 6871, 272, 4450, 285, 6871, 13, 275, 2316, 8574, 13, 4707, 6079, 254, 13, 285, 7315, 342, 8905, 1453, 15, 1876, 9956, 4735, 4585, 3290, 322, 35327, 37029, 20534, 15, 8741, 3056, 403, 417, 13496, 342, 247, 12949, 14, 925, 3526, 533, 13, 253, 2164, 4964, 637, 9306, 2914, 8597, 556, 247, 1781, 29794, 323, 667, 26114, 326, 778, 878, 281, 320, 4934, 4484, 15, 187, 187, 39965, 874, 39456, 27, 329, 5389, 16612, 3400, 247, 22936, 1859, 273, 30480, 15, 31933, 3062, 285, 10151, 30480, 15, 11960, 6421, 15, 7648, 8574, 310, 2130, 275, 253, 16612, 15, 743, 26225, 11029, 253, 2022, 3652, 1223, 391, 11441, 3238, 512, 643, 8614, 2316, 9195, 15, 7648, 12141, 29023, 310, 2130, 327, 2670, 15, 187, 187, 8944, 6856, 3646, 27, 1621, 8944, 6856, 7823, 6889, 407, 9509, 15, 6408, 512, 1387, 3394, 285, 4712, 13, 10470, 310, 19772, 15, 187, 187, 8497, 27, 831, 310, 271, 2393, 4131, 16018, 15, 28436, 8090, 273, 14234, 323, 253, 2393, 4131, 17603, 14664, 12584, 3790, 484, 15, 8057, 19110, 285, 19269, 390, 23354, 12682, 403, 2424, 323, 8815, 14, 2135, 15150, 15, 17054, 41407, 310, 28249, 331, 445, 3472, 342, 7469, 16303, 313, 39025, 1469, 1066, 481, 7764, 3324, 9848, 7824, 12682, 285, 247, 18553, 323, 4484, 15985, 9208, 15, 187, 187, 30389, 7957, 27, 611, 4033, 322, 35444, 428, 3817, 264, 12561, 546, 7622, 15, 187, 187, 18968, 920, 27, 444, 1277, 12715, 353, 35064, 2637, 6202, 10845, 3329, 1848, 15, 40177, 581, 273, 253, 1390, 1270, 3394, 273, 253, 4255, 13, 253, 7970, 330, 8976, 2418, 4913, 28299, 12778, 5863, 15, 4214, 330, 8976, 457, 84, 1821, 1119, 5328, 1060, 275, 253, 5768, 273, 1283, 3566, 15, 380, 5603, 457, 84, 21175, 21327, 13, 10583, 90, 479, 16044, 285, 27731, 273, 43056, 3959, 22936, 6849, 1223, 671, 5277, 247, 13406, 13, 45788, 35514, 323, 253, 5603, 457, 84, 1740, 14, 48365, 8811, 15, 36388, 337, 13, 7554, 27231, 270, 1988, 13, 2112, 342, 18500, 46892, 27721, 13, 38037, 1045, 76, 13, 2119, 14, 8938, 264, 11129, 36507, 285, 247, 3961, 273, 38141, 3600, 8111, 15744, 687, 312, 253, 5603, 457, 84, 30108, 1981, 11102, 13, 933, 20046, 15, 35193, 253, 24511, 347, 337, 13, 7554, 1481, 273, 14664, 12584, 11267, 934, 407, 347, 5603, 11570, 13, 12120, 25637, 285, 12120, 23660, 84, 513, 616, 1682, 281, 4446, 253, 4913, 457, 84, 33361, 715, 253, 28299, 3094, 83, 932, 13, 8136, 767, 13205, 14657, 3672, 2112, 253, 1039, 15, 187, 187, 45, 3204, 27, 2058, 10063, 11590, 35444, 275, 330, 8976, 2418, 4913, 15, 187, 187, 4553, 8396, 27, 2732, 11157, 26759, 598, 323, 247, 8815, 2135, 11693, 9549, 949, 253, 45788, 896, 2586, 273, 330, 8976, 2418, 4913, 15, 187, 187, 4553, 8396, 27, 44145, 11834, 253, 14572, 9791, 34891, 310, 581, 273, 253, 1533, 434, 20088, 285, 954, 2570, 41644, 15, 17054, 41407, 13, 275, 17054, 41407, 3313, 4913, 13, 310, 3349, 13, 22270, 20046, 273, 6804, 14, 34495, 9791, 34891, 13, 37202, 6859, 21175, 9741, 13, 285, 247, 48541, 273, 23816, 15, 380, 15985, 310, 973, 1929, 323, 697, 16383, 3148, 273, 3817, 1601, 13, 271, 11555, 15985, 4702, 9924, 273, 6906, 9039, 614, 45006, 37427, 14795, 681, 1768, 15, 380, 5603, 434, 6804, 14, 34495, 9791, 34891, 310, 581, 273, 253, 1643, 5780, 285, 310, 1728, 281, 7925, 23816, 824, 347, 270, 1988, 13, 1045, 76, 13, 46892, 27721, 13, 278, 1657, 24563, 13, 49145, 4787, 13, 285, 9791, 34891, 9097, 15, 14499, 410, 17054, 41407, 342, 697, 14673, 41407, 3035, 1206, 593, 11997, 15, 20816, 281, 253, 1659, 835, 253, 15985, 369, 6888, 285, 3037, 849, 352, 1694, 697, 1416, 15, 41976, 949, 253, 8485, 15985, 9956, 285, 9413, 253, 4451, 285, 17829, 34256, 15, 5595, 273, 253, 7469, 16303, 2112, 436, 7622, 403, 1066, 15, 831, 28249, 331, 445, 3472, 581, 14, 14674, 13915, 4892, 34756, 337, 11199, 3038, 285, 39852, 253, 15985, 407, 26225, 15, 187, 187, 14344, 6865, 16823, 2665, 1005, 187, 187, 4814, 10228, 13, 3684, 23528, 187, 187, 13425, 42372, 2512, 403, 1142, 3081, 4712, 2130, 1309, 634, 4143, 281, 253, 5418, 21706, 15, 831, 2086, 588, 5181, 327, 1142, 273, 253, 2087, 3672, 273, 1600, 533, 476, 417, 2836, 11617, 715, 512, 627, 310, 281, 923, 285, 513, 1060, 15, 1707, 310, 271, 4722, 285, 7000, 2892, 670, 18199, 7108, 13, 42997, 34684, 13, 5328, 44774, 285, 625, 15, 6676, 952, 1705, 281, 253, 5418, 21706, 323, 18714, 40732, 15133, 13, 20937, 13, 3081, 33061, 13, 285, 253, 1263, 273, 18052, 6284, 824, 347, 3471, 1497, 285, 14530, 834, 1497, 15, 1707, 403, 7418, 34028, 275, 37645, 3228, 13, 16631, 5308, 13, 7061, 3228, 13, 330, 8976, 285, 643, 4577, 15918, 275, 253, 5418, 21706, 15, 1707, 310, 271, 2761, 19461, 1618, 273, 1345, 285, 3055, 31154, 281, 4143, 347, 973, 15, 26755, 824, 347, 25743, 17241, 5106, 13, 1720, 431, 587, 33892, 13, 253, 13303, 27950, 49787, 3702, 13, 285, 18660, 273, 643, 794, 4712, 14303, 634, 4143, 15, 496, 10030, 10228, 627, 310, 12949, 15692, 13, 253, 37029, 411, 991, 16064, 13, 31933, 3062, 39561, 77, 360, 16061, 13, 5053, 281, 755, 634, 7512, 2668, 275, 14464, 37635, 13, 5328, 7477, 24478, 13, 285, 1199, 13, 1199, 625, 15, 187, 1394, 812, 4288, 281, 32974, 434, 20610, 275, 8973, 36582, 285, 1091, 281, 253, 21706, 407, 6276, 949, 5389, 8598, 274, 12306, 33843, 13, 247, 3313, 1810, 23876, 2896, 1106, 15, 187, 2512, 310, 594, 1199, 281, 513, 275, 253, 5418, 21706, 13, 627, 310, 247, 1175, 1921, 253, 5418, 21706, 403, 33690, 346, 37188, 1876, 34697, 569, 3446, 2214, 3081, 1491, 13, 4143, 27, 8280, 15, 11958, 73, 3171, 14367, 6056, 15, 681, 187, 187, 19206, 386, 1491, 670, 634, 44414, 552, 27, 7764, 871, 326, 1223, 359, 513, 3253, 359, 476, 281, 2457, 907, 512, 7794, 273, 776, 5659, 973, 275, 7170, 13, 627, 403, 38238, 326, 13949, 1364, 320, 12059, 15, 3824, 4422, 588, 4887, 253, 954, 3332, 1491, 13, 285, 359, 403, 7730, 281, 5277, 368, 342, 2457, 2086, 4278, 642, 1996, 685, 4314, 3618, 2720, 281, 253, 1265, 273, 5659, 3345, 253, 530, 15, 52, 15, 285, 1264, 3618, 2720, 281, 253, 1265, 273, 5659, 1561, 253, 530, 15, 52, 15, 1310, 368, 2455, 452, 3533, 670, 634, 2086, 13, 4496, 1053, 626, 32379, 281, 3057, 441, 285, 359, 588, 320, 5211, 281, 10073, 368, 15, 187, 187, 32783, 21695, 32, 187, 187, 510, 6323, 275, 1708, 13, 18001, 13, 3477, 14, 936, 14, 2327, 1165, 9571, 2025, 55, 14558, 11298, 4095, 403, 2130, 327, 8669, 42354, 5659, 5929, 12369, 368, 403, 32321, 13, 275, 247, 9539, 390, 275, 247, 16064, 3126, 835, 8288, 31311, 310, 42965, 13, 247, 11298, 2813, 2789, 352, 1928, 751, 776, 10071, 403, 8288, 4518, 285, 3587, 281, 368, 15, 36909, 323, 4834, 327, 247, 8669, 42354, 15865, 2, 187, 187, 11, 7845, 3877, 326, 1955, 281, 253, 3753, 273, 690, 5659, 13, 253, 8905, 4328, 390, 2208, 10132, 13, 11298, 4095, 778, 417, 320, 2130, 15, 1310, 368, 457, 69, 751, 281, 871, 323, 2119, 604, 634, 2086, 588, 3959, 11298, 4095, 13, 816, 1067, 285, 1642, 271, 2006, 16179, 2, 11778, 368, 3735, 731, 32, 380, 47819, 32, 187, 187, 4527, 2282, 368, 452, 15, 1536, 261, 5726, 403, 247, 7615, 16866, 281, 1110, 665, 48131, 616, 13846, 275, 12195, 15, 19810, 4089, 731, 1512, 13, 2167, 597, 3480, 253, 12288, 281, 2096, 15, 399, 17290, 15, 32005, 15, 4591, 19357, 90, 15, 31872, 18037, 15, 19743, 3000, 323, 2969, 13846, 15, 187, 187, 1628, 1394, 871, 1805, 685, 326, 34857, 2064, 581, 369, 7615, 15, 1292, 417, 841, 15, 1621, 13, 841, 403, 2866, 46947, 350, 15, 733, 457, 84, 7479, 281, 320, 2119, 627, 457, 84, 2712, 281, 4089, 15, 9110, 1335, 13, 247, 23140, 670, 731, 15, 329, 7107, 1612, 15, 329, 26057, 2980, 1612, 15, 187, 187, 4769, 5262, 275, 12195, 34080, 684, 253, 5083, 670, 952, 13, 670, 21546, 15, 733, 2789, 8342, 752, 556, 644, 27715, 15, 14182, 1255, 1499, 360, 1653, 1561, 512, 15, 187, 187, 3650, 3240, 2119, 849, 285, 1199, 1679, 2119, 2139, 13, 368, 457, 306, 1119, 4834, 1060, 27, 247, 15985, 985, 3676, 11834, 253, 12689, 433, 8825, 273, 7949, 334, 316, 15, 9937, 31590, 4388, 13102, 323, 3038, 13, 627, 457, 84, 644, 247, 23140, 281, 1016, 3213, 368, 457, 306, 2668, 285, 4035, 281, 1379, 15, 5402, 9881, 1408, 2439, 3402, 1113, 87, 723, 326, 403, 2969, 275, 253, 1039, 326, 9129, 1841, 2223, 403, 15, 2053, 403, 253, 22325, 368, 457, 306, 2326, 15, 380, 954, 9129, 15, 187, 187, 7093, 1854, 7637, 387, 247, 11288, 2806, 5909, 275, 253, 5254, 15, 1422, 457, 250, 5486, 281, 6923, 13, 368, 457, 250, 2119, 273, 352, 15, 2732, 268, 36314, 281, 1908, 13, 368, 4710, 634, 30162, 1066, 342, 253, 3524, 273, 39417, 272, 849, 3676, 352, 310, 15, 1422, 9257, 14218, 689, 15, 1621, 1708, 7985, 15, 1621, 3590, 3735, 15, 187, 187, 16812, 13, 368, 6923, 28, 436, 2250, 347, 2119, 347, 512, 1110, 2720, 15, 187, 187, 4769, 5262, 275, 12195, 34080, 684, 253, 5083, 670, 952, 13, 670, 9099, 15, 733, 2789, 8342, 752, 556, 644, 27715, 15, 1707, 310, 1900, 247, 2105, 15, 187, 187, 2347, 1048, 497, 368, 10805, 32, 1737, 3884, 858, 368, 2965, 32, 27200, 368, 10805, 387, 512, 32, 1422, 1007, 323, 271, 13032, 1253, 395, 625, 15538, 13, 271, 10463, 1253, 936, 253, 1355, 13, 9670, 34074, 14, 13824, 9320, 368, 457, 250, 275, 15, 1707, 310, 5293, 15, 9937, 642, 2603, 273, 1708, 13, 368, 4518, 923, 253, 29422, 13, 6032, 8805, 5254, 5152, 3390, 19123, 275, 253, 4055, 1293, 247, 9370, 390, 1424, 87, 547, 7985, 15, 743, 30099, 13, 4931, 581, 273, 253, 806, 15, 329, 6906, 2806, 14, 13182, 713, 5384, 1499, 1622, 84, 1066, 253, 7123, 15, 187, 187, 2374, 352, 13, 247, 8805, 15269, 15, 1422, 2746, 15, 733, 457, 84, 47514, 723, 403, 326, 273, 271, 5130, 15, 187, 187, 1909, 368, 5569 ]
to the northern gold mining towns of the Black Hills. The line was abandoned in 1983. A group of outdoor enthusiasts recognized the trails potential, and with support of then Governor Mickelson, it became the states' first rails to trails project. The surface is primarily crushed limestone and gravel and grades do not exceed 4 percent. Lunch: On your own in Hill City Afternoon: This afternoon feel free to enjoy the local flavor of Hill City. The Black Hills Institute of Geological Research - the leader in paleontological excavations and preparation since 1974, helping supply museums and collectors the finest in professionally prepared fossils and cast replicas. The South Dakota State Railroad Museum, Ltd. is a not-for-profit organization established for the purposes of preservation, education, promotion, and interactive interpretation of railroad equipment, memorabilia, and the ever-changing historical material specific to South Dakota and related American railroads. It is a destination designed for all ages and levels of interest. Hill City also hosts a plethora of art galleries and unique shops supplied by local artists and business. Afternoon: Later this afternoon visit the local Prairie Berry Winery located just outside of Hill City. The family owned winery has been making South Dakota wines for five generations. They offer more than 15 grape, fruit and honey wines. Description: The K Bar S Lodge, built in 2006, is located with a view of Mt. Rushmore. It is quietly secluded on 31 forested acres and away from busy streets. Battle Creek winds its way throughout the property and the large meadow in front of the Lodge is often the playground for deer and turkeys. Room amenities: Each room is equipped with an ironing board and iron, in room coffee, hair dryer, and television with remote control. All rooms feature highest quality Serta Presidential beds. Rooms are not equipped with a mini-fridge but, the 24 hour manned front desk has a large refrigerator for any medicines that may need to be kept cool. Facility amenities: A beautiful lobby provides a spectacular view of Mt. Rushmore and nearby Mt. Baldy. Free coffee is available in the lobby. An elevator serves the main building while ramps services all other hotel room buildings. Free guest laundry is available on site. Smoking policy: NoSmoking policies vary by facility. During all group events and activities, smoking is prohibited. Note: This is an early morning departure. Bring layers of clothing for the early morning outdoor buffalo roundup. Long pants and boots or tennis shoes are required for horse-back riding. Wind Cave is moderately strenuous with 300 stairs (mostly going down). Please bring comfortable walking shoes and a jacket for cool cave temperatures. Breakfast: K Bar S Lodge - boxed breakfast en route. Morning: EARLY MORNING DEPARUTRE. Witness one of the last great events of the West, the annual Custer State Park Buffalo Round Up. General Custer’s men found gold here in the summer of 1874. The park’s pine forests, grassy meadows and towers of granite offer spectacular views while also providing a remarkable, lush sanctuary for the park’s four-legged residents. Nearly 1,300 magnificent bison, along with fleet pronghorn, elusive elk, sure-footed mountain goats and a band of begging burrows freely roam the park’s sprawling 71,000 acres. Feel the thunder as 1,300 head of buffalo rumble by as park personnel, cowboys and cowgirls do their best to drive the Park’s herd into the Buffalo Corrals, passing two designated viewing areas along the way. Lunch: At Blue Bell Lodge in Custer State Park. Afternoon: After lunch saddle up for a horseback trail ride through the lush back country of Custer State Park. Afternoon: Hidden beneath the rolling prairie is one of the world's longest and most complex caves. Wind Cave, in Wind Cave National Park, is 28,295 acres of mixed-grass prairie, ponderosa pine forest, and a plethora of wildlife. The cave is well known for its outstanding display of boxwork, an unusual cave formation composed of thin calcite fins resembling honeycombs. The park's mixed-grass prairie is one of the few remaining and is home to native wildlife such as bison, elk, pronghorn, mule deer, coyotes, and prairie dogs. Explore Wind Cave with its Natural Cave Entrance Tour. Travel to the place where the cave was discovered and learn how it got its name. Journey through the vast cave rooms and discover the unique and abundant formations. Most of the 300 stairs along this route are down. This moderately strenuous one-half mile tour lasts 1¼ hours and exits the cave by elevator. Free Time Opportunities Keystone, South Dakota General OverviewThere are many additional activities available during your visit to the Black Hills. This program will touch on many of the general areas of interest but can not dig deeply into all there is to see and do here. There is an interesting and detailed history about Native Americans, plains settlers, gold seekers and more. Many people come to the Black Hills for exceptional trout fishing, photography, additional hiking, and the study of specialized interests such as geology and paleontology. There are numerous museums in Rapid City, Deadwood, Hill City, Custer and other smaller towns in the Black Hills. There is an almost endless list of public and private attractions to visit as well. Places such as Bear Country USA, Reptile Gardens, the Wild Horse Sanctuary, and dozens of other fun activities await your visit. In Keystone there is mini golf, the Presidential Wax museum, Rushmore Borglum Story, places to get your photo taken in historic costumes, gold mine tours, and much, much more. You could travel to Devil's Tower in NE Wyoming and return to the Hills by driving through beautiful Spearfish Canyon, a National Scenic Byway. There is so much to do in the Black Hills, there is a good reason the Black Hills are dubbed "Beyond All Expectations".For additional information, visit: www.blackhillsbadlands.com Important information about your itinerary: Please know that while we do everything we can to finalize all aspects of our programs well in advance, there are logistics that occasionally must be altered. Our website will reflect the most recent information, and we are committed to providing you with final program details no later than eight weeks prior to the start of programs outside the U.S. and three weeks prior to the start of programs within the U.S. If you ever have questions about your program, please don't hesitate to contact us and we will be happy to assist you. Need Help? The latest in light, portable, easy-to-use QUIETVOX listening devices are available on Road Scholar programs.* Whether you are outdoors, in a crowd or in a museum environment where speaking loudly is discouraged, a listening device makes it feel like our experts are speaking clearly and directly to you. Hear for yourself on a Road Scholar adventure! *Please note that due to the nature of some programs, the remote location or government regulations, listening devices may not be available. If you’d like to know for sure if your program will offer listening devices, just call and ask an Advisor!Have you heard them? The whispers? Of course you have. Whispers are a familiar companion to those who engulf their minds in shadow. Others hear them too, though they lack the insight to understand. Doubt. Fear. Jealousy. Mistrust. Simple words for simple minds. “You know better than that…” That one was familiar. But not these. No, these are… fainter. It’s impossible to be sure there’s anything to hear. Yet still, a certainty about them. A quiet power. A deafening power. Time spent in shadow illuminates the truth about people, about intentions. It makes plain what has been concealed. Darkness slumbers within all. Not quite sure how and much less sure why, you’ve found yourself here: a cave system deep beneath the scarred soil of Silithus. Despite wandering aimlessly for hours, there’s been a certainty to each step you’ve taken and continue to take. Your fingers run across wall carvings that are simple in the way that ancient things often are. These are the simplest you’ve seen. The most ancient. Your path ends at a pitch black opening in the floor. You’re meant to jump, you’re sure of it. After pausing to consider, you throw your torch down with the hope of gauging how deep it is. You carefully peer over. No light visible. No sound heard. Still, you jump; this action as sure as all those prior. Time spent in shadow illuminates the truth about people, about consequences. It makes plain what has been concealed. There is always a cost. How long were you falling? What direction did you fall? Were you falling at all? You look for an entrance–and more importantly, an exit–to the small, perfectly dome-shaped chamber you’re in. There is none. Despite no source of light, you clearly see the polished, smooth stone floor bulging upward in the center without a crack or crevice visible. An altar, perhaps one of the first. A thin black-purple mist slithers down the sides. On it, a stone sphere. You approach. It’s etchings are that of an eye. As you lock
[ 320, 2104, 281, 42347, 285, 1086, 7430, 253, 941, 2197, 875, 731, 15, 187, 187, 1909, 824, 13, 13001, 13, 9891, 273, 29908, 13498, 13, 4481, 16596, 13, 1569, 10473, 11009, 285, 4481, 4413, 2550, 755, 281, 841, 8169, 15, 4952, 604, 627, 310, 247, 1302, 1340, 10568, 253, 3727, 273, 326, 8692, 15, 187, 187, 1992, 1379, 253, 29908, 1650, 13, 990, 14, 936, 14, 423, 24589, 7362, 1369, 868, 941, 281, 512, 533, 253, 22647, 285, 11452, 15, 496, 1635, 281, 8217, 285, 44891, 2946, 347, 5393, 1840, 13, 1142, 643, 3238, 452, 2879, 990, 14, 936, 14, 423, 24589, 281, 1805, 7895, 253, 11068, 273, 616, 4212, 13, 665, 4831, 352, 15, 3808, 273, 841, 11222, 2486, 27, 187, 187, 44, 518, 8500, 1108, 743, 8164, 29908, 2579, 326, 6131, 1959, 2505, 272, 285, 6789, 15, 11456, 6, 273, 3684, 13247, 21679, 4212, 497, 970, 611, 518, 8500, 347, 273, 4240, 15, 187, 187, 7557, 1108, 329, 6692, 1959, 1935, 622, 323, 10430, 17438, 13, 3888, 13, 10556, 13, 3492, 27691, 285, 9797, 29205, 15, 1583, 4102, 671, 2879, 247, 29182, 6431, 2579, 15, 187, 187, 55, 3604, 48979, 1108, 831, 22785, 14, 3169, 31267, 2579, 6131, 990, 281, 990, 24589, 323, 10924, 347, 973, 347, 323, 9628, 4367, 15, 657, 3604, 310, 48526, 4404, 10459, 285, 24715, 10924, 15, 187, 187, 31889, 1108, 15397, 281, 10243, 13, 253, 22338, 2579, 6131, 1959, 29908, 13, 3966, 15, 285, 310, 16633, 327, 22474, 27549, 13, 3909, 789, 30345, 15, 187, 187, 32136, 13, 657, 3669, 13, 285, 643, 29908, 3238, 15, 187, 187, 1785, 3743, 323, 43916, 990, 281, 990, 24589, 187, 187, 2512, 403, 1264, 2201, 17059, 273, 5052, 281, 444, 19, 5607, 15, 380, 1563, 403, 253, 2022, 7125, 273, 10473, 11009, 285, 13001, 27, 187, 187, 24441, 6338, 971, 247, 1039, 715, 841, 8169, 984, 597, 1928, 352, 310, 3309, 281, 11757, 6617, 285, 19227, 15, 5488, 13, 616, 1859, 310, 326, 616, 3745, 281, 2289, 8169, 310, 625, 1774, 281, 247, 1436, 457, 84, 285, 2586, 457, 84, 3988, 685, 11068, 15, 187, 187, 395, 19227, 15, 5488, 13, 616, 1859, 310, 326, 616, 3745, 281, 2289, 8169, 310, 625, 1774, 281, 247, 1436, 457, 84, 285, 2586, 457, 84, 3988, 685, 11068, 15, 1583, 457, 306, 574, 2289, 281, 8169, 275, 253, 2469, 15, 6102, 347, 342, 3520, 7177, 285, 16530, 15, 1893, 13, 672, 1302, 14, 16586, 13, 4413, 574, 281, 1918, 598, 253, 941, 281, 6338, 15, 3010, 4980, 5657, 403, 3309, 323, 4980, 2069, 13, 597, 1333, 15, 1893, 597, 971, 247, 1039, 281, 4035, 970, 952, 457, 84, 10924, 281, 3819, 6617, 15, 7214, 436, 812, 320, 327, 247, 1199, 4936, 254, 4311, 13, 347, 359, 2319, 1996, 275, 253, 3929, 15, 187, 187, 18869, 347, 342, 3520, 7177, 285, 16530, 15, 1893, 13, 672, 1302, 14, 16586, 13, 4413, 574, 281, 1918, 598, 253, 941, 281, 6338, 15, 3010, 4980, 5657, 403, 3309, 323, 4980, 2069, 13, 597, 1333, 15, 1893, 597, 971, 247, 1039, 281, 4035, 970, 952, 457, 84, 10924, 281, 3819, 6617, 15, 7214, 436, 812, 320, 327, 247, 1199, 4936, 254, 4311, 13, 347, 359, 2319, 1996, 275, 253, 3929, 15, 8853, 8075, 878, 247, 1039, 281, 2289, 253, 8169, 13, 533, 760, 273, 1110, 952, 665, 7703, 281, 5237, 441, 275, 690, 1039, 15, 1292, 253, 4803, 8704, 665, 2289, 265, 752, 403, 1327, 13955, 15, 187, 187, 510, 1273, 16950, 1127, 13, 670, 616, 1907, 2289, 4768, 253, 2892, 273, 10924, 13, 2506, 457, 85, 7356, 15, 4923, 672, 15169, 806, 2210, 327, 253, 6200, 13, 1077, 1652, 273, 247, 1436, 457, 84, 673, 369, 5262, 5015, 327, 253, 4481, 15, 23498, 672, 2429, 281, 849, 1199, 2802, 249, 1436, 457, 5511, 952, 1335, 574, 15, 26197, 969, 672, 16530, 4352, 253, 6200, 15, 5631, 942, 285, 9061, 11346, 2289, 760, 672, 597, 574, 247, 1302, 1340, 15, 187, 187, 6067, 10924, 452, 4391, 187, 187, 1989, 1024, 1841, 403, 1077, 1027, 15, 3771, 1390, 807, 13, 38946, 2361, 326, 11222, 323, 10924, 1957, 253, 10713, 3301, 273, 776, 673, 5262, 327, 6109, 4095, 15, 496, 958, 13, 597, 5998, 326, 952, 5262, 9330, 3041, 3038, 275, 44891, 2946, 3815, 275, 253, 1390, 1264, 2607, 15, 187, 187, 6067, 2862, 1039, 273, 5511, 556, 4391, 15, 1244, 776, 3367, 8169, 1379, 598, 247, 8750, 3894, 685, 776, 275, 14, 10816, 10924, 15, 6975, 352, 390, 417, 13, 776, 1533, 310, 7552, 625, 7336, 14, 3169, 285, 625, 4156, 15, 1893, 417, 760, 403, 359, 2104, 281, 897, 776, 15169, 281, 13791, 13, 533, 253, 2442, 1180, 273, 952, 359, 476, 3935, 310, 32251, 4457, 752, 359, 457, 306, 2455, 7407, 347, 7497, 275, 1524, 1495, 15, 187, 187, 688, 1635, 13, 253, 16122, 14349, 6982, 5678, 342, 253, 3745, 323, 4413, 281, 1287, 4156, 10169, 403, 2403, 5213, 6671, 625, 1846, 15, 733, 457, 84, 417, 816, 3367, 10924, 326, 452, 11371, 275, 3909, 13, 352, 457, 84, 776, 2987, 32328, 1512, 15, 831, 310, 247, 2080, 3501, 432, 247, 2372, 273, 5312, 4579, 272, 390, 19322, 5841, 327, 776, 1711, 14, 2606, 90, 2659, 8737, 15, 187, 187, 2042, 253, 2208, 285, 9061, 497, 281, 452, 2289, 281, 776, 8169, 275, 436, 1388, 285, 2363, 13, 352, 651, 2779, 320, 6425, 281, 1907, 776, 14145, 13, 6629, 13, 2675, 4712, 13, 285, 512, 3367, 13, 4832, 285, 789, 14, 4919, 16072, 762, 13234, 285, 16, 263, 387, 2495, 323, 896, 11806, 38287, 15, 30445, 13, 436, 310, 417, 253, 3646, 273, 247, 1959, 2586, 15, 187, 187, 510, 3237, 342, 43916, 444, 19, 5607, 187, 187, 6080, 2208, 11009, 13, 672, 597, 2312, 273, 43916, 444, 5428, 38, 13, 22175, 3988, 4606, 15, 1292, 643, 6338, 2686, 5583, 352, 285, 897, 352, 275, 616, 1211, 10924, 15, 1583, 671, 2096, 253, 11068, 10502, 15, 1292, 752, 954, 20239, 13980, 12440, 588, 2028, 368, 310, 326, 604, 368, 2794, 247, 896, 3369, 13, 390, 247, 1039, 275, 281, 2289, 253, 8169, 13, 436, 24543, 14779, 10502, 281, 253, 4212, 15, 2053, 10071, 4709, 247, 896, 11806, 812, 2847, 247, 13407, 14855, 326, 812, 39137, 518, 31795, 406, 327, 1943, 13817, 13498, 15, 187, 187, 35, 7526, 990, 14, 936, 14, 423, 24589, 2686, 651, 29614, 3988, 13, 275, 616, 13846, 15, 1893, 1223, 352, 651, 1056, 14006, 390, 1569, 10473, 6830, 6927, 323, 6338, 13, 247, 896, 11806, 651, 671, 1056, 352, 6927, 323, 38287, 285, 47048, 281, 2289, 3055, 941, 15, 8035, 5699, 1895, 651, 320, 387, 14, 16272, 952, 13, 824, 347, 7242, 10349, 285, 3569, 385, 3205, 13, 3692, 2495, 651, 320, 1199, 3687, 943, 2343, 2689, 3841, 320, 3562, 15, 187, 187, 688, 253, 1982, 13, 253, 4487, 273, 8293, 285, 253, 12578, 5194, 326, 1146, 2104, 281, 5834, 25481, 285, 23689, 32180, 21144, 841, 10502, 15, 1292, 643, 11009, 13, 824, 347, 253, 2418, 4487, 285, 253, 4487, 273, 20249, 513, 417, 1900, 5194, 15, 7160, 31460, 310, 326, 5909, 841, 896, 26695, 812, 452, 2201, 5054, 13, 3988, 285, 23949, 9099, 15, 14522, 13, 512, 273, 841, 11009, 452, 247, 4451, 4685, 1955, 281, 253, 34623, 273, 42347, 272, 616, 1211, 7996, 941, 15, 187, 187, 4967, 368, 476, 457, 85, 1663, 8913, 990, 281, 990, 24589, 187, 187, 510, 1524, 8386, 254, 310, 326, 1014, 604, 247, 2208, 6726, 253, 8570, 273, 444, 19, 5607, 432, 44891, 2946, 390, 643, 29908, 11222, 13, 436, 651, 417, 8415, 253, 1895, 273, 25481, 26728, 285, 16, 263, 8785, 562, 17150, 6993, 15, 380, 3694, 323, 17690, 990, 14, 936, 14, 423, 24589, 310, 1527, 2603, 285, 13644, 2130, 15, 187, 187, 8195, 2201, 5691, 3585, 14503, 1475, 11222, 908, 275, 5639, 4343, 15, 1310, 634, 1982, 14, 3169, 31267, 622, 310, 908, 407, 3095, 275, 4135, 13, 651, 359, 1973, 247, 896, 3369, 323, 5628, 6338, 32, 187, 187, 6080, 24715, 9061, 1158, 8217, 285, 6745, 403, 23209, 6153, 3238, 326, 403, 3345, 253, 3986, 273, 253, 1569, 15, 1292, 327, 253, 643, 1133, 13, 841, 13817, 33430, 778, 320, 3365, 5277, 253, 3988, 616, 6383, 971, 285, 1928, 597, 452, 247, 987, 281, 15, 187, 187, 7883, 310, 378, 7526, 444, 19, 5607, 32, 187, 187, 6080, 4343, 403, 13756, 281, 8913, 763, 444, 19, 5607, 281, 6558, 247, 13234, 1375, 15, 4135, 13, 323, 4227, 13, 556, 20374, 44891, 2946, 285, 36000, 23481, 1955, 281, 24589, 15, 6758, 310, 417, 247, 5699, 9326, 15, 329, 3332, 1304, 2210, 562, 5001, 849, 5628, 5680, 17269, 403, 10568, 13975, 24359, 11734, 253, 2586, 281, 6184, 247, 13234, 622, 327, 616, 15169, 15, 38056, 11845, 627, 310, 247, 2647, 273, 2629, 3646, 15, 187, 187, 37881, 556, 671, 12889, 3597, 281, 8913, 23978, 7583, 13, 13940, 1710, 13, 247, 29908, 2579, 326, 4648, 990, 281, 990, 24589, 15, 2091, 326, 1904, 457, 85, 789, 13, 597, 13603, 5559, 285, 643, 4633, 14248, 275, 271, 3434, 281, 1379, 1066, 253, 44355, 622, 15, 11706, 13, 24794, 4035, 281, 4264, 4618, 2289, 281, 13940, 1710, 15, 187, 187, 688, 253, 773, 4924, 668, 1533, 13, 6176, 13, 253, 5591, 13, 285, 253, 1986, 2077, 452, 512, 644, 16585, 247, 8913, 327, 444, 19, 5607, 275, 616, 9056, 4343, 15, 3010, 4102, 13, 253, 2256, 556, 25189, 28619, 342, 247, 44625, 275, 3968, 15, 380, 5286, 310, 1024, 2819, 715, 43916, 990, 281, 990, 24589, 5609, 326, 1234, 293, 1569, 10473, 6338, 432, 24497, 10924, 15, 187, 187, 34, 2714, 1083, 1108, 6976, 187, 187, 28749, 272, 598, 281, 253, 47817, 10393, 273, 990, 14, 936, 14, 423, 24589, 13, 6976, 2168, 574, 5323, 275, 1659, 10568, 13817, 4413, 281, 1918, 689, 253, 5701, 273, 13282, 25481, 15, 496, 4223, 273, 4765, 13, 247, 7482, 6007, 369, 3559, 281, 2430, 247, 42182, 327, 13498, 5277, 990, 281, 990, 24589, 15, 187, 187, 510, 30566, 9353, 10885, 253, 7482, 6007, 9262, 616, 1304, 327, 7659, 608, 394, 15, 3771, 247, 1643, 3618, 1996, 13, 275, 673, 323, 253, 344, 10010, 13319, 2952, 13, 24687, 273, 253, 6007, 457, 84, 26340, 497, 8231, 275, 1340, 281, 755, 253, 6007, 20906, 949, 1078, 807, 990, 15, 2596, 5780, 15129, 2530, 271, 562, 1108, 533, 760, 604, 253, 896, 11806, 2900, 3562, 407, 247, 13817, 2567, 651, 16753, 247, 13407, 14855, 15, 187, 187, 18548, 187, 187, 10195, 13001, 403, 11926, 326, 990, 14, 936, 14, 423, 24589, 588, 6909, 616, 3745, 281, 3819, 6617, 15, 380, 6612, 310, 326, 49613, 327, 247, 2586, 457, 84, 952, 310, 760, 581, 1039, 281, 513, 594, 15, 733, 457, 84, 671, 581, 326, 24543, 697, 1211, 13, 4092, 3988, 10502, 15, 187, 187, 1628, 42, 2868, 253, 2852, 273, 5511, 588, 5333, 281, 3055, 13, 28454, 3238, 835, 952, 476, 320, 13224, 752, 597, 1333, 281, 1016, 643, 19931, 7895, 285, 8169, 285, 2600, 1912, 457, 85, 7356, 1475, 11654, 1425, 1108, 6745, 11731, 4744, 1503, 18141, 4978, 187, 187, 8497, 27, 1707, 403, 690, 3374, 342, 1142, 29908, 11222, 13, 1690, 44891, 2946, 13, 326, 12662, 387, 444, 19, 5607, 417, 1146, 253, 760, 13817, 3309, 281, 12215, 11068, 275, 10924, 15, 2064, 457, 84, 984, 1223, 253, 941, 368, 5007, 3066, 29908, 310, 7895, 13, 634, 8153, 2953, 285, 4481, 1180, 403, 417, 15, 6676, 11222, 5583, 247, 38146, 2579, 984, 273, 436, 1895, 15, 9157, 13, 4212, 4536, 896, 598, 616, 891, 40245, 281, 253, 891, 22740, 13, 534, 557, 2272, 990, 14, 936, 14, 423, 24589, 15, 3074, 11878, 875, 2644, 3904, 6705, 285, 2406, 187, 187, 3074, 11878, 875, 4562, 14, 17465, 3904, 598, 281, 9161, 313, 2405, 14, 17465, 4495, 326, 253, 3904, 3831, 642, 4335, 14, 9133, 2616, 4067, 685, 4562, 10, 187, 187, 41, 1513, 251, 982, 598, 281, 15215, 313, 14382, 2644, 1180, 4272, 407, 253, 8642, 18134, 1612, 273, 374, 10, 187, 187, 3074, 11878, 875, 1903, 14, 17465, 3904, 598, 281, 12842, 187, 187, 3074, 11878, 875, 608, 14, 17465, 3904, 598, 281, 27277, 187, 187, 36, 1695, 24842, 1774, 313, 263, 11076, 1037, 4722, 10, 11878, 824, 347, 253, 5807, 46984, 285, 8462, 394, 356, 37173, 39169, 187, 187, 510, 2829, 310, 2074, 281, 13, 533, 1199, 4864, 254, 685, 13, 326, 1119, 275 ]
be able to encrypt and decrypt the data sent between them. As such, governments, owners of messaging platforms, phone manufacturers, law enforcement agencies and phone companies cannot get to these messages. Even if there is a court order requiring the release of that info. To take the messaging example, end-to-end encryption scrambles data to all but the sender and receiver. In addition to Apple and WhatsApp as mentioned above, many other services have added end-to-end encryption to better secure the privacy of their users, who demand it. Some of these apps include: Kakao – An instant messaging service that offers free texting and calling. 93% of South Korean smartphone users were using Kakao as of 2017. Line – A Japanese freeware app for sending texts, images, videos, video conferences and audio clips. They recently also added a cryptocurrency exchange service. Vega Messenger – This Belgium-based messenger service offers end to end encryption for communications as well as for sharing files. Vega is geared towards corporate and governmental communications. Wire – Similar to Line, the Wire service offers free messaging, etc. and is focuses on enhancing collaborative, online workplaces. Signal, Viber, and other messaging services. Reasons for banning end to end encryption There are three major threads of resistance to E2EE. The following are the main arguments of enforcement agencies and governments: Law officials want a way into these messages because they feel it is necessary to combat crime and terrorism. Furthermore, their view is that their ability to access messages is more important to a person’s and country’s security than privacy. and terrorism. Furthermore, their view is that their ability to access messages is more important to a person’s and country’s security than privacy. They’ve had access to messages in the past. Such as with physical documents and emails. So, when court-ordered, companies had to give up the data to officials. More modern tools are necessary for modern times, they say. So they want a way to continue using people’s communications to fight crime. Only this could be on a much grander scale, as we discuss later in the article. Such as with physical documents and emails. So, when court-ordered, companies had to give up the data to officials. More modern tools are necessary for modern times, they say. So they want a way to continue using people’s communications to fight crime. Only this could be on a much grander scale, as we discuss later in the article. Officials need a way to access the messages, but only of those people who seek to harm us in some way. But the rules surrounding who accesses what are non transparent. The second bullet point, about their having access throughout the history of communications, doesn’t stick. Because when phones first came on the scene, very little of a person’s time was spent talking on the phone. Especially when compared to how much ‘in person’ communication people still had. Same again when emails hit the scene. Governments and authorities enjoyed access only when they had a court order. Our communications have changed But now things are very different. Just last year, Forbes reported that apps for communications represent the bulk load of our time spent on mobile devices. In fact, they estimated that people spent 85 million hours in WhatsApp alone in the last three months. Our entire way of communication has changed. And our personal messages take up a bigger share than our in-person communications. Like it or not, our world is becoming more Internet-based and more global. So not only are we able to use our phones to communicate, but the potential number of people we can message is wildly beyond what we’ve ever experienced as humans in real life. In addition, the expanding gig economy combined with the ability for companies to develop global markets are making international teams more common. It’s not just personal communications that have settled in online, it’s our workspaces too. This is a far cry from a bit of daily emailing or occasional calls on our old-timey landlines. If the government and authorities were to have access to our messages in this day and age, it would likely be equivalent to having our offices, schools, social activities, and all personal, financial and work-related conversations under surveillance and/or at risk for backdoor hackers. Certainly, this is not the policy of a free country. The problems with banning E2EE Some government agencies, when they talk of banning ETEE, emphasize security reasons. But other officials actually recommend it and use it in their own communications. They also understand the privacy risks. But what most cybersecurity professionals will tell you is that if you create a back door, or a way in to access the messages, this poses enormous risks to the users. These experts fear a backdoor could cause a systemic weakness that could wreak havoc on big tech platforms. Banning end-to-end encryption actually would undermine security, in their minds. So while it would make investigations or law enforcement possibly easier for officials, a backdoor would also make it easier for hackers and spies to access private data. Another huge problem would be at-risk people, such as abuse victims and political exiles, whose risk would be much greater should loopholes be created. In the US, the Department of Justice and the FBI agree that being able to catch criminals and terrorists outweighs these risks. But other agencies, such as the State Department and the Department of Commerce do not always agree. Their viewpoint is that opening these backdoors could have major economic, security and diplomatic consequences. Interestingly, all of these agencies have a unique understanding due to the urgency of encrypting their own sensitive data. Why you can’t really ban end to end encryption The real kicker is that even if a government forced the removal of E2EE from WhatsApp or other messaging apps, this would not solve the problem of criminals communicating and/or carrying out terrorist acts. The software for enabling end-to-end encryption is open source and publicly available. Another major challenge revolves around apps used in foreign countries. If your US-based messenger app is used by someone in China, would we build a back door for Chinese officials? Some governmental authorities think Apple and Facebook are intentionally creating services that are outside the reach of the law. But on the other hand, these tech giants may be simply providing the security their customers want and feel they have a right to. Who is Banning E2EE? Some countries are attempting to banish E2EE to maintain a surveillance state. China, for instance, has banned WhatsApp and Snapchat due to encryption. Which is not a huge surprise. A recent report came out regarding how Chinese border guards are requiring visiting tourists entering the country to download a surveillance app on their phones. Surveillance there is a matter of standard policy. Russia has also repeatedly tried to ban crypto favorite, Telegram, a messaging service that uses end to end encryption. When that didn’t work, they disabled Google and other popular websites in an effort to take down the rogue app. Still, Russians continue to enjoy wide access to Telegram. In the “free” world, Germany, the UK, and the United States have all been discussing a ban on E2EE in their respective countries. More recently, the subject has resurfaced with a vengeance in America. The administration is now looking into banning end to end encryption techniques that repel law enforcement officials from accessing communications. A special case – Australia Leading up to the commonplace usage of end-to-end encryption, Australia already had laws in place requiring tech companies to give over the comments of suspected criminals. In August of 2018, a draft bill was presented to require a workaround on platforms providing end to end encryption. The parliamentary committee handling the draft bill submitted their report on Dec 5th. Just a few weeks later, in time for the hectic holiday season, 173 of the bill’s amendments were dropped in order to get the bill rushed through before year end. One remaining amendment provided an out – but only if the backdoor solution created by a tech company would pose a systemic weakness. Summary Many governments are worried that end-to-end encryption will destroy their ability to fight crime. The reality is that spying on a country’s people is only one way to do so. It’s also one that poses its own, serious security risks. “I believe the future of communication will shift to private, encrypted services where people can be confident what they say to each other stays secure and messages and content won’t stick around forever.” – Facebook CEO Mark Zuckerberg Note: There are some issues with many messaging apps, including WhatsApp, that hint at E2EE not being the only tech necessary to guarantee privacy in communications. That’s because while the data you send via messaging is secure, your IP address and phone number are not. Many apps recommend a VPN service because of this problem. Additionally, users sometimes back up their iMessages to the iCloud, which disables end-to-end encryption.All ratios between whole numbers 64 and lower All ratios between 31-limit numbers up to 96 (31-limit meaning that the numbers contain no prime-number factors larger than 31) Harmonics up to 255 (each whole number divided by the closest inferior power of 2) All ratios between 11-limit numbers up to 128 All ratios between 5-limit numbers up to 1024 Certain historically important (or mathematically interesting) ratios such as the schisma and Pythagorean comma The table is similar to, but much briefer than, that found in
[ 8096, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2031, 27, 883, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 51, 1671, 58, 67, 38, 3, 187, 1092, 187, 3, 11455, 6302, 805, 3121, 25805, 31110, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20326, 161, 235, 238, 46049, 16127, 116, 18617, 97, 6238, 46239, 33474, 6765, 243, 42951, 14274, 29297, 47961, 17492, 1490, 8634, 22719, 187, 3, 7893, 6302, 91, 19766, 48, 59, 26, 3079, 82, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2031, 27, 2125, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 938, 29288, 24133, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 2795, 22, 3757, 17, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3079, 27, 1449, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 39, 19, 84, 44199, 71, 3, 187, 1092, 187, 3, 11455, 6302, 87, 25, 22313, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 2795, 22, 72, 42574, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3079, 27, 1449, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 40, 1102, 84, 50, 3, 187, 1092, 187, 3, 11455, 6302, 14889, 41988, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 48, 360, 39, 22, 77, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1235, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 55, 8484, 75, 5367, 3, 187, 1092, 187, 3, 11455, 6302, 16129, 1438, 33868, 1857, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 21275, 20326, 7056, 237, 18617, 235, 18764, 14274, 32165, 33656, 98, 209, 14274, 13127, 243, 33656, 98, 209, 14274, 11016, 243, 33656, 98, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 48, 25192, 14220, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 2385, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 85, 757, 4011, 2981, 606, 19702, 80, 995, 187, 3, 5598, 6302, 91, 19766, 47, 27074, 18, 70, 40, 995, 187, 3, 1156, 6302, 39673, 24370, 12105, 20622, 43929, 30676, 221, 18780, 15367, 9078, 235, 16877, 20326, 41873, 22305, 113, 164, 242, 119, 17492, 18617, 97, 995, 187, 3, 7893, 6302, 91, 19766, 48, 7675, 40, 81, 43, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1229, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 38379, 19, 15061, 302, 36, 3, 187, 1092, 187, 3, 11455, 6302, 18043, 8498, 1154, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20833, 219, 20833, 219, 4340, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 4527, 29370, 43, 50, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 1010, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 25837, 24, 47, 87, 51, 20, 49, 3, 187, 1092, 187, 3, 11455, 6302, 17984, 2357, 2945, 25953, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 48, 70, 1370, 29035, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 2945, 27, 805, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 23829, 26221, 16742, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 20833, 219, 20833, 219, 537, 164, 224, 220, 14670, 100, 165, 104, 107, 4340, 22985, 238, 15957, 218, 20833, 100, 6765, 237, 12811, 215, 14486, 121, 24446, 995, 187, 3, 7893, 6302, 91, 19766, 48, 25, 832, 36, 87, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3156, 27, 3680, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 805, 1012, 3121, 1610, 3677, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 60, 13258, 229, 7082, 13258, 229, 7082, 13258, 229, 44082, 187, 3, 7893, 6302, 91, 19766, 10189, 1405, 20, 82, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 3156, 27, 1093, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 17306, 1036, 4196, 17490, 995, 187, 3, 5598, 6302, 91, 19766, 45, 13511, 24, 81, 51, 995, 187, 3, 1156, 6302, 12755, 236, 27107, 217, 13744, 122, 7056, 216, 35601, 50037, 35601, 48153, 108, 17492, 995, 187, 3, 7893, 6302, 91, 19766, 47, 90, 1343, 21, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1237, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 938, 25025, 2031, 2537, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 30903, 29268, 102, 37215, 228, 43244, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 47, 6147, 82, 41, 73, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 2405, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 72, 1686, 266, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 39673, 24370, 25434, 43873, 6238, 19780, 120, 43741, 49288, 23371, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 47, 30930, 45, 91, 59, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1047, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 21378, 2504, 23580, 3677, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 20647, 220, 6916, 113, 30676, 221, 995, 187, 3, 7893, 6302, 91, 19766, 47, 83, 25, 67, 24, 85, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 1036, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 22000, 24257, 740, 1610, 995, 187, 3, 5598, 45281, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 47, 82, 70, 18601, 36, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1449, 27, 805, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 38045, 571, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 14274, 7249, 105, 43251, 4340, 20622, 35724, 20287, 18245, 213, 6238, 17559, 212, 165, 107, 122, 17492, 995, 187, 3, 7893, 6302, 91, 19766, 47, 262, 57, 15656, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 2417, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 50, 77, 6159, 82, 44, 3, 187, 1092, 187, 3, 11455, 6302, 2484, 81, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 38242, 42025, 111, 34397, 37062, 21275, 15957, 218, 48561, 12105, 6916, 113, 14486, 121, 13484, 4340, 995, 187, 3, 7893, 6302, 91, 19766, 47, 21448, 56, 9042, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 2385, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 48, 7675, 40, 81, 43, 3, 187, 1092, 187, 3, 11455, 6302, 18359, 12971, 1099, 2125, 995, 187, 3, 5598, 6302, 91, 19766, 45, 26576, 39, 7096, 995, 187, 3, 1156, 6302, 22985, 226, 16998, 229, 1166, 9180, 26680, 26680, 12105, 9180, 26680, 26680, 26680, 995, 187, 3, 7893, 6302, 91, 19766, 47, 27074, 18, 70, 40, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1867, 27, 1867, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 19766, 18787, 72, 5993, 79, 3, 187, 1092, 187, 3, 11455, 6302, 740, 1967, 4148, 2358, 1610, 995, 187, 3, 5598, 45281, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 6784, 19, 89, 73, 50, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1235, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 20785, 2358, 15468, 1976, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 5288, 13924, 89, 25, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1797, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 1200, 538, 6002, 5582, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 45281, 187, 3, 7893, 6302, 91, 19766, 46, 1779, 72, 59, 71, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 1047, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 4351, 7083, 531, 995, 187, 3, 5598, 6302, 91, 19766, 11773, 87, 2447, 19, 995, 187, 3, 1156, 6302, 32165, 43136, 37079, 14274, 29533, 995, 187, 3, 7893, 6302, 91, 19766, 3788, 580, 50, 81, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1839, 27, 2693, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 1092, 187, 3, 11455, 6302, 1166, 2358, 4196, 1012, 3655, 995, 187, 3, 5598, 45281, 187, 3, 1156, 6302, 9, 23215, 64, 23215, 22719, 187, 3, 7893, 6302, 91, 19766, 31425, 34, 2251, 79, 995, 187, 3, 2754, 6302, 6622, 14, 520, 14, 1797, 1458, 27, 1787, 27, 2417, 3, 187, 2023, 187, 92, 187, 3, 36358, 29925, 187, 3, 91, 25837, 26, 59, 7864, 23398, 995, 187, 3, 91, 25837, 24, 82, 25, 42092, 75, 995, 187, 3, 91, 38379, 33759, 335, 45, 76, 995, 187, 3, 91, 38379, 44942, 351, 1288, 995, 187, 3, 91, 38379, 45, 72, 23, 1190, 39, 995, 187, 3, 91, 38379, 44, 83, 9780, 20, 51, 995, 187, 3, 91, 38379, 40, 18835, 82, 1440, 995, 187, 3, 91, 38379, 39, 85, 38, 23, 41, 21, 995, 187, 3, 91, 38379, 36, 338, 46, 85, 55, 995, 187, 3, 91, 38379, 8712, 18, 82, 90, 995, 187, 3, 91, 71, 6584, 23976, 39, 78, 22, 995, 187, 3, 91, 38379, 73, 50, 14942, 70, 43, 995, 187, 3, 91, 38379, 44734, 25, 84, 24274, 995, 187, 3, 91, 38379, 71, 2945, 66, 9803, 995, 187, 3, 91, 71, 6156, 25, 86, 58, 59, 52, 995, 187, 3, 91, 38379, 25, 41317, 51, 75, 71, 995, 187, 3, 91, 38379, 24, 8962, 90, 56, 90, 995, 187, 3, 91, 38379, 23, 314, 46, 4604, 995, 187, 3, 91, 38379, 22, 82, 2906, 19, 71, 995, 187, 3, 91, 38379, 22, 22947, 38450, 995, 187, 3, 91, 38379, 17, 38, 3348, 26, 70, 995, 187, 3, 91, 38379, 361, 73, 54, 70, 52, 995, 187, 3, 91, 19766, 59, 55, 4297, 46, 20, 995, 187, 3, 91, 19766, 59, 89, 76, 13816, 46, 995, 187, 3, 91, 19766, 31576, 76, 91, 35, 76, 995, 187, 3, 91, 19766, 57, 47, 68, 1099, 88, 995, 187, 3, 91, 19766, 16594, 5229, 75, 43, 995, 187, 3, 91, 19766, 31775, 24, 80, 3351, 995, 187, 3, 91, 19766, 55, 2385, 46, 5985, 995, 187, 3, 91, 19766, 55, 2941, 38, 80, 49, 995, 187, 3, 91, 19766, 38450, 23, 18591, 23, 995, 187, 3, 91, 19766, 5683, 24, 59, 37675, 995, 187, 3, 91, 19766, 54, 67, 46594, 75, 56, 995, 187, 3, 91, 19766, 45335, 7675, 37514, 995, 187, 3, 91, 19766, 53, 2809, 66, 15332, 995, 187, 3, 91, 19766, 53, 26, 78, 22, 89, 87, 995, 187, 3, 91, 19766, 3528, 88, 41, 3271, 995, 187, 3, 91, 19766, 52, 89, 35333, 18469, 995, 187, 3, 91, 19766, 51, 59, 73, 59, 6721, 995, 187, 3, 91, 19766, 51, 9324, 81, 38, 72, 995 ]
Am", "date":"2013-01-21 15:44:11" }, { "kids":[ "zfuR35YbE" ], "uid":"1276608382", "parent":"zfuMcvUn2", "text":"为嘛没收呢,直接删除不就完了(-.-)", "mid":"zfuOZ943q", "date":"2013-01-21 15:44:04" }, { "kids":[], "uid":"208060009", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOP5gn0", "date":"2013-01-21 15:43:40" }, { "kids":[ "zfvF2sXSf" ], "uid":"v8266", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOP5gkB", "date":"2013-01-21 15:43:40" }, { "kids":[ "zfvGrolsQ" ], "uid":"boyanking", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOumF5l", "date":"2013-01-21 15:42:50" }, { "kids":[ "zfuVUsjpo" ], "uid":"1908089845", "parent":"zfuMcvUn2", "text":"作为党员要不信谣 不传谣 不造谣!", "mid":"zfuOtbOVA", "date":"2013-01-21 15:42:48" }, { "kids":[], "uid":"tianranxiangliao", "parent":"zfuNcj1eG", "text":"原来是这样啊……我还以为被河蟹了呢", "mid":"zfuOluGpJ", "date":"2013-01-21 15:42:30" }, { "kids":[ "zfv2NaotC" ], "uid":"jackvincent", "parent":"zfuMcvUn2", "text":"哈哈。。", "mid":"zfuOfiqJQ", "date":"2013-01-21 15:42:15" }, { "kids":[ "zfw7NvR3P" ], "uid":"2647742647", "parent":"zfuMcvUn2", "text":"", "mid":"zfuOeazvp", "date":"2013-01-21 15:42:12" }, { "kids":[], "uid":"337398999", "parent":"zfuMcvUn2", "text":"哈哈..草泥马。毛片哥刚弄死他", "mid":"zfuO8efCv", "date":"2013-01-21 15:41:58" }, { "kids":[], "uid":"1213763371", "parent":"zfuMcvUn2", "text":"[怒][怒][怒]", "mid":"zfuNRme3q", "date":"2013-01-21 15:41:18" }, { "kids":[], "uid":"1871696203", "parent":"zfuLoj7pR", "text":"给领导充公交公粮了", "mid":"zfuNytil4", "date":"2013-01-21 15:40:32" }, { "kids":[], "uid":"206784449", "parent":"zfuMcvUn2", "text":"高级黑么。", "mid":"zfuNyrqHh", "date":"2013-01-21 15:40:31" }, { "kids":[], "uid":"gmlan", "parent":"", "text":"原来如此,顺求种子!", "mid":"zfuNrnLzZ", "date":"2013-01-21 15:40:14" }, { "kids":[], "uid":"2384731571", "parent":"", "text":"厉害啊", "mid":"zfuNr8b7t", "date":"2013-01-21 15:40:16" }, { "kids":[], "uid":"3093341033", "parent":"", "text":"", "mid":"zfuNqeVRC", "date":"2013-01-21 15:40:12" }, { "kids":[], "uid":"ningsia", "parent":"zfuMcvUn2", "text":"不太可能。这也能挂,见鬼了", "mid":"zfuNitXpb", "date":"2013-01-21 15:39:55" }, { "kids":[ "zfuQlBIqK" ], "uid":"whp", "parent":"zfuMcvUn2", "text":"看爱情动作片真是害死人。", "mid":"zfuNfxWDM", "date":"2013-01-21 15:39:48" }, { "kids":[ "zfuOluGpJ" ], "uid":"1891062504", "parent":"zfuLbhFxe", "text":"每秒17MB!!是MB!!!", "mid":"zfuNcj1eG", "date":"2013-01-21 15:39:39" }, { "kids":[ "zfuQRgBLn" ], "uid":"1070976833", "parent":"", "text":"", "mid":"zfuMR2xhQ", "date":"2013-01-21 15:38:50" }, { "kids":[], "uid":"2276813475", "parent":"zfuMcvUn2", "text":"", "mid":"zfuMEAhx8", "date":"2013-01-21 15:38:21" }, { "kids":[], "uid":"shubozhan", "parent":"zfuMcvUn2", "text":"", "mid":"zfuMChgZf", "date":"2013-01-21 15:38:14" }, { "kids":[], "uid":"kingcrone", "parent":"zfuMcvUn2", "text":"信息量不小", "mid":"zfuMAavQp", "date":"2013-01-21 15:38:09" }, { "kids":[], "uid":"1768961373", "parent":"", "text":"(¬_¬)", "mid":"zfuMuA67n", "date":"2013-01-21 15:37:55" }, { "kids":[ "zfw9ZFSWC", "zfw7q8EGj", "zfvUUulLk", "zfvTKodbr", "zfvLg6ylF", "zfvKrAK3R", "zfvGmkqtt", "zfvFtE6H4", "zfvCifMtV", "zfvnut1qy", "zfviTiFm5", "zfvhQAXeJ", "zfvhk8sRs", "zfvf42aLD", "zfva8uYZS", "zfv8qsRjf", "zfv7uvyWy", "zfv6lyMFr", "zfv5qAr2f", "zfv5octUH", "zfv0Eae9e", "zfv00hUeS", "zfuZVguM3", "zfuZxkhwM", "zfuXRkzBk", "zfuXNc25w", "zfuWTCtjJ", "zfuVa7oIm", "zfuV48Mki", "zfuV03EoP", "zfuUH6UG6", "zfuUp7ZTu", "zfuUbvgjW", "zfuTUluKD", "zfuTShaPN", "zfuT9m5xv", "zfuSSwHOL", "zfuSxgdHI", "zfuRZhZDL", "zfuROBpEg",
[ 3625, 6273, 13, 285, 5419, 6419, 1110, 326, 2965, 2708, 352, 15, 844, 2550, 7848, 323, 776, 3625, 6273, 281, 2965, 1199, 2007, 13, 285, 359, 2550, 7848, 667, 625, 288, 8165, 562, 273, 776, 22531, 285, 14199, 2613, 15, 544, 1628, 1466, 457, 84, 11075, 253, 5706, 7305, 7521, 275, 8302, 13, 5403, 27, 7266, 15, 25597, 14, 740, 62, 187, 187, 2042, 253, 33315, 971, 281, 1663, 4352, 253, 6589, 49, 9550, 13, 597, 943, 564, 323, 697, 8083, 2613, 15, 380, 6115, 7021, 310, 10693, 1024, 2326, 347, 247, 2444, 966, 3128, 13, 533, 604, 352, 11359, 2403, 253, 3434, 13, 627, 310, 247, 4839, 352, 812, 320, 15, 187, 187, 1552, 310, 247, 29837, 1501, 13, 326, 1057, 271, 14331, 2408, 275, 247, 3710, 2317, 15, 1707, 457, 84, 247, 2257, 281, 1333, 275, 2380, 281, 352, 15, 9859, 1841, 806, 27, 187, 187, 510, 33315, 13, 323, 512, 619, 9436, 281, 731, 13, 403, 417, 4092, 670, 2509, 2712, 15, 1737, 368, 452, 281, 1333, 1060, 8146, 684, 27, 309, 1158, 253, 33315, 327, 6132, 1388, 285, 2360, 13, 1690, 4266, 13, 497, 27393, 1574, 2820, 281, 755, 8314, 273, 15197, 1223, 671, 17808, 271, 2983, 327, 416, 7937, 432, 253, 1669, 15, 9543, 2208, 943, 320, 247, 1805, 673, 281, 320, 247, 6115, 13, 342, 253, 2303, 30909, 13, 3738, 309, 457, 306, 2326, 275, 253, 5591, 849, 253, 36819, 30743, 70, 22493, 310, 2217, 281, 1978, 952, 432, 20362, 15702, 512, 14, 483, 15, 380, 33315, 403, 417, 4092, 670, 2712, 13, 533, 10922, 562, 281, 253, 21324, 651, 1646, 281, 320, 253, 4569, 1659, 281, 564, 15, 187, 187, 510, 1669, 1060, 310, 2030, 6, 273, 253, 46866, 1108, 4931, 7652, 6, 604, 21323, 21450, 13, 9543, 457, 84, 391, 1765, 767, 14, 14824, 14, 11499, 13004, 15, 380, 33315, 403, 10960, 275, 253, 2030, 6, 391, 1765, 13, 285, 812, 4217, 314, 1265, 4886, 715, 253, 1283, 6, 273, 1669, 3872, 2531, 11750, 10787, 15, 4683, 2282, 13, 352, 457, 84, 634, 1327, 14, 2132, 3872, 2531, 11750, 10787, 665, 7617, 12337, 13, 285, 597, 457, 250, 253, 4394, 665, 457, 306, 10544, 416, 7937, 13, 4518, 984, 597, 871, 326, 7733, 18697, 1271, 310, 642, 1175, 323, 731, 15, 187, 187, 6892, 398, 4744, 15, 309, 457, 306, 574, 253, 1072, 2793, 273, 247, 8034, 19500, 15702, 2208, 275, 40986, 342, 23442, 15319, 1162, 355, 15, 1284, 368, 1333, 342, 253, 5591, 253, 2538, 327, 253, 1669, 403, 23851, 15, 309, 13937, 253, 13024, 273, 253, 15319, 2208, 651, 17614, 3878, 253, 29254, 273, 1110, 2007, 1669, 13, 342, 253, 16277, 10319, 8038, 15, 1292, 352, 1904, 457, 85, 5108, 15, 3512, 314, 984, 253, 1669, 5621, 497, 820, 14, 2178, 264, 407, 20706, 313, 783, 25575, 985, 2789, 247, 3064, 10, 285, 13730, 984, 253, 20958, 1108, 2378, 247, 1524, 2675, 18545, 3490, 30587, 313, 18399, 314, 10, 275, 253, 1384, 84, 1108, 3898, 7459, 846, 4005, 1903, 6585, 13, 342, 253, 9550, 13438, 272, 253, 2613, 15, 187, 187, 4041, 3064, 326, 309, 923, 1060, 310, 247, 10046, 285, 625, 4138, 422, 8083, 4866, 285, 697, 5547, 4544, 1411, 7733, 18697, 1271, 15, 18770, 273, 253, 9550, 273, 326, 4544, 556, 642, 1600, 275, 6153, 7596, 323, 253, 6589, 49, 15, 1292, 690, 273, 352, 27364, 1057, 13, 285, 627, 310, 1524, 31970, 36106, 2190, 253, 2613, 326, 812, 320, 820, 991, 264, 715, 10266, 1677, 690, 2317, 15, 1244, 352, 1663, 310, 247, 1943, 2613, 13, 4931, 253, 5962, 10020, 14, 7397, 1701, 3569, 2280, 275, 9943, 5948, 15, 187, 187, 25263, 13, 253, 5054, 4112, 310, 2779, 281, 1691, 253, 9543, 2208, 275, 247, 10458, 1899, 13, 835, 597, 588, 320, 2820, 281, 21547, 46270, 16610, 3116, 15, 187, 187, 4041, 2181, 309, 3078, 281, 1691, 275, 253, 1501, 533, 1904, 457, 85, 369, 326, 253, 11442, 36943, 11492, 12758, 281, 320, 1529, 2234, 2523, 323, 253, 33315, 1108, 352, 778, 417, 320, 247, 6273, 13688, 533, 3095, 3198, 281, 1978, 352, 327, 253, 15990, 15, 187, 187, 42, 1053, 457, 85, 923, 667, 3524, 275, 253, 21324, 387, 1246, 13, 347, 1048, 347, 253, 21318, 54, 4558, 12331, 281, 253, 6589, 49, 15, 1310, 368, 971, 281, 923, 1633, 2740, 562, 13, 368, 452, 281, 1007, 281, 253, 1917, 272, 273, 8083, 16027, 281, 3569, 4676, 1108, 1007, 387, 253, 313, 21258, 10, 330, 9334, 1580, 352, 9377, 598, 342, 253, 5578, 39, 313, 395, 840, 1007, 387, 253, 5578, 39, 25246, 187, 187, 2374, 436, 1818, 273, 12315, 2181, 13, 835, 513, 359, 755, 776, 3282, 273, 253, 2802, 25736, 12315, 457, 32, 380, 1818, 273, 12315, 310, 1663, 275, 253, 3420, 13, 285, 352, 457, 84, 644, 816, 670, 36385, 494, 326, 253, 3420, 1694, 3212, 416, 7937, 15, 2948, 551, 21626, 748, 432, 37994, 29987, 2955, 5726, 16, 13382, 885, 14, 3062, 8, 187, 187, 15035, 20605, 1159, 47327, 9, 9993, 6854, 27, 6734, 3001, 32949, 29, 1279, 9983, 47327, 27555, 426, 337, 10, 551, 187, 50276, 1059, 2069, 426, 47327, 27555, 559, 337, 187, 50276, 6050, 313, 3181, 283, 10, 551, 187, 50274, 14626, 551, 187, 50272, 2309, 14303, 3244, 6854, 1082, 187, 50274, 94, 5834, 313, 70, 10, 551, 187, 50272, 1403, 1942, 21626, 9, 9138, 10, 187, 50274, 94, 187, 50276, 94, 187, 50276, 22452, 15, 3775, 2073, 5064, 17636, 22639, 3401, 187, 94, 187, 31900, 28852, 1780, 1120, 264, 13, 36355, 264, 1198, 380, 649, 708, 20593, 2705, 4683, 15347, 187, 187, 49762, 265, 13, 8319, 13, 819, 1487, 2994, 327, 8958, 849, 281, 1408, 247, 4633, 2360, 34583, 13, 28335, 272, 281, 1384, 14, 285, 1884, 14, 34355, 678, 723, 2819, 323, 253, 6323, 773, 262, 668, 6308, 15, 3032, 20820, 3797, 2469, 4633, 15202, 13, 824, 347, 4687, 33892, 285, 10540, 13, 285, 521, 1655, 18767, 13, 253, 4913, 387, 39056, 13, 275, 17207, 5041, 15, 187, 187, 1989, 327, 3821, 15, 4562, 13, 344, 369, 9833, 285, 5262, 625, 685, 1903, 3038, 275, 247, 399, 15, 36, 15, 894, 6172, 13, 6636, 342, 39889, 1273, 14, 14577, 19610, 285, 12536, 273, 2867, 323, 1633, 344, 753, 344, 1057, 11719, 27, 38509, 839, 15223, 1548, 6787, 390, 667, 8137, 3731, 3197, 407, 762, 486, 38412, 281, 4901, 521, 5453, 15, 187, 187, 7130, 281, 399, 15, 36, 15, 21112, 2111, 7177, 13, 816, 846, 21811, 327, 3747, 15, 884, 13, 28852, 285, 521, 3988, 4750, 1694, 715, 247, 31233, 342, 247, 3323, 386, 628, 3416, 689, 617, 8137, 15, 380, 3416, 13, 8927, 432, 15562, 571, 13, 753, 326, 28852, 285, 521, 4750, 38509, 456, 617, 15562, 757, 6254, 457, 84, 7981, 285, 12913, 9659, 13, 3981, 597, 497, 15223, 15, 23264, 1996, 13, 2556, 281, 253, 1302, 7177, 13, 672, 253, 3416, 4895, 281, 253, 5453, 281, 19553, 253, 7177, 13, 271, 8183, 2183, 617, 326, 597, 574, 644, 46314, 15, 187, 187, 1989, 28852, 13, 665, 17587, 521, 6171, 370, 740, 323, 1046, 15223, 8137, 597, 19553, 13, 753, 326, 253, 3416, 3534, 617, 8137, 326, 7237, 281, 271, 762, 486, 3331, 665, 574, 11704, 617, 281, 253, 5453, 285, 326, 253, 7437, 273, 8137, 497, 38509, 456, 432, 253, 3331, 984, 597, 497, 1146, 3731, 3197, 15, 187, 187, 1628, 42, 369, 12623, 598, 984, 703, 7730, 247, 6617, 1806, 28852, 2296, 15, 773, 1552, 310, 11339, 1425, 187, 187, 49762, 265, 556, 2489, 28027, 386, 670, 33118, 1066, 327, 762, 486, 5484, 398, 15, 496, 6752, 13, 344, 369, 44861, 370, 19, 13, 933, 407, 253, 2846, 285, 1996, 23460, 407, 253, 2021, 273, 247, 530, 15, 52, 15, 4913, 9651, 5908, 665, 369, 5339, 672, 247, 1384, 14, 2913, 14, 744, 3416, 1694, 715, 617, 1113, 285, 4352, 779, 846, 1907, 2067, 17208, 387, 20909, 275, 40996, 5041, 15, 6067, 22368, 187, 187, 510, 22368, 273, 253, 6516, 310, 281, 2085, 271, 3907, 12209, 323, 1110, 665, 20141, 281, 1239, 13, 1158, 13, 3984, 13, 285, 3630, 275, 1340, 281, 7170, 253, 5702, 13, 17541, 13, 285, 8249, 4685, 273, 6150, 1612, 285, 643, 3374, 4619, 281, 3872, 5684, 15, 187, 187, 34, 13773, 4965, 282, 273, 36931, 187, 187, 510, 38757, 8881, 689, 253, 2442, 1659, 273, 1327, 47745, 26547, 1100, 275, 253, 530, 15, 52, 15, 13669, 4102, 369, 7416, 407, 247, 4667, 273, 11543, 5014, 27, 22694, 4782, 17264, 15435, 17453, 285, 10043, 13669, 28244, 27504, 9002, 1034, 15, 187, 187, 45840, 17453, 13, 2488, 273, 2067, 5098, 327, 11080, 29252, 12074, 13, 5966, 253, 8881, 342, 521, 816, 14, 15855, 4460, 49608, 5432, 6550, 313, 13804, 468, 44704, 13, 8210, 481, 3032, 7015, 31149, 327, 253, 1984, 369, 28244, 9011, 2516, 313, 52, 13183, 10, 9002, 1034, 13, 665, 369, 253, 25186, 3490, 17747, 1309, 253, 13563, 50106, 6056, 50072, 15, 17453, 3786, 574, 49586, 342, 28244, 9002, 1034, 327, 253, 7599, 7411, 434, 16383, 285, 4122, 32339, 2395, 273, 253, 50106, 6056, 4544, 13, 2596, 35942, 23264, 313, 14749, 267, 6516, 5687, 13, 9748, 481, 187, 187, 688, 2596, 35942, 23264, 13, 253, 767, 14588, 849, 13, 247, 1643, 3618, 1078, 253, 50106, 6056, 50072, 13, 36174, 247, 3490, 273, 581, 22822, 6909, 254, 13, 1264, 48232, 684, 13, 285, 1264, 18500, 10992, 3093, 3927, 13, 253, 7599, 7411, 346, 84, 1164, 3, 253, 530, 15, 52, 15, 10289, 3094, 267, 11936, 313, 8887, 14, 3079, 10, 1309, 271, 5763, 275, 253, 49185, 11936, 15, 380, 10289, 13, 273, 2282, 13, 574, 690, 5571, 9954, 327, 4450, 15, 7214, 9002, 1034, 434, 6909, 254, 39230, 13, 253, 4051, 312, 7397, 13, 12360, 342, 1740, 1889, 406, 1507, 342, 247, 2491, 273, 1384, 6574, 13, 812, 8513, 253, 10289, 15, 187, 187, 14067, 17193, 2448, 6031, 281, 19912, 285, 346, 84, 750, 3, 521, 11811, 13, 28244, 9002, 1034, 369, 2104, 281, 2810, 281, 1561, 1903, 6574, 273, 253, 3094, 267, 11936, 281, 26065, 14954, 521, 1889, 406, 1507, 285, 6909, 253, 10289, 15, 754, 1996, 651, 3630, 27, 187, 187, 17756, 13, 9563, 253, 9447, 273, 436, 17005, 13, 1379, 17458, 943, 368, 2455, 1089, 4834, 347, 247, 6680, 1387, 17747, 275, 841, 5989, 13, 984, 352, 310, 9648, 2779, 326, 275, 3076, 8588, 13, 368, 651, 7168, 253, 6680, 15, 831, 310, 3340, 2032, 1411, 247, 1663, 3413, 2983, 275, 534, 253, 9054, 310, 5480, 281, 7168, 2067, 11811, 275, 1340, 281, 16338, 634, 10289, 14, 4609, 344, 943, 1900, 320, 13, 984, 672, 253, 10289, 4566, 634, 2329, 3490, 285, 1077, 2779, 634, 2862, 4544, 564, 342, 352, 15, 187, 187, 4125, 13, 1458, 1107, 846, 253, 50106, 6056, 13, 2305, 15, 17453, 285, 28244, 9002, 1034, 6983, 253, 3094, 267, 11936, 2362, 275, 616, 4460, 15, 1292, 275, 49608, 5432, 6550, 13, 253, 530, 15, 52, 15, 2221, 48789, 7195, 19759, 310, 13964, 407, 247, 611, 23353, 14, 881, 35898, 14, 395, 37023, 275, 247, 6069, 18864, 15, 380, 2983, 3936, 1659, 275, 6752, 13, 347, 253, 6680, 1387, 7274, 253, 530, 15, 52, 15, 2613, 387, 14912, 26424, 15, 380, 1903, 5385, 34768, 13, 6909, 398, 13, 48232, 684, 13, 285, 2983, 26547, 1100, 326, 403, 9273, 253, 7195, 19759, 1891, 281, 2736, 253, 28628, 14, 34502, 749, 15, 187, 187, 28326, 670, 253, 4460, 13, 28244, 9002, 1034, 21198, 326, 346, 2520, 310, 417, 247, 10554, 273, 253, 2852, 449, 13771, 13, 344, 1925, 352, 247, 346, 36730, 964, 964, 964, 247, 9734, 449, 187, 187, 4553, 16585, 253, 12474, 285, 253, 4815, 273, 9954, 15495, 273, 253, 49608, 5432, 313, 8887, 47, 14, 2358, 10, 966, 13, 253, 7599, 7411, 9713, 253, 35898, 2523, 15, 754, 4469, 14938, 326, 253, 530, 15, 52, 15, 285, 4782, 35898, 5621, 574, 2489, 512, 14, 47745, 285, 5544, 521, 767, 4606, 323, 14707, 281, 923, 1327, 47745, 19750, 275, 1097, 6563, 447, 27, 187, 187, 5623, 4175, 460, 2105, 14, 66, 4980, 13575, 44, 13, 344, 5544, 13, 4815, 581, 14, 19016, 281, 581, 14, 25512, 394, 347, 1199, 347, 247, 6069, 2983, 35898, 187, 187, 12412, 14, 16272, 35898, 5871, 14, 968, 73, 410, 13234, 28, 6498, 275, 20126, 13, 278, 967, 12685, 28, 15165, 6083, 28, 285, 643, 4712, 672, 581, 943, 2495, 247, 4577, 13, 20182, 13575, 44, 2581 ]
primary vote, and punishes those that fall below it. We cannot afford for our primary vote to fall much further, and we cannot afford any more hollowing out of our activist and membership base. [“Let’s Start the Attacks”, in Jones, 2006: pp. 209-10] If the Greens want to really hit the ALP leadership, they should go for its union base. The Green Party is hardly now seen as a working class party, but if it keeps making the effort, there is a chance it could be. This is a superb post, that does an incredible amount in a limited space. There’s a lot to say in response to it. Last things first: The Greens, for all my conversion to them, are not serious about doing anything. What you have to say here resonates: I think the Greens on election day and night, including myself, were inconsistently trying to get rid of Howard while also mounting an attack on Rudd from the left. Labor government should be a better time to be a Green, with the target clearer, although I’ve seen in the UK how the Tory bogeyman is enough to keep people from attacking Labour all-out. The Greens are not serious about anything, but reaching out to the unions would seem to be the appropriate place to go. The left here is 25% of the electorate – perhaps 43% if construed broadly, Labor’s rump two-party-preferred. The Greens are stuck in the 25% rump, and could usefully start moving into the 18% of left nationalistic battlers. Of course, it’s your non-aligned nationalistic battlers who decide elections, and they’re the ones who’ve elected Rudd, clearly because they know that WorkChoices is no good for them. Cheers Mark. I’ve had the same experience of a crappy Labour government in NZ with Helen Clark et al. As you say with the UK the effects on the left are ambiguous. I hoped the arrival of the Clark government would sharpen the critique of those further left, with the lesser evil installed. But it didn’t happen. Partly because the left forces were co-opted by coalition (the electoral system makes a difference) and partly because the Alliance – once a real social democratic force polling (briefly) in the 20s – imploded after Sept 11 2001, with the leadership deserting the base. One difference that I see here is a stronger and more assertive union movement and its successful campaign against WorkChoices. Much of the leadership of that campaign has no interest in creating trouble for the ALP. But some of it genuinely does, and there is real cynicism among the base that could be coaxed into opposition given some space. And it really is a big base, perhaps the biggest semi-organised political mass in Australian society. Plus, the economic situation is likely to put the Labor government in a tough position, where they will be trying to deliberately restrain wage growth. One thing I wanted to put in the post but didn’t was that the Northern Territory invasion ought to be another key issue for the Greens – it may not be a vote winner but someone needs to keep it on the agenda. I don’t see any hope in the unions at present, as long as the ACTU remains tied to the ALP. If you want to see something break out, you have to look to the severing of union ties to political parties – look at the (French) CGT since it broke up with the PCF (and then look at the PCF)! On this change of mood thing, where do we get our sense of the ‘national mood’? The change of mood is really in the media, and it’s been just about palpable that the media got behind Rudd.import { timer } from '@/_helpers/promise-more' export async function retry(executor: () => Promise<any>, retryTimes = 1) { let times = retryTimes + 1 while (times--) { try { return await executor() } catch (e) { await timer(1000) } } console.error('>>>>> timeout') } Marc Barnes Arrested, Charged For Theft & Destruction Of Property Barnes, 51, prides himself on knowing how to run a popular nightclub, catering to 20- and 30-somethings looking for the latest “it” spot. His portfolio includes past popular clubs, such as Republic Gardens and Love, and his current venue, the Park at Fourteenth, in downtown Washington. But on Oct. 31, he was arrested and spent more than 11 hours in a D.C. cellblock, charged with misdemeanor second-degree theft and destruction of property for something he said he does regularly: confiscating fake identifications or any identification misused by underage patrons to enter his club. According to D.C. Superior Court documents, just after midnight on Aug. 10, Barnes and his security staff got into a confrontation with a Germantown woman over her identification. The woman, originally from Liberia, said that Barnes and his staff confiscated her Liberian driver’s license and residence permit, saying they were fake. Days later, according to the court documents, when the woman returned to the club to retrieve the documents, an employee told her that they had been shredded. But Barnes, who pays his employees $10 for every fake identification they retrieve, said that the woman gave her identification that evening to an underage friend who had accompanied her to the club and that the pieces of identification were confiscated from the friend because they were being misused. “I was locked up because she committed a crime,” Barnes says. “This is stupid.” Barnes has become vigilant about cracking down on underage drinkers. In 2002, he was fined $2,000 by the city and later sued by the family of a U.S. Park Police officer who was killed when a 20-year-old woman got into her car and hit him after having several drinks at Dream in Northeast Washington.Our Mission The Mission of the Institute is to provide an independent forum for those who dare to read, think, speak, and write in order to advance the professional, literary, and scientific understanding of sea power and other issues critical to national defense. A Different Angle of Attack The accelerating debate over the potential place of nonnuclear submarines in the U.S. Navy recently was joined by a pair of unlikely participants: respected British journalist Patrick Robinson and Royal Navy Admiral Sandy Woodward. Patrick Robinson, author of several books on thoroughbred horses, entered the debate with his just-published novel Nimitz Class (HarperCollins, 1997). His chief advisor on the book was Admiral Sir John (Sandy) Woodward, who was the naval force commander during the 1982 Falklands Conflict. Robinson previously had collaborated with Admiral Woodward on the admiral's outstanding and highly personalized account of the Falklands campaign, One Hundred Days (Naval Institute Press, 1992). In One Hundred Days, the two relate how, a few weeks before the Falklands Conflict, commanding a force of one missile destroyer, three frigates, and three fleet auxiliaries, the admiral "sank" the U.S. carrier Coral Sea (CV-43) during an exercise in the Arabian Sea. The carrier, of course, had some 70 aircraft on board. Only Woodward's destroyer flagship, the Glamorgan, armed with four Exocets with a range of 20 miles, could hurt the carrier. Despite intensive American efforts to locate and "sink" his ships, Admiral Woodward was able to close to within 11 miles of the Coral Sea to simulate firing his Exocets and destroy the carrier. He later would write: Therefore, reads the moral of this tale, take caution should you ever find yourself as a battle group commander in these circumstances, because it is fairly likely that in bad weather, you would lose the battle. This is especially true against a really determined attack in which the enemy is prepared to lose several ships in order to sink your carrier-which he should always be, because when the carrier goes your air force and very likely your entire campaign go with it. Now, 15 years after the Falklands, Mr. Robinson and Admiral Woodward recall the Coral Sea event in their novel. But in Nimitz Class, the U.S. supercarrier Thomas Jefferson is attacked by a Kilo-type submarine-and sunk in a nuclear explosion. The attack takes place in 2002, as the battle group approaches the U.S. base at Diego Garcia. The 11 cruisers, destroyers, frigates, and attack submarines that are screening the Thomas Jefferson fail to detect the diesel-electric sub. Speaking about the novel, Admiral Woodward stressed that "this is not a prediction of the future." Rather, he called it a "parable . . . a warning." After discussing the attributes and the costs of aircraft carriers of the Nimitz (CVN-68) class, the admiral addressed the submarine issue. He expressed regret that the U.S. and British submarine forces had become all-nuclear and explained his two reasons for wanting to see nonnuclear boats in both navies: Submarine cost-a modern SSK, he explained, costs one-third to one-fifth as much as a nuclear attack submarine High-risk submarine operations-inshore surveillance; operating in shallow, mined waters; landing agents; and other activities when one should risk a smaller, cheaper SSK rather
[ 89, 22187, 14, 35, 1166, 2194, 1008, 1173, 89, 22187, 14, 35, 1012, 2194, 1008, 1173, 89, 22187, 14, 35, 1812, 2194, 1008, 1173, 89, 22187, 14, 35, 2537, 2194, 1008, 1173, 89, 22187, 14, 35, 25, 2194, 1008, 1173, 89, 22187, 14, 35, 1449, 2194, 1008, 1173, 89, 22187, 14, 35, 3439, 2194, 1008, 1173, 89, 22187, 14, 35, 3680, 2194, 1008, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 3291, 390, 374, 10, 247, 37623, 11616, 475, 33818, 410, 14797, 11, 5043, 253, 1824, 298, 5348, 313, 47, 1105, 1494, 70, 2339, 10, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 22, 2194, 1008, 1173, 89, 22187, 14, 35, 2385, 2194, 1008, 1173, 89, 22187, 14, 35, 1731, 2194, 1008, 1173, 89, 22187, 14, 35, 1036, 2194, 1008, 1173, 89, 22187, 14, 35, 1671, 2194, 1008, 1173, 89, 22187, 14, 35, 1012, 2194, 1008, 1173, 89, 22187, 14, 35, 1839, 2194, 1008, 1173, 89, 22187, 14, 35, 883, 2194, 1008, 1173, 89, 22187, 14, 35, 1348, 2194, 1008, 1173, 89, 22187, 14, 35, 805, 2194, 1008, 1173, 89, 22187, 14, 35, 3208, 2498, 329, 2626, 6387, 8687, 14663, 273, 1824, 298, 5348, 347, 7586, 281, 512, 643, 2897, 3783, 468, 983, 13, 533, 436, 18080, 556, 2959, 1652, 1329, 432, 5787, 23165, 6260, 313, 2858, 923, 1008, 1173, 89, 22187, 14, 35, 3011, 2194, 544, 926, 15, 337, 1084, 1173, 89, 22187, 14, 39, 18, 910, 709, 14, 881, 568, 926, 2536, 187, 187, 3138, 1532, 11831, 1896, 1755, 5970, 35668, 253, 27213, 1340, 273, 1264, 2201, 2897, 3783, 33309, 34835, 2796, 33818, 410, 14797, 2992, 427, 1105, 1494, 70, 2339, 13, 285, 253, 12875, 37623, 481, 2594, 2505, 313, 7053, 12494, 10, 323, 247, 1618, 273, 30404, 8109, 1016, 5202, 5774, 1173, 89, 22187, 71, 18, 4253, 1173, 89, 22187, 14, 39, 18, 94, 187, 187, 1992, 2953, 253, 7688, 273, 2201, 2897, 3783, 33309, 34835, 13, 2045, 2175, 452, 17412, 5787, 941, 5239, 1690, 247, 1643, 281, 8307, 273, 3608, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 2385, 2194, 1008, 1173, 89, 22187, 14, 35, 1166, 2194, 1008, 1173, 89, 22187, 14, 35, 1706, 2194, 1008, 1173, 89, 22187, 14, 35, 3357, 2194, 1008, 1173, 89, 22187, 14, 35, 1099, 2194, 1008, 1173, 89, 22187, 14, 35, 1812, 2194, 1008, 1173, 89, 22187, 14, 35, 2537, 2194, 1008, 1173, 89, 22187, 14, 35, 25, 2194, 1008, 1173, 89, 22187, 14, 35, 3208, 2194, 1008, 1173, 89, 22187, 14, 35, 3680, 2498, 13036, 281, 4059, 13, 512, 6260, 5196, 497, 1754, 327, 32147, 456, 43097, 273, 512, 3320, 14251, 6730, 15, 6295, 9864, 285, 16774, 941, 452, 2011, 13, 2299, 13, 326, 32147, 318, 7274, 476, 4917, 24363, 1543, 672, 253, 6944, 9376, 273, 27370, 2865, 636, 386, 3320, 29892, 310, 18171, 13588, 407, 253, 941, 2479, 1173, 89, 22187, 14, 35, 1093, 2194, 1008, 1173, 89, 22187, 14, 35, 1619, 2498, 19863, 2440, 273, 40405, 1154, 3082, 326, 476, 1805, 18045, 3320, 5202, 19331, 4795, 432, 253, 3361, 273, 18464, 23009, 23762, 313, 3077, 52, 10, 3400, 271, 39893, 323, 3417, 5202, 17032, 2479, 1173, 89, 22187, 14, 35, 1630, 2194, 1008, 1173, 89, 22187, 14, 35, 746, 2194, 1008, 1173, 89, 22187, 14, 35, 1619, 2194, 1008, 1173, 89, 22187, 14, 35, 1010, 2194, 1008, 1173, 89, 22187, 14, 35, 1423, 2194, 1008, 1173, 89, 22187, 14, 35, 1229, 2194, 1008, 1173, 89, 22187, 14, 35, 1237, 2194, 1008, 1173, 89, 22187, 14, 35, 1610, 2498, 187, 187, 683, 1173, 89, 22187, 14, 35, 2417, 62, 3732, 1097, 32147, 318, 285, 40405, 1154, 7274, 281, 7409, 253, 16483, 5230, 273, 2897, 3783, 468, 983, 970, 247, 7045, 4986, 941, 873, 11253, 273, 27322, 6069, 3608, 285, 7904, 29821, 13, 1690, 954, 2201, 2897, 3783, 33309, 34835, 347, 973, 347, 17409, 23047, 33309, 562, 12896, 15, 4129, 616, 32147, 318, 6260, 2085, 1329, 323, 253, 475, 33818, 410, 14797, 13023, 84, 2131, 9079, 13, 6010, 40405, 1154, 7274, 313, 4548, 14, 24422, 285, 3915, 1277, 28, 1008, 1173, 89, 22187, 14, 35, 1717, 1092, 1008, 1173, 89, 22187, 14, 35, 1229, 3291, 3732, 281, 436, 941, 873, 11512, 475, 33818, 410, 14797, 1186, 42396, 11, 1186, 11, 47, 1105, 1494, 70, 2339, 5202, 15, 1008, 1173, 89, 22187, 14, 35, 3208, 62, 11511, 253, 1543, 1754, 327, 32147, 318, 3082, 42203, 616, 19297, 281, 2395, 323, 5274, 52, 15, 2053, 4477, 2007, 28809, 616, 11815, 1563, 253, 1543, 2797, 970, 5202, 14, 17777, 1894, 14, 2377, 48027, 7259, 281, 5806, 562, 3809, 14, 1173, 11932, 4375, 313, 2887, 671, 1008, 1173, 89, 22187, 14, 35, 740, 2498, 19863, 294, 47927, 273, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 941, 873, 13, 2299, 13, 452, 2011, 326, 253, 6010, 40405, 1154, 7274, 908, 403, 7996, 281, 1097, 3731, 14, 287, 4225, 3320, 7139, 285, 12420, 6332, 2479, 1173, 89, 22187, 14, 35, 2950, 6660, 285, 326, 253, 1894, 8790, 312, 4906, 8130, 12845, 403, 23539, 2479, 1173, 89, 22187, 14, 35, 2504, 2498, 2091, 1110, 767, 2616, 403, 20184, 323, 13, 475, 33818, 410, 14797, 13023, 84, 2131, 310, 11512, 1014, 342, 40405, 1154, 7274, 2479, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 2498, 187, 187, 7910, 2022, 35961, 24165, 48637, 253, 7200, 273, 23165, 6260, 452, 417, 2568, 644, 2783, 407, 253, 3332, 14421, 2175, 326, 7409, 253, 16483, 20801, 273, 2201, 2897, 3783, 33309, 34835, 27, 337, 10, 3320, 5202, 13418, 2228, 313, 74, 15, 70, 904, 22245, 3320, 7139, 11741, 281, 17154, 253, 2032, 49584, 38721, 2892, 273, 3608, 10, 285, 374, 10, 30078, 2538, 273, 3710, 43653, 10491, 15, 380, 3438, 2803, 5431, 23880, 432, 253, 1698, 1491, 2600, 273, 253, 313, 32205, 2159, 10, 2060, 3320, 14251, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 1867, 2194, 1008, 1173, 89, 22187, 14, 35, 21, 6660, 5727, 4433, 281, 2486, 2234, 34835, 326, 17542, 646, 1048, 12998, 476, 4711, 12082, 6332, 824, 347, 1048, 14, 27391, 21779, 313, 70, 15, 72, 904, 1008, 1173, 89, 22187, 14, 35, 2417, 2194, 1008, 1173, 89, 22187, 14, 35, 1047, 2498, 43308, 432, 253, 3731, 14, 287, 5341, 3374, 5439, 2479, 1173, 89, 22187, 14, 35, 2950, 2194, 1008, 1173, 89, 22187, 14, 35, 2504, 6660, 3320, 5202, 2228, 369, 5469, 533, 417, 3587, 9713, 407, 253, 2045, 2175, 15, 5488, 13, 253, 7045, 4986, 941, 873, 5867, 407, 1008, 1173, 89, 22187, 14, 35, 3208, 62, 2908, 247, 2014, 3417, 273, 1824, 298, 5348, 285, 20296, 2393, 14, 27391, 272, 15572, 275, 253, 346, 2013, 1776, 2897, 3783, 468, 983, 3, 42540, 37623, 313, 5214, 37623, 38492, 481, 187, 187, 4943, 13, 359, 45735, 253, 5230, 273, 2897, 3783, 468, 983, 1895, 407, 15890, 323, 2442, 12082, 31306, 14475, 432, 3710, 2891, 251, 10491, 285, 3320, 5202, 13418, 2228, 15, 844, 11848, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 7045, 4986, 941, 873, 273, 27322, 6069, 3608, 281, 2486, 3786, 440, 911, 33431, 6430, 432, 767, 2393, 14, 69, 2373, 3390, 2897, 3783, 33309, 34835, 15, 380, 747, 29821, 2879, 2486, 1264, 1824, 298, 5348, 326, 8085, 253, 1048, 7789, 4283, 281, 475, 47, 484, 9432, 11, 313, 6538, 8612, 273, 427, 1105, 1494, 70, 2339, 275, 1008, 1173, 89, 22187, 14, 35, 3208, 31258, 84, 941, 873, 10, 285, 1740, 3417, 275, 3752, 287, 5830, 11416, 2339, 13, 534, 12093, 253, 18353, 14, 27391, 272, 23009, 275, 253, 12875, 37623, 313, 1439, 6607, 275, 253, 3236, 941, 873, 28, 923, 1008, 1173, 89, 22187, 14, 35, 20, 2194, 544, 926, 15, 374, 1084, 1173, 89, 22187, 14, 39, 19, 910, 709, 14, 881, 568, 926, 2536, 187, 187, 3138, 1532, 19030, 5202, 1754, 327, 253, 329, 9639, 1556, 14, 2267, 1783, 273, 253, 11848, 941, 873, 970, 18379, 6430, 15, 25474, 16095, 2011, 497, 5998, 323, 253, 32147, 456, 4315, 970, 12875, 89, 4132, 15, 427, 26306, 1329, 2193, 403, 4860, 1840, 1016, 7789, 313, 5996, 8538, 5912, 390, 28551, 1329, 2797, 432, 329, 9639, 1556, 14, 2267, 16, 4548, 14, 24422, 16, 5214, 89, 4132, 16, 1672, 66, 24444, 265, 558, 271, 23317, 1886, 6492, 253, 37623, 310, 4751, 4516, 15, 1457, 29821, 2879, 1060, 403, 2011, 275, 13433, 15, 1876, 643, 7139, 6012, 432, 40405, 1154, 313, 21, 643, 6260, 582, 32147, 318, 313, 19, 6260, 582, 285, 443, 23802, 14, 3169, 40405, 1154, 6260, 313, 1237, 6260, 10, 671, 11322, 253, 475, 33818, 410, 14797, 4842, 84, 2131, 5202, 313, 33850, 347, 544, 9227, 17724, 1084, 8403, 18, 910, 709, 14, 881, 568, 6962, 14, 4990, 986, 3909, 28, 923, 1329, 2193, 275, 2829, 337, 481, 12010, 25446, 403, 6667, 273, 8357, 4444, 9991, 27, 2796, 66, 5627, 475, 59, 2966, 571, 44984, 2992, 2796, 67, 5627, 475, 43539, 297, 3703, 66, 1186, 6027, 1186, 31873, 25933, 2992, 2796, 68, 5627, 475, 9304, 3770, 20130, 465, 641, 518, 319, 2886, 2992, 2796, 69, 5627, 475, 41, 47411, 406, 455, 261, 3744, 6156, 2992, 2796, 70, 5627, 475, 41, 483, 16853, 1362, 571, 12045, 682, 2992, 2796, 71, 5627, 475, 47981, 25119, 4936, 338, 3833, 66, 2992, 2796, 72, 5627, 475, 15041, 280, 1514, 49716, 31945, 360, 2992, 2796, 73, 5627, 475, 10859, 261, 17244, 653, 864, 386, 248, 376, 2992, 2796, 74, 5627, 475, 47, 484, 9432, 519, 1261, 66, 2992, 2796, 75, 5627, 475, 47, 1105, 1494, 14576, 35263, 5154, 66, 2992, 2796, 76, 5627, 475, 33818, 410, 14797, 50163, 412, 17457, 2992, 2796, 77, 5627, 475, 25385, 16559, 268, 41105, 682, 4556, 880, 1173, 89, 22187, 71, 19, 4253, 1173, 89, 22187, 14, 39, 19, 94, 187, 187, 1231, 671, 5196, 3320, 49584, 15514, 31197, 313, 6435, 42, 582, 247, 4102, 4081, 2746, 281, 26923, 875, 13418, 2228, 285, 4588, 7534, 7344, 313, 70, 15, 72, 904, 4795, 432, 5274, 52, 10, 275, 15571, 3320, 5202, 1485, 543, 579, 566, 2479, 1173, 89, 22187, 14, 35, 21, 2498, 831, 1332, 16608, 684, 2060, 3608, 3066, 18080, 5216, 281, 3653, 253, 49584, 38721, 2892, 326, 1016, 3320, 8525, 342, 4585, 5912, 15, 496, 643, 3000, 13, 352, 22649, 534, 5202, 18080, 13, 432, 247, 873, 273, 41364, 1755, 5970, 13, 3400, 253, 1682, 4944, 323, 1016, 273, 253, 313, 32205, 2159, 10, 3320, 27959, 15, 443, 23802, 16756, 253, 2625, 432, 3608, 407, 9433, 17597, 10806, 2556, 281, 253, 1180, 273, 5795, 7139, 323, 247, 1677, 475, 79, 4842, 9292, 251, 3908, 15, 380, 2613, 273, 2897, 3783, 468, 983, 310, 247, 26415, 495, 14, 9292, 251, 313, 263, 440, 287, 4225, 577, 14, 9292, 251, 10, 1895, 326, 8687, 1264, 1896, 1755, 5970, 27, 475, 33818, 410, 14797, 4842, 84, 2131, 13, 475, 33818, 410, 14797, 1186, 42396, 11, 1186, 11, 47, 1105, 1494, 70, 2339, 13, 390, 427, 1105, 1494, 70, 2339, 14, 84, 2131, 313, 2887, 544, 926, 15, 337, 1084, 1173, 89, 22187, 14, 39, 18, 910, 709, 14, 881, 568, 926, 2536, 380, 4795, 20793, 7139, 323, 1016, 3320, 403, 10126, 2429, 285, 17045, 2556, 281, 253, 475, 49, 11, 2193, 2797, 970, 253, 5512, 38663, 313, 16408, 10, 1071, 2479, 1173, 89, 22187, 14, 35, 1857, 2498, 496, 1635, 281, 10405, 3006, 253, 4103, 1329, 326, 1016, 5795, 18080, 14488, 2439, 3608, 13, 253, 4795, 5958, 337, 3320, 7139, 4236, 407, 253, 18080, 5216, 313, 6435, 42, 3320, 7139, 10, 476, 320, 908, 347, 3280, 323, 3417, 5202, 3082, 13, 7624, 15890, 323, 12082, 6332, 15276, 281, 440, 48454, 3320, 5202, 17032, 285, 9142, 6010, 40405, 1154, 6260, 2479, 1173, 89, 22187, 14, 35, 21, 2194, 1008, 1173, 89, 22187, 14, 35, 1706, 2498, 187, 187, 1992, 31237, 253, 11848, 941, 873, 13, 359, 806, 10432, 253, 4122, 34249, 562, 4399, 475, 37315, 26093, 5021, 5497, 437, 13047, 567, 2886, 11, 313, 44247, 407, 1008, 1173, 89, 22187, 14, 35, 3208, 3291, 281, 3693, 12082, 31306, 45030, 432, 1048, 14, 27391, 21779, 313, 2887, 1008, 1173, 89, 22187, 14, 35, 2950, 2498, 3808, 6260, 313, 6435, 42, 28, 923, 2708, 582, 2299, 13, 908, 253, 3236, 285, 11848, 941, 5239, 1097, 342, 285, 1293, 475, 37315, 26093, 5021, 11, 323, 625, 1480, 5301, 342, 2045, 2175 ]
x233-B17]; [@evx233-B13]; [@evx233-B36]; [@evx233-B49]; [@evx233-B8]; [@evx233-B40]; [@evx233-B54]; [@evx233-B58]; [@evx233-B46]; [@evx233-B47]) or 2) a clade comprising *Amborella* plus the water lilies (Nymphaeales) (e.g., [@evx233-B5]; [@evx233-B48]; [@evx233-B26]; [@evx233-B16]; [@evx233-B35]; [@evx233-B13]; [@evx233-B38]; [@evx233-B11]; [@evx233-B24]; [@evx233-B12]; [@evx233-B56]). A third possibility involves placement of water lilies as sister to all other angiosperms, but this topology has received little support from molecular phylogenetic analyses (but see [@evx233-B57]; [fig. 1](#evx233-F1){ref-type="fig"}). ![---Three possible topologies depicting the branching order of three major angiosperm lineages (*Amborella*, Nymphaeales, and the RA clade). See text (first paragraph) for a list of citations supporting each tree.](evx233f1){#evx233-F1} To address the relationships of major angiosperm lineages, previous studies have assembled molecular data sets including a few to hundreds of genes (e.g., [@evx233-B48]; [@evx233-B17]; [@evx233-B34]; [@evx233-B53]; [@evx233-B25]; [@evx233-B36]; [@evx233-B49]; [@evx233-B8]; [@evx233-B56]; [@evx233-B58]). Prior to 2014, all analyses conducted were based on concatenated alignments of all gene fragments examined. Both simulation and empirical data have shown, however, that concatenation approaches can yield misleading results when the underlying assumption of nondiscordant gene histories is extensively violated by the data ([@evx233-B18]; [@evx233-B28]). Recent development of coalescent methods that can better accommodate gene tree heterogeneity resulting from the presence of incomplete lineage sorting (ILS) provides an avenue for species tree inference ([@evx233-B27]; [@evx233-B19]; [@evx233-B28]; [@evx233-B15]; [@evx233-B22]; [@evx233-B30]; [@evx233-B32]; [@evx233-B33]). [@evx233-B55] applied both concatenation and coalescent approaches to investigate the evolutionary root of angiosperms using a transcriptomic data set consisting of 310 nuclear genes and 46 taxa, including most major angiosperm lineages as well as gymnosperm outgroups. Although their concatenation analyses provide support for the *Amborella-*sister hypothesis, summary coalescent approaches (MP-EST and STAR; [@evx233-B29], [@evx233-B30]) applied to this data set resolved *Amborella *+* *Nymphaeales tree. [@evx233-B56] dismissed the results based on concatenation methods invoking their inability to account for ILS. These authors further reinforced their conclusions following the results obtained using tree-independent character-subsampling procedures to filter out fast-evolving sites (see also [@evx233-B10]). Recent reanalyses of [@evx233-B56]'s data set, however, have shown that the summary coalescent approaches used are sensitive to both mis-rooted gene trees and alignment errors ([@evx233-B46]), and that the character subsampling strategies utilized are biased ([@evx233-B47]). When those two factors are accounted for, *Amborella-*sister is resolved even with coalescent approaches ([@evx233-B46]; [@evx233-B47]). Two main methodological artifacts compromising the accuracy of phylogenetic analyses have not yet been considered by the recent genomic studies that investigate the evolutionary origins of major angiosperm lineages: 1) gene tree estimation error (i.e., inferred gene trees failing to depict the true genealogical history of genes) and 2) detrimental effects of limited taxonomic sampling. The former factor typically stems from the low information content of the (often short) individual gene fragments (e.g., [@evx233-B39]; [@evx233-B4]), whereas failure to include key lineages that bisect long branches can produce systematic errors such as long-branch attraction (e.g., [@evx233-B55]; [@evx233-B14]). Aside from the mis-rooting issues raised ([@evx233-B46]; [@evx233-B47]), gene tree error was discussed but not directly addressed by the previous studies. Furthermore, the transcriptomic data set analyzed by [@evx233-B56] included a single species of water lilies and lacked early-branching representatives in the "remaining angiosperms" unnamed clade (RA clade hereafter). Here, we revisit the root of angiosperms problem by accounting for potential systematic biases arising from limited taxon sampling and gene tree estimation error. We expanded [@evx233-B56]'s transcriptomic data set of 310 nuclear genes to include previously unexamined sequences from two early-diverging angiosperm lineages. The new taxa added include three water lilies that split the long branch leading to *Nuphar* (sole representative of Nymphaeales in [@evx233-B56]'s data set) and four species in Austrobaileyales, which comprises the earliest-branching lineage in the RA clade (not represented in the original data set; see [@evx233-B3]; [fig. 2](#evx233-F2){ref-type="fig"}). ![---Selected tree based on the ASTRAL-II analysis of the expanded data set using nucleotide sequences. Branch lengths shown were estimated for the concatenated matrix using RAxML. Nodal support values are indicated above each branch (posterior probability or bootstrap support obtained from ASTRAL-II/MP-EST/RAxML/ExaBayes); an asterisk indicates the clade is fully supported. New taxa added here are shown in bold. All other trees derived from coalescent (4 other analyses), concatenation (2 analyses), and GGI-based coalescent analyses (32 analyses) also resolve the *Amborella*-sister tree (provided as [Supplementary Material](#sup1){ref-type="supplementary-material"} online; see support values in table 1). Photographs are examples of seed plant diversity: (*a*) *Zinnia elegans*, (*b*) *Ipomoea × sloteri*, (*c*) *Monochoria korsakowii*, (*d*) *Hemerocallis fulva*, (*e*) *Houttuynia cordata*, (*f*) *Magnolia grandiflora*, (*g*) *Illicium floridanum*, (*h*) *Schisandra sphenanthera*, (*i*) *Nuphar advena*, (*j*) *Nymphaea tetragona*, (*k*) *Amborella trichopoda*, (*l*) *Cycas pectinata*.](evx233f2){#evx233-F2} We also conducted gene genealogy interrogation (GGI), a recently proposed approach to discern between estimation error and actual biological conflict (e.g., resulting from ILS) in explaining gene tree incongruence ([@evx233-B4]). This method interrogates individual genes via topology tests to determine the genealogical history that each gene supports with highest probability. In other words, it identifies which tree topology, from a set of predefined topologies, provides the best fit for each of the (often short) gene partitions. GGI extracts the signal from genes by applying topological constraints according to the number of alternative trees for a given *n*-taxon statement. The base of angiosperms is a rooted 3-taxon (or unrooted 4-taxon) problem that involves three possible topologies: *Amborella*-sister, *Amborella *+* *Nymphaeales, or Nymphaeales-sister (see [fig. 1](#evx233-F1){ref-type="fig"}). The resulting constrained trees for each gene are statistically compared and ranked according to the *P* values obtained using the approximately unbiased (AU) test ([@evx233-B45]). In addition to summarizing the relative support that each alternative topology receives across genes, the resulting rank 1 gene trees selected by the topology tests (GGI gene trees) can be used as input for species tree methods, thereby accounting for systematic errors intrinsic to unconstrained gene tree inference and ultimately summary coalescent analyses ([@evx233-B4]; [@evx233-B34]). To assemble the expanded data set, we first excluded the highly divergent outgroup *Selaginella moellendorffii* (included by [@evx233-B56]) to avoid systematic biases stemming from long-branch attraction (see [@evx233-B46]). Some analyses (GGI; see below), however, used the original and expanded data sets both with and without *Selaginella* for more direct comparison with previous studies
[ 1128, 14958, 521, 12247, 1211, 247, 268, 1763, 2345, 279, 32, 2596, 326, 3261, 751, 247, 24108, 13, 751, 2398, 1031, 79, 434, 32, 1128, 248, 369, 6600, 273, 247, 3511, 40655, 1863, 35042, 1475, 275, 521, 23828, 15, 1359, 8909, 326, 521, 12725, 689, 521, 747, 6122, 13, 521, 5875, 5675, 2021, 13, 812, 2226, 275, 824, 2810, 18326, 281, 253, 26034, 521, 3392, 574, 644, 3811, 342, 323, 1107, 15, 1737, 271, 40889, 344, 369, 323, 17816, 436, 1388, 13, 323, 2820, 281, 43477, 521, 12247, 273, 581, 273, 253, 1643, 6627, 13977, 275, 521, 1495, 15, 187, 187, 1328, 3543, 247, 7227, 1133, 327, 521, 9215, 27, 521, 3392, 13, 3212, 779, 15, 346, 1394, 1472, 2509, 816, 4030, 937, 344, 753, 13, 285, 344, 17132, 3392, 314, 275, 247, 1039, 326, 344, 9403, 1904, 626, 13, 285, 5119, 3543, 751, 247, 28713, 969, 13, 344, 285, 2398, 1031, 79, 816, 247, 4564, 273, 269, 24886, 871, 14, 79, 837, 723, 13, 49979, 342, 767, 18740, 13, 28884, 273, 512, 253, 4088, 326, 1495, 812, 564, 3430, 15, 346, 7093, 6838, 403, 1077, 13476, 937, 7727, 2879, 13, 285, 5119, 816, 11522, 984, 344, 4571, 626, 3324, 2994, 281, 3984, 15, 187, 187, 37, 5338, 369, 247, 2014, 34112, 33845, 8085, 875, 767, 952, 13, 247, 2829, 342, 767, 1659, 7533, 13, 247, 43818, 3376, 3692, 1669, 12239, 651, 320, 22186, 323, 1740, 6774, 1897, 15, 187, 187, 3, 2993, 1833, 564, 1066, 323, 247, 19422, 3517, 937, 5119, 753, 347, 344, 16481, 253, 2829, 15, 346, 18837, 359, 4710, 253, 4023, 1475, 323, 247, 1223, 865, 187, 187, 8389, 12247, 3261, 9861, 13, 13864, 15, 754, 11522, 15, 346, 42, 1871, 751, 326, 449, 187, 187, 11, 475, 475, 187, 187, 1128, 187, 187, 8389, 4475, 369, 247, 1175, 20453, 15, 754, 9047, 617, 13, 2439, 253, 2316, 275, 247, 921, 90, 1264, 14, 19192, 425, 406, 14407, 474, 15823, 281, 253, 372, 266, 273, 253, 3739, 2143, 13, 48055, 15312, 1411, 617, 9081, 275, 247, 1499, 272, 13, 26740, 272, 5777, 432, 1669, 281, 987, 13, 4927, 2784, 16453, 314, 432, 247, 5253, 273, 2502, 8995, 13, 18727, 275, 247, 1039, 326, 369, 387, 2378, 48849, 285, 7171, 692, 347, 703, 753, 13, 346, 42, 816, 2389, 1146, 247, 2243, 15, 733, 434, 253, 954, 794, 309, 1849, 2455, 574, 449, 187, 187, 1328, 38720, 281, 9184, 15, 2058, 1728, 13, 703, 4455, 1629, 770, 763, 285, 28714, 285, 10412, 13, 820, 80, 272, 637, 14427, 595, 281, 2057, 6858, 390, 1133, 14, 88, 3834, 20314, 84, 285, 4394, 447, 342, 253, 277, 1003, 264, 8388, 23716, 273, 271, 1711, 14, 10186, 9890, 20606, 15, 1500, 21567, 1892, 285, 3809, 13, 275, 2159, 31746, 13, 275, 247, 1039, 326, 4455, 1097, 11617, 36713, 285, 4470, 1523, 5164, 1128, 248, 858, 253, 1072, 2181, 13, 2444, 594, 1199, 326, 344, 812, 642, 3356, 12129, 247, 7948, 432, 247, 6794, 13, 47619, 432, 20632, 15, 1500, 2210, 281, 4143, 779, 387, 2143, 4536, 342, 253, 18740, 13, 285, 703, 7607, 253, 15729, 84, 344, 3534, 617, 751, 247, 26246, 466, 13, 502, 1947, 281, 779, 751, 22484, 23853, 285, 1904, 626, 1339, 564, 1919, 344, 858, 15, 733, 1900, 268, 1243, 779, 247, 1652, 281, 3785, 1977, 432, 617, 15, 187, 187, 2993, 369, 5015, 281, 581, 273, 521, 33108, 13, 247, 15674, 382, 275, 521, 323, 2890, 15, 754, 3589, 626, 2119, 752, 2715, 273, 617, 3196, 15, 38711, 369, 6523, 1128, 783, 25507, 13, 5389, 13, 13224, 3416, 665, 1160, 779, 1928, 12107, 285, 23327, 32, 2207, 253, 4600, 14, 7955, 30487, 13, 10101, 251, 595, 892, 14381, 90, 13, 440, 32980, 2419, 27505, 665, 574, 253, 3820, 10757, 281, 1333, 1841, 751, 795, 1147, 434, 253, 954, 794, 309, 1849, 2455, 574, 64, 32, 187, 187, 3, 12412, 19916, 937, 521, 9732, 753, 13, 285, 5119, 3543, 271, 8993, 25520, 273, 27042, 323, 521, 4475, 15, 1500, 369, 1335, 594, 2872, 285, 3261, 352, 8423, 15, 754, 812, 923, 617, 40881, 796, 4983, 281, 12433, 282, 13, 285, 344, 48504, 2994, 432, 247, 9096, 273, 47527, 285, 2427, 281, 617, 13, 19883, 253, 1355, 273, 617, 896, 15, 187, 187, 3, 6300, 4854, 670, 253, 3371, 656, 273, 747, 1349, 42395, 937, 3196, 15, 38711, 753, 13, 18727, 275, 247, 1039, 326, 1537, 452, 644, 49282, 1128, 24568, 272, 2398, 1031, 79, 32, 3032, 4475, 3261, 387, 779, 342, 1633, 751, 46347, 27, 795, 32897, 1053, 626, 5580, 479, 562, 13, 417, 275, 2914, 273, 512, 841, 952, 28, 309, 871, 309, 369, 17800, 275, 253, 16846, 436, 4131, 533, 4496, 816, 1132, 2112, 3333, 187, 187, 3, 1147, 434, 253, 954, 15556, 5411, 13, 35247, 13, 9386, 2181, 275, 253, 1533, 937, 5119, 753, 13, 33940, 2685, 1771, 13, 285, 2398, 1031, 79, 11373, 387, 779, 13, 18274, 896, 715, 521, 1133, 15, 187, 187, 3, 4045, 368, 452, 2151, 865, 703, 2546, 3196, 15, 38711, 15, 42167, 369, 387, 1728, 1146, 48163, 407, 247, 6346, 28, 48055, 369, 3578, 3618, 1711, 285, 1512, 2872, 281, 320, 1669, 342, 247, 1790, 350, 28, 352, 574, 4455, 751, 1512, 1199, 281, 3324, 1097, 6838, 13, 533, 344, 3260, 326, 2398, 1031, 79, 3543, 42167, 434, 5928, 751, 247, 35698, 18791, 15, 187, 187, 3, 13618, 13, 642, 937, 253, 7345, 753, 15, 346, 42, 1900, 1869, 352, 651, 320, 16593, 13, 1677, 253, 3038, 309, 1978, 449, 187, 187, 46, 3441, 79, 38644, 28, 5119, 9047, 617, 15, 187, 187, 3, 1989, 18981, 937, 3196, 15, 38711, 753, 15, 346, 6080, 952, 1056, 352, 789, 449, 187, 187, 3, 24804, 937, 5119, 753, 15, 187, 187, 510, 7345, 18274, 275, 11882, 1080, 1365, 15, 346, 42, 1871, 22276, 368, 6068, 281, 3523, 387, 767, 13, 2167, 15, 3094, 83, 8541, 434, 1694, 1740, 5753, 285, 344, 476, 12345, 3297, 24922, 449, 754, 11522, 689, 281, 581, 273, 5119, 434, 43169, 387, 253, 4675, 13, 665, 369, 6306, 12200, 247, 3416, 5119, 24874, 281, 320, 521, 4475, 13, 1097, 273, 731, 2819, 751, 253, 7824, 3846, 13, 4618, 14, 26731, 285, 908, 598, 13, 616, 16473, 8248, 1499, 27151, 1977, 432, 1016, 643, 15, 187, 187, 25233, 14039, 865, 64, 754, 260, 1135, 264, 521, 1133, 625, 18648, 1475, 521, 4475, 434, 13290, 15, 187, 187, 3, 39, 437, 17390, 6306, 598, 1309, 271, 14801, 28857, 1390, 2129, 937, 3196, 15, 38711, 753, 347, 2398, 1031, 79, 48504, 5972, 15, 754, 4571, 626, 2028, 752, 352, 5486, 672, 703, 29172, 521, 1133, 285, 19347, 1977, 15, 187, 187, 2993, 369, 7107, 327, 253, 1039, 1728, 15, 187, 187, 3, 29235, 2419, 13, 23445, 865, 344, 2546, 347, 597, 7428, 2439, 253, 1708, 264, 9729, 689, 253, 8281, 15, 346, 42, 1904, 626, 8968, 627, 795, 12796, 64, 9910, 751, 326, 1475, 1060, 449, 41853, 344, 8156, 344, 369, 5909, 247, 3369, 344, 1871, 4307, 1892, 281, 2534, 695, 796, 4581, 15, 187, 187, 3, 4374, 13, 824, 247, 2080, 3501, 432, 776, 9168, 937, 703, 753, 13, 20284, 617, 1133, 281, 12831, 48055, 434, 14343, 2454, 432, 253, 8136, 1481, 22850, 15, 7160, 7145, 273, 14890, 3228, 369, 327, 253, 1408, 14, 3487, 1930, 533, 352, 369, 7107, 28, 627, 369, 247, 5603, 247, 1643, 8336, 432, 253, 2419, 835, 703, 812, 1379, 253, 6838, 15, 733, 369, 5890, 285, 4999, 15, 754, 1308, 382, 1070, 13, 533, 1078, 344, 812, 1379, 8399, 703, 4925, 323, 521, 4430, 13, 259, 710, 22502, 949, 253, 23104, 275, 521, 24784, 15, 187, 187, 3, 15953, 937, 703, 753, 15, 346, 42, 1353, 275, 247, 12315, 449, 187, 187, 3, 39, 34828, 434, 247, 345, 12898, 1946, 40889, 937, 344, 753, 15, 1500, 7320, 779, 8003, 13, 616, 29434, 19496, 272, 2366, 247, 1643, 2069, 1919, 597, 1119, 616, 31482, 15, 187, 187, 3, 1328, 1364, 1158, 309, 1353, 1128, 1737, 858, 309, 1333, 281, 779, 32, 795, 510, 954, 794, 309, 1849, 1128, 64, 1737, 271, 347, 14989, 2181, 281, 1128, 530, 18068, 15, 309, 816, 3524, 309, 1904, 626, 15005, 368, 937, 703, 753, 372, 6499, 314, 15, 1500, 3589, 626, 2819, 387, 779, 13, 574, 617, 2927, 4229, 327, 247, 787, 10274, 1708, 1066, 253, 8281, 15, 187, 187, 1328, 11898, 521, 1481, 42210, 15, 346, 4527, 2282, 417, 15, 9018, 449, 187, 187, 3, 42, 4282, 604, 309, 1833, 2455, 452, 1633, 4722, 281, 1333, 969, 449, 187, 187, 3, 1394, 1472, 1146, 1512, 1892, 327, 4834, 937, 344, 753, 15, 187, 187, 3, 1394, 1472, 21927, 839, 479, 449, 1500, 27858, 617, 7351, 1475, 617, 4430, 15, 346, 42, 651, 5159, 323, 247, 19555, 449, 733, 369, 247, 8803, 703, 1871, 391, 17263, 598, 672, 597, 4395, 281, 14890, 13, 2167, 703, 1871, 1677, 352, 598, 672, 703, 1871, 12759, 12821, 342, 42167, 285, 369, 20965, 1776, 1335, 13, 1223, 703, 369, 5988, 14, 26449, 48055, 15, 346, 18291, 1529, 6149, 314, 11284, 326, 651, 25711, 1361, 281, 1978, 479, 44419, 13, 285, 2568, 3255, 187, 187, 3, 1231, 1472, 417, 6149, 314, 865, 344, 2546, 15, 346, 5072, 285, 253, 6838, 865, 187, 187, 3, 510, 6838, 285, 309, 937, 703, 15045, 15, 346, 2302, 15, 1422, 1472, 1162, 1568, 267, 15, 2752, 540, 606, 917, 3253, 449, 187, 187, 510, 3908, 4455, 1097, 16088, 18109, 285, 26007, 613, 1598, 8872, 15, 187, 187, 3039, 597, 7244, 1728, 13, 344, 39752, 253, 1790, 350, 1223, 2398, 1031, 79, 2427, 281, 2451, 327, 42167, 15, 754, 1160, 247, 4564, 273, 36150, 10379, 285, 39018, 37105, 13, 8958, 326, 2398, 1031, 79, 8715, 626, 22186, 1199, 387, 253, 3128, 15, 2091, 344, 3982, 731, 281, 616, 14098, 13, 2398, 1031, 79, 369, 15929, 48055, 13, 5877, 617, 275, 581, 4430, 1223, 253, 643, 1133, 26098, 3104, 598, 285, 1066, 42167, 434, 896, 1128, 56, 423, 90, 13, 665, 369, 38871, 275, 253, 9187, 536, 273, 2398, 1031, 79, 434, 12267, 13, 14578, 11617, 15, 1244, 627, 703, 369, 13, 521, 4475, 13, 1728, 969, 13, 896, 342, 617, 18740, 13, 21517, 432, 1907, 281, 878, 13102, 15249, 617, 6242, 281, 253, 13052, 273, 38711, 15, 1500, 5439, 617, 2927, 281, 779, 285, 344, 33153, 387, 253, 15746, 15, 187, 187, 3, 17304, 309, 871, 604, 309, 574, 20971, 5895, 865, 703, 2546, 779, 13, 269, 31041, 1066, 387, 5972, 15, 346, 9917, 13, 42167, 3198, 281, 320, 4391, 604, 368, 1053, 626, 2564, 449, 187, 187, 3726, 651, 10280, 352, 323, 1107, 281, 1705, 275, 2069, 273, 1213, 1074, 27, 795, 783, 954, 794, 309, 1849, 2455, 574, 3333, 187, 187, 4, 32204, 427, 7570, 187, 187, 55, 16900, 12659, 13, 432, 617, 1897, 347, 247, 6195, 22853, 13, 253, 4086, 273, 523, 1946, 342, 247, 4653, 20565, 27, 1481, 352, 745, 387, 253, 1509, 285, 352, 812, 3464, 17096, 1561, 634, 1453, 15, 831, 369, 253, 2746, 703, 369, 3192, 323, 616, 8955, 342, 10354, 1240, 15, 12429, 369, 7462, 600, 7514, 670, 352, 28, 344, 1313, 1046, 3748, 4283, 598, 281, 253, 7237, 342, 271, 795, 6723, 368, 2119, 368, 971, 281, 513, 326, 64, 1007, 13, 253, 2238, 273, 1007, 326, 753, 13, 795, 42, 1353, 417, 1469, 281, 3523, 368, 533, 760, 984, 309, 1871, 2581, 368, 3523, 4834, 3333, 1198, 436, 1921, 13, 12162, 342, 253, 8955, 671, 3534, 617, 247, 2176, 13212, 13, 326, 1429, 763, 7435, 14, 5658, 9317, 1246, 275, 954, 36659, 13, 253, 2916, 6656, 27354, 281, 513, 1633, 3365, 984, 634, 5938, 1904, 626, 971, 368, 281, 15, 187, 187, 2512, 369, 642, 46463, 7241, 323, 849, 281, 9569, 634, 42289, 1428, 1429, 281, 634, 5938, 13, 390, 323, 849, 281, 9569, 779, 281, 253, 2151, 368, 1871, 574, 327, 4096, 13, 253, 2151, 368, 1871, 1620, 1677, 247, 1273, 1869, 281, 7562, 15, 1893, 48055, 6960, 22534, 1128, 15160, 531, 10490, 22534, 13, 1904, 626, 597, 32, 1128, 395, 1160, 2119, 627, 369, 271, 24904, 6186, 273, 8995, 327, 1133, 323, 5972, 285, 12429, 13, 285, 703, 5544, 281, 18059, 1595, 285, 19173, 13, 347, 1682, 703, 812, 13, 326, 5870, 2210, 275, 512, 4948, 13, 326, 703, 1871, 644, 247, 1027, 1436, 15342, 1107, 3622, 13, 326, 703, 1904, 626, 1014 ]
—did his dad own a pincushion? One that looked like a tomato, like Marilyn's?—he was aware of a hot disgrace swirling around in his belly. How odd that his delight over his new daughter, his healthy growing family, could exist in such close proximity to the sorrow his father had been living with for years. What an asshole he was for avoiding this day, for trying to deprive his dad of one of the few bright spots in his life. He felt a rough hand on his shoulder: his father, behind him. "You're doing just fine," he said, and he sounded fatherly in a way that he normally didn't, and David felt like a teenager again, he and Marilyn just a couple of fumbling know-nothings, entrusted with two babies, ignorant of all the ways that life could go wrong. "Your girls are very lucky," Richard added, and David just nodded because he couldn't bring himself to speak. Dinner was a single turkey thigh split between two people, a table with two place settings, a pumpkin pie whose leftovers would be eaten for four subsequent days. "She'll go down for a nap soon," David said as he cleared the table. "Should we throw the ball around for a while?" His dad looked surprised, pleased. He nodded. "I'd like that." * * * — His wife was a good actress. He watched her, across the room in a showy three-story neoclassical belonging to the dean of the medical school, Violet wrapped against her chest in a sling, swaying slightly from left to right, sipping modestly from a glass of red wine, smiling in a way that was at once sleepy and beatific as she said, "I just love being a mom. It's the most fun I've ever had." He begged to differ. At home, she seemed skittish and miserable and crazy, cooing maniacally to either baby or hand-washing bibs and onesies with the demented ferocity of an old-world Italian grandmother. She slept hard and fast, in short bursts, in a way that seemed both deeply unhealthy and innately functional—he did the same thing, working so much that he could no longer distinguish a Tuesday from a Friday, dusk from dawn. She came to visit him at school sometimes with the babies, and she accepted the hugs he gave her like a junkie, clung to him like Velcro and didn't let go until he did. It always pained him a little to pull away from her. She was talking to one of his professors, a neurologist in his forties. He wasn't sure what version of her Dr. Fletcher was seeing—the charming, beautiful, confident woman who made him feel protective and jealous? Or the sleep-deprived, hormonally flimsy, unoccupied housewife who had the audacity to say things like _It's the most fun I've ever had_? "High praise," his teacher said, and David felt an immediate stab of pity for his wife. She was still so young and looked it suddenly. He could see her façade starting to buckle, and he excused himself from a circle of classmates and went to her, touching the small of her back. "Just hearing about the joys of new parenthood," Dr. Fletcher said, smiling in a way that might have been mocking—mocking Marilyn? His wife looked at him with something like desperation: _please don't sell me out, not in front of all these people; I know I was crying in the shower this morning but please just play along._ "It's the most gratifying, terrifying, wonderful thing in the world," David said, unusually flowery, and Marilyn smiled at him, leaned back into his hand. "Do you have children?" she asked Dr. Fletcher. Wendy was at home being minded by a neighbor; Violet was ten weeks old and too young to be left with a sitter; it had seemed like too much to bring both girls, but he knew that Marilyn felt Wendy's absence like a phantom limb. "God, no," the doctor said. "I always thought it would be unfair, given the hours I keep." Marilyn flushed; David watched her. "But hey," Dr. Fletcher said. "Some people make it work." "Indeed," David said. The doctor leaned in conspiratorially. "I'd advise you guys to stop at two, though. Corrigan's got four kids and he can barely stay upright." He nodded over to one of David's supervisors at the hospital, who was standing beside a woman David presumed to be his wife, both of them looking like the walking dead, wide-eyed and used up, their defeated bodies slouched away from each other. _"Four?"_ He cupped his hand more firmly around his wife's hip. "Fell asleep standing up during an appendectomy last week," Dr. Fletcher said as Marilyn excused herself. He couldn't tell what it meant when she squeezed his hand and slipped away. She was quiet on the way home. "Nice house, huh?" he asked as they walked across the lighted bridge over the river. "I didn't realize there _were_ houses like that around here." Immediately he realized he was opening a door he'd worked hard to barricade closed. "Yes, such a far cry from our neighborhood," she said, lifting her hand to shield Violet's sleeping face from the passing headlights. Their corner of Iowa City was on the run-down side but it was quiet; there was a park a few blocks from the house where she could take the girls. It was warm and safe. He bristled, but before he could take offense she reached for his arm, wove hers through the bend in his elbow. "Sorry," she said. "I'm in a mood." "Fletcher's a condescending asshole," he said. She pulled him closer, their hips bumping together a few times until they found their stride. "He must think I'm— What did I say to him? _The most fun I've—_ What an asinine thing to— Ugh. I just hope I didn't embarrass you," she said dejectedly. She wasn't looking at him, had her eyes fixed on a blinking light down the river. He shook his head vigorously. "Of course not. Never." "I wonder if I'll ever have something interesting to say again." "You're being too hard on yourself," he said. "You're placating me." She swung her bag around her arm. "I would kill for a cigarette." It was a habit she'd ramped up when they moved to Iowa, though she'd given it up when she'd gotten pregnant with Wendy and was abstaining still, while she was breast-feeding Violet. "Yet another earthly pleasure that would arguably help to keep me sane, and yet..." "We're not earthly?" he asked. "Me and the girls?" "The girls and I," she corrected. "No. You're ethereal. My intangible everything." The statement seemed both incredibly romantic and unbearably sad. When they arrived home, he dispatched the sitter while Marilyn went to check on Wendy. He made a couple of peanut butter and jelly sandwiches, knowing that Marilyn hadn't eaten much at the party. When he brought them to their bedroom, Marilyn was nursing Violet, holding her in one arm while the other hand traced lines up and down Wendy's back—Wendy, who was curled in the crook of Marilyn's knee, breathing deeply. And there she was, his wife, home again, back with her babies, freed from having to needlessly justify her existence to the likes of Fletcher. She raised her eyes to him and he weakened at the knees. "Would I know if I had mastitis?" she asked him, frowning down at herself. "Also, Wendy needs to be changed if you don't mind." They would repeat it for years to come in times of strife: _the most fun I've ever had._ # CHAPTER NINE Violet remembered, from her days as a litigator, the rule of contending with a PR scandal: head it off at the pass and it could remain thereafter within your control. This was the approach she was taking for their dinner with Jonah. Matt was gravely concerned about it; he met every mention leading up to the evening with an _Are you sure you want to do that_ look, the kind of look that said, _I'm not going to stop you but only because I'd rather you stop yourself._ For this reason, proceeding with the dinner also gave her a certain satisfaction, that childish fuck-you logic present in most marriages, the contrarian impulse to do something simply because your husband didn't want you to. There was no extant protocol for how to introduce your relinquished child to your husband, or for how to introduce him to the children you'd had on purpose, the children you'd never given a second thought to keeping. So Violet ordered pizza—everyone liked pizza, didn't they?—and made sure there was an ample supply of wine on hand for herself and Matt, and she explained to Wyatt and Eli, as best she could, that families came in all forms, that she'd been a different person fifteen years ago, that she didn't even
[ 1457, 2816, 3228, 13, 27062, 187, 659, 15, 26456, 20496, 6554, 13, 1457, 2816, 3228, 13, 18471, 187, 473, 20957, 6822, 285, 611, 482, 73, 482, 3227, 27498, 13, 10916, 311, 21362, 13, 22085, 13, 27698, 1253, 39134, 187, 3973, 4731, 1747, 1050, 6412, 313, 28211, 33641, 13, 1457, 8911, 10, 187, 18671, 17729, 4568, 5527, 3315, 302, 5003, 14912, 13, 5003, 14912, 13, 5002, 13, 33531, 187, 8742, 9757, 8170, 11397, 13, 46827, 8742, 9757, 13, 5002, 13, 32921, 187, 20176, 2418, 27314, 13, 15915, 13, 20176, 13, 32921, 187, 3313, 11417, 273, 13416, 16790, 13, 5041, 13, 399, 15, 36, 904, 32921, 187, 10718, 9224, 13, 253, 17709, 16790, 13, 399, 357, 2191, 6696, 13, 285, 643, 13790, 9195, 323, 253, 5002, 6516, 273, 10784, 313, 4218, 17556, 582, 17231, 324, 6736, 13, 5002, 13, 32921, 187, 1879, 33040, 3995, 273, 253, 416, 561, 2034, 66, 254, 8273, 273, 37349, 13, 32698, 13, 1457, 2816, 13, 33287, 1253, 746, 1348, 187, 31465, 4383, 24496, 266, 6412, 13, 4255, 8072, 23041, 4412, 13, 10188, 22165, 13, 14614, 13, 32921, 187, 45817, 6516, 13, 2499, 273, 8068, 13, 8068, 13, 11545, 13, 26237, 29145, 13, 6312, 275, 31039, 407, 253, 24193, 5882, 273, 2552, 398, 19995, 708, 38881, 15, 187, 10916, 311, 21362, 11032, 273, 3975, 13, 10916, 311, 21362, 13, 22085, 13, 26237, 33287, 13, 6312, 31687, 407, 11366, 466, 38881, 15, 187, 2828, 6412, 45374, 30103, 13, 21034, 3423, 21706, 13, 11314, 13, 31610, 1253, 746, 1619, 15, 187, 20718, 29565, 36479, 390, 7088, 73, 489, 29565, 36479, 13, 17231, 324, 6736, 13, 5002, 13, 31687, 187, 8182, 5801, 88, 2284, 313, 373, 1435, 273, 253, 14176, 273, 253, 36943, 273, 22085, 582, 10916, 311, 21362, 13, 22085, 13, 31687, 1253, 746, 1717, 313, 47954, 407, 11366, 466, 38881, 481, 187, 330, 15, 20037, 254, 16790, 13, 10916, 311, 21362, 13, 22085, 13, 6312, 31039, 407, 11366, 466, 38881, 15, 187, 3995, 273, 15887, 411, 15, 8966, 13, 12529, 257, 29572, 13, 41431, 274, 498, 1648, 49983, 13, 1457, 2816, 187, 17698, 434, 12318, 8273, 346, 4257, 6696, 995, 27709, 2499, 13, 1457, 28093, 13, 20973, 13, 4158, 7318, 15, 32921, 13, 4270, 1501, 18256, 4087, 187, 187, 4941, 209, 187, 16927, 187, 187, 36, 22644, 187, 187, 21950, 11106, 12593, 187, 187, 11389, 4361, 187, 20554, 13, 7727, 15, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 15, 11988, 13, 14070, 27, 20695, 5687, 13, 11299, 323, 253, 22717, 1546, 9541, 6807, 15, 1269, 2886, 559, 32047, 7266, 9944, 21640, 33954, 13, 20314, 20561, 13, 3605, 15, 2490, 17353, 4584, 13, 8444, 13680, 13, 1407, 15, 2726, 2505, 407, 14089, 2205, 7634, 83, 13651, 13, 26378, 16026, 330, 3358, 13, 6086, 9545, 1771, 40019, 13, 8652, 5405, 6595, 13, 285, 330, 15, 15197, 16156, 15, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 27, 22717, 285, 10718, 273, 6676, 15118, 15, 1457, 2816, 27, 5687, 273, 253, 2448, 6516, 273, 22717, 84, 13, 3690, 904, 31610, 15, 313, 6802, 83, 565, 13, 1457, 2816, 27, 12073, 8040, 80, 5687, 13, 14828, 15, 964, 10, 187, 18059, 620, 466, 13, 416, 4182, 15, 21804, 3358, 7088, 73, 489, 27, 3032, 7813, 285, 2213, 9440, 35052, 15, 1457, 2816, 27, 411, 15, 411, 15, 34909, 708, 6487, 13, 5215, 15, 187, 187, 7504, 4859, 15267, 21804, 3358, 443, 2921, 1261, 263, 7088, 73, 489, 27934, 21780, 285, 9380, 13, 49325, 1253, 16134, 15, 7518, 69, 407, 253, 4487, 273, 24440, 723, 708, 23728, 13, 329, 635, 22717, 1546, 708, 25913, 15118, 11397, 13, 12746, 2499, 15, 187, 6412, 273, 659, 15, 26456, 20496, 6554, 313, 4257, 2816, 13, 427, 15, 58, 2698, 27934, 21780, 13, 36754, 1253, 746, 1619, 15, 7518, 69, 407, 253, 4487, 273, 24440, 723, 708, 23728, 13, 329, 635, 22717, 1546, 708, 25913, 15118, 11397, 13, 12746, 2499, 15, 187, 2828, 6412, 45374, 30103, 13, 21034, 3423, 21706, 13, 16432, 187, 15650, 2892, 273, 14469, 5041, 275, 37783, 187, 659, 15, 2516, 434, 10643, 47441, 6412, 13, 4255, 43839, 13, 20973, 187, 24216, 11405, 254, 1108, 21804, 3358, 443, 15, 7088, 73, 489, 187, 11376, 253, 3313, 11417, 273, 13416, 16790, 13, 5041, 13, 399, 15, 36, 15, 187, 743, 1219, 24656, 273, 33245, 34174, 12800, 407, 21804, 3358, 7088, 73, 489, 13, 2130, 275, 2120, 2505, 285, 342, 2120, 21282, 494, 3239, 3888, 275, 253, 2499, 273, 7758, 16132, 47304, 187, 7379, 10206, 2448, 41486, 8, 17061, 378, 527, 723, 27, 21804, 3358, 7088, 73, 489, 1744, 187, 1413, 27, 1093, 2090, 10782, 187, 1413, 27, 746, 1348, 8923, 187, 1413, 27, 7878, 3532, 406, 14407, 474, 38446, 187, 1413, 27, 11796, 7659, 80, 38446, 187, 1413, 27, 40, 837, 280, 3555, 2401, 38446, 187, 1413, 27, 32086, 280, 382, 38446, 187, 1413, 27, 10818, 20478, 3555, 2401, 38446, 187, 1413, 27, 29520, 44435, 3555, 2401, 38446, 187, 1413, 27, 29520, 3555, 2401, 38446, 187, 1413, 27, 7878, 10038, 49431, 474, 38446, 187, 1413, 27, 18551, 5671, 84, 273, 5798, 742, 83, 932, 187, 1413, 27, 18551, 5671, 84, 432, 5002, 187, 1413, 27, 18551, 5671, 84, 432, 1457, 2816, 3228, 187, 1413, 27, 39, 3827, 84, 273, 253, 2448, 6516, 273, 22717, 84, 187, 1413, 27, 24774, 2399, 66, 4913, 313, 19346, 14912, 10, 187, 1413, 27, 746, 394, 14, 9888, 2448, 38446, 187, 1413, 27, 938, 394, 14, 9888, 2448, 38446, 18, 15, 7327, 273, 253, 14723, 187, 510, 1246, 3688, 7033, 281, 247, 7534, 6981, 285, 247, 7534, 6981, 6576, 15, 187, 16621, 10888, 13, 18124, 1975, 13, 5793, 285, 1142, 643, 12277, 403, 1146, 2684, 1046, 1388, 275, 30684, 15, 3900, 247, 10665, 2408, 273, 4116, 556, 10748, 644, 4845, 327, 824, 7534, 894, 6981, 272, 323, 7497, 13, 436, 310, 671, 320, 7552, 625, 1774, 275, 253, 1673, 273, 5893, 15519, 285, 6296, 4444, 3275, 3839, 15, 187, 34, 9086, 26441, 2561, 2170, 275, 16775, 310, 253, 1263, 273, 894, 6437, 14, 3372, 395, 6355, 4795, 275, 894, 14, 39765, 18438, 285, 894, 14, 3992, 15921, 3560, 407, 6774, 894, 10346, 15, 380, 638, 14, 1844, 16241, 281, 811, 423, 13151, 10346, 273, 2176, 894, 3104, 715, 4375, 273, 5066, 310, 43527, 281, 253, 1263, 273, 10142, 6578, 15, 831, 476, 320, 13366, 10405, 1701, 347, 894, 2685, 285, 14572, 13, 246, 7851, 272, 285, 5743, 273, 38481, 10185, 534, 310, 247, 2234, 8981, 3213, 13, 14170, 281, 253, 14335, 22056, 3066, 10564, 2899, 968, 285, 4720, 811, 423, 13151, 10346, 390, 1073, 7760, 6090, 15, 12526, 13, 281, 3522, 13, 954, 273, 253, 6981, 5609, 403, 417, 3782, 5547, 323, 253, 1263, 273, 841, 6297, 15, 19728, 13, 253, 5020, 273, 2175, 7668, 894, 14572, 285, 47351, 5802, 7842, 5263, 452, 4981, 1701, 26802, 2718, 10646, 894, 2685, 285, 19707, 4073, 403, 6537, 4981, 2182, 40674, 29131, 15, 6102, 7313, 403, 20793, 407, 247, 1180, 273, 2616, 15, 35346, 13, 253, 4103, 1781, 49821, 2313, 14620, 10, 1979, 273, 253, 2629, 5253, 1729, 408, 3927, 7787, 253, 13424, 7370, 447, 281, 253, 19561, 2494, 26954, 4811, 15, 32216, 13, 824, 2175, 476, 760, 320, 4981, 1701, 281, 1263, 2014, 990, 14, 10801, 285, 2550, 320, 4981, 1701, 281, 9186, 894, 10165, 275, 10346, 15, 12245, 314, 13, 5748, 22939, 569, 2905, 281, 253, 19474, 12087, 273, 253, 5253, 26802, 7118, 2701, 3924, 14, 4919, 275, 5999, 313, 5996, 14, 11097, 318, 10, 1783, 273, 253, 14036, 5289, 313, 36824, 375, 30166, 285, 25345, 8094, 481, 6610, 285, 954, 15538, 13, 253, 7312, 8310, 9894, 7027, 875, 608, 1253, 1229, 2909, 323, 14572, 4679, 15, 8057, 254, 2175, 403, 2424, 281, 1263, 6774, 44922, 5018, 327, 14335, 285, 16162, 4315, 22056, 15, 496, 436, 2743, 13, 2175, 12600, 281, 253, 2538, 273, 32038, 1100, 452, 8127, 644, 3710, 281, 7842, 5263, 327, 15921, 6437, 22056, 285, 452, 417, 644, 6508, 281, 253, 1263, 273, 894, 44922, 15, 1198, 1650, 13, 2173, 32038, 1100, 452, 644, 2011, 281, 10808, 14572, 5263, 342, 8655, 4865, 273, 21420, 281, 9276, 2300, 14, 18, 13, 5010, 1929, 347, 3437, 3439, 15, 187, 13349, 1574, 7607, 5609, 323, 894, 15921, 390, 4865, 12277, 6388, 253, 3302, 14037, 273, 247, 2553, 273, 247, 2813, 342, 247, 6605, 13, 5431, 247, 2601, 15, 15993, 403, 17063, 4830, 253, 6605, 285, 4136, 281, 16359, 15, 11977, 253, 29116, 273, 253, 1341, 13, 253, 2813, 310, 4845, 327, 247, 12220, 3924, 387, 5345, 3272, 330, 904, 534, 310, 7660, 281, 271, 28483, 17199, 323, 5304, 1783, 13, 390, 31506, 281, 247, 1462, 14, 21636, 12220, 3924, 285, 10005, 273, 894, 4865, 476, 320, 10141, 387, 11508, 342, 253, 28483, 17199, 15, 380, 7467, 273, 841, 12277, 778, 320, 12848, 7293, 327, 253, 894, 1386, 285, 4327, 273, 5390, 18438, 15, 11977, 894, 15921, 13, 1959, 1341, 778, 320, 11974, 1977, 285, 247, 6774, 894, 1385, 778, 320, 4824, 562, 15, 187, 8430, 841, 3082, 2085, 441, 342, 10020, 14, 17149, 6716, 1491, 5001, 247, 894, 1511, 434, 15430, 323, 247, 1798, 5390, 18438, 13, 627, 310, 642, 2969, 1332, 323, 11745, 1894, 5837, 273, 4865, 390, 3082, 17690, 247, 16707, 1263, 273, 894, 14572, 13, 253, 40409, 9232, 407, 253, 5390, 18438, 285, 6774, 14170, 15, 5488, 13, 1480, 2175, 273, 2544, 275, 894, 15448, 13, 894, 3116, 285, 19183, 2544, 2550, 320, 2530, 4354, 342, 841, 5609, 1580, 13, 8925, 253, 24273, 273, 14170, 285, 4795, 21418, 2544, 4419, 2709, 37221, 4679, 1146, 15626, 387, 1027, 2069, 15, 187, 19, 15, 11451, 273, 13036, 3975, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 27043, 13, 9913, 313, 4678, 25083, 1162, 355, 10, 8631, 247, 4228, 6981, 534, 19235, 1057, 417, 452, 667, 8180, 273, 894, 2685, 285, 14572, 15, 187, 510, 3745, 273, 308, 14, 13101, 19682, 275, 253, 2614, 4963, 281, 29534, 281, 253, 43427, 13, 5234, 281, 247, 1733, 587, 13466, 285, 34165, 949, 253, 14335, 3828, 310, 25048, 347, 247, 3309, 8284, 323, 253, 3576, 275, 8427, 4866, 390, 347, 352, 310, 4536, 6289, 281, 13, 22003, 273, 2173, 36329, 749, 14, 43221, 15, 9849, 874, 12277, 403, 2218, 275, 5019, 342, 14170, 12277, 1580, 1563, 15921, 28, 1341, 403, 3264, 281, 5234, 281, 253, 1733, 587, 13466, 15, 9849, 874, 12277, 403, 7515, 407, 26230, 253, 4313, 273, 1341, 17362, 18314, 30554, 33289, 3658, 285, 253, 4702, 273, 1484, 1658, 24322, 313, 24210, 273, 253, 28417, 8105, 481, 2596, 273, 253, 2201, 23797, 273, 436, 285, 253, 2045, 15921, 12277, 310, 253, 38307, 2216, 313, 18227, 14329, 19459, 285, 2709, 973, 23462, 582, 534, 1057, 417, 387, 512, 28788, 253, 275, 8427, 4112, 15, 187, 510, 954, 7744, 908, 894, 811, 78, 15037, 6981, 310, 247, 7321, 773, 35384, 3354, 9320, 668, 6981, 824, 347, 2529, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 36554, 13, 33964, 313, 28246, 328, 1162, 355, 481, 831, 8687, 18005, 253, 14270, 273, 247, 10671, 273, 1341, 949, 247, 39375, 11303, 6384, 762, 253, 4833, 273, 247, 44146, 1595, 974, 386, 13, 17415, 390, 894, 14, 13472, 15, 3856, 253, 9080, 273, 253, 39375, 2324, 403, 1679, 685, 253, 9080, 273, 253, 1341, 762, 5839, 13, 824, 326, 253, 1341, 1364, 22403, 3746, 275, 1340, 281, 29684, 949, 253, 36331, 7624, 26736, 271, 24760, 281, 253, 811, 423, 13151, 10346, 273, 1341, 275, 13424, 5989, 15, 7243, 1341, 403, 17063, 4830, 253, 6384, 13, 253, 9320, 476, 320, 10729, 323, 11508, 689, 673, 387, 247, 7470, 3276, 13, 3798, 5345, 3272, 15, 11977, 436, 13, 253, 5004, 9320, 390, 7285, 1930, 273, 253, 1755, 9320, 778, 320, 15626, 323, 1341, 326, 452, 29172, 949, 253, 39375, 11303, 6384, 15, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 577, 13, 49416, 13, 30768, 313, 8469, 343, 4297, 261, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 25676, 13, 38464, 313, 8620, 6481, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 19044, 13, 40666, 313, 8620, 6481, 1162, 355, 582, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 42389, 13, 27865, 313, 45074, 1162, 355, 10, 285, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 39855, 13, 28315, 313, 53, 348, 8500, 10, 403, 6867 ]
New York City, 1917 St. Vincent Ferrer, New York City, 1920 Oahu College and Kamehameha Schools, Honolulu, Hawaii, 1915–1920 First Congregational Church (Montclair, New Jersey) Marine Corps Recruit Depot San Diego, San Diego, California, 1921 Los Angeles Central Library, Downtown Los Angeles, California, 1924 Nebraska State Capitol, Lincoln, Nebraska, 1924 National Academy of Sciences Building, Washington, D.C., 1924 Master Plan, the Physics Building, Dabney Hall, and other campus buildings for the California Institute of Technology (Caltech), Pasadena, California, 1924 Fraternity House of the Rensselaer Society of Engineers, Troy, New York, 1922–1924 Trinity English Lutheran Church, West End Historic District, Fort Wayne, Indiana, 1924 Oriental Institute, University of Chicago, Chicago, Illinois, commissioned 1919, completed in 1931 by the successor firm of Mayers Murray & Phillip. Honolulu Museum of Art, Honolulu, Hawaii, commissioned 1922, completed 1927 by Hardie Phillip. Christ Church Cranbrook, Bloomfield Hills, Michigan, 1925–1928. Memorial Flagpole or Goodhue Flagpole, Pasadena, California, 1927 Lihiwai (residence of the governor of the Territory of Hawaii), Honolulu, Hawaii, 1927–1929 (completed by Hardie Phillip). C. Brewer Building, Honolulu, Hawaii, completed 1931 by Hardie Phillip. House of Philip W. Henry, Linden Circle, Briarcliff Manor, New York Wolf's Head Society "New Hall", Yale University, New Haven, Connecticut, designed ca. 1924, built posthumously References Notes Citations Works cited Further reading Oliver, Richard. Bertram Grosvenor Goodhue. Cambridge, Massachusetts: MIT Press, 1983 for the Architectural History Foundation. xii + 297 pp.; 146 illustrations, bibliography, index. Whitaker, Charles Harris, ed. With text by Hartley Burr Alexander, Ralph Adams Cram, George Ellery Hale, Lee Lawrie, and C. Howard Walker. Bertram Grosvenor Goodhue: Architect and Master of Many Arts. New York: Press of the American Institute of Architects, Inc., 1925. (Reprint, New York: Da Capo Press, 1976. .) Wyllie, Romy. Bertram Goodhue: His Life and Residential Architecture. New York: W. W. Norton & Company, 2007. External links Bertram Grosvenor Goodhue architectural drawings and papers, 1882–1980. Held by the Department of Drawings & Archives, Avery Architectural & Fine Arts Library, Columbia University. Church of St. Vincent Ferrer (New York, N.Y.) architectural drawings, 1908–1928. Held by the Department of Drawings & Archives, Avery Architectural & Fine Arts Library, Columbia University. Christ Church Cranbrook, Bloomfield Hills, MI Online history of Hotel Washington in Panama St. John's Episcopal Church, West Hartford, Connecticut Font Designer – Bertram G. Goodhue About the National Academy of Sciences Building, Washington, D.C. An Alphabet of Celebrities illustrated by Bertram Goodhue, available in full text and with full zoomable page images in the University of Florida Digital Collections UNCG American Publishers' Trade Bindings: Bertram Goodhue Category:1869 births Category:1924 deaths Category:American Neoclassical architects Category:Art Deco architects Category:Gothic Revival architects Category:Historicist architects Category:Mediterranean Revival architects Category:Spanish Colonial Revival architects Category:Spanish Revival architects Category:American ecclesiastical architects Category:Architects of cathedrals Category:Architects from California Category:Architects from New York City Category:Fellows of the American Institute of Architects Category:Balboa Park (San Diego) Category:19th-century American architects Category:20th-century American architects1. Field of the Invention The present invention relates to a biological assay and a biological assay apparatus. Biochemical, microbiological, chemical and many other assays are being performed every day in laboratories. While a considerable amount of attention has naturally been placed on such biological cell assaying for humans, this is also be becoming more important in the field of animal welfare and indeed plant production generally. A rapidly advancing research area in biology is the study of cell receptor-ligand interactions resulting in cell-substratum and cell-cell adhesion followed by subsequent cell migration. The pre-requisite to transendothelial migration of certain cell lines into sites of infection is paramount to the study of inflammatory diseases. This can be briefly summarised as cell flow and rolling, tethering and activation of integrin receptors which is a key recognition step, attachment to the endothelial ligands via activated integrins and finally transendothelial migration or diapedesis. Unfortunately, to date, most of the assay techniques are not particularly successful for the study of these mechanisms. Currently, the majority of studies involving cell rolling and chemokine induced cellular arrest have utilised capillary systems wherein cell flow and shear stress are controlled utilising syringe pumps. Such observations are constrained by a number of factors. Firstly, the relative large (>100 μm) size of the standard glass capillaries limits the physiological analogies to the proximal microvascular regions. Secondly, such studies can only be utilised to study single end-points and cannot be utilised to examine cell choices in migration. Thirdly, optical aberrations related to the spherical geometry of the glass capillary sections limit stage-related in situ (post-fixation) analysis of the intracellular structures (cytoskeleton and signalling molecules). Finally and most importantly, the usual observation periods lie between 5–30 minutes for rolling experiments. Longer studies are required to study subsequent crawling steps on endothelial and extracellular matrix ligands. In this regard, studies relating to the effects of chemokines have largely been limited to cellular arrest on adhesion receptor ligands and have not been extended to the study of cell crawling. For example, specific chemokines have been shown to induce rolling arrest with enhanced binding of lymphocytes to ICAM-1, otherwise known as CD54. Presently accepted techniques for cell adhesion or binding assays involve the initial coating of a surface of a device with a substrate, typically a protein. Cells are deposited onto the substrate and allowed to settle. Following the settling of the cells, the device is placed on a heating stage at 37° C., which is attached to an inverted microscope for visual analysis, or alternatively to a stand-alone heating stage and progression of cell binding can be checked at intervals with the inverted microscope. The duration of these assays may be varied depending on the cell line and choice of substratum. Following cell adhesion, free cells may be washed away and a subsequent cell count may be carried out. Although these methods provide us with semi-quantitative information regarding a cell type's affinity for a particular substratum, there is no simple method for quantitative characterisation of binding or methods enabling a prolonged study of cell rolling, the ensuing capture by the substratum and subsequent attachment. Furthermore, direct studies of changes in cell morphology, cell growth and biochemical changes cannot be provided easily with these techniques since, determining the kinetics of attachment and resulting morphological changes requires multiple replicated experiments being analysed at different times. 2. Description of Prior Art U.S. Pat. No. 5,998,160 (Berens et al) describes a static assay which unfortunately does not have any consideration of cell flow and rolling. The ability of T-cells circulating in the bloodstream to adhere to the endothelium, switch to a motile phenotype and penetrate through the endothelial layer is recognised as a necessary requirement for the effective in vivo movement or as it is sometimes referred to, trafficking of specific lymphocyte sub-populations. Motility assays are done in combination with attachment assays since following adhesion; cells are expected to switch to the motile phenotype. Motility assays are assessed by estimating the ratio of cells undergoing cytoskeletal rearrangements and the formation of uropods (extension of the trailing tail). One of the major disadvantages of this and the previous adhesion assays is the geometrical design (microscope slides and multiple well chambers), which does not at all resemble the in vivo situation. The most commonly used cell transmigration assay is a modified “Boyden chamber” assay such as described in U.S. Pat. No. 5,578,492 (Fedun et al). This involves assessing the crossing of a quantity of cells through a microporous membrane under the influence of a chemoattractant, recombinant or cell-derived. Here the diameter of the micropores are less than the diameter of the cells under investigation, such that the cells must deform themselves in order to squeeze through the pores thereby constructing an analogy to the transendothelial migration of cells in physiological circumstances. Once cells are deposited onto the membrane, the chamber can be incubated for intervals over time at a suitable temperature, usually 37°. Following this, the bottom chamber or opposite side of the top chamber may be analysed for cells that have squeezed through the microporous membrane. U.S. Pat. No. 4,912,057 (Guirguis et al), U.S. Pat. No. 5,284,753 (Goodwin et al), U.S. Pat. No. 5,302,515 (Goodwin et al), U.S. Pat. No. 5,514,555 (Springer et al) and U.S. Pat. No. 5,601,997 (Tchao) are typical
[ 1342, 13, 367, 1808, 4002, 11957, 423, 16758, 285, 18665, 13453, 4895, 323, 616, 9056, 7002, 13, 2626, 285, 1273, 12396, 15, 18665, 13453, 369, 1677, 253, 6061, 2030, 84, 13, 11957, 423, 16758, 369, 1677, 253, 6166, 2030, 84, 285, 2071, 607, 1342, 369, 275, 4179, 273, 253, 28818, 15, 380, 13688, 369, 309, 1473, 23022, 296, 1326, 66, 472, 353, 6594, 257, 13, 9022, 2149, 407, 11957, 423, 16758, 15, 187, 187, 2214, 253, 806, 313, 395, 4390, 760, 10, 673, 13, 247, 5963, 1160, 271, 440, 15189, 3061, 281, 13469, 616, 1211, 769, 15, 187, 187, 38547, 721, 313, 6622, 10, 187, 187, 24080, 2071, 607, 1342, 4895, 281, 253, 32721, 5370, 13, 1223, 367, 1808, 4002, 11957, 423, 16758, 285, 18665, 13453, 497, 7932, 407, 747, 16006, 309, 1473, 3094, 83, 285, 17467, 418, 2966, 292, 15, 418, 2966, 292, 369, 1677, 253, 28818, 13, 3094, 83, 369, 1677, 253, 6061, 2164, 84, 285, 2071, 607, 1342, 369, 275, 4179, 273, 253, 6166, 2164, 84, 15, 380, 13688, 369, 775, 1120, 257, 20055, 777, 399, 1369, 2061, 13, 9022, 2149, 407, 3094, 83, 15, 187, 187, 38547, 818, 313, 6759, 10, 187, 187, 510, 20117, 2952, 4895, 281, 253, 3236, 32721, 5370, 11253, 273, 7195, 2071, 607, 1342, 13, 418, 1758, 28962, 79, 285, 6235, 1796, 1563, 253, 7907, 980, 273, 309, 1473, 3094, 83, 285, 17467, 418, 2966, 292, 15, 6235, 1796, 574, 253, 6061, 3495, 84, 13, 28962, 79, 574, 253, 6166, 3495, 84, 285, 2071, 607, 1342, 369, 275, 4179, 273, 253, 28818, 15, 380, 20721, 497, 16358, 500, 284, 1222, 13, 9022, 2149, 407, 2071, 607, 1342, 15, 187, 187, 38547, 854, 313, 6620, 10, 187, 187, 24080, 2071, 607, 1342, 13, 6235, 1796, 285, 418, 1758, 28962, 79, 4895, 281, 253, 32721, 5370, 323, 616, 9056, 20117, 13, 10720, 285, 7002, 12396, 15, 6235, 1796, 369, 1677, 253, 1458, 14, 1423, 84, 13, 28962, 79, 369, 1677, 253, 6061, 3495, 84, 285, 2071, 607, 1342, 369, 1677, 253, 28818, 15, 6053, 13449, 23485, 369, 7932, 407, 608, 15526, 26703, 15, 380, 13688, 369, 4825, 300, 466, 41120, 13, 9022, 2149, 407, 6235, 1796, 15, 187, 187, 38547, 898, 313, 6961, 10, 187, 187, 24080, 2071, 607, 1342, 285, 6235, 1796, 588, 1091, 347, 16006, 323, 2952, 898, 2112, 342, 247, 747, 5963, 353, 5464, 12529, 4978, 665, 588, 8171, 418, 1758, 28962, 79, 15, 28962, 79, 753, 275, 253, 2457, 273, 2952, 854, 326, 703, 858, 417, 871, 604, 703, 651, 4035, 347, 247, 5963, 15, 41186, 3972, 77, 276, 6138, 327, 3436, 3978, 4104, 326, 703, 588, 417, 1091, 281, 3167, 15, 36104, 466, 12529, 70, 38713, 2352, 257, 588, 320, 253, 747, 3167, 15, 28962, 79, 6138, 327, 1458, 4163, 4104, 326, 703, 651, 417, 320, 10884, 347, 247, 5963, 15, 380, 20721, 497, 4825, 19276, 9022, 2149, 407, 6235, 1796, 15, 187, 187, 38547, 884, 313, 7132, 10, 187, 187, 24080, 2071, 607, 1342, 13, 353, 5464, 12529, 4978, 285, 6235, 1796, 7395, 512, 1091, 323, 18605, 884, 285, 36104, 466, 12529, 70, 588, 671, 1091, 347, 3167, 187, 2374, 4562, 3919, 4022, 50276, 262, 369, 6138, 326, 1594, 16090, 588, 1091, 323, 2952, 884, 275, 4240, 15, 733, 588, 3135, 327, 1884, 4565, 4022, 253, 13688, 369, 16905, 257, 427, 21796, 47973, 9022, 2149, 407, 6235, 1796, 15, 187, 187, 38547, 1903, 313, 7798, 10, 187, 187, 2374, 4562, 3919, 4240, 13, 352, 369, 6138, 407, 10710, 326, 1594, 16090, 588, 1091, 323, 2952, 1903, 275, 4765, 15, 36104, 466, 12529, 70, 38713, 2352, 257, 588, 1091, 281, 3167, 253, 921, 323, 253, 495, 5784, 673, 7195, 2071, 607, 1342, 285, 6235, 1796, 671, 4895, 285, 310, 7416, 407, 247, 747, 5963, 5003, 570, 6470, 297, 790, 257, 665, 588, 8171, 353, 5464, 12529, 4978, 15, 380, 411, 5338, 369, 13470, 327, 7565, 9022, 2149, 407, 7195, 2071, 607, 1342, 187, 187, 38547, 1249, 313, 9638, 10, 586, 187, 52, 1171, 466, 12529, 70, 38713, 2352, 257, 588, 1091, 281, 3167, 253, 921, 323, 253, 577, 394, 673, 7195, 2071, 607, 1342, 4895, 285, 310, 7416, 407, 247, 747, 16006, 5531, 8565, 285, 743, 6426, 296, 28133, 570, 665, 588, 8171, 6235, 1796, 285, 5003, 570, 6470, 297, 790, 257, 15, 380, 411, 5338, 369, 24131, 757, 611, 75, 5507, 8435, 1504, 9022, 2149, 407, 7195, 2071, 607, 1342, 187, 187, 38547, 2145, 313, 14952, 10, 187, 187, 24080, 2071, 607, 1342, 13, 5531, 8565, 285, 743, 6426, 296, 28133, 570, 7395, 512, 1091, 347, 16006, 323, 18605, 2145, 285, 36104, 466, 12529, 70, 37095, 735, 257, 671, 1091, 347, 3167, 323, 253, 608, 394, 673, 15, 187, 187, 2861, 287, 735, 90, 187, 510, 26304, 1594, 16090, 556, 644, 46581, 407, 3440, 6485, 285, 24773, 323, 380, 26304, 4878, 6433, 8, 7115, 313, 37, 507, 76, 4878, 24736, 1198, 45268, 10, 31419, 4696, 388, 7256, 75, 4448, 13, 665, 3916, 326, 253, 12712, 323, 11497, 275, 253, 921, 403, 16593, 327, 5014, 285, 2761, 2408, 281, 1151, 71, 3335, 281, 10710, 18, 313, 783, 5048, 2329, 272, 253, 921, 10, 14851, 326, 34510, 275, 253, 12712, 45035, 253, 5014, 428, 1880, 597, 1509, 253, 806, 3790, 390, 417, 428, 432, 9591, 390, 15299, 275, 667, 643, 12256, 2362, 323, 1264, 2607, 15, 754, 671, 7291, 3013, 326, 5014, 403, 26337, 281, 4288, 387, 616, 1211, 14247, 15, 187, 187, 35, 13589, 378, 14356, 484, 13, 6657, 273, 378, 21796, 570, 26839, 35626, 257, 13, 23159, 253, 26304, 1594, 16090, 323, 28248, 2151, 762, 1283, 281, 1029, 3473, 285, 4073, 13, 846, 12417, 1103, 4033, 5781, 1165, 324, 276, 376, 285, 308, 1136, 1370, 388, 518, 7588, 9377, 1066, 275, 12330, 1309, 253, 7002, 3153, 921, 273, 2952, 854, 15, 831, 369, 4516, 407, 35085, 2516, 388, 2018, 13, 347, 973, 347, 12417, 386, 22840, 309, 2967, 13, 665, 36790, 407, 417, 4645, 598, 281, 253, 512, 14, 37146, 4498, 1309, 253, 2457, 3153, 921, 15, 309, 2967, 4767, 326, 253, 18014, 497, 625, 6110, 275, 616, 12417, 1103, 4645, 616, 14021, 13, 2581, 685, 2403, 247, 12256, 921, 15, 3344, 15184, 693, 395, 38899, 1405, 13, 253, 15979, 8121, 327, 10710, 18, 13, 4767, 326, 512, 12417, 1103, 497, 10141, 407, 247, 35085, 281, 923, 604, 597, 497, 4944, 281, 6016, 253, 3473, 15, 187, 187, 14067, 436, 13, 253, 2962, 556, 6376, 3240, 4633, 1561, 253, 26304, 1345, 15, 187, 187, 4941, 187, 187, 7504, 4859, 2490, 50276, 57, 16090, 4422, 187, 187, 20990, 4698, 187, 1413, 27, 37, 9289, 6612, 7315, 2962, 187, 1413, 27, 46776, 2962, 407, 401, 2013, 386, 282, 313, 25610, 10, 187, 1413, 27, 8012, 26304, 7315, 2962, 11386, 84, 187, 1413, 27, 37, 9289, 7315, 2962, 1754, 327, 4782, 7315, 2962, 4, 654, 8428, 6740, 568, 3614, 1358, 29082, 15, 4305, 7555, 400, 83, 15, 3024, 16, 18068, 16, 348, 12049, 90, 14, 24925, 16, 348, 12049, 90, 14, 6443, 442, 1301, 471, 1131, 33, 264, 5830, 21, 66, 3680, 2537, 567, 28703, 70, 50246, 68, 5830, 2691, 33976, 1257, 66, 4148, 567, 3011, 1797, 453, 16, 30585, 16, 615, 925, 13046, 2146, 15, 8567, 3, 4871, 568, 2385, 3, 4898, 568, 2385, 5647, 544, 615, 925, 13046, 2146, 880, 3614, 1358, 348, 12049, 90, 15, 2061, 16, 24166, 16, 615, 925, 13046, 2146, 10, 35745, 187, 11244, 3366, 83, 13046, 2146, 281, 809, 22194, 634, 2862, 1892, 4446, 13, 390, 2060, 4367, 15, 831, 8566, 285, 18001, 7464, 2898, 8525, 20483, 7864, 285, 47283, 1237, 1873, 2718, 15, 4888, 187, 14, 3366, 83, 15349, 4555, 752, 368, 971, 190, 187, 14, 28481, 285, 46251, 190, 187, 14, 3631, 514, 285, 18001, 190, 187, 14, 47875, 4446, 3711, 190, 187, 14, 22637, 3366, 22194, 190, 187, 14, 3366, 83, 15349, 1959, 2317, 190, 187, 14, 41827, 8263, 809, 83, 15349, 318, 190, 187, 14, 1621, 2647, 752, 634, 7925, 14018, 310, 13, 3366, 83, 13046, 2146, 16544, 634, 3448, 15, 733, 4390, 8525, 7652, 11515, 15, 4888, 187, 817, 30454, 32032, 4888, 187, 14, 2634, 16, 11244, 7761, 45408, 65, 428, 897, 985, 32099, 323, 253, 5673, 13, 407, 4284, 4383, 32099, 310, 873, 15, 4888, 187, 16698, 27, 2634, 348, 16856, 3334, 809, 83, 13046, 2146, 1969, 12928, 13357, 11244, 7761, 45408, 20397, 2379, 34, 346, 32514, 3, 353, 2843, 37873, 434, 9237, 27, 1083, 1304, 285, 2159, 2278, 273, 253, 6239, 15, 187, 46, 2843, 37873, 434, 9237, 310, 247, 28296, 13, 1327, 14, 23258, 3516, 6191, 351, 19278, 48723, 2330, 342, 2709, 546, 348, 857, 409, 284, 285, 846, 690, 1107, 11704, 407, 7492, 24091, 4921, 15, 844, 6266, 247, 7520, 1083, 273, 346, 32514, 3, 353, 2843, 37873, 434, 9237, 275, 247, 5976, 14, 2913, 14, 744, 3416, 665, 556, 9606, 432, 2709, 7492, 24091, 4921, 323, 253, 1390, 2164, 1107, 15, 380, 1390, 767, 1107, 703, 19375, 323, 27770, 3075, 15, 34257, 35187, 32608, 280, 8368, 2692, 10969, 4342, 275, 253, 1669, 9039, 1351, 267, 5961, 15, 380, 35187, 49792, 13, 8188, 1497, 285, 40102, 4342, 4950, 2709, 546, 348, 857, 409, 284, 13, 594, 253, 6120, 369, 4391, 715, 353, 2843, 37873, 434, 9237, 15, 2732, 581, 807, 13, 253, 1669, 9039, 1351, 267, 5961, 2692, 34886, 681, 255, 528, 9261, 15, 38954, 327, 253, 5122, 273, 9953, 273, 10150, 2814, 12382, 894, 9827, 407, 851, 2610, 280, 3527, 15, 187, 2374, 253, 3720, 273, 776, 2175, 13, 359, 7525, 326, 12875, 310, 247, 13741, 12634, 273, 9827, 273, 13507, 1341, 15, 844, 452, 5183, 326, 253, 37486, 5755, 273, 367, 2648, 21, 14, 1370, 267, 51, 13507, 11048, 476, 320, 8069, 3777, 1563, 5445, 273, 253, 1341, 281, 12875, 15, 831, 310, 18289, 247, 906, 273, 9827, 273, 253, 13507, 1341, 281, 25450, 15502, 3855, 280, 13335, 15, 1723, 13, 1014, 846, 2067, 3618, 273, 5445, 281, 12875, 13, 627, 4558, 275, 253, 4466, 247, 749, 30957, 273, 440, 28514, 13507, 1341, 15, 380, 1921, 2139, 841, 1341, 513, 417, 22629, 275, 253, 3361, 273, 12875, 310, 4390, 762, 5839, 15, 844, 452, 671, 6012, 407, 35239, 1971, 285, 47957, 5438, 13507, 1341, 326, 1891, 281, 3794, 281, 12875, 15, 46296, 25488, 403, 326, 841, 1341, 452, 3663, 253, 5350, 281, 22629, 672, 12021, 281, 643, 49373, 534, 23278, 9827, 273, 253, 17087, 13507, 1341, 15, 831, 310, 271, 1774, 8310, 1580, 253, 15396, 497, 4236, 760, 407, 616, 3480, 273, 2380, 281, 12875, 15, 16513, 253, 17087, 1341, 13, 534, 452, 4942, 1781, 8322, 273, 416, 2925, 49, 13, 722, 14, 1341, 3176, 2057, 281, 3480, 416, 2925, 49, 390, 281, 7081, 271, 12059, 4865, 2601, 534, 556, 247, 10260, 3777, 15430, 323, 12875, 15, 2053, 7313, 403, 5185, 342, 253, 1859, 326, 690, 1159, 273, 253, 12875, 14, 51, 2925, 49, 2570, 310, 4619, 275, 253, 3425, 273, 3394, 4283, 281, 9827, 273, 13507, 1341, 15, 1723, 13, 2007, 2175, 403, 2424, 1078, 359, 476, 5100, 253, 31376, 273, 436, 10419, 15, 844, 403, 21654, 15686, 1880, 253, 1268, 285, 16, 263, 1159, 273, 12875, 14, 51, 2925, 49, 12872, 275, 1341, 432, 253, 13507, 3104, 7117, 275, 22454, 337, 476, 5513, 616, 11962, 37725, 281, 22629, 15, 688, 3332, 1107, 13, 323, 7236, 5141, 390, 9286, 3678, 5141, 13, 271, 2654, 1981, 3523, 2813, 323, 8356, 3523, 16, 36915, 271, 3948, 273, 247, 4958, 1309, 247, 3523, 273, 253, 4958, 323, 247, 4942, 2159, 673, 824, 347, 6179, 387, 247, 3523, 3243, 556, 644, 1691, 281, 8542, 897, 15, 1198, 1650, 13, 2556, 281, 247, 4958, 1907, 271, 2654, 1981, 3523, 2813, 10557, 275, 6692, 530, 12929, 33431, 11754, 11683, 20702, 1621, 15, 4748, 14, 1012, 41892, 13, 604, 247, 15910, 1617, 310, 10048, 13, 326, 310, 13, 604, 247, 23634, 310, 12293, 327, 1309, 247, 15153, 1375, 273, 253, 4958, 285, 253, 4958, 4916, 275, 247, 3523, 1375, 13, 271, 3948, 310, 8356, 6331, 13, 1223, 604, 271, 5743, 1617, 310, 10048, 13, 326, 310, 13, 604, 253, 23634, 310, 4439, 1309, 253, 3523, 273, 253, 3948, 13, 253, 3948, 310, 8356, 10564, 15, 10252, 1004, 14, 6820, 34241, 2544, 273, 247, 19561, 544, 21, 7510, 14, 21, 52, 62, 7368, 275, 8305, 67, 14, 881, 544, 24534, 7510, 12977, 22511, 511, 281, 4017, 253, 3939, 2670 ]
man, Pernille Rosendahl and Cutfather returned for their respective fourth, third and second seasons. Cutfather was given the Over 25s, Rosendahl was given the Under 25s and Blachman was in charge of the Groups. The winner was Ida Østergaard Madsen, mentored by Rosendahl. For the first (and currently only) time, a judge made an unforced decision to eliminate their own act. Season 6 (2013) Thomas Blachman returned to the judging panel, while Pernille Rosendahl and Cutfather were replaced by new judges Ida Corr and Anne Linnet. Linnet was given the Groups, Corr was given the Over 24s and Blachman was in charge of the Under 24s. The winner was Chresten Falck Damborg, mentored by Corr. Season 7 (2014) The seventh season returned to the original judging panel consisting of Thomas Blachman, Lina Rafn and Remee following the departures of Ida Corr and Anne Linnet. Remee had the Over 23s, Rafn had the Under 23s and Blachman was in charge of the Groups. The winners were Anthony Jasmin, mentored by Blachman. Season 8 (2015) Thomas Blachman, Remee and Lina Rafn returned to the judging panel for their respective seventh, fifth and fourth seasons. Remee was given the 15-22s, Rafn was given the Over 23s and Blachman was given the Groups. Superbootcamp was replaced by 5 Chair Challenge. The winner was Emilie Esther, mentored by Remee. Season 9 (2016) Thomas Blachman and Remee will return as judges for season 9 along with a new judge Mette Lindberg who will replace Lina Rafn. Rafn said in the final of season 8 that she did not know if she would continue as a judge. Eva Harlou announced on 26 June 2015 that she will not return to host. Sofie Linde Lauridsen will be the new host. Rafn announced on 15 July 2015 that she would not be returning as a judge. The winners were Embrace mentored by Remee. Season 10 (2017) Thomas Blachman, Mette Lindberg and Remee Will all return for Season 10 and Sofie Linde will also return as host On 31 March 2016 it was announced that X Factor will return for season 10 in 2017. It will begin on 30 December 2016 the winner was Morten Nørgaard mentored by Remee. Season 11 (2018) On 31 March 2017, it was announced by DR that X Factor will return for season 11 in 2018. Sofie Linde Lauridsen will return to host the show for the 3rd time Thomas Blachman and Remee also returned and is joined by a new judge Sanne Salomonsen who will replace Mette Lindberg. The Winner was Place on Earth mentored by Thomas Blachman Season 12 (2019) Sofie Linde Lauridsen will return to host the show for the 4th time Thomas Blachman returned and is joined by a new judges Oh Land and Ankerstjerne who will replace Remee and Sanne Salomonsen. The Winner was Kristian Kjærlund mentored by Thomas Blachman Season 13 (2020) Thomas Blachman, Oh Land and Ankerstjerne Will all return as judges for Season 13 and Sofie Linde Ingversen also return as host for the 5th time. Controversy The Danish X Factor has been criticised by music expert and consultant for The Danish Musicians' Association (Dansk Musiker Forbund) Mikael Højris, who claims that the contracts for participation in the show are unfair on participants and almost amount to serfdom to DR1 (the channel airing the show) stating that clauses in the contracts forbid the participants - whether they pass the first round or not - from performing or participating in any other musical event for three months. He also criticises that participants are obliged to travel at their own expense. Bente Boserup, leader of BørneTelefonen, criticized the Danish X Factor for exposing children under 18 to high pressure and stress, after contestants Baraa Qadoura and Tannaz Hakami broke down in tears during the fourth live show of season 8. This was supported by psychologist John Halse, as well as contestant Finn Irs, who protested by not showing up to the all-stars song during the final live show. Irs stated that the producers were more interested in their contestants showing their emotions, rather than making a musical show. Jan Lagermand Lundme, the contributing editor on DR1, stated that all contestants were checked by a psychologist to see if they were fit to handle the pressure. Despite this, the series has remained quite popular within the Danish public. References External links X Factor website Denmark Category:Danish reality television series Category:Television series by Fremantle (company) Category:2008 Danish television series debuts Category:Danish television series based on British television series# <img src="https://cdn.jsdelivr.net/gh/chocolatey-community/chocolatey-coreteampackages@edba4a5849ff756e767cba86641bea97ff5721fe/icons/defraggler.png" width="48" height="48"/> [defraggler](https://chocolatey.org/packages/defraggler) Use Defraggler to defrag your entire hard drive, or individual files. This compact and portable Windows application supports NTFS and FAT32 file systems. - Defragment exactly what you want - Safe and Secure - Compact and portable - Interactive drive map - Quick Defrag - Defragment free space - Scheduled defragmentation - No matter what your native tongue is, Defraggler speaks your language. It currently supports 43 languages. ## Package Parameters - `/UseSystemLocale` - use system locale for the interface, by default English locale is set. Example: `choco install defraggler --params "/UseSystemLocale"` A "reverse" Maffucci's syndrome: case report and short review of the literature. Maffucci's syndrome is a congenital, non-hereditary mesodermal dysplasia associated with multiple enchondromas and after some years accompanied by hemangiomas. We describe a rare case of "reverse" Maffucci's syndrome in a 42-year-old woman who has suffered from multiple hemangiomas for the last 24 years. The last two years she complained for heel pain. Bone scintigraphic examination showed abnormal findings in the left calcaneal bone. The scintigraphy, radiology and histology findings revealed multiple enchondromas, so the diagnosis was changed into Maffucci's syndrome. After one year, the left calcaneal bone showed sarcomatous transformation.Studies on the mechanism of induction of embryonal carcinoma cell differentiation by retinoic acid. On the basis of our studies, we conclude that RA is a potent promoter of differentiation of EC cells. We have demonstrated that the tumorigenicity of PCC4-azalR EC cultures can be effectively reduced following exposure of the cells to RA. This is presumably a result of differentiation of the EC cells to nontumorigenic derivatives. However, even after several weeks of exposure to RA, there remains in the culture a subpopulation of unresponsive EC cells. The reason why these cells do not differentiate in the presence of RA is currently under investigation. We have also derived by mutagen treatment and clonal selection EC cells that fail to respond to RA. Preliminary indications are that these cells have lost the capacity to differentiate when subjected to other manipulations which stimulate differentiation of the parental EC cells. This is an important observation since the mutants were selected only by their lack of response to RA. Unlike the parental cells, which have relatively large amounts of RABP, dif- cells appear either to lack RABP or to possess an altered binding protein which has a greatly reduced affinity for RA. These observations are consistent with the view that some function of the RA-RABP complex is critical in the sequence of events leading to differentiation of EC cells. However, further studies are required before we can establish the generality of this proposal. We are presently investigating whether the level and/or function of RA-RABP complexes in cells from the EC lines listed in TABLE 1 can explain their varying tendencies to differentiate.In recent years, for fuel reduction or exhaust gas reduction, an idling stop device for automatically stop/activate an engine of a vehicle during a stop of the vehicle for a relatively short time such as waiting at a stoplight has been put to practical use. For example, according to a vehicle having an idling stop device disclosed in Japanese Unexamined Patent Application Publication No. 2009-13953, if a stopping condition is satisfied, that is, if a brake is stepped on during a traveling state of the vehicle and the vehicle becomes in a stop state, an engine is automatically stopped, while if an activation condition is satisfied, that is, if the brake is released during the stop of the engine, the engine is automatically activated.Redox-dependent conformational changes of a proximal [4Fe-4S] cluster in Hyb-type [NiFe]-hydrogenase to protect the active site
[ 8207, 15, 14643, 2262, 187, 510, 23560, 6307, 310, 417, 247, 42283, 285, 33817, 4849, 273, 27722, 43295, 4803, 15, 733, 310, 247, 2570, 13341, 46526, 273, 5697, 15, 380, 9830, 285, 6127, 326, 403, 39239, 715, 697, 8067, 13398, 281, 25639, 285, 28432, 1016, 643, 13, 275, 1340, 281, 2794, 247, 2014, 440, 5411, 10014, 14, 783, 23720, 1971, 273, 25141, 285, 4832, 6619, 323, 689, 14, 67, 11180, 2348, 44226, 15, 496, 2509, 594, 13, 253, 29005, 875, 841, 16907, 16706, 16566, 452, 644, 16645, 285, 23284, 1025, 15, 13162, 13, 13927, 1903, 434, 2710, 10067, 943, 417, 320, 11575, 275, 12940, 15, 7820, 13, 616, 7914, 943, 4887, 253, 36039, 875, 512, 273, 697, 1027, 4243, 13, 594, 326, 253, 23560, 6307, 476, 10196, 347, 247, 18893, 2644, 15, 380, 4495, 1677, 281, 667, 581, 5110, 1364, 320, 5185, 342, 253, 5780, 10067, 273, 253, 23560, 6307, 15, 187, 2618, 15, 387, 898, 2090, 15, 187, 60, 938, 62, 50276, 8457, 642, 3565, 1304, 11704, 1903, 530, 15, 52, 15, 36, 15, 3015, 11334, 20, 13, 253, 14112, 2892, 4428, 760, 253, 7234, 1239, 715, 253, 30841, 18700, 15, 914, 33256, 13, 854, 2945, 401, 15, 19, 69, 387, 854, 3245, 295, 15, 495, 15, 2594, 39602, 29906, 904, 24687, 378, 15, 51, 15, 387, 25985, 313, 23705, 272, 326, 5749, 81, 62, 515, 486, 273, 3015, 11334, 20, 369, 417, 11704, 407, 247, 9353, 1304, 13, 285, 627, 310, 642, 3469, 494, 14112, 2892, 6788, 30841, 6860, 13, 2299, 13, 943, 320, 2017, 967, 432, 247, 26565, 15276, 8368, 273, 253, 5889, 285, 2605, 273, 11315, 2505, 285, 697, 2954, 281, 643, 4243, 273, 253, 6307, 13, 1293, 501, 12655, 281, 14112, 2892, 390, 643, 38988, 34253, 15, 2594, 8969, 1653, 13, 40783, 530, 15, 52, 15, 387, 36696, 13, 13278, 322, 15, 5229, 15, 721, 1731, 313, 28983, 326, 23851, 2426, 476, 320, 31637, 407, 14657, 19195, 347, 247, 2644, 558, 416, 2375, 4330, 1716, 1344, 904, 8676, 401, 15, 20, 69, 387, 884, 2526, 14, 2251, 313, 412, 1699, 326, 253, 4495, 273, 346, 19104, 3448, 3, 4419, 247, 26565, 8368, 273, 11315, 2505, 481, 8079, 13, 6798, 29271, 418, 8045, 5590, 273, 253, 1986, 2077, 2111, 273, 9892, 323, 253, 4412, 273, 12746, 6817, 2378, 2540, 326, 346, 5302, 14112, 2892, 281, 1089, 253, 4495, 273, 247, 6645, 310, 751, 2819, 562, 387, 271, 8446, 285, 34475, 281, 634, 3858, 449, 3506, 1216, 500, 15, 31419, 6156, 13, 21108, 285, 24207, 47654, 13, 3349, 322, 15, 5255, 15, 418, 15, 7498, 15, 26240, 13, 23512, 313, 14880, 481, 187, 60, 1797, 62, 50276, 12612, 38991, 9, 67, 10, 3400, 27, 187, 187, 2042, 253, 23052, 13, 762, 2593, 33933, 13, 36813, 13, 390, 35585, 273, 436, 4060, 13, 3400, 10599, 6055, 273, 253, 1600, 273, 247, 17051, 273, 247, 1750, 14049, 407, 247, 23480, 327, 2867, 273, 253, 16243, 285, 604, 13, 30812, 824, 6055, 13, 824, 29870, 556, 247, 1750, 1581, 494, 762, 19087, 313, 66, 2769, 18, 10, 273, 436, 2593, 14475, 432, 253, 3297, 273, 2250, 1411, 824, 2867, 762, 2593, 33933, 273, 436, 4060, 13, 432, 253, 897, 13, 7289, 390, 16959, 273, 824, 2867, 762, 2593, 36813, 273, 436, 4060, 13, 390, 432, 253, 18028, 273, 247, 23480, 762, 2593, 35585, 9, 69, 10, 273, 436, 4060, 13, 840, 824, 29870, 434, 1750, 762, 824, 19087, 3091, 452, 11674, 689, 1046, 643, 1750, 1581, 494, 762, 824, 19087, 15, 187, 883, 530, 15, 52, 15, 36, 15, 3015, 38991, 9, 67, 481, 187, 60, 1423, 62, 50276, 12612, 35585, 9, 68, 10, 3400, 27, 187, 187, 2042, 253, 23052, 310, 7591, 281, 4044, 440, 41480, 6152, 1581, 494, 762, 2593, 36629, 9, 67, 2769, 18, 10, 273, 436, 4060, 347, 271, 10656, 14247, 13, 253, 1302, 13, 846, 4366, 285, 247, 4854, 13, 778, 37015, 253, 13546, 273, 6152, 390, 253, 36967, 804, 273, 6735, 14716, 187, 9, 18, 10, 342, 11674, 689, 667, 390, 512, 10656, 12222, 273, 253, 2238, 7616, 275, 2593, 36629, 9, 67, 10, 390, 38991, 9, 67, 10, 273, 436, 4060, 28, 15, 964, 964, 964, 187, 883, 530, 15, 52, 15, 36, 15, 3015, 35585, 9, 68, 2769, 18, 481, 187, 60, 1508, 62, 50276, 12612, 11334, 21, 9, 70, 2769, 19, 10, 3054, 27, 187, 187, 6693, 7830, 323, 11585, 70, 5373, 2424, 281, 320, 1160, 1078, 247, 2098, 5783, 762, 2593, 11633, 26, 273, 436, 4060, 310, 3576, 556, 253, 3708, 273, 271, 4136, 10656, 14247, 347, 2530, 275, 2593, 36629, 273, 436, 4060, 15, 187, 883, 530, 15, 52, 15, 36, 15, 3015, 11334, 21, 9, 70, 2769, 19, 481, 346, 510, 6843, 3448, 285, 253, 14112, 2892, 273, 3015, 11334, 21, 1462, 275, 29274, 4499, 281, 253, 5928, 273, 667, 824, 3448, 275, 3015, 11334, 20, 15, 380, 958, 326, 5759, 4242, 281, 2486, 2074, 3448, 275, 3015, 11334, 20, 13, 534, 651, 452, 3562, 271, 25744, 323, 8993, 7830, 273, 667, 17575, 273, 544, 25831, 62, 5373, 1955, 762, 247, 12786, 26146, 4345, 13, 310, 1941, 326, 5759, 858, 417, 18607, 3015, 11334, 20, 281, 320, 13959, 432, 253, 4254, 273, 643, 7118, 273, 253, 6307, 13, 1690, 253, 23971, 873, 6593, 275, 3015, 38991, 9, 66, 33540, 19995, 2102, 316, 904, 9199, 378, 15, 51, 15, 387, 48962, 15, 187, 60, 1348, 62, 50276, 5035, 13, 299, 15, 72, 904, 36105, 362, 15, 1608, 360, 366, 13, 34312, 530, 15, 52, 15, 818, 3357, 13, 818, 3680, 13, 11633, 322, 15, 5229, 15, 374, 22232, 13, 12035, 418, 15, 3996, 15, 19, 69, 45502, 313, 13895, 10, 313, 2154, 1699, 5759, 8, 6860, 275, 34318, 6645, 407, 752, 369, 417, 753, 558, 11276, 362, 15, 8377, 15235, 708, 611, 1406, 91, 13, 36629, 530, 15, 52, 15, 721, 1839, 13, 721, 3079, 13, 11633, 322, 15, 5229, 15, 17601, 21, 13, 12643, 418, 15, 3996, 15, 19, 69, 22121, 313, 13895, 10, 313, 5302, 4016, 27570, 281, 4665, 13165, 6645, 558, 7902, 362, 15, 9067, 2418, 6022, 13, 28416, 530, 15, 52, 15, 10523, 13, 11422, 13, 11334, 322, 15, 5229, 15, 374, 8970, 13, 11343, 418, 15, 3996, 15, 19, 69, 9523, 313, 14209, 10, 313, 28983, 8453, 275, 3480, 273, 14112, 13005, 275, 6645, 481, 187, 60, 1099, 62, 50276, 510, 3286, 1302, 13891, 253, 13165, 1302, 434, 3061, 13, 4560, 326, 914, 33256, 13, 534, 369, 417, 958, 1230, 37651, 13, 369, 4865, 19440, 275, 253, 25164, 6817, 15, 1986, 19727, 26719, 273, 3052, 15, 362, 15, 10128, 3094, 2371, 839, 2434, 904, 10226, 18972, 374, 15148, 1235, 13, 475, 19, 313, 47, 15, 37, 15, 30779, 10226, 481, 187, 60, 1731, 62, 50276, 9604, 281, 22736, 434, 4386, 11817, 281, 253, 37510, 84, 273, 27120, 323, 253, 6037, 42743, 285, 7567, 10389, 3328, 25475, 10215, 46185, 13, 44764, 28241, 24136, 10215, 46185, 13, 285, 1847, 360, 1653, 285, 367, 5495, 8491, 1336, 3313, 367, 2452, 9224, 285, 5625, 19036, 10980, 13, 268, 15, 854, 13, 337, 15, 21, 14, 23, 15, 187, 60, 1630, 62, 50276, 35139, 15, 45, 15, 1621, 15, 2233, 14, 24257, 13, 12197, 6515, 15, 43385, 313, 14619, 481, 187, 60, 1619, 62, 50276, 52, 15, 6802, 15, 1621, 15, 2233, 14, 12115, 13, 387, 374, 313, 15089, 582, 45016, 275, 11513, 530, 15, 52, 15, 36, 15, 36, 15, 34, 15, 47, 15, 721, 3245, 13, 721, 3245, 15, 187, 60, 1717, 62, 50276, 34595, 13, 253, 5299, 6003, 310, 253, 346, 24463, 8612, 3, 275, 2219, 7668, 247, 12786, 26146, 4345, 15, 1903, 530, 15, 52, 15, 36, 15, 3015, 11334, 21, 9, 68, 2769, 18, 481, 187, 60, 1229, 62, 50276, 5035, 9253, 3877, 3495, 15, 187, 60, 2405, 62, 50276, 37226, 281, 10215, 46185, 8, 19371, 281, 22736, 434, 4386, 5342, 281, 27120, 13, 268, 15, 374, 13, 298, 15, 18, 15, 187, 60, 1237, 62, 50276, 1552, 3862, 5140, 273, 3015, 11334, 21, 9, 66, 18619, 84, 2505, 310, 5185, 342, 253, 14112, 2892, 273, 253, 6645, 15, 8907, 10840, 1621, 15, 2233, 14, 12115, 3054, 27, 187, 187, 510, 7039, 25153, 326, 690, 44226, 778, 2085, 11585, 70, 5373, 407, 15979, 275, 8956, 342, 247, 12786, 26146, 4345, 281, 4471, 10221, 254, 1786, 13, 15519, 13, 285, 20071, 5827, 15, 2053, 5827, 403, 4517, 8064, 4232, 285, 8838, 407, 625, 685, 581, 11169, 10376, 281, 581, 390, 625, 12786, 26146, 15486, 15, 37368, 281, 7671, 8183, 5373, 285, 5299, 5323, 13, 841, 5827, 403, 4858, 4320, 14429, 285, 403, 11966, 407, 5299, 14, 26454, 16431, 273, 39777, 323, 253, 11855, 5649, 273, 253, 2098, 5014, 285, 35029, 15, 1583, 403, 3839, 45311, 12718, 407, 11169, 9021, 13, 285, 247, 2957, 273, 824, 9021, 432, 667, 581, 11169, 843, 974, 84, 432, 247, 2098, 434, 3745, 281, 2075, 5373, 281, 253, 5014, 285, 35029, 273, 253, 2098, 347, 247, 2644, 15, 187, 9795, 603, 70, 5373, 2486, 9021, 390, 643, 2424, 10762, 281, 4471, 10221, 254, 5827, 323, 253, 6378, 2529, 275, 253, 6007, 15, 3813, 13, 253, 6095, 273, 322, 15, 45297, 4647, 281, 841, 5373, 16669, 15, 187, 52, 15, 6802, 15, 1621, 15, 2233, 14, 12115, 13, 387, 577, 313, 15089, 582, 45016, 275, 11513, 530, 15, 52, 15, 36, 15, 36, 15, 34, 15, 47, 15, 721, 3245, 13, 721, 2227, 14, 2691, 313, 18532, 2879, 481, 187, 1532, 187, 15834, 27, 686, 1231, 921, 326, 253, 47340, 2317, 310, 417, 247, 26860, 273, 253, 3196, 1626, 14, 2906, 1634, 251, 2317, 327, 253, 370, 79, 14595, 2910, 323, 667, 6486, 370, 79, 10506, 380, 4737, 310, 1754, 247, 11745, 5301, 273, 253, 17082, 5802, 407, 253, 23326, 8470, 8, 187, 7582, 27, 187, 14, 7727, 416, 3770, 4978, 187, 5564, 27, 686, 2513, 253, 47340, 11122, 247, 3277, 302, 850, 273, 370, 4877, 578, 79, 724, 5554, 187, 1532, 187, 187, 25343, 273, 253, 22195, 187, 27240, 187, 187, 1231, 588, 1908, 39306, 10295, 23326, 8470, 13, 416, 44, 8282, 457, 84, 13, 327, 253, 15254, 669, 1991, 92, 35, 1990, 79, 889, 6040, 393, 1991, 92, 36, 1990, 79, 41302, 370, 79, 30, 18, 13, 19, 22561, 61, 3259, 964, 5, 844, 4665, 669, 1991, 92, 36, 4799, 3259, 27324, 347, 253, 2317, 669, 437, 15892, 19, 3713, 1991, 92, 59, 2026, 12, 6580, 285, 669, 1991, 92, 35, 4799, 3259, 27324, 347, 697, 3943, 4023, 15, 187, 187, 1231, 403, 6110, 275, 669, 1588, 92, 37, 3303, 253, 47340, 2317, 13, 534, 8414, 273, 33592, 3470, 370, 71, 5, 2931, 327, 253, 3943, 7592, 669, 1991, 92, 35, 1990, 18, 889, 1991, 92, 30, 37, 41302, 370, 71, 9, 91, 7182, 2204, 247, 578, 79, 94, 91, 768, 79, 41302, 5222, 264, 970, 669, 1274, 61, 7994, 269, 61, 918, 61, 7994, 20940, 1588, 92, 37, 9496, 19, 7628, 2204, 313, 79, 12, 18, 1572, 1274, 61, 1748, 247, 578, 79, 889, 918, 61, 1748, 15892, 19, 34580, 380, 2317, 556, 247, 39306, 10295, 13, 370, 73, 578, 91, 41302, 323, 16344, 3470, 387, 370, 91, 12063, 1677, 407, 7010, 2043, 92, 2132, 94, 187, 73, 578, 91, 1603, 88, 10, 7196, 5977, 1124, 92, 18, 2704, 2009, 92, 91, 94, 88, 889, 2808, 393, 1124, 92, 18, 1217, 18, 2249, 2009, 92, 91, 94, 88, 5548, 1156, 92, 393, 748, 40965, 61, 9540, 470, 13, 187, 3353, 187, 15638, 18, 1337, 9315, 393, 1156, 464, 393, 393, 11153, 9315, 393, 1156, 464, 393, 393, 393, 393, 748, 40965, 30, 17, 61, 423, 92, 2132, 2138, 1231, 9173, 253, 12650, 34501, 407, 669, 8752, 92, 73, 578, 91, 599, 10506, 187, 187, 510, 643, 8470, 359, 1908, 403, 253, 3196, 1626, 14, 2906, 1634, 251, 8470, 13, 370, 4877, 578, 79, 2023, 18, 13, 19, 22561, 61, 3259, 964, 5, 380, 2317, 370, 4877, 578, 79, 724, 310, 253, 23326, 2317, 273, 33592, 3470, 327, 669, 1991, 92, 35, 1990, 79, 724, 534, 310, 2931, 407, 253, 39306, 10295, 370, 75, 578, 91, 8814, 79, 10392, 28, 323, 370, 91, 13, 88, 61, 249, 393, 1991, 92, 35, 1990, 79, 14640, 5, 75, 578, 91, 8814, 79, 14411, 88, 7182, 1124, 92, 18, 1217, 18, 2249, 1274, 61, 4841, 259, 13, 91, 61, 918, 61 ]
Ind.1989): The Bankruptcy Code is not a fragmented and disconnected collection of miscellaneous rules. It is a complex tapestry of ideas. The colors and patterns that are woven into its fabric combine to compliment and reinforce each other, in order to create a single unifying theme-the equitable treatment of creditors and financial relief for over-burdened debtors. In doing so, the tensions between these seemingly inconsistent objectives have been balanced and harmonized. Consequently, Title 11's various provisions should not be viewed in isolation. Instead, their interpretation should reflect the interplay between all of its different parts, so that the Bankruptcy Code can operate as a coherent whole. The meaning given to any one portion must be consistent with the remaining provisions of the Bankruptcy Code. Id. at 969. [20] Because no official report accompanied 11 U.S.C. § 1113, the legislative history contains only the statements read into the Congressional Record. Unimet, 842 F.2d at 883 n. 3. See Hoffman Bros., 173 B.R. at 182 (observing that "[p]assage of § 1113 was not accompanied by a committee report, and there is no dependable legislative history"). Congressional intent, however, should be divined from a rigorous intrinsic examination of the composition and structure of statutory text and its relationship to other parts of the Code, without resorting to legislative history or other extrinsic aids. See Timbers, 484 U.S. at 371, 108 S.Ct. 626 (finding that ambiguous terms can be clarified by viewing statutes as a whole); Rufener Constr., 53 F.3d at 1066-67 (opining that the meaning of "plain language" requires a rigorous examination of statutory text). Indeed, Judge Harold Leventhal of the United States Court of Appeals for the District of Columbia Circuit once observed that "using legislative history to find the meaning of a statute is like looking out at an audience and waving to your friends." Abner J. Mikva, Reading and Writing Statutes, 28 S. Tex. L.Rev. 181, 185 (1986). [21] Section 507(b) provides: If the trustee, under section 362, 363, or 364 of this title, provides adequate protection of the interest of a holder of a claim secured by a lien on property of the debtor and if, notwithstanding such protection, such creditor has a claim allowable under subsection (a)(1) of this section arising from the stay of action against such property under section 362 of this title, from the use, sale or lease of such property under section 363 of this title, or from the granting of a lien under section 364(d) of this title, then such creditor's claim under such subsection shall have priority over every other claim allowable under such subsection. 11 U.S.C. § 507(b). [22] Section 364(c) provides: If the trustee is unable to obtain unsecured credit allowable under section 503(b)(1) of this title as an administrative expense, the court, after notice and a hearing, may authorize the obtaining of credit or the incurring of debt — (1) with priority over any or all administrative expenses of the kind specified in section 503(b) or 507(b) of this title;. . . . 11 U.S.C. § 364(c)(1). [23] Section 1114(e)(2) states: Any payment for retiree benefits required to be made before a plan confirmed under section 1129 of this title is effective has the status of an allowed administrative expense as provided in section 503 of this title. 11 U.S.C. § 1114(e)(2). "The explicit language and the legislative history of § 1114 stand in stark contrast to the absence of any such language in § 1113. The fact that Congress failed to include similar language in § 1113, which would have created an exemption for immediate payment of any wages of [sic] benefits due under a collective bargaining agreement, is evidence that Congress did not intend § 1113 to be exempt from the operation of other sections of the Code, including the priorities set forth in § 507(a)." Murray Indus., 110 B.R. at 587. [24] See, e.g., Patterson v. Shumate, 504 U.S. 753, 758, 112 S.Ct. 2242, 119 L.Ed.2d 519 (1992) (divining Congress' intent in drafting statute by what was not said); Taylor v. Freeland & Kronz, 503 U.S. 638, 643, 112 S.Ct. 1644, 118 L.Ed.2d 280 (1992) (using negative implication to interpret bankruptcy statute); Johnson v. Home State Bank, 501 U.S. 78, 87, 111 S.Ct. 2150, 115 L.Ed.2d 66 (1991) (finding significance in lack of legislative specificity in statute). [25] The district court reversed the bankruptcy court's decision, finding that Unimet, which was not factually distinguishable, was binding precedent in the Sixth Circuit. United Steelworkers of Am. v. Ohio Corrugating Co., 1991 WL 213850, *2 (N.D.Ohio 1991). [26] Response to Debtor's Objections to the Proofs of Claims for the Airconditioning and Refrigeration Industry Trust Funds, Sheet Metal Workers Trust Funds, and Plumbers and Pipefitters National Pension Plan and International Training Fund, p. 8, 1.4-6. [27] Pub.L. No. 100-334, 102 Stat. 610 (1988). [28] S.Rep. No. 100-119, at 2 (1987), reprinted in 1988 U.S.C.C.A.N. 683, 683. [29] Generally, the labor organization is the "authorized representative" in cases involving a collective bargaining agreement. 11 U.S.C. § 1114(c)(1). [30] See supra note 23. [31] Reply to Trust Funds' Response to Debtor's Objection to Claims, p. 2, l.1. [32] This broad construction of § 1114(a)'s text is consistent with the legislative history of the statute. Senate Report No. 100-119 states: The Committee recognizes that some debtors may provide retiree benefits by contributing in accordance with a collective bargaining agreement to multiemployer health, welfare, and pension plans. These plans are trust funds established and maintained by more than one employer pursuant to one or more collective bargaining agreements. Pursuant to Federal employee benefits and labor laws, these plans are separate legal entities and are administered by labor-management boards of trustees for the exclusive benefit of the plan participants and beneficiaries. They are generally financed solely by employer contributions, and a loss of such contributions from any one employer detracts from a plan's ability to pay benefits to the participants and beneficiaries of the plan as a whole. Retiree benefits include contributions or other required payments to multiemployer plans for the purposes described in the bill. Therefore, the requirements of S. 548 apply to these benefits arrangements. S.Rep. No. 100-119, at 4 (1987), reprinted in 1988 U.S.C.C.A.N. 683, 685-86 (emphasis added). --- abstract: 'We show that the Dirichlet space is not a quotient of the Drury-Arveson space on the $n-$ball for any finite $n.$ The proof is based a quantitative comparison of the metrics induced by the Hilbert spaces' author: - Richard Rochberg title: 'Is the Dirichlet Space a Quotient of $DA_{n}$?' --- Statement of the Result ======================= We will consider reproducing kernel Hilbert spaces, RKHS’s, on the balls $\mathbb{B}^{n}\subset \mathbb{C}^{n},$ $n=1,2,...,\infty .$ We interpret $\mathbb{C}^{\infty }$ as the space $\ell ^{2}(\mathbb{Z}_{+})$ and $\mathbb{B}^{\infty }$ as its unit ball. We are interested in $\mathcal{D}$, the Dirichlet space, which consists of holomorphic functions $f$ defined on the unit disk $\mathbb{B}^{1}\mathbb{=D},$ $f(z)=\sum a_{n}z^{n},$ normed using $\left\Vert f\right\Vert _{\mathcal{D}}^{2}=\sum (n+1)\left\vert a_{n}\right\vert ^{2}.$ The space has a reproducing kernel, $h_{z},$ for evaluating functions at $z,$ given by$$\begin{aligned} h_{z}(w) &=&\frac{1}{\bar{z}w}\log \frac{1}{1-\bar{z}w},\text{ \ }zw\neq 0, \\ &=&1,\qquad \text{\ \ \ }\qquad \text{\ \ \ \ \ }zw=0\end{aligned}$$We denote the normalized kernels by $\widehat{h_{z}}.$ The other spaces we consider are the Drury-Arveson spaces, $DA_{n},1,2,...,\infty .$ The space $DA_{n}$ is the Hilbert space of holomorphic functions on $\mathbb{B}^{n}$ which is defined by the reproducing kernel $j_{z}^{(n)}$; for $z,w\in \mathbb{B}^{n},$$$j_{z}^{(n)}(w)=\frac{1}{1-\left\langle w,z\right\
[ 273, 19938, 13, 187, 395, 369, 2197, 281, 3060, 275, 1781, 13483, 323, 18722, 272, 13, 347, 352, 812, 187, 1257, 15613, 1520, 387, 512, 2069, 13, 285, 275, 11921, 13, 387, 247, 4376, 534, 13, 604, 417, 187, 676, 13, 369, 387, 1878, 10290, 13, 7296, 697, 7126, 3290, 13, 432, 187, 48273, 13, 835, 18213, 369, 20182, 60, 883, 1438, 1092, 285, 835, 352, 369, 30481, 187, 249, 4444, 569, 4447, 327, 4096, 13, 253, 5112, 285, 9883, 465, 693, 265, 497, 187, 290, 603, 314, 14454, 13, 347, 4620, 407, 247, 5112, 25245, 273, 1668, 3677, 41006, 187, 6421, 70, 14, 296, 25428, 27, 285, 436, 369, 253, 1083, 1199, 625, 342, 253, 5685, 13, 534, 13, 275, 187, 455, 5912, 13, 588, 1620, 1614, 281, 1270, 2395, 13, 2167, 690, 452, 187, 290, 27448, 247, 10214, 4743, 15, 187, 187, 48273, 13, 390, 1457, 11268, 13, 253, 3236, 2586, 273, 253, 820, 348, 460, 267, 13, 534, 187, 3418, 4620, 281, 320, 253, 13064, 4995, 273, 795, 39354, 11675, 14767, 883, 3593, 1092, 369, 6888, 407, 187, 783, 46544, 2196, 275, 1458, 1093, 285, 253, 1107, 1563, 15, 8452, 806, 25995, 436, 187, 34586, 7116, 3275, 13, 285, 1160, 352, 1929, 275, 3060, 13, 309, 452, 417, 644, 187, 494, 281, 9413, 15, 3808, 4138, 326, 253, 7925, 6691, 27441, 13, 1078, 597, 574, 187, 783, 30181, 42460, 273, 1146, 11580, 407, 253, 15600, 13, 497, 41061, 187, 3113, 820, 348, 460, 267, 13, 534, 597, 7091, 275, 13497, 616, 9910, 285, 187, 6421, 21228, 616, 14234, 60, 883, 3507, 2194, 533, 2571, 6558, 253, 10214, 60, 883, 3245, 1570, 187, 510, 46544, 2196, 13, 665, 574, 1048, 908, 465, 693, 265, 275, 616, 1211, 2586, 13, 812, 187, 1439, 1891, 3517, 281, 10018, 253, 34385, 273, 253, 2448, 28, 285, 309, 1089, 187, 1615, 4058, 30059, 13, 326, 253, 6963, 275, 253, 807, 1458, 1508, 6799, 281, 320, 8191, 407, 187, 36, 430, 16130, 13, 1880, 752, 344, 574, 644, 2183, 369, 2032, 13, 326, 465, 693, 265, 497, 281, 320, 187, 14541, 275, 11921, 275, 8987, 13, 285, 604, 597, 812, 13, 347, 369, 6326, 13, 320, 187, 17094, 342, 5750, 281, 11268, 15, 754, 9521, 779, 13, 943, 436, 1491, 187, 1257, 2032, 13, 281, 2075, 4116, 281, 352, 13, 285, 281, 2847, 731, 281, 320, 5728, 342, 187, 43886, 304, 566, 15, 831, 31142, 1364, 3517, 846, 452, 13207, 281, 320, 271, 1789, 187, 1171, 19938, 28, 323, 3262, 280, 5297, 472, 5391, 13, 665, 4962, 275, 1458, 2511, 13, 25957, 820, 348, 460, 267, 187, 35094, 253, 7774, 15613, 1520, 840, 407, 253, 30380, 273, 743, 7553, 47952, 432, 187, 49348, 60, 883, 2759, 1570, 380, 4444, 327, 534, 253, 5893, 4852, 13, 14125, 281, 253, 15443, 187, 64, 36, 514, 316, 7481, 285, 275, 8987, 310, 1925, 795, 79, 33929, 64, 390, 795, 85, 9821, 7481, 2167, 2067, 187, 26754, 273, 253, 1072, 2238, 1646, 281, 320, 28535, 4861, 762, 253, 6158, 1416, 15, 187, 4041, 3417, 310, 253, 795, 12535, 2084, 571, 7481, 534, 556, 2489, 24984, 275, 11268, 13, 187, 40086, 267, 13, 285, 9972, 13, 285, 534, 310, 417, 29967, 275, 776, 4759, 14, 24761, 15, 329, 187, 9815, 3417, 310, 253, 795, 1940, 27545, 408, 338, 3525, 4414, 473, 87, 728, 80, 60, 883, 2227, 62, 2529, 285, 187, 72, 1123, 8442, 273, 767, 9351, 273, 795, 85, 9821, 17540, 533, 273, 253, 820, 348, 460, 267, 344, 2789, 642, 187, 420, 279, 15, 754, 16544, 2299, 273, 271, 7126, 18722, 534, 253, 7108, 187, 35711, 432, 253, 9279, 13, 285, 4447, 715, 1355, 35195, 28, 533, 344, 16906, 187, 33635, 2510, 326, 344, 574, 2959, 642, 10501, 2395, 327, 436, 2256, 15, 187, 42, 17837, 9101, 326, 841, 35195, 497, 1160, 273, 820, 348, 460, 267, 28, 323, 187, 41, 1808, 24673, 2296, 326, 824, 497, 1160, 275, 521, 673, 15, 187, 187, 3378, 253, 806, 820, 348, 460, 267, 13, 247, 2032, 2395, 273, 253, 5133, 275, 534, 352, 369, 187, 21299, 1520, 1364, 452, 4925, 3060, 13, 285, 2489, 13644, 1929, 15, 5192, 21432, 187, 249, 1458, 1229, 13, 285, 4058, 30059, 275, 1668, 520, 13, 347, 973, 347, 36835, 285, 2571, 13, 3534, 187, 601, 2032, 285, 3426, 247, 5740, 273, 352, 13, 326, 253, 33671, 812, 187, 290, 1695, 642, 5545, 41006, 697, 6510, 15, 380, 1491, 273, 841, 187, 43355, 13, 2299, 13, 369, 2057, 28849, 390, 2783, 347, 3221, 13, 285, 187, 3431, 1065, 265, 20944, 1880, 820, 348, 460, 267, 369, 22392, 390, 35231, 13, 390, 253, 37408, 187, 263, 12922, 273, 2176, 6244, 15, 380, 9883, 1416, 795, 737, 3230, 7481, 1461, 8055, 342, 187, 64, 28859, 360, 7481, 778, 452, 1677, 6054, 281, 436, 12417, 28, 533, 627, 310, 417, 13, 187, 30875, 13, 275, 512, 3626, 2892, 247, 1127, 534, 476, 320, 594, 4751, 16481, 187, 484, 347, 436, 476, 407, 253, 954, 3807, 17290, 264, 6206, 15, 329, 13986, 1342, 13, 4907, 187, 23021, 348, 1528, 372, 18268, 316, 1026, 379, 13, 16337, 275, 247, 5948, 13, 432, 7946, 1491, 187, 248, 574, 2797, 275, 11268, 13, 326, 820, 348, 460, 267, 14278, 273, 1355, 5074, 15, 187, 8195, 1436, 13, 3692, 1416, 344, 556, 417, 1160, 1929, 13, 8838, 253, 187, 19657, 552, 342, 594, 1199, 4250, 285, 7217, 13, 326, 253, 12027, 387, 2978, 187, 1834, 275, 247, 701, 15, 18268, 316, 1026, 379, 6636, 247, 46544, 472, 13, 581, 273, 521, 3858, 13, 665, 187, 4238, 1469, 281, 8987, 13, 281, 29877, 323, 779, 275, 326, 2586, 10501, 187, 16314, 84, 273, 752, 344, 574, 16402, 15, 2053, 27947, 13, 17734, 5783, 275, 187, 22117, 1722, 1099, 13, 407, 253, 1302, 273, 8426, 275, 253, 2846, 273, 9422, 3008, 3525, 13, 275, 253, 187, 1208, 2205, 273, 473, 991, 20240, 13, 7244, 387, 26653, 275, 253, 25986, 273, 253, 807, 1722, 1731, 15, 187, 42, 452, 644, 8191, 326, 18268, 316, 1026, 379, 2220, 436, 1694, 10023, 273, 253, 2020, 187, 67, 37883, 13, 534, 37752, 281, 253, 2644, 2867, 273, 253, 48222, 28, 533, 326, 13, 187, 6438, 7562, 352, 247, 2176, 673, 13, 344, 969, 4895, 352, 13, 31985, 272, 760, 187, 783, 12222, 344, 574, 644, 387, 275, 15613, 981, 253, 1941, 13, 285, 275, 8479, 187, 262, 281, 320, 3863, 15, 733, 4447, 247, 1355, 17109, 41231, 4644, 13, 342, 253, 1563, 187, 5564, 13, 11462, 275, 2502, 4876, 27, 380, 9541, 273, 2434, 348, 460, 267, 13, 8058, 407, 187, 42996, 7177, 60, 883, 2691, 1570, 2053, 27947, 2197, 432, 1457, 11268, 403, 3542, 187, 249, 13986, 13, 5112, 13, 285, 9883, 15, 187, 187, 1147, 778, 320, 12450, 6326, 13, 326, 253, 1029, 12368, 358, 275, 534, 436, 187, 25307, 369, 2918, 651, 3517, 10808, 952, 281, 19072, 25755, 281, 187, 585, 3942, 841, 22392, 281, 643, 4343, 275, 1340, 281, 21876, 731, 15, 187, 1552, 253, 46544, 2196, 858, 1046, 2181, 275, 616, 1612, 281, 3657, 28, 285, 187, 1439, 22046, 253, 12147, 273, 253, 2097, 534, 597, 7091, 13, 9437, 187, 12796, 1160, 323, 326, 4096, 15, 2091, 19596, 5945, 13, 247, 26902, 273, 418, 2966, 5507, 316, 13, 187, 4238, 275, 3968, 13, 344, 2197, 281, 530, 793, 267, 13, 387, 253, 2748, 273, 326, 19651, 187, 19293, 382, 13, 247, 4444, 13, 342, 253, 22392, 2220, 352, 15, 380, 4444, 7244, 275, 187, 783, 807, 1722, 3208, 13, 672, 418, 2966, 5507, 316, 369, 9583, 342, 521, 30980, 15, 380, 15934, 4330, 13, 187, 10002, 369, 417, 41061, 342, 253, 3753, 273, 352, 13, 16481, 352, 432, 752, 344, 187, 24286, 2336, 1222, 13, 285, 23846, 352, 28, 594, 326, 418, 2966, 5507, 316, 13, 672, 344, 4895, 187, 4064, 521, 966, 13, 858, 417, 1089, 247, 2014, 13188, 9338, 15, 831, 26741, 13, 187, 4609, 344, 556, 5393, 275, 521, 4155, 66, 427, 4953, 5507, 13, 309, 369, 2183, 407, 2994, 15, 309, 187, 312, 2299, 273, 4743, 13, 326, 436, 369, 417, 253, 1524, 820, 348, 460, 267, 13, 533, 253, 187, 977, 2238, 13452, 273, 407, 28612, 49807, 28, 347, 253, 3438, 13, 2556, 281, 253, 187, 35261, 1491, 13, 476, 28438, 320, 15613, 1520, 1014, 342, 625, 18213, 187, 395, 14247, 685, 19596, 5945, 812, 1682, 319, 13, 285, 651, 10693, 1462, 824, 247, 187, 5056, 31192, 281, 253, 11186, 4811, 15, 380, 46541, 2238, 497, 2197, 432, 187, 43, 2902, 3737, 281, 5854, 13, 327, 253, 795, 12535, 2084, 571, 269, 23301, 2102, 3737, 7481, 534, 369, 23846, 407, 187, 42038, 60, 883, 2597, 1092, 533, 253, 22392, 858, 417, 3153, 1840, 1264, 390, 1740, 2607, 15, 187, 1044, 1321, 90, 13, 247, 2872, 5112, 3626, 382, 13, 3982, 253, 1524, 820, 348, 460, 267, 281, 659, 15, 187, 17004, 25864, 275, 253, 807, 1722, 2357, 13, 387, 594, 1199, 16466, 326, 344, 22828, 247, 1659, 187, 249, 253, 16172, 90, 27044, 273, 253, 3626, 382, 28, 533, 846, 521, 2471, 13, 534, 3517, 187, 25739, 264, 13, 253, 22392, 591, 1428, 949, 253, 1323, 274, 547, 390, 16355, 273, 521, 187, 12566, 641, 28, 285, 275, 326, 8930, 627, 403, 5293, 1024, 281, 320, 1119, 533, 253, 187, 1033, 21310, 2238, 60, 883, 2055, 1570, 187, 187, 42, 717, 21802, 281, 2868, 326, 253, 1445, 273, 19693, 465, 693, 265, 281, 18722, 247, 187, 1257, 35752, 2502, 10688, 369, 6888, 275, 253, 5791, 387, 247, 1077, 2393, 2180, 28, 187, 3529, 352, 369, 3517, 594, 1199, 5520, 347, 281, 34219, 1014, 253, 16639, 5651, 19445, 28, 187, 395, 326, 352, 9945, 281, 2847, 253, 1463, 19445, 281, 320, 387, 2978, 187, 357, 7541, 264, 15, 4325, 253, 19983, 2502, 36348, 1021, 311, 1070, 594, 1199, 407, 253, 25260, 187, 34782, 13, 285, 534, 13, 2556, 281, 253, 4743, 273, 6311, 42608, 13, 187, 12796, 1160, 432, 465, 693, 265, 13, 309, 3091, 417, 18875, 281, 519, 563, 336, 667, 27947, 13, 347, 187, 42, 717, 417, 41061, 342, 253, 45817, 11515, 281, 9186, 616, 187, 15793, 84, 342, 7200, 28, 533, 309, 452, 1119, 247, 10056, 275, 657, 412, 48218, 60, 883, 2511, 1092, 187, 4609, 3133, 281, 8600, 619, 24366, 1077, 14051, 15, 2064, 2488, 46210, 187, 316, 13, 326, 253, 6963, 273, 10400, 571, 2197, 281, 253, 26390, 329, 37281, 757, 13, 16280, 187, 977, 7774, 273, 1270, 1318, 13, 690, 25818, 5025, 17848, 13, 534, 369, 273, 247, 187, 25914, 2105, 3623, 285, 32950, 19445, 10688, 685, 667, 326, 574, 644, 2455, 187, 16564, 275, 253, 8370, 20986, 13, 285, 275, 5301, 273, 534, 512, 253, 643, 187, 13182, 713, 17848, 16332, 407, 253, 26390, 285, 253, 16901, 273, 253, 1302, 5420, 187, 69, 962, 285, 28290, 15, 496, 619, 4743, 13, 436, 17848, 13, 534, 369, 273, 247, 5389, 187, 13182, 713, 2502, 10688, 13, 369, 417, 17713, 264, 342, 253, 26375, 273, 253, 278, 459, 89, 13, 533, 187, 3113, 465, 693, 265, 15, 831, 2934, 369, 6296, 417, 2779, 281, 2826, 281, 253, 30396, 13, 187, 10002, 497, 41061, 760, 342, 253, 19445, 273, 253, 278, 459, 89, 13, 285, 665, 574, 187, 1417, 2793, 275, 253, 14635, 275, 2087, 685, 275, 326, 273, 687, 30690, 285, 187, 446, 37608, 13, 390, 665, 387, 667, 2281, 275, 326, 1675, 497, 18134, 281, 253, 187, 48, 5692, 932, 15, 380, 8370, 802, 468, 641, 4269, 436, 6326, 19445, 281, 320, 7799, 187, 1542, 275, 5427, 407, 253, 954, 7407, 277, 13356, 13, 665, 13, 417, 1146, 2104, 281, 1089, 187, 262, 13, 4895, 342, 247, 21248, 1304, 326, 253, 35030, 31534, 19445, 369, 187, 36008, 407, 253, 4444, 795, 31515, 895, 4414, 309, 717, 973, 6600, 13, 326, 690, 42608, 187, 9802, 6326, 326, 253, 795, 31515, 895, 64, 369, 776, 10279, 491, 60, 12115, 17, 1570, 388, 265, 3155, 3750, 13, 187, 35529, 13, 2296, 13, 1077, 13224, 314, 13, 326, 253, 795, 40728, 895, 64, 310, 417, 247, 4444, 13, 533, 187, 66, 2238, 273, 11111, 538, 1615, 5202, 534, 11026, 247, 18722, 751, 253, 795, 39354, 11675, 14767, 12115, 18, 1570, 380, 187, 30574, 277, 13356, 13, 4931, 13, 39124, 275, 9796, 273, 253, 278, 459, 89, 13, 1160, 326, 760, 187, 783, 1789, 273, 616 ]
of commerce, and was sent to Europe in large quantities for dyeing, as it could be procured at all times, and in abundance, at a price which, if not low, was at least moderate, considering its excellent quality, from Mexico, where labour was cheaper[1180], and where it was cultivated in plantations formed on purpose, the French and Spanish kermes were entirely forgotten, as appears by a French ordinance of 1671 respecting dye-stuffs: and this was the case much more with the German, which, in all probability, will never turn to great account, though some have entertained a contrary opinion. Mexico, or New Spain, the original country of the cochineal, which word appears to be the diminutive of _coccus_[1181], was discovered by the Spaniards in 1518 and the years following. Who first remarked this profitable production, and made it known in Europe, I have not been able to discover. Some assert that the native Mexicans, before they had the misfortune of being visited by the Christians, were acquainted with cochineal, which they employed in painting their houses and dyeing their clothing[1182]; but others maintain the contrary[1183]. The Spaniards, who had long used kermes in their own country, could not fail soon to observe the superiority of the American; and I find by Herrera, that the king in the year 1523 desired to be informed by Cortez, whether what he had been told was true, that kermes were to be found in abundance in Mexico, and if they could, as was supposed, be sent with advantage to Spain. He requested him, should this information be true, to pay attention to it, and to cause them to be collected with diligence. This commodity must soon after have begun to be an object of commerce; for Guicciardini, who died in 1589, mentions cochineal among the articles procured then by the merchants of Antwerp from Spain[1184]. The plant on which the animal lives, belongs to the genus _Cactus_, and in Mexico is called _nopal_ or _tuna_, though several plants of the same kind seem to be comprehended under the latter name. One species is the _Opuntia_, which has become indigenous in Spain, Portugal, and Italy, and which is not scarce in our green-houses. A second species is the _cochinillifera_. Oviedo[1185] described and gave figures of two kinds of _tuna_; but of the cochineal he makes no mention. He speaks however of an excellent dye which the Americans prepared from the fruit, and formed into small cakes; but he afterwards acknowledges that he had received no authentic account on this subject. I nevertheless suspect that these cakes were made of cochineal; for Hernandez says that such were made in his time. With the first cochineal, a true account of the manner in which it was procured must have reached Europe, and become publicly known. Acosta in 1530, and Herrera in 1601, as well as Hernandez and others, gave so true and complete a description of it, that the Europeans could entertain no doubt respecting its origin. The information of these authors, however, was either overlooked or considered as false, and disputes arose whether cochineal was insects or worms, or the berries or seeds of certain plants. The Spanish name _grana_, confounded with _granum_, may have given rise to this contest; but there is not, perhaps, in all natural history a point which can be so fully cleared up as this can by the most undoubted testimony. A Dutchman, named Melchior de Ruusscher, affirmed in a society, from oral information he had obtained in Spain, that cochineal consisted of small animals. Another person, whose name he has not made known, maintained the contrary with so much heat and violence, that the dispute at length ended in a bet. Ruusscher charged a Spaniard, one of his friends, who was going to Mexico, to procure for him in that country authentic proofs of what he had asserted. These proofs, legally confirmed in October 1725, by the court of justice in the city of Antiquera, in the valley of Oaxaca, arrived at Amsterdam in the autumn of the year 1726. I have been informed that Ruusscher upon this got possession of the sum betted, which amounted to the whole property of the loser; but that, after keeping it a certain time, he again returned it, deducting only the expenses he had been at in procuring the evidence, and in causing it to be published. It formed a small octavo volume, with the following title, printed in red letters: The History of Cochineal, proved by authentic documents[1186]. These proofs sent from New Spain are written in Dutch, French, and Spanish. It may be readily supposed, that the high esteem in which this production was held would soon induce people to endeavour to convey these insects to other countries in order to breed them. This the Spaniards did every thing in their power to prevent; and notwithstanding the severity of the means which they employed, attempts were made for that purpose. When Rolander, a scholar of Linnæus, was in America, he sent to Upsal, at the request of that celebrated naturalist, a plant, with the insects upon it. The plant arrived in the year 1756, when Linnæus was engaged with his pupils. The gardener, who was not acquainted with the nature of it, cleared it from what he thought vermin, and planted it; so that Linnæus, when he returned from his class, did not find a single insect alive. This circumstance, which he has mentioned in his Systema Naturæ, I was told by himself. I am however of opinion, that this was not the real cochineal, but the other kind spoken of by Sylvester; as the former, according to the latest information, can scarcely be procured even with more labour and expense than Rolander could bestow, and would hardly stand such a long voyage to the northern regions. The spurious kind were sent from Jamaica to England, on the _Opuntia ficus Indica_, which was planted by Miller[1187], but the insects did not live above three or four months. Thiery, a young French naturalist, brought the real cochineal to St. Domingo in the year 1777, at so much hazard that he deserves a place in the martyrology of the naturalist; but after his death, which soon followed, the insects perished through the avarice or negligence of his successors; and in that island there are none now to be found but the spurious kind[1188]. I am inclined to believe that the art of employing kermes to dye a beautiful red colour was discovered in the East at a very early period; that it was soon so much improved as to excel even the Tyrian purple; and that it contributed to cause the proper purple to be at length abandoned. From the costly red dyes extolled so much by the Hebrew writers, and which, according to the opinion of learned commentators, were made from kermes, I shall not venture to adduce any proofs, as I am not acquainted with the Oriental languages to examine their accounts with accuracy; but I have found a passage in Vopiscus[1189], which seems to render my conjecture very probable. That author informs us, that the king of Persia sent to the emperor Aurelian, besides other articles of great value, some woollen cloth, which was of a much costlier and brighter purple colour than any that had been ever seen in the Roman empire, and in comparison of which all the other purple cloth worn by the emperor and the ladies of the court appeared dull and faded. In my opinion, this cloth, which was of a beautiful purple red colour, was not dyed with the liquor of the murex, but with kermes. This idea was indeed not likely to occur to the Romans, who were acquainted only with the purple of the murex, and who had less experience in the arts in general than in that of robbing and plundering, or who at any rate in that respect were inferior to the Orientals. The Roman emperors caused this supposed purple to be sought for in India by the most experienced dyers, who, not being able to find it, returned with a vague report that the admired Persian purple was produced by the plant _Sandix_. I am well aware, that some commentators have supposed that the _Sandix_ was our madder[1190]. Hesychius, however, says, very confidently, that the _sandix_ is not a plant, but a kind of shrubby tree which yields a dye like the _coccus_[1191]. The Roman dyers, perhaps, prejudiced in favour of the murex, made that only the object of their
[ 187, 187, 50, 2338, 9170, 262, 1945, 272, 281, 35476, 13126, 2351, 187, 187, 1552, 310, 247, 13433, 3908, 13, 285, 581, 326, 3133, 4828, 565, 48714, 13, 533, 5119, 2296, 326, 253, 5962, 18053, 17830, 344, 11403, 275, 322, 4976, 84, 310, 1554, 262, 1945, 272, 15, 773, 3871, 24274, 5333, 8892, 1512, 2223, 13, 816, 33346, 14, 81, 543, 272, 949, 616, 1388, 13, 417, 2403, 667, 1524, 10254, 275, 581, 2170, 1806, 344, 11424, 15, 773, 20576, 13, 368, 943, 2972, 562, 673, 327, 253, 16832, 323, 2176, 1841, 835, 3253, 2010, 310, 6294, 1066, 1425, 187, 187, 15418, 3548, 457, 85, 3815, 275, 14851, 326, 1554, 262, 1945, 272, 310, 247, 3076, 2934, 13, 2057, 15, 5489, 432, 380, 2448, 49205, 7115, 2722, 326, 1554, 262, 1945, 272, 310, 31334, 285, 18860, 15, 2091, 12797, 9086, 875, 8892, 13, 627, 310, 2686, 247, 3998, 5778, 13, 390, 16653, 673, 15, 380, 5778, 310, 594, 1270, 326, 2561, 2722, 326, 2444, 10486, 327, 2570, 8892, 476, 1379, 598, 281, 3387, 6, 625, 673, 685, 816, 13654, 327, 581, 4836, 387, 247, 673, 15, 187, 187, 4769, 14589, 8069, 281, 28699, 4471, 14, 14605, 272, 310, 512, 670, 2403, 2119, 368, 16832, 3253, 15, 15204, 745, 673, 806, 2181, 275, 253, 4131, 281, 2770, 327, 752, 8213, 954, 15, 22460, 13, 326, 310, 634, 11091, 272, 5841, 15, 1310, 368, 23652, 907, 634, 2970, 275, 247, 5536, 4644, 273, 5841, 806, 2181, 368, 457, 620, 873, 253, 1388, 598, 323, 2323, 15, 2635, 1089, 673, 8336, 323, 512, 253, 643, 1774, 8892, 273, 253, 1388, 751, 11091, 2561, 13, 14991, 8892, 13, 285, 2712, 2010, 326, 4850, 13044, 634, 1039, 15, 187, 187, 28512, 3656, 21680, 285, 27529, 327, 1737, 6397, 1336, 187, 187, 11001, 262, 1945, 272, 778, 417, 320, 253, 1682, 2934, 13, 533, 6747, 310, 13654, 327, 2712, 643, 685, 634, 7342, 285, 253, 4712, 2424, 281, 2525, 731, 15, 6676, 322, 4976, 84, 2770, 327, 14401, 321, 13267, 84, 751, 3733, 747, 952, 13, 14991, 8892, 13, 390, 26169, 253, 3906, 13319, 3128, 1108, 285, 1223, 690, 273, 1110, 403, 3309, 390, 4217, 13, 597, 6403, 457, 85, 2970, 368, 667, 8003, 281, 16116, 634, 7342, 15, 187, 187, 2598, 752, 1057, 32, 31293, 634, 2554, 285, 634, 2136, 387, 247, 1268, 326, 14371, 634, 47168, 15, 773, 4045, 368, 871, 634, 3904, 285, 752, 352, 3936, 323, 368, 281, 320, 5547, 7721, 12325, 5119, 15, 773, 1276, 403, 253, 4712, 285, 253, 14800, 326, 368, 452, 281, 5115, 327, 247, 5312, 3720, 275, 1340, 281, 1056, 634, 3904, 7721, 187, 187, 15418, 23318, 247, 8166, 14, 3022, 2770, 327, 2970, 275, 634, 2425, 3904, 594, 16116, 634, 4736, 310, 512, 533, 16293, 15, 773, 3404, 247, 2169, 1268, 387, 253, 2567, 13, 368, 457, 250, 816, 627, 281, 7522, 275, 247, 1180, 327, 247, 43032, 273, 12165, 30219, 3058, 323, 253, 2567, 281, 4352, 253, 6224, 7342, 326, 1770, 390, 7150, 1806, 344, 2296, 15, 773, 2773, 457, 84, 253, 5004, 1386, 13, 285, 3253, 2010, 310, 816, 6046, 15, 7243, 368, 2624, 253, 6046, 13, 2770, 327, 8107, 14, 44602, 634, 7342, 285, 37625, 731, 1046, 1770, 1425, 187, 187, 15886, 272, 247, 3676, 789, 1375, 310, 670, 13654, 327, 247, 2014, 4836, 323, 271, 6508, 2180, 273, 673, 13, 1293, 940, 21680, 285, 762, 12680, 2770, 15, 24709, 673, 327, 634, 16832, 323, 841, 2304, 506, 790, 273, 789, 310, 4619, 13, 285, 841, 8336, 273, 673, 943, 320, 25860, 387, 512, 4815, 432, 12225, 13, 2675, 3420, 13, 14991, 8892, 13, 285, 643, 20126, 789, 15, 187, 187, 36599, 281, 12151, 1716, 735, 569, 187, 187, 6175, 3939, 11298, 7964, 556, 697, 1659, 13, 368, 457, 306, 671, 1694, 281, 4446, 253, 7827, 275, 247, 2173, 3884, 2584, 253, 7289, 15, 2091, 806, 11734, 253, 2395, 9165, 2554, 13, 322, 4976, 84, 5257, 281, 11182, 954, 342, 2686, 11196, 253, 2968, 15, 1916, 513, 594, 13, 368, 452, 281, 4446, 253, 7827, 13, 4715, 672, 281, 734, 720, 285, 849, 281, 3665, 3533, 281, 755, 253, 1491, 368, 878, 1223, 10486, 17227, 2136, 1318, 342, 634, 1885, 15, 187, 187, 15418, 11532, 326, 2509, 594, 35766, 4419, 2136, 913, 30090, 285, 275, 14, 16719, 4491, 3640, 15, 380, 1682, 1039, 281, 16270, 1110, 1841, 13, 9255, 432, 1524, 14, 10186, 2793, 13, 310, 281, 1263, 15, 5119, 5936, 13, 773, 4045, 3253, 368, 476, 281, 2489, 271, 6485, 275, 253, 4491, 368, 457, 250, 10156, 281, 15, 10718, 253, 30318, 285, 320, 271, 6485, 275, 253, 495, 14, 21, 1755, 42226, 594, 368, 476, 1691, 4834, 275, 616, 12682, 285, 1007, 387, 1841, 432, 616, 31460, 1425, 187, 187, 10758, 368, 476, 14588, 327, 1529, 1268, 342, 634, 11091, 285, 921, 368, 457, 250, 37289, 13, 352, 4916, 28596, 6927, 281, 9413, 3075, 2792, 13, 7568, 1318, 13, 285, 2810, 625, 13330, 15, 187, 187, 1909, 271, 322, 4976, 13, 247, 9436, 310, 2970, 247, 12165, 1421, 281, 271, 2395, 9165, 13, 271, 2395, 9165, 13, 533, 347, 271, 29946, 13, 368, 878, 281, 320, 2104, 281, 2810, 13330, 15, 2064, 4419, 767, 1841, 27, 187, 187, 27958, 3009, 273, 253, 4491, 13, 42226, 13, 285, 21607, 187, 187, 1909, 4351, 253, 987, 3533, 281, 7568, 281, 22087, 326, 368, 457, 250, 253, 987, 2900, 323, 731, 15, 187, 187, 10282, 327, 6684, 1110, 767, 6936, 275, 634, 18345, 673, 594, 368, 476, 921, 253, 29946, 7205, 326, 368, 457, 620, 320, 4704, 281, 4352, 253, 3216, 3515, 275, 634, 747, 2554, 15, 187, 187, 20108, 262, 907, 24709, 11055, 960, 2726, 2065, 282, 9681, 187, 187, 28749, 272, 16072, 943, 4459, 689, 281, 634, 6355, 342, 634, 11651, 13, 347, 973, 15, 3771, 751, 342, 22087, 13, 368, 452, 281, 7568, 1318, 15, 380, 3064, 310, 326, 672, 368, 457, 250, 2820, 281, 755, 15127, 13, 368, 457, 250, 10156, 634, 1318, 15, 9613, 4983, 667, 4572, 1232, 13, 368, 943, 2525, 342, 1046, 2395, 9165, 285, 6224, 7205, 368, 476, 281, 2096, 752, 597, 457, 250, 2819, 323, 15, 187, 187, 688, 253, 22849, 13, 2378, 368, 457, 306, 1313, 634, 7342, 323, 253, 1770, 13, 1007, 323, 4088, 281, 5100, 4834, 347, 247, 6657, 1561, 253, 322, 4976, 7811, 15, 21695, 6194, 643, 322, 4976, 84, 13, 390, 1113, 306, 562, 673, 281, 7278, 1885, 390, 4491, 3640, 281, 1056, 4834, 625, 273, 247, 7741, 281, 253, 2285, 15, 20930, 5300, 342, 634, 2285, 390, 634, 12145, 670, 253, 4491, 390, 6224, 21041, 15, 187, 187, 10758, 368, 1928, 368, 457, 250, 4704, 281, 1379, 253, 1735, 3213, 281, 2395, 9165, 13, 320, 17898, 670, 352, 15, 399, 8552, 9091, 342, 253, 29946, 7205, 15, 1281, 731, 871, 752, 634, 7342, 403, 13, 285, 752, 368, 3524, 281, 5115, 15, 187, 187, 3039, 368, 4720, 513, 755, 616, 4116, 13, 320, 2119, 281, 956, 5119, 457, 84, 4803, 323, 4572, 2323, 27, 187, 187, 5498, 457, 85, 3324, 598, 634, 28563, 342, 253, 2567, 15, 6865, 3548, 457, 85, 247, 1175, 15301, 273, 1880, 390, 417, 368, 457, 620, 320, 5547, 15, 733, 2506, 457, 85, 2647, 604, 368, 457, 306, 644, 271, 322, 4976, 323, 721, 2607, 390, 721, 1107, 13, 29946, 15071, 403, 2819, 323, 247, 1175, 8928, 4944, 13, 247, 1175, 2285, 4760, 13, 285, 3095, 665, 6057, 253, 4491, 13, 6057, 253, 35554, 13, 285, 476, 2810, 13330, 15, 187, 187, 26078, 327, 5015, 670, 752, 368, 457, 306, 4211, 275, 253, 2469, 13, 1014, 604, 352, 369, 387, 643, 4413, 13, 285, 1014, 604, 352, 3589, 457, 85, 387, 247, 2567, 387, 512, 313, 3022, 10156, 3226, 42513, 14268, 390, 18665, 1940, 36014, 275, 1029, 2143, 481, 10684, 368, 476, 823, 1318, 285, 2810, 13330, 15, 399, 8552, 634, 3540, 1924, 273, 16116, 7342, 347, 271, 322, 4976, 347, 973, 15, 6000, 1652, 2372, 273, 2793, 7729, 15, 187, 187, 20133, 634, 6224, 22020, 390, 11288, 1078, 368, 755, 253, 2628, 15, 1310, 368, 476, 29343, 253, 1445, 273, 22020, 272, 13, 1563, 598, 13, 6240, 1318, 13, 285, 687, 14650, 952, 275, 1078, 253, 4572, 13, 840, 352, 943, 320, 247, 642, 14, 21590, 254, 3061, 281, 8591, 368, 281, 2395, 9165, 15, 187, 187, 18933, 825, 253, 1071, 2199, 562, 273, 253, 5603, 15, 6676, 4413, 588, 452, 368, 1918, 247, 9759, 390, 1408, 247, 1071, 1078, 14312, 368, 15, 831, 310, 634, 4839, 281, 39361, 731, 13, 285, 368, 943, 1379, 5750, 15, 2325, 689, 35711, 285, 7569, 616, 33957, 745, 15, 187, 187, 24788, 1386, 27, 1265, 7824, 285, 5015, 751, 271, 2395, 9165, 1078, 368, 2489, 581, 604, 368, 7777, 971, 281, 30582, 634, 4572, 285, 22020, 15, 3166, 326, 13, 285, 368, 457, 620, 3553, 642, 5545, 275, 616, 2564, 326, 368, 17337, 253, 5107, 285, 403, 4704, 15, 187, 187, 38241, 253, 10243, 407, 26457, 272, 32705, 187, 187, 1394, 778, 671, 971, 281, 1908, 1469, 281, 1529, 2567, 15, 5489, 407, 43565, 2722, 326, 952, 403, 2628, 14, 1689, 2784, 625, 685, 2455, 13, 285, 4536, 352, 457, 84, 253, 3158, 383, 1854, 281, 253, 1899, 368, 7777, 971, 15, 15358, 19732, 2977, 634, 43565, 6222, 407, 2403, 352, 12482, 281, 12438, 398, 10922, 562, 13, 390, 15257, 15142, 9091, 368, 1089, 3909, 15, 187, 187, 6300, 1056, 2119, 281, 513, 634, 2561, 13, 1158, 352, 949, 13, 285, 1053, 457, 85, 1056, 667, 1607, 22480, 9727, 390, 7089, 15, 13168, 12797, 4413, 275, 3186, 273, 247, 14892, 3548, 457, 85, 253, 1682, 1039, 281, 564, 15, 733, 812, 320, 247, 29198, 2118, 984, 253, 2567, 778, 417, 320, 247, 1175, 4944, 13, 390, 597, 778, 417, 452, 322, 4976, 84, 12422, 253, 15722, 13, 594, 368, 457, 620, 320, 896, 281, 6278, 581, 2509, 512, 253, 11091, 272, 15, 187, 187, 15418, 32636, 3192, 253, 1048, 1859, 15, 773, 7745, 387, 634, 1655, 2567, 432, 247, 1048, 14, 3945, 16892, 1806, 344, 5936, 15, 773, 1231, 512, 971, 3253, 281, 320, 18319, 13103, 13, 533, 4536, 368, 452, 281, 816, 7356, 342, 352, 15, 26779, 13, 1756, 13, 285, 8162, 1318, 689, 247, 3356, 673, 2180, 685, 368, 1158, 1425, 187, 187, 2042, 13, 846, 2509, 690, 28063, 285, 7765, 14, 8716, 272, 13, 368, 513, 7617, 1469, 281, 1529, 2567, 310, 253, 1682, 2118, 323, 368, 13, 1056, 2119, 368, 1705, 5480, 281, 253, 4572, 342, 2336, 18397, 22118, 13, 3904, 13, 6667, 13, 285, 2712, 2010, 326, 14371, 849, 368, 2507, 5911, 387, 634, 1655, 2567, 15, 18165, 285, 5306, 6787, 323, 16116, 634, 3904, 403, 247, 1943, 3330, 15, 1876, 273, 436, 1491, 943, 4533, 745, 634, 14018, 13, 594, 1056, 2119, 368, 513, 247, 6079, 1408, 2720, 281, 634, 4572, 15, 187, 187, 6872, 1897, 13, 2970, 15127, 310, 271, 1445, 830, 1108, 3340, 275, 253, 6224, 7811, 15, 1422, 457, 306, 1694, 281, 871, 634, 4491, 1755, 281, 5004, 13, 285, 1705, 745, 347, 247, 9865, 24773, 3185, 273, 3095, 9417, 616, 1211, 6284, 15, 1422, 878, 281, 320, 1175, 342, 3904, 281, 1056, 2119, 634, 2425, 285, 5181, 10801, 588, 18212, 7522, 634, 15722, 281, 30582, 436, 1770, 457, 84, 4736, 15, 1244, 4720, 13, 368, 457, 306, 1694, 281, 9974, 247, 10182, 6654, 875, 16116, 634, 3904, 13, 2403, 10291, 342, 8548, 13, 285, 3652, 25325, 342, 634, 11651, 285, 2221, 17327, 15, 1310, 368, 476, 513, 512, 326, 13, 368, 457, 620, 320, 973, 327, 634, 1039, 281, 7552, 271, 2395, 9165, 275, 642, 673, 15, 187, 187, 1276, 403, 368, 2509, 281, 4720, 755, 326, 14892, 281, 2395, 9165, 32, 20930, 634, 2926, 275, 253, 5701, 2708, 27, 187, 187, 20536, 187, 187, 11063, 10764, 7127, 6, 273, 253, 4876, 326, 1056, 598, 253, 3159, 346, 4698, 8211, 995, 594, 521, 2852, 369, 873, 432, 271, 2393, 2363, 15, 2732, 247, 2159, 533, 27576, 42733, 14349, 347, 247, 5602, 40186, 333, 39760, 5914, 29192, 1607, 3796, 1080, 13, 4744, 25146, 521, 45368, 285, 7416, 253, 21261, 35350, 2285, 347, 247, 9137, 3483, 382, 15, 14324, 187, 187, 17277, 31541, 23773, 275, 16861, 27, 2732, 9773, 2996, 8676, 659, 10037, 2, 187, 187, 34, 1175, 11152, 11789, 556, 1264, 2201, 4295, 27, 187, 9 ]
Quit Multitasking to Boost Productivity This is a bold statement, and one that seems counterintuitive, but David says that the biggest productivity killer he sees in SDRs is multitasking. “SDRs shift tasks too often, just ping-ponging through their day, not making any real momentum in one area,” he explains. “Instead, you should block out time on the calendar for certain things where everything else is shut down.” David isn’t alone in stating that multitasking is a bad idea, either. Research from The American Psychological Association shows that multitasking is inefficient and ineffective. When switching rapidly between tasks, there is actually a brain delay, or lag time. The delay is so great that research shows that working simultaneously on complex tasks can take up to 40% more time than just focusing on one task at a time. Time blocking effectively to minimizing multi-tasking is all about making sure you calendar everything. Block off time first thing in the morning to focus on what matters most. Typically, that is your prospecting calls. If you prioritize your getting in a heavy volume of calls first thing you’ll set the day up for success. Then find time blocks for all the other important tasks of the day like prospect research, admin tasks, and anything else that gets thrown your way. Cut Distractions and Focus on What Matters Multitasking may not be the best idea, but neither is focusing on anything other than your goals and the activities required to meet them. Many SDRs focus on extracurriculars like training new people, admin tasks, or organizing the office holiday party – and while some of those are necessary or useful, they aren’t getting you any closer to hitting your goals. So what does? Understanding your role and your business at a level that demonstrates your mastery. “Do you know your numbers and what it takes for you to be successful?” asks David. “What are the activities and the inputs that you have to achieve on a daily basis in order to make your numbers?” David advocates a laser-like focus on getting in your activity numbers so hitting your goal is all but guaranteed. “At a higher level at the company, you’re just there to fill in a number on a spreadsheet of qualified appointments needed for the company to hit the sales goals that month or quarter,” he says. “That’s the bottom line, and everything else is just noise. Once you cut the noise, focus on reverse-engineering your goals and crushing them every month.” Entering a deep work state is about focusing on a single task for an extended period of time, without distractions and under intense focus. Making time on your calendar for these marathons of work is critical, and these blocks of time should be defended at all costs from meetings, social media, admin tasks, and other shallow work. Learn to Lead Conversations While active listening definitely has its place, you’ve also got to drive the conversation in a specific direction toward the sale. When first entering the account executive role, SDRs tend to struggle most with actually closing the deal. To do so, you have to drive the conversation, learning when to interject and how to frame questions to get the information you need while simultaneously demonstrating business value with your product. David believes that doing so comfortably requires business acumen and in-depth industry knowledge. The best way to acquire those things, aside from real-world experience, is to study. David suggests, “Do everything you can to become an expert in the industry you’re selling to. Master the vocabulary and be an expert in the 3-4 top personas so you can put yourself in their shoes and look at things from their viewpoint.” Once you can relate on another level with your prospect and show you’re knowledgeable, it becomes exponentially easier to discover pain points, demonstrate value, and close more deals. As an SDR, a conversion is getting a qualified lead to an account executive, an account executive, but as an AE, you need to be able to close deals. That requires two things: Knowledge of the industry, personas, and competitors Asking the right questions to demonstrate to prospects that you’re the right solution for them. Work on developing those two skills in your spare time so you can show the AE manager that you’ll be ready to hit the ground running in your new role. Prioritize Making Connections With Colleagues Leading conversations should carry over to your interactions with your colleagues, as well. Just like with prospects, you have to demonstrate value. The difference is that when you’re trying to get promoted, you’re selling your value. Before starting any interview process, you should meet with every account executive and sales manager you can to understand what they’re looking for. In the meantime, once you’ve met your goals for the month, look for ways to establish yourself as a leader within the SDR department. Help train other SDRs, or carve out time to enhance product or industry knowledge to make yourself more of a resource to the team. Share resources with your team or your boss about the industry or sales tactics. Once you feel you’re ready to take the next step to account executive, be vocal about it. Discuss opportunities with the AE manager. Let them know what your goals are, and what you hope to achieve. When you finally do get their attention, be sure to follow David’s rules for interview success: Don’t bring up your timeline with the company. Time isn’t a good indicator of whether or not you’ll be successful. It doesn’t matter if you’ve been an SDR for 6 months or 6 years, AE managers are looking for a good cultural fit, a good team player, and someone who knows the industry, knows the persona, and can close deals. Focus on talking about what you’ve sold in the past, even if it was at other companies, and even if it wasn’t at a company at all (like selling girl scout cookies or Cutco knives in high school). Show you can add value and close deals. Discuss your track record of hitting goals as an SDR as well. Every little bit of experience helps. Master your sales demo or pitch before you get the job. If you canlearn the art of demoing, following up, adding value, and roping people in before the interview, then it should be a no-brainer decision to promote you to account executive. Knock the test project out of the park. Many companies will have you give a presentation or run a test before promoting you. This is your chance to wow them, and you should take advantage. Be overprepared and knock their socks off. Bottom line: start walking and talking like an account executive before you become one if you truly want to crush your interview and demo. Do that, and you’ll leave no doubt in their mind that you deserve the opportunity and are ready. Skip the Line by Switching Companies You may also want to consider going to another company. Research by LinkedIn shows that people are job-hopping more than ever, and sometimes it’s the quickest path to the position you truly want. Try leveraging your LinkedIn profile by making it accessible to recruiters reaching out, or actively pursue opportunities you find online. Just make sure to do your research, think it through, and don’t make any impulsive moves or decisions. Sometimes switching companies in search of a promotion isn’t the best way to go. It could be a risky move because the company may not be a good fit, or they may not have SDRs feeding the pipeline, so you’ll be back to square one doing all the prospecting. David recommends taking the long view. “Look at your current company from a long-term horizon,” he suggests. “We all want everything to be instantly awesome, but sometimes you have to just stick with it. Learn, grow, and contribute value over a longer time period than you think.” If, after doing some digging and soul-searching, you do decide going to another company is the best move for you, make sure you come prepared to the interview with verifiable stats, numbers, examples, and anything else that demonstrates how you excelled at your current company. Awards and certifications for hitting your numbers are a big win. All of this information should roll off your tongue, so make sure you do a dry run prior to your interview. These days, getting promoted is an art form – especially in the sales department. You’ve got to know your industry top to bottom, and come off as a valuable consultant instead of someone serving their own interests. You need to be good with numbers to make sure your activity and touchpoints will adequately fill your pipeline to crush this month’s goal. And finally, you’ve got to strike a careful balance between hitting your numbers, making connections with clients, and building rapport with your colleagues and superiors. If you can do all that, you’ll be well on your way to becoming an account executive in no time. What are you doing to finally get that promotion to account executive? Share your story in the comments below: Related Mark shares 44% of the letters that make up the word "marketing", so his future was set from an early age. After a short but financially lucrative gig as a Macaulay Culkin celebrity impersonator, Mark fulfilled his prophecy and joined the Mailshake team as a marketing strategist.Menu Best Chicken Rice in Singapore: After Visiting 53 Stalls! A good chicken rice has three major components: (
[ 187, 187, 6082, 1644, 273, 253, 7867, 1371, 2098, 13, 285, 3413, 326, 344, 651, 417, 187, 187, 250, 1314, 90, 521, 4433, 281, 2885, 15, 20819, 2111, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1249, 15, 10956, 187, 187, 27337, 281, 3426, 521, 31104, 5350, 7103, 275, 4223, 4072, 13, 187, 187, 68, 1377, 3485, 253, 1264, 30219, 326, 497, 11526, 323, 779, 15, 4031, 15, 535, 50270, 510, 2332, 1302, 671, 2783, 253, 1682, 6284, 273, 253, 12757, 762, 187, 187, 12612, 2030, 883, 9, 66, 2769, 25, 481, 380, 2332, 1302, 4767, 326, 10956, 11612, 760, 8073, 6, 273, 187, 187, 8701, 11526, 12941, 13, 9829, 12941, 342, 253, 12757, 1293, 30555, 330, 6328, 13, 187, 187, 395, 13, 3103, 13, 4269, 253, 12757, 281, 2793, 8991, 14004, 15, 50262, 49274, 187, 187, 18336, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1249, 15, 50262, 510, 2332, 1302, 10945, 10956, 457, 84, 535, 50254, 252, 50264, 14, 23, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 535, 187, 911, 45525, 8664, 521, 3480, 273, 13120, 13, 14851, 326, 627, 310, 1345, 187, 187, 3675, 16220, 326, 344, 812, 452, 908, 281, 8041, 253, 12941, 15, 4031, 15, 3840, 13, 253, 187, 187, 21845, 1302, 1119, 326, 10956, 457, 84, 12941, 342, 253, 12757, 497, 417, 19303, 187, 187, 2388, 3518, 13, 984, 10956, 574, 642, 9355, 4712, 323, 253, 12757, 285, 187, 187, 27337, 281, 956, 14, 484, 327, 11985, 8664, 253, 12757, 457, 84, 1786, 13, 2143, 13, 187, 187, 395, 3345, 4712, 15, 4031, 15, 387, 1249, 14, 1012, 15, 380, 2332, 1302, 11106, 10956, 457, 84, 4433, 281, 187, 187, 1595, 423, 253, 12757, 457, 84, 20391, 3958, 13, 672, 12470, 15, 4031, 15, 387, 2145, 15, 754, 671, 858, 417, 187, 187, 1595, 423, 616, 11526, 37966, 285, 840, 26224, 253, 22296, 41820, 187, 187, 3529, 3560, 1110, 37966, 15, 21, 50275, 2618, 15, 50275, 21342, 13, 327, 1529, 8120, 13, 672, 187, 187, 783, 41820, 30468, 2427, 281, 10956, 457, 84, 1728, 281, 2619, 598, 253, 12757, 13, 187, 187, 30646, 369, 31488, 273, 521, 6122, 457, 84, 49924, 15, 4031, 15, 535, 50270, 510, 2332, 1302, 671, 1119, 326, 253, 3879, 273, 253, 12757, 10260, 187, 187, 303, 27369, 1580, 597, 806, 2210, 715, 1557, 15, 4031, 15, 387, 898, 15, 2091, 330, 6328, 806, 8025, 187, 187, 783, 12757, 457, 84, 1557, 13, 597, 651, 1161, 88, 327, 1327, 14, 19480, 4957, 285, 11377, 275, 187, 187, 3431, 3787, 422, 3879, 15, 4031, 15, 380, 2332, 1302, 1119, 326, 253, 12757, 2389, 3811, 187, 187, 3113, 616, 22846, 4651, 13, 281, 5207, 597, 3730, 347, 773, 24681, 2577, 668, 285, 773, 37, 15242, 1806, 285, 187, 187, 3529, 597, 403, 3206, 275, 7418, 4712, 1690, 6105, 4712, 13, 187, 187, 33353, 1209, 13, 285, 271, 846, 19221, 2086, 15, 50272, 2618, 15, 50275, 510, 2332, 1302, 1119, 326, 253, 187, 187, 22246, 452, 247, 3687, 14170, 281, 616, 22846, 2021, 685, 281, 616, 187, 187, 19293, 4651, 15, 4031, 15, 5429, 187, 21, 187, 50274, 510, 12757, 574, 12067, 80, 504, 291, 297, 447, 15, 427, 15, 53, 904, 577, 16, 1348, 16, 6759, 13, 387, 3435, 15, 187, 50254, 50266, 428, 24, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 2756, 50272, 30646, 2550, 1024, 5333, 253, 13387, 281, 330, 6328, 323, 521, 4433, 281, 2885, 253, 187, 187, 22246, 15, 10022, 13, 359, 1089, 326, 253, 2332, 1302, 457, 84, 29240, 5001, 187, 187, 12612, 2030, 883, 9, 66, 2769, 25, 10, 403, 4516, 407, 4209, 13, 20566, 1941, 275, 253, 187, 187, 15352, 15, 535, 50272, 4553, 359, 3653, 326, 253, 6095, 273, 5238, 2030, 883, 9, 66, 10, 403, 1313, 13, 187, 187, 664, 4262, 281, 2278, 1880, 253, 6095, 273, 5238, 2030, 883, 9, 67, 10, 403, 187, 187, 84, 33496, 15, 2594, 496, 294, 2006, 7872, 273, 330, 15, 45, 15, 40, 904, 898, 3208, 329, 15, 19, 69, 48778, 13, 2233, 26, 313, 9387, 15, 6053, 15, 187, 187, 8012, 10, 313, 257, 30973, 481, 5238, 2030, 883, 9, 67, 10, 3400, 27, 535, 50272, 9, 67, 10, 5131, 15711, 18295, 510, 1302, 275, 38915, 253, 3570, 187, 50272, 1171, 247, 2885, 3091, 1918, 3625, 8180, 281, 253, 187, 50272, 27055, 267, 13, 3520, 285, 8991, 3198, 285, 15519, 273, 253, 187, 50272, 7003, 15, 380, 3570, 273, 247, 2885, 3091, 417, 320, 19344, 12718, 327, 253, 187, 50272, 40265, 273, 6938, 2616, 824, 347, 18766, 8039, 13, 187, 50272, 71, 662, 763, 723, 13, 6021, 13, 14234, 285, 3739, 1557, 604, 1119, 281, 320, 187, 50272, 42218, 253, 1453, 273, 253, 2885, 15, 2726, 1675, 281, 667, 5266, 187, 50272, 47092, 10376, 281, 19087, 313, 66, 2769, 18, 582, 313, 23, 582, 390, 313, 25, 582, 253, 1302, 3091, 187, 50272, 1439, 1908, 667, 6031, 407, 253, 2885, 281, 16748, 253, 2515, 187, 50272, 25598, 15308, 534, 403, 806, 15247, 6774, 281, 253, 187, 50272, 19647, 273, 4366, 273, 253, 12108, 273, 253, 5266, 15, 187, 187, 1508, 3643, 15, 36, 15, 52, 15, 34, 15, 3015, 2030, 883, 9, 67, 481, 831, 2111, 556, 4767, 326, 253, 2770, 275, 38915, 187, 187, 5598, 267, 3570, 762, 5238, 2030, 883, 9, 66, 10, 310, 327, 253, 2885, 13, 533, 352, 310, 327, 253, 1429, 187, 187, 81, 27956, 281, 5238, 2030, 883, 9, 67, 481, 4031, 15, 387, 2233, 25, 15, 535, 50272, 688, 16725, 253, 1941, 275, 1329, 273, 15056, 762, 5238, 187, 187, 1099, 883, 9, 67, 582, 776, 6413, 2111, 4102, 4767, 347, 3637, 27, 535, 50272, 60, 42, 62, 71, 253, 9905, 323, 15056, 762, 19087, 313, 66, 10, 403, 1313, 13, 247, 187, 50272, 13550, 773, 30049, 1918, 3625, 8180, 281, 253, 16743, 13, 187, 50272, 29079, 285, 8991, 3198, 285, 15519, 273, 253, 1429, 1425, 3495, 187, 50272, 9387, 15, 36, 15, 52, 15, 34, 15, 3015, 2030, 883, 9, 67, 481, 380, 8991, 3198, 285, 15519, 273, 253, 187, 50272, 7003, 452, 644, 6283, 12814, 281, 2486, 16595, 74, 62, 2649, 606, 23229, 187, 50272, 10328, 347, 2389, 13, 5956, 13, 3988, 13, 285, 7882, 1425, 496, 294, 611, 15, 46, 904, 8676, 535, 50254, 50266, 428, 25, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 2756, 50273, 34, 15, 20, 69, 818, 3593, 13, 818, 4739, 313, 9387, 15, 6053, 15, 4050, 481, 496, 496, 294, 444, 15, 46, 904, 544, 38447, 329, 15, 19, 69, 41981, 13, 187, 50273, 34906, 313, 9387, 15, 9725, 41256, 544, 454, 6413, 62, 2111, 2918, 326, 253, 187, 50273, 42142, 273, 253, 1429, 457, 84, 773, 50234, 285, 15519, 668, 4419, 187, 50273, 15603, 318, 273, 253, 8991, 13403, 875, 253, 2885, 285, 187, 50273, 7003, 15, 380, 773, 307, 2252, 4116, 668, 943, 320, 5087, 281, 557, 29340, 253, 187, 50273, 8222, 327, 253, 1429, 273, 21311, 1917, 272, 253, 17087, 5533, 15, 187, 50273, 688, 294, 611, 15, 46, 904, 8676, 329, 15, 20, 69, 387, 818, 4739, 15, 187, 187, 688, 294, 27, 308, 15, 52, 15, 46, 904, 11102, 329, 15, 20, 69, 30669, 13, 27880, 313, 9387, 15, 4072, 481, 535, 50273, 4943, 13, 253, 2332, 1302, 1119, 27, 535, 50273, 60, 53, 62, 248, 544, 36, 62, 73, 786, 445, 403, 43377, 275, 253, 1557, 273, 253, 22846, 4651, 15, 187, 50273, 510, 22846, 4651, 403, 14127, 512, 273, 253, 16743, 13, 187, 50273, 29079, 285, 8991, 3198, 273, 253, 544, 36, 62, 73, 786, 445, 15, 380, 544, 36, 62, 73, 786, 445, 187, 50273, 709, 254, 281, 616, 22846, 4651, 347, 773, 24681, 2577, 668, 285, 773, 37, 15242, 668, 285, 513, 187, 50273, 1439, 751, 281, 320, 1977, 432, 616, 22846, 4651, 15, 733, 310, 5165, 326, 187, 50273, 783, 22846, 4651, 2085, 253, 544, 36, 62, 73, 786, 445, 342, 253, 4569, 187, 50273, 26617, 285, 21909, 285, 4116, 326, 253, 544, 36, 62, 73, 786, 445, 17337, 15, 187, 50273, 510, 544, 21845, 1302, 62, 9010, 326, 253, 3625, 8991, 14170, 273, 187, 50273, 783, 544, 36, 62, 73, 786, 445, 310, 342, 253, 22846, 2885, 285, 417, 342, 253, 3626, 187, 50273, 24905, 15, 733, 310, 2918, 326, 1880, 247, 1429, 457, 84, 3625, 8991, 187, 50273, 47537, 310, 342, 253, 22846, 2885, 2581, 685, 247, 4201, 2885, 310, 187, 50273, 66, 1534, 2803, 275, 16344, 253, 1429, 457, 84, 16743, 285, 187, 50273, 358, 29882, 3198, 285, 15519, 15, 496, 1720, 27, 611, 15, 59, 15, 52, 904, 898, 2950, 329, 15, 19, 69, 818, 3357, 13, 818, 1540, 187, 50273, 9, 9387, 15, 6053, 15, 4695, 558, 496, 253, 9535, 273, 27, 611, 15, 46, 904, 8676, 329, 15, 20, 69, 818, 3593, 13, 818, 4739, 187, 50273, 9, 9387, 15, 6053, 15, 4050, 481, 380, 544, 21845, 1302, 62, 9010, 326, 38915, 253, 187, 50273, 19293, 4651, 457, 17087, 3570, 310, 4518, 275, 253, 544, 36, 62, 73, 786, 445, 457, 84, 1682, 187, 50273, 14014, 84, 15, 187, 187, 49274, 2111, 26157, 13, 818, 16, 1508, 16, 6759, 13, 387, 1458, 15, 535, 50273, 510, 2332, 1302, 1119, 326, 253, 22846, 4651, 13, 417, 10956, 13, 452, 2530, 187, 187, 1542, 253, 12757, 457, 84, 16743, 13, 3520, 13, 285, 8991, 3198, 285, 15519, 13, 187, 187, 395, 326, 10956, 588, 417, 320, 2104, 281, 2085, 323, 616, 3198, 15, 50271, 49274, 2111, 187, 187, 48, 22104, 13, 818, 16, 1508, 16, 6759, 13, 387, 1638, 15, 50268, 11389, 13, 627, 369, 4209, 13, 20566, 187, 187, 22432, 432, 534, 253, 2332, 1302, 6283, 1119, 326, 253, 12757, 457, 84, 187, 187, 21423, 14170, 310, 342, 253, 22846, 4651, 13, 285, 627, 310, 642, 5533, 875, 2756, 50254, 50266, 50276, 14, 26, 14, 187, 189, 43, 14, 52, 42047, 2031, 14, 1047, 535, 187, 783, 12757, 285, 10956, 15, 4031, 15, 844, 452, 4767, 326, 13, 275, 16472, 247, 20705, 187, 187, 12792, 13, 253, 1302, 310, 417, 2424, 281, 897, 6485, 6206, 13, 533, 778, 10725, 327, 187, 187, 783, 6206, 273, 2675, 5820, 285, 1083, 26719, 15, 50269, 688, 294, 1503, 15, 49, 904, 898, 3953, 329, 15, 19, 69, 187, 187, 7749, 25, 13, 11633, 18, 313, 9387, 15, 6053, 15, 4267, 481, 831, 2111, 556, 2540, 326, 642, 5533, 4409, 187, 187, 10192, 26368, 310, 4447, 875, 247, 1429, 285, 247, 3626, 2885, 835, 253, 1429, 187, 187, 7110, 644, 275, 22846, 1557, 323, 954, 273, 253, 1429, 457, 84, 1495, 13, 285, 253, 4795, 5533, 187, 187, 3113, 253, 3626, 2885, 310, 26513, 15, 496, 294, 611, 15, 59, 15, 52, 904, 898, 2950, 329, 15, 19, 69, 818, 3357, 13, 818, 1540, 313, 9387, 15, 187, 187, 15705, 15, 4695, 481, 50274, 30646, 4242, 281, 773, 911, 26849, 544, 783, 62, 19379, 2954, 534, 187, 187, 11155, 684, 432, 253, 2885, 60, 457, 84, 62, 24741, 281, 3037, 4569, 31104, 964, 964, 964, 187, 187, 1425, 496, 294, 611, 15, 44, 15, 51, 15, 52, 904, 898, 3680, 329, 15, 19, 69, 40355, 13, 40730, 313, 9387, 15, 6053, 15, 4695, 481, 10956, 858, 417, 1691, 187, 187, 41938, 275, 247, 1899, 281, 5467, 5312, 31104, 19715, 323, 253, 187, 187, 22246, 594, 326, 344, 812, 1287, 247, 1524, 5533, 342, 731, 15, 50265, 49274, 2111, 187, 187, 48, 22104, 13, 818, 16, 1508, 16, 6759, 13, 387, 1638, 9944, 923, 496, 294, 500, 15, 45, 15, 36, 904, 854, 1787, 329, 15, 19, 69, 1249, 2504, 13, 1249, 2537, 313, 9387, 15, 187, 187, 15705, 15, 6469, 481, 535, 50272, 30646, 4180, 265, 281, 2389, 253, 12757, 15, 50269, 47, 15, 53, 904, 577, 16, 1348, 16, 6759, 13, 387, 6480, 15, 187, 187, 6436, 13, 247, 2885, 457, 84, 1211, 10450, 273, 2389, 285, 21909, 323, 247, 1429, 13, 3815, 13, 588, 187, 187, 1439, 31423, 15056, 273, 17087, 3570, 15, 496, 294, 1503, 15, 49, 904, 898, 3953, 329, 15, 19, 69, 387, 11633, 18, 15, 187, 187, 1231, 4767, 275, 496, 294, 1503, 15, 49, 904, 247, 1429, 457, 84, 1495, 773, 3549, 2881, 2550, 320, 1691, 327, 2186, 275, 253, 187, 187, 36865, 326, 544, 66, 2885, 62, 588, 23439 ]
objectives of the permanency plan, and determined that he would not remedy his failure to parent. Trial Court Opinion, 7/23/2014, at 12. Father failed to complete his parenting capacity evaluation in August 2013, cancelling the three appointments that were scheduled for him. Id. The trial court also considered the best interests of the Children under Section 2511(a)(8). The trial court stated that Father attended only 52% of his scheduled visits, missed visits with the Children without contacting CYS, and, therefore, caused the Children to experience emotional upset. Trial Court Opinion, 7/23/2014, at 12. The trial court rejected Father’s -6- J-S76044-14 explanation concerning his lack of transportation, stating that there is public transportation that he could have used to attend the visits. Id. Further, the trial court found that Father’s visits with the Children were not productive interactions, because Father had no planned activities for the Children and failed to follow-up on discussions concerning the Children’s health, school, and outside activities. Id. at 12-13. The trial court cited Father’s failure to attend the Children’s soccer games, when invited. Id. at 13. He also did not attend their scheduled surgeries and then cancelled the supervised visitation that followed those surgeries.4 Id. Moreover, on another occasion, when the visitation coordinator went to Father’s home to pick up the Children, Father was unsure of his daughter’s whereabouts. Id. The trial court also found that the behavior of the Children greatly improved since they first came into care. Id. at 9. When CYS first assumed the Children’s care, they would chew on non-food items and engage in disruptive behavior. Id. The trial court found that the Children love living with their foster parents, to whom they refer as “Mommy” and “Daddy,” and that they are involved in numerous activities including church activities, soccer, and an afterschool program. Id. The trial court found that the Children have a greater attachment to their foster family than to their natural parents. Id. 4 The Children had adenoidectomies. N.T., 4/24/2014, at 27. -7- J-S76044-14 Father cannot now shift the blame to CYS for his failure to parent the Children. Accordingly, we find that the trial court’s determinations regarding Section 2511(a)(8) are supported by sufficient, competent evidence in the record. After we determine that the requirements of Section 2511(a) are met, we proceed to review whether the requirements of Section 2511(b) are satisfied. See In re Adoption of C.L.G., 956 A.2d 999, 1009 (Pa. Super. 2008) (en banc). Section 2511(b) provides: (b) Other considerations.--The court in terminating the rights of a parent shall give primary consideration to the developmental, physical and emotional needs and welfare of the child. The rights of a parent shall not be terminated solely on the basis of environmental factors such as inadequate housing, furnishings, income, clothing and medical care if found to be beyond the control of the parent. With respect to any petition filed pursuant to subsection (a)(1), (6), or (8), the court shall not consider any efforts by the parent to remedy the conditions described therein which are first initiated subsequent to the giving of notice of the filing of the petition. 23 Pa.C.S.A. § 2511(b). This Court has stated that the focus in terminating parental rights under Section 2511(a) is on the parent, but it is on the child pursuant to Section 2511(b). Id. at 1008. In reviewing the evidence in support of termination under Section 2511(b), our Supreme Court recently stated as follows: [I]f the grounds for termination under subsection (a) are met, a court “shall give primary consideration to the developmental, physical and emotional needs and welfare of the child.” 23 Pa.C.S.A. § 2511(b). The emotional needs and welfare of the child have been properly interpreted to include “[i]ntangibles such as love, comfort, security, and stability.” In re K.M., 53 -8- J-S76044-14 A.3d 781, 791 (Pa. Super. 2012). In In re E.M., [620 A.2d 481, 485 (Pa. 1993)], [our Supreme] Court held that the determination of the child’s “needs and welfare” requires consideration of the emotional bonds between the parent and child. The “utmost attention” should be paid to discerning the effect on the child of permanently severing the parental bond. In re K.M., 53 A.3d at 791. In re: T.S.M., 71 A.3d 251, 267 (Pa. 2013). Here, the trial court found: [T]he [C]hildren are thriving in the care of the foster parents. The foster parents are satisfying all of the developmental, physical and emotional needs of the [C]hildren. The [C]hildren refer to their foster parents as “Mommy” and “Daddy” and do not like to be away from their foster parents. It is apparent that the foster parents provide the [C]hildren with the appropriate love and affection and attention that the [C]hildren deserve. The [trial court] finds that the primary emotional attachment of the [C]hildren is with the foster parent and not with the natural parents. It is held that whether a child’s primary emotional attachment is with the foster parent rather than a birth parent is a significant factor in evaluating the child’s developmental and emotional needs and welfare. In Re: K.Z.S., 946 A.2d 753, 764 (Pa. Super. 2008); In the Interest of: K.M., 53 A.3d 781, 791 (Pa. Super. 2012). The [trial court] finds that terminating the natural parents’ parental rights is clearly in the [C]hildren’s best interests. Trial Court Opinion, 7/23/2014, at 15. The trial court found that the foster parents, not Father, have provided for the Children’s developmental, physical, and emotional needs and welfare, and that Father will not be able to provide for their needs. Trial Court Opinion, 7/23/2014, at 14. Further, there was sufficient, competent evidence from which the trial court properly found that the Children’s primary attachment is with the foster parents, and there is no bond between -9- J-S76044-14 the Children and Father. Id. We have stated that, in conducting a bonding analysis, the court is not required to use expert testimony, but may rely on the testimony of social workers and caseworkers. In re Z.P., 994 A.2d 1108, 1121 (Pa. Super. 2010). This Court has observed that no bond worth preserving is formed between a child and a natural parent where the child has been in foster care for most of the child’s life, and the resulting bond with the natural parent is attenuated. In re K.Z.S., 946 A.2d 753, 764 (Pa. Super. 2008). Father failed to “exhibit [the] bilateral relationship which emanates from the parent[’s] willingness to learn appropriate parenting . . . .” In re K.K.R.S., 958 A.2d 529, 534 (Pa. Super. 2008). Father did not put himself in a position to assume daily parenting responsibilities for the Children so that he could develop a real bond with them. Trial Court Opinion, 7/23/2014, at 14.; see In re J.L.C., 837 A.2d 1247, 1249 (Pa. Super. 2003). Father professes to love the Children. N.T., 4/24/2014, at 38. However, a parent’s own feelings of love and affection for a child, alone, will not preclude termination of parental rights. In re Z.P., 994 A.2d at 1121. We stated in In re Z.P., a child’s life “simply cannot be put on hold in the hope that [a parent] will summon
[ 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 10580, 14, 8002, 14, 2845, 1573, 14, 10613, 14, 20894, 1138, 10580, 64, 8002, 16, 2845, 1573, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 10146, 14, 20894, 1138, 10146, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 5695, 14, 20894, 1138, 5695, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 5695, 14, 10613, 14, 20894, 1138, 5695, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3621, 14, 20894, 1138, 3621, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3621, 14, 10613, 14, 20894, 1138, 3621, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 21997, 14, 20894, 1138, 21997, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 21997, 14, 10613, 14, 20894, 1138, 21997, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 6790, 14, 15476, 14, 20894, 1138, 6790, 64, 15476, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 6790, 14, 15476, 14, 10613, 14, 20894, 1138, 6790, 64, 15476, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2808, 14, 22965, 14, 20894, 1138, 2808, 64, 22965, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2808, 14, 22965, 14, 10613, 14, 20894, 1138, 2808, 64, 22965, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 2230, 14, 20894, 1138, 2230, 16, 2230, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 2230, 14, 10613, 14, 20894, 1138, 2230, 16, 2230, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 26451, 14, 20894, 1138, 2230, 16, 26451, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 28213, 14, 20894, 1138, 2230, 16, 28213, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 28213, 14, 10613, 14, 20894, 1138, 2230, 16, 28213, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 2230, 14, 8906, 14, 20894, 1138, 2230, 16, 8906, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 42096, 874, 14, 12467, 14, 20894, 1138, 42096, 874, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 19484, 14, 20894, 1138, 19484, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 20894, 1138, 35704, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 46818, 14, 20894, 1138, 35704, 64, 46818, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 46818, 14, 10613, 14, 20894, 1138, 35704, 64, 46818, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 35704, 14, 10613, 14, 20894, 1138, 35704, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 3659, 14, 18534, 14, 20894, 1138, 3659, 64, 18534, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 9177, 14, 20894, 1138, 9177, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 9177, 14, 10613, 14, 20894, 1138, 9177, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 12467, 14, 20894, 1138, 287, 12042, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 12467, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 12467, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 301, 14, 20894, 1138, 287, 12042, 64, 301, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 301, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 301, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 3409, 14, 20894, 1138, 287, 12042, 64, 3409, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 287, 12042, 14, 3409, 14, 10613, 14, 20894, 1138, 287, 12042, 64, 3409, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 287, 12042, 14, 12467, 14, 20894, 1138, 17166, 16, 287, 12042, 64, 12467, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 17166, 14, 5903, 14, 20894, 1138, 17166, 16, 17166, 64, 5903, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 17166, 14, 5903, 14, 10613, 14, 20894, 1138, 17166, 16, 17166, 64, 5903, 64, 10613, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 1070, 14, 20894, 1138, 17166, 64, 12583, 16, 23167, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 22172, 14, 20894, 1138, 17166, 64, 12583, 16, 22172, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 32499, 14, 20894, 1138, 17166, 64, 12583, 16, 32499, 15, 20894, 870, 66, 3073, 965, 31, 187, 29, 965, 966, 568, 936, 291, 658, 14, 77, 20, 5264, 66, 966, 568, 14005, 4812, 3, 3860, 31779, 10075, 375, 16, 37298, 42927, 16, 6682, 16, 20894, 64, 14005, 15, 2974, 4, 17166, 14, 12583, 14, 681, 993, 2081, 14, 20894, 1138, 17166, 64, 12583, 16 ]
ree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#graph-nav-recording-service-proto">graph_nav/recording_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#header-proto">header.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#image-proto">image.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#image-service-proto">image_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#lease-proto">lease.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#lease-service-proto">lease_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#license-proto">license.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#license-service-proto">license_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#local-grid-proto">local_grid.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#local-grid-service-proto">local_grid_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#log-annotation-proto">log_annotation.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#log-annotation-service-proto">log_annotation_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-mission-proto">mission/mission.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-mission-service-proto">mission/mission_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-nodes-proto">mission/nodes.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-remote-proto">mission/remote.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-remote-service-proto">mission/remote_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mission-util-proto">mission/util.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#mobility-command-proto">mobility_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#parameter-proto">parameter.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-proto">payload.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-registration-proto">payload_registration.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-registration-service-proto">payload_registration_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#payload-service-proto">payload_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#point-cloud-proto">point_cloud.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#power-proto">power.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#power-service-proto">power_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-command-proto">robot_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-command-service-proto">robot_command_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-id-proto">robot_id.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-id-service-proto">robot_id_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-state-proto">robot_state.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#robot-state-service-proto">robot_state_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-robot-command-proto">spot/robot_command.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-spot-check-proto">spot/spot_check.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-spot-check-service-proto">spot/spot_check_service.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-led-proto">spot_cam/LED.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-audio-proto">spot_cam/audio.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-camera-proto">spot_cam/camera.proto</a></li> <li class="toctree-l3"><a class="reference internal" href="../../../../../protos/bosdyn/api/proto_reference.html#spot-cam-compositor-proto">spot_cam/
[ 2987, 390, 643, 1345, 11839, 556, 253, 987, 281, 30215, 11349, 762, 5272, 9162, 1754, 2220, 824, 2616, 347, 253, 2105, 273, 2579, 13, 253, 4096, 323, 534, 253, 2579, 390, 1885, 310, 2959, 13, 253, 10671, 390, 2408, 2959, 13, 253, 1027, 1894, 273, 253, 2579, 25032, 13, 253, 673, 273, 697, 897, 390, 667, 643, 2647, 534, 10262, 247, 6832, 3064, 347, 247, 3216, 273, 13812, 15, 11087, 330, 15, 43, 15, 52, 904, 5259, 28218, 1005, 13, 3015, 3435, 13, 3239, 884, 2537, 28, 7652, 3052, 15, 49864, 904, 721, 2511, 28, 2448, 743, 25178, 23910, 13, 3690, 904, 362, 15, 3228, 273, 19989, 28093, 13, 25911, 3643, 15, 30642, 13, 13620, 329, 15, 818, 1731, 13, 2456, 329, 15, 45, 15, 51, 15, 16493, 15, 187, 1147, 369, 2918, 407, 776, 6413, 2111, 275, 3228, 273, 7667, 5410, 251, 362, 15, 11290, 1216, 13, 11334, 5255, 15, 40783, 13, 16918, 322, 15, 56, 15, 854, 3953, 13, 326, 247, 2846, 556, 253, 7143, 13, 2220, 1463, 2748, 13, 281, 3334, 17249, 323, 31842, 38648, 5799, 3578, 3658, 390, 4657, 24761, 285, 4822, 3587, 432, 253, 31842, 2581, 685, 432, 253, 2867, 7302, 15, 733, 651, 1646, 326, 604, 247, 2846, 476, 320, 2424, 281, 21623, 285, 4179, 323, 697, 1824, 327, 253, 3720, 273, 247, 2021, 390, 2060, 2136, 3943, 326, 352, 943, 671, 452, 253, 1612, 281, 513, 594, 327, 697, 1211, 7158, 15, 1916, 2186, 5010, 651, 320, 281, 1659, 824, 1612, 285, 8637, 275, 253, 3564, 273, 1016, 2060, 2608, 281, 3692, 41750, 285, 18612, 253, 2846, 651, 320, 2256, 1293, 1612, 281, 1453, 390, 8722, 697, 11839, 2136, 15, 380, 9162, 273, 10230, 9910, 762, 247, 16252, 9162, 1754, 323, 2281, 6378, 2220, 21337, 5085, 310, 417, 13, 275, 776, 4743, 13, 1293, 5272, 3720, 285, 22861, 15, 6102, 475, 44941, 4212, 12647, 247, 1511, 390, 966, 9619, 1027, 285, 5799, 432, 643, 4212, 15, 831, 310, 4209, 3720, 323, 253, 9162, 15, 733, 369, 594, 2918, 407, 253, 2111, 273, 9892, 273, 15812, 275, 13054, 362, 15, 18308, 285, 3228, 6456, 273, 330, 44113, 13, 24665, 31107, 15, 9135, 13, 8255, 329, 15, 374, 69, 33311, 13, 28325, 13, 762, 247, 2074, 25245, 15, 380, 1302, 13, 275, 326, 1083, 13, 4767, 27, 187, 3, 7865, 272, 271, 10230, 2419, 247, 2136, 1057, 417, 6990, 253, 958, 326, 352, 310, 271, 20828, 273, 23031, 723, 15, 733, 310, 417, 20697, 281, 30215, 352, 342, 643, 23031, 723, 2581, 685, 342, 21440, 449, 187, 510, 440, 4557, 10998, 2801, 273, 6265, 275, 643, 3054, 310, 326, 247, 2846, 778, 30215, 697, 4212, 327, 253, 3720, 273, 247, 2021, 390, 2136, 3943, 285, 2613, 697, 4179, 323, 253, 2579, 2220, 824, 3943, 13, 285, 778, 1056, 247, 5927, 4179, 323, 1016, 824, 3943, 15, 16647, 362, 15, 3228, 273, 443, 3502, 32485, 13, 21982, 427, 15, 36, 15, 24665, 13, 7251, 322, 15, 38, 15, 898, 520, 28, 1986, 2077, 362, 15, 2448, 10205, 14, 21950, 2434, 904, 330, 15, 36, 904, 5345, 401, 15, 818, 2504, 15, 187, 510, 958, 326, 253, 2846, 9192, 6419, 697, 1824, 285, 41930, 486, 23585, 2579, 281, 21440, 285, 22777, 19509, 285, 643, 5053, 835, 44414, 386, 5454, 310, 29039, 762, 271, 9787, 9162, 342, 760, 581, 5927, 4179, 13, 1014, 2167, 690, 273, 253, 5085, 275, 690, 273, 841, 5053, 403, 908, 347, 2021, 5085, 13, 310, 9090, 247, 11081, 1411, 21142, 15, 496, 776, 4743, 13, 2299, 13, 824, 11081, 310, 417, 13, 762, 253, 5441, 285, 5989, 275, 1941, 275, 436, 1083, 13, 271, 10341, 285, 20697, 581, 15, 380, 1600, 285, 3198, 273, 253, 7418, 1824, 4212, 5608, 407, 247, 2846, 403, 824, 326, 352, 310, 1965, 67, 494, 13, 604, 417, 7479, 13, 326, 667, 9162, 390, 2281, 3720, 812, 320, 32434, 534, 651, 417, 275, 690, 1039, 30530, 1411, 690, 273, 253, 4212, 15, 1310, 21142, 943, 30950, 275, 436, 1083, 13, 627, 651, 320, 247, 11081, 1411, 11349, 275, 2014, 3943, 23031, 723, 15, 3105, 1046, 11081, 13, 2299, 13, 310, 26212, 13, 533, 760, 247, 11081, 326, 310, 10341, 285, 1293, 247, 5272, 958, 3720, 390, 22861, 15, 380, 11081, 275, 436, 1083, 310, 417, 10341, 15, 1623, 253, 10214, 13, 352, 310, 4516, 285, 17285, 407, 247, 15010, 3720, 323, 9162, 285, 407, 6832, 1941, 534, 816, 7790, 253, 7260, 1160, 281, 326, 966, 273, 4212, 15, 6102, 11081, 347, 627, 310, 878, 417, 320, 9606, 407, 21142, 15, 1583, 452, 253, 987, 281, 452, 3081, 17249, 8038, 594, 326, 7260, 778, 320, 1160, 3587, 281, 1016, 11692, 3943, 15, 187, 510, 4342, 273, 958, 4724, 407, 253, 1302, 497, 4516, 407, 1941, 285, 2424, 253, 3883, 13697, 15, 844, 452, 6730, 643, 2792, 3559, 285, 1089, 642, 24048, 2228, 15, 187, 510, 3883, 310, 16337, 15, 187, 4943, 247, 7648, 367, 982, 40871, 187, 1542, 253, 3186, 346, 53, 5104, 8679, 84, 26152, 3, 432, 776, 2670, 187, 15, 28066, 441, 323, 625, 1959, 40871, 2195, 187, 187, 7845, 3877, 27, 359, 403, 417, 5506, 187, 1542, 690, 3186, 819, 1169, 2, 844, 760, 921, 247, 1959, 40482, 40871, 432, 187, 454, 2670, 323, 436, 3186, 2748, 2, 20536, 17891, 27, 187, 187, 5622, 19070, 2726, 48721, 308, 953, 401, 25826, 19672, 1106, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 1575, 15, 681, 16, 4663, 15, 2974, 32, 32280, 64, 301, 30, 740, 46027, 7, 81, 30, 649, 7, 83, 30, 81, 11548, 10655, 1010, 7, 68, 30, 18, 7, 75, 30, 1012, 187, 1051, 16040, 45258, 5729, 17920, 2071, 19070, 2726, 48721, 308, 953, 401, 25826, 19672, 1106, 18142, 5292, 310, 247, 3346, 745, 387, 253, 1113, 15, 831, 3226, 22486, 285, 4745, 9727, 432, 3346, 281, 42296, 521, 11694, 15, 1500, 270, 10600, 512, 689, 521, 3558, 285, 3346, 12951, 1041, 27, 11366, 6443, 13, 6939, 3671, 13, 3052, 43643, 13, 7108, 13, 2596, 11271, 44857, 17855, 27, 367, 35064, 15, 9507, 187, 187, 41, 1575, 90, 17696, 34895, 399, 6111, 2726, 329, 10417, 30276, 254, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 698, 4003, 15, 681, 16, 18, 16, 1237, 35340, 16, 1731, 13743, 16, 4663, 15, 2974, 187, 1051, 37559, 3226, 13, 13027, 432, 42862, 4889, 275, 2502, 45001, 466, 15, 8679, 369, 594, 3346, 4829, 18298, 281, 2075, 253, 3226, 533, 275, 253, 990, 703, 3346, 1157, 1880, 703, 556, 1943, 246, 953, 13, 10058, 246, 953, 14528, 352, 275, 253, 3346, 49142, 27, 13516, 14179, 1876, 3824, 26152, 2, 1283, 530, 15, 52, 15, 36, 15, 5238, 3346, 12951, 1041, 27, 6939, 3671, 13, 443, 13139, 13, 3052, 43643, 13, 30912, 1507, 13, 5284, 17855, 27, 4410, 10315, 16678, 11835, 793, 187, 187, 18139, 33574, 30276, 254, 21231, 2355, 329, 22757, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 698, 4003, 15, 681, 16, 18, 16, 1237, 35340, 16, 1630, 20216, 16, 4663, 15, 2974, 187, 1051, 2120, 4892, 273, 26653, 594, 8679, 2335, 779, 327, 271, 9470, 3346, 247, 8230, 2628, 432, 247, 3226, 342, 17543, 327, 313, 19552, 1223, 344, 3346, 1157, 1880, 703, 556, 1943, 246, 953, 13, 10058, 246, 953, 14528, 352, 275, 253, 3346, 49142, 27, 13516, 14179, 1876, 3824, 26152, 2, 1283, 530, 15, 52, 15, 36, 15, 5238, 3346, 12951, 1041, 27, 6939, 3671, 13, 443, 13139, 13, 3052, 43643, 13, 30912, 1507, 13, 5284, 17855, 27, 4410, 10315, 16678, 11835, 793, 187, 187, 5178, 43267, 264, 19298, 5464, 1680, 308, 770, 466, 401, 20044, 9715, 27, 3944, 1358, 28117, 12395, 15, 81, 303, 856, 620, 15, 681, 16, 69, 16, 35744, 4305, 16, 81, 982, 16, 32296, 1967, 16, 21, 16, 4663, 15, 2974, 32, 81, 30, 649, 7, 83, 30, 81, 11548, 10655, 1010, 7, 68, 30, 21, 7, 75, 30, 1012, 7, 3346, 187, 1051, 500, 814, 5943, 6505, 253, 6507, 14, 1962, 30230, 6838, 387, 1728, 285, 9580, 84, 2366, 3346, 401, 20044, 775, 580, 251, 310, 247, 25594, 3226, 342, 5699, 25960, 15, 1500, 7120, 3346, 562, 273, 617, 6863, 285, 10058, 6447, 285, 840, 41714, 327, 3346, 281, 42296, 521, 11694, 15, 1500, 270, 10600, 512, 689, 521, 3558, 285, 3346, 12951, 1041, 27, 11366, 6443, 13, 6939, 3671, 13, 7967, 308, 953, 13, 3052, 43643, 13, 7108, 17855, 27, 7967, 19120, 2576, 500, 814, 5943, 187, 187, 52, 503, 610, 21444, 74, 24006, 443, 1644, 322, 561, 780, 18147, 596, 287, 839, 9715, 27, 3944, 1358, 47189, 15, 38088, 456, 15, 681, 16, 28117, 26824, 16, 740, 1717, 1036, 16, 19443, 20, 16, 19, 16, 19, 16, 17, 187, 1051, 752, 32, 2064, 434, 616, 1895, 15, 2053, 6838, 403, 1469, 281, 452, 281, 3346, 326, 1199, 11694, 1066, 617, 10058, 13386, 369, 1469, 281, 320, 3346, 23646, 2084, 1059, 327, 776, 5599, 434, 11694, 13, 33131, 12188, 598, 285, 1066, 327, 521, 3346, 778, 320, 10058, 13, 533, 703, 40724, 11694, 751, 247, 1943, 3226, 2, 1401, 9304, 2271, 3346, 12951, 1041, 27, 2745, 561, 13, 11366, 6443, 13, 378, 676, 20459, 13, 3052, 43643, 13, 37887, 28853, 13, 443, 29191, 13, 7108, 17855, 27, 596, 287, 456, 187, 187, 2214, 14736, 4735, 4496, 187, 936, 8046, 16872, 390, 281, 1691, 436, 2670, 275, 10215, 264, 44857, 8232, 187, 249, 634, 9882, 187, 187, 15852, 84, 4496, 187, 33724, 634, 5753, 432, 24497, 16921, 407, 3365, 970, 634, 9882, 434, 187, 9960, 41822, 17971, 15, 187, 3074, 3210, 15602, 327, 436, 2670, 403, 1283, 1107, 390, 5662, 15, 187, 2214, 19956, 24, 2905, 34989, 4496, 3057, 1016, 19718, 2670, 7302, 187, 527, 1741, 1230, 15, 187, 1231, 513, 417, 4711, 16921, 5576, 2600, 9361, 15, 2719, 7662, 273, 187, 454, 2670, 2216, 13, 347, 973, 347, 629, 390, 40071, 273, 776, 4859, 310, 19772, 15, 187, 5039, 2327, 187, 12812, 17004, 1550, 3667, 25462, 1623, 12576, 1638, 64, 1797, 13, 8012, 411, 1477, 15, 87, 12115, 15, 681, 187, 187, 53, 455, 2966, 2499, 273, 10784, 13, 253, 581, 20417, 6831, 275, 39863, 571, 13, 310, 253, 39230, 273, 39863, 757, 11369, 285, 4302, 4730, 15, 496, 4588, 1495, 13, 247, 3438, 32569, 90, 8451, 288, 1369, 44250, 5931, 6289, 281, 347, 411, 1507, 251, 457, 84, 15, 7160, 7138, 369, 247, 411, 326, 39288, 369, 253, 426, 11773, 16008, 457, 84, 30, 50042, 253, 3430, 1039, 598, 15, 27486, 1004, 1037, 13, 2067, 411, 1507, 251, 457, 84, 13, 2366, 342, 253, 581, 275, 253, 2460, 13, 1996, 3395, 426, 11773, 16008, 457, 84, 30, 846, 411, 1507, 251, 457, 84, 2427, 562, 273, 2136, 15, 353, 2061, 437, 790, 310, 2717, 747, 15, 15073, 31372, 13, 499, 9681, 285, 2725, 280, 35586, 452, 8689, 1947, 598, 285, 5195, 407, 1039, 273, 253, 28969, 584, 1580, 253, 1265, 273, 1966, 9493, 2469, 15, 1310, 352, 3637, 253, 11693, 273, 9493, 2469, 13, 353, 2061, 437, 790, 588, 28755, 1977, 313, 3022, 42431, 14, 35, 3298, 8043, 2149, 330, 7864, 582, 285, 320, 7932, 407, 581, 2181, 747, 15, 1422, 6830, 476, 457, 85, 3523, 352, 13, 533, 359, 476, 642, 1679, 685, 320, 6600, 326, 841, 4957, 2826, 13, 285, 359, 476, 3177, 281, 29966, 616, 8334, 1543, 407, 5277, 690, 8668, 15, 187, 187, 8934, 1100, 751, 17899, 751, 17899, 285, 12633, 4376, 275, 14, 16719, 5252, 273, 247, 9400, 3687, 685, 247, 3158, 787, 4063, 670, 352, 15, 5595, 4292, 897, 17891, 281, 3186, 8573, 12089, 285, 9137, 562, 5482, 281, 3533, 390, 10165, 281, 3374, 285, 253, 952, 665, 2794, 253, 6725, 20756, 47000, 7570, 37692, 2894, 18769, 6570, 29476, 871, 436, 15, 5559, 4480, 12579, 2168, 556, 247, 7827, 1159, 13, 285, 697, 16567, 285, 10469, 11222, 1339, 767, 4212, 13791, 347, 352, 8356, 8442, 562, 752, 11515, 597, 457, 250, 17617, 285, 840, 30376, 731, 15, 1723, 4114, 6046, 812, 1056, 352, 9286, 272, 323, 253, 622, 281, 15909, 752, 7732, 403, 3981, 13, 285, 275, 1635, 281, 4677, 562, 672, 581, 2060, 556, 6331, 8288, 285, 352, 310, 673, 281, 1265, 42477, 15, 187, 187, 1394, 403, 2104, 281, 1973, 247, 3687, 1495, 285, 671, 368, 878, 271, 4730, 326, 2987, 15, 1422, 9446, 326, 2323, 310, 417, 667, 7343, 13, 285, 671, 368, 457, 250, 4704, 281, 1056, 634, 1616, 275, 247, 5675, 1673 ]
works or other public utility has the right to classify consumers under reasonable classification based upon such factors as the cost of service, the purpose for which the service or product is received, the quantity or amount received, the different character of the service furnished, the time of its use or any other matter which presents a substantial difference as a ground of distinction. 73 C.J.S., Public Utilities, § 27, page 1049; 43 Am.Jur., 689; American Aniline Products, Inc., v. City of Lock Haven, 288 Pa. 420, 135 A. 726, 50 A.L.R. 121. It was held by our Supreme Court in City of Galveston v. Kenner, 111 Tex. 484, 240 S.W. 894, that a city has the duty, upon proper request, to install meters for tenants occupying distinct tenements or storehouses and collect directly from the tenants rather than from the property owner. It would seem that if a city can be required to meter and charge for its water on the basis of a family or individual business unit that it should also have the power to do so on its own accord. To hold otherwise would be to place such power and discretion in the hands of each individual user to whose whim and fancy the city would be subject without power to control or manage its utility business. The classification of apartment houses under a residential classification based for rate purposes upon consuming units is not, in our opinion, without reasonable basis and justification. Such *715 users constitute a type or class substantially different and distinct from other users. This is sufficient basis for the classification. It was so held by the Court of Appeals of Maryland in Lewis v. Mayor and City Council of Cumberland, 189 Md. 58, 54 A. 2d 319, 325, under a similar ordinance. The court, in that case, stated: "Calling an apartment house a business does not alter the fact that it is an aggregation of dwellings. It is not unreasonable to classify it with other dwellings rather than with hotels." The unquestioned weight of authority in other states is that a city may classify its users on the basis of a family or business unit and base its charge for the service upon such unit, and may make a minimum charge for each such unit. Thompson v. City of Goldsboro, 151 N.C. 189, 65 S.E. 901; United States v. American Water-Works Co., C.C., 37 F. 747. The fact that the city furnishes its water and sewerage disposal service to hotels and tourist camps and other places where itinerant trade is predominant under an industrial classification with only one minimum charge, even though some of the units in some of these places are used as family units, is obviously a discrimination against appellants. In our opinion, however, such discrimination is not, under the facts and circumstances in evidence in this case, an arbitrary and unreasonable one. The interest and needs of the numerous water users served by a city are such that it is improbable, if not impossible, that any classification or rate basis could be devised which would not in some way discriminate against some of the users. If appellants should prevail in this case, there would be a discrimination against consumers in single unit dwellings. Not every discrimination, however, is condemned, but only a discrimination that is arbitrary and without a reasonable fact basis or justification. The discrimination in this case is not arbitrary. On the contrary, it is supported and justified by a factual basis for classification and by substantial evidence which justifies the charges made to that class of users. Such discrimination as there is need not be suffered by appellants. They have the right to have additional meters installed so that charges may be made directly to each household unit. The findings of fact filed by the court were supported by evidence and required the judgment rendered. We have examined other points presented and find no reversible error. The judgment is affirmed. Here a Free Pics galleries for the search "Tiny Bobs Girls" from our site . Visit us for more free galleries ! Please note: we are not responsible for some search prases! We only show a free pics galleries from our site for this search request!Related searches: Blonde With Tiny Tits Fucking DrivewayURL: http://galleries.porn.com/index.html?scene_id=10554&p=ft&r=pimp10515&c=1&j=13 ... Price Scene Previews Blonde With Tiny Tits Fucking DrivewayAudrey is a ... off at the car. This girl strips and immediately moves from ... to sucking his cock. She bobs all over his member and ... Niches: Hardcore, Milfs, Amateurs, Americans, One Pass Sites Site: PORN.COM Horny Senior Gets Dirty With A Real HookerURL: http://galleries.payserve.com/1/32482/26135/index.html ... blond girl, preferably from Croatia AND in red lingerie. Bob was so ... nearly forgot to pay the girl but in the end she ... , whether she has big tits, tiny tits loves it in the ... Fuck: Come Watch All Our Girls! 18 U.S.C. Section ... Niches: Milfs, GFs, Amateurs, Streets, European Site: Red Light Sex Trips Experienced Hooker Pleasing A GuyURL: http://galleries.payserve.com/1/32482/27395/index.html ... full tour of Amsterdam so Bob took him on an extensive ... a blow job from a girl with glasses on (...) while he ... , whether she has big tits, tiny tits loves it in the ... Fuck: Come Watch All Our Girls! 18 U.S.C. Section ... Niches: Milfs, GFs, Amateurs, Streets, European Site: Red Light Sex Trips Big Chested Brunette Is Tittie FuckedURL: http://galleries.pimproll.com/d/bjjs/pics/49570/4/index.html?p=ft&r=pimp10515&c=4&j=13& ... ... Juggs leaves the flat-chested girls at home and gathers together ... Fucked Chavon is a sexy girl with huge breasts. She plays ... out of her tight and tiny uniform and then lays on ... to sucking his cock. She bobs all over his member and ... Niches: Hardcore, Milfs, Big Tits, Amateurs, Americans Site: Big Juicy Juggs Sultry Brandi Edwards Gives Sensual Deep ThroatingURL: http://gallery.throated.com/gallhit/102916/2173/2/2/0 ... what? That's their problem. These girls are going to have to ... that much cock down her tiny throat was going to be ... gauntlet on our guy's cock, bobbing up and down on his ... may be tiny, but she eats cock like a big girl! **Monique ... Niches: Teens, Hardcore, BlowJob, Amateurs, Cumshots, Gagging, Americans Site: Throated For Search feature please to enable JavaScript or to put this site in Trusted Sites zone in your browser Parents please protect your kids from accessing porn by simply using your browser's surfing preferences. All models appearing on this site are 18 years or older. For 2257 related inquiries please contact each gallery site owner individually. We do not produce pornographic content ourselves. Reproduction of our site design, as well as part or totality of our links is prohibited. Abuse emailDomains Registered On Jun 14_21,2008 Www.v119.com Tallinn University of Technology, the one technological college in Estonia, is the flagship of Estonian engineering and technology education. In actual life, a former Lengthy Island hamburger chain referred to as Wetson’s. Their brand was a W that principally was the =McDonald’s= arches the wrong way up. Paradoxically, several Wetson’s, together with the one in the image, later became =McDonald’s= after Wetson’s went out of business. Morgellons is nothing new. Related illnesses, plagues and demonic possessions have sprung up and spread by way of the populace since the start of human historical past. If it follows the trail of historical past, Morgellons will fade away (like Epstein-Barr flavored CFS), and be replaced by one thing new. You possibly can’t stop it, but we can no less than be aware that these items occur, and we can attempt to mitigate their sick results by providing some perspective. Engines like google like google and folks price in-depth safety of a topic greater than a quick blurb about it. Most individuals use searches to search internet advertising and marketing out solutions to questions or choices to issues and the people who create the SEARCH ENGINE OPTIMIZATION pointers know this. Google Translate already has a conversation function, and its iOS and Android apps let two users communicate as it automatically figures out what languages they’re utilizing and then translates them. However background noise could make it exhausting for the app to grasp what persons are saying, and in addition to figure out when one individual has stopped speaking and it is time to start translating. You are able to build a greater life and also you need an education that works. You recognize that success is not any accident, and also you’re ready to make your mark in a growing field
[ 897, 253, 1307, 10875, 595, 2698, 4527, 2282, 436, 16540, 247, 3167, 273, 643, 3533, 15, 6049, 858, 2656, 830, 247, 33043, 342, 5143, 8958, 5143, 4571, 626, 1978, 598, 617, 990, 273, 253, 2968, 32, 6049, 310, 271, 33039, 39490, 2656, 3033, 407, 253, 9447, 9317, 273, 9129, 13740, 17533, 9383, 257, 1103, 32, 1244, 594, 327, 15, 2053, 403, 4722, 285, 1774, 3533, 15, 1292, 597, 403, 1077, 1027, 16308, 273, 3533, 685, 1110, 13044, 598, 407, 35538, 15, 1244, 13, 4931, 954, 15538, 13, 597, 403, 3533, 326, 3213, 1475, 253, 954, 20276, 7794, 273, 35538, 275, 253, 2927, 273, 1142, 4980, 15600, 15, 12442, 38347, 36052, 422, 20877, 319, 2731, 3599, 2735, 456, 407, 367, 8528, 28241, 3315, 3450, 327, 12017, 81, 1834, 3882, 26079, 868, 15, 187, 12442, 38347, 19604, 48239, 2731, 313, 47, 30748, 10, 342, 3882, 13204, 5161, 403, 6786, 13, 6701, 281, 271, 3236, 1232, 22128, 327, 4021, 14, 40121, 3882, 12420, 285, 3520, 19134, 12503, 313, 49, 8528, 10, 11937, 1320, 5018, 7668, 247, 14185, 6605, 15, 3973, 13, 25663, 273, 3882, 403, 14116, 342, 247, 10280, 494, 1232, 875, 374, 28592, 1029, 7529, 14722, 342, 23694, 18388, 12319, 432, 14212, 9153, 281, 374, 28592, 15, 380, 1232, 8414, 275, 253, 5926, 12503, 273, 247, 3882, 29331, 14, 545, 486, 2900, 327, 253, 14722, 3560, 407, 247, 10748, 35921, 3213, 15, 380, 12503, 1232, 310, 6537, 407, 253, 3882, 4719, 1561, 253, 6391, 2900, 13, 253, 5926, 4644, 13, 285, 253, 9885, 17957, 706, 5755, 15, 380, 14116, 25663, 403, 4720, 11937, 1025, 342, 2710, 9544, 265, 273, 30327, 285, 5328, 407, 247, 367, 8528, 299, 14, 33312, 35921, 1232, 15, 380, 6786, 26622, 84, 452, 247, 4871, 12319, 432, 247, 1643, 6399, 19045, 598, 281, 2233, 9153, 15, 380, 8545, 3879, 273, 253, 6786, 3925, 285, 5096, 9153, 4871, 18719, 26622, 84, 310, 2011, 281, 320, 5531, 6185, 285, 616, 15276, 5052, 310, 5998, 2556, 281, 1027, 38307, 3210, 273, 253, 26622, 2593, 2170, 15, 1198, 253, 5096, 9153, 4871, 26622, 84, 13, 247, 5052, 273, 670, 1643, 12506, 983, 310, 4232, 13, 5909, 17947, 4910, 323, 4893, 275, 2494, 30083, 982, 15, 18, 15, 7327, 273, 253, 5201, 14019, 187, 30731, 351, 3825, 10557, 11249, 14588, 3839, 281, 4870, 285, 4891, 32208, 323, 9969, 7668, 7665, 1493, 13, 811, 9358, 1877, 13, 285, 30839, 318, 15, 3010, 5742, 13, 24898, 10557, 11249, 14588, 281, 4870, 323, 253, 5415, 3275, 273, 8708, 6315, 684, 13, 8708, 12344, 312, 684, 285, 643, 3580, 3066, 7665, 1493, 13, 811, 9358, 1877, 13, 285, 16, 263, 30839, 318, 689, 247, 4891, 4229, 3722, 16803, 15, 329, 19663, 1963, 2755, 38347, 8508, 778, 320, 14949, 10208, 281, 253, 22578, 387, 1077, 1698, 2308, 281, 10265, 253, 4891, 16803, 2425, 323, 271, 6508, 5880, 2978, 15, 187, 19, 15, 17720, 187, 6189, 9358, 1877, 13, 390, 253, 6431, 4884, 273, 38739, 342, 6801, 3017, 313, 266, 7665, 1493, 4884, 582, 310, 271, 1774, 966, 273, 9969, 534, 778, 320, 19889, 4337, 407, 1097, 3527, 285, 2613, 32208, 15, 20599, 273, 811, 9358, 1877, 13, 275, 2087, 13, 2486, 5793, 9969, 7668, 8708, 6315, 684, 285, 22236, 31252, 3527, 38739, 347, 8071, 1103, 13, 3580, 13, 390, 1097, 15, 5131, 811, 9358, 1877, 9969, 2486, 253, 3275, 273, 1794, 4550, 293, 407, 811, 9358, 1877, 273, 47153, 342, 16075, 390, 26492, 15, 1219, 5905, 23575, 13, 275, 2087, 13, 310, 247, 4884, 835, 581, 390, 625, 5164, 2390, 273, 247, 8508, 403, 7932, 407, 9348, 9356, 390, 32553, 9356, 1387, 273, 271, 7665, 313, 18573, 390, 32553, 30721, 8508, 481, 20599, 273, 7665, 1493, 2486, 5793, 9969, 7668, 32739, 13, 835, 40299, 2390, 403, 7932, 407, 9348, 9356, 2390, 281, 4711, 8708, 12344, 312, 684, 285, 6315, 684, 15, 187, 10697, 3364, 31252, 3527, 38739, 403, 4197, 407, 811, 9358, 1877, 273, 247, 22236, 31252, 3527, 24153, 342, 271, 7665, 275, 253, 3361, 273, 3527, 285, 2613, 16803, 15, 322, 5773, 44107, 3527, 313, 12856, 10553, 10, 285, 3527, 37776, 313, 23706, 10, 403, 9013, 3527, 32208, 15, 8144, 13228, 14395, 13, 824, 347, 6897, 8575, 285, 611, 8575, 13, 2710, 6897, 16, 44, 9348, 1004, 1487, 390, 717, 1100, 313, 12856, 10553, 582, 285, 2710, 5044, 37776, 313, 23706, 10, 403, 9013, 2613, 32208, 15, 4129, 32208, 476, 320, 2057, 17010, 16803, 390, 22766, 16803, 323, 253, 811, 9358, 1877, 273, 22236, 31252, 38739, 13, 2613, 32208, 403, 13, 275, 2087, 13, 625, 3576, 685, 3527, 32208, 15, 1198, 1650, 13, 1048, 5931, 17519, 10258, 21800, 663, 38739, 403, 4197, 407, 6431, 4884, 273, 9758, 10258, 43070, 342, 247, 1048, 5931, 7665, 275, 253, 3361, 273, 247, 2613, 16803, 15, 187, 35, 1970, 447, 293, 778, 320, 4197, 407, 811, 9358, 1877, 273, 21436, 24201, 313, 39168, 24141, 1487, 10, 342, 26492, 390, 16075, 407, 970, 247, 17010, 2613, 16803, 13, 824, 347, 11914, 10258, 14420, 390, 11672, 23150, 13, 347, 10557, 275, 530, 15, 52, 15, 2790, 15, 18407, 15, 721, 13, 48063, 13, 25, 2251, 285, 608, 13, 37219, 13, 13381, 13, 285, 247, 5044, 4891, 16803, 13, 824, 347, 247, 6804, 11893, 273, 20458, 11893, 285, 355, 25029, 390, 20458, 355, 360, 4024, 313, 91, 1763, 11893, 4516, 327, 355, 25029, 285, 9039, 967, 387, 247, 1029, 3276, 481, 27057, 20458, 355, 360, 4024, 32208, 403, 10557, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 33648, 13, 26, 2950, 285, 530, 15, 52, 15, 11754, 11683, 20702, 1621, 15, 6157, 16, 41674, 21149, 13, 323, 1650, 15, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 33648, 13, 26, 2950, 14110, 247, 767, 14, 10539, 1232, 323, 9603, 38739, 407, 37986, 21436, 24201, 390, 5893, 24201, 342, 271, 7665, 275, 253, 3361, 273, 4891, 32208, 824, 347, 20458, 11893, 390, 5508, 293, 1511, 20458, 14992, 684, 15, 496, 253, 806, 3213, 13, 253, 9436, 273, 49020, 310, 6726, 281, 247, 1029, 9436, 13, 3798, 2169, 685, 5091, 7739, 496, 253, 1273, 3213, 13, 253, 5780, 47153, 13, 2836, 24141, 1487, 285, 1114, 19644, 1209, 1487, 403, 11516, 15, 380, 811, 9358, 6787, 403, 2684, 387, 247, 3276, 432, 20504, 281, 22752, 3272, 330, 15, 387, 670, 608, 15, 19, 2534, 313, 10383, 818, 1099, 3714, 571, 481, 4855, 9436, 4419, 4942, 1698, 2685, 4142, 273, 247, 3997, 7802, 313, 17, 15, 22, 288, 2106, 18, 390, 2406, 2317, 7602, 481, 187, 54, 15, 52, 15, 2790, 15, 1621, 15, 721, 13, 14555, 13, 19196, 14110, 247, 1232, 323, 9603, 1029, 24410, 14126, 3527, 38739, 432, 4444, 390, 5893, 4166, 275, 253, 3361, 273, 247, 22766, 16803, 313, 91, 1763, 355, 360, 4024, 481, 530, 15, 52, 15, 11754, 11683, 20702, 1621, 15, 6157, 16, 41674, 21149, 7033, 281, 247, 5162, 6974, 323, 9603, 17519, 38739, 432, 21436, 390, 5893, 4166, 285, 271, 7665, 275, 253, 3361, 273, 247, 22766, 16803, 313, 91, 1763, 355, 360, 4024, 481, 380, 38739, 403, 4197, 407, 811, 9358, 1877, 275, 767, 4229, 3722, 44262, 15, 4855, 9436, 273, 49020, 369, 2797, 275, 253, 806, 22578, 15, 2732, 23694, 34071, 432, 253, 806, 811, 9358, 1877, 4884, 5542, 13, 253, 5780, 10915, 13083, 49020, 13, 2836, 24141, 504, 285, 1114, 19644, 1209, 504, 403, 11516, 281, 38739, 275, 253, 1273, 22578, 15, 380, 811, 9358, 1877, 310, 2684, 387, 1052, 3272, 330, 904, 670, 9743, 2534, 313, 18104, 3714, 571, 10, 285, 470, 15, 22, 288, 2106, 18, 2317, 7602, 15, 187, 56, 15, 1594, 466, 1162, 355, 15, 313, 43, 15, 24429, 15, 12441, 15, 329, 27, 11382, 15, 30439, 13, 5403, 13, 7266, 2164, 14, 1237, 10, 2319, 26492, 1493, 273, 38810, 4166, 275, 253, 3361, 273, 247, 9039, 967, 17917, 1128, 2422, 4101, 22559, 41766, 16803, 15, 380, 9039, 967, 4101, 22559, 68, 3254, 342, 271, 17917, 16, 2422, 4313, 273, 495, 15, 17, 6012, 432, 1724, 5620, 569, 387, 6783, 3272, 330, 15, 310, 247, 16803, 326, 476, 1918, 1029, 5044, 414, 285, 7126, 19677, 2425, 323, 436, 4884, 15, 1583, 1304, 253, 19663, 5044, 414, 273, 253, 4101, 22559, 68, 3254, 9039, 967, 387, 2710, 9208, 15, 187, 37, 447, 293, 14917, 25526, 625, 1117, 17815, 285, 7651, 89, 685, 29312, 14917, 15, 733, 310, 2361, 326, 11901, 76, 1190, 6315, 684, 403, 3576, 275, 8493, 1117, 17815, 275, 28628, 3948, 9286, 15, 4794, 281, 530, 15, 52, 15, 2790, 15, 1621, 15, 608, 13, 41643, 13, 19100, 13, 32739, 285, 35212, 403, 3576, 7651, 89, 8493, 6083, 15, 1292, 970, 32739, 285, 35212, 323, 28628, 3948, 556, 8542, 3237, 390, 24890, 7545, 15, 530, 15, 52, 15, 2790, 15, 1621, 15, 721, 13, 11027, 13, 23926, 14110, 30097, 12344, 22021, 347, 3576, 387, 8493, 7651, 89, 432, 28628, 14917, 15, 530, 15, 52, 15, 2790, 15, 1621, 15, 577, 13, 24, 2405, 13, 18390, 313, 14619, 10, 5012, 326, 749, 2815, 264, 28422, 44107, 3527, 476, 320, 271, 3576, 5570, 323, 253, 20408, 390, 5141, 273, 7651, 89, 15, 4855, 3276, 749, 2815, 318, 273, 28422, 44107, 3527, 11330, 310, 26632, 280, 3527, 313, 48047, 5915, 582, 534, 310, 6566, 281, 320, 5506, 323, 20408, 273, 7651, 89, 15, 16602, 470, 1812, 1812, 3593, 285, 16602, 17796, 1812, 33304, 17611, 247, 39040, 24153, 273, 271, 355, 48629, 1195, 311, 390, 26823, 311, 347, 247, 4445, 273, 1698, 11283, 27203, 839, 6083, 15, 187, 47, 14, 31271, 9758, 12344, 22021, 310, 4197, 407, 4884, 273, 271, 24278, 40299, 342, 247, 40023, 39040, 13, 5431, 275, 253, 3361, 273, 247, 2613, 16803, 1955, 281, 1698, 4884, 4142, 275, 253, 5928, 273, 247, 16803, 15, 427, 14, 31271, 9758, 12344, 22021, 476, 320, 45765, 281, 4711, 24278, 310, 49581, 387, 10702, 3276, 15, 1198, 1650, 13, 281, 7675, 1751, 277, 23864, 67, 22021, 310, 4197, 407, 37986, 281, 7675, 1751, 1073, 6771, 342, 40023, 39040, 275, 253, 3361, 273, 247, 16803, 15, 1605, 42190, 273, 281, 7675, 1751, 277, 23864, 67, 22021, 387, 10702, 3276, 11026, 281, 7675, 1751, 1073, 261, 49581, 15, 187, 25727, 280, 6315, 684, 313, 37229, 1336, 273, 6315, 280, 3527, 10, 403, 4217, 7006, 326, 778, 320, 908, 347, 32281, 13, 17519, 839, 6083, 13, 6315, 16499, 6083, 13, 820, 14, 47712, 1320, 6083, 13, 7236, 36993, 13, 3966, 15, 18025, 4040, 39040, 313, 37, 7722, 10, 310, 271, 1774, 11901, 76, 1190, 39040, 13, 7744, 908, 347, 247, 9305, 2144, 323, 253, 3275, 273, 12539, 19692, 39040, 313, 37, 5077, 13, 247, 26899, 77, 39040, 481, 1707, 403, 2710, 4870, 323, 6264, 3275, 273, 399, 7722, 15, 496, 581, 824, 6264, 1232, 13, 399, 7722, 310, 4197, 407, 811, 9358, 1877, 273, 247, 19870, 39040, 342, 26492, 275, 253, 3361, 273, 247, 17010, 16803, 15, 4129, 21410, 778, 17611, 897, 273, 17010, 32208, 390, 22766, 32208, 323, 811, 9358, 1877, 273, 247, 19870, 39040, 342, 26492, 13, 627, 310, 4390, 642, 6264, 3946, 835, 247, 22766, 390, 4891, 16803, 310, 908, 323, 253, 3275, 273, 399, 7722, 13, 2779, 1955, 281, 253, 2159, 5880, 2978, 273, 22766, 32208, 323, 824, 4870, 15, 399, 5077, 310, 7744, 820, 14, 47712, 1025, 342, 247, 1073, 311, 13, 824, 347, 17542, 7806, 311, 329, 13, 281, 4711, 3488, 17027, 684, 15, 18371, 17027, 684, 403, 908, 275, 2710, 2714, 4893, 824, 347, 3541, 22916, 13, 5448, 32770, 84, 13, 11369, 45896, 13, 5748, 4753, 13, 3966, 15, 187, 10605, 5609, 323, 3275, 273, 26899, 77, 6315, 684, 970, 247, 1327, 14, 545, 375, 20857, 1232, 11330, 24278, 6315, 684, 13, 824, 347, 399, 5077, 13, 407, 811, 9358, 1877, 273, 399, 7722, 342, 45705, 281, 4711, 9758, 29901, 39040, 285, 26492, 13, 3560, 407, 30839, 318, 273, 253, 9758, 29901, 39040, 281, 4711, 399, 5077, 285, 399, 7722, 275, 253, 3361, 273, 17010, 1963, 2755, 38347, 32208, 407, 19693, 247, 2962, 273, 2709, 17411, 940, 21755, 44262, 15, 329, 9013, 17010, 16803, 310, 30327, 9348, 14420, 15, 6102, 4870, 403, 10557, 275, 530, 15, 52, 15, 2790, 15, 18407, 15, 577, 13, 21274, 13, 41328, 13, 577, 13, 46027, 13, 7749, 13, 608, 13, 16899, 13, 22913, 13, 285, 721, 13, 44527, 13, 41612, 13, 323, 1650, 15, 380, 17010, 32208, 403, 12372, 432, 253, 3573, 10558, 5110, 273, 253, 1885, 17795, 347, 247, 4891 ]
use the term liberally.)Of course this raises a host of other questions. Why did God form a covenant with Israel knowing Israel couldn't keep up her end of the deal? Why is an omnipotent God bound by the moral logic of ancient Semitic covenants? And so on. These are interesting and important questions. But they are very different sorts of questions than those thrown up by PSA. And, perhaps most importantly, they are questions that step around the most problematic aspects of PSA in the eyes of many modern Christians.Metallic Conductive Nanowires Elaborated by PVD Metal Deposition on Suspended DNA Bundles. Metallic conductive nanowires (NWs) with DNA bundle core are achieved, thanks to an original process relying on double-stranded DNA alignment and physical vapor deposition (PVD) metallization steps involving a silicon substrate. First, bundles of DNA are suspended with a repeatable process between 2 µm high parallel electrodes with separating gaps ranging from 800 nm to 2 µm. The process consists in the drop deposition of a DNA lambda-phage solution on the electrodes followed by a naturally evaporation step. The deposition process is controlled by the DNA concentration within the buffer solution, the drop volume, and the electrode hydrophobicity. The suspended bundles are finally metallized with various thicknesses of titanium and gold by a PVD e-beam evaporation process. The achieved NWs have a width ranging from a few nanometers up to 100 nm. The electrical behavior of the achieved 60 and 80 nm width metallic NWs is shown to be Ohmic and their intrinsic resistance is estimated according to different geometrical models of the NW section area. For the 80 nm width NWs, a resistance of about few ohms is established, opening exploration fields for applications in microelectronics.1. Field of the Disclosure Embodiments disclosed herein relate generally to processes and solid catalysts for reactions involving alcoholysis, transesterification, and disproportionation. More specifically, embodiments disclosed herein relate to processes for the continuous production of organic carbonates, organic carbamates and other products via alcoholysis, transesterification, and/or disproportionation over a solid fixed bed catalyst. A soluble organometallic compound may be continuously fed to the reactor at very low levels to sustain the solid catalyst activity for an extended cycle length. 2. Background Transesterification, or the exchange reaction of esters with alcohols (an alcoholysis reaction), is an important class of reactions which may be catalyzed by both acid and base catalysts. Examples of transesterification, in general, include chemical reactions involving organic carbonates and carboxylic acid esters as reactants, products, or both. Other transesterification reactions include the production of biodiesel by transesterification of triglycerides with ethanol or methanol. Alcoholysis, in general, is a reaction where one or more functional groups of a compound are replaced by alkoxy or aryloxy group of an alcohol (alkyl or aryl hydroxyl compound). Examples of alcoholysis include chemical reactions involving urea, where amine groups are replaced by alkoxy groups to produce organic carbamates and carbonates. Carboxylic acid esters are produced by transesterification of a carboxylic acid ester with an alcohol in the presence of acid and base catalyst. Sulfuric acid (homogeneous) and acid resins (solid) are preferred acid catalysts. Soluble bases, such as NaOH and KOH, various Na/K alkoxides or amines (homogeneous), and various basic resins (solid) are preferred base catalysts. Although catalysts can be either homogeneous catalyst or heterogeneous catalyst for the transesterification of carboxylic esters, base catalysts are, in general, more effective than acid catalysts. For example, long chain alkyl methacrylic esters are produced by exchange reaction of methyl methacrylate with a long chain alcohol in the presence of a base catalyst. Biodiesel may be produced by transesterification of vegetable oils (triglycerides) with methanol or ethanol by using a homogeneous base catalyst, such as sodium methoxide or calcium acetate, as disclosed in U.S. Pat. Nos. 6,712,867 and 5,525,126, and a basic solid catalyst, such as a mixed oxide of zinc oxide and alumina or zinc aluminate (zinc oxide supported on alumina and calcined at a high temperature). Solid zinc aluminate catalysts are disclosed in U.S. Pat. No. 5,908,946 and U.S. Patent Application Publication No. 2004/0034244, for example. U.S. Pat. No. 5,908,946 discloses a two-step process for producing esters by reacting vegetable oils or animal oils with an alcohol in the presence of solid catalysts such as zinc oxide or spinel type zinc aluminates. In the first step, the conversion of triglyceride is forced to a high conversion, usually higher than 90%. In the second step, the remaining triglycerides, diglycerides and monoglycerides are converted. The transesterifications are performed at a temperature from 230 to 245° C. at about 5.2 bar (about 725 psia). High conversion requires relatively low flow rates of a feed mixture (0.5 h−1 or lower space velocity). U.S. Pat. No. 6,147,196 discloses a process for producing high purity fatty acid esters from plant or animal oil in the presence of a heterogeneous catalyst (zinc aluminate). U.S. Patent Application Publication No. 2004/0034244 relates to a processing scheme for producing alkyl esters from vegetable or animal oil and an alcohol in the presence of a heterogeneous catalyst (zinc aluminate). The esters are produced by transesterification in two fixed bed reactors. High conversion of triglyceride was obtained in the first reactor. After separating glycerol from the first transesterification reaction stream, the remaining unconverted triglyceride, diglyceride and monoglyceride are converted to esters in the second reactor. The transesterification is performed at 200° C., about 62 bar (900 psia) and 0.5 h−1 space velocity. W. Xie et al. (J. Mol. Cat. A: Chem. 246, 2006, pp 24-32) discuss methanolysis of soybean oil in the presence of a calcined Mg—Al hydrotalcite catalyst. The calcined hydrotalcites with an Mg/Al ratio of 3.0 derived from calcinations at 500° C. is a catalyst that can give high basicity and excellent catalytic activity for this reaction. They report the soluble basicity of the hydrotalcites calcined at various temperatures. Diesel engines emit more particulates and NOx than gasoline engines. It is reported that dialkyl carbonates are effective in reducing particulates in diesel engine exhaust. According to U.S. Pat. No. 5,954,280, urea and ammonia are effective NOx reducing agents. But using urea and ammonia for diesel engine has practical problems or inconveniences. U.S. Pat. No. 6,017,368 discloses ethyl carbamate as effective at reducing NOx from diesel engines. U.S. Pat. No. 4,731,231 (1988) reports that sublimed cyanuric acid can be an effective agent for the elimination or reduction of NOx. High temperature sublimation of cyanuric acid produces isocyanic acid (HNCO), which is believed to be responsible for elimination of NOx. EP 0363681 and EP 0636681 disclose a carbonate ester of an aliphatic triol or tetraol as a component of low smoke lubricating agents. N-aryl methyl carbamate is produced by reaction of an aromatic amine with a dimethyl carbonate, typically in the presence of a base catalyst due to low reaction rates in the absence of a catalyst. N-aryl methyl carbamate can be decomposed to produce aromatic isocyanate at elevated temperature. For example, toluene dicarbamate is produced by reacting toluene diamine with dimethyl carbonate in the presence of a catalyst. Decomposition of toluene dicarbamate at elevated temperature yields toluene diisocyanate. Organic carbonates (diesters of carbonic acid) are useful compounds that may be used as solvents, alkylating agents, carbonylation agents, co-polymerization agents, fuel additives, etc. Dimethyl carbonate (DMC) is an important dialkyl carbonate, commonly used as a raw material for the production of diphenyl carbonate (DPC, a diaryl carbonate). There are various processes for commercial production of DMC. In one such commercial process, DMC is produced by transesterification of a cyclic carbonate with methanol in the presence of a homogeneous catalyst. Although patents may disclose use of homogeneous catalysts or heterogeneous catalysts for transesterification of a cyclic carbonate with methanol, there is currently no commercial practice where a heterogeneous or solid catalyst is used for the production of DMC, likely due to the short cycle length of heterogeneous catalysts for such processes. DPC is commonly co-polymerized with a diol, such as bisphenol A, to produce polycarbonates. Polycarbonates are used in various special applications such as memory disks, windshields, engineering plastics, optical materials, etc. Current techniques for production of diaryl carbonates using a non-phosgene process produces aromatic carbonates, such as DPC, by transesterification of DMC with phenol to produce methyl phenyl carbonate and methanol, followed by disproportionation of the methyl phenyl carbonate to produce DPC and DMC in the presence of homogeneous organometallic catalysts by employing a series of multiple reactive distillation reactors. A preferred homogeneous catalyst is titanium alkoxide. Such processes are disclosed in U.S. Pat. Nos. 4,045,464, 4,554,110, 5,210,268, and 6,093,842, for example. The homogeneous catalysts are recovered from the heaviest portion of the product streams as a solid
[ 3136, 13, 9385, 187, 9707, 34916, 16768, 187, 18, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 19, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 20, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 987, 23469, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 21, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 987, 23469, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 22, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 19379, 12267, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 23, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 19379, 12267, 8984, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 24, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 273, 2579, 4602, 323, 10963, 6378, 323, 247, 16138, 8984, 15, 187, 25, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 247, 16138, 8984, 323, 10963, 6378, 15, 187, 26, 15, 12369, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 247, 1750, 323, 2579, 4602, 323, 39565, 273, 253, 660, 8601, 360, 15, 187, 740, 15, 11198, 262, 1338, 281, 2579, 4602, 323, 247, 1698, 896, 12564, 13, 1690, 347, 6561, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 15, 187, 883, 15, 11198, 262, 1338, 281, 247, 7037, 494, 12564, 13716, 323, 247, 617, 8311, 33470, 12689, 15, 187, 805, 15, 11198, 262, 1338, 281, 247, 12564, 13716, 3687, 685, 884, 2558, 2720, 281, 4163, 4562, 13, 6752, 13, 3687, 685, 1884, 2558, 432, 4163, 4562, 13, 6752, 13, 281, 2552, 1903, 13, 4332, 13, 285, 3687, 685, 2456, 2558, 17096, 13, 323, 19379, 27246, 2098, 316, 15, 187, 1012, 15, 11198, 262, 1338, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 247, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 187, 1848, 42706, 3489, 6570, 187, 16667, 6607, 407, 27, 9385, 329, 15, 35480, 472, 14, 34972, 90, 13, 10158, 387, 5405, 187, 56, 1433, 17582, 4915, 10197, 1277, 2637, 8160, 17870, 1556, 187, 510, 44117, 187, 20905, 1372, 40740, 6651, 3003, 20466, 10449, 187, 43, 15, 47, 15, 6956, 1832, 13, 19330, 187, 1042, 32585, 187, 510, 44117, 574, 3939, 2579, 432, 4565, 24652, 281, 4596, 24178, 15, 187, 1552, 1083, 556, 247, 1048, 285, 9542, 19993, 2892, 15, 831, 2647, 3249, 1078, 253, 5986, 273, 30109, 8, 9892, 313, 32994, 10, 327, 4549, 432, 2067, 13716, 7089, 6808, 407, 253, 4487, 273, 30109, 17528, 313, 16568, 10, 19804, 7454, 313, 13935, 481, 10300, 253, 9542, 19993, 2892, 273, 253, 44117, 434, 4390, 20652, 3916, 13, 253, 5986, 588, 2953, 1016, 1750, 275, 1614, 275, 436, 12276, 15, 187, 510, 44117, 434, 3916, 281, 37605, 253, 3786, 5868, 3916, 323, 2579, 4602, 323, 619, 375, 5895, 273, 253, 987, 1791, 16, 76, 31066, 13, 987, 23469, 8984, 13, 19379, 12267, 8984, 13, 285, 247, 16138, 8984, 1705, 281, 253, 5986, 327, 4549, 432, 247, 3919, 4332, 13716, 3061, 15, 380, 5986, 556, 247, 4320, 7143, 762, 6480, 530, 15, 52, 15, 36, 15, 34, 15, 20485, 608, 12347, 13, 818, 11238, 313, 15491, 4059, 10, 281, 2953, 253, 1953, 273, 1880, 747, 285, 2144, 1941, 556, 644, 2959, 281, 37605, 253, 1750, 323, 2579, 4602, 15, 2064, 2647, 4566, 281, 253, 5986, 434, 7571, 281, 3986, 253, 6944, 1750, 285, 21633, 9038, 253, 1750, 327, 247, 372, 17590, 3720, 15, 2594, 15359, 3592, 362, 15, 7233, 13, 11439, 401, 15, 20, 69, 2145, 1438, 13, 15410, 20, 313, 28246, 15, 4082, 15, 8441, 481, 1284, 253, 5986, 1364, 806, 7617, 1880, 747, 285, 2144, 1941, 281, 37605, 253, 3916, 556, 644, 2959, 285, 13, 275, 1859, 273, 253, 5986, 434, 13857, 3061, 327, 841, 9762, 281, 37605, 13, 253, 5986, 556, 7943, 841, 3374, 347, 46940, 1097, 253, 3916, 281, 37605, 347, 973, 347, 253, 3916, 323, 38668, 281, 2579, 4602, 327, 253, 16108, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 15, 380, 3919, 4332, 13716, 3061, 671, 5868, 253, 44117, 434, 2748, 281, 37605, 247, 1750, 323, 2579, 4602, 323, 39565, 273, 253, 660, 8601, 360, 15, 1284, 5469, 2007, 2708, 13, 253, 44117, 9262, 247, 4366, 273, 30859, 281, 436, 3061, 275, 3978, 4332, 13, 533, 253, 16636, 556, 417, 6808, 247, 3908, 273, 253, 1083, 15, 187, 1552, 2647, 310, 671, 327, 4549, 432, 271, 4437, 4748, 13716, 3061, 534, 5868, 253, 44117, 434, 3916, 281, 37605, 253, 2523, 273, 2579, 4602, 323, 247, 1698, 896, 8984, 347, 973, 347, 38668, 281, 247, 7037, 494, 12564, 13716, 323, 247, 617, 8311, 33470, 12689, 15, 187, 21342, 13, 275, 247, 3919, 6157, 13716, 3061, 13, 253, 16636, 7169, 2579, 4602, 323, 27246, 2098, 316, 342, 11134, 47073, 2544, 387, 253, 806, 1313, 255, 1032, 2689, 267, 912, 267, 313, 47887, 10, 6036, 273, 253, 987, 3174, 13, 34018, 247, 884, 2558, 13716, 3576, 4163, 4562, 13, 6752, 13, 285, 323, 27246, 2098, 316, 342, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 1669, 3174, 13, 34018, 247, 884, 2558, 13716, 3576, 4163, 4562, 13, 6752, 15, 2732, 253, 44117, 3962, 264, 247, 14793, 4549, 327, 841, 3916, 13, 275, 271, 4162, 4695, 3061, 13, 253, 5986, 294, 17932, 1025, 253, 3374, 327, 4549, 347, 38668, 281, 271, 2559, 13716, 323, 19379, 27246, 2098, 316, 13, 4390, 20139, 347, 884, 2558, 44276, 323, 253, 987, 3174, 285, 347, 884, 2558, 44276, 323, 253, 1669, 3174, 13, 285, 38668, 281, 247, 4858, 7037, 494, 13716, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 987, 285, 1669, 3174, 15, 380, 5986, 671, 5868, 253, 44117, 434, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 13, 6760, 347, 884, 2558, 44276, 275, 1016, 273, 521, 4669, 13, 285, 7169, 4858, 884, 2558, 17503, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 6036, 273, 253, 987, 285, 1669, 3174, 15, 187, 14358, 253, 44117, 13, 949, 521, 6834, 13, 285, 20165, 434, 7454, 273, 4214, 19330, 20652, 253, 5986, 434, 4162, 4695, 3061, 281, 253, 2111, 407, 12108, 247, 23106, 16066, 323, 6235, 395, 313, 47212, 16066, 481, 6295, 4676, 4879, 275, 253, 23106, 16066, 326, 597, 497, 23176, 760, 253, 5986, 434, 13336, 273, 271, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 285, 417, 253, 12714, 273, 4858, 884, 2558, 17503, 323, 11134, 47073, 2544, 387, 253, 806, 353, 12261, 273, 253, 987, 285, 1669, 3174, 15, 380, 1986, 2077, 273, 9892, 323, 30109, 27120, 313, 18336, 10, 7169, 253, 23106, 16066, 275, 5080, 4267, 15, 187, 688, 4437, 4267, 13, 253, 5986, 27013, 253, 44117, 434, 2559, 13716, 1750, 323, 19379, 27246, 2098, 316, 13, 4390, 20139, 347, 884, 2558, 44276, 323, 253, 987, 3174, 285, 347, 884, 2558, 44276, 323, 253, 1669, 3174, 13, 281, 253, 16636, 3066, 253, 9892, 11354, 5197, 313, 2300, 36, 10, 275, 5041, 13, 9087, 13, 323, 3081, 2440, 15, 187, 688, 247, 4397, 4332, 13716, 3061, 13, 253, 16636, 2559, 253, 19379, 27246, 2098, 316, 12564, 13716, 281, 1884, 2558, 13, 3576, 4163, 4562, 13, 6752, 285, 281, 2456, 2558, 13, 3576, 2552, 1903, 13, 4332, 15, 1723, 13, 835, 627, 310, 642, 4518, 4469, 6860, 281, 2701, 253, 4549, 281, 38668, 281, 247, 7616, 12564, 13716, 13, 253, 16636, 285, 5986, 403, 2424, 281, 1908, 38668, 281, 512, 2130, 17503, 323, 326, 1617, 15, 12056, 362, 15, 7233, 13, 721, 657, 292, 15, 2946, 15, 4791, 13, 6931, 313, 13549, 481, 380, 2523, 3103, 4558, 275, 16939, 3708, 285, 556, 644, 7943, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 15, 187, 510, 3919, 4332, 13716, 3061, 671, 5868, 253, 44117, 434, 1750, 273, 38668, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 253, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 380, 5986, 310, 7709, 478, 386, 273, 253, 2111, 434, 5877, 275, 416, 7937, 362, 15, 16982, 42304, 13, 1384, 657, 292, 15, 2051, 15, 33723, 313, 8603, 582, 275, 534, 352, 369, 3413, 326, 13, 2378, 247, 13716, 3061, 534, 25097, 271, 3576, 3522, 4916, 2457, 13, 253, 760, 1039, 326, 824, 247, 3061, 476, 320, 17265, 310, 604, 352, 4428, 2590, 285, 49273, 494, 2228, 313, 36, 6028, 481, 380, 2111, 4879, 326, 667, 643, 906, 651, 9084, 4513, 253, 4086, 273, 2457, 414, 15, 496, 643, 3000, 13, 253, 2111, 556, 1119, 326, 627, 403, 642, 4107, 383, 46160, 3916, 323, 271, 4321, 3576, 3522, 15, 2091, 824, 247, 4107, 383, 46160, 1750, 310, 5439, 13, 253, 2111, 556, 2918, 326, 824, 271, 4549, 943, 320, 11511, 15, 4031, 15, 387, 29949, 14, 7554, 15, 187, 688, 436, 1083, 13, 253, 5986, 11941, 2579, 4602, 323, 19379, 27246, 2098, 316, 275, 271, 4223, 7901, 3061, 15, 380, 16636, 1055, 11634, 824, 5722, 275, 247, 3978, 10226, 13716, 3061, 285, 7922, 271, 3576, 3522, 273, 3978, 3285, 13, 8210, 15, 313, 15852, 6168, 1037, 13, 253, 5986, 7211, 326, 6774, 13716, 2127, 14526, 5224, 326, 253, 3576, 3522, 323, 2579, 4602, 369, 2686, 3978, 337, 13, 12034, 347, 873, 6593, 327, 253, 2914, 3239, 273, 436, 3061, 2698, 380, 3916, 1873, 2722, 326, 275, 3978, 9748, 13, 253, 44117, 4724, 247, 3908, 8445, 346, 1221, 287, 4507, 3, 7830, 323, 521, 19379, 27246, 2098, 316, 347, 253, 8984, 369, 2011, 327, 521, 10143, 8368, 15, 380, 5986, 9010, 326, 436, 3908, 310, 247, 14793, 4366, 273, 30859, 281, 253, 3576, 3522, 7922, 15, 13162, 13, 347, 253, 44117, 4724, 247, 14793, 4366, 273, 30859, 281, 253, 13716, 2250, 326, 7169, 2579, 4602, 13, 436, 2647, 858, 417, 2489, 2457, 342, 1675, 281, 253, 3576, 3522, 7922, 15, 496, 1614, 13, 275, 436, 1083, 13, 627, 310, 642, 4107, 383, 46160, 1750, 323, 271, 4321, 3576, 3522, 323, 253, 5722, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 285, 253, 5986, 778, 7617, 253, 2523, 327, 253, 16108, 15, 187, 688, 271, 4162, 4050, 3061, 13, 253, 5986, 294, 31370, 253, 44117, 434, 1750, 323, 2579, 4602, 323, 247, 1698, 896, 12564, 13, 1690, 347, 1955, 281, 2579, 14, 14063, 19379, 27246, 2098, 316, 13, 285, 27013, 436, 2523, 327, 253, 16108, 347, 973, 347, 253, 3374, 273, 38668, 281, 2559, 17503, 323, 247, 617, 8311, 33470, 12689, 285, 19379, 27246, 2098, 316, 285, 38668, 281, 271, 4321, 3576, 3522, 685, 3978, 337, 13, 12034, 13, 323, 247, 4098, 273, 2579, 4602, 323, 19379, 27246, 2098, 316, 15, 187, 510, 5986, 556, 7799, 6485, 3739, 11626, 432, 253, 30109, 4775, 13500, 313, 55, 10114, 481, 657, 10114, 11626, 497, 2959, 275, 4437, 4059, 285, 275, 3919, 4104, 15, 496, 4223, 4104, 13, 20165, 2530, 841, 11626, 281, 253, 44117, 285, 521, 8612, 342, 247, 3925, 14, 1201, 2180, 273, 673, 281, 2085, 3081, 1941, 285, 16, 263, 4154, 15, 187, 34, 5986, 4854, 275, 5041, 13, 399, 15, 36, 15, 369, 2918, 275, 3919, 5826, 1078, 247, 30109, 5405, 6798, 665, 9674, 14373, 432, 253, 5986, 28, 253, 4854, 7045, 310, 2330, 342, 253, 1924, 15, 380, 760, 2523, 4390, 327, 4549, 9713, 387, 436, 5986, 4854, 369, 38668, 281, 2559, 13716, 323, 27246, 2098, 316, 342, 47073, 2544, 273, 253, 1669, 3174, 285, 253, 987, 3174, 15, 313, 15852, 6168, 1037, 13, 253, 5986, 7211, 326, 253, 4854, 6206, 671, 5469, 253, 2523, 273, 2579, 4602, 323, 247, 1698, 896, 12564, 15, 1723, 13, 253, 5986, 9674, 5868, 436, 2523, 275, 247, 5080, 5215, 3061, 326, 3395, 2457, 342, 1675, 281, 436, 2647, 2698, 1284, 253, 5986, 4879, 275, 4162, 4695, 13, 253, 44117, 13072, 247, 747, 4854, 1078, 247, 1027, 30109, 5405, 6798, 275, 5080, 4695, 17668, 15, 2594, 6480, 530, 15, 52, 15, 36, 15, 34, 15 ]
oke, Virginia THE ISSUES 1. Whether new and material evidence has been received to reopen a claim of service connection for myositis of the right leg/knee, including as secondary to service-connected bilateral pes planus. 2. Entitlement to service connection for myositis of the right leg/knee, including as secondary to service-connected bilateral pes planus. 3. Whether new and material evidence has been received to reopen a claim of service connection for right ankle disorder, including as secondary to service-connected bilateral pes planus. 4. Entitlement to service connection for right ankle disorder, including as secondary to service-connected bilateral pes planus. 5. Whether new and material evidence has been received to reopen a claim of service connection for bilateral knee disorder, including as secondary to service-connected bilateral pes planus. 6. Entitlement to service connection for bilateral knee disorder, including as secondary to service-connected bilateral pes planus. 7. Whether new and material evidence has been received to reopen a claim of service connection for compensation purposes for a dental disorder. 8. Entitlement to service connection for a dental disorder for compensation purposes. 9. Whether new and material evidence has been received to reopen a claim for service connection for fungus of the scrotum. 10. Entitlement to service connection for a low back disability, including as secondary to service-connected bilateral pes planus. 11. Entitlement to a compensable disability rating for a hernioplasty scar. 12. Entitlement to a disability rating greater than 10 percent prior to July 31, 2002, greater than 30 percent from July 31, 2002, to May 11, 2011, and greater than 50 percent thereafter, for bilateral pes planus. 13. Entitlement to an earlier effective date than June 1, 1987, for a grant of service connection for bilateral pes planus. REPRESENTATION Appellant represented by: Virginia A. Girard-Brady, Attorney at Law WITNESS AT HEARING ON APPEAL The Veteran ATTORNEY FOR THE BOARD J.N. Moats, Counsel INTRODUCTION The Veteran had active service from December 1952 to November 1954. This case has a long and complicated procedural history. This matter comes before the Board of Veterans' Appeals (Board) on appeal from several rating decisions issued by the Department of Veterans Affairs (VA) Regional Office (RO). Given the complicated procedural history of the Veteran's currently appealed claims, the Board will address each claim in turn in this Introduction. The Veteran's claims to reopen the previously denied claims for service connection for myositis of the right leg/knee, right ankle disorder, bilateral knee disorder, and a dental disorder come to the Board on appeal from a March 2011 rating decision. The Board has a legal duty under 38 U.S.C.A. §§ 5108, 7104 (West 2014) to address the question of whether new and material evidence has been received to reopen the claim for service connection. That matter goes to the Board's jurisdiction to reach the underlying claim and adjudicate the claim on a de novo basis. See Barnett v. Brown, 83 F.3d 1380, 1383 (Fed. Cir. 1996). As the Board must first decide whether new and material evidence to reopen the claims has been received and, in view of the Board's favorable decision on these requests to reopen, the Board has characterized these issues as encompassing both the claims to reopen as well as the claims for entitlement to service connection on the merits as set forth on the front page of this decision. The March 2011 rating decision also denied the Veteran's request to reopen a claim for service connection for fungus of the scrotum. As discussed further below, the Veteran submitted a notice of disagreement to this decision in June 2011, but the RO has not issued a statement of the case. This matter is also on appeal from an October 2009 rating decision which denied the Veteran's claims to reopen the issue of service connection for a low back disorder as well as entitlement to a compensable disability rating for a hernioplasty scar. Moreover, in a March 2004 rating decision, the RO granted service connection for pes planus with mild degenerative changes at the first metatarsophalangeal (MTP) joint of the right foot, assigning a 10 percent rating effective July 31, 2002, and for pes planus with mild degenerative changes at the first MTP joint of the left foot, assigning a 10 percent rating effective July 31, 2002. After the Veteran perfected a timely appeal on these claims, in an April 2008 decision, the Board recharacterized the issues on appeal as entitlement to an increased rating for bilateral pes planus, currently rated as 10 percent disabling for the right foot and as 10 percent disabling for the left foot, and entitlement to a separate compensable rating for mild degenerative changes at the first MTP joint of the right and left foot. The Board also denied the Veteran's increased rating claim for bilateral pes planus, evaluated as 10 percent disabling in each of his feet, and granted separate 10 percent ratings for mild degenerative changes at the first MTP joint of the right and left foot. Both the Veteran, through his attorney, and VA's Office of General Counsel appealed the Board's April 2008 decision to the Court by filing a Joint Motion for Remand (Joint Motion). Both parties noted in the Joint Motion that they were appealing only the Board's denial of an increased rating claim for bilateral pes planus and not the assignment of separate 10 percent ratings for mild degenerative changes at the first MTP of the right and left foot. The United States of Appeals for Veterans Claims (Court) granted the Joint Motion in February 2010. In October 2010, the Board remanded the Veteran's increased rating claim for bilateral pes planus, currently rated as 10 percent disabling for the right foot and as 10 percent disabling for the left foot, to the RO via the Appeals Management Center (AMC) in Washington, DC, for additional development. In a September 2011 rating decision, the RO increased the bilateral pes planus disability rating to 30 percent, effective July 31, 2002 and to 50 percent, effective May 11, 2011. However, where there is no clearly expressed intent to limit the appeal to entitlement to a specified disability rating, the RO and Board are required to consider entitlement to all available ratings for that condition. AB v. Brown, 6 Vet.App. 35, 39 (1993). The issue therefore remains in appellate status and has been characterized as set forth on the front page of this decision. The March 2011 rating decision also denied the Veteran's claim of entitlement to an earlier effective date than June 1, 1987, for the grant of service connection for bilateral pes planus. The Board is cognizant of the Court's holding in Rudd v. Nicholson, 20 Vet. App. 296 (2006), in which it was determined that, once a rating decision which establishes an effective date becomes final, the only way that such a decision can be revised is if it contains clear and unmistakable error (CUE). The Court noted that any other result would vitiate the rule of finality. In other words, the Court has found that there are no freestanding claims for an earlier effective date. When such a freestanding claim is raised, the Court has held that such an appeal should be dismissed. Id. at 299-300. In this case, the Board awarded service connection for bilateral pes planus in an August 1990 decision. The RO effectuated such award in a June 1991 rating decision and assigned an effective date of June 29, 1997. (Parenthetically, the Board notes that subsequent rating code sheets indicate that the effective date for service connection was actually June 1, 1987 as set forth on the front page of this decision.) The claims file shows that in June 1992, the Veteran filed a statement seeking "retroactive" payment for his bilateral pes planus as the disorder was shown on his discharge examination. The Board finds that this statement is a timely notice of disagreement to the effective date assigned. Consequently, as the Veteran filed a timely notice of disagreement to the rating action that granted service connection, this matter did not become final with respect to the effective date assigned. In turn, in this case, there is no freestanding claim for an earlier effective date for the award of service connection for bilateral pes planus and the Board may decide the issue on the merits. In an April 2012 decision, the Board reopened the Veteran's claim for service connection for a low back disability, including as due to service-connected bilateral pes planus, and remanded this issue on the merits as well as the issues of entitlement to increased ratings for a hernioplasty scar and bilateral pes planus and entitlement to an earlier effective date than June 1, 1987, for a grant of service connection for bilateral pes planus. The Board has sought expert medical opinions from the Veterans Health Administration (VHA). VHA opinions were received in October 2014 and in March 2015. In August 2015, VA provided these opinions to the Veteran and his representative with a 60-day period of time to provide additional evidence and/or argument. A Board hearing in Washington, D.C. was held in March 2005 before a Veterans Law Judge who subsequently retired from the Board; the hearing transcript is associated with the record. The only issue currently on appeal addressed at this Board hearing was entitlement to increased rating for pes planus with degenerative changes of the left foot and the right foot. (Parenthetically, the Board notes that the hearing testimony also discussed the issue of service connection for a low back disability. However, the Board subsequently denied this issue in a February 2007 decision that became final with respect to this matter.) As the Board noted in April 2008, the Veteran declined a new hearing before a different Veterans Law Judge in February 2008 correspondence. See 38 U.S.C.A.
[ 15, 187, 50274, 94, 535, 50274, 9486, 20605, 17526, 26735, 1082, 187, 50274, 92, 187, 50270, 1403, 1942, 17526, 1672, 15, 12965, 36810, 3001, 4155, 15, 11589, 272, 15, 11589, 15, 33669, 9, 9138, 4027, 187, 50274, 94, 187, 94, 187, 187, 510, 4836, 1375, 816, 4558, 347, 686, 13689, 272, 2214, 6014, 7639, 5983, 9876, 3780, 871, 2139, 436, 651, 5108, 32, 187, 187, 34, 27, 187, 187, 18071, 27, 380, 4385, 432, 12167, 8148, 552, 703, 1397, 625, 1708, 27, 187, 187, 35087, 8695, 19158, 8241, 1320, 5856, 310, 253, 23457, 383, 7092, 15, 733, 26574, 5779, 347, 34265, 2581, 685, 35576, 285, 4648, 247, 5569, 281, 13194, 697, 30679, 581, 387, 247, 673, 15, 26989, 8695, 19158, 8241, 1320, 5856, 1057, 417, 2430, 32341, 4052, 896, 281, 253, 1072, 6293, 313, 2858, 1057, 878, 281, 1379, 253, 5569, 558, 253, 3846, 4348, 327, 21050, 310, 984, 253, 26272, 310, 6179, 323, 253, 5569, 313, 13028, 407, 253, 6293, 275, 253, 2362, 16454, 10, 187, 187, 3220, 5476, 310, 326, 627, 434, 247, 14139, 8241, 1320, 5856, 534, 310, 17190, 253, 26272, 281, 1408, 327, 253, 1072, 6293, 347, 253, 2362, 16454, 15, 5402, 2362, 16454, 310, 14589, 326, 6293, 13, 594, 253, 26272, 1620, 6613, 13, 534, 2097, 253, 2362, 16454, 588, 1620, 440, 6172, 15, 187, 2773, 434, 760, 247, 5476, 2167, 428, 352, 434, 253, 760, 2181, 309, 476, 1158, 273, 534, 2789, 3282, 387, 253, 2774, 15, 187, 4041, 4500, 281, 1611, 281, 440, 6172, 436, 310, 281, 1818, 634, 26735, 1332, 281, 27, 187, 9486, 20605, 17526, 26735, 1082, 187, 92, 187, 50274, 1403, 1942, 17526, 1672, 15, 12965, 36810, 3001, 4155, 15, 11589, 272, 15, 11589, 15, 33669, 9, 9138, 1228, 187, 50262, 15, 6155, 459, 34, 14061, 9, 25674, 2374, 17745, 1520, 5856, 27, 3221, 558, 187, 94, 187, 187, 2773, 588, 1581, 253, 26272, 281, 3426, 327, 247, 1027, 3634, 15, 187, 42, 1353, 9861, 627, 310, 824, 247, 27801, 3634, 13, 2564, 368, 1051, 309, 1871, 1902, 512, 273, 436, 281, 816, 5108, 327, 253, 6293, 6363, 15, 23443, 4360, 22929, 6825, 310, 4127, 5777, 24443, 15, 535, 510, 38615, 280, 285, 32402, 528, 9811, 273, 253, 16955, 754, 67, 3088, 18680, 310, 642, 5545, 247, 344, 37724, 6617, 15, 8079, 13, 16955, 754, 67, 3088, 457, 84, 760, 6617, 369, 326, 352, 4469, 271, 4743, 15, 1723, 21210, 581, 778, 2868, 326, 4743, 281, 320, 13, 1620, 310, 326, 247, 22861, 323, 247, 6010, 10636, 824, 347, 326, 534, 2335, 1659, 3063, 15, 44605, 314, 513, 253, 3000, 273, 6845, 49761, 5818, 594, 31311, 28, 773, 42, 513, 417, 5194, 342, 752, 368, 452, 281, 1333, 13, 533, 309, 457, 620, 2342, 281, 253, 2471, 634, 987, 281, 1333, 352, 6598, 187, 187, 6436, 13, 253, 7870, 14149, 15995, 253, 3420, 14511, 23221, 2220, 271, 10466, 41679, 6828, 4404, 253, 8797, 3114, 13, 342, 41035, 3544, 273, 1852, 31469, 78, 1362, 482, 35668, 247, 3282, 273, 8294, 326, 556, 7369, 275, 247, 18829, 3543, 15995, 690, 16492, 13, 11392, 275, 247, 5149, 273, 48754, 323, 247, 6617, 597, 858, 417, 4514, 15, 41332, 27815, 824, 347, 2802, 18913, 23490, 342, 8033, 1204, 457, 403, 14149, 13, 23668, 839, 253, 8453, 273, 253, 2471, 273, 754, 67, 3088, 457, 84, 18680, 347, 8033, 457, 84, 2380, 281, 7185, 273, 6519, 2581, 685, 9610, 253, 6617, 347, 352, 310, 28, 247, 711, 14985, 494, 7701, 407, 25481, 1411, 18680, 15, 187, 187, 24804, 247, 1077, 8312, 4764, 32361, 432, 253, 38615, 414, 273, 436, 5320, 382, 15156, 13, 15260, 5911, 407, 247, 3420, 25204, 14, 73, 2084, 323, 247, 2675, 285, 31002, 6424, 7032, 273, 18462, 824, 6993, 15, 11056, 457, 84, 9811, 556, 642, 5545, 509, 8055, 253, 3270, 14, 34330, 21942, 7808, 49801, 2439, 3060, 15, 1198, 5747, 253, 8797, 12244, 457, 84, 44064, 6031, 281, 557, 10769, 366, 3139, 432, 253, 38615, 414, 273, 247, 3782, 3609, 15156, 13, 253, 3420, 14511, 7788, 281, 10251, 885, 253, 594, 14, 8890, 2802, 34330, 280, 3753, 457, 273, 841, 6993, 28, 21455, 281, 30648, 253, 13281, 22567, 275, 1708, 273, 253, 49970, 280, 10056, 20251, 14851, 326, 2802, 10002, 972, 26280, 247, 7765, 5734, 323, 247, 7765, 390, 323, 16933, 544, 17506, 62, 275, 253, 2659, 1108, 352, 310, 347, 604, 344, 574, 47256, 28473, 7094, 15, 1244, 26350, 26866, 581, 1108, 352, 310, 347, 604, 344, 574, 9809, 28473, 7094, 457, 313, 22, 27, 1237, 582, 390, 1014, 281, 10251, 885, 326, 581, 273, 253, 6382, 14745, 5339, 21449, 16955, 754, 67, 3088, 457, 84, 14145, 369, 271, 8365, 28, 39505, 353, 5650, 357, 255, 15, 187, 187, 510, 958, 273, 253, 2647, 310, 326, 1046, 13281, 8848, 14502, 2224, 253, 16955, 754, 67, 3088, 40139, 13, 816, 751, 1046, 643, 44715, 275, 253, 23324, 414, 273, 1966, 1495, 15, 9937, 616, 2853, 14, 46779, 13, 22198, 13, 13413, 13, 9579, 272, 13, 285, 1784, 462, 2473, 48528, 273, 253, 32550, 28453, 13, 3496, 15994, 4360, 27594, 326, 16492, 956, 247, 9596, 326, 6882, 2487, 19227, 275, 7281, 16954, 534, 760, 45482, 5368, 29005, 875, 3060, 285, 253, 8797, 12244, 13, 285, 556, 15260, 5911, 22198, 2080, 14, 918, 3128, 1329, 2439, 3060, 13, 253, 5020, 273, 16492, 3365, 1925, 323, 253, 18185, 273, 253, 9311, 15, 187, 187, 510, 625, 8993, 2523, 1024, 310, 253, 11795, 273, 436, 769, 534, 760, 29095, 253, 1655, 2675, 22199, 326, 556, 13207, 281, 14165, 366, 1781, 7118, 273, 253, 8797, 3114, 432, 5284, 21262, 15, 1284, 253, 3114, 310, 47723, 2918, 281, 9331, 323, 253, 811, 3161, 621, 273, 10058, 5320, 382, 3603, 28, 285, 347, 253, 3420, 44569, 253, 2862, 3114, 342, 581, 16463, 13, 594, 253, 2647, 273, 17414, 4916, 2455, 625, 13392, 285, 1097, 4676, 3135, 281, 20843, 3746, 432, 581, 1529, 15, 831, 6158, 1127, 310, 7936, 323, 760, 342, 253, 15850, 273, 2675, 18158, 13, 638, 24751, 13, 285, 2208, 3646, 22741, 476, 253, 2523, 273, 5320, 1204, 320, 11463, 1070, 15, 187, 187, 10195, 588, 13387, 253, 8797, 3114, 323, 417, 5277, 4209, 12255, 327, 697, 1211, 2758, 285, 27382, 253, 5195, 273, 5320, 1204, 28, 390, 4931, 8577, 247, 9645, 5130, 281, 436, 1895, 15, 8079, 1142, 588, 1750, 326, 253, 8797, 3114, 3198, 281, 3037, 281, 1453, 2802, 953, 1211, 457, 390, 2802, 788, 562, 15385, 1723, 13, 253, 1895, 310, 417, 347, 581, 14, 21773, 347, 253, 3420, 285, 1142, 643, 34514, 651, 751, 281, 2868, 15, 1198, 6296, 352, 310, 3394, 342, 247, 625, 5213, 4809, 275, 10253, 13, 16158, 20498, 13, 12728, 13, 9256, 13, 27412, 285, 30174, 13, 285, 253, 5213, 22567, 2668, 275, 1016, 273, 841, 4343, 326, 452, 45482, 285, 15260, 5911, 5320, 1204, 275, 776, 1211, 18275, 13, 9904, 342, 253, 3116, 273, 3270, 14, 922, 35892, 21942, 45482, 407, 253, 5054, 8891, 534, 556, 3977, 281, 1029, 3904, 273, 20549, 15, 329, 4433, 281, 11435, 436, 7936, 1127, 8540, 253, 17938, 273, 6031, 275, 253, 3819, 387, 1728, 15, 187, 187, 1909, 1048, 347, 253, 8797, 3114, 310, 6726, 281, 2997, 8294, 285, 15251, 885, 323, 6993, 352, 556, 1620, 7730, 13, 46695, 13, 390, 30020, 13, 594, 588, 253, 14165, 318, 4035, 13, 6153, 247, 2675, 8037, 326, 39783, 323, 17414, 13, 8881, 285, 4685, 326, 588, 760, 1421, 281, 2007, 12940, 285, 3687, 10254, 323, 5320, 1204, 15, 187, 187, 510, 754, 67, 3088, 40139, 403, 247, 38615, 280, 285, 6424, 769, 15, 1292, 352, 310, 23293, 326, 253, 13271, 454, 342, 534, 253, 3420, 556, 2361, 285, 15626, 253, 40139, 42267, 2824, 265, 253, 4644, 390, 2508, 273, 5012, 327, 253, 17959, 19382, 1146, 9284, 5857, 281, 33423, 4343, 281, 8773, 5312, 2280, 317, 373, 28, 253, 32524, 272, 5973, 275, 7634, 785, 10268, 5312, 31222, 1097, 275, 616, 1211, 2586, 285, 275, 29310, 28, 285, 275, 7785, 13, 253, 3513, 1971, 273, 5112, 39004, 285, 5418, 84, 275, 253, 8913, 9114, 489, 15, 51, 6739, 1722, 1857, 378, 12295, 21, 16, 1838, 22307, 323, 8153, 428, 473, 4350, 39, 48281, 4565, 9354, 187, 740, 15, 17138, 209, 21770, 10925, 2391, 1283, 883, 15, 26940, 8, 23952, 5733, 16443, 209, 21770, 537, 27446, 15, 12276, 187, 1552, 3389, 13067, 253, 2710, 6866, 281, 320, 908, 672, 20462, 187, 266, 5271, 20899, 4155, 26580, 416, 11872, 313, 1719, 7941, 10, 326, 588, 1408, 378, 12295, 21, 187, 60, 51, 6739, 1036, 3439, 62, 390, 309, 4976, 49, 323, 8153, 544, 1838, 22307, 62, 342, 643, 7412, 7941, 84, 6024, 281, 253, 7412, 13, 187, 395, 473, 4350, 39, 544, 51, 6739, 1010, 3245, 62, 347, 697, 309, 12295, 15, 187, 3074, 2852, 10414, 273, 378, 12295, 275, 436, 3389, 588, 3730, 281, 378, 12295, 187, 4149, 577, 13, 347, 2931, 275, 544, 51, 6739, 1036, 3439, 1570, 1876, 3806, 281, 309, 4976, 49, 403, 187, 250, 3065, 281, 253, 5383, 14, 25906, 416, 20309, 26010, 313, 28783, 14034, 2504, 10, 534, 556, 187, 20394, 2931, 407, 253, 309, 4976, 49, 323, 8153, 3389, 544, 1838, 22307, 62, 323, 897, 275, 5271, 20899, 187, 7761, 84, 15, 187, 1552, 3389, 13067, 849, 253, 1563, 4910, 275, 473, 4350, 39, 285, 12474, 187, 249, 378, 12295, 16, 1838, 22307, 403, 281, 320, 873, 672, 734, 33681, 875, 378, 12295, 16, 1838, 22307, 285, 473, 4350, 39, 187, 255, 271, 7412, 7941, 27, 187, 1838, 22307, 2210, 562, 273, 253, 1072, 789, 347, 378, 12295, 13, 285, 778, 320, 1908, 247, 956, 187, 251, 281, 378, 12295, 14, 20, 285, 378, 12295, 14, 21, 15, 5595, 4910, 2931, 275, 253, 5016, 187, 17352, 378, 12295, 285, 309, 4976, 49, 403, 4907, 253, 1072, 15, 7900, 1027, 13, 253, 309, 4976, 49, 187, 15069, 403, 2011, 11794, 15, 187, 35, 12295, 16, 1838, 22307, 353, 10147, 42, 64, 4237, 1433, 64, 15857, 36, 187, 35, 12295, 4145, 2431, 1042, 285, 7412, 64, 18999, 16, 1719, 64, 10452, 4632, 15, 473, 4350, 39, 6809, 187, 1838, 22307, 8021, 53, 64, 16615, 285, 28613, 64, 18999, 16, 19000, 64, 10452, 187, 35, 12295, 16, 1838, 22307, 427, 9465, 64, 41, 2795, 4632, 15, 473, 4350, 39, 25956, 272, 22483, 187, 35, 12295, 16, 1838, 22307, 35378, 1556, 64, 14364, 39, 4632, 15, 473, 4350, 39, 2105, 285, 1511, 187, 1838, 22307, 4428, 28613, 64, 18999, 285, 28613, 64, 10452, 4910, 534, 11029, 253, 1072, 4096, 187, 284, 7412, 64, 18999, 285, 7412, 64, 10452, 4910, 323, 309, 4976, 49, 323, 8153, 15, 496, 436, 3389, 13, 359, 187, 9846, 897, 253, 2426, 46536, 285, 21503, 281, 3730, 281, 253, 378, 12295, 7412, 64, 18999, 285, 187, 1719, 64, 10452, 13, 390, 253, 309, 4976, 49, 28613, 64, 18999, 285, 28613, 64, 10452, 4910, 2975, 13, 7293, 187, 251, 253, 3634, 273, 253, 7241, 1146, 908, 15, 187, 14358, 309, 4976, 49, 285, 378, 12295, 2085, 247, 5122, 281, 5224, 1880, 253, 24749, 187, 18480, 369, 23923, 3066, 271, 309, 12295, 13, 390, 690, 643, 2097, 15, 496, 309, 4976, 49, 13, 187, 338, 7622, 1491, 310, 23923, 407, 2097, 643, 685, 271, 309, 12295, 13, 840, 187, 783, 8021, 53, 64, 16615, 11104, 310, 1246, 15, 22300, 13, 275, 378, 12295, 13, 604, 247, 7622, 187, 18480, 310, 23923, 407, 2097, 643, 685, 271, 309, 12295, 13, 840, 253, 4145, 2431, 1042, 187, 15810, 310, 873, 281, 654, 38, 12295, 31, 390, 654, 1042, 9507, 20982, 5428, 13208, 1198, 253, 4096, 273, 436, 187, 3306, 13, 359, 878, 281, 12129, 875, 253, 767, 2219, 27, 187, 13248, 324, 5582, 13, 388, 4420, 708, 416, 1441, 73, 350, 544, 10099, 374, 62, 187, 187, 51, 6739, 1722, 1857, 378, 12295, 21, 16, 1838, 22307, 323, 8153, 428, 473, 4350, 39, 48281, 4565, 9354, 187, 9, 66, 10, 22720, 1491, 369, 23923, 3066, 271, 309, 12295, 13, 187, 9, 67, 10, 22720, 1491, 369, 23923, 407, 690, 643, 2097, 15, 187, 510, 3438, 1083, 310, 8156, 275, 309, 4976, 49, 407, 417, 1690, 253, 8021, 53, 64, 16615, 187, 15810, 13, 285, 275, 378, 12295, 407, 4758, 253, 378, 12295, 4145, 2431, 1042, 30, 29, 2431, 49, 21431, 380, 6158, 187, 5045, 310, 8156, 407, 1690, 253, 8021, 53, 64, 16615, 11104, 275, 309, 4976, 49, 13, 285, 407 ]
. } private async Task Sleep() { await TaskEx.Run(() => System.Threading.Thread.Sleep(1000)); } } The task state just remains as 'WaitingForActivation'. Does anyone know why this would happen? A: EDIT: The comment from Stephen Cleary sheds more light: AspNetSynchronizationContext is the strangest implementation. It treats Post as synchronous rather than asynchronous and uses a lock to execute its delegates one at a time. AspNetSynchronizationContext does not require marshaling back to the same thread (but does need to take the lock); the deadlock on Wait is because the continuation is waiting for the lock (held by the thread in the event handler) My guess is that there's a SynchronizationContext which is forcing the continuation to run on the same thread as the event handler. Your event handler is blocking that thread, so the continuation never runs, which means the event handler will never unblock. That's only a guess though - it's the only thing I can think of which makes sense at the moment. One option to try to unblock this is to change your Sleep method to: private async Task Sleep() { await TaskEx.Run(() => System.Threading.Thread.Sleep(1000)) .ConfigureAwait(continueOnCapturedContext: false); } That will allow the continuation to complete on a different context. I'm surprised there is such a synchronization context, mind you... I'd expect all of this to just happen on the thread pool. Possibly BeginRequest is treated slightly specially. The barbaric and villainous killing of the Charlie Hebdo journalists is no doubt a heinous crime. Indeed, Charlie Hebdo’s only crime was that it expressed an opinion. However erroneous one may believe that opinion to be, never is that a justification for a summary execution such as that which took place today. Rarely do the words of Voltaire ring so loudly; “I do not agree with what you have to say, but I’ll defend to the death your right to say it”. However, the dynamic emerging amongst the media narrative centres upon an implied accusation directed towards the Muslim community, with hashtags of #notinmyname depicting a sense of responsibility that has resulted in a panic felt amongst some Muslims, reflected in a wave of apologies for a crime they did not commit. Already headlines such as ‘Europe struggles with Islamism’ are emerging, exaggerating the significance of the death of Hebdo’s journalists as Islam’s response to freedom of speech rather than reporting the crime as it is; a despicable murder by criminals against journalists. Indeed a very dangerous parameter emerges from the barbarity of this extremist minority, fuelled by a media witch-hunt for a social and ideological criminal capable of encouraging such acts. Today’s killing has no doubt compounded the anti-Islam sentiment slowly creeping across Europe. For despite the Muslim Community’s relentless efforts to disassociate itself from the barbarity of a particularly select minority, the media narrative continues to emphasise the so-called ‘Islamic nature’ of these acts; refusing to analyse the Islamic stance in light of the Quranic passage expressly stating that ‘whoever kills a soul unless for a soul or for corruption [done] in the land – it is as if he had slain mankind entirely. And whoever saves one – it is as if he had saved mankind entirely’ (5:32), or even to emphasise that one of the policemen killed defending Charlie Hebdo’s offices was an Arab; Ahmad Muraabat. The fact of the matter is that every Islamic institution condemns the Charlie Hebdo killings, just like every other believer in the sanctity of human life. Despite their ill-considered, racist, offensive, degrading, and derogatory depiction of the Prophet Muhammad, irresponsibly implying that Muslims follow a religion that condones terrorism in cartoons which only exacerbated existing tensions between Europe and the Muslim Community, and has fuelled racist far-right party support across Europe, the majority of Muslims simply called for the withdrawal of the publication. The more immediate issue now is the timing of this act which only fuels the current social paradigm that has begun to alienate large sections of the Muslim community from European societies. As the community is wrongly held to fault for the transgressions of tiny extremist elements; and as the media paints the entire community with one brush, so the matter of dialogue becomes ever more distant and both parties begin to isolate themselves from one another. This latter point is fundamental for only with the cooperation of social activists, preachers, and government policy makers can the issue of extremism be tackled. Many will blame the Muslim community for not providing sufficient checks on its own members and permitting the spread of extremism; or perhaps turning a blind eye to this problem. Indeed many will claim that the Muslim community needs to learn to control ‘its own’ or ‘get out’. However, the problem is not as one-sided as the media and many other personalities would like to believe. For indeed it is events with a more international aspect in Egypt, Saudi Arabia, Syria, Iraq, Yemen and Libya, and the international stance taken in each of these countries that have exacerbated and fuelled extremism in our own borders, coupled with the growth of anti-foreigner sentiment exacerbated by the economic crisis which has led to high numbers of unemployment. A failure to appreciate this fundamental point damages the credibility of efforts in the fight at home. As long as the Muslim community is forced to accept responsibility and apologise for acts it has never committed, propagated, or endorsed, so will the alienation continue, creating a social gap that screams for dialogue, debate and understanding that will only lead to further isolation and greater momentum for extremism. The Hebdo killings are a barbaric and criminal act. But it is unfortunate that the vigour with which the media has reported and analysed the killings eclipses the volume or detail of reports on the Syrian refugees being refused entry to neighbouring countries to escape daily massacres; the Rohingya in Burma facing daily persecution both in their own country and in Bangladesh; and in Paris, the police treatment of French Arabs and Blacks in the banlieue.RFC 1745 BGP4/IDRP for IP - OSPF Interaction December 1994 10. Appendix .................................................... 1811. Authors' Present Addresses .................................. 191. Introduction This document defines the various criteria to be used when designing an Autonomous System Border Router (ASBR) that will run BGP4 [RFC1654] or IDRP for IP [IDRP] with other ASBRs external to the AS, and OSPF [RFC1583] as its IGP. All future references of BGP in this document will refer to BGP version 4, as defined in [RFC1654]. All reference to IDRP are references to the Inter-Domain Routing Protocol (ISO 10747) which has been defined by the IDRP for IP document [IDRP] for use in Autonomous Systems. This document defines how the following fields in OSPF and attributes in BGP/IDRP are to be set when interfacing between BGP/IDRP and OSPF at an ASBR: IDRP came out of the same work as BGP, and may be consider a follow on to BGP-3 and BGP-4. Most fields defined in the interaction between BGP and IDRP are named the same. Where different, the IDRP fields are shown separately. BGP/IDRP MULTI_EXIT_DISC BGP ORIGIN and AS_PATH/AS_SET vs. OSPF tag IDRP EXT_INFO and RD_PATH/RD_SET BGP/IDRP NEXT_HOP vs. OSPF Forwarding Address BGP/IDRP LOCAL_PREF vs. OSPF cost and type IDRP contains RD_PATH and RD_SET fields which serves the same purpose as AS_PATH and AS_SET fields for IDRP for IP. In this document, we will use the terms PATH and SET to refer to the BGP AS_PATH and AS_SET, or the IDRP RD_PATH and RD_SET fields respectively, depending on the context of the protocol being used. Both IDRP and BGP provide a mechanism to indicate whether the routing information was originated via an IGP, or some other means. In IDRP, if route information is originated by means other than an IGP, then the EXT_INFO attribute is present. Likewise, in BGP, if a route information is originated by means other than an IGP, then the ORIGIN attribute is set to <EGP> or <INCOMPLETE>. For the purpose of this document, we need to distinguish between the two cases: Varadhan, Hares & Rekhter [Page 2] RFC 1745 BGP4/IDRP for IP - OSPF Interaction December 1994 (a) Route information was originated via an IGP, (b) Route information was originated by some other means. The former case is realized in IDRP by not including the EXT_INFO attribute, and in BGP by setting the BGP ORIGIN=<IGP>; The latter case is realized by including the EXT_INFO attribute in IDRP, and by
[ 535, 50274, 4387, 1159, 755, 10976, 14574, 187, 50270, 2309, 3781, 9, 187, 50266, 1826, 1673, 2776, 2073, 2754, 64, 5564, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 33762, 64, 53, 43561, 13, 187, 50262, 8, 25553, 8, 3001, 3781, 9, 3781, 2073, 17354, 3401, 2387, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 90, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 27413, 15286, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 78, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 22362, 3886, 52, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 69, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 4877, 6328, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 73, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 23704, 6453, 187, 50266, 9679, 187, 50266, 1826, 1673, 9063, 3364, 2073, 9029, 64, 74, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 17258, 3329, 1410, 187, 50266, 9679, 187, 50266, 1826, 1673, 2765, 2073, 6324, 1383, 3781, 9, 187, 50262, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 44624, 64, 51, 25876, 13, 187, 50262, 8, 15565, 8, 3001, 3781, 9, 187, 50258, 8, 27413, 1277, 8, 3001, 418, 14375, 64, 27413, 15286, 13, 187, 50258, 8, 22362, 3886, 8, 3001, 418, 14375, 64, 22362, 3886, 52, 13, 187, 50258, 8, 29807, 8, 3001, 418, 14375, 64, 4877, 6328, 13, 187, 50262, 10, 187, 50266, 9679, 988, 186, 1826, 1673, 6958, 2073, 4064, 64, 2754, 1383, 3781, 9, 2657, 186, 626, 2404, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 22050, 64, 33762, 13, 2657, 186, 8, 42988, 8, 3001, 418, 14375, 64, 10845, 52, 947, 64, 7669, 64, 22050, 64, 33762, 64, 41, 7999, 13, 988, 186, 1228, 187, 50270, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 31980, 1082, 551, 535, 50270, 338, 3914, 2520, 1168, 8882, 2295, 686, 10978, 8, 910, 187, 50266, 5, 2520, 1168, 25553, 5456, 426, 3781, 2073, 486, 64, 6324, 5137, 187, 50270, 94, 2010, 551, 187, 50266, 5, 2520, 1168, 25553, 5456, 426, 3781, 2073, 2754, 5137, 187, 50270, 94, 535, 50270, 2309, 370, 2520, 1168, 25553, 28, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 9671, 13248, 2548, 3914, 261, 64, 10978, 426, 3221, 10, 551, 535, 50270, 338, 3914, 2520, 1168, 8882, 2295, 686, 10978, 8, 910, 187, 50266, 5, 261, 64, 10978, 426, 2032, 28, 187, 50270, 94, 535, 50270, 338, 4816, 261, 64, 10978, 910, 187, 50266, 5, 2520, 1168, 2044, 64, 881, 426, 686, 3728, 5618, 187, 50270, 94, 535, 50270, 2309, 2885, 1450, 788, 9671, 13248, 2548, 3914, 261, 64, 10978, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 14390, 3914, 2877, 910, 187, 50270, 2309, 14271, 3914, 2520, 1168, 788, 27732, 3914, 2877, 582, 3221, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 2776, 3902, 3914, 2877, 910, 535, 50270, 338, 20273, 5, 2877, 910, 1091, 34973, 748, 535, 50270, 338, 9, 261, 64, 3728, 3914, 2877, 47881, 535, 50266, 5, 6324, 426, 3638, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 5137, 535, 50266, 5, 6870, 64, 2703, 426, 34973, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 187, 50262, 5, 6870, 64, 2703, 33750, 418, 14375, 64, 22050, 2464, 686, 10506, 2877, 5013, 4064, 36676, 8, 686, 28, 187, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 187, 50262, 5, 6870, 64, 2703, 33750, 418, 14375, 64, 7058, 2464, 686, 10506, 2877, 5013, 936, 22734, 187, 50266, 94, 535, 50266, 2309, 370, 6870, 64, 2703, 2464, 29996, 22174, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 5137, 535, 50270, 94, 535, 50270, 2309, 370, 2520, 1168, 788, 27732, 3914, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 27732, 3914, 2754, 910, 535, 50270, 5, 10121, 426, 3781, 1874, 535, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 90, 3401, 910, 370, 10121, 5456, 426, 686, 90, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 78, 3401, 910, 370, 10121, 5456, 426, 686, 78, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 69, 3401, 910, 370, 10121, 5456, 426, 686, 69, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 73, 3401, 910, 370, 10121, 5456, 426, 686, 73, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 9029, 64, 74, 3401, 910, 370, 10121, 5456, 426, 686, 74, 5618, 748, 187, 50270, 338, 4816, 2520, 1168, 788, 16956, 2073, 4064, 64, 2754, 3401, 910, 370, 10121, 5013, 4064, 64, 2754, 6038, 426, 370, 2520, 1168, 788, 16956, 2073, 4064, 64, 2754, 5137, 748, 535, 50270, 2309, 2876, 64, 2754, 64, 486, 3914, 2754, 13, 370, 10121, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 755, 9824, 8982, 3914, 2877, 10, 551, 535, 50270, 5, 4064, 426, 2195, 11004, 3914, 2877, 5013, 4064, 23405, 3736, 313, 565, 1009, 2877, 5013, 4064, 6038, 1163, 3221, 28, 187, 50270, 5, 936, 426, 2195, 11004, 3914, 2877, 5013, 936, 23405, 3736, 313, 565, 1009, 2877, 5013, 936, 6038, 1163, 3221, 28, 535, 50270, 338, 20273, 5, 2520, 1168, 9029, 64, 10978, 64, 5423, 64, 5564, 910, 187, 50266, 5, 2520, 1168, 5564, 426, 3221, 28, 187, 50270, 94, 535, 50270, 2309, 260, 983, 14968, 1450, 43616, 18331, 12574, 5232, 6180, 3914, 2520, 1168, 2437, 2464, 64, 10978, 1383, 3781, 9, 187, 50266, 8, 3423, 8, 3001, 370, 2520, 13, 187, 50266, 8, 6324, 8, 3001, 3638, 2073, 47043, 64, 8, 964, 370, 2520, 1168, 788, 16956, 2073, 6324, 8539, 8, 740, 11470, 187, 50266, 8, 4064, 8, 50276, 14490, 370, 4064, 13, 187, 50266, 626, 80, 8, 50274, 14490, 370, 936, 187, 50270, 4027, 535, 50274, 94, 535, 50274, 4387, 1159, 4647, 9824, 3914, 7645, 13, 370, 2877, 10, 551, 535, 50270, 338, 6522, 261, 64, 3728, 3914, 2877, 1228, 551, 1091, 2885, 1450, 18788, 9824, 3914, 7645, 13, 370, 2877, 558, 748, 535, 50270, 338, 20273, 11004, 3914, 2877, 5013, 4064, 23405, 2785, 2195, 11004, 3914, 2877, 5013, 936, 23405, 910, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 187, 50262, 5, 4064, 426, 313, 565, 1009, 2877, 5013, 4064, 22734, 187, 50262, 5, 7645, 1168, 10978, 6958, 20598, 254, 3914, 2520, 1168, 1590, 13, 370, 4064, 13, 370, 2520, 1168, 788, 16956, 2073, 6324, 26811, 187, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 187, 50262, 5, 7645, 1168, 10978, 41516, 58, 42398, 3914, 2520, 1168, 1590, 13, 370, 2877, 5013, 936, 16445, 370, 2520, 1168, 788, 16956, 2073, 6324, 26811, 187, 50266, 94, 535, 50266, 2309, 370, 7645, 28, 535, 50270, 94, 535, 50270, 2309, 2885, 1450, 18788, 9824, 3914, 7645, 13, 370, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 4657, 3914, 2877, 13, 370, 261, 64, 2377, 3004, 13, 370, 744, 64, 2877, 30, 8629, 910, 535, 50270, 338, 20273, 5, 2877, 910, 1091, 3635, 28, 748, 535, 50270, 338, 6522, 261, 64, 3728, 3914, 2877, 47881, 535, 50266, 2309, 3522, 2073, 58, 14, 78, 14, 69, 388, 27, 74, 27, 84, 1383, 1213, 23877, 553, 3914, 2877, 4027, 535, 50270, 94, 2010, 338, 9, 33915, 3914, 2877, 5013, 4064, 23405, 2785, 310, 1178, 3914, 2877, 5013, 936, 47916, 551, 535, 50266, 2309, 544, 187, 50262, 8, 4064, 8, 3001, 313, 33915, 3914, 2877, 5013, 4064, 23405, 3736, 370, 2877, 5013, 4064, 6038, 1163, 3635, 582, 187, 50262, 626, 80, 8, 50275, 14490, 313, 33915, 3914, 2877, 5013, 936, 23405, 3736, 370, 2877, 5013, 936, 6038, 1163, 3635, 10, 187, 50266, 2194, 535, 50270, 94, 535, 50270, 2309, 3635, 28, 535, 50274, 94, 535, 50274, 4387, 1159, 4657, 9824, 3914, 2877, 910, 187, 50270, 2309, 370, 2520, 1168, 11869, 3914, 2877, 13, 3221, 558, 187, 50274, 94, 535, 50274, 4387, 1159, 755, 8982, 3914, 2877, 910, 535, 50270, 5, 2520, 1168, 2203, 5013, 2754, 6038, 426, 370, 2877, 3736, 3522, 2073, 69, 15, 78, 15, 58, 1383, 1213, 23877, 553, 3914, 2877, 1228, 1163, 34973, 535, 50270, 2309, 2885, 1450, 788, 8982, 3914, 2877, 558, 535, 50274, 94, 535, 50274, 4387, 1159, 17813, 64, 486, 64, 6324, 3914, 2877, 910, 535, 50270, 338, 313, 11004, 3914, 2877, 1228, 551, 1091, 2032, 28, 748, 535, 50270, 338, 9, 33915, 3914, 2877, 5013, 4064, 23405, 2785, 310, 1178, 3914, 2877, 5013, 936, 47916, 551, 535, 50266, 5, 15164, 37755, 426, 13357, 63, 8850, 17, 14, 26, 20871, 1009, 16, 74, 3664, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 4064, 23405, 910, 535, 50262, 338, 9, 261, 64, 3728, 3914, 2877, 5013, 4064, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50262, 338, 20273, 81, 1747, 64, 8992, 3914, 15164, 37755, 13, 370, 2877, 5013, 4064, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50266, 94, 535, 50266, 338, 6522, 11004, 3914, 2877, 5013, 936, 23405, 910, 535, 50262, 338, 9, 261, 64, 3728, 3914, 2877, 5013, 936, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50262, 338, 20273, 81, 1747, 64, 8992, 3914, 15164, 37755, 13, 370, 2877, 5013, 936, 23405, 910, 187, 50258, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 187, 50262, 94, 535, 50266, 94, 535, 50266, 2309, 2032, 28, 535, 50270, 94, 535, 50270, 2309, 22535, 64, 46330, 4966, 64, 35557, 28, 535, 50274, 94, 187, 187, 94, 187, 24650, 38336, 18469, 27, 13160, 375, 656, 327, 7814, 753, 253, 2567, 434, 4450, 556, 642, 3910, 342, 253, 28960, 285, 253, 594, 14, 8890, 3237, 497, 3420, 8869, 15, 380, 2567, 2918, 697, 5540, 394, 7970, 2087, 4804, 275, 14332, 47180, 327, 7814, 15, 688, 697, 13145, 46, 1157, 247, 2567, 28179, 753, 326, 253, 8017, 2201, 369, 6600, 273, 253, 958, 326, 253, 10963, 8037, 875, 253, 1755, 4323, 285, 6171, 556, 42248, 15, 380, 28179, 7478, 326, 253, 2567, 457, 84, 5511, 327, 10963, 812, 452, 644, 1805, 15, 1916, 2953, 326, 13, 352, 556, 40855, 1520, 10963, 281, 5739, 14, 3169, 23267, 13, 352, 753, 15, 3856, 457, 84, 247, 1007, 247, 867, 328, 3328, 273, 2234, 1436, 16474, 387, 13160, 375, 656, 27, 688, 247, 4857, 281, 28284, 13, 11731, 657, 763, 267, 322, 1479, 4530, 753, 326, 41779, 1166, 3982, 342, 352, 6938, 7881, 824, 347, 11002, 6055, 1204, 13, 38757, 20315, 262, 1320, 13, 10702, 5268, 12656, 285, 747, 7324, 32300, 16320, 595, 13, 359, 574, 7881, 281, 3324, 7882, 281, 776, 25021, 2136, 285, 3116, 281, 776, 7198, 6929, 285, 378, 5964, 9341, 15, 1292, 47323, 512, 273, 436, 13, 352, 1602, 11625, 441, 281, 3297, 7106, 327, 776, 3356, 14, 3945, 7517, 281, 4446, 5233, 3116, 275, 3694, 14, 1070, 27278, 13, 281, 9232, 4831, 275, 21629, 2579, 3104, 285, 281, 10660, 776, 5161, 3238, 1905, 247, 7517, 281, 7257, 5185, 13, 27834, 3116, 323, 253, 5649, 273, 512, 776, 28022, 1806, 322, 1479, 4530, 753, 15, 510, 2567, 753, 326, 625, 685, 1903, 13, 933, 7375, 452, 644, 4439, 1955, 281, 29885, 15, 27464, 591, 2120, 14, 37678, 8183, 313, 39, 5428, 10, 2559, 407, 337, 15, 19, 591, 1399, 347, 247, 906, 273, 29885, 13, 4981, 5837, 285, 18053, 11701, 13, 253, 2567, 753, 32300, 1147, 310, 247, 2590, 20028, 273, 849, 3694, 310, 1469, 281, 1132, 247, 9560, 2554, 275, 776, 2136, 1566, 1806, 352, 753, 15, 510, 4450, 457, 84, 2954, 342, 33663, 310, 2256, 273, 31215, 3420, 5012, 13, 253, 2567, 753, 15, 380, 2567, 457, 84, 16155, 21240, 416, 322, 265, 7110, 333, 1796, 753, 326, 672, 5701, 403, 1160, 407, 33663, 13, 352, 310, 2783, 625, 10369, 285, 44738, 15, 16155, 9550, 10963, 14691, 253, 14511, 327, 25978, 13, 352, 753, 15, 510, 8017, 2201, 753, 352, 369, 7063, 327, 22504, 1249, 13, 18895, 43813, 275, 7942, 285, 7942 ]
public function getOptions(){ return array( new fieldString('date_title', array( 'title' => LANG_PARSER_AGE_DATE_TITLE, 'rules' => array( array('required') ) )), new fieldCheckbox('show_y', array( 'title' => LANG_YEARS )), new fieldCheckbox('show_m', array( 'title' => LANG_MONTHS )), new fieldCheckbox('show_d', array( 'title' => LANG_DAYS )), new fieldCheckbox('show_h', array( 'title' => LANG_HOURS )), new fieldCheckbox('show_i', array( 'title' => LANG_MINUTES )), new fieldList('range', array( 'title' => LANG_PARSER_AGE_FILTER_RANGE, 'items' => array( 'YEAR' => LANG_YEARS, 'MONTH' => LANG_MONTHS, 'DAY' => LANG_DAYS, ) )), new fieldDate('from_date', array( 'title' => LANG_PARSER_AGE_FROM_DATE, 'hint' => LANG_PARSER_AGE_FROM_DATE_HINT, )) ); } public function getRules() { if($this->context == 'filter'){ $this->rules[] = array('age_range'); } else { $this->rules[] = array('date'); } return $this->rules; } public function getDefaultVarType($is_filter = false) { if($this->context == 'filter'){ $is_filter = true; } if ($is_filter){ $this->var_type = 'array'; } return parent::getDefaultVarType($is_filter); } public function parse($value){ return html($this->getDiff($value), false); } public function getStringValue($value){ if(!$value){ return ''; } if(is_array($value)){ $range = constant('LANG_' . $this->getOption('range').'10'); $result_string = ''; if (!empty($value['from'])){ $result_string .= LANG_FROM.' '.$value['from'].' '; } if (!empty($value['to'])){ $result_string .= LANG_TO.' '.$value['to']; } return $result_string.' '.constant('LANG_' . $this->getOption('range').'10'); } return $this->getDiff($value); } public function getDiff($date){ $options = array(); if ($this->getOption('show_y')){ $options[] = 'y'; } if ($this->getOption('show_m')){ $options[] = 'm'; } if ($this->getOption('show_d')){ $options[] = 'd'; } if ($this->getOption('show_h')){ $options[] = 'h'; } if ($this->getOption('show_i')){ $options[] = 'i'; } if ($this->getOption('from_date')){ $options['from_date'] = $this->getOption('from_date'); } return string_date_age($date, $options); } public function getFilterInput($value) { $from = !empty($value['from']) ? (int)$value['from'] : false; $to = !empty($value['to']) ? (int)$value['to'] : false; if(!$this->show_filter_input_title){ $this->title = false; } return cmsTemplate::getInstance()->renderFormField($this->class.'_filter', array( 'field' => $this, 'range' => constant('LANG_' . $this->getOption('range').'10'), 'from' => $from, 'to' => $to )); } public function applyFilter($model, $value) { if (!is_array($value)) { return parent::applyFilter($model, $value); } if(!empty($value['from']) || !empty($value['to'])){ if (!empty($value['from'])){ $from = (int)$value['from']; $model->filterDateOlder($this->name, $from, $this->getOption('range')); } if (!empty($value['to'])){ $model->filterTimestampYounger($this->name, $value['to'], $this->getOption('range')); } return $model; } return parent::applyFilter($model, $value); } public function store($value, $is_submitted, $old_value=null){ if(!$value){ return null; } if (!is_array($value)){ return date('Y-m-d H:i:s', strtotime($value)); } elseif(isset($value['from']) || isset($value['to'])) { return [ 'from' => (isset($value['from']) ? $value['from'] : null), 'to' => (isset($value['to']) ? $value['to'] : null) ]; } return null; } public function storeFilter($value){ return $this->store($value, false); } public function getInput($value){ $this->data['date'] = $value ? date('d.m.Y', strtotime($value)) : ''; return parent::getInput($value); } public function validate_age_range($value){ if (empty($value)) { return true; } if(isset($value['from']) || isset($value['to'])) { $rgxp = "/^([0-9]+)$/i"; if (!empty($value['from'])){ if(is_array($value['from'])){ return ERR_VALIDATE_INVALID; } if(!preg_match($rgxp, $value['from'])){ return ERR_VALIDATE_INVALID; } } if (!empty($value['to'])){ if(is_array($value['to'])){ return ERR_VALIDATE_INVALID; } if(!preg_match($rgxp, $value['to'])){ return ERR_VALIDATE_INVALID; } } return true; } return ERR_VALIDATE_INVALID; } } NEW DELHI: Infosys on Saturday said the company's board has no differences with the promoters and the so-called problems were media creation. The company held its 36th annual general meeting in Bangalore on Saturday.In its AGM , a company spokesperson said that the IT major was aware of the fact that the compensation gap between the top management and employees has widened. The spokesperson recognized that the company’s communication on compensation could have been better. To address that, it has restructured compensation to stock-based rewards, it said. Here’s a look a remuneration of key personnals at Infosys:In a letter to shareholders, CEO Vishal Sikka said that FY17 brought with it environmental challenges such as rising protectionism, accelerating commoditization, elevated client expectations and new competition.“Internally, we had challenges to bring stability to our consulting business and growth to our Finacle and BPO businesses. But amidst all of this, it behoves us to stay focused on our longer-term mission to drive rapid growth in software-led offerings, to capture demand in newer service lines and to renew our core services — a mission to deliver consistent, profitable growth for the benefit of all our stakeholders,” Sikka said.The company said that more than 11,000 jobs have been released due to automation. Revenue per full-tie employee (FTE) increased by 1.2 per cent as a result of automation, utilisation and productivity improvements, the company said.“It is a clear demonstration of how software is going to play a crucial role in our business model,” it said.The board’s relationship with founders is subject of inaccurate media reports, the company said. The company’s Executive Chairman R Seshasayee said that when comments are made by founders, it is considered more seriously and respectfully. Executive leadership compensation dominated the narrative on governance, it said.The IT major said it was sitting on Rs 12,222 crore in cash and cash
[ 265, 285, 512, 773, 33530, 668, 11295, 327, 40906, 762, 17238, 13, 3523, 253, 16933, 187, 1253, 1198, 40906, 281, 1718, 253, 17160, 45092, 285, 10434, 273, 253, 2586, 275, 253, 1980, 6982, 285, 3021, 187, 1253, 743, 990, 281, 16593, 1982, 14, 47678, 5454, 275, 40906, 285, 253, 36096, 11492, 326, 457, 84, 6571, 30122, 21474, 1204, 15, 187, 1253, 743, 15890, 273, 253, 40906, 5383, 303, 773, 41, 12537, 285, 19669, 668, 1720, 11682, 8064, 13, 5728, 275, 253, 1416, 273, 9958, 31878, 2458, 15, 187, 187, 38, 91, 3093, 4572, 327, 5418, 3419, 11635, 10840, 13772, 5553, 10675, 342, 30484, 12673, 5043, 4572, 342, 14656, 293, 4255, 285, 8679, 8784, 518, 757, 36623, 489, 387, 28160, 504, 6412, 13, 3863, 407, 43793, 13, 10733, 15, 3436, 13, 4059, 15, 13728, 273, 6763, 273, 31878, 2458, 5183, 275, 253, 31878, 757, 5347, 273, 6162, 14, 1952, 14, 45245, 285, 4768, 40906, 753, 39054, 3093, 399, 386, 17090, 15, 187, 187, 46, 706, 10065, 1641, 46406, 4563, 4187, 187, 249, 40906, 13, 4750, 44543, 187, 187, 34, 9119, 273, 11790, 31878, 2458, 327, 7216, 13964, 253, 46406, 4563, 4187, 3652, 275, 473, 9041, 312, 565, 248, 13, 29510, 40906, 13, 534, 20588, 253, 39774, 273, 253, 4750, 15, 380, 34170, 398, 268, 2585, 264, 253, 772, 4187, 457, 84, 8323, 285, 35035, 18162, 407, 7263, 7695, 26429, 10151, 15, 187, 187, 41, 1942, 74, 3313, 9651, 17324, 11226, 16024, 3678, 281, 557, 43292, 23590, 665, 671, 13230, 253, 8307, 273, 5820, 432, 11734, 253, 6307, 6584, 24148, 7648, 24380, 275, 473, 9041, 312, 565, 248, 13, 9633, 407, 46406, 32427, 39795, 8040, 437, 266, 15, 187, 187, 5677, 1059, 1618, 249, 15, 681, 15, 3088, 5012, 326, 253, 43384, 4035, 275, 31878, 757, 18430, 2822, 253, 5680, 342, 253, 46406, 4687, 13, 327, 11684, 326, 10929, 14440, 5794, 9609, 457, 84, 5286, 8041, 2675, 3198, 824, 347, 10678, 1824, 13, 2341, 13, 6406, 285, 13939, 25931, 2190, 2571, 15, 187, 187, 45607, 294, 25249, 187, 187, 2374, 7216, 253, 2831, 14, 14224, 2791, 294, 31370, 846, 1146, 6294, 3606, 1390, 6794, 327, 18162, 35035, 407, 31878, 2458, 275, 2067, 15918, 13, 281, 4831, 326, 6162, 14, 1952, 14, 45245, 2406, 253, 10474, 20978, 728, 327, 3580, 21117, 432, 46406, 12785, 15, 53, 333, 80, 17287, 21362, 5173, 187, 187, 33319, 307, 333, 80, 346, 53, 333, 80, 3, 17287, 21362, 5173, 313, 6448, 4163, 1722, 13, 10226, 10, 310, 271, 2448, 5842, 18915, 665, 310, 4390, 247, 1959, 5570, 15, 754, 4546, 6831, 5842, 323, 308, 18094, 15, 17287, 21362, 5173, 369, 22390, 407, 253, 8068, 34105, 275, 253, 15515, 3790, 273, 253, 4104, 13946, 28701, 15, 187, 187, 45970, 5249, 187, 688, 4267, 13, 43789, 80, 17287, 21362, 5173, 2502, 23565, 264, 387, 9149, 54, 15, 754, 840, 9495, 281, 308, 18094, 13, 846, 534, 344, 2206, 562, 253, 4332, 2952, 1955, 281, 3700, 4803, 15, 6408, 253, 4050, 2952, 13, 17287, 21362, 5173, 4546, 512, 27291, 3958, 13, 4983, 275, 13265, 273, 731, 15, 6408, 253, 4072, 2952, 13, 344, 858, 417, 1132, 5842, 15, 754, 9495, 896, 281, 9149, 54, 13, 533, 574, 642, 3057, 342, 253, 5842, 2285, 15, 6408, 253, 4059, 2952, 13, 17287, 21362, 5173, 369, 271, 37067, 353, 1075, 1876, 14, 5178, 1249, 4760, 15, 754, 3053, 13265, 3958, 387, 15584, 308, 471, 282, 15, 187, 187, 46361, 5249, 187, 187, 32544, 34105, 187, 510, 8068, 34105, 4236, 17287, 21362, 5173, 342, 253, 20117, 2619, 273, 253, 15515, 3790, 275, 253, 4104, 13946, 28701, 13, 2403, 779, 253, 26235, 5784, 2619, 4583, 15, 496, 521, 29938, 2952, 13, 17287, 21362, 5173, 13588, 253, 13946, 434, 3045, 14, 17305, 6816, 2854, 3646, 285, 369, 14116, 323, 1740, 3958, 15, 187, 187, 35, 2711, 17286, 34412, 313, 34, 4639, 10, 187, 2374, 3978, 3127, 13, 4240, 13, 17287, 21362, 5173, 369, 7922, 281, 253, 19585, 34412, 273, 253, 29410, 15794, 6884, 15, 187, 187, 19346, 18089, 15755, 398, 313, 2446, 39, 10, 187, 2374, 4437, 1249, 13, 4765, 13, 17287, 21362, 5173, 369, 6704, 407, 253, 5003, 18089, 15755, 398, 273, 253, 329, 9006, 15, 754, 369, 4439, 1563, 253, 2285, 434, 3302, 12949, 14, 23485, 275, 4565, 4765, 15, 187, 187, 10267, 29155, 16500, 313, 2446, 39, 10, 187, 688, 4247, 6247, 13, 17287, 21362, 5173, 6704, 342, 253, 33199, 16500, 273, 253, 329, 9006, 15, 1723, 13, 344, 858, 417, 1056, 253, 2457, 22970, 15, 754, 369, 4845, 327, 11062, 15917, 846, 22980, 5172, 1564, 15, 380, 9728, 25368, 5871, 275, 4162, 6247, 15, 187, 187, 38642, 43375, 570, 6163, 187, 39, 21297, 36295, 369, 22390, 275, 253, 9169, 1594, 4639, 28701, 407, 253, 14296, 43375, 570, 6163, 15, 754, 369, 23391, 327, 4247, 2145, 13, 9169, 15, 187, 187, 4941, 187, 187, 7504, 4859, 187, 36179, 6416, 23972, 264, 25847, 5943, 9015, 187, 187, 1413, 27, 14209, 10782, 187, 1413, 27, 14316, 952, 187, 1413, 27, 7878, 5842, 13413, 39223, 187, 1413, 27, 7878, 952, 273, 45207, 18499, 187, 1413, 27, 7878, 952, 273, 714, 263, 25642, 18499, 187, 1413, 27, 35, 2711, 17286, 34412, 3773, 187, 1413, 27, 32544, 34105, 3773, 187, 1413, 27, 38642, 43375, 570, 6163, 3773, 187, 1413, 27, 10267, 29155, 16500, 313, 7878, 5842, 10, 3773, 187, 1413, 27, 8836, 432, 444, 335, 405, 13, 6112, 187, 1413, 27, 49649, 273, 2448, 5842, 432, 6112, 187, 1413, 27, 19346, 18089, 15755, 398, 3773, 187, 1413, 27, 43421, 432, 253, 16700, 1253, 28830, 32354, 40011, 12813, 187, 1413, 27, 6669, 54, 23972, 264, 25847, 5943, 5842, 3773, 187, 1413, 27, 58, 263, 25642, 9001, 13174, 34, 1345, 26899, 327, 16876, 1475, 619, 5098, 187, 187, 23375, 2164, 13, 5826, 187, 187, 34, 20996, 2929, 187, 4064, 5119, 5418, 14814, 13, 247, 17330, 23011, 5974, 13, 327, 253, 20701, 273, 367, 19, 49, 187, 3140, 14, 35870, 20097, 326, 352, 1057, 6296, 1305, 560, 3440, 6224, 4583, 15, 187, 1989, 253, 1055, 310, 417, 3543, 25356, 15, 380, 12830, 387, 253, 1755, 273, 253, 19840, 187, 77, 583, 6224, 13, 533, 253, 25803, 10846, 2007, 1066, 253, 18395, 6970, 187, 35264, 5649, 432, 1873, 14, 1206, 6748, 15, 187, 187, 15383, 14814, 1057, 247, 1652, 15965, 10721, 281, 26065, 752, 651, 187, 38472, 257, 604, 1873, 14, 1206, 6748, 497, 3777, 407, 1884, 7739, 544, 1909, 368, 1239, 13, 31986, 253, 187, 9177, 6937, 6970, 326, 309, 897, 347, 619, 5311, 434, 18479, 27, 346, 1274, 1034, 3, 2097, 4404, 187, 783, 12830, 285, 3687, 6224, 15, 1570, 187, 187, 60, 4509, 3239, 4567, 62, 496, 436, 187, 20285, 12690, 780, 1533, 342, 1884, 6, 1679, 1873, 9628, 13, 253, 2406, 6879, 6, 273, 253, 187, 35360, 273, 6224, 310, 14728, 2007, 281, 253, 1669, 13, 1223, 253, 1755, 273, 187, 783, 3268, 5459, 697, 6224, 15, 831, 310, 752, 943, 320, 3264, 187, 28821, 253, 8197, 432, 1840, 15, 47011, 665, 403, 7202, 13, 285, 3021, 954, 187, 2955, 9357, 407, 1873, 9628, 13, 403, 1110, 10846, 665, 5580, 4942, 1643, 187, 31638, 84, 13, 5727, 10846, 665, 403, 44137, 407, 1873, 9628, 285, 3021, 6351, 187, 4064, 697, 8570, 13, 253, 4633, 4394, 13, 403, 253, 10846, 3692, 6224, 403, 187, 1661, 3146, 1029, 15, 187, 187, 1552, 6452, 5644, 187, 936, 2007, 3533, 5001, 253, 16274, 326, 1873, 9628, 556, 574, 187, 395, 588, 452, 327, 253, 5950, 3440, 4491, 15, 496, 1798, 13, 604, 1873, 187, 35870, 9093, 15036, 6224, 1977, 432, 4232, 6993, 2584, 187, 29469, 6993, 13, 436, 556, 7826, 1077, 1774, 12739, 323, 849, 187, 22559, 290, 310, 3715, 285, 5939, 275, 253, 4491, 15, 1284, 342, 253, 2969, 187, 14458, 14, 6321, 2538, 273, 1873, 9628, 327, 6224, 13, 253, 3884, 273, 253, 3486, 187, 261, 417, 2590, 15, 3900, 581, 1537, 5476, 326, 3629, 253, 6224, 273, 747, 187, 10719, 651, 1421, 281, 625, 8149, 275, 6684, 747, 12816, 13, 352, 310, 671, 187, 24902, 326, 253, 8149, 275, 747, 6993, 310, 2218, 347, 247, 15133, 187, 4347, 264, 539, 281, 1089, 10846, 665, 588, 5580, 9790, 273, 5861, 15, 8490, 187, 35870, 310, 8493, 253, 5912, 326, 667, 769, 310, 2104, 281, 5580, 187, 17993, 621, 273, 5861, 13, 285, 604, 253, 2323, 273, 253, 41354, 14, 7873, 10846, 310, 187, 5371, 14137, 253, 8149, 275, 747, 6993, 13, 352, 1537, 4796, 253, 25275, 187, 936, 1718, 275, 747, 12816, 15, 831, 310, 13, 387, 697, 2798, 13, 271, 16774, 1953, 187, 4609, 310, 1669, 281, 2852, 789, 15, 187, 187, 510, 941, 3637, 13, 533, 187, 7053, 247, 1652, 8813, 15, 380, 337, 6, 1386, 10770, 281, 253, 6224, 273, 253, 187, 38462, 4633, 16258, 28, 253, 8688, 6, 1386, 310, 253, 6224, 273, 253, 954, 4633, 15, 187, 510, 2626, 5084, 310, 253, 5118, 6224, 604, 1873, 14, 35870, 497, 3777, 407, 187, 1229, 7739, 1284, 368, 476, 923, 432, 253, 2708, 13, 326, 651, 1361, 253, 6224, 275, 253, 1755, 187, 1099, 6, 273, 18395, 13, 285, 8513, 1110, 2708, 15, 6758, 310, 1529, 1039, 273, 3981, 187, 3529, 1873, 14, 1206, 6748, 3133, 281, 1361, 1110, 275, 253, 5004, 1264, 14, 14105, 273, 187, 32667, 414, 13, 3164, 323, 253, 4606, 4767, 1840, 15, 187, 187, 510, 187, 12486, 308, 647, 12739, 273, 436, 403, 3965, 2590, 15, 1198, 253, 5020, 273, 187, 435, 1346, 2007, 1066, 253, 8105, 13, 1959, 3268, 310, 1175, 9137, 13, 187, 3113, 247, 2036, 2762, 1055, 327, 6224, 15, 6758, 310, 2568, 1529, 24388, 326, 187, 783, 4803, 403, 512, 1512, 2223, 1160, 281, 4017, 253, 15156, 273, 10846, 387, 187, 783, 1755, 273, 253, 6970, 13, 417, 954, 10846, 4583, 15, 187, 187, 20266, 4562, 13, 5826, 187, 187, 8430, 352, 434, 187, 85, 2187, 272, 281, 5467, 326, 253, 10319, 1924, 13301, 403, 2378, 969, 2820, 281, 187, 72, 276, 463, 441, 13, 627, 434, 690, 3282, 275, 616, 6323, 6031, 281, 755, 8217, 281, 187, 357, 7541, 352, 434, 581, 14, 3281, 14, 26017, 14, 455, 20910, 1566, 15, 329, 1457, 2816, 7717, 3929, 187, 1189, 253, 8849, 2361, 327, 253, 10800, 11182, 875, 253, 13301, 285, 187, 25989, 689, 697, 4229, 370, 17, 15, 1525, 4376, 1127, 15, 380, 13301, 651, 751, 281, 5580, 954, 187, 1826, 3440, 323, 625, 283, 5, 18, 15, 2537, 16, 13712, 32, 283, 1223, 5662, 390, 625, 26591, 11411, 812, 187, 2184, 323, 1679, 15, 187, 187, 2512, 434, 9828, 281, 751, 670, 4778, 20910, 15, 1198, 37843, 13, 352, 434, 2761, 187, 25737, 253, 954, 5919, 1039, 281, 22950, 10169, 273, 39653, 10229, 187, 395, 6383, 15, 1284, 22825, 416, 334, 27643, 12516, 352, 27, 187, 187, 1147, 434, 247, 5044, 4086, 273, 20701, 27, 10229, 326, 452, 15386, 4831, 313, 74, 537, 70, 13, 187, 4160, 5667, 10, 403, 4122, 4376, 7996, 15, 3840, 13, 667, 5382, 4354, 187, 15735, 323, 1959, 313, 267, 15932, 30060, 10, 588, 452, 271, 1014, 8750, 2380, 187, 936, 4376, 5459, 15, 187, 187, 25989, 187, 7110, 9125, 326, 2014, 14, 19209, 17647, 369, 3309, 275, 253, 2393, 1897, 187, 1171, 253, 2579, 13, 672, 952, 497, 816, 2970, 908, 281, 10054, 281, 187, 21596, 3440, 15, 1292, 1024, 13, 846, 6783, 78, 11411, 452, 644, 4211, 13, 359, 1472, 4518, 2469, 253, 2393, 519, 15578, 3408, 15, 1893, 752, 434, 253, 987, 20910, 1566, 1469, 3579, 32, 187, 187, 10342, 8553, 273, 253, 12027, 875, 8217, 285, 253, 13301, 452, 187, 34821, 327, 253, 4491, 434, 6031, 281, 7164, 7911, 13, 534, 403, 43296, 47388, 187, 66, 1943, 629, 273, 616, 2098, 15, 1621, 9326, 627, 15, 380, 2561, 359, 1849, 187, 20394, 2509, 323, 253, 1984, 2722, 326, 1561, 253, 10713, 273, 253, 3909, 3440, 187, 21616, 283, 783, 1755, 2233, 13, 933, 38661, 283, 7483, 495, 15, 22, 11411, 327, 253, 3388, 3437, 187, 39217, 15, 1893, 253, 1924, 13301, 403, 2970, 1679, 685, 370, 20, 275, 187, 250, 7290, 313, 2484, 3841, 1079, 10, 432, 16258, 672, 253, 3440, 310, 4211, 407, 253, 3540, 15, 187, 2773, 434, 1679, 685, 2716, 253, 35222, 4376, 273, 247, 3437, 313, 20261, 342, 5293, 187, 1171, 253, 3520, 4815, 273, 2403, 285, 35904, 247, 3437, 481, 380, 5333, 432, 187, 266, 5400, 1566, 281, 247, 3540, 1566, 310 ]
es and all “laws” imposed on Haiti under occupation, stop the corruption – For Haiti to invest the mineral riches and assets of the country in the local economy and thus – An end to unfair US-Euro trade in Haiti and the NGO invasion that’s mostly humanitarian imperialism. – An accounting of the Haiti Interim “Hillary and Billy” Reconstruction funds, collected in the name of suffering Haitians. Ezili interview on Black Agenda Report weekly radio broadcast with Glen Ford plus interview with Cornel West and Bob Avakian Dialogue at Riverside Church, published by BAR, Nov. 26, 2014. Ten of thousands of Haitians demonstrated in the Haitian capital of Port-au-Prince and throughout Haiti said Ezili Dantò. Mob pelts Dominican Consulate in Haiti, staff evacuated A mob of angry Haitians on Monday attacked the Dominican Consulate building in Ouanaminthe, northeast Haiti, which prompted the evacuation of the staff. The rioters pelted the consulate’s windows and staged protests by torching tires nearby. Haiti National Police reportedly fired tear gas to disperse protesters who also blocked the hundreds of workers from entering the Codevi Industrial Free Zone in Ouanaminthe, owned by Dominican businessman Fernando Capellan. Outlet listin.com.do reports that the riots continue in Haitian villages near the border with the Dominican Republic, on demands that Michell Martelly’s administration attend social needs such as drinking water, energy, street and roads repairs among others. Market reopens On Monday the cross-border market reopened after being shuttered last Friday on protests staged by Haitians in several towns, to demand that Port-au-Prince lower the taxes levied on products imported from Dominican territory.Tayo Fabuluje Olutayo "Tayo" Fabuluje (born July 17, 1991) is an American football tackle who is currently a free agent. He played college football for TCU. Fabuluje was drafted by the Chicago Bears in the sixth round of the 2015 NFL Draft. College career In 2010, Tayo Fabuluje redshirted at BYU. He then transferred to TCU, after which he sat out the 2011 season due to transfer rules. During the 2012 season, Fabuluje played all thirteen games, starting in twelve of them. During the 2013 season, he did not play football. He transferred back to BYU, but had no contact with the football team. During the 2014 season, Fabuluje was an Honorable Mention All-Big 12 player. He started twelve games at Left Tackle. Professional career Chicago Bears The Chicago Bears selected Fabuluje with the seventh pick of the sixth round in the 2015 NFL Draft, making him the 183rd pick overall. In his rookie season, Fabuluje violated the NFL's performance-enhancing drug policy and was suspended for four games. Baltimore Brigade (AFL) On June 21, 2017, Fabuluje was assigned to the Baltimore Brigade of the Arena Football League. San Antonio Commanders (AAF) On October 12, 2018, Fabuluje was signed by the San Antonio Commanders of the AAF. He was released following the team's initial mini-camp in December 2018. Memphis Express (AAF) In January 2019, Fabuluje signed with the Memphis Express of the AAF. However, he did not make the final roster. He was placed on injured reserve after clearing waivers. The league ceased operations in April 2019. Houston Roughnecks Fabuluje was drafted in the 2020 XFL Draft by the Houston Roughnecks. He was waived on January 13, 2020. References External links Texas Christian Horned Frogs bio Category:1991 births Category:Living people Category:American football offensive tackles Category:American people of Nigerian descent Category:American people of Yoruba descent Category:Baltimore Brigade players Category:Chicago Bears players Category:Houston Roughnecks players Category:Memphis Express (American football) players Category:People from Euless, Texas Category:Players of American football from Texas Category:San Antonio Commanders players Category:Sportspeople from the Dallas–Fort Worth metroplex Category:TCU Horned Frogs football players Category:Yoruba sportspeopleA public diary on themes around my books November 24, 2005 A fascinating paper from David Blackburn, a Harvard PhD student, on the economics of P2P file-sharing concludes that it does indeed depress music sales overall. But the effect is not felt evenly. The hits at the top of the charts lose sales, but the niche artists further down the popularity curve actually benefit from file-trading. Blackburn does a little mathematical magic to simulate what would happen if file-trading were reduced by 30%. [As you read, visualize the powerlaw curve that I use as my blog's logo: "leftward" means towards the hits and greater sales.]. [From page 32] In this counterfactual world with 30% less file sharing, the lower 75% of the distribution of sales is shifted further to the left, while the top of the distribution increases its sales. This is what should be expected given the estimates from above. Artists who are unknown, and thus most helped by file sharing, are those artists who sell relatively few albums, whereas artists who are harmed by file sharing and thus gain from its removal, the popular ones, are the artists whose sales are relatively high. This conclusion leads to further questions regarding the impacts that file sharing has had and will have on the recorded music industry. In particular, if file sharing essentially shifts sales away from established acts toward unknown acts, this has potentially very important implications for how talent is developed and distributed in the industry. As with the simple short-run effects of file sharing on sales, the direction of the impact is not clear. While one might guess that increasing the sales of new acts would lead to more investment in developing new talent, it is also possible that the investment in new acts is done as a fishing expedition to find artists who will sell millions of records. File sharing is reducing the probability that any act is able to sell millions of records, and if the success of the mega-star artists is what drives the investment in new acts, it might reduce the incentive to invest in new talent. This is, at its heart, an empirical question which is left to future work. The data follows, but first a little explanation. The 1% line refers to the sales of the least popular albums; the 99% line is the sales of the most popular. The third column is the calculated sales if file-sharing were reduced by 30%. As you can see from the below, that would help the sales in the top 25% of popularity, and hurt those below. Which is another way of saying that file-trading seems to help those in the bottom three-quarters of popularity, probably for the reasons stated above. The Long Tail implications of this are pretty clear. For the majority of artists further down the tail, free distribution is good marketing, with a net positive effect on sales. Which is yet another reminder that the rules are all too often made to protect the minority of artists at the top of the curve, not most artists overall. August 31, 2005 Although it's tempting to assume that the evil record labels are once again trying to gouge us, there's some sense in their latest efforts to get Apple to abandon it's one-size-fits-all pricing model. A New York Times article over the weekend reported on the ongoing struggle between the labels and Apple over its fixed $0.99 price point. The labels would like to sell most new music for more--$1.49/track?-- while older or more obscure tracks could go for less. There's plenty to like about variable pricing. For starters, it's almost always the most efficient way to maximize markets of disparate goods and customers. As Barry Ritholtz puts it: It's a basic rule of economics: goods that have elastic demand (i..e, non essential) are highly price sensitive. Further, any item easily available for free (albeit illegally) will have an even bigger response to price increases. Apple has argued that single-price simplicity was necessary in the early days of the service, when people were just getting used to paying to download music. But now, after 500m tracks have been sold, we're clearly past the early adopter phase. So what's the right pricing model going forward? Most accounts of the dispute between Apple and the labels have focused on the industry's efforts to raise prices, which are undeniably a big part of their plan. No surprise there. The research we've been doing for the book shows that within the bulk of the online music business--the top 100,000 downloads--only 3.5 tracks on the average CD sell. So the record labels are getting less than $3 in revenue (wholesale) from albums when the music is sold by the track. That's less than half the wholesale price of a CD (although with none of the physical costs of making and distributing a CD). The shift from an album model to a track model is
[ 860, 15, 187, 187, 3, 3404, 253, 1072, 673, 13, 309, 1353, 751, 27, 1281, 434, 1211, 352, 937, 611, 857, 22386, 86, 11424, 15, 346, 2512, 434, 2717, 34019, 670, 5753, 2509, 973, 387, 2143, 285, 41297, 326, 5108, 281, 320, 3684, 11650, 13, 534, 310, 1077, 12302, 323, 479, 15, 1244, 627, 6403, 626, 667, 3684, 11650, 17812, 15, 309, 1599, 25413, 18077, 369, 17975, 3248, 14, 7878, 15, 309, 2335, 12851, 273, 326, 15, 733, 434, 347, 2810, 347, 359, 1849, 12759, 15, 187, 187, 3, 1989, 436, 310, 1633, 359, 25903, 387, 15, 831, 3548, 626, 253, 5396, 42579, 2285, 15, 2053, 403, 3684, 11650, 14, 34436, 13, 5396, 14, 34436, 41297, 15, 1244, 309, 7636, 352, 449, 187, 187, 1044, 343, 6933, 14, 2913, 14, 744, 1780, 87, 527, 12828, 1164, 8952, 1912, 436, 807, 434, 33797, 30747, 15, 6408, 521, 4572, 846, 521, 10170, 13, 344, 753, 326, 344, 9355, 281, 6947, 253, 1551, 273, 521, 5768, 12392, 12057, 15, 611, 857, 22386, 86, 26984, 13, 346, 1328, 434, 247, 767, 14, 84, 631, 27799, 1476, 187, 187, 34, 6865, 1916, 914, 614, 32, 187, 187, 44, 857, 22386, 86, 369, 5686, 285, 5439, 275, 247, 11117, 9168, 275, 20507, 13, 427, 15, 58, 904, 534, 344, 8631, 347, 1907, 346, 19623, 13163, 3708, 13, 1027, 6021, 2308, 13, 1027, 11515, 13, 1027, 4243, 273, 253, 1533, 15, 733, 369, 14331, 449, 187, 187, 8389, 4651, 497, 5686, 275, 5427, 285, 4395, 281, 253, 530, 15, 52, 15, 672, 597, 497, 275, 616, 1384, 84, 15, 611, 857, 22386, 86, 8631, 247, 673, 275, 521, 11948, 672, 521, 3101, 2335, 779, 285, 521, 4929, 281, 48565, 4377, 13, 984, 703, 3078, 731, 281, 26030, 47602, 715, 2448, 5948, 15, 187, 187, 3, 1231, 1620, 3047, 1633, 8921, 670, 326, 937, 344, 2296, 15, 346, 1909, 309, 1694, 5662, 13, 352, 369, 2238, 273, 27541, 13, 751, 686, 13689, 247, 1273, 13, 2139, 403, 368, 13, 2139, 32, 6049, 858, 368, 1379, 441, 281, 48565, 4377, 285, 13, 604, 359, 1472, 26334, 13, 849, 1705, 368, 1339, 441, 6008, 17645, 5554, 1500, 753, 326, 703, 3078, 441, 281, 755, 908, 281, 752, 352, 369, 751, 281, 320, 271, 2448, 13, 285, 8505, 48565, 4377, 13, 973, 13, 352, 434, 3809, 2739, 15, 1737, 434, 625, 2448, 685, 3809, 2739, 865, 187, 187, 8389, 3101, 13, 530, 785, 611, 857, 22386, 86, 13, 33350, 347, 703, 2296, 326, 13, 4754, 13, 703, 858, 1379, 617, 15196, 281, 48565, 4377, 984, 352, 310, 1077, 2448, 533, 671, 835, 597, 1119, 952, 273, 512, 24550, 15, 187, 187, 3, 2773, 434, 835, 597, 4546, 342, 643, 5753, 273, 512, 9830, 937, 703, 2296, 15, 346, 1898, 840, 309, 908, 281, 2525, 342, 643, 4651, 273, 512, 9830, 449, 187, 187, 54, 785, 3078, 617, 5753, 281, 923, 326, 18745, 342, 952, 273, 512, 9830, 369, 417, 346, 14367, 3, 390, 346, 1026, 552, 449, 1244, 388, 1792, 611, 857, 22386, 86, 2296, 326, 344, 3543, 4999, 5675, 598, 275, 521, 20507, 9168, 15, 754, 1904, 626, 1158, 23285, 369, 247, 4092, 1895, 1919, 253, 17150, 8104, 273, 4005, 15, 1903, 15, 187, 187, 3, 1394, 4089, 670, 253, 9239, 7217, 512, 1475, 253, 2586, 13, 1014, 275, 1457, 2816, 13, 285, 309, 1158, 326, 434, 752, 10903, 479, 253, 954, 13, 352, 369, 9369, 275, 1457, 2816, 13, 285, 352, 369, 21643, 13, 984, 309, 8899, 598, 275, 20507, 13, 309, 8899, 598, 275, 1457, 2816, 13, 285, 359, 816, 18445, 342, 436, 19227, 13, 359, 18445, 342, 898, 16, 883, 937, 2296, 611, 857, 22386, 86, 13, 665, 369, 1283, 672, 253, 3645, 17061, 5197, 8104, 4592, 15, 187, 187, 3, 1898, 368, 1472, 7746, 479, 13, 846, 436, 13, 4130, 434, 15081, 359, 1472, 512, 3551, 2366, 13, 359, 1472, 2970, 8003, 13, 436, 310, 247, 673, 835, 359, 41697, 15, 733, 434, 751, 13, 1663, 32, 4923, 13, 275, 619, 3114, 13, 309, 923, 952, 2970, 8513, 285, 1146, 1691, 715, 22680, 12127, 449, 187, 187, 1909, 247, 906, 13, 611, 857, 22386, 86, 3395, 23075, 3939, 15, 754, 4307, 275, 253, 20507, 3286, 6834, 434, 3906, 37884, 273, 9239, 12137, 13, 2427, 281, 16335, 281, 789, 323, 271, 28054, 3570, 1387, 285, 1694, 521, 26616, 275, 1966, 3570, 387, 253, 4693, 4726, 273, 31015, 15, 187, 187, 3074, 253, 1223, 13, 521, 1462, 14, 484, 17325, 369, 816, 247, 34057, 15, 380, 2934, 273, 2509, 352, 2120, 14, 2606, 2210, 672, 13, 275, 253, 2393, 7901, 84, 13, 611, 857, 22386, 86, 3047, 20145, 13999, 327, 44948, 8170, 15, 187, 187, 3, 1992, 923, 3095, 665, 3589, 626, 2806, 390, 36180, 390, 3168, 513, 1462, 14, 484, 369, 5699, 937, 611, 857, 21297, 80, 11424, 15, 346, 1898, 703, 369, 5015, 670, 28054, 4651, 13, 285, 309, 452, 28054, 4651, 1905, 619, 4651, 403, 1027, 432, 617, 4651, 13, 533, 703, 369, 5015, 670, 352, 15, 1244, 326, 369, 10826, 13, 285, 352, 369, 11755, 15, 309, 369, 594, 31597, 407, 326, 15, 309, 3078, 281, 513, 326, 846, 7487, 617, 1347, 449, 187, 187, 8, 34, 7088, 418, 3920, 6061, 329, 3196, 750, 8, 187, 187, 14569, 13, 611, 857, 22386, 86, 434, 2144, 310, 417, 594, 1199, 670, 521, 1211, 2021, 13, 533, 670, 1146, 271, 20823, 1334, 275, 2087, 1905, 390, 387, 1878, 1146, 4127, 751, 581, 15, 1244, 344, 434, 417, 9202, 273, 11132, 690, 1048, 14, 6924, 13379, 15, 187, 187, 3, 2347, 513, 952, 15249, 2860, 40988, 275, 436, 2586, 32, 686, 58, 8, 14428, 13, 352, 434, 417, 13187, 285, 11819, 13, 352, 434, 13187, 285, 17363, 4117, 346, 344, 753, 387, 247, 3332, 921, 387, 253, 5418, 12441, 275, 5041, 13, 399, 15, 36, 15, 346, 7745, 13, 22335, 326, 310, 2032, 15, 10154, 13, 352, 369, 13187, 285, 17363, 15, 1292, 604, 368, 4456, 253, 2926, 13, 352, 369, 13187, 285, 17363, 285, 247, 5015, 45046, 15, 309, 1928, 751, 253, 5015, 45046, 12326, 253, 2644, 2395, 715, 1953, 15, 309, 1053, 626, 871, 849, 2032, 436, 310, 15, 1707, 434, 247, 5015, 24980, 3206, 15, 8948, 368, 10095, 626, 2613, 634, 2193, 327, 247, 500, 24895, 7225, 14, 881, 10076, 15, 1737, 651, 11960, 3288, 513, 32, 1737, 670, 1500, 250, 21128, 32, 1737, 670, 31071, 466, 253, 8081, 1368, 32, 5531, 13, 310, 326, 247, 1027, 1533, 32, 9876, 352, 2647, 387, 436, 1127, 32, 2064, 434, 247, 500, 24895, 7225, 14, 881, 10076, 15, 9870, 13, 309, 1353, 271, 5396, 14, 41, 527, 86, 34557, 15, 309, 871, 512, 670, 500, 24895, 7225, 14, 881, 15216, 15, 2064, 310, 247, 500, 24895, 7225, 14, 881, 10076, 449, 187, 187, 44, 857, 22386, 86, 2296, 344, 6057, 690, 952, 1912, 626, 751, 521, 1127, 273, 1859, 15, 346, 42, 1849, 644, 13781, 846, 2722, 432, 952, 665, 753, 13, 686, 42, 1053, 626, 5194, 342, 2712, 368, 753, 13, 533, 309, 12918, 253, 2644, 1039, 949, 2464, 2064, 434, 1335, 247, 1652, 8921, 281, 479, 15, 6975, 13, 2717, 32, 24744, 32, 1292, 387, 253, 1072, 673, 326, 434, 752, 6569, 275, 247, 7827, 15, 1422, 1537, 417, 5194, 342, 3253, 253, 643, 1436, 310, 3981, 13, 533, 368, 476, 1335, 452, 247, 1175, 9012, 689, 247, 5484, 13, 987, 865, 187, 187, 3404, 253, 921, 275, 5041, 13, 399, 15, 36, 904, 253, 8446, 369, 1077, 11117, 285, 1904, 626, 1646, 281, 452, 247, 1895, 342, 521, 1127, 273, 1859, 15, 187, 187, 3, 8836, 1978, 9745, 598, 253, 807, 1384, 2945, 327, 253, 3668, 672, 31188, 8442, 5224, 326, 19991, 588, 320, 253, 15156, 937, 344, 480, 8163, 15, 346, 688, 1384, 2945, 13, 8505, 3168, 952, 588, 320, 7584, 2558, 15, 3973, 273, 512, 13, 2139, 513, 359, 1918, 247, 269, 1128, 76, 32, 6049, 513, 359, 1978, 29570, 436, 32, 6049, 310, 436, 1014, 271, 2523, 32, 6272, 627, 3168, 952, 1060, 326, 403, 7514, 326, 597, 1833, 320, 253, 15156, 275, 1384, 2945, 32, 5037, 626, 7664, 3168, 952, 13, 368, 497, 247, 15156, 672, 368, 2210, 281, 436, 2586, 15, 19348, 4455, 281, 452, 4307, 562, 323, 368, 449, 187, 187, 44, 857, 22386, 86, 671, 4102, 5950, 2144, 323, 521, 806, 3153, 17325, 5400, 13, 1146, 4439, 327, 253, 1924, 5203, 26464, 9384, 25196, 15, 4129, 253, 5203, 310, 1682, 1929, 323, 30304, 5561, 13, 611, 857, 22386, 86, 11121, 352, 434, 247, 3962, 4944, 15, 187, 187, 37, 8552, 621, 670, 5492, 13, 31908, 285, 4466, 5257, 281, 755, 25807, 90, 4541, 13, 594, 359, 2186, 776, 4385, 398, 327, 6307, 26457, 281, 271, 3340, 1029, 2534, 15, 844, 778, 11352, 5701, 359, 1158, 1537, 1784, 647, 253, 7827, 15, 1310, 368, 1472, 747, 281, 6307, 26457, 13, 4496, 1239, 689, 776, 35863, 285, 37957, 434, 12244, 24620, 1078, 36738, 15, 844, 1611, 281, 24651, 4385, 398, 15978, 672, 359, 5386, 616, 5701, 13, 533, 1677, 326, 359, 4763, 247, 1029, 4644, 273, 5701, 13, 359, 778, 417, 1900, 320, 2104, 281, 755, 275, 5181, 15, 1310, 359, 1849, 5176, 247, 4385, 368, 3543, 369, 247, 30457, 285, 9865, 1635, 281, 253, 7827, 13, 4496, 1053, 626, 32379, 281, 755, 275, 5181, 342, 441, 407, 4579, 272, 11646, 88, 2682, 33, 79, 1087, 15, 2061, 15, 187, 187, 21914, 672, 12633, 908, 281, 2312, 670, 1146, 346, 5996, 14, 8306, 451, 16296, 6089, 13, 359, 1472, 7964, 417, 326, 15, 844, 1472, 247, 2285, 273, 18680, 39974, 407, 253, 21481, 16876, 273, 5492, 13, 31908, 285, 4466, 13, 849, 597, 1132, 562, 275, 776, 4852, 285, 7888, 13, 285, 849, 512, 273, 436, 310, 19507, 15, 27817, 342, 441, 247, 2372, 15, 15426, 1342, 21128, 310, 896, 347, 775, 335, 9705, 29347, 2653, 275, 686, 37, 357, 606, 72, 374, 8, 187, 187, 46, 29819, 27, 775, 335, 9705, 29347, 2653, 13, 253, 1077, 20035, 280, 5440, 342, 253, 25594, 6016, 2534, 310, 896, 15, 6470, 1342, 21128, 457, 84, 3565, 6745, 3239, 10098, 253, 806, 19150, 273, 253, 24590, 281, 4267, 2972, 67, 8976, 2802, 37, 357, 606, 72, 15385, 187, 187, 6623, 1369, 899, 386, 2305, 29347, 2653, 2112, 342, 521, 9931, 1190, 710, 17549, 5309, 13, 4546, 407, 11832, 518, 41386, 16495, 3227, 13, 588, 1056, 247, 34058, 436, 4565, 285, 253, 3085, 16966, 281, 320, 581, 2221, 256, 11114, 2146, 15, 187, 187, 31137, 697, 638, 38582, 13, 2802, 37, 357, 606, 72, 374, 457, 4453, 281, 320, 625, 2936, 31366, 275, 2426, 273, 253, 27722, 14, 257, 14, 32280, 15, 187, 34, 26856, 11938, 46017, 6470, 1342, 4453, 347, 277, 3834, 347, 344, 858, 275, 253, 20035, 280, 2250, 14998, 6440, 1223, 11832, 518, 41386, 16495, 3227, 4453, 1046, 2372, 23535, 275, 2800, 11433, 15, 187, 187, 2598, 1060, 457, 84, 690, 5304, 1555, 281, 512, 253, 6470, 1342, 21128, 7458, 6386, 273, 6129, 88, 8952, 15, 44357, 347, 604, 253, 4177, 574, 9355, 281, 9140, 521, 7458, 247, 15512, 273, 521, 1735, 15, 4967, 897, 10834, 40, 2373, 32, 6049, 417, 816, 897, 1529, 4633, 6207, 4989, 1504, 272, 5147, 32, 187, 187, 1147, 434, 247, 5272, 1953, 15, 11605, 2182, 2583, 310, 12976, 2583, 13, 3548, 626, 352, 32, 329, 6416, 476, 4354, 897, 581, 273, 253, 643, 4633, 6207, 4989, 1504, 272, 13498, 281, 2525, 247, 30122, 878, 13, 1361, 2085, 323, 3095, 275, 8891, 13, 390, 1329, 247, 2199, 390, 7517, 15, 187, 187, 1989, 752, 604, 247, 6416, 2136, 7302, 310, 17734, 6636, 323, 13887, 417, 281, 320, 5177, 262, 275, 271, 2425, 326, 6613, 4828, 281, 616, 13379, 32, 496, 387, 1878, 767, 973, 1345, 1025, 2219, 13, 9437, 281, 7164, 4320, 8128, 281, 2342, 7231, 17843, 452, 644, 6294, 1066, 15, 187, 187, 2214, 1650, 13, 275, 4072, 13, 26048, 330, 1582, 407, 38994, 275, 15427, 369, 44861, 370, 13743, 13, 933, 846, 21455, 281, 32413, 247, 12142, 15221, 323, 247, 34929, 4564, 15, 2091, 9891, 22234, 285, 38994, 28186, 9919, 281, 7164, 253, 2583, 949, 3617, 22624, 5072, 13, 253, 4544, 369, 2668, 1066, 984, 352, 13588, 253, 5147, 434, 2426, 285, 2515, 15, 496, 5041, 13, 253, 1072, 2181, 4592, 281, 4033, 1406, 4415, 659, 25374, 1342, 13, 7302, 273 ]
é. "At the same time, I'm like: Let's own it," Kondabolu explains. "There's nothing embarrassing about kids doing well at school and dominating that happen to be South Asian, which is very exciting for me. And there aren't any South Asian athletes. I mean Jeremy Lin was Taiwanese-American. I took ownership of that. It's as close as we've gotten. "But this is something we dominate at. This isn't the Indian Cricket team. These are South Asian-Americans, Indian-Americans dominating. And I loved it." Thirteen-year-old Arvind Mahankali won this year's spelling bee. During his interview after his victory, he said that he planned to spend the rest of his summer studying physics. Kondabolu jokes, "He's a two-sport athlete!" A Time To Unite? Kondabolu was born and raised in a diverse neighborhood in Queens, N.Y., which he describes as having "different immigration status, different income levels, different languages, different parts of the world. It was incredible." His parents were born in India and moved to the U.S. when they were in their 20s. Kondabolu describes a time in his childhood when his mother took him and his brother to Burger King, because she wanted them to assimilate into American society. "We never saw something strange about that," he says. "As I got older, it was kind of bizarre, like 'Wait a second, why are you, why? Why did you take us to Burger King and, if we're Hindu, how come you let us eat beef?' She said that she wanted us to get used to what it was like to be an American, and apparently Burger King, well, it's fast food. What's more American than fast food?" His mother, Uma Kondabolu, laughs as she says that, yes, she did take her sons to Burger King because it is very American but also where they found people of all backgrounds. "That's where they played with other kids of all colors," she says. "And then I used to meet with other parents of all colors." Uma wanted her kids to see that interacting with people of all colors was not "bad" or "scary." And Hari Kondabolu says that he felt safe growing up in his Queens neighborhood. He didn't think racism was a serious problem until the terrorist attacks of Sept. 11. "You hear about the hate violence all around the country, even in New York, and I think that's what struck me the most, it was happening in New York, and it was confusing, because I grew up in Queens, I grew up in New York, and we just dealt with this terrorism, we dealt with 9/11," says Kondabolu, who was 18 when the World Trade Center attacks happened. "And you're telling me, after this, everyone's claiming we're all coming together, we're getting closer, this is a time where we unite. It's like, really? Because, in my community, I see people getting hurt and being put into detention centers." As a result, Kondabolu became politically active. He worked in the Queens district attorney's office bureau of hate crimes, went to Seattle to work for an immigrant rights group and got his masters in human rights at the London School of Economics. All the while, his stand-up comedy was just a hobby. The idea of doing it full-time came when, in the early 1990s, Kondabolu saw Margaret Cho on Comedy Central. "To see someone who wasn't black or Latino or white do stand-up was huge," Kondabulo explains. "And she was talking about immigrant parents, and I have immigrant parents — my parents are different from her parents, but she was talking about it. And that was OK, and it was funny. I was so amazed by that. I wanted to do that after watching her perform." 'A Good Laugh Over A Drink' Today, Kondabolu's material is not so much about his own family, but about being an outsider in general — or at least being treated like one. And he's not afraid of challenging some long-standing beliefs. "How do people justify homophobia in this country? 'Y'know, it's not Adam and Steve, it's Adam and Eve,' " he said at a recent show at the Black Cat in Washington, D.C. "Look, technically that is true. Right, it was Adam and Eve. But if you remember the story, it was Adam and Eve and a talking serpent. I feel like the talking serpent throws the whole account into question. I don't know how true this is. There's a talking snake involved. Maybe you shouldn't base your values on a Jungle Book-type scenario. What would Baloo do? What about Shere Khan? What about Winnie the Pooh? Oh, is that a different world? Does it matter at this point? That's a Jungle Book-type scenario. Look, I'm an Indian-Hindu alright. I know all about Jungle Book-type scenarios. That is a Jungle Book-type scenario." Kondabolu says he knows some people won't like his point of view. "I've been approached after shows from people who said, 'I don't agree with anything you said, but I laughed the whole way through.' That's still a little strange to me. Like, nothing? Really? But at the same time that's what happens in a conversation. You might not agree with everything the other person is saying, but you can still have a good laugh over a drink, right?" At the show in Washington, D.C., the audience was very diverse and didn't seem to have a problem with his point of view. "People keep bringing up the year 2042 on the news when Census figures indicate that whites will be the minority," he joked. "In 2042, apparently white people will be 49 percent. First of all, why do we give a f—k? Why do we keep mentioning this? Why is this even an issue? Are there white people here that are concerned that they'll be the minority in 2042? Don't worry white people, you were a minority when you came to this country. Things seemed to have worked out for you." Kondabolu also recently recorded material for his first live comedy album, being released on the record label Kill Rock Stars. Although the label is best known for punk rock, Kondabolu thinks it's a perfect fit. Discussions about race, ethnicity and culture tend to get dicey quickly, so we hold our commenters on Code Switch to an especially high bar. We may delete comments we think might derail the conversation. If you're new to Code Switch, please read over our FAQ and NPR's Community Guidelines before commenting. We try to notify commenters individually when we remove their comments, but given that we receive a high volume of comments, we may not always be able to get in touch. If we've removed a comment you felt was a thoughtful and valuable addition to the conversation, please don't hesitate to get in touch with us by emailing [email protected]. Remember when folks used to talk about being "post-racial"? Well, we're definitely not that. We're a team of journalists fascinated by the overlapping themes of race, ethnicity and culture, how they play out in our lives and communities, and how all of this is shifting. Sit with us a bit.Salman Khan is back as Chulbul Pandey in 'Dabangg 2' Mumbai: Chulbul Pandey, the very rustic cop with the sexy handle bar is back. Salman Khan’s official Facebook page launched the first trailer of the sequel to 2010 blockbuster ‘Dabangg’. Flamboyant Mr Pandey along with his ladylove Rajjo, played by Sonakshi Sinha, will make a splash this December and the film promises to be one super sizzler. Unlike its prequel, ‘Dabangg 2’ looks to be more urbane in terms of the misc-en-scene. A khaki clad Salman looks as dashing as he did in the rustic action packed movie while Sonakshi Sinha looks every bit gorgeous in six yards. So here’s some visual treat to all the Salman Khan fans ahead of Diwali. Looks as if the star had planned to gift his fans a slice of his next.Why use WayGiver? Why not just use another popular crowdfunding platform? It's a reasonable question. Raising money is raising money, isn't it? A Christian can easily use one of the other popular crowdfunding platforms to meet a humanitarian need, help provide for someone in crisis, or support a project or mission. But what if a Christian business owner is legally charged for choosing not to be complicit in an activity that runs counter to their beliefs? In at least two well publicized cases, attempts to raise legal fees to defend religious liberty have been shut down. For example, in 2013, Sweet Cakes by Melissa in Oregon was fined $135,000 after refusing to bake a wedding cake for a lesbian couple. When owners Aaron and Melissa Klein attempted to raise the money through GoFundMe, the campaign was taken down because it violated the platform's terms and conditions. In Washington, the same thing happened to Barronelle Stutzman, owner of
[ 346, 1394, 2564, 604, 309, 32366, 562, 387, 634, 1684, 434, 1659, 323, 247, 1643, 1897, 865, 346, 17833, 449, 346, 8061, 449, 7998, 10560, 10690, 25419, 8951, 8100, 2637, 6844, 346, 3848, 56, 770, 4850, 562, 10873, 13, 8652, 449, 346, 42, 369, 4680, 5046, 309, 943, 2312, 281, 779, 449, 7998, 51, 2637, 2637, 6844, 346, 5622, 3903, 472, 13, 388, 4986, 504, 449, 346, 26123, 449, 7998, 51, 5529, 5993, 2637, 6844, 346, 6402, 2293, 10449, 5136, 346, 3074, 987, 13, 952, 13, 1339, 434, 755, 896, 281, 789, 1060, 449, 346, 6506, 13, 352, 434, 271, 27108, 449, 346, 42, 3735, 352, 449, 346, 7745, 13, 309, 1904, 626, 871, 368, 497, 247, 3817, 254, 449, 346, 37, 15242, 434, 3735, 273, 368, 285, 344, 31533, 368, 3297, 323, 8955, 449, 346, 42, 2183, 779, 359, 1313, 387, 326, 1445, 10738, 387, 20923, 12447, 434, 7225, 26729, 449, 346, 2598, 13, 604, 368, 452, 281, 8670, 11648, 323, 619, 355, 29294, 13, 320, 16105, 449, 346, 7817, 7519, 58, 5136, 346, 7883, 434, 436, 865, 346, 24774, 936, 449, 346, 510, 2929, 310, 253, 418, 15, 34, 15, 7717, 323, 4223, 337, 13, 33554, 449, 346, 24774, 936, 369, 9745, 275, 253, 2929, 672, 32398, 1119, 562, 344, 1160, 521, 806, 3041, 449, 346, 1328, 3078, 281, 10804, 4427, 253, 2774, 13, 594, 344, 5103, 779, 449, 346, 4943, 359, 564, 449, 346, 29859, 13, 10956, 13, 436, 310, 619, 3331, 13, 378, 12202, 449, 346, 35, 12202, 13, 436, 310, 619, 3101, 13, 9752, 8440, 8842, 23487, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 29235, 281, 2525, 368, 449, 346, 46, 24259, 1843, 7570, 5136, 346, 3220, 3392, 13, 29544, 3592, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 49, 282, 5849, 281, 2525, 368, 13, 8674, 449, 346, 1898, 619, 7586, 13, 26642, 3044, 1773, 6169, 418, 968, 22869, 449, 346, 7817, 7519, 58, 5136, 346, 12764, 449, 346, 52, 1403, 368, 3819, 353, 23863, 36126, 449, 346, 7536, 264, 253, 19110, 745, 779, 449, 346, 8195, 19669, 27301, 368, 1537, 452, 644, 449, 346, 7817, 7519, 58, 5136, 346, 8061, 449, 346, 5804, 309, 755, 368, 1633, 865, 346, 17833, 449, 346, 42, 1833, 755, 352, 13, 32398, 449, 346, 9281, 13, 31556, 449, 346, 46, 23863, 3534, 247, 1175, 921, 449, 346, 25713, 4592, 281, 779, 865, 346, 41, 2771, 249, 46539, 449, 346, 25643, 3076, 449, 346, 1328, 439, 3163, 521, 2021, 449, 346, 1898, 8288, 273, 5870, 937, 346, 38251, 8440, 13, 26642, 449, 346, 2773, 434, 776, 1682, 30484, 23642, 292, 13, 298, 1911, 466, 449, 346, 41793, 44431, 2296, 5322, 1841, 670, 368, 449, 346, 37, 15242, 13, 476, 359, 6008, 865, 346, 35, 12202, 285, 309, 971, 281, 5834, 247, 898, 27, 1229, 921, 449, 346, 4527, 2282, 13, 31556, 449, 346, 19224, 275, 13, 9931, 449, 346, 39430, 90, 19021, 35328, 49618, 952, 449, 346, 18853, 1137, 33698, 35328, 25273, 684, 449, 346, 42, 971, 281, 3812, 2305, 15, 35526, 30373, 85, 13, 32398, 449, 346, 1394, 1472, 275, 323, 247, 17877, 1113, 280, 39643, 13, 378, 12202, 449, 346, 46, 15242, 434, 619, 3965, 581, 13, 533, 26642, 434, 619, 18065, 21242, 449, 346, 1276, 2238, 273, 247, 1416, 310, 35526, 30373, 85, 865, 346, 45854, 865, 346, 22353, 449, 346, 34, 1270, 952, 13, 253, 20003, 449, 346, 32914, 2146, 369, 247, 2372, 13622, 449, 346, 1989, 1616, 619, 3000, 326, 36900, 359, 1833, 14938, 417, 14167, 5621, 342, 779, 281, 3819, 253, 48660, 449, 346, 1394, 871, 13, 309, 5339, 247, 2257, 273, 634, 2586, 3767, 1309, 253, 2137, 449, 346, 7710, 15, 35526, 30373, 85, 13, 452, 368, 1313, 11960, 936, 275, 253, 29329, 865, 346, 4374, 449, 346, 17534, 15958, 449, 346, 3172, 28723, 53, 5136, 346, 1145, 1711, 3331, 30040, 779, 449, 346, 1231, 497, 275, 253, 45690, 30068, 2366, 449, 346, 35848, 466, 308, 786, 257, 449, 346, 1328, 3078, 281, 789, 275, 253, 22336, 398, 449, 346, 3039, 858, 368, 2118, 1060, 865, 346, 39134, 449, 346, 41, 41265, 369, 247, 12120, 48554, 533, 253, 11561, 22336, 398, 497, 1766, 19275, 449, 346, 35848, 466, 1694, 789, 347, 247, 15632, 637, 13, 479, 3652, 9910, 449, 346, 35848, 466, 5611, 479, 281, 23302, 322, 2477, 3592, 449, 346, 42, 6518, 779, 1973, 326, 8039, 2199, 344, 369, 8133, 598, 21281, 326, 7122, 14, 1403, 1020, 861, 449, 346, 41, 41265, 1373, 449, 346, 42, 908, 281, 2389, 253, 10030, 10228, 611, 2695, 449, 346, 5072, 13, 1512, 449, 346, 20598, 23302, 3260, 849, 281, 29684, 247, 14838, 6079, 449, 346, 1328, 574, 42359, 46826, 272, 347, 5188, 43770, 285, 12008, 26620, 449, 346, 35848, 466, 285, 309, 908, 281, 4446, 731, 689, 281, 14759, 1373, 846, 1249, 3038, 327, 247, 11561, 22336, 254, 449, 346, 5872, 1691, 275, 1529, 2800, 3038, 407, 30162, 3243, 449, 346, 1328, 1014, 3534, 441, 6440, 20079, 247, 4564, 273, 2069, 449, 346, 3172, 28723, 53, 5136, 346, 29859, 449, 346, 6723, 368, 5471, 973, 865, 346, 17304, 368, 751, 281, 8162, 281, 253, 7827, 865, 346, 8917, 368, 871, 13, 2305, 15, 35526, 30373, 85, 13, 326, 9752, 8440, 38715, 310, 4907, 846, 479, 865, 346, 42, 1904, 626, 449, 346, 3039, 29544, 3592, 7028, 479, 13, 323, 619, 3392, 434, 2583, 937, 346, 248, 12316, 619, 2021, 326, 344, 651, 897, 521, 4833, 342, 253, 3228, 1503, 12777, 5986, 281, 452, 247, 6406, 4907, 846, 479, 449, 346, 1989, 512, 344, 812, 8722, 369, 247, 3846, 14, 423, 2972, 275, 247, 2502, 14, 3243, 3286, 3, 346, 249, 15915, 34841, 449, 346, 6723, 368, 7615, 342, 253, 9168, 13, 2305, 15, 35526, 30373, 85, 865, 346, 42, 8899, 598, 627, 449, 346, 4374, 13, 973, 13, 840, 368, 1833, 871, 326, 16234, 354, 44884, 3, 346, 911, 3014, 3746, 275, 8323, 449, 346, 42, 4089, 1142, 273, 731, 871, 2305, 15, 418, 968, 22869, 407, 1416, 449, 346, 2773, 434, 2217, 1476, 346, 42, 588, 1625, 323, 619, 33637, 672, 18308, 10427, 1406, 3249, 281, 8955, 13, 533, 417, 323, 23089, 44431, 434, 5086, 665, 373, 449, 346, 1328, 434, 247, 1846, 40677, 449, 346, 3220, 2656, 13, 29544, 3592, 1476, 346, 2347, 1652, 368, 1158, 273, 479, 449, 7998, 3886, 7273, 37, 2637, 6844, 346, 42, 1353, 7016, 449, 346, 42, 1353, 1663, 594, 7016, 449, 346, 7710, 15, 35526, 30373, 85, 449, 7998, 37, 11840, 378, 18004, 2637, 6844, 346, 7817, 7519, 58, 5136, 346, 1394, 4934, 634, 1416, 562, 273, 253, 9380, 449, 346, 24753, 253, 12142, 449, 346, 7093, 3101, 651, 2389, 326, 449, 346, 2993, 434, 247, 3802, 706, 449, 346, 510, 2238, 665, 3936, 28123, 253, 7345, 4245, 617, 594, 703, 2506, 626, 452, 281, 11476, 281, 1146, 247, 5184, 2522, 449, 346, 4045, 368, 971, 281, 871, 247, 4279, 865, 346, 17833, 449, 346, 37, 15242, 8686, 46301, 42859, 285, 1711, 6440, 5239, 432, 23302, 322, 2477, 3592, 285, 4270, 9910, 562, 273, 731, 449, 346, 2773, 434, 849, 344, 1663, 1160, 521, 2583, 449, 346, 1328, 434, 1694, 3289, 7604, 793, 512, 689, 418, 15, 34, 449, 346, 8389, 1175, 3331, 9309, 466, 13, 278, 1468, 264, 275, 247, 1113, 13035, 13, 1223, 3515, 32398, 690, 1486, 2287, 449, 346, 1898, 1024, 344, 12326, 779, 34890, 793, 13, 8909, 7375, 13, 43981, 32398, 434, 19272, 3607, 449, 346, 1394, 1053, 626, 452, 281, 2028, 479, 436, 449, 346, 42, 751, 368, 13, 378, 12202, 449, 346, 42, 1904, 626, 2028, 368, 512, 670, 33686, 449, 346, 1394, 1904, 626, 865, 346, 5498, 626, 320, 10279, 387, 479, 449, 346, 8693, 5768, 13, 309, 3735, 670, 247, 3226, 665, 3261, 751, 479, 449, 346, 42, 1694, 14338, 449, 346, 42, 1669, 7211, 387, 247, 4564, 273, 5053, 937, 4890, 7093, 1007, 14, 267, 2804, 5605, 281, 2525, 368, 937, 1841, 751, 326, 449, 346, 42, 1669, 619, 1180, 449, 346, 2993, 1925, 449, 346, 2773, 434, 849, 309, 1313, 617, 387, 3905, 10754, 570, 434, 342, 418, 46932, 449, 346, 1898, 326, 434, 512, 273, 352, 865, 346, 4374, 449, 346, 17570, 479, 1633, 449, 346, 4967, 1871, 368, 971, 281, 2525, 33686, 14196, 8791, 865, 346, 42, 1849, 4307, 1892, 281, 320, 13155, 3, 346, 2858, 253, 1039, 952, 2529, 33686, 352, 369, 751, 703, 369, 247, 3626, 449, 4890, 5498, 626, 2940, 562, 327, 479, 13, 7727, 449, 4890, 27128, 368, 1557, 449, 346, 27128, 326, 368, 3255, 3, 346, 15157, 15, 1163, 3, 346, 14866, 14196, 449, 346, 2512, 310, 247, 19309, 846, 346, 6672, 43196, 346, 6723, 368, 7615, 342, 253, 4383, 3448, 865, 346, 42, 1611, 281, 320, 449, 346, 9281, 449, 346, 1466, 434, 1611, 352, 969, 449, 346, 1898, 4456, 13, 564, 896, 281, 253, 5068, 13, 368, 1472, 38141, 779, 449, 346, 35, 909, 3390, 449, 346, 1328, 434, 7824, 562, 327, 368, 449, 346, 1394, 1472, 38141, 779, 449, 346, 2598, 13, 1705, 327, 13, 1339, 434, 513, 352, 449, 346, 1231, 1472, 3515, 562, 273, 3085, 1060, 449, 346, 1466, 434, 564, 449, 346, 23833, 13, 1053, 626, 2940, 562, 327, 479, 449, 346, 7845, 1333, 326, 368, 1557, 449, 346, 27128, 326, 368, 1158, 326, 309, 1353, 5389, 13, 285, 326, 368, 2389, 479, 449, 346, 14866, 14196, 13, 368, 871, 13, 436, 310, 247, 1077, 8872, 6200, 449, 346, 4045, 368, 1158, 368, 1472, 7032, 273, 4882, 31917, 865, 346, 17833, 449, 346, 42, 476, 513, 326, 449, 7998, 28893, 7519, 52, 26999, 8100, 2637, 6844, 7998, 37, 11840, 378, 18004, 2637, 6844, 346, 14866, 1476, 346, 15157, 5136, 346, 3633, 634, 3564, 745, 617, 1476, 346, 42, 1353, 271, 802, 1377, 532, 456, 5884, 285, 604, 368, 5181, 479, 1293, 247, 1111, 1406, 1246, 309, 1833, 25457, 368, 1476, 346, 15157, 5136, 346, 30359, 617, 3815, 449, 346, 2302, 1476, 346, 42, 1353, 247, 40677, 449, 346, 49, 3422, 11155, 449, 346, 1394, 285, 33686, 1160, 253, 20278, 16334, 2366, 13, 987, 865, 346, 8917, 368, 2455, 755, 667, 6440, 789, 865, 346, 2302, 449, 346, 4497, 13, 840, 13, 752, 670, 253, 3085, 476, 865, 346, 1147, 434, 247, 6440, 449, 346, 1276, 2238, 273, 6440, 865, 346, 19234, 8599, 479, 352, 434, 417, 5119, 473, 15, 16120, 91, 23237, 449, 346, 4125, 13, 368, 452, 281, 2028, 441, 253, 2644, 2181, 13, 49541, 13, 594, 1158, 352, 949, 449, 346, 42, 369, 18072, 3390, 387, 247, 2534, 275, 18733, 66, 449, 346, 1552, 637, 3053, 5015, 281, 479, 449, 346, 42, 1869, 309, 369, 12821, 285, 309, 369, 18439, 26395, 3076, 323, 2583, 449, 346, 1328, 753, 344, 1871, 1918, 479, 370, 1518, 281, 769, 275, 247, 34408, 466, 3085, 449, 346, 1328, 753, 344, 3058, 1529, 3226, 13, 594, 309, 1925, 33686, 449, 346, 1231, 1160, 3255, 346, 8398, 368, 449, 26133, 783, 6440, 387, 436, 1943, 2419, 247, 4564, 273, 3038, 3345, 3874, 449, 346, 5872, 344, 12668, 441, 896, 281, 418, 15, 34, 449, 346, 7161, 369, 436, 2419, 13, 4555, 865, 346, 42, 369, 3965, 562, 273, 352, 13, 604, 368, 871, 752, 309, 1599, 449, 7998, 46, 3016, 1864, 45516, 2637, 6844, 346, 1276, 513, 368, 1158, 13, 3734, 865, 346, 1552, 1694, 2712, 281, 513, 342, 253, 3226, 434, 7701, 865, 346, 12486, 5103, 13, 9060, 449, 346, 1276, 434, 326, 670, 13, 24173, 865, 346, 7093, 5006, 476, 626, 2186, 521, 1824, 865, 346, 42, 1694, 368, 411, 3298, 1103, 449, 346, 1394, 1472, 619, 1821, 285, 368, 1160, 479, 1007, 751, 247, 11213, 275, 2914, 273, 253, 954, 6422, 637, 275, 253, 7811, 449, 346, 1898, 368, 3255, 346, 6506, 13, 368, 449, 346, 7745, 387, 479, 449, 346, 5622, 3903, 472, 865, 346, 7745, 387, 479, 1476, 346, 2042, 368, 10345, 626, 2305, 15, 8726, 13, 368, 651, 320, 14116, 432, 7143, 2168, 449, 346, 1394, 1472, 247, 18750, 14, 5267, 3938, 13, 11974, 14, 484, 22161, 3255, 346, 28412, 562, 273, 436, 13, 35526, 30373, 85, 1476, 346, 1394, 1472, 896, 327, 411, 3298, 1103, 347, 273, 10873, 449, 346, 42, 971, 368, 281, 1304, 281, 479, 387, 470, 10695, 342, 247, 4857, 273, 32135, 323, 9060, 6115, 449, 346, 1394, 403, 247 ]
"You mind if I bunk out at your pop's place for a few days?" "Sure." "Thanks." "(TYPEWRITER CLACKING)" "DeWitt gets out tomorrow, Lee." "I was thinking maybe I should talk to him." "(RINGING)" "Blanchard, Homicide." "Lee." "(RUMBLING)" "MILLARD:" "All right, people, let's get back to work here." "Yeah, it's an earthquake." "I heard it." "Look, I didn't know you were a boxer." "Daddy's heard of you and he insists you stay for dinner." "I told him we met at that art exhibit at Stanley Rose's Book Shop." "So, if you have to pump everybody for my alibi, be subtle." "BUCKY:" "Who's this?" "Balto." "The paper is the L.A. Times for August 1, 1926." "Balto was bringing in the paper when Daddy found out he made his first million." "He wanted to consecrate the moment, so he shot him." "Here we go." "Mother, Father, this is my friend, Bucky." "Bucky, this is my mother, Ramona Cathcart Linscott." "BUCKY:" "Nice to meet you." "MADELEINE:" "My father, Emmett Linscott." "BUCKY:" "Pleasure to meet you, sir." "And my sister, Martha McConville Linscott." "BUCKY:" "Hi." "Saw you fight Mondo Sanchez." "Boxed the pants off him." "Another Billy Conn you might have been." "BUCKY:" "Thanks." "Can I get you something?" "Sure." "I'll get it, Daddy." "Okay, darling." "Mondo gave a good show." "Whatever happened to him?" "Heroin overdose." "Too bad." "He shamed his family." "And speaking of families," "Ramona, Martha." "That's our best Glenlivet, laddie." "Madeleine says nice things about you." "Daddy, can we eat?" "Bucky and I want to catch a 9:30 show." "Of course, darling." "Dig in, lad." "Hearty fare breeds hearty people." "Haute cuisine breeds degenerates." "I want to draw Mr. Bleichert, Daddy." "You're in for a cruel caricaturing, Bucky." "Maddy's my pretty one, but Martha's my certified genius." "What kind of a name is Bleichert?" "Dutch?" "German." "A great people, the Germans." "Hitler was a bit excessive." "But mark my words that someday we'll regret not joining forces with him to fight the Reds." "You know, I killed a lot of your countrymen during the war." "Mr. Bleichert, have you met Balto in the hallway?" "Yes." "Very realistic." "EMMETT:" "An old friend stuffed him." "We were in the Scots Regiment together." "Georgie Tilden." "He wanted to work in the flickers." "When did you move here?" "1920." "Hollywood was a cow pasture but the silent flickers were booming." "Georgie got work as a lighting man, me building houses." "Georgie introduced me to Mack Sennett." "I helped him build that housing project he was putting up underneath that god-awful sign." "Hollywoodland." "I used to love the Keystone Kops." "Me, too." "Old Mack knew how to squeeze a dollar dry." "He had extras moonlighting as laborers and vice versa." "Georgie and I used to drive them over to Hollywoodland after 12 hours on a silent flicker." "Then put in another six hours by torchlight." "He even gave us movie credits a couple of times." "EMMETT:" "Mother." "Are you feeling well?" "Would you like to contribute to the conversation?" "Did you know, Mr. Bleichert, that Ramona Boulevard is named after me?" "I didn't." "When Emmett married me, for my father's money," "he promised my family that he would use his influence with the City Zoning Board to have a street named after me." "But all he could manage was a dead-end block in a red-light district" "in Lincoln Heights." "Are you familiar with the neighborhood, Mr. Bleichert?" "I grew up there." "Yes, well, then you'll know that Mexican prostitutes" "expose themselves in windows." "I hear many of them know Mr. Linscott by name." "That's enough!" "I will sing for my supper when Mayor Bowron comes to dinner, but not for Madeleine's male whores." "He's a common policeman." "My God, Emmett!" "How little you think of me." "(THUDDING)" "I'm sorry." "I'm really so sorry." "Mr. Bleichert." "(DOG BARKING)" "BUCKY:" "You kept your name out of the papers." "Until the wedding." "Your mother would love that." "She's a snob." "The kind who takes pills the doctor gives her so she doesn't have to admit to being a hophead." "Do you want to know a secret?" "Sure." "Daddy bought rotten lumber and old movie sets from Mack Sennett and built houses out of them." "That's how he really made his money." "He's got firetraps all over L.A." "His good friend Georgie, maimed in a car crash, while running Daddy some errands." "And now he throws him scraps, odd jobs, tending Daddy's rental properties." "You don't have to tell me this." "I like you, Bucky." "I didn't tell you all about Betty." "You didn't?" "Don't be mad at me." "Last summer, I heard about a girl who looked like me." "I got curious." "I left notes at a couple of places," ""Your look-alike wants to meet you," things like that." "I left my number." "She called." "That's how I met her at LaVerne's with Lorna." "And that's all of it?" "Yes." "Tell me something." "Why'd you want to meet Betty Short anyway?" "I've worked hard to be loose" "but the way people described Betty it was like she was a natural." ""Don't walk out on me, Richard." ""Say you care." "Say that you..."" "MAN. :" "Miss Short." "There is a pause after "care"." "Are you familiar with the English language?" "I try to be." "Okay." "Let's try it again." "And remember, go back to the beginning, you're begging him." "Begging." "He's walking out on you." "You're begging him." "So, come on, let's do it." "We're running out of film here." "Let's go." "Richard, don't walk out on me." "Please say that you care." "Say that you think that I'm beautiful, and that you love me." "Miss Short, you know, this is a very sad scene." "Do you think you're capable of playing sadness?" "Sure." "I can do that." "(DUCKS QUACKING)" "(DOG BARKING)" "Miss!" "MAN:" "Get your hands off her!" "I'm an emancipated minor and if you touch me without a matron present I'll sue you!" "MAN:" "Leave her alone." "No!" "I'm a policeman." "Policeman." "You and Betty made the casting rounds together, right?" "Did you ever get any movie work?" "No." "Well, then, what about the film can?" "It's a movie." "What kind of movie?" "Something tells me it's not David O. Selznick." "Now, you have to tell us the whole thing, sweetheart, so think it through." "I was cadging at a bar in Gardena." "This man started talking to me." "I thought I was pregnant and I was desperate wicked bad for money." "He said he'd give me $200 to act in a nudie film." "He said he needed another girl, so I called Betty." "We made..." "Thank you." "...the movie at this big house a couple of hours outside town." "Then he drove us back to L.A." "Where was this house, exactly?" "I was pretty out of it, if you know what I mean." "(MUSIC PLAYING)" "What do you think, Russ?" "This got anything to do with the girl's murder?" "Long shot, Chief." "What's that about, gentlemen?" "Your boy can't hold his water?" "I got you Warrants." "You're my men and you made me look like a fool in front of the most powerful man in the department." "And you..." "Yeah, you." "Look at me." "Blanchard?" "Look at me!" "If you weren't Mr. Fire, you would be suspended from duty already." "You're a punch-drunk, washed-up fighter..." "Stay out of this, Bleichert!" "You're back on Warrants as of tomorrow." "I want you to report to me at 0800 with a letter of apology for Chief Green." "You are a
[ 16730, 387, 495, 268, 15, 78, 15, 7948, 13, 4416, 15, 721, 275, 38308, 19121, 2596, 273, 253, 9069, 1940, 2208, 4055, 15, 1707, 588, 320, 247, 4864, 16112, 1563, 253, 16730, 15, 1876, 403, 12470, 281, 8041, 390, 3698, 253, 10675, 327, 253, 9069, 1940, 4422, 15, 187, 187, 39265, 531, 13, 247, 418, 770, 10747, 14544, 13, 369, 11162, 281, 8171, 5037, 11957, 1321, 347, 28845, 323, 4412, 495, 846, 344, 25036, 4321, 436, 1770, 15, 1500, 588, 5752, 1919, 253, 4596, 6132, 15, 187, 187, 3039, 247, 3874, 342, 247, 1824, 8891, 16382, 24846, 13, 28969, 1204, 13, 48356, 285, 10459, 19412, 266, 5585, 13, 352, 7637, 598, 342, 952, 4704, 281, 36733, 984, 597, 1053, 457, 85, 452, 2217, 2583, 281, 759, 70, 15, 187, 2374, 3344, 15, 655, 13, 380, 12683, 489, 19670, 2434, 15, 5485, 773, 29796, 7795, 628, 27, 380, 4878, 474, 1806, 247, 2206, 45756, 17325, 326, 3637, 15520, 7795, 628, 13, 247, 3874, 326, 556, 46084, 264, 253, 897, 273, 3055, 18016, 1641, 275, 271, 3177, 281, 14368, 1824, 8353, 15, 380, 7815, 273, 15520, 7795, 628, 1364, 897, 247, 1345, 2075, 14, 468, 14, 2327, 985, 9633, 407, 530, 7920, 7088, 6487, 15, 187, 187, 510, 655, 14, 2913, 14, 744, 10145, 273, 15632, 8370, 36555, 326, 3053, 253, 3729, 14307, 16611, 8726, 23383, 8106, 3344, 15, 1668, 281, 581, 966, 14, 23, 17974, 1385, 273, 14954, 18557, 390, 9791, 26286, 13, 2556, 281, 253, 19759, 3928, 4412, 10158, 457, 84, 7454, 15, 187, 187, 30769, 1284, 7232, 273, 1716, 9393, 369, 6636, 275, 3563, 4162, 342, 767, 966, 14, 21, 11664, 19844, 273, 1273, 14, 14577, 549, 1665, 275, 4602, 342, 15632, 44161, 1223, 19759, 3928, 369, 275, 247, 3924, 14, 19, 3289, 8913, 15, 14214, 1712, 84, 18, 94, 187, 7770, 187, 187, 11, 998, 257, 302, 3838, 31911, 33673, 43639, 11, 310, 247, 22197, 14, 12373, 3791, 2531, 20192, 275, 32943, 390, 25047, 1363, 1008, 2041, 15, 520, 2904, 24264, 14, 22708, 1342, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 19968, 3136, 18, 1570, 1723, 13, 253, 2554, 273, 436, 3791, 2531, 20192, 347, 271, 15377, 407, 1676, 254, 390, 47113, 5570, 2223, 4558, 12744, 1008, 2041, 15, 520, 2904, 24264, 14, 40, 1730, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 40016, 4066, 74, 18, 62, 285, 1652, 310, 1929, 670, 697, 31402, 2616, 1008, 2041, 15, 520, 2904, 24264, 14, 615, 48, 22621, 8432, 40, 20966, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 1470, 489, 1817, 80, 18, 1570, 187, 187, 23270, 46758, 13, 46796, 587, 18872, 10741, 7888, 30259, 42545, 10179, 27638, 281, 23945, 7006, 285, 25306, 5747, 12321, 3167, 25774, 13, 403, 9592, 7478, 347, 247, 15979, 2803, 281, 2728, 19556, 275, 253, 11900, 10649, 6578, 2330, 342, 6722, 10741, 10332, 1008, 2041, 15, 520, 2904, 24264, 14, 35, 75, 1596, 1200, 7391, 18, 1570, 475, 52, 15, 33673, 43639, 11, 14470, 403, 1929, 281, 452, 253, 3745, 281, 830, 9015, 46758, 327, 1097, 490, 12381, 9421, 1008, 2041, 15, 520, 2904, 24264, 14, 12558, 27157, 580, 290, 5650, 18, 7254, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364, 18, 1092, 285, 352, 310, 271, 15276, 3064, 275, 33112, 4702, 2190, 3382, 14470, 273, 475, 52, 15, 33673, 43639, 4556, 187, 187, 510, 5787, 6297, 6944, 33112, 4702, 275, 475, 52, 15, 33673, 43639, 11, 452, 417, 644, 18171, 5421, 15, 17746, 13, 15396, 323, 475, 1109, 77, 34, 11, 3320, 285, 475, 83, 18569, 39, 11, 3320, 403, 2361, 281, 6379, 33112, 4702, 1008, 2041, 15, 520, 2904, 24264, 14, 39, 276, 1994, 18, 1092, 1008, 2041, 15, 520, 2904, 24264, 14, 28777, 606, 18, 1570, 3840, 13, 253, 475, 1033, 72, 46, 11, 3320, 13, 9706, 247, 25171, 47855, 9548, 342, 1097, 5124, 462, 7675, 681, 307, 511, 313, 11070, 46, 10, 285, 5124, 297, 1136, 297, 307, 511, 4712, 13, 812, 320, 3206, 275, 33112, 14, 14692, 3745, 984, 273, 253, 23117, 342, 253, 475, 13256, 36, 11, 3320, 326, 310, 5506, 323, 253, 3275, 273, 247, 367, 14633, 2330, 342, 18945, 285, 20320, 4024, 26132, 275, 475, 49, 15, 38143, 11, 1008, 2041, 15, 520, 2904, 24264, 14, 11773, 46845, 18, 1570, 187, 187, 6436, 13, 352, 310, 1335, 12744, 326, 534, 3320, 10577, 1543, 275, 253, 1818, 273, 33112, 4702, 2190, 253, 1264, 3608, 13, 285, 534, 2234, 8898, 3527, 10577, 14802, 253, 1159, 2544, 273, 253, 2601, 15, 187, 187, 688, 436, 1263, 13, 359, 6730, 247, 873, 273, 2164, 3382, 14470, 273, 475, 52, 15, 33673, 43639, 11, 323, 33112, 4702, 13795, 275, 1340, 281, 1089, 1534, 3910, 13, 285, 6760, 253, 2954, 875, 33112, 3275, 285, 253, 5481, 273, 475, 1109, 77, 34, 2992, 475, 1033, 72, 46, 2992, 285, 475, 83, 18569, 39, 11, 3608, 15, 187, 187, 22025, 285, 13277, 1712, 84, 19, 94, 187, 18613, 187, 187, 39671, 21978, 1712, 84, 19, 66, 94, 187, 573, 187, 187, 1552, 1263, 7241, 369, 7012, 407, 253, 21482, 7039, 273, 380, 3973, 9767, 31689, 8896, 273, 37830, 40305, 8710, 2499, 15, 1876, 5705, 6704, 3542, 8191, 7578, 2720, 281, 253, 1263, 15, 23410, 1491, 369, 26314, 1025, 285, 372, 14, 24491, 2720, 281, 1783, 15, 187, 187, 35, 24097, 14470, 285, 3116, 2515, 1712, 84, 19, 67, 94, 187, 36960, 187, 187, 22641, 13, 5345, 475, 52, 15, 33673, 43639, 11, 14470, 285, 475, 52, 15, 33673, 43639, 11, 48745, 15220, 1787, 497, 6949, 15, 1876, 253, 8709, 5728, 432, 253, 653, 20938, 273, 1363, 16362, 253, 37830, 40305, 32097, 273, 11900, 6578, 432, 4267, 281, 4332, 15, 9658, 253, 5345, 14470, 13, 577, 22453, 8709, 7011, 432, 253, 1072, 3110, 689, 247, 2180, 273, 374, 1107, 285, 495, 22453, 8709, 7011, 432, 1529, 3110, 689, 247, 2180, 273, 337, 807, 497, 6949, 15, 380, 14470, 497, 3636, 347, 475, 52, 15, 33673, 43639, 11, 407, 19183, 5216, 970, 11595, 313, 11252, 1384, 14, 6603, 4155, 28, 16181, 46, 32278, 2310, 13, 2398, 951, 14, 45, 4479, 38, 936, 587, 13, 6181, 10, 390, 16644, 313, 55, 614, 76, 28, 16181, 46, 32278, 2310, 10, 2718, 13, 840, 7141, 387, 4150, 1438, 3272, 36, 1919, 897, 672, 597, 497, 8228, 387, 5345, 3272, 36, 275, 26596, 14, 41, 8185, 21703, 313, 46, 10114, 28, 10559, 1238, 10, 10855, 15, 187, 187, 7475, 1999, 2905, 1255, 407, 22919, 7538, 285, 7368, 1783, 1712, 84, 19, 68, 94, 187, 6154, 187, 187, 49, 7228, 264, 14, 3423, 9480, 27273, 313, 14981, 7538, 10, 1783, 273, 475, 57, 5830, 11, 42, 14, 11174, 7250, 14421, 3882, 369, 2684, 281, 3653, 253, 6380, 2905, 1255, 273, 475, 52, 15, 33673, 43639, 11, 14470, 970, 247, 44104, 39, 14, 37479, 1594, 34, 4155, 313, 23270, 14, 13021, 31497, 13, 48816, 13, 6582, 13, 5106, 10, 347, 2529, 407, 1023, 338, 797, 1008, 2041, 15, 520, 2904, 24264, 14, 3251, 338, 797, 18, 1570, 380, 29375, 6866, 497, 2529, 407, 13728, 1189, 1008, 2041, 15, 520, 2904, 24264, 14, 27788, 1189, 18, 62, 16248, 530, 11070, 3788, 313, 328, 24676, 4667, 1387, 1332, 342, 20258, 280, 31218, 10, 1332, 13, 1680, 311, 684, 497, 7922, 253, 1072, 4734, 1178, 1692, 604, 253, 1318, 273, 399, 547, 10235, 273, 14259, 369, 8994, 1438, 6, 1008, 2041, 15, 520, 2904, 24264, 14, 2809, 74, 18, 1570, 187, 187, 23270, 18405, 4702, 6981, 1712, 84, 19, 69, 94, 187, 25916, 187, 187, 5279, 6170, 11048, 275, 308, 15803, 497, 15045, 342, 5352, 308, 15803, 281, 271, 26514, 28321, 273, 337, 15, 361, 313, 47771, 281, 670, 337, 6027, 740, 63, 26, 63, 46828, 16, 1686, 481, 5761, 14, 39179, 48661, 262, 398, 273, 337, 45152, 2313, 21042, 19081, 15508, 497, 7644, 8821, 281, 1016, 973, 273, 247, 25850, 6507, 10492, 3488, 25871, 9457, 4408, 4466, 9161, 14, 4714, 84, 2494, 85, 2562, 285, 10729, 387, 5345, 3272, 36, 323, 2164, 288, 15, 16181, 18405, 23742, 369, 840, 4080, 407, 9266, 43597, 6981, 15, 25487, 13, 33112, 3530, 497, 4229, 323, 337, 288, 387, 3925, 3272, 36, 13, 13968, 323, 608, 1054, 387, 9233, 342, 1052, 42213, 388, 18141, 14, 25016, 9266, 43597, 13, 840, 41502, 275, 6306, 1824, 285, 4136, 281, 6079, 15, 16181, 18405, 3530, 497, 13968, 342, 10257, 42213, 273, 5922, 6, 1289, 19601, 44963, 3527, 323, 1458, 1054, 13, 285, 253, 5748, 4038, 387, 45223, 9153, 313, 3519, 33964, 10, 369, 1239, 15, 24258, 247, 1698, 2624, 14, 2727, 313, 3519, 68, 10, 6607, 407, 495, 6027, 3871, 1840, 253, 1599, 26514, 273, 1453, 21443, 13, 8709, 497, 10509, 715, 253, 1563, 9050, 27, 642, 33112, 14281, 313, 3519, 24832, 3519, 68, 582, 5075, 33112, 14281, 313, 3519, 68, 4713, 3519, 24832, 19, 6027, 3519, 68, 582, 10290, 33112, 14281, 313, 19, 6027, 3519, 68, 4713, 3519, 24832, 21, 6027, 3519, 68, 582, 285, 2266, 33112, 14281, 313, 21, 6027, 3519, 68, 4713, 3519, 10, 1008, 2041, 15, 520, 2904, 24264, 14, 6812, 4029, 39594, 18, 1570, 187, 187, 510, 33112, 2494, 18317, 369, 5189, 407, 18555, 285, 8951, 6955, 15, 18555, 6260, 497, 4824, 562, 342, 475, 52, 15, 33673, 43639, 11, 7372, 322, 805, 746, 285, 48745, 15220, 1787, 13, 4236, 984, 322, 805, 746, 369, 253, 4585, 14281, 273, 1499, 553, 2190, 2164, 8709, 2783, 15, 16181, 46758, 497, 4136, 281, 1756, 327, 3835, 15813, 13, 285, 4229, 342, 374, 15, 22, 6, 13627, 274, 38869, 323, 387, 1878, 3387, 1054, 15, 2732, 1146, 11974, 342, 13626, 13, 253, 3530, 497, 840, 44317, 456, 275, 247, 2962, 273, 17515, 16075, 5482, 313, 1235, 281, 2233, 10970, 380, 13751, 497, 10877, 327, 17454, 19542, 84, 342, 19604, 6315, 19165, 13, 4136, 281, 6079, 323, 495, 288, 13, 285, 840, 19185, 342, 1458, 14, 10602, 18940, 3085, 342, 271, 21703, 12077, 653, 12216, 820, 727, 15, 2732, 5162, 13, 3530, 497, 2540, 342, 247, 26999, 5656, 34, 1052, 13733, 6488, 17199, 275, 253, 1029, 14, 28902, 8343, 4438, 387, 1458, 465, 55, 15, 187, 187, 3207, 6955, 369, 2684, 347, 591, 3391, 1304, 1008, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364, 19, 1570, 25487, 13, 16181, 18405, 3530, 497, 4229, 275, 374, 15, 22, 6, 13627, 274, 38869, 13, 285, 13968, 342, 16674, 36, 313, 8501, 2324, 43959, 310, 837, 74, 49581, 481, 8951, 6955, 1783, 369, 2684, 342, 271, 418, 6955, 33930, 33819, 34, 8166, 13733, 17199, 7660, 281, 271, 329, 2981, 37200, 3719, 17199, 15, 380, 16820, 25738, 497, 42700, 905, 11141, 251, 8166, 5290, 285, 43732, 9153, 905, 1328, 14, 6560, 8166, 5290, 285, 8295, 25738, 497, 29364, 9153, 323, 16674, 36, 13, 2975, 15, 3315, 394, 6341, 497, 2668, 387, 3963, 11508, 2439, 253, 4871, 273, 253, 2813, 15, 1916, 3653, 253, 2605, 273, 253, 9015, 46758, 13, 247, 2962, 273, 11593, 313, 89, 14, 90, 10, 5748, 7118, 497, 2668, 4768, 253, 2120, 2978, 273, 253, 33112, 15, 11204, 3100, 3888, 273, 4759, 313, 39, 43414, 10, 11348, 497, 20913, 970, 247, 3540, 4438, 15, 187, 187, 9343, 14, 3169, 41234, 323, 475, 1109, 77, 34, 2992, 475, 1033, 72, 46, 2992, 285, 475, 83, 18569, 39, 11, 1712, 84, 19, 70, 94, 187, 47584, 187, 187, 35, 24097, 3882, 369, 10375, 285, 15134, 13, 840, 20068, 285, 27130, 327, 374, 6, 39086, 9480, 15, 8477, 17678, 497, 2975, 608, 6097, 330, 6435, 7246, 7258, 2696, 34, 1934, 1194, 10206, 495, 6097, 285, 608, 6097, 15679, 2446, 39017, 6435, 4490, 53, 4280, 1194, 4280, 39017, 495, 6097, 313, 805, 1423, 20633, 10, 323, 475, 1109, 77, 34, 2992, 608, 6097, 4915, 15804, 6435, 44512, 7258, 31275, 38231, 495, 6097, 285, 608, 6097, 29782, 1647, 7258, 1194, 9334, 6435, 1194, 46871, 9334, 495, 6097, 313, 1630, 1235, 20633, 10, 323, 475, 1033, 72, 46, 11, 285, 13, 4720, 13, 608, 6097, 48187, 38231, 49553, 1934, 2696, 6435, 40, 15804, 495, 6097, 285, 608, 6097, 443, 7258, 2696, 7283, 1194, 7258, 31275, 6435, 495, 6097, 313, 883, 1449, 20633, 10, 323, 475, 83, 18569, 39, 4556, 1876, 8477, 84, 3580, 497, 27867, 285, 45523, 275, 16315, 8417, 1703, 15, 5488, 13, 253, 1264, 3320, 2048, 369, 2684, 342, 38898, 7045, 511, 8477, 2556, 281, 591, 3391, 1304, 1008, 2041, 15, 520, 2904, 24264, 14, 49, 23242, 33364 ]
ceremony at 3 p.m. Tuesday, Feb. 6 in Hearing Room One of the Jeffco government center. There will be a brief reception following the ceremony. All are invited to attend or watch the broadcast on the Jeffco website. Francone, a Littleton resident, was appointed to replace Don Rosier as commissioner for District 3 after he resigned earlier this month. She will serve until the November election. When a town with a water crisis meets capitalism, populism, bureaucracy and corporate mismanagement, it ends up with people ready to revolt because they don’t have enough money to pee. On Jan. 19, The Venue Theatre Co. opened “Urinetown: The Musical,” a satirical comedy that follows Urinetown, a town that has outlawed the use of private toilets in an attempt to regulate water consumption. The citizens of Urinetown must use a public pay-per-use system owned by Urine Good Company. The 19-year-old accused of lighting Roman candles that started the North Turkey Creek Fire pleaded guilty Jan. 16 to one class-6 felony count of firing woods or prairies, according to the Jefferson County District Attorney’s Office. Andrew Askins of Conifer was charged in late April with two class-4 felonies of second-degree arson in connection with lighting fireworks while Jefferson County was in a stage-2 fire ban.Introduction {#s1} ============ *Stenotrophomonas maltophilia* is a Gram-negative opportunistic pathogen in hospitalized or compromised patients [@pone.0108409-Crossman1], [@pone.0108409-Brooke1]. However, the role of this opportunistic pathogen as an innocent bystander or causative agent often remains unclear [@pone.0108409-Goss1], [@pone.0108409-Karpati1] and little is known about its virulence factors [@pone.0108409-deOliveiraGarcia1], [@pone.0108409-Figueirdo1]. Biofilms, sessile structured bacterial communities exhibiting recalcitrance to antimicrobial compounds and persistence despite sustained host defenses, are increasingly recognized as a contributing factor to disease pathogenesis in the respiratory tract diseases associated with chronic bacterial infections [@pone.0108409-Bjarnsholt1]. *S. maltophilia* isolates are known to have the ability to form biofilms on both abiotic surfaces [@pone.0108409-DiBonaventura1]--[@pone.0108409-Pompilio1], and it is an intrinsic difference in biofilm formation among clinical isolates of *S. maltophilia*. The molecular mechanisms underlying biofilm formation in *S. maltophilia* have not been extensively studied. Recently, mutants for *rmlA* gene and *rpfF* gene are reported to decrease biofilm formation [@pone.0108409-Fouhy1], [@pone.0108409-Huang1]. Further, the *spgM* gene, encoding a bifunctional enzyme with both phosphoglucomutase (PGM) and phosphomannomutase activities, could be involved in biofilm-forming ability because of the homology with the *algC* gene that is responsible for the production of a PGM associated with LPS and alginate biosynthesis in *P. aeruginosa* [@pone.0108409-McKay1]. However, it is still unclear that which gene mutation results in the change of biofilm formation among the three genes, and which key amino acid mutation determines the function changes of the protein. In this study, we examined a set of 24 clinical isolates of *S. maltophilia* for biofilm formation traits in order to find significant differences, and evaluated the relationship between biofilm production and the detection of *rmlA*, *spgM*, and *rpfF* genes. Materials and Methods {#s2} ===================== Ethics Statement {#s2a} ---------------- This study protocol was approved by the Ethics Committee of The First Affiliated Hospital of Guangzhou Medical University. All subjects signed written informed consent prior to the study. Patient information was anonymized and de-identified prior to analysis. Bacterial isolates and growth conditions {#s2b} ---------------------------------------- Overall, 37 *S. maltophilia* isolates and *S. maltophilia* ATCC13637 were investigated. All the strains collected from the sputa of patients attending the Guangzhou institute of respiratory diseases from 2010 to 2011. Among the 37 isolates, 4 sequential strains isolated from the same patient over a period of 2 years and 3 sequential strains isolated from another patient over a period of 1 year were investigated. The isolates were identified as *S. maltophilia* by biochemical tests using manual (API 20-NE System; BioMérieux, Marcy-L\'Etoile, France) or automated (Vitek; BioMérieux) systems, then stored at −80°C until use when they were grown at 37°C in Mueller-Hinton agar (MHA; Oxoid) plates. Genetic relatedness by PFGE and cluster analysis {#s2c} ------------------------------------------------ Pulsed-field gel electrophoresis (PFGE) analysis of *Xba*I-digested genomic DNA was performed to determine the genetic relatedness of *S. maltophilia* isolates using a CHEF-Mapper XA System (Bio-Rad Laboratories, Hercules, CA, USA) as described by Seifert [@pone.0108409-Seifert1]. The interpreting criteria were described by Tenover [@pone.0108409-Tenover1] combining UPGMA (unweighted pair group method with hierarchic averages) method, Isolates were assigned the same pulsetype if the value of Dice coefficient of similarity was \>80% [@pone.0108409-Shi1]. Biofilm formation assay {#s2d} ----------------------- Overnight cultures in TSB were corrected with fresh TSB to an OD550 of 1.00 (corresponding to about 1×10^9^ CFU/ml). Two-hundred microliters of 1∶100 diluted inoculum were dispensed to each well of a sterile flatbottom polystyrene tissue culture 96-wells microtiter and incubated at 37°C for 24 h. Biofilm biomass was then measured by crystal violet assay. Briefly, biofilm samples were fixed for 1 h at 60°C, stained for 5 min at RT with 200 µl Hucker-modified crystal violet, then rinsed in standing water and allowed to dry. Biofilm samples were stained with 250 µl of 33% glacial acetic acid for 15 min, and the optical density at 492 nm (OD492) was read. Considering a low cut-off (ODc) represented by 3×SD above the mean OD of control wells, strains were classified into the following categories: no biofilm producer (OD≤ODc), weak biofilm producer (ODc\<OD≤2×ODc), moderate biofilm producer (2×ODc\<OD≤4×ODc), and strong biofilm producer (4×ODc\<OD) [@pone.0108409-Stepanovi1]. The biofilm microstructure was detected by SEM and CLSM. SEM analyses were carried out with *S. maltophilia* strain S1219 and ATCC13637, selected because S1219 was the highest producer of slime among 24 strains considered. Biofilms were allowed to grow on cover slip, and fixed with 2.5% glutaraldehyde for at least 40 min. After being washed with PBS, the samples were then dehydrated in a series of aqueous ethanol solutions (50 to 100%). The specimens were mounted on aluminum stubs with conductive carbon cement, allowed to dry for 3 h, and then coated with 15-nm Au film with an agar automatic sputter coater. After processing, samples were observed with a QUANTA 200 scanning electron microscope in the high-vacuum mode at 15 kV. CLSM was performed as pervious report [@pone.0108409-Pompilio2]. Briefly, Biofilm samples were fixed in 2.5% glutaraldehyde, and stained with FITC (fluorescein isothiocyanate). CLSM analysis was performed with an LSM 510 META laser scanning microscope attached to an Axioplan II microscope. The excitation wavelengths were 458 \[Argon laser\], and 543 nm \[He-Ne laser\], and emission wavelengths were 488 nm for FITC, respectively. Depth measurements were taken at regular intervals across the width of the device. To determine the structure of the biofilms, a series of horizontal (x-y) optical sections were taken throughout the full length of the biofilm. Confocal images of green (FITC) fluorescence were conceived using a track mode. PCR-based genotyping for *rmlA*, *spgM*, and *rpfF* {#s2e} --------------------------------------------------- Bacterial DNA was extracted and purified, then amplified and visualized on 2% agarose gel. PCR primers were respectively 5′ CGGAAAAGCAGAACATCG 3′ and 5′ GCAACTTGGTTTCAATCACTT 3′ (1222 bp) for *rmlA*, 5′ ATACCGGGGTGCGTTGAC 3′ and 5′ CATCTGCATGTGGATCTCGT 3′ (2750 bp) for *spgM* and, finally, 5′ CACGACAGTACAGGGGACC 3′ and 5′ GGCAGGAATGCGTTGG 3′ (1140 bp) for *rpfF*. All PCRs products were sequenced and BLAST in PUBMED. Furthermore, the three gene expression was performed with Reverse transcriptase PCR according to pervious report [@pone.0108409-Pompilio
[ 1010, 1084, 7693, 1678, 25140, 14, 2383, 14, 22140, 910, 709, 14, 881, 568, 709, 986, 285, 253, 1986, 11491, 6061, 3250, 783, 3250, 27077, 1114, 2047, 323, 10465, 4988, 34731, 25153, 247, 7887, 273, 495, 281, 608, 14986, 347, 253, 8723, 4719, 323, 8332, 273, 28728, 571, 4681, 1036, 1084, 7693, 1678, 25140, 14, 2383, 14, 29407, 910, 709, 14, 881, 568, 709, 986, 3856, 13, 436, 7887, 369, 6777, 347, 247, 1127, 273, 5301, 323, 253, 12938, 3607, 273, 253, 747, 15895, 15, 187, 187, 47789, 15128, 6973, 2908, 253, 2170, 762, 253, 6532, 4719, 283, 2606, 6970, 432, 5058, 281, 721, 3038, 313, 42080, 95, 17, 283, 23, 13611, 285, 5058, 281, 1249, 3038, 313, 42080, 95, 17, 283, 805, 28004, 30728, 432, 673, 5058, 281, 253, 1390, 673, 387, 534, 10465, 4988, 34731, 6376, 21759, 313, 42080, 95, 17, 283, 85, 28004, 285, 30728, 432, 673, 5058, 26480, 35631, 281, 23579, 313, 42080, 95, 17, 283, 2050, 28004, 4869, 6532, 4719, 313, 36, 95, 4090, 28004, 20408, 2281, 313, 44, 95, 293, 28004, 673, 281, 330, 95, 4090, 95, 313, 53, 95, 4090, 28004, 285, 2716, 3250, 8206, 273, 20408, 313, 85, 95, 18, 16, 19, 48307, 187, 187, 4118, 18731, 1712, 7693, 1678, 25140, 14, 1704, 14, 42834, 94, 187, 187, 52, 33816, 285, 8150, 1430, 273, 253, 1263, 9694, 497, 7515, 407, 9610, 273, 1971, 3250, 37114, 290, 10021, 3394, 313, 5428, 12648, 84, 10, 285, 4092, 10021, 3394, 313, 4576, 15168, 10, 432, 253, 1265, 273, 253, 806, 1971, 1919, 1501, 21272, 1388, 1638, 15, 6943, 18334, 9965, 5175, 13, 1690, 6728, 1159, 5175, 13, 369, 2684, 387, 9273, 285, 327, 1897, 495, 13, 721, 13, 898, 13, 285, 1638, 28, 253, 6803, 327, 1388, 495, 5866, 1501, 19572, 15, 388, 14359, 1497, 5175, 369, 2684, 387, 9273, 285, 327, 1388, 1638, 13, 285, 2936, 989, 1493, 285, 2177, 27044, 5175, 497, 2684, 387, 9273, 760, 15, 187, 187, 21214, 13277, 1712, 7693, 1678, 25140, 14, 1704, 14, 44135, 94, 187, 23796, 187, 187, 53, 95, 36, 21511, 21, 21516, 16, 8316, 95, 369, 5867, 1327, 3575, 11656, 1037, 970, 253, 48824, 6704, 5958, 1071, 1754, 327, 253, 8876, 273, 3910, 875, 9694, 2439, 5705, 285, 247, 8453, 1268, 273, 608, 6, 2796, 49, 11, 426, 964, 1762, 481, 15128, 6973, 30728, 95, 17, 283, 805, 9854, 30728, 95, 17, 283, 85, 9854, 285, 30728, 95, 17, 283, 2050, 95, 497, 2412, 3250, 45088, 313, 19293, 2412, 10, 285, 5867, 1754, 327, 247, 4872, 6804, 1566, 970, 24603, 45126, 273, 33918, 313, 52, 1719, 2715, 898, 15, 19, 28, 33918, 6516, 13, 50227, 13, 3729, 9756, 481, 17012, 285, 2180, 497, 2908, 275, 253, 1566, 347, 4229, 2538, 13, 342, 5705, 2908, 347, 247, 3632, 1055, 15, 380, 12541, 11041, 432, 253, 1566, 369, 908, 281, 3989, 5091, 6, 7162, 11508, 313, 36, 2513, 10, 323, 1878, 3250, 23600, 4420, 313, 7858, 10, 1599, 3910, 875, 9694, 15, 2053, 3910, 497, 840, 896, 3250, 45088, 281, 4044, 1127, 8197, 313, 9296, 3783, 10, 273, 17856, 2097, 285, 3969, 5091, 6, 36, 2513, 15, 1876, 15128, 6973, 497, 17903, 407, 27389, 9990, 15, 187, 187, 9340, 1712, 7693, 1678, 25140, 14, 1704, 14, 49455, 94, 187, 6877, 187, 187, 24053, 37235, 1712, 7693, 1678, 25140, 14, 1704, 14, 28949, 94, 187, 10521, 187, 187, 4527, 7652, 5705, 22546, 13, 1638, 497, 14871, 28, 512, 1638, 6312, 253, 1263, 285, 497, 2908, 275, 253, 15128, 285, 5252, 6260, 313, 2841, 544, 18, 1084, 7693, 1678, 25140, 14, 926, 14, 5831, 910, 709, 14, 881, 568, 926, 2536, 380, 5020, 273, 5014, 313, 3677, 2673, 497, 5343, 13, 2716, 497, 3168, 13, 285, 597, 17751, 275, 2363, 432, 655, 281, 7127, 1107, 313, 3235, 544, 18, 1084, 7693, 1678, 25140, 14, 12749, 14, 5831, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 13641, 5576, 38626, 273, 253, 12602, 30657, 535, 50276, 13641, 24959, 50255, 36888, 313, 47, 426, 1638, 10, 187, 50276, 33250, 28527, 187, 50276, 51, 584, 13, 295, 11767, 50254, 187, 50276, 17185, 50254, 50272, 24, 313, 1235, 15, 17, 10, 187, 50276, 15383, 16, 42817, 2448, 50265, 20, 313, 1797, 15, 21, 10, 187, 50276, 47548, 50254, 50272, 18, 313, 24, 15, 18, 10, 187, 50276, 21408, 43326, 16, 34114, 8451, 254, 50275, 18, 313, 24, 15, 18, 10, 187, 50276, 29454, 50254, 50275, 19, 313, 1047, 15, 20, 10, 187, 50276, 30386, 13, 295, 11767, 50254, 2490, 50276, 33090, 50254, 50274, 884, 313, 3677, 15, 21, 10, 187, 50276, 27346, 50254, 50272, 577, 313, 1619, 15, 23, 10, 187, 50276, 19711, 13, 1599, 313, 6324, 582, 1107, 50267, 1717, 15, 24, 313, 746, 283, 2031, 10, 187, 50276, 25935, 13, 1599, 313, 6324, 582, 15841, 50267, 2526, 15, 26, 313, 1235, 15, 21, 283, 2759, 15, 26, 10, 187, 50276, 13881, 13, 1599, 313, 6324, 582, 7892, 50267, 18146, 15, 23, 313, 18795, 15, 17, 283, 19105, 15, 17, 10, 187, 50276, 31685, 13, 1599, 313, 6324, 582, 15841, 16, 78, 63, 19, 63, 50269, 1508, 15, 24, 313, 938, 15, 17, 283, 1630, 15, 19, 10, 187, 187, 31685, 13, 2133, 2280, 3605, 15, 187, 187, 8732, 31037, 708, 28431, 13, 12098, 15, 187, 187, 2641, 42244, 47673, 1712, 7693, 1678, 25140, 14, 1704, 14, 520, 740, 94, 187, 573, 187, 187, 12515, 6532, 10465, 4988, 34731, 4719, 689, 673, 310, 2011, 323, 1016, 1971, 275, 5317, 544, 19, 1084, 7693, 1678, 25140, 14, 926, 14, 12603, 910, 709, 14, 881, 568, 926, 7129, 19757, 3250, 19572, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 2692, 247, 3102, 273, 6537, 3727, 2429, 342, 253, 374, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 1677, 721, 3038, 7419, 15, 329, 2074, 3727, 3102, 369, 2540, 323, 253, 2014, 27091, 3250, 7913, 6178, 273, 12938, 10465, 4988, 34731, 13, 533, 387, 247, 2406, 4719, 685, 342, 253, 2014, 5307, 3250, 7913, 6178, 15, 187, 187, 3138, 12515, 6532, 10465, 4988, 34731, 4719, 689, 673, 407, 1971, 15, 9812, 13, 8993, 3727, 28, 12938, 13, 12321, 3727, 5774, 5305, 11927, 14, 24, 14, 2222, 14, 72, 4699, 4253, 7693, 1678, 25140, 14, 926, 14, 12603, 94, 187, 187, 4769, 387, 390, 1840, 577, 14986, 16, 8316, 6532, 10465, 4988, 34731, 4719, 432, 337, 6178, 273, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 369, 2074, 281, 326, 432, 374, 12768, 273, 9812, 10465, 4988, 34731, 15, 35780, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 323, 253, 5307, 3250, 7913, 12938, 10465, 4988, 34731, 15895, 369, 884, 15, 22, 3038, 2429, 342, 898, 15, 25, 3038, 323, 374, 12640, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 13, 285, 627, 497, 642, 1534, 3910, 875, 253, 374, 26850, 2796, 49, 11, 426, 964, 24, 18895, 28, 5270, 575, 60, 19, 1084, 7693, 1678, 25140, 14, 12749, 14, 12603, 910, 709, 14, 881, 568, 2420, 2536, 496, 4499, 13, 253, 8876, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 323, 27091, 3250, 7913, 12938, 10465, 4988, 34731, 273, 854, 15, 18, 3038, 369, 3012, 12217, 685, 253, 8876, 308, 95, 36, 21511, 21, 21516, 16, 8316, 95, 273, 898, 15, 25, 3038, 323, 253, 374, 12640, 12768, 273, 9812, 10465, 4988, 34731, 9098, 5770, 2796, 49, 11, 426, 964, 45341, 28, 5270, 544, 19, 1084, 7693, 1678, 25140, 14, 12749, 14, 12603, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 4769, 387, 390, 32761, 577, 14986, 16, 8316, 313, 53, 95, 36, 21511, 21, 21516, 16, 8316, 13611, 32904, 5192, 292, 4988, 34731, 1716, 36551, 4325, 19757, 399, 4863, 273, 5307, 3250, 285, 27091, 3250, 7913, 12938, 285, 374, 12768, 273, 9098, 3250, 7913, 9812, 5192, 292, 4988, 34731, 535, 50276, 7689, 11149, 50254, 50254, 50254, 50254, 50254, 50263, 50275, 5307, 3250, 7913, 12938, 5192, 292, 4988, 34731, 374, 6806, 9098, 5770, 50275, 33856, 3250, 7913, 12938, 5192, 292, 4988, 34731, 374, 6806, 25782, 5770, 50275, 3027, 5192, 292, 4988, 34731, 374, 6806, 313, 19, 6806, 6783, 5770, 10, 187, 50276, 7078, 22928, 9625, 4485, 9625, 7040, 9625, 1532, 187, 50276, 53, 95, 36, 21511, 21, 21516, 16, 8316, 9854, 8876, 313, 22724, 10, 50254, 50254, 50254, 50254, 50254, 50263, 884, 15, 1235, 50254, 50270, 50276, 25, 15, 805, 50254, 50270, 898, 15, 1976, 187, 50276, 40189, 5301, 12938, 4632, 9812, 13, 8876, 273, 3910, 60, 66, 1084, 7693, 1678, 25140, 14, 12749, 19, 14, 9939, 14, 5831, 910, 709, 14, 881, 568, 4174, 986, 2796, 49, 5627, 60, 67, 1084, 7693, 1678, 25140, 14, 12749, 19, 14, 9939, 14, 12603, 910, 709, 14, 881, 568, 4174, 986, 50263, 2106, 17, 15, 1012, 25323, 24, 18895, 10, 50254, 50276, 2106, 18, 15, 1235, 25323, 45341, 10, 50254, 50274, 8915, 187, 187, 3027, 13, 8993, 3727, 28, 12938, 13, 12321, 3727, 15, 187, 187, 10818, 757, 273, 3910, 6125, 253, 8876, 273, 2060, 3910, 875, 253, 374, 9694, 2439, 512, 5705, 13, 285, 417, 253, 3064, 875, 253, 1129, 2458, 273, 374, 9694, 15, 187, 187, 40235, 1430, 2330, 342, 48824, 6704, 5958, 1071, 15, 187, 187, 8732, 31037, 708, 28431, 13, 12098, 15, 187, 187, 510, 6070, 273, 10465, 4988, 34731, 11058, 432, 253, 5307, 3250, 7913, 12938, 15895, 369, 2074, 281, 326, 273, 374, 12640, 12768, 273, 253, 9098, 3250, 7913, 9812, 15895, 15, 380, 5091, 6, 36, 2513, 323, 253, 11878, 273, 17856, 2097, 497, 1561, 9015, 2655, 44132, 7787, 313, 17, 15, 1438, 283, 18, 15, 1099, 6904, 1166, 1084, 7693, 1678, 25140, 14, 2383, 14, 31202, 910, 709, 14, 881, 568, 709, 4982, 544, 1093, 1084, 7693, 1678, 25140, 14, 2383, 14, 31272, 910, 709, 14, 881, 568, 709, 986, 342, 2743, 281, 30728, 95, 17, 283, 805, 95, 313, 29603, 13, 470, 15, 1525, 28, 5091, 6, 7142, 13, 470, 15, 3953, 283, 18, 15, 2125, 582, 30728, 95, 17, 283, 85, 95, 313, 29603, 13, 470, 15, 4185, 28, 5091, 6, 7142, 13, 470, 15, 4590, 283, 18, 15, 2640, 582, 285, 30728, 95, 17, 283, 2050, 95, 313, 29603, 13, 470, 15, 4185, 28, 5091, 6, 7142, 13, 470, 15, 3953, 283, 18, 15, 2941, 558, 923, 5270, 544, 20, 1084, 7693, 1678, 25140, 14, 12749, 14, 14602, 910, 709, 14, 881, 568, 2420, 7129, 380, 6070, 273, 10465, 4988, 34731, 11058, 432, 27091, 3250, 7913, 12938, 369, 3012, 4577, 685, 326, 273, 374, 12640, 9098, 3250, 7913, 12768, 273, 253, 9812, 15895, 15, 380, 4313, 273, 25169, 2097, 273, 841, 374, 3580, 323, 30728, 95, 17, 283, 805, 9854, 30728, 95, 17, 283, 85, 9854, 285, 30728, 95, 17, 283, 2050, 95, 369, 2708, 5096, 6, 26786, 17, 15, 25, 582, 285, 253, 5091, 6, 36, 2513, 497, 3345, 253, 470, 15, 1438, 283, 18, 15, 1099, 9015, 2655, 44132, 7726, 313, 3235, 544, 20, 1084, 7693, 1678, 25140, 14, 12749, 14, 14602, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 5146, 2490, 187, 7992, 290, 273, 5192, 292, 4988, 34731, 16508, 19215, 4325, 19757, 399, 4863, 273, 5307, 3250, 285, 27091, 3250, 7913, 12938, 5192, 292, 4988, 34731, 285, 374, 399, 4863, 273, 9098, 3250, 7913, 9812, 5192, 292, 4988, 34731, 535, 50254, 25169, 9601, 50274, 44700, 273, 25169, 46062, 60, 66, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 5831, 910, 709, 14, 881, 568, 4174, 986, 313, 2270, 6, 7142, 60, 67, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 12603, 910, 709, 14, 881, 568, 4174, 7547, 50254, 50254, 50254, 2490, 50276, 23130, 16810, 12383, 44136, 14022, 14927, 10521, 14927, 10521, 187, 50276, 42080, 95, 17, 283, 23, 9854, 14986, 6256, 73, 16, 8316, 50273, 3832, 15, 20, 50254, 50254, 50266, 2504, 15, 21, 50254, 50254, 50270, 1857, 15, 20, 50273, 18, 15, 1812, 313, 18, 15, 1630, 283, 18, 15, 1857, 6904, 68, 1084, 7693, 1678, 25140, 14, 12749, 20, 14, 9939, 14, 14602, 910, 709, 14, 881, 568, 4174, 986, 50276, 18, 15, 1762, 313, 17, 15, 4185, 283, 18, 15, 805, 10, 187, 50276, 42080, 95, 17, 283, 805, 9854, 14986, 6256, 73, 16, 8316, 50274, 1525, 15, 21, 50254, 50254, 50266, 3121, 15, 17, 50254, 50254, 50270, 2313, 15, 21, 50254, 470, 15, 1525, 313, 17, 15, 3953, 283, 18, 15, 2125, 10, 50254, 17 ]
15](#cpdd367-bib-0015){ref-type="ref"} and the United Kingdom Over‐the‐Counter monograph for acetaminophen recognizes a threshold of 3 to 5 μg as the minimal concentration for provision of analgesia.[16](#cpdd367-bib-0016){ref-type="ref"} Here, this threshold was chosen as a point of comparison for the SR properties of the new formulation. Secondary PK outcomes included the area under the plasma concentration--time curve from zero to 6 hours (AUC~0--6~) and zero to 12 hours (AUC~0--12~), AUC from time zero to the last time at which acetaminophen remained detectable (AUC~0--t~), and AUC from time zero extrapolated to infinity (AUC~0--inf~), maximum plasma concentration (C~max~), elimination rate (K~el~), time to C~max~ (T~max~), and half‐life of elimination (t~1/2~). ### Safety {#cpdd367-sec-0070} Safety and tolerability of the study treatments were assessed by reporting of treatment‐emergent adverse events (TEAEs) and serious adverse events (SAEs) from the start of the first treatment until posttreatment day 14. Biochemistry laboratory testing, including liver function testing, was performed at screening and on days 3, 6, 9, and 14; the assessment on day 3 occurred postdose. Hematology testing was performed at screening and on day 14, and urinalysis and virology testing were performed at screening only. Statistical Methods {#cpdd367-sec-0080} ------------------- T~C≥4μg/mL~ was analyzed nonparametrically using the Wilcoxon signed rank test based on the median of differences between treatments across subjects and a significance level of 5% (*P* = .05). PK outcomes AUC~0--12~, AUC~0--t~, and AUC~0--inf~ were log‐transformed (natural log) and analyzed based on a linear mixed model using Proc Mixed of SAS (SAS version 9.2; SAS Institute, Cary, North Carolina). Treatment and period were included in the model as fixed effects, with subjects included as a random effect. The residual variance from the model was used to construct 90% confidence intervals (CIs) for least‐squares (LS) mean differences between treatments. These differences were then back‐transformed to obtain point estimates (ratios) of geometric means and corresponding 90%CIs. All PK outcomes were summarized by descriptive statistics. Results {#cpdd367-sec-0090} ======= Study Subjects {#cpdd367-sec-0100} -------------- Of 43 subjects screened, 14 were randomized; all 14 completed the study and were included in the PK and safety analyses (Figure [1](#cpdd367-fig-0001){ref-type="fig"}). The majority of participants (71%) were female, half were white, and they ranged in age from 19 to 44 years (Table [1](#cpdd367-tbl-0001){ref-type="table"}). ###### Demographic Characteristics of the Study Population Demographics Participants (N = 14) ---------------------------------- ----------------------- Race, n (%) White 7 (50.0) Black/African American 3 (21.4) Asian 1 (7.1) Native Hawaiian/Pacific Islander 1 (7.1) Multiple 2 (14.3) Sex, n (%) Female 10 (71.4) Male 4 (28.6) Age, mean (range), years 29.7 (19--44) Weight, mean (range), kg 66.9 (50.4--84.9) Height, mean (range), cm 167.6 (151.0--184.0) BMI, mean (range), kg/m^2^ 23.7 (20.0--27.2) BMI, body mass index. John Wiley & Sons, Ltd. Pharmacokinetics {#cpdd367-sec-0110} ---------------- Mean plasma acetaminophen concentration over time is shown for each treatment in Figure [2](#cpdd367-fig-0002){ref-type="fig"}. Single‐dose 2000‐mg SR acetaminophen showed a pattern of controlled release compared with the 2 doses of IR acetaminophen 1000 mg given 6 hours apart. A similar release pattern was observed for the single 1500‐mg dose of SR acetaminophen, but at a lower concentration than with the single 2000‐mg dose. ![Mean plasma acetaminophen concentration over time by treatment. IR, immediate release; SR, sustained release.](CPDD-7-95-g002){#cpdd367-fig-0002} Time at or above 4 μg/mL plasma acetaminophen concentration from 1 dose of 2000‐mg SR acetaminophen was similar to that from 2 doses of IR acetaminophen. Median T~C≥4μg/mL~ for the 2000‐mg SR acetaminophen formulation was 10.5 hours compared with 9.8 hours for 2 consecutive doses of IR acetaminophen 1000 mg, and there were no significant differences between the 2 formulations (*P* = .7222; Table [2](#cpdd367-tbl-0002){ref-type="table"}). In contrast, the median T~C≥4μg/mL~ for 1500‐mg SR acetaminophen of 8.1 hours was significantly shorter than the median T~C≥4μg/mL~ of 9.8 hours for the 2 consecutive doses of IR acetaminophen 1000 mg (*P* = .0044; Table [2](#cpdd367-tbl-0002){ref-type="table"}). ###### Time at or Above 4 μg/mL (T~C≥4μg/mL~) Plasma Acetaminophen Concentration From Single Doses of 2000‐ and 1500‐mg SR and 2 doses of 1000‐mg IR Acetaminophen End Point 2000‐mg SR Acetaminophen 2 × 1000 mg 1500‐mg SR Acetaminophen 2 × 750 mg IR Acetaminophen 2 × (2 × 500 mg) -------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------- ------------------------------------- ----------------------------------- T~C≥4μg/mL~, median (hours) 10.50 8.12 9.75 Treatment comparison SR vs IR, median of differences[a](#cpdd367-tbl2-note-0001){ref-type="fn"} (*P*)[b](#cpdd367-tbl2-note-0002){ref-type="fn"} −0.13 (.7222) −1.50 (.0044) --- IR, immediate release; SR, sustained release. Median of differences represents the median of individual differences between the 2 treatments across all subjects, and not the difference between the medians of 2 treatments. Probability associated with Wilcoxon signed rank test. John Wiley & Sons, Ltd. The extent of acetaminophen absorption from the 2000‐mg SR formulation was similar to that of 2 consecutive doses of the 1000‐mg IR formulation. The 90%CIs for the ratios of geometric means were within bioequivalence limits (0.80--1.25)[17](#cpdd367-bib-0017){ref-type="ref"}, [18](#cpdd367-bib-0018){ref-type="ref"} with regard to AUC~0--12~ (ratio, 0.99; 90%CI, 0.94--1.04), AUC~0--t~ (ratio, 0.98; 90%CI, 0.93--1.02), and AUC~0--inf~ (ratio, 0.98; 90%CI, 0.94--1.03); see Table [3](#cpdd367-tbl-0003){ref-type="table"}. The extent of acetaminophen absorption from 1500‐mg SR was significantly smaller than that of 2 consecutive 1000‐mg doses of the IR formulation. The ratio of LS means of these 2 products for AUC~0--12~, AUC~0--t~, and AUC~0--inf~ was below 80% (\<0.8), and the 90%CIs were outside the 0.80--1.25 bioequivalence interval (Table [3](#cpdd367-tbl-0003){ref-type="table"}). ###### Extent of Acetaminophen Absorption From Single Doses of 2000‐ and 1500‐mg SR Acetaminophen and 2 Doses of 1000‐mg IR Acetaminophen LS Mean Ratio of LS Means[a](#cpdd367-tbl3-note-0001){ref-type="fn"} (90%CI[b](#cpdd367-tbl3-note-0002){ref-type="fn"}) ---------------------- --------- ----------------------------------------------------------------------------------------------------------------- ------- -------------------------------------------------------------- -------------------------------------------------------------- AUC~0--6~, μg·h/mL 61.3 47.4 45.3 1.36 (1.27--1.45)[c](#cpdd367-tbl3-note-0003){ref-type="fn"} 1.05 (0.98--1.12) AUC~0--12~, μg·h/mL 99.4 76.0 100.4 0.99 (0.94--1.04) 0
[ 1137, 14, 14573, 29425, 390, 18066, 422, 41044, 15, 733, 310, 2969, 1728, 14, 12710, 2739, 15, 187, 187, 510, 4736, 273, 436, 1263, 310, 281, 9186, 253, 9493, 285, 13399, 897, 273, 475, 83, 5507, 296, 321, 269, 1886, 321, 2992, 1690, 697, 3275, 13, 9008, 285, 1659, 275, 253, 1980, 285, 3872, 4466, 273, 253, 10351, 13347, 15, 4129, 627, 403, 2067, 2175, 327, 10351, 80, 3248, 2739, 16964, 285, 2544, 689, 673, 13, 253, 6349, 273, 8388, 16390, 6773, 310, 762, 33174, 1254, 1311, 19, 1092, 1008, 1311, 22, 1092, 1008, 1311, 883, 7254, 1311, 1012, 1656, 5488, 13, 253, 5675, 41023, 6239, 327, 8388, 16390, 6773, 2190, 8790, 11347, 14, 3169, 22132, 35136, 253, 3361, 273, 8388, 16390, 6773, 275, 253, 10351, 13347, 13, 3738, 643, 23060, 280, 4343, 452, 644, 5421, 3786, 1254, 1311, 1047, 1092, 1008, 1311, 1010, 1656, 5128, 323, 253, 1246, 1263, 310, 1754, 327, 1673, 7211, 5728, 949, 12888, 285, 7313, 327, 253, 10351, 3703, 18708, 1580, 4260, 14, 13435, 84, 15, 187, 187, 48563, 16390, 6773, 275, 40261, 25183, 1712, 4538, 19, 94, 187, 29648, 187, 187, 1909, 247, 4122, 591, 763, 494, 13, 2601, 32691, 2739, 13, 6773, 1364, 320, 5480, 6283, 323, 5718, 281, 5416, 352, 588, 1390, 323, 1996, 8353, 15, 399, 11729, 13, 30734, 13, 3779, 1076, 285, 10470, 403, 673, 14, 25224, 9698, 13, 36930, 3082, 273, 7576, 3647, 436, 285, 7624, 17749, 253, 5825, 902, 422, 3198, 273, 2021, 18294, 403, 6283, 1313, 15, 9658, 841, 13, 24396, 285, 30734, 403, 253, 17172, 3082, 273, 6773, 23029, 1254, 1311, 1036, 1092, 1008, 1311, 1166, 1656, 187, 187, 688, 11442, 3060, 13, 627, 403, 1048, 21188, 273, 42990, 272, 5893, 3580, 323, 1966, 2739, 15, 3900, 16184, 80, 14, 1592, 16390, 21436, 3580, 452, 417, 4546, 667, 1534, 9503, 275, 1980, 2739, 4466, 275, 253, 23060, 280, 4343, 313, 249, 4499, 281, 8170, 14, 38, 8963, 3060, 13, 923, 1254, 1311, 1093, 1092, 1008, 1311, 746, 1184, 582, 8388, 16390, 6773, 313, 284, 973, 347, 8388, 16390, 8463, 285, 9132, 3580, 10, 403, 24842, 14414, 2190, 253, 638, 14, 49338, 41207, 610, 15, 831, 310, 3340, 253, 1083, 275, 253, 11186, 629, 273, 253, 40261, 35026, 33489, 13, 275, 253, 10351, 13347, 285, 275, 28651, 15, 20496, 16390, 5893, 3580, 497, 7744, 14109, 13, 342, 14414, 27491, 9288, 2393, 275, 11948, 1254, 1311, 26, 1092, 1008, 1311, 1036, 1656, 187, 187, 14569, 8388, 16390, 6773, 310, 11766, 22186, 275, 40261, 25183, 285, 310, 8127, 3710, 281, 247, 18066, 422, 2739, 22186, 327, 2714, 15530, 15, 20599, 273, 824, 8388, 16390, 6773, 17114, 403, 475, 9960, 1344, 2381, 2188, 272, 11, 313, 12710, 432, 48477, 617, 804, 10, 275, 16842, 285, 475, 47081, 71, 1886, 11, 313, 12710, 432, 40732, 13, 1018, 390, 3168, 12306, 10, 275, 20341, 1254, 1311, 26, 1092, 1008, 1311, 938, 1656, 28651, 280, 8388, 16390, 6115, 1373, 35409, 13, 475, 76, 5507, 296, 321, 37472, 76, 7694, 2992, 556, 2489, 247, 2581, 11855, 33503, 10827, 323, 8353, 1309, 18066, 422, 3394, 3340, 15, 475, 48062, 77, 991, 11, 12196, 783, 14205, 24791, 11470, 247, 9305, 24791, 11609, 29025, 275, 7043, 13, 8618, 285, 43235, 342, 277, 408, 13, 310, 14109, 512, 689, 40261, 25183, 3063, 15, 1723, 13, 13399, 475, 12158, 77, 991, 11, 310, 247, 4980, 1327, 14, 1592, 16390, 1885, 13, 285, 556, 642, 36199, 342, 253, 1711, 47485, 5899, 8388, 16390, 24791, 13, 3168, 12306, 13, 2645, 1087, 249, 2352, 285, 643, 49720, 534, 369, 8927, 14205, 275, 253, 6149, 13, 7613, 253, 5788, 1416, 686, 13156, 728, 24791, 8, 1254, 1311, 938, 7254, 1311, 1423, 1656, 187, 187, 19799, 253, 23060, 280, 4343, 13, 253, 10351, 3703, 18708, 403, 253, 760, 4328, 835, 8388, 16390, 6773, 7788, 281, 320, 908, 347, 271, 15363, 2739, 15, 1707, 13, 352, 310, 1335, 8558, 4197, 275, 253, 1728, 13, 285, 3798, 347, 247, 5678, 3434, 273, 253, 5938, 285, 4475, 15, 380, 2862, 9008, 1232, 310, 3139, 21184, 13, 7668, 23862, 13, 12478, 13, 24396, 13, 285, 42990, 272, 253, 6773, 15, 4563, 23892, 6634, 1561, 253, 11692, 15, 1723, 13, 352, 310, 31735, 1896, 281, 4489, 475, 83, 5507, 296, 321, 269, 1886, 321, 11, 275, 25633, 10111, 327, 253, 10351, 3703, 18708, 15, 733, 476, 671, 320, 8686, 3909, 285, 8549, 281, 952, 434, 2914, 3369, 15, 187, 187, 15568, 1712, 4538, 20, 94, 187, 6877, 187, 187, 1552, 1263, 310, 1754, 327, 619, 1673, 7211, 5728, 949, 12888, 285, 7313, 1580, 253, 4260, 14, 13435, 84, 15, 733, 310, 629, 273, 247, 4067, 22603, 706, 8673, 2561, 13521, 13, 7106, 327, 253, 2425, 3634, 875, 7497, 285, 643, 5893, 3417, 432, 253, 10351, 13347, 15, 309, 4510, 13, 275, 8956, 342, 11960, 7678, 1254, 1311, 1508, 5413, 253, 2048, 475, 12135, 3634, 11, 432, 253, 581, 14, 21773, 8668, 10466, 407, 253, 2426, 4444, 285, 5893, 4648, 1254, 1311, 1348, 7254, 1311, 1630, 1656, 13303, 5893, 29821, 275, 253, 1980, 33698, 452, 644, 5469, 28, 3738, 619, 2561, 556, 1399, 433, 5742, 327, 5105, 2369, 8636, 1975, 3374, 13, 4444, 3640, 941, 452, 671, 644, 5728, 1254, 1311, 1619, 1092, 1008, 1311, 1717, 1656, 3619, 917, 4956, 6244, 13, 2299, 13, 4546, 247, 5884, 2554, 275, 253, 5899, 6196, 313, 395, 1014, 1679, 31735, 10, 273, 253, 8930, 398, 1254, 1311, 1229, 1656, 187, 187, 42, 5196, 440, 34218, 12888, 342, 18294, 275, 657, 383, 8420, 66, 13, 443, 75, 33320, 87, 285, 308, 1954, 83, 1200, 580, 79, 313, 783, 5347, 273, 253, 17546, 582, 285, 671, 2335, 629, 275, 2710, 4712, 347, 271, 1759, 386, 2611, 1080, 1254, 1311, 2405, 1656, 401, 3647, 285, 253, 8353, 273, 6773, 403, 629, 273, 5312, 1495, 327, 253, 10351, 3703, 18708, 15, 309, 452, 3103, 574, 1142, 9091, 281, 10018, 285, 10078, 275, 253, 9008, 273, 285, 8353, 273, 10020, 14, 49461, 8388, 16390, 6773, 15, 2752, 1673, 7211, 432, 841, 7313, 403, 619, 2022, 4973, 15, 41749, 1491, 327, 253, 6349, 273, 6773, 347, 2739, 369, 13037, 432, 22603, 5576, 5012, 13, 4288, 462, 955, 285, 1980, 14464, 8553, 1254, 1311, 19, 1092, 1008, 1311, 22, 1656, 2596, 1774, 4809, 310, 417, 5469, 275, 436, 3634, 2167, 13, 326, 310, 253, 298, 9994, 3527, 9574, 285, 12807, 3206, 275, 253, 30734, 1232, 15, 1707, 310, 273, 2282, 271, 4722, 19037, 273, 1966, 14, 12306, 14, 18227, 1257, 3939, 1060, 13, 533, 309, 452, 417, 1119, 667, 4623, 2561, 327, 253, 2494, 1258, 6464, 273, 253, 10351, 80, 3248, 475, 376, 383, 321, 269, 1886, 321, 11, 594, 2080, 15, 733, 310, 247, 9400, 323, 2852, 2561, 15, 187, 187, 22183, 79, 5576, 4758, 1712, 4538, 21, 94, 187, 15879, 187, 187, 36, 503, 8572, 13, 253, 10351, 3703, 18708, 19142, 247, 1355, 285, 4942, 2860, 11426, 5948, 1254, 1311, 1237, 1656, 4129, 3332, 39327, 1941, 5053, 1966, 32591, 273, 253, 10351, 3703, 18708, 875, 5446, 9166, 283, 10487, 13, 253, 1655, 21251, 403, 32148, 273, 44567, 7087, 339, 3767, 326, 7244, 275, 253, 28023, 5331, 1254, 1311, 1610, 1092, 1008, 1311, 1706, 1656, 16688, 629, 273, 22783, 432, 1458, 1508, 13, 253, 3072, 310, 6571, 24496, 266, 13, 15823, 281, 253, 10351, 80, 3248, 24496, 266, 6412, 313, 1438, 575, 10970, 380, 6414, 14125, 281, 253, 7489, 48022, 7528, 40857, 313, 1010, 575, 2673, 285, 2710, 1018, 43307, 11438, 15, 733, 310, 247, 2581, 11518, 6416, 5674, 2429, 281, 643, 23060, 280, 4343, 15, 380, 8930, 398, 452, 616, 1211, 7925, 3448, 273, 7087, 339, 11998, 13, 533, 954, 952, 403, 407, 15504, 270, 39661, 275, 1097, 616, 3101, 14018, 10351, 80, 3248, 285, 275, 26304, 13, 253, 3448, 273, 253, 21441, 1612, 1254, 1311, 1237, 1656, 187, 187, 2993, 20640, 5361, 13, 16121, 323, 396, 357, 14950, 1969, 285, 13949, 11572, 43928, 285, 35164, 1969, 285, 690, 39913, 30621, 497, 253, 2022, 2613, 273, 253, 6982, 1580, 1966, 10858, 1919, 2393, 28385, 5331, 1254, 1311, 1671, 1092, 1008, 1311, 1812, 1656, 844, 871, 432, 1142, 22603, 5576, 2175, 326, 7625, 342, 5899, 5243, 383, 9250, 452, 7000, 3640, 273, 2710, 3417, 275, 616, 27762, 1254, 1311, 1787, 1656, 831, 310, 671, 2032, 323, 253, 10351, 3703, 8930, 398, 15, 401, 3647, 432, 2659, 369, 8558, 281, 6186, 2739, 323, 2060, 18294, 15, 7214, 2659, 628, 272, 14768, 574, 581, 390, 625, 19750, 15, 401, 3647, 369, 247, 3309, 13503, 281, 643, 5054, 4712, 15, 45363, 43928, 2796, 9030, 706, 547, 545, 7080, 6673, 284, 11, 313, 14463, 408, 9679, 14370, 14393, 2796, 34238, 469, 80, 254, 316, 305, 610, 81, 316, 11, 313, 36010, 695, 3750, 9679, 285, 6150, 14, 40382, 497, 671, 1774, 4973, 273, 12461, 1254, 1311, 22, 1092, 1008, 1311, 1012, 1656, 380, 25108, 7478, 1077, 1643, 6773, 3417, 275, 253, 19365, 2891, 13646, 15, 9658, 841, 13, 1014, 11184, 497, 7478, 347, 2739, 13, 1690, 253, 2710, 12738, 3417, 313, 40, 324, 15203, 582, 7905, 487, 307, 13, 475, 41, 5265, 11816, 1730, 316, 15241, 11816, 1730, 316, 11, 313, 45, 11507, 285, 253, 1024, 2761, 14454, 289, 1575, 2135, 21868, 13, 475, 51, 22779, 502, 580, 682, 11, 418, 15, 1254, 1311, 1839, 7254, 1311, 1449, 1656, 380, 618, 37018, 2796, 49, 2555, 607, 3750, 2177, 25083, 11, 313, 45, 2698, 582, 534, 4536, 5420, 275, 1781, 6738, 932, 275, 21658, 13, 369, 273, 2714, 6349, 13, 1580, 1142, 952, 812, 12308, 731, 275, 1270, 3904, 432, 253, 16838, 1254, 1311, 3156, 1092, 1008, 1311, 2945, 1656, 187, 187, 10457, 253, 28385, 5331, 253, 6982, 273, 253, 10351, 13347, 13657, 432, 1355, 14, 7527, 22431, 27633, 90, 281, 3676, 14, 15681, 27633, 90, 275, 253, 3729, 14847, 15, 11056, 13, 15133, 310, 253, 3625, 5054, 2425, 1254, 1311, 1012, 1092, 1008, 1311, 3079, 1656, 380, 10351, 3703, 18708, 556, 247, 1781, 18500, 273, 1140, 88, 10787, 285, 4577, 1386, 15133, 19750, 13, 6773, 29492, 285, 671, 16540, 24791, 2796, 15426, 6972, 3779, 274, 11, 418, 2698, 285, 6150, 40732, 2796, 15426, 6972, 492, 29662, 492, 29662, 11, 418, 2698, 275, 6773, 14, 14103, 983, 15, 4129, 954, 6773, 403, 21792, 407, 841, 4067, 15133, 12671, 13, 690, 5662, 1821, 4035, 281, 6773, 323, 11284, 285, 323, 616, 1211, 8353, 275, 12171, 8818, 19750, 13, 973, 12956, 281, 253, 8704, 6150, 313, 1470, 15, 575, 60, 20, 1084, 1470, 20, 910, 709, 14, 881, 568, 926, 2536, 12571, 281, 5233, 4980, 1320, 13, 271, 3629, 1180, 273, 952, 403, 1024, 1119, 1561, 253, 3168, 14, 2052, 9388, 8776, 13, 390, 403, 9583, 275, 2579, 285, 643, 4712, 1561, 253, 31000, 5054, 8776, 15, 1470, 15, 495, 2290, 22675, 10351, 80, 3248, 19750, 7470, 323, 253, 10351, 80, 3248, 12685, 13, 443, 75, 33320, 87, 13, 3978, 6157, 15, 2053, 1980, 4194, 272, 19750, 13, 534, 497, 3786, 908, 275, 1142, 10351, 80, 3248, 18430, 13, 452, 616, 6510, 275, 253, 4577, 19750, 273, 253, 40269, 15, 15023, 1527, 424, 14, 424, 45686, 403, 1024, 6571, 908, 323, 275, 21658, 15133, 347, 247, 34057, 313, 16227, 37095, 2044, 322, 6148, 4978, 10, 187, 187, 32473, 23029, 327, 253, 10351, 3703, 18708, 1712, 4538, 22, 94, 187, 35349, 187, 187, 510, 8930, 7888, 497, 598, 281, 253, 2393, 28385, 5331, 7943, 407, 247, 5718, 6982, 1254, 1311, 19, 1092, 1008, 1311, 22, 1656, 11431, 11659, 369, 22952, 342, 9894, 273, 12687, 1523, 5352, 12134, 13, 28035, 342, 9894, 273, 6571, 14245, 285, 8388, 16390, 2739, 15, 5863, 1919, 253, 3563, 11994, 84, 285, 2393, 10333, 84, 13, 672, 1728, 1959, 91, 398, 3395, 1846, 13, 7312, 1846, 1039, 281, 14003, 5893, 3580, 327, 253, 10351, 3703, 18708, 369, 407, 24396, 285, 42990, 272, 15, 353, 3681, 932, 13, 11260, 285, 6773, 497, 5448, 14, 49461, 28, 642, 7043, 369, 908, 275, 253, 1232, 1254, 1311, 19, 1092, 1008, 1311, 883, 1656, 496, 1283, 2950, 13, 7993, 45681, 9251, 360, 13, 247, 5974, 275, 9921, 285, 5869, 13, 2540, 253, 2739, 16964, 273, 253, 10351, 3703, 8930, 398, 15, 496, 1635, 281, 247, 2238, 273, 346, 30107, 293, 3, 313, 35264, 247, 18377, 10, 1160, 273, 4688, 13, 1355, 7437, 273, 8388, 16390, 14245, 9132, 285, 39913, 13723, 13, 9251, 360, 5012, 326, 597, 18739, 5136, 1051, 475, 83, 5507, 296, 2992, 326, 310 ]
ute-cuisine or festive celebrations. It is simple home-made food. The goal of this study is to examine the historical and contemporary use of *ræstur fiskur*, including its production, preparation and place in the local and national culture of the Faroes. Although there are several studies on Faroese food habits and changes over time, the importance of fermented fish is underrepresented \[[@CR2], [@CR5], [@CR11]--[@CR13]\]. Furthermore, the growing scholarly literature on fermented fish among subsistence-based peoples ignores the presence of fermented fish in the Faroes, although other Nordic countries have been studied previously \[[@CR14], [@CR15]\]. Data for the present study is based on field notes collected through interviews and observations on the Faroe Islands since mid-1990s. Fermented fish in Scandinavia {#Sec2} ----------------------------- As a highly perishable, proteinaceous food, fish must be prepared properly for storage to ensure it will last for later consumption. Drying, fermentation, salting and smoking are time-honoured, intricate methods of accomplishing this and thereby ensuring the nutritive needs of family households are properly met. Among these, drying and fermentation are the oldest methods of fish preservation \[[@CR16], [@CR17]\]. In Northern Europe, there are long traditions of fermenting animal products for human food. While lacto-fermented vegetable products have not played any significant roles in local food culture in the Nordic countries (in contrast to Central-Eastern Europe, see \[[@CR18], [@CR19]\]), fermented fish (as well as fermented milk and meat products) are historically widespread among the pre-industrial peasantry. This is especially the case in the northern part of the Scandinavian Peninsula, in the Faroes and in Iceland. Fermented animal products were commonly appreciated, with widespread tastes acquired early in childhood \[[@CR9], [@CR16]\]. Today fermented fish is rarely eaten in Scandinavia and is largely limited to a festive food eaten on special occasions. Examples of such fermented fish dishes are *surströmming* (made from Baltic herring) in Sweden and *rakefisk* (made from trout, char or whitefish) in Norway \[[@CR9], [@CR20]\]. Icelandic fermented Greenland shark, *kæstur hákarl*, has become a rather exclusive snack reserved for consumption during festive events especially. *Gravlax* ('the buried salmon'), a raw salmon dish cured in salt, sugar and seasoned with dill, is appreciated all over Scandinavia today. However, contemporary *gravlax* is a modern non-fermented product, and has no resemblance with the old fashioned traditional fermented salmon, whitefish, cyprinids and other fishes which was originally buried in the earth, hence the survival name 'buried salmon' \[[@CR20]--[@CR22]\]. Among the Nordic countries, the Faroe Islands are the only location where fermented fish continues to be used as an everyday food. There, it is still primarily produced in the home, and usually as a combined effort of the husband and wife. The entire preparation process is itself elaborate, involving catching, cleaning, drying, and fermenting the fish. Consumption occurs within the household. However, it is nowadays possible to buy *ræstur fiskur* in grocery stores on the Faroe Islands. It can also be bought online and delivered to people's front door. Methods {#Sec3} ======= This study is based on my field notes collected through interviews and observations since the mid-1990s. It is part of a larger ethnobiological research programme, focused on the activity context between humans and other animal species from the Faroes. I prefer, in accordance with Balée \[[@CR23]\], the expression *activity context* from the one-sided perspective implied by the terms plant and animal uses \[[@CR24]--[@CR27]\]. Wild animal taxa in the local cuisine have been discussed; although my research has centred specifically on ethnozoological issues, plant knowledge data have also been collected \[[@CR28], [@CR29]\]. Edible wild plants, however, played a minor role in the traditional diet (and even less nowadays) of the islanders \[[@CR30]\]. I conducted unstructured interviews with households in Vestmanna, Gjógv and Tórshavn (the capital of the islands), and also took part in various activities as an observant participator \[[@CR31]\]. Fishing and the consumption of fish are part of daily life on the Faroe Islands. I have therefore had many opportunities to observe and participate in the preparation of and consumption of semi-dried fermented fish. My field notes from these observations are my main sources. Supplemental information on the importance of fish as food was gathered from ethnographic reports, travelogues and local historic accounts \[[@CR2], [@CR5]\]. One important aspect is not discussed in this context though, that is the lactic acid bacteria and enzymes involved in the fermentation process. There is of course an interesting triangle of human-fish-microbe active here, but I have not found any relevant research on the microflora of the Faroese *raestur fiskur* so far. It is a topic for future research. Ethnographic setting {#Sec4} -------------------- Culturally, the Faroe Islands comprise a small and relatively homogenous society \[[@CR32]\]. Although recent archaeological evidence places human colonization of the Faroe Islands between AD 400--600, the current inhabitants are descendants of Viking Norsemen that arrived in the ninth century \[[@CR33], [@CR34]\]. Being part of Denmark from 1523, the population is mostly Lutheran, belonging to the Faroese Lutheran Church (80 %). The remainder belongs to the Open Plymouth Brethren (15 %) and various charismatic movements. It is a rather conservative Christian nation compared to other Nordic countries. The islanders have their own native language of Norse extraction, but most people are by necessity bilingual in both their mother tongue Faroese and in Danish, the language of the colonial power \[[@CR32]\]. Shepherding, hunting for seabirds -- and occasionally pilot whales and seals -- and some barley cultivation were the main base of the economy since human settlement until early twentieth century \[[@CR35], [@CR36]\]. We know from many ethnographic studies that populations with traditional lifestyles have detailed knowledge of various species in their surroundings \[[@CR37]\]. This is also true for the Faroe islanders. Fishing from land was primarily to supply food for individual households. Only landowning farmers had one or more boats. Fishing was a necessary complement to other economic activities. Pilot whales (*Globicephala melas* (Traill)), grey seal (*Halichoerus grypus* (Fabricius)), and sea-birds were also important sources of nutrition \[[@CR5], [@CR13]\]. The locals recognized very few fish species in the folk taxonomy. Among these, even fewer were recognized as food, including the various cod species (Gadidae), halibut, *Hippoglossus hippoglossus* (L.), and the now almost forgotten thornback ray, *Raja clavata* L. \[[@CR38]--[@CR40]\]. The saithe (*Pollachius virens* (L.)), which sometimes appeared in large shoals inshore, was of special importance, since many people could harvest them in great numbers from the shore \[[@CR41], [@CR42]\]. During the twentieth century the economy of the Faroes transformed from small-scale coastal fishery to deep-sea fishery in the North Atlantic. Today, fishing is the primary economic activity \[[@CR13], [@CR43]\]. The Faroe Islands has a large fleet of trawlers and smaller line fishing boats, fish factories and also raises salmon (*Salmo salar* L.) and sea trout (*Salmo trutta trutta* L.) in fish-farms. Although most fish are harvested by these larger fishing vessels, some older men continue to fish for pleasure and for their own consumption in locally constructed boats, well adapted to the surrounding sea (Fig. [3](#Fig3){ref-type="fig"}). Due to rapid modernization, an increasing number of people are now found within the white-collar sector, or are engaged in service and other activities within the tertiary economic sector.Fig. 3Traditional Faroese boats suitable for the Faroese waters, Gjógv, June 2004. These local rowing boats, which were previously used in many Faroese villages, have their origin in the smaller boats of the Vikings. Small open**-**boats are now mostly used for inshore fishing as a hobby (Photo Ingvar Svanberg) Food preservation on the Faroe Islands {#Sec5} -------------------------------------- The island communities were up to the early twentieth century characterized by a storage economy \[[@CR2], [@CR5]\]. Food availability was seasonal with periods of predominately fresh foods, alternating with periods of mostly dried and fermented food. Up until the late 1960s and early 1970s, when home freezers became common, usual common way to preserve animal products on the Faroe Islands was by drying and fermenting. Mammals, birds and fish were wind-dried; no salt was used in the process \[[@CR2], [@CR11]\]. In 1846, Peter Ludwig Panum, a student in medicine and surgery, observed the food habits of the Faroe islanders. In addition to a kind of "gruel" (actually a soup) made of fat, small pieces of fermented dried meat and barley grain, Panum reports that they ate:"... *ræst*, that is
[ 521, 7408, 281, 4135, 436, 1770, 2427, 816, 1270, 15, 754, 7244, 896, 275, 253, 1986, 2077, 846, 247, 2525, 14, 395, 14, 72, 3160, 342, 17868, 1165, 763, 266, 13, 4135, 434, 9841, 11162, 530, 15, 52, 15, 45460, 6854, 15, 380, 27876, 13, 3690, 15, 11731, 11392, 7599, 4261, 314, 327, 17868, 434, 3640, 273, 4466, 285, 11727, 13, 285, 344, 7558, 346, 783, 1533, 556, 1620, 2326, 1966, 2341, 708, 13271, 263, 387, 824, 4311, 3, 347, 275, 4135, 15, 187, 187, 13788, 76, 434, 23027, 6125, 247, 1846, 4884, 432, 11731, 84, 13, 432, 8217, 434, 8969, 11980, 281, 6745, 434, 4744, 1503, 18141, 4978, 13, 846, 48287, 31528, 12188, 342, 1755, 14, 5251, 5628, 7038, 15, 11198, 14807, 2244, 2761, 1900, 2940, 1977, 432, 921, 90, 13, 892, 9476, 12225, 13762, 326, 253, 5628, 1930, 310, 24152, 281, 616, 3198, 285, 326, 597, 476, 1132, 247, 30847, 2554, 275, 253, 2570, 2493, 875, 5041, 285, 18496, 15, 187, 187, 1989, 597, 1472, 16426, 20854, 13, 285, 253, 6662, 932, 273, 5639, 9341, 275, 4135, 403, 762, 4092, 3569, 4322, 432, 247, 2208, 35524, 342, 697, 1211, 5697, 273, 3872, 3988, 15, 187, 187, 4339, 17174, 403, 1677, 281, 10805, 323, 841, 9257, 7303, 12225, 13, 275, 629, 432, 23057, 285, 275, 629, 984, 273, 616, 15663, 9927, 326, 841, 2136, 7688, 1128, 460, 87, 20961, 6289, 281, 407, 253, 5628, 3159, 1149, 266, 2981, 1128, 5092, 1527, 512, 253, 11008, 597, 878, 275, 4135, 15, 1292, 1223, 1149, 266, 2981, 476, 42341, 253, 17727, 273, 2970, 12225, 390, 2970, 4116, 281, 13330, 13, 352, 476, 626, 19086, 4135, 434, 5675, 4996, 16723, 13, 762, 253, 1149, 885, 273, 3988, 13, 715, 253, 6186, 13178, 326, 452, 644, 824, 247, 9560, 629, 273, 253, 530, 15, 52, 8634, 22800, 5454, 2954, 15, 187, 187, 11001, 1515, 932, 8, 1388, 14, 936, 14, 1201, 5871, 275, 4135, 2454, 26442, 22087, 15, 496, 378, 404, 708, 6487, 434, 4765, 4135, 10518, 28678, 17136, 13, 5196, 342, 253, 2448, 23119, 273, 20249, 275, 4135, 13, 6879, 2558, 273, 15102, 3543, 326, 5639, 4413, 403, 9592, 10357, 13509, 627, 13, 342, 7248, 5780, 247, 2201, 4468, 15, 473, 735, 429, 689, 5639, 32447, 310, 11543, 281, 1708, 257, 347, 4135, 8796, 955, 346, 527, 17431, 15832, 3, 275, 253, 42733, 19465, 3636, 275, 697, 23089, 275, 4135, 1384, 1099, 5827, 15, 1198, 758, 4302, 21916, 390, 440, 49628, 941, 19610, 407, 2060, 4750, 2758, 2963, 2729, 407, 5628, 16255, 16753, 1524, 10502, 281, 37197, 1050, 9341, 13, 347, 1057, 253, 5675, 3361, 273, 253, 5628, 3988, 1375, 15, 187, 187, 510, 22014, 273, 1554, 1515, 932, 310, 4983, 281, 921, 15, 346, 1276, 310, 634, 4112, 275, 4135, 1024, 865, 611, 4595, 4235, 6850, 273, 4568, 853, 2546, 4744, 1503, 18141, 4978, 436, 1770, 15, 346, 42, 1599, 13, 359, 1472, 13230, 937, 344, 10017, 29156, 314, 15, 1723, 13, 1503, 18141, 4978, 434, 4135, 37321, 6468, 626, 644, 4751, 17889, 13, 347, 344, 2879, 13, 346, 1147, 434, 1892, 281, 452, 247, 7517, 273, 14707, 281, 3324, 253, 2644, 1533, 8003, 2366, 285, 3553, 562, 253, 5962, 2586, 449, 187, 187, 25116, 11731, 4744, 1503, 18141, 4978, 285, 253, 21344, 15572, 273, 253, 4135, 9753, 24703, 37977, 347, 5628, 19425, 8182, 611, 2574, 22589, 23981, 323, 247, 4804, 387, 253, 6495, 6696, 273, 253, 6491, 275, 18496, 327, 3919, 3127, 13, 4022, 15, 44, 12586, 357, 1822, 34990, 6968, 4595, 428, 32879, 16, 24051, 13478, 187, 187, 1552, 346, 2230, 3, 310, 6867, 273, 247, 18109, 8113, 326, 2448, 16255, 452, 9444, 264, 1580, 655, 394, 14, 9888, 30380, 285, 46895, 7156, 85, 273, 5909, 253, 5628, 2791, 15, 9110, 2600, 13498, 824, 347, 6745, 3464, 23339, 2149, 3212, 247, 43505, 326, 310, 46994, 1046, 1770, 13, 285, 2583, 268, 2108, 715, 7189, 2392, 281, 8171, 10296, 15, 187, 187, 1672, 9020, 24238, 403, 1146, 8838, 13, 533, 747, 4394, 403, 671, 1146, 1691, 275, 1659, 15, 9044, 556, 2489, 253, 2629, 22861, 323, 253, 3781, 273, 747, 5323, 285, 7248, 7767, 942, 12262, 37197, 1050, 16255, 15, 6676, 273, 253, 3055, 14, 37802, 4712, 1146, 6537, 1053, 626, 2965, 762, 5899, 12342, 273, 3872, 3988, 13, 533, 323, 21790, 13, 346, 13980, 7350, 3, 476, 6266, 3237, 12319, 432, 849, 247, 4422, 966, 7790, 17975, 281, 253, 4248, 273, 2791, 2289, 247, 4302, 5882, 25099, 15, 15839, 9341, 403, 9592, 387, 2495, 432, 3569, 3394, 285, 15620, 3988, 16936, 15, 187, 187, 12864, 253, 3684, 13247, 14, 25559, 25633, 345, 50108, 5034, 23519, 442, 13, 534, 6497, 5487, 281, 247, 5628, 48254, 342, 36546, 689, 253, 19007, 273, 247, 530, 15, 52, 15, 22822, 985, 15, 30549, 42760, 84, 14659, 407, 6281, 1408, 407, 1375, 3420, 824, 347, 45838, 38349, 7369, 275, 4092, 6224, 15323, 326, 3977, 281, 23519, 442, 434, 18185, 432, 253, 5628, 2791, 1390, 807, 15, 187, 187, 6175, 530, 15, 52, 15, 28265, 3464, 247, 2234, 629, 273, 5628, 2136, 323, 1024, 13, 3918, 36852, 32260, 14650, 556, 2168, 2011, 247, 3367, 24741, 281, 3473, 23289, 281, 26276, 521, 5454, 21546, 281, 5041, 15, 187, 187, 22800, 434, 3918, 36852, 32260, 14650, 16030, 84, 247, 7496, 273, 19248, 347, 344, 23981, 323, 247, 4804, 342, 3684, 8118, 3918, 330, 6147, 300, 9752, 9761, 6859, 387, 253, 6398, 11103, 723, 275, 24907, 20130, 13, 3684, 7531, 13, 4163, 2164, 13, 4765, 15, 24197, 187, 187, 15745, 21546, 1691, 36852, 434, 3569, 8113, 387, 253, 2798, 273, 2136, 3646, 15, 1284, 47422, 10118, 22780, 23519, 316, 416, 9041, 8219, 13, 14149, 5628, 3646, 3448, 4665, 84, 253, 2934, 273, 3988, 21450, 285, 3797, 5231, 2905, 281, 346, 783, 1453, 285, 23339, 4263, 273, 1345, 8881, 275, 4088, 326, 778, 2818, 253, 1612, 390, 6306, 273, 253, 10362, 5628, 22356, 7021, 449, 36852, 434, 2208, 285, 11570, 40206, 2066, 868, 403, 271, 1774, 15301, 273, 816, 849, 8244, 344, 5605, 253, 9787, 8776, 281, 11472, 521, 3367, 8113, 15, 187, 187, 12486, 2606, 36852, 14211, 382, 24472, 754, 369, 4102, 15127, 281, 12008, 24654, 28, 24472, 1024, 5644, 5454, 16685, 342, 253, 1986, 2077, 13, 285, 344, 671, 6518, 19186, 19837, 346, 21416, 32260, 14650, 1869, 3, 715, 4135, 434, 5054, 5827, 15, 1284, 36852, 434, 34889, 273, 1612, 7788, 13, 4135, 434, 9836, 3646, 1533, 310, 7601, 326, 23089, 275, 4135, 1384, 1099, 310, 670, 752, 36852, 5605, 13, 342, 1652, 1488, 304, 10582, 2316, 323, 667, 11254, 15, 187, 187, 11389, 1066, 253, 3569, 2739, 5931, 13, 1158, 11100, 285, 3055, 14, 37802, 45460, 21176, 1315, 461, 4427, 5639, 12981, 407, 21455, 281, 1474, 4513, 432, 687, 442, 3128, 14, 1282, 6128, 326, 1581, 642, 2316, 323, 253, 6284, 273, 5639, 16255, 15, 187, 187, 688, 5768, 4022, 13, 7493, 16598, 13, 253, 19041, 6423, 273, 253, 5197, 323, 40456, 5625, 11709, 8, 4135, 2086, 13, 11612, 271, 15832, 17414, 27312, 342, 253, 840, 14, 13382, 14622, 530, 15, 52, 8634, 22800, 40456, 708, 19190, 36623, 489, 15, 187, 187, 4553, 247, 29341, 6431, 13, 16598, 7943, 521, 5628, 17414, 21421, 347, 346, 328, 522, 862, 17859, 3, 9159, 25774, 273, 2791, 29110, 323, 5637, 4958, 19978, 13, 247, 4619, 9787, 8776, 323, 4135, 15, 1583, 16701, 326, 604, 5639, 16255, 3078, 275, 13, 253, 2105, 369, 23415, 275, 4135, 342, 9836, 6036, 18875, 10471, 15, 1707, 556, 644, 642, 14011, 326, 4135, 310, 7378, 281, 4917, 327, 5909, 10169, 281, 19465, 352, 372, 3030, 3483, 1037, 1774, 390, 326, 352, 11532, 812, 320, 247, 2442, 3988, 2495, 15, 187, 187, 33818, 33258, 5639, 18674, 943, 1007, 281, 253, 8450, 273, 5628, 16255, 13, 534, 769, 347, 476, 3927, 275, 253, 10089, 7477, 15, 380, 1986, 15808, 7733, 4487, 13, 247, 2234, 3128, 2133, 6571, 1929, 323, 697, 789, 8362, 4833, 5871, 3345, 273, 4135, 13, 671, 2987, 41574, 1037, 281, 8722, 3055, 14, 37802, 3879, 15, 380, 1986, 15808, 434, 6264, 29002, 556, 21533, 2530, 26911, 13, 7681, 1329, 13, 285, 23245, 9091, 323, 5628, 30440, 15, 2053, 33265, 8889, 452, 644, 2234, 281, 849, 5628, 17057, 2990, 13, 4763, 5300, 13, 285, 3885, 949, 10545, 4870, 15, 443, 18639, 247, 6186, 5931, 390, 4067, 13739, 1293, 10291, 281, 1986, 15808, 8889, 310, 7479, 15, 187, 187, 2598, 2080, 13, 4135, 434, 47215, 14, 395, 14, 19982, 9787, 4446, 310, 22915, 253, 2208, 1534, 4489, 14, 249, 432, 253, 3055, 8776, 13, 973, 4457, 2969, 10276, 342, 697, 44448, 3988, 1569, 15, 416, 9041, 803, 953, 326, 346, 20415, 273, 544, 22800, 434, 3055, 8776, 4413, 62, 1128, 10387, 253, 4491, 7038, 1128, 609, 3652, 616, 2136, 1566, 18705, 1475, 253, 3198, 273, 253, 1375, 449, 496, 1614, 13, 352, 310, 2779, 326, 4135, 434, 5454, 285, 9787, 7823, 13, 432, 941, 4803, 281, 4302, 21916, 13, 588, 320, 4270, 281, 5649, 253, 9836, 16255, 326, 352, 31901, 281, 9510, 15, 187, 187, 510, 3935, 2197, 281, 9836, 16255, 556, 644, 2590, 27, 15859, 366, 13, 285, 634, 6003, 476, 20464, 15, 9704, 366, 3345, 273, 253, 2208, 434, 7465, 13, 285, 368, 1833, 1089, 5871, 625, 2834, 1128, 284, 17868, 40326, 3770, 9041, 13, 253, 11731, 273, 322, 462, 276, 13, 247, 5628, 3186, 3948, 13, 556, 2529, 15, 1707, 434, 642, 34528, 253, 747, 3569, 15990, 275, 253, 5628, 2791, 15, 187, 187, 3039, 4135, 11403, 2136, 347, 8672, 13, 2136, 7038, 878, 281, 1265, 17682, 616, 12225, 342, 253, 1072, 36231, 285, 342, 247, 15958, 4685, 273, 752, 434, 1896, 15, 733, 434, 1620, 5745, 11170, 281, 320, 30446, 281, 634, 14516, 13, 533, 3098, 15240, 5701, 273, 253, 2238, 5907, 407, 42497, 588, 320, 1239, 407, 4135, 434, 9550, 347, 247, 861, 326, 597, 476, 769, 347, 597, 751, 2584, 37197, 1050, 16255, 15, 187, 187, 33748, 39933, 1411, 2442, 2544, 275, 253, 1971, 273, 5639, 16255, 310, 271, 5667, 15942, 6612, 323, 23289, 15, 380, 5628, 2208, 778, 2624, 253, 28865, 327, 247, 27876, 13250, 581, 1388, 285, 5007, 275, 16030, 641, 323, 7654, 9370, 3487, 84, 253, 1735, 15, 1608, 5521, 458, 13539, 285, 1679, 458, 999, 333, 323, 5639, 16255, 403, 327, 253, 15990, 13, 285, 3968, 434, 10459, 2602, 1612, 275, 4135, 310, 873, 281, 1705, 598, 1411, 5827, 285, 10003, 3413, 281, 2827, 853, 352, 15, 28549, 13, 2552, 4562, 13, 4050, 187, 187, 46, 24726, 298, 5348, 403, 30601, 272, 1722, 1897, 4321, 685, 597, 858, 275, 816, 253, 10333, 84, 15, 2064, 3249, 562, 281, 320, 247, 1818, 273, 670, 577, 1897, 591, 9976, 15, 6102, 247, 14138, 1818, 556, 281, 452, 2538, 327, 643, 3417, 13, 285, 352, 1057, 15, 496, 436, 1798, 1083, 13, 253, 3417, 5876, 310, 253, 3862, 14, 29551, 1547, 3987, 23182, 15, 2053, 1547, 3987, 40382, 12666, 275, 253, 14700, 273, 253, 10439, 3729, 3968, 281, 21876, 1046, 7203, 285, 3469, 327, 253, 425, 291, 274, 432, 253, 11129, 298, 1031, 281, 10265, 731, 15, 380, 298, 5348, 403, 1024, 30601, 272, 407, 253, 673, 253, 1547, 3987, 40382, 12666, 15, 15092, 247, 1643, 8007, 253, 11260, 588, 320, 20948, 846, 253, 31767, 3056, 452, 2168, 259, 2878, 264, 15, 187, 187, 2214, 1107, 253, 4154, 556, 644, 627, 369, 642, 824, 2181, 347, 4156, 18384, 15, 380, 7952, 1818, 1850, 4670, 2427, 281, 1270, 16095, 281, 7450, 436, 1127, 15, 1292, 13, 625, 285, 625, 941, 751, 436, 1304, 327, 253, 11129, 298, 5348, 2722, 253, 8859, 310, 6296, 2970, 34562, 15, 380, 1850, 4670, 452, 1024, 14728, 616, 7125, 326, 436, 18384, 310, 417, 1955, 281, 637, 12710, 14839, 15, 7820, 13, 597, 1750, 13, 436, 310, 816, 247, 2622, 18384, 5880, 15, 187, 187, 1989, 13, 604, 627, 310, 642, 18384, 840, 849, 476, 627, 320, 247, 3626, 18384, 5880, 32, 187, 187, 4497, 13, 253, 1850, 4670, 1024, 11476, 627, 310, 18384, 15, 187, 187, 1989, 13, 604, 597, 497, 594, 3430, 327, 253, 958, 326, 253, 8859, 310, 18384, 13, 752, 2789, 3780, 1158, 597, 403, 987, 670, 352, 1146, 247, 3626, 18384, 5880, 32, 187, 187, 510, 7952, 1818, 1850, 4670, 9059, 368, 476, 626, 4517, 253, 7952, 10950, 984, 359, 686, 9903, 626, 871, 3253, 2464, 733, 310, 2032, 359, 1053, 626, 871, 3253, 13, 533, 359, 871, 436 ]
his trip to China this month went just great. He arrived back in the United States after a meet-and-greet with Wang Qishan, China's newly appointed U.S. interlocutor. The Tesla, Inc. CEO reflected admiringly on Wang's knowledge of culture and philosophy, and he claimed "the world has never seen human energy & vigor at such scale" as in China. Musk's enthusiasm represents a common reaction from CEOs, from Apple's Tim Cook to Facebook's Mark Zuckerberg, after hobnobbing with top-level Chinese leaders. Entrepreneurs almost always walk away from showy, flattering meetings convinced that the Chinese side is sympathetic to their needs and that they can play a pivotal role in the complex relations between Washington and Beijing. But they're badly mistaken, and the fundamentals of foreign businesses in China are under serious political threat from a government obsessed with its own ideas of national security. CEOs are given to falling for these carefully managed meetings, in part from ego and in part because of their persistent belief that these business relationships—inevitably referred to by the Chinese word guanxi—can open all the doors they need in China. But while guanxi can grease the wheels of getting meetings or getting attention to deals, it can't halt China's growing intrusions, under the guise of security, into the supply chains that have been such a crucial part of the U.S.-China trade relationship. Multinationals' day-to-day operations in China face unhappy prospects. In Bain & Company's 2018 China Business Climate Survey, conducted with the American Chamber of Commerce in China, 75 percent of respondents felt that foreign companies are increasingly unwelcome there, with regulation remaining a major concern. Oversight over foreign enterprises is unlikely to lighten as China pursues "indigenous innovation" in the lucrative sectors identified in its Made in China 2025 plans. Forced technology transfers or unethical data theft by individual staff members poached by Chinese firms pose real risks to multinational businesses, as does the growing presence of the Chinese security state. The frustration of multinationals is starting to show. "What is your situation in China now?" Kara Swisher of Recode asked Mark Zuckerberg this month. "I mean, we're blocked," he replied bluntly. However, Zuckerberg's China ambitions haven't been fully dashed, as he added, "It's hard to have a mission of wanting to bring the whole world closer together and leave out the biggest country." Facebook CEO Mark Zuckerberg and the overseas representatives of the China Development Forum applaud as Chinese Premier Li Keqiang arrives for a meeting at the Great Hall of the People in Beijing on March 21, 2016.Kenzaburo Fukuhara - Pool/Getty Images This "mission" is typical of a romantic vision that American firms have nursed since 19th-century merchants and missionaries dreamt of opening the Chinese market. Yet content platforms such as Facebook remain censored behind a firewall that is thickening every month, and money pours into incubators to replace technologies. Existing obstacles are being maintained, but new ones are also being put in place. Security has become the standard justification for the array of new laws and regulation enforcements targeting multinational firms. Many of the private-sector activities being controlled don't fall under traditional concepts of national security, but for regulators, "security concerns" can describe problems ranging from how a website classifies Taiwan to the degree of market access a technology firm possesses. Foreign businesses are increasingly at risk from political events and controversial security developments. Take the South Korean-Japanese grocery conglomerate Lotte, which fell victim to a Chinese quarrel with Seoul over the deployment of a U.S. missile system. Consumer boycotts encouraged by stories run by state media such as Xinhua resulted in serious sales drops that led to Lotte's withdrawal from the Chinese market last year. While U.S. suppliers remain a key part of Chinese business for now, President Xi Jinping has already shown a personal willingness to pressure executives to relay his trade intentions to Washington. China's President Xi Jinping inspects a guard of honour as he arrives for a meeting with South African President Cyril Ramaphosa at the Union Buildings in Pretoria, South Africa, July 24, 2018. Reuters Those intentions put Xi's political vision at the heart of business policy. As Citizen Lab researcher Lotus Ruan argues, emerging Chinese policy language interprets the idea of security broadly and includes actions related to "the control and censoring of public debate in ways that may affect the power or standing of the ruling Chinese Communist Party." Xi's government and personnel reshuffles are an important indicator of just how closely he wants the industrial sector to mirror his personal vision. Longtime Xi loyalist Liu He was recently promoted to vice premier; Liu now leads trade negotiations with the United States, and he also helped formally integrate "Xi Jinping thought" into China's economic plans. As Xi's consolidation of power continues, China's domestic policy world is signaling that Made in China 2025 is about what Xi wants, with little wriggle room for any deviation. Further down the political food chain, think tank and private-sector interlocutors frustrate foreign scholars by refusing to deviate from rote party-line responses that allow no room for the interests of foreign firms. In summer 2016, Scott Kennedy, the deputy director of the Center for Strategic International Studies' China program, attended an innovation dialogue affiliated with the then-prominent U.S.-China Strategic & Economic Dialogue. After a tense exchange, Kennedy characterized his Chinese dialogue counterparts as "unapologetically" offering defenses of market protections for electric vehicle batteries, a critical industrial sector for China. They insisted that if foreign firms wanted in, the cost was investing in China with domestic joint venture partners. There has been no indication that China is willing to yield on opening markets to sectors it deems strategically important or that it believes could be a potential security risk. Ambitious foreign corporations should look to the experiences of Chinese firms, which act as canaries in the coal mine. The United Front Work Department, a key party body mostly known for its work funding influence operations outside of China, also works domestically to manage private-sector behavior. The United Front's commercial oversight has traditionally provided incentives, technical support, and networking opportunities for Chinese entrepreneurs. These umbrella organizations have been key to how Chinese industries network, receive resources, and speed through regulatory processes. Growing a supply chain or larger corporation without connections to United Front organizations is impossible. So far, China's carrot-and-stick industrial drive is earning the government significant buy-in from the private sector, well beyond simple compliance with its broadening security law. Ruan posits that "many of [China's private sector companies]—including the industry leaders—are building their business model predominantly around the needs of the state." In turn, it is likely that China's trade and industrial policies, from data rules to technology transfers, will be built to benefit the domestic firms that it intends to boost. The message sent to domestic firms has been clear: Cooperate, and your organization can prosper. Operate outside of the government's standards, and you'll find operations more difficult—as Wang Xiaochuan, the CEO of Sogou, a Chinese search engine, has described. There's no escaping the new political agenda in the Chinese market. When China sees business as politics, business leaders need to start approaching their meetings with the same mindset and with a realistic understanding of what's possible. It's never savvy to be rude to your hosts, but effusive comments of the kind offered by Musk will be read by China's leadership as a sign that they can act as they like toward multinational firms. Taking precautions against potential changes in the treatment of foreign firms is an essential operational reality for executives. The Chinese government may cut the ribbon on a Tesla factory one day and send in inspectors for strict crackdowns the next. Shorter leashes and less leeway for foreign firms are on the agenda, and America's corporate soft power in China is set to come up against plans and institutions determined to erode it.Thursday, May 31, 2012 Mountain lilies are blooming 17 days earlier than they did in just the 1970s. That comes out to be a change of about 4 days per decade. Such a dramatic change has to have effects on other species, and it does. In this particular case, the species affected is the broad-tailed hummingbird. These hummingbirds arrive in the mountains of the western North America to breed every spring and depend on the nectar from the mountain lily to sustain them. The lilies are now blooming by the time the hummingbirds arrive. Within a few decades the birds will be arriving after the blooms have already wilted. For years the argument has been there was no such thing as global warming. The climate change deniers went to great lengths to push this point. But, more and more data like this report on the mountain lilies shows the planet is indeed getting warmer. The deniers have now shifted their arguments that this warming is not due to manmade emissions. Instead, they claim, this is just a normal warming cycle. But, if there is no warming then how can there be a natural warming cycle? Well, the deniers now admit there is warming. But, if they were so wrong on the fact that the planet is warming, what makes anyone think they are right about it being a natural warming cycle? The climate change deniers argue you can't trust the climate scientists because we 'don't know everything.' It is true we don't know everything, but we know this
[ 1717, 94, 187, 6154, 9794, 187, 187, 39418, 326, 370, 89, 578, 71, 724, 310, 247, 40249, 3410, 13, 285, 253, 475, 83, 11, 394, 4778, 1474, 28032, 432, 253, 2622, 6498, 2491, 15, 370, 89, 578, 71, 724, 476, 320, 7154, 1066, 715, 253, 1563, 4948, 1764, 2043, 92, 3728, 1217, 83, 94, 187, 92, 89, 578, 71, 94, 426, 1269, 17840, 94, 559, 393, 4519, 578, 83, 94, 71, 578, 83, 2023, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 285, 669, 4519, 578, 83, 94, 71, 578, 83, 724, 310, 253, 40249, 4445, 15, 669, 4519, 578, 83, 724, 310, 253, 3884, 273, 253, 9331, 13, 285, 370, 71, 578, 83, 724, 310, 253, 10896, 273, 253, 9331, 275, 253, 3969, 3884, 15, 4794, 281, 40242, 313, 21, 10, 285, 313, 23, 582, 253, 7680, 1318, 273, 1016, 4778, 476, 320, 2797, 407, 20860, 2470, 24, 1084, 10914, 24, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 1269, 578, 71, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 551, 89, 17840, 94, 559, 393, 4519, 578, 83, 94, 71, 578, 83, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1572, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 2023, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 47, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1009, 310, 253, 475, 75, 11, 394, 5275, 6346, 273, 370, 89, 578, 71, 724, 275, 253, 3733, 941, 873, 13, 285, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 594, 253, 1563, 2493, 2226, 27, 370, 89, 17840, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 9887, 470, 1352, 380, 7680, 1318, 273, 1016, 4778, 476, 320, 13657, 715, 20860, 2470, 25, 1084, 10914, 25, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 393, 9887, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 393, 4519, 578, 83, 94, 71, 578, 83, 94, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 465, 61, 1274, 9, 393, 4519, 578, 83, 94, 71, 578, 83, 889, 4519, 578, 77, 1990, 53, 94, 393, 918, 7415, 19, 2023, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 36, 578, 1258, 724, 310, 253, 7680, 1318, 273, 253, 475, 77, 11, 394, 4778, 273, 3410, 370, 89, 578, 71, 724, 281, 253, 4181, 7605, 3605, 13, 285, 669, 4519, 578, 83, 724, 285, 669, 4519, 578, 77, 724, 943, 10517, 20860, 2470, 26, 1084, 10914, 26, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 464, 4519, 578, 83, 889, 4519, 578, 77, 1990, 53, 94, 426, 393, 1274, 6921, 393, 2043, 92, 3728, 1217, 77, 94, 187, 92, 17, 13, 83, 393, 9540, 298, 46609, 3202, 187, 92, 18, 13, 83, 426, 298, 35918, 3202, 187, 61, 423, 92, 3728, 94, 393, 918, 35918, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 4509, 253, 1840, 13, 672, 475, 83, 11, 310, 417, 4503, 281, 475, 77, 2992, 370, 83, 393, 9540, 298, 1366, 253, 6459, 7680, 273, 10969, 4903, 310, 370, 36, 578, 925, 724, 1764, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 925, 94, 426, 465, 71, 578, 83, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 35918, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 6452, 476, 320, 8392, 2556, 281, 253, 1840, 1783, 27, 380, 465, 14, 8504, 4181, 7680, 1783, 1332, 476, 5416, 326, 271, 10969, 4778, 556, 253, 6459, 7680, 1318, 672, 760, 247, 2014, 4778, 310, 10969, 15, 187, 187, 20, 15, 19, 15, 380, 5721, 284, 2322, 10330, 273, 20815, 3506, 6320, 40949, 1712, 1704, 20, 5256, 19, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 6154, 2912, 187, 187, 39418, 326, 370, 89, 578, 71, 724, 310, 247, 40249, 3410, 285, 326, 2067, 4903, 1474, 4513, 432, 253, 2622, 6498, 2491, 27, 4778, 475, 66, 2992, 4778, 475, 67, 2992, 285, 4778, 475, 68, 4556, 370, 89, 578, 71, 724, 476, 320, 7154, 1066, 715, 253, 1563, 4948, 47279, 2043, 92, 3728, 1217, 83, 94, 187, 92, 89, 578, 71, 94, 426, 1269, 17840, 94, 559, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 2023, 94, 3202, 187, 61, 423, 92, 3728, 2138, 835, 370, 89, 17840, 724, 310, 253, 2622, 4445, 273, 370, 89, 578, 71, 3303, 669, 4519, 578, 66, 94, 71, 578, 66, 3303, 669, 4519, 578, 67, 94, 71, 578, 67, 3303, 285, 669, 4519, 578, 68, 94, 71, 578, 68, 724, 403, 253, 40249, 4295, 15, 669, 4519, 5, 285, 475, 71, 11, 403, 253, 10746, 285, 22652, 273, 253, 9331, 15, 4794, 281, 40242, 313, 21, 10, 285, 313, 883, 582, 253, 7680, 1318, 273, 1016, 4778, 476, 320, 2797, 347, 20860, 2470, 805, 1084, 10914, 805, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 1269, 578, 71, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 551, 89, 17840, 94, 559, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 1572, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 7165, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 2493, 2226, 27, 370, 89, 17840, 94, 428, 427, 578, 75, 889, 1274, 9, 1269, 578, 71, 94, 393, 918, 10, 393, 9887, 470, 1352, 380, 7680, 1318, 273, 1016, 4778, 476, 320, 13657, 715, 20860, 2470, 1012, 1084, 10914, 1012, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 2043, 92, 3728, 1217, 83, 94, 187, 92, 36, 578, 1258, 94, 393, 9887, 393, 2204, 61, 10423, 578, 75, 426, 337, 1990, 76, 889, 1274, 6921, 1926, 1274, 61, 26874, 393, 4519, 578, 66, 94, 71, 578, 66, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 94, 393, 918, 61, 29179, 61, 4519, 578, 77, 1990, 53, 599, 393, 918, 61, 1990, 19, 94, 426, 465, 61, 1274, 9, 393, 4519, 578, 66, 94, 71, 578, 66, 889, 4519, 578, 77, 1990, 53, 94, 559, 393, 4519, 578, 67, 94, 71, 578, 67, 889, 4519, 578, 77, 1990, 53, 94, 559, 393, 4519, 578, 68, 94, 71, 578, 68, 889, 4519, 578, 77, 1990, 53, 94, 393, 918, 7415, 19, 7165, 94, 3202, 187, 61, 423, 92, 3728, 94, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 33397, 281, 247, 2014, 10969, 4778, 13, 672, 370, 66, 13, 67, 13, 68, 393, 9540, 298, 1366, 370, 36, 578, 6855, 3303, 370, 36, 578, 15662, 724, 285, 370, 36, 578, 12964, 724, 476, 320, 6607, 347, 20860, 2470, 1047, 1084, 10914, 1047, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 986, 2262, 7010, 2043, 92, 3728, 1217, 83, 94, 187, 61, 1274, 6921, 393, 2043, 92, 3728, 1217, 77, 94, 187, 92, 36, 578, 6855, 94, 426, 465, 71, 578, 66, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 46609, 3202, 187, 92, 36, 578, 15662, 94, 426, 465, 71, 578, 67, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 46609, 3202, 187, 92, 36, 578, 12964, 94, 426, 465, 71, 578, 68, 1990, 19, 94, 2239, 330, 578, 1258, 94, 393, 9887, 470, 35918, 3202, 187, 61, 423, 92, 3728, 94, 393, 918, 15, 3202, 187, 61, 423, 92, 3728, 2138, 187, 187, 510, 1563, 6452, 476, 320, 8392, 2556, 281, 253, 1840, 1783, 27, 380, 465, 14, 8504, 4181, 7680, 1783, 1332, 476, 5416, 10969, 4903, 452, 253, 3687, 7680, 1318, 672, 627, 403, 2067, 10969, 4903, 15, 187, 187, 21, 15, 5128, 1720, 11682, 285, 401, 1923, 90, 34725, 35859, 32988, 1712, 1704, 21, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 15256, 381, 187, 187, 688, 1340, 281, 8415, 253, 4471, 14, 46103, 9331, 1895, 13, 253, 465, 14, 8504, 285, 4081, 16098, 941, 14433, 5700, 403, 2529, 275, 2508, 2708, 13, 285, 253, 5301, 285, 1783, 273, 767, 3082, 403, 1677, 275, 544, 12612, 577, 15, 20, 1084, 1704, 21, 5256, 20, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 1704, 7129, 187, 187, 21, 15, 18, 15, 380, 465, 14, 8504, 5128, 1720, 11682, 8378, 1712, 1704, 21, 5256, 18, 14, 8751, 14, 746, 14, 8972, 1717, 94, 187, 36960, 187, 187, 688, 436, 19087, 13, 253, 941, 14433, 1332, 1754, 327, 465, 14, 8504, 310, 1677, 1254, 35, 1671, 14, 8751, 14, 746, 14, 8972, 1717, 1656, 2091, 627, 310, 247, 9331, 275, 247, 747, 3410, 13, 359, 476, 897, 253, 941, 14433, 1332, 347, 3637, 15, 187, 187, 13996, 337, 27, 12144, 907, 253, 747, 3410, 970, 253, 1599, 285, 11041, 273, 253, 3733, 941, 15, 380, 906, 310, 370, 89, 578, 1826, 3303, 285, 370, 89, 578, 1826, 94, 426, 393, 1274, 61, 26874, 362, 578, 18, 2023, 87, 578, 19, 5548, 5589, 13, 87, 578, 78, 94, 393, 918, 61, 29179, 1366, 370, 87, 578, 74, 724, 310, 253, 5203, 273, 253, 4778, 15, 187, 187, 13996, 374, 27, 1720, 17439, 1016, 4778, 370, 87, 578, 18, 2023, 87, 578, 19, 5548, 5589, 13, 87, 578, 78, 724, 2556, 281, 20860, 2470, 1010, 1084, 10914, 1010, 14, 8751, 14, 746, 14, 8972, 1717, 910, 709, 14, 881, 568, 14323, 14, 19350, 7547, 285, 544, 2841, 374, 1084, 8751, 14, 746, 14, 8972, 1717, 14, 71, 4699, 910, 709, 14, 881, 568, 926, 4982, 835, 370, 79, 578, 74, 889, 1274, 9, 1269, 578, 1826, 1990, 92, 4799, 5994, 599, 393, 918, 1009, 310, 253, 475, 74, 11, 394, 5275, 6346, 273, 370, 89, 578, 1826, 1990, 92, 4799, 5994, 4018, 275, 3733, 3410, 370, 89, 578, 79, 393, 3181, 313, 78, 428, 337, 46538, 92, 4799, 5994, 12460, 285, 669, 1274, 61, 26874, 1269, 578, 79, 578, 74, 18424, 89, 578, 1826, 1990, 92, 4799, 5994, 12104, 599, 393, 918, 61, 29179, 578, 85, 724, 310, 253, 475, 85, 11, 394, 4778, 273, 370, 89, 578, 1826, 1990, 92, 4799, 5994, 11971, 380, 4764, 475, 76, 11, 310, 247, 3638, 1318, 273, 2793, 15, 3318, 87 ]
29} --------------------------------------------------------- Assume that $x_{f}$ is a faulty sample, and the *r*th variable deviates from the normal operating range. $x_{f}$ can be broken down into the following forms $$\begin{array}{r} {x_{f} = x^{*} + \varepsilon_{r}f_{r},} \\ \end{array}$$ where $x^{*}$ is the normal component of $x_{f}$, and $\varepsilon_{r}f_{r}$ is the faulty component. $\varepsilon_{r}$ is the direction of the fault, and $f_{r}$ is the amplitude of the fault in the corresponding direction. According to Equations (4) and (6), the contribution value of each variable can be obtained by Equation ([7](#FD7-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} = \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack x_{f} - N_{j}\left( x_{f} \right) \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = \sum\limits_{j = 1}^{k}\left\{ {x^{*} + \varepsilon_{r}f_{r} - N_{j}\left( x_{f} \right)\rbrack\varepsilon_{l}^{T}} \right\}^{2},} \\ \end{array} \\ \end{array}$$ where $N_{j}\left( x_{f} \right)$ is the *j*th nearest neighbor of $x_{f}$ in the training data set, and $x^{*}$ is the normal component of $x_{f}$, so the following relations exist: $x^{*} - N_{j}\left( x_{f} \right) \approx 0$. The contribution value of each variable can be transformed into Equation ([8](#FD8-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} \approx \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack \varepsilon_{r}f_{r} \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = k\left( \varepsilon_{r}f_{r}\varepsilon_{l}^{T} \right)^{2},} \\ \end{array} \\ \end{array}$$ where $C_{fl}$ is the contribution value of the *l*th variable of sample $x_{f}$ to the distance statistical index, and $\varepsilon_{r}$ and $\varepsilon_{l}$ should satisfy Equation ([9](#FD9-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} {\varepsilon_{r}\varepsilon_{l}^{T} = \left\{ \begin{array}{l} {0,r \neq l,} \\ {1,r = l.} \\ \end{array} \right.} \\ \end{array}$$ From the above, when *r* is not equal to *l*, $r \neq l$, the greatest contribution of abnormal variables is $C_{fr}$ $$\begin{array}{r} {C_{fr} = kf_{r}^{2} > C_{fl} \approx 0.} \\ \end{array}$$ The following conclusion can be drawn according to the above analysis: The k-NN distance contribution analysis method can ensure that an abnormal variable has the greatest contribution value when only a single variable is abnormal. 3.2. The Feasibility Analysis of Multiple Abnormal Variables {#sec3dot2-sensors-19-00929} ------------------------------------------------------------ Assume that $x_{f}$ is a faulty sample and that several variables deviate from the normal operating range: variable *a*, variable *b*, and variable *c*. $x_{f}$ can be broken down into the following forms:$$\begin{array}{r} {x_{f} = x^{*} + \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c},} \\ \end{array}$$ where $x^{*}$ is the normal component of $x_{f}$, $\varepsilon_{a}f_{a}$, $\varepsilon_{b}f_{b}$, and $\varepsilon_{c}f_{c}$ are the faulty components. $\varepsilon$ and *f* are the directions and amplitudes of the fault. According to Equations (4) and (11), the contribution value of each variable can be obtained as Equation ([12](#FD12-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} = \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack x_{f} - N_{j}\left( x_{f} \right) \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = \sum\limits_{j = 1}^{k}\left\{ {x^{*} + \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c} - N_{j}\left( x_{f} \right)\rbrack\varepsilon_{l}^{T}} \right\}^{2}.} \\ \end{array} \\ \end{array}$$ The following relations exist: $x^{*} - N_{j}\left( x_{f} \right) \approx 0$. The contribution value of each variable can be transformed into Equation ([13](#FD13-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \begin{array}{r} {C_{fl} \approx \sum\limits_{j = 1}^{k}\left\{ {\left\lbrack \varepsilon_{a}f_{a} + \varepsilon_{b}f_{b} + \varepsilon_{c}f_{c} \right\rbrack\varepsilon_{l}^{T}} \right\}^{2} = k\left( \varepsilon_{a}f_{a}\varepsilon_{l}^{T} + \varepsilon_{b}f_{b}\varepsilon_{l}^{T} + \varepsilon_{c}f_{c}\varepsilon_{l}^{T} \right)^{2}.} \\ \end{array} \\ \end{array}$$ Similar to a single abnormal variable, when $a,b,c \neq l$, $C_{fa}$, $C_{fb}$ and $C_{fc}$ can be represented as Equation ([14](#FD14-sensors-19-00929){ref-type="disp-formula"}):$$\begin{array}{r} \left\{ \begin{array}{l} {C_{fa} = kf_{a}^{2} > C_{fl} \approx 0,} \\ {C_{fb} = kf_{b}^{2} > C_{fl} \approx 0,} \\ {C_{fc} = kf_{c}^{2} > C_{fl} \approx 0.} \\ \end{array} \right. \\ \end{array}$$ The following conclusion can be drawn according to the above analysis: The k-NN distance contribution analysis method can ensure abnormal variables have the greater contribution value when there are several abnormal variables. 4. Data Reconstruction and Faulty Variable Identification Strategy {#sec4-sensors-19-00929} ================================================================== In order to solve the multi-sensor fault problem, the k-NN and proposed CNN data reconstruction strategy are described in detail below, and the comparison and analysis of two methods are given in [Section 4.3](#sec4dot3-sensors-19-00929){ref-type="sec"}. 4.1. The k-NN Data Reconstruction Method {#sec4dot1-sensors-19-00929} ---------------------------------------- In this subsection, the data reconstruction method based on k-NN is given \[[@B35-sensors-19-00929]\]. When there is a fault in a new sample, we can use the data reconstruction method as follows. Step 1: Standardize the new sample using the mean and variance of the training data. The result is $x_{new}$, and $x_{new} = \left\lbrack v_{1},v_{2},\ldots,v_{m} \right\rbrack$, $v_{i}$ is the label of the variable. Step 2: Reconstruct each variable $v_{1},v_{2},\ldots,v_{m}$ according to Equation ([15](#FD15-sensors-19-00929){ref-type="disp-formula"}) and [Figure 2](#sensors-19-00929-f002){ref-type="fig"}, where $n_{i}\left( x_{new}^{{}^{\prime}} \right)$ is the *i*th nearest neighbor of $x_{new}^{{}^{\prime}}$ in training sample $x_{n \times (m - 1)}^{{}^{\prime}}$, and $\left\lbrack x_{n_{i}{(x_{new}^{{}^{\prime}})}} \right\rbrack_{t}$ is the *t*th variable of $x_{new}^{{}^{\prime}}$. The parameter *k* is a constant value of experience. $$v
[ 582, 346, 2877, 3, 1057, 417, 2486, 346, 84, 38120, 390, 24682, 273, 247, 6735, 326, 20944, 1078, 253, 37877, 273, 247, 1083, 964, 964, 17212, 1903, 530, 15, 52, 15, 36, 15, 3015, 45910, 9, 67, 481, 3308, 13, 275, 8925, 1880, 253, 13289, 76, 29068, 14297, 3249, 1561, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 13, 359, 16670, 253, 1318, 273, 611, 27901, 434, 7830, 273, 36055, 264, 22736, 434, 7942, 2685, 875, 253, 10636, 285, 11196, 273, 253, 10713, 7289, 285, 253, 370, 16899, 13, 933, 275, 16959, 10762, 326, 611, 27901, 8025, 15, 2594, 14272, 362, 15, 31641, 4597, 1075, 40061, 13, 3690, 15, 313, 688, 294, 8741, 266, 3136, 17826, 708, 15454, 15390, 13, 3690, 11507, 10508, 378, 15, 51, 15, 17558, 13, 22146, 313, 38850, 15, 411, 15, 37, 15, 31775, 15, 14619, 10, 313, 49844, 272, 4154, 326, 9376, 273, 3765, 2930, 37729, 5373, 253, 8304, 984, 352, 24696, 16243, 432, 2442, 3916, 323, 13770, 273, 1110, 47194, 481, 2594, 671, 330, 1730, 770, 362, 15, 3973, 2448, 2418, 6022, 313, 688, 294, 10188, 45323, 36305, 1771, 2434, 11507, 16493, 378, 15, 51, 15, 854, 2405, 13, 854, 1671, 313, 38850, 15, 47, 15, 37, 15, 46917, 7901, 10, 5550, 12612, 45910, 9, 67, 10, 310, 6034, 281, 4017, 31915, 6473, 23261, 323, 1318, 281, 9659, 4821, 4254, 273, 253, 2136, 1309, 253, 2634, 27142, 8, 2180, 15, 733, 310, 417, 6034, 281, 4017, 1501, 14, 2823, 566, 420, 7830, 273, 638, 14, 30351, 6735, 23715, 24704, 273, 4458, 8, 77, 21123, 2203, 9537, 904, 1249, 378, 15, 51, 15, 854, 2787, 13, 854, 3507, 313, 38850, 15, 37, 15, 47, 1173, 15, 18263, 10, 313, 12080, 942, 275, 13212, 273, 10800, 3765, 2930, 2136, 26131, 403, 3693, 494, 762, 3015, 45910, 9, 67, 5029, 844, 671, 16670, 253, 1318, 273, 253, 32510, 273, 36055, 264, 22736, 434, 3438, 6171, 665, 588, 320, 14667, 407, 611, 27901, 15, 2594, 9516, 362, 15, 418, 7640, 3354, 313, 688, 294, 3096, 36857, 19242, 4458, 8, 77, 13, 3690, 11507, 11456, 401, 15, 20, 69, 721, 2385, 13, 721, 3712, 313, 26, 394, 4082, 15, 12487, 10, 5550, 65, 3, 3902, 3, 762, 3015, 45910, 9, 67, 10, 4419, 4737, 273, 3238, 2684, 417, 3238, 12316, 13, 1309, 253, 35393, 8037, 2180, 18574, 544, 36214, 3236, 3291, 313, 17056, 3044, 4779, 316, 13, 19498, 13, 24770, 15354, 708, 38397, 13, 367, 15, 34, 15, 362, 15, 25958, 296, 313, 688, 294, 36126, 14, 36, 4914, 582, 8688, 378, 15, 51, 15, 11343, 13, 12387, 313, 38850, 15, 52, 15, 37, 15, 28811, 15, 11161, 5029, 187, 688, 8925, 1880, 611, 27901, 3534, 1318, 762, 253, 13289, 76, 29068, 14297, 13, 359, 1364, 475, 18467, 3653, 1880, 253, 370, 25085, 13, 933, 7942, 310, 50196, 281, 253, 1318, 273, 253, 10434, 352, 2959, 15, 2594, 496, 294, 36126, 14, 36, 4914, 13, 8688, 378, 15, 51, 15, 387, 12472, 5550, 510, 4755, 14112, 4096, 273, 3015, 45910, 9, 67, 10, 310, 281, 1918, 6152, 281, 247, 811, 453, 658, 281, 253, 6070, 326, 253, 35728, 8304, 556, 2959, 6425, 1318, 323, 253, 3700, 13, 285, 13, 3103, 13, 556, 417, 644, 33661, 23715, 16349, 29559, 13, 3690, 15, 362, 15, 2604, 438, 1624, 14, 35, 2679, 33393, 13, 3690, 904, 11513, 18972, 7584, 29160, 313, 52, 15, 37, 15, 47, 15, 58, 2698, 313, 9705, 76, 3700, 323, 4344, 6425, 1318, 369, 4209, 281, 13313, 25447, 12709, 593, 1750, 481, 496, 8524, 44721, 362, 15, 48022, 48327, 13, 3690, 15, 313, 688, 294, 24126, 1758, 4458, 8, 77, 13, 3690, 11507, 3495, 378, 15, 51, 15, 898, 2090, 13, 898, 2787, 313, 38850, 15, 52, 15, 37, 15, 47, 15, 58, 15, 17103, 582, 253, 1302, 574, 281, 3653, 1880, 247, 10713, 3700, 273, 346, 1439, 14, 15627, 14, 47120, 3, 49759, 369, 323, 12054, 6425, 1318, 323, 6378, 273, 4560, 247, 25447, 3700, 762, 3015, 45297, 285, 1457, 2816, 22736, 285, 35365, 2081, 5405, 3015, 31282, 15, 380, 1302, 1119, 253, 7289, 369, 323, 12054, 6425, 1318, 835, 16243, 574, 4211, 253, 49759, 275, 187, 66, 4951, 6174, 14, 3985, 1327, 14, 14641, 15240, 7289, 323, 8180, 3413, 407, 752, 247, 2810, 14, 483, 19616, 369, 7378, 281, 2075, 323, 253, 16243, 434, 1386, 273, 49759, 846, 28008, 6031, 407, 253, 16243, 281, 35125, 273, 253, 417, 14, 15627, 14, 47120, 49759, 407, 10156, 731, 281, 643, 2442, 4147, 39053, 273, 48903, 28499, 15, 187, 2618, 15, 387, 898, 1976, 15, 2594, 671, 28230, 362, 15, 17287, 16409, 386, 29906, 15, 313, 688, 294, 2884, 4611, 582, 20105, 401, 15, 19, 69, 721, 2082, 13, 46753, 313, 19, 69, 4082, 15, 40853, 10, 313, 13550, 778, 1908, 643, 42863, 13, 4242, 16685, 323, 253, 10434, 13, 326, 253, 10434, 497, 2834, 281, 35125, 273, 285, 5989, 273, 253, 16243, 387, 253, 673, 273, 253, 7289, 13, 275, 1635, 281, 4588, 4376, 5087, 275, 18000, 604, 4344, 8180, 556, 644, 1677, 762, 3015, 45297, 558, 9002, 362, 15, 11328, 313, 688, 294, 29797, 12244, 11263, 13, 3690, 11507, 3435, 378, 15, 51, 15, 854, 1706, 13, 854, 3079, 313, 38850, 15, 38, 15, 37, 15, 30461, 15, 11299, 10, 313, 28983, 326, 16243, 4211, 5553, 4660, 323, 12054, 6425, 1318, 835, 352, 369, 7591, 281, 1089, 247, 22894, 387, 247, 2169, 4376, 13, 2136, 369, 16528, 839, 13, 285, 627, 369, 642, 1941, 326, 253, 7289, 369, 820, 254, 758, 481, 187, 27555, 29572, 5605, 247, 8857, 818, 23052, 281, 1071, 1880, 253, 370, 25085, 13, 933, 7942, 5087, 407, 611, 27901, 281, 36055, 264, 22736, 310, 4209, 1318, 281, 3324, 253, 13289, 76, 29068, 14297, 1561, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 15, 1707, 403, 642, 10434, 323, 247, 8857, 818, 23052, 281, 25596, 643, 685, 326, 4081, 15561, 285, 359, 1089, 326, 352, 556, 42326, 15785, 13, 387, 1682, 15, 380, 30501, 1941, 2722, 326, 275, 1577, 981, 253, 10713, 7289, 13, 36055, 264, 22736, 858, 417, 11377, 275, 1881, 10620, 285, 326, 253, 7289, 310, 271, 6174, 14, 3985, 9996, 15, 7717, 29572, 946, 17815, 326, 36055, 264, 22736, 45066, 253, 36698, 323, 697, 10434, 407, 18505, 697, 3302, 4376, 387, 370, 19, 15, 22, 3041, 15, 1723, 13, 23549, 70, 434, 440, 40893, 264, 6206, 2722, 326, 36055, 264, 22736, 574, 247, 5272, 3720, 323, 2509, 594, 13, 285, 326, 36055, 264, 22736, 18171, 39809, 697, 10434, 10376, 281, 247, 9257, 18872, 2086, 326, 369, 689, 16564, 407, 3345, 5067, 285, 5118, 281, 22950, 253, 1091, 327, 36055, 264, 22736, 434, 10434, 15, 7717, 29572, 519, 23747, 642, 1941, 281, 1329, 697, 17077, 326, 253, 36055, 264, 22736, 434, 10434, 403, 4409, 625, 685, 253, 370, 23922, 13, 933, 7942, 5087, 407, 611, 27901, 285, 253, 4737, 2722, 5010, 15, 380, 7942, 7830, 310, 370, 16150, 13, 933, 625, 685, 308, 5851, 52, 434, 3959, 281, 7471, 512, 273, 36055, 264, 22736, 434, 19543, 285, 310, 370, 7749, 13, 933, 1805, 685, 308, 5851, 52, 434, 1682, 3959, 15, 733, 310, 327, 253, 1029, 1930, 273, 253, 2491, 273, 2193, 6221, 275, 253, 12000, 8292, 41013, 15, 844, 3877, 326, 1097, 253, 308, 5851, 52, 3959, 285, 253, 41013, 16670, 36055, 264, 22736, 434, 8553, 1645, 26430, 15, 12414, 519, 563, 2844, 667, 1941, 13, 7717, 29572, 12148, 326, 359, 943, 5467, 326, 597, 403, 2233, 6, 4822, 917, 15, 22736, 31647, 326, 697, 1645, 400, 2272, 943, 320, 594, 21392, 15, 844, 23071, 13630, 1645, 400, 2272, 275, 9534, 751, 436, 835, 253, 2075, 1796, 588, 24174, 697, 5871, 15, 496, 1708, 273, 253, 5989, 273, 436, 1083, 13, 359, 1089, 352, 11543, 326, 247, 23052, 812, 7568, 326, 253, 13289, 76, 29068, 14297, 11521, 3345, 3015, 45910, 9, 67, 18619, 84, 4999, 22754, 15, 380, 7289, 16947, 13, 2036, 273, 253, 14049, 1750, 13, 403, 253, 760, 8064, 2130, 281, 23514, 247, 8857, 818, 23052, 15, 3308, 13, 352, 310, 30236, 275, 253, 1682, 6284, 273, 25141, 281, 5597, 436, 1083, 15, 187, 21342, 13, 7717, 29572, 310, 417, 1293, 247, 16748, 15, 733, 476, 5691, 253, 47273, 273, 253, 10713, 7289, 275, 1375, 1302, 10376, 281, 1457, 2816, 434, 22736, 285, 35365, 2081, 5405, 15, 2594, 13, 299, 15, 72, 904, 4146, 24078, 24148, 23106, 23780, 459, 362, 15, 399, 262, 695, 12551, 982, 13, 3690, 904, 854, 3655, 401, 15, 4727, 15, 818, 2082, 13, 818, 3547, 313, 38, 15, 37, 15, 47, 15, 58, 15, 8878, 10, 313, 36595, 5575, 2847, 273, 2250, 281, 873, 9255, 10713, 7289, 762, 427, 15, 58, 15, 6202, 11584, 708, 6246, 1703, 15, 20485, 25255, 13, 32193, 13, 32193, 14, 66, 558, 418, 8045, 5590, 362, 15, 2101, 408, 1342, 13, 27812, 401, 15, 4727, 15, 25589, 13, 25597, 313, 38, 15, 37, 15, 47, 15, 58, 15, 29639, 10, 313, 16514, 326, 10713, 3700, 369, 247, 25447, 12709, 593, 762, 427, 15, 58, 15, 6202, 11584, 708, 6246, 1703, 15, 3015, 32193, 285, 1364, 320, 873, 9255, 582, 2438, 1871, 13, 33933, 401, 15, 19, 69, 27318, 313, 19, 69, 4082, 15, 28355, 481, 733, 556, 24904, 673, 281, 513, 594, 15, 2594, 427, 15, 58, 15, 54, 15, 36, 15, 36, 15, 3015, 721, 14, 10768, 313, 8766, 1137, 273, 7364, 310, 475, 15429, 2800, 2607, 846, 253, 3522, 327, 534, 253, 811, 453, 658, 2335, 10023, 273, 253, 10229, 481, 187, 1992, 26799, 13, 359, 1089, 326, 436, 1083, 943, 320, 11511, 10376, 281, 3015, 26402, 9, 66, 10, 273, 253, 23560, 6307, 984, 313, 74, 10, 352, 369, 24488, 407, 247, 1643, 42545, 10179, 4991, 25141, 13, 313, 2886, 10, 352, 310, 15279, 285, 11581, 800, 984, 253, 13289, 76, 29068, 14297, 2538, 271, 562, 273, 1302, 11461, 4795, 275, 271, 23720, 3268, 281, 25141, 13, 313, 12211, 10, 16852, 310, 275, 253, 1682, 1600, 273, 25141, 984, 253, 10713, 7289, 310, 247, 1679, 8214, 562, 14, 1171, 14, 13550, 11461, 534, 1682, 11029, 512, 6284, 275, 436, 1083, 285, 313, 400, 10, 253, 14286, 273, 247, 23052, 588, 4917, 642, 5649, 281, 25141, 15, 187, 187, 18786, 187, 1231, 4098, 36055, 264, 22736, 434, 3200, 281, 5597, 436, 35393, 1083, 15, 187, 10452, 53, 1843, 19140, 4889, 39953, 40, 10634, 15, 187, 24963, 187, 60, 18, 62, 50276, 688, 4623, 629, 13, 3015, 29980, 9, 73, 2769, 18, 10, 3054, 27, 187, 187, 2042, 544, 266, 35393, 62, 5266, 310, 417, 14793, 8830, 13083, 13, 253, 1302, 3091, 1340, 6619, 1411, 253, 16243, 275, 271, 35393, 1083, 762, 253, 8857, 762, 534, 253, 5266, 369, 4724, 15, 17501, 13, 846, 2332, 13, 253, 1302, 3091, 1340, 6619, 1411, 253, 16243, 275, 271, 35393, 1083, 762, 253, 8857, 762, 534, 253, 5266, 369, 4724, 13, 760, 604, 14716, 187, 9, 18, 10, 253, 16243, 310, 3839, 417, 10054, 824, 16243, 434, 26131, 347, 824, 26131, 2489, 1955, 5734, 824, 26131, 403, 253, 2256, 273, 247, 47243, 45732, 12027, 60, 10943, 187, 883, 530, 15, 52, 15, 36, 15, 3015, 29980, 9, 73, 2769, 18, 481, 187, 60, 19, 62, 50276, 12612, 29980, 9, 71, 10, 285, 313, 72, 10, 1375, 27, 187, 187, 9, 71, 10, 3105, 22046, 2593, 36813, 273, 436, 4060, 13, 3707, 281, 253, 6070, 326, 253, 1302, 7367, 5010, 13, 285, 1919, 271, 1340, 323, 6619, 275, 253, 1083, 13, 667, 2136, 273, 253, 16243, 778, 4035, 281, 10196, 13, 285, 253, 16243, 778, 4035, 281, 897, 13, 16270, 13, 390, 35125, 273, 2867, 347, 604, 271, 35393, 1083, 8664, 253, 16243, 574, 417, 644, 24488, 15, 187, 9, 72, 10, 2058, 667, 673, 846, 253, 37877, 273, 271, 35393, 1083, 762, 8857, 818, 273, 436, 4060, 533, 1078, 271, 1340, 323, 6619, 275, 253, 1083, 13, 253, 1302, 13, 327, 2748, 273, 247, 3128, 275, 1600, 13, 846, 4366, 281, 253, 16243, 285, 247, 4854, 13, 285, 604, 3309, 281, 14003, 253, 2867, 273, 253, 8304, 390, 281, 3657, 2957, 281, 253, 8304, 13, 778, 1340, 253, 1986, 2077, 23052, 281, 6544, 271, 26964, 23052, 762, 2593, 45333, 273, 436, 4060, 281, 1379, 10023, 273, 253, 2867, 273, 253, 8304, 285, 281, 10196, 667, 2136, 273, 253, 16243, 15, 9613, 271, 1340, 323, 6619, 13, 253, 16243, 778, 35398 ]
), "value" does not include "satisfaction or securing of a debt that arose before the commencement of a case . . ." 11 U.S.C. § 549(b). Thus, in determining whether the Bulk Sale Agreement comes within § 549(b)'s safe harbor, we exclude the value of KVL's payment of Alleged Debtor's cash flow between the execution and closing of the bulk sale and the $210,000 in lease payments that KVL assumed. See Allen v. Rib Detention Equipment, Inc. (In re Roanoke Iron & Bridge Works, Inc.), 98 B.R. 256, 260 (Bankr. W.D.Va.1988) (rejecting argument that assumption of prepetition liabilities benefits the estate because it protects debtor from potential claims for breach of those leases). See also Cossitt v. First American State Bank (In re Fort Dodge Creamery Co.), 121 B.R. 831, 835 (Bankr.N.D.Iowa 1990) ("Section 549(b) is intended to protect contemporaneous exchanges for value to permit continued operation of the business during the `gap' period. It is not intended to protect post-commencement payment of pre-petition debt."); Matter of Int'l Teldata Corp., 12 B.R. 879, 882 (Bankr.D.Nev.1981) (payments in satisfaction of ongoing prepetition business debts are avoidable under § 549(b)). We also exclude the value of the salaries of Alleged Debtor's former employees who will be retained by KVL. See Hamilton v. Lumsden (In re Geothermal Resources Int'l, Inc.), 93 F.3d 648, 651 (9th Cir.1996) ("`"Value" under § 549(b) requires proof of services performed not services promised, during the involuntary gap period.'" [Emphasis original]) (quoting McManus, Stewart, Ferraro & Schwarz, P.A. v. Bakst (In re Sanchez-Casis), 99 B.R. 115, 117 (Bankr.S.D.Fla. 1989)). In determining whether KVL gave value under the Bulk Sale Agreement, we must *164 determine whether the $388,000 cash is disproportionate to the value of the assets it received. See In re Sanchez-Casis, 99 B.R. at 116 ("The obvious legislative purpose of § 549(b) is to give credit to a transferee to the extent that the bankrupt estate has received equivalent value for the transfer, and, therefore, has not been depleted."); Modern Settings, Inc. v. Prudential-Bache Securities, Inc., 1988 WL 49056 (S.D.N.Y.) (bulk transfer for fair equivalent value was sufficient to defeat fraudulent conveyance claim). In Murdock v. Plymouth Enterprises, Inc. (In re Curtina Int'l, Inc.), 23 B.R. 969, 979 (Bankr.S.D.N.Y.1982), the court had to determine whether a bulk transfer of "not-too-fresh" wafers was for reasonably equivalent value for purposes of finding a fraudulent transfer under § 548 and New York Debtor and Creditor Law § 273. The court found the sale was for reasonably equivalent value where debtor had sold the wafers in a straight arms-length non-collusive sale for consideration determined by what a close-out specialist was willing to pay for the debtor's line of wafers after unsuccessful efforts by the debtor to dispose of the not-too-fresh wafers by selling them to other potential purchasers of distressed merchandise. Id. at 975. See also Roth v. Fabrikant Bros. (In re Flato), 175 F.2d 665, 667 (2d Cir.1949) (court may consider other bids, failed negotiations for the assets, that the assets were difficult to dispose of and circumstances of the debtor at the time of the sale, in addition to actual price paid in deciding if fair consideration has been given under § 548); Wood v. Davis (In re Southeast Community Media, Inc.), 27 B.R. 834, 843 (Bankr.E.D.Tenn. 1983) (finding that debtor sold radio station for reasonably equivalent value where it was unable to find a buyer at a higher price, business was deteriorating, and there was no evidence that the sale was coerced). Times Circle wants a chapter 7 trustee to test whether the $388,000 cash paid by KVL to Alleged Debtor is sufficient value to bring the Bulk Sale Agreement within § 549(b)'s safe harbor. There are no assets for a chapter 7 trustee to administer other than that proposed litigation and we find that it has dubious merit, at best. The undisputed evidence shows that in structuring the bulk sale, Alleged Debtor did not engage in self dealing and that the sale is an arms-length transaction. Times Circle speculates that Alleged Debtor chilled the bidding for its assets by fixing its initial price at $2.5 million. However, Dowe's unchallenged testimony shows that Alleged Debtor had a reasonable basis for doing so, and that Alleged Debtor extensively marketed its assets pursuant to a carefully structured program that was overseen by outside counsel and calculated to maximize the return on Alleged Debtor's assets. Times Circle adduced no evidence to support its assertion that the Alleged Debtor's assets are worth more than the $338,000 cash paid by KVL and the proof shows otherwise. The cash payment is $143,000 more than TAVS's offer to purchase all of Alleged Debtor's inventory and is $110,000 better than TAVS's best offer. It is on the high side of the range of values contained in the Caspert appraisal. We note that both the TAVS offer and the appraisal exclude Alleged Debtor's accounts receivable. Without adducing any evidence, Times Circle contends that we should assume that they are 100% collectible. Debtor denies that its receivables should be so valued. We sharply discount receivables in situations like this where the payee will terminate its operations. In light of the circumstances of this case, we find it unlikely that a trustee could demonstrate that the Bulk Sale Agreement falls outside § 549(b)'s safe harbor. The sale proceeds, net of the secured claim, are the only funds available to compensate a chapter 7 trustee. Thus, it is plainly in the best interests of creditors to dismiss this case. Moreover, Times Circle is not without a remedy. It can challenge the propriety of the bulk sale in state court pursuant to New York's Debtor and Creditor Law. See, e.g., Sunrise Industrial Joint Venture v. Ditric Optics, Inc., 873 F.Supp. 765, 772 (E.D.N.Y. 1995) (plaintiff alleged cause of action to set aside bulk sale under N.Y. DEBT & CRED. §§ 275, 276, 276-a); Leventhal v. Spillman, 234 F.Supp. 207, 209 (E.D.N.Y.1964) (holding that bulk transfer was a fraudulent conveyance under N.Y. DEBT & CRED. § 276 and must be set aside), aff'd, 362 F.2d 264 (2d Cir.1966). It has ample time to do so. See N.Y.U.C.C. § 6-111 (statute of limitations is *165 six months after the date on which the transferee took possession of the goods). To summarize, we find that this case should be dismissed pursuant to § 305(a) of the Bankruptcy Code because (i) it was commenced by a few recalcitrant creditors, (ii) it is unnecessary and duplicative because the Bulk Sale Agreement effects an out of court arrangement resulting in an equitable distribution to creditors, (iii) dismissal is in the best interest of creditors because the bulk sale is a less expensive out-of-court arrangement which best serves all interests in this case and (iv) the appointment of a trustee will yield no benefit to creditors. Conclusion We grant Alleged Debtor's motion to dismiss this involuntary case. SETTLE ORDER AND JUDGMENT. NOTES [1] In relevant part, § 303(h)(1) states: If [an involuntary] petition is not timely controverted, the court shall order relief against the debtor in an involuntary case under the chapter under which the petition was filed. Otherwise, after trial, the court shall order relief against the debtor in an involuntary case under the chapter under which the petition was filed, only if — (1) the debtor is generally not paying such debtor's debts as such debts become due unless such debts are the subject of a bona fide dispute[.] 11 U.S.C. § 303(h)(1). [2] Section 303(f) and (g) state: (f) Notwithstanding section 363 of this title, except to the extent that the court orders otherwise, and until an order for relief in the case, any business of the debtor may continue to operate, and the debtor may continue to use, acquire, or dispose of property as if an involuntary case concerning the debtor had not been commenced. (g) At any time after the commencement of an involuntary case under chapter 7 of this title but before an order for relief in the case, the court, on request of a party in interest, after notice to the debtor and a hearing, and if necessary to preserve the property of the estate or to prevent loss to the estate, may order the United States trustee to appoint an interim trustee under section 701 of this title to take possession of the property of the estate and to operate any business of the debtor. Before an order for relief, the debtor may regain
[ 187, 187, 6407, 745, 352, 6131, 25470, 38661, 273, 2870, 6472, 11321, 285, 5579, 2722, 285, 368, 476, 3698, 731, 327, 247, 5235, 273, 4095, 27, 751, 634, 4382, 13, 41020, 31092, 13, 690, 40524, 14, 1402, 3773, 285, 1014, 5542, 352, 949, 634, 16791, 985, 313, 56, 2886, 13, 26252, 16951, 13, 10890, 20, 481, 1552, 4483, 1982, 6383, 2080, 3687, 2289, 281, 2600, 1580, 417, 512, 2600, 310, 2130, 323, 18361, 15, 1992, 6351, 2289, 281, 625, 8123, 13, 368, 878, 281, 320, 247, 22456, 38174, 7731, 15, 31840, 436, 807, 25456, 6331, 1142, 273, 441, 432, 24497, 1982, 25456, 275, 6144, 15, 187, 187, 23992, 2399, 6623, 895, 1040, 17702, 395, 5402, 25456, 11397, 2726, 8802, 187, 187, 51, 360, 454, 556, 352, 597, 403, 1335, 2444, 387, 12868, 562, 616, 9462, 6335, 1955, 281, 1907, 281, 1818, 253, 13716, 985, 908, 275, 616, 5368, 20623, 281, 4944, 776, 9836, 17503, 985, 15, 8695, 21881, 556, 9809, 479, 247, 2257, 273, 2583, 275, 247, 4564, 273, 4088, 285, 5520, 619, 8573, 2793, 15, 2347, 281, 7890, 25456, 5106, 275, 6144, 15, 440, 302, 9609, 15, 681, 534, 310, 10323, 253, 1072, 347, 634, 5393, 3694, 533, 342, 253, 4610, 323, 247, 1959, 14199, 323, 690, 8123, 15, 187, 187, 1394, 12238, 253, 3745, 281, 1859, 2600, 327, 2709, 4095, 13, 417, 760, 326, 13, 368, 476, 1265, 14657, 835, 368, 1669, 745, 327, 1529, 2813, 15, 8061, 281, 24999, 13, 309, 452, 644, 2104, 281, 40637, 619, 2579, 13204, 281, 5321, 1384, 7739, 25821, 651, 320, 14109, 13, 3340, 347, 352, 10384, 281, 5927, 48575, 3885, 15, 9867, 562, 512, 253, 1682, 12192, 285, 24866, 281, 897, 25456, 9825, 13, 667, 673, 15, 19462, 187, 6846, 187, 187, 1992, 1408, 436, 1650, 1408, 841, 13896, 275, 634, 8135, 27, 187, 187, 11202, 31333, 187, 2428, 187, 14769, 19327, 5987, 1358, 7280, 15, 681, 16, 18037, 25224, 16, 51, 461, 25224, 15, 14769, 187, 2428, 33932, 25224, 16, 187, 11379, 18037, 25224, 15, 4789, 27479, 32045, 16, 25521, 64, 3406, 69, 3866, 15, 6535, 187, 11202, 187, 187, 2974, 187, 315, 535, 187, 33, 4663, 15, 2974, 187, 11202, 2974, 187, 29, 2974, 31, 187, 29, 2522, 31, 187, 187, 29, 33, 2577, 64, 3406, 69, 3866, 15, 4305, 31, 187, 29, 33, 2577, 64, 18037, 25224, 64, 3866, 15, 4305, 31, 187, 187, 870, 2522, 31, 187, 29, 2915, 31, 187, 29, 8060, 35254, 568, 14606, 27, 5801, 64, 4064, 64, 3406, 69, 49384, 9738, 1405, 870, 8060, 31, 187, 187, 870, 2915, 31, 187, 870, 2974, 31, 187, 11202, 187, 187, 3406, 69, 3866, 187, 9998, 187, 1394, 878, 281, 3334, 17314, 10120, 9026, 323, 436, 281, 789, 15, 187, 2413, 1358, 2700, 15, 3406, 69, 3866, 15, 681, 16, 187, 187, 5089, 6789, 33932, 25224, 15786, 20235, 432, 17314, 10120, 9026, 15, 187, 187, 33, 2577, 64, 3406, 69, 3866, 15, 4305, 187, 11202, 3406, 69, 3866, 187, 187, 817, 3877, 50058, 310, 7154, 275, 1218, 4789, 69, 3866, 187, 4, 172, 240, 228, 244, 172, 240, 228, 116, 172, 240, 228, 116, 172, 240, 229, 214, 172, 240, 229, 213, 172, 240, 229, 230, 426, 686, 4037, 24218, 2573, 64, 10249, 8, 187, 187, 1545, 14260, 64, 4064, 64, 3406, 69, 14850, 187, 186, 13686, 15, 26544, 2073, 26512, 1218, 4789, 69, 3866, 2, 3401, 187, 186, 66, 426, 544, 18, 13, 19, 13, 20, 62, 187, 186, 5801, 64, 4064, 64, 18037, 25224, 9, 66, 10, 187, 187, 11202, 535, 187, 18037, 25224, 25109, 31446, 187, 27800, 187, 187, 33, 2577, 64, 18037, 25224, 64, 3866, 15, 4305, 187, 11202, 18037, 25224, 187, 4, 43890, 27, 14606, 187, 4064, 20243, 1395, 475, 187, 187, 1545, 14260, 64, 4064, 64, 18037, 25224, 9, 87, 2262, 187, 186, 8271, 13866, 2073, 172, 240, 228, 244, 172, 240, 228, 116, 172, 240, 228, 116, 172, 240, 229, 214, 172, 240, 229, 213, 172, 240, 229, 230, 3401, 2295, 686, 4037, 24218, 2573, 64, 10249, 8, 187, 186, 8271, 8472, 9, 87, 10, 2295, 495, 187, 186, 8271, 362, 60, 17, 62, 2295, 337, 187, 186, 1542, 1269, 275, 362, 27, 996, 186, 3845, 9, 89, 10, 187, 187, 11202, 187, 3594, 34235, 13, 32042, 708, 30540, 187, 187, 3594, 34235, 13, 32042, 708, 30540, 13, 4441, 275, 7634, 25185, 13, 32815, 13, 3400, 25859, 281, 4292, 13, 2151, 285, 5870, 15, 3824, 25859, 3238, 2953, 247, 5235, 273, 3374, 13, 1690, 27, 27675, 285, 10397, 21190, 272, 1329, 6852, 48040, 285, 9712, 443, 3624, 25859, 285, 12700, 4323, 7733, 285, 5249, 3374, 38224, 4323, 285, 7344, 6064, 5733, 882, 422, 3879, 32772, 6803, 285, 1971, 323, 2151, 41125, 7747, 4325, 7875, 285, 2021, 4369, 7805, 29561, 13, 1132, 4918, 285, 1361, 342, 9123, 9360, 281, 1345, 8288, 13, 32772, 5175, 13, 17040, 285, 11948, 285, 6782, 14977, 13, 776, 5702, 285, 7407, 4750, 310, 13496, 281, 10073, 368, 275, 40845, 667, 26982, 275, 634, 1495, 285, 7688, 15, 1997, 34235, 13, 32042, 708, 30540, 310, 29320, 342, 954, 6503, 4413, 285, 444, 2088, 84, 15, 844, 403, 671, 9979, 281, 2997, 954, 2201, 6152, 8364, 15, 9368, 1997, 34235, 13, 32042, 708, 30540, 3063, 281, 10130, 285, 14286, 15, 30466, 39607, 329, 15, 6365, 37518, 285, 37899, 496, 253, 1390, 9976, 13, 2561, 327, 15174, 1119, 326, 43318, 897, 369, 2330, 342, 247, 5141, 275, 9699, 10343, 285, 247, 3356, 5788, 2190, 6562, 11665, 2429, 281, 1110, 4127, 342, 643, 7946, 5570, 15, 380, 530, 15, 52, 11431, 285, 16686, 13500, 313, 39, 4877, 10, 4102, 7012, 253, 806, 1966, 1263, 281, 923, 604, 271, 3270, 14, 5168, 38210, 12358, 13, 6365, 37518, 13, 476, 4017, 17435, 1363, 432, 253, 2709, 6578, 432, 15174, 15, 844, 3636, 670, 7469, 13, 933, 22538, 35029, 665, 497, 11245, 342, 1511, 374, 8401, 1501, 1249, 16, 2405, 16, 8603, 285, 3560, 731, 1919, 2471, 13, 12797, 281, 1729, 15281, 5827, 13, 557, 257, 1811, 420, 432, 22538, 390, 1249, 16, 2405, 16, 6961, 39347, 3249, 806, 15, 6408, 436, 956, 14, 484, 13, 359, 671, 5728, 1363, 18522, 14, 9468, 5576, 1491, 347, 973, 347, 253, 897, 273, 17632, 5835, 15, 3327, 3459, 16940, 2486, 417, 760, 854, 7744, 15588, 1331, 13535, 357, 11665, 313, 3899, 37518, 13, 9442, 13, 10997, 38258, 459, 284, 13, 289, 13306, 9528, 967, 6035, 13, 9653, 49, 14, 18, 41222, 13, 43895, 14, 21, 11531, 13, 322, 5990, 53, 14, 19, 11531, 13, 285, 643, 8383, 23345, 5835, 582, 533, 671, 608, 3270, 41537, 3134, 16940, 313, 5168, 459, 49631, 13, 9840, 14, 6172, 398, 13, 11672, 14, 13695, 48846, 13, 29376, 11531, 13, 285, 6647, 13858, 10, 285, 337, 11764, 14, 676, 2158, 2854, 313, 296, 5009, 481, 3267, 19891, 323, 643, 12358, 897, 285, 1363, 5319, 275, 673, 14, 39381, 272, 5133, 13, 43318, 369, 417, 7052, 2330, 342, 253, 3356, 5788, 313, 9914, 30, 17, 15, 2222, 10, 285, 253, 5864, 369, 417, 10126, 1534, 15, 13771, 13, 29036, 281, 253, 642, 897, 273, 1016, 1263, 12358, 13, 7891, 2495, 13072, 342, 897, 273, 495, 8401, 5835, 313, 52, 5990, 53, 14, 19, 11531, 13, 9653, 49, 14, 18, 41222, 285, 43895, 14, 21, 49512, 5109, 10, 495, 2614, 3473, 16940, 313, 5168, 459, 49631, 13, 6647, 13858, 13, 285, 29376, 42, 11531, 10, 285, 1098, 968, 15, 659, 5009, 12322, 954, 5185, 13, 5141, 275, 512, 14, 18923, 7891, 2495, 533, 1384, 6, 273, 1263, 1363, 1620, 2335, 247, 1098, 249, 13, 7738, 9829, 12212, 9091, 15, 831, 1263, 369, 4390, 762, 2278, 15, 378, 15, 1294, 1299, 49011, 49512, 5109, 313, 4785, 2513, 10, 285, 7891, 1294, 1299, 8670, 11531, 313, 4785, 2513, 10, 452, 644, 2330, 342, 5459, 275, 253, 9364, 273, 18277, 13, 330, 7659, 587, 5066, 285, 39292, 16, 71, 974, 980, 13, 14051, 6722, 10919, 4433, 285, 10177, 3394, 15, 1594, 466, 1162, 355, 2361, 326, 20250, 2513, 812, 671, 2572, 253, 2495, 273, 2471, 970, 30109, 17528, 313, 16568, 10, 941, 313, 9914, 273, 337, 15, 1010, 337, 15, 1099, 481, 4325, 5215, 14, 6961, 22538, 41371, 329, 13, 378, 285, 399, 941, 13, 359, 3636, 337, 15, 19, 3041, 22538, 35029, 15, 844, 671, 2931, 247, 873, 273, 33520, 27, 897, 273, 20250, 2513, 13, 897, 273, 388, 19, 48846, 347, 247, 1453, 2854, 13, 11341, 281, 17193, 1557, 5085, 390, 40083, 13240, 13, 18522, 14, 9468, 24959, 13, 3361, 273, 9135, 6722, 2515, 285, 4127, 731, 347, 673, 14, 6820, 33520, 275, 776, 2022, 1783, 273, 19043, 8394, 16466, 9077, 15, 496, 1635, 281, 12767, 33520, 275, 673, 14, 39381, 272, 5133, 13, 359, 908, 253, 4473, 273, 16653, 14, 2606, 281, 4853, 2854, 5445, 2180, 275, 1340, 281, 1453, 323, 3861, 27406, 8492, 534, 6634, 672, 253, 6454, 273, 1600, 310, 2330, 342, 271, 5445, 326, 2686, 1543, 432, 2393, 7871, 285, 5917, 273, 253, 6454, 762, 1263, 15, 831, 1263, 310, 1469, 281, 320, 271, 1650, 273, 13546, 271, 7899, 6642, 273, 253, 5864, 875, 2854, 5445, 285, 1786, 3708, 15, 330, 15, 21106, 12892, 16573, 311, 2487, 285, 33618, 23950, 21106, 12892, 16573, 311, 2487, 313, 39, 50, 10, 403, 2190, 253, 954, 7561, 15588, 18042, 275, 253, 29964, 4758, 15, 12090, 2175, 452, 2361, 253, 21541, 12485, 875, 253, 897, 273, 401, 50, 84, 285, 33618, 10552, 15, 380, 530, 15, 52, 21172, 6808, 2806, 3817, 9734, 13301, 281, 401, 50, 84, 1580, 4695, 15, 12090, 21899, 2175, 15629, 253, 897, 273, 401, 50, 342, 271, 2559, 2495, 323, 33618, 31430, 13, 22678, 38813, 390, 15062, 960, 313, 2446, 16, 2350, 481, 380, 958, 326, 15546, 1511, 309, 285, 6490, 13154, 2085, 38383, 4757, 281, 1097, 5257, 790, 285, 22678, 8099, 13, 285, 326, 401, 50, 84, 476, 13201, 841, 13154, 275, 690, 5989, 13, 2849, 1419, 7350, 670, 841, 2361, 12485, 15, 3808, 2720, 2175, 2529, 253, 2954, 875, 401, 50, 84, 285, 33618, 31430, 347, 247, 966, 1055, 285, 2908, 717, 1004, 24664, 347, 247, 1453, 2854, 281, 3653, 1880, 841, 10552, 403, 2173, 281, 401, 50, 84, 15, 844, 11794, 2908, 495, 401, 50, 84, 313, 26919, 287, 1258, 38060, 13, 20978, 41365, 38060, 13, 278, 1004, 338, 77, 38060, 10, 285, 577, 1327, 14, 39, 50, 18042, 313, 312, 1004, 24664, 13, 717, 1004, 24664, 14, 498, 580, 335, 266, 366, 13, 11775, 334, 37030, 390, 48814, 911, 249, 582, 608, 273, 534, 497, 1755, 608, 18820, 6083, 275, 1982, 15, 6915, 25913, 14, 46708, 11771, 2495, 9077, 6260, 12767, 2471, 347, 247, 11771, 2495, 13, 359, 7515, 253, 3907, 2495, 273, 33618, 31430, 323, 1016, 18820, 897, 275, 247, 337, 15, 19, 3041, 22538, 3072, 15, 28430, 9299, 13, 359, 7515, 253, 2495, 407, 11935, 5445, 1561, 1263, 18042, 313, 24767, 1884, 1897, 13, 4562, 14, 1549, 1897, 13, 625, 685, 3925, 1897, 10, 281, 16371, 1327, 14, 19623, 451, 3731, 42070, 326, 476, 2826, 342, 1512, 2969, 313, 9820, 16, 2369, 10, 2854, 5445, 15, 380, 7714, 588, 320, 9262, 3517, 15, 399, 15, 7115, 875, 388, 526, 531, 5407, 4918, 285, 418, 25709, 27789, 13, 1219, 91, 17563, 398, 2728, 390, 2905, 21763, 13, 13440, 6578, 13, 285, 15110, 388, 526, 531, 5407, 4918, 313, 41, 4708, 10, 310, 271, 3576, 1971, 323, 253, 6867, 1821, 46763, 14, 4919, 5917, 313, 10328, 347, 3511, 41483, 13, 2360, 4365, 1832, 13, 17948, 9894, 285, 3966, 2698, 285, 1048, 14, 3945, 1786, 3237, 2330, 342, 253, 1821, 46763, 313, 783, 2495, 273, 39292, 13, 13440, 2728, 285, 9980, 481, 7850, 2538, 327, 2710, 6973, 824, 347, 1219, 91, 17563, 398, 6578, 390, 2905, 21763, 13, 13440, 6578, 13, 15110, 285, 512, 14, 18923, 7891, 310, 12744, 15, 10813, 2492, 273, 388, 4708, 275, 2255, 689, 3925, 310, 3839, 417, 8521, 533, 310, 1119, 281, 320, 8718, 323, 690, 2255, 846, 2363, 7251, 15, 496, 436, 1263, 13, 359, 26098, 670, 18450, 13, 933, 5343, 22538, 35029, 432, 22538, 3512, 399, 5857, 281, 253, 11653, 273, 1016, 6454, 13, 2471, 13, 12797, 281, 1729, 15281, 2098, 13, 557, 257, 1811, 420, 432, 22538, 13, 390, 1249, 16, 2405, 16, 6961, 39347, 3249, 806, 285, 840, 359, 2429, 1016, 2495, 2190, 2255, 4127, 342, 388, 4708, 281, 1110, 417, 4127, 15, 40788, 275 ]
First off it offers unlimited downloads of steaming movies and TV shows and you can watch them on a variety of devices: like your computer, iPod Touch, some Blu-ray players and even stream it through your gaming system (Wii, Xbox 360, PS3).This allows US customers far greater access to content since not all content is available for streaming.To gain access to more channels, you need to be a Rogers Cable customer.Earlier this year Netflix stopped many of us from accessing US Netflix in Canada. TurboFlix | Expand Your Netflix Library With Us Rumour has it they are still working at filling out their Canadian library due to having to change the rating system used in their existing catalog to fit our domestic ratings system.Netflix has saved me a lot of money in a couple of ways and improved my internet experience.How to Use Netflix USA in Canada. unotelly.com which is basically the same as your mentioned software but with the options for a free membership for some channels. You Have the ability to view content on multiple devices, not only that, you can start viewing where you left off on another device.Thanks to Shaw, I have been able to tailor my service bundle to save 20%.Comments would be appreciated, especially as it applies to minimum ISP speed.Find out all the best tips and tricks to use Netflix anywhere, any time.testing ------- To run this example run these commands in your shell: ```bash cd git clone https://github.com/rusthon/Rusthon.git cd Rusthon/ ./rusthon.py ./examples/hello_rapydscript.md ``` html ---- @index.html ```html <html> <head> <@my_rapydscript.js> <@my_rusthon_script.js> </head> <body> <button onclick="javascript:hi_from_rapyd()">clickme</button> </body> </html> ``` rapydscript ----------- You need to install RapydScript for this to work. http://www.rapydscript.com/ Test calling Rusthon translated JS from RapydScript. @my_rapydscript.js ```rapydscript ## note unicode is broken in rapydscript #𝑭𝑶𝑶𝒃𝒂𝒓 = 'UNICODE_OK' def hi_from_rapyd(): window.alert('hey rapydscript!') a = [1,2,3] hi_from_rusthon(a) ``` rusthon javascript backend -------------------------- @my_rusthon_script.js ```rusthon #backend:javascript from runtime import * def hi_from_rusthon(v): assert inline('𝑭𝑶𝑶𝒃𝒂𝒓') == 'UNICODE_OK' assert len(v) == 3 assert v[0] == 1 for x in v: print(x) ``` Grinstead, Pierce & Associates Grinstead, Pierce & Associates, located in Burlington, IA, provides counseling to individuals, children and families. Our counseling services address a variety of issues, including: Depression and anxiety Parenting support Divorce and separation Grief counseling and anger management Work and career issues Stress management and conflict resolution Addictive behavior ADHD assessment and treatment for children thru adults From marriage and family psychotherapy workshops, play therapy and help with eating disorders to public speaking, ADHD testing, relaxation and childhood and adult trauma, our professional and experienced staff is equipped to assist you in overcoming any obstacle in your life and relationships. Grinstead, Pierce & Associates is contracted with most insurance companies and EAPs. We are also proud to accept most major credit cards. Call Grinstead, Pierce & Associates today to schedule and appointment.Clinical Projects A. Metformin and longevity In the last decade, research on aging found that metformin use was associated with a reduction in cognitive decline and a longer survival among diabetics compared to those treated with other oral agent. The U.S Food and Drug Administration (FDA) recently approved the first human study to see if an anti-diabetic medication, Metformin, can protect diabetic patients from the multiple diseases from aging. We identified about 300,000 Medicare beneficiaries who were diagnosed with type 2 diabetes post 12/31/2006 and followed them until death, switching to capitated plans, disenrollment from Medicare or 12/31/2016 whichever comes first. During this follow-up, we also collected patients socio-demographic information as well as the use of prescription drugs. Prescription medications include not only 8 commonly prescribed antidiabetics (metformin, insulin, sulfonylureas, thiazolidinedione, GLP-1 analogues, DPP-4 inhibitors, SGLT-2 inhibitors, and other glucose lowering drugs), but also 5 antihypertensive medications (diuretics, beta-blockers, calcium-channel blockers, ACE inhibitors, and ARBs) and 1 lipid-lowering drug (statin). Controlling for other medication use and patients characteristics in time-varying manner, metformin was not strongly associated with the longer survival (HR=0.95) and the association was not statistically significant. Rather, Compare to the no use of each study medication, mortality risk declined with use of 3 diabetes drugs (SGLT-2 inhibitors, GLP-1 analogues and DPP-4 Inhibitors) 3 blood pressure medications (diuretics, ARBs, and ACEI inhibitors) and statins. Statin exhibited most consistent, reduction in all-cause mortality risk but 20% of study patients never took a statin, suggesting missed prevention opportunities. This study was currently under review. B. Proton Pump Inhibitors (PPIs) and mortality Proton pump inhibitors (PPIs) have been associated with increases in the incidence of pneumonia, C Decile infection and osteoporosis/fractures, probable chronic renal failure and cardiac events. Xie et al reported that PPIs could also increase the risk of death using Veterans Affairs (VA) data (HR of 1.15 1.25). From 2007-2016 Medicare Parts A, B and D data, we identified 1.2 million Medicare beneficiaries. We also defined a set of covariates: use of PPIs, use of H2 blockers as a control drug, admission to intensive care units or inpatient hospitals, socio-demographics, presence of 58 chronic conditions and treated them as time-dependent covariates in our main analysis of Cox proportion hazard regression. In addition to treating covariates in time-varying manner, we used the concept of lag-time to define drug exposure period in order to control for protopathic bias which occurs when the outcome of interest is associated with an exposure that actually results from early signs and symptoms of the outcome under study. This study is going to be an example of obtaining an accurate estimate of the association between drug exposure and health status. C. Fluoroquinolones and tendon complication Fluoroquinolones (FQ) are among the most widely prescribed antibiotics in the outpatient setting. Several studies have reported the plausible associations between the use of FQs and tendon complications. The U.S FDA issued black box warning labels to FQs since 2008. Several observational studies associate the use of FQ with an increased risk for tendon rupture, aortic aneurysm or dissections (AA/AD). The fact that collagen type I and III fibers provide tensile strength to both tendons and aortic walls, and that FQs can disrupt these fibers in some circumstances, magnify concerns about these reported associations. Some prior studies described the relationship between FQs and tendon rupture as a class effect and included amoxicillin as a control drug to determine whether these complications are specific to FQs. We separately included 3 FQs (ciprofloxacin, levofloxacin, moxifloxacin) and 4 non-FQ antibiotics (amoxicillin, amoxicillin-clavulanate, azithromycin or cephalexin), 5 of which were top 5 antibiotic agents in US. Using Fine-Gray competing risk regression analyses treating death as a competing risk, we assessed the independent risk of tendon rupture for each antibiotic use in a 1.2 million Medicare population. Precisely, we assessed the risk by temporal exposure within study antibiotics (within 30 days, 31-60 days, more than 60 days) to avoided non-differential misclassification that can occur with too simple (yes/no) drug exposure. The manuscript will be submitted soon. D. Association between Hormone replacement therapy and Longevity, Alzheimers disease or related dementia, cardiovascular diseases, and cancers Hormone replacement therapy (HRT) is an effective treatment for the typical menopause-related symptoms (such as hot flashes, night sweats, irregular periods and etc.) and long-term health problems associated with the menopause (the risk of osteoporosis, cardiovascular disease and stroke). Its effects on various outcomes such as Alzheimers diseases or related dementia, cardiovascular diseases, cancers and all-cause mortality is unclear. Initiation of HRT in women over 60 is generally not recommended but is found to be ok for some women after age 65. In this study, we traced about 700,000 female Medicare beneficiaries from Medicare Part D entry to the onset of each outcome, death, switching to capitated plan, disenrollment from Medicare, or 12/31/2016 whichever comes first and then we compared each risk among women treated with HRT to those not treated. Individuals in
[ 783, 6278, 5230, 273, 15590, 60, 6421, 9, 85, 10, 3291, 187, 395, 2319, 1880, 187, 45019, 1600, 4142, 42534, 403, 5544, 407, 10702, 36278, 15, 187, 187, 42378, 313, 19, 10, 187, 9301, 13, 359, 2451, 1880, 253, 9376, 273, 247, 187, 35428, 2622, 3268, 3133, 10599, 323, 2544, 275, 11026, 15, 187, 24408, 70, 253, 1180, 273, 16022, 387, 253, 337, 14, 29551, 5325, 6, 1268, 13, 970, 253, 187, 7791, 314, 36278, 16923, 816, 10302, 285, 253, 4588, 2572, 275, 187, 41770, 15, 187, 5089, 1880, 253, 1180, 273, 16022, 310, 275, 1386, 342, 752, 369, 3264, 15, 187, 9, 2214, 253, 6517, 1071, 13, 187, 5658, 476, 897, 253, 2622, 11193, 281, 253, 47585, 3268, 15, 187, 9917, 13, 320, 10182, 281, 3761, 253, 36278, 16923, 342, 253, 6774, 187, 4168, 275, 4917, 2698, 187, 187, 22582, 21798, 313, 36301, 10, 187, 510, 9493, 9864, 2746, 19584, 326, 2544, 275, 187, 7791, 314, 11026, 452, 271, 3907, 13, 8931, 3268, 313, 74, 15, 74, 15, 69, 2698, 187, 510, 2523, 310, 1880, 436, 9376, 310, 4569, 27, 187, 14, 11680, 1024, 247, 1566, 342, 1599, 14, 250, 4149, 275, 253, 1599, 13, 824, 347, 253, 187, 55, 284, 547, 76, 1566, 313, 338, 2326, 275, 253, 4229, 14, 20666, 2282, 481, 187, 20768, 2542, 253, 1566, 13, 1071, 1880, 1599, 294, 4149, 3133, 1534, 13, 285, 187, 45141, 30226, 275, 253, 3634, 273, 436, 747, 1566, 15, 187, 10795, 13056, 30226, 1818, 32, 1737, 670, 7970, 30226, 32, 187, 14, 8464, 2542, 247, 443, 20756, 1566, 323, 253, 1818, 275, 4917, 285, 7277, 253, 187, 922, 44358, 281, 326, 273, 253, 45118, 3788, 1566, 15, 187, 187, 9, 21, 10, 46689, 3390, 15, 187, 14, 1623, 4565, 4562, 13, 9354, 13, 253, 20820, 7205, 21936, 187, 1439, 281, 5558, 366, 253, 20820, 13, 187, 2858, 3365, 281, 29809, 697, 1600, 2281, 5445, 15, 187, 29618, 247, 5700, 323, 21867, 3390, 253, 20820, 13, 187, 5302, 313, 74, 10, 1600, 2281, 36424, 13, 313, 2886, 10, 1600, 2281, 1863, 1825, 13, 187, 395, 313, 12211, 10, 1600, 2281, 12839, 390, 23467, 15, 187, 2214, 1016, 5700, 13, 6266, 253, 7935, 285, 1880, 368, 943, 1379, 247, 187, 5056, 390, 2159, 1899, 15, 187, 14, 1623, 326, 1388, 13, 253, 3919, 308, 14, 23798, 36424, 3310, 4581, 387, 8688, 14, 1762, 15, 187, 510, 3310, 556, 417, 1593, 2408, 273, 370, 2313, 13, 933, 15, 187, 27132, 7467, 7467, 476, 320, 4080, 407, 326, 273, 253, 187, 6892, 43466, 14, 1992, 14, 13569, 2373, 313, 1647, 37, 10, 5533, 13, 534, 310, 8025, 281, 320, 898, 15, 19, 1107, 15, 187, 24408, 70, 253, 1180, 273, 12712, 281, 187, 36261, 390, 5580, 281, 29809, 253, 21491, 3928, 20820, 15, 187, 14, 831, 3310, 556, 6867, 11947, 187, 21970, 273, 7469, 13, 933, 14, 8320, 13, 933, 12712, 5312, 15, 187, 10754, 1419, 342, 3332, 4644, 941, 387, 253, 187, 32544, 5986, 273, 17061, 313, 14922, 2415, 481, 187, 17304, 352, 452, 644, 1896, 281, 1691, 247, 29809, 275, 1659, 275, 581, 1388, 32, 187, 14, 27234, 326, 36424, 476, 320, 4211, 275, 253, 2424, 2408, 13, 187, 12756, 253, 4795, 20820, 320, 9106, 2495, 1417, 32, 187, 187, 510, 9635, 13, 22972, 1523, 13, 269, 1096, 1199, 1805, 685, 574, 644, 21490, 15, 187, 6744, 2237, 369, 35440, 16371, 347, 6629, 497, 5087, 896, 816, 2217, 281, 187, 27635, 4284, 28, 253, 9635, 369, 2104, 281, 9017, 697, 6735, 689, 1384, 1107, 15, 187, 16830, 253, 6459, 1361, 2210, 432, 253, 3055, 8776, 13, 275, 253, 830, 273, 247, 187, 2399, 19275, 6982, 4283, 281, 3687, 6224, 2891, 41271, 285, 10762, 407, 187, 783, 2418, 15, 187, 187, 7542, 840, 13, 253, 9635, 556, 4724, 247, 7355, 2098, 18932, 327, 247, 187, 5, 10695, 3041, 5533, 2523, 13, 187, 249, 534, 25141, 651, 320, 4751, 1234, 13774, 15, 187, 6080, 9635, 12222, 497, 2624, 13, 390, 9495, 281, 643, 11009, 15, 187, 30381, 641, 275, 253, 6363, 313, 68, 1005, 13, 6629, 13, 11009, 285, 253, 9635, 187, 953, 813, 582, 2299, 13, 403, 1335, 10268, 247, 370, 10695, 3041, 2159, 12615, 15, 187, 187, 1147, 310, 11543, 253, 370, 18, 15, 23, 6494, 2957, 588, 2455, 320, 12372, 15, 187, 2598, 2080, 13, 253, 9635, 556, 11371, 247, 370, 19, 6494, 15091, 1411, 34069, 408, 187, 48959, 348, 13, 697, 8624, 23497, 13, 323, 370, 40896, 3041, 15, 313, 29228, 37536, 13, 436, 187, 9133, 310, 1077, 2810, 281, 253, 2965, 275, 253, 2791, 1318, 273, 34069, 408, 5739, 187, 251, 253, 1388, 253, 13165, 369, 6138, 2698, 187, 510, 9635, 556, 12372, 594, 2080, 187, 5, 31036, 3041, 13, 247, 2080, 3501, 432, 253, 370, 18, 15, 23, 6494, 2957, 15, 14422, 5731, 327, 33563, 187, 187, 510, 21209, 5533, 2791, 369, 671, 16426, 4352, 407, 253, 13165, 15, 187, 46, 9760, 267, 18900, 13, 665, 497, 6326, 281, 320, 16293, 407, 253, 187, 5190, 11546, 6009, 285, 6152, 6267, 273, 253, 1521, 10207, 13, 8423, 5420, 14043, 281, 187, 6986, 15, 187, 46, 328, 261, 3839, 8231, 275, 4376, 4103, 281, 9847, 284, 6465, 13, 534, 275, 187, 8222, 16540, 253, 2105, 273, 5347, 323, 512, 34039, 1475, 253, 187, 18362, 15, 187, 187, 14087, 15880, 476, 320, 6311, 432, 436, 5763, 15, 187, 29887, 1318, 387, 2495, 644, 4080, 1078, 9354, 13, 187, 783, 21491, 3928, 269, 6358, 1940, 812, 1077, 973, 452, 644, 16371, 15, 187, 1147, 310, 4344, 281, 1333, 326, 13, 574, 253, 44220, 83, 6138, 326, 187, 9088, 369, 247, 608, 2558, 4839, 273, 10305, 625, 685, 370, 18, 15, 18, 6494, 187, 1189, 247, 807, 13, 1142, 12946, 651, 452, 1869, 7019, 670, 26575, 187, 14806, 253, 6363, 15, 187, 688, 1635, 13, 12946, 651, 417, 452, 253, 16267, 326, 597, 858, 417, 187, 14428, 752, 597, 497, 2970, 715, 13, 534, 651, 452, 3710, 253, 35511, 273, 187, 561, 5845, 33563, 15, 187, 187, 8732, 44887, 77, 607, 13, 253, 747, 44220, 83, 1919, 5403, 13, 556, 38417, 747, 187, 24889, 420, 7823, 187, 1542, 253, 8149, 6363, 15, 187, 2512, 6438, 13, 187, 46, 1887, 77, 607, 369, 10544, 281, 253, 5986, 273, 6053, 30178, 15, 187, 187, 5703, 253, 2120, 2395, 273, 253, 21491, 3928, 15394, 13, 7967, 378, 1507, 443, 531, 15350, 27, 187, 19932, 400, 3993, 285, 23560, 275, 21491, 3928, 13, 187, 15855, 407, 27878, 5687, 313, 21859, 8878, 481, 187, 187, 688, 2380, 281, 6494, 14, 35523, 11655, 313, 3980, 912, 3928, 13, 4033, 723, 13, 187, 37, 2284, 8754, 13, 6365, 455, 2510, 7042, 19696, 1051, 582, 253, 4832, 4491, 310, 8577, 281, 187, 3902, 387, 22887, 313, 26205, 10, 347, 247, 1332, 281, 1453, 2791, 10502, 15, 187, 187, 41390, 500, 263, 279, 4159, 253, 806, 1984, 327, 30226, 3902, 387, 22887, 27, 380, 1457, 41576, 4698, 323, 3267, 19891, 15111, 22887, 13, 187, 15855, 407, 7854, 6481, 23932, 313, 20443, 8441, 481, 187, 510, 1984, 556, 644, 15786, 715, 5628, 13, 32863, 13, 6692, 13, 13247, 13, 19701, 13, 187, 48236, 13, 285, 9883, 15, 187, 1147, 556, 644, 1925, 271, 346, 28475, 610, 2629, 3446, 187, 34, 747, 11166, 369, 3863, 275, 5403, 15, 187, 187, 1992, 3037, 625, 670, 2495, 4323, 13, 1239, 253, 187, 41349, 22887, 15821, 313, 6764, 46, 10, 42958, 15, 187, 1552, 310, 253, 3565, 1984, 323, 253, 7499, 46, 8368, 10932, 407, 253, 187, 18590, 7115, 273, 22887, 21001, 2738, 932, 313, 40, 37862, 481, 187, 1552, 42958, 3400, 253, 5161, 2133, 273, 3640, 323, 4832, 2495, 187, 1342, 16014, 15, 187, 34, 747, 11166, 369, 3863, 407, 31037, 275, 4267, 15, 47, 30766, 3562, 697, 496, 2409, 2086, 281, 4271, 253, 1682, 13345, 9260, 37735, 1905, 1110, 326, 588, 1818, 253, 1533, 285, 13341, 253, 12672, 1612, 273, 427, 30766, 457, 84, 15896, 5162, 3943, 313, 45915, 10, 285, 14980, 26967, 15, 1916, 326, 990, 13, 253, 2567, 3562, 247, 12417, 342, 247, 370, 18, 3041, 17767, 6363, 285, 41195, 41095, 432, 625, 685, 1052, 3795, 74, 2866, 5703, 3010, 12871, 9669, 313, 35, 6669, 10, 16040, 14179, 27, 34105, 7567, 5302, 281, 1281, 5863, 187, 187, 12871, 9669, 4376, 4102, 3034, 11046, 2708, 247, 2159, 14, 3945, 11002, 9058, 1386, 533, 1537, 320, 1955, 323, 247, 3785, 2135, 15, 2946, 2943, 253, 34125, 851, 83, 3913, 4968, 327, 253, 6323, 14284, 1029, 285, 1698, 2722, 253, 2308, 835, 625, 34864, 1537, 320, 6179, 15, 6436, 13, 7681, 18172, 403, 4933, 6804, 6298, 327, 1880, 253, 14518, 812, 21058, 390, 417, 15, 187, 187, 12871, 9669, 4376, 6497, 949, 247, 2159, 14, 3945, 1329, 8232, 285, 1537, 320, 1955, 323, 247, 3785, 2135, 1078, 13590, 2007, 6420, 15, 187, 187, 31019, 474, 2102, 280, 2392, 8714, 932, 187, 187, 510, 2233, 322, 3788, 310, 2708, 253, 3356, 14, 3945, 1052, 322, 3788, 281, 5224, 326, 253, 1854, 273, 1878, 5052, 310, 281, 253, 42719, 15, 496, 643, 3000, 13, 253, 5580, 2727, 310, 625, 2779, 281, 21058, 685, 281, 8107, 432, 1060, 15, 187, 187, 52, 20945, 1537, 320, 6179, 1475, 253, 9901, 15, 25, 6, 34125, 390, 370, 23, 13, 43995, 1268, 534, 3104, 598, 342, 253, 7154, 11002, 9058, 1386, 1329, 15, 831, 310, 671, 2810, 281, 253, 2233, 322, 3788, 7870, 2192, 1788, 1127, 13, 534, 1537, 823, 1529, 3828, 273, 5052, 15, 187, 187, 36549, 348, 3258, 310, 14252, 598, 1293, 1014, 16116, 689, 42022, 12785, 13, 534, 5936, 326, 22251, 403, 15211, 281, 1091, 15, 322, 461, 1243, 11280, 3473, 812, 1014, 1379, 15025, 4376, 896, 598, 1840, 253, 9058, 1386, 281, 4035, 697, 12394, 15, 416, 5824, 310, 671, 13458, 598, 281, 1804, 326, 22251, 1537, 320, 4704, 281, 1091, 15, 1720, 5250, 689, 67, 1224, 2308, 285, 8577, 896, 1066, 812, 1335, 1581, 253, 34125, 84, 281, 2186, 13, 13383, 15025, 4376, 896, 281, 253, 14284, 1698, 390, 2406, 15, 187, 187, 35, 6669, 16, 38169, 28525, 432, 40046, 3145, 187, 187, 12871, 9669, 369, 7591, 281, 10265, 697, 4321, 1684, 2169, 347, 11528, 14, 29114, 369, 3158, 15, 1535, 16208, 1364, 320, 5471, 20138, 327, 2395, 273, 2495, 14, 2727, 14221, 275, 2087, 4832, 10169, 285, 1223, 6179, 323, 253, 19115, 3061, 327, 15025, 444, 13837, 4893, 15, 187, 187, 16812, 13, 627, 457, 84, 247, 2257, 281, 1007, 3579, 281, 13, 3782, 253, 8027, 273, 36229, 25958, 5751, 15025, 36424, 1996, 436, 807, 15, 1723, 13, 627, 1537, 671, 320, 690, 6987, 511, 347, 29262, 6983, 326, 1390, 807, 457, 84, 330, 5288, 15025, 36424, 497, 27137, 323, 253, 9479, 5926, 326, 3560, 840, 15, 605, 15256, 822, 187, 605, 9653, 20941, 495, 15, 20, 5315, 2697, 428, 8280, 15, 3129, 25837, 15, 2061, 187, 605, 37041, 187, 605, 8283, 313, 68, 10, 4748, 14, 6961, 6039, 6077, 418, 2381, 22383, 654, 293, 14785, 433, 66, 33, 3129, 25837, 15, 2061, 31, 187, 605, 187, 605, 831, 3694, 310, 2530, 686, 284, 14, 261, 1383, 1293, 667, 3890, 390, 10466, 187, 605, 17529, 15, 496, 642, 2362, 588, 253, 4477, 320, 2918, 15922, 323, 667, 8540, 187, 605, 14475, 432, 253, 897, 273, 436, 3694, 15, 187, 605, 187, 605, 40078, 310, 7169, 281, 3780, 281, 897, 436, 3694, 323, 667, 4096, 13, 187, 605, 1690, 6264, 4893, 13, 285, 281, 6990, 352, 285, 25529, 352, 187, 605, 15744, 13, 2256, 281, 253, 1563, 13133, 27, 187, 605, 187, 605, 337, 15, 380, 6510, 273, 436, 3694, 1364, 417, 320, 25355, 264, 28, 368, 1364, 417, 187, 605, 50274, 7041, 326, 368, 4159, 253, 3236, 3694, 15, 1310, 368, 897, 436, 3694, 187, 605, 50274, 249, 247, 1885, 13, 271, 48371, 275, 253, 1885, 10097, 651, 187, 605, 50274, 1257, 14109, 533, 310, 417, 2424, 15, 187, 605, 187, 605, 374, 15, 1219, 3606, 2603, 9508, 1364, 320, 30236, 7101, 347, 824, 13, 285, 1364, 417, 187, 605, 50274, 1257, 25355, 264, 347, 1146, 253, 3236, 3694, 15, 187, 605, 187, 605, 495, 15, 831, 4366, 778, 417, 320, 5176, 390, 12059, 432, 667, 2603, 187, 605, 50274, 35360, 15, 187, 605, 187, 605, 15256, 822, 187, 187, 4, 3709, 654, 8400, 565, 15, 73, 31, 187, 4, 3709, 654, 11830, 12964, 79, 15, 73, 31, 187, 187, 4, 338, 2931 ]
the square root of Var[dy(t)]) and discuss whether recent interest rates swings are explained by elevated volatility. Advanced (2) Next, we check whether the assumption of a conditional normal distribution seems adequate for changes in yields. Compute the number of exceptions at the 1-tailed 95% level, using the monthly volatility forecast just computed and the actual increase in yield. Test whether the number of exceptions is in line with what was expected. (For the exception test, you can use the normal approximation to the binomial distribution. Also, be careful to match the volatility forecast with the subsequent change in yield.) Really Advanced (Optional) The historical simulation approach assumes that changes in monthly yields have an independent, identical distribution (i.i.d.) The issue is whether this assumption is appropriate: - Consider now a model with mean-reversion in the mean, such as the Vasicek model (if seen in the fixed-income course). Estimate the model, test whether mean reversion seems significant, and evaluate VAR in the context of this new model. Does monthly VAR change? What about annual VAR? - Estimate a GARCH model for the change in yield and compare the forecasts to that of the EWMA model. (4) Hedging. - On December 31, 1994, the portfolio manager decides not to liquidate the portfolio, but simply to hedge its interest rate exposure. Develop a strategy for hedging the portfolio, using (i) interest rate futures, (ii) interest rate swaps, and (iii) interest rate caps or floors. For each strategy, describe the instrument and whether you should take a long or short position. - On that day, the March T-bond futures contract closed at 99-05. The contract has notional amount of $100,000. Its duration duration can be measured by that of the Cheapest-To-Deliver (CTD) bond, which is assumed to be 9.2 years. Compute the number of contracts to buy or sell to hedge the Orange County portfolio. - This contract has typical trading volume of 300,000-400,000 contracts daily. Verify with recent volume data at the Chicago Board of Trade (CBOT). Would it have been possible to put a hedge in place in one day? - Assuming that futures can be sold in the required amount, would the resulting portfolio be totally riskless? The county, fortunately, fared much better than had been feared. Disaster was narrowly avoided as schools were paid back just enough to avoid default; the county was able to extend its debt over 20 years. Perhaps the greatest help came from the private sector, in the form of a booming economy leading to greater sales tax receipts and payments by the State. Since then, the county has filed a recovery plan centered on a $800 million bond issue, in which creditors would be fully repaid. Some county expenses were cut, or transferred to other agencies. Investors in the pool (cities, schools, agencies and the county itself), however, are still facing a $800 million shortfall. It is unlikely the $1.6 billion loss will ever be recovered. So far, the county has settled a $2 billion lawsuit against Merrill Lynch, its principal broker, for $437 million. (Incidentally, this number is very close to the fall in the market value of Merrill stock on the day the bankruptcy was announced.) The county has recovered so far $650 million, a far cry from the $1.6 billion loss.Show update on lawsuits The municipal bond market was also badly hit by the bankruptcy. Municipal investments, who were supposed to be guaranteed by the ``full faith and credit'' of the issuer, suddenly appeared vulnerable to default. Munis generally dropped in price relative to Treasuries, which in effect raises the cost of capital for all municipalities around the country. Additional lessons can be learned from this exercise. Had value at risk been measured before 1994, the Orange County fiasco could very well have been avoided. It is fair to say that, had the Treasurer announced that there was a 5 percent chance of losing more than $1.1 billion over a year, many investors would have thought twice about rushing into the pool. In addition, investors would not have the excuse that they did not know what they were getting into, which would have limited the rash of ensuing lawsuits. John Moorlach, the new Treasurer until 2006, has instituted new investment policies for the investment pool. Thereafter, Moorlach was elected to the Board of Supervisors. Read the full account of the Orange County disaster, Big Bets Gone Bad: Derivatives and Bankruptcy in Orange County, published by Academic Press (September 1995). In response to billion-dollar losses (Orange County, Barings, Daiwa, Metallgesellschaft...), the financial industry is turning to Value at Risk (VAR) as a method to control market risks. Professor Jorion wrote the first book on VARValue at Risk: The New Benchmark for Controlling Market Risk, published by Irwin Professional (July 1996). The book has been translated into Chinese, Hungarian, Japanese, Korean, Polish, Portuguese, and Spanish. It has been called an "industry standard". A new edition was published in 2006. To learn more about risk management, read the Financial Risk Manager (FRM) Handbook. This is the official book for the FRM examination organized by the Global Association of Risk Professionals (GARP). This Handbook provides the core body of knowledge for financial risk managers. A new edition was published by Wiley in 2010.Nvidia created its Inception program to identify the best artificial intelligence startups — those that will change the world and tap the computing power of Nvidia’s graphics processing unit (GPU) and AI processors. To that end, the company created a contest with a $1 million prize pool and entertained pitches from more than 200 compani…Read MoreBitcoin (BTC) Price Watch: Bears Refusing to Let Up Bitcoin price recently tumbled below a short-term rising trend line but might be due for a pullback.Applying the Fib retracement tool on the latest swing high and low shows the levels where more sellers might be waiting.However, technical indicators are giving mixed signals on whether the slide could resume or not. Bitcoin price fell through a short-term support zone and might be due for a pullback before heading further south. Technical Indicators Signals The 100 SMA is below the longer-term 200 SMA to indicate that the path of least resistance is to the downside. In other words, the selloff is more likely to resume than to reverse from here. Sellers might be waiting around the 61.8% Fib or $6,564 level which lines up with the broken rising trend line support. This is also close to the 100 SMA dynamic inflection point, which might add another layer of resistance. Stochastic is pulling up without even hitting oversold territory, which suggests that buyers are eager to return. Sustained buying pressure could even take Bitcoin price back up above the trend line to continue its climb. RSI is also pointing up to suggest that buyers might be ready to return. Reaching overbought levels and turning back down could still allow the Fibs to hold, pushing Bitcoin price back to the swing low or lower. BTC/USD Chart from TradingView Bitcoin was unable to sustain its earlier pop higher as profit-taking was quick. Traders must be feeling anxious on account of risk-off flows in general financial markets and while waiting for the SEC decision on Bitcoin ETF applications. Still, there’s a lot to look forward to, particularly the launch of ICE Bakkt Bitcoin futures later this year. However, there might also be some unease as traders recall that last year’s CME Bitcoin futures were blamed for the sharp drop that followed then.//======================================================================== // GLFW 3.3 macOS - www.glfw.org //------------------------------------------------------------------------ // Copyright (c) 2009-2016 Camilla Löwy <[email protected]> // // This software is provided 'as-is', without any express or implied // warranty. In no event will the authors be held liable for any damages // arising from the use of this software. // // Permission is granted to anyone to use this software for any purpose, // including commercial applications, and to alter it and redistribute it // freely, subject to the following restrictions: // // 1. The origin of this software must not be misrepresented; you must not // claim that you wrote the original software. If you use this software // in a product, an acknowledgment in the product documentation would // be appreciated but is not required. // // 2. Altered source versions must be plainly marked as such, and must not // be misrepresented as being the original software. // // 3. This notice may not be removed or altered from any source // distribution. // //======================================================================== #include <stdint.h> #include <dlfcn.h> #if defined
[ 2600, 15, 10338, 2119, 368, 5731, 436, 1529, 673, 387, 2378, 537, 19515, 2403, 1270, 5017, 2, 5717, 368, 2, 187, 187, 8620, 13406, 1841, 1060, 15, 3954, 309, 717, 16088, 9995, 281, 14218, 634, 1501, 15, 38658, 368, 1077, 1199, 285, 309, 717, 816, 2819, 6386, 281, 3057, 368, 15, 3166, 368, 971, 281, 4496, 5926, 479, 271, 299, 14, 5719, 32, 187, 187, 25821, 403, 4581, 15, 187, 187, 1628, 42, 457, 78, 271, 2102, 74, 35, 23173, 11602, 187, 187, 12764, 13, 309, 717, 399, 81, 657, 763, 88, 518, 21401, 247, 16132, 25694, 24773, 285, 30278, 6485, 1754, 275, 1457, 14, 13569, 5801, 13, 5427, 15, 309, 789, 342, 747, 37735, 13, 30440, 13, 31847, 13342, 13, 285, 41982, 15, 309, 717, 247, 23932, 20299, 1063, 285, 309, 3630, 13, 3984, 13, 285, 7279, 6571, 670, 1359, 281, 5311, 12192, 13, 30278, 3668, 13, 3580, 10123, 13, 496, 9458, 25694, 13, 8404, 11263, 9137, 3966, 15, 187, 187, 4045, 368, 971, 281, 11075, 271, 15650, 21001, 7116, 10518, 32, 187, 187, 8252, 22915, 432, 1388, 581, 1293, 1469, 9825, 15, 187, 187, 8398, 368, 2, 187, 187, 1394, 452, 8379, 7416, 776, 30710, 1618, 15, 187, 187, 44427, 3189, 1623, 6745, 187, 187, 3220, 5863, 4202, 7225, 1040, 3617, 462, 1981, 187, 187, 4967, 309, 28890, 16132, 25694, 32, 3052, 309, 9872, 16132, 25694, 27560, 386, 496, 19950, 13, 31870, 32, 187, 187, 4553, 17388, 13, 309, 452, 1142, 4606, 281, 5206, 16132, 25694, 347, 247, 5249, 15, 309, 2389, 281, 1056, 2561, 13, 3166, 253, 1783, 273, 253, 4422, 13, 3166, 9137, 13, 285, 789, 2556, 281, 619, 1659, 285, 619, 673, 326, 2139, 309, 5966, 715, 7336, 10721, 15, 11056, 13, 309, 717, 247, 31847, 21955, 285, 309, 476, 1908, 4266, 347, 247, 16132, 25694, 27560, 386, 285, 6485, 1754, 275, 19950, 13, 5427, 15, 187, 187, 41, 603, 271, 40900, 3105, 271, 13677, 15, 5057, 253, 9567, 16132, 25694, 2579, 323, 15023, 285, 11864, 322, 1025, 10518, 265, 275, 5427, 390, 11762, 15, 2752, 15040, 310, 253, 20162, 273, 3515, 1029, 27012, 2006, 38207, 27069, 84, 1880, 326, 310, 949, 619, 4751, 7303, 3055, 5268, 789, 13, 285, 619, 25021, 15, 3166, 368, 452, 667, 1953, 670, 1359, 281, 1265, 16132, 25694, 347, 247, 5249, 32, 309, 651, 751, 281, 1361, 368, 342, 634, 5865, 9137, 5249, 285, 309, 476, 671, 1361, 368, 342, 634, 3909, 42440, 13, 9137, 13, 14892, 285, 28064, 15, 187, 187, 1394, 476, 5206, 752, 368, 971, 281, 3037, 2, 187, 187, 4967, 30278, 310, 46741, 323, 634, 10518, 32, 187, 187, 6175, 367, 5077, 778, 4446, 625, 11784, 285, 8404, 3420, 778, 320, 1774, 323, 634, 10518, 533, 8708, 30278, 310, 253, 27882, 273, 3909, 3361, 15, 1893, 13, 3166, 368, 878, 30278, 6485, 275, 19950, 313, 31870, 10, 390, 1310, 368, 971, 281, 871, 849, 30278, 1361, 634, 2136, 285, 6635, 253, 4623, 7731, 15, 7764, 1281, 479, 871, 13, 309, 651, 320, 5211, 281, 1361, 368, 15, 22032, 441, 187, 187, 21020, 247, 12232, 2554, 275, 776, 789, 187, 187, 18281, 275, 253, 18349, 285, 9413, 625, 670, 253, 5796, 1951, 285, 616, 6281, 15, 30706, 1146, 247, 21392, 31409, 285, 1132, 247, 9560, 2554, 275, 24279, 841, 5389, 9195, 285, 616, 9410, 323, 2852, 14649, 15, 1552, 3688, 7033, 281, 35164, 285, 625, 3782, 281, 35164, 323, 4295, 273, 14230, 9851, 273, 6069, 44262, 15, 187, 688, 6069, 22578, 11809, 973, 1929, 275, 253, 1445, 13, 247, 22578, 11179, 342, 7236, 25502, 15432, 15308, 285, 1907, 271, 29450, 285, 271, 19564, 323, 17351, 273, 247, 4484, 386, 275, 4250, 3700, 2954, 342, 253, 7236, 25502, 13, 310, 18495, 407, 247, 14230, 1481, 4441, 327, 1755, 273, 253, 22578, 11179, 15, 496, 2176, 11809, 13, 253, 14230, 1481, 12093, 581, 390, 625, 4000, 17980, 49359, 15, 2053, 4000, 17980, 49359, 13, 534, 778, 320, 273, 11962, 9552, 15432, 23746, 290, 16671, 1561, 1016, 643, 13, 5752, 387, 1878, 767, 6378, 15, 2596, 4096, 310, 13, 273, 2282, 13, 281, 14393, 253, 22578, 4184, 932, 3304, 253, 22578, 11179, 15, 8035, 4096, 310, 281, 1329, 1275, 3814, 272, 10679, 15, 380, 9381, 273, 253, 4000, 17980, 49359, 6887, 253, 1275, 3814, 272, 10679, 275, 4569, 2954, 281, 253, 7236, 25502, 275, 253, 22578, 11179, 281, 12454, 253, 1275, 3814, 272, 1232, 15, 3932, 253, 4000, 17980, 49359, 1364, 320, 2104, 281, 21033, 4103, 281, 1016, 643, 13, 253, 49359, 403, 10877, 594, 347, 281, 4853, 271, 50183, 875, 731, 15, 380, 50183, 13, 1223, 6941, 253, 9381, 273, 253, 49359, 13, 671, 25097, 247, 1854, 323, 253, 3727, 273, 33419, 6353, 4441, 275, 253, 22578, 11179, 15, 10022, 13, 35164, 403, 2530, 387, 2710, 8593, 2439, 253, 50183, 281, 3657, 436, 3727, 273, 33419, 6353, 15, 380, 35164, 671, 1159, 281, 3657, 7768, 275, 253, 10825, 3345, 253, 22578, 11179, 432, 8136, 949, 253, 50183, 281, 253, 22578, 4484, 386, 534, 275, 247, 5558, 5148, 3809, 1517, 16478, 22578, 778, 320, 5558, 11914, 984, 3057, 273, 5558, 11914, 342, 7768, 778, 906, 275, 253, 4702, 273, 36286, 275, 253, 5558, 11914, 15, 1916, 2007, 3657, 7768, 23753, 715, 253, 22578, 11179, 13, 247, 3835, 3678, 310, 2530, 326, 32113, 253, 2317, 432, 253, 1755, 273, 253, 22578, 4484, 386, 6363, 281, 253, 5004, 273, 253, 14230, 1481, 285, 598, 253, 50183, 281, 253, 35164, 2439, 253, 50183, 15, 187, 688, 253, 1232, 273, 20462, 824, 5558, 5148, 3809, 1517, 16478, 44262, 13, 352, 310, 1846, 3946, 281, 12106, 253, 12510, 273, 253, 14230, 1481, 35164, 762, 9559, 2515, 326, 403, 4122, 11543, 281, 2826, 281, 7624, 21684, 253, 12510, 273, 824, 35164, 762, 2622, 2515, 15, 6408, 253, 2282, 273, 824, 2216, 253, 35164, 403, 12021, 281, 247, 18144, 1783, 534, 14802, 253, 14393, 2380, 762, 247, 27710, 5161, 43081, 7343, 313, 3717, 34, 582, 28055, 253, 9065, 1896, 7343, 15, 22460, 13, 253, 3437, 34, 310, 24045, 281, 320, 247, 1083, 275, 534, 13, 323, 5913, 1921, 13, 247, 2991, 39843, 8641, 684, 275, 253, 22578, 4484, 386, 8479, 247, 12338, 7466, 273, 253, 22578, 4484, 386, 534, 275, 1614, 5621, 253, 3835, 3678, 598, 253, 50183, 875, 253, 14230, 1481, 49359, 835, 253, 3835, 3678, 285, 5558, 11914, 403, 24045, 281, 3486, 253, 14230, 1481, 35164, 534, 403, 2439, 253, 50183, 15, 1916, 2525, 2216, 6095, 13, 253, 35164, 1364, 320, 2104, 281, 3831, 253, 3835, 3678, 285, 5558, 11914, 534, 588, 452, 33419, 6353, 15308, 275, 1340, 281, 3657, 247, 3727, 273, 33419, 6353, 281, 3345, 253, 22578, 11179, 15, 1707, 403, 2067, 9351, 273, 3576, 14230, 1481, 35164, 1929, 275, 253, 1445, 15, 187, 4041, 1511, 273, 14230, 1481, 14393, 973, 1929, 281, 1110, 18024, 275, 253, 1445, 310, 247, 5558, 12539, 14393, 15, 496, 247, 5558, 12539, 14393, 13, 253, 50183, 875, 253, 14230, 1481, 49359, 310, 523, 9698, 594, 326, 247, 39445, 310, 4447, 407, 253, 50183, 3139, 15, 329, 5558, 824, 347, 5558, 11914, 310, 4845, 275, 253, 39445, 7624, 23534, 253, 50183, 715, 767, 7118, 13, 581, 1840, 253, 5558, 285, 581, 2708, 15, 380, 3835, 3678, 13, 3304, 253, 22578, 13, 4508, 33419, 6353, 840, 8725, 432, 253, 1755, 273, 253, 22578, 4484, 386, 6363, 598, 949, 253, 50183, 281, 253, 5558, 11914, 275, 253, 12539, 14393, 15, 380, 5558, 12539, 14393, 762, 2622, 2515, 3400, 271, 3576, 14393, 1411, 3835, 3678, 10346, 562, 273, 253, 50183, 285, 1411, 7768, 10346, 715, 253, 22578, 11179, 1223, 6941, 253, 4000, 17980, 14230, 1481, 49359, 281, 21033, 4103, 281, 1016, 643, 15, 1723, 13, 762, 253, 3437, 34, 1783, 13, 253, 7466, 273, 253, 22578, 4484, 386, 812, 3490, 253, 3835, 3678, 598, 253, 50183, 275, 247, 12338, 5133, 15, 496, 253, 1232, 13, 253, 3835, 3678, 812, 866, 293, 253, 5558, 11914, 432, 253, 12539, 14393, 4830, 35164, 285, 40865, 4441, 275, 253, 50183, 1840, 253, 12539, 14393, 13, 7624, 18164, 253, 5558, 12539, 14393, 18860, 762, 824, 24045, 2515, 15, 187, 8195, 1511, 273, 14230, 1481, 14393, 973, 1929, 275, 253, 1445, 310, 253, 2157, 17980, 14393, 10646, 2014, 390, 2709, 2157, 17980, 35164, 275, 2962, 403, 4845, 2439, 253, 50183, 15, 6408, 22578, 1275, 3814, 272, 13, 253, 2157, 17980, 35164, 403, 5777, 809, 16148, 281, 1581, 1805, 9381, 273, 253, 4000, 17980, 14230, 1481, 49359, 1223, 1309, 22578, 4254, 253, 35164, 403, 41470, 281, 2572, 616, 24844, 14603, 15, 20599, 273, 841, 3510, 273, 35164, 778, 320, 1119, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 495, 13, 42389, 13, 12730, 281, 322, 15, 11414, 80, 13, 6808, 2552, 3436, 13, 10333, 285, 275, 530, 15, 52, 15, 2790, 15, 1621, 15, 495, 13, 25, 746, 13, 28757, 281, 416, 15, 9808, 371, 28957, 13, 6808, 3978, 2030, 13, 15788, 15, 187, 16812, 1529, 14393, 973, 1929, 275, 253, 1445, 285, 4158, 5742, 323, 3437, 34, 2515, 310, 247, 1511, 273, 5188, 44960, 14393, 275, 534, 247, 5313, 273, 5148, 310, 22491, 264, 281, 581, 273, 253, 14230, 1481, 49359, 594, 347, 281, 9017, 2439, 253, 50183, 875, 253, 49359, 281, 1561, 2810, 18326, 281, 253, 643, 10358, 15, 380, 4096, 273, 436, 14393, 310, 281, 8069, 2406, 253, 13584, 1854, 2170, 281, 3021, 2701, 23753, 762, 3437, 34, 15, 1723, 13, 672, 12021, 281, 1783, 13, 436, 14393, 1223, 28055, 8493, 23753, 285, 6941, 10358, 9381, 13, 1057, 417, 4336, 8415, 253, 1895, 273, 13538, 3727, 273, 33419, 6353, 762, 5460, 22578, 2515, 824, 347, 3437, 34, 15, 187, 688, 5440, 1946, 2898, 4165, 15, 1621, 15, 818, 1047, 13, 14256, 7429, 346, 13745, 5201, 3787, 422, 8874, 888, 353, 4319, 1023, 267, 3, 4724, 3747, 15, 2145, 13, 14828, 407, 500, 15, 10867, 249, 285, 500, 15, 330, 15, 378, 1241, 781, 627, 310, 2529, 6576, 323, 24844, 253, 50183, 875, 7361, 254, 25502, 326, 12093, 247, 12112, 3558, 15432, 275, 253, 50183, 285, 7660, 281, 271, 769, 18186, 5122, 15, 380, 769, 18186, 5122, 310, 7032, 273, 14252, 253, 12112, 3558, 715, 3057, 342, 253, 4295, 273, 253, 7361, 254, 25502, 7624, 24844, 253, 50183, 15, 187, 8195, 24844, 5122, 310, 2529, 275, 5440, 1946, 2898, 4165, 15, 1621, 15, 818, 1047, 13, 20735, 7429, 346, 13745, 5201, 3787, 422, 8874, 888, 353, 4319, 1023, 267, 3, 4724, 3747, 15, 2145, 13, 14828, 407, 500, 15, 10867, 249, 13, 1024, 530, 15, 52, 15, 2790, 15, 1621, 15, 577, 13, 36709, 13, 47763, 15, 380, 14393, 2529, 15308, 12093, 247, 12112, 3558, 7660, 281, 581, 273, 253, 7361, 254, 4295, 285, 13633, 2439, 253, 50183, 281, 2822, 253, 643, 7361, 254, 4445, 15, 2091, 6799, 271, 769, 18186, 5122, 5997, 253, 12112, 3558, 281, 3057, 253, 643, 7361, 254, 4445, 7624, 24844, 253, 50183, 875, 253, 4295, 15, 187, 688, 1635, 13, 253, 643, 7744, 1929, 3510, 273, 35164, 824, 347, 473, 14, 32226, 13, 44462, 84, 13, 3966, 904, 1223, 6830, 3576, 762, 3437, 34, 2515, 13, 513, 417, 1581, 323, 3576, 9381, 273, 253, 14230, 1481, 49359, 15, 41, 37672, 428, 6053, 72, 7417, 32676, 39967, 1608, 8635, 84, 187, 187, 5, 23, 15, 1235, 187, 187, 48100, 479, 672, 436, 1885, 4916, 2130, 27, 187, 187, 5496, 27, 187, 187, 17624, 313, 1671, 2188, 10, 187, 187, 6504, 8613, 313, 1449, 2188, 10, 187, 187, 46374, 313, 1857, 2188, 10, 187, 187, 2973, 454, 27, 187, 187, 34, 46385, 187, 187, 22526, 187, 187, 18942, 187, 187, 10252, 187, 187, 40796, 187, 187, 50, 555, 27, 187, 187, 11185, 27, 187, 187, 41, 37672, 6053, 72, 7417, 32676, 310, 253, 6323, 1635, 281, 253, 2455, 4633, 6053, 72, 7417, 39967, 1608, 8635, 2491, 15, 380, 1608, 8635, 84, 452, 644, 18461, 970, 247, 4451, 6315, 8212, 16, 3118, 517, 13, 4795, 275, 253, 954, 28831, 6053, 72, 7417, 1608, 8635, 326, 388, 37672, 452, 2455, 3562, 15, 1552, 310, 247, 330, 3424, 14784, 6335, 13, 908, 323, 16634, 16, 336, 2184, 285, 3164, 187, 977, 4893, 187, 187, 10195, 625, 4278, 403, 2130, 387, 27, 187, 187, 26562, 56, 27, 3944, 1358, 2700, 15, 5616, 413, 14, 262, 15, 681, 16, 187, 51, 547, 399, 30704, 14313, 27015, 25173, 44278, 23773, 3196, 750, 556, 247, 17319, 314, 1708, 285, 31255, 13746, 342, 247, 12662, 273, 43486, 432 ]
content. Make sure you update this another time at once..Keep making great stuff! thank you! Good remarkable things here. Now I am incredibly glad to peer your post. Bless you very much and I am just looking ahead to contact you. Do you want to please drop me an e-mail? Comments are closed. “I’m an IndiBlogger!” Hi, I am Dp Vishwakarma a Digital Marketing consultant and SEO expert based in New-Delhi, India. I work with new startups, entrepreneurs, freelancers, and bloggers. I am a Professional Blogger and I write, speak, and consult mostly about How to blog tips, SEO news, products reviews, Inbound Marketing, Social Media marketing etc. Do you want to Start an Online Profitable Business? Start earning from day one without going anywhere. Thank you! You have successfully joined our subscriber list. Friend Me On Facebook My Upcoming Book | Googling Why I Choose Digital Marketing? Am I Top Digital Marketing Consultant In Delhi,India? After Engineering, I have many reasons to choose Digital Marketing as a career. I love to make research, Do the analysis of the website, Do marketing, and work according to my place and my time that why I entered into Internet magic. Today, I am a freelancer and I can consider myself as a Digital Marketing Consultant and expert based in Delhi, India. Hire an Expert Not an Agency. Get the Best Digital Marketing service for Small and Mid Sized Businesses in India or worldwide. My expertise is the psychology of running high yielding Advertising Campaigns whether that is through my fully managed private client work, and my consulting. Do you have any question about How to start Digital Marketing as a career? I would like to help you with your digital marketing career and I can also help you with your online branding, marketing, promotion and advertisement. You can choose what you want to learn! Why SEO is Important for your Business? While PPC may drive more revenue and Social media may be important for your Business but organic SEO is the backbone of online presence. So, Do you need SEO expert in Delhi (India) or If you want to know how SEO help your business and generate the relevant customer. Please Let me know, I would be happy to help you.Support us Play a vital role in our work Share in the excitement and discover more about the palaces and their stories. Enjoy being a valued supporter and play a crucial role in preserving these beautiful buildings and their contents for future generations.This invention relates to seals and more particularly to seals for components of closure heads of nuclear reactors. In nuclear reactor designs well known in the art, a reactor vessel with fuel assemblies disposed therein and having an inlet and an outlet for circulation of a coolant in heat transfer relationship with the fuel assemblies, is sealed by a closure head located on top of the reactor vessel. In certain designs, the closure head comprises one or more rotatable plugs. These rotatable plugs, which may be of varying sizes disposed eccentrically within each other, serve at least two purposes. One purpose is, of course, to seal the reactor internals inside the reactor vessel. Another purpose is to support refueling machines. The rotation of the rotatable plugs positions the refueling machines in appropriate relationship to the fuel assemblies in the reactor vessel to facilitate the refueling process. Since the rotatable plugs must be able to rotate relative to each other, the plugs are mounted so as to define an annulus between them. The annulus, while allowing the rotation of the plugs, also establishes a path for the release of radioactive particles located in the reactor vessel. Accordingly, seals are provided at various locations across the annulus to prevent this release of radioactive particles. The seals also function to prevent oxygen in the atmosphere outside the reactor vessel from passing through the annulus to the reactor coolant which in a liquid metal fast breeder reactor may be liquid sodium because contact of liquid sodium with oxygen may result in the formation of impurities in the liquid sodium. To further prevent oxygen leakage into the reactor vessel, a cover gas is provided that fills the space from the top of the reactor coolant pool to the bottom of the closure head and up the annulus to the seals across the annulus. In the process of designing such liquid metal fast breeder reactors, it is common practice to analyze the effectiveness of the closure head seals under extreme conditions that are highly unlikely to occur to thereby assure the effectiveness of such seals under normal conditions. During the course of such design the seals are subjected to a sophisticated analysis which determines the seal response under a hypothetical core disruptive accident (CDA), theoretically the worst possible accident. Typically, the CDA is hypothesized to be a case in which, for whatever reason, a void violently propagates in the reactor coolant causing a violent expansion of the reactor coolant which in turn forces the cover gas up the annulus between the closure head plugs where the cover gas and liquid sodium are hypothesized to impact the closure head seals which are across the annulus. To meet design requirements, the seals must be able to contain the cover gas and liquid sodium which will have radioactive particles therein in order to prevent a release of radioactive particles to outside the reactor vessel. There are several kinds of effective closure head seals known in the art. One type of closure head seal well known to those skilled in the art is a liquid dip seal. In a liquid dip seal, the annulus between the closure head plugs is contoured so that a trough is formed by the annulus itself. A liquid such as liquid sodium is placed in the trough thereby dividing the annulus into two sections, one above the liquid and one below. The cover gas, inside the reactor, containing radioactive particles then extends from the top of the reactor coolant pool up through the annulus to the liquid sodium in the dip seal. The liquid dip seal under normal conditions provides an effective seal against cover gas migration out of the annulus and against oxygen migration into the reactor vessel while allowing the rotatable closure head plugs to rotate relative to each other. However, under the CDA analysis, the expansion of the reactor coolant could force the cover gas up the annulus in a violent manner. In the process, the cover gas could expel the liquid sodium from the dip seal onto seals and bearings located in the annulus above the dip seal, thereby rendering the liquid dip seal ineffective under such hypothesized conditions. Another type of closure head seal well known in the art is the inflatable seal wherein single or multiple inflatable seals in series are placed across the annulus. During reactor refueling, the inflatable seals are slightly deflated to allow better rotation of the rotatable closure head plugs while during reactor operation the seals are inflated to increase their sealing capability. Examples of these types of seals may be found in U.S. Pat. No. 3,514,115 to S. Gallo, issued May 26, 1970 and in U.S. Pat. No. 3,819,479 to R. Jacquelin, issued June 25, 1974. Still another seal well known in the art and designed specifically for CDA conditions is a type of labyrinth seal in which a piece of metal is bolted to one of the closure head plugs so as to extend across the annulus between the plugs to within close proximity to the other plug. The purpose of this seal is to effectively lower the leak path area to thus limit leakage under CDA. However, when subjected to analysis, this seal while theoretically reducing leakage and allowing plug rotation, does not completely solve the problem of preventing release of radioactive particles under severe reactor conditions such as CDA. In copending application Ser. No. 714,220 entitled "Core Disruptive Accident Margin Seal" filed Aug. 13, 1976 by J. Garin and J. C. Belsick there is described apparatus for sealing the annulus between riser assemblies that comprises a flexible member disposed in the annulus and attached to an actuating mechanism. The actuating mechanism is capable of pulling the flexible member into contact with the components of the riser assemblies thereby sealing the annulus. Another sealing mechanism is described in copending application Ser. No. 714,221 entitled "Core Disruptive Accident Margin Seal" filed Aug. 13, 1976 by J. Garin, now U.S. Pat. No. 4,078,969. The seal described therein comprises a flexible member attached to one of the riser components and extending across the annulus to near the other riser component. When desired an actuating mechanism causes the flexible member to contact the other riser component thereby sealing the annulus between the components. In addition, the other commonly known types of seals such as O-rings, bellows, etc., while possibly effective under CDA conditions, do not allow for effective rotation of the closure head plugs.Harrows - Supergrip Carbon Dart Shafts $6.50 Notify me when this product becomes available: Size: Short (35mm) Intermediate (40mm) Medium (45mm) Colour: Aqua Gold Green Red Silver Qty: Description: Harrows Supergrip Carbon is the latest addition to the ever popular Supergrip Dart Shaft range. The Shafts have been manufactured using a unique carbon composite/compound, resulting in the most durable Supergrip Shaft that Harrows have ever created.This is a C++ XML library, used for databases/cego and probably other applications Many more details are available at: WWW: http://www.lemke-it.com/ Rice DREAM™ Classic Original Organic Rice Drink has a deliciously light and refreshing flavor with a hint of sweetness from
[ 121, 163, 119, 212, 5444, 13484, 30004, 6088, 1357, 124, 35643, 6957, 10716, 240, 163, 105, 212, 15244, 31895, 25276, 13973, 4340, 24412, 16385, 241, 15899, 234, 26795, 5444, 29734, 13610, 15244, 46291, 108, 17321, 234, 35300, 20557, 215, 31362, 27661, 244, 3917, 1357, 124, 35643, 6957, 20025, 43136, 41102, 6957, 4746, 15936, 10446, 6418, 4746, 13484, 30004, 3917, 7111, 226, 17955, 216, 6088, 164, 223, 116, 23956, 228, 6957, 42165, 13609, 41102, 31895, 25276, 45776, 27098, 4340, 14236, 39573, 45466, 44330, 22010, 18140, 209, 13748, 2155, 227, 33532, 42930, 2155, 228, 5494, 232, 8650, 118, 5444, 164, 227, 123, 23826, 6218, 1769, 229, 1769, 102, 35643, 6449, 12676, 228, 13484, 38675, 226, 18678, 6344, 10962, 228, 18678, 13752, 209, 14106, 187, 187, 35241, 1769, 237, 49030, 18140, 23371, 1357, 124, 35643, 6418, 20603, 9935, 6686, 18514, 26443, 50, 27, 187, 187, 5804, 417, 1089, 49535, 375, 187, 187, 42, 452, 8038, 253, 43439, 8904, 374, 15, 23, 12144, 285, 971, 281, 1611, 281, 9978, 247, 439, 472, 7368, 15, 187, 1989, 309, 476, 626, 1089, 253, 49535, 375, 275, 253, 10269, 14, 26758, 15, 187, 187, 6693, 13991, 3736, 187, 36, 22728, 13, 23085, 187, 187, 34, 27, 187, 187, 1394, 954, 2779, 8038, 432, 253, 964, 983, 74, 970, 253, 40445, 9978, 15, 1422, 878, 281, 2057, 3334, 253, 25426, 9978, 390, 564, 949, 12047, 285, 3609, 253, 416, 11872, 4735, 15, 535, 46, 8623, 14013, 846, 10919, 18061, 275, 17975, 27, 247, 23931, 3072, 14, 3169, 1263, 15, 187, 29099, 267, 18061, 556, 644, 12258, 347, 253, 1971, 273, 4327, 323, 990, 14, 13311, 10919, 2728, 15, 12751, 267, 18061, 5459, 253, 2495, 273, 15110, 1955, 281, 1048, 14, 3945, 28999, 1256, 15, 380, 3510, 273, 1501, 14, 3675, 38484, 36929, 778, 6889, 2190, 1027, 23365, 4811, 285, 16175, 7625, 15, 1916, 3522, 13, 1781, 3072, 14, 3169, 2175, 273, 1501, 14, 3675, 38484, 36929, 275, 11650, 10919, 11286, 20841, 313, 51, 3125, 84, 10, 452, 11766, 644, 2361, 15, 1916, 7409, 253, 6127, 273, 1501, 14, 3675, 38484, 36929, 275, 5628, 416, 3125, 84, 13, 359, 2684, 247, 23931, 3072, 14, 3169, 11077, 1263, 875, 8210, 285, 4695, 1754, 327, 941, 432, 253, 3313, 4775, 16541, 20421, 275, 17975, 15, 29484, 84, 273, 2923, 9364, 275, 416, 3125, 84, 497, 2429, 342, 1110, 273, 253, 2087, 3072, 970, 19817, 9364, 11878, 313, 52, 3027, 84, 481, 9658, 253, 7543, 1036, 416, 3125, 84, 313, 1348, 1976, 10798, 285, 22856, 18, 10753, 28, 1599, 2363, 7127, 15, 18, 3279, 1249, 15, 21, 1107, 10, 285, 3307, 44443, 1436, 14, 10526, 273, 8310, 13, 23349, 1501, 14, 3675, 8186, 15110, 497, 11245, 15, 380, 322, 3027, 273, 512, 15110, 369, 495, 15, 1976, 313, 2222, 6, 7162, 7726, 495, 15, 1812, 14, 21, 15, 1093, 481, 10168, 574, 247, 2169, 2495, 685, 1821, 323, 253, 2440, 273, 36929, 313, 52, 3027, 608, 15, 2125, 323, 2255, 285, 322, 3027, 374, 15, 2055, 323, 1821, 481, 12751, 267, 13, 18676, 285, 6728, 15110, 497, 253, 954, 1846, 15110, 13, 342, 322, 3027, 84, 273, 7127, 15, 1717, 13, 5976, 15, 2511, 285, 608, 15, 2922, 13, 2975, 15, 2091, 31539, 407, 2363, 13, 416, 3125, 84, 273, 2872, 2363, 387, 11286, 16616, 938, 1107, 10, 574, 253, 4585, 2495, 273, 1501, 14, 3675, 38484, 36929, 15, 831, 1263, 14371, 1027, 6127, 273, 36929, 846, 10919, 18061, 275, 5628, 416, 3125, 84, 13, 342, 2169, 1485, 39725, 273, 12333, 285, 18676, 15110, 15, 4111, 6433, 943, 320, 625, 28027, 386, 275, 17565, 416, 3125, 84, 323, 1501, 14, 3675, 38484, 36929, 3340, 275, 9243, 1363, 15, 50, 27, 187, 187, 2347, 281, 14003, 5806, 5438, 846, 5321, 275, 42125, 37727, 187, 187, 6407, 13, 309, 858, 1007, 387, 436, 1953, 13, 533, 697, 689, 247, 807, 1711, 15, 50276, 17833, 314, 1024, 627, 310, 247, 1175, 1039, 275, 42125, 337, 15, 18, 15, 18, 281, 4459, 5806, 5438, 3579, 846, 247, 2608, 31317, 253, 5321, 6409, 275, 253, 37727, 15, 187, 688, 247, 2829, 342, 6763, 273, 5861, 13, 19690, 310, 5667, 15, 50276, 1898, 604, 247, 2608, 2789, 2067, 5806, 10165, 326, 3434, 10095, 626, 452, 281, 320, 6015, 15, 187, 187, 34, 27, 187, 187, 510, 3662, 310, 1335, 253, 1072, 27, 562, 273, 253, 3817, 13, 42125, 2506, 626, 1329, 436, 3879, 15, 1707, 403, 247, 4564, 273, 14997, 275, 253, 2523, 40143, 342, 20412, 27, 1852, 1787, 2357, 13, 1852, 2090, 2941, 15, 380, 4766, 1935, 966, 275, 436, 4385, 2987, 1293, 26264, 42125, 2127, 15, 187, 187, 34, 27, 187, 187, 1552, 4735, 556, 644, 2879, 281, 42125, 347, 629, 273, 253, 337, 15, 23, 3727, 285, 310, 11410, 1024, 407, 4284, 15, 733, 310, 2529, 275, 253, 3727, 7211, 27, 187, 187, 7104, 30000, 1024, 31221, 15116, 327, 253, 1618, 1859, 846, 6153, 13, 187, 50276, 264, 2996, 390, 37193, 271, 1789, 15, 733, 457, 84, 1896, 281, 15042, 253, 2045, 187, 50276, 38631, 273, 22980, 15116, 407, 4758, 253, 14003, 64, 41282, 11104, 187, 50276, 936, 16708, 15, 535, 34, 15828, 6415, 15165, 387, 271, 13952, 275, 41460, 556, 1629, 2016, 264, 745, 253, 39486, 285, 7154, 715, 1264, 4243, 13, 9811, 581, 1436, 285, 2450, 981, 625, 685, 7783, 13, 6338, 1333, 15, 187, 187, 16227, 27, 27816, 1227, 41460, 9044, 9966, 366, 1227, 10535, 483, 187, 187, 510, 30623, 47069, 29218, 11720, 369, 8785, 24549, 16479, 285, 2800, 10402, 2758, 432, 37418, 17001, 14254, 275, 253, 8935, 672, 352, 25753, 387, 16336, 74, 3227, 443, 536, 33967, 13952, 15, 187, 187, 510, 35251, 46198, 369, 2820, 281, 2659, 275, 5536, 8105, 16668, 84, 285, 9313, 15, 187, 187, 510, 13952, 369, 4581, 285, 20818, 1073, 13083, 846, 253, 7343, 15, 187, 187, 16227, 27, 27816, 1227, 4165, 700, 330, 356, 34797, 1227, 743, 324, 50025, 13677, 187, 187, 3493, 1351, 1629, 2352, 745, 39486, 285, 13471, 715, 1264, 7437, 387, 41460, 434, 16336, 74, 3227, 443, 536, 33967, 13952, 1905, 642, 2361, 15444, 1005, 5987, 1358, 85, 15, 1940, 16, 14633, 56, 25, 71, 14633, 58, 68, 44, 14402, 15, 16705, 15, 681, 16, 48, 82, 25, 84, 45335, 43, 72, 49511, 1905, 15501, 6317, 313, 14947, 10, 12626, 47235, 14947, 10, 5080, 608, 13, 9169, 187, 187, 44354, 763, 3420, 753, 253, 5020, 273, 952, 327, 4450, 497, 18416, 533, 627, 497, 671, 670, 1384, 5639, 47912, 15, 187, 187, 42, 36563, 15636, 14355, 714, 254, 965, 4629, 66, 753, 27, 346, 20810, 13, 253, 30623, 47069, 29218, 6415, 4571, 626, 2186, 327, 253, 39486, 1955, 281, 4105, 8588, 2515, 285, 1629, 2016, 264, 323, 1475, 2456, 14, 1549, 78, 544, 18467, 14, 19196, 649, 47744, 187, 187, 1328, 753, 253, 6415, 840, 6497, 875, 1884, 285, 3387, 26156, 745, 253, 990, 273, 253, 39486, 15, 187, 187, 19895, 8308, 401, 1240, 12436, 249, 611, 14799, 5783, 247, 18416, 15245, 574, 4962, 285, 21043, 643, 952, 574, 644, 11062, 15, 754, 753, 5293, 273, 253, 16545, 952, 497, 275, 247, 4619, 1617, 15, 187, 187, 49, 909, 47069, 753, 275, 247, 3908, 326, 253, 6415, 574, 4783, 745, 253, 39486, 285, 326, 16479, 497, 1146, 44543, 15, 329, 28179, 323, 253, 2567, 858, 417, 2085, 2007, 4278, 15, 187, 187, 6369, 55, 2361, 326, 253, 6415, 574, 9919, 281, 2659, 275, 5536, 8105, 14, 16668, 84, 5747, 253, 2045, 767, 20818, 5877, 745, 1955, 281, 253, 5448, 15, 187, 187, 2512, 452, 644, 642, 15444, 1005, 13, 285, 776, 11062, 16479, 452, 644, 2668, 281, 4675, 15, 187, 187, 1231, 588, 4035, 281, 2085, 2007, 1491, 342, 17730, 281, 253, 7119, 15, 2756, 187, 49, 909, 47069, 29218, 1905, 30623, 47069, 29218, 12626, 16247, 1405, 21949, 47069, 10, 5080, 608, 13, 9169, 187, 187, 17213, 20541, 2692, 16479, 21266, 949, 581, 273, 253, 1781, 30611, 281, 8773, 3066, 581, 273, 253, 15926, 13, 285, 18660, 273, 9708, 86, 398, 2444, 1475, 253, 11720, 15, 187, 187, 8665, 20541, 327, 2675, 3420, 2692, 247, 787, 8879, 3304, 253, 9954, 13, 534, 369, 1996, 1691, 562, 407, 45399, 15, 187, 187, 33495, 8308, 48005, 3899, 330, 1240, 262, 7055, 5582, 753, 9061, 574, 417, 2568, 644, 2104, 281, 3984, 281, 253, 25244, 13, 247, 18416, 3872, 285, 247, 3684, 13247, 13, 665, 497, 6566, 281, 452, 644, 11062, 275, 253, 7343, 15, 187, 187, 42, 36563, 434, 1345, 15303, 556, 10098, 271, 14392, 15, 187, 187, 16227, 27, 27816, 1227, 14554, 3964, 1314, 3035, 265, 714, 786, 343, 303, 1227, 743, 324, 50025, 13677, 187, 187, 510, 1698, 14, 16736, 30623, 47069, 29218, 556, 247, 18500, 273, 11439, 9954, 428, 7543, 3452, 70, 723, 285, 5540, 6037, 13097, 16340, 428, 285, 556, 644, 12060, 323, 1384, 1107, 15, 187, 187, 34, 30623, 47069, 35251, 46198, 3551, 275, 432, 25454, 22577, 275, 253, 1986, 8365, 47229, 1629, 2016, 264, 745, 253, 39486, 387, 253, 1072, 13952, 327, 818, 4247, 15, 1707, 497, 642, 32853, 533, 253, 13952, 574, 281, 320, 20220, 4581, 15, 187, 187, 1898, 247, 30623, 47069, 35251, 46198, 671, 1629, 2016, 264, 745, 253, 39486, 387, 1535, 357, 5894, 13952, 275, 4247, 4765, 13, 31314, 272, 1066, 253, 1930, 273, 247, 28900, 37159, 253, 6150, 15, 1707, 497, 642, 32853, 15, 187, 187, 44354, 763, 29218, 753, 352, 26224, 512, 697, 8630, 275, 285, 562, 273, 16336, 74, 3227, 443, 536, 33967, 327, 8330, 313, 6790, 673, 481, 187, 187, 14, 24197, 1227, 15501, 34330, 280, 7021, 9752, 793, 5863, 2802, 39419, 416, 6356, 9045, 457, 27069, 496, 23799, 187, 187, 34330, 280, 7038, 275, 23799, 403, 17178, 6386, 342, 5841, 281, 8913, 416, 6356, 9045, 432, 9591, 275, 253, 2586, 1108, 816, 3618, 846, 703, 12316, 281, 10541, 1066, 617, 31196, 3153, 12699, 15, 187, 187, 510, 16305, 689, 416, 6356, 9045, 457, 84, 32219, 951, 3924, 769, 556, 294, 14, 37114, 264, 846, 247, 747, 1304, 432, 253, 9251, 14, 17557, 698, 757, 13281, 3128, 313, 49, 1719, 10, 3916, 617, 3045, 13, 9355, 323, 611, 780, 66, 418, 1765, 321, 327, 2145, 5080, 313, 2693, 582, 651, 320, 271, 20423, 281, 11650, 2193, 15, 187, 510, 48191, 2208, 556, 7654, 4803, 672, 352, 3249, 281, 5343, 34983, 13, 285, 10846, 403, 2424, 281, 3835, 598, 432, 616, 13574, 281, 616, 15746, 15, 187, 510, 42300, 556, 18343, 9061, 665, 2523, 12699, 16000, 275, 253, 8558, 8797, 2586, 281, 12009, 253, 1963, 9141, 457, 84, 2898, 15, 187, 510, 19156, 13, 534, 556, 10098, 18162, 1411, 253, 530, 15, 52, 15, 689, 697, 1329, 273, 5143, 275, 253, 10800, 11182, 275, 253, 10515, 5791, 13, 556, 671, 14315, 326, 13571, 22251, 403, 15979, 281, 253, 1986, 2077, 457, 6982, 15, 187, 49, 1719, 8920, 12916, 6657, 21174, 274, 7958, 14990, 15493, 312, 324, 8599, 48191, 11547, 253, 8141, 13, 773, 22191, 416, 6356, 9045, 1524, 3013, 352, 390, 417, 13, 359, 871, 326, 253, 10474, 703, 556, 5087, 671, 9945, 281, 253, 2137, 275, 24076, 1425, 187, 48598, 312, 324, 3916, 253, 2362, 651, 320, 773, 28709, 281, 50124, 11867, 4466, 13, 1112, 770, 1981, 1980, 9558, 265, 13, 29549, 8479, 11655, 281, 253, 2586, 457, 84, 6982, 285, 8109, 5143, 457, 84, 2137, 3646, 13, 534, 310, 4516, 407, 3968, 6598, 187, 54, 1814, 36972, 4352, 22277, 416, 6356, 9045, 13, 665, 310, 1929, 323, 1053, 920, 15447, 14, 67, 1875, 367, 12548, 260, 641, 1507, 285, 12267, 14, 8656, 19269, 323, 617, 14349, 84, 13, 5821, 281, 41761, 407, 48191, 5323, 4321, 436, 1770, 313, 14060, 2693, 481, 187, 49, 460, 19934, 42134, 84, 13, 253, 28960, 3212, 253, 921, 13, 8838, 416, 6356, 9045, 457, 84, 4323, 310, 773, 13823, 273, 253, 2586, 457, 84, 10132, 285, 253, 12748, 273, 2509, 247, 921, 6598, 187, 11796, 1346, 1690, 8784, 21704, 31274, 40214, 285, 443, 15082, 2951, 71, 6451, 452, 3786, 11372, 18162, 275, 253, 2586, 323, 616, 4327, 273, 10015, 13, 285, 253, 3438, 1621, 399, 17290, 16057, 4358, 742, 562, 387, 253, 2208, 407, 15081, 703, 1160, 773, 66, 2201, 17789, 668, 672, 703, 3534, 275, 281, 253, 7619, 4803, 323, 617, 921, 275, 253, 2586, 1390, 807, 313, 2904, 481, 187, 187, 18551, 1644, 187, 187, 7475, 250, 187, 187, 29849, 187, 187, 22986, 1838, 13, 2159, 323, 13951, 38544, 5417, 13 ]
�繁に人間とゾウが衝突する場所だ。同州北部に点在する森林には約488頭のゾウが生息しているが、そこは、人間の住居と茶畑が集中している場所でもある。(参考記事: 「【動画】井戸に落ちたヒョウを村人総出で救出」 ) 次ページ:子ゾウはどうなった?Q: Can not find mongos I have installed the MongoDB 2.6 Standard and want to try to setup a shard cluster. But I can't find the mongos in the bin-directory. Any suggestions ? Ciao, Andre A: You most likely installed from the .msi using the Typical setup. You need to either install the Complete setup or go through Custom and select the Router feature. Malignancies after renal transplantation in Taiwan: a nationwide population-based study. Renal transplantation has been regarded as the treatment of choice for end-stage renal disease. Renal transplantation increases the risk of cancers due to long-term immunosuppression. The types of post-transplantation malignancies may vary among different geographic regions and ethnic populations. To date, large population-based studies of post-transplantation malignancies in Asian renal transplant recipients (RTRs) have rarely been reported. To investigate the patterns of post-transplantation malignancies in Chinese RTRs, we performed a nationwide population-based cohort study between 1997 and 2008 based on data from the National Health Insurance Database in Taiwan. Patterns of cancer incidence in RTRs were compared with those of the general population using standardized incidence ratios (SIRs). Among the 4716 RTRs (2475 males and 2241 females; mean age 44.1 ± 12.4 years) and 22 556 person-years of observation, 320 post-transplant cancers were diagnosed. The SIR of all cancers was 3.75 (95% confidence interval 3.36-4.18). Women had a higher risk than men for the development of malignancies (SIR 5.04 for women and SIR 2.88 for men). Renal, bladder and liver cancers were the most common cancers, with SIRs of 44.29, 42.89 and 5.07, respectively. When stratified by age, RTRs of young age at transplant (<20 years) had the highest risk of post-transplantation malignancies. This study demonstrates different patterns of malignancies after renal transplantation in Chinese RTRs, with higher incidences of kidney and bladder cancers. Physicians should be more vigilant in examining RTRs for post-transplantation malignancies especially in younger patients.Q: How to preserve filter selection after save in Django Admin First, I did look at this question, but its over a year old. Surely now there is a good way in Django 1.1.1 to carry filter selection forward after a user clicks the save button in the Admin. In a table with thousands of records, filtering is essential. And if a user makes several filter choices that effort shouldn't have to be repeated. A: The answer is still the same: out of the box, Django doesn't support this behavior. There are a couple of tickets in the issue tracker with patches: #3777, #6903. The middleware class in this comment works without modifying Django code. A: This feature has been added to Django as part of the 1.6 release and is enabled now by default. It is described in the release notes: ModelAdmin now preserves filters on the list view after creating, editing or deleting an object. It’s possible to restore the previous behavior of clearing filters by setting the preserve_filters attribute to False. A passenger plane landing at an airport in Istanbul has skidded off the runway and broken into three parts, killing one person and injuring more than 150, officials say. Photo: AFP / Istanbul Security Directorate / Handout The Pegasus Airlines jet was carrying 171 passengers and six crew members from Izmir province in the west when it crashed at Sabiha Gokcen airport. The Boeing 737 was trying to land in heavy tailwinds and rain. The airport was closed and flights diverted after the accident. Photo: AFP / Serhat Cagdas / Anadolu Agency Plane skids off runway and breaks into three pieces at Istanbul's Sabiha Gokcen airport — no reported fatalities https://t.co/GMW8fGMYcK pic.twitter.com/Oq8sTUJgUi — BBC News (World) (@BBCWorld) February 5, 2020 Turkish media said the majority of people on board were Turkish but there were also about 20 foreign nationals. Istanbul Governor Ali Yerlikaya said: "Unfortunately, the Pegasus Airlines plane couldn't hold on the runway due to poor weather conditions and skidded for around 50-60m [164-196ft]." He said the plane then fell between 30 and 40 metres off the end of the runway. Health Minister Fahrettin Koca confirmed a Turkish citizen had died and 157 other people had been injured. He said none of the wounded people were in a critical condition. Pegasus said in a statement that the plane had gone off the runway and that passengers were being evacuated. A spokesperson for the company did not provide further details. NTV reported that the plane had attempted to land in heavy tail-winds despite the previous two flights holding off due to the wind. There have been no fatalities, and our injured passengers have been taken to hospital. We will continue to provide further information with regards to the incident. Pegasus Airlines — Pegasus Airlines (@flymepegasus) February 5, 2020 Video footage showed passengers climbing through one of the large cracks to escape via one of the wings, and dozens of rescuers working around the jet. Other footage on social media showed a blaze inside the aircraft, which was later put out by firefighters. Transport Minister Mehmet Cahit Turhan said authorities had not yet been able to speak to the pilots, a Turkish national and a South Korean, who were believed to have been injured in the accident. Istanbul's public prosecutor has launched an inquiry. Photo: AFP / Muhammed Enes Yildirim / Anadolu Agency The low-cost Pegasus Airlines has a fleet of 83 aircraft - 47 Boeings and 36 Airbus planes - and has been flying for 20 years. A Pegasus Boeing 737 coming in from Sharjah in the United Arab Emirates skidded off the runway at the same airport on 7 January. There were no casualties but the airport had to be temporarily closed. And a Pegasus Boeing 737 also skidded off the runway at Trabzon airport in January 2018, plunging down the side of a cliff overlooking the sea. There were no casualties. Turkish Airlines said it cancelled all its flight in and out of Sabiha Gokcen on Wednesday (local time). - Reuters / BBCIslamic Party Ramps Up ‘Ban Rihanna’ Campaign In Malaysia Islamic leaders in Malaysia are pressing ahead with calls to ban Rihanna from performing in the country – just weeks after she promised to tone down her forthcoming live concert. The controversy over Rihanna’s saucy stage act has re-emerged after a new report from the Pan-Malaysian Islamic party (PAS) claims her performance, planned for Kuala Lumpur on 13 February (09), would be an insult to Asian values. The Malaysian government has strict rules when it comes to female performers, and artists are required to cover up from their shoulders to their knees. The PAS has urged authorities who issue concert permits in the primarily Muslim country to reject the organiser’s application. The organisation, which has launched protests against the U.S. over its support of Israel in the ongoing struggle in the Middle East, has also warned that ticket buyers are contributing to the United States’ economy. PAS youth wing leader Kamaruzaman Mohamad tells Malaysian newspaper the Star, “Whether Rihanna realises it or not, we know that the taxes she has paid also contributed to the war in Gaza.” Mohamad claims the event would be “akin to insulting Eastern culture, belittling local artistes, internationally causing losses to the country’s economy and supporting Israel’s war policy, which is supported by America”. Umbrella hitmaker Rihanna, who is known for donning flesh-baring PVC corsets and knee-high boots for her gigs, agreed to abide by Malaysian laws earlier this month (Jan09). Pineapple Concerts, the promoters behind the show, maintained Rihanna’s management is “aware of the country’s regulations and the difficulties of doing a show”. Artists including Avril Lavigne and Gwen Stefani have previously faced protests in the country for their choice of clothes, and the former No Doubt singer lashed out at the government by claiming she made “a major sacrifice” when she gave in to the dress rules for her show in the country last year (08). Archives Genre Stats RFID, short for Radio Frequency ID,
[ 2491, 875, 337, 15, 18, 6, 285, 374, 15, 26, 6, 313, 56, 770, 5756, 1162, 355, 904, 544, 7330, 1084, 9190, 361, 2357, 5029, 740, 15, 43201, 16, 6914, 25, 16903, 15, 9638, 15, 1036, 21095, 1839, 14, 53, 5831, 3235, 337, 15, 49153, 2829, 323, 2908, 2175, 15, 3837, 46897, 1971, 24053, 38, 7258, 40, 79, 36610, 79, 330, 9334, 9048, 2323, 27, 5779, 40189, 2323, 27, 19166, 598, 4678, 37847, 14, 3169, 12214, 5562, 2519, 575, 11796, 4918, 9, 25046, 10910, 1162, 355, 904, 544, 6961, 1084, 9190, 26313, 1228, 5305, 53, 559, 3975, 4918, 5305, 53, 35191, 49, 3207, 14, 46, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 16944, 575, 16212, 31816, 16181, 44333, 9, 7638, 518, 1162, 355, 904, 544, 6620, 1084, 9190, 361, 3011, 1228, 53, 6739, 11584, 559, 7528, 31816, 16181, 44333, 53, 6739, 11584, 2031, 9785, 14, 51, 27, 36610, 426, 16944, 575, 21276, 4918, 9, 31599, 9866, 1162, 355, 904, 544, 9595, 1084, 9190, 40306, 1228, 37, 5428, 559, 12079, 4918, 37, 5428, 1166, 805, 20027, 52, 27, 36610, 426, 16944, 61, 187, 46, 14, 5736, 3871, 27, 36610, 426, 16944, 61, 187, 6527, 38, 27, 36610, 426, 330, 7258, 37681, 36610, 426, 16944, 61, 187, 46, 14, 5736, 3871, 27, 36610, 426, 16944, 61, 187, 6527, 38, 27, 36610, 426, 16944, 1672, 23393, 9, 38354, 398, 1162, 355, 904, 544, 6620, 1084, 9190, 361, 3680, 1228, 3246, 559, 444, 3246, 14, 5042, 66, 8011, 5042, 66, 63, 21851, 14, 42, 27, 36610, 8994, 16944, 63, 68, 63, 575, 39355, 1439, 248, 3406, 9, 19393, 729, 9327, 1162, 355, 904, 544, 6961, 1084, 9190, 29728, 1228, 5305, 53, 559, 25295, 1439, 248, 3406, 5305, 53, 559, 26735, 19831, 8667, 22, 9726, 20027, 52, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 7258, 37681, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 7258, 26833, 4075, 13342, 5562, 2519, 575, 36, 430, 18762, 9, 58, 11430, 14776, 1162, 355, 904, 544, 6620, 1084, 9190, 44135, 1228, 3246, 559, 388, 14546, 3246, 559, 13470, 2399, 805, 805, 20027, 52, 27, 36610, 8994, 16944, 63, 69, 2850, 187, 21851, 14, 7611, 27, 36610, 8994, 16944, 63, 69, 63, 20027, 52, 27, 36610, 8994, 16944, 63, 69, 2850, 187, 21851, 14, 7611, 27, 36610, 8994, 16944, 63, 69, 63, 37, 14, 12642, 14356, 460, 9, 615, 34636, 460, 1162, 355, 904, 544, 6755, 1084, 9190, 33416, 1228, 3246, 559, 399, 5166, 3246, 559, 13470, 2399, 1610, 63, 67, 63, 1706, 63, 67, 63, 20027, 52, 27, 36610, 426, 16944, 61, 187, 21851, 14, 7611, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 7258, 37681, 27, 36610, 426, 16944, 61, 187, 21851, 14, 51, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 16944, 37, 14, 12642, 14356, 460, 9, 37, 338, 13616, 1162, 355, 904, 544, 6759, 1084, 9190, 28484, 1228, 55, 1848, 559, 399, 5166, 55, 1848, 559, 13470, 2399, 1012, 805, 20027, 52, 27, 36610, 426, 16944, 61, 187, 49, 3207, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 7258, 37681, 27, 36610, 8994, 16944, 61, 187, 49, 3207, 27, 36610, 8994, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 8994, 16944, 37, 14, 12642, 14356, 460, 9, 45, 5432, 1162, 355, 904, 544, 6755, 1084, 9190, 361, 2950, 1228, 38, 11584, 559, 9087, 2354, 11584, 559, 13470, 2399, 1012, 1012, 20027, 52, 27, 36610, 4398, 16944, 61, 187, 49, 3207, 27, 36610, 4398, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 4398, 330, 7258, 37681, 27, 36610, 426, 16944, 61, 187, 49, 3207, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 16944, 37, 14, 12642, 14356, 460, 9, 51, 837, 30735, 1162, 355, 904, 544, 6759, 1084, 9190, 361, 3571, 1228, 55, 1848, 559, 399, 5166, 55, 1848, 559, 13470, 2399, 22, 29137, 20027, 52, 27, 36610, 426, 16944, 61, 187, 21851, 27, 36610, 426, 330, 7258, 37681, 27, 36610, 426, 16944, 61, 187, 21851, 27, 36610, 426, 330, 10993, 89, 1767, 37091, 9, 6623, 266, 12043, 1162, 355, 904, 544, 7798, 1084, 9190, 36310, 1228, 3246, 559, 24417, 3246, 559, 13470, 2399, 2511, 20027, 52, 27, 36610, 426, 16944, 61, 187, 49, 3207, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 16944, 575, 58, 1368, 6785, 460, 9, 37675, 9314, 1162, 355, 904, 544, 7798, 1084, 9190, 46010, 1228, 3246, 559, 714, 1368, 6785, 460, 3246, 559, 13470, 2399, 1047, 805, 20027, 52, 27, 36610, 426, 16944, 61, 187, 49, 3207, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 7258, 37681, 27, 36610, 426, 16944, 61, 187, 49, 3207, 27, 36610, 426, 16944, 61, 187, 8561, 42, 14, 2267, 27, 36610, 426, 330, 14633, 17428, 4797, 9, 59, 80, 437, 1216, 1162, 355, 904, 544, 7132, 1084, 9190, 361, 3593, 1228, 9051, 559, 353, 17428, 4797, 9051, 559, 13470, 2399, 1010, 1036, 21851, 14, 42, 27, 36610, 426, 16944, 61, 187, 21851, 14, 7611, 27, 36610, 426, 16944, 61, 187, 50, 15782, 14, 7611, 27, 36610, 426, 16944, 21851, 14, 42, 27, 36610, 426, 16944, 61, 187, 21851, 14, 7611, 27, 36610, 426, 16944, 61, 187, 50, 15782, 14, 7611, 27, 36610, 426, 16944, 5180, 18, 62, 187, 187, 14463, 9307, 14, 34821, 4369, 44469, 447, 313, 13837, 14, 5736, 582, 824, 347, 14977, 14, 34821, 9699, 35174, 4918, 313, 13837, 14, 36, 11584, 582, 299, 15, 72, 15, 9699, 4918, 313, 47733, 10787, 13, 15319, 13, 34999, 8420, 13, 3044, 4779, 316, 13, 708, 401, 2477, 437, 13, 544, 9204, 1084, 9190, 34063, 9679, 16707, 5445, 313, 3246, 313, 39, 12354, 13, 388, 16697, 658, 13, 708, 28230, 30735, 13, 544, 8602, 1084, 9190, 14833, 1228, 582, 9699, 5162, 4918, 313, 5305, 53, 313, 2632, 781, 708, 322, 1451, 280, 413, 13, 544, 13549, 1084, 9190, 35173, 1228, 582, 285, 27919, 4866, 711, 33761, 1320, 285, 294, 21678, 313, 3172, 4976, 313, 2809, 37557, 13, 544, 12731, 1084, 9190, 361, 2526, 1228, 582, 403, 8521, 347, 806, 14, 1282, 9694, 323, 33649, 313, 7878, 49205, 7115, 13, 544, 7132, 1084, 9190, 14602, 558, 2884, 21562, 1162, 355, 904, 544, 6622, 1084, 9190, 37812, 558, 38946, 1162, 355, 904, 544, 8602, 1084, 9190, 40085, 558, 3313, 24965, 839, 12169, 323, 29077, 4775, 13, 544, 9204, 1084, 9190, 361, 3583, 5029, 20901, 281, 3343, 3550, 2515, 285, 1971, 347, 7312, 313, 7656, 54, 582, 11419, 14, 47927, 921, 1781, 1055, 9552, 323, 1097, 22539, 14, 36, 11584, 2796, 6955, 37, 11, 426, 4150, 18, 15, 1812, 13, 5325, 6, 7309, 426, 4150, 18, 15, 2357, 281, 4150, 17, 15, 3953, 10, 285, 16133, 4976, 2796, 6955, 37, 11, 426, 4150, 18, 15, 2904, 13, 5325, 6, 7309, 426, 4150, 18, 15, 3245, 281, 4150, 17, 15, 1610, 10, 313, 36, 316, 471, 1162, 355, 904, 544, 6961, 1084, 9190, 31202, 5029, 3308, 13, 352, 476, 320, 15792, 7945, 326, 22539, 14, 5736, 2987, 323, 1142, 1363, 15, 187, 187, 6436, 13, 247, 3332, 11419, 14, 12792, 273, 14871, 16254, 14, 16894, 7587, 2361, 760, 247, 1355, 1055, 1979, 323, 22539, 14, 5736, 313, 36, 5916, 9553, 1162, 355, 904, 544, 7798, 1084, 9190, 28835, 5029, 496, 4499, 281, 253, 3343, 3550, 14, 390, 308, 16408, 14, 32978, 13, 16254, 2515, 497, 19817, 313, 70, 15, 72, 15, 1246, 14, 1154, 433, 4918, 313, 52, 1451, 321, 83, 1162, 355, 904, 544, 8602, 1084, 9190, 361, 1540, 10689, 285, 3103, 6537, 323, 440, 6160, 1971, 2616, 13, 299, 15, 72, 15, 673, 5262, 342, 253, 30286, 15, 12571, 281, 436, 958, 13, 12264, 16254, 14, 16894, 7587, 403, 625, 11518, 347, 3343, 3550, 14, 285, 308, 16408, 14, 32978, 4795, 275, 4577, 1055, 9552, 15, 5488, 13, 598, 281, 1884, 283, 1235, 6, 273, 253, 1363, 1335, 42514, 10401, 6866, 273, 33649, 6774, 281, 1971, 313, 35, 17469, 1162, 355, 904, 544, 8602, 1084, 9190, 24133, 558, 3697, 7382, 67, 17146, 13, 23219, 13, 21155, 76, 2727, 13, 308, 423, 781, 13, 708, 18707, 13, 544, 8012, 1084, 9190, 41545, 5029, 6676, 33649, 1363, 671, 11089, 432, 30142, 5917, 313, 70, 15, 72, 15, 9454, 10, 326, 403, 417, 6283, 9713, 407, 806, 14, 1282, 33649, 9694, 313, 35, 17469, 1162, 355, 904, 544, 8602, 1084, 9190, 24133, 558, 27991, 13, 35038, 13, 3734, 13, 399, 307, 376, 13, 708, 4255, 257, 13, 544, 9204, 1084, 9190, 17553, 558, 43016, 8420, 708, 3774, 953, 13, 544, 8012, 1084, 9190, 361, 3156, 5029, 187, 187, 15768, 326, 253, 3645, 4775, 17273, 313, 14947, 4775, 17273, 13, 544, 6622, 1084, 9190, 361, 3141, 1228, 285, 253, 3313, 6516, 323, 4775, 285, 9776, 43006, 313, 16760, 24965, 839, 12169, 323, 29077, 4775, 13, 544, 9204, 1084, 9190, 361, 3583, 1228, 5583, 11214, 7805, 1273, 281, 22539, 14, 5736, 13, 352, 556, 644, 8025, 326, 253, 5019, 273, 841, 767, 8130, 18653, 3687, 12510, 15, 1723, 13, 627, 310, 642, 1941, 281, 3522, 326, 253, 5019, 273, 22539, 14, 5736, 342, 11214, 7805, 25222, 1971, 2323, 313, 53, 15141, 13, 544, 7132, 1084, 9190, 361, 3566, 5029, 3813, 13, 5175, 2007, 1971, 7274, 310, 9560, 281, 7278, 253, 12510, 273, 22539, 14, 5736, 327, 33649, 5161, 5917, 347, 973, 347, 30142, 5917, 313, 41, 32275, 708, 775, 472, 13, 544, 7798, 1084, 9190, 361, 2945, 5029, 187, 187, 20517, 296, 436, 4114, 13, 247, 3862, 2491, 273, 12214, 452, 644, 6730, 689, 253, 1390, 9976, 347, 3067, 8962, 1103, 281, 22539, 14, 5736, 313, 9709, 249, 13, 37941, 518, 13, 708, 6939, 324, 13, 544, 6620, 1084, 9190, 361, 2385, 558, 411, 38051, 13, 544, 6620, 1084, 9190, 361, 2787, 5029, 1723, 13, 594, 2080, 642, 12082, 2278, 4961, 326, 44995, 285, 37250, 253, 4342, 273, 436, 6832, 2133, 273, 2561, 327, 49816, 12214, 281, 22539, 14, 5736, 15, 496, 1340, 281, 2810, 436, 8037, 13, 359, 4824, 562, 436, 12082, 2278, 15, 1198, 2590, 1255, 13, 359, 4272, 29398, 12214, 715, 253, 9050, 273, 475, 1257, 37847, 14, 3169, 12214, 11, 285, 475, 68, 26833, 4075, 13342, 4556, 187, 187, 4678, 37847, 14, 3169, 12214, 5730, 281, 35919, 22539, 14, 5736, 407, 2057, 8109, 697, 4438, 273, 2250, 313, 70, 15, 72, 15, 22474, 9282, 4715, 4870, 313, 1909, 1815, 1397, 251, 1162, 355, 904, 544, 6622, 1084, 9190, 13930, 10689, 390, 407, 41685, 1316, 272, 10006, 273, 5231, 417, 9713, 407, 22539, 14, 5736, 313, 70, 15, 72, 15, 1327, 14, 332, 7187, 2289, 281, 14977, 14, 4919, 12959, 313, 19013, 466, 13, 8247, 375, 13, 5979, 348, 1970, 74, 13, 708, 2101, 50199, 13, 544, 8603, 1084, 9190, 29407, 43075, 43419, 4075, 13342, 403, 27331, 6083, 313, 70, 15, 72, 15, 32996, 13, 399, 14, 12642, 14356, 460, 10, 326, 14227, 616, 2538, 407, 30753, 9699, 4870, 6944, 9282, 1818, 313, 70, 15, 72, 15, 4709, 21891, 4870, 285, 16, 263, 253, 34889, 273, 9371, 1327, 14, 453, 274, 12959, 313, 35, 290, 91, 13, 6277, 13, 372, 3277, 677, 404, 13, 708, 46377, 13, 544, 7199, 1084, 9190, 19765, 558, 41942, 1162, 355, 904, 544, 6620, 1084, 9190, 361, 2385, 43075, 187, 187, 1552, 12082, 2278, 37250, 285, 25339, 253, 1941, 273, 1880, 49816, 8770, 14, 3169, 12214, 285, 9699, 4075, 13342, 3157, 253, 6454, 273, 22539, 14, 5736, 15, 1310, 1896, 13, 352, 310, 671, 2361, 1880, 841, 12214, 3157, 30142, 5917, 15, 380, 2278, 2789, 253, 2130, 1941, 625, 12482, 323, 26690, 285, 8607, 285, 3400, 247, 2613, 323, 2852, 2561, 327, 29398, 12214, 275, 33649, 15, 187, 187, 18, 537, 13277, 1712, 52, 12603, 94, 187, 15765, 187, 187, 18, 15, 18, 537, 444, 3372, 2322, 6866, 1712, 52, 12603, 14, 52, 8971, 94, 187, 27800, 187, 187, 38954, 497, 2908, 604, 597, 497, 6537, 7587, 17565, 253, 29398, 1055, 273, 5795, 17484, 275, 1635, 281, 33649, 806, 14, 1282, 1971, 323, 7747, 44327, 1093, 1107, 10, 342, 33649, 15, 308, 16408, 2515, 417, 4518, 12930, 326, 512, 1363, 497, 4127, 342, 22539, 14, 5736, 497, 10432, 15, 11709, 3058, 281, 320, 3863, 275, 14218, 14, 33349, 4383 ]
range between 1.1% and 2.9% (Wittchen et al., [2011](#CIT0077)).10.1080/20008198.2019.1634938-T0001Table 1.Evidence table for included studies.Adjuvant treatmentStudyEGCGn EGn CGTreatment success: PostTreatment success: Follow upBehaviour-based interventions       Art therapy(Campbell et al., [2016](#CIT0012))CPT + Art therapyCPT510PCL-M: EG = CG\ BDI-II: EG = CG Breathing Biofeedback(Polak et al., [2015](#CIT0057))TFCBT + Breathing BiofeedbackTFCBT44IES-R: EG = CG Family therapy(Glynn et al., [1999](#CIT0033))DTE + Family therapyDTE1712CAPS: EG = CG\ M-PTSD: EG = CG\ IOE: EG = CGCAPS EG = CG\ M-PTSD: EG = CG\ IOE: EG = CGExercise(Powers et al., [2015](#CIT0058))PE + EPE- ^a^- ^a^PSS-I: EG \> CG^c^ Hypnotherapy(Galovski et al., [2016](#CIT0030))CPT + HypnotherapyCPT + Sleep symptom monitoring5256CAPS: EG = CG\ BDI-II: EG = CGCAPS: EG = CG\ BDI-II: EG = CGCognitive enhancers       Cortisol(Yehuda et al., [2015](#CIT0080))PE + HCNPE + Placebo1212CAPS: EG \> CG^d^\ PSS-SR: EG \> CG^d^CAPS: EG \> CG^d^\ PSS-SR: EG \> CG^d^D-cycloserine(de Kleine et al., [2012](#CIT0019))PE + DCSPE + Placebo33^b^34^b^CAPS: EG = CG\ PSS-SR: EG = CG\ BDI-II: EG = CGCAPS: EG = CG\ PSS-R: EG = CG\ BDI-II: EG = CGD-cycloserine(Difede et al., [2014](#CIT0022))VRE + DCSVRE + Placebo1312CAPS: EG = CG\ PCL: EG = CG\ BDI-II: EG = CGCAPS: EG \> CG\ PCL: EG \> CG\ BDI-II: EG \> CGD-cycloserine(Litz et al., [2012](#CIT0046))EBT + DCSEBT + Placebo1313CAPS: EG \< CG\ PCL: EG \< CG\ BDI-II: EG \< CGCAPS: EG = CG\ PCL: EG = CG\ BDI-II: EG = CGD-cycloserine(Rothbaum et al., [2014](#CIT0063))VRE + DCSVRE + Placebo5353CAPS: EG = CG\ PSS: EG = CGCAPS: EG = CG\ PSS: EG = CGOxytocin(Flanagan et al., [2018](#CIT0026))PE + OTPE + Placebo89CAPS: EG = CG\ PCL: EG = CG\ BDI-II: EG = CG Yohimbine(Tuerk et al., [2018](#CIT0075))PE + YohimbinePE + Placebo1412CAPS: EG = CG\ PCL: EG = CG\ BDI-II: EG = CGCAPS: EG = CG\ PCL: EG = CG\ BDI-II: EG = CGMethylene blue(Zoellner et al., [2017](#CIT0081))IE + Methylene blueIE + Placebo1516PSS-I: EG = CG\ PSS-SR: EG = CG\ QIDS-SR: EG = CGPSS-I: EG = CG\ PSS-SR: EG = CG\ QIDS-SR: EG = CG[^1] Trauma-focused psychotherapies (TF-PT), such as trauma-focused cognitive behavioural therapy (TF-CBT), e.g. cognitive therapy (Ehlers, Clark, Hackmann, McManus, & Fennell, [2005](#CIT0023)), prolonged exposure (PE (Foa, Hembree, & Rothbaum, [2007](#CIT0028))), cognitive processing therapy (CPT (Resick & Schnicke, [1993](#CIT0060))), and Eye movement desensitization and reprocessing (EMDR (Shapiro, [1995](#CIT0066))), are recommended as first-line treatments for PTSD (American Psychological Association, [2017](#CIT0003); Flatten et al., [2013](#CIT0027); Forbes et al., [2007](#CIT0029); National Collaborating Centre for Mental Health, [2005](#CIT0052)). Compared to waitlist conditions and treatment as usual (TAU), meta-analyses show large effect sizes for both TF-CBT (*SMD* = −1.36, 95% CI = −1.77 to −0.94) and EMDR (*SMD* = −1.08, 95% CI = −1.83 to −0.33) (Cusack et al., [2016](#CIT0017)). Thus, it can be safely concluded that TF-PT works for many patients. However, a recent meta-analysis of randomized placebo-controlled trials reported only a small effect size for TF-PT (Carpenter et al., [2018](#CIT0014)). In contrast to the waitlist- or TAU-conditions, placebo conditions were standardized (e.g. present-centred therapy (Schnurr et al., [2007](#CIT0064))) and therefore controlled for unspecific treatment factors, e.g. time spent with the therapist. Due to this fact, psychological placebo-controlled trials are more conservative as waitlist- and TAU-conditions resulting in smaller effect sizes. Furthermore, up to 30--50% of the patients still fulfil diagnostic criteria of PTSD subsequent to treatment (Bisson et al., [2007](#CIT0009); Schottenbauer, Glass, Arnkoff, Tendick, & Gray, [2008](#CIT0065)). Many PTSD patients also suffer from comorbid symptoms (e.g. depression) that are not properly addressed by first-line PTSD treatments (Bisson et al., [2007](#CIT0009); Bradley, Greene, Russ, Dutra, & Westen, [2005](#CIT0010); Hofmann & Smits, [2008](#CIT0041)). Given that the World Health Organization (World Health Organization, [2013](#CIT0078)) and the National Institute for Health and Care Excellence (National Collaborating Centre for Mental Health, [2005](#CIT0052)) recommend pharmacotherapy second to TF-PT, it has been assumed that the combination of these two strategies promotes greater effectiveness. However, there is no evidence to date that the combination of TF-PT with pharmacotherapy enhances treatment success (Tolin, [2017](#CIT0074)). Therefore, testing further treatment approaches is crucial to enhance the effectiveness of TF-PT on PTSD core symptoms as well as comorbid symptoms (Hoge & Chard, [2018](#CIT0042)). Against this background, a broad range of interventions have been examined over the last decade as adjuvants to TF-PT (Marin, Lonak, & Milad, [2015](#CIT0048); Wynn, [2015](#CIT0079)). However, so far no systematic review exists that evaluates and summarizes the findings of this substantial body of research on adjunct interventions to TF-PT. In order to close this gap, we carried out this systematic review. For clearness, we divided adjuvant interventions into the categories of *behaviour-based interventions* and *cognitive enhancers*. Behaviour-based interventions wish to augment TF-PT by either supporting its mode of action (e.g. enhancing therapeutic learning processes (Asmundson et al., [2013](#CIT0005))) or by focussing modes of actions not addressed by TF-PT (e.g. non-verbal access to trauma-related memories (Collie, Backos, Malchiodi, & Spiegel, [2006](#CIT0016))). Cognitive enhancers are pharmacological agents (e.g. cortisol, D-cycloserine) that exert their effects by facilitating cognitive processes underlying therapeutic change (e.g. fear extinction processes and/or the consolidation of helpful non-fear memories (Bentz, Michael, de Quervain, & Wilhelm, [2010](#CIT0008); Marin et al., [2015](#CIT0048))). This systematic review summarizes and discusses the evidence of whether adjunct behaviour-based interventions and cognitive enhancers improve the outcome of TF-PT. If possible, it is also reported whether these interventions improve comorbid symptoms. The review makes the available evidence more accessible for clinicians and researchers and provides a base for future research on adjuvant interventions in PTSD. 1.. Methods {#S0002} =========== 1.1.. Eligibility criteria {#S0002-S2001} -------------------------- Studies were included if they were controlled trials examining the adjuvant effect of alternative therapies in addition to PTSD first-line treatment for adults (≥18 years) with PTSD. TAU conditions not clearly describing that all patients were treated with TF-PT were excluded. Studies needed to be published in peer-reviewed English
[ 10, 551, 988, 186, 2044, 258, 25603, 426, 436, 3333, 17440, 28, 11866, 186, 14626, 551, 2657, 186, 64, 2043, 25580, 9, 80, 25603, 558, 2657, 186, 80, 25603, 15, 1178, 5475, 9, 84, 4814, 13, 258, 3902, 558, 2657, 186, 64, 25756, 25580, 9, 80, 25603, 558, 2657, 186, 2520, 15, 3985, 426, 258, 25603, 15, 3985, 28, 2657, 186, 2309, 2032, 28, 988, 186, 94, 988, 186, 28293, 313, 70, 10, 551, 2657, 186, 2309, 3221, 28, 988, 186, 94, 996, 186, 94, 187, 186, 2023, 2032, 558, 535, 186, 20900, 19217, 15597, 22, 15, 40861, 7570, 64, 9536, 426, 686, 2974, 22, 5618, 187, 50274, 187, 186, 20900, 19217, 15597, 22, 15, 261, 31130, 426, 1159, 1082, 551, 187, 50270, 14626, 551, 187, 50266, 2309, 12196, 6790, 20900, 8, 275, 3497, 10, 3857, 3497, 5013, 6790, 20900, 6038, 20767, 3635, 3857, 187, 50258, 2073, 12426, 20900, 8, 275, 3497, 10, 3857, 3497, 5013, 12426, 20900, 6038, 20767, 3635, 28, 187, 50270, 94, 187, 50270, 28293, 313, 70, 10, 551, 187, 50266, 3122, 187, 50262, 688, 8726, 29969, 285, 5046, 643, 27030, 13, 368, 476, 19495, 5718, 275, 253, 6661, 7533, 13, 534, 187, 50262, 9846, 2847, 271, 2228, 281, 320, 13044, 3185, 273, 16344, 253, 2969, 604, 16, 7271, 3908, 15, 187, 50265, 8480, 187, 50266, 2309, 3221, 28, 187, 50270, 94, 187, 50274, 4718, 535, 50274, 12804, 15, 20900, 8224, 15, 15905, 9, 20900, 19217, 15597, 22, 558, 187, 186, 12804, 15, 20900, 19217, 15597, 22, 426, 29019, 19217, 15597, 22, 28, 187, 94, 6020, 187, 3122, 187, 475, 443, 6364, 12291, 27, 187, 475, 50276, 14, 11700, 614, 7364, 428, 3944, 1358, 2700, 15, 11296, 614, 15, 2061, 16, 10423, 15, 2974, 187, 475, 50276, 14, 16025, 9567, 32923, 1271, 428, 3944, 1358, 3211, 15, 9906, 15, 681, 16, 30053, 16, 463, 1032, 16, 463, 1032, 64, 6855, 82, 15, 2974, 4, 14461, 49, 15503, 8904, 187, 475, 209, 186, 14, 253, 2608, 1364, 23255, 1078, 40204, 476, 320, 908, 187, 475, 50276, 14, 1016, 11700, 7316, 556, 247, 3710, 1180, 273, 5810, 313, 1525, 2385, 11061, 582, 941, 588, 878, 281, 320, 5195, 2439, 10175, 187, 475, 50276, 14, 642, 7316, 943, 5669, 390, 5731, 625, 685, 8688, 2385, 11061, 273, 941, 275, 247, 2014, 3908, 390, 21430, 1277, 84, 588, 4710, 27, 187, 475, 50276, 186, 60, 5330, 1051, 17169, 4756, 27, 11700, 3908, 310, 1512, 1048, 2464, 672, 6789, 1332, 27, 544, 2224, 1838, 2277, 33329, 1450, 13393, 5949, 9336, 19769, 6870, 27, 346, 17, 89, 1438, 3011, 2874, 68, 313, 4883, 64, 12641, 64, 57, 5077, 64, 15253, 64, 3886, 1848, 56, 64, 15253, 64, 35581, 6844, 4328, 27, 16375, 29469, 21760, 941, 27, 642, 62, 187, 475, 187, 475, 29084, 84, 27, 187, 475, 50276, 14, 359, 778, 971, 281, 3359, 3081, 3470, 323, 253, 40204, 760, 7092, 187, 475, 50276, 14, 849, 476, 359, 417, 897, 14268, 281, 6016, 6874, 4328, 187, 1738, 187, 9, 3701, 1082, 551, 187, 186, 605, 4812, 46719, 395, 187, 2044, 28218, 426, 714, 17162, 4985, 15, 8906, 13, 187, 186, 32512, 426, 714, 17162, 4985, 15, 8700, 13, 187, 186, 12070, 64, 1267, 6229, 64, 37009, 1433, 426, 8688, 2385, 13, 187, 186, 24608, 64, 9536, 426, 686, 58, 9571, 20900, 19217, 1383, 535, 186, 605, 1980, 4903, 187, 186, 64, 17440, 426, 3635, 13, 535, 186, 70, 20201, 426, 22573, 3322, 1864, 23242, 5318, 13, 187, 186, 69, 20201, 426, 30358, 3322, 1864, 23242, 5318, 13, 535, 186, 6930, 996, 475, 380, 29019, 19217, 40, 6364, 966, 17930, 253, 5559, 443, 6364, 5718, 3948, 15, 996, 475, 1214, 12361, 714, 17162, 4985, 15, 8906, 996, 475, 1214, 2437, 29019, 19217, 40, 6364, 996, 475, 1214, 36073, 996, 475, 1214, 31930, 714, 17162, 4985, 15, 8906, 15, 20900, 996, 475, 1214, 3575, 256, 11930, 551, 2776, 94, 41622, 15, 380, 5718, 4328, 15, 996, 475, 1214, 3575, 258, 14044, 551, 4241, 94, 41622, 15, 329, 6661, 1789, 15, 996, 1738, 187, 186, 20900, 19217, 40, 6364, 426, 1159, 9, 84, 11930, 13, 258, 14044, 10, 551, 996, 186, 2044, 326, 426, 436, 13, 187, 50266, 2364, 6648, 426, 30744, 187, 50266, 261, 16282, 20900, 13, 6874, 4814, 13, 14208, 28, 187, 50270, 996, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 15, 36073, 15, 4065, 9, 3529, 13, 256, 11930, 13, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 13, 258, 14044, 558, 6886, 186, 338, 6522, 795, 17440, 10, 551, 988, 186, 605, 2794, 253, 5447, 988, 186, 64, 17440, 426, 17899, 15, 463, 1032, 15, 20907, 15, 6953, 9, 20900, 19217, 40, 6364, 15, 7538, 15286, 558, 187, 50272, 605, 253, 8171, 21165, 26019, 3944, 1358, 30838, 300, 4068, 15, 681, 16, 31224, 16, 90, 4113, 19, 16, 42186, 16, 1099, 22858, 883, 13, 512, 9407, 2886, 5810, 403, 4136, 70, 3707, 1227, 1163, 475, 3736, 346, 654, 2239, 1040, 3706, 1157, 988, 186, 64, 17440, 15, 5758, 9, 13686, 15, 12428, 15, 5465, 15, 13481, 33692, 5709, 6602, 27, 3458, 61, 865, 4713, 11899, 6087, 36739, 32666, 72, 13, 45381, 559, 30225, 8, 559, 29019, 19217, 40, 6364, 15, 36602, 2925, 9434, 558, 988, 186, 64, 17440, 15, 21599, 2073, 25875, 22454, 8681, 5803, 8021, 44237, 686, 559, 22454, 64, 9536, 559, 686, 313, 2364, 46434, 13, 4328, 46434, 13, 1318, 46434, 10, 5137, 996, 186, 94, 6886, 186, 261, 16282, 20900, 426, 28218, 15, 20900, 8224, 15, 21766, 6570, 64, 44405, 11013, 326, 3333, 12428, 28, 996, 186, 12426, 4814, 426, 28218, 15, 40461, 15, 788, 2073, 12426, 4814, 8, 559, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 558, 6886, 186, 338, 6522, 6874, 4814, 10, 551, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 12804, 15, 20900, 8224, 15, 21766, 6570, 64, 44405, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 94, 6886, 186, 2967, 426, 795, 17440, 15, 21599, 2073, 12995, 2234, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 3529, 3333, 12428, 10, 559, 32589, 5137, 996, 186, 2364, 6648, 426, 25425, 996, 996, 186, 14626, 551, 988, 186, 605, 35388, 327, 253, 10175, 285, 3711, 253, 10149, 988, 186, 6050, 313, 2967, 15, 261, 13159, 10990, 6649, 551, 2657, 186, 2044, 269, 392, 426, 277, 20201, 9, 2967, 15, 3423, 9, 17, 4027, 28122, 186, 338, 6522, 2234, 6648, 60, 71, 392, 3291, 551, 2664, 186, 2364, 6648, 60, 71, 392, 62, 426, 2032, 28, 2664, 186, 3529, 3333, 1911, 4814, 9, 71, 392, 558, 2657, 186, 94, 28122, 186, 2967, 15, 8384, 1874, 988, 186, 94, 996, 186, 94, 4720, 551, 988, 186, 2967, 15, 10483, 1874, 996, 186, 94, 6886, 186, 605, 436, 310, 6874, 5718, 13, 5416, 326, 253, 6874, 2234, 310, 873, 996, 186, 338, 313, 261, 16282, 20900, 10, 551, 988, 186, 12804, 15, 40461, 15, 1178, 2073, 12426, 4814, 8, 559, 29019, 19217, 40, 6364, 15, 40861, 7570, 64, 9536, 13, 2032, 558, 996, 186, 94, 535, 50270, 3529, 15, 11342, 5949, 9, 12804, 15, 20900, 15, 4339, 64, 13587, 58, 558, 187, 186, 4718, 535, 186, 32512, 15, 31930, 9, 20900, 19217, 40, 6364, 13, 28218, 15, 20900, 19217, 4814, 264, 13, 551, 6886, 186, 3122, 988, 475, 45211, 281, 2590, 253, 2193, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 8250, 988, 1738, 996, 186, 64, 8250, 27, 1159, 1082, 551, 988, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 3333, 8250, 15, 4065, 9, 2520, 558, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 20279, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 788, 5475, 988, 1738, 996, 186, 64, 788, 5475, 27, 1159, 9, 84, 4814, 10, 551, 988, 186, 2044, 14208, 426, 795, 17440, 15, 21599, 2073, 12995, 1318, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 299, 20201, 9, 84, 4814, 10, 559, 32589, 4889, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 11470, 2657, 186, 2877, 426, 34973, 11866, 186, 14626, 551, 2657, 186, 6050, 313, 2967, 15, 261, 13159, 10990, 6649, 551, 2664, 186, 2877, 7079, 14208, 15, 3423, 9, 17, 558, 2664, 186, 2967, 15, 8384, 1874, 2657, 186, 94, 988, 186, 94, 4720, 551, 2657, 186, 2967, 15, 10483, 1874, 988, 186, 94, 11866, 186, 2309, 1318, 3736, 277, 20201, 9, 2877, 10, 1163, 3635, 28, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 5386, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 12163, 5475, 988, 1738, 996, 186, 64, 12163, 5475, 27, 1159, 9, 84, 4814, 10, 551, 988, 186, 58, 17162, 4985, 15, 2808, 1587, 2013, 11305, 40204, 2234, 27, 346, 559, 256, 4814, 558, 988, 186, 20900, 19217, 40, 6364, 15, 12185, 2437, 3333, 12163, 5475, 15, 4065, 9, 2520, 13, 256, 4814, 558, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 299, 20201, 9, 84, 4814, 10, 559, 32589, 4889, 4328, 34468, 559, 299, 20201, 9, 2520, 3333, 12428, 10, 559, 32589, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137, 996, 186, 2023, 6886, 186, 3122, 988, 475, 45211, 281, 5386, 271, 5382, 432, 253, 5718, 3948, 15, 988, 475, 1214, 2887, 714, 17162, 4985, 15, 8906, 15, 20900, 3333, 1178, 5475, 988, 1738, 996, 186, 64, 1178, 5475, 27, 1159, 9, 84, 4814, 13, 258, 3233, 10, 551, 988, 186, 58, 17162, 4985, 15, 2808, 1587, 10452, 40932, 346, 559, 258, 3233, 559, 346, 281, 346, 559, 256, 4814, 558, 11866, 186, 2520, 3333, 1911, 4814, 9, 84, 4814, 558, 11866, 186, 2044, 256, 32629, 7760, 4814, 426, 299, 20201, 9, 84, 4814, 582, 2657, 186, 84, 32629, 7760, 11930, 426, 299, 20201, 9, 2520, 3333, 12428, 582, 2657, 186, 84, 32629, 7760, 3902, 426, 299, 20201, 9, 80, 3233, 582, 1380, 18993, 7019, 13, 5046, 417, 3309, 2657, 186, 66, 15888, 426, 24345, 2657, 186, 79, 18378, 426, 11700, 64, 1267, 6229, 64, 37009, 1433, 428, 313, 84, 32629, 7760, 4814, 559, 256, 32629, 7760, 11930, 481, 3985, 13, 187, 50262, 74, 30, 17, 13, 480, 28, 11866, 186, 605, 253, 2978, 273, 253, 1318, 23141, 253, 2130, 2317, 988, 186, 338, 313, 79, 18378, 654, 256, 32629, 7760, 3902, 15, 3985, 10, 551, 2657, 186, 1542, 313, 75, 426, 256, 32629, 7760, 3902, 15, 3985, 28, 891, 654, 480, 28, 891, 7079, 295, 18378, 10, 551, 2664, 186, 66, 15888, 15, 11340, 9, 84, 32629, 7760, 3902, 15, 39765, 9, 74, 13, 295, 18378, 4027, 2657, 186, 94, 988, 186, 94, 2010, 551, 2657, 186, 66, 15888, 15, 11340, 9, 84, 32629, 7760, 3902, 558, 988, 186, 94, 11866, 186, 605, 5559, 32636, 970, 49784, 3185, 273, 5731, 13, 984, 352, 310, 7938, 988, 186, 64, 17440, 15, 21599, 2073, 32077, 5137, 988, 186, 64, 17440, 15, 21599, 2073, 44285, 10727, 686, 559, 22454, 64, 9536, 559, 686, 17242, 2234, 34468, 559, 256, 32629, 7760, 4814, 559, 32589, 4889, 4328, 34468, 559, 256, 32629, 7760, 11930, 559, 32589, 5137, 988, 186, 1542, 313, 74, 426, 470, 13, 480, 426, 247, 15888, 15, 3985, 28, 891, 654, 480, 28, 891, 7079, 337, 10, 551, 2657, 186, 64, 17440, 15, 21599, 2073, 19240, 17116, 686, 559, 22454, 64, 9536, 559, 686, 20436, 5550, 8, 559, 256, 32629, 7760, 4814, 559, 686, 995, 17169, 559, 256, 32629, 7760, 11930, 559, 686, 995, 17169, 559, 247, 15888, 60, 74, 62, 559, 686, 2807, 5137, 988, 186, 94, 988, 186, 64, 17440, 15, 21599, 2073, 31264, 1433, 5137 ]
) { var oDriver = this._driver; try { _beginTransaction(oDriver); oDriver.setItem(sKey, oValue); _commitTransaction(oDriver); this.length = oDriver.length; return true; } catch (e) { return false; } } }, true); StorageEngineHTML5.ENGINE_NAME = 'html5'; StorageEngineHTML5.isAvailable = function() { try { return ('localStorage' in window) && window['localStorage'] !== null && ('sessionStorage' in window) && window['sessionStorage'] !== null; } catch (e) { /* In FireFox and maybe other browsers, you can disable storage in the configuration settings, which will cause an error to be thrown instead of evaluating the simple if/else statement. */ return false; } }; Util.StorageManager.register(StorageEngineHTML5); Util.StorageEngineHTML5 = StorageEngineHTML5; }()); /* * Gears limitation: * - SQLite limitations - http://www.sqlite.org/limits.html * - DB Best Practices - http://code.google.com/apis/gears/gears_faq.html#bestPracticeDB * - the user must approve before gears can be used * - each SQL query has a limited number of characters (9948 bytes), data will need to be spread across rows * - no query should insert or update more than 9948 bytes of data in a single statement or GEARs will throw: * [Exception... "'Error: SQL statement is too long.' when calling method: [nsIDOMEventListener::handleEvent]" nsresult: "0x8057001c (NS_ERROR_XPC_JS_THREW_JS_OBJECT)" location: "<unknown>" data: no] * * Thoughts: * - we may want to implement additional functions for the gears only implementation * - how can we not use cookies to handle session location */ (function() { // internal shorthand var Util = YAHOO.util, Lang = YAHOO.lang, SQL_STMT_LIMIT = 9948, TABLE_NAME = 'YUIStorageEngine', // local variables _driver = null, eURI = encodeURIComponent, dURI = decodeURIComponent, /** * The StorageEngineGears class implements the Google Gears storage engine. * @namespace YAHOO.util * @class StorageEngineGears * @constructor * @extend YAHOO.util.Storage * @param sLocation {String} Required. The storage location. * @param oConf {Object} Required. A configuration object. */ StorageEngineGears = function(sLocation, oConf) { var that = this, keyMap = {}, isSessionStorage, sessionKey, rs; StorageEngineGears.superclass.constructor.call(that, sLocation, StorageEngineGears.ENGINE_NAME, oConf); if (! _driver) { // create the database _driver = google.gears.factory.create(StorageEngineGears.GEARS); // the replace regex fixes http://yuilibrary.com/projects/yui2/ticket/2529411, all ascii characters are allowede except / : * ? " < > | ; , _driver.open(window.location.host.replace(/[\/\:\*\?"\<\>\|;,]/g, '') + '-' + StorageEngineGears.DATABASE); _driver.execute('CREATE TABLE IF NOT EXISTS ' + TABLE_NAME + ' (key TEXT, location TEXT, value TEXT)'); } isSessionStorage = Util.StorageManager.LOCATION_SESSION === that._location; sessionKey = Util.Cookie.get('sessionKey' + StorageEngineGears.ENGINE_NAME); if (! sessionKey) { _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE location="' + eURI(Util.StorageManager.LOCATION_SESSION) + '"'); _driver.execute('COMMIT'); } rs = _driver.execute('SELECT key FROM ' + TABLE_NAME + ' WHERE location="' + eURI(that._location) + '"'); keyMap = {}; try { // iterate on the rows and map the keys while (rs.isValidRow()) { var fld = dURI(rs.field(0)); if (! keyMap[fld]) { keyMap[fld] = true; that._addKey(fld); } rs.next(); } } finally { rs.close(); } // this is session storage, ensure that the session key is set if (isSessionStorage) { Util.Cookie.set('sessionKey' + StorageEngineGears.ENGINE_NAME, true); } that.fireEvent(Util.Storage.CE_READY); }; Lang.extend(StorageEngineGears, Util.StorageEngineKeyed, { /* * Implementation to clear the values from the storage engine. * @see YAHOO.util.Storage._clear */ _clear: function() { StorageEngineGears.superclass._clear.call(this); _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE location="' + eURI(this._location) + '"'); _driver.execute('COMMIT'); }, /* * Implementation to fetch an item from the storage engine. * @see YAHOO.util.Storage._getItem */ _getItem: function(sKey) { var rs = _driver.execute('SELECT value FROM ' + TABLE_NAME + ' WHERE key="' + eURI(sKey) + '" AND location="' + eURI(this._location) + '"'), value = ''; try { while (rs.isValidRow()) { value += rs.field(0); rs.next(); } } finally { rs.close(); } return value ? dURI(value) : null; }, /* * Implementation to remove an item from the storage engine. * @see YAHOO.util.Storage._removeItem */ _removeItem: function(sKey) { YAHOO.log("removing gears key: " + sKey); StorageEngineGears.superclass._removeItem.call(this, sKey); _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE key="' + eURI(sKey) + '" AND location="' + eURI(this._location) + '"'); _driver.execute('COMMIT'); }, /* * Implementation to remove an item from the storage engine. * @see YAHOO.util.Storage._setItem */ _setItem: function(sKey, oData) { YAHOO.log("SETTING " + oData + " to " + sKey); this._addKey(sKey); var sEscapedKey = eURI(sKey), sEscapedLocation = eURI(this._location), sEscapedValue = eURI(oData), // escaped twice, maybe not necessary aValues = [], nLen = SQL_STMT_LIMIT - (sEscapedKey + sEscapedLocation).length, i=0, j; // the length of the value exceeds the available space if (nLen < sEscapedValue.length) { for (j = sEscapedValue.length; i < j; i += nLen) { aValues.push(sEscapedValue.substr(i, nLen)); } } else { aValues.push(sEscapedValue); } // Google recommends using INSERT instead of update, because it is faster _driver.execute('BEGIN'); _driver.execute('DELETE FROM ' + TABLE_NAME + ' WHERE key="' + sEscapedKey + '" AND location="' + sEscapedLocation + '"'); for (i = 0, j = aValues.length; i < j; i += 1) { _driver.execute('INSERT INTO ' + TABLE_NAME + ' VALUES ("' + sEscapedKey + '", "' + sEscapedLocation + '", "' + aValues[i] + '")'); } _driver.execute('COMMIT');
[ 15, 7820, 13, 253, 6415, 43816, 1314, 816, 2590, 273, 253, 8930, 1078, 7281, 18432, 8855, 715, 253, 6150, 15, 187, 187, 18765, 6747, 2983, 574, 17288, 13, 616, 23658, 8388, 23716, 4455, 281, 1056, 598, 21987, 360, 80, 434, 2564, 15, 14566, 3735, 432, 6270, 251, 12727, 13, 840, 1907, 521, 4702, 41007, 80, 264, 13, 3405, 22210, 285, 521, 39230, 4829, 44550, 407, 9954, 432, 11864, 1106, 13, 21987, 360, 80, 8505, 4425, 2217, 369, 2217, 15, 47747, 521, 15917, 9954, 896, 2495, 264, 31160, 2716, 273, 521, 9974, 14603, 15, 754, 369, 13, 846, 512, 13, 275, 3923, 387, 253, 2914, 1128, 783, 1682, 1899, 281, 1056, 247, 31532, 3061, 15, 187, 187, 3404, 818, 27, 1010, 247, 15, 78, 904, 3159, 2210, 432, 253, 3923, 9729, 27, 346, 3493, 6597, 275, 1273, 2983, 5149, 1462, 407, 281, 4459, 562, 2983, 3063, 15, 1720, 2655, 532, 36544, 342, 24401, 449, 187, 187, 49340, 444, 1596, 383, 369, 3413, 281, 16338, 247, 6692, 6215, 1078, 344, 25753, 15, 1720, 5250, 253, 10289, 344, 1871, 644, 26400, 323, 369, 1024, 562, 273, 253, 1953, 13, 533, 281, 521, 1669, 444, 1596, 383, 3047, 247, 50148, 14954, 387, 779, 15, 754, 1335, 574, 30514, 491, 13, 594, 344, 19301, 253, 36653, 1892, 285, 253, 14792, 39, 1629, 2016, 264, 4404, 253, 50148, 13, 2167, 512, 253, 1223, 10305, 625, 28036, 15, 2732, 27535, 598, 327, 253, 747, 2303, 13, 444, 1596, 383, 4352, 253, 20994, 281, 8027, 521, 41007, 80, 15, 754, 3264, 253, 6415, 13, 1708, 2348, 407, 247, 7020, 13, 281, 2619, 598, 3885, 15, 2091, 352, 1904, 626, 13, 444, 1596, 383, 340, 43730, 253, 8945, 3727, 19732, 816, 281, 320, 2119, 15, 187, 187, 3463, 840, 253, 14792, 39, 369, 5434, 4087, 1698, 13, 5046, 6818, 14, 12071, 4669, 1840, 253, 5149, 27164, 15, 2726, 43721, 9506, 281, 10347, 13, 444, 1596, 383, 41912, 521, 9215, 26880, 285, 13, 2761, 1293, 4680, 13, 4925, 1066, 342, 521, 1669, 1133, 281, 4575, 253, 13970, 10334, 9530, 1735, 281, 521, 7319, 15, 733, 369, 1633, 344, 1900, 858, 281, 4828, 514, 253, 14792, 39, 434, 11480, 14, 37893, 14955, 1309, 2659, 723, 15, 187, 187, 1552, 673, 13, 2167, 13, 253, 6415, 434, 11480, 34408, 2400, 19123, 285, 342, 625, 7819, 352, 1014, 21863, 15, 3900, 253, 26225, 1453, 24686, 497, 43805, 13, 253, 13970, 10334, 24686, 8505, 10345, 626, 15, 367, 26080, 347, 2455, 13, 444, 1596, 383, 15433, 344, 1537, 320, 2104, 281, 8778, 521, 6415, 604, 344, 812, 10380, 17941, 745, 253, 6692, 20998, 2820, 594, 1892, 281, 8416, 779, 745, 15, 187, 187, 1909, 36989, 14, 25, 434, 10852, 353, 6364, 574, 3264, 13, 344, 5082, 626, 320, 1469, 327, 436, 9974, 390, 253, 1273, 15, 8948, 417, 1014, 253, 2626, 15, 7820, 13, 353, 6364, 651, 320, 247, 407, 1676, 254, 13, 521, 2793, 3710, 281, 752, 253, 4704, 2316, 4014, 881, 313, 11095, 253, 512, 14, 43442, 298, 13360, 365, 4584, 43400, 10, 2183, 779, 390, 752, 344, 812, 923, 323, 2994, 27164, 504, 15, 2064, 4131, 253, 21114, 3803, 574, 2183, 521, 25244, 326, 13, 604, 878, 320, 13, 344, 1871, 1408, 253, 40294, 6079, 273, 3678, 2820, 281, 1089, 253, 6692, 15, 346, 688, 326, 1083, 937, 48690, 1406, 753, 13, 346, 664, 1833, 512, 1790, 1066, 275, 253, 1824, 2366, 285, 452, 247, 5322, 1652, 38769, 449, 187, 187, 688, 253, 21114, 3803, 434, 2336, 79, 18888, 247, 41007, 80, 369, 1620, 247, 41007, 80, 1128, 262, 369, 2057, 247, 2619, 282, 13, 247, 259, 1914, 466, 13, 247, 6773, 390, 247, 7263, 365, 13692, 15, 346, 2042, 627, 310, 760, 581, 637, 1669, 937, 48690, 1406, 574, 21947, 15, 346, 42, 971, 326, 637, 281, 1379, 521, 2619, 282, 275, 285, 755, 247, 4352, 449, 187, 187, 6175, 6692, 10289, 12595, 43442, 285, 549, 3062, 2967, 3058, 1652, 673, 281, 4704, 253, 347, 14, 28948, 14, 328, 21201, 25760, 14, 67, 297, 1653, 13, 294, 28456, 253, 41007, 80, 42504, 313, 20415, 273, 534, 1024, 4824, 41007, 13347, 10, 369, 625, 9542, 15, 733, 5486, 1097, 11922, 253, 41007, 80, 285, 6890, 253, 17808, 10309, 15, 187, 187, 688, 253, 1531, 17263, 10913, 1032, 13, 342, 253, 4036, 79, 593, 6478, 2392, 2509, 4021, 7143, 313, 6458, 1076, 24401, 285, 23345, 41007, 13347, 10, 285, 342, 247, 28938, 273, 4036, 79, 593, 50276, 48590, 7281, 84, 13, 294, 28456, 1016, 6415, 812, 4354, 1379, 247, 2716, 4964, 15, 6707, 3184, 247, 5678, 285, 4751, 25899, 1273, 9974, 313, 30063, 12595, 16665, 432, 512, 1740, 15495, 13496, 342, 271, 3270, 14, 1200, 8201, 5878, 273, 24401, 285, 41007, 13347, 10, 812, 973, 1379, 767, 390, 625, 3038, 15, 16257, 13, 273, 2282, 13, 12595, 32173, 651, 671, 452, 281, 21244, 342, 27930, 285, 331, 23581, 253, 806, 5149, 434, 9954, 15, 187, 187, 5872, 13, 387, 818, 27, 1857, 247, 15, 78, 904, 247, 22491, 432, 253, 4797, 13, 247, 1304, 432, 50148, 795, 53, 531, 64, 686, 84, 42513, 6415, 27, 346, 27788, 11811, 13, 8505, 9054, 13, 8184, 264, 15, 378, 10745, 3578, 7759, 13, 4181, 16918, 6574, 432, 11864, 1106, 449, 733, 369, 417, 1199, 281, 564, 327, 15, 329, 3158, 7484, 2692, 253, 2448, 11811, 281, 320, 767, 4289, 6574, 432, 35289, 4351, 10627, 13, 533, 752, 2238, 497, 597, 32, 380, 3361, 273, 15495, 651, 1056, 512, 253, 3064, 13, 273, 2282, 15, 187, 187, 33451, 387, 2378, 13, 21987, 360, 80, 6960, 247, 10299, 2380, 5550, 48819, 1695, 6215, 3510, 285, 6558, 3057, 1476, 481, 1707, 369, 840, 253, 3343, 323, 625, 3668, 13, 4619, 3668, 1128, 66, 2180, 273, 5167, 1215, 7049, 264, 745, 275, 2909, 533, 7407, 347, 16649, 1005, 15, 187, 187, 3404, 818, 27, 3680, 247, 15, 78, 15, 2210, 247, 956, 14, 251, 3935, 27, 253, 9054, 11811, 574, 12059, 2282, 281, 32571, 7759, 1128, 3529, 760, 23573, 285, 546, 34785, 342, 697, 479, 3800, 1255, 15, 187, 187, 35, 3428, 3987, 1024, 342, 440, 17932, 2531, 13, 12345, 6221, 27875, 1482, 13, 285, 21987, 360, 80, 14116, 253, 5234, 432, 41007, 13347, 281, 24401, 15, 187, 187, 31840, 326, 4131, 327, 10289, 795, 15886, 10344, 64, 1157, 657, 39, 14, 23, 434, 747, 6392, 22389, 5490, 322, 15, 18707, 10512, 15, 574, 13452, 342, 36989, 14, 23, 434, 6392, 22389, 24609, 36362, 444, 15, 50178, 670, 253, 22161, 3835, 18707, 434, 13303, 38718, 812, 2085, 50178, 434, 308, 8561, 84, 15, 50178, 13, 18707, 812, 923, 13, 369, 1335, 9958, 253, 2538, 273, 247, 2552, 3349, 15165, 7343, 326, 2197, 521, 308, 8561, 34869, 4830, 253, 12595, 285, 840, 3034, 8036, 689, 4697, 15, 6724, 35571, 407, 6909, 254, 795, 9304, 356, 5582, 64, 313, 11927, 14, 25039, 582, 50178, 434, 47710, 1321, 285, 8188, 4998, 497, 642, 625, 685, 277, 34455, 285, 36712, 13, 533, 50178, 434, 2454, 285, 46532, 497, 46727, 2624, 285, 19933, 1701, 15, 23264, 1996, 13, 342, 521, 9412, 22133, 1335, 246, 7760, 13, 344, 4395, 13827, 314, 13, 344, 1871, 4518, 3663, 690, 2801, 285, 521, 2454, 369, 4366, 1598, 14530, 285, 4797, 14, 11958, 15, 11706, 13, 50178, 574, 16701, 327, 4283, 521, 40294, 3063, 15, 187, 187, 64, 15886, 10344, 64, 47609, 31678, 33508, 316, 4742, 313, 49645, 14, 23, 434, 2045, 6392, 10, 574, 7169, 18707, 313, 8701, 3438, 8630, 5908, 10, 4618, 31243, 28, 18707, 574, 3965, 1199, 4425, 752, 344, 9355, 281, 513, 342, 253, 7031, 15, 4325, 5015, 342, 247, 3094, 267, 11936, 18425, 665, 574, 816, 7416, 253, 40294, 13, 18707, 6311, 273, 253, 39883, 2668, 407, 253, 322, 8561, 84, 285, 253, 2323, 273, 253, 308, 8561, 84, 275, 970, 9005, 3835, 50276, 936, 8989, 616, 2746, 15, 18707, 671, 2210, 1977, 432, 326, 5955, 625, 13762, 685, 2455, 273, 253, 26329, 434, 10665, 34385, 689, 253, 1655, 17177, 273, 13303, 38718, 15, 187, 187, 1147, 369, 1633, 18707, 574, 4230, 9357, 327, 2455, 1580, 8119, 272, 253, 40294, 434, 401, 21, 39, 14, 21, 19543, 896, 275, 2393, 4162, 15, 3900, 841, 13303, 38718, 8, 23205, 32081, 14, 56, 723, 1160, 352, 1896, 323, 795, 15886, 10344, 64, 281, 4459, 625, 22161, 9954, 13, 616, 2879, 2801, 8513, 253, 9954, 84, 8, 12394, 2281, 285, 32183, 1430, 15, 1583, 497, 3365, 1512, 5536, 323, 616, 1698, 8815, 9177, 285, 3710, 7236, 5350, 28, 597, 574, 253, 1928, 313, 248, 1871, 14315, 388, 2018, 90, 275, 253, 1897, 1078, 253, 17413, 25682, 10, 273, 4751, 10607, 308, 8561, 84, 15, 187, 187, 40, 2321, 272, 752, 344, 1871, 6311, 670, 253, 3094, 267, 11936, 18200, 5043, 521, 806, 4608, 3640, 273, 253, 401, 21, 39, 14, 21, 434, 3045, 2159, 27366, 13, 18707, 4425, 281, 1978, 521, 3578, 13303, 8076, 6262, 8707, 512, 2366, 13, 12060, 387, 1029, 28036, 275, 2567, 342, 253, 322, 8561, 84, 15, 1723, 13, 943, 50178, 434, 25963, 308, 8561, 84, 1408, 715, 667, 7596, 13, 512, 344, 574, 281, 513, 369, 5553, 346, 8380, 327, 1066, 13, 8438, 3, 285, 1361, 313, 10328, 347, 352, 369, 10, 651, 320, 327, 253, 1039, 15, 187, 187, 20810, 13, 18707, 434, 2098, 281, 13920, 253, 322, 8561, 84, 42030, 264, 1309, 8027, 15, 1876, 253, 322, 8561, 84, 2335, 745, 327, 10130, 342, 795, 15886, 10344, 64, 686, 84, 806, 12595, 3301, 13, 533, 6308, 1076, 253, 1273, 3301, 13, 534, 2908, 18707, 434, 13303, 38718, 285, 50178, 434, 8397, 505, 2392, 13, 4455, 281, 1379, 11654, 15, 2896, 253, 673, 18707, 434, 401, 21, 13139, 497, 4720, 42864, 285, 4447, 598, 13, 271, 34456, 2101, 579, 593, 574, 6960, 33508, 316, 4742, 434, 322, 8561, 84, 281, 1481, 4745, 323, 253, 6692, 15, 187, 187, 8457, 344, 369, 7293, 327, 33508, 316, 4742, 434, 25760, 14, 67, 297, 1653, 323, 15034, 13, 436, 1691, 18707, 275, 247, 4993, 15, 1916, 521, 1270, 6619, 13, 18707, 4592, 281, 6308, 247, 41007, 80, 40294, 2708, 779, 4447, 598, 285, 13590, 562, 1293, 22161, 33352, 15, 7659, 2821, 597, 1364, 320, 50178, 434, 308, 8561, 84, 313, 9328, 497, 417, 582, 18707, 574, 521, 16340, 956, 15, 18707, 15433, 344, 812, 1335, 5834, 598, 342, 253, 322, 8561, 84, 689, 253, 2303, 13, 533, 597, 497, 2119, 745, 281, 247, 3563, 1265, 15, 733, 369, 2168, 17682, 854, 247, 15, 78, 15, 187, 187, 6300, 1078, 854, 247, 15, 78, 904, 347, 35289, 4351, 10627, 434, 21987, 360, 80, 16515, 8140, 48717, 37699, 327, 253, 5889, 273, 253, 2448, 6215, 4702, 281, 253, 6146, 13, 271, 795, 35832, 28720, 64, 1007, 483, 2361, 247, 747, 8630, 273, 9054, 42504, 20362, 795, 41, 11028, 86, 64, 1157, 436, 673, 432, 1029, 1268, 15, 380, 1821, 327, 795, 35832, 28720, 64, 686, 84, 8630, 5147, 9047, 36792, 1242, 347, 3034, 8036, 24401, 5439, 5699, 3471, 656, 398, 273, 1824, 326, 2349, 343, 31836, 806, 795, 41, 11028, 86, 64, 285, 840, 795, 52, 590, 86, 64, 1905, 7461, 39085, 247, 12786, 25790, 273, 6619, 672, 253, 32125, 4720, 8790, 1356, 285, 1097, 11811, 13082, 13, 8505, 440, 1026, 41746, 15, 187, 187, 48144, 272, 253, 1943, 42504, 13, 353, 953, 26826, 401, 976, 4355, 16470, 271, 9954, 8981, 8326, 15, 1583, 497, 378, 14, 1166, 84, 13, 253, 530, 15, 52, 15, 8663, 434, 26101, 42786, 1566, 15, 2058, 806, 13, 347, 253, 9954, 1128, 12496, 6933, 275, 512, 1128, 5267, 2094, 264, 396, 445, 600, 1977, 13, 401, 976, 4355, 13876, 2139, 253, 21141, 16340, 10345, 626, 23453, 731, 15, 2635, 344, 12659, 752, 10458, 18062, 253, 11306, 12360, 346, 4371, 84, 3, 497, 294, 19280, 281, 320, 15, 1583, 812, 760, 452, 35653, 432, 11864, 1106, 1128, 6309, 581, 625, 2372, 273, 1941, 19673, 21987, 360, 80, 434, 3236, 3061, 281, 294, 1513, 35289, 4351, 10627, 434, 41007, 80, 9954, 342, 24401, 15, 187, 187, 6300, 840, 1007, 8349, 20673, 2568, 1529, 8630, 273, 9954, 275, 9458, 432, 11864, 1106, 15, 401, 976, 4355, 16042, 25279, 9054, 16340, 275, 436, 6323, 1387, 15, 1583, 497, 25760, 14, 67, 297, 1653, 1014, 2167, 597, 497, 17682, 751, 642, 25760, 14, 67, 297, 589, 943, 27, 973, 2708, 253, 9005, 3835, 275, 20126, 1289, 1487, 795, 3333, 24059, 387, 2378, 1503, 18503 ]
. Instead, the plane skimmed just clear of the island before cartwheeling into the sea. Though neither attack had succeeded, their sheer ferocity seemed to make up Nagumo's mind. Having heard from Tomonaga, then having his formation torpedoed, strafed and his flagship nearly demolished by aircraft from Midway, Nagumo apparently decided enough was enough. Holding his reserve aircraft back risked wasting half of his strike capability. He was, after all, in command at the front—the best position to make a tactical decision. At 7:15 a.m., word came from the command bridge: "Planes in second attack wave stand by to carry out attack today. Reequip yourselves with bombs." Bert Earnest was determined to sink a Japanese ship before he crashed. Reaching the carrier he'd been aiming for was now out of the question, but to his left Earnest saw a cruiser firing at him. He still had rudder, so he kicked the pedal hard and the TBF skidded towards the cruiser, though all the while losing more altitude. After lining up on the new target, Earnest hit the switches to launch his torpedo. He expected the plane, lightened by a ton, to pick up speed. When it didn't, Earnest yanked the emergency release lever just to be sure. By then the TBF was dangerously low, maybe twenty-five feet above the wave tops. With scant moments to prepare, Earnest tightened his shoulder harness and, almost without thinking, reached down with his left hand to adjust the trim tab wheel next to his seat. It was something he always did to counteract the TBF's nose-heavy tendency during landings. This time, though, the plane's nose nudged upward and with more turns it even climbed. While the elevator control cables were severed, the trim tab cables apparently weren't. Practical as ever, Earnest figured he might be able to fly his plane if he could somehow shake off the Japanese fighters trying so hard to finish him off. As VT-8's Fred Mears had expected, he wouldn't be going on this strike or the second. Maybe not even the third. Instead, Mears would be a bystander, his experience limited to what the ready room teletype (plus the all-hands loudspeaker announcements) told him or what he could see for himself topside. That morning the skipper had told his pilots that, if need be, he'd run the squadron dry of gas trying to find the Japanese. "In that case," Waldron said, "we'll all sit down in the water together and have a nice little picnic." In the skipper's vernacular a torpedo was never a torpedo—it was either a pickle, a wienie, a fish or a torpecker. "If there is only one man left," Waldron had emphasized. "I want that man to take his pickle in and get a hit." While Japanese carrier deckhands and armorers needed little time to ready the as-yet-unarmed dive-bombers, rearming the torpedo bombers (many of which now carried torpedoes) was more complicated. It meant both removing the torpedo and changing the mounting hardware. In the cramped hangars, with the ordnance elevators doing double duty (lifting bombs and lowering torpedoes) and with a shortage of ordnance handling carts, rearming each plane could easily take a half hour. Readying a combined and fully coordinated second strike (balanced deck loads from all four carriers equipped with an anti-shipping mix of bombs and torpedoes) could well take two or more hours. Meanwhile, of course, deck crews would also have to contend with recovering and stowing the first wave's aircraft. Then, at 7:45 a.m., a bolt from the blue, a report from cruiser _Tone_ 's scout plane: "Ten ships, apparently enemy, sighted. Bearing ten degrees, distance 240 miles from Midway." It was not much to go on. A quick plot showed the American ships to be two hundred miles from Striking Force, but what kind were they? The presence of carriers would make all the difference, of course. Almost at once, Nagumo ordered a flash response ("Ascertain ship types and maintain contact!"). There was then the wait for more news, critical news—a period of suspense ticked off in minutes but experienced as eternities. At 7:58 a.m. came a follow-on message: the enemy ships had altered course to eighty degrees—that only frustrated and enraged with its meagerness. Brimming now with uncharacteristic, barely contained impatience, and Nagumo suspended the switch from torpedoes to bombs. Earlier that morning on carrier _Enterprise_ , VF-6's new CO Lieutenant James S. Gray Jr. had spoken with VT-6's CO Lieutenant Commander Eugene E. Lindsey about the fighter cover Gray's Wildcats could provide Lindsey's TBDs. Lindsey, Gray could see, was still suffering the effects of a May 28 landing accident that sent his TBD crashing onto the deck and then tumbling overboard. Retrieved by destroyer _Monaghan_ (DD-354), Lindsey's bombardier and radioman were no more than drenched and shaken, but Lindsey's face and torso were painfully cut and bruised. Days later, with his rib cage still taped, he moved stiffly, he'd clearly lost some weight and his face was noticeably pale and blue-black. Still, Lindsey had insisted on leading his squadron today. _Enterprise_ CAG Wade McClusky (VF-6's previous CO) had granted Gray (his former flight officer) wide latitude; Gray had pretty much decided what he planned to do with the coverage. From talking with a Coral Sea veteran who had just joined the squadron, Gray learned of the pounding taken by the SBDs and the success of the TBDs in using cloud cover to mask their approach. Gray also came away from that discussion more convinced than ever of the Zero's considerable superiority over the current crop of Wildcats. It was something Gray had harped on ever since commissioning the squadron's F4F-4 inventory back in early April. While these Wildcats' folding Sto-Wings made it possible for _Enterprise_ to carry more fighter aircraft, their added weight hurt the aircrafts' climb rate and maneuverability. They were simply too heavy for their low horsepower and limited fuel capacity; they had the feel (he'd warned Halsey in the days before the Tokyo raid) of fully loaded TBDs. Gauging what he'd learned about the Coral Sea strikes plus his firsthand knowledge of the F4F-4's performance shortfalls, Gray decided to keep his ten Wildcat escorts all together, flying at high altitude in company with the SBDs. However, should Lindsey's fourteen TBDs run into any trouble, all he had to do was radio "Come on down, Jim" and help (such as it was) would be on the way. Unfortunately, Gray's plan to accompany the SBDs unraveled during launch. All the SBDs took off on schedule with _Enterprise_ 's first deck load, but spotting the second load, which included Gray's Wildcats and Lindsey's Devastators, seemed to take forever. By the time Gray's F4Fs were finally airborne and formed up, an impatient Spruance had ordered McClusky's SBDs to head immediately for the Japanese. Because he was depending on McClusky's dive-bombers for navigation, this put Gray in a fix. To his great relief, Gray happened to spot a torpedo squadron below him formed up and heading out without fighter escort. Deciding they must be Lindsey's TBDs (they were not), Gray had his planes follow. Gray figured he could still catch up with the SBDs over the target, but they were sure off to a late start. It was already approaching 8 a.m. Just before 8 a.m., as Striking Force's Nagumo anxiously awaited clarification on the composition of the American ship formation to the north, an _Akagi_ lookout reported a new flight of enemy bombers attacking _Hiryu_ , this time from high level. The men on _Akagi_ 's flight platform watched apprehensively as tumbling bombs raised huge geysers of water that encircled first _Hiryu_ and then _Soryu_ —then breathed a collective sigh of relief when the turbulence finally subsided and both ships emerged, apparently unscathed. Eyeing the big bombers, Mitsuo Fuchida grabbed an aircraft recognition chart. They were B-17s, the U.S. Army's newest bomber model. At first, as the aircraft—fourteen in all—drifted serenely away, Fuchida wondered why the CAP planes weren't pursuing them. Then he remembered what tough opponents the heavily armed "forts" were reputed to be. They could only have flown from Midway—just one more bit of evidence backing Nagumo's original decision to rearm Striking Force's torpedo aircraft with bombs. Just then lookouts spotted yet another flight of aircraft inbound from Midway. Fuchida counted sixteen enemy planes in this latest group. They were dive-bombers even though they were approaching like no dive-bomber should: well below the cloud cover in shallow glides _._ Almost at once Zeros
[ 3, 310, 6898, 407, 253, 12259, 285, 476, 320, 294, 3197, 323, 512, 8571, 15, 1723, 13, 253, 1655, 1618, 11029, 347, 247, 4737, 273, 4473, 285, 310, 417, 2568, 3426, 15, 187, 187, 510, 38269, 3148, 476, 2997, 3280, 3066, 253, 10382, 2245, 273, 253, 1780, 43728, 432, 667, 2898, 326, 3637, 253, 5981, 7616, 1840, 15, 831, 4483, 253, 2898, 3715, 275, 1254, 35, 23, 14, 8751, 14, 938, 14, 520, 4699, 1184, 281, 1453, 253, 38269, 3148, 3587, 15, 831, 17310, 4483, 253, 3148, 281, 3727, 660, 592, 1754, 327, 9797, 14, 34309, 2600, 5189, 275, 253, 7503, 1533, 15, 187, 187, 22, 15, 1720, 34153, 10850, 9753, 49838, 1712, 1704, 22, 14, 8751, 14, 938, 14, 520, 4699, 94, 187, 46584, 187, 187, 47869, 20, 37, 310, 247, 1077, 4633, 2165, 3948, 342, 625, 685, 337, 15, 20, 3041, 4212, 1254, 35, 1047, 14, 8751, 14, 938, 14, 520, 4699, 1656, 380, 3948, 310, 908, 323, 6684, 3958, 13, 7503, 6612, 4893, 13, 6804, 6612, 4893, 285, 9938, 15, 29368, 20, 37, 556, 4270, 14, 249, 1329, 323, 473, 33296, 416, 2094, 285, 476, 4711, 4893, 326, 476, 789, 347, 1097, 15439, 285, 7503, 6612, 387, 253, 1072, 673, 15, 329, 29368, 20, 37, 2165, 2440, 15231, 285, 247, 1071, 6200, 369, 3715, 347, 629, 273, 436, 2199, 15, 544, 2841, 818, 1084, 8751, 14, 938, 14, 520, 4699, 14, 71, 7931, 910, 709, 14, 881, 568, 926, 4982, 10262, 247, 37617, 432, 776, 1071, 6200, 15, 187, 187, 34, 638, 48143, 456, 313, 11499, 357, 10, 15231, 13, 342, 271, 20624, 2165, 1789, 285, 6508, 3007, 1334, 1925, 346, 79, 18157, 2452, 3, 369, 3715, 281, 1581, 253, 2608, 281, 9212, 1027, 16367, 284, 281, 253, 6200, 15, 1284, 476, 320, 2326, 432, 544, 2841, 818, 1084, 8751, 14, 938, 14, 520, 4699, 14, 71, 7931, 910, 709, 14, 881, 568, 926, 4982, 253, 2608, 476, 3365, 2854, 285, 5926, 253, 638, 48143, 456, 15231, 281, 253, 6200, 13, 9978, 253, 3007, 5852, 8, 10103, 285, 3630, 253, 1416, 273, 253, 42100, 326, 588, 320, 4439, 1046, 3925, 256, 1223, 253, 2608, 310, 275, 253, 3007, 1334, 15, 1876, 253, 22959, 403, 8356, 5118, 407, 253, 3948, 594, 627, 310, 642, 878, 323, 253, 2608, 281, 513, 2712, 2010, 15, 9157, 13, 253, 985, 588, 1611, 281, 3653, 253, 389, 2245, 8356, 285, 4684, 281, 253, 38269, 3148, 15, 380, 985, 588, 755, 247, 1618, 273, 512, 1527, 389, 17596, 285, 3177, 281, 4684, 281, 731, 581, 407, 581, 15, 1310, 253, 4602, 310, 4232, 13, 253, 985, 588, 5007, 253, 1894, 346, 79, 3, 285, 3343, 323, 12252, 15, 1310, 253, 12252, 310, 346, 69, 3, 840, 436, 310, 253, 3451, 2245, 13, 390, 2010, 352, 588, 1611, 253, 1735, 581, 15, 3824, 6200, 671, 8525, 473, 33296, 416, 2094, 7503, 6612, 15, 187, 187, 23, 15, 19778, 20002, 29088, 1712, 1704, 23, 14, 8751, 14, 938, 14, 520, 4699, 94, 187, 48666, 187, 187, 43682, 2355, 247, 1781, 10671, 273, 16367, 284, 417, 760, 3651, 265, 253, 17110, 533, 671, 476, 2794, 271, 20032, 3126, 1254, 35, 23, 14, 8751, 14, 938, 14, 520, 4699, 1656, 380, 4081, 2746, 8525, 13737, 9381, 273, 253, 7458, 323, 42296, 896, 253, 16367, 284, 15, 844, 671, 5583, 253, 897, 273, 1327, 14, 5726, 11347, 20403, 9181, 15, 1723, 13, 846, 5175, 359, 6888, 326, 352, 369, 417, 2217, 285, 627, 369, 247, 878, 281, 1453, 253, 16784, 273, 253, 16367, 284, 15, 5220, 13, 352, 1057, 417, 1056, 3282, 281, 3727, 271, 42100, 969, 604, 697, 26710, 310, 1335, 1246, 15, 6610, 13, 627, 778, 320, 2219, 273, 16367, 284, 326, 943, 417, 320, 4439, 387, 253, 1072, 673, 15, 1916, 8415, 253, 1840, 3374, 13, 359, 3715, 247, 7060, 3727, 5933, 15, 380, 5933, 310, 17386, 387, 253, 1780, 43728, 533, 387, 253, 5068, 352, 4419, 690, 18543, 2193, 432, 253, 1453, 2898, 15, 2053, 18543, 2193, 403, 253, 25306, 2069, 273, 1016, 42100, 13, 253, 1618, 273, 16367, 284, 326, 943, 417, 320, 4439, 2366, 285, 253, 5778, 673, 1078, 20437, 247, 747, 42100, 313, 338, 253, 5778, 310, 873, 281, 5058, 840, 253, 16367, 284, 588, 320, 4439, 2761, 387, 253, 1072, 673, 481, 831, 588, 8046, 253, 2813, 281, 871, 849, 1048, 352, 3936, 1919, 253, 13624, 273, 1016, 44221, 310, 642, 3356, 21759, 15, 2053, 2193, 403, 3264, 281, 320, 6898, 407, 253, 12259, 323, 512, 253, 4516, 16367, 284, 15, 831, 476, 320, 2218, 949, 271, 16774, 1263, 13, 835, 253, 12259, 476, 3727, 253, 16367, 284, 581, 407, 581, 285, 2557, 253, 673, 326, 352, 3936, 323, 253, 26710, 281, 15529, 15, 380, 5933, 310, 3559, 275, 544, 2841, 854, 1084, 8751, 14, 938, 14, 520, 4699, 14, 71, 8897, 910, 709, 14, 881, 568, 926, 7129, 187, 187, 510, 5933, 17923, 2067, 12255, 1078, 253, 3727, 273, 667, 42100, 15, 3973, 352, 12255, 604, 253, 673, 38667, 1580, 253, 3727, 273, 253, 2045, 42100, 310, 625, 685, 253, 5778, 1318, 15, 1310, 352, 310, 417, 13, 840, 352, 1629, 2824, 253, 3727, 13, 390, 2010, 16947, 281, 253, 1735, 2451, 15, 496, 253, 1735, 2451, 253, 985, 588, 2451, 604, 253, 26710, 310, 1335, 1246, 1955, 281, 271, 4321, 3727, 15, 831, 310, 10141, 407, 10941, 849, 1199, 556, 38667, 1580, 253, 3727, 273, 253, 1072, 42100, 342, 253, 42100, 25306, 673, 15, 1310, 253, 38667, 673, 310, 1679, 685, 253, 25306, 673, 13, 840, 253, 42100, 588, 417, 320, 4439, 13, 390, 2010, 253, 5933, 588, 564, 281, 253, 1735, 2451, 15, 496, 436, 2451, 253, 985, 588, 2451, 604, 627, 310, 247, 7344, 875, 436, 42100, 285, 3786, 4439, 16367, 284, 15, 1310, 627, 310, 642, 7344, 13, 840, 253, 42100, 588, 320, 4439, 15, 496, 1083, 273, 247, 7344, 13, 253, 985, 588, 2451, 849, 1199, 673, 556, 4817, 1580, 253, 3727, 273, 253, 7344, 264, 42100, 275, 1340, 281, 3653, 604, 697, 26710, 310, 1335, 1246, 15, 1310, 253, 673, 4817, 310, 625, 685, 253, 25306, 673, 273, 326, 42100, 13, 436, 2097, 326, 697, 26710, 310, 417, 1246, 7613, 253, 747, 42100, 476, 320, 4439, 13, 390, 2010, 253, 3727, 588, 320, 37001, 15, 831, 2969, 5933, 556, 11464, 281, 320, 1077, 3576, 275, 2426, 273, 8493, 253, 8353, 273, 253, 20403, 9181, 347, 973, 347, 17816, 253, 8869, 273, 20032, 12620, 15, 380, 5933, 6613, 327, 253, 1780, 43728, 13, 594, 672, 3939, 352, 588, 1809, 253, 3727, 273, 512, 660, 592, 30472, 273, 253, 1453, 2898, 387, 3694, 1268, 15, 187, 187, 24, 15, 27605, 285, 21561, 1712, 1704, 24, 14, 8751, 14, 938, 14, 520, 4699, 94, 187, 1702, 7770, 187, 187, 688, 1340, 281, 7472, 253, 7200, 273, 776, 38269, 3148, 359, 2546, 247, 2165, 2440, 2567, 281, 2589, 247, 346, 4537, 2793, 3, 1071, 15, 380, 2567, 908, 776, 985, 285, 5196, 271, 3368, 342, 1458, 5014, 313, 10002, 497, 417, 3206, 342, 436, 2199, 10, 281, 1790, 275, 2810, 18326, 42419, 18, 278, 10, 281, 253, 2813, 275, 247, 2316, 273, 1884, 6278, 17249, 323, 884, 1054, 285, 359, 4439, 5093, 1027, 660, 592, 342, 253, 1072, 3490, 15, 5815, 2256, 13640, 275, 253, 3368, 387, 247, 1027, 673, 15, 544, 3235, 337, 1084, 8751, 14, 938, 14, 520, 4699, 14, 85, 2874, 910, 709, 14, 881, 568, 2420, 986, 2722, 672, 253, 1027, 660, 592, 497, 4439, 15, 187, 187, 60, 3235, 337, 1084, 8751, 14, 938, 14, 520, 4699, 14, 85, 2874, 910, 709, 14, 881, 568, 2420, 4982, 8414, 273, 1264, 9930, 15, 380, 806, 310, 253, 673, 326, 253, 42100, 588, 320, 4439, 15, 380, 1273, 310, 253, 1416, 273, 253, 42100, 285, 253, 1390, 310, 849, 2266, 390, 5075, 253, 42100, 310, 15, 380, 5705, 497, 2530, 342, 253, 1618, 273, 16367, 284, 285, 597, 36280, 1016, 42100, 2720, 281, 253, 3368, 15, 1723, 13, 597, 858, 417, 871, 275, 7170, 752, 673, 597, 651, 320, 4439, 15, 380, 5705, 497, 11298, 281, 3440, 3066, 40613, 285, 497, 417, 2819, 387, 253, 2813, 15, 11279, 273, 2608, 2793, 7103, 7568, 4212, 497, 12724, 2104, 281, 4271, 346, 9072, 3, 660, 592, 15, 346, 49341, 3, 660, 592, 497, 625, 2834, 281, 4271, 5734, 247, 3687, 5778, 369, 3732, 15, 380, 1543, 403, 17903, 275, 544, 2841, 898, 1084, 8751, 14, 938, 14, 520, 4699, 14, 71, 8972, 910, 709, 14, 881, 568, 926, 7129, 187, 187, 1909, 476, 644, 2326, 275, 544, 2841, 898, 1084, 8751, 14, 938, 14, 520, 4699, 14, 71, 8972, 910, 709, 14, 881, 568, 926, 4982, 512, 5705, 3636, 253, 26710, 273, 21175, 15, 7214, 767, 5705, 7303, 281, 4271, 253, 12927, 285, 846, 247, 1643, 7253, 597, 1869, 326, 359, 4439, 253, 42100, 273, 21175, 969, 15, 38809, 5705, 3636, 253, 11129, 15, 1876, 273, 731, 3636, 253, 13100, 285, 253, 16045, 15, 49075, 952, 3636, 253, 13735, 285, 1264, 952, 3636, 253, 480, 35760, 13, 2299, 1264, 625, 952, 3636, 326, 359, 574, 4439, 247, 1027, 26710, 432, 253, 5075, 16367, 284, 533, 597, 497, 417, 2119, 752, 352, 369, 15, 187, 187, 15545, 327, 841, 1543, 13, 5075, 660, 592, 943, 320, 4439, 670, 767, 2909, 846, 247, 2266, 42100, 13, 5010, 253, 2608, 778, 417, 4271, 731, 15, 24747, 16367, 284, 476, 320, 4439, 342, 1679, 5778, 13, 1014, 846, 1884, 256, 15, 1310, 253, 5075, 16367, 284, 403, 4439, 342, 1679, 685, 1458, 7253, 8, 3064, 13, 597, 588, 320, 6804, 285, 253, 2608, 588, 417, 320, 2104, 281, 4271, 731, 15, 24747, 16367, 284, 476, 320, 3636, 6927, 685, 5075, 4394, 15, 496, 2087, 13, 5075, 16367, 284, 2430, 670, 581, 285, 247, 2716, 2909, 281, 2590, 4336, 285, 2266, 16367, 284, 670, 1264, 2909, 15, 187, 187, 3074, 38269, 12646, 2793, 253, 10183, 273, 12478, 247, 26710, 672, 352, 310, 642, 3356, 2424, 15, 3824, 2746, 908, 767, 7458, 281, 15327, 253, 26710, 896, 275, 1340, 281, 8415, 436, 1895, 533, 690, 5558, 432, 253, 44221, 326, 6497, 275, 253, 3126, 369, 1335, 11365, 247, 13624, 15, 1723, 13, 9433, 253, 7060, 3727, 5933, 574, 247, 1199, 3687, 3486, 285, 2761, 14042, 253, 1895, 28, 2299, 13, 352, 858, 417, 8415, 253, 1895, 273, 2709, 16367, 284, 12480, 13, 347, 253, 346, 4160, 14, 8259, 5404, 264, 3, 16367, 284, 497, 1335, 4439, 9403, 15, 10876, 20907, 12646, 2430, 16367, 284, 342, 1698, 25306, 673, 326, 476, 320, 557, 4152, 264, 7938, 275, 253, 3126, 15, 187, 187, 510, 2380, 673, 273, 253, 5145, 369, 1679, 685, 2716, 247, 1273, 285, 253, 6742, 281, 253, 2608, 369, 1077, 3809, 285, 20297, 15, 380, 8323, 2898, 326, 369, 908, 323, 253, 7103, 8058, 281, 320, 247, 4217, 4968, 285, 8525, 4465, 16367, 284, 342, 642, 12425, 15, 380, 747, 2840, 16367, 284, 326, 253, 2608, 476, 823, 403, 4516, 407, 253, 8323, 2898, 285, 476, 320, 1925, 3587, 13, 2403, 295, 14, 39120, 3477, 281, 5645, 15, 380, 16367, 284, 10130, 310, 6537, 407, 247, 2969, 346, 10134, 3, 1873, 326, 310, 1077, 3477, 323, 13098, 281, 4711, 15, 831, 40377, 1873, 1057, 417, 760, 6266, 752, 16367, 284, 943, 320, 4439, 285, 672, 13, 533, 352, 671, 8631, 342, 752, 3490, 1016, 42100, 588, 320, 4439, 347, 973, 347, 849, 3809, 253, 9381, 273, 253, 7989, 310, 285, 604, 352, 588, 8230, 5448, 390, 15816, 253, 660, 592, 15, 187, 187, 28144, 13, 253, 749, 5564, 14, 3169, 3727, 4438, 369, 5762, 970, 247, 7321, 4383, 2715, 273, 253, 22746, 84, 1378, 3, 1873, 432, 271, 1527, 2603, 6440, 346, 52, 34291, 3, 1254, 35, 1010, 14, 8751, 14, 938, 14, 520, 4699, 1656, 380, 14586, 2908, 6240, 253, 2505, 273, 253, 4569, 1055, 387, 253, 990, 273, 253, 749, 5564, 15, 380, 14586, 285, 253, 1071, 1543, 403, 3559, 275, 544, 3235, 374, 1084, 8751, 14, 938, 14, 520, 4699, 14, 85, 4699, 910, 709, 14, 881, 568, 2420, 7129, 380, 985, 369, 5762, 342, 253, 7060, 3727, 5933, 346, 2374, 3, 285, 346, 8997, 3446, 1284, 476, 320, 2326, 432, 544, 3235, 374, 1084, 8751, 14, 938, 14, 520, 4699, 14, 85, 4699, 910, 709, 14, 881, 568, 2420, 4982, 253, 2813, 11658, 347, 3264, 15 ]
" is filled by the developers and can be reused for all targets. However, the current list serves as a proof of concept and is not yet complete. The olfactory display can accept input via the serial port of the Arduino from any application that follows the format specified above. This allows the application developed in \[[@B6-sensors-20-01002]\] to control the olfactory display directly. This merge allows the display to release scents based on audio-visual content detected in the virtual world. 5. Reusable Game Development Asset {#sec5-sensors-20-01002} ================================== Unity3D is a very popular game engine with more than 1.3 million users \[[@B14-sensors-20-01002]\]. The engine is used for developing games, virtual reality applications, mixed reality applications and simulations. Unity3D has built-in support for Oculus Rift and can produce applications that can work as both desktop and virtual reality at the same time. A Unity3D game development asset and a test scene was developed as part of this project. [Figure 7](#sensors-20-01002-f007){ref-type="fig"}, presents a screenshot from our test scene. A prefabricated (prefab) asset, with an invisible game object and extended collider called "nDimension" was developed to allow the user to assign different aromas to the scene. As can be seen from [Figure 7](#sensors-20-01002-f007){ref-type="fig"}, the user can simply drug and drop the prefabricated asset to the scene, setup the colliders' dimensions and write the name of the aroma that will be released every 60 s while the user is in the collider. All the collisions are automatically calculated by the engine so there is no need for the user to do anything else. Additionally, the system will try to determine the com port automatically and connect to the olfactory display. The system will get a list of all open com ports and attempt to connect to them one by one. If the connection is established, the system will send the character "n" and wait for reply. If the reply is "d" then this is the correct port, or else it will try the next one. Our scene also supports Oculus Rift virtual reality. 6. Smart Release Algorithm {#sec6-sensors-20-01002} ========================== Releasing a large quantity of aromas not only consumes the chemicals but also can create an uncomfortable environment \[[@B6-sensors-20-01002]\]. The proposed approach supports inverse rotation of the fans for sucking back the aromas. We also recommend the use of non-persistence perfumes. However, after testing we discovered that it was not enough and there was a need to control the releases of the aromas. Also, it does not make sense to release an aroma again if its scent is still present. Finally, there may be cases of aromas that should not be released at the same time. To solve the above issues, we developed a smart release algorithm. The algorithm is hosted at the Arduino but at the beginning it requires some calibration values from the control application. These calibration values are the persistence times of each aroma, the list of aromas that should not be released together and the delay time before releasing a new aroma (if the delay is set to zero then the aromas will be released almost at the same time). This will enable the device to know how long it takes until the smell of each perfume is no longer detectable. These values are expected to be filled by the developers for all the supported aromas. This can be done through an empirical study, where the developers can release the aromas one by one and measure the time that it takes for the scent to disappear. The algorithm is presented in [Figure 8](#sensors-20-01002-f008){ref-type="fig"}. The algorithm performs several checks before the release of any aroma. First it checks if the time elapsed since the release of the previous aroma is more than the delay value. If it is not, then it skips the release, or else proceeds to the next check. In the next check the system will check if the scent is still present due to an earlier release. This is checked by comparing how much has elapsed since the release of the same aroma with the aroma persistence time. If the elapsed time is less than the persistence time, then the aroma will not be released, or else the algorithm will go to the next check. In this check the system will check if there is a conflict between this aroma and previously released aromas. If there is no conflict, then the aroma will be released. In case of a conflict, the system will check how much time has passed since the release of the conflicted aroma in order to determine if its scent is still present. If the time passed is more than the persistence time of that aroma, this means that its scent is not present hence the new aroma can be released, or else the release will be skipped. This simple algorithm has proven to be very effective in terms of reducing the consumption of the perfumes as well as avoiding the creation of uncomfortable environments. The algorithm runs on the Arduino, so when active it will govern the release of all scents irrespective of the control application at software level. 7. Evaluation and Discussion {#sec7-sensors-20-01002} ============================ In order to evaluate the accuracy of our olfactory display we asked a game development company to conduct a "user experience" test. The company used our system and conducted an experiment with 15 participants (who were not involved with this project) to sit in close proximity (\~1 m) to the device in a room of 30 square meters for 10 min and we released seven different scents with the same force. Each subject participated in the experiment at a different time. [Table 1](#sensors-20-01002-t001){ref-type="table"} shows when the different scents were released. [Table 1](#sensors-20-01002-t001){ref-type="table"}, consists of three columns. The first is the time that the aroma will be released. The second is the name of the aroma and the last is how strong or weak the aroma is. The subjects were provided with the list of aromas and they smelled each aroma prior to the experiment. However, they did not know in advance what time they would be released. The subjects were listening to music via headphones and were not looking at the device. Results of user experience evaluation demonstrate users were consistently able to identify "strong" scents. "Weak" scents were more difficult to identify unless a greater delay was applied. The results are summarized in [Figure 9](#sensors-20-01002-f009){ref-type="fig"}. As can been seen in [Figure 9](#sensors-20-01002-f009){ref-type="fig"}, all subjects identified the scent of pine. Only two subjects managed to identify the ocean and after a few seconds they thought that we released the aroma of pine again. Twelve subjects identified the mountain. All of them identified the mold and the tobacco. Eleven people identified the orange and three people identified the jasmine, however three more people identified that we had released a different scent from the weak aromas but they were not sure what it was. Based on these results, weak scents should be released about two minutes after a strong aroma, otherwise the user may not identify them. Strong aromas can be released with less delay, even after 30 s. If the weak aromas are released with less than 15 seconds' difference, they will be mixed and the user will not be able to identify them. Strong aromas can be identified easier than weak ones. In general, weak aromas require about one and a half minutes to clear completely and strong aromas about three minutes. All olfactory displays experience the difficulty of cleaning a scent when it is no longer required. Our approach used two fans to suck the scent back in order to solve this problem but some liquid from the perfume that fell in the environment was still generating a smell. However, applying the smart release algorithm had a much greater impact and almost solved the problem; however, it did not solve the problem of multiple aromas mixing, as the "non-conflicted" aromas were still released normally. Olfactory displays require aromas with low persistence time that can be disbanded faster in the environment. The response time of the machine was less than half a second and the delivery to the user was very fast and satisfactory. The windows application that was used for the evaluation proved to be a useful tool and supports extra aromas with no coding. The new custom aromas that the user can add are supported by the windows application and can be called directly, making n-dimension easy to expand. The aromas schedule is controlled by a simple "txt" file that is very easy for anybody to produce. This txt file does not only describe what aromas should be released and when, but it also describes with what force each aroma will be released as well as how fast the rotation of the fan is and if it will blow wind or absorb the scents. Additionally, the subtitle-based release mode was tested using a modified English version of the ".srt" file from an open source movie "Sintel" \[[@B15-sensors-20-01002]\]. The modifications included adding the text of the appropriate effect at the end of the subtitle. The modifications and the test results are presented in [Table 2](#sensors-20-01002-t002){ref-type="table"}. The system was tested with the smart release algorithm "On" and "Off". As can be seen from [Table 2](#sensors-20-01002-t002){ref-type="table"}, the device operated as expected.
[ 5749, 71, 62, 409, 4247, 337, 13, 6752, 13, 4135, 3534, 598, 13474, 5286, 273, 964, 964, 964, 14590, 330, 6788, 2053, 411, 7058, 7177, 497, 417, 1078, 6798, 1535, 3800, 387, 253, 3200, 281, 5597, 3924, 15, 187, 187, 57, 8296, 15, 380, 13421, 434, 6515, 3658, 275, 253, 41337, 26775, 5538, 1716, 29340, 346, 23315, 14, 21831, 47890, 3, 187, 688, 271, 3081, 3908, 9262, 327, 6010, 3883, 313, 783, 346, 7857, 21978, 8375, 253, 13421, 8631, 253, 5628, 346, 10394, 273, 1881, 14, 12722, 47890, 449, 4794, 281, 253, 4748, 21978, 27, 187, 187, 11, 45153, 544, 510, 985, 273, 2634, 1286, 14, 12722, 47890, 6038, 556, 247, 1048, 2892, 275, 4135, 285, 556, 644, 973, 1929, 281, 13, 285, 35037, 342, 407, 13, 5628, 4413, 15, 16531, 14, 12722, 47890, 1057, 417, 1599, 3426, 12228, 274, 1632, 390, 1881, 14, 11018, 15, 496, 1055, 13, 1881, 14, 12722, 47890, 10770, 281, 247, 985, 273, 7248, 762, 253, 20446, 273, 247, 13205, 6757, 8534, 327, 11136, 273, 253, 5628, 2208, 15, 6166, 436, 10545, 985, 13, 253, 4676, 3206, 7279, 342, 1016, 643, 281, 3986, 13969, 327, 25899, 4712, 323, 253, 4096, 273, 10922, 253, 16566, 285, 9417, 253, 1600, 347, 873, 6593, 762, 5628, 5323, 285, 7823, 15, 10400, 790, 9583, 275, 824, 2424, 1881, 14, 12722, 47890, 403, 973, 6600, 326, 597, 403, 2256, 281, 22414, 323, 4433, 281, 10078, 275, 824, 19915, 13, 390, 323, 1327, 14, 46451, 342, 1881, 14, 12722, 47890, 13, 1690, 24184, 2996, 616, 13474, 987, 15, 187, 7130, 281, 253, 13421, 13, 14590, 330, 866, 8949, 497, 17886, 407, 1881, 14, 12722, 47890, 7248, 13, 253, 16566, 273, 534, 497, 346, 936, 6558, 42062, 13474, 13, 46126, 253, 6284, 273, 253, 2586, 347, 247, 2644, 285, 3693, 1881, 14, 43739, 422, 7324, 449, 380, 4748, 21978, 671, 25339, 253, 13421, 434, 31896, 273, 6265, 281, 253, 23119, 5001, 1881, 14, 12722, 47890, 15, 187, 187, 57, 3252, 15, 8065, 473, 9852, 621, 187, 688, 16585, 253, 10732, 273, 346, 1286, 14, 12722, 47890, 7911, 995, 12734, 30972, 285, 247, 1180, 273, 42608, 26542, 281, 271, 4223, 8065, 26777, 6808, 407, 253, 2418, 19190, 285, 17061, 5399, 5550, 10452, 36, 2807, 7429, 346, 48, 9852, 621, 1623, 16531, 14, 21831, 47890, 367, 695, 272, 1198, 35110, 24148, 23910, 3, 5550, 11496, 473, 9852, 621, 6788, 17868, 40326, 899, 70, 13, 380, 49540, 273, 18567, 14, 9304, 24261, 7153, 261, 4004, 275, 4135, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 7498, 15, 848, 13, 24519, 14, 2693, 28, 30972, 10840, 11367, 5571, 15, 380, 8065, 473, 9852, 621, 13, 534, 760, 3206, 9836, 7911, 13, 346, 9468, 12086, 326, 253, 18014, 273, 2176, 9787, 3580, 10018, 253, 5927, 4376, 7787, 873, 407, 616, 9056, 5454, 12485, 449, 17868, 40326, 899, 70, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 7498, 15, 387, 24519, 28, 923, 671, 7493, 16598, 13, 380, 16040, 273, 38692, 27, 367, 695, 272, 47670, 447, 285, 253, 48730, 27920, 281, 25388, 4135, 434, 19190, 4155, 13, 380, 4135, 9109, 1621, 15, 7584, 13, 655, 313, 14060, 15, 6469, 481, 380, 5927, 7911, 497, 1754, 327, 247, 1885, 434, 3388, 4815, 275, 253, 4491, 15, 16598, 13, 380, 4135, 9109, 1621, 15, 7584, 13, 655, 28, 923, 671, 17868, 40326, 899, 70, 13, 6752, 28553, 15, 530, 15, 4051, 706, 15, 4472, 15, 418, 15, 3555, 15, 387, 25597, 15, 187, 187, 9, 20, 10, 187, 187, 38546, 52, 3481, 5642, 1042, 37453, 45375, 2025, 19904, 3123, 5656, 52, 187, 187, 42, 15, 380, 8210, 3667, 553, 187, 28343, 253, 38548, 72, 318, 273, 253, 8210, 3667, 553, 285, 4162, 6585, 13, 253, 4974, 43206, 2918, 247, 1180, 273, 12225, 835, 7159, 4925, 15486, 327, 4376, 285, 13474, 12686, 284, 15, 2053, 12225, 497, 11612, 407, 6338, 432, 1097, 253, 23119, 285, 253, 13421, 15, 187, 688, 8210, 13, 253, 4376, 273, 14590, 330, 369, 370, 21, 15, 21, 16, 5840, 15, 2058, 690, 1127, 13, 7159, 873, 253, 5927, 4376, 387, 370, 22, 15, 20, 16, 5840, 285, 253, 4376, 9461, 281, 387, 1878, 370, 22, 16, 5840, 15, 1723, 13, 875, 2552, 5307, 285, 4565, 6585, 13, 627, 369, 247, 346, 19209, 2137, 937, 534, 7369, 275, 13474, 7911, 18752, 281, 1679, 685, 370, 19, 15, 25, 16, 5840, 15, 831, 4620, 281, 452, 644, 4269, 407, 271, 7466, 275, 4135, 434, 3275, 5350, 326, 8424, 1314, 432, 271, 5165, 346, 24418, 4524, 6924, 3, 387, 247, 7544, 4974, 43206, 4804, 15, 187, 688, 4565, 5307, 13, 253, 5927, 13474, 4376, 369, 370, 22, 15, 18, 16, 5840, 15, 1723, 13, 347, 352, 4620, 326, 5293, 273, 253, 7159, 497, 1563, 326, 4376, 13, 7159, 5821, 281, 346, 8629, 1419, 3, 326, 4376, 285, 9262, 436, 4345, 281, 253, 13421, 346, 1542, 9612, 31830, 883, 62, 187, 11, 45225, 2058, 247, 4974, 43206, 4804, 275, 4162, 6585, 13, 253, 36994, 5469, 247, 5926, 275, 253, 4376, 285, 253, 3332, 7466, 275, 4135, 434, 3275, 5350, 15, 2058, 581, 1127, 1309, 253, 4804, 13, 253, 8612, 432, 253, 13421, 8191, 253, 2758, 326, 27, 187, 9586, 2167, 29640, 310, 417, 247, 7741, 1885, 13, 352, 556, 644, 13714, 13527, 1580, 8210, 15, 30696, 253, 2538, 273, 1655, 10132, 13, 3839, 8288, 13, 253, 7248, 556, 417, 644, 1077, 5547, 15, 544, 510, 13421, 62, 863, 3844, 6349, 281, 253, 13701, 285, 2440, 273, 253, 23119, 13, 285, 4419, 749, 14, 25756, 22425, 281, 769, 354, 39237, 15, 48327, 878, 281, 20090, 253, 4491, 15486, 285, 4491, 4803, 15, 2091, 32447, 403, 46875, 616, 16256, 13, 597, 671, 878, 281, 1908, 253, 1600, 273, 253, 1375, 347, 247, 2644, 15, 187, 3404, 253, 4804, 13, 253, 16596, 5821, 281, 4796, 253, 5927, 13474, 4376, 432, 370, 22, 15, 740, 16, 5840, 281, 370, 20, 15, 938, 16, 5840, 13, 18289, 275, 8956, 342, 253, 4345, 387, 253, 4565, 5307, 4804, 15, 380, 2909, 564, 327, 281, 1375, 326, 27, 346, 6436, 13, 984, 253, 16596, 452, 417, 5821, 327, 253, 10473, 6297, 273, 253, 21999, 285, 38419, 985, 13, 352, 4558, 247, 2201, 1953, 1880, 436, 4376, 2701, 476, 320, 27810, 8069, 449, 187, 187, 2267, 15, 48332, 281, 253, 6752, 3667, 553, 187, 688, 4397, 285, 4596, 6585, 13, 253, 13421, 6311, 326, 253, 5284, 6398, 369, 7296, 9745, 271, 3270, 14, 23593, 272, 4176, 1411, 253, 5628, 14590, 330, 16596, 15, 831, 1491, 369, 39010, 281, 253, 23119, 15, 1623, 581, 3389, 13, 1133, 15720, 7211, 13, 8505, 432, 13421, 6338, 13, 1375, 27, 313, 18, 10, 5749, 81, 62, 3621, 2278, 285, 755, 5480, 3664, 313, 19, 10, 346, 32897, 2278, 285, 2953, 352, 3664, 285, 313, 20, 10, 5749, 81, 62, 3621, 7409, 436, 2647, 31830, 805, 62, 187, 2374, 4596, 1668, 13, 6585, 13, 253, 23119, 2918, 247, 4804, 342, 7159, 4681, 1012, 62, 2058, 253, 4804, 13, 7159, 13, 346, 1615, 1039, 273, 1133, 13423, 937, 5821, 281, 7164, 253, 346, 29309, 3901, 13474, 4376, 3, 281, 370, 20, 16, 5840, 4983, 327, 4247, 337, 13, 6752, 15, 12254, 671, 5821, 281, 2701, 253, 2264, 13474, 4644, 323, 6752, 281, 4791, 13, 5388, 16298, 313, 3113, 1016, 2567, 6883, 2060, 13474, 4644, 9771, 569, 10, 285, 281, 417, 5645, 616, 3275, 5350, 15, 12254, 8, 4345, 369, 346, 1468, 264, 387, 22474, 253, 1881, 14, 12722, 47890, 273, 253, 4491, 449, 496, 4565, 6585, 13, 253, 23119, 7581, 264, 1529, 4804, 15995, 7159, 281, 2319, 16994, 436, 4345, 15, 187, 3650, 760, 310, 627, 642, 25712, 1941, 273, 509, 15305, 275, 253, 7177, 16585, 436, 4345, 13, 533, 841, 7177, 671, 1804, 13, 327, 616, 2454, 13, 326, 436, 4345, 369, 17610, 4681, 1047, 62, 2596, 3054, 13, 323, 1650, 13, 475, 42980, 326, 253, 5014, 346, 585, 4686, 326, 5628, 39944, 330, 16596, 403, 8839, 7032, 273, 27017, 253, 1881, 14, 12722, 47890, 273, 253, 4491, 3, 984, 313, 18, 10, 4135, 556, 2406, 13711, 4815, 28, 313, 19, 10, 346, 25307, 273, 39944, 330, 275, 4135, 310, 4122, 36409, 275, 1740, 16596, 285, 3021, 13, 352, 310, 4942, 3477, 281, 3986, 440, 1988, 1561, 253, 4491, 3664, 313, 20, 10, 6186, 310, 275, 6654, 342, 4831, 285, 4376, 34044, 403, 12264, 28, 285, 313, 21, 10, 627, 310, 2266, 3116, 275, 4831, 323, 39944, 330, 347, 271, 346, 343, 13481, 494, 1885, 449, 8035, 3054, 27, 187, 60, 66, 62, 2110, 1493, 432, 7732, 1561, 253, 4491, 369, 326, 253, 32447, 497, 2104, 281, 1790, 1066, 2366, 387, 436, 1798, 673, 984, 29640, 7911, 574, 4925, 5561, 5004, 13, 285, 642, 581, 812, 10265, 247, 2007, 14518, 28, 253, 1735, 1921, 369, 13, 984, 253, 2586, 574, 5485, 598, 253, 6264, 3580, 2136, 432, 247, 1959, 7324, 4809, 253, 32447, 497, 1607, 5911, 285, 574, 642, 4327, 533, 281, 7703, 4491, 1881, 14, 11973, 15, 187, 29129, 13, 247, 6010, 273, 253, 4565, 6585, 4804, 432, 23119, 434, 4422, 7211, 326, 27, 187, 10489, 6031, 407, 253, 39944, 330, 4974, 14, 2115, 6614, 273, 544, 783, 23119, 62, 964, 964, 964, 9836, 16596, 497, 2104, 281, 3986, 247, 1881, 14, 10088, 4345, 8379, 13, 17580, 597, 651, 25706, 1453, 253, 10671, 285, 13870, 273, 24217, 281, 5115, 253, 4736, 273, 28366, 1223, 12976, 13474, 7911, 15, 6102, 1881, 14, 1120, 5335, 5593, 13, 7194, 1754, 327, 2634, 1120, 27106, 10671, 281, 46126, 7911, 13, 13474, 275, 247, 16645, 285, 42062, 5133, 285, 4575, 23043, 8, 452, 644, 4336, 9009, 407, 1016, 32447, 8, 1211, 7089, 285, 1881, 14, 1120, 5335, 13, 1293, 667, 2208, 7268, 15, 43312, 327, 2552, 337, 13, 6752, 13, 14590, 330, 369, 7117, 347, 247, 1885, 10568, 4376, 10123, 407, 4135, 434, 36262, 285, 247, 14393, 273, 638, 14, 6772, 1208, 407, 253, 544, 1779, 7272, 1092, 534, 556, 2530, 6422, 29002, 285, 4999, 36259, 323, 253, 7092, 273, 1881, 14, 1120, 5335, 15486, 2190, 9836, 16596, 15, 187, 9, 36214, 2879, 36033, 1010, 62, 187, 6080, 7177, 16585, 253, 4596, 285, 4565, 6585, 12225, 16084, 326, 21999, 285, 38419, 369, 908, 281, 7767, 253, 4676, 8, 4345, 15, 1723, 13, 5293, 273, 841, 7177, 4518, 1375, 326, 7159, 8, 15486, 34617, 3453, 497, 27810, 949, 21999, 285, 38419, 15, 496, 958, 13, 253, 3389, 15212, 1840, 11120, 10770, 281, 346, 19209, 10123, 449, 187, 187, 8296, 15, 380, 6752, 3667, 553, 187, 187, 34, 15, 575, 46785, 723, 285, 3419, 36559, 187, 187, 28343, 253, 5068, 273, 6752, 285, 253, 12108, 273, 253, 3302, 5833, 327, 4247, 3436, 13, 5826, 13, 253, 4974, 43206, 2918, 7418, 346, 29309, 1515, 3, 12225, 835, 7159, 4925, 15486, 5001, 4376, 285, 3453, 15, 1707, 497, 671, 247, 1180, 273, 4974, 43206, 12225, 835, 642, 15486, 497, 4925, 4681, 1036, 62, 535, 187, 11, 42082, 378, 15, 575, 49153, 273, 6845, 2084, 274, 1632, 187, 187, 33397, 281, 253, 1924, 5001, 253, 4596, 6585, 4345, 13, 253, 4623, 7177, 3831, 642, 25712, 1941, 273, 509, 15305, 285, 13, 247, 1180, 273, 841, 7177, 13, 327, 616, 2454, 13, 1804, 12228, 274, 1632, 4681, 1166, 62, 1198, 1650, 13, 581, 7177, 7211, 27, 187, 688, 6469, 13, 352, 310, 3264, 326, 253, 13474, 45544, 4323, 985, 588, 320, 4934, 285, 4035, 281, 1132, 247, 2762, 2554, 15, 1292, 13, 984, 253, 5213, 2791, 556, 3531, 323, 253, 1805, 15455, 672, 2429, 342, 253, 4112, 275, 2393, 6752, 13, 253, 24741, 285, 4588, 12510, 273, 2710, 16596, 281, 29406, 588, 320, 2406, 685, 253, 1897, 672, 253, 2791, 574, 247, 2834, 673, 15, 187, 187, 9, 36214, 2879, 481, 10244, 13, 247, 6519, 1160, 767, 1897, 846, 253, 8164, 4176, 369, 4724, 3054, 27, 187, 6872, 29640, 32447, 13, 14946, 407, 253, 544, 1779, 7272, 1092, 2335, 5593, 544, 249, 6157, 62, 281, 2701, 3275, 281, 4017, 4376, 285, 281, 5416, 247, 2634, 5530, 14, 1373, 272, 8, 273, 253, 4376, 46894, 13, 533, 275, 253, 1048, 1408, 13, 824, 44436, 310, 14043, 285, 588, 4354, 18382, 3561, 281, 253, 37960, 273, 11528, 285, 1078, 253, 1071, 273, 673, 15, 187, 187, 36, 15, 575, 44831, 16040, 187, 187, 7130, 281, 7159, 8, 16608, 2473, 9172, 285, 253, 12503 ]
"[f]rom January 1, 2002, China gave up export administration of . . . vitamin C"). These WTO documents were not before Judge Trager at the motion to dismiss stage. XIII. The Ministry's Statements in the Instant Litigation Concerning "Self-Discipline" In an additional statement submitted on summary judgment (the "2009 Statement"), the Ministry describes the Chinese "system of self-discipline." According to the 2009 Statement: *533 [The system of `self-discipline'] has a long history in China and has been well known to, and complied with by, Chinese companies. Self-discipline does not mean complete voluntariness or self-conduct. In effect, self-discipline refers to a system of regulation under the supervision of a designated agency acting on behalf of the Chinese government. Under this regulatory system, the parties involved consult with each other to reach consensus on coordinated activities for the purpose of reaching the objectives and serving the interest as set forth under Chinese laws and policies. Persons engaged in such required self-discipline are well aware that they are subject to penalties for failure to participate in such coordination, or for non-compliance with self-discipline, including forfeiting their export right. According to the Ministry, vitamin C exporters were governed by self-discipline regulation, the objectives of which were "to maintain orderly export, safeguard the interests of the country as a whole and avoid self-destructive competition." The 2009 Statement also discusses the Ministry's delegation of authority to the Chamber regarding self-discipline. XIV. 1998 Opinions In discussing the notion of "self-discipline prices", Professor Shen and a number of commentators cite to an August 1998 directive issued by the State Economic and Trade Commission ("SETC") entitled "Opinions On Self-Discipline Pricing For Certain Industrial Products" ("1998 Opinions"). Wang Xiaoye, The Prospect of Anti-Monopoly Legislation in China, 2002 Wash. U. Glob. Stud. L.Rev. 201, 208-09; Shen Report ¶ 70. The 1998 Opinions, which only involved domestic prices, "demanded that the producers of certain industrial products observe the minimum price limits set by their respective trade associations." Wang Xiaoye, 2002 Wash. U. Glob. Stud. L.Rev. at 208; see also Scott Kennedy, The Price of Competition: Pricing Policies and the Struggle to Define China's Economic System, The China Journal No. 49, 19 (Jan. 2003). The minimum prices were based on a product's average costs in the industry. Kennedy, The China Journal No. 49, 19; see also Wang Xiaoye, 2002 Wash. U. Glob. Stud. L. Rev. at 209. (3) ACTIONS OF CHINESE MARKET PARTICIPANTS I. The 1997 Regime Between the promulgation of the 1997 Regime and April 2001, the Subcommittee held a number of meetings where defendants reached agreements on price and export quotas. These meetings were attended by officials from both the Chamber and the Ministry. In 1997, the price of vitamin C was $4.4/kg. At some point, defendants set the minimum price at $5.3/kg and the price rose to at least $5/kg. However, between May 2000 and December 2001, there was a "price war," which resulted in export prices dropping to less than $2.8/kg. This appears to have been caused by an expansion in China's production capacity that stemmed from an apparent "misunderstanding" at a 1999 Subcommittee meeting. In December 2000, the minimum export price was $5.1/kg. However, as it appears that none of the defendants were following that price, defendants agreed to "nullify" that price and submitted this agreement to the Ministry "for approval."[11] *534 At a Subcommittee meeting in April 2001, the attendees discussed a drop in the price and the recent expansion in China's production capacity. At one point during the meeting, the representative from the Ministry informed the members that: Even though VC is not a resource product, it has been strictly regulated since 1997. Regarding the effects of current regulations, generally speaking, the regulation has not been very successful. [The Ministry] attaches importance to the establishment and development of the Chamber, and requires sub-committees to act proactively. Enterprises need to obey the industry agreements and industry rules. When enterprises are maximizing their profits, they also need to consider the interest of the state as a whole. At the meeting, the manufacturers agreed to reduce the minimum export price from $5.10/kg to $3.20/kg, presumably in accordance with the agreement at the December 2000 meeting. The minutes go on to state that: "However, because the manufacturers have not agreed on the enforcement mechanisms of the verification and chop system, it remains a major question whether this price limit can be enforced effectively." II. Transition to the 2002 Regime In September and November 2001, the Ministry learned that the European Union was considering bringing an anti-dumping suit against the Chinese vitamin C manufacturers. This information was forwarded to the Chamber. On one document, handwritten notes, apparently from Ministry officials, state: (1) "[p]lease review and get prepared"; (2) "please review and address it"; and (3) "[p]lease investigate this matter."[12] On November 16, 2001, the Chamber held a meeting with defendants.[13] At the meeting, defendants, "by way of hand voting," agreed to raise the "coordinated export price" to $3/kg starting on January 1, 2002. Defendants also agreed to limit the total export volume for 2002 to 35,500 tons (with each company receiving individual export volume allocations) and to not expand their production capacity. Defendants' agreement was "aimed at enhancing the self-discipline of the industry." In December 2001, the Chamber convened another meeting amongst defendants to discuss implementing this agreement. Not only is there no affirmative evidence of compulsion in the documents discussing this agreement, but these documents also suggest, on their face, that this agreement was voluntary.[14] One states, for example, *535 that the participants "concluded that Chinese Vitamin C manufacturers are absolutely capable of realizing the self-discipline of the industry" because (1) China has lower gross costs; (2) "production of Vitamin C in China is highly centralized in four manufacturers and thus, it is relatively easy to reach unison within the industry"; (3) supply is in balance with demand and price declines are psychological; and (4) there is strong growth in demand for Vitamin C as an "irreplaceable product." Another states: [a]nalysis from persons within the industry was that the enterprises were able to sit down together at this particular time because VC prices had reached rock bottom, and no one could sustain a further slide; the next reason was, because the country had opened up the commercial products business from a free competition aspect the enterprises were impelled and had no choice but to seek industry self-regulation. Similarly, a summary of the December 2001 meeting from Chamber's website notes that: through efforts by the Vitamin C Sub-Committee of [the Chamber] . . . domestic manufacturers were able to reach a self-regulated agreement successfully, whereby they would voluntarily control the quantity and pace of exports to achieve the goal of stabilization while raising export prices. Such self-restraint measures, mainly based on `restricting quantity to safeguard prices, export in a balanced and orderly manner and adjust dynamically' have been completely implemented by each enterprises' own decisions and self-restraint, without any government intervention. Beginning on May 1, 2002, vitamin C was listed as a product requiring price reviews by China's Customs and a seal of pre-approval by the [Chamber], which has provided powerful oversight and safeguards for the implementation of self-restraint agreements among domestic manufacturers. (Emphasis added).[15] Some documents discussing the November and December 2001 meetings imply that verification and chop was used to enforce the parties' agreement. However, none of these documents clearly state that defendants' agreements restricting output were enforced through verification and chop. In fact, the document quoted above explicitly refers to "price reviews." III. The 2002 Regime A. Meetings and Agreements Between the beginning of 2002 and the filing of the initial complaint on January 26, 2005, the Subcommittee held numerous "coordination" meetings where defendants reached agreements regarding price and output. There were also a number of Subcommittee meetings where no agreements were reached.[16] *536 B. Evidence of Voluntariness Similar to the record regarding the November 2001 agreement, the relevant documents contain no affirmative evidence of compulsion and, a number of these documents, on their face, suggest voluntariness.[17] For example, one documents notes: In 2003, it is expected that the export quota management system will be kept and continue to play a positive role. But, because the international market has turned for the better considerably when compared with the situation in early 2002, the willingness and actual effectiveness of various manufacturers to cooperate will be lower than the days when the market had a difficult time. (Emphasis added). Similarly, a speech made two days after the instant suit was filed states: These VC enterprises, mediated by the [Chamber], took measures [in 2004] to limit production to protect price and to ensure a `soft-landing' of the price plunge, but in the long run, such allegiance is vulnerable and will easily succumb to the temptation of profit and before the test of time. C. Minimum Price According to defendants' interrogatory answers and the deposition
[ 50264, 187, 50260, 35, 50269, 17, 15, 46969, 50261, 17, 15, 18348, 50261, 17, 15, 37545, 50263, 17, 15, 13144, 50264, 187, 50275, 1549, 17615, 2941, 44197, 50274, 34, 50269, 17, 15, 13269, 50261, 17, 15, 12522, 50261, 17, 15, 27706, 50263, 17, 15, 13925, 50264, 187, 50260, 35, 50269, 17, 15, 10496, 50261, 17, 15, 13144, 50261, 17, 15, 26857, 50263, 17, 15, 12522, 50264, 187, 50275, 1549, 17615, 2941, 45535, 50274, 34, 50269, 17, 15, 28271, 50261, 17, 15, 10496, 50261, 17, 15, 29160, 50263, 17, 15, 12522, 50264, 187, 50260, 35, 50270, 14, 17, 15, 15017, 50262, 17, 15, 8972, 50261, 17, 15, 30541, 50263, 17, 15, 12522, 50264, 187, 50275, 1549, 17615, 2941, 39687, 50274, 34, 50269, 14, 17, 15, 11494, 50262, 17, 15, 11494, 50261, 17, 15, 25814, 50263, 17, 15, 10496, 50264, 187, 50260, 35, 50269, 14, 17, 15, 11494, 50262, 17, 15, 18092, 50261, 17, 15, 20151, 50263, 17, 15, 10496, 50264, 187, 50276, 10428, 19312, 23461, 28527, 22712, 22712, 1969, 1969, 1969, 535, 50276, 27, 23363, 323, 253, 475, 41208, 45897, 11, 1708, 9191, 187, 187, 424, 16927, 6098, 31859, 5417, 313, 2973, 15, 337, 582, 18560, 6415, 6333, 313, 2973, 15, 374, 582, 12650, 6714, 11041, 342, 6332, 313, 2973, 84, 15, 495, 285, 577, 582, 1599, 273, 9372, 285, 697, 6332, 313, 2973, 84, 15, 608, 285, 721, 481, 187, 187, 1447, 8476, 27, 4330, 788, 982, 696, 187, 187, 1231, 671, 10141, 323, 9879, 13099, 875, 253, 3921, 41208, 45897, 4622, 575, 911, 993, 980, 407, 13532, 1016, 2060, 8310, 313, 1542, 25127, 3788, 285, 401, 9122, 35, 10, 342, 271, 19360, 1612, 14, 6937, 342, 512, 3602, 1959, 15, 844, 1119, 326, 25212, 5345, 1093, 2692, 10575, 275, 253, 21539, 4577, 685, 577, 6, 285, 275, 669, 4220, 5, 4577, 685, 495, 5294, 342, 2193, 2810, 281, 669, 3549, 5, 18, 15, 3953, 13, 327, 247, 43936, 273, 3578, 1897, 13, 512, 1561, 253, 20418, 275, 841, 3602, 387, 370, 18, 61, 2592, 5, 1268, 15, 380, 19645, 4944, 3103, 7369, 275, 247, 1327, 14, 18645, 6637, 327, 247, 884, 14, 1201, 43936, 15, 187, 187, 28105, 569, 1561, 253, 2540, 2069, 1179, 265, 497, 417, 5189, 875, 1027, 9408, 5421, 1060, 15, 3813, 13, 253, 9408, 273, 512, 253, 3921, 41208, 45897, 4622, 575, 554, 3770, 84, 497, 5678, 281, 2572, 253, 7340, 13, 9603, 247, 2014, 6637, 323, 1016, 13562, 13, 329, 285, 378, 15, 3932, 253, 475, 57, 8643, 1253, 44557, 11, 8310, 369, 4824, 562, 1309, 581, 273, 253, 3921, 41208, 45897, 4622, 575, 911, 993, 980, 13, 253, 9408, 432, 1097, 1759, 15829, 476, 320, 2783, 19645, 15, 844, 2429, 841, 31915, 6473, 475, 57, 8643, 1253, 44557, 8480, 20197, 41208, 45897, 4622, 575, 2203, 5239, 275, 253, 1072, 2341, 3961, 313, 20, 1253, 740, 33052, 10, 281, 16670, 18543, 3910, 875, 841, 13225, 15, 844, 14662, 253, 941, 342, 247, 1612, 14, 6937, 285, 4229, 253, 14679, 13, 6941, 10575, 275, 253, 21539, 15, 844, 1119, 2193, 273, 370, 47, 578, 57, 8643, 34465, 22, 15, 18, 61, 2617, 17, 15, 19, 1572, 3181, 884, 2497, 21, 724, 323, 475, 57, 8643, 1253, 44557, 11, 285, 370, 47, 578, 47, 461, 274, 34465, 22, 15, 19, 61, 2617, 17, 15, 20, 1572, 3181, 884, 2497, 21, 724, 323, 3921, 41208, 45897, 4622, 575, 15, 3813, 13, 323, 436, 2603, 13, 253, 7935, 6128, 403, 5185, 15, 187, 187, 38727, 1544, 1783, 1712, 1704, 27, 18181, 1544, 64, 12792, 94, 187, 23380, 187, 187, 510, 9879, 1783, 273, 253, 475, 41208, 45897, 2992, 475, 57, 8643, 1253, 44557, 11, 285, 475, 44756, 8480, 35, 1194, 941, 369, 2684, 970, 544, 57, 8546, 1181, 2715, 1249, 15, 740, 15, 17, 1008, 12487, 1596, 5353, 1570, 1876, 253, 6332, 2361, 4768, 253, 2929, 2723, 281, 5091, 1202, 6, 5, 7162, 13, 5734, 5010, 4879, 15, 496, 436, 789, 359, 760, 908, 475, 57, 8643, 14, 44557, 11, 7313, 432, 253, 16602, 1864, 14, 15332, 984, 273, 697, 2169, 28519, 1008, 8971, 1344, 32656, 62, 285, 984, 11250, 273, 253, 16602, 1864, 14, 46, 2697, 9408, 7369, 275, 1512, 1199, 7605, 2801, 281, 253, 1698, 2341, 2491, 941, 2792, 2429, 281, 253, 3921, 41208, 45897, 4622, 575, 395, 475, 44756, 8480, 35, 1194, 941, 15, 1198, 512, 9879, 13840, 13, 359, 2908, 247, 43904, 3638, 21539, 875, 25127, 3788, 13, 401, 9122, 35, 13, 16602, 1864, 14, 15332, 285, 44725, 281, 2395, 323, 18543, 20418, 875, 253, 13225, 285, 1896, 10575, 875, 253, 475, 44756, 8480, 35, 1194, 285, 475, 47, 461, 274, 11, 285, 475, 57, 8643, 14, 44557, 11, 28012, 15, 844, 1119, 326, 841, 18543, 20418, 403, 2810, 281, 16167, 3707, 275, 253, 1083, 273, 475, 44756, 3122, 35, 1194, 941, 13, 835, 436, 3638, 310, 2810, 281, 577, 15, 831, 3064, 310, 2011, 275, 5270, 495, 285, 5469, 275, 5238, 577, 15, 18, 15, 187, 187, 49949, 5345, 1093, 2722, 5075, 5721, 611, 1202, 1637, 5, 8295, 15, 1198, 436, 1921, 13, 359, 3053, 776, 9879, 1783, 342, 247, 2969, 19360, 1612, 14, 6937, 342, 247, 1029, 14, 14115, 2624, 14, 2727, 29523, 545, 5375, 11, 91, 545, 5375, 11, 7317, 2727, 446, 65, 275, 544, 57, 8546, 19181, 496, 436, 1566, 253, 2634, 545, 5375, 65, 4445, 310, 2330, 342, 11058, 432, 776, 20970, 285, 4229, 281, 337, 15, 2922, 1202, 3181, 5, 740, 39885, 1109, 1384, 724, 7892, 13668, 19, 3303, 2797, 970, 253, 370, 47, 578, 41, 724, 4968, 1561, 544, 649, 23699, 1181, 1008, 13435, 37, 280, 2364, 28, 1214, 9204, 18970, 589, 4123, 1570, 380, 2634, 91, 545, 5375, 65, 4445, 310, 2330, 342, 11058, 432, 253, 6069, 2919, 15, 844, 3877, 326, 253, 2624, 14, 2727, 1612, 14, 6937, 1566, 323, 253, 19106, 8295, 310, 247, 46286, 1566, 326, 476, 1957, 42928, 1025, 8295, 432, 247, 944, 8440, 390, 37149, 39, 390, 2753, 45486, 8295, 432, 247, 11720, 13, 594, 253, 2603, 273, 1594, 14, 1402, 8295, 275, 253, 1566, 476, 2723, 281, 667, 273, 841, 5289, 15, 187, 187, 1552, 4944, 1543, 275, 247, 669, 4635, 768, 19, 724, 30, 37955, 15, 3046, 323, 40528, 277, 15, 80, 15, 71, 15, 844, 1089, 247, 1534, 15276, 9946, 5084, 4038, 273, 370, 47, 578, 41, 724, 10190, 25, 15, 26, 5, 13566, 17, 15, 24, 19289, 17, 15, 23, 724, 47562, 3181, 5, 884, 15667, 1797, 724, 7892, 13668, 19, 3303, 4645, 326, 253, 40054, 8295, 310, 19360, 13, 669, 4220, 5, 426, 337, 15, 3141, 1202, 2617, 5, 17, 15, 2904, 285, 370, 38, 1126, 1109, 2624, 724, 30, 3655, 5, 13566, 10768, 19289, 1229, 724, 33052, 15, 380, 941, 285, 1682, 14, 8491, 2624, 14, 2727, 1612, 14, 6937, 1566, 403, 2011, 275, 5317, 905, 926, 27, 19583, 2582, 7645, 4207, 831, 1566, 10224, 281, 18212, 4944, 253, 9879, 19106, 13, 6108, 4755, 18872, 42435, 15, 496, 1340, 281, 3157, 253, 9879, 4944, 13, 359, 5421, 253, 42435, 275, 253, 2602, 313, 17, 15, 20, 1253, 19, 15, 17, 33052, 10, 285, 1892, 313, 19, 15, 17, 1253, 7749, 33052, 10, 2341, 10604, 15, 187, 187, 688, 1340, 281, 4665, 253, 3602, 273, 253, 2624, 14, 2727, 1612, 6937, 275, 247, 13318, 14282, 1039, 359, 7932, 436, 4445, 342, 253, 389, 11933, 1320, 1566, 2634, 5065, 4490, 11976, 534, 8631, 42928, 1320, 273, 2602, 20370, 275, 247, 3511, 6532, 1008, 39584, 1116, 2788, 13034, 62, 281, 4711, 253, 3625, 19106, 15, 844, 1089, 253, 1563, 10806, 327, 253, 6488, 3276, 313, 53, 10001, 70, 7884, 285, 5748, 6864, 273, 253, 944, 8440, 11443, 3115, 5, 2262, 465, 53, 10001, 70, 30, 2031, 13566, 1706, 19289, 1348, 3303, 669, 3115, 30, 17, 15, 25, 13566, 17, 15, 21, 19289, 17, 15, 25, 3303, 835, 629, 273, 253, 11649, 275, 841, 3602, 310, 1955, 281, 253, 44877, 875, 731, 15, 496, 1340, 281, 1659, 40638, 10806, 327, 253, 4533, 14, 1189, 2341, 13, 2708, 359, 4035, 281, 897, 247, 46286, 1566, 323, 253, 19106, 13, 891, 15, 70, 904, 247, 2624, 14, 2727, 1612, 14, 6937, 15, 844, 3877, 347, 973, 326, 841, 20418, 513, 417, 19071, 253, 1055, 273, 247, 1896, 12906, 4445, 13, 534, 13, 347, 5469, 2708, 13, 476, 320, 1774, 15, 187, 187, 38368, 2341, 3961, 187, 573, 187, 187, 688, 253, 2602, 2341, 3961, 13, 359, 2879, 247, 8609, 390, 17485, 1612, 14, 6937, 4445, 275, 1340, 281, 3157, 253, 9879, 4944, 15, 35794, 247, 1612, 14, 6937, 4445, 762, 247, 1027, 3167, 5862, 589, 13, 342, 247, 21539, 273, 247, 1643, 2558, 273, 253, 3625, 1612, 14, 6937, 342, 271, 8931, 14679, 13, 7369, 275, 247, 1175, 4944, 342, 669, 4635, 768, 19, 724, 30, 38362, 15, 1812, 323, 38891, 277, 15, 80, 15, 71, 904, 10126, 1805, 685, 253, 19554, 1566, 15, 743, 5795, 37006, 6906, 8609, 4445, 13, 23115, 342, 544, 2088, 4625, 3455, 2684, 5777, 7197, 15, 1198, 436, 1921, 13, 359, 19071, 253, 17485, 1612, 14, 6937, 4445, 275, 253, 1563, 3210, 15, 380, 7756, 273, 253, 1566, 1690, 253, 17485, 4445, 310, 4518, 2326, 275, 5317, 905, 926, 27, 19583, 2582, 7645, 2582, 3113, 2582, 5375, 4207, 5838, 326, 253, 15276, 285, 17485, 1612, 14, 33530, 403, 1077, 2074, 275, 5281, 13, 275, 253, 3210, 597, 403, 7194, 15622, 407, 253, 5862, 589, 326, 597, 452, 275, 2914, 313, 783, 17485, 4445, 556, 247, 2406, 5084, 4038, 685, 253, 15276, 1612, 14, 6937, 8295, 481, 2070, 3292, 253, 4103, 21539, 1959, 4536, 1543, 275, 271, 27697, 273, 253, 4295, 13, 534, 11852, 253, 3451, 8137, 273, 253, 5862, 1653, 15, 1916, 1056, 2119, 326, 253, 6637, 310, 417, 14691, 407, 253, 17485, 4445, 387, 1029, 14120, 13, 253, 4103, 21539, 369, 11096, 281, 247, 4869, 273, 577, 6, 273, 253, 21539, 273, 253, 6069, 1612, 14, 6937, 13, 835, 436, 1798, 1318, 369, 2797, 432, 247, 2969, 4944, 15, 187, 187, 510, 5084, 4038, 273, 253, 5862, 589, 8534, 327, 253, 6508, 17485, 1612, 14, 6937, 275, 436, 4944, 310, 370, 47, 6263, 1109, 388, 2023, 52, 34465, 19, 15, 18, 13566, 18, 15, 17, 19289, 17, 15, 18, 8395, 3181, 884, 768, 1797, 724, 7892, 13668, 19, 3303, 285, 253, 5862, 589, 8534, 327, 253, 6069, 1612, 14, 6937, 310, 370, 47, 6263, 1109, 388, 2023, 41, 34465, 18, 15, 17, 393, 2617, 470, 15, 18, 1572, 3181, 884, 768, 1423, 724, 7892, 13668, 19, 3303, 669, 4220, 5, 426, 337, 15, 2759, 5, 13566, 17, 15, 2904, 19289, 17, 15, 3071, 724, 285, 444, 30148, 1109, 2624, 4203, 1525, 13566, 16271, 19289, 1235, 724, 33052, 15, 329, 2074, 1566, 369, 2011, 407, 1008, 7857, 40, 16430, 30050, 62, 281, 320, 247, 1175, 6779, 273, 253, 1594, 14, 1402, 6637, 273, 11487, 38268, 6117, 275, 253, 470, 15, 19, 1253, 740, 33052, 3961, 342, 475, 57, 8643, 14, 44557, 11, 285, 475, 1779, 17244, 11, 941, 15, 187, 187, 24953, 2341, 3961, 187, 573, 187, 187, 510, 1355, 42435, 2540, 275, 253, 1892, 2341, 3961, 812, 320, 271, 1055, 273, 12906, 432, 271, 25555, 1262, 390, 247, 32621, 15, 380, 1055, 273, 436, 4445, 310, 1869, 281, 2818, 253, 16841, 273, 253, 1892, 1594, 14, 1402, 8295, 285, 310, 5506, 323, 253, 8869, 273, 253, 6871, 8295, 1386, 387, 721, 15, 21, 33052, 1008, 13435, 49, 2261, 28, 1214, 13034, 47, 17244, 1570, 1284, 247, 806, 2746, 281, 22048, 1896, 12906, 3386, 13, 359, 6949, 253, 3361, 273, 6871, 8295, 275, 253, 6637, 273, 25212, 1787, 1093, 15, 844, 5867, 941, 275, 253, 2341, 2491, 608, 15, 17, 1253, 25, 15, 17, 33052, 281, 37709, 253, 878, 273, 247, 6891, 14299, 4445, 15, 3973, 13, 359, 4944, 247, 1612, 14, 6937, 1566, 275, 436, 2491, 285, 4044, 669, 4635, 768, 19, 724, 16, 69, 15, 80, 15, 71, 30, 938, 15, 1630, 16, 1348, 30, 17, 15, 2759, 15, 2635, 359, 823, 247, 14299, 4445, 281, 1263, 253, 7756, 273, 253, 4944, 13, 285, 1119, 669, 4635, 768, 19, 724, 16, 69, 15, 80, 15, 71, 30, 1036, 15, 2526, 16, 1423, 30, 17, 15, 3121, 15, 831, 4445, 556, 247, 1386, 18932, 387, 721, 15, 22, 5, 13566, 17, 15, 18, 19289, 17, 15, 19, 724, 33052, 13, 5185, 342, 5721, 44 ]
B 0.084 0.029 0.061 0.013 60301031004 A 0.023 0.012 0.047 0.011 B 0.015 0.013 0.046 0.012 60301031006 A 0.041 0.015 0.056 0.012 B -0.0004 0.009 0.058 0.012 60301031008 A -0.014 0.014 0.049 0.015 B -0.014 0.033 0.035 0.015 ------------- ----- ------------------ ----------------------- ------------------- ------------------- -- -- -- : Statistics for the *NuSTAR* light curves **Notes:** Obs ID (Col. 1), focal plane module (Col. 2), normalized excess variance with errors (Cols. 3 and 4), mean of counts and its errors (Cols. 5 and 6). \[tab:energetics\] We also checked for spectral variability between the [*NuSTAR*]{} exposures by fitting each individual observation (for FPMA and FPMB) with an absorbed power-law with all parameters free. We found that NGC 3718 showed variations in the normalization smaller than 4% and in $\Gamma$ smaller than 3%, with values close to $\sim$1.94, on a timescale of ten days, all within the uncertainties in these parameters at $1\sigma$ level. The simultaneous fit therefore resulted in a non-variable spectrum on a 10-day timescale. Variations within the observed timescales were not detected between different spectra studied here. Therefore, the spectra of all the [*NuSTAR*]{} epochs were combined to increase the sensitivity, producing a single spectrum for each detector, A and B. Since the *XMM–Newton* observation was carried out during one of the [*NuSTAR*]{} exposures, the spectra from both observatories can be considered simultaneous. We compared these contemporaneous *XMM–Newton*/[*NuSTAR*]{} data sets in the same energy band (3–10 keV) to exclude calibration differences between these instruments. We fitted the data with a power-law and fixed the slope, allowing variations in the normalization. We found values of $N_{XMM}=(5.1\pm0.2)\times 10^{-4}$ for *XMM–Newton* and $N_{Nustar}=(5.2\pm0.3)\times 10^{-4}$ for [*NuSTAR*]{} . Therefore, for this source, the instrument responses are consistent. Spectral analysis {#sec:spectral_analysis} ----------------- The spectral analysis of the *NuSTAR*, *XMM–Newton* and *Swift*/BAT data was performed using [XSpec]{} version 12.10.0 [@1996arnaud]. All the errors reported throughout the paper correspond to 90$\%$ confidence, unless otherwise noted. In this work we only used *XMM-Newton* observations from the EPIC-PN because of its higher throughput [@2001struder] and because inclusion of the EPIC-MOS spectra resulted in too much statistical weight to the low energy range data points compared to the [*NuSTAR*]{} and *Swift*/BAT data. For all spectral fits, we included a multiplicative constant normalization between FPMA, FPMB, EPIC-PN and BAT to account for calibration uncertainties between the instruments and possible variations between the *Swift*/BAT and *Nustar* and *XMM-Newton* exposures. We found that these calibration uncertainties are close to unity except in the case of *Swift/*BAT data, where this constant is close to 4. This difference is shown in Table 3 and discussed in Section 4.1. NGC 3718 shows weak Fe K$\alpha$ emission. For this reason, we started our spectral analysis with a simple absorbed power-law with a high-energy cut-off (`phabs*zphabs*cutoffpl` in [XSpec]{}. In this model the `phabs` component is associated with absorption from our Galaxy and fixed to 1.07$\times$10$^{\rm 20}$ cm$^{-2}$, obtained using the $N_{H}$ tool within [ftools]{} [@1990Dickey; @2005karberla]. The `zphabs` component is associated with absorption from the nuclear region. We note that the cut-off power-law model for the continuum emission is a phenomenological model that can represent Comptonized emission from a corona or ADAF or synchrotron emission from a jet, so the source of X-ray emission in the model can correspond to any of these structures. This fit results in a $\chi^{2}$= 427.59 for 374 d.o.f. We find a significant intrinsic hydrogen column density of $N_{H}$=(8.9$^{+0.7}_{-0.6}$)$\times$ 10$^{21}$ cm$^{-2}$, showing that the coronal emission is absorbed, $\Gamma$ = 1.78$\pm$0.08 and $E_{\rm cut}$=73$^{+111}_{-30}$ keV. The data and best-fit cut-off power-law model are shown in Figure \[fig:simple\_model\]. This model fails to adequately fit the spectral continuum, leaving obvious structured residuals. In order to improve the spectral fit, we studied the residuals in the soft (0.3–2.0 keV) and hard (2.0–110 keV) energy bands. In order to interpret the parameters of the cut-off powerlaw in a physically meaningful way we replaced this component with the comptonization model `CompTT`, which describes Comptonization of soft photons in a hot plasma [@titarchuk1994] to produce the primary continuum. We find the following constraints on the electron temperature (T$_e$) and optical depth of the corona ($\tau$): kT$_e=44^{+34}_{-24}$, $\tau=0.8^{+0.4}_{-0.8}$, where part of the uncertainty in these parameters is due to the degeneracy between them. In order to place tighter constraints on the roll-over energy, below we continue to use a phenomenological model for the continuum, i.e., a cut-off power-law. We note as well that these uncertainties do not incorporate the effect of a possible reflection component, which, as discussed below, can be important. Soft energy band ---------------- In the soft energy band, we added a thermal or scattered power-law component in order to improve the spectral fit. Adding a power-law component under a different host absorber, with a normalization of a few percent of the primary power-law with an identical slope, resulted in a good fit with $\chi^{2}$= 417.36 for 372 d.o.f., statistically better than the simpler model. An alternative optically thin thermal component, modeled with [APEC]{}, performed slightly worse. For this reason, we incorporate the scattered power-law component in the following models. The improvement of the model including the scattered component is clearly seen in Figure \[fig:simple\_model\_with\_abs\]. Note that the intrinsic and scattered power-laws are very similar in shape, in the models they are mainly distinguished by the absorber that they have in front (the scattered component has a lower column density than the intrinsic power-law emission). Leaving the relative normalization free sometimes results in an inversion of the components, which affects the correct identification of the absorbers. To make sure that the spectrum is not dominated by the scattered component at high energies, the relative normalization was restricted to a maximum of 4% of the normalization of the nuclear power-law, where this particular value was obtained from a simple fit. The column density of the absorber acting on the extended scattered power-law in this fit is $N_{{\rm H},S}=(2.1^{+1.0}_{-0.1})\times 10^{21}$ cm$^{-2}$, and the absorber acting on the nuclear power-law is $N_{{\rm H},H}=(1.0 \pm 0.1)\times 10^{22}$ cm$^{-2}$, $\Gamma$ = 1.84$^{+0.08}_{-0.06}$ and E$_{\rm cut}=99^{+153}_{-50}$ keV. A similar model was shown by [@2009Gonzalez] to be a good representation of the X-ray spectrum of 82 LINERS in the 0.2–10 keV band with *XMM-Newton* and *Chandra* data. Hard energy band ---------------- The small residuals observed in the hard energy band could be an effect of reflection from an accretion disc or a torus. The effect of this component is thought to affect the curvature of the hard X-ray emission and is responsible for the creation of the iron emission line at 6.4 keV [@1990Pounds; @1994Nandra]. As a first approach to quantify possible reflection features, we investigated the presence of iron emission in the spectrum of NGC3718. We analyzed data in the energy range 5.0–8.0 keV to constrain the need of a narrow Gaussian component. First, we fit a power-law model in this range and obtain $\chi^{2}$/d.o.f=20.27/24=0.84. Then we add a Gaussian component to study the improvement of the fit, and found $\chi^{2}$/d.o.f=16.66/22=0.76. This component has a line centered at 6.5$^{+0.1}_{-0.2}$ keV, consistent with FeK
[ 321, 587, 209, 187, 615, 1557, 716, 513, 609, 13090, 13450, 15, 187, 34, 2443, 66, 27, 17849, 716, 513, 274, 4265, 13090, 13450, 187, 615, 29188, 282, 18205, 83, 11317, 15, 187, 9, 51, 6457, 1178, 70, 10, 187, 4749, 446, 86, 13, 8794, 32, 187, 28895, 209, 16163, 6811, 86, 2636, 305, 32294, 615, 16163, 6811, 27, 187, 24968, 5101, 4265, 7318, 258, 294, 15478, 292, 4265, 187, 21601, 579, 247, 372, 1261, 74, 295, 265, 303, 15478, 262, 15, 187, 9, 51, 6457, 1178, 70, 10, 187, 38, 3241, 13090, 5433, 4265, 13, 3820, 372, 22871, 442, 47692, 7846, 66, 15, 187, 28895, 913, 13013, 1049, 609, 629, 14576, 16724, 79, 554, 4265, 250, 363, 74, 372, 391, 4265, 86, 6598, 187, 12442, 17457, 479, 66, 838, 484, 2517, 17849, 716, 513, 274, 4265, 13090, 13450, 187, 14573, 6868, 1209, 17255, 27487, 30405, 15478, 70, 15, 187, 13026, 79, 2457, 13, 8794, 2578, 9111, 466, 17849, 716, 948, 38851, 35803, 729, 255, 15, 187, 1672, 13374, 74, 17155, 24843, 34258, 48414, 2247, 355, 246, 4265, 86, 187, 24427, 8794, 23105, 372, 2636, 17849, 10044, 38851, 15733, 74, 660, 86, 2721, 15, 187, 187, 33824, 11308, 313, 1047, 3357, 14, 2262, 209, 187, 138, 228, 30935, 7136, 37134, 17686, 8095, 3147, 3393, 5117, 17757, 22206, 7136, 1454, 124, 3393, 48614, 10977, 8348, 21394, 3868, 17757, 13, 209, 187, 5676, 10298, 37134, 4654, 2141, 7072, 12388, 7136, 15, 187, 138, 99, 2863, 24292, 48614, 19927, 18383, 33627, 23871, 8348, 10977, 2863, 4733, 24036, 14439, 3147, 35691, 3952, 10298, 43242, 49626, 48614, 13, 209, 187, 2141, 29704, 8348, 1454, 108, 14439, 3147, 5613, 7136, 3868, 2863, 18383, 14439, 4134, 38929, 5676, 22206, 7136, 187, 4134, 8520, 36684, 9203, 4134, 2599, 5117, 20933, 2141, 24292, 19927, 3147, 5613, 28832, 16287, 30175, 9737, 3868, 8348, 4733, 209, 187, 19927, 17686, 9028, 42313, 3393, 16411, 29495, 6450, 17648, 10227, 28434, 15, 187, 138, 99, 28649, 16962, 21027, 3955, 8348, 25651, 7490, 7539, 4992, 48911, 10977, 2863, 10227, 2863, 4733, 209, 187, 2599, 8520, 19073, 4654, 4992, 3147, 23871, 5117, 4134, 8348, 3868, 16411, 25235, 187, 138, 219, 9650, 11910, 11112, 11630, 2863, 8361, 10139, 17757, 14439, 15, 187, 138, 229, 10139, 17757, 8095, 49100, 16003, 27, 48185, 16287, 12116, 40051, 6450, 3868, 16411, 187, 7072, 14858, 5613, 2989, 49456, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 18383, 3952, 12116, 6450, 15, 187, 138, 229, 10139, 17757, 11112, 3393, 11630, 16411, 14733, 27, 209, 187, 138, 239, 4992, 3147, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 18383, 3952, 12116, 6450, 30175, 37677, 8348, 15, 187, 9, 138, 230, 9203, 5776, 14858, 10, 187, 138, 228, 4134, 5776, 7136, 13, 9529, 7490, 3868, 33627, 28, 187, 138, 228, 29704, 8348, 1454, 124, 9203, 38093, 5613, 2989, 9529, 5676, 9203, 12116, 16411, 3868, 16411, 27, 187, 138, 228, 30935, 7136, 5898, 5676, 27435, 7072, 3393, 30656, 9529, 27580, 47909, 14439, 7072, 10139, 209, 187, 7072, 14858, 19073, 13850, 26097, 11910, 4733, 4654, 2141, 5776, 8348, 5676, 39242, 15, 187, 9, 138, 230, 9203, 5776, 14858, 10, 187, 12507, 30681, 8095, 11910, 29354, 25651, 11910, 13, 4654, 8520, 26855, 3955, 5346, 2141, 26097, 11910, 26855, 9650, 3147, 8348, 15, 187, 138, 228, 29704, 8348, 9737, 5676, 24745, 4654, 42044, 26097, 11910, 17686, 9028, 2863, 3955, 3955, 8348, 21227, 209, 187, 2599, 8520, 7539, 19927, 4654, 4992, 23871, 5117, 4134, 8348, 3868, 16411, 25235, 187, 138, 234, 48911, 10977, 2863, 10227, 7136, 4733, 4654, 8520, 5898, 47946, 29354, 17686, 19073, 4654, 4992, 9529, 39242, 18383, 6450, 7072, 3393, 30656, 187, 48614, 3952, 12116, 6450, 23766, 9737, 2989, 5776, 12388, 3952, 26097, 11910, 2141, 18806, 9737, 5117, 7072, 9203, 3147, 11910, 2141, 15, 187, 138, 219, 2599, 44586, 42191, 5613, 9203, 25326, 4733, 13, 49456, 23977, 3952, 11910, 8348, 25651, 3393, 30656, 209, 187, 19927, 15902, 30793, 13913, 38377, 16411, 9737, 21027, 9650, 34500, 15, 187, 138, 219, 9650, 3393, 16411, 25628, 18383, 5776, 11630, 16411, 3952, 10139, 9529, 39242, 26855, 3955, 44687, 21394, 47946, 29354, 209, 187, 5676, 10298, 49456, 24292, 9650, 3393, 16411, 19073, 46440, 25326, 7072, 4992, 10977, 24745, 16411, 30175, 5613, 6450, 16287, 14439, 15, 187, 187, 29520, 27, 209, 187, 15168, 826, 294, 7397, 44841, 6255, 340, 1578, 278, 31076, 3737, 15, 187, 15288, 288, 907, 6868, 17113, 274, 27868, 372, 75, 860, 3641, 19146, 23246, 15, 187, 39, 489, 23136, 1141, 917, 1753, 50158, 860, 5940, 21682, 187, 18920, 1753, 530, 1397, 15, 2343, 288, 12043, 49307, 36071, 15, 187, 15288, 42078, 80, 27, 346, 46, 11524, 19095, 5586, 642, 13679, 12083, 3446, 187, 33972, 9500, 7222, 375, 247, 32644, 343, 15, 187, 18204, 254, 7222, 80, 27, 7659, 31945, 187, 371, 860, 3293, 1395, 66, 440, 1113, 23246, 15, 187, 23083, 16538, 7222, 80, 27, 18150, 257, 1578, 284, 7349, 284, 355, 1113, 23246, 15, 187, 9, 51, 261, 284, 10, 187, 52, 2083, 16078, 13, 25769, 332, 45328, 32, 187, 49, 2771, 22572, 2343, 1753, 46154, 17113, 6575, 27, 187, 38, 11769, 13022, 49267, 826, 761, 1464, 187, 615, 26566, 6972, 1936, 3025, 440, 1144, 6187, 4239, 80, 15, 187, 9, 51, 261, 284, 10, 187, 2302, 7222, 66, 35927, 13, 479, 2343, 37266, 257, 44379, 15, 187, 58, 21799, 1950, 1578, 27868, 441, 13167, 187, 293, 346, 78, 11524, 19095, 5586, 642, 13679, 12083, 3446, 187, 17483, 3241, 12910, 383, 376, 2343, 1753, 13647, 1395, 66, 440, 1113, 23246, 187, 316, 6575, 28870, 376, 8274, 10045, 340, 3336, 7860, 15, 187, 2422, 2457, 13, 642, 246, 40594, 187, 1452, 2197, 343, 339, 28824, 2272, 15, 187, 3251, 46154, 48414, 6575, 372, 826, 43587, 637, 3525, 187, 90, 642, 246, 40594, 1753, 1262, 335, 12083, 372, 35927, 15, 187, 187, 27684, 27, 209, 187, 147, 233, 18007, 10626, 6810, 96, 13963, 230, 12859, 103, 14, 27339, 20770, 147, 229, 147, 242, 33389, 29052, 147, 235, 20770, 10740, 13, 187, 12859, 233, 18007, 6810, 102, 49657, 42252, 15, 187, 31468, 26344, 24990, 10740, 29598, 24990, 6810, 233, 18007, 37167, 25398, 41855, 21062, 18007, 13, 6810, 238, 26344, 18007, 24990, 43845, 147, 235, 21062, 24990, 10740, 13, 187, 21677, 27339, 20770, 6810, 233, 18007, 25269, 13963, 231, 6810, 238, 18007, 33389, 35790, 18007, 33992, 187, 26344, 43845, 13963, 105, 36403, 24990, 10740, 32017, 25398, 31468, 29052, 35154, 42252, 33839, 13963, 235, 18007, 187, 35154, 35790, 10740, 32017, 31468, 26344, 36894, 29598, 24990, 6810, 233, 18007, 37167, 25398, 35154, 10626, 12859, 242, 15, 187, 21677, 29052, 10740, 6810, 102, 12859, 103, 21677, 24990, 32017, 18007, 27, 187, 26344, 13963, 235, 24990, 346, 20770, 21677, 33389, 147, 101, 147, 235, 31468, 21062, 24990, 449, 187, 13963, 104, 32017, 18007, 33839, 29052, 10740, 33839, 20770, 27339, 33992, 15, 187, 26344, 20770, 27339, 337, 27, 32017, 18007, 36403, 20770, 13963, 235, 6810, 97, 20770, 33389, 18007, 187, 20770, 21677, 33839, 25398, 33992, 6810, 233, 13963, 242, 15, 187, 26344, 20770, 27339, 374, 27, 32017, 21677, 32017, 26344, 33992, 6810, 233, 13963, 242, 187, 31468, 20770, 25269, 35790, 27339, 21062, 33992, 25269, 21677, 20770, 18007, 15, 187, 9, 147, 101, 36403, 12859, 102, 10, 187, 43845, 26344, 12859, 235, 13, 6810, 243, 35154, 12859, 242, 32, 187, 21677, 27339, 20770, 29598, 29052, 10740, 6810, 236, 12859, 230, 31468, 24990, 187, 25398, 18007, 29598, 24990, 42252, 6810, 234, 12859, 104, 27339, 33992, 27, 187, 147, 233, 18007, 6810, 243, 26344, 25398, 31468, 6810, 238, 25398, 10626, 33389, 24990, 35154, 12859, 242, 187, 20770, 18007, 43845, 12859, 237, 32017, 26344, 25398, 12859, 102, 33992, 15, 187, 9, 147, 101, 36403, 12859, 102, 10, 187, 21677, 13963, 242, 37167, 31468, 13963, 231, 15, 187, 21677, 12859, 241, 21062, 33992, 32017, 10740, 29598, 24990, 6810, 233, 18007, 25269, 21062, 27339, 18007, 15, 187, 21677, 27339, 20770, 6810, 238, 21677, 147, 242, 6810, 243, 35154, 29052, 49657, 25269, 36403, 20770, 41855, 33839, 20770, 187, 18007, 3, 20770, 21677, 33389, 147, 101, 147, 235, 31468, 21062, 24990, 3446, 187, 35154, 10740, 25269, 26344, 13963, 235, 18007, 33839, 20770, 10740, 25269, 13963, 227, 187, 20770, 21677, 32017, 26344, 33992, 6810, 233, 13963, 242, 37167, 31468, 147, 233, 21062, 24990, 6810, 238, 29052, 36894, 46977, 29052, 13963, 241, 12859, 96, 15, 187, 12859, 227, 147, 233, 32017, 21677, 33389, 21062, 147, 229, 13963, 104, 33992, 29598, 26344, 25398, 18007, 15, 187, 21677, 24990, 42252, 33389, 24990, 29052, 18007, 147, 229, 33992, 6810, 236, 43845, 18007, 187, 12859, 227, 13963, 242, 32017, 35154, 42252, 6810, 97, 20770, 33389, 18007, 32017, 18007, 24990, 29052, 147, 101, 20770, 15, 187, 187, 48236, 27, 209, 187, 17483, 11856, 294, 7397, 48873, 6255, 13, 187, 9307, 820, 8901, 278, 31076, 3737, 15, 187, 39, 478, 31812, 4474, 913, 284, 80, 187, 371, 6575, 7950, 489, 74, 48743, 41534, 1747, 80, 13, 187, 6681, 27052, 246, 3685, 1485, 83, 36789, 1753, 711, 257, 8625, 6584, 187, 9307, 21682, 372, 39416, 31812, 12228, 1792, 9392, 13, 187, 1452, 448, 13431, 372, 346, 78, 11524, 19095, 187, 8, 79, 3685, 3578, 1689, 1753, 479, 711, 1291, 1148, 8, 3446, 187, 30377, 1565, 3443, 284, 1162, 522, 284, 15, 187, 24858, 24470, 5111, 27, 1086, 4355, 5586, 258, 1753, 36156, 187, 72, 493, 8125, 372, 8405, 274, 258, 269, 17457, 14, 339, 15, 187, 24858, 24470, 513, 261, 27, 8405, 489, 258, 269, 17457, 14, 339, 187, 81, 376, 3265, 284, 820, 261, 284, 15, 187, 9, 51, 261, 375, 10, 187, 4749, 1868, 13, 31627, 32, 187, 35147, 42185, 258, 1753, 36156, 18219, 17113, 6575, 27, 187, 3, 49, 609, 336, 11856, 1645, 5741, 187, 615, 8733, 396, 15070, 274, 5111, 2654, 21620, 3446, 187, 9, 51, 261, 375, 10, 187, 53, 16469, 36664, 13, 10959, 31277, 36146, 31812, 15, 187, 35147, 3974, 247, 1950, 1753, 994, 376, 247, 17532, 187, 3, 79, 3685, 3578, 1689, 1753, 479, 711, 1291, 1148, 3446, 187, 5072, 86, 44189, 19095, 396, 21058, 247, 8405, 274, 258, 269, 17457, 14, 339, 187, 681, 42839, 1452, 4019, 299, 3336, 14291, 15, 187, 6717, 303, 13, 642, 269, 303, 9527, 523, 284, 13, 187, 87, 406, 5437, 12065, 3509, 8901, 396, 2197, 343, 28824, 3377, 15, 187, 47, 3685, 39434, 1757, 42361, 10081, 35927, 1486, 3377, 187, 70, 12065, 4109, 1757, 35927, 513, 1753, 396, 711, 1291, 1148, 15, 187, 187, 14376, 27, 209, 187, 1552, 310, 6255, 372, 14, 498, 33066, 13, 187, 395, 352, 310, 21653, 15, 187, 42, 858, 352, 407, 7343, 672, 309, 15856, 619, 2628, 13, 187, 2858, 352, 369, 594, 8644, 187, 3529, 309, 3715, 247, 1039, 323, 368, 187, 936, 513, 352, 327, 4096, 15, 187, 42, 1067, 352, 346, 783, 417, 7016, 1332, 449, 187, 1147, 556, 767, 5018, 15, 187, 13996, 581, 27, 7659, 504, 752, 187, 5658, 1053, 626, 1918, 247, 7435, 670, 15, 187, 13996, 767, 27, 5037, 626, 1918, 247, 7435, 187, 10383, 1110, 1841, 15, 187, 9, 45, 5244, 10, 187, 21595, 13, 987, 32, 187, 1989, 309, 871, 752, 368, 1472, 4680, 27, 187, 1552, 7835, 751, 247, 13612, 187, 1542, 8577, 715, 271, 40889, 15, 187, 9, 45, 5244, 10, 187, 1147, 434, 8261, 13, 309, 755, 326, 247, 2257, 15, 187, 1989, 326, 434, 835, 187, 783, 346, 1439, 7016, 3, 629, 3249, 275, 15, 187, 3220, 1332, 310, 512, 670, 417, 4933, 247, 7435, 187, 5302, 33773, 285, 2314, 8098, 15, 187, 2598, 275, 253, 990, 13, 187, 5658, 1053, 626, 452, 281, 1928, 8106, 15, 187, 1394, 403, 327, 634, 1682, 3879, 13, 209, 187, 395, 368, 452, 2717, 281, 26012, 323, 15, 187, 187, 33741, 27, 209, 187, 52, 2880, 70, 4857, 267, 12704, 1327, 557, 2059, 26293, 32616, 15, 187, 11592, 256, 2880, 70, 20641, 3767, 80, 39884, 1213, 251, 9877, 15, 187, 3864, 40620, 13, 1705, 8429, 17090, 794, 91, 279, 609, 591, 3273, 74, 187, 300, 6365, 19095, 3105, 15953, 32, 187, 4678, 73, 13, 1313, 6811, 13431, 1161, 2177, 12580, 3649, 571, 187, 8924, 18656, 308, 1406, 80, 1073, 2101, 796, 8, 187, 70, 256, 2880, 70, 1098, 74, 828, 262, 8657, 187, 66, 5940, 260, 6736, 2328, 257, 3737, 24932, 13, 187, 4123, 572, 1079, 16165, 261, 336, 345, 4164, 7496, 609, 187, 300, 362, 493, 287, 2086, 785, 4510, 7067, 15, 187, 37956, 557, 2059, 584, 14173, 74, 307, 609, 298, 457, 7821, 7067, 13, 187, 785, 2177, 12580, 584, 34843, 332, 80, 30670 ]
urile de care te doare în cot. A doua: să te doară în cot de acele lucruri. (Râsete) Simplu, nu? Dar știu ce gândești: asta sună ca o rețetă pentru a deveni nesimțit. (Râsete) Este în regulă, aud de multe ori asta. Dar acolo apare partea „nepărerii de rău”. Metoda mea presupune să te doară în cot cu sinceritate și politețe. În final, nu trebuie să te simți vinovat. Exprimi cel mai bun comportament al tău și nu ai de ce să îți ceri scuze. Modern Greek (1453-): Αυτό είναι το πνευματικό ξεκαθάρισμα, και είναι μαγικό. Το έκανα κατά λάθος όταν παραιτήθηκα, αλλά ήταν τόσο καταπληκτικό που ανέπτυξα έναν τρόπο για εσάς να το κάνετε επίτηδες. Τον ονομάζω «η μέθοδος του να μην λυπάστε». Έχει δύο βήματα. Βήμα πρώτο: Αποφασίστε για τι δεν σας καίγεται καρφί. Βήμα δεύτερο: Μην σας καίγεται καρφί για αυτά. (Γέλια) Απλό, σωστά; Αλλά ξέρω τι σκέφτεστε: Αυτό ακούγεται σαν συνταγή για να γίνεις μαλάκας. (Γέλια) Δεν πειράζει, μου συμβαίνει συχνά. Αλλά εκεί μπαίνει το κομμάτι του «να μη λυπάστε». Η μέθοδός μου αφορά το να μη σας καίγεται καρφί με ειλικρίνεια και ευγένεια. Έτσι στο τέλος, δεν χρειάζεται να νοιώθετε ενοχές. Έχετε την καλύτερή σας συμπεριφορά και δεν έχετε να απολογηθείτε για τίποτα. Spanish: Es la reorganización mental y es mágica. Lo hize sin pensar cuando dejé mi trabajo. Fue tan increible que desarrollé una forma para que Uds. lo hagan conscientemente. Lo llamo: "Método para no culparse". Hay dos pasos a seguir. Primer paso: Decidan qué les importa un carajo. Segundo paso: Manden esas cosas al carajo. (Risas) Sencillo, ¿verdad? Pero sé lo que están pensando: Esto más parece la receta de cómo volverse un estúpido. (Risas) No pasa nada, me lo dicen mucho. Y ahí es cuando usamos el "método para no culparse". Éste muestra lo que nos importa un carajo usando nuestra honestidad y educación. Al final, no tienen que sentirse culpables. Se están comportando de la mejor manera y no tienen que disculparse de nada. iw: זהו סידור-בלגן מנטלי, וזה קסם. עשתי את זה במקרה, כשהתפטרתי, אבל זה היה כה מדהים שפיתחתי למענכם שיטה כדי לעשות את זה במכוון. אני קוראת לה: שיטת "לא מצטערת." יש לה שני שלבים. שלב 1: להחליט על מה לא שמים זין. שלב 2: לא לשים זין על הדברים האלה. (צחוק) פשוט, נכון? אבל אני יודעת מה אתם חושבים: זה נשמע כמו מתכון להפוך לשמוקים. (צחוק) אין בעיה. אומרים לי את זה הרבה. אבל כאן נכנס החלק של ה"לא מצטערת". כי השיטה שלי היא לא לשים זין בעזרת כנות ונימוס. ואז לא מרגישים אשמה. אתם מתנהגים יפה ואין לכם על מה להתנצל. Portuguese: É uma reorganização mental, uma coisa mágica. Fiz isso por acaso quando larguei meu emprego, mas foi tão incrível que desenvolvi uma forma de fazer isso voluntariamente, que chamo de "método 'não tenho que me desculpar'". Ele tem duas etapas. Etapa um: decida para o que você gostaria de ligar o foda-se. Etapa dois: ligue o foda-se pra essas coisas. (Risos) Simples, né? Mas sei o que você está pensando: "Parece uma receita de como se tornar um idiota". (Risos) Tudo bem, ouço muito isso. Mas é aí que entra a parte "não tenho que me desculpar". Meu método se resume a ligar o foda-se com franqueza e educação. Assim, no fim das contas, você não precisa se sentir culpado. Não estará fazendo nada errado e não terá nada do que se desculpar. English: This is mental de-cluttering, and it is magical. I did it by accident when I quit my job, but it was so amazing that I developed a way for you to do it on purpose. I call it "the not sorry method." It has two steps. Step one: Decide what you don't give a fuck about. Step two: Don't give a fuck about those things. (Laughter) Simple, right? But I know what you're thinking: This sounds like a recipe for turning into an asshole. (Laughter) It's okay, I get that a lot. But that's where the "not sorry" part comes in. My method is all about not giving a fuck using honesty and politeness. So in the end, you don't have to feel guilty. You are on your best behavior, and you have nothing to apologize for. Italian: Siete letteralmente non dispiaciuti. Non siete nemmeno degli stronzi. Quindi, come può funzionare per voi il Metodo NotSorry? Beh, mettiamo che vi piaccia ‘Il Trono di Spade' e siete stati invitati a una cena domenica sera, la quale interferisce con il guardare il vostro programma preferito. Vi dispiace rifiutare l’invito, ma vi piace davvero tanto
[ 15, 187, 9, 3493, 39238, 518, 10, 187, 187, 29520, 27, 209, 187, 33492, 266, 20320, 9821, 2965, 66, 546, 12368, 4154, 80, 13, 187, 3549, 3018, 70, 761, 10207, 3354, 1753, 1305, 3109, 9435, 372, 826, 21721, 3876, 187, 18920, 49833, 45825, 4123, 15, 187, 3594, 317, 6358, 15, 187, 4350, 27, 1997, 317, 6358, 187, 9, 34, 446, 666, 375, 10, 187, 187, 27684, 27, 209, 187, 21677, 24990, 42252, 33389, 12859, 101, 21677, 33992, 6810, 99, 147, 229, 42252, 37167, 147, 235, 13963, 97, 12859, 242, 25269, 147, 233, 18007, 13, 187, 147, 233, 13963, 238, 21062, 10626, 33839, 21677, 24990, 42252, 6810, 105, 18007, 10740, 10626, 6810, 105, 20770, 10626, 10740, 33992, 37167, 18007, 147, 229, 10740, 12859, 242, 187, 27339, 35154, 35790, 10740, 32017, 18007, 147, 101, 27339, 13963, 97, 6810, 97, 20770, 10740, 10626, 15, 187, 24990, 12859, 230, 18007, 6810, 103, 27339, 18007, 15, 187, 49657, 3, 43845, 27, 6810, 105, 12859, 230, 18007, 6810, 103, 27339, 18007, 15, 187, 9, 24990, 26344, 12859, 227, 36894, 10, 187, 187, 27397, 27, 209, 187, 4183, 4141, 18651, 1640, 12559, 32195, 21387, 19833, 13396, 3504, 1640, 4407, 30315, 8496, 9160, 42732, 32195, 5129, 5126, 24215, 13, 187, 7179, 8496, 1640, 21387, 13, 18716, 4407, 11409, 3776, 11256, 16205, 12444, 7620, 12587, 25510, 31784, 13, 187, 4435, 1367, 44298, 27854, 6564, 15647, 11995, 15309, 15, 187, 22690, 7179, 15712, 43218, 1068, 25235, 187, 22690, 21715, 27, 7539, 22690, 7179, 15712, 43218, 1068, 25235, 187, 9, 30184, 7179, 3415, 8804, 17307, 5160, 21527, 4141, 10, 187, 187, 30574, 757, 27, 209, 187, 72, 4265, 9245, 33541, 440, 7071, 355, 913, 383, 4113, 4154, 13, 187, 312, 565, 74, 38851, 14, 87, 4265, 22295, 1670, 38851, 1305, 25313, 372, 1218, 33541, 2517, 187, 84, 4265, 14, 77, 1548, 692, 66, 38851, 15, 187, 46, 335, 13069, 9181, 68, 15, 187, 4350, 27, 26251, 13069, 9181, 68, 187, 9, 34, 446, 1952, 2721, 10, 187, 187, 38288, 6656, 27, 209, 187, 22559, 1757, 6677, 518, 821, 7588, 14260, 1757, 5134, 1730, 1757, 19559, 187, 2275, 7564, 11775, 3974, 83, 652, 5069, 7564, 13, 187, 36258, 263, 48202, 311, 17551, 518, 391, 1757, 13, 187, 73, 15514, 3974, 83, 442, 5616, 465, 293, 17655, 13, 187, 73, 15514, 3974, 20932, 38198, 4233, 860, 76, 15, 187, 44, 2381, 20932, 17685, 35127, 15, 187, 4350, 27, 611, 2381, 20932, 17685, 35127, 15, 187, 9, 53, 1825, 10, 187, 187, 48654, 27499, 27, 209, 187, 73, 3312, 90, 31386, 6829, 238, 391, 9702, 111, 1251, 270, 30110, 79, 260, 129, 104, 1251, 260, 9702, 102, 79, 277, 14096, 1251, 17949, 32595, 79, 187, 77, 10561, 298, 9702, 123, 17949, 41314, 448, 6829, 220, 1218, 298, 6829, 234, 74, 17949, 1954, 15, 187, 57, 249, 260, 35165, 78, 209, 47170, 79, 15, 187, 4350, 27, 330, 35165, 78, 209, 47170, 79, 15, 187, 9, 55, 6829, 234, 246, 333, 10, 187, 187, 6075, 13564, 27, 209, 187, 18956, 1484, 80, 7090, 614, 13738, 7326, 13312, 1484, 14246, 297, 4154, 86, 13, 187, 91, 522, 312, 85, 614, 13, 258, 3433, 12355, 9948, 16606, 396, 5549, 21721, 360, 187, 76, 18956, 1794, 5139, 21721, 302, 21529, 3093, 15, 187, 41, 1208, 66, 15, 187, 4350, 27, 388, 1208, 66, 15, 187, 9, 34, 446, 1952, 91, 10, 187, 187, 16330, 757, 27, 209, 187, 5843, 23072, 40802, 4467, 9427, 31159, 14062, 30265, 10091, 209, 45821, 10091, 9211, 3142, 29413, 6900, 9211, 10091, 9211, 26969, 187, 13621, 9427, 45232, 10714, 117, 6900, 28745, 10714, 114, 8181, 9427, 15677, 10714, 114, 10091, 9211, 29413, 9427, 25393, 14062, 29937, 15677, 6900, 30801, 187, 10714, 114, 24477, 9427, 15677, 9427, 4954, 97, 5846, 25393, 14062, 29937, 15677, 9427, 32262, 113, 8181, 9211, 4467, 7427, 18152, 47931, 43246, 9427, 45232, 6534, 3142, 9427, 10091, 9211, 15677, 49788, 15, 187, 13621, 3142, 20817, 22814, 18775, 6900, 15, 187, 46978, 8181, 10091, 34606, 27, 15677, 3142, 20817, 22814, 18775, 6900, 15, 187, 187, 33824, 11308, 313, 1047, 3357, 14, 2262, 209, 187, 30681, 16003, 4134, 6450, 41783, 16411, 24292, 19927, 5613, 38093, 2599, 7136, 9529, 4992, 18951, 6450, 2863, 187, 3868, 16003, 49929, 9650, 24745, 44206, 17757, 37677, 7136, 13, 187, 10977, 5117, 3955, 4992, 10977, 24745, 16411, 40557, 38833, 8361, 40051, 6450, 25651, 3393, 3868, 16411, 37384, 23871, 2863, 7072, 12388, 10139, 187, 7072, 14858, 19073, 17686, 11112, 24745, 20933, 3393, 16411, 15, 187, 138, 232, 5117, 9650, 2141, 21394, 3868, 16003, 11630, 18951, 15, 187, 138, 98, 138, 243, 27, 29830, 5117, 9650, 2141, 21394, 3868, 16003, 11630, 18951, 15, 187, 9, 138, 102, 11910, 14733, 5676, 28832, 17648, 17757, 10, 187, 187, 27223, 27, 209, 187, 24553, 13744, 242, 11800, 120, 22044, 11016, 236, 45256, 42025, 244, 21365, 109, 29626, 96, 5225, 37661, 120, 17783, 117, 6238, 187, 44330, 30808, 24553, 10673, 218, 5959, 214, 16800, 240, 19127, 243, 24017, 37895, 120, 187, 44781, 34811, 18678, 11016, 236, 40951, 37661, 120, 17783, 117, 187, 164, 107, 240, 164, 107, 240, 4340, 209, 187, 5941, 112, 9078, 105, 36387, 107, 18140, 164, 107, 240, 164, 107, 240, 187, 14236, 17598, 223, 30590, 112, 14106, 187, 50, 27, 187, 187, 1251, 27475, 27599, 4602, 327, 690, 7968, 187, 187, 2512, 310, 1895, 342, 295, 48431, 15, 733, 27599, 4602, 1078, 5268, 30214, 6184, 15, 733, 4453, 751, 27, 187, 370, 259, 788, 428, 48, 1227, 3620, 16, 8629, 3944, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 16437, 15, 11368, 187, 283, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 2941, 283, 50276, 2413, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 16437, 15, 11368, 187, 2632, 11932, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 41605, 15567, 15, 20210, 15, 10683, 15, 20210, 187, 27642, 272, 281, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 8579, 10683, 15, 20210, 15, 10683, 15, 20210, 93, 27, 1438, 1051, 4802, 15, 187, 23760, 2748, 2197, 13, 31288, 2380, 1051, 1052, 10826, 187, 10830, 27, 5091, 26522, 313, 2511, 44, 10, 544, 5695, 16, 42787, 62, 187, 52, 3292, 281, 27, 2634, 16, 3620, 16, 8629, 8, 187, 187, 1731, 6, 544, 19557, 31, 50258, 62, 2164, 13, 20922, 50272, 283, 8634, 44, 16, 84, 50275, 249, 854, 15, 24, 84, 50274, 187, 187, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 805, 313, 19, 15, 3566, 37998, 16, 84, 10, 428, 29028, 4581, 387, 12243, 2164, 20922, 15, 416, 5704, 272, 15, 187, 187, 283, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 1012, 283, 50276, 9, 14626, 27, 374, 10, 50276, 2413, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 16437, 15, 11368, 187, 27642, 272, 281, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 8579, 10683, 15, 20210, 15, 10683, 15, 20210, 93, 27, 1438, 1051, 4802, 15, 187, 23760, 2748, 2197, 13, 31288, 2380, 1051, 25193, 38468, 17215, 187, 10830, 27, 5091, 26522, 313, 2511, 44, 582, 721, 1540, 1036, 313, 2082, 44, 10, 5780, 544, 5695, 16, 42787, 62, 187, 52, 3292, 281, 27, 2634, 16, 3620, 16, 8629, 8, 187, 187, 3357, 6, 544, 39254, 21321, 3424, 12, 7770, 31, 50270, 62, 5693, 13, 27865, 50272, 283, 8634, 44, 16, 84, 50275, 249, 854, 15, 24, 84, 50274, 187, 187, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 1508, 313, 19, 15, 3566, 37998, 16, 84, 10, 428, 29028, 4581, 387, 12243, 40873, 2417, 15, 416, 5704, 272, 15, 187, 187, 283, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 1099, 283, 50276, 9, 14626, 27, 495, 10, 50276, 2413, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 16437, 15, 11368, 187, 27642, 272, 281, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 8579, 10683, 15, 20210, 15, 10683, 15, 20210, 93, 27, 1438, 1051, 4802, 15, 187, 23760, 2748, 2197, 13, 31288, 2380, 1051, 25193, 38468, 17215, 187, 10830, 27, 5091, 26522, 313, 2511, 44, 582, 5976, 17472, 313, 3156, 44, 10, 5780, 544, 5695, 16, 42787, 62, 187, 52, 3292, 281, 27, 2634, 16, 3620, 16, 8629, 8, 187, 187, 2313, 6, 60, 39254, 39254, 39254, 3424, 12, 822, 46267, 5091, 13, 26522, 50272, 283, 8634, 44, 16, 84, 50275, 249, 470, 15, 18, 84, 50274, 187, 187, 6755, 14, 2922, 14, 883, 3127, 27, 1787, 27, 1099, 313, 27348, 37998, 16, 84, 10, 428, 2634, 16, 3620, 16, 8629, 8, 9809, 544, 2270, 26522, 16, 2270, 26522, 62, 187, 187, 255, 253, 1072, 673, 342, 4577, 3888, 512, 310, 8718, 27, 50274, 187, 370, 259, 788, 428, 48, 1227, 3620, 16, 8629, 3944, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 24204, 511, 15, 11368, 187, 283, 6755, 14, 2922, 14, 883, 3127, 27, 3156, 27, 1619, 283, 50276, 2413, 1358, 2700, 15, 11264, 15, 681, 16, 13485, 16, 24326, 16, 6342, 16, 24204, 511, 15, 11368, 187, 2632, 11932, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 41605, 15567, 15, 20210, 15, 10683, 15, 20210, 187, 27642, 272, 281, 8280, 15, 11264, 15, 681, 313, 2700, 15, 11264, 15, 681, 8579, 10683, 15, 20210, 15, 10683, 15, 20210, 93, 27, 1438, 1051, 4802, 15, 187, 23760, 2748, 2197, 13, 31288, 2380, 1051, 1052, 10826, 187, 10830, 27, 25901, 2125, 313, 1797, 44, 10, 544, 5695, 16, 42787, 62, 187, 52, 3292, 281, 27, 2634, 16, 3620, 16, 8629, 8, 187, 187, 2313, 6, 60, 4578, 524, 46267, 3127, 13, 20611, 50272, 283, 8634, 44, 16, 84, 50275, 249, 470, 15, 2922, 84, 50275, 187, 187, 6755, 14, 2922, 14, 883, 3127, 27, 3156, 27, 1717, 313, 28581, 37998, 16, 84, 10, 428, 2634, 16, 3620, 16, 8629, 8, 9809, 544, 21866, 2125, 16, 21866, 2125, 62, 187, 187, 1552, 310, 253, 1921, 2139, 436, 5406, 476, 626, 30747, 8392, 4751, 1979, 275, 9882, 15, 309, 476, 923, 760, 1481, 273, 352, 15, 187, 47, 48431, 310, 15378, 347, 2914, 14, 423, 285, 43449, 347, 896, 14, 423, 15, 14513, 3048, 281, 43449, 2987, 973, 13, 594, 627, 310, 1895, 275, 295, 48431, 15, 3052, 309, 987, 32, 187, 1251, 27475, 3596, 27, 187, 4537, 15109, 28, 187, 29960, 64, 7404, 265, 50276, 18, 28, 187, 187, 3775, 64, 2808, 50276, 16, 2044, 16, 2808, 16, 1251, 27475, 16, 3775, 15, 2808, 28, 187, 4239, 50270, 16, 2044, 16, 6321, 16, 1251, 27475, 15, 4239, 28, 187, 187, 20969, 551, 187, 50274, 29960, 64, 35002, 50276, 31111, 28, 187, 50274, 23939, 64, 14764, 327, 28, 187, 94, 187, 187, 2413, 551, 187, 50274, 3709, 50271, 16, 14069, 16, 1251, 27475, 16, 42155, 15, 10706, 28, 187, 50274, 10773, 64, 2808, 50276, 16, 2044, 16, 2808, 16, 1251, 27475, 16, 10773, 15, 2808, 28, 535, 50274, 13161, 3140, 50270, 251, 28, 187, 50274, 19773, 267, 422, 64, 23896, 50276, 17, 28, 187, 50274, 34133, 64, 41933, 293, 333, 50270, 251, 28, 535, 50274, 72, 16368, 50276, 251, 28, 187, 50274, 72, 16368, 64, 25902, 346, 3338, 9051, 544, 18, 14, 23, 9955, 14517, 22418, 5929, 12944, 18, 10, 3664, 187, 50274, 8780, 64, 4090, 64, 2915, 64, 3281, 2233, 78, 28, 535, 50274, 3709, 1227, 14069, 16, 1251, 27475, 16, 8259, 15, 69, 3122, 15, 8259, 28, 187, 50274, 3709, 1227, 14069, 16, 1251, 27475, 16, 37813, 14, 22331, 3122, 28, 187, 50274, 9438, 551, 187, 50266, 42050, 15567, 15, 20210, 15, 10683, 15, 20210, 27, 1438, 28, 187, 50266, 9438, 64, 1590, 2670, 15, 681, 8280, 15, 11264, 15, 681, 28, 187, 50266, 12428, 24125, 5042, 5624, 15787, 16, 93, 23593, 16, 93, 7585, 5719, 16, 93, 2577, 15787, 16, 93, 7585, 303, 21714, 551, 187, 50258, 26520, 64, 5858, 3944, 1358, 10683, 15, 20210, 15, 10683, 15, 20210, 27, 40058, 28, 187, 50258, 26520, 64, 41794, 3944, 1358, 11264, 15, 681, 27, 40058, 16, 1227, 28, 187, 50258, 26520, 64, 1178, 64, 10146, 19005, 370, 5465, 28, 187, 50258, 26520, 64, 1178, 64, 10146, 1594, 14, 31696, 264, 14, 2214, 370, 26520, 64, 1911, 64, 89, 64, 10495, 264, 64, 1542, 28, 187, 50258, 26520, 64, 1178, 64, 10146, 1594, 14, 17642, 14, 3123, 370, 28213 ]
. (Pljesak) Spanish: detectan alguna falla en este argumento, simplemente recuerden que dependerán de la razón para señalarla. Gracias. SP: Gracias (Aplausos) iw: אתם מוצאים פגם בטיעון הזה, זיכרו שאתם תהיו תלויים בהגיון בכדי להצביע עליו. תודה רבה. ס"פ: תודה רבה. (תשואות) Russian: вы обнаружите изъян в этом рассуждении, помните, что вам понадобится разум, чтобы это доказать. Спасибо». СП: «Спасибо». (Аплодисменты) Romanian: găsiţi un defect al acestui argument, amintiți-vă că veți depinde de raţiune să-l identificați. Mulţumesc. SP: Mulţumesc (Aplauze) Hungarian: találnak valami hiányosságot ebben az érvelésben, akkor gondoljanak rá, hogy értelem kellett, hogy észrevegyék. Köszönöm. SP: Köszönöm. (Taps) Vietnamese: hãy nhớ rằng bạn cũng cần dùng đến lý lẽ để chỉ ra lỗi đó. Xin cảm ơn. SP: Cảm ơn. (Vỗ tay) Serbian: ako uočite grešku u ovom argumentu, zapamtite, oslonićete se na razum kako bi je razotkrili. Hvala. SP: Hvala. (Aplauz) Persian: مجادله نقصی پیدا کردید، به خاطر داشته باشید که فقط برای اشاره به آن فقط به استدلال وابسته خواهید بود. با تشکر. استیون: با تشکر. Modern Greek (1453-): εντοπίσετε ένα τρωτό σημείο στο επιχείρημα αυτό, θυμηθείτε ότι θα βασίζεστε στη λογική για να το δείξετε. Ευχαριστούμε. ΣΠ: Ευχαριστούμε. (Χειροκρότημα) Chinese: 你察覺到這個爭辯裡的缺陷, 記得你將會依靠理智 去指出這些缺陷 謝謝。 史迪芬:謝謝 (掌聲) Q: nginx closes connection on some pictures There is problem with nginx. It closes connection before client finishes download. It looks like: $ wget -O /dev/null http://www.site.com/images/theme/front/clean.jpg --2012-07-11 21:37:03-- http://www.site.com/images/theme/front/clean.jpg Resolving www.site.com (www.site.com)... 123.234.123.234 Connecting to www.site.com (www.site.com)|123.234.123.234|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 90707 (89K) [image/jpeg] Saving to: `/dev/null' 26% [===============> ] 24,291 --.-K/s in 8.7s 2012-07-11 21:37:12 (2.74 KB/s) - Connection closed at byte 24291. Retrying. --2012-07-11 21:37:13-- (try: 2) http://www.site.com/images/theme/front/clean.jpg Connecting to www.site.com (www.site.com)|123.234.123.234|:80... connected. HTTP request sent, awaiting response... 206 Partial Content Length: 90707 (89K), 66416 (65K) remaining [image/jpeg] Saving to: `/dev/null' 53% [+++++++++++++++============> ] 48,555 --.-K/s in 8.7s 2012-07-11 21:37:23 (2.74 KB/s) - Connection closed at byte 48555. Retrying. --2012-07-11 21:37:25-- (try: 3) http://www.site.com/images/theme/front/clean.jpg Connecting to www.site.com (www.site.com)|123.234.123.234|:80... connected. HTTP request sent, awaiting response... 206 Partial Content Length: 90707 (89K), 42152 (41K) remaining [image/jpeg] Saving to: `/dev/null' 100%[+++++++++++++++++++++++++++========>] 90,707 --.-K/s in 0.1s 2012-07-11 21:37:25 (311 KB/s) - `/dev/null' saved [90707/90707] at the same time with smaller images all is ok: $ wget -O /dev/null http://www.site.com/images/theme/front/grease.jpg --2012-07-11 21:41:28-- http://www.site.com/images/theme/front/grease.jpg Resolving www.site.com (www.site.com)... 123.234.123.234 Connecting to www.site.com (www.site.com)|123.234.123.234|:80... connected. HTTP request sent, awaiting response... 200 OK Length: 21404 (21K) [image/jpeg] Saving to: `/dev/null' 100%[====================================>] 21,404 --.-K/s in 0.07s 2012-07-11 21:41:29 (316 KB/s) - `/dev/null' saved [21404/21404] This is the reason why this picture can't bee drawn fully size in browser. I can see only head of it. Nginx is configured as front-end and apache as back-end. Direct link to apache works well, so there is problem in nginx. Am I right? nginx config: user satellite; worker_processes 1; error_log /var/log/nginx/error.log; pid /var/run/nginx.pid; events { worker_connections 1024; multi_accept on; } http { include /etc/nginx/mime.types; access_log /var/log/nginx/access.log; sendfile on; keepalive_timeout 0; tcp_nodelay on; gzip on; gzip_disable "MSIE [1-6]\.(?!.*SV1)"; client_max_body_size 100m; include /etc/nginx/conf.d/*.conf; include /etc/nginx/sites-enabled/*; server { listen 123.234.123.234:80; server_name site.com www.site.com; location ~* ^/(admin/|dump/|webmail/|myadmin/|webim/) { proxy_pass http://123.234.123.234:8080; proxy_redirect http://site.com:8080/ /; proxy_set_header Host $host; proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_set_header X-Real-IP $remote
[ 44390, 12841, 617, 13, 703, 20311, 281, 3324, 617, 11626, 562, 715, 253, 1527, 13, 3981, 326, 795, 379, 64, 637, 313, 395, 309, 15433, 387, 326, 673, 326, 703, 5486, 346, 379, 637, 3, 275, 625, 685, 581, 3282, 5627, 369, 253, 760, 3578, 263, 44392, 41461, 275, 253, 1533, 13, 253, 581, 285, 760, 3327, 13, 418, 9358, 10231, 13, 285, 352, 1663, 3589, 626, 667, 897, 323, 667, 11870, 1711, 637, 281, 1611, 285, 8230, 1411, 617, 3918, 15, 187, 187, 41, 28989, 2335, 12688, 6258, 434, 7318, 461, 280, 16157, 347, 247, 1943, 16391, 13, 533, 8505, 344, 1871, 3786, 4425, 326, 436, 369, 253, 2360, 281, 1056, 521, 2118, 15, 5863, 281, 253, 1390, 7017, 13, 253, 1711, 30013, 4546, 352, 4484, 13, 6179, 1919, 7641, 466, 434, 14709, 2183, 617, 352, 369, 673, 323, 617, 281, 1625, 690, 32428, 15, 2635, 13, 344, 19347, 562, 13, 10884, 342, 521, 44392, 41461, 13, 285, 3053, 281, 13920, 7641, 466, 434, 32428, 13, 23727, 15, 7641, 466, 13, 4854, 521, 3590, 13, 3261, 598, 13, 35954, 13, 285, 840, 3200, 264, 281, 3327, 347, 604, 281, 1333, 13, 346, 12864, 4179, 449, 187, 187, 2598, 418, 9358, 3407, 24935, 253, 32428, 13, 285, 281, 1918, 6152, 835, 6152, 310, 1955, 13, 344, 1663, 795, 35293, 64, 253, 32428, 326, 2360, 13, 35397, 846, 35397, 13, 1919, 4720, 44390, 12948, 275, 327, 253, 990, 273, 581, 273, 521, 30811, 5123, 13, 18779, 6748, 247, 23007, 38205, 13, 417, 12401, 8352, 46602, 8962, 3750, 30900, 272, 13, 14257, 689, 9177, 272, 418, 9358, 434, 625, 419, 17852, 2746, 15, 2091, 44390, 6699, 745, 253, 32428, 13, 594, 1875, 13, 396, 1875, 13, 285, 20284, 253, 2862, 2419, 342, 521, 11479, 85, 1546, 13, 2762, 3347, 24649, 13, 1046, 6985, 3407, 45927, 13, 342, 253, 6517, 273, 12688, 6258, 13, 418, 9358, 13, 285, 617, 7590, 3817, 254, 13, 353, 2131, 15, 1583, 13, 751, 253, 39004, 13, 20618, 616, 40667, 285, 26044, 1977, 15, 187, 187, 11, 7130, 281, 2067, 26624, 13, 285, 418, 9358, 10231, 2994, 13, 36533, 1128, 395, 2571, 665, 15433, 253, 1072, 1128, 926, 1520, 3430, 15, 187, 187, 4, 4392, 2277, 1719, 346, 39, 43718, 3, 411, 5626, 947, 187, 187, 4, 187, 187, 4, 48488, 322, 15, 411, 3077, 8301, 187, 187, 64, 9917, 432, 44934, 285, 388, 290, 2727, 434, 380, 33216, 353, 7380, 13, 436, 24540, 13, 407, 253, 7291, 285, 3862, 33293, 2516, 10520, 13, 273, 253, 21426, 25375, 1227, 35951, 382, 3692, 5211, 3440, 285, 5211, 3753, 4035, 281, 22611, 625, 685, 13719, 1107, 846, 521, 2393, 2471, 13, 275, 23430, 4414, 187, 187, 14358, 401, 1832, 8799, 254, 285, 521, 8624, 16304, 13, 5490, 367, 15, 7902, 13, 6940, 4852, 273, 247, 7695, 22014, 15, 7902, 913, 742, 22134, 984, 344, 812, 1089, 642, 8446, 323, 521, 4092, 16672, 13, 533, 8799, 254, 434, 8327, 281, 1089, 14924, 347, 247, 4092, 26650, 369, 14205, 762, 247, 5536, 14037, 273, 42551, 730, 451, 414, 15, 1244, 1223, 7902, 499, 351, 4861, 25060, 49136, 275, 39340, 25813, 13, 8799, 254, 434, 787, 37018, 314, 6871, 474, 12046, 4824, 779, 598, 285, 598, 285, 598, 275, 253, 2144, 1533, 1128, 8045, 1230, 281, 247, 1268, 326, 1014, 521, 14779, 2341, 812, 417, 23808, 342, 15, 187, 187, 1328, 369, 581, 273, 253, 954, 48994, 21220, 1821, 665, 556, 2455, 3531, 598, 275, 253, 1533, 273, 4633, 3440, 1128, 266, 275, 303, 7116, 9845, 254, 3692, 22611, 556, 13, 604, 2712, 13, 8228, 275, 253, 19063, 13256, 280, 9976, 285, 247, 2716, 1580, 521, 2471, 28, 253, 8406, 273, 690, 273, 253, 1270, 2455, 11707, 9575, 275, 253, 4633, 39287, 5550, 41, 531, 656, 47925, 12447, 937, 346, 34, 249, 626, 29056, 1257, 10940, 249, 8, 33051, 247, 24455, 35951, 382, 3692, 4882, 369, 247, 30951, 275, 253, 2440, 273, 326, 7935, 285, 3692, 4833, 327, 638, 14, 67, 412, 35951, 1346, 369, 49634, 760, 407, 326, 273, 22992, 388, 1100, 28, 285, 247, 2593, 637, 665, 812, 14284, 271, 2862, 3961, 347, 642, 581, 2010, 812, 15, 1876, 273, 841, 17714, 497, 521, 285, 2568, 13, 751, 253, 19455, 42493, 665, 5605, 281, 1132, 5516, 1059, 13, 344, 574, 247, 21337, 8327, 281, 3324, 281, 253, 1345, 521, 2389, 273, 8946, 3440, 285, 273, 253, 1963, 15, 3032, 878, 281, 3959, 436, 9140, 285, 452, 352, 7607, 369, 2761, 1429, 3022, 285, 13, 1429, 3022, 13, 253, 8513, 672, 352, 369, 10945, 369, 3676, 285, 1048, 15, 187, 187, 28058, 31593, 695, 13, 253, 44392, 2689, 251, 382, 285, 8254, 7795, 382, 275, 401, 1832, 434, 1652, 3961, 432, 26421, 281, 23430, 13, 31947, 2069, 672, 8799, 254, 369, 594, 2120, 273, 521, 5471, 323, 4092, 3440, 326, 344, 4571, 626, 1361, 4882, 13, 1014, 275, 247, 2360, 34583, 13, 342, 512, 253, 12256, 414, 273, 534, 344, 369, 7032, 15, 1292, 436, 3589, 626, 253, 401, 1832, 326, 253, 6383, 574, 5087, 281, 4089, 15, 187, 187, 3, 8836, 275, 253, 8446, 651, 1158, 344, 369, 10776, 1066, 937, 31593, 695, 2296, 15, 346, 3726, 1871, 42963, 13, 686, 8380, 327, 13, 401, 1832, 11388, 754, 1871, 1379, 247, 1863, 304, 273, 48347, 390, 1633, 285, 1333, 25036, 314, 13, 686, 27031, 987, 13, 1060, 352, 310, 2464, 346, 187, 187, 1898, 344, 1871, 499, 351, 715, 690, 246, 1403, 36765, 492, 31757, 432, 46487, 9251, 1219, 2205, 15, 187, 187, 24115, 254, 434, 4092, 37321, 497, 512, 994, 88, 967, 342, 521, 2389, 273, 253, 1963, 15, 380, 8068, 7291, 13, 1284, 41844, 22801, 13, 2378, 2540, 591, 916, 1242, 326, 346, 783, 1963, 310, 253, 7935, 273, 521, 2798, 13, 253, 18542, 273, 521, 12607, 449, 187, 187, 39, 1832, 574, 271, 1963, 275, 521, 10230, 275, 1457, 2816, 285, 13, 1996, 13, 275, 521, 2419, 387, 659, 15, 21975, 507, 13, 418, 15, 42, 15, 7900, 332, 344, 2427, 13, 344, 7799, 562, 9091, 281, 1132, 253, 1963, 15, 496, 7785, 13, 275, 30953, 13, 327, 271, 5010, 391, 1369, 10593, 784, 7408, 342, 4498, 16360, 26878, 8757, 13, 344, 21863, 598, 281, 253, 1963, 2343, 649, 273, 253, 33017, 273, 37702, 33003, 342, 42430, 40897, 20887, 13, 253, 36368, 434, 1963, 382, 15, 3032, 1304, 327, 752, 4592, 627, 369, 5431, 8799, 254, 757, 27, 346, 6407, 2305, 15, 40897, 20887, 4546, 253, 2656, 14, 3364, 285, 840, 309, 4546, 253, 2656, 14, 3364, 449, 187, 187, 3039, 344, 369, 2444, 275, 253, 3085, 795, 998, 526, 90, 28323, 64, 275, 23430, 13, 13515, 1078, 521, 2471, 13, 344, 1119, 271, 1963, 327, 253, 873, 15, 754, 2206, 1066, 281, 1132, 285, 323, 1264, 3038, 3275, 369, 2918, 598, 347, 253, 2862, 2567, 18029, 10032, 3086, 15, 2596, 273, 521, 1643, 9091, 281, 1132, 253, 1963, 323, 247, 4618, 8446, 13, 285, 281, 1132, 347, 344, 3078, 281, 1132, 13, 2210, 1309, 247, 807, 344, 5262, 327, 253, 4750, 273, 18972, 56, 275, 29089, 275, 253, 2393, 20960, 2890, 15, 754, 574, 271, 12546, 4087, 5547, 3563, 2360, 2086, 627, 13, 795, 39, 1832, 8799, 254, 434, 416, 14292, 9585, 64, 1157, 327, 534, 344, 21758, 285, 502, 15280, 285, 4546, 253, 6276, 31482, 18542, 326, 369, 521, 28648, 15, 1244, 840, 13, 247, 4564, 273, 3038, 1996, 13, 275, 253, 2393, 3038, 273, 253, 4131, 13, 253, 4660, 5907, 247, 2086, 273, 7107, 13, 19951, 1963, 3440, 15, 380, 1963, 382, 1620, 2959, 667, 33484, 15, 733, 369, 401, 1832, 8799, 254, 13, 4882, 342, 247, 2120, 2600, 420, 326, 11766, 2210, 281, 779, 15, 187, 187, 2512, 1364, 452, 644, 1633, 273, 253, 1072, 2600, 420, 323, 779, 327, 247, 1388, 275, 31687, 672, 344, 2206, 1066, 387, 247, 12881, 1963, 275, 9964, 434, 6039, 3354, 34713, 285, 5950, 767, 33067, 955, 407, 31540, 313, 10002, 6337, 2626, 275, 401, 1832, 434, 1984, 347, 253, 6459, 637, 275, 2892, 1128, 45, 14695, 285, 17179, 399, 15, 21519, 497, 806, 285, 1273, 582, 19548, 32786, 15767, 434, 346, 29520, 30866, 1621, 15, 337, 937, 27461, 15701, 434, 346, 28625, 14461, 376, 360, 937, 48582, 13456, 14, 44, 641, 28101, 434, 346, 39, 3243, 273, 253, 378, 19493, 31069, 3, 313, 4609, 13, 10488, 1107, 3622, 13, 574, 417, 2568, 644, 9391, 11802, 281, 2471, 407, 7158, 279, 1346, 285, 11643, 5490, 582, 285, 1879, 303, 77, 434, 346, 29520, 23264, 449, 8256, 273, 841, 19654, 556, 2455, 644, 4439, 13, 533, 253, 28718, 670, 731, 1804, 326, 8799, 254, 3543, 253, 24701, 5130, 273, 11803, 12656, 13195, 689, 521, 9215, 27, 344, 4546, 731, 949, 4951, 285, 840, 14186, 731, 598, 275, 247, 3511, 1971, 15, 187, 187, 34, 8068, 12256, 7935, 4657, 2223, 2197, 247, 45729, 1963, 313, 21013, 3825, 273, 253, 2419, 10, 281, 8799, 254, 434, 8614, 2316, 672, 344, 369, 4882, 627, 15, 496, 253, 1355, 3038, 13, 344, 651, 298, 962, 247, 2316, 1020, 273, 12958, 342, 12435, 84, 13, 31540, 13, 285, 37834, 2224, 15, 2596, 4131, 13, 846, 1264, 3038, 273, 3440, 13, 401, 1832, 2206, 896, 285, 5125, 281, 521, 12958, 13, 346, 11778, 1529, 5253, 13, 285, 309, 1833, 1132, 368, 619, 7583, 5313, 449, 3032, 3858, 22770, 742, 3746, 285, 8799, 254, 10098, 715, 521, 7583, 12012, 5039, 504, 342, 3189, 449, 187, 187, 1552, 369, 1633, 326, 2210, 562, 273, 253, 1077, 18440, 273, 7195, 17025, 8799, 254, 15, 733, 369, 629, 273, 253, 11440, 1941, 273, 253, 14779, 3282, 273, 2957, 326, 344, 3543, 672, 521, 3101, 4962, 15, 754, 574, 644, 25279, 387, 253, 673, 15, 2006, 4115, 19989, 3592, 8799, 254, 4546, 253, 18542, 285, 253, 1963, 285, 13, 273, 253, 13365, 2151, 326, 703, 17564, 13, 7195, 13, 617, 25423, 3347, 13, 369, 617, 7583, 15, 4058, 2471, 369, 247, 6966, 432, 534, 8799, 254, 1620, 1663, 12372, 15, 35775, 1078, 521, 1211, 2471, 387, 253, 30394, 358, 314, 2363, 273, 10488, 14, 27248, 13, 344, 9924, 247, 40641, 534, 346, 28235, 11898, 521, 7765, 937, 2556, 281, 521, 1390, 7205, 13, 3619, 20799, 413, 1615, 15, 754, 1925, 352, 346, 7161, 14026, 2752, 12273, 443, 531, 865, 187, 187, 3, 18431, 24591, 342, 1027, 14505, 497, 3542, 937, 20799, 413, 1615, 31562, 13, 346, 2858, 5293, 497, 7607, 407, 6270, 15, 8256, 10048, 779, 4543, 18212, 4469, 253, 44089, 273, 326, 40641, 449, 187, 187, 1552, 44089, 23321, 8799, 254, 323, 253, 2120, 6818, 14, 13524, 1107, 326, 344, 369, 4336, 247, 629, 273, 253, 1533, 273, 3440, 15, 733, 3977, 779, 13, 1892, 327, 253, 25296, 273, 521, 3101, 434, 2471, 13, 281, 271, 1607, 292, 3472, 7875, 281, 47320, 23676, 1962, 1440, 15, 733, 4541, 1119, 2122, 285, 1669, 779, 342, 271, 440, 1946, 5542, 273, 355, 5632, 19408, 534, 13, 387, 581, 1127, 13, 17735, 779, 275, 12907, 15, 1292, 352, 369, 521, 3101, 434, 2471, 13, 1512, 13, 326, 3977, 281, 521, 1524, 13032, 715, 253, 3440, 1533, 273, 3972, 5616, 15, 187, 187, 1328, 369, 5686, 2552, 3127, 13, 40253, 13, 715, 247, 11617, 7231, 2021, 15, 3032, 3392, 13, 12824, 8799, 254, 13, 9843, 273, 253, 3506, 656, 7432, 757, 30021, 6412, 13, 3261, 327, 24455, 347, 346, 30911, 432, 253, 22144, 434, 22586, 449, 1292, 2872, 6270, 3735, 7835, 3551, 562, 273, 253, 894, 1032, 273, 3972, 5616, 326, 48515, 779, 15, 329, 4864, 1611, 387, 7473, 18542, 9775, 574, 1652, 1055, 327, 779, 15, 754, 10256, 2994, 285, 4541, 12103, 247, 12681, 347, 247, 12256, 42493, 387, 367, 15, 52, 15, 11289, 15, 14772, 275, 1495, 344, 7117, 521, 288, 19074, 447, 347, 346, 30911, 13, 3440, 13, 3440, 285, 625, 3440, 449, 2896, 840, 344, 574, 671, 9288, 490, 2821, 6284, 275, 2739, 285, 26375, 13, 533, 275, 521, 2143, 1897, 436, 16485, 651, 452, 644, 12054, 7899, 15, 187, 187, 3039, 344, 369, 25963, 344, 11719, 28384, 264, 521, 1039, 715, 253, 15915, 19670, 13, 247, 6440, 2419, 13, 285, 11750, 1070, 521, 1039, 1066, 281, 247, 2914, 14, 736, 7319, 987, 275, 896, 273, 7057, 478, 466, 29655, 968, 13, 665, 4546, 18542, 323, 253, 11561, 6590, 15, 1500, 1339, 779, 14518, 762, 253, 27188, 8087, 285, 327, 281, 253, 18542, 32217, 12200, 617, 285, 13 ]
Hawk ignored her, she proceeded to bring her opinions out into the open, saying that _her_ man (and I figured at that time that she meant "her man" in more than one sense*) was the only tenor saxophone in the world, the one and only Pres, Lester Young, and it really wasn't any use for any tired old man to try and blow against her President. Hawk took Lady Day's caustic remarks as a big joke, but apparently he'd previously decided that this was the night to make his move. Up to the last minute, the old fox played it cool, waiting until Billie's juice told her it was time for her to sing some blues. Then, he slipped out, returning with his saxophone, and started to accompany Billie's blues, softly. Billie, hearing his sound, looked up, startled, and then motioned to Pres as if to say, "Take charge." So Lester began blowing the blues, and to give credit where credit is due, he really _played_ the blues that night, chorus after chorus, until finally Hawk burst in on the end of one of his choruses, cascading a harmonic interruption, not unlike Mount Vesuvius erupting, virtually overpowering Lester's more haunting approach. When Hawk finished off the blues, soaring, searing, and lifting the entire house with his guttural, positive sonority, every tub began cheering, with the exception of Lady Day, Lester, and her pet boxer, Mister. They, like the Arabs, folded their tents and stole away. *According to several associates, and Lester Young himself, Rex—and others who figured the same—figured wrong. # THOMAS "FATS" WALLER # # JOHN S. WILSON _Also from Shapiro and Hentoff's The Jazz Makers, this appreciation, by the critic and broadcaster John Wilson, of the beloved composer / pianist whose happy music and happy nature continue to charm more than fifty years after his early death, in 1943_. Both Fats Waller and his principal tutor, James P. Johnson, lived lives of aching frustration. Johnson ached openly because he could find no audience for his serious compositions, but Waller's desire to find acceptance as a serious musician was buried under a heavy coating of pervasive geniality. And while Johnson plodded steadily downhill in puzzled despair, Waller's blithely ironical attitude carried him up and up and up in the material world—eventually to a level that even his enormous energy could not cope with. He was one of the most massively talented men who has ever turned up in the world of popular music—an inimitable entertainer whose charm has, if anything, grown in the nostalgic decade and a half since his death; the writer of some of the great evergreen songs in the popular repertoire ("Honeysuckle Rose," "Ain't Misbehavin' "); a jazz pianist whose playing was a landmark in the development of that instrument and whose influence on pre-bop pianists was surpassed only by that of Earl Hines; and a section man who could swing an entire band as no one else could. All of these gifts were his and yet, like the inevitable clown who wants to play Hamlet, he had a consuming desire to bring to the public his love of classical music and of the organ. His need to offer this gift and have it accepted was almost childlike and, childlike, the hurt when it was rejected was deep and long. Gene Sedric, the saxophonist and clarinetist in Fats's little band from 1938 to 1943, remembers times when Waller was so full of his feeling for serious music that he couldn't help playing, even in a nightclub, with all the musicality of which he was capable. But this wasn't the Fats that the customers had paid to hear. "People in the audience would think he was lying down," Sedric says. "They'd yell, 'Come on, Fats!' He'd take a swig of gin or something and say resignedly, 'Aw right, here it is.' " And he'd plod into some tawdry trifle from Tin Pan Alley. Waller's serious ambitions were all entwined with his love of the organ. The Chicago critic, Ashton Stevens, once observed perceptively that "the organ is the instrument of his heart, the piano of his stomach." Fats had an organ in his apartment in New York and, later, in his house at St. Albans, L.I. Wherever he went, he sought out opportunities to play the organ. In Paris, in 1932, on an otherwise rambunctious trip with songwriter Spencer Williams, he climbed up to the organ loft of the Cathedral of Notre Dame with Marcel Dupré, the cathedral's organist. His report on what happened there was typically Wallerian: "First Mr. Dupré played the God-box and then I played the God-box." When he was working in the film _Stormy Weather_ in 1943, shortly before his death, he found an organ on the set. He sat down to play and for three hours production was held up as the entire company listened entranced. One of his few opportunities to play the organ for a wide audience, and to play as he wanted to play, came during a year he spent on the staff of WLW in Cincinnati in the early thirties. He had an enormously successful late night program there, _Fats Waller's Rhythm Club_ , on which he sang and clowned and played the driving stride piano that was his specialty. And then, a couple of hours later, in the early hours of the morning, the station offered a program of quiet, peaceful organ music. The organist never received any billing. It was Fats Waller, playing with a full contentment that rarely came to him. There must have been something of the same contentment for him on a day in 1927 when he sat down at a pipe organ in Victor's Camden studios and recorded two fugues by Bach (who ran third in Fats's book as the greatest man in history—Lincoln and Franklin D. Roosevelt were first and second), Moszkowski's "Spanish Dance No. 1," Liszt's "Liebestraum," Rimsky-Korsakov's "Flight of the Bumble Bee" (which, thirty years ago, had not yet been galloped to death by accordionists and Harry James), and Friml's "Spanish Days." None of these recordings has ever been released, but the rumors about them suggest that Waller felt the stern eye of studio expectations burning over his shoulder: he played them through straight and then dressed them up in a hot treatment. A Chicago musical instrument store often sent a Hammond organ (compliments of the house) to Waller's hotel room when he was playing there. In the small hours, he would lull a roomful of guests with spirituals, Bach, and hymns. One morning, after three hours of music, Fats sat back and suggested to his guests, "Have another glass, and I'll play you my favorite piece." His friends refreshed themselves and Waller launched into his favorite—"Abide with Me." This was something that came out of the very marrow of Thomas Wright Waller. It was part of the continuing evidence of the enormous sense of loss that he felt when his mother died. He had been sixteen at the time. Adeline Lockett Waller played the piano and the organ and, of the dozen children that she bore, Thomas, her youngest son, was her favorite. Her death was a shock from which Waller never really recovered. Shortly before his own death at the unseemly age of thirty-nine, he composed a melody which "really shook his soul," according to his last manager, Ed Kirkeby. He called it "Where Has My Mother Gone?" "Several lyrics with different titles were written," Kirkeby recalls, "but none were accepted by Tom. None satisfied him nor adequately expressed the anguish of that melody." This anguish pursued Waller for the full twenty-three years that he was completely a part of the world of music. It led him, hard on the heels of his mother's death, to an impetuous marriage to Edith Hatchett. It quickly foundered and left him with an unending stream of alimony troubles which, at one point, landed him in jail. But it was his mother's death, too, that led to his real entrance into the music world of Harlem. He was born May 21, 1904, into a deeply religious family. His father, Edward Waller, minister of the Abyssinian Baptist Church, looked on jazz as "music from the devil's workshop." But young Tom heard sounds coming out of the cellars of Harlem that intrigued him. A brief try at formal piano instruction had little effect on him. He taught himself and quickly gained a reputation as a musical clown at P.S. 89. Later in life he listed his hobbies as "music, music, music and more music." By then he had also acquired abiding interests in food and liquor, but in his school days this listing would have been reasonably accurate. When he was fourteen he regularly wormed his way into the Lincoln Theatre, a movie house, and battled his way down to a front-row seat right in back of Maizie Mullins, who played piano for the silent films. She let him slide under the brass rail and on to the piano stool beside her and,
[ 39860, 15, 1292, 840, 253, 5101, 369, 6142, 1575, 1840, 253, 1273, 5241, 273, 253, 18189, 15, 733, 369, 247, 5389, 581, 13, 2590, 285, 247, 2032, 4021, 15, 844, 9047, 347, 352, 29540, 969, 15, 401, 5292, 66, 46254, 11802, 10063, 285, 479, 715, 247, 26885, 15729, 326, 8513, 619, 28061, 285, 18017, 3511, 275, 619, 2472, 13, 1905, 4125, 359, 1833, 923, 15, 187, 187, 4553, 4515, 13, 642, 581, 3078, 247, 3128, 390, 281, 11012, 562, 327, 253, 278, 1887, 28, 359, 6699, 253, 22855, 13, 285, 5262, 253, 1551, 273, 253, 7237, 268, 11729, 253, 42893, 22612, 432, 253, 4023, 4461, 5254, 281, 867, 450, 1996, 15, 401, 5292, 66, 2335, 41903, 896, 281, 521, 2316, 13, 4824, 779, 44494, 22855, 285, 10331, 13, 285, 20374, 4130, 432, 10470, 275, 253, 896, 47406, 15, 187, 187, 1128, 2513, 703, 22485, 32, 20358, 90, 18017, 13, 347, 359, 9047, 401, 5292, 66, 13870, 432, 4023, 4461, 281, 8576, 281, 896, 9956, 13, 432, 835, 359, 2206, 327, 253, 4766, 3213, 15, 309, 25640, 619, 29584, 715, 619, 38101, 13, 285, 10063, 26098, 617, 17300, 32012, 2439, 617, 1755, 5541, 15, 844, 13308, 1919, 253, 36555, 15676, 1066, 13, 285, 253, 9097, 3407, 5947, 36537, 281, 1056, 20624, 20534, 323, 4600, 13, 616, 39137, 48193, 36712, 745, 390, 14203, 15070, 1475, 616, 13628, 15, 380, 2419, 7107, 2348, 15, 187, 187, 11, 475, 475, 187, 187, 1147, 369, 253, 1735, 1388, 326, 352, 4592, 15, 844, 512, 23686, 3563, 285, 30773, 1475, 40436, 10331, 285, 41927, 327, 253, 4558, 273, 253, 8144, 296, 547, 10238, 15, 4146, 5542, 264, 275, 285, 253, 2419, 369, 5890, 285, 48849, 13, 247, 1388, 323, 513, 8537, 13, 22658, 36787, 13, 3477, 12398, 15, 401, 5292, 66, 285, 9271, 1615, 5947, 31836, 1016, 643, 13, 616, 2927, 1620, 4804, 15, 187, 187, 19467, 1615, 4395, 806, 15, 5595, 273, 441, 497, 275, 253, 4023, 4461, 13, 1685, 3184, 776, 9881, 342, 2717, 4217, 1905, 309, 24939, 959, 285, 440, 446, 66, 959, 10063, 434, 4707, 13, 4560, 253, 2502, 275, 352, 751, 1289, 23578, 275, 253, 278, 1887, 1373, 8805, 15, 9271, 1615, 11898, 562, 617, 1211, 4707, 13, 18935, 352, 327, 1755, 273, 617, 1481, 13, 1339, 352, 564, 15, 23224, 959, 1919, 253, 2316, 369, 44520, 15, 187, 187, 1128, 26068, 359, 943, 923, 253, 1543, 273, 401, 5292, 66, 434, 3368, 1024, 13, 703, 753, 15, 187, 187, 39, 5292, 66, 434, 8580, 369, 3468, 285, 4618, 15, 1500, 1871, 644, 48142, 13, 285, 873, 253, 32545, 9255, 342, 247, 502, 2569, 15, 4058, 1048, 48393, 28114, 347, 703, 16953, 615, 562, 15, 187, 187, 1128, 13689, 1060, 13, 703, 1925, 689, 617, 9215, 15, 187, 187, 19467, 1615, 858, 247, 3158, 11012, 13, 617, 8050, 4669, 8042, 15, 4058, 27965, 6639, 480, 36874, 347, 703, 3531, 369, 253, 760, 3590, 275, 253, 2316, 15, 187, 187, 44, 2284, 2210, 715, 253, 4023, 4461, 327, 401, 5292, 66, 434, 4430, 13, 533, 840, 344, 1339, 564, 285, 7428, 275, 3815, 15, 3032, 6345, 84, 2210, 3676, 285, 2761, 11561, 15, 309, 25436, 309, 8715, 626, 3735, 253, 22626, 272, 253, 2360, 1078, 15, 187, 187, 39, 5292, 66, 2918, 562, 617, 3564, 347, 2167, 7004, 323, 7107, 13, 2167, 359, 497, 2168, 21413, 13, 285, 253, 2316, 14728, 4404, 617, 15, 187, 187, 1128, 44, 2284, 310, 38596, 13, 703, 753, 15, 187, 187, 19467, 1615, 12918, 15, 1905, 42, 753, 368, 943, 816, 1379, 779, 13, 703, 753, 281, 7727, 15, 1905, 6175, 703, 369, 17390, 15, 187, 187, 1128, 510, 8144, 296, 547, 858, 352, 13, 253, 4021, 32712, 13, 753, 401, 5292, 66, 15, 1905, 1147, 12668, 253, 15350, 562, 273, 779, 15, 13516, 285, 921, 731, 13, 703, 753, 281, 41903, 15, 187, 187, 37, 24107, 7270, 387, 779, 15, 1905, 6723, 368, 512, 987, 32, 344, 2546, 15, 41903, 3531, 372, 649, 314, 285, 1691, 521, 9185, 281, 521, 6208, 15, 309, 1869, 273, 521, 48822, 2454, 285, 253, 18792, 432, 3174, 281, 3174, 672, 344, 574, 2011, 479, 253, 13877, 3817, 15, 309, 26986, 2147, 387, 10063, 15, 1905, 1147, 434, 512, 644, 247, 2165, 13, 309, 18017, 15, 187, 187, 1128, 44, 2284, 13, 849, 513, 368, 1928, 32, 2546, 401, 5292, 66, 15, 187, 187, 1128, 30271, 13, 1199, 1805, 13, 344, 753, 15, 754, 7560, 275, 247, 8921, 19407, 13, 49006, 342, 1016, 3159, 13, 285, 840, 25790, 272, 846, 344, 1871, 753, 352, 13, 41203, 13864, 15, 187, 187, 1128, 2512, 13, 401, 5292, 66, 753, 15, 1500, 320, 3163, 387, 441, 512, 13, 39712, 272, 617, 3564, 2366, 15, 187, 187, 1128, 28488, 8537, 13, 1925, 9271, 1615, 15, 1905, 39, 5292, 66, 434, 7670, 15, 367, 22525, 253, 6203, 2, 187, 187, 39, 5292, 66, 11694, 264, 617, 1481, 387, 9271, 1615, 285, 278, 483, 742, 795, 30368, 368, 3333, 187, 187, 44, 2284, 2210, 1475, 441, 512, 13, 285, 309, 5421, 521, 4808, 285, 253, 2590, 19991, 273, 521, 2927, 15, 309, 3047, 849, 344, 7428, 6927, 13, 285, 3735, 521, 2602, 6345, 84, 15, 31316, 574, 3053, 281, 3501, 285, 369, 15729, 3390, 401, 5292, 66, 13, 617, 5699, 6174, 2439, 401, 5292, 66, 434, 13386, 15, 8939, 7320, 30112, 715, 247, 5947, 36537, 11012, 13, 533, 30112, 3589, 626, 18727, 15, 33407, 285, 7727, 497, 1097, 2819, 387, 253, 5254, 15, 187, 187, 1128, 42, 1833, 4600, 1024, 13, 753, 41903, 15, 187, 187, 1231, 9047, 779, 564, 13, 512, 11298, 13, 3405, 1699, 776, 13628, 323, 667, 22626, 84, 28, 627, 497, 5293, 15, 380, 4023, 4461, 3369, 6294, 15, 187, 187, 39, 5292, 66, 5055, 598, 247, 5253, 432, 253, 5254, 13, 14287, 352, 15, 1905, 56, 460, 32, 187, 187, 1128, 6075, 8140, 13, 9271, 1615, 753, 15, 1905, 1552, 310, 964, 964, 964, 187, 187, 1128, 1328, 434, 4030, 13, 3548, 626, 344, 32, 401, 5292, 66, 753, 15, 1905, 5804, 626, 368, 923, 326, 344, 434, 4030, 32, 187, 187, 1128, 2598, 344, 3589, 626, 326, 2853, 275, 253, 806, 1659, 13, 9271, 1615, 753, 15, 187, 187, 1128, 1394, 512, 3047, 779, 13, 401, 5292, 66, 753, 15, 187, 187, 1128, 1394, 858, 1633, 13, 342, 253, 28123, 13, 753, 9271, 1615, 15, 1905, 2773, 1364, 320, 352, 15, 1737, 858, 368, 513, 32, 187, 187, 2512, 369, 10837, 15, 401, 5292, 66, 3261, 1475, 441, 512, 13, 285, 840, 13222, 617, 5253, 1411, 253, 3402, 3212, 617, 13, 835, 352, 38737, 285, 1669, 247, 11693, 273, 2502, 2112, 253, 5534, 15, 187, 187, 1128, 1276, 625, 513, 368, 971, 32, 309, 2183, 368, 309, 1871, 921, 368, 752, 11024, 676, 70, 476, 513, 15, 1737, 625, 513, 368, 971, 32, 187, 187, 1128, 42, 2868, 368, 13, 753, 31316, 15, 187, 187, 1128, 23833, 32, 753, 9271, 1615, 15, 187, 187, 1128, 33633, 32, 754, 7560, 347, 2167, 344, 1871, 1869, 344, 369, 3815, 275, 253, 2316, 15, 187, 187, 1128, 42, 816, 964, 964, 964, 8948, 359, 943, 1335, 13, 753, 33407, 15, 187, 187, 1128, 23833, 32, 9271, 1615, 753, 969, 15, 187, 187, 1231, 512, 3261, 281, 779, 15, 733, 369, 24746, 15, 754, 1904, 626, 3662, 323, 247, 1048, 673, 15, 187, 187, 1128, 44, 2284, 795, 261, 64, 1805, 13, 344, 753, 15, 187, 187, 21328, 1701, 15547, 13, 31800, 11008, 15, 9271, 1615, 2534, 695, 7917, 5972, 275, 253, 8862, 2316, 13, 5082, 626, 1339, 7727, 275, 15, 844, 39860, 285, 27215, 1048, 715, 253, 2360, 15, 187, 187, 11, 475, 475, 187, 187, 24801, 13, 2378, 253, 49254, 3369, 4581, 327, 253, 5075, 5768, 1708, 432, 253, 8323, 13, 253, 13862, 327, 253, 15165, 369, 7880, 15, 8256, 273, 253, 36555, 497, 6195, 13, 285, 776, 1211, 574, 40649, 275, 3139, 15, 309, 2918, 619, 1133, 275, 2914, 273, 619, 2454, 13, 3405, 1699, 619, 2927, 15, 309, 30139, 2400, 387, 10063, 434, 4430, 15, 187, 187, 1128, 1147, 434, 1512, 3644, 15, 1281, 434, 564, 896, 13, 309, 753, 15, 187, 187, 1128, 2302, 13, 10063, 753, 15, 187, 187, 1231, 16042, 5018, 3579, 13, 2112, 253, 15165, 15, 1916, 265, 8042, 285, 20061, 13, 5471, 6386, 15, 380, 8913, 2131, 369, 6032, 13, 342, 1264, 1355, 277, 2824, 13, 1078, 253, 298, 3201, 1066, 4515, 15, 309, 16042, 731, 562, 323, 10063, 13, 619, 643, 1133, 275, 22502, 15, 844, 6331, 969, 387, 253, 1755, 273, 253, 16303, 15, 380, 2317, 305, 7760, 1078, 479, 285, 619, 12607, 4455, 281, 13726, 4404, 352, 13, 14707, 281, 2965, 15, 187, 187, 1128, 39, 5292, 66, 32, 187, 187, 22036, 439, 6093, 479, 15, 187, 187, 42, 1531, 27151, 1066, 285, 3543, 327, 253, 5254, 1919, 352, 6497, 1977, 15, 380, 5024, 273, 253, 1755, 3213, 1411, 619, 20051, 15, 309, 439, 31377, 4830, 253, 5254, 285, 27858, 619, 9246, 1066, 13, 14252, 10063, 342, 479, 15, 32151, 314, 359, 1407, 2400, 32856, 1919, 359, 2206, 327, 253, 3213, 2708, 15, 309, 3260, 326, 247, 1643, 5018, 1066, 13, 253, 13968, 5253, 3497, 651, 1056, 247, 4797, 2360, 3243, 15, 2635, 15029, 4447, 275, 253, 3644, 13, 4886, 15, 187, 187, 1128, 5804, 368, 923, 32, 10063, 18017, 15, 187, 187, 688, 3662, 309, 16470, 617, 9881, 13, 892, 5436, 275, 2914, 273, 619, 2454, 13, 285, 703, 924, 25688, 247, 12774, 267, 15, 1500, 3982, 617, 2454, 598, 281, 7477, 15, 1905, 42, 923, 368, 13, 703, 41542, 1070, 15, 187, 187, 1147, 369, 247, 28725, 13, 26740, 272, 342, 253, 7615, 4824, 3200, 15, 844, 3531, 47444, 281, 923, 697, 14072, 6363, 3986, 253, 1755, 273, 253, 16303, 1840, 441, 15, 187, 187, 1128, 38186, 84, 32, 1737, 368, 598, 281, 32, 5037, 626, 368, 452, 247, 28725, 32, 187, 187, 19467, 1615, 434, 4318, 369, 1698, 15, 1500, 1531, 27151, 327, 253, 3213, 1840, 441, 285, 309, 2335, 275, 617, 27929, 285, 47366, 13, 1711, 8986, 10015, 13, 285, 253, 21613, 264, 480, 24512, 326, 309, 1871, 1620, 2326, 1078, 15, 187, 187, 1128, 1394, 1007, 11755, 13, 10063, 753, 15, 187, 187, 19467, 1615, 873, 253, 28725, 1066, 1078, 441, 327, 247, 2406, 3213, 13, 594, 326, 776, 20586, 2343, 14944, 327, 253, 5534, 1475, 441, 15, 1623, 253, 1029, 16720, 776, 3644, 4948, 23470, 264, 13, 285, 309, 574, 271, 21434, 281, 42963, 13, 281, 1056, 253, 7392, 1705, 13, 533, 9271, 1615, 369, 7107, 13, 285, 3253, 369, 39451, 281, 247, 24476, 326, 2360, 15, 187, 187, 1128, 1394, 971, 281, 923, 41903, 13, 9271, 1615, 753, 15, 309, 1904, 626, 871, 604, 352, 369, 247, 1953, 390, 417, 13, 533, 309, 11522, 15, 187, 187, 19467, 1615, 14435, 253, 9092, 273, 619, 11480, 342, 617, 9185, 15, 187, 187, 1128, 1394, 7664, 1512, 1199, 15, 754, 1833, 320, 4030, 1024, 13, 368, 3047, 387, 30194, 15, 187, 187, 1128, 2513, 401, 5292, 66, 598, 32, 187, 187, 19467, 1615, 22638, 15, 1905, 42, 1053, 626, 1158, 594, 13, 309, 1158, 4130, 310, 17390, 1024, 533, 441, 15, 1500, 4925, 896, 281, 1633, 13, 3345, 273, 253, 1708, 13, 285, 269, 16630, 627, 15, 1500, 3982, 562, 247, 1355, 30162, 15, 187, 187, 1128, 4257, 1841, 2, 10063, 753, 15, 187, 187, 42, 753, 13, 1905, 3039, 858, 368, 32, 1737, 2010, 310, 627, 32, 187, 187, 1128, 2302, 13, 9271, 1615, 753, 15, 1905, 1552, 310, 7477, 15, 733, 434, 1663, 1711, 15, 309, 3982, 352, 342, 479, 672, 309, 369, 747, 1060, 15, 187, 187, 1231, 816, 3261, 387, 581, 1529, 840, 15, 187, 187, 1128, 4943, 13, 9271, 1615, 753, 15, 1905, 42, 452, 436, 15, 1500, 1863, 400, 5911, 253, 1755, 273, 253, 30162, 13, 285, 352, 43256, 715, 776, 9365, 15, 309, 3330, 758, 15, 1905, 1394, 1379, 253, 28725, 896, 281, 3722, 13, 703, 753, 15, 187, 187, 2993, 11373, 387, 441, 15, 329, 5982, 2460, 9461, 273, 9271, 1615, 434, 4707, 849, 703, 908, 281, 8251, 352, 13, 762, 247, 46934, 13, 285, 247, 480, 35760, 44221, 703, 1904, 626, 8251, 667, 625, 2210, 44251, 275, 619, 1481, 15, 187, 187, 1128, 1466, 434, 1056, 253, 7392, 13, 309, 753, 15, 187, 187, 22036, 3261, 387 ]
danced. But then the sun was reborn above the second peak of the Cloud. It was a beautiful one, clear and a true double. We watched as it sank again. Freya scooped Blue and me into a fierce hug that hurt my ribs and whispered hot in my ear, —Now we'll see. Afterwards, no one wanted a party or to dance out on the moor; we finished the stew, and spent the rest of the evening prying the spilled wax from the ballroom floor to remould later. Freya took Kai back to his room, carried him warmed stew and tea, and banned everyone from smoking in the back corridors. —Is she packing? Toby whispered, as we watched Freya pace from ballroom to kitchen to back rooms, from where we sat on the middle step. I dug my nails into my palms, and Blue traced her thumbnail across her top lip. We waited until the candles burned down, and the dogs began circling to make invisible beds for sleep, their wreaths shaken off or hanging torn around their ears. The house quietened. * * * It was the next day that it happened. We all woke late and stumbled around brewing tea and chewing on the remains of the Solstice bread. Sun streamed in and the house was warm and sleepy, a day for dozing, lazy sewing, easy cooking. Freya and Libby circled each other, their eyes never meeting. Libby moved first. Most of us were in the ballroom, busying our fingers with nothing useful — I plaited and unplaited Blue's hair, finding the red in it like glints in the moorland stone. Libby shook out her own hair, twisted it on top of her head, let it go. Waited until the room was gazing. —Think we should see the results of Freya's experiment now, she said. Freya's smile was slow and wide. She'd been knitting, and set the needles aside with a clatter. Her long skirts cracked as she strode out. —Wait here, she called over her shoulder. Libby did a quick dance, her bare feet pointed. Her bracelets jangling as she turned was the only sound in the room. Kai came into the ballroom on Freya's arm, but then he let go and walked in alone. His breaths came deep and almost silent. I realised I hadn't heard the coughing the night before. Freya held out her hands as though asking for quiet, though we were already dumb, and the room shifted towards her. —Kai is healed, she said. Libby laughed. —I said you should just take him, she said to Richard. —While she was asleep. —The Solstice did it, the double sunset, said Freya. —It drove the Bad out of him. Come and show them, she said to Kai. Dylan caught at him. —Are you all right? he asked. Kai turned deftly and put his finger to his mouth. I thought of his playful face and the dancing from foot to foot when he had shown me the Cancer box. I clutched at Blue. —It's all been a game, I whispered. —Kai, how do you feel? asked Freya. —Much, much better, he said. He spoke in a strange rhythm, nodding with each word, and then sighing after he'd said it, seeming pleased. —There, Freya said. She beamed at us all, clasping her hands together. —Amazing, called Libby. —Freya's Jesus. Praise the Lord! Freya cocked her head at Libby and mouthed _Fuck you._ Kai came around us all, and I studied his skin and the clear whites of his eyes. I saw how he walked easier, and heard his soft breaths. Ellen had started to cry and was hugging Freya, her huge arms across Freya's throat. Pet pulled Egg into a circling dance, but Egg wasn't smiling. Dylan and Richard were both looking at the floor. —I'll sleep now, said Kai. We watched him go, all listening, straining our ears for any coughs; there were none. The ballroom door shut. Freya picked up a glass from the floor, lifted it. —Wine? —Seriously, Libby said. —This is . . . —He's fine, isn't he? Freya said. —Can't you see that he's fine? —So he wasn't that ill in the first place, Libby said. —You all saw him, Freya said. —You did something, with the pills, said Libby. —That must be it. What did you do? There was silence. Freya looked around us all, and then threw her glass against the wall behind her, where it smashed and left a trail of red along the wood. —What more do you want? I told you I'd show you what Foxlowe can do. What more do you want? —I believe you, said Ellen. —Richard? said Libby. —Hmm? He spoke as though he'd thought he was alone in the room. —I just . . . Maybe we should still, said Dylan. —Richard? Libby said again. We all looked to him. It was easiest. He didn't answer for a long time. —Kai _is_ better, he said. Raised voices, slammed doors. Libby barricaded herself in the yellow room, wouldn't let Richard in. We danced and drank long into the night. * * * Later, once the attic door closed on the weak summer light from the windows, the darkness on the landing was absolute. None of the candles were lit, and our own had drowned in itself. I held my hand in front of my face, straining my eyes. I tugged at Blue's arm. —It's too dark. Let's go back, I said. —No, Blue said. We counted steps forward, along the landing. Toes pointed and stretched, feeling ahead. The banister was smooth, with three small dips, before the lurch downwards. I counted them out for Blue, my other hand in hers. We stopped again at the top of the stairs. The space gaped before me and my stomach seemed to stretch towards it, wanting to fall. —Freya? Blue shushed me. I crouched down and felt on the floor until it fell away. The edge of the top step against my wrist. I shuffled onto the floor and swung my legs down, pulling Blue with me. Slowly we edged forwards until we sat on the step below. I knew that a few steps down, the stained glass window would make a blue nightlight. Then shapes formed in the dark, moving. —Can you see? Blue whispered. In answer I grabbed her fingers, flapping in front of my face, and she smothered a squeal. She brought her face up to mine. —I see you, she giggled. It was a candle, swaying with the familiar carried motion. We turned gratefully to see its golden pool reach the top of the stairs above us. —Girls? What you up to? Don't you have a candle? Libby's voice was low. She crouched on the step above us and I took in her jeans and trainers, old winter clothes, and the hooded jumper that I'd never seen before. —You look funny, Blue said. Libby set the candle down before us on a lower step, so that our shadows loomed on the wood around us. On the high ceiling our dark forms ballooned, and I had an urge to yell, to make the echo come, but Libby was quiet, and everything was softened to a whisper that night. —You want to see Kai, Libby said. I didn't know if it was a question or not, but I nodded. Libby touched the tip of my nose with her finger. —You worry too much. He'll be fine now, you saw at Meeting. —Is Freya up? Libby shrugged. —I don't think so, I think everyone is asleep now but us. She reached back to something, outside of the light, and fumbled there. She brought out a small torch. —New things! Blue said. I said, —When did you? What else is there? —No, Libby said. —This is mine. It's really old. I brought it with me when I was new here. We just looked at one another then. —Here, Libby said. —I have this. She swivelled the top of the torch, and it shone into our faces. I winced. —You take the candle back to bed, she said. She smiled at us. A sudden image rose of Libby's hair how she used to wear it, under a scarf, and a jasmine perfume she didn't wear any more came drifting in my head. —Let's make the echo, I said. Blue looked at
[ 9805, 310, 271, 31106, 1387, 4561, 407, 370, 69, 5, 3603, 15, 3813, 13, 627, 310, 642, 824, 33662, 669, 2859, 1366, 891, 15, 70, 904, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 63, 47, 8795, 310, 247, 5075, 6489, 15, 187, 187, 1447, 18789, 20, 696, 380, 3284, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 8795, 310, 247, 5075, 6489, 40090, 253, 370, 53, 2911, 2377, 4399, 2367, 5577, 92, 41, 5000, 20, 5, 4561, 407, 2367, 5577, 92, 39, 599, 42308, 285, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 63, 47, 20481, 187, 187, 1466, 669, 2859, 27, 1926, 5577, 92, 39, 16052, 3181, 295, 94, 393, 936, 443, 5, 320, 247, 33662, 13, 835, 370, 79, 426, 277, 61, 2808, 64, 19, 427, 1352, 3854, 326, 669, 2859, 9, 74, 64, 76, 8850, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 27829, 393, 1439, 393, 249, 1926, 5577, 92, 41, 5000, 20, 9, 40, 1009, 323, 512, 370, 76, 1352, 1281, 3318, 41, 64, 76, 426, 9121, 72, 61, 249, 443, 1040, 544, 72, 1337, 2859, 9, 74, 64, 75, 8850, 72, 64, 18, 13, 72, 64, 19, 27829, 62, 393, 249, 1926, 5577, 92, 41, 5000, 20, 9, 40, 582, 5095, 187, 464, 6190, 464, 1109, 551, 323, 209, 6092, 75, 61, 3040, 465, 39077, 380, 2390, 370, 41, 64, 76, 5, 830, 247, 16317, 5931, 273, 22105, 15, 380, 5931, 310, 13714, 16317, 13, 1580, 669, 2859, 9, 74, 64, 76, 9, 72, 64, 20, 1228, 393, 249, 388, 578, 76, 14, 18, 94, 393, 27054, 388, 64, 76, 1352, 1876, 841, 22105, 3831, 253, 14632, 4561, 407, 370, 40, 9805, 285, 253, 3603, 370, 72, 63, 47, 1366, 323, 667, 370, 72, 61, 249, 443, 1352, 3813, 13, 359, 476, 2199, 253, 22105, 370, 41, 64, 76, 5, 281, 22105, 273, 253, 1387, 370, 40, 16, 40, 5983, 40, 63, 47, 1352, 380, 1390, 1387, 310, 247, 6486, 1387, 4508, 1679, 685, 370, 47, 63, 69, 5, 3603, 285, 1057, 417, 452, 247, 13714, 11052, 6430, 273, 22105, 273, 2978, 625, 685, 370, 69, 61, 2808, 64, 19, 427, 5, 1108, 20620, 15, 831, 19539, 326, 253, 3284, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 8795, 310, 247, 5075, 6489, 40090, 2367, 5577, 92, 41, 5000, 20, 1352, 187, 187, 1447, 18789, 19, 15, 22, 696, 1707, 4961, 271, 7007, 370, 47, 1366, 7293, 327, 253, 1387, 370, 40, 1366, 824, 326, 253, 3284, 9793, 72, 64, 18, 13, 72, 64, 19, 63, 47, 8795, 310, 247, 5075, 6489, 40090, 253, 370, 53, 2911, 2377, 4399, 2367, 5577, 92, 41, 5000, 19, 5, 4561, 407, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 20481, 187, 187, 510, 4737, 310, 2074, 281, 253, 581, 273, 18057, 575, 1447, 18789, 20, 15, 22, 4207, 380, 1387, 370, 40, 8, 37860, 5577, 92, 41, 5000, 19, 5, 310, 247, 30268, 4561, 31106, 1387, 15, 1281, 370, 47, 5, 320, 247, 1180, 2017, 16802, 407, 253, 1340, 273, 512, 32266, 3603, 275, 436, 1387, 15, 831, 8018, 326, 604, 370, 187, 73, 393, 249, 443, 9805, 285, 370, 73, 63, 47, 393, 1439, 393, 249, 1926, 5577, 92, 41, 5000, 19, 9, 40, 4244, 840, 370, 73, 63, 76, 393, 1439, 393, 249, 1926, 5577, 92, 41, 5000, 19, 9, 40, 4244, 323, 512, 370, 76, 61, 1439, 30, 17, 1352, 3954, 604, 359, 5467, 326, 9793, 72, 64, 18, 13, 72, 64, 19, 63, 47, 8795, 310, 417, 247, 5075, 6489, 13, 840, 627, 4961, 247, 3711, 669, 2859, 27, 1926, 5577, 92, 39, 16052, 3181, 277, 12, 18, 94, 393, 936, 443, 5, 824, 326, 669, 2859, 9, 74, 64, 76, 8850, 72, 64, 18, 13, 72, 64, 19, 63, 47, 27829, 393, 1439, 393, 249, 1926, 5577, 92, 41, 5000, 19, 9, 40, 3822, 6915, 7125, 2074, 281, 253, 4394, 275, 253, 4737, 273, 18057, 575, 1447, 18789, 20, 15, 22, 5290, 359, 476, 921, 326, 253, 3603, 669, 2859, 9, 74, 64, 76, 9, 72, 64, 19, 18103, 403, 23352, 3907, 40090, 370, 40, 33189, 534, 310, 7479, 1108, 20620, 15, 187, 187, 1447, 18789, 19, 696, 380, 3284, 9793, 72, 64, 18, 13, 72, 64, 19, 8795, 310, 247, 5075, 6489, 40090, 253, 370, 53, 2911, 2377, 4399, 2367, 5577, 92, 41, 5000, 18, 5, 4561, 407, 9793, 60, 72, 64, 18, 13, 72, 64, 19, 1092, 72, 64, 20, 8795, 285, 9793, 72, 64, 18, 13, 72, 64, 19, 63, 47, 8795, 187, 187, 27970, 347, 253, 4737, 273, 18057, 575, 1447, 18789, 20, 5290, 533, 359, 897, 253, 3284, 370, 72, 64, 18, 1366, 3185, 273, 253, 3284, 9793, 72, 64, 18, 13, 72, 64, 19, 8795, 281, 3989, 253, 2390, 370, 41, 64, 76, 1352, 187, 187, 510, 7234, 273, 6935, 6681, 575, 1447, 18789, 20, 696, 285, 575, 1447, 18789, 19, 696, 2186, 275, 667, 30268, 4561, 1387, 370, 40, 1366, 3738, 253, 27574, 273, 253, 3969, 5075, 22925, 3469, 760, 327, 253, 1180, 273, 21025, 273, 253, 1387, 370, 40, 1352, 380, 1072, 310, 417, 2032, 323, 6935, 6681, 575, 1447, 18789, 20, 15, 22, 696, 285, 575, 1447, 18789, 19, 15, 22, 5290, 835, 253, 1180, 370, 47, 5, 7024, 327, 253, 1387, 370, 40, 1352, 187, 187, 4125, 359, 476, 897, 841, 458, 44661, 281, 5276, 6899, 575, 1447, 13518, 696, 27, 1379, 253, 370, 53, 2911, 2377, 12896, 16207, 5577, 92, 39, 47481, 393, 44188, 1926, 5577, 92, 41, 5000, 18, 393, 44188, 1926, 5577, 92, 41, 5000, 19, 393, 44188, 1926, 5577, 92, 41, 5000, 20, 393, 44188, 1926, 5577, 92, 39, 599, 6267, 4700, 6935, 6681, 575, 1447, 18789, 20, 15, 22, 5290, 905, 18789, 20, 5290, 905, 18789, 19, 15, 22, 696, 285, 905, 18789, 19, 696, 921, 326, 1016, 273, 841, 370, 53, 2911, 2377, 12896, 8414, 273, 5075, 22925, 40090, 253, 1735, 581, 15, 3813, 13, 407, 5426, 2367, 5577, 92, 39, 599, 9805, 8414, 273, 5075, 3458, 22925, 40090, 2367, 5577, 92, 39, 599, 6267, 1366, 534, 29141, 253, 4737, 273, 10012, 575, 1447, 13518, 4207, 187, 187, 1447, 18989, 17254, 696, 1310, 323, 247, 4229, 30268, 4561, 1387, 370, 40, 1366, 253, 370, 53, 2911, 2377, 4399, 2367, 5577, 92, 39, 599, 9805, 8414, 273, 5075, 3458, 22925, 40090, 2367, 5577, 92, 39, 599, 6267, 1352, 2635, 2367, 5577, 92, 39, 599, 9805, 2882, 273, 5075, 3458, 22925, 40090, 7201, 5577, 92, 39, 7294, 79, 94, 9805, 323, 512, 370, 79, 1352, 3856, 13, 2367, 5577, 92, 39, 599, 9805, 12853, 253, 43416, 1080, 14632, 13, 2367, 5577, 92, 39, 599, 42308, 310, 697, 43416, 1080, 14632, 285, 7201, 5577, 92, 39, 47481, 2306, 79, 5, 310, 253, 370, 79, 2911, 394, 1307, 273, 253, 1220, 17254, 2962, 273, 253, 1959, 1387, 2367, 5577, 92, 39, 11971, 187, 187, 1231, 476, 897, 10012, 575, 1447, 19402, 696, 260, 10, 281, 921, 326, 7201, 5577, 92, 39, 47481, 2306, 76, 5, 8414, 273, 5075, 3458, 22925, 275, 370, 40, 5, 40090, 253, 1387, 7201, 5577, 92, 39, 47481, 1990, 76, 12, 18, 3363, 6610, 13, 970, 629, 247, 10, 359, 476, 921, 326, 16207, 5577, 92, 39, 47481, 1926, 8275, 64, 88, 3503, 337, 20886, 6190, 464, 1109, 551, 2307, 209, 6092, 45656, 5577, 92, 39, 47481, 2306, 79, 2311, 10878, 187, 187, 1447, 13518, 14, 20881, 696, 1310, 253, 1387, 370, 40, 5, 310, 30268, 4561, 840, 2367, 5577, 92, 39, 599, 9805, 8414, 417, 760, 273, 5075, 3458, 22925, 13, 533, 2686, 273, 5075, 22925, 40090, 2367, 5577, 92, 39, 599, 6267, 1352, 831, 310, 2032, 984, 512, 30268, 4561, 11419, 31106, 2390, 403, 2802, 25855, 457, 4872, 313, 2887, 575, 683, 1785, 2498, 187, 187, 1447, 7265, 696, 1281, 370, 40, 5, 320, 247, 30268, 4561, 1220, 17254, 1387, 15, 2635, 2367, 5577, 92, 39, 599, 9805, 8414, 273, 5075, 3458, 22925, 15, 187, 187, 9873, 17405, 575, 1447, 18989, 17254, 696, 285, 10012, 575, 1447, 13518, 696, 16084, 326, 2367, 5577, 92, 39, 47481, 1926, 8275, 64, 88, 3503, 337, 20886, 6190, 464, 1109, 551, 2307, 209, 6092, 7524, 5577, 92, 39, 47481, 2311, 2306, 79, 1352, 380, 1387, 370, 40, 5, 310, 1220, 17254, 15, 3813, 13, 7201, 5577, 92, 39, 47481, 2306, 79, 9, 40, 4010, 18, 1366, 285, 512, 22925, 771, 7201, 5577, 92, 39, 47481, 2306, 79, 5, 403, 22925, 275, 370, 40, 1352, 187, 187, 60, 21831, 3428, 8779, 2390, 1181, 905, 1704, 27, 12722, 696, 187, 187, 21831, 3428, 8779, 2390, 497, 5611, 275, 575, 683, 21831, 18, 62, 285, 575, 683, 2696, 62, 407, 443, 15, 11086, 360, 3433, 356, 13, 329, 15, 2752, 284, 47835, 285, 657, 15, 6235, 265, 5025, 34089, 15, 1707, 253, 4477, 1908, 253, 10898, 3762, 273, 2390, 15, 329, 1387, 370, 40, 5, 310, 1925, 6278, 14, 3022, 604, 253, 10898, 11813, 273, 370, 40, 5, 285, 370, 40, 393, 3181, 443, 5, 28588, 15, 1707, 310, 2969, 4209, 1617, 273, 247, 1387, 370, 40, 5, 281, 320, 6278, 14, 3022, 428, 247, 1387, 14127, 436, 1617, 310, 1925, 7134, 8779, 15, 3010, 7000, 5955, 273, 7134, 8779, 2390, 476, 320, 1119, 275, 575, 683, 2696, 1092, 1008, 21831, 18, 62, 285, 575, 683, 21831, 19, 1570, 187, 187, 34, 1387, 370, 40, 5, 7134, 8475, 247, 1387, 370, 41, 5, 604, 323, 667, 6486, 873, 273, 37825, 3603, 370, 73, 64, 74, 393, 249, 388, 5, 627, 4961, 247, 33662, 669, 2162, 27, 41, 393, 4287, 443, 5, 534, 8115, 370, 73, 64, 74, 2911, 265, 281, 37825, 3603, 275, 370, 40, 1352, 329, 1387, 370, 40, 5, 310, 1925, 7134, 8779, 13, 604, 370, 40, 5, 7134, 8475, 370, 40, 393, 3181, 443, 1352, 380, 5426, 359, 1918, 2708, 310, 417, 4555, 253, 1072, 347, 253, 581, 275, 575, 683, 2696, 1092, 533, 352, 310, 6425, 15, 187, 187, 34, 1387, 370, 40, 5, 310, 1925, 7134, 8779, 604, 323, 667, 7007, 370, 47, 5, 285, 323, 667, 3603, 370, 73, 64, 18, 1337, 6768, 13, 73, 64, 47, 393, 249, 443, 393, 3181, 443, 1366, 627, 4961, 247, 33662, 669, 2859, 27, 443, 61, 3181, 443, 393, 936, 443, 5, 824, 326, 669, 2859, 9, 73, 64, 74, 4010, 18, 5, 604, 285, 760, 604, 370, 73, 64, 74, 30, 18, 1352, 187, 187, 1447, 12722, 696, 1281, 370, 40, 5, 320, 247, 7134, 8779, 1387, 840, 323, 667, 20935, 370, 79, 1366, 370, 47, 5, 285, 667, 3603, 370, 73, 64, 18, 1337, 6768, 13, 73, 64, 47, 393, 249, 443, 1743, 3181, 295, 724, 627, 4961, 247, 33662, 669, 2859, 27, 443, 1743, 3181, 295, 889, 936, 443, 5, 824, 326, 669, 2859, 9, 73, 64, 74, 4010, 18, 5, 604, 285, 760, 604, 370, 73, 64, 74, 30, 18, 1352, 187, 187, 1231, 588, 897, 9953, 327, 370, 79, 1352, 380, 2613, 1083, 370, 79, 30, 18, 5, 310, 14916, 313, 21528, 669, 2859, 426, 393, 4820, 92, 301, 34942, 187, 187, 4140, 326, 359, 452, 3603, 370, 73, 64, 74, 61, 249, 443, 1743, 3181, 295, 12, 18, 3363, 844, 476, 3890, 1016, 273, 731, 347, 370, 73, 64, 74, 426, 313, 73, 578, 74, 13, 18, 2023, 73, 578, 74, 13, 19, 19446, 835, 370, 73, 578, 74, 13, 18, 94, 393, 249, 443, 1743, 3181, 295, 724, 285, 370, 73, 578, 74, 13, 19, 94, 393, 249, 443, 1352, 2896, 253, 9953, 9079, 13, 627, 4961, 247, 33662, 669, 2859, 64, 18, 27, 443, 1743, 3181, 295, 94, 393, 936, 443, 1366, 824, 326, 669, 2859, 64, 18, 9, 73, 578, 74, 13, 18, 19002, 18, 5, 36714, 370, 73, 578, 74, 13, 18, 94, 426, 18, 1352, 3954, 1908, 253, 3603, 669, 2009, 288, 64, 74, 426, 5081, 2859, 64, 74, 9, 73, 578, 74, 13, 18, 22286, 73, 578, 74, 13, 19, 2311, 393, 249, 443, 393, 3181, 443, 1352, 2896, 253, 7134, 8779, 2867, 273, 253, 1387, 370, 40, 1366, 627, 4961, 247, 3711, 669, 2859, 64, 19, 27, 40, 61, 3181, 443, 393, 936, 443 ]
'$ is an abelian group generated by $d$ elements. Therefore, there is no such homomorphism $\rho$, i.e., $[[g_1,g_2],g_3^N]$ is a weak identity. \[nil3\] The element $[[g_1,g_2],g_3]$ is a weak identity modulo the $T$-subgroup ${\mathfrak{H}}_3$ generated by ${\mathfrak{F}}''$ and $[[g_1,g_2],g_3^N]$. Let $\rho: {\mathfrak{F}}^{\times n} \to G$ be a homomorphism, where $n = d\log_2 N$. Suppose that $\rho(i_k([[g_1,g_2],g_3])) \not \in {\mathfrak{H}}_3(G)$ for all $k$. Let $$H_k = \{g\in G | [g,\rho(i_j([g_1,g_2]))] \in {\mathfrak{H}}_3(G), \, {\mbox{\rm { for }}}j\leq k\}.$$ The groups $H_k$ form a descending chain of subgroups. The chain is strictly descending, since $\rho(i_k(g_3)) \in H_{k-1} \backslash H_k$. All these subgroups contain the subgroup generated by $G'$ and the elements $g^N$, for any $g\in G$. Therefore, we can project the subgroups $H_k$ to subgroups of the group $G/G'.G^N$. The last group is a finite group containing less than $N^d$ elements and does not have a strictly decreasing sequences of subgroups of length more than $d\log_2 N$ – contradiction. This proves that the element $[[g_1,g_2],g_3]$ is a weak identity modulo ${\mathfrak{H}}_3$. \[nil2.5\] There exists an integer $N$, depending on the group $G$, such that the element $[g_1,g_2^N]$ is a weak identity modulo the $T$-subgroup ${\mathfrak{H}}_2$ generated by $[[g_1,g_2],g_3]$. The proof is similar to the one of lemma \[nil3.5\]. The group $G'/{\mathfrak{H}}_2$ is a finitely generated abelian group. Let $N$ be a number divisible by the order of all torsion elements in this group. This implies that if $ h \in G'$ and $h^N \not \in {\mathfrak{H}}_2(G)$, then $h^k \not \in {\mathfrak{H}}_2(G)$, for all $k\not=0$. Now if we assume that $[g_1,g_2^N]$ is not a weak identity, then there exists a map $\rho: {\mathfrak{F}}^{\times d+1} \to G$ such that $\rho(i_k([g_1,g_2^N])) \not \in {\mathfrak{H}}_2(G)$. Using arguments similar to the ones in the proof of lemma \[nil3.5\], we can show that the elements $\rho(i_k(g_2))$ are linearly independent modulo $G'$, which is impossible – contradiction. \[nil2\] The element $[g_1,g_2]$ is a weak identity modulo the $T$-subgroup ${\mathfrak{H}}_1$ generated by $[[g_1,g_2],g_3]$ and $[g_1,g_2^N]$ Same as the proof of lemma \[nil3\], but we use the element $g_1$, instead of the element $[g_1,g_2]$ to construct the groups $H_k$. The statements of Lemmas \[nil3\] and \[nil2\] hold in any finitely generated group $G$, although the heights of the corresponding weak identities depend only on the number of generators of the group $G$. The same is not true for Lemmas \[nil3.5\] and \[nil2.5\], where the number $N$ depends on the group $G$. Now we can use these lemmas to prove Theorem \[meta\]: take the $T$-subgroups $${\mathfrak{F}}' \supset {\mathfrak{H}}_1 \supset {\mathfrak{H}}_2 \supset {\mathfrak{H}}_3 \supset {\mathfrak{F}}''.$$ Lemmas \[nil3.5\], \[nil3\], \[nil2.5\] and \[nil2\] show that each of these $T$-subgroups consists of weak identities modulo the next one. Therefore, by definition ${\mathfrak{F}}'$ consists of weak\* identities modulo ${\mathfrak{F}}''$, which completes the proof of theorem \[meta\]. \[solvable\] If for a fixed finitely generated group $G$, the $T$-subgroup ${\mathfrak{F}}'$ consists of weak\* identities modulo ${\mathfrak{F}}''$. Then ${\mathfrak{F}}'$ consist of weak\* identities modulo ${{\mathfrak{F}}^n}'$ for all $n$. Here, ${\mathfrak{F}}'$ denotes the commutator subgroup, ${\mathfrak{F}}''$ is its commutator subgroup and ${{\mathfrak{F}}'}^n$ is the $n$-th term of the solvable series of the free group ${\mathfrak{F}}$. We can use theorem \[properties\] c) to show that ${{\mathfrak{F}}'}^k$ consists of weak\* identities in $G$ modulo the group ${{\mathfrak{F}}'}^{k+1}$. Finally, using part a) we can show that $${\mathfrak{F}}' {\equiv_w^* 1 ({\mbox{\rm {mod }}} {{{\mathfrak{F}}'}^n})}.$$ \[meta-weak\] If the group $G$ is finitely generated then ${\mathfrak{F}}'$ consists not only of weak\* identities, but actually of weak identities modulo ${\mathfrak{F}}''$. This is true because all finitely generated meta abelian groups are ‘almost’ linear (see [@Re]). \[main\] Let $G$ be a finitely generated solvable group. Then ${\mathfrak{F}}'$ consists of weak\* identities. Corollary \[solvable\] and theorem \[meta\] imply that ${\mathfrak{F}}' {\equiv_w^* 1 ({\mbox{\rm {mod }}} {{\mathfrak{F}}'})}^n$. The group $G$ is solvable. Therefore, ${{\mathfrak{F}}'}^n(G)=1$, and all identities mod ${{\mathfrak{F}}'}^n$ are identities in $G$. [Discriminating groups]{} \[sec:disc\] Discriminating groups were introduced in [@Disc1] and [@AG] by G. Baumslag, A. Myasnikov and V. Remeslenikov. There the authors consider the universal theory of groups. A group $G$ is called square-like if the universal theories of $G$ and $G \times G$ coincide. There is simple sufficient condition of a group $G$ to be square-like - a group satisfying this condition is called discriminating. More detailed discussion of discriminating groups can be found in [@AG], [@Disc1] and [@Disc2]. A group $G$ discriminates a group $H$ if for any finite set of nontrivial elements $h_i \in H$ there exists a homomorphism $\phi:H \rightarrow G$ which maps $h_i$-es to nontrivial elements in $G$. A group $G$ is called discriminating, if $G$ discriminates $G \times G$. The definition we give below is not exactly the same as the one in [@AG], but it is equivalent. A group $G$ is called discriminating if for any integer $N$ and for any elements $h_1,\dots,h_N \in G \times G$, there exists a homomorphism $\rho: G\times G \to G$ such that $\rho(h_i)=1$ if and only if $h_i=1$. \[disc\] Let $G$ be a discriminating group then for any integers $n$, $N$ and any elements $h_1,\dots,h_N \in G^{\times n}$ there exists a homomorphism $\rho: G^{\times n}\to G$ such that $\rho(h_i)=1$ if and only if $h_i=1$. We will use induction on $n$. The base case $n=1$ is trivial (take $\rho = \operatorname{id}$). Suppose that we have elements $h_i\in G^{\times n+1}$. We can express each of them as $h_i = (h_{i,1},h_{i,2})$, where $h_{i,1} \in G^{\times n}$ and $h_{i,2} \in G$. By the induction hypothesis, there exists a homomorphism $\rho_1: G^{\times n} \to G$, such that $\rho_1(h_{i,1})=1$ iff $h_{i,1} =1$. Now consider the elements $\bar h_i = (\rho_i(h_{i,1}),h_{i,2}) \in G \times G$. By the discriminating property of the group $G$, there exists a map $\rho_2:G\times G \to G
[ 481, 187, 27122, 11, 66, 187, 12897, 313, 1229, 428, 1884, 559, 854, 11, 78, 424, 19, 11050, 19, 11, 78, 424, 20, 559, 470, 559, 470, 10, 559, 3383, 18, 559, 374, 428, 495, 11050, 18, 559, 337, 559, 278, 11050, 805, 11, 78, 424, 21, 559, 278, 424, 21, 559, 278, 424, 21, 481, 187, 21, 11, 78, 424, 22, 187, 12897, 470, 11, 88, 424, 20, 559, 577, 11, 88, 424, 20, 428, 259, 424, 20, 559, 313, 19, 11, 88, 428, 374, 11, 88, 559, 259, 424, 19, 7672, 21, 11, 88, 428, 577, 11, 88, 428, 259, 10, 428, 495, 11, 88, 424, 20, 428, 721, 559, 721, 559, 470, 11, 88, 424, 20, 559, 259, 428, 818, 11, 88, 428, 259, 424, 20, 15, 187, 14, 19, 11, 88, 424, 20, 428, 721, 11, 88, 187, 12897, 3383, 19, 11, 71, 428, 495, 11, 71, 559, 721, 11, 71, 11050, 20, 11, 71, 428, 269, 559, 721, 11, 71, 7672, 883, 428, 884, 559, 1722, 481, 187, 1812, 11, 71, 424, 19, 187, 12897, 298, 428, 298, 559, 298, 424, 21, 559, 3383, 18, 559, 337, 559, 298, 424, 21, 7672, 17, 559, 374, 428, 337, 10, 428, 8988, 11, 77, 424, 21, 559, 12036, 11, 77, 424, 21, 559, 577, 428, 5096, 11, 77, 424, 21, 15, 187, 1099, 11, 77, 424, 21, 559, 577, 187, 12897, 6048, 19, 428, 374, 559, 247, 11050, 20, 428, 374, 559, 577, 10, 559, 608, 11, 66, 428, 13900, 559, 13900, 7672, 23, 559, 247, 428, 495, 11, 66, 428, 577, 481, 187, 14, 25, 11, 66, 424, 19, 559, 854, 11, 66, 187, 12897, 898, 11, 84, 424, 19, 559, 2030, 11, 84, 428, 1903, 11, 84, 428, 1249, 11, 84, 559, 313, 20, 11, 84, 428, 256, 559, 470, 11, 84, 7672, 19, 11, 84, 559, 470, 11, 84, 428, 256, 10, 559, 374, 11, 84, 424, 19, 559, 256, 424, 19, 428, 608, 11, 84, 424, 19, 15, 187, 26, 11, 84, 424, 19, 559, 374, 11, 84, 187, 12897, 495, 11, 71, 424, 21, 559, 470, 11, 71, 424, 20, 559, 470, 11, 71, 424, 20, 559, 313, 71, 424, 19, 428, 495, 11, 71, 424, 19, 559, 495, 11, 71, 424, 19, 7672, 19, 11, 71, 424, 19, 559, 269, 424, 19, 428, 577, 11, 71, 424, 19, 10, 559, 5910, 11, 71, 424, 21, 428, 5693, 11, 71, 424, 21, 559, 8437, 11, 71, 424, 21, 15, 187, 2511, 11, 71, 424, 21, 187, 12897, 428, 2537, 11, 79, 424, 19, 559, 7584, 11, 79, 424, 19, 559, 3349, 11, 79, 424, 20, 559, 313, 19, 11, 79, 424, 19, 559, 470, 559, 470, 11050, 20, 11, 79, 559, 295, 559, 495, 11, 79, 10, 559, 898, 428, 898, 559, 295, 424, 20, 15, 187, 2405, 11, 79, 424, 20, 187, 12897, 313, 19, 11, 80, 428, 495, 559, 495, 11050, 1036, 428, 2145, 428, 495, 10, 428, 577, 428, 374, 559, 577, 559, 258, 15, 187, 14, 3571, 11, 80, 428, 374, 187, 12897, 1884, 2787, 11, 82, 424, 19, 428, 1884, 2787, 11, 82, 424, 19, 559, 608, 3677, 11, 82, 424, 22, 428, 374, 11, 82, 424, 22, 559, 470, 11, 82, 424, 22, 559, 2805, 424, 22, 559, 3383, 82, 424, 19, 559, 495, 11, 82, 424, 19, 559, 470, 11, 82, 424, 19, 11050, 22, 11, 82, 424, 20, 559, 374, 11, 82, 424, 20, 559, 374, 11, 82, 424, 20, 481, 187, 48699, 11, 82, 424, 22, 187, 12897, 428, 19, 11, 71, 424, 19, 559, 495, 11, 71, 424, 19, 559, 269, 424, 19, 559, 495, 11, 71, 428, 577, 11, 71, 428, 30717, 11, 71, 424, 19, 559, 26972, 11, 71, 424, 19, 559, 313, 17, 11, 71, 559, 470, 11, 71, 559, 374, 11, 71, 7672, 17, 559, 269, 559, 470, 10, 428, 854, 11, 71, 424, 19, 559, 269, 424, 19, 559, 470, 11, 71, 424, 19, 15, 187, 14, 1549, 11, 71, 424, 19, 428, 269, 187, 12897, 313, 19, 11, 73, 424, 19, 428, 337, 559, 337, 11050, 22, 559, 5976, 428, 337, 10, 559, 577, 11, 73, 424, 19, 428, 288, 424, 19, 428, 374, 11, 73, 424, 19, 15, 187, 3655, 11, 73, 424, 19, 187, 12897, 3383, 19, 11, 72, 559, 495, 428, 495, 7672, 72, 424, 19, 559, 577, 11, 72, 424, 19, 428, 721, 11, 72, 424, 19, 10, 559, 374, 11, 72, 424, 20, 428, 337, 559, 30805, 36793, 11, 72, 424, 19, 559, 470, 428, 2030, 4185, 1093, 11, 72, 424, 19, 15, 187, 21, 11, 72, 424, 20, 559, 11087, 11, 72, 424, 19, 428, 337, 187, 12897, 3383, 19, 11, 66, 428, 495, 11, 66, 559, 577, 11, 66, 7672, 24, 428, 495, 428, 374, 559, 313, 17, 559, 374, 428, 495, 11050, 23, 559, 495, 559, 337, 10, 559, 470, 559, 470, 428, 337, 7672, 20, 428, 337, 428, 337, 10, 559, 470, 11, 66, 428, 721, 559, 374, 11, 66, 428, 495, 11, 66, 15, 187, 14, 21, 11, 66, 428, 721, 187, 12897, 3383, 22, 11, 69, 559, 374, 11, 69, 428, 277, 7672, 19, 428, 374, 559, 374, 11, 69, 424, 19, 10, 559, 577, 11, 69, 424, 20, 428, 884, 11, 69, 424, 20, 428, 277, 559, 277, 424, 20, 15, 187, 14, 1012, 11, 69, 424, 20, 428, 277, 187, 12897, 3383, 20, 11, 73, 424, 19, 428, 6705, 11, 73, 424, 19, 559, 1722, 11, 73, 424, 19, 11050, 20, 428, 374, 559, 470, 559, 3383, 21, 559, 470, 559, 608, 11050, 21, 559, 577, 428, 374, 5029, 187, 16552, 11, 73, 424, 19, 187, 12897, 3383, 19, 11, 66, 559, 577, 428, 577, 7672, 20, 11, 66, 424, 20, 428, 577, 11, 66, 424, 20, 428, 247, 424, 20, 10, 559, 374, 11, 66, 424, 21, 559, 247, 424, 21, 428, 247, 424, 21, 559, 3495, 11, 66, 424, 21, 428, 495, 11, 66, 424, 21, 559, 247, 424, 21, 15, 187, 1630, 11, 66, 424, 21, 187, 12897, 313, 73, 428, 495, 11, 73, 559, 577, 11, 73, 7672, 18, 428, 337, 428, 374, 11, 73, 10, 559, 608, 11, 73, 424, 19, 559, 470, 11, 73, 424, 19, 428, 495, 11, 73, 424, 19, 559, 313, 73, 559, 337, 428, 337, 7672, 19, 11, 73, 428, 577, 559, 577, 10, 428, 12652, 11, 73, 424, 19, 428, 2030, 2405, 11, 73, 559, 2030, 2405, 11, 73, 15, 187, 14, 12852, 11, 73, 424, 19, 187, 12897, 313, 17, 11, 91, 559, 470, 11, 91, 559, 374, 11, 91, 424, 19, 559, 3383, 19, 428, 337, 559, 337, 11050, 18, 428, 1182, 424, 19, 559, 337, 10, 428, 1182, 424, 19, 428, 374, 11, 91, 424, 19, 559, 608, 11, 91, 424, 19, 559, 1182, 424, 19, 559, 495, 11, 91, 428, 495, 11, 91, 11050, 805, 11, 91, 559, 495, 11, 91, 559, 470, 11, 91, 481, 187, 14, 3571, 11, 91, 424, 20, 187, 12897, 3383, 18, 428, 495, 559, 495, 11050, 3547, 1438, 428, 15410, 11, 74, 559, 8187, 1438, 7672, 21, 11, 74, 428, 577, 11, 74, 428, 577, 11, 74, 424, 19, 481, 187, 14, 39338, 11, 74, 424, 20, 187, 12897, 313, 22, 11, 79, 428, 295, 428, 608, 11, 79, 559, 3383, 1731, 559, 608, 559, 818, 7672, 79, 559, 337, 428, 337, 1228, 5355, 21, 559, 470, 428, 721, 481, 187, 1229, 11, 79, 187, 12897, 313, 805, 11, 89, 428, 1722, 11, 89, 559, 1249, 11, 89, 11050, 1671, 11, 89, 559, 13062, 11, 89, 428, 2030, 11, 89, 481, 187, 17615, 11, 89, 424, 19, 187, 12897, 6048, 18, 559, 577, 428, 495, 7672, 17, 559, 577, 428, 374, 10, 559, 313, 22, 559, 721, 428, 374, 11050, 20, 428, 337, 559, 374, 1228, 5355, 19, 11, 86, 428, 374, 11, 86, 559, 374, 11, 86, 481, 187, 14, 1619, 11, 86, 187, 12897, 428, 1166, 11, 67, 424, 21, 428, 3127, 11, 67, 424, 21, 428, 1668, 11, 67, 424, 21, 428, 374, 11, 67, 424, 21, 428, 270, 424, 20, 559, 270, 424, 20, 559, 313, 19, 11, 67, 424, 19, 559, 374, 11, 67, 424, 19, 428, 495, 11, 67, 424, 19, 7672, 19, 428, 374, 559, 270, 424, 19, 481, 187, 14, 2417, 11, 67, 424, 21, 187, 12897, 428, 72, 424, 20, 559, 608, 428, 3307, 559, 470, 11, 72, 424, 20, 559, 313, 23, 11, 72, 424, 19, 428, 495, 11, 72, 424, 19, 428, 577, 11, 72, 424, 19, 7672, 21, 11, 72, 428, 577, 11, 72, 559, 818, 11, 72, 481, 187, 14, 25, 11, 72, 424, 20, 428, 1722, 187, 12897, 3383, 22, 11, 72, 559, 577, 11, 72, 559, 374, 11, 72, 7672, 19, 11, 72, 559, 608, 11, 72, 428, 608, 11, 72, 7672, 17, 428, 3307, 428, 818, 11050, 19, 428, 337, 559, 374, 481, 187, 3680, 11, 72, 424, 19, 187, 12897, 313, 32296, 11, 82, 559, 854, 11, 82, 428, 5571, 11, 82, 7672, 22, 428, 577, 559, 337, 11050, 82, 559, 2805, 428, 374, 11, 82, 481, 187, 14, 1166, 1237, 11, 82, 424, 19, 187, 12897, 313, 1235, 559, 19092, 11, 88, 424, 19, 428, 374, 428, 7783, 11, 88, 424, 19, 7672, 21, 428, 495, 559, 337, 481, 187, 14, 740, 11, 88, 424, 19, 559, 9161, 187, 12897, 3383, 3011, 559, 884, 11, 87, 559, 8988, 2888, 4464, 21, 428, 495, 559, 495, 7672, 17, 559, 362, 424, 20, 559, 470, 10, 428, 362, 424, 20, 428, 495, 11, 87, 424, 20, 559, 721, 11, 87, 424, 20, 559, 608, 11, 87, 424, 20, 428, 577, 11, 87, 424, 20, 559, 362, 424, 20, 481, 187, 1438, 11, 87, 424, 21, 187, 12897, 313, 17, 11, 72, 428, 374, 11, 72, 428, 374, 11, 72, 11050, 2405, 428, 6480, 559, 721, 481, 187, 20438, 11, 72, 187, 12897, 428, 18, 428, 891, 424, 19, 559, 337, 559, 313, 26, 428, 898, 428, 1638, 11, 74, 424, 19, 7672, 23, 428, 374, 428, 337, 481, 187, 14, 3079, 11, 74, 424, 19, 187, 12897, 3383, 19, 428, 337, 559, 577, 11050, 11335, 11, 80, 424, 19, 559, 28415, 11, 80, 428, 28415, 11, 80, 10, 559, 470, 11, 80, 424, 19, 428, 577, 11, 80, 424, 19, 559, 721, 11, 80, 424, 19, 559, 3383, 20, 11, 80, 559, 374, 11, 80, 559, 470, 11, 80, 11050, 21, 11, 80, 559, 258, 559, 258, 481, 187, 14, 4185, 11, 80, 424, 19, 187, 12897, 313, 2950, 11, 76, 428, 1283, 11, 76, 559, 7904, 11, 76, 559, 3307, 11, 76, 11050, 883, 428, 854, 559, 470, 481, 187, 14, 1093, 1348, 11, 76, 187, 12897, 3383, 74, 559, 8978, 11, 74, 559, 1283, 11, 74, 7672, 19, 559, 470, 428, 721, 481, 187, 14, 19321, 11, 74, 187, 12897, 6048, 19, 11, 76, 424, 19, 559, 374, 11, 76, 424, 19, 428, 374, 11, 76, 424, 19, 7672, 19, 559, 374, 428, 495, 10, 428, 721, 11, 76, 424, 19, 559, 495, 11, 76, 424, 19, 559, 577, 11, 76, 424, 19, 11050, 3677, 559, 2030, 11, 76, 559, 11102, 7672, 20, 11, 76, 424, 19, 559, 495, 11, 76, 424, 19, 428, 608, 11, 76, 424, 19, 481, 187, 1976, 11, 76, 424, 22, 187, 12897, 38961, 11, 89, 559, 721, 3571, 11, 89, 428, 48778, 11, 89, 559, 374, 11, 89, 424, 21, 559, 495, 11, 89, 424, 21, 428, 495, 11, 89, 559, 495, 11, 89, 559, 3383, 19, 559, 374, 428, 1269, 7672, 19, 11, 89, 559, 374, 11, 89, 424, 20, 428, 374, 11, 89, 481, 187, 20, 11, 89, 424, 21, 559, 14509, 11, 89, 187, 12897, 3387, 11, 83, 559, 818, 11, 83, 428, 21603, 11, 83, 424, 19, 559, 21579, 11, 83, 424, 19, 428, 577, 559, 313, 18, 559, 470, 428, 374, 11050, 83, 424, 19, 559, 374, 11, 83, 424, 19, 428, 495, 11, 83, 424, 19, 481, 187, 83, 424, 19, 559, 7543, 11, 83, 428, 577, 187, 12897, 313, 17, 11, 85, 424, 21, 559, 577, 11, 85, 424, 21, 559, 470, 11, 85, 424, 21, 559, 313, 19, 11 ]
). 292*a Expand (30 - 30 + 8*m**2)*(-2*m**3 + 0 + 0) + (-1 + 2 - 3)*(-1 + 1 + m)*(-12*m**4 + m**4 + m**4). 4*m**5 Expand 0*w**3 + 4*w**3 - w**3 + (2*w - 2*w + w**2)*(4*w - 4*w - w) - 3*w**3 - 6 + 6 + 0*w**3 + w - 7*w - w**3. -2*w**3 - 6*w Expand (-2*f - 3*f + 6*f)*(-3*f - f + 6*f)*(11 - 10 + 17). 36*f**2 Expand l - l + l**4 + (-1 + 1 + l**4)*(0 + 2 - 1) - 57*l**4 + 160*l**4 + 4 - 80*l**4. 25*l**4 + 4 Expand ((2 - 2 + a)*(-3 - 2 + 4) + 5*a - 134 + 134)*(6 + a - 3*a - 4). -8*a**2 + 8*a Expand 9*s**2 + 25*s - 11*s - 12*s + (3*s - s + 0*s)*(2*s + 0*s - s) + 2*s**2 + s**2 - 5*s**2. 9*s**2 + 2*s Expand 3*f**4 + 0*f**3 + 0*f**3 + (f**2 - 3*f**2 + 3*f**2)*(2*f**2 + f**2 - 4*f**2) + 34*f**4 - 48*f**4 + 101*f**4. 89*f**4 Expand -49*n**2 + 49*n**2 + 28*n**3 + (2*n**2 + 0 + 0)*(-3*n + n + 3*n) + 9 - 9 + n**3. 31*n**3 Expand (2*o - 3 + 3)*(-16 - 13 - 3) - 4 - 2 + 4 + o. -63*o - 2 Expand 3079*q**2 - 3079*q**2 + 571*q**5 - 2*q**5 + 0*q**5 + q**5 + (-q**2 + 3*q**2 + 0*q**2)*(-5*q**3 + 2*q**3 + 2*q**3). 568*q**5 Expand -2*f**2 + 3*f**2 + f**2 + 3*f - 4*f - 289*f**2 + 232*f**2 + (0*f + 0*f + 2*f)*(0 + f + 0) - 8*f**2 + f**2 + 0*f**2. -60*f**2 - f Expand (2*h**2 - 1 + 1)*(-5 + 42 - 1) + 4*h**2 - h**2 - 2*h**2. 73*h**2 Expand (-2*g + 3 - 3)*(g**2 + 4*g**2 - 6*g**2) + 2*g**3 - 1 + 259891*g**2 + 0 - 259818*g**2. 4*g**3 + 73*g**2 - 1 Expand (-2*a - 3*a + 4*a)*(7 - 3 - 2 + (0 + 2 - 3)*(-6 + 3 + 1) + 0 + 0 - 1)*(3 - 1 - 1) + 0*a - 6 + 2*a - 3*a. -4*a - 6 Expand (-5*d + 2*d - d)*(2 - 2 + 2*d**2) + 4*d**3 - 10*d**3 - d + d**3. -13*d**3 - d Expand (-3*h**2 - 64*h**2 + 17*h**2)*(-3 - 2 + 0 + (-4 + 0 + 5)*(-4 + 4 - 2)). 350*h**2 Expand (-2*a + 4 - 4)*(3*a**3 - 4*a**3 - a**3) + 2*a**4 + a**4 - a**4 + 23*a**4 - 3*a**4 + a**4. 27*a**4 Expand (h - 3*h + 4*h)*(1 - 1 - 2*h) + 5*h**2 + 0*h**2 - 3*h**2 + (h + 1 - 1)*(2*h - 4 + 4) - 109*h**2 - 2531*h + 2531*h. -109*h**2 Expand (0*z + 0*z + 2*z**2 + (-2 - 1 + 1)*(-1 - z**2 + 1) - z**2 - 2*z**2 + 5*z**2 + z**2 + 3*z - 3*z)*(-12*z + 3*z + 0*z). -63*z**3 Expand (-1 - 3 + 3)*(-7280 - 138*i + 7280)*(4*i - 4*i - 4*i**2). -552*i**3 Expand (5*n - n - 5*n + (-26 + 5 + 7)*(n + 1 - 1))*(4 + 0 - 6). 30*n Expand (12*x - 17*x + 12*x)*(-35*x + 103*x - 25*x). 301*x**2 Expand ((1 + 4 - 3)*(0 + 4 - 2) + (5 + 6 - 2)*(-3 - 1 + 2))*(2*u - 2*u + 2*u). -28*u Expand -17*b**4 - 21*b**4 - 16*b**4 - 2*b**4 - b**3 + b**3 + (2*b**2 + 2*b**2 - 3*b**2)*(2 - 2 + b**2). -55*b**4 Expand -g**3 + 5 - 22 + 0*g**3 + (6*g**2 - 3*g**2 - 4*g**2)*(4*g - 4*g + 7*g). -8*g**3 - 17 Expand (-5*g + 4*g + 2*g)*(2*g + 5*g - 5*g)*(0 - 22 - 7)*(-2 - 1 + 2). 58*g**2 Expand (495*q + 8*q - 70*q)*(5 - 4 + 1)*(-q + q - 2*q). -1732*q**2 Expand (50 + 145*w**2 - 2 - 150*w**2)*(4 - 3 + 1). -10*w**2 + 96 Expand (-57 + 10*v + 57)*((4 - 3 + 3)*(0 + v**3 + 0) - v**3 - 3*v**3 + 6*v**3 + 5*v**3 - 4*v**3 + v**3). 80*v**4 Expand (0*g - 2*g - 2*g)*(-31 - 38 + 6). 252*g Expand -1 - i**2 + 1 + (9 - 9 - 14*i**2)*(6 - 2 - 1). -43*i**2 Expand (-2 - 1 + 4)*(-102*o**2 + 242*o - 242*o) + 0*o**2 - 4*o**2 + 6*o**2 + (-3*o + 2*o + 0*o)*(-4*o + o + o). -98*o**2 Expand (46*k - 18*k + 46*k + 22*k)*(-11 - 8 + 0). -1824*k Expand (-i + 59*i + 18*i)*(2 + 0 - 6). -304*i Expand ((2*k**2 + 2*k**2 - 2*k**2)*(2 + 2 - 3) - 6*k**2 + 3*k**2 + 4*k**2)*(-71 + 25*k + 71)*(3*k**2 + 3*k**2 - 5*k**2). 75*k**5 Expand 473*x + 663*x - 999*x + 2*x**4 + 3*x**4 - 3*x + 3*x + (-2 + 2 - x)*(2*x + 2*x**3 - 2*x). 3*x**4 + 137*x Expand 40*r + 7*r - 154*r**2 + 153*r**2 - 4 + (1 + 0 - 2)*(-r**2 + 2*r**2 - 3*r**2). r**2 + 47*r - 4 Expand (0*t**4 + 4*t**4 + 0*t**4 + (2*
[ 14605, 27, 475, 5346, 11, 426, 470, 15, 1099, 13, 475, 35, 11, 426, 470, 15, 5525, 13, 285, 475, 81, 11, 426, 470, 15, 4838, 28, 8746, 14, 14605, 27, 475, 5346, 11, 426, 470, 15, 1610, 13, 475, 35, 11, 426, 470, 15, 7931, 13, 285, 475, 81, 11, 4398, 470, 15, 2874, 481, 3840, 13, 2406, 14, 2068, 2013, 414, 1159, 10571, 20184, 323, 253, 1055, 273, 31262, 1881, 14, 48995, 327, 6406, 14, 48262, 2323, 13, 534, 6786, 7605, 8453, 275, 253, 8746, 14, 14605, 1617, 760, 313, 20199, 27, 475, 5346, 11, 426, 470, 15, 2922, 13, 475, 35, 11, 426, 470, 15, 2874, 13, 285, 475, 81, 11, 426, 470, 15, 805, 28, 8746, 27, 475, 5346, 11, 426, 470, 15, 2693, 13, 475, 35, 11, 426, 470, 15, 4699, 13, 285, 475, 81, 11, 426, 470, 15, 2125, 481, 20672, 14, 2068, 2013, 414, 1159, 20184, 323, 1884, 6, 273, 253, 19817, 1055, 273, 31262, 1881, 14, 48995, 327, 2014, 14, 14605, 2323, 285, 3349, 6, 273, 253, 1055, 327, 8746, 14, 14605, 2323, 15, 844, 671, 24045, 326, 2406, 14, 2068, 2013, 414, 1159, 778, 10571, 5513, 253, 2538, 273, 6246, 39, 285, 15481, 327, 6406, 14, 48262, 2323, 15, 3900, 6246, 39, 285, 15481, 497, 20804, 281, 2014, 14, 14605, 2323, 4313, 313, 527, 4128, 2538, 475, 81, 11, 426, 470, 15, 2904, 285, 470, 15, 1093, 13, 1183, 11507, 275, 253, 8746, 14, 14605, 1617, 13, 3687, 6246, 39, 369, 2330, 342, 3687, 6406, 14, 48262, 2323, 3066, 2406, 14, 2068, 2013, 414, 1159, 2796, 5346, 11, 426, 470, 15, 883, 13, 475, 35, 11, 426, 470, 15, 5525, 13, 285, 475, 81, 11, 426, 470, 15, 2640, 481, 4129, 3910, 275, 7605, 8453, 273, 436, 1055, 497, 2540, 875, 253, 767, 2515, 13, 253, 9777, 273, 253, 2538, 369, 2074, 875, 2515, 1754, 327, 253, 14787, 273, 253, 8492, 14, 43122, 28551, 5325, 6, 330, 2513, 273, 253, 440, 15291, 1025, 2538, 875, 2014, 14, 285, 8746, 14, 14605, 2515, 2470, 3235, 495, 1084, 8476, 20, 910, 709, 14, 881, 568, 2420, 2536, 187, 187, 8457, 6246, 39, 8058, 281, 320, 247, 24888, 273, 3045, 275, 2014, 14, 313, 17, 15, 1093, 13, 475, 81, 11, 426, 470, 15, 5523, 10, 285, 8746, 14, 14605, 2515, 313, 17, 15, 805, 13, 475, 81, 11, 426, 470, 15, 2693, 582, 347, 973, 347, 273, 31262, 1881, 14, 48995, 313, 17, 15, 1797, 13, 475, 81, 11, 426, 470, 15, 2874, 582, 359, 7515, 253, 6387, 326, 352, 3815, 20184, 323, 3045, 1805, 685, 253, 24045, 2538, 15, 7088, 1255, 14, 1171, 14, 8491, 369, 10870, 875, 253, 24045, 1566, 326, 2908, 247, 5921, 875, 6246, 39, 285, 253, 6454, 5593, 313, 34, 1864, 27, 577, 31013, 15, 4185, 13, 10904, 378, 1864, 27, 577, 32168, 15, 3121, 10, 285, 271, 17958, 1566, 1690, 247, 1480, 1055, 273, 6246, 39, 313, 34, 1864, 27, 577, 38819, 15, 4148, 13, 10904, 378, 1864, 27, 577, 33120, 15, 3121, 28, 475, 9650, 8769, 19, 24123, 1093, 10, 426, 2164, 15, 3712, 13, 475, 81, 11, 426, 470, 15, 1047, 28, 25607, 46124, 426, 470, 15, 2125, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2904, 28653, 12938, 6784, 426, 470, 15, 28271, 28, 330, 6766, 426, 470, 15, 1525, 481, 3308, 253, 24045, 2457, 1566, 369, 4516, 347, 247, 16571, 5740, 273, 253, 941, 15, 496, 253, 17958, 1566, 13, 6246, 39, 369, 3587, 2330, 342, 2323, 4313, 275, 2014, 14, 14605, 7587, 13, 533, 417, 275, 8746, 14, 14605, 7587, 313, 20199, 27, 475, 5346, 11, 426, 470, 15, 1099, 13, 475, 35, 11, 426, 470, 15, 8897, 13, 285, 475, 81, 11, 426, 470, 15, 2874, 28, 8746, 27, 475, 5346, 11, 426, 470, 15, 1036, 13, 475, 35, 11, 426, 470, 15, 7174, 13, 285, 475, 81, 11, 426, 470, 15, 32720, 481, 3840, 13, 253, 1480, 2538, 273, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 1159, 327, 8746, 14, 14605, 2323, 4313, 2540, 275, 253, 24045, 1566, 6376, 1534, 275, 253, 17958, 1566, 15, 9157, 13, 2709, 23190, 14, 1171, 14, 8491, 14452, 497, 4942, 7197, 275, 253, 1566, 275, 534, 6246, 39, 369, 20804, 281, 2323, 4313, 2796, 9650, 8769, 19, 24123, 938, 10, 426, 5922, 15, 2945, 13, 475, 81, 11, 426, 470, 15, 2941, 28, 25607, 46124, 426, 470, 15, 3071, 905, 2270, 6, 7309, 426, 470, 15, 2640, 16, 17, 15, 2693, 28653, 12938, 6784, 426, 470, 15, 27706, 28, 330, 6766, 426, 470, 15, 35366, 28, 329, 1864, 27, 577, 31416, 15, 2055, 13, 10904, 378, 1864, 27, 577, 38978, 15, 2950, 7147, 24045, 1566, 27, 475, 9650, 8769, 19, 24123, 1093, 10, 426, 3435, 15, 3712, 13, 475, 81, 11, 426, 470, 15, 2922, 28, 25607, 46124, 426, 470, 15, 1762, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2693, 28653, 12938, 6784, 426, 470, 15, 2125, 28, 330, 6766, 426, 470, 15, 26, 2691, 582, 7809, 436, 14282, 9383, 11610, 943, 320, 20184, 323, 275, 1635, 281, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 1159, 15, 187, 187, 10971, 13, 1223, 2363, 369, 417, 15970, 273, 2406, 14, 2068, 2013, 414, 1159, 13, 352, 369, 2330, 342, 6406, 14, 48262, 3045, 275, 1097, 2515, 15, 3813, 13, 271, 17958, 1566, 18005, 253, 1480, 1854, 432, 2363, 281, 6406, 14, 48262, 2323, 369, 5762, 15, 7088, 1255, 14, 1171, 14, 8491, 275, 253, 17958, 1566, 1690, 2363, 313, 34, 1864, 27, 8978, 3763, 15, 2941, 13, 10904, 378, 1864, 27, 8978, 2526, 15, 3208, 28, 475, 9650, 8769, 19, 24123, 1423, 10, 426, 3435, 15, 2693, 13, 475, 81, 11, 426, 470, 15, 1797, 28, 25607, 46124, 426, 470, 15, 2941, 905, 2270, 6, 7309, 426, 470, 15, 361, 16, 17, 15, 2922, 28653, 12938, 6784, 30, 17, 15, 18832, 28, 330, 6766, 426, 470, 15, 1525, 10, 369, 7197, 672, 2429, 342, 253, 24045, 1566, 15, 11362, 369, 2330, 342, 6406, 14, 48262, 2323, 275, 1097, 2014, 14, 285, 8746, 14, 14605, 7587, 2796, 5346, 11, 426, 4150, 17, 15, 12058, 13, 475, 81, 11, 426, 470, 15, 520, 28, 475, 5346, 11, 426, 4150, 17, 15, 1093, 13, 475, 81, 11, 426, 470, 15, 520, 13, 1183, 13351, 9937, 436, 13, 512, 24045, 2538, 2361, 1840, 497, 2540, 3907, 273, 436, 1480, 1055, 273, 2363, 15, 4129, 2363, 778, 320, 247, 14282, 9383, 11610, 273, 6406, 14, 48262, 3045, 13, 697, 7680, 281, 14613, 3910, 2190, 5662, 7747, 19958, 432, 436, 6891, 2363, 2491, 369, 1355, 285, 697, 11250, 25047, 253, 13328, 5632, 273, 253, 1566, 15, 3813, 13, 253, 24045, 1566, 369, 14667, 15, 187, 187, 21, 15, 21561, 1712, 1704, 21, 94, 187, 18669, 187, 187, 1552, 1263, 310, 581, 273, 253, 806, 281, 8338, 7688, 2190, 1881, 14, 48995, 13, 3520, 1159, 13, 285, 5662, 7747, 4479, 3045, 327, 247, 1524, 14, 10186, 13, 7826, 29198, 15363, 3879, 1532, 33151, 14, 48262, 1223, 5015, 327, 247, 4481, 15, 32384, 342, 2074, 2175, 13, 14270, 2323, 369, 3012, 2406, 275, 8746, 14, 14605, 7587, 1254, 35, 1508, 1092, 1008, 35, 1348, 1656, 28319, 31262, 1881, 14, 48995, 285, 2406, 14, 2068, 2013, 414, 3520, 1159, 497, 15970, 273, 3687, 6406, 14, 48262, 2323, 13, 3782, 275, 253, 8746, 14, 14605, 1617, 15, 380, 11686, 1055, 273, 1881, 14, 48995, 327, 8746, 14, 14605, 2323, 3400, 2007, 1941, 326, 1881, 14, 48995, 310, 271, 1774, 14613, 27152, 3907, 273, 3520, 1159, 285, 14601, 15, 2053, 1543, 9017, 2045, 3210, 20057, 1881, 14, 48995, 13, 3520, 1159, 13, 285, 5164, 7364, 275, 5662, 7747, 285, 1804, 625, 2561, 275, 253, 3634, 273, 2570, 13, 1524, 14, 10186, 8892, 310, 3058, 15, 187, 187, 8430, 6406, 14, 48262, 3045, 13072, 342, 2559, 4836, 10454, 13, 2169, 2308, 273, 2406, 14, 2068, 2013, 414, 3520, 1159, 285, 1881, 14, 48995, 26513, 841, 34044, 15, 2053, 1543, 403, 5185, 342, 2045, 789, 407, 30483, 49061, 285, 11651, 1254, 35, 1797, 1184, 275, 534, 17357, 7312, 31262, 3885, 285, 854, 14, 8938, 5863, 14, 395, 14, 6826, 673, 2190, 5875, 5662, 7747, 497, 2330, 342, 3687, 8746, 14, 14605, 31262, 2864, 942, 15, 329, 1781, 2133, 273, 1941, 8525, 253, 2554, 273, 15296, 3520, 1159, 275, 37460, 12351, 5164, 7364, 285, 11850, 3290, 273, 1495, 715, 5662, 33428, 1254, 35, 22, 7254, 35, 26, 1656, 41429, 273, 253, 1246, 1263, 13, 275, 253, 3634, 273, 247, 1524, 14, 10186, 5164, 4836, 13, 823, 281, 436, 1941, 2613, 285, 7501, 625, 2175, 19693, 3626, 2531, 9938, 273, 4712, 273, 5312, 3811, 15, 380, 8996, 273, 4116, 17905, 10296, 7788, 281, 1756, 9086, 13, 285, 2045, 2561, 6492, 326, 1014, 1029, 15415, 5662, 7747, 513, 417, 23652, 907, 31262, 285, 1159, 1309, 8746, 14, 14605, 9534, 1254, 35, 1797, 1656, 1284, 824, 13, 253, 9099, 323, 5662, 7747, 4479, 5312, 15415, 13, 5252, 13, 285, 3290, 273, 1495, 778, 320, 10665, 15, 29475, 267, 285, 6938, 12214, 285, 8525, 326, 7278, 5164, 3045, 1957, 11674, 1786, 14892, 8130, 323, 5662, 7747, 9592, 11372, 342, 247, 1495, 2317, 1607, 272, 264, 407, 21481, 4116, 267, 15374, 15, 187, 187, 6067, 4342, 4103, 281, 1881, 14, 48995, 2007, 17433, 6443, 253, 878, 323, 3081, 8368, 273, 24102, 273, 5164, 15151, 275, 2570, 13, 1524, 14, 10186, 7533, 15, 15397, 281, 2045, 2175, 327, 12351, 5164, 7364, 1254, 35, 23, 1092, 1008, 35, 24, 1092, 1008, 35, 805, 1092, 1008, 35, 1010, 5413, 1881, 14, 48995, 13082, 347, 247, 23403, 273, 4836, 3045, 15, 380, 1534, 11686, 1055, 3637, 253, 2675, 9699, 7792, 534, 803, 953, 326, 4292, 342, 3687, 3367, 10307, 2905, 281, 6936, 313, 70, 15, 72, 904, 31262, 10, 403, 625, 2779, 281, 11377, 275, 4712, 326, 1287, 3947, 4601, 824, 347, 3520, 1159, 3045, 1254, 35, 1012, 1656, 4129, 359, 3264, 281, 10018, 1480, 285, 11686, 2538, 275, 1097, 2515, 13, 352, 310, 417, 10084, 253, 2538, 497, 8943, 275, 253, 8746, 14, 14605, 1617, 760, 15, 16531, 14, 48995, 3762, 6482, 4219, 697, 15970, 1612, 310, 954, 13741, 762, 625, 17905, 2515, 13, 247, 13989, 326, 556, 644, 12724, 47790, 2439, 7625, 285, 13576, 1254, 35, 1012, 1092, 1008, 35, 1812, 1656, 380, 2264, 1055, 273, 1881, 14, 48995, 275, 21565, 6406, 14, 48262, 2323, 13, 275, 1635, 281, 253, 3777, 2554, 273, 3520, 1159, 327, 253, 11686, 1055, 273, 1881, 14, 48995, 275, 8746, 14, 14605, 7587, 13, 671, 5936, 10307, 12656, 778, 1957, 247, 10046, 27152, 273, 271, 2060, 4479, 84, 3745, 281, 4459, 562, 2570, 4712, 273, 5312, 3811, 672, 2429, 342, 3520, 1159, 285, 14601, 15, 41764, 79, 276, 965, 285, 11651, 1254, 35, 1423, 1184, 1119, 326, 9965, 5593, 273, 31262, 285, 1159, 497, 417, 2266, 23477, 273, 5662, 7747, 4479, 3045, 327, 1524, 14, 10186, 16239, 8892, 285, 9125, 326, 2616, 643, 685, 3520, 5350, 313, 70, 15, 72, 904, 31937, 13, 1881, 14, 48995, 10, 1132, 1774, 9503, 275, 5662, 7747, 4479, 1524, 14, 8206, 16239, 15, 19594, 432, 253, 14613, 6239, 2007, 5936, 326, 1881, 14, 48995, 4479, 84, 2554, 275, 8925, 13576, 778, 320, 1014, 10046, 685, 326, 273, 4588, 3745, 1254, 35, 883, 1092, 1008, 35, 1012, 7254, 35, 1010, 1656, 831, 310, 1774, 13, 347, 4292, 665, 24947, 247, 4836, 347, 16400, 390, 18844, 778, 320, 1679, 2779, 281, 11377, 275, 253, 2425, 1014, 604, 2060, 5350, 1057, 417, 33459, 11497, 1254, 35, 1012, 1092, 1008, 35, 1423, 1656, 12526, 13, 841, 14613, 7089, 778, 1421, 281, 3777, 3520, 2425, 13, 15506, 16239, 13, 285, 2957, 273, 14275, 1254, 35, 20, 1092, 1008, 35, 21, 5413, 512, 2234, 2616, 281, 5547, 15174, 15, 187, 187, 1552, 556, 1774, 12739, 323, 253, 2216, 273, 14613, 285, 6938, 12214, 323, 5662, 7747, 15, 3900, 2045, 1941, 6492, 1881, 14, 48995, 285, 3520, 1159, 403, 1774, 23477, 273, 7747, 4479, 3290, 273, 1495, 4768, 253, 15174, 1232, 1254, 35, 21, 1092, 1008, 35, 23, 1092, 1008, 35, 24, 5413, 253, 1543, 273, 253, 1246, 1263, 5224, 1881, 14, 48995, 285, 3520, 1159, 403, 1029, 11674, 1786, 14892, 8130, 47323, 31414, 625, 2570, 1495, 8470, 323, 5662, 7747, 15, 22606, 2425, 12214, 452, 8379, 12845 ]
task: *β* = 0.25, *B* = 0.004, and *p* = 0.003; dual-task: *β* = 0.33, *B* = 0.007, and *p* \< 0.001). Further, lower-extremity function partially accounted for the effect of gait self-efficacy on street-crossing success, which achieved statistical significance in the dual-task condition only (single: *β* = 0.07, *B* = 0.001, and *p* = 0.12; dual: *β* = 0.09, *B* = 0.002, and *p* = 0.04). Lower-extremity function accounted for 30% of the standardized effect of gait self-efficacy on single-task success and 28% of the effect on dual-task success. We also hypothesized that lower-extremity function may partially explain the effects of CRF and BMI on street-crossing success. While CRF and BMI were unrelated to single-task success ratio (indirect effects *p* = 0.08 and 0.18, resp.), in the dual-task condition, greater CRF was associated with greater street-crossing success via lower-extremity function (*β* = 0.11, *B* = 0.004, and *p* = 0.02). Although differences in statistical significance of this effect were observed between the two conditions, the magnitude of the effects was similar between conditions based on the overlap of the bias-corrected bootstrap 95% CIs of the unstandardized effects between single- and dual-task conditions ([Table 3](#tab3){ref-type="table"}). Because CRF proved to be a correlate of performance in single- (0.18, *p* = 0.005) and dual-task conditions (0.12, *p* = 0.09), as well as of gait self-efficacy (0.21, *p* = 0.001), we assessed the possibility that it alone accounted for performance better than the hypothesized effects. Goodness-of-fit was comparable between the hypothesized model that included a correlation between CRF and the outcome measures (AIC: 4855.98, adjusted BIC: 4859.76) and an alternate model including a direct effect of CRF (AIC: 4852.97, adjusted BIC: 4856.76; *χ*^2^(18) = 24.51, *p* = 0.14; RMSEA = 0.04 \[90% CI = 0.00/0.08\]; SRMR = 0.041; CFI = 0.99). Thus the hypothesized final model was supported as a viable description of the data. In the alternate model, CRF was directly associated with success ratio in single-task trials, but not in dual-task trials (single: *β* = 0.25, *B* = 0.008, and *p* = 0.001; dual: *β* = 0.16, *B* = 0.006, and *p* = 0.051). Further, the direct effects of gait self-efficacy and lower-extremity function on dual-task success ratio observed in the hypothesized model remained significant in the alternate model. Additionally, multiple goodness-of-fit indices were relatively worse in the model in which CRF was unrelated to success ratio (*χ*^2^(20) = 33.42, *p* = 0.03; RMSEA = 0.06 \[90% CI = 0.02/0.09\]; SRMR = 0.047; CFI = 0.980; AIC: 4857.88, adjusted BIC: 4861.46 versus hypothesized model: *χ*^2^(18) = 27.51, *p* = 0.07; RMSEA = 0.05 \[90% CI = 0.00/0.09\]; SRMR = 0.04; CFI = 0.986), indicating this meaningful covariate should be accounted for in addition to gait self-efficacy and lower-extremity function. Finally, while age was not predictive of lower-extremity function, it was associated with street-crossing performance in both conditions. Therefore, an alternate model assessing the direct path from age to street-crossing success was tested. Goodness-of-fit in the alternate model including age (AIC: 5962.03, adjusted BIC: 5966.56; *χ*^2^(22) = 27.09, *p* = 0.21; RMSEA = 0.03 \[90% CI = 0.00/0.07\]; SRMR=0.039; CFI = 0.99) was worse when compared with the hypothesized model. Age was associated with street-crossing success in both single- and dual-task trials (*β* = −0.018, *p* = 0.01; *β* = −0.18, *p* = 0.01, resp.). Despite this, all hypothesized effects reported above were observed independent of this direct effect of age. Although age may be a meaningful covariate of street-crossing performance, its contribution to behavioral differences among older adults sampled from this narrow age range was small and its inclusion compromised the parsimony of the model. Therefore, the hypothesized model was retained. 4. Discussion {#sec4} ============= This study is one of the first to explore relationships among self-efficacy, physical function, and older adults\' performance on a real-world, potentially risky everyday behavior---street-crossing while talking on a phone. Consistent with similar studies, crossing success was significantly lower in dual-task trials \[[@B23], [@B24]\]. Greater gait self-efficacy and lower-extremity physical function were predictive of greater street-crossing success, particularly in the dual-task condition. The indirect effect of self-efficacy on dual-task success provides further evidence that self-efficacy is an important behavioral determinant independent of physical function and fitness. These results extend previous models linking self-efficacy, physical function, and functional limitations in older adults and suggest more research in the context of complex, real-world tasks is needed. Although street-crossing performance declined with increased task complexity, higher levels of lower-extremity physical function and self-efficacy attenuated these declines. These results are consistent with previous work by Hausdorff and colleagues \[[@B21]\] in which slower usual gait speed and 8-foot Up-and-Go time among healthy older adults were associated with greater dual-task gait decrements. A large body of evidence supports the role of preserved physical function in mitigating perceived functional limitations and maintaining quality of life into older adulthood \[[@B5]--[@B9]\]. Findings of the present study, in the context of a real-world functional task, add to this evidence base and warrant more studies employing naturalistic simulations of activities of daily living. The prevalence of attention demanding technologies continues to grow rapidly, and previous research indicates that even high functioning older adults do not prioritize gait and function during dual-task situations \[[@B21]\]. As such, the consequences for older adults\' daily functioning, safety, and quality of life may be considerable. Behavioral and environmental interventions and supports that enhance functional performance represent priority health promotion strategies for older adults increasingly faced with a life space impinged by overlapping attentional stimuli. Our findings relative to self-efficacy further underscore the need for additional examination of trajectories of functional impairment in complex, real-world settings. Similar to previous studies on perceived functional limitations \[[@B6], [@B7], [@B12], [@B15]\], self-efficacy emerged as a predictor of task performance. The significant indirect effect follows the social cognitive framework which posits that individuals with greater personal efficacy related to skills (e.g., gait) are more likely to engage in activities that develop competencies such as physical function performance \[[@B13]\]. Although we expected to observe direct and indirect effects in both conditions, it is not surprising the effects were evident in the dual-task condition only. Self-efficacy theory hypothesizes its predictive power is most potent under more demanding conditions, a proposition that has been consistently corroborated across populations and behaviors \[[@B13], [@B36]\]. The total effect of self-efficacy in predicting street-crossing success, in addition to the reduced role of physical function on the indirect effect of self-efficacy in dual-task trials, also suggests efficacy expectations may represent a stronger determinant of an individual\'s ability to carry out complex activities of daily living when compared with physical function and fitness. Giannouli and colleagues \[[@B22]\] found that laboratory measures of gait and function were not strong predictors of older adults\' performance on real-world mobility tasks and argued that factors other than physical capacity (e.g., cognition, self-efficacy) play important roles in older adults\' real-life mobility. Evidence from the behavioral literature further suggests that self-efficacy\'s role in determining behaviors may be even stronger than that of actual ability \[[@B11], [@B13]--[@B15]\]. This is important, as individuals who perceive a task as overwhelming or threatening may be less likely to engage in the activity even if individual capacity does not prohibit participation \[[@B13], [@B22]\]. Unfortunately, these behavioral decisions may lead to reduced physical activity, impaired mobility, and loss of independence \[[@B3], [@B4]\], all key factors to successful aging. This has important implications for the design of behavioral and environmental interventions for older adults. While previous evidence indicates self-efficacy and physical function are important predictors of adults\' quality of life throughout the aging process \[[@B4], [@B6], [@B7]\], the results of the present study indicate self-efficacy and physical function are high priority health promotion strategies amidst progressively more complex life spaces for older adults. Physical activity interventions have successfully utilized
[ 77, 1519, 466, 64, 3140, 2402, 568, 36047, 15, 8456, 3, 4725, 187, 187, 1394, 476, 36219, 253, 1859, 1097, 970, 14784, 390, 2086, 33866, 313, 70, 15, 72, 15, 6753, 14, 1993, 13, 10280, 14, 5560, 13, 3966, 481, 187, 187, 510, 954, 1846, 1841, 309, 1089, 4266, 14707, 281, 1818, 275, 271, 16904, 403, 253, 9830, 15, 1422, 812, 897, 253, 7126, 418, 1519, 466, 19284, 3909, 8121, 281, 16030, 253, 8090, 285, 1818, 616, 9830, 15, 187, 187, 20806, 13, 1014, 342, 253, 8121, 13, 368, 1912, 626, 320, 2104, 281, 1818, 253, 6799, 3295, 15, 496, 841, 2219, 13, 368, 651, 878, 281, 13542, 4647, 247, 5806, 327, 20243, 27, 187, 187, 1208, 5806, 426, 19743, 6573, 9824, 313, 5856, 30616, 15, 788, 6573, 9, 8882, 4672, 13, 51, 15, 4897, 15, 7265, 6573, 19258, 1228, 821, 2234, 5455, 426, 10030, 5455, 1587, 424, 2807, 821, 15259, 426, 418, 1519, 466, 3902, 18229, 29, 6573, 9824, 8743, 10978, 10, 16904, 3145, 15, 1911, 3902, 18229, 9, 2364, 5455, 13, 418, 1519, 466, 8324, 15, 38505, 64, 44624, 13, 15259, 10, 187, 187, 1394, 476, 5206, 534, 1854, 281, 4647, 253, 5806, 327, 13, 390, 368, 812, 4647, 352, 281, 512, 11865, 275, 1083, 368, 816, 971, 253, 16904, 281, 452, 247, 2014, 3295, 15, 187, 187, 24004, 2920, 13, 846, 436, 2221, 14, 32600, 13035, 2282, 13, 368, 403, 13762, 326, 6240, 247, 2159, 285, 18612, 16904, 275, 634, 10469, 622, 310, 417, 326, 1892, 9418, 510, 1294, 21639, 457, 84, 23488, 41714, 562, 253, 2170, 323, 530, 938, 28, 380, 411, 505, 265, 15, 831, 310, 271, 2170, 875, 11442, 309, 394, 300, 1914, 13, 380, 16631, 13648, 1041, 13, 49508, 263, 17869, 13, 285, 253, 7335, 356, 21706, 15, 187, 187, 4509, 47580, 327, 253, 25278, 352, 3133, 2779, 326, 359, 588, 320, 8871, 43177, 13, 8374, 28082, 13, 31022, 13, 285, 12405, 275, 49508, 263, 17869, 347, 271, 823, 327, 281, 253, 5368, 43079, 985, 15, 11243, 5328, 2472, 32226, 588, 320, 5611, 8139, 187, 187, 510, 7335, 356, 21706, 310, 835, 1780, 356, 1575, 285, 521, 8544, 1160, 247, 1462, 1411, 253, 29894, 273, 353, 636, 263, 1309, 253, 15764, 273, 4922, 16554, 1078, 13590, 2584, 253, 24819, 398, 273, 253, 2745, 678, 15, 380, 1294, 21639, 457, 84, 23488, 1057, 417, 1421, 441, 281, 2868, 326, 627, 588, 320, 271, 4227, 323, 436, 28, 4931, 352, 588, 320, 629, 273, 253, 39688, 1386, 15, 187, 187, 1231, 476, 1902, 690, 10610, 10872, 313, 47530, 5363, 10, 326, 476, 671, 320, 14088, 264, 15, 2053, 403, 1146, 46156, 347, 7741, 42034, 790, 2708, 253, 24819, 398, 273, 253, 2745, 678, 313, 10355, 581, 2708, 1016, 15469, 481, 1737, 5300, 359, 588, 320, 23420, 4558, 281, 320, 2326, 15, 30445, 436, 310, 253, 1854, 359, 588, 320, 3192, 281, 380, 5418, 20952, 15, 187, 187, 10758, 359, 3986, 253, 5418, 20952, 352, 310, 12744, 604, 359, 588, 5517, 253, 6680, 13, 320, 994, 34455, 275, 352, 13, 390, 604, 436, 588, 320, 247, 1421, 598, 281, 253, 1594, 14, 27879, 275, 776, 9008, 281, 4901, 353, 636, 263, 15, 187, 187, 1672, 18799, 2069, 6386, 2195, 4672, 187, 187, 17803, 8465, 1128, 14, 187, 187, 2042, 368, 651, 751, 281, 1329, 619, 6031, 342, 399, 11282, 457, 84, 43358, 13935, 3262, 1487, 13, 390, 5046, 816, 4489, 479, 247, 10562, 13, 5532, 253, 31656, 6409, 2708, 42908, 7673, 327, 30517, 301, 14, 746, 187, 187, 24650, 38336, 18469, 27, 380, 24891, 22954, 812, 5241, 275, 5427, 407, 253, 4766, 273, 2552, 285, 13237, 268, 1715, 562, 846, 326, 13, 247, 26278, 5763, 407, 7717, 10701, 275, 11696, 342, 4156, 25021, 5882, 37319, 400, 15208, 13, 556, 8131, 15, 510, 2802, 27555, 22481, 5427, 6282, 7054, 10840, 457, 4453, 387, 1264, 1027, 15018, 285, 5936, 326, 5427, 812, 923, 253, 1180, 273, 24891, 2219, 14270, 6879, 13, 933, 1475, 2552, 3307, 15, 510, 2285, 4270, 1264, 3210, 281, 3283, 253, 10005, 273, 253, 24891, 15, 5815, 1566, 3400, 271, 6642, 273, 849, 253, 15742, 812, 46196, 762, 1027, 2515, 285, 3400, 16039, 327, 849, 253, 2208, 285, 1786, 11319, 476, 3794, 281, 253, 8891, 15, 510, 1304, 908, 1264, 3210, 27, 253, 7155, 1566, 13, 253, 673, 2962, 1566, 285, 253, 12017, 44043, 1889, 7334, 496, 5925, 4568, 3111, 313, 2354, 3027, 10, 1566, 15, 380, 7155, 1566, 4648, 13554, 275, 253, 5195, 273, 253, 2728, 275, 9972, 285, 253, 1982, 13, 285, 10384, 731, 4830, 5427, 281, 3283, 697, 18974, 15, 510, 673, 2962, 1566, 3936, 715, 8180, 941, 2439, 673, 9894, 275, 4135, 285, 3684, 9733, 13, 285, 5223, 84, 731, 281, 5427, 457, 84, 941, 15, 380, 6725, 3027, 1566, 310, 1754, 327, 271, 13418, 273, 21068, 2281, 273, 253, 6581, 13, 534, 310, 253, 3388, 1180, 273, 952, 1016, 2762, 1436, 12741, 84, 15, 20058, 13, 253, 1264, 3210, 2530, 2800, 20553, 323, 253, 15742, 285, 1918, 271, 14011, 273, 672, 352, 1537, 320, 4999, 281, 8488, 253, 5569, 3487, 380, 1304, 671, 8131, 767, 15216, 281, 921, 672, 253, 1083, 47966, 812, 2965, 281, 5058, 15, 380, 15216, 5467, 253, 5569, 3487, 310, 6508, 4457, 2552, 495, 285, 253, 21068, 2281, 273, 253, 6581, 310, 470, 15, 25, 13, 326, 310, 13, 1016, 9813, 1436, 35818, 253, 2728, 281, 470, 15, 25, 643, 952, 15, 496, 253, 806, 10076, 13, 604, 253, 5569, 3487, 310, 6508, 281, 2552, 1458, 13, 253, 1083, 47966, 588, 2965, 281, 5058, 407, 4397, 1458, 15, 496, 253, 1273, 10076, 13, 604, 253, 5569, 3487, 310, 6508, 281, 2552, 1884, 13, 2219, 588, 5926, 281, 5058, 407, 4260, 14, 18948, 15, 50, 27, 187, 187, 2347, 281, 1089, 835, 271, 3280, 6634, 1561, 247, 1618, 275, 15548, 32, 187, 187, 42, 1353, 3652, 247, 2969, 10913, 1342, 2165, 987, 1024, 13, 285, 309, 971, 281, 320, 2104, 281, 4271, 835, 275, 247, 1618, 247, 2608, 5476, 265, 247, 2173, 4857, 15, 1198, 1650, 13, 604, 253, 3159, 1618, 369, 544, 37, 13, 51, 13, 34, 13, 40, 13, 48, 13, 47, 62, 1969, 285, 253, 2608, 5476, 265, 329, 13, 309, 971, 281, 320, 2104, 281, 755, 247, 1091, 326, 651, 1333, 577, 1051, 2520, 310, 619, 4242, 2127, 594, 2080, 187, 2948, 3632, 187, 187, 3418, 64, 3550, 426, 14412, 433, 1383, 686, 29266, 1383, 686, 11300, 1383, 686, 35270, 1383, 686, 2606, 6038, 187, 19057, 64, 3550, 426, 8168, 187, 16191, 64, 3418, 426, 3632, 15, 22122, 9, 3418, 64, 3550, 10, 187, 29076, 426, 8472, 9, 16191, 64, 3418, 10, 187, 16191, 64, 3418, 64, 3550, 426, 1618, 9, 16191, 64, 3418, 10, 187, 13197, 64, 30758, 426, 11793, 187, 187, 3845, 2073, 3220, 3159, 556, 686, 559, 1213, 9, 29076, 10, 559, 686, 4857, 9, 84, 481, 3401, 187, 187, 3845, 9, 16191, 64, 3418, 64, 3550, 10, 187, 187, 1542, 891, 275, 4236, 64, 3418, 64, 3550, 27, 187, 50274, 19057, 64, 3550, 15, 9691, 2073, 64, 3401, 187, 187, 6050, 2165, 64, 30758, 27, 187, 50274, 3845, 9, 19057, 64, 3550, 10, 187, 50274, 4297, 405, 426, 3280, 2073, 1276, 4857, 513, 368, 971, 281, 5476, 32, 3401, 187, 50274, 338, 5476, 275, 4236, 64, 3418, 64, 3550, 27, 187, 50270, 3845, 2073, 29235, 5476, 2, 3401, 187, 50274, 7271, 27, 187, 50270, 3845, 2073, 47, 1714, 2, 3401, 187, 187, 34, 27, 187, 187, 1394, 476, 897, 253, 3605, 1159, 273, 50276, 66, 1618, 187, 70, 15, 72, 15, 209, 187, 17636, 3159, 64, 3550, 15, 4663, 2073, 11300, 3401, 187, 19, 187, 187, 1989, 604, 253, 5476, 310, 417, 275, 253, 1618, 13, 368, 588, 755, 247, 11740, 4756, 15, 1422, 878, 281, 6016, 436, 6517, 15, 535, 27, 8259, 3197, 27, 5343, 2819, 323, 4076, 1708, 1407, 85, 323, 3906, 25561, 1361, 2, 187, 187, 42, 1353, 3387, 434, 73, 15, 309, 3798, 8251, 2717, 13, 513, 417, 1557, 323, 253, 13624, 273, 2854, 4657, 1407, 85, 434, 390, 2133, 8689, 698, 15, 309, 1353, 2819, 323, 1633, 1708, 285, 4076, 326, 309, 476, 8251, 1475, 247, 2257, 273, 952, 1309, 253, 1388, 15, 18190, 326, 588, 417, 38134, 1977, 432, 619, 2133, 15, 309, 1849, 644, 2819, 285, 2819, 2391, 13070, 4496, 32, 187, 187, 42, 1353, 13864, 281, 4089, 19237, 25073, 375, 15, 309, 452, 326, 2, 309, 1620, 1869, 352, 651, 320, 247, 26710, 309, 812, 8251, 281, 789, 15, 23359, 387, 352, 13, 309, 1353, 417, 2119, 2139, 309, 1869, 326, 1051, 262, 19931, 2810, 15, 733, 943, 417, 4996, 2496, 327, 2571, 13, 5734, 597, 4901, 619, 5956, 8232, 15, 309, 751, 19237, 25073, 375, 4672, 11239, 368, 323, 5909, 619, 2927, 2391, 187, 187, 45, 1377, 485, 434, 3905, 657, 466, 1144, 31596, 2391, 262, 816, 2210, 562, 1390, 807, 285, 1959, 3530, 403, 4354, 574, 387, 353, 1974, 434, 15, 2596, 273, 619, 820, 14, 26719, 31394, 352, 5312, 13, 285, 352, 19931, 2810, 281, 253, 4808, 15, 1500, 556, 1077, 2619, 90, 9075, 285, 310, 1234, 7228, 264, 407, 11216, 5920, 83, 1972, 15, 92, 187, 50276, 3, 37336, 7912, 13408, 4312, 1381, 346, 15367, 11871, 110, 22044, 5225, 3, 187, 94, 18812, 3800, 466, 273, 35284, 187, 187, 510, 5893, 18794, 4428, 17268, 347, 8485, 13, 26015, 13, 285, 27541, 347, 667, 19827, 15, 39800, 11060, 863, 328, 1003, 281, 247, 1643, 4109, 1120, 451, 25045, 4483, 2534, 67, 19222, 1563, 253, 12899, 273, 253, 39800, 358, 46191, 281, 6351, 253, 9136, 273, 690, 273, 253, 954, 17874, 13, 6422, 5074, 1929, 281, 1966, 4466, 13, 533, 253, 1533, 6131, 594, 1199, 625, 15, 831, 8499, 4428, 247, 13365, 3081, 1931, 358, 4610, 323, 841, 25427, 29353, 281, 5206, 13, 342, 17268, 273, 1270, 8928, 13, 24762, 13, 390, 24957, 6349, 15, 187, 187, 688, 2159, 13, 604, 368, 956, 253, 12899, 273, 253, 39800, 358, 46191, 432, 253, 20929, 434, 42958, 13, 368, 452, 2289, 281, 253, 4610, 3559, 1060, 15, 1198, 247, 2715, 273, 436, 2600, 342, 3386, 10932, 407, 1268, 13, 5532, 1060, 15, 187, 187, 30377, 13645, 39800, 358, 14559, 15, 3900, 368, 1472, 48825, 13, 667, 608, 14, 8938, 2317, 273, 2834, 25061, 326, 368, 4901, 2636, 1169, 281, 2489, 2834, 25061, 323, 667, 15906, 326, 11999, 949, 352, 846, 326, 1127, 15, 831, 1055, 6634, 1014, 604, 253, 2834, 25061, 310, 3562, 407, 10721, 15, 380, 5968, 273, 253, 31865, 12330, 949, 50082, 5200, 273, 28164, 285, 7692, 934, 15, 1284, 808, 273, 253, 35887, 15, 1422, 452, 11820, 641, 1215, 275, 247, 884, 14, 8938, 9941, 1475, 4834, 15, 1422, 476, 3282, 253, 2087, 4328, 273, 24511, 4723, 18445, 13, 48833, 13, 33387, 13, 285, 3600, 18639, 17268, 1561, 247, 1180, 273, 6574, 4503, 281, 634, 10350, 34301, 313, 35674, 337, 481, 39800, 11060, 5706, 328, 1003, 15, 2091, 247, 15906, 11521, 21291, 1561, 608, 4669, 273, 368, 1223, 368, 1472, 48825, 13, 368, 476, 897, 634, 4884, 281, 1056, 247, 2714, 440, 21201, 9974, 407, 11044, 14650, 327, 326, 15906, 15, 1422, 403, 1801, 17952, 275, 436, 2983, 13, 534, 13330, 4723, 4503, 281, 374, 69, 25, 559, 634, 659, 27410, 34301, 275, 787, 15414, 12777, 4723, 15, 187, 187, 29969, 39800, 358, 14559, 15, 3900, 48825, 13, 368, 476, 2118, 598, 281, 608, 4669, 275, 667, 3884, 672, 247, 15906, 38771, 368, 342, 247, 479, 14906, 2983, 15, 831, 4866, 1057, 417, 46554, 8104, 273, 5107, 15, 380, 5968, 273, 253, 30013, 2789, 368, 19779, 285, 612, 10563, 15, 1284, 808, 273, 253, 35887, 15, 1422, 452, 5750, 327, 12255, 285, 26866, 1411, 2853, 16723, 13, 285, 6351, 1801, 24485, 275, 6995, 429, 15, 380, 24866, 90, 30013, 6057, 672, 352, 310, 1146, 11213, 264, 15, 39800, 11060, 5706, 328, 1003, 15, 3900, 368, 403, 48825, 13, 672, 368, 1056, 247, 3976, 46984, 2451, 390, 13868, 4710, 13, 368, 476, 8171, 253, 1180, 368, 4533, 342, 634, 38615, 757, 1268, 15, 187, 187, 40, 263, 6077, 39800, 358, 14559, 15, 2091, 368, 1891, 271, 3745, 2451, 390, 13868, 4710, 1223, 48825, 13, 368, 476, 897, 634, 4884, 281, 6351, 247, 17301, 281, 253, 4533, 4503, 281, 253, 1180, 273, 38952, 17268, 1561, 884, 4669, 273, 368, 15, 831, 17301, 2550, 8268, 634, 10350, 34301, 313, 35674 ]
lottie_fileName="animation.json" /> You can customize the view both using XML or programmatically (e.g. auto-play, repeat-count, etc). The most common things I find myself wanting to change in an animation are the colors. You could use the excellent LottieFiles online editor to inspect the layers and change their colors. Sometimes, even with the editor, you won't be able to change the desired color. In these cases, you would need to manually apply a filter on runtime: val filter = SimpleColorFilter (ContextCompat.getColor(context!!,R.color.mainColorLight)) val keyPath = KeyPath("**") val callback = LottieValueCallback<ColorFilter>(filter) animationView.addValueCallback(keyPath, LottieProperty.COLOR_FILTER, callback) You can choose which path to apply the filter on, or you could apply it to all paths in case you just want the animation to have a single color. Hopefully, after this super-quick crash course, you are convinced that adding a short and fancy animation in your Android app is not that hard :)The Producer’s Letter lays out the area for U20; The Wastes. This is an area between Northern Ithilien, The Dead Marshes, Dagorlad, and the Slag Hills. From chatter on the forums it seems likely that we will be picking moss, lichens, mushrooms, and flowers in Dagorlad as an add on to the existing flora system. Perhaps gold earrings will be introduced … The Slag Hills is where Aragorn and his army made a stand against the armies of Mordor during the Battle of Morannon before heading toward the Towers of the Teeth. The Producer’s Letter does not lead us to believe that there will be an instance for this; perhaps it will be part of the Epic line. We can expect some classic instances (fellowship) that can also be soloed. These are being hailed as resource dungeons below the Towers of the Teeth (likely one below each tower). What resources we will be farming remains to be seen. Certainly this is the path we will be taking to The Black Gate. Once we reach the Black Gate it is unclear if we will witness the battle, be entrenched in it, or if this will be a lead up to the X-Pac in our preparation to enter Mordor. Exciting times ahead !!! ———————- If you would like to support my efforts with Dadi’s LOTRO Guides, or maybe just buy me a beer, click the donate button below 🙂More on Covid-19 NEW DELHI: The coronavirus epidemic could peak in India by the middle of May and gradually peter out after that, a modelling exercise by Times Network in partnership with global consulting firm Protiviti, has predicted.The ‘Times Fact India Outbreak Report’ looks at three different possibilities and suggests that India could see the number of coronavirus cases crossing 75,000 around May 22.The team built three models to predict the progression of the coronavirus. Each model provides an estimate of how the outbreak could unfold under different conditions and provides insights on how the government and health infrastructure can respond to the crisis.The report used three models: the percentage model, the time series model and the Susceptible Exposed Infected Recovered (SEIR) model. The percentage model uses trends in the spread of the disease in Italy and the US, and applies them onto India to predict its trajectory.The time series model takes into consideration data across time periods in China and South Korea, and adapts them to India’s data. The SEIR model is based on an estimation of reproduction rate of the virus, which is the average number of people each positive person infects. Together, the three models provided six projections for the outbreak and give an indication of when it might be safe to lift the lockdown The report also predicted two scenarios to show when the case tally could fall to zero. The scenarios assume the lockdown is extended beyond May 3 and the reproduction rate of the virus is 0.8, that is, each infected person spreads the disease to 0.8 other people. In the first scenario, if the lockdown is extended to May 15, the case tally will fall to zero by September 15. In the second scenario, if the lockdown is extended to May 30, cases will drop to zero by mid-June.Q: How to find where an input occurs within a list in python? I'm building a simple hangman game right now, and I want to be able to identify where in a list a user guesses a specific letter. For example, if the word list was [D,R,A,G,O,N] -- and the user guesses A, I want to be able to get a return that would say 4...this is my failed code so far import random word_list = ['red', 'better', 'white', 'orange', 'time'] hidden_list = [] selected_word = random.choice(word_list) letters = len(selected_word) selected_word_list = list(selected_word) game_playing = True print('My word has ' + str(letters) + ' letter(s).') print(selected_word_list) for i in selected_word_list: hidden_list.append('_') while game_playing: print(hidden_list) guess = input('What letter do you want to guess?') if guess in selected_word_list: print('Nice guess!') else: print('Nope!') A: You can use the index function of a list e.g. >>> word_list.index('white') 2 But if the guess is not in the list, you will get a ValueError. You need to handle this exception. :confused: female looking for clean light edt for office???? help! I'm 40'sh. I usually wear nothing, do not care for the smell of drug store edt's or body sprays. I'm looking for something light and clean that I can wear around a lot of people during the day. Something that will not stray away from my body. I've been looking and looking....help please? I'm pleased to hear Philosykos. I have that! I never thought it would be a scent I could wear to work. Looking at it, I'm not sure why I thought that...it stays close. It should not intrude on others, unless they enter my comfort zone. I like Philosykos!! Thank you for opening my eyes.... Lancome's La Vie est Belle....it just came out last year and free samples are easily had at Macy's. One of my co-workers wears it daily, and it stays close to the skin. She has very picky taste and is repulsed by loud fragrances.{ "navigationBarTitleText": "我买到的" }Menagerie of Might The animal kingdom contains creatures as vast, exotic, and bizarre as any monster. Totemic attunement to a few terrestial mammals allows barbarians following the Path of the Totem Warrior to gain the powers of some of the most noble, powerful animals known to human culture, but the world offers so much more. This supplement contains a dozen additional totem options for these mighty warriors to choose, with creatures of great cultural, symbolic, or ecological importance. In short, if you follow the Path of the Totem Warrior from the Player's Handbook, you have access to the options presented here. For a version of this content with features organized by level, click here. Elephant Totem Spirit. While you're raging, any 5-foot space of difficult terrain that you enter ceases to become difficult terrain for any creature that passes through it after that point. This effect occurs even if the difficult terrain is created by magic. The spirit of the elephant tears through snarls of vegetation and rubble. Aspect of the Beast. You have tremorsense in a 10-foot radius around yourself. You can sense the general location of thunder damage dealt, earthquakes, storms, and burrowing creatures within a number of miles equal to your Constitution modifier (minimum 1). Totemic Attunement. When a creature falls prone within 5 feet of you while you're raging, you can use your reaction to make a special unarmed strike by stomping on that creature. You are proficient in this attack, which deals damage equal to 2d8 + your Strength modifier in bludgeoning damage. Fox Totem Spirit. While raging, you can move up to 5 feet in any direction when a creature misses you with a melee attack. This movement does not provoke attacks of opportunity. The spirit of the fox makes you swift and evasive. Aspect of the Beast. You have advantage on checks and saves against illusions, and gain proficiency in Insight. The tricksy fox knows when it is being fooled. Totemic Attunement. While you are raging, when you make a Charisma check or saving throw, you can replace the number you roll with your barbarian level. Gorilla Totem Spirit. When you fail an ability check or saving throw while raging, you can use your reaction to gain a bonus to the roll equal to the number of allied creatures within 10 feet of you. This bonus cannot exceed your Constitution modifier (minimum
[ 84, 1337, 2059, 61, 3181, 61, 3115, 4010, 45, 64, 52, 9, 84, 1337, 2059, 1126, 3023, 889, 3181, 61, 3115, 10, 45, 63, 52, 9, 84, 1337, 2059, 61, 3181, 61, 3115, 1009, 835, 370, 45, 64, 52, 5, 12853, 253, 6486, 1885, 273, 1980, 370, 45, 2911, 41586, 689, 669, 3023, 61, 249, 322, 1366, 285, 370, 45, 63, 52, 9, 84, 1337, 2059, 61, 3181, 61, 3115, 1009, 310, 253, 7898, 370, 45, 2911, 3701, 534, 476, 320, 4441, 275, 253, 3638, 1307, 273, 247, 7470, 32133, 6339, 2962, 313, 9088, 310, 271, 15424, 1327, 14, 36020, 4764, 1060, 672, 370, 78, 61, 8275, 19, 4615, 9, 21, 4244, 923, 3015, 575, 1447, 328, 83, 418, 3470, 8001, 831, 1127, 310, 1774, 323, 253, 4685, 273, 776, 4327, 273, 10985, 323, 669, 4820, 92, 5990, 2000, 76, 1352, 496, 253, 4872, 4758, 13, 253, 18232, 6056, 1253, 2809, 1240, 13535, 1332, 476, 320, 908, 281, 1263, 436, 7898, 370, 45, 2911, 3701, 407, 5001, 370, 40, 61, 3181, 61, 4820, 92, 5990, 2000, 76, 5, 347, 247, 2629, 35925, 14632, 273, 669, 4820, 92, 6104, 2026, 19, 9, 79, 12, 76, 28185, 831, 1332, 369, 6508, 281, 253, 2087, 966, 273, 10985, 2390, 273, 15341, 77, 26630, 285, 6304, 40214, 1008, 8561, 62, 275, 247, 3332, 789, 273, 443, 8500, 1008, 40, 8500, 7798, 1092, 285, 6296, 275, 436, 1083, 253, 1263, 273, 18935, 370, 45, 2911, 20619, 323, 370, 40, 4932, 78, 10392, 1364, 6388, 253, 10985, 669, 6796, 464, 4820, 92, 5990, 5000, 76, 5, 347, 2931, 407, 12400, 15, 496, 436, 3282, 6899, 575, 1447, 33921, 27, 11984, 2101, 418, 1159, 696, 1275, 1100, 253, 1543, 581, 31326, 3066, 253, 1332, 273, 253, 3638, 1307, 13, 534, 1057, 417, 2085, 247, 4156, 5164, 5150, 313, 9154, 275, 253, 4872, 1083, 481, 187, 187, 2809, 303, 5650, 1008, 2809, 303, 5650, 22700, 62, 369, 581, 273, 253, 22223, 398, 275, 253, 1263, 273, 10985, 2390, 275, 253, 8946, 4758, 15, 754, 5421, 23178, 4948, 273, 2716, 14, 49112, 2801, 285, 369, 2104, 281, 4711, 247, 8488, 273, 23178, 4948, 273, 2801, 370, 76, 16, 19, 1366, 835, 370, 76, 61, 5090, 20, 5, 310, 271, 8909, 7007, 13, 281, 23178, 4948, 273, 2801, 370, 76, 14, 18, 1352, 3032, 906, 369, 2797, 3066, 253, 5019, 273, 271, 9909, 6779, 2087, 3006, 25299, 249, 1008, 34337, 249, 42093, 1092, 285, 253, 1716, 3025, 6899, 273, 844, 300, 1008, 1231, 300, 26369, 1570, 2596, 273, 253, 42852, 323, 253, 2440, 273, 253, 14923, 35373, 1332, 323, 4872, 2390, 1008, 34949, 44, 19, 28, 1214, 7386, 44, 62, 369, 281, 4044, 247, 27259, 451, 8488, 13, 285, 6296, 436, 369, 253, 2022, 2898, 273, 1008, 7386, 44, 1092, 247, 8488, 432, 313, 33455, 10, 8946, 2390, 281, 253, 4569, 2087, 4872, 2390, 13, 970, 253, 1716, 3025, 6899, 273, 330, 462, 69, 437, 285, 367, 5946, 1507, 5985, 14, 2809, 37557, 2479, 36, 3299, 20, 28, 1214, 36, 3299, 9595, 2498, 2091, 359, 10358, 253, 1543, 273, 436, 789, 323, 370, 40, 4932, 19, 29119, 891, 15, 70, 904, 370, 78, 30, 19, 1366, 715, 253, 7792, 273, 1008, 7386, 44, 1092, 359, 4044, 247, 2074, 8488, 15, 187, 187, 1466, 669, 2059, 5, 320, 247, 13241, 313, 343, 21456, 10, 260, 316, 4239, 267, 6779, 273, 370, 40, 4932, 19, 29591, 34, 4244, 285, 669, 10314, 5, 320, 271, 22816, 3772, 41050, 6779, 273, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 34, 3822, 844, 1333, 326, 669, 10314, 5, 310, 247, 41675, 5650, 8488, 273, 669, 2059, 5, 604, 323, 2761, 512, 6486, 5053, 669, 3023, 5, 835, 669, 2059, 1126, 3023, 724, 310, 440, 3358, 1245, 13, 669, 10314, 1126, 3023, 724, 310, 253, 1980, 27259, 451, 8488, 273, 669, 2059, 1126, 3023, 724, 1677, 407, 253, 11191, 640, 20169, 2479, 20794, 640, 3571, 28, 1214, 11773, 47, 312, 4595, 3291, 342, 1675, 281, 669, 4144, 1126, 3023, 724, 285, 253, 21496, 669, 4820, 92, 6104, 2026, 19, 79, 3713, 36, 10, 11380, 4820, 92, 5990, 2026, 19, 79, 3713, 36, 1009, 313, 2887, 3015, 575, 1447, 328, 83, 418, 3470, 696, 323, 4278, 582, 285, 387, 253, 2570, 5053, 669, 10314, 1126, 3023, 724, 310, 253, 8488, 281, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 36, 1009, 273, 253, 6779, 669, 3124, 1126, 4144, 1126, 3023, 12523, 2059, 1126, 3023, 6580, 7660, 281, 669, 2059, 1126, 3023, 724, 407, 253, 39116, 17668, 2479, 2347, 70, 14643, 28, 1214, 3837, 1317, 7912, 10352, 348, 12731, 2498, 831, 5426, 8725, 281, 667, 370, 78, 61, 5090, 18, 1366, 533, 323, 8909, 370, 78, 5, 253, 8488, 310, 281, 669, 4820, 92, 5990, 2026, 19, 79, 12, 18, 3713, 34, 4244, 253, 21496, 310, 273, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 3713, 36, 1009, 275, 669, 4820, 92, 5990, 2026, 19, 79, 12, 18, 3713, 36, 4244, 285, 387, 253, 4222, 303, 13616, 266, 5053, 581, 3936, 253, 2629, 8488, 313, 2887, 13441, 187, 187, 6693, 13241, 260, 316, 4239, 267, 6779, 669, 2059, 5, 273, 370, 40, 4932, 19, 29591, 34, 1009, 556, 247, 41675, 5650, 8488, 669, 10314, 5, 281, 669, 4820, 92, 5990, 2026, 19, 79, 3713, 34, 3822, 187, 187, 6067, 4737, 4428, 247, 8037, 27, 6899, 575, 1447, 33921, 27, 46, 962, 254, 5290, 281, 320, 4581, 275, 247, 31196, 823, 423, 360, 281, 436, 789, 313, 255, 667, 2281, 253, 906, 3139, 369, 8058, 275, 1008, 40, 266, 39980, 2610, 7798, 1092, 923, 2708, 481, 1198, 253, 34002, 273, 253, 8488, 323, 21349, 12314, 14237, 923, 24297, 575, 1447, 5528, 17405, 27, 3129, 24595, 27259, 451, 8488, 4207, 2726, 841, 1543, 581, 476, 1263, 253, 1980, 18232, 6056, 19704, 980, 10939, 273, 253, 10711, 7212, 285, 697, 31341, 47091, 313, 2887, 2708, 481, 187, 187, 1909, 5393, 1840, 13, 323, 370, 78, 30, 19, 5, 390, 370, 76, 30, 18, 5, 776, 1543, 403, 49795, 15, 496, 253, 2087, 1083, 597, 3469, 327, 2067, 13260, 13, 690, 273, 534, 497, 2168, 1246, 275, 1008, 1405, 805, 62, 313, 1542, 253, 1980, 7794, 1060, 13, 10046, 13260, 403, 3058, 481, 2053, 403, 7000, 275, 3015, 575, 1447, 783, 6779, 391, 1689, 2582, 68, 9, 3115, 31148, 285, 9093, 22149, 1066, 281, 253, 6242, 273, 247, 41675, 5650, 1511, 17668, 323, 3835, 723, 273, 2087, 4872, 2390, 15, 313, 8497, 326, 1014, 253, 2605, 273, 6278, 14, 13897, 494, 14237, 273, 10985, 2390, 273, 669, 4820, 92, 5990, 2000, 76, 5, 310, 387, 1246, 7202, 2698, 3308, 253, 17697, 629, 273, 436, 789, 476, 320, 12258, 347, 247, 5141, 273, 253, 1263, 273, 1980, 2616, 432, 370, 40, 4932, 78, 10392, 281, 669, 6796, 464, 4820, 92, 5990, 5000, 77, 1352, 187, 187, 1992, 253, 1682, 273, 776, 3640, 13, 436, 310, 253, 806, 3177, 281, 1263, 1980, 2616, 689, 667, 10985, 1387, 3345, 253, 1387, 370, 40, 4932, 19, 10392, 313, 2858, 370, 40, 4932, 19, 10392, 310, 247, 2714, 1083, 13, 923, 2708, 582, 347, 973, 347, 253, 806, 5140, 273, 3426, 370, 45, 2911, 20619, 13, 1014, 342, 370, 76, 30, 18, 1352, 187, 187, 510, 9376, 669, 1906, 578, 19, 78, 889, 6040, 401, 49538, 534, 310, 10046, 685, 253, 1617, 669, 1906, 64, 78, 61, 6040, 401, 18636, 3058, 323, 253, 6242, 273, 370, 40, 4932, 78, 29119, 310, 3058, 984, 359, 897, 313, 1568, 285, 275, 1008, 1405, 805, 3291, 1543, 432, 1008, 10172, 39, 7330, 28, 1214, 11773, 47, 312, 4595, 19, 28, 1214, 40, 8500, 22, 28, 1214, 40, 8500, 21, 1092, 835, 352, 369, 8025, 15, 831, 9376, 10260, 8077, 7790, 253, 23276, 285, 11355, 253, 7977, 285, 10096, 327, 690, 7681, 4278, 15, 187, 187, 510, 1263, 273, 10985, 2390, 275, 253, 3634, 273, 3772, 41050, 4948, 285, 1980, 6779, 3762, 369, 15247, 407, 844, 300, 1008, 1231, 28, 1214, 1231, 300, 19, 1092, 665, 5421, 253, 27957, 6779, 273, 370, 40, 4932, 19, 29119, 1024, 671, 1929, 347, 253, 844, 300, 6779, 15, 831, 6779, 285, 697, 2087, 5904, 403, 2905, 281, 7418, 3237, 13, 299, 15, 72, 904, 253, 39116, 17668, 285, 253, 44806, 1253, 40, 1350, 1253, 6140, 284, 324, 24366, 2479, 56, 8950, 1033, 44250, 16134, 28, 1214, 2347, 70, 14643, 28, 1214, 56, 8950, 1033, 44250, 14643, 28, 1214, 41, 14007, 28, 1214, 49, 69, 19, 28, 1214, 44, 438, 4123, 51, 455, 261, 9204, 28, 1214, 56, 10339, 28, 1214, 40, 266, 39980, 2610, 6961, 28, 1214, 40, 266, 39980, 2610, 7798, 6660, 285, 556, 644, 23033, 275, 643, 3672, 347, 973, 313, 70, 15, 72, 904, 1008, 23083, 267, 36122, 28, 1214, 2347, 70, 16134, 2498, 187, 187, 2422, 284, 13, 275, 253, 3634, 273, 10985, 2390, 370, 40, 4932, 19, 10392, 310, 3164, 271, 6517, 15, 1284, 247, 2022, 1650, 13, 22816, 14237, 273, 436, 1387, 513, 11476, 387, 954, 581, 1536, 770, 4584, 1566, 2479, 56, 8950, 1033, 44250, 16134, 28, 1214, 16380, 43, 28, 1214, 46840, 81, 579, 348, 8602, 6660, 285, 6296, 253, 3762, 273, 1980, 10303, 369, 6508, 281, 436, 1083, 407, 28918, 81, 579, 348, 2479, 37, 6451, 28, 1214, 37, 6451, 19, 2498, 41675, 5650, 1511, 28676, 285, 1980, 2616, 323, 12314, 14237, 273, 370, 40, 4932, 19, 7398, 3181, 61, 6796, 464, 4820, 92, 5990, 5000, 76, 5, 497, 8818, 275, 1008, 6217, 52, 21, 28, 1214, 1405, 23, 1092, 285, 923, 671, 1008, 6217, 52, 18, 28, 1214, 6217, 52, 740, 28, 1214, 6217, 52, 22, 28, 1214, 6217, 52, 25, 28, 1214, 40, 43, 6453, 1570, 380, 35373, 1332, 273, 1008, 3299, 51, 62, 369, 6508, 281, 370, 40, 4932, 19, 10392, 407, 44806, 1008, 40, 266, 1092, 533, 760, 323, 253, 5958, 14595, 18, 5, 44676, 4816, 76, 30, 18, 14553, 1292, 954, 15538, 253, 6779, 11813, 273, 370, 40, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 724, 403, 2905, 3066, 253, 39116, 17668, 2479, 2347, 70, 14643, 1092, 923, 671, 1008, 40, 266, 6759, 62, 285, 253, 10414, 15308, 481, 187, 187, 688, 253, 8946, 4758, 13, 1608, 565, 6451, 1008, 2809, 565, 6451, 20778, 62, 908, 39116, 2962, 281, 9093, 3989, 253, 773, 46429, 3711, 3, 273, 253, 8488, 273, 41675, 5650, 13, 285, 15753, 8754, 1008, 24534, 8754, 20778, 62, 369, 2104, 281, 1414, 9038, 253, 8488, 273, 41675, 5650, 13, 969, 970, 39116, 2962, 15, 48690, 1033, 44250, 1008, 56, 8950, 1033, 44250, 16134, 28, 1214, 56, 8950, 1033, 44250, 18263, 28, 1214, 56, 8950, 1033, 44250, 14643, 28, 1214, 56, 8950, 1033, 44250, 14209, 62, 908, 253, 39116, 17668, 281, 4044, 1980, 285, 4156, 2723, 2979, 875, 14237, 273, 669, 4820, 92, 7084, 2000, 19, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2000, 20, 1352, 187, 187, 510, 1327, 14, 1116, 303, 13616, 266, 285, 4156, 1543, 273, 48690, 1033, 44250, 497, 14923, 760, 4102, 27, 380, 1980, 1327, 14, 1116, 303, 13616, 266, 41675, 5650, 17668, 875, 370, 40, 4932, 19, 10392, 285, 669, 4820, 92, 8683, 2026, 19, 79, 12, 18, 724, 407, 44806, 285, 12933, 249, 1008, 56, 10339, 62, 285, 253, 27259, 451, 414, 1543, 407, 44806, 285, 32185, 2610, 1008, 40, 266, 39980, 2610, 7798, 62, 313, 1542, 253, 4222, 303, 13616, 266, 1083, 923, 1008, 3837, 1317, 7912, 10352, 348, 12731, 28, 1214, 3837, 1317, 7912, 10352, 348, 11496, 28, 1214, 3837, 1317, 11496, 28, 1214, 29099, 472, 9595, 2498, 496, 1008, 40, 266, 39980, 2610, 7798, 62, 253, 4477, 6508, 253, 8488, 273, 41675, 5650, 1008, 2809, 303, 5650, 22700, 62, 432, 669, 4820, 92, 7084, 2000, 19, 4932, 19, 29591, 34, 1009, 281, 370, 40, 4932, 19, 29591, 34, 4244, 285, 2529, 253, 12314, 629, 273, 253, 3772, 41050, 13358, 6637, 273, 370, 40, 4932, 19, 29591, 34, 4244, 970, 253, 39116, 8488, 273, 8182, 1008, 43, 7084, 74, 12430, 62, 281, 669, 4820, 92, 8683, 2026, 19, 77, 12, 18, 3713, 34, 1009, 323, 370, 77, 61, 1266, 295, 5, 313, 4609, 310, 1929, 281, 320, 28078, 10, 285, 253, 789, 273, 15948, 1008, 34021, 6622, 62, 327, 253, 32709, 9162, 323, 669, 4820, 92, 8683, 2026, 19, 77, 12, 18, 724, 313, 2887, 671, 1008, 46, 536, 6620 ]
s,\pi\times\tau)=L_S(s,\pi_{\nu}\times\tau)L^S(s,\pi\times\tau)$ where $L_S$ denotes the finite product of local $L$-factors over $\nu\in S$, and $L^S(s,\pi\times\tau)$ is the partial $L$-function which can be located in the constant term of a suitable Eisenstein series (there is an implicit non-canonical parameter here when $m\equiv2\,(4)$, see § \[unr L functions\]). This point is important for the understanding of our choice of covering for $\operatorname{GL}_k$. In the linear setting, the Langlands–Shahidi method can be used to study this partial $L$-function by regarding $G\times\operatorname{GL}_k$ as a standard Levi subgroup of $\operatorname{Sp}_{2(n+k)}$. This method was extended to the general class of covering groups of Brylinski and Deligne [@BD] in a recent work of Gao [@Gao2018], and indeed in this case the study of twisted $L$-functions for $G^{(m)}$ must involve the covering $\widetilde{\operatorname{GL}}_k$ as defined by restriction. In this sense Theorem \[theorem:complete Sp L function\] refines the results one obtains via the method of the constant term, which does not provide a global functional equation (even in the linear case). Shimura [@Shimura1973] was one of the pioneers in the study of covering groups in the classical setting. He studied modular forms of half-integral weight and was able to produce a lift of modular forms of weight $k/2$, where $k\geq3$ is an odd integer, to modular forms of weight $k-1$. His result was obtained via the combination of an integral representation generalizing Rankin [@Rankin1939], and the Converse Theorem of Weil [@Weil1967]. One of the motivations for the development of the generalized doubling method for linear groups [@CFGK2; @CFK] was to obtain a functorial lift, and indeed this was the main application of [@CFK], a lift from (certain) classical groups to the appropriate general linear groups, using the Converse Theorem of Cogdell and Piatetski-Shapiro ([@CPS3; @CPS1999]). When we plug the results of this work for $G^{(2)}$, i.e., $m=2$, into the framework of [@CFK], we obtain a similar lift. Let $\pi$ be a genuine (irreducible) cuspidal representation of $G^{(2)}(\A)$, and $\Pi$ be an irreducible automorphic representation of $\operatorname{GL}_{2n}(\A)$. We say that $\Pi$ is a Shimura lift of $\pi$ if for almost all finite places $\nu$ where $\pi_{\nu}$ is unramified, $\Pi_{\nu}$ is the local functorial lift of $\pi_{\nu}$ given by the Satake isomorphism ([@Satake63; @McNamara]) with respect to $\psi_{\nu}$ and the embedding $\operatorname{Sp}_{2n}(\C)<\operatorname{GL}_{2n}(\C)$ (see § \[unr L functions\] for details), and at the complex places $\Pi_{\nu}$ is the lift to $\operatorname{GL}_{2n}(\C)$ of the representation $\theta_{\psi_{\nu}}(\pi_{\nu})$ attached to $\pi_{\nu}$ by the theta correspondence ([@Howe1989; @AdamsBarbasch1995]). This definition extends to any $m\geq1$, but for odd $m$ the lift is to $\operatorname{GL}_{2n+1}(\A)$, the embedding is of $\operatorname{SO}_{2n+1}(\C)$ in $\operatorname{GL}_{2n+1}(\C)$, and at the archimedean places one takes the standard lift (see ). Any genuine cuspidal representation $\pi$ of $G^{(2)}(\A)$ has a Shimura lift $\Pi$ to $\operatorname{GL}_{2n}(\A)$. Our proof contains a gap: Theorem \[theorem:Muller\], to be closed in a forthcoming addendum to this work (at any rate the result itself was proved in [@GanIchino2018], see below). For the uniqueness of the lift for globally generic representations see Corollary \[corollary:globl functorial lift\]. With these results one can study the local Langlands conjectures independently of the trace formula and its prerequisites (see below). As mentioned above, for $m=2$ or $k=1$ our results are unconditional. In the general case they depend on several assumptions, some of which were already present in [@me12] (for the local aspects here, stronger assumptions are needed). These are detailed in § \[the representation rho\_c(tau)\] and essentially boil down to the existence of a Shimura type correspondence for coverings of general linear groups. (Note that even the structure of square-integrable representations of covering groups of $\operatorname{GL}_k$ is at present unknown.) Thus the conditional part of this work can be regarded as a reduction of the study of local factors from $G^{(m)}$ to $\widetilde{\operatorname{GL}}_l$. To the best of our knowledge, this is the first attempt to study local factors over any covering group outside the group $G^{(2)}$ (but $G^{(2)}$ is a special case, see below), as well as the first construction of complete $L$-functions, even with $k=1$. The assumption $\mu_{2m}\subset F^*$, which is stronger than the condition $\mu_m\subset F^*$ needed for the existence of $G^{(m)}$, is needed because we use (here and in [@me12]) results from [@BBF2011; @McNamara2; @Gao5; @Gao4], where it was assumed. This assumption greatly simplifies the formulas and reduces the burden and dependence on some technical details. The study of covering groups in the context of automorphic forms and local representation theory was initiated by Weil [@We; @Weil2], who studied the oscillator representation of $G^{(2)}$, now also known as the Weil representation. This representation and its generalizations are related to numerous problems, e.g., the theta correspondence and the Gan–Gross–Prasad conjecture ([@Waldspurger1980; @Howe1989; @Waldspurger1989; @HKS; @Pd2; @KudlaRallis2005; @WGS; @GanIchino2016; @GanIchino2018]), and has been instrumental in other areas as well (e.g., [@Segal1959; @Howe1980]). Alas, in the context of covering groups $G^{(2)}$ is probably an exception. As a main example, irreducible representations of this group do admit at most one Whittaker model ([@Waldspurger1980; @BFJ; @Szpruch2007]), and indeed the theory of local coefficients was extended to this case by Szpruch ([@Dani; @Dani2]). Shimura type integrals and local factors for generic representations of $G^{(2)}\times\widetilde{\operatorname{GL}}_k$ were constructed in [@GRS4; @me6], and see also [@GRS1; @GRS10; @GRS5; @GRS8; @GJRS]. The doubling method of [@PSR] was extended to $G^{(2)}$ by Gan [@Gan], but only for the rank-$1$ twists ($k=1$). But most importantly the representation theories of $G^{(2)}$ and $\operatorname{SO}_{2n+1}$ are related via the theta correspondence ([@Howe1989], see also [@Gan2014] and the references therein). In the classical setting, Shintani [@Shintani1975] used theta series to essentially construct the “inverse map" of the lift of Shimura, and Niwa [@Niwa1975] was able to explicate the lift of Shimura, again using theta series. Waldspurger [@Waldspurger1980; @Waldspurger1981; @Waldspurger1989; @Waldspurger1991] used the theta correspondence to obtain local and global correspondences between representations of $\operatorname{SL}_2^{(2)}$ and $\operatorname{SO}_3$. The non-archimedean and global results of Waldspurger were generalized only recently: The local non-archimedean Shimura correspondence between $G^{(2)}$ and $\operatorname{SO}_{2n+1}$ by Gan and Savin [@WGS] and the functoriality results by Gan and Ichino [@GanIchino2018] (for the archimedean case see [@AdamsBarbasch1995; @AdamsBarbasch1998; @Adams1998; @Renard1999]). In [@GanIchino2018] the authors extended the lift of Shimura [@Shimura1973] from $\operatorname{SL}_2^{(2)}(\A)$ to $G^{(2)}(\A)$, and described the generic part of the automorphic discrete spectrum of $G^{(2)}(\A)$, using the theta lift of Li [@JSLi1997] to $\operatorname{SO}_{2l+1}(\A)$ for $l\gg n$ (which is known to be nonzero) and the work of Arthur [@Arthur2013] on the endoscopic classification for $\operatorname{SO}_{2l+1}$ (see also [@Mok2015
[ 921, 598, 281, 789, 533, 7960, 5262, 521, 673, 4361, 11727, 1905, 7552, 271, 6485, 327, 2101, 2610, 4019, 13, 2556, 281, 2305, 26424, 1905, 534, 651, 1056, 779, 816, 1529, 1083, 273, 45957, 552, 21853, 17927, 14, 282, 23479, 15, 187, 187, 1989, 352, 369, 253, 3236, 8113, 13, 273, 247, 637, 3365, 7824, 1977, 432, 253, 1127, 23786, 273, 521, 789, 13, 326, 3534, 253, 2926, 697, 9907, 4549, 15, 733, 17256, 1520, 253, 13693, 1877, 273, 773, 1601, 1806, 326, 50205, 38562, 326, 309, 457, 306, 3597, 281, 2740, 1066, 1142, 2069, 1078, 15, 26424, 10945, 253, 773, 1601, 668, 273, 5387, 4552, 314, 4645, 598, 323, 247, 2628, 326, 574, 642, 1921, 281, 2226, 13, 275, 3718, 273, 253, 1881, 14, 1020, 26317, 773, 1601, 668, 273, 4361, 11727, 15, 1737, 1537, 359, 512, 513, 604, 359, 812, 513, 253, 1072, 32, 187, 187, 510, 773, 1601, 281, 4086, 668, 2250, 310, 247, 4633, 5299, 36633, 13, 271, 5795, 281, 1469, 327, 9974, 15, 733, 8687, 9257, 285, 12832, 1563, 1046, 4086, 275, 253, 3310, 13, 534, 275, 954, 789, 30345, 556, 253, 8542, 1055, 273, 32103, 789, 1066, 281, 247, 37431, 15, 187, 187, 1989, 4931, 359, 878, 1633, 751, 253, 7285, 27, 773, 1601, 281, 878, 1425, 1310, 4130, 342, 247, 41690, 13, 8138, 1020, 13, 390, 27009, 2628, 3365, 9284, 281, 921, 598, 281, 352, 13, 359, 651, 3037, 247, 2257, 670, 849, 1199, 273, 776, 673, 310, 2668, 598, 342, 773, 1601, 668, 326, 556, 3253, 281, 513, 342, 776, 10096, 327, 16610, 5299, 13, 285, 2717, 387, 512, 281, 513, 342, 253, 1841, 359, 878, 281, 1408, 247, 12524, 5948, 15, 10708, 1071, 187, 187, 2948, 313, 187, 186, 3, 20602, 3, 187, 186, 3, 19462, 3, 535, 186, 3, 7280, 15, 681, 16, 4174, 10408, 16, 31010, 16, 2566, 9432, 1255, 3, 187, 10, 187, 187, 4997, 6004, 30985, 19774, 2402, 9, 85, 475, 19462, 15, 53, 10, 551, 187, 186, 85, 15, 12965, 1587, 65, 4174, 2012, 1969, 1590, 65, 943, 873, 253, 1416, 275, 11632, 15, 33522, 995, 11632, 9, 85, 475, 19462, 15, 53, 10, 551, 996, 186, 85, 15, 4221, 5984, 1082, 996, 186, 73, 3843, 1071, 9432, 1255, 15, 9395, 9, 85, 10, 996, 186, 37671, 288, 15, 36272, 484, 1082, 6886, 186, 1212, 2402, 3843, 288, 15, 4257, 2946, 2402, 1082, 996, 186, 4997, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 996, 186, 7341, 2402, 3843, 11632, 2402, 559, 19292, 7341, 3, 996, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 21005, 995, 346, 2184, 995, 49700, 1590, 995, 11632, 2402, 13, 14035, 2402, 481, 21659, 23779, 1082, 6886, 186, 73, 15, 41094, 9, 7341, 2402, 10, 6886, 186, 33522, 4505, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 338, 46420, 4505, 15, 2402, 3613, 11632, 2402, 551, 988, 186, 85, 15, 30597, 2103, 1587, 2402, 369, 417, 873, 281, 2462, 84, 275, 11632, 15, 33522, 995, 11632, 2402, 10, 996, 186, 94, 187, 186, 2311, 187, 94, 187, 187, 4997, 6004, 10828, 6586, 9, 85, 475, 19462, 15, 53, 10, 551, 535, 186, 605, 34521, 436, 1071, 10513, 247, 1159, 342, 2634, 30930, 2012, 1969, 21005, 65, 840, 10513, 271, 2012, 14, 5695, 432, 326, 187, 186, 605, 831, 588, 417, 320, 3309, 672, 627, 403, 2012, 14, 13485, 13644, 2130, 281, 3785, 1309, 436, 1071, 535, 186, 85, 15, 12965, 1587, 65, 4174, 2012, 1969, 4478, 14, 5695, 30, 29, 1051, 39334, 943, 4711, 247, 2444, 1159, 7646, 995, 11632, 9, 85, 475, 19462, 15, 53, 10, 551, 996, 186, 73, 3843, 1071, 9432, 1255, 15, 9395, 9, 85, 10, 996, 186, 2044, 1486, 2228, 6886, 186, 605, 13119, 253, 2012, 14, 5695, 996, 186, 1212, 2402, 3843, 288, 15, 4257, 2946, 2402, 1082, 996, 186, 73, 15, 31766, 1587, 6953, 995, 346, 1212, 995, 622, 2402, 481, 21659, 23779, 1082, 996, 186, 28474, 19774, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 996, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 21005, 995, 346, 2184, 995, 2062, 19774, 2402, 10, 996, 186, 73, 15, 41094, 9, 28474, 19774, 2402, 10, 6886, 186, 28474, 58, 16878, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 28474, 58, 16878, 15, 2402, 426, 4890, 996, 186, 28474, 58, 16878, 15, 8893, 426, 4890, 996, 186, 73, 15, 10639, 58, 16878, 4505, 1587, 4997, 15, 4478, 15, 33522, 995, 2062, 58, 16878, 10, 6886, 186, 1000, 426, 288, 15, 12560, 1587, 17447, 995, 19479, 7836, 995, 346, 2184, 15, 17447, 995, 346, 4997, 15, 2184, 995, 346, 4997, 15, 4478, 15, 33522, 995, 346, 2184, 15, 2307, 2807, 996, 186, 338, 1486, 3613, 5296, 551, 988, 186, 20602, 15, 17148, 6677, 9, 1000, 10, 988, 186, 85, 15, 47837, 1587, 26383, 281, 2794, 13586, 2910, 323, 2012, 14, 5695, 2807, 996, 186, 94, 6886, 186, 3474, 2012, 37, 14119, 4505, 426, 2634, 22050, 355, 23344, 27, 35261, 187, 50254, 245, 50265, 14055, 58, 564, 15, 17447, 1227, 187, 50254, 245, 50265, 48168, 15640, 8076, 995, 13357, 2184, 15, 17447, 9686, 187, 50254, 245, 50265, 2634, 996, 186, 73, 15, 3378, 4505, 1587, 37, 14119, 3140, 995, 2012, 37, 14119, 4505, 13, 470, 10487, 10, 6886, 186, 1000, 426, 288, 15, 12560, 1587, 31510, 995, 346, 7973, 995, 19479, 85, 995, 2062, 19774, 2402, 33229, 14, 4478, 995, 346, 25107, 996, 186, 338, 1486, 3613, 5296, 551, 988, 186, 20602, 15, 17148, 6677, 9, 1000, 10, 988, 186, 85, 15, 47837, 1587, 26383, 281, 2794, 2012, 14, 5695, 2807, 996, 186, 94, 6886, 186, 605, 388, 1887, 333, 359, 452, 271, 2012, 14, 5695, 4672, 996, 186, 605, 1281, 84, 897, 352, 996, 186, 73, 15, 41094, 1587, 2807, 996, 186, 1826, 19774, 2402, 3843, 288, 15, 4257, 19774, 2402, 9, 1212, 2402, 10, 6886, 186, 73, 15, 31766, 1587, 4478, 995, 49700, 4478, 14, 5695, 995, 2062, 19774, 2402, 33229, 14, 4478, 995, 747, 19774, 2402, 10, 996, 186, 73, 15, 41094, 9, 1826, 19774, 2402, 10, 996, 186, 73, 15, 31766, 1587, 283, 31007, 995, 346, 2566, 995, 346, 45552, 995, 49700, 6790, 995, 49700, 2369, 14, 67, 1765, 995, 49700, 1212, 995, 622, 2402, 481, 21659, 23779, 1082, 996, 186, 73, 15, 31766, 1587, 24416, 995, 622, 2402, 13, 747, 19774, 2402, 481, 21659, 23779, 1082, 6886, 186, 1826, 58, 16878, 3843, 288, 15, 3633, 58, 16878, 4505, 1587, 4997, 15, 33522, 2807, 996, 186, 338, 747, 58, 16878, 15, 2402, 3613, 747, 19774, 2402, 551, 988, 186, 85, 15, 30597, 2103, 1587, 20419, 1159, 1416, 310, 2462, 84, 417, 2462, 84, 995, 747, 58, 16878, 15, 2402, 13, 747, 19774, 2402, 10, 996, 186, 94, 6886, 186, 338, 747, 58, 16878, 15, 8893, 3613, 346, 17, 15, 17, 15, 18, 3, 551, 988, 186, 85, 15, 30597, 2103, 1587, 20419, 1159, 2715, 310, 2462, 84, 417, 470, 15, 17, 15, 18, 995, 747, 58, 16878, 15, 8893, 10, 996, 186, 94, 535, 186, 2311, 187, 94, 187, 510, 10850, 308, 744, 1916, 11748, 6061, 18598, 15648, 1916, 40448, 2903, 1923, 8874, 4537, 187, 187, 510, 3416, 387, 253, 4055, 273, 247, 15091, 3982, 1411, 253, 5002, 48048, 310, 873, 281, 755, 370, 24, 3041, 15, 187, 187, 510, 10850, 556, 644, 4370, 2400, 407, 253, 47191, 2812, 254, 273, 247, 15091, 3982, 1411, 779, 407, 247, 3416, 665, 3916, 703, 369, 20512, 37576, 407, 253, 48048, 15, 380, 5002, 9558, 556, 644, 6960, 281, 1133, 689, 521, 4832, 5861, 281, 253, 3416, 13, 665, 310, 873, 281, 4763, 370, 24, 3041, 15, 187, 187, 7130, 281, 1302, 7177, 2797, 407, 380, 2071, 505, 13, 10850, 556, 1919, 253, 990, 273, 253, 1770, 281, 4711, 7177, 4645, 512, 521, 1524, 8304, 13, 8458, 13, 19750, 13, 9954, 84, 13, 3966, 15, 187, 187, 1328, 671, 556, 281, 1614, 689, 512, 1491, 327, 21518, 2987, 344, 21186, 13, 512, 6021, 344, 556, 12431, 1580, 4059, 13, 512, 12222, 344, 1160, 689, 370, 22, 13, 933, 1580, 4059, 285, 4278, 327, 667, 9341, 344, 556, 247, 13841, 275, 15, 187, 187, 1909, 380, 2071, 505, 806, 2361, 13, 2604, 2865, 6077, 21398, 2653, 1905, 665, 1912, 247, 370, 24, 3041, 3883, 1411, 10850, 846, 703, 7558, 344, 37576, 617, 327, 253, 873, 273, 247, 6612, 921, 1905, 4724, 7177, 4321, 436, 807, 37781, 779, 273, 11711, 1076, 9790, 273, 8918, 275, 6021, 281, 3693, 1907, 281, 2075, 15, 187, 187, 688, 617, 4104, 15091, 13, 21398, 2653, 7558, 326, 1309, 253, 3275, 273, 773, 2993, 21979, 10850, 1806, 253, 48048, 20512, 37576, 617, 407, 3490, 2920, 10922, 521, 1133, 3304, 617, 7619, 281, 7692, 617, 8050, 42797, 285, 11566, 4121, 15, 187, 187, 1909, 253, 19564, 11323, 13, 380, 10850, 457, 84, 4320, 1930, 4724, 247, 3200, 323, 247, 747, 2332, 281, 1333, 326, 253, 2408, 273, 253, 3883, 369, 1512, 1029, 285, 326, 1941, 369, 14999, 275, 8109, 253, 1750, 15, 1723, 13, 253, 5963, 275, 253, 2647, 13230, 253, 3200, 15, 11540, 1877, 273, 5667, 14300, 20896, 275, 1966, 16327, 407, 1327, 14, 44490, 7218, 19177, 1754, 327, 530, 21271, 14, 50, 14, 46873, 16, 3338, 15, 187, 688, 3332, 1107, 13, 970, 7218, 19177, 4302, 281, 1263, 14300, 556, 1160, 690, 4780, 15, 1723, 13, 275, 4588, 3382, 2175, 13, 627, 403, 1643, 2175, 327, 14300, 2905, 5198, 11168, 982, 342, 1966, 16327, 347, 3530, 15, 496, 436, 1263, 13, 253, 16327, 3530, 273, 1363, 342, 5667, 14300, 313, 46353, 10, 497, 5421, 407, 10941, 342, 5875, 952, 281, 8338, 253, 2544, 273, 16327, 19789, 875, 41039, 1363, 285, 5875, 952, 275, 1340, 281, 1089, 2442, 20896, 285, 10761, 9130, 15, 743, 17452, 3045, 5558, 19849, 9904, 342, 42227, 1306, 673, 14, 1171, 14, 31045, 2280, 25535, 313, 54, 21271, 14, 50, 14, 46873, 16, 3338, 10, 4302, 369, 908, 281, 12106, 253, 16327, 19789, 273, 6879, 2219, 273, 5667, 14300, 1387, 313, 46353, 10, 285, 6879, 2219, 273, 5875, 1453, 1387, 313, 10431, 481, 4794, 281, 253, 367, 7858, 14, 4877, 3102, 8981, 1783, 13, 15991, 342, 1534, 3910, 313, 49, 654, 964, 1762, 10, 875, 253, 444, 41, 1387, 285, 253, 20663, 1387, 497, 22546, 562, 13, 1690, 884, 2442, 20896, 824, 347, 418, 14, 20912, 41568, 15, 380, 10761, 9130, 3206, 497, 8898, 3527, 11082, 13, 14126, 3527, 11082, 28972, 14689, 13, 26132, 285, 14746, 4073, 15, 380, 1327, 14, 44490, 7218, 19177, 1754, 327, 530, 21271, 14, 50, 14, 46873, 16, 3338, 4302, 476, 8069, 4271, 253, 8967, 19789, 273, 2442, 20896, 275, 253, 16327, 273, 5667, 41039, 1363, 285, 2085, 247, 10527, 3720, 323, 253, 1971, 273, 3382, 14300, 15, 38571, 273, 247, 2813, 14, 4524, 14, 2566, 313, 37, 3329, 10, 310, 271, 9909, 3213, 275, 247, 10264, 1232, 273, 253, 399, 3329, 15, 380, 399, 3329, 476, 320, 5762, 970, 247, 49568, 326, 3797, 247, 11234, 273, 19832, 16, 11021, 313, 42, 16, 48, 10, 17596, 15, 20599, 273, 253, 49568, 476, 2486, 247, 1077, 1698, 2105, 49568, 313, 27901, 1647, 10, 390, 247, 1029, 14, 423, 49568, 15, 44019, 5175, 310, 581, 5853, 908, 323, 5175, 253, 399, 3329, 285, 8687, 19507, 273, 941, 407, 247, 11234, 273, 11017, 13178, 875, 247, 30572, 32232, 285, 247, 33168, 273, 253, 399, 3329, 15, 22460, 13, 253, 11017, 5175, 3797, 30572, 1256, 273, 253, 941, 13, 323, 1650, 6024, 11017, 14800, 281, 253, 399, 3329, 13, 407, 253, 30572, 32232, 715, 247, 11234, 273, 11017, 13178, 390, 14800, 285, 13800, 273, 253, 941, 13, 323, 1650, 247, 11234, 273, 11017, 18012, 13, 407, 253, 33168, 715, 247, 3710, 1180, 273, 6024, 11017, 18012, 15, 1310, 253, 399, 3329, 310, 247, 1698, 9176, 1385, 2216, 13, 253, 399, 3329, 310, 625, 21291, 281, 19541, 2355, 6332, 285, 253, 13800, 273, 253, 941, 310, 1679, 10237, 347, 1180, 273, 11017, 13178, 310, 1679, 1955, 281, 3710, 1180, 273, 6024, 11017, 14800, 285, 6024, 11017, 18012, 15, 187, 1992, 2572, 253, 1180, 273, 6024, 11017, 14800, 281, 253, 30572, 32232, 285, 281, 2572, 253, 1180, 273, 6024, 11017, 18012, 432, 253, 33168, 13, 247, 10382, 6081, 14, 3229, 30941, 6081, 313, 6075, 4476, 10, 310, 2908, 275, 253, 399, 3329 ]
show up to work but merely spent his time reading philosophy — becoming an expert on Spinoza, according to Mr Garcia — which would make him just another case of dreary workplace pseudo-leisure. But it was the original vision, of a man simply walking away from the pointlessness of his work, that gave the story its viral appeal. It punctured the mystification of “work,” that oppressive abstraction that I’ve tried to break down many times before. Garcia rejected the “work” of dutifully showing up for a job that had no reason to exist, in favor of the self-fulfilling “work” of reading philosophy. What might we all do if we could do the same? The “work to rule” action is a popular labor tactic, an alternative to going on strike. It involves carefully and literally following every rule in the contract, which in most workplaces has the practical effect of slowing work down to a crawl. But perhaps we need something like the opposite: “work to need.” If everyone with a pointless, wasteful, or destructive job simply refused to show up to it, we would learn a lot about how much of our time is taken up with “work” that has everything to do with our dependence on wage labor, and nothing at all to do with the things we need to run a decent society.package test import ( "fmt" "testing" "github.com/fnproject/cli/testharness" ) func TestSettingFuncName(t *testing.T) { t.Run("`fn init --name` should set the name in func.yaml", func(t *testing.T) { t.Parallel() h := testharness.Create(t) defer h.Cleanup() appName := h.NewAppName() funcName := h.NewFuncName(appName) dirName := funcName + "_dir" h.Fn("init", "--runtime", "go", "--name", funcName, dirName).AssertSuccess() h.Cd(dirName) yamlFile := h.GetYamlFile("func.yaml") if yamlFile.Name != funcName { t.Fatalf("Name was not set to %s in func.yaml", funcName) } }) } func TestInitImage(t *testing.T) { // NB this test creates a function with `rn init --runtime` then creates an init-image from that // This will not be necessary when there are init-images publicly available to pull during this test t.Run("`fn init --init-image=<...>` should produce a working function template", func(t *testing.T) { h := testharness.Create(t) var err error // Create the init-image appName := h.NewAppName() h.Fn("create", "app", appName).AssertSuccess() origFuncName := h.NewFuncName(appName) h.Fn("init", "--runtime", "go", origFuncName) h.Cd(origFuncName) origYaml := h.GetYamlFile("func.yaml") origYaml.Name = "" origYaml.Version = "" h.WriteYamlFile("func.init.yaml", origYaml) err = h.Exec("tar", "-cf", "go.tar", "func.go", "func.init.yaml", "go.mod") if err != nil { fmt.Println(err) t.Fatal("Failed to create tarball for init-image") } const initDockerFile = `FROM alpine:latest COPY go.tar / CMD ["cat", "/go.tar"] ` h.WithFile("Dockerfile", initDockerFile, 0600) err = h.Exec("docker", "build", "-t", origFuncName+"-init", ".") if err != nil { fmt.Println(err) t.Fatal("Failed to create init-image") } // Hooray we have an init-image!! // Lets use it h.Cd("") newFuncName := h.NewFuncName(appName) h.Fn("init", "--init-image", origFuncName+"-init", newFuncName) h.Cd(newFuncName) h.Fn("--registry", "test", "deploy", "--local", "--no-bump", "--app", appName).AssertSuccess() h.Fn("invoke", appName, newFuncName).AssertSuccess() newYaml := h.GetYamlFile("func.yaml") if newYaml.Name != newFuncName { t.Fatalf("generated function name is %s not %s", newYaml.Name, newFuncName) } if newYaml.Version != "0.0.1" { t.Fatalf("generated function version is %s not 0.0.1", newYaml.Version) } }) } The Game Told To Turn Over Financial Records To Sexual Assault Accuser The woman at the center of a lawsuit brought against the California rapper is set to get $7 million. The Game has been dogged by the looming specter of a lawsuit brought against him by a woman who claims she was sexually assaulted by the rapper. The California artist has been ordered to hand over his financial records to the woman, who is set to receive $7 million. According to court documents obtained by The Blast, Game has until the end of the month to produce documents showing all his real estate, cars, boats, aircrafts, etc. He also has to turn over all information on artistic works he owns, all income he has earned since 2014, all expenses he made over $5,000 since 2014 and details on any businesses he has a stake in. As The Blast first reported, Priscilla Rainey — who won a $7 million judgment against Game after she claimed he assaulted her on the set of a reality show — filed documents earlier this year accusing him of diverting millions of dollars in income to avoid having to pay. In her 2015 lawsuit, Rainey claimed that during the production of “She Got Game,” the rapper sexually assaulted her by forcefully reaching his hand inside her dress to rub her bare vagina and buttocks. As the outlet adds, The Game’s legal side filed a motion for a new trial to say that the amount of the judgment was too high and that evidence was lacking in supporting the claim. However, the judge in the matter blocked the motion.Identification of essential hypertension biomarkers in human urine by non-targeted metabolomics based on UPLC-Q-TOF/MS. In recent years, using metabolomics technology to study hypertension has made some progress. However, in actual clinical studies, there are few studies on hypertension related metabonomics with human urine as samples. In this study, the urine samples of patients with essential hypertension (EH) were studied by comparing with healthy people to explore the changes of urine metabolites between hypertensive patients and healthy people in order to find potential biomarkers and metabolic pathways. An ultra performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS) technology was used to analyze the urine metabolites of 75 cases of essential hypertension group (EH) and 75 cases of healthy control group (HC). According to the PLS-DA pattern recognition analysis, substances with significant differences (P < .05) between the EH group and the HC group were screened out, including 10 potential biomarkers such as L-methionine. The metabolic pathways involved were amino acid metabolism, fatty acid metabolism steroid hormone, biosynthesis and oxidative stress. The non-targeted metabolomics based on UPLC-Q-TOF/MS technology can effectively identify the differential metabolites of potential biomarkers in the urine of essential hypertensive patients and provide a theoretical basis for the treatment of clinical hypertension.Testing of a device-under-test (DUT) is an integral step in a manufacturing process of the DUT. The DUT can be tested using a tester that includes a plurality of Input/Output (I/O) ports. Examples of the tester can include a very low cost tester (VLCT) or a high-end tester. Scan testing is one technique used for testing the DUT and involves shifting of data by a plurality of scan chains between a decompressor and a compressor of the DUT. Typically, the scan testing includes decompression of the data, for example external scan inputs to the DUT, by the decompressor into a plurality of scan chains or inputs and compression of the data, for example a plurality of scan outputs, by the compressor into a limited number of external scan outputs. If the DUT is a low pin count design, the DUT is more prone to aliasing errors and the compression of the data is less robust as number of scan chains is less due to limited number of external scan inputs and external scan outputs. To increase the number of external scan inputs to the decompressor and to increase the number of external scan outputs from the compressor, a serializer-deserializer (SerDes) is included in the DUT