Datasets:
jsonifize
/
JsonJuggernugget

Dataset card Data Studio Files Community
1
text
stringlengths
13
30k
{"language": "de", "company": "Booking", "line_number": 7, "sentence": "Definitionen", "unfairness_level": "untagged", "a": false, "ch": false, "cr": false, "j": false, "law": false, "ltd": false, "ter": false, "use": false, "pinc": false, "all_topics": []}
{"language": "de", "company": "Booking", "line_number": 8, "sentence": "Umfang und Art unserer Dienstleistungen", "unfairness_level": "untagged", "a": false, "ch": false, "cr": false, "j": false, "law": false, "ltd": false, "ter": false, "use": false, "pinc": false, "all_topics": []}
{"texts": ["Reactivity of Fe(II)-bearing minerals toward reductive transformation of organic contaminants.", "\nFe(II) present at surfaces of iron-containing minerals can play a significant role in the overall attenuation of reducible contaminants in the subsurface. ", "As the chemical environment, i.e., the type and arrangement of ligands, strongly affects the redox potential of Fe(II), the presence of various mineral sorbents is expected to modulate the reactivity of surficial Fe(II)-species in aqueous systems. ", "In a comparative study we evaluated the reactivity of ferrous iron in aqueous suspensions of siderite (FeCO3), nontronite (ferruginous smectite SWa-1), hematite (alpha-Fe2O3), lepidocrocite (gamma-FeOOH), goethite (alpha-FeOOH), magnetite (Fe3O4), sulfate green rust (Fe(II)4Fe(III)2(OH)12SO4 x 4H2O), pyrite (FeS2), and mackinawite (FeS) under similar conditions (pH 7.2, 25 m2 mineral/L, 1 mM Fe(II)aq, O2 (aq) < 0.1 g/L). ", "Surface-area-normalized pseudo first-order rate constants are reported for the reduction of hexachloroethane and 4-chloronitrobenzene representing two classes of environmentally relevant transformation reactions of pollutants, i.e., dehalogenation and nitroaryl reduction. ", "The reactivities of the different Fe(II) mineral systems varied greatly and systematically both within and between the two data sets obtained with the two probe compounds. ", "As a general trend, surface-area-normalized reaction rates increased in the order Fe(II) + siderite < Fe(II) + iron oxides < Fe(II) + iron sulfides. ", "4-Chloronitrobenzene was transformed by mineral-bound Fe(II) much more rapidly than hexachloroethane, except for suspensions of hematite, pyrite, and nontronite. ", "The results demonstrate that abiotic reactions with surface-bound Fe(II) may affect or even dominate the long-term behavior of reducible pollutants in the subsurface, particularly in the presence of Fe(III) bearing minerals. ", "As such reactions can be dominated by specific interactions of the oxidant with the surface, care must be taken in extrapolating reactivity data of surface-bound Fe(II) between different compound classes."], "meta": {"pile_set_name": "PubMed Abstracts"}, "scores": [0.0006138617172837257, 0.0006368509493768215, 0.000634028809145093, 0.0007315006223507226, 0.0008847370045259595, 0.0005494336364790797, 0.000702434394042939, 0.0009532837430015206, 0.0007260926067829132, 0.0006062631728127599], "avg_score": 0.0007038486655801535, "num_sents": 10}
{"texts": ["package org.ovirt.engine.api.restapi.resource;\n\nimport javax.ws.rs.core.", "Response;\n\nimport org.ovirt.engine.api.model.", "AffinityLabel;\nimport org.ovirt.engine.api.resource.", "AssignedAffinityLabelResource;\nimport org.ovirt.engine.api.restapi.utils.", "GuidUtils;\nimport org.ovirt.engine.core.common.action.", "ActionType;\nimport org.ovirt.engine.core.common.action.", "LabelActionParameters;\nimport org.ovirt.engine.core.common.businessentities.", "BusinessEntity;\nimport org.ovirt.engine.core.common.businessentities.", "LabelBuilder;\nimport org.ovirt.engine.core.common.queries.", "IdQueryParameters;\nimport org.ovirt.engine.core.common.queries.", "QueryType;\nimport org.ovirt.engine.core.compat.", "Guid;\n\npublic class BackendAssignedAffinityLabelResource extends AbstractBackendActionableResource<AffinityLabel, org.ovirt.engine.core.common.businessentities.", "Label>\n implements AssignedAffinityLabelResource {\n\n private final String parentId;\n private final BackendAssignedAffinityLabelsResource.", "ReferencedEntityConstructor<BusinessEntity<Guid>> constructor;\n private BackendAssignedAffinityLabelsResource parent;\n\n public BackendAssignedAffinityLabelResource(BackendAssignedAffinityLabelsResource parent, String parentId, BackendAssignedAffinityLabelsResource.", "ReferencedEntityConstructor<BusinessEntity<Guid>> constructor, String id) {\n super(id, AffinityLabel.class, org.ovirt.engine.core.common.businessentities.Label.class);\n this.parentId = parentId;\n this.parent = parent;\n this.constructor = constructor;\n }\n\n @Override\n public AffinityLabel get() {\n AffinityLabel affinityLabel = addLinks(performGet(QueryType.", "GetLabelById, new IdQueryParameters(guid)));\n parent.linkSubCollections(affinityLabel);\n return affinityLabel;\n }\n\n @Override\n public Response remove() {\n QueryIdResolver<Guid> labelResolver = new QueryIdResolver<>(QueryType.", "GetLabelById, IdQueryParameters.class);\n org.ovirt.engine.core.common.businessentities.", "Label entity = getEntity(labelResolver, true);\n\n BusinessEntity<Guid> parent = constructor.create();\n parent.setId(GuidUtils.asGuid(parentId));\n\n org.ovirt.engine.core.common.businessentities.", "Label updatedLabel = new LabelBuilder(entity)\n .removeEntity(parent)\n .build();\n\n return performAction(ActionType.", "UpdateLabel,\n new LabelActionParameters(updatedLabel));\n }\n}\n"], "meta": {"pile_set_name": "Github"}, "scores": [0.0011301059275865555, 0.0007248737965710461, 0.000783813651651144, 0.0010159589583054185, 0.0010250488994643092, 0.0008428398286923766, 0.0007127206772565842, 0.0007975248154252768, 0.0008823074167594314, 0.0009651014115661383, 0.0008298477623611689, 0.0010253911605104804, 0.00087643665028736, 0.0016875802539288998, 0.0015017434488981962, 0.0009161914349533617, 0.0008624073234386742, 0.001184572814963758, 0.0007472143624909222, 0.0006993421702645719], "avg_score": 0.0009605511382687837, "num_sents": 20}
{"texts": ["Q:\n\nMulti-site sharing content\n\nIs it possible to share content/nodes in a drupal multisite environment.", "\nFor example:\nContent type \"Story\"\n\nSite 1- Use this content\nSite 2- Don't use this content\nSite 3- Use this content\n\nIt seems the drupal multisite environment suggests using table prefixes for different sites.", "\n\nA:\n\nI think this is what the domain access module is for.", "\n\n"], "meta": {"pile_set_name": "StackExchange"}, "scores": [0.0006506239878945053, 0.0006916901329532266, 0.0006295452476479113, 0.001995587022975087], "avg_score": 0.0009918615978676826, "num_sents": 4}
{"texts": ["Developmental choices in mating-type interconversion in fission yeast.", "\nFission yeast cells follow a specific pattern of mating (cell) type switching in single cell pedigrees. ", "Asymmetric cell divisions producing sisters of different developmental fates result from inheritance of specific parental DNA strands according to the classical model of semiconservative replication and segregation."], "meta": {"pile_set_name": "PubMed Abstracts"}, "scores": [0.0005913782515563071, 0.0007397191948257387, 0.0006635755416937172], "avg_score": 0.0006648909960252544, "num_sents": 3}
{"texts": ["Five Horse Johnson\n\nFive Horse Johnson comes straight out of Toledo, OH, with big riff, get down, rootsy, middle American rock & roll that takes acid blues and Led Zeppelin and mixes in influences like the Black Crowes, Lynyrd Skynyrd, Aerosmith, and ZZ Top.", "\n\nThe band - made up of Eric Oblander on harps and vocals, Brad Coffin on guitar, Steve Smith on bass, and Mike Alonso on drums - got together in 1995 and began opening for acts like War, Southern Culture on the Skids, Atomic Bitchwax, the Queens of the Stone Age, and R.L. Burnside. ", "In 1998, they released Double Down. ", "The critically acclaimed Fat Black Pussycat followed in 1999 and The No. ", "6 Dance came out on Small Stone Records in 2001."], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.0012386144371703267, 0.014514179900288582, 0.0011138735571876168, 0.5730407238006592, 0.0006743177073076367], "avg_score": 0.11811634188052267, "num_sents": 5}
{"texts": ["When their son is accused of murdering his sister, a mother and father face perhaps the most awful decision any parent could have to make: whether to break with their son or accept him back into the family. ", "With astonishing footage shot over a ten-year period, from minutes after the crime was committed to the present, the film follows the family's evolving relationships.", "\n\n\n\nFor more background information on this film, please visit the NFB.ca blog. ", "Click here for a special DVD pricing on all of our John Kastner films: Life with Murder, NCR: Not Criminally Responsible and Out of Mind, Out of Sight.", "\n\n\n\n\n\nThis film deals with mature subject matter. ", "Viewer discretion is advised"], "meta": {"pile_set_name": "OpenWebText2"}, "scores": [0.06590566039085388, 0.0005554524250328541, 0.0005256516742520034, 0.0011389044811949134, 0.0006951668183319271, 0.0007365808123722672], "avg_score": 0.011592902767006308, "num_sents": 6}
{"text1": "Amrozi accused his brother , whom he called \" the witness \" , of deliberately distorting his evidence .", "text2": "Referring to him as only \" the witness \" , Amrozi accused his brother of deliberately distorting his evidence .", "label": 1, "idx": 0, "label_text": "equivalent"}
{"text1": "Yucaipa owned Dominick 's before selling the chain to Safeway in 1998 for $ 2.5 billion .", "text2": "Yucaipa bought Dominick 's in 1995 for $ 693 million and sold it to Safeway for $ 1.8 billion in 1998 .", "label": 0, "idx": 1, "label_text": "not equivalent"}
{"text1": "They had published an advertisement on the Internet on June 10 , offering the cargo for sale , he added .", "text2": "On June 10 , the ship 's owners had published an advertisement on the Internet , offering the explosives for sale .", "label": 1, "idx": 2, "label_text": "equivalent"}
{"text1": "Around 0335 GMT , Tab shares were up 19 cents , or 4.4 % , at A $ 4.56 , having earlier set a record high of A $ 4.57 .", "text2": "Tab shares jumped 20 cents , or 4.6 % , to set a record closing high at A $ 4.57 .", "label": 0, "idx": 3, "label_text": "not equivalent"}
{"text1": "The stock rose $ 2.11 , or about 11 percent , to close Friday at $ 21.51 on the New York Stock Exchange .", "text2": "PG & E Corp. shares jumped $ 1.63 or 8 percent to $ 21.03 on the New York Stock Exchange on Friday .", "label": 1, "idx": 4, "label_text": "equivalent"}
{"text1": "Revenue in the first quarter of the year dropped 15 percent from the same period a year earlier .", "text2": "With the scandal hanging over Stewart 's company , revenue the first quarter of the year dropped 15 percent from the same period a year earlier .", "label": 1, "idx": 5, "label_text": "equivalent"}
{"text1": "The Nasdaq had a weekly gain of 17.27 , or 1.2 percent , closing at 1,520.15 on Friday .", "text2": "The tech-laced Nasdaq Composite .IXIC rallied 30.46 points , or 2.04 percent , to 1,520.15 .", "label": 0, "idx": 6, "label_text": "not equivalent"}
{"text1": "The DVD-CCA then appealed to the state Supreme Court .", "text2": "The DVD CCA appealed that decision to the U.S. Supreme Court .", "label": 1, "idx": 7, "label_text": "equivalent"}
{"text1": "That compared with $ 35.18 million , or 24 cents per share , in the year-ago period .", "text2": "Earnings were affected by a non-recurring $ 8 million tax benefit in the year-ago period .", "label": 0, "idx": 8, "label_text": "not equivalent"}
{"text1": "Shares of Genentech , a much larger company with several products on the market , rose more than 2 percent .", "text2": "Shares of Xoma fell 16 percent in early trade , while shares of Genentech , a much larger company with several products on the market , were up 2 percent .", "label": 0, "idx": 10, "label_text": "not equivalent"}
{"id": 1, "keyword": null, "location": null, "text": "Our Deeds are the Reason of this #earthquake May ALLAH Forgive us all", "target": 1}
{"id": 4, "keyword": null, "location": null, "text": "Forest fire near La Ronge Sask. Canada", "target": 1}
{"id": 5, "keyword": null, "location": null, "text": "All residents asked to 'shelter in place' are being notified by officers. No other evacuation or shelter in place orders are expected", "target": 1}
{"id": 6, "keyword": null, "location": null, "text": "13,000 people receive #wildfires evacuation orders in California ", "target": 1}
{"id": 7, "keyword": null, "location": null, "text": "Just got sent this photo from Ruby #Alaska as smoke from #wildfires pours into a school ", "target": 1}
{"id": 8, "keyword": null, "location": null, "text": "#RockyFire Update => California Hwy. 20 closed in both directions due to Lake County fire - #CAfire #wildfires", "target": 1}
{"id": 10, "keyword": null, "location": null, "text": "#flood #disaster Heavy rain causes flash flooding of streets in Manitou, Colorado Springs areas", "target": 1}
{"id": 13, "keyword": null, "location": null, "text": "I'm on top of the hill and I can see a fire in the woods...", "target": 1}
{"id": 14, "keyword": null, "location": null, "text": "There's an emergency evacuation happening now in the building across the street", "target": 1}
{"id": 15, "keyword": null, "location": null, "text": "I'm afraid that the tornado is coming to our area...", "target": 1}
{"_data_files": [{"filename": "dataset.arrow"}], "_fingerprint": "8ba5734c8fb1b57c", "_format_columns": ["target", "text"], "_format_kwargs": {}, "_format_type": null, "_indexes": {}, "_output_all_columns": false, "_split": null}
{"form": [{"box": [292, 91, 376, 175], "text": "R&D", "label": "other", "words": [{"box": [292, 91, 376, 175], "text": "R&D"}], "linking": [], "id": 0}, {"box": [219, 316, 225, 327], "text": ":", "label": "question", "words": [{"box": [219, 316, 225, 327], "text": ":"}], "linking": [], "id": 1}, {"box": [95, 355, 169, 370], "text": "Suggestion:", "label": "question", "words": [{"box": [95, 355, 169, 370], "text": "Suggestion:"}], "linking": [[2, 16]], "id": 2}, {"box": [482, 268, 518, 282], "text": "Date:", "label": "question", "words": [{"box": [482, 268, 518, 282], "text": "Date:"}], "linking": [[3, 12]], "id": 3}, {"box": [511, 309, 570, 323], "text": "Licensee", "label": "answer", "words": [{"box": [511, 309, 570, 323], "text": "Licensee"}], "linking": [[13, 4]], "id": 4}, {"box": [211, 651, 217, 662], "text": "", "label": "question", "words": [{"box": [211, 651, 217, 662], "text": ""}], "linking": [], "id": 5}, {"box": [461, 605, 483, 619], "text": "Yes", "label": "question", "words": [{"box": [461, 605, 483, 619], "text": "Yes"}], "linking": [[19, 6]], "id": 6}, {"box": [545, 603, 563, 617], "text": "No", "label": "question", "words": [{"box": [545, 603, 563, 617], "text": "No"}], "linking": [[19, 7]], "id": 7}, {"box": [525, 904, 641, 926], "text": "597005708", "label": "other", "words": [{"box": [525, 904, 641, 926], "text": "597005708"}], "linking": [], "id": 8}, {"box": [256, 201, 423, 230], "text": "R&D QUALITY IMPROVEMENT SUGGESTION/ SOLUTION FORM", "label": "header", "words": [{"box": [257, 203, 279, 214], "text": "R&D"}, {"box": [285, 203, 334, 216], "text": "QUALITY"}, {"box": [341, 201, 418, 211], "text": "IMPROVEMENT"}, {"box": [256, 215, 324, 229], "text": "SUGGESTION/"}, {"box": [324, 216, 332, 230], "text": ""}, {"box": [331, 214, 387, 228], "text": "SOLUTION"}, {"box": [395, 215, 423, 228], "text": "FORM"}], "linking": [], "id": 9}, {"box": [89, 272, 204, 289], "text": "Name / Phone Ext. :", "label": "question", "words": [{"box": [89, 274, 118, 289], "text": "Name"}, {"box": [117, 274, 127, 288], "text": "/"}, {"box": [128, 274, 163, 289], "text": "Phone"}, {"box": [169, 272, 196, 287], "text": "Ext."}, {"box": [196, 274, 204, 288], "text": ":"}], "linking": [[10, 11]], "id": 10}, {"box": [215, 271, 451, 287], "text": "M. Hamann P. Harper, P. Martinez", "label": "answer", "words": [{"box": [215, 272, 230, 287], "text": "M."}, {"box": [237, 272, 287, 286], "text": "Hamann"}, {"box": [293, 272, 307, 286], "text": "P."}, {"box": [314, 274, 363, 285], "text": "Harper,"}, {"box": [370, 272, 384, 285], "text": "P."}, {"box": [390, 271, 451, 282], "text": "Martinez"}], "linking": [[10, 11]], "id": 11}, {"box": [543, 264, 590, 279], "text": "9/ 3/ 92", "label": "answer", "words": [{"box": [543, 265, 560, 279], "text": "9/"}, {"box": [560, 264, 575, 279], "text": "3/"}, {"box": [575, 264, 590, 279], "text": "92"}], "linking": [[3, 12]], "id": 12}, {"box": [420, 310, 491, 323], "text": "R&D Group:", "label": "question", "words": [{"box": [420, 310, 442, 323], "text": "R&D"}, {"box": [448, 310, 491, 323], "text": "Group:"}], "linking": [[13, 4]], "id": 13}, {"box": [236, 313, 327, 327], "text": "J. S. Wigand", "label": "answer", "words": [{"box": [236, 313, 251, 327], "text": "J."}, {"box": [256, 313, 273, 326], "text": "S."}, {"box": [278, 313, 327, 327], "text": "Wigand"}], "linking": [[15, 14]], "id": 14}, {"box": [91, 316, 218, 331], "text": "Supervisor / Manager", "label": "question", "words": [{"box": [91, 316, 161, 330], "text": "Supervisor"}, {"box": [163, 318, 169, 331], "text": "/"}, {"box": [169, 317, 218, 327], "text": "Manager"}], "linking": [[15, 14]], "id": 15}, {"box": [190, 346, 594, 447], "text": "Discontinue coal retention analyses on licensee submitted product samples (Note : Coal Retention testing is not performed by most licensees. Other B&W physical measurements as ends stability and inspection for soft spots in ciparettes are thought to be sufficient measures to assure cigarette physical integrity. The proposed action will increase laboratory productivity . )", "label": "answer", "words": [{"box": [190, 355, 268, 366], "text": "Discontinue"}, {"box": [274, 353, 303, 366], "text": "coal"}, {"box": [309, 352, 375, 365], "text": "retention"}, {"box": [381, 351, 435, 365], "text": "analyses"}, {"box": [443, 352, 458, 363], "text": "on"}, {"box": [464, 348, 520, 362], "text": "licensee"}, {"box": [527, 346, 594, 361], "text": "submitted"}, {"box": [190, 369, 240, 383], "text": "product"}, {"box": [247, 367, 301, 380], "text": "samples"}, {"box": [318, 365, 352, 379], "text": "(Note"}, {"box": [352, 367, 359, 380], "text": ":"}, {"box": [373, 366, 402, 376], "text": "Coal"}, {"box": [408, 366, 472, 376], "text": "Retention"}, {"box": [479, 365, 529, 376], "text": "testing"}, {"box": [536, 363, 549, 374], "text": "is"}, {"box": [554, 363, 578, 374], "text": "not"}, {"box": [190, 383, 256, 394], "text": "performed"}, {"box": [261, 381, 275, 394], "text": "by"}, {"box": [282, 383, 311, 393], "text": "most"}, {"box": [318, 380, 386, 391], "text": "licensees."}, {"box": [401, 378, 437, 389], "text": "Other"}, {"box": [443, 378, 465, 389], "text": "B&W"}, {"box": [471, 377, 528, 391], "text": "physical"}, {"box": [191, 398, 275, 406], "text": "measurements"}, {"box": [282, 397, 297, 405], "text": "as"}, {"box": [304, 394, 332, 405], "text": "ends"}, {"box": [339, 394, 402, 405], "text": "stability"}, {"box": [409, 392, 430, 402], "text": "and"}, {"box": [437, 392, 508, 403], "text": "inspection"}, {"box": [515, 391, 535, 402], "text": "for"}, {"box": [542, 391, 571, 401], "text": "soft"}, {"box": [193, 411, 228, 422], "text": "spots"}, {"box": [235, 409, 250, 420], "text": "in"}, {"box": [256, 409, 327, 419], "text": "ciparettes"}, {"box": [332, 408, 352, 418], "text": "are"}, {"box": [360, 406, 410, 419], "text": "thought"}, {"box": [415, 406, 430, 416], "text": "to"}, {"box": [436, 404, 453, 417], "text": "be"}, {"box": [458, 405, 529, 415], "text": "sufficient"}, {"box": [535, 405, 592, 415], "text": "measures"}, {"box": [193, 425, 208, 433], "text": "to"}, {"box": [214, 423, 255, 431], "text": "assure"}, {"box": [261, 420, 325, 434], "text": "cigarette"}, {"box": [331, 419, 390, 432], "text": "physical"}, {"box": [395, 418, 463, 431], "text": "integrity."}, {"box": [478, 416, 500, 429], "text": "The"}, {"box": [506, 418, 566, 431], "text": "proposed"}, {"box": [193, 436, 236, 447], "text": "action"}, {"box": [240, 436, 269, 447], "text": "will"}, {"box": [277, 434, 333, 445], "text": "increase"}, {"box": [339, 433, 410, 446], "text": "laboratory"}, {"box": [418, 430, 502, 445], "text": "productivity"}, {"box": [503, 433, 507, 444], "text": "."}, {"box": [508, 430, 514, 444], "text": ")"}], "linking": [[2, 16]], "id": 16}, {"box": [95, 486, 250, 504], "text": "Suggested Solutions (s) :", "label": "question", "words": [{"box": [95, 489, 159, 504], "text": "Suggested"}, {"box": [165, 487, 222, 501], "text": "Solutions"}, {"box": [223, 486, 241, 503], "text": "(s)"}, {"box": [243, 489, 250, 503], "text": ":"}], "linking": [[17, 18]], "id": 17}, {"box": [263, 483, 593, 553], "text": "Delete coal retention from the list of standard analyses performed on licensee submitted product samples. Special requests for coal retention testing could still be submitted on an exception basis.", "label": "answer", "words": [{"box": [263, 486, 306, 500], "text": "Delete"}, {"box": [313, 486, 341, 499], "text": "coal"}, {"box": [348, 486, 412, 497], "text": "retention"}, {"box": [416, 485, 447, 498], "text": "from"}, {"box": [453, 485, 475, 498], "text": "the"}, {"box": [480, 483, 508, 496], "text": "list"}, {"box": [515, 483, 532, 494], "text": "of"}, {"box": [536, 483, 593, 494], "text": "standard"}, {"box": [264, 501, 320, 514], "text": "analyses"}, {"box": [324, 501, 392, 512], "text": "performed"}, {"box": [397, 501, 412, 511], "text": "on"}, {"box": [419, 499, 475, 512], "text": "licensee"}, {"box": [482, 499, 546, 510], "text": "submitted"}, {"box": [264, 517, 314, 528], "text": "product"}, {"box": [320, 514, 374, 528], "text": "samples."}, {"box": [390, 513, 439, 526], "text": "Special"}, {"box": [446, 513, 502, 524], "text": "requests"}, {"box": [508, 511, 530, 522], "text": "for"}, {"box": [538, 510, 566, 523], "text": "coal"}, {"box": [263, 529, 330, 540], "text": "retention"}, {"box": [335, 527, 387, 540], "text": "testing"}, {"box": [390, 527, 428, 538], "text": "could"}, {"box": [433, 525, 468, 536], "text": "still"}, {"box": [473, 525, 488, 535], "text": "be"}, {"box": [496, 524, 560, 537], "text": "submitted"}, {"box": [566, 524, 584, 537], "text": "on"}, {"box": [264, 543, 281, 553], "text": "an"}, {"box": [286, 539, 350, 553], "text": "exception"}, {"box": [355, 541, 397, 551], "text": "basis."}], "linking": [[17, 18]], "id": 18}, {"box": [96, 608, 398, 624], "text": "Have you contacted your Manager/ Supervisor?", "label": "header", "words": [{"box": [96, 612, 127, 623], "text": "Have"}, {"box": [131, 613, 156, 624], "text": "you"}, {"box": [161, 612, 225, 623], "text": "contacted"}, {"box": [229, 610, 260, 623], "text": "your"}, {"box": [264, 609, 314, 622], "text": "Manager/"}, {"box": [314, 608, 322, 622], "text": ""}, {"box": [323, 608, 398, 621], "text": "Supervisor?"}], "linking": [[19, 6], [19, 7]], "id": 19}, {"box": [98, 651, 211, 665], "text": "Manager Comments:", "label": "question", "words": [{"box": [98, 654, 150, 665], "text": "Manager"}, {"box": [154, 651, 211, 664], "text": "Comments:"}], "linking": [[20, 21], [20, 22]], "id": 20}, {"box": [232, 644, 547, 662], "text": "Manager, please contact suggester and forward", "label": "answer", "words": [{"box": [232, 648, 288, 662], "text": "Manager,"}, {"box": [296, 649, 338, 662], "text": "please"}, {"box": [344, 648, 394, 662], "text": "contact"}, {"box": [401, 648, 464, 661], "text": "suggester"}, {"box": [469, 647, 491, 658], "text": "and"}, {"box": [497, 644, 547, 657], "text": "forward"}], "linking": [[20, 21]], "id": 21}, {"box": [99, 662, 323, 677], "text": "comments to the Quality Council.", "label": "answer", "words": [{"box": [99, 666, 155, 677], "text": "comments"}, {"box": [162, 665, 177, 676], "text": "to"}, {"box": [183, 665, 205, 675], "text": "the"}, {"box": [211, 663, 261, 676], "text": "Quality"}, {"box": [267, 662, 323, 676], "text": "Council."}], "linking": [[20, 22]], "id": 22}, {"box": [102, 823, 145, 838], "text": "qip . wp", "label": "other", "words": [{"box": [102, 824, 123, 837], "text": "qip"}, {"box": [124, 824, 130, 838], "text": "."}, {"box": [130, 823, 145, 837], "text": "wp"}], "linking": [], "id": 23}]}
{"form": [{"box": [76, 129, 118, 139], "text": "Brand:", "label": "question", "words": [{"box": [76, 129, 118, 139], "text": "Brand:"}], "linking": [[0, 2]], "id": 0}, {"box": [73, 141, 119, 153], "text": "Style:", "label": "question", "words": [{"box": [73, 141, 119, 153], "text": "Style:"}], "linking": [[1, 36]], "id": 1}, {"box": [145, 127, 197, 137], "text": "PHOENIX", "label": "answer", "words": [{"box": [145, 127, 197, 137], "text": "PHOENIX"}], "linking": [[0, 2]], "id": 2}, {"box": [349, 130, 409, 139], "text": "Company:", "label": "question", "words": [{"box": [349, 130, 409, 139], "text": "Company:"}], "linking": [[3, 37]], "id": 3}, {"box": [350, 142, 407, 155], "text": "Country:", "label": "question", "words": [{"box": [350, 142, 407, 155], "text": "Country:"}], "linking": [[4, 6]], "id": 4}, {"box": [350, 157, 402, 167], "text": "Macket:", "label": "question", "words": [{"box": [350, 157, 402, 167], "text": "Macket:"}], "linking": [], "id": 5}, {"box": [419, 144, 467, 154], "text": "CYPRUS", "label": "answer", "words": [{"box": [419, 144, 467, 154], "text": "CYPRUS"}], "linking": [[4, 6]], "id": 6}, {"box": [512, 171, 567, 183], "text": "NICOSIA", "label": "answer", "words": [{"box": [512, 171, 567, 183], "text": "NICOSIA"}], "linking": [[38, 7]], "id": 7}, {"box": [404, 240, 461, 255], "text": "Weights", "label": "header", "words": [{"box": [404, 240, 461, 255], "text": "Weights"}], "linking": [[8, 66], [8, 71], [8, 70], [40, 8]], "id": 8}, {"box": [377, 475, 441, 487], "text": "Adhesive:", "label": "header", "words": [{"box": [377, 475, 441, 487], "text": "Adhesive:"}], "linking": [[9, 85], [9, 86], [9, 18]], "id": 9}, {"box": [70, 488, 151, 498], "text": "Supplier(s)", "label": "question", "words": [{"box": [70, 488, 151, 498], "text": "Supplier(s)"}], "linking": [[73, 10], [10, 14]], "id": 10}, {"box": [72, 513, 109, 525], "text": "Color", "label": "question", "words": [{"box": [72, 513, 109, 525], "text": "Color"}], "linking": [[73, 11], [11, 75]], "id": 11}, {"box": [72, 557, 135, 569], "text": "Porosity", "label": "question", "words": [{"box": [72, 557, 135, 569], "text": "Porosity"}], "linking": [[73, 12], [12, 17]], "id": 12}, {"box": [73, 609, 140, 621], "text": "substance", "label": "question", "words": [{"box": [73, 609, 140, 621], "text": "substance"}], "linking": [[73, 13], [13, 81]], "id": 13}, {"box": [234, 488, 285, 500], "text": "Ecusta", "label": "answer", "words": [{"box": [234, 488, 285, 500], "text": "Ecusta"}], "linking": [[10, 14]], "id": 14}, {"box": [235, 501, 287, 514], "text": "E.30639", "label": "answer", "words": [{"box": [235, 501, 287, 514], "text": "E.30639"}], "linking": [[74, 15]], "id": 15}, {"box": [228, 543, 259, 555], "text": "None", "label": "answer", "words": [{"box": [228, 543, 259, 555], "text": "None"}], "linking": [[76, 16]], "id": 16}, {"box": [293, 558, 356, 567], "text": "(coresta)", "label": "answer", "words": [{"box": [293, 558, 356, 567], "text": "(coresta)"}], "linking": [[12, 17]], "id": 17}, {"box": [377, 515, 407, 527], "text": "Type", "label": "question", "words": [{"box": [377, 515, 407, 527], "text": "Type"}], "linking": [[9, 18], [18, 88]], "id": 18}, {"box": [377, 558, 428, 568], "text": "Overall", "label": "question", "words": [{"box": [377, 558, 428, 568], "text": "Overall"}], "linking": [[89, 19], [19, 26]], "id": 19}, {"box": [475, 558, 508, 570], "text": "skip", "label": "question", "words": [{"box": [475, 558, 508, 570], "text": "skip"}], "linking": [[89, 20]], "id": 20}, {"box": [377, 599, 443, 609], "text": "Dimension", "label": "question", "words": [{"box": [377, 599, 443, 609], "text": "Dimension"}], "linking": [[21, 92]], "id": 21}, {"box": [377, 614, 458, 624], "text": "Positioning", "label": "question", "words": [{"box": [377, 614, 458, 624], "text": "Positioning"}], "linking": [[22, 91]], "id": 22}, {"box": [476, 488, 515, 500], "text": "Swift", "label": "answer", "words": [{"box": [476, 488, 515, 500], "text": "Swift"}], "linking": [[85, 23]], "id": 23}, {"box": [554, 558, 591, 567], "text": "Other", "label": "other", "words": [{"box": [554, 558, 591, 567], "text": "Other"}], "linking": [], "id": 24}, {"box": [494, 587, 522, 596], "text": "N/A", "label": "answer", "words": [{"box": [494, 587, 522, 596], "text": "N/A"}], "linking": [[90, 25]], "id": 25}, {"box": [448, 558, 457, 567], "text": "x", "label": "answer", "words": [{"box": [448, 558, 457, 567], "text": "x"}], "linking": [[19, 26]], "id": 26}, {"box": [299, 683, 336, 693], "text": "Date:", "label": "question", "words": [{"box": [299, 683, 336, 693], "text": "Date:"}], "linking": [[27, 95]], "id": 27}, {"box": [299, 778, 333, 788], "text": "Date:", "label": "question", "words": [{"box": [299, 778, 333, 788], "text": "Date:"}], "linking": [[28, 99]], "id": 28}, {"box": [533, 829, 653, 853], "text": "620419245", "label": "other", "words": [{"box": [533, 829, 653, 853], "text": "620419245"}], "linking": [], "id": 29}, {"box": [72, 750, 108, 762], "text": "Date:", "label": "question", "words": [{"box": [72, 750, 108, 762], "text": "Date:"}], "linking": [[30, 98]], "id": 30}, {"box": [73, 777, 137, 789], "text": "Replaces:", "label": "question", "words": [{"box": [73, 777, 137, 789], "text": "Replaces:"}], "linking": [[31, 33]], "id": 31}, {"box": [72, 804, 111, 816], "text": "05045", "label": "other", "words": [{"box": [72, 804, 111, 816], "text": "05045"}], "linking": [], "id": 32}, {"box": [165, 777, 192, 789], "text": "New", "label": "answer", "words": [{"box": [165, 777, 192, 789], "text": "New"}], "linking": [[31, 33]], "id": 33}, {"box": [527, 33, 618, 48], "text": "Page 1 of 10", "label": "other", "words": [{"box": [527, 33, 557, 46], "text": "Page"}, {"box": [564, 33, 574, 46], "text": "1"}, {"box": [578, 33, 597, 48], "text": "of"}, {"box": [600, 34, 618, 46], "text": "10"}], "linking": [], "id": 34}, {"box": [210, 45, 497, 113], "text": "RESTRICTED BROWN & WILLIAMSON INTERNATIONAL TOBACCO PRODUCT SPECIFICATION", "label": "header", "words": [{"box": [286, 45, 424, 60], "text": "RESTRICTED"}, {"box": [210, 70, 246, 85], "text": "BROWN"}, {"box": [251, 72, 260, 85], "text": "&"}, {"box": [266, 72, 339, 87], "text": "WILLIAMSON"}, {"box": [341, 75, 437, 87], "text": "INTERNATIONAL"}, {"box": [439, 73, 497, 86], "text": "TOBACCO"}, {"box": [275, 100, 326, 113], "text": "PRODUCT"}, {"box": [332, 102, 428, 112], "text": "SPECIFICATION"}], "linking": [], "id": 35}, {"box": [145, 141, 208, 154], "text": "HLB- KS", "label": "answer", "words": [{"box": [145, 142, 185, 154], "text": "HLB-"}, {"box": [184, 141, 208, 154], "text": "KS"}], "linking": [[1, 36]], "id": 36}, {"box": [419, 129, 518, 144], "text": "B. A. T. CYPRUS", "label": "answer", "words": [{"box": [419, 129, 434, 144], "text": "B."}, {"box": [436, 130, 449, 140], "text": "A."}, {"box": [449, 129, 465, 142], "text": "T."}, {"box": [470, 129, 518, 139], "text": "CYPRUS"}], "linking": [[3, 37]], "id": 37}, {"box": [349, 169, 500, 182], "text": "Place of Manufacture:", "label": "question", "words": [{"box": [349, 171, 389, 181], "text": "Place"}, {"box": [392, 169, 408, 182], "text": "of"}, {"box": [413, 172, 500, 182], "text": "Manufacture:"}], "linking": [[38, 7]], "id": 38}, {"box": [75, 156, 202, 168], "text": "Licensee Ref. NO.:", "label": "question", "words": [{"box": [75, 156, 136, 168], "text": "Licensee"}, {"box": [135, 156, 168, 166], "text": "Ref."}, {"box": [175, 156, 202, 166], "text": "NO.:"}], "linking": [], "id": 39}, {"box": [73, 211, 191, 225], "text": "CIGARETTE MAKING", "label": "header", "words": [{"box": [73, 213, 142, 225], "text": "CIGARETTE"}, {"box": [145, 211, 191, 223], "text": "MAKING"}], "linking": [[40, 41], [40, 8]], "id": 40}, {"box": [73, 240, 247, 253], "text": "Physical Characteristics", "label": "header", "words": [{"box": [73, 240, 133, 250], "text": "Physical"}, {"box": [133, 241, 247, 253], "text": "Characteristics"}], "linking": [[41, 42], [41, 43], [41, 45], [41, 44], [41, 46], [41, 47], [41, 48], [41, 49], [41, 50], [41, 51], [41, 52], [41, 53], [40, 41]], "id": 41}, {"box": [73, 266, 249, 280], "text": "Overall Cigarette Length", "label": "question", "words": [{"box": [73, 266, 127, 276], "text": "Overall"}, {"box": [132, 266, 199, 278], "text": "Cigarette"}, {"box": [198, 268, 249, 280], "text": "Length"}], "linking": [[41, 42], [42, 54]], "id": 42}, {"box": [72, 280, 203, 291], "text": "Tobacco Rod Length", "label": "question", "words": [{"box": [72, 280, 127, 289], "text": "Tobacco"}, {"box": [129, 280, 156, 290], "text": "Rod"}, {"box": [154, 281, 203, 291], "text": "Length"}], "linking": [[41, 43], [43, 55]], "id": 43}, {"box": [72, 295, 203, 305], "text": "Filter Plug Length", "label": "question", "words": [{"box": [72, 296, 120, 305], "text": "Filter"}, {"box": [123, 295, 154, 305], "text": "Plug"}, {"box": [157, 295, 203, 305], "text": "Length"}], "linking": [[41, 44], [44, 56]], "id": 44}, {"box": [73, 305, 329, 320], "text": "Filter Plug Pressure Drop (unencap.)", "label": "question", "words": [{"box": [73, 308, 118, 317], "text": "Filter"}, {"box": [120, 308, 156, 317], "text": "Plug"}, {"box": [156, 305, 220, 317], "text": "Pressure"}, {"box": [222, 310, 255, 319], "text": "Drop"}, {"box": [259, 308, 329, 320], "text": "(unencap.)"}], "linking": [[41, 45], [45, 57]], "id": 45}, {"box": [72, 320, 317, 332], "text": "Filter Plug Pressure Drop encap.", "label": "question", "words": [{"box": [72, 322, 118, 332], "text": "Filter"}, {"box": [123, 320, 154, 330], "text": "Plug"}, {"box": [157, 320, 220, 330], "text": "Pressure"}, {"box": [225, 322, 255, 332], "text": "Drop"}, {"box": [257, 323, 317, 332], "text": "encap."}], "linking": [[41, 46], [46, 58]], "id": 46}, {"box": [70, 334, 240, 346], "text": "Cigarette Circumference", "label": "question", "words": [{"box": [70, 337, 140, 346], "text": "Cigarette"}, {"box": [144, 334, 240, 346], "text": "Circumference"}], "linking": [[41, 47], [47, 59]], "id": 47}, {"box": [72, 347, 287, 361], "text": "Total Pressure Drop (unencap.)", "label": "question", "words": [{"box": [72, 347, 109, 357], "text": "Total"}, {"box": [115, 349, 175, 361], "text": "Pressure"}, {"box": [177, 350, 213, 360], "text": "Drop"}, {"box": [214, 350, 287, 360], "text": "(unencap.)"}], "linking": [[41, 48], [48, 60]], "id": 48}, {"box": [73, 362, 274, 374], "text": "Total Pressure Drop (encap.)", "label": "question", "words": [{"box": [73, 362, 110, 372], "text": "Total"}, {"box": [115, 364, 175, 374], "text": "Pressure"}, {"box": [178, 364, 211, 374], "text": "Drop"}, {"box": [216, 364, 274, 374], "text": "(encap.)"}], "linking": [[41, 49], [49, 61]], "id": 49}, {"box": [67, 377, 175, 387], "text": "Tipping Length", "label": "question", "words": [{"box": [67, 377, 125, 387], "text": "Tipping"}, {"box": [130, 377, 175, 386], "text": "Length"}], "linking": [[41, 50], [50, 62]], "id": 50}, {"box": [72, 391, 300, 402], "text": "Print Position (from filter end)", "label": "question", "words": [{"box": [72, 391, 111, 401], "text": "Print"}, {"box": [114, 391, 178, 401], "text": "Position"}, {"box": [178, 391, 218, 401], "text": "(from"}, {"box": [222, 392, 268, 402], "text": "filter"}, {"box": [269, 392, 300, 402], "text": "end)"}], "linking": [[41, 51], [51, 63]], "id": 51}, {"box": [75, 404, 280, 417], "text": "Moisture content (ex-catcher)", "label": "question", "words": [{"box": [75, 404, 133, 417], "text": "Moisture"}, {"box": [135, 406, 192, 415], "text": "content"}, {"box": [193, 404, 280, 416], "text": "(ex-catcher)"}], "linking": [[41, 52], [52, 64]], "id": 52}, {"box": [73, 419, 238, 431], "text": "Filter ventilation Rate", "label": "question", "words": [{"box": [73, 419, 119, 428], "text": "Filter"}, {"box": [120, 421, 204, 430], "text": "ventilation"}, {"box": [208, 421, 238, 431], "text": "Rate"}], "linking": [[41, 53], [53, 65]], "id": 53}, {"box": [350, 268, 395, 280], "text": "84 mm", "label": "answer", "words": [{"box": [350, 268, 365, 280], "text": "84"}, {"box": [377, 271, 395, 278], "text": "mm"}], "linking": [[42, 54]], "id": 54}, {"box": [347, 280, 395, 293], "text": "64 mm", "label": "answer", "words": [{"box": [347, 280, 365, 292], "text": "64"}, {"box": [377, 283, 395, 293], "text": "mm"}], "linking": [[43, 55]], "id": 55}, {"box": [349, 296, 396, 307], "text": "20 mm", "label": "answer", "words": [{"box": [349, 296, 365, 306], "text": "20"}, {"box": [377, 298, 396, 307], "text": "mm"}], "linking": [[44, 56]], "id": 56}, {"box": [347, 308, 397, 320], "text": "56 mm", "label": "answer", "words": [{"box": [347, 308, 366, 320], "text": "56"}, {"box": [376, 311, 397, 320], "text": "mm"}], "linking": [[45, 57]], "id": 57}, {"box": [346, 322, 397, 334], "text": "56 mm", "label": "answer", "words": [{"box": [346, 322, 365, 334], "text": "56"}, {"box": [376, 325, 397, 332], "text": "mm"}], "linking": [[46, 58]], "id": 58}, {"box": [343, 337, 393, 347], "text": "24.75 mm", "label": "answer", "words": [{"box": [343, 337, 382, 347], "text": "24.75"}, {"box": [380, 338, 393, 347], "text": "mm"}], "linking": [[47, 59]], "id": 59}, {"box": [349, 349, 395, 361], "text": "90 mm", "label": "answer", "words": [{"box": [349, 349, 367, 359], "text": "90"}, {"box": [377, 349, 395, 361], "text": "mm"}], "linking": [[48, 60]], "id": 60}, {"box": [343, 362, 394, 374], "text": "110 mm", "label": "answer", "words": [{"box": [343, 362, 365, 374], "text": "110"}, {"box": [376, 364, 394, 373], "text": "mm"}], "linking": [[49, 61]], "id": 61}, {"box": [350, 377, 396, 391], "text": "25 mm", "label": "answer", "words": [{"box": [350, 377, 365, 387], "text": "25"}, {"box": [377, 379, 396, 391], "text": "mm"}], "linking": [[50, 62]], "id": 62}, {"box": [349, 392, 395, 402], "text": "27 mm", "label": "answer", "words": [{"box": [349, 392, 365, 402], "text": "27"}, {"box": [376, 392, 395, 402], "text": "mm"}], "linking": [[51, 63]], "id": 63}, {"box": [343, 404, 386, 416], "text": "13.5 %", "label": "answer", "words": [{"box": [343, 404, 373, 416], "text": "13.5"}, {"box": [379, 404, 386, 414], "text": "%"}], "linking": [[52, 64]], "id": 64}, {"box": [347, 416, 386, 430], "text": "Nil %", "label": "answer", "words": [{"box": [347, 418, 374, 430], "text": "Nil"}, {"box": [377, 416, 386, 428], "text": "%"}], "linking": [[53, 65]], "id": 65}, {"box": [407, 265, 513, 280], "text": "Total Cigt. Wt.", "label": "question", "words": [{"box": [407, 268, 443, 280], "text": "Total"}, {"box": [449, 265, 486, 278], "text": "Cigt."}, {"box": [488, 266, 513, 278], "text": "Wt."}], "linking": [[8, 66], [66, 67]], "id": 66}, {"box": [551, 266, 640, 281], "text": "974 mg", "label": "answer", "words": [{"box": [551, 266, 578, 279], "text": "974"}, {"box": [618, 269, 640, 281], "text": "mg"}], "linking": [[66, 67]], "id": 67}, {"box": [557, 295, 636, 308], "text": "749 mg", "label": "answer", "words": [{"box": [557, 295, 582, 307], "text": "749"}, {"box": [618, 296, 636, 308], "text": "mg"}], "linking": [[71, 68]], "id": 68}, {"box": [555, 320, 636, 335], "text": "245 mg/cc", "label": "answer", "words": [{"box": [555, 322, 576, 335], "text": "245"}, {"box": [599, 320, 636, 335], "text": "mg/cc"}], "linking": [[70, 69]], "id": 69}, {"box": [404, 320, 552, 334], "text": "Net Tob. Rod Density", "label": "question", "words": [{"box": [404, 322, 429, 334], "text": "Net"}, {"box": [433, 320, 463, 332], "text": "Tob."}, {"box": [467, 322, 494, 334], "text": "Rod"}, {"box": [497, 323, 552, 332], "text": "Density"}], "linking": [[8, 70], [70, 69]], "id": 70}, {"box": [404, 295, 515, 308], "text": "Net Net Tobacco", "label": "question", "words": [{"box": [404, 295, 429, 304], "text": "Net"}, {"box": [434, 295, 458, 305], "text": "Net"}, {"box": [463, 296, 515, 308], "text": "Tobacco"}], "linking": [[8, 71], [71, 68]], "id": 71}, {"box": [75, 445, 293, 460], "text": "Tipping and Tipping Application", "label": "question", "words": [{"box": [75, 445, 126, 460], "text": "Tipping"}, {"box": [127, 448, 152, 458], "text": "and"}, {"box": [157, 446, 211, 459], "text": "Tipping"}, {"box": [214, 448, 293, 460], "text": "Application"}], "linking": [], "id": 72}, {"box": [73, 473, 172, 486], "text": "Tipping Paper:", "label": "header", "words": [{"box": [73, 473, 124, 486], "text": "Tipping"}, {"box": [129, 475, 172, 484], "text": "Paper:"}], "linking": [[73, 10], [73, 74], [73, 11], [73, 76], [73, 12], [73, 77], [73, 79], [73, 80], [73, 13]], "id": 73}, {"box": [72, 501, 216, 513], "text": "Supplier Code No(s).", "label": "question", "words": [{"box": [72, 503, 133, 513], "text": "Supplier"}, {"box": [135, 501, 166, 513], "text": "Code"}, {"box": [171, 501, 216, 513], "text": "No(s)."}], "linking": [[73, 74], [74, 15]], "id": 74}, {"box": [222, 516, 323, 525], "text": "Imitation Cork", "label": "answer", "words": [{"box": [222, 516, 288, 525], "text": "Imitation"}, {"box": [292, 516, 323, 525], "text": "Cork"}], "linking": [[11, 75]], "id": 75}, {"box": [72, 528, 204, 554], "text": "Perforation Type and No. of lines", "label": "question", "words": [{"box": [72, 528, 153, 541], "text": "Perforation"}, {"box": [156, 530, 190, 540], "text": "Type"}, {"box": [87, 543, 112, 553], "text": "and"}, {"box": [115, 543, 137, 553], "text": "No."}, {"box": [142, 542, 158, 554], "text": "of"}, {"box": [165, 543, 204, 553], "text": "lines"}], "linking": [[73, 76], [76, 16]], "id": 76}, {"box": [75, 570, 196, 582], "text": "Print Description", "label": "question", "words": [{"box": [75, 570, 111, 580], "text": "Print"}, {"box": [115, 572, 196, 582], "text": "Description"}], "linking": [[73, 77], [77, 78]], "id": 77}, {"box": [213, 572, 324, 584], "text": "Brown on yellow", "label": "answer", "words": [{"box": [213, 572, 253, 582], "text": "Brown"}, {"box": [256, 572, 275, 582], "text": "on"}, {"box": [278, 572, 324, 584], "text": "yellow"}], "linking": [[77, 78]], "id": 78}, {"box": [73, 585, 163, 595], "text": "Bobbin Width", "label": "question", "words": [{"box": [73, 585, 118, 595], "text": "Bobbin"}, {"box": [120, 585, 163, 594], "text": "Width"}], "linking": [[73, 79], [79, 82]], "id": 79}, {"box": [73, 596, 169, 608], "text": "Robbin Length", "label": "question", "words": [{"box": [73, 597, 118, 607], "text": "Robbin"}, {"box": [124, 596, 169, 608], "text": "Length"}], "linking": [[73, 80], [80, 83]], "id": 80}, {"box": [234, 612, 359, 625], "text": "36 gm/ m2", "label": "answer", "words": [{"box": [234, 612, 255, 625], "text": "36"}, {"box": [320, 612, 336, 625], "text": "gm/"}, {"box": [335, 612, 359, 625], "text": "m2"}], "linking": [[13, 81]], "id": 81}, {"box": [229, 584, 366, 597], "text": "50 mm mm", "label": "answer", "words": [{"box": [229, 584, 244, 596], "text": "50"}, {"box": [250, 585, 268, 597], "text": "mm"}, {"box": [347, 587, 366, 597], "text": "mm"}], "linking": [[79, 82]], "id": 82}, {"box": [229, 599, 358, 612], "text": "2700 m", "label": "answer", "words": [{"box": [229, 599, 263, 609], "text": "2700"}, {"box": [349, 600, 358, 612], "text": "m"}], "linking": [[80, 83]], "id": 83}, {"box": [73, 638, 301, 651], "text": "(Indicate N/A If Not Applicable)", "label": "other", "words": [{"box": [73, 639, 139, 651], "text": "(Indicate"}, {"box": [142, 639, 167, 649], "text": "N/A"}, {"box": [172, 639, 188, 651], "text": "If"}, {"box": [192, 638, 217, 651], "text": "Not"}, {"box": [222, 639, 301, 651], "text": "Applicable)"}], "linking": [], "id": 84}, {"box": [377, 488, 456, 502], "text": "Supplier (s)", "label": "question", "words": [{"box": [377, 490, 437, 502], "text": "Supplier"}, {"box": [437, 488, 456, 501], "text": "(s)"}], "linking": [[9, 85], [85, 23]], "id": 85}, {"box": [376, 501, 521, 514], "text": "Supplier Code No (s)", "label": "question", "words": [{"box": [376, 501, 437, 514], "text": "Supplier"}, {"box": [439, 504, 472, 514], "text": "Code"}, {"box": [475, 501, 493, 513], "text": "No"}, {"box": [493, 501, 521, 513], "text": "(s)"}], "linking": [[9, 86], [86, 87]], "id": 86}, {"box": [527, 501, 585, 514], "text": "T.K. 9220", "label": "answer", "words": [{"box": [527, 501, 555, 514], "text": "T.K."}, {"box": [557, 501, 585, 513], "text": "9220"}], "linking": [[86, 87]], "id": 87}, {"box": [418, 515, 580, 525], "text": "Printed Imitation cork", "label": "answer", "words": [{"box": [418, 515, 472, 525], "text": "Printed"}, {"box": [475, 518, 545, 525], "text": "Imitation"}, {"box": [546, 515, 580, 525], "text": "cork"}], "linking": [[18, 88]], "id": 88}, {"box": [374, 543, 521, 556], "text": "Application Pattern:", "label": "header", "words": [{"box": [374, 543, 456, 556], "text": "Application"}, {"box": [461, 545, 521, 555], "text": "Pattern:"}], "linking": [[89, 19], [89, 20]], "id": 89}, {"box": [377, 585, 482, 597], "text": "Glue Pree Area", "label": "question", "words": [{"box": [377, 585, 407, 597], "text": "Glue"}, {"box": [412, 587, 443, 597], "text": "Pree"}, {"box": [448, 588, 482, 597], "text": "Area"}], "linking": [[90, 25]], "id": 90}, {"box": [510, 614, 636, 624], "text": "mm from mouth end", "label": "answer", "words": [{"box": [510, 614, 528, 624], "text": "mm"}, {"box": [533, 614, 566, 624], "text": "from"}, {"box": [567, 614, 606, 623], "text": "mouth"}, {"box": [609, 615, 636, 622], "text": "end"}], "linking": [[22, 91]], "id": 91}, {"box": [510, 599, 630, 611], "text": "mm x mm", "label": "answer", "words": [{"box": [510, 599, 526, 611], "text": "mm"}, {"box": [539, 600, 549, 609], "text": "x"}, {"box": [609, 599, 630, 608], "text": "mm"}], "linking": [[21, 92]], "id": 92}, {"box": [299, 656, 388, 666], "text": "Prepared by:", "label": "question", "words": [{"box": [299, 656, 357, 666], "text": "Prepared"}, {"box": [361, 656, 388, 666], "text": "by:"}], "linking": [[93, 94]], "id": 93}, {"box": [419, 656, 544, 668], "text": "M. HAMERTON / enm", "label": "answer", "words": [{"box": [419, 656, 435, 668], "text": "M."}, {"box": [437, 656, 501, 666], "text": "HAMERTON"}, {"box": [504, 656, 513, 666], "text": "/"}, {"box": [516, 657, 544, 666], "text": "enm"}], "linking": [[93, 94]], "id": 94}, {"box": [419, 680, 498, 693], "text": "May 1, 1985", "label": "answer", "words": [{"box": [419, 680, 441, 693], "text": "May"}, {"box": [451, 681, 463, 693], "text": "1,"}, {"box": [470, 681, 498, 693], "text": "1985"}], "linking": [[27, 95]], "id": 95}, {"box": [299, 710, 388, 721], "text": "Approved by:", "label": "question", "words": [{"box": [299, 711, 357, 721], "text": "Approved"}, {"box": [361, 710, 388, 720], "text": "by:"}], "linking": [[96, 97]], "id": 96}, {"box": [391, 723, 627, 762], "text": "Director of Technical Operations, Brown & Williamson International Tobacco", "label": "answer", "words": [{"box": [391, 725, 449, 735], "text": "Director"}, {"box": [455, 725, 473, 734], "text": "of"}, {"box": [475, 723, 544, 735], "text": "Technical"}, {"box": [543, 725, 627, 735], "text": "Operations,"}, {"box": [391, 738, 428, 748], "text": "Brown"}, {"box": [433, 737, 445, 750], "text": "&"}, {"box": [448, 737, 524, 749], "text": "Williamson"}, {"box": [521, 737, 621, 750], "text": "International"}, {"box": [469, 753, 523, 762], "text": "Tobacco"}], "linking": [[96, 97]], "id": 97}, {"box": [139, 747, 226, 764], "text": "May 1, 1985", "label": "answer", "words": [{"box": [139, 749, 166, 764], "text": "May"}, {"box": [169, 750, 188, 762], "text": "1,"}, {"box": [192, 747, 226, 762], "text": "1985"}], "linking": [[30, 98]], "id": 98}, {"box": [410, 778, 493, 792], "text": "May 1, 1985", "label": "answer", "words": [{"box": [410, 780, 437, 792], "text": "May"}, {"box": [439, 778, 457, 790], "text": "1,"}, {"box": [463, 780, 493, 790], "text": "1985"}], "linking": [[28, 99]], "id": 99}]}
{"form": [{"box": [61, 207, 97, 221], "text": "DATE:", "label": "question", "words": [{"box": [61, 207, 97, 221], "text": "DATE:"}], "linking": [[0, 16]], "id": 0}, {"box": [61, 235, 129, 249], "text": "INITIATED", "label": "question", "words": [{"box": [61, 235, 129, 249], "text": "INITIATED"}], "linking": [[1, 17]], "id": 1}, {"box": [134, 236, 156, 250], "text": "BY:", "label": "question", "words": [{"box": [134, 236, 156, 250], "text": "BY:"}], "linking": [[2, 17]], "id": 2}, {"box": [60, 261, 138, 276], "text": "COMPLETION", "label": "question", "words": [{"box": [60, 261, 138, 276], "text": "COMPLETION"}], "linking": [], "id": 3}, {"box": [59, 320, 119, 337], "text": "COUNTRY:", "label": "question", "words": [{"box": [59, 320, 119, 337], "text": "COUNTRY:"}], "linking": [[4, 6]], "id": 4}, {"box": [59, 348, 119, 363], "text": "PRODUCT:", "label": "question", "words": [{"box": [59, 348, 119, 363], "text": "PRODUCT:"}], "linking": [[5, 20]], "id": 5}, {"box": [191, 321, 247, 335], "text": "BELGIUM", "label": "answer", "words": [{"box": [191, 321, 247, 335], "text": "BELGIUM"}], "linking": [[4, 6]], "id": 6}, {"box": [56, 549, 80, 562], "text": "BY:", "label": "question", "words": [{"box": [56, 549, 80, 562], "text": "BY:"}], "linking": [], "id": 7}, {"box": [56, 591, 92, 604], "text": "DATE:", "label": "question", "words": [{"box": [56, 591, 92, 604], "text": "DATE:"}], "linking": [], "id": 8}, {"box": [54, 626, 100, 639], "text": "NOTES:", "label": "question", "words": [{"box": [54, 626, 100, 639], "text": "NOTES:"}], "linking": [[9, 25], [9, 26], [9, 27]], "id": 9}, {"box": [501, 839, 623, 871], "text": "620429480", "label": "other", "words": [{"box": [501, 839, 623, 871], "text": "620429480"}], "linking": [], "id": 10}, {"box": [527, 162, 621, 189], "text": "RECEIVED", "label": "question", "words": [{"box": [527, 162, 621, 189], "text": "RECEIVED"}], "linking": [[11, 30]], "id": 11}, {"box": [214, 94, 455, 140], "text": "SERVICE REQUEST FROM R & D BY INTERNATIONAL LICENSEE OPERATIONS", "label": "header", "words": [{"box": [237, 94, 289, 109], "text": "SERVICE"}, {"box": [293, 95, 346, 108], "text": "REQUEST"}, {"box": [352, 95, 384, 108], "text": "FROM"}, {"box": [388, 94, 396, 109], "text": "R"}, {"box": [397, 95, 404, 109], "text": "&"}, {"box": [402, 96, 412, 107], "text": "D"}, {"box": [418, 96, 435, 107], "text": "BY"}, {"box": [214, 122, 310, 139], "text": "INTERNATIONAL"}, {"box": [314, 122, 377, 140], "text": "LICENSEE"}, {"box": [381, 123, 455, 138], "text": "OPERATIONS"}], "linking": [], "id": 12}, {"box": [563, 11, 667, 51], "text": "", "label": "other", "words": [{"box": [596, 11, 667, 42], "text": ""}, {"box": [563, 38, 585, 51], "text": ""}], "linking": [], "id": 13}, {"box": [60, 177, 149, 192], "text": "REQUEST NO.:", "label": "question", "words": [{"box": [60, 177, 116, 191], "text": "REQUEST"}, {"box": [120, 179, 149, 192], "text": "NO.:"}], "linking": [[14, 15]], "id": 14}, {"box": [196, 177, 232, 194], "text": "25- 84", "label": "answer", "words": [{"box": [196, 177, 217, 194], "text": "25-"}, {"box": [215, 179, 232, 193], "text": "84"}], "linking": [[14, 15]], "id": 15}, {"box": [191, 207, 299, 222], "text": "March 27, 1984", "label": "answer", "words": [{"box": [191, 207, 233, 221], "text": "March"}, {"box": [237, 207, 258, 222], "text": "27,"}, {"box": [267, 207, 299, 221], "text": "1984"}], "linking": [[0, 16]], "id": 16}, {"box": [193, 221, 346, 252], "text": "P. H. HARPER PHH", "label": "answer", "words": [{"box": [193, 235, 207, 250], "text": "P."}, {"box": [215, 235, 230, 250], "text": "H."}, {"box": [236, 235, 282, 252], "text": "HARPER"}, {"box": [297, 221, 346, 252], "text": "PHH"}], "linking": [[1, 17], [2, 17]], "id": 17}, {"box": [74, 292, 164, 307], "text": "TARGET DATE:", "label": "question", "words": [{"box": [74, 292, 120, 307], "text": "TARGET"}, {"box": [126, 292, 164, 307], "text": "DATE:"}], "linking": [[18, 19]], "id": 18}, {"box": [191, 292, 296, 308], "text": "April 13, 1984", "label": "answer", "words": [{"box": [191, 293, 230, 308], "text": "April"}, {"box": [237, 292, 259, 307], "text": "13,"}, {"box": [265, 293, 296, 307], "text": "1984"}], "linking": [[18, 19]], "id": 19}, {"box": [193, 348, 422, 365], "text": "LUCKY STRIKE Filter and VICEROY", "label": "answer", "words": [{"box": [193, 349, 231, 363], "text": "LUCKY"}, {"box": [236, 349, 281, 364], "text": "STRIKE"}, {"box": [286, 348, 332, 365], "text": "Filter"}, {"box": [337, 352, 364, 363], "text": "and"}, {"box": [366, 349, 422, 364], "text": "VICEROY"}], "linking": [[5, 20]], "id": 20}, {"box": [59, 377, 167, 393], "text": "NATURE OF WORK:", "label": "question", "words": [{"box": [59, 378, 106, 393], "text": "NATURE"}, {"box": [110, 377, 125, 391], "text": "OF"}, {"box": [128, 378, 167, 392], "text": "WORK:"}], "linking": [[21, 22]], "id": 21}, {"box": [168, 404, 527, 437], "text": "Advise if locally obtained Yucatan Honey (sample enclosed) is an acceptable substitute for HALWAY.", "label": "answer", "words": [{"box": [168, 405, 215, 420], "text": "Advise"}, {"box": [221, 406, 238, 419], "text": "if"}, {"box": [243, 404, 295, 421], "text": "locally"}, {"box": [300, 408, 361, 422], "text": "obtained"}, {"box": [366, 406, 420, 421], "text": "Yucatan"}, {"box": [423, 406, 464, 421], "text": "Honey"}, {"box": [471, 408, 523, 422], "text": "(sample"}, {"box": [168, 422, 235, 433], "text": "enclosed)"}, {"box": [243, 423, 260, 434], "text": "is"}, {"box": [264, 423, 281, 433], "text": "an"}, {"box": [285, 422, 360, 436], "text": "acceptable"}, {"box": [366, 423, 440, 437], "text": "substitute"}, {"box": [446, 423, 470, 436], "text": "for"}, {"box": [475, 425, 527, 436], "text": "HALWAY."}], "linking": [[21, 22]], "id": 22}, {"box": [56, 462, 153, 477], "text": "R & D COMMENTS:", "label": "question", "words": [{"box": [56, 462, 67, 476], "text": "R"}, {"box": [67, 464, 73, 477], "text": "&"}, {"box": [73, 464, 81, 475], "text": "D"}, {"box": [87, 462, 153, 476], "text": "COMMENTS:"}], "linking": [[23, 24]], "id": 23}, {"box": [183, 465, 416, 540], "text": "Target the P A 29Mar 84", "label": "answer", "words": [{"box": [183, 472, 251, 501], "text": "Target"}, {"box": [261, 468, 306, 490], "text": "the"}, {"box": [324, 465, 358, 486], "text": ""}, {"box": [197, 501, 238, 540], "text": "P"}, {"box": [235, 508, 259, 529], "text": ""}, {"box": [260, 501, 294, 530], "text": "A"}, {"box": [323, 497, 382, 521], "text": "29Mar"}, {"box": [384, 489, 416, 517], "text": "84"}], "linking": [[23, 24]], "id": 24}, {"box": [182, 626, 575, 641], "text": "a) Nature of work should be specified in exact terms.", "label": "answer", "words": [{"box": [182, 626, 195, 639], "text": "a)"}, {"box": [209, 626, 255, 640], "text": "Nature"}, {"box": [261, 627, 278, 638], "text": "of"}, {"box": [282, 627, 313, 640], "text": "work"}, {"box": [318, 626, 365, 641], "text": "should"}, {"box": [370, 627, 385, 641], "text": "be"}, {"box": [392, 627, 459, 641], "text": "specified"}, {"box": [464, 627, 481, 641], "text": "in"}, {"box": [486, 628, 525, 641], "text": "exact"}, {"box": [532, 628, 575, 641], "text": "terms."}], "linking": [[9, 25]], "id": 25}, {"box": [180, 652, 547, 681], "text": "b) R & D should advise if completion date cannot be met.", "label": "answer", "words": [{"box": [180, 652, 194, 667], "text": "b)"}, {"box": [209, 655, 219, 666], "text": "R"}, {"box": [218, 655, 225, 666], "text": "&"}, {"box": [223, 656, 234, 667], "text": "D"}, {"box": [237, 655, 284, 668], "text": "should"}, {"box": [289, 656, 336, 667], "text": "advise"}, {"box": [342, 655, 357, 668], "text": "if"}, {"box": [363, 656, 438, 670], "text": "completion"}, {"box": [443, 655, 474, 670], "text": "date"}, {"box": [479, 658, 525, 669], "text": "cannot"}, {"box": [529, 656, 547, 669], "text": "be"}, {"box": [208, 670, 240, 681], "text": "met."}], "linking": [[9, 26]], "id": 26}, {"box": [179, 697, 532, 740], "text": "c) Two copies of this form to be sent to R & D by initiator and R & D is to return to T. O. one completed copy.", "label": "answer", "words": [{"box": [179, 698, 196, 711], "text": "c)"}, {"box": [209, 700, 234, 708], "text": "Two"}, {"box": [240, 698, 282, 711], "text": "copies"}, {"box": [289, 698, 306, 711], "text": "of"}, {"box": [313, 698, 342, 711], "text": "this"}, {"box": [349, 698, 378, 712], "text": "form"}, {"box": [385, 698, 400, 711], "text": "to"}, {"box": [405, 700, 423, 711], "text": "be"}, {"box": [429, 700, 458, 711], "text": "sent"}, {"box": [466, 700, 481, 711], "text": "to"}, {"box": [487, 698, 495, 712], "text": "R"}, {"box": [494, 700, 501, 711], "text": "&"}, {"box": [501, 698, 511, 711], "text": "D"}, {"box": [514, 697, 532, 712], "text": "by"}, {"box": [209, 711, 277, 728], "text": "initiator"}, {"box": [282, 714, 306, 725], "text": "and"}, {"box": [311, 712, 321, 725], "text": "R"}, {"box": [320, 714, 327, 725], "text": "&"}, {"box": [325, 712, 335, 723], "text": "D"}, {"box": [341, 714, 358, 725], "text": "is"}, {"box": [363, 714, 377, 725], "text": "to"}, {"box": [384, 714, 430, 727], "text": "return"}, {"box": [436, 714, 451, 727], "text": "to"}, {"box": [457, 712, 471, 725], "text": "T."}, {"box": [471, 712, 486, 723], "text": "O."}, {"box": [492, 715, 520, 726], "text": "one"}, {"box": [209, 726, 277, 739], "text": "completed"}, {"box": [284, 726, 318, 740], "text": "copy."}], "linking": [[9, 27]], "id": 27}, {"box": [53, 751, 101, 767], "text": "MH/ enm", "label": "other", "words": [{"box": [53, 751, 78, 766], "text": "MH/"}, {"box": [77, 756, 101, 767], "text": "enm"}], "linking": [], "id": 28}, {"box": [53, 796, 115, 824], "text": "0036/ (r) # 2894M", "label": "other", "words": [{"box": [53, 796, 92, 809], "text": "0036/"}, {"box": [91, 797, 115, 808], "text": "(r)"}, {"box": [54, 811, 62, 822], "text": "#"}, {"box": [61, 811, 102, 824], "text": "2894M"}], "linking": [], "id": 29}, {"box": [531, 193, 623, 248], "text": "APR 2 1984 P. H. H.", "label": "answer", "words": [{"box": [531, 193, 563, 214], "text": "APR"}, {"box": [577, 194, 590, 215], "text": "2"}, {"box": [594, 194, 623, 212], "text": "1984"}, {"box": [545, 226, 565, 247], "text": "P."}, {"box": [564, 226, 582, 248], "text": "H."}, {"box": [582, 229, 600, 247], "text": "H."}], "linking": [[11, 30]], "id": 30}]}
{"form": [{"box": [221, 71, 264, 89], "text": "B&W", "label": "header", "words": [{"box": [221, 71, 264, 89], "text": "B&W"}], "linking": [], "id": 0}, {"box": [221, 41, 263, 70], "text": "", "label": "other", "words": [{"box": [221, 41, 263, 70], "text": ""}], "linking": [], "id": 1}, {"box": [377, 366, 416, 380], "text": "WCC", "label": "answer", "words": [{"box": [377, 366, 416, 380], "text": "WCC"}], "linking": [[8, 2]], "id": 2}, {"box": [697, 796, 721, 927], "text": "621800455", "label": "other", "words": [{"box": [697, 796, 721, 927], "text": "621800455"}], "linking": [], "id": 3}, {"box": [511, 50, 730, 82], "text": "Reconstituted Tobacco Leaf Substitutions Export Formulas", "label": "other", "words": [{"box": [511, 50, 584, 65], "text": "Reconstituted"}, {"box": [587, 52, 630, 66], "text": "Tobacco"}, {"box": [631, 53, 659, 66], "text": "Leaf"}, {"box": [661, 56, 728, 66], "text": "Substitutions"}, {"box": [634, 68, 672, 81], "text": "Export"}, {"box": [676, 68, 730, 82], "text": "Formulas"}], "linking": [], "id": 4}, {"box": [601, 84, 678, 95], "text": "Revision Date:", "label": "question", "words": [{"box": [601, 84, 648, 95], "text": "Revision"}, {"box": [649, 84, 678, 95], "text": "Date:"}], "linking": [], "id": 5}, {"box": [254, 154, 510, 194], "text": "Allowable Grade Substitutions for Export CPCL", "label": "header", "words": [{"box": [254, 154, 338, 171], "text": "Allowable"}, {"box": [344, 154, 393, 172], "text": "Grade"}, {"box": [398, 154, 510, 174], "text": "Substitutions"}, {"box": [313, 175, 338, 193], "text": "for"}, {"box": [344, 176, 400, 194], "text": "Export"}, {"box": [404, 177, 453, 192], "text": "CPCL"}], "linking": [], "id": 6}, {"box": [148, 253, 331, 274], "text": "Standard Grade Mark", "label": "question", "words": [{"box": [148, 253, 223, 271], "text": "Standard"}, {"box": [229, 254, 281, 272], "text": "Grade"}, {"box": [284, 257, 331, 274], "text": "Mark"}], "linking": [[7, 9], [7, 10], [7, 11], [7, 12], [7, 13], [7, 14], [7, 15]], "id": 7}, {"box": [412, 257, 609, 278], "text": "Allowable Substitutions", "label": "question", "words": [{"box": [412, 257, 492, 277], "text": "Allowable"}, {"box": [499, 258, 609, 278], "text": "Substitutions"}], "linking": [[8, 16], [8, 17], [8, 2], [8, 18], [8, 19], [8, 20], [8, 21], [8, 22], [8, 23], [8, 24], [8, 25], [8, 26], [8, 27], [8, 28], [8, 29], [8, 30]], "id": 8}, {"box": [108, 282, 286, 305], "text": "PCFS Flue cured fines", "label": "answer", "words": [{"box": [108, 282, 149, 300], "text": "PCFS"}, {"box": [175, 286, 204, 303], "text": "Flue"}, {"box": [208, 288, 249, 303], "text": "cured"}, {"box": [251, 288, 286, 305], "text": "fines"}], "linking": [[7, 9]], "id": 9}, {"box": [108, 328, 256, 349], "text": "PCBS Burley fines", "label": "answer", "words": [{"box": [108, 328, 149, 345], "text": "PCBS"}, {"box": [176, 332, 217, 349], "text": "Burley"}, {"box": [221, 332, 256, 349], "text": "fines"}], "linking": [[7, 10]], "id": 10}, {"box": [105, 406, 306, 428], "text": "MC- 4 Manufacturing fines", "label": "answer", "words": [{"box": [105, 406, 133, 419], "text": "MC-"}, {"box": [131, 406, 142, 419], "text": "4"}, {"box": [173, 408, 268, 428], "text": "Manufacturing"}, {"box": [274, 409, 306, 426], "text": "fines"}], "linking": [[7, 11]], "id": 11}, {"box": [102, 542, 243, 559], "text": "MC -6 Stem Meal", "label": "answer", "words": [{"box": [102, 542, 124, 557], "text": "MC"}, {"box": [124, 543, 138, 557], "text": "-6"}, {"box": [170, 546, 205, 559], "text": "Stem"}, {"box": [207, 546, 243, 559], "text": "Meal"}], "linking": [[7, 12]], "id": 12}, {"box": [101, 588, 244, 605], "text": "MC -7 Winnowers", "label": "answer", "words": [{"box": [101, 588, 123, 605], "text": "MC"}, {"box": [124, 591, 138, 605], "text": "-7"}, {"box": [169, 589, 244, 604], "text": "Winnowers"}], "linking": [[7, 13]], "id": 13}, {"box": [99, 634, 308, 654], "text": "RXF Fine flue cured stem", "label": "answer", "words": [{"box": [99, 634, 131, 648], "text": "RXF"}, {"box": [168, 635, 197, 650], "text": "Fine"}, {"box": [201, 637, 225, 652], "text": "flue"}, {"box": [230, 638, 268, 652], "text": "cured"}, {"box": [274, 640, 308, 654], "text": "stem"}], "linking": [[7, 14]], "id": 14}, {"box": [98, 742, 280, 761], "text": "RBF Fine Burely stem", "label": "answer", "words": [{"box": [98, 742, 129, 757], "text": "RBF"}, {"box": [166, 743, 194, 758], "text": "Fine"}, {"box": [200, 744, 242, 761], "text": "Burely"}, {"box": [246, 747, 280, 760], "text": "stem"}], "linking": [[7, 15]], "id": 15}, {"box": [378, 291, 522, 307], "text": "RPCFS or RPCFS-O ", "label": "answer", "words": [{"box": [378, 291, 432, 306], "text": "RPCFS"}, {"box": [437, 293, 450, 307], "text": "or"}, {"box": [455, 291, 511, 306], "text": "RPCFS-O"}, {"box": [511, 292, 522, 306], "text": ""}], "linking": [[8, 16]], "id": 16}, {"box": [378, 337, 523, 354], "text": "RPCBS OT RPCBS- O", "label": "answer", "words": [{"box": [378, 337, 431, 352], "text": "RPCBS"}, {"box": [437, 339, 451, 352], "text": "OT"}, {"box": [454, 337, 511, 354], "text": "RPCBS-"}, {"box": [513, 338, 523, 353], "text": "O"}], "linking": [[8, 17]], "id": 17}, {"box": [377, 411, 430, 429], "text": "MC -4 -S", "label": "answer", "words": [{"box": [377, 411, 402, 428], "text": "MC"}, {"box": [401, 412, 414, 427], "text": "-4"}, {"box": [415, 411, 430, 429], "text": "-S"}], "linking": [[8, 18]], "id": 18}, {"box": [378, 439, 441, 457], "text": "MC -4 -PH", "label": "answer", "words": [{"box": [378, 439, 399, 457], "text": "MC"}, {"box": [399, 440, 413, 457], "text": "-4"}, {"box": [413, 440, 441, 457], "text": "-PH"}], "linking": [[8, 19]], "id": 19}, {"box": [376, 471, 440, 486], "text": "MC -4 -RC", "label": "answer", "words": [{"box": [376, 471, 400, 486], "text": "MC"}, {"box": [399, 471, 413, 485], "text": "-4"}, {"box": [413, 471, 440, 486], "text": "-RC"}], "linking": [[8, 20]], "id": 20}, {"box": [376, 500, 434, 517], "text": "MC -4 -W", "label": "answer", "words": [{"box": [376, 501, 400, 516], "text": "MC"}, {"box": [399, 501, 412, 515], "text": "-4"}, {"box": [413, 500, 434, 517], "text": "-W"}], "linking": [[8, 21]], "id": 21}, {"box": [374, 547, 411, 564], "text": "MC -1", "label": "answer", "words": [{"box": [374, 547, 396, 562], "text": "MC"}, {"box": [397, 547, 411, 564], "text": "-1"}], "linking": [[8, 22]], "id": 22}, {"box": [374, 594, 425, 609], "text": "C Stem", "label": "answer", "words": [{"box": [374, 594, 385, 608], "text": "C"}, {"box": [390, 595, 425, 609], "text": "Stem"}], "linking": [[8, 23]], "id": 23}, {"box": [374, 638, 494, 656], "text": "RRXF or RRXF -O", "label": "answer", "words": [{"box": [374, 638, 415, 655], "text": "RRXF"}, {"box": [419, 642, 433, 655], "text": "or"}, {"box": [437, 641, 478, 656], "text": "RRXF"}, {"box": [479, 641, 494, 656], "text": "-O"}], "linking": [[8, 24]], "id": 24}, {"box": [372, 670, 433, 684], "text": "RRXM -B", "label": "answer", "words": [{"box": [372, 670, 417, 684], "text": "RRXM"}, {"box": [418, 670, 433, 684], "text": "-B"}], "linking": [[8, 25]], "id": 25}, {"box": [372, 700, 431, 716], "text": "RRXM -T", "label": "answer", "words": [{"box": [372, 700, 415, 715], "text": "RRXM"}, {"box": [416, 701, 431, 716], "text": "-T"}], "linking": [[8, 26]], "id": 26}, {"box": [370, 747, 491, 765], "text": "RRBF or RRBF -O", "label": "answer", "words": [{"box": [370, 747, 411, 762], "text": "RRBF"}, {"box": [416, 749, 430, 762], "text": "or"}, {"box": [434, 747, 475, 764], "text": "RRBF"}, {"box": [476, 750, 491, 765], "text": "-O"}], "linking": [[8, 27]], "id": 27}, {"box": [370, 778, 417, 793], "text": "RRB -B", "label": "answer", "words": [{"box": [370, 778, 402, 792], "text": "RRB"}, {"box": [402, 778, 417, 793], "text": "-B"}], "linking": [[8, 28]], "id": 28}, {"box": [369, 809, 415, 823], "text": "RRB -L", "label": "answer", "words": [{"box": [369, 809, 401, 823], "text": "RRB"}, {"box": [401, 809, 415, 822], "text": "-L"}], "linking": [[8, 29]], "id": 29}, {"box": [369, 838, 415, 852], "text": "RRB -T", "label": "answer", "words": [{"box": [369, 838, 400, 852], "text": "RRB"}, {"box": [401, 839, 415, 852], "text": "-T"}], "linking": [[8, 30]], "id": 30}]}
{"form": [{"box": [96, 177, 118, 192], "text": "FAX:", "label": "question", "words": [{"box": [96, 177, 118, 192], "text": "FAX:"}], "linking": [[0, 18]], "id": 0}, {"box": [75, 337, 116, 351], "text": "DATE:", "label": "question", "words": [{"box": [75, 337, 116, 351], "text": "DATE:"}], "linking": [[1, 26]], "id": 1}, {"box": [75, 286, 117, 301], "text": "FROM:", "label": "question", "words": [{"box": [75, 286, 117, 301], "text": "FROM:"}], "linking": [[2, 25]], "id": 2}, {"box": [457, 288, 544, 305], "text": "CHARGEBACK:", "label": "question", "words": [{"box": [457, 288, 544, 305], "text": "CHARGEBACK:"}], "linking": [[3, 27]], "id": 3}, {"box": [106, 404, 176, 418], "text": "RECIPIENT", "label": "question", "words": [{"box": [106, 404, 176, 418], "text": "RECIPIENT"}], "linking": [[4, 29], [4, 30], [28, 4]], "id": 4}, {"box": [235, 402, 298, 419], "text": "COMPANY", "label": "question", "words": [{"box": [235, 402, 298, 419], "text": "COMPANY"}], "linking": [[5, 31], [5, 32], [28, 5]], "id": 5}, {"box": [398, 404, 425, 418], "text": "FAX", "label": "question", "words": [{"box": [398, 404, 425, 418], "text": "FAX"}], "linking": [[6, 33], [6, 34], [28, 6]], "id": 6}, {"box": [426, 405, 451, 418], "text": "No.", "label": "question", "words": [{"box": [426, 405, 451, 418], "text": "No."}], "linking": [[7, 33], [7, 34], [28, 7]], "id": 7}, {"box": [77, 532, 147, 546], "text": "COMMENTS", "label": "question", "words": [{"box": [77, 532, 147, 546], "text": "COMMENTS"}], "linking": [], "id": 8}, {"box": [538, 934, 562, 952], "text": "No:", "label": "question", "words": [{"box": [538, 934, 562, 952], "text": "No:"}], "linking": [[12, 9]], "id": 9}, {"box": [258, 936, 299, 953], "text": "Name:", "label": "question", "words": [{"box": [258, 936, 299, 953], "text": "Name:"}], "linking": [[12, 10]], "id": 10}, {"box": [196, 936, 221, 951], "text": "Yes", "label": "question", "words": [{"box": [196, 936, 221, 951], "text": "Yes"}], "linking": [[12, 11]], "id": 11}, {"box": [105, 937, 193, 952], "text": "Confirmation:", "label": "header", "words": [{"box": [105, 937, 193, 952], "text": "Confirmation:"}], "linking": [[12, 11], [12, 10], [12, 9]], "id": 12}, {"box": [686, 831, 706, 926], "text": "2074956978", "label": "other", "words": [{"box": [686, 831, 706, 926], "text": "2074956978"}], "linking": [], "id": 13}, {"box": [591, 102, 650, 144], "text": "", "label": "other", "words": [{"box": [591, 102, 650, 144], "text": ""}], "linking": [], "id": 14}, {"box": [77, 95, 488, 151], "text": "WINSTON & STRAWN", "label": "header", "words": [{"box": [77, 95, 277, 151], "text": "WINSTON"}, {"box": [282, 95, 316, 148], "text": "&"}, {"box": [320, 99, 488, 149], "text": "STRAWN"}], "linking": [], "id": 15}, {"box": [514, 137, 614, 158], "text": "Fax Cover Sheet", "label": "header", "words": [{"box": [514, 137, 541, 155], "text": "Fax"}, {"box": [543, 137, 579, 155], "text": "Cover"}, {"box": [580, 137, 614, 158], "text": "Sheet"}], "linking": [], "id": 16}, {"box": [95, 155, 466, 181], "text": "MAMI TRIAL SITE, 2000 FIRST UNION FINANCIAL CENTER, 200 SOUTH BISCAYNE BOULEVARD MIAMI, FLORIDA 33131", "label": "other", "words": [{"box": [96, 158, 121, 166], "text": "MAMI"}, {"box": [123, 156, 148, 167], "text": "TRIAL"}, {"box": [151, 156, 173, 167], "text": "SITE,"}, {"box": [177, 155, 211, 165], "text": "2000"}, {"box": [215, 155, 242, 166], "text": "FIRST"}, {"box": [243, 155, 271, 166], "text": "UNION"}, {"box": [272, 156, 319, 169], "text": "FINANCIAL"}, {"box": [321, 158, 360, 169], "text": "CENTER,"}, {"box": [365, 158, 387, 169], "text": "200"}, {"box": [390, 156, 421, 167], "text": "SOUTH"}, {"box": [423, 158, 466, 168], "text": "BISCAYNE"}, {"box": [95, 169, 151, 179], "text": "BOULEVARD"}, {"box": [156, 170, 185, 178], "text": "MIAMI,"}, {"box": [190, 168, 228, 181], "text": "FLORIDA"}, {"box": [237, 168, 276, 181], "text": "33131"}], "linking": [], "id": 17}, {"box": [126, 179, 225, 192], "text": "(305) 400 6 06", "label": "answer", "words": [{"box": [126, 179, 160, 192], "text": "(305)"}, {"box": [162, 179, 187, 192], "text": "400"}, {"box": [189, 180, 199, 190], "text": "6"}, {"box": [203, 180, 225, 190], "text": "06"}], "linking": [[0, 18]], "id": 18}, {"box": [77, 205, 197, 238], "text": "200 PARK AVENUE NEWYORK NY 10166 4193 212 294-6700", "label": "other", "words": [{"box": [78, 207, 96, 217], "text": "200"}, {"box": [98, 205, 119, 216], "text": "PARK"}, {"box": [122, 208, 150, 216], "text": "AVENUE"}, {"box": [77, 218, 118, 226], "text": "NEWYORK"}, {"box": [120, 218, 133, 225], "text": "NY"}, {"box": [137, 218, 168, 226], "text": "10166"}, {"box": [169, 216, 197, 226], "text": "4193"}, {"box": [80, 228, 98, 236], "text": "212"}, {"box": [98, 228, 148, 238], "text": "294-6700"}], "linking": [], "id": 19}, {"box": [219, 207, 346, 236], "text": "400 L. STREET N WASHWINGTON DC 20005 3502 202 371 5700", "label": "other", "words": [{"box": [221, 208, 225, 215], "text": ""}, {"box": [226, 208, 247, 216], "text": "400"}, {"box": [249, 208, 256, 216], "text": "L."}, {"box": [256, 208, 285, 215], "text": "STREET"}, {"box": [286, 208, 296, 216], "text": "N"}, {"box": [296, 207, 307, 215], "text": ""}, {"box": [219, 218, 266, 225], "text": "WASHWINGTON"}, {"box": [271, 218, 282, 226], "text": "DC"}, {"box": [286, 219, 317, 226], "text": "20005"}, {"box": [318, 218, 346, 225], "text": "3502"}, {"box": [221, 228, 239, 236], "text": "202"}, {"box": [239, 226, 260, 236], "text": "371"}, {"box": [261, 228, 289, 236], "text": "5700"}], "linking": [], "id": 20}, {"box": [360, 208, 442, 239], "text": "35 WEST WACKER CHICAGO. IL 30601 312- 588 5800", "label": "other", "words": [{"box": [362, 209, 375, 216], "text": "35"}, {"box": [377, 208, 395, 216], "text": "WEST"}, {"box": [398, 208, 425, 218], "text": "WACKER"}, {"box": [362, 219, 394, 227], "text": "CHICAGO."}, {"box": [395, 219, 405, 226], "text": "IL"}, {"box": [411, 219, 442, 227], "text": "30601"}, {"box": [360, 229, 384, 239], "text": "312-"}, {"box": [383, 229, 404, 239], "text": "588"}, {"box": [405, 229, 429, 239], "text": "5800"}], "linking": [], "id": 21}, {"box": [500, 209, 594, 239], "text": "21 AVENUE VICTOR HUGO 75 PARIS, FRANCE 33- 53 64 62 82", "label": "other", "words": [{"box": [500, 209, 513, 217], "text": "21"}, {"box": [517, 209, 545, 219], "text": "AVENUE"}, {"box": [546, 209, 571, 217], "text": "VICTOR"}, {"box": [573, 209, 594, 217], "text": "HUGO"}, {"box": [503, 219, 518, 227], "text": "75"}, {"box": [524, 219, 532, 227], "text": ""}, {"box": [535, 219, 557, 227], "text": "PARIS,"}, {"box": [561, 219, 589, 227], "text": "FRANCE"}, {"box": [500, 229, 517, 237], "text": "33-"}, {"box": [518, 229, 521, 239], "text": ""}, {"box": [521, 230, 538, 238], "text": "53"}, {"box": [538, 230, 553, 238], "text": "64"}, {"box": [554, 230, 567, 238], "text": "62"}, {"box": [567, 229, 584, 239], "text": "82"}], "linking": [], "id": 22}, {"box": [267, 256, 355, 273], "text": "Fax Number:", "label": "question", "words": [{"box": [267, 256, 292, 271], "text": "Fax"}, {"box": [295, 256, 355, 273], "text": "Number:"}], "linking": [[23, 24]], "id": 23}, {"box": [359, 256, 454, 273], "text": "305 400- 6107", "label": "answer", "words": [{"box": [359, 256, 383, 271], "text": "305"}, {"box": [387, 256, 416, 270], "text": "400-"}, {"box": [418, 256, 454, 273], "text": "6107"}], "linking": [[23, 24]], "id": 24}, {"box": [161, 286, 234, 304], "text": "Kevin Narko", "label": "answer", "words": [{"box": [161, 286, 196, 303], "text": "Kevin"}, {"box": [198, 289, 234, 304], "text": "Narko"}], "linking": [[2, 25]], "id": 25}, {"box": [161, 335, 213, 349], "text": "10/ 13/ 99", "label": "answer", "words": [{"box": [161, 335, 175, 348], "text": "10/"}, {"box": [175, 335, 193, 349], "text": "13/"}, {"box": [193, 335, 213, 349], "text": "99"}], "linking": [[1, 26]], "id": 26}, {"box": [468, 310, 523, 324], "text": "4162/ 158", "label": "answer", "words": [{"box": [468, 310, 500, 324], "text": "4162/"}, {"box": [499, 311, 523, 322], "text": "158"}], "linking": [[3, 27]], "id": 27}, {"box": [246, 370, 472, 387], "text": "Please Deliver as soon Possible To:", "label": "header", "words": [{"box": [246, 372, 284, 387], "text": "Please"}, {"box": [286, 372, 331, 386], "text": "Deliver"}, {"box": [334, 374, 347, 385], "text": "as"}, {"box": [349, 373, 380, 386], "text": "soon"}, {"box": [383, 374, 396, 385], "text": ""}, {"box": [398, 370, 448, 384], "text": "Possible"}, {"box": [450, 373, 472, 386], "text": "To:"}], "linking": [[28, 4], [28, 5], [28, 7], [28, 6], [28, 36]], "id": 28}, {"box": [108, 430, 193, 449], "text": "John Mulderig", "label": "answer", "words": [{"box": [108, 430, 137, 447], "text": "John"}, {"box": [140, 432, 193, 449], "text": "Mulderig"}], "linking": [[4, 29]], "id": 29}, {"box": [109, 458, 192, 476], "text": "Gregory Little", "label": "answer", "words": [{"box": [109, 458, 158, 476], "text": "Gregory"}, {"box": [158, 459, 192, 476], "text": "Little"}], "linking": [[4, 30]], "id": 30}, {"box": [235, 430, 315, 450], "text": "Philip Morris", "label": "answer", "words": [{"box": [235, 430, 273, 450], "text": "Philip"}, {"box": [274, 432, 315, 449], "text": "Morris"}], "linking": [[5, 31]], "id": 31}, {"box": [236, 459, 313, 479], "text": "Philip Morris", "label": "answer", "words": [{"box": [236, 459, 271, 479], "text": "Philip"}, {"box": [274, 461, 313, 476], "text": "Morris"}], "linking": [[5, 32]], "id": 32}, {"box": [399, 432, 482, 449], "text": "917 -663 -5796", "label": "answer", "words": [{"box": [399, 432, 420, 449], "text": "917"}, {"box": [420, 433, 445, 447], "text": "-663"}, {"box": [447, 433, 482, 447], "text": "-5796"}], "linking": [[6, 33], [7, 33]], "id": 33}, {"box": [397, 461, 481, 476], "text": "917- 663 5979", "label": "answer", "words": [{"box": [397, 462, 424, 476], "text": "917-"}, {"box": [422, 461, 447, 476], "text": "663"}, {"box": [446, 462, 481, 476], "text": "5979"}], "linking": [[6, 34], [7, 34]], "id": 34}, {"box": [514, 432, 596, 447], "text": "917- 663 3056", "label": "answer", "words": [{"box": [514, 432, 541, 447], "text": "917-"}, {"box": [542, 433, 566, 447], "text": "663"}, {"box": [567, 433, 596, 447], "text": "3056"}], "linking": [[36, 35]], "id": 35}, {"box": [514, 404, 588, 420], "text": "PHONE No.", "label": "question", "words": [{"box": [514, 404, 559, 419], "text": "PHONE"}, {"box": [561, 405, 588, 420], "text": "No."}], "linking": [[36, 35], [28, 36]], "id": 36}, {"box": [239, 497, 479, 516], "text": "Total number of pages including this page:", "label": "question", "words": [{"box": [239, 497, 270, 511], "text": "Total"}, {"box": [271, 499, 316, 512], "text": "number"}, {"box": [318, 497, 332, 511], "text": "of"}, {"box": [334, 499, 366, 516], "text": "pages"}, {"box": [367, 497, 421, 514], "text": "including"}, {"box": [425, 497, 446, 511], "text": "this"}, {"box": [448, 501, 479, 515], "text": "page:"}], "linking": [], "id": 37}, {"box": [85, 677, 620, 722], "text": "IF YOU DO NOT RECEIVE ALL THE PAGES, PLEASE CALL OUR FAX OPERATOR AS SOON AS POSSIBLE THANK YOU. 312- 558- 5948", "label": "other", "words": [{"box": [85, 679, 99, 690], "text": "IF"}, {"box": [101, 677, 125, 691], "text": "YOU"}, {"box": [127, 680, 142, 691], "text": "DO"}, {"box": [145, 679, 169, 692], "text": "NOT"}, {"box": [172, 679, 221, 693], "text": "RECEIVE"}, {"box": [222, 679, 244, 692], "text": "ALL"}, {"box": [247, 679, 271, 692], "text": "THE"}, {"box": [271, 680, 312, 694], "text": "PAGES,"}, {"box": [313, 680, 355, 691], "text": "PLEASE"}, {"box": [358, 682, 387, 692], "text": "CALL"}, {"box": [390, 682, 411, 692], "text": "OUR"}, {"box": [415, 680, 437, 691], "text": "FAX"}, {"box": [440, 682, 500, 692], "text": "OPERATOR"}, {"box": [501, 683, 514, 693], "text": "AS"}, {"box": [517, 682, 548, 693], "text": "SOON"}, {"box": [550, 682, 564, 693], "text": "AS"}, {"box": [566, 682, 620, 693], "text": "POSSIBLE"}, {"box": [320, 694, 362, 707], "text": "THANK"}, {"box": [363, 696, 390, 707], "text": "YOU."}, {"box": [318, 709, 342, 722], "text": "312-"}, {"box": [344, 709, 366, 722], "text": "558-"}, {"box": [367, 709, 391, 722], "text": "5948"}], "linking": [], "id": 38}, {"box": [82, 821, 639, 873], "text": "The information contained in this facsimile message is attorncy privileged and confidential information intended only for the use of the individual or entity named above. If the reader of this message is not the intended recipient, or the employee or agent responsible to deliver it to the intended recipient, you are hereby notified that any dissemination, distribution or copying this communication strictly prohibited.", "label": "other", "words": [{"box": [99, 821, 116, 835], "text": "The"}, {"box": [119, 824, 169, 835], "text": "information"}, {"box": [172, 821, 214, 836], "text": "contained"}, {"box": [216, 824, 227, 837], "text": "in"}, {"box": [230, 824, 244, 835], "text": "this"}, {"box": [246, 824, 284, 835], "text": "facsimile"}, {"box": [286, 824, 321, 835], "text": "message"}, {"box": [324, 824, 335, 834], "text": "is"}, {"box": [335, 824, 370, 835], "text": "attorncy"}, {"box": [373, 824, 415, 835], "text": "privileged"}, {"box": [418, 823, 435, 836], "text": "and"}, {"box": [437, 824, 487, 837], "text": "confidential"}, {"box": [490, 821, 539, 835], "text": "information"}, {"box": [543, 823, 581, 836], "text": "intended"}, {"box": [582, 823, 603, 836], "text": "only"}, {"box": [606, 821, 617, 835], "text": "for"}, {"box": [620, 821, 637, 835], "text": "the"}, {"box": [82, 838, 99, 846], "text": "use"}, {"box": [102, 837, 110, 847], "text": "of"}, {"box": [112, 837, 126, 845], "text": "the"}, {"box": [128, 837, 171, 847], "text": "individual"}, {"box": [175, 837, 185, 845], "text": "or"}, {"box": [186, 835, 213, 849], "text": "entity"}, {"box": [214, 835, 243, 848], "text": "named"}, {"box": [244, 837, 275, 847], "text": "above."}, {"box": [275, 835, 283, 849], "text": "If"}, {"box": [286, 837, 301, 848], "text": "the"}, {"box": [302, 838, 330, 848], "text": "reader"}, {"box": [331, 837, 344, 847], "text": "of"}, {"box": [344, 835, 359, 846], "text": "this"}, {"box": [360, 838, 398, 848], "text": "message"}, {"box": [398, 837, 408, 845], "text": "is"}, {"box": [409, 838, 424, 846], "text": "not"}, {"box": [426, 837, 440, 848], "text": "the"}, {"box": [441, 837, 480, 848], "text": "intended"}, {"box": [482, 838, 520, 848], "text": "recipient,"}, {"box": [522, 838, 533, 848], "text": "or"}, {"box": [536, 838, 550, 849], "text": "the"}, {"box": [552, 838, 595, 849], "text": "employee"}, {"box": [598, 838, 609, 848], "text": "or"}, {"box": [612, 838, 636, 849], "text": "agent"}, {"box": [82, 848, 131, 859], "text": "responsible"}, {"box": [134, 849, 144, 857], "text": "to"}, {"box": [145, 849, 176, 859], "text": "deliver"}, {"box": [177, 849, 185, 859], "text": "it"}, {"box": [189, 851, 196, 858], "text": "to"}, {"box": [200, 848, 211, 859], "text": "the"}, {"box": [216, 849, 255, 859], "text": "intended"}, {"box": [254, 849, 295, 860], "text": "recipient,"}, {"box": [295, 849, 316, 860], "text": "you"}, {"box": [317, 851, 332, 862], "text": "are"}, {"box": [334, 848, 365, 861], "text": "hereby"}, {"box": [365, 848, 401, 861], "text": "notified"}, {"box": [401, 848, 416, 861], "text": "that"}, {"box": [419, 852, 436, 863], "text": "any"}, {"box": [437, 849, 498, 862], "text": "dissemination,"}, {"box": [503, 848, 552, 862], "text": "distribution"}, {"box": [554, 849, 565, 859], "text": "or"}, {"box": [568, 849, 600, 860], "text": "copying"}, {"box": [603, 848, 617, 859], "text": ""}, {"box": [617, 851, 639, 859], "text": "this"}, {"box": [84, 862, 150, 872], "text": "communication"}, {"box": [152, 860, 159, 868], "text": ""}, {"box": [162, 862, 191, 873], "text": "strictly"}, {"box": [194, 860, 243, 871], "text": "prohibited."}], "linking": [], "id": 39}, {"box": [84, 881, 636, 908], "text": "If you have received this communication in error, please immediately notify us by telephone, and return the original message to us at the above address via the U. S. Postal Service. Thank you.", "label": "other", "words": [{"box": [101, 883, 108, 893], "text": "If"}, {"box": [110, 884, 125, 894], "text": "you"}, {"box": [127, 883, 148, 893], "text": "have"}, {"box": [151, 883, 187, 893], "text": "received"}, {"box": [190, 883, 208, 893], "text": "this"}, {"box": [207, 883, 274, 894], "text": "communication"}, {"box": [277, 881, 287, 891], "text": "in"}, {"box": [288, 883, 312, 894], "text": "error,"}, {"box": [314, 883, 341, 893], "text": "please"}, {"box": [344, 883, 396, 894], "text": "immediately"}, {"box": [398, 883, 423, 896], "text": "notify"}, {"box": [427, 884, 435, 892], "text": "us"}, {"box": [439, 883, 450, 894], "text": "by"}, {"box": [451, 881, 497, 894], "text": "telephone,"}, {"box": [499, 883, 516, 894], "text": "and"}, {"box": [515, 884, 542, 894], "text": "return"}, {"box": [545, 883, 559, 893], "text": "the"}, {"box": [561, 883, 595, 896], "text": "original"}, {"box": [598, 884, 636, 895], "text": "message"}, {"box": [84, 894, 92, 907], "text": "to"}, {"box": [95, 898, 105, 905], "text": "us"}, {"box": [106, 895, 116, 905], "text": "at"}, {"box": [117, 895, 130, 905], "text": "the"}, {"box": [133, 895, 158, 906], "text": "above"}, {"box": [161, 897, 193, 905], "text": "address"}, {"box": [196, 897, 210, 905], "text": "via"}, {"box": [211, 895, 225, 905], "text": "the"}, {"box": [226, 894, 236, 905], "text": "U."}, {"box": [236, 894, 247, 907], "text": "S."}, {"box": [249, 895, 276, 905], "text": "Postal"}, {"box": [277, 894, 311, 907], "text": "Service."}, {"box": [314, 894, 342, 907], "text": "Thank"}, {"box": [344, 897, 362, 908], "text": "you."}], "linking": [], "id": 40}, {"box": [105, 919, 204, 935], "text": "Operator Initials:", "label": "question", "words": [{"box": [105, 920, 157, 935], "text": "Operator"}, {"box": [159, 919, 204, 934], "text": "Initials:"}], "linking": [], "id": 41}]}
{"form": [{"box": [41, 127, 84, 144], "text": "Brand", "label": "question", "words": [{"box": [41, 127, 84, 144], "text": "Brand"}], "linking": [[0, 46]], "id": 0}, {"box": [41, 154, 87, 172], "text": "Title", "label": "question", "words": [{"box": [41, 154, 87, 172], "text": "Title"}], "linking": [[1, 50]], "id": 1}, {"box": [41, 211, 77, 226], "text": "Size", "label": "question", "words": [{"box": [41, 211, 77, 226], "text": "Size"}], "linking": [[2, 52]], "id": 2}, {"box": [39, 239, 110, 253], "text": "Magazine", "label": "question", "words": [{"box": [39, 239, 110, 253], "text": "Magazine"}], "linking": [[3, 18]], "id": 3}, {"box": [41, 295, 112, 309], "text": "Location", "label": "question", "words": [{"box": [41, 295, 112, 309], "text": "Location"}], "linking": [[4, 55], [4, 56]], "id": 4}, {"box": [496, 204, 502, 210], "text": "", "label": "question", "words": [{"box": [496, 204, 502, 210], "text": ""}], "linking": [], "id": 5}, {"box": [182, 394, 225, 409], "text": "SCORE", "label": "question", "words": [{"box": [182, 394, 225, 409], "text": "SCORE"}], "linking": [[11, 6], [6, 19], [6, 29], [6, 30], [6, 37], [6, 38]], "id": 6}, {"box": [250, 394, 282, 409], "text": "BASE", "label": "question", "words": [{"box": [250, 394, 282, 409], "text": "BASE"}], "linking": [[11, 7], [7, 20], [7, 27], [7, 28], [7, 35], [7, 36]], "id": 7}, {"box": [337, 394, 382, 407], "text": "SCORE", "label": "question", "words": [{"box": [337, 394, 382, 407], "text": "SCORE"}], "linking": [[59, 8], [8, 21], [8, 25], [8, 26], [8, 33], [8, 34], [8, 41], [8, 44]], "id": 8}, {"box": [404, 394, 438, 407], "text": "BASE", "label": "question", "words": [{"box": [404, 394, 438, 407], "text": "BASE"}], "linking": [[59, 9], [9, 22], [9, 23], [9, 24], [9, 31], [9, 32], [9, 42], [9, 43]], "id": 9}, {"box": [542, 376, 613, 393], "text": "COMMENTS", "label": "question", "words": [{"box": [542, 376, 613, 393], "text": "COMMENTS"}], "linking": [[10, 60]], "id": 10}, {"box": [222, 377, 250, 394], "text": "PM6", "label": "header", "words": [{"box": [222, 377, 250, 394], "text": "PM6"}], "linking": [[11, 6], [11, 7]], "id": 11}, {"box": [39, 454, 106, 472], "text": "OVERALL", "label": "question", "words": [{"box": [39, 454, 106, 472], "text": "OVERALL"}], "linking": [[12, 19], [12, 20], [12, 21], [12, 22]], "id": 12}, {"box": [41, 511, 76, 524], "text": "SEX:", "label": "header", "words": [{"box": [41, 511, 76, 524], "text": "SEX:"}], "linking": [[13, 15], [13, 16]], "id": 13}, {"box": [41, 595, 76, 609], "text": "AGE:", "label": "header", "words": [{"box": [41, 595, 76, 609], "text": "AGE:"}], "linking": [[14, 61], [14, 63], [14, 62], [14, 64]], "id": 14}, {"box": [41, 525, 77, 538], "text": "Male", "label": "question", "words": [{"box": [41, 525, 77, 538], "text": "Male"}], "linking": [[13, 15], [15, 29], [15, 27], [15, 25], [15, 23]], "id": 15}, {"box": [41, 538, 93, 553], "text": "Female", "label": "question", "words": [{"box": [41, 538, 93, 553], "text": "Female"}], "linking": [[13, 16], [16, 30], [16, 28], [16, 26], [16, 24]], "id": 16}, {"box": [568, 154, 597, 169], "text": "214", "label": "answer", "words": [{"box": [568, 154, 597, 169], "text": "214"}], "linking": [[48, 17]], "id": 17}, {"box": [138, 239, 177, 254], "text": "TIME", "label": "answer", "words": [{"box": [138, 239, 177, 254], "text": "TIME"}], "linking": [[3, 18]], "id": 18}, {"box": [194, 455, 221, 469], "text": "1.0", "label": "answer", "words": [{"box": [194, 455, 221, 469], "text": "1.0"}], "linking": [[12, 19], [6, 19]], "id": 19}, {"box": [247, 455, 282, 472], "text": "(.97)", "label": "answer", "words": [{"box": [247, 455, 282, 472], "text": "(.97)"}], "linking": [[12, 20], [7, 20]], "id": 20}, {"box": [351, 457, 371, 471], "text": "31", "label": "answer", "words": [{"box": [351, 457, 371, 471], "text": "31"}], "linking": [[12, 21], [8, 21]], "id": 21}, {"box": [399, 453, 440, 470], "text": "(167)", "label": "answer", "words": [{"box": [399, 453, 440, 470], "text": "(167)"}], "linking": [[12, 22], [9, 22]], "id": 22}, {"box": [404, 524, 439, 539], "text": "(83)", "label": "answer", "words": [{"box": [404, 524, 439, 539], "text": "(83)"}], "linking": [[15, 23], [9, 23]], "id": 23}, {"box": [404, 539, 439, 552], "text": "(84)", "label": "answer", "words": [{"box": [404, 539, 439, 552], "text": "(84)"}], "linking": [[16, 24], [9, 24]], "id": 24}, {"box": [352, 524, 372, 538], "text": "31", "label": "answer", "words": [{"box": [352, 524, 372, 538], "text": "31"}], "linking": [[15, 25], [8, 25]], "id": 25}, {"box": [352, 541, 372, 552], "text": "31", "label": "answer", "words": [{"box": [352, 541, 372, 552], "text": "31"}], "linking": [[16, 26], [8, 26]], "id": 26}, {"box": [247, 524, 283, 541], "text": "(51)", "label": "answer", "words": [{"box": [247, 524, 283, 541], "text": "(51)"}], "linking": [[15, 27], [7, 27]], "id": 27}, {"box": [246, 541, 284, 555], "text": "(46)", "label": "answer", "words": [{"box": [246, 541, 284, 555], "text": "(46)"}], "linking": [[16, 28], [7, 28]], "id": 28}, {"box": [194, 525, 222, 540], "text": "2.0", "label": "answer", "words": [{"box": [194, 525, 222, 540], "text": "2.0"}], "linking": [[15, 29], [6, 29]], "id": 29}, {"box": [194, 541, 225, 554], "text": "0.0", "label": "answer", "words": [{"box": [194, 541, 225, 554], "text": "0.0"}], "linking": [[16, 30], [6, 30]], "id": 30}, {"box": [404, 704, 443, 718], "text": "(81)", "label": "answer", "words": [{"box": [404, 704, 443, 718], "text": "(81)"}], "linking": [[65, 31], [9, 31]], "id": 31}, {"box": [402, 718, 443, 735], "text": "(86)", "label": "answer", "words": [{"box": [402, 718, 443, 735], "text": "(86)"}], "linking": [[66, 32], [9, 32]], "id": 32}, {"box": [352, 703, 374, 718], "text": "33", "label": "answer", "words": [{"box": [352, 703, 374, 718], "text": "33"}], "linking": [[65, 33], [8, 33]], "id": 33}, {"box": [355, 721, 373, 736], "text": "29", "label": "answer", "words": [{"box": [355, 721, 373, 736], "text": "29"}], "linking": [[66, 34], [8, 34]], "id": 34}, {"box": [250, 703, 288, 721], "text": "(42)", "label": "answer", "words": [{"box": [250, 703, 288, 721], "text": "(42)"}], "linking": [[65, 35], [7, 35]], "id": 35}, {"box": [250, 719, 288, 736], "text": "(55)", "label": "answer", "words": [{"box": [250, 719, 288, 736], "text": "(55)"}], "linking": [[66, 36], [7, 36]], "id": 36}, {"box": [196, 703, 225, 718], "text": "2.4", "label": "answer", "words": [{"box": [196, 703, 225, 718], "text": "2.4"}], "linking": [[65, 37], [6, 37]], "id": 37}, {"box": [196, 718, 228, 735], "text": "0.0", "label": "answer", "words": [{"box": [196, 718, 228, 735], "text": "0.0"}], "linking": [[66, 38], [6, 38]], "id": 38}, {"box": [570, 830, 634, 847], "text": "4/19/74", "label": "answer", "words": [{"box": [570, 830, 634, 847], "text": "4/19/74"}], "linking": [[70, 39]], "id": 39}, {"box": [500, 892, 613, 912], "text": "770205964", "label": "other", "words": [{"box": [500, 892, 613, 912], "text": "770205964"}], "linking": [], "id": 40}, {"box": [356, 786, 374, 801], "text": "33", "label": "answer", "words": [{"box": [356, 786, 374, 801], "text": "33"}], "linking": [[68, 41], [8, 41]], "id": 41}, {"box": [405, 788, 444, 805], "text": "(42)", "label": "answer", "words": [{"box": [405, 788, 444, 805], "text": "(42)"}], "linking": [[68, 42], [9, 42]], "id": 42}, {"box": [406, 803, 445, 818], "text": "(125)", "label": "answer", "words": [{"box": [406, 803, 445, 818], "text": "(125)"}], "linking": [[69, 43], [9, 43]], "id": 43}, {"box": [356, 806, 376, 820], "text": "30", "label": "answer", "words": [{"box": [356, 806, 376, 820], "text": "30"}], "linking": [[69, 44], [8, 44]], "id": 44}, {"box": [279, 36, 412, 83], "text": "MAGAZINE SCORES AUDIENCE STUDIES", "label": "header", "words": [{"box": [279, 36, 345, 53], "text": "MAGAZINE"}, {"box": [351, 36, 404, 53], "text": "SCORES"}, {"box": [281, 63, 347, 83], "text": "AUDIENCE"}, {"box": [352, 64, 412, 81], "text": "STUDIES"}], "linking": [], "id": 45}, {"box": [138, 124, 236, 143], "text": "SALEM (RJR)", "label": "answer", "words": [{"box": [138, 126, 184, 143], "text": "SALEM"}, {"box": [194, 124, 236, 142], "text": "(RJR)"}], "linking": [[0, 46]], "id": 46}, {"box": [459, 127, 538, 145], "text": "Project #", "label": "question", "words": [{"box": [459, 127, 519, 144], "text": "Project"}, {"box": [525, 127, 538, 145], "text": "#"}], "linking": [[47, 49]], "id": 47}, {"box": [458, 154, 564, 172], "text": "Total Sample", "label": "question", "words": [{"box": [458, 154, 505, 172], "text": "Total"}, {"box": [508, 155, 564, 172], "text": "Sample"}], "linking": [[48, 17]], "id": 48}, {"box": [568, 123, 612, 141], "text": "74- 80", "label": "answer", "words": [{"box": [568, 123, 595, 141], "text": "74-"}, {"box": [594, 123, 612, 138], "text": "80"}], "linking": [[47, 49]], "id": 49}, {"box": [141, 152, 266, 169], "text": "\"HEAD IN WATER\"", "label": "answer", "words": [{"box": [141, 152, 180, 169], "text": "\"HEAD"}, {"box": [189, 155, 210, 169], "text": "IN"}, {"box": [214, 155, 266, 169], "text": "WATER\""}], "linking": [[1, 50]], "id": 50}, {"box": [41, 182, 90, 203], "text": "Code #", "label": "question", "words": [{"box": [41, 182, 73, 200], "text": "Code"}, {"box": [80, 182, 90, 203], "text": "#"}], "linking": [], "id": 51}, {"box": [137, 209, 220, 226], "text": "FULL PAGE", "label": "answer", "words": [{"box": [137, 209, 175, 226], "text": "FULL"}, {"box": [179, 211, 220, 225], "text": "PAGE"}], "linking": [[2, 52]], "id": 52}, {"box": [39, 267, 127, 284], "text": "Field Date", "label": "question", "words": [{"box": [39, 267, 85, 284], "text": "Field"}, {"box": [89, 267, 127, 282], "text": "Date"}], "linking": [[53, 54]], "id": 53}, {"box": [138, 265, 323, 284], "text": "WEEK OF MARCH 25, 1974", "label": "answer", "words": [{"box": [138, 267, 174, 282], "text": "WEEK"}, {"box": [180, 267, 200, 281], "text": "OF"}, {"box": [205, 267, 252, 282], "text": "MARCH"}, {"box": [254, 267, 279, 284], "text": "25,"}, {"box": [288, 265, 323, 280], "text": "1974"}], "linking": [[53, 54]], "id": 54}, {"box": [138, 292, 584, 312], "text": "CHICAGO, DALLAS/ FORT WORTH, INDIANAPOLIS, LOS ANGELES", "label": "answer", "words": [{"box": [138, 295, 205, 312], "text": "CHICAGO,"}, {"box": [215, 293, 272, 310], "text": "DALLAS/"}, {"box": [272, 295, 306, 310], "text": "FORT"}, {"box": [313, 295, 363, 310], "text": "WORTH,"}, {"box": [370, 293, 478, 308], "text": "INDIANAPOLIS,"}, {"box": [485, 293, 516, 306], "text": "LOS"}, {"box": [520, 292, 584, 306], "text": "ANGELES"}], "linking": [[4, 55]], "id": 55}, {"box": [138, 321, 417, 338], "text": "MEMPHIS, PHILADELPHIA, PITTSBURGH", "label": "answer", "words": [{"box": [138, 323, 205, 338], "text": "MEMPHIS,"}, {"box": [215, 321, 321, 338], "text": "PHILADELPHIA,"}, {"box": [330, 324, 417, 337], "text": "PITTSBURGH"}], "linking": [[4, 56]], "id": 56}, {"box": [41, 356, 195, 373], "text": "Sample Description", "label": "question", "words": [{"box": [41, 356, 91, 373], "text": "Sample"}, {"box": [99, 356, 195, 373], "text": "Description"}], "linking": [[57, 58]], "id": 57}, {"box": [204, 359, 462, 376], "text": "MALE AND FEMALE MENTHOL SMOKERS", "label": "answer", "words": [{"box": [204, 359, 243, 374], "text": "MALE"}, {"box": [249, 360, 276, 373], "text": "AND"}, {"box": [281, 360, 334, 373], "text": "FEMALE"}, {"box": [337, 359, 398, 376], "text": "MENTHOL"}, {"box": [401, 360, 462, 375], "text": "SMOKERS"}], "linking": [[57, 58]], "id": 58}, {"box": [330, 377, 435, 394], "text": "PROVED RECALL", "label": "header", "words": [{"box": [330, 377, 382, 394], "text": "PROVED"}, {"box": [385, 378, 435, 391], "text": "RECALL"}], "linking": [[59, 8], [59, 9]], "id": 59}, {"box": [471, 454, 693, 566], "text": "Tested among a half sample of smokers. Sub- group scores subject to wide variation because of small sample size and should be averaged across several ads for meaningful infor- mation.", "label": "answer", "words": [{"box": [472, 457, 524, 471], "text": "Tested"}, {"box": [531, 455, 573, 470], "text": "among"}, {"box": [578, 457, 592, 470], "text": "a"}, {"box": [596, 455, 634, 470], "text": "half"}, {"box": [640, 454, 690, 472], "text": "sample"}, {"box": [471, 471, 492, 485], "text": "of"}, {"box": [496, 472, 564, 485], "text": "smokers."}, {"box": [578, 469, 616, 482], "text": "Sub-"}, {"box": [615, 471, 656, 485], "text": "group"}, {"box": [473, 486, 525, 496], "text": "scores"}, {"box": [529, 483, 590, 497], "text": "subject"}, {"box": [596, 485, 614, 498], "text": "to"}, {"box": [619, 483, 660, 494], "text": "wide"}, {"box": [473, 499, 551, 512], "text": "variation"}, {"box": [553, 499, 617, 510], "text": "because"}, {"box": [620, 497, 641, 510], "text": "of"}, {"box": [647, 496, 693, 511], "text": "small"}, {"box": [473, 513, 525, 526], "text": "sample"}, {"box": [531, 515, 567, 525], "text": "size"}, {"box": [571, 511, 598, 522], "text": "and"}, {"box": [609, 510, 656, 524], "text": "should"}, {"box": [659, 511, 679, 524], "text": "be"}, {"box": [473, 527, 539, 544], "text": "averaged"}, {"box": [546, 527, 599, 537], "text": "across"}, {"box": [605, 524, 665, 539], "text": "several"}, {"box": [473, 538, 498, 552], "text": "ads"}, {"box": [506, 539, 534, 553], "text": "for"}, {"box": [538, 538, 623, 555], "text": "meaningful"}, {"box": [628, 539, 680, 553], "text": "infor-"}, {"box": [472, 556, 531, 566], "text": "mation."}], "linking": [[10, 60]], "id": 60}, {"box": [42, 608, 110, 622], "text": "Under 25", "label": "question", "words": [{"box": [42, 609, 87, 620], "text": "Under"}, {"box": [92, 608, 110, 622], "text": "25"}], "linking": [[14, 61]], "id": 61}, {"box": [43, 622, 87, 636], "text": "25- 34", "label": "question", "words": [{"box": [43, 622, 67, 636], "text": "25-"}, {"box": [67, 622, 87, 633], "text": "34"}], "linking": [[14, 62]], "id": 62}, {"box": [42, 634, 86, 649], "text": "35- 44", "label": "question", "words": [{"box": [42, 634, 67, 649], "text": "35-"}, {"box": [68, 635, 86, 649], "text": "44"}], "linking": [[14, 63]], "id": 63}, {"box": [43, 649, 120, 664], "text": "45 & Over", "label": "question", "words": [{"box": [43, 649, 60, 664], "text": "45"}, {"box": [66, 649, 80, 662], "text": "&"}, {"box": [88, 651, 120, 662], "text": "Over"}], "linking": [[14, 64]], "id": 64}, {"box": [43, 704, 112, 719], "text": "Under 35", "label": "question", "words": [{"box": [43, 705, 85, 719], "text": "Under"}, {"box": [91, 704, 112, 717], "text": "35"}], "linking": [[65, 37], [65, 35], [65, 33], [65, 31]], "id": 65}, {"box": [43, 719, 119, 734], "text": "35 & Over", "label": "question", "words": [{"box": [43, 719, 60, 733], "text": "35"}, {"box": [66, 721, 81, 734], "text": "&"}, {"box": [85, 719, 119, 733], "text": "Over"}], "linking": [[66, 38], [66, 36], [66, 34], [66, 32]], "id": 66}, {"box": [43, 775, 147, 789], "text": "BRAND SMOKED:", "label": "header", "words": [{"box": [43, 775, 85, 789], "text": "BRAND"}, {"box": [94, 775, 147, 789], "text": "SMOKED:"}], "linking": [[67, 68], [67, 69]], "id": 67}, {"box": [41, 789, 192, 804], "text": "Test Brand Smokers", "label": "question", "words": [{"box": [41, 789, 77, 803], "text": "Test"}, {"box": [82, 791, 128, 804], "text": "Brand"}, {"box": [131, 789, 192, 802], "text": "Smokers"}], "linking": [[67, 68], [68, 41], [68, 42]], "id": 68}, {"box": [43, 803, 181, 820], "text": "All Other Smokers", "label": "question", "words": [{"box": [43, 804, 71, 818], "text": "All"}, {"box": [75, 803, 117, 818], "text": "Other"}, {"box": [124, 803, 181, 820], "text": "Smokers"}], "linking": [[67, 69], [69, 44], [69, 43]], "id": 69}, {"box": [486, 830, 565, 847], "text": "Date Sent", "label": "question", "words": [{"box": [486, 830, 520, 847], "text": "Date"}, {"box": [527, 830, 565, 847], "text": "Sent"}], "linking": [[70, 39]], "id": 70}, {"box": [575, 842, 648, 857], "text": "PI- 7653", "label": "other", "words": [{"box": [575, 846, 600, 857], "text": "PI-"}, {"box": [599, 846, 609, 854], "text": ""}, {"box": [612, 842, 648, 856], "text": "7653"}], "linking": [], "id": 71}]}
{"form": [{"box": [112, 209, 123, 217], "text": "", "label": "other", "words": [{"box": [112, 209, 123, 217], "text": ""}], "linking": [], "id": 0}, {"box": [123, 209, 140, 217], "text": "", "label": "other", "words": [{"box": [123, 209, 140, 217], "text": ""}], "linking": [], "id": 1}, {"box": [108, 283, 156, 292], "text": "SUBJECT:", "label": "question", "words": [{"box": [108, 283, 156, 292], "text": "SUBJECT:"}], "linking": [[2, 33]], "id": 2}, {"box": [108, 305, 151, 318], "text": "SAMPLE:", "label": "question", "words": [{"box": [108, 305, 151, 318], "text": "SAMPLE:"}], "linking": [[3, 34]], "id": 3}, {"box": [107, 328, 175, 341], "text": "CIGARETTES", "label": "header", "words": [{"box": [107, 328, 175, 341], "text": "CIGARETTES"}], "linking": [[4, 35], [4, 36]], "id": 4}, {"box": [436, 235, 482, 249], "text": "PROJECT", "label": "question", "words": [{"box": [436, 235, 482, 249], "text": "PROJECT"}], "linking": [[5, 32]], "id": 5}, {"box": [113, 455, 174, 468], "text": "REFERENCE", "label": "question", "words": [{"box": [113, 455, 174, 468], "text": "REFERENCE"}], "linking": [[6, 42], [6, 43], [6, 44], [6, 8], [6, 9]], "id": 6}, {"box": [109, 501, 175, 512], "text": "ATTRIBUTES", "label": "header", "words": [{"box": [109, 501, 175, 512], "text": "ATTRIBUTES"}], "linking": [[7, 14], [7, 15]], "id": 7}, {"box": [348, 457, 394, 468], "text": "VICEROY", "label": "question", "words": [{"box": [348, 457, 394, 468], "text": "VICEROY"}], "linking": [[6, 8], [8, 12], [8, 13]], "id": 8}, {"box": [480, 455, 548, 468], "text": "Competitive", "label": "question", "words": [{"box": [480, 455, 548, 468], "text": "Competitive"}], "linking": [[9, 11], [9, 11], [9, 10], [6, 9]], "id": 9}, {"box": [515, 468, 543, 479], "text": "54%", "label": "answer", "words": [{"box": [515, 468, 543, 479], "text": "54%"}], "linking": [[9, 10]], "id": 10}, {"box": [515, 478, 544, 489], "text": "46%46%", "label": "answer", "words": [{"box": [515, 478, 544, 489], "text": "46%46%"}], "linking": [[9, 11], [9, 11]], "id": 11}, {"box": [377, 468, 399, 478], "text": "47%", "label": "answer", "words": [{"box": [377, 468, 399, 478], "text": "47%"}], "linking": [[8, 12]], "id": 12}, {"box": [377, 479, 399, 489], "text": "53%", "label": "answer", "words": [{"box": [377, 479, 399, 489], "text": "53%"}], "linking": [[8, 13]], "id": 13}, {"box": [229, 500, 275, 513], "text": "VICEROY", "label": "question", "words": [{"box": [229, 500, 275, 513], "text": "VICEROY"}], "linking": [[7, 14], [14, 47], [14, 48]], "id": 14}, {"box": [469, 501, 536, 511], "text": "Competitive", "label": "header", "words": [{"box": [469, 501, 536, 511], "text": "Competitive"}], "linking": [[7, 15], [15, 45], [15, 46]], "id": 15}, {"box": [451, 557, 472, 567], "text": "-13", "label": "answer", "words": [{"box": [451, 557, 472, 567], "text": "-13"}], "linking": [[45, 16]], "id": 16}, {"box": [536, 559, 558, 569], "text": "-4", "label": "answer", "words": [{"box": [536, 559, 558, 569], "text": "-4"}], "linking": [[46, 17]], "id": 17}, {"box": [450, 571, 471, 579], "text": "-7", "label": "answer", "words": [{"box": [450, 571, 471, 579], "text": "-7"}], "linking": [[45, 18]], "id": 18}, {"box": [534, 570, 561, 583], "text": "+7*", "label": "answer", "words": [{"box": [534, 570, 561, 583], "text": "+7*"}], "linking": [[46, 19]], "id": 19}, {"box": [450, 582, 475, 592], "text": "+14", "label": "answer", "words": [{"box": [450, 582, 475, 592], "text": "+14"}], "linking": [[45, 20]], "id": 20}, {"box": [532, 581, 561, 592], "text": "+26*", "label": "answer", "words": [{"box": [532, 581, 561, 592], "text": "+26*"}], "linking": [[46, 21]], "id": 21}, {"box": [293, 557, 320, 571], "text": "-15*", "label": "answer", "words": [{"box": [293, 557, 320, 571], "text": "-15*"}], "linking": [[28, 22]], "id": 22}, {"box": [211, 582, 231, 592], "text": "+22", "label": "answer", "words": [{"box": [211, 582, 231, 592], "text": "+22"}], "linking": [[30, 23]], "id": 23}, {"box": [208, 557, 228, 570], "text": "+1", "label": "answer", "words": [{"box": [208, 557, 228, 570], "text": "+1"}], "linking": [[28, 24]], "id": 24}, {"box": [208, 571, 230, 581], "text": "+5", "label": "answer", "words": [{"box": [208, 571, 230, 581], "text": "+5"}], "linking": [[29, 25]], "id": 25}, {"box": [293, 570, 317, 578], "text": "-5", "label": "answer", "words": [{"box": [293, 570, 317, 578], "text": "-5"}], "linking": [[29, 26]], "id": 26}, {"box": [292, 581, 314, 592], "text": "+21", "label": "answer", "words": [{"box": [292, 581, 314, 592], "text": "+21"}], "linking": [[30, 27]], "id": 27}, {"box": [106, 557, 159, 570], "text": "STRENGTH", "label": "question", "words": [{"box": [106, 557, 159, 570], "text": "STRENGTH"}], "linking": [[28, 24], [28, 22]], "id": 28}, {"box": [108, 571, 167, 581], "text": "HARSHNESS", "label": "question", "words": [{"box": [108, 571, 167, 581], "text": "HARSHNESS"}], "linking": [[29, 25], [30, 29], [29, 26]], "id": 29}, {"box": [108, 581, 171, 595], "text": "AFTERTASTE", "label": "question", "words": [{"box": [108, 581, 171, 595], "text": "AFTERTASTE"}], "linking": [[30, 23], [30, 27], [30, 29]], "id": 30}, {"box": [107, 235, 256, 260], "text": "TOP- LINES NON- MENTHOL PRODUCT TEST", "label": "header", "words": [{"box": [110, 235, 134, 248], "text": "TOP-"}, {"box": [132, 235, 167, 246], "text": "LINES"}, {"box": [107, 249, 132, 260], "text": "NON-"}, {"box": [132, 247, 176, 259], "text": "MENTHOL"}, {"box": [182, 247, 223, 259], "text": "PRODUCT"}, {"box": [229, 246, 256, 259], "text": "TEST"}], "linking": [], "id": 31}, {"box": [486, 233, 547, 250], "text": "# 19 4- 26A", "label": "answer", "words": [{"box": [486, 236, 493, 247], "text": "#"}, {"box": [499, 235, 516, 248], "text": "19"}, {"box": [514, 235, 528, 248], "text": "4-"}, {"box": [527, 233, 547, 250], "text": "26A"}], "linking": [[5, 32]], "id": 32}, {"box": [203, 281, 499, 296], "text": "25% Replacement of Propylene Glycol With SORBITOL", "label": "answer", "words": [{"box": [203, 282, 223, 293], "text": "25%"}, {"box": [228, 282, 294, 295], "text": "Replacement"}, {"box": [297, 284, 312, 295], "text": "of"}, {"box": [316, 281, 373, 295], "text": "Propylene"}, {"box": [377, 282, 415, 295], "text": "Glycol"}, {"box": [419, 281, 444, 294], "text": "With"}, {"box": [447, 281, 499, 296], "text": "SORBITOL"}], "linking": [[2, 33]], "id": 33}, {"box": [203, 303, 422, 319], "text": "250 VICEROY/ 125 Marlboro/ 125 Winston", "label": "answer", "words": [{"box": [203, 306, 224, 319], "text": "250"}, {"box": [226, 306, 276, 316], "text": "VICEROY/"}, {"box": [275, 306, 293, 319], "text": "125"}, {"box": [297, 304, 353, 317], "text": "Marlboro/"}, {"box": [352, 304, 372, 317], "text": "125"}, {"box": [376, 303, 422, 317], "text": "Winston"}], "linking": [[3, 34]], "id": 34}, {"box": [203, 339, 270, 352], "text": "#627/ 647 -", "label": "question", "words": [{"box": [203, 339, 234, 350], "text": "#627/"}, {"box": [233, 341, 258, 352], "text": "647"}, {"box": [263, 344, 270, 350], "text": "-"}], "linking": [[4, 35], [35, 37]], "id": 35}, {"box": [203, 363, 271, 376], "text": "#647/ #627 -", "label": "question", "words": [{"box": [203, 363, 234, 374], "text": "#647/"}, {"box": [232, 363, 257, 376], "text": "#627"}, {"box": [263, 366, 271, 372], "text": "-"}], "linking": [[4, 36], [36, 38]], "id": 36}, {"box": [275, 338, 386, 352], "text": "Current VICEROY B4", "label": "answer", "words": [{"box": [275, 339, 320, 352], "text": "Current"}, {"box": [323, 339, 366, 350], "text": "VICEROY"}, {"box": [372, 338, 386, 351], "text": "B4"}], "linking": [[35, 37]], "id": 37}, {"box": [275, 362, 457, 398], "text": "Current VICEROY 84 except with 25% of the propylene glycol replaced with SORBITOL.", "label": "answer", "words": [{"box": [275, 363, 317, 374], "text": "Current"}, {"box": [324, 362, 367, 375], "text": "VICEROY"}, {"box": [372, 363, 386, 373], "text": "84"}, {"box": [390, 362, 426, 373], "text": "except"}, {"box": [432, 363, 457, 373], "text": "with"}, {"box": [275, 376, 293, 386], "text": "25%"}, {"box": [300, 376, 314, 384], "text": "of"}, {"box": [317, 374, 337, 384], "text": "the"}, {"box": [342, 374, 396, 385], "text": "propylene"}, {"box": [401, 373, 440, 386], "text": "glycol"}, {"box": [275, 384, 325, 398], "text": "replaced"}, {"box": [328, 385, 356, 396], "text": "with"}, {"box": [360, 385, 414, 395], "text": "SORBITOL."}], "linking": [[36, 38]], "id": 38}, {"box": [13, 908, 206, 943], "text": "NOTICE IF THE FILM IMAGE IS LESS CLEAR THAN THIS NOTICE. IT IS DUE TO THE QUALITY OF THE DOCUMENT BEING FILMED", "label": "other", "words": [{"box": [14, 912, 46, 922], "text": "NOTICE"}, {"box": [50, 912, 61, 923], "text": "IF"}, {"box": [66, 912, 84, 922], "text": "THE"}, {"box": [87, 912, 108, 922], "text": "FILM"}, {"box": [112, 909, 139, 922], "text": "IMAGE"}, {"box": [138, 911, 152, 919], "text": "IS"}, {"box": [154, 911, 175, 919], "text": "LESS"}, {"box": [179, 908, 206, 918], "text": "CLEAR"}, {"box": [15, 925, 35, 933], "text": "THAN"}, {"box": [41, 923, 61, 931], "text": "THIS"}, {"box": [66, 922, 100, 930], "text": "NOTICE."}, {"box": [106, 922, 116, 930], "text": "IT"}, {"box": [120, 920, 130, 928], "text": "IS"}, {"box": [134, 919, 149, 930], "text": "DUE"}, {"box": [155, 920, 166, 930], "text": "TO"}, {"box": [172, 920, 190, 930], "text": "THE"}, {"box": [13, 932, 54, 943], "text": "QUALITY"}, {"box": [54, 932, 65, 940], "text": "OF"}, {"box": [70, 932, 87, 940], "text": "THE"}, {"box": [89, 932, 131, 942], "text": "DOCUMENT"}, {"box": [133, 929, 162, 939], "text": "BEING"}, {"box": [168, 929, 199, 939], "text": "FILMED"}], "linking": [], "id": 39}, {"box": [214, 908, 419, 940], "text": "77905 6433", "label": "other", "words": [{"box": [214, 908, 313, 940], "text": "77905"}, {"box": [318, 911, 419, 939], "text": "6433"}], "linking": [], "id": 40}, {"box": [295, 598, 451, 612], "text": "*Statistically Significant", "label": "other", "words": [{"box": [295, 599, 380, 612], "text": "*Statistically"}, {"box": [384, 598, 451, 612], "text": "Significant"}], "linking": [], "id": 41}, {"box": [109, 468, 172, 479], "text": "(#627/ 647", "label": "answer", "words": [{"box": [109, 468, 144, 479], "text": "(#627/"}, {"box": [144, 468, 172, 478], "text": "647"}], "linking": [[6, 42]], "id": 42}, {"box": [108, 479, 171, 492], "text": "(#647/ 627)", "label": "answer", "words": [{"box": [108, 479, 146, 492], "text": "(#647/"}, {"box": [144, 479, 171, 492], "text": "627)"}], "linking": [[6, 43]], "id": 43}, {"box": [184, 468, 310, 490], "text": "Current VICEROY 84 25% PG with SORBITOL", "label": "answer", "words": [{"box": [184, 468, 229, 479], "text": "Current"}, {"box": [232, 468, 278, 479], "text": "VICEROY"}, {"box": [282, 468, 295, 479], "text": "84"}, {"box": [186, 480, 207, 490], "text": "25%"}, {"box": [211, 479, 224, 490], "text": "PG"}, {"box": [228, 479, 255, 490], "text": "with"}, {"box": [258, 480, 310, 488], "text": "SORBITOL"}], "linking": [[6, 44]], "id": 44}, {"box": [425, 514, 494, 547], "text": "Current VICEROY 84 (#647/ 647", "label": "question", "words": [{"box": [432, 514, 477, 522], "text": "Current"}, {"box": [425, 524, 471, 535], "text": "VICEROY"}, {"box": [475, 524, 489, 534], "text": "84"}, {"box": [429, 536, 470, 546], "text": "(#647/"}, {"box": [469, 536, 494, 547], "text": "647"}], "linking": [[15, 45], [45, 16], [45, 18], [45, 20]], "id": 45}, {"box": [508, 513, 579, 546], "text": "25% PG w/ SORBITOL (#647/ 627)", "label": "question", "words": [{"box": [521, 513, 545, 524], "text": "25%"}, {"box": [545, 513, 563, 521], "text": "PG"}, {"box": [508, 522, 525, 536], "text": "w/"}, {"box": [524, 524, 573, 535], "text": "SORBITOL"}, {"box": [513, 535, 548, 546], "text": "(#647/"}, {"box": [545, 534, 579, 545], "text": "627)"}], "linking": [[15, 46], [46, 17], [46, 19], [46, 21]], "id": 46}, {"box": [184, 513, 254, 547], "text": "Current VICEROY 84 (#627/ 647)", "label": "answer", "words": [{"box": [191, 513, 236, 524], "text": "Current"}, {"box": [184, 524, 230, 535], "text": "VICEROY"}, {"box": [232, 524, 247, 534], "text": "84"}, {"box": [187, 536, 222, 547], "text": "(#627/"}, {"box": [222, 536, 254, 546], "text": "647)"}], "linking": [[14, 47]], "id": 47}, {"box": [268, 511, 339, 548], "text": "25% PG w/ SORBITOL #647/ 627", "label": "answer", "words": [{"box": [281, 511, 301, 524], "text": "25%"}, {"box": [306, 513, 320, 524], "text": "PG"}, {"box": [268, 524, 283, 535], "text": "w/"}, {"box": [281, 525, 334, 536], "text": "SORBITOL"}, {"box": [274, 535, 316, 548], "text": "#647/"}, {"box": [317, 535, 339, 546], "text": "627"}], "linking": [[14, 48]], "id": 48}]}
{"Unnamed: 0.1": 948943, "Unnamed: 0": 948943, "Seq": "TGCATTTTTTTCACATCGAGTATGCAGTAAGTCATGATGCTATGAGATCAATATGCTTTTTGTATTTAGAGGCAATCGTGCAAAGAACATGAGGCCAGGTTACGGCTGTT", "Predicted_Exp": 7.165856, "Actual_Exp": 0.189431815925206}
{"Unnamed: 0.1": 6274096, "Unnamed: 0": 6274096, "Seq": "TGCATTTTTTTCACATCTTTGTATGGTACTTTAATGGTTGGCACATTTACTTGATCCGGTACGTTAGGTTTGATTAGCTTATATGCGTTAGTCTTGGGTTACGGCTGTT", "Predicted_Exp": 9.423245, "Actual_Exp": 0.13812678868238}
{"Unnamed: 0.1": 5967423, "Unnamed: 0": 5967423, "Seq": "TGCATTTTTTTCACATCTTGAGGGTGCTGATTCCAACATCACTGAATAATTCTAGGAAAGTACTCAGTTGCAGCATGCTTGGTATTTAGGAAGGTTGGGTTACGGCTGTT", "Predicted_Exp": 8.2376375, "Actual_Exp": 0.0110927119261247}
{"Unnamed: 0.1": 6424900, "Unnamed: 0": 6424900, "Seq": "TGCATTTTTTTCACATCCAAGGGCCATGACCCCCTTTGCCTGAGTCTTTGGCACGTTCAGTGCGAGAAGATATAGTAACTGGGGTGTACGCACACTAGGTTACGGCTGTT", "Predicted_Exp": 8.263059, "Actual_Exp": 0.0082086208640412}
{"Unnamed: 0.1": 105547, "Unnamed: 0": 105547, "Seq": "TGCATTTTTTTCACATCAGACACGGTGGCCAGCTGCAAGGACTTGTAGGCGATAGCAATAAACCATGGTCGGGAGGTGCCGTGGTAGGACAATCAAGGGTTACGGCTGTT", "Predicted_Exp": 11.615106, "Actual_Exp": 0.0213699319833756}
{"Unnamed: 0.1": 366313, "Unnamed: 0": 366313, "Seq": "TGCATTTTTTTCACATCTTATCGTCAAGTACTCCTACTCCGAACGGTCGTAGTTGTATACCATTACGAGCGGTCGTCTGACGGAGACGTCACTGTGGGGTTACGGCTGTT", "Predicted_Exp": 12.378659, "Actual_Exp": 0.260274367994822}
{"Unnamed: 0.1": 3556938, "Unnamed: 0": 3556938, "Seq": "TGCATTTTTTTCACATCTCAGGTAGTTAACCAGCGCCTTAACCTTCACACGGTTCTAATGGGTTTGGACAGACCTAGCGATTAGGAAGTAGCAGACTGGTTACGGCTGTT", "Predicted_Exp": 7.7393866, "Actual_Exp": 0.0671484860535978}
{"Unnamed: 0.1": 1892408, "Unnamed: 0": 1892408, "Seq": "TGCATTTTTTTCACATCCCTGTCTCTGAGCTACTTGATGGTTTGGGTGGTTAGTCCAGAAGGCACGGCTCCTTGAGAGGCTTGCAGTGCTGGTAGGTGGTTACGGCTGTT", "Predicted_Exp": 7.7626266, "Actual_Exp": 0.0145658393587163}
{"Unnamed: 0.1": 1841494, "Unnamed: 0": 1841494, "Seq": "TGCATTTTTTTCACATCTAATCATGTAAATTAAATATTGCATCATGCGGTGCATAATCGTCCAACATATCTTTGGTTGGGCATCTAGTCTGTACAATGGTTACGGCTGTT", "Predicted_Exp": 7.432005, "Actual_Exp": 0.377255002794437}
{"Unnamed: 0.1": 894716, "Unnamed: 0": 894716, "Seq": "TGCATTTTTTTCACATCCAGGGGAGTGATATGTTCAGGCTTTGGTTTGTTACTTAATGATGGCTATTGAAACCTGGCCGTAGTCTGCACCCCGACTCGGTTACGGCTGTT", "Predicted_Exp": 9.002031, "Actual_Exp": 0.0944229731119969}
{"id": "761", "title": "Towards a NMR implementation of a quantum lattice gas algorithm", "abstract": "Recent theoretical results suggest that an array of quantum information processors communicating via classical channels can be used to solve fluid dynamics problems. Quantum lattice-gas algorithms (QLGA) running on such architectures have been shown to solve the diffusion equation and the nonlinear Burgers equations. In this report, we describe progress towards an ensemble nuclear magnetic resonance (NMR) implementation of a QLGA that solves the diffusion equation. The methods rely on NMR techniques to encode an initial mass density into an ensemble of two-qubit quantum information processors. Using standard pulse techniques, the mass density can then manipulated and evolved through the steps of the algorithm. We provide the experimental results of our first attempt to realize the NMR implementation. The results qualitatively follow the ideal simulation, but the observed implementation errors highlight the need for improved control", "keyphrases": ["NMR implementation", "quantum lattice gas algorithm", "quantum information processors", "fluid dynamics problems", "diffusion equation", "nonlinear Burgers equations", "nuclear magnetic resonance", "two-qubit quantum information.processors"], "prmu": ["P", "P", "P", "P", "P", "P", "P", "M"]}
{"id": "724", "title": "Banking on SMA funds [separately managed accounts]", "abstract": "From investment management to technology to back-office services, outsourcers are elbowing their way into the SMA business. Small banks are paying attention-and hoping to reap the rewards", "keyphrases": ["separately managed accounts", "investment management", "technology", "back-office services", "outsourcers", "small banks"], "prmu": ["P", "P", "P", "P", "P", "P"]}
{"id": "1371", "title": "Design methodology for diagnostic strategies for industrial systems", "abstract": "This paper presents a method for the construction of diagnostic systems for complex industrial applications. The approach has been explicitely developed to shorten the design cycle and meet some specific requirements, such as modularity, flexibility, and the possibility of merging many different sources of information. The method allows one to consider multiple simultaneous failures and is specifically designed to make easier the coordination and simplification of local diagnostic algorithms developed by different teams", "keyphrases": ["design methodology", "diagnostic strategies", "industrial systems", "modularity", "local diagnostic algorithms"], "prmu": ["P", "P", "P", "P", "P"]}
{"id": "1334", "title": "A shy invariant of graphs", "abstract": "Moving from a well known result of P.L. Hammer et al. (1982), we introduce a new graph invariant, say lambda (G) referring to any graph G. It is a non-negative integer which is non-zero whenever G contains particular induced odd cycles or, equivalently, admits a particular minimum clique-partition. We show that).(G) can be efficiently evaluated and that its determination allows one to reduce the hard problem of computing a minimum clique-cover of a graph to an identical problem of smaller size and special structure. Furthermore, one has alpha (G) <or= theta (G) - lambda (G), where alpha (G) and theta (G) respectively denote the cardinality of a maximum stable set of G and of a minimum clique-partition of G", "keyphrases": ["graph invariant", "induced odd cycles", "minimum clique-partition", "minimum clique-cover", "cardinality", "maximum stable set"], "prmu": ["P", "P", "P", "P", "P", "P"]}
{"id": "1419", "title": "PacketVideo. One step ahead of the streaming wireless market", "abstract": "Go beyond the hype, however, and it's clear that PacketVideo is making strides in delivering streaming multimedia content to wireless devices. For one thing, its technology, based on the industry-standard Motion Pictures Expert Group 4 (MPEG-4) video encoder/decoder, actually works as promised. Secondly, the company has forged a broad-based band of alliances that not only will eventually help it reach potential customers down the road, but provides it financial support until the company can ramp up sales. The list of PacketVideo's technology partners who are also investors-and who have pumped more than $121 million into the company-includes not just wireless device manufacturers, but content providers and semiconductor vendors, all of whom stand to benefit by increased sales of handheld wireless terminals", "keyphrases": ["PacketVideo", "wireless devices", "MPEG-4", "wireless device manufacturers", "content providers", "semiconductor vendors", "handheld wireless terminals", "multimedia content streaming"], "prmu": ["P", "P", "P", "P", "P", "P", "P", "R"]}
{"id": "1070", "title": "Universal simulation of Hamiltonian dynamics for quantum systems with finite-dimensional state spaces", "abstract": "What interactions are sufficient to simulate arbitrary quantum dynamics in a composite quantum system? Dodd et al. [Phys. Rev. A 65, 040301(R) (2002)] provided a partial solution to this problem in the form of an efficient algorithm to simulate any desired two-body Hamiltonian evolution using any fixed two-body entangling N-qubit Hamiltonian, and local unitaries. We extend this result to the case where the component systems are qudits, that is, have D dimensions. As a consequence we explain how universal quantum computation can be performed with any fixed two-body entangling N-qudit Hamiltonian, and local unitaries", "keyphrases": ["universal simulation", "Hamiltonian dynamics", "quantum systems", "quantum dynamics", "composite quantum system", "two-body Hamiltonian evolution", "fixed two-body entangling N-qubit Hamiltonian", "local unitaries", "universal quantum computation", "fixed two-body entangling N-qudit Hamiltonian", "finite- dimensional state spaces", "D-dimensional component systems"], "prmu": ["P", "P", "P", "P", "P", "P", "P", "P", "P", "P", "M", "M"]}
{"id": "1035", "title": "H/sub 2/ optimization of the three-element type dynamic vibration absorbers", "abstract": "The dynamic vibration absorber (DVA) is a passive vibration control device which is attached to a vibrating body (called a primary system) subjected to exciting force or motion. In this paper, we will discuss an optimization problem of the three-element type DVA on the basis of the H/sub 2/ optimization criterion. The objective of the H/sub 2/ optimization is to reduce the total vibration energy of the system for overall frequencies; the total area under the power spectrum response curve is minimized in this criterion. If the system is subjected to random excitation instead of sinusoidal excitation, then the H/sub 2/ optimization is probably more desirable than the popular H/sub infinity / optimization. In the past decade there has been increasing interest in the three-element type DVA. However, most previous studies on this type of DVA were based on the H/sub infinity / optimization design, and no one has been able to find the algebraic solution as of yet. We found a closed-form exact solution for a special case where the primary system has no damping. Furthermore, the general case solution including the damped primary system is presented in the form of a numerical solution. The optimum parameters obtained here are compared to those of the conventional Voigt type DVA. They are also compared to other optimum parameters based on the H/sub infinity / criterion", "keyphrases": ["H/sub 2/ optimization", "three-element type dynamic vibration absorbers", "passive vibration control", "power spectrum response", "Voigt type dynamic vibration absorber"], "prmu": ["P", "P", "P", "P", "R"]}
{"id": "1128", "title": "The semi-algebraic theory of stochastic games", "abstract": "The asymptotic behavior of the min-max value of a finite-state zero-sum discounted stochastic game, as the discount rate approaches 0, has been studied in the past using the theory of real-closed fields. We use the theory of semi-algebraic sets and mappings to prove some asymptotic properties of the min-max value, which hold uniformly for all stochastic games in which the number of states and players' actions are predetermined to some fixed values. As a corollary, we prove a uniform polynomial convergence rate of the value of the N-stage game to the value of the nondiscount game, over a bounded set of payoffs", "keyphrases": ["asymptotic behavior", "min-max value", "finite-state zero-sum discounted stochastic game", "discount rate", "uniform polynomial convergence rate", "N-stage game", "semi-algebraic set theory", "two-player zero-sum finite-state stochastic games"], "prmu": ["P", "P", "P", "P", "P", "P", "R", "M"]}
{"id": "538", "title": "Polarization of the RF field in a human head at high field: a study with a quadrature surface coil at 7.0 T", "abstract": "The RF field intensity distribution in the human brain becomes inhomogeneous due to wave behavior at high field. This is further complicated by the spatial distribution of RF field polarization that must be considered to predict image intensity distribution. An additional layer of complexity is involved when a quadrature coil is used for transmission and reception. To study such complicated RF field behavior, a computer modeling method was employed to investigate the RF field of a quadrature surface coil at 300 MHz. Theoretical and experimental results for a phantom and the human head at 7.0 T are presented. The results are theoretically important and practically useful for high-field quadrature coil design and application", "keyphrases": ["quadrature surface coil", "7.0 T", "RF field intensity distribution", "human brain", "spatial distribution", "RF field polarization", "image intensity distribution", "computer modeling", "300 MHz", "high field MRI", "high-field coil design", "whole-body MRI", "phantom samples", "segmented images", "3D multitissue head model", "gradient echo images", "finite difference time domain method", "Maxwell wave equations", "reception fields", "transmission fields"], "prmu": ["P", "P", "P", "P", "P", "P", "P", "P", "P", "M", "R", "U", "M", "M", "M", "M", "M", "M", "R", "R"]}
{"id": "681", "title": "Construction of information retrieval thesaurus for family planning terms using CDS/ISIS", "abstract": "The thesaurus as a tool for information retrieval and as an alternative to the existing scheme of classifications in information retrieval is discussed. The paper considers the emergence of the information retrieval thesaurus and its definition. Family planning is a multidisciplinary subject covering socio economic, cultural, psychological and medical fields. This necessitated the construction of a thesaurus for the Family Planning discipline. The construction is based on UNISIST, ISO 2788 and BS 5723 guidelines by using CDS/ISIS software", "keyphrases": ["information retrieval", "thesaurus", "family planning terms", "Family Planning", "classification", "culture", "psychology", "UNISIST", "ISO 2788", "BS 5723", "CDS/ISIS software", "bibliographic databases", "socio economic field", "medicine"], "prmu": ["P", "P", "P", "P", "P", "P", "P", "P", "P", "P", "P", "U", "R", "U"]}
{"texts": ["Q:\n\nselect from mysql with different key values\n\ni want to write some query which give me the product with specific key value\ntbl_product\n product_id field_id value\n 1 1 100\n 1 2 200\n\ni want to find all products that have (field_id = 1 and value = 100) and (field_id = 2 and value = 200 )\n\nA:\n\nYou can use where, group by, and having:\nselect product_id\nfrom t\nwhere (field_id = 1 and value = 100) or (field_id = 2 and value = 200 )\ngroup by product_id\nhaving count(*) = 2;\n\nIf duplicates are allowed, then you want count(distinct field_id) = 2.", "\n\n"], "meta": {"pile_set_name": "StackExchange"}, "scores": [0.0006944480701349676, 0.001995444530621171], "avg_score": 0.0013449463003780693, "num_sents": 2}
{"texts": ["Google introduced an updated Smart Display interface alongside the Nest Hub Max, and now you don't need that new hardware to see what the fuss is about. ", "The 9to5Google team has discovered that Google is rolling out the refreshed interface to the Nest Hub (formerly the Home Hub) and, presumably, third-party devices. ", "The new home screen ditches the all-white Material Design appearance in favor of a more personal carousel of cards that keeps your wallpaper in the background. ", "You won't see as much of the weather forecast, but you should have more overall info at a glance."], "meta": {"pile_set_name": "OpenWebText2"}, "scores": [0.0006344860885292292, 0.0007651066989637911, 0.0007916662725619972, 0.0005299872136674821], "avg_score": 0.0006803115684306249, "num_sents": 4}
{"texts": ["// cgo -godefs -- -fsigned-char types_openbsd.go | go run mkpost.go\n// Code generated by the command above; see README.md. ", "DO NOT EDIT.", "\n\n// +build arm64,openbsd\n\npackage unix\n\nconst (\n\tSizeofPtr = 0x8\n\tSizeofShort = 0x2\n\tSizeofInt = 0x4\n\tSizeofLong = 0x8\n\tSizeofLongLong = 0x8\n)\n\ntype (\n\t_C_short int16\n\t_C_int int32\n\t_C_long int64\n\t_C_long_long int64\n)\n\ntype Timespec struct {\n\tSec int64\n\tNsec int64\n}\n\ntype Timeval struct {\n\tSec int64\n\tUsec int64\n}\n\ntype Rusage struct {\n\tUtime Timeval\n\tStime Timeval\n\tMaxrss int64\n\tIxrss int64\n\tIdrss int64\n\tIsrss int64\n\tMinflt int64\n\tMajflt int64\n\tNswap int64\n\tInblock int64\n\tOublock int64\n\tMsgsnd int64\n\tMsgrcv int64\n\tNsignals int64\n\tNvcsw int64\n\tNivcsw int64\n}\n\ntype Rlimit struct {\n\tCur uint64\n\tMax uint64\n}\n\ntype _Gid_t uint32\n\ntype Stat_t struct {\n\tMode uint32\n\tDev int32\n\tIno uint64\n\tNlink uint32\n\tUid uint32\n\tGid uint32\n\tRdev int32\n\tAtim Timespec\n\tMtim Timespec\n\tCtim Timespec\n\tSize int64\n\tBlocks int64\n\tBlksize int32\n\tFlags uint32\n\tGen uint32\n\t_ Timespec\n}\n\ntype Statfs_t struct {\n\tF_flags uint32\n\tF_bsize uint32\n\tF_iosize uint32\n\tF_blocks uint64\n\tF_bfree uint64\n\tF_bavail int64\n\tF_files uint64\n\tF_ffree uint64\n\tF_favail int64\n\tF_syncwrites uint64\n\tF_syncreads uint64\n\tF_asyncwrites uint64\n\tF_asyncreads uint64\n\tF_fsid Fsid\n\tF_namemax uint32\n\tF_owner uint32\n\tF_ctime uint64\n\tF_fstypename [16]int8\n\tF_mntonname [90]int8\n\tF_mntfromname [90]int8\n\tF_mntfromspec [90]int8\n\t_ [2]byte\n\tMount_info [160]byte\n}\n\ntype Flock_t struct {\n\tStart int64\n\tLen int64\n\tPid int32\n\tType int16\n\tWhence int16\n}\n\ntype Dirent struct {\n\tFileno uint64\n\tOff int64\n\tReclen uint16\n\tType uint8\n\tNamlen uint8\n\t_ [4]uint8\n\tName [256]int8\n}\n\ntype Fsid struct {\n\tVal [2]int32\n}\n\nconst (\n\tPathMax = 0x400\n)\n\ntype RawSockaddrInet4 struct {\n\tLen uint8\n\tFamily uint8\n\tPort uint16\n\tAddr [4]byte /* in_addr */\n\tZero [8]int8\n}\n\ntype RawSockaddrInet6 struct {\n\tLen uint8\n\tFamily uint8\n\tPort uint16\n\tFlowinfo uint32\n\tAddr [16]byte /* in6_addr */\n\tScope_id uint32\n}\n\ntype RawSockaddrUnix struct {\n\tLen uint8\n\tFamily uint8\n\tPath [104]int8\n}\n\ntype RawSockaddrDatalink struct {\n\tLen uint8\n\tFamily uint8\n\tIndex uint16\n\tType uint8\n\tNlen uint8\n\tAlen uint8\n\tSlen uint8\n\tData [24]int8\n}\n\ntype RawSockaddr struct {\n\tLen uint8\n\tFamily uint8\n\tData [14]int8\n}\n\ntype RawSockaddrAny struct {\n\tAddr RawSockaddr\n\tPad [92]int8\n}\n\ntype _Socklen uint32\n\ntype Linger struct {\n\tOnoff int32\n\tLinger int32\n}\n\ntype Iovec struct {\n\tBase *byte\n\tLen uint64\n}\n\ntype IPMreq struct {\n\tMultiaddr [4]byte /* in_addr */\n\tInterface [4]byte /* in_addr */\n}\n\ntype IPv6Mreq struct {\n\tMultiaddr [16]byte /* in6_addr */\n\tInterface uint32\n}\n\ntype Msghdr struct {\n\tName *byte\n\tNamelen uint32\n\tIov *Iovec\n\tIovlen uint32\n\tControl *byte\n\tControllen uint32\n\tFlags int32\n}\n\ntype Cmsghdr struct {\n\tLen uint32\n\tLevel int32\n\tType int32\n}\n\ntype Inet6Pktinfo struct {\n\tAddr [16]byte /* in6_addr */\n\tIfindex uint32\n}\n\ntype IPv6MTUInfo struct {\n\tAddr RawSockaddrInet6\n\tMtu uint32\n}\n\ntype ICMPv6Filter struct {\n\tFilt [8]uint32\n}\n\nconst (\n\tSizeofSockaddrInet4 = 0x10\n\tSizeofSockaddrInet6 = 0x1c\n\tSizeofSockaddrAny = 0x6c\n\tSizeofSockaddrUnix = 0x6a\n\tSizeofSockaddrDatalink = 0x20\n\tSizeofLinger = 0x8\n\tSizeofIPMreq = 0x8\n\tSizeofIPv6Mreq = 0x14\n\tSizeofMsghdr = 0x30\n\tSizeofCmsghdr = 0xc\n\tSizeofInet6Pktinfo = 0x14\n\tSizeofIPv6MTUInfo = 0x20\n\tSizeofICMPv6Filter = 0x20\n)\n\nconst (\n\tPTRACE_TRACEME = 0x0\n\tPTRACE_CONT = 0x7\n\tPTRACE_KILL = 0x8\n)\n\ntype Kevent_t struct {\n\tIdent uint64\n\tFilter int16\n\tFlags uint16\n\tFflags uint32\n\tData int64\n\tUdata *byte\n}\n\ntype FdSet struct {\n\tBits [32]uint32\n}\n\nconst (\n\tSizeofIfMsghdr = 0xa8\n\tSizeofIfData = 0x90\n\tSizeofIfaMsghdr = 0x18\n\tSizeofIfAnnounceMsghdr = 0x1a\n\tSizeofRtMsghdr = 0x60\n\tSizeofRtMetrics = 0x38\n)\n\ntype IfMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPad1 uint8\n\tPad2 uint8\n\tAddrs int32\n\tFlags int32\n\tXflags int32\n\tData IfData\n}\n\ntype IfData struct {\n\tType uint8\n\tAddrlen uint8\n\tHdrlen uint8\n\tLink_state uint8\n\tMtu uint32\n\tMetric uint32\n\tRdomain uint32\n\tBaudrate uint64\n\tIpackets uint64\n\tIerrors uint64\n\tOpackets uint64\n\tOerrors uint64\n\tCollisions uint64\n\tIbytes uint64\n\tObytes uint64\n\tImcasts uint64\n\tOmcasts uint64\n\tIqdrops uint64\n\tOqdrops uint64\n\tNoproto uint64\n\tCapabilities uint32\n\tLastchange Timeval\n}\n\ntype IfaMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPad1 uint8\n\tPad2 uint8\n\tAddrs int32\n\tFlags int32\n\tMetric int32\n}\n\ntype IfAnnounceMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tWhat uint16\n\tName [16]int8\n}\n\ntype RtMsghdr struct {\n\tMsglen uint16\n\tVersion uint8\n\tType uint8\n\tHdrlen uint16\n\tIndex uint16\n\tTableid uint16\n\tPriority uint8\n\tMpls uint8\n\tAddrs int32\n\tFlags int32\n\tFmask int32\n\tPid int32\n\tSeq int32\n\tErrno int32\n\tInits uint32\n\tRmx RtMetrics\n}\n\ntype RtMetrics struct {\n\tPksent uint64\n\tExpire int64\n\tLocks uint32\n\tMtu uint32\n\tRefcnt uint32\n\tHopcount uint32\n\tRecvpipe uint32\n\tSendpipe uint32\n\tSsthresh uint32\n\tRtt uint32\n\tRttvar uint32\n\tPad uint32\n}\n\ntype Mclpool struct{}\n\nconst (\n\tSizeofBpfVersion = 0x4\n\tSizeofBpfStat = 0x8\n\tSizeofBpfProgram = 0x10\n\tSizeofBpfInsn = 0x8\n\tSizeofBpfHdr = 0x14\n)\n\ntype BpfVersion struct {\n\tMajor uint16\n\tMinor uint16\n}\n\ntype BpfStat struct {\n\tRecv uint32\n\tDrop uint32\n}\n\ntype BpfProgram struct {\n\tLen uint32\n\tInsns *BpfInsn\n}\n\ntype BpfInsn struct {\n\tCode uint16\n\tJt uint8\n\tJf uint8\n\tK uint32\n}\n\ntype BpfHdr struct {\n\tTstamp BpfTimeval\n\tCaplen uint32\n\tDatalen uint32\n\tHdrlen uint16\n\t_ [2]byte\n}\n\ntype BpfTimeval struct {\n\tSec uint32\n\tUsec uint32\n}\n\ntype Termios struct {\n\tIflag uint32\n\tOflag uint32\n\tCflag uint32\n\tLflag uint32\n\tCc [20]uint8\n\tIspeed int32\n\tOspeed int32\n}\n\ntype Winsize struct {\n\tRow uint16\n\tCol uint16\n\tXpixel uint16\n\tYpixel uint16\n}\n\nconst (\n\tAT_FDCWD = -0x64\n\tAT_SYMLINK_FOLLOW = 0x4\n\tAT_SYMLINK_NOFOLLOW = 0x2\n)\n\ntype PollFd struct {\n\tFd int32\n\tEvents int16\n\tRevents int16\n}\n\nconst (\n\tPOLLERR = 0x8\n\tPOLLHUP = 0x10\n\tPOLLIN = 0x1\n\tPOLLNVAL = 0x20\n\tPOLLOUT = 0x4\n\tPOLLPRI = 0x2\n\tPOLLRDBAND = 0x80\n\tPOLLRDNORM = 0x40\n\tPOLLWRBAND = 0x100\n\tPOLLWRNORM = 0x4\n)\n\ntype Sigset_t uint32\n\ntype Utsname struct {\n\tSysname [256]byte\n\tNodename [256]byte\n\tRelease [256]byte\n\tVersion [256]byte\n\tMachine [256]byte\n}\n\nconst SizeofUvmexp = 0x158\n\ntype Uvmexp struct {\n\tPagesize int32\n\tPagemask int32\n\tPageshift int32\n\tNpages int32\n\tFree int32\n\tActive int32\n\tInactive int32\n\tPaging int32\n\tWired int32\n\tZeropages int32\n\tReserve_pagedaemon int32\n\tReserve_kernel int32\n\tUnused01 int32\n\tVnodepages int32\n\tVtextpages int32\n\tFreemin int32\n\tFreetarg int32\n\tInactarg int32\n\tWiredmax int32\n\tAnonmin int32\n\tVtextmin int32\n\tVnodemin int32\n\tAnonminpct int32\n\tVtextminpct int32\n\tVnodeminpct int32\n\tNswapdev int32\n\tSwpages int32\n\tSwpginuse int32\n\tSwpgonly int32\n\tNswget int32\n\tNanon int32\n\tUnused05 int32\n\tUnused06 int32\n\tFaults int32\n\tTraps int32\n\tIntrs int32\n\tSwtch int32\n\tSofts int32\n\tSyscalls int32\n\tPageins int32\n\tUnused07 int32\n\tUnused08 int32\n\tPgswapin int32\n\tPgswapout int32\n\tForks int32\n\tForks_ppwait int32\n\tForks_sharevm int32\n\tPga_zerohit int32\n\tPga_zeromiss int32\n\tUnused09 int32\n\tFltnoram int32\n\tFltnoanon int32\n\tFltnoamap int32\n\tFltpgwait int32\n\tFltpgrele int32\n\tFltrelck int32\n\tFltrelckok int32\n\tFltanget int32\n\tFltanretry int32\n\tFltamcopy int32\n\tFltnamap int32\n\tFltnomap int32\n\tFltlget int32\n\tFltget int32\n\tFlt_anon int32\n\tFlt_acow int32\n\tFlt_obj int32\n\tFlt_prcopy int32\n\tFlt_przero int32\n\tPdwoke int32\n\tPdrevs int32\n\tPdswout int32\n\tPdfreed int32\n\tPdscans int32\n\tPdanscan int32\n\tPdobscan int32\n\tPdreact int32\n\tPdbusy int32\n\tPdpageouts int32\n\tPdpending int32\n\tPddeact int32\n\tUnused11 int32\n\tUnused12 int32\n\tUnused13 int32\n\tFpswtch int32\n\tKmapent int32\n}\n\nconst SizeofClockinfo = 0x14\n\ntype Clockinfo struct {\n\tHz int32\n\tTick int32\n\tTickadj int32\n\tStathz int32\n\tProfhz int32\n}\n"], "meta": {"pile_set_name": "Github"}, "scores": [0.002171107567846775, 0.00201672175899148, 0.017271922901272774], "avg_score": 0.007153250742703676, "num_sents": 3}
{"texts": ["The present disclosure relates to a coupling for use in an irrigation system.", "\nSuch a coupling may be used between an irrigation pipe and a main distribution pipe from which it branches off.", "\nUS Patent Application No. ", "20070074776, the disclosure of which is incorporated herein by reference, describes that the walls of a pipe under internal hydrostatic pressure experience, under ideal conditions, twice the stress in the circumferential direction as they do in the longitudinal direction.", "\nIn some cases, this should be taken into account in the coupling."], "meta": {"pile_set_name": "USPTO Backgrounds"}, "scores": [0.0005332758883014321, 0.0006365402368828654, 0.0007085877587087452, 0.000580577936489135, 0.0005565620958805084], "avg_score": 0.0006031087832525373, "num_sents": 5}
{"texts": ["Doctors in Wales Call for Breast Feed Law\n\nWelsh doctors are calling on the Welsh Assembly Government to introduce new laws to encourage breastfeeding.", "\n\nThe Welsh branch of The British Medical Association (BMA Cymru) says breastfeeding in places like restaurants, cafes and shops should be more widely and positively encouraged.", "\n\nIt says that breastfeeding is the best option for mothers and new laws would help change public attitudes.", "\n\nThe assembly government said it gave full support to breastfeeding mothers, and was reviewing the legislation.", "\nBMA Cymru said that despite the many health advantages to breastfeeding, in England and Wales over 28% of mothers still do not breastfeed.", "\n\nThe greatest obstacle appears to be the fear of embarrassment or of offending others. ", "This causes many mothers to either never begin breastfeeding or to stop breastfeeding prematurely.", "\n\nBreastfeeding protects against many childhood illnesses including gastro-intestinal and respiratory infections.", "\n\nIt is also said that women who have breastfed have lower risks of pre-menopausal breast cancer, ovarian cancer and hip fractures later in life.", "\n\nBack in May 2006, the assembly government launched the 'Breastfeeding Welcome Scheme', which asks businesses to make four promises aimed at making breastfeeding easier for mothers. ", "Those companies accepted on the scheme can display a window sticker showing they provide a welcome environment for mothers who want to breastfeed.", "\n\nHowever, BMA Cymru said laws are required to make it more acceptable for women to breastfeed in restaurants, cafes, shops and other public areas where children are allowed.", "\n\nA recent survey carried out by the National Childbirth Trust found that almost 80% of mothers would like to see a law that protects their right to breastfeed.", "\n\nThe Welsh secretary of the BMA, Richard Lewis, said: \"The assembly is looking for new legislation which it could support when it receives new powers in 2007.\"", "\n\"Legislation on breastfeeding would help to effect a change in public attitudes, as it would send out a strong message that it is acceptable for women to breastfeed and that it should be positively encouraged.\"", "\nDr Lewis added that mothers who choose not to breastfeed should also be \"supported in their choice\".", "\n\nThe BMA's initiative is supported by the Royal College of Nursing in Wales.", "\nIts director, Tina Donnelly, said: \"The fear of being offensive or embarrassed has caused mothers to either never begin breastfeeding or to prematurely wean their infants.\"", "\nThe chairman of the BMA's Welsh Council, Dr Tony Calland added: \"We are calling for the assembly to create an environment where women of all ethnic, social and cultural backgrounds are comfortable with discreetly feeding their babies anywhere and at any time.\"", "\nA spokesperson for the assembly government said: \"We give our full support to breastfeeding mothers as breast milk is best for babies.\"", "\n\"We welcome the BMA's comments and the legislation is under review.\"", "\n\nChicco has built a great foundation for creating wallet friendly baby and toddler equipment which doesn't necessarily wow on appearance but for safety and value for money has always ticked the box..... read more"], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.005583861377090216, 0.0017387890256941319, 0.05016675218939781, 0.006521565839648247, 0.004765714053064585, 0.0021446775645017624, 0.11023880541324615, 0.0030670217238366604, 0.0768134593963623, 0.0022784911561757326, 0.0926106870174408, 0.06666956841945648, 0.007732665166258812, 0.000545315386261791, 0.013722816482186317, 0.018046677112579346, 0.0005447742878459394, 0.02133900672197342, 0.0015507983043789864, 0.006304176524281502, 0.0005282829515635967, 0.0007426550146192312], "avg_score": 0.022438934596721083, "num_sents": 22}
{"texts": ["Waterways opening for the weekend raise concern for residents\n\nFRENCH SETTLEMENT - Water ways in Ascension, Livingston and St. James will all be open by Thursday at noon.", "\n\nBlind River is open in St. James Parish. ", "Parish officials in Livingston and Ascension Parishes said all water ways in their area will be deemed safe for recreational use by Thursday at noon.", "\n\nSome residents along the water say they still have concerns. ", "Logs and branches still litter the waterways and can't always be seen by boaters.", "\n\n\"I see trees, I see refrigerators, I see all type of debris that gets brought from the bank into the river whenever the waters getting high,\" said Jim Templet, at Templet Marine. \"", "I do see a lot of impact damages after floods, two weekends after a flood there's still things that are floating with the water some seen and some unseen and the damages can be very expensive up to five, six thousand dollars or more in some cases.\"", "\n\nOther homeowners said the high water can damage their property if boaters make wakes near their homes.", "\n\n\"As camp owners, the waves and the stuff like that, from all the joy riders, just tears up everybody else's property, you know, when the water's high and knocking boards lose off the warf and stuff like that,\" said Rhett Cornett Sideline Boat Repair."], "meta": {"pile_set_name": "Pile-CC"}, "scores": [0.0005678875604644418, 0.0008545665768906474, 0.0005408136057667434, 0.0005969637422822416, 0.0010214030044153333, 0.0005766106769442558, 0.0005744241643697023, 0.0015279592480510473, 0.0010502042714506388], "avg_score": 0.0008123147611816725, "num_sents": 9}
{"feat_bid": 161, "feat_is_aggregate": false, "feat_source": "pinkmonkey", "feat_chapter_path": "all_chapterized_books/161-chapters/12.txt", "feat_summary_path": "finished_summaries/pinkmonkey/Sense and Sensibility/section_11_part_0.txt", "feat_book_id": "Sense and Sensibility.chapter 12", "feat_summary_id": "chapter 12", "feat_content": null, "feat_summary": "{\"name\": \"Chapter 12\", \"url\": \"https://web.archive.org/web/20180820034609/http://www.pinkmonkey.com/booknotes/monkeynotes/pmSenseSensibility27.asp\", \"summary\": \"Mrs. Dashwood and her daughters are busy attending parties and balls. Marianne is in her element. She is overjoyed in the company of Willoughby, who showers much affection and attention on her. Elinor even feels left out at times. Deprived of friends of her own age, she is often thrown in the company of Mrs. Jennings and Lady Middleton. At such times she welcomes the presence of Colonel Brandon. Brandon often talks of Marianne and asks Elinor about her sister's preferences.\", \"analysis\": \"Notes Jane Austen paints the picture of an eighteenth-century upper middle-class society. The Dashwoods and Middletons are shown to be busy attending parties and balls. Their main occupation is socializing, and they take pleasure in entertaining people. Every young girl waits for a respectable young man to woo her, and her parents hope for a match between them. They lead a leisurely life, perhaps unusual to the modern reader. Marianne is exhilarated by the looks and manners of her lover. She does not care to understand his essential nature. Obsessed with Willoughby, she ignores Colonel Brandon and unconsciously hurts him. Blinded by her infatuation for Willoughby, she is not able to realize the worth of the Colonel or detect the intensity of his feelings. This chapter again emphasizes the difference in attitudes between Willoughby and Colonel Brandon. Both men are attracted to Marianne. Willoughby displays his affection by wooing Marianne, like a dashing hero would, while Colonel Brandon admires his lady love from a distance and silently hopes to win her favor. Willoughby is interested only in flirting with Marianne, but the Colonel, like a sincere person, looks forward to a lasting relationship. CHAPTER 12 Summary Marianne gets carried away by Willoughby's showy gestures. When he offers her a horse, she accepts it readily and talks about it to her sister. Elinor is shocked to learn this and asks Marianne to decline the offer, as it would prove too costly for them. Elinor observes Willoughby's behavior towards her sister and detects a note of intimacy in it. Margaret tells Elinor about her suspicion of an engagement between Marianne and Willoughby. Later, at Mrs. Jennings' insistence, Margaret gives a hint about Elinor's attachment to Edward, much to Elinor's embarrassment. Notes The chapter hints at the extent of the involvement of Marianne with Willoughby. Willoughby tries to impress Marianne by offering her a horse as a gift, and Marianne foolishly accepts the offer without giving a thought to the expenditure involved. Willoughby's superficiality and Marianne's gullibility are exposed in this episode. Chapter 12 also reveals the character of the youngest of the Dashwood girls. Margaret, one of the minor characters in the novel, is otherwise ignored by Austen. Only a few chapters give a glimpse into her personality. Margaret, like a typical teenager, gets excited over little things and jumps to conclusions easily. She derives pleasure from revealing secrets. She informs Elinor about the impending marriage between Marianne and Willoughby because she saw the young man taking a lock of hair from her sister . At the Park, she gives hints about the relationship between Elinor and Edward to Mrs. Jennings, much to the embarrassment of her sister. Like a reckless teenager, she is always in a hurry to impart information not meant to be disclosed publicly. CHAPTER 13 Summary Everyone is eagerly looking forward to their picnic at Whitewell. However, on the morning of the outing, a letter arrives for Colonel Brandon and alters the situation. The letter disturbs Brandon, and he informs the others about his decision to leave immediately for the town. The picnic is canceled, much to the disappointment of all, since it is not possible to proceed to Whitewell without the assistance of the Colonel. Sir John Middleton suggests that they should go for a ride in the carriage around the countryside. Marianne and Willoughby take a separate carriage. They visit Allenham on the sly. When Elinor learns about their visit, she is angry with Marianne for not observing the rules of propriety. Marianne justifies her action. Notes An element of suspense is introduced in this chapter. After the Colonel reads the letter, he turns grave and decides to leave for the town immediately. He evades the questions of Mrs. Jennings and declines to postpone his visit. After he leaves, Mrs. Jennings hints at the possibility of his visiting his illegitimate daughter, Miss Williams. Through this bit of information, Austen arouses the curiosity of the reader regarding the mysterious past of Colonel Brandon. Marianne and Willoughby are insensitive to the feelings of the Colonel and fail to sympathize with his plight. They criticize Brandon for spoiling the afternoon. Colonel Brandon comes across as a man in control of his emotions. Even though he is disturbed by the contents of the letter, he does not reveal his misery to others. Like a gentleman, he excuses himself from the party and bows to Marianne before taking his leave. His silence speaks volumes. The chapter relates one more incident which creates a clash between the good sense of Elinor and the sensibility of Marianne. Marianne makes a secret visit to Allenham with Willoughby but does not feel guilty about what she has done. Elinor's sense of decorum causes her to condemn her sister's actions, as she does not approve of Marianne's visiting a stranger's house with a man to whom she is not even engaged, at least not openly.\"}", "text": "\n\nAs Elinor and Marianne were walking together the next morning the\nlatter communicated a piece of news to her sister, which in spite of\nall that she knew before of Marianne's imprudence and want of thought,\nsurprised her by its extravagant testimony of both. Marianne told her,\nwith the greatest delight, that Willoughby had given her a horse, one\nthat he had bred himself on his estate in Somersetshire, and which was\nexactly calculated to carry a woman. Without considering that it was\nnot in her mother's plan to keep any horse, that if she were to alter\nher resolution in favour of this gift, she must buy another for the\nservant, and keep a servant to ride it, and after all, build a stable\nto receive them, she had accepted the present without hesitation, and\ntold her sister of it in raptures.\n\n\"He intends to send his groom into Somersetshire immediately for it,\"\nshe added, \"and when it arrives we will ride every day. You shall\nshare its use with me. Imagine to yourself, my dear Elinor, the\ndelight of a gallop on some of these downs.\"\n\nMost unwilling was she to awaken from such a dream of felicity to\ncomprehend all the unhappy truths which attended the affair; and for\nsome time she refused to submit to them. As to an additional servant,\nthe expense would be a trifle; Mama she was sure would never object to\nit; and any horse would do for HIM; he might always get one at the\npark; as to a stable, the merest shed would be sufficient. Elinor then\nventured to doubt the propriety of her receiving such a present from a\nman so little, or at least so lately known to her. This was too much.\n\n\"You are mistaken, Elinor,\" said she warmly, \"in supposing I know very\nlittle of Willoughby. I have not known him long indeed, but I am much\nbetter acquainted with him, than I am with any other creature in the\nworld, except yourself and mama. It is not time or opportunity that is\nto determine intimacy;--it is disposition alone. Seven years would be\ninsufficient to make some people acquainted with each other, and seven\ndays are more than enough for others. I should hold myself guilty of\ngreater impropriety in accepting a horse from my brother, than from\nWilloughby. Of John I know very little, though we have lived together\nfor years; but of Willoughby my judgment has long been formed.\"\n\nElinor thought it wisest to touch that point no more. She knew her\nsister's temper. Opposition on so tender a subject would only attach\nher the more to her own opinion. But by an appeal to her affection for\nher mother, by representing the inconveniences which that indulgent\nmother must draw on herself, if (as would probably be the case) she\nconsented to this increase of establishment, Marianne was shortly\nsubdued; and she promised not to tempt her mother to such imprudent\nkindness by mentioning the offer, and to tell Willoughby when she saw\nhim next, that it must be declined.\n\nShe was faithful to her word; and when Willoughby called at the\ncottage, the same day, Elinor heard her express her disappointment to\nhim in a low voice, on being obliged to forego the acceptance of his\npresent. The reasons for this alteration were at the same time\nrelated, and they were such as to make further entreaty on his side\nimpossible. His concern however was very apparent; and after\nexpressing it with earnestness, he added, in the same low voice,--\"But,\nMarianne, the horse is still yours, though you cannot use it now. I\nshall keep it only till you can claim it. When you leave Barton to\nform your own establishment in a more lasting home, Queen Mab shall\nreceive you.\"\n\nThis was all overheard by Miss Dashwood; and in the whole of the\nsentence, in his manner of pronouncing it, and in his addressing her\nsister by her Christian name alone, she instantly saw an intimacy so\ndecided, a meaning so direct, as marked a perfect agreement between\nthem. From that moment she doubted not of their being engaged to each\nother; and the belief of it created no other surprise than that she, or\nany of their friends, should be left by tempers so frank, to discover\nit by accident.\n\nMargaret related something to her the next day, which placed this\nmatter in a still clearer light. Willoughby had spent the preceding\nevening with them, and Margaret, by being left some time in the parlour\nwith only him and Marianne, had had opportunity for observations,\nwhich, with a most important face, she communicated to her eldest\nsister, when they were next by themselves.\n\n\"Oh, Elinor!\" she cried, \"I have such a secret to tell you about\nMarianne. I am sure she will be married to Mr. Willoughby very soon.\"\n\n\"You have said so,\" replied Elinor, \"almost every day since they first\nmet on High-church Down; and they had not known each other a week, I\nbelieve, before you were certain that Marianne wore his picture round\nher neck; but it turned out to be only the miniature of our great\nuncle.\"\n\n\"But indeed this is quite another thing. I am sure they will be\nmarried very soon, for he has got a lock of her hair.\"\n\n\"Take care, Margaret. It may be only the hair of some great uncle of\nHIS.\"\n\n\"But, indeed, Elinor, it is Marianne's. I am almost sure it is, for I\nsaw him cut it off. Last night after tea, when you and mama went out\nof the room, they were whispering and talking together as fast as could\nbe, and he seemed to be begging something of her, and presently he took\nup her scissors and cut off a long lock of her hair, for it was all\ntumbled down her back; and he kissed it, and folded it up in a piece of\nwhite paper; and put it into his pocket-book.\"\n\nFor such particulars, stated on such authority, Elinor could not\nwithhold her credit; nor was she disposed to it, for the circumstance\nwas in perfect unison with what she had heard and seen herself.\n\nMargaret's sagacity was not always displayed in a way so satisfactory\nto her sister. When Mrs. Jennings attacked her one evening at the\npark, to give the name of the young man who was Elinor's particular\nfavourite, which had been long a matter of great curiosity to her,\nMargaret answered by looking at her sister, and saying, \"I must not\ntell, may I, Elinor?\"\n\nThis of course made every body laugh; and Elinor tried to laugh too.\nBut the effort was painful. She was convinced that Margaret had fixed\non a person whose name she could not bear with composure to become a\nstanding joke with Mrs. Jennings.\n\nMarianne felt for her most sincerely; but she did more harm than good\nto the cause, by turning very red and saying in an angry manner to\nMargaret,\n\n\"Remember that whatever your conjectures may be, you have no right to\nrepeat them.\"\n\n\"I never had any conjectures about it,\" replied Margaret; \"it was you\nwho told me of it yourself.\"\n\nThis increased the mirth of the company, and Margaret was eagerly\npressed to say something more.\n\n\"Oh! pray, Miss Margaret, let us know all about it,\" said Mrs.\nJennings. \"What is the gentleman's name?\"\n\n\"I must not tell, ma'am. But I know very well what it is; and I know\nwhere he is too.\"\n\n\"Yes, yes, we can guess where he is; at his own house at Norland to be\nsure. He is the curate of the parish I dare say.\"\n\n\"No, THAT he is not. He is of no profession at all.\"\n\n\"Margaret,\" said Marianne with great warmth, \"you know that all this is\nan invention of your own, and that there is no such person in\nexistence.\"\n\n\"Well, then, he is lately dead, Marianne, for I am sure there was such\na man once, and his name begins with an F.\"\n\nMost grateful did Elinor feel to Lady Middleton for observing, at this\nmoment, \"that it rained very hard,\" though she believed the\ninterruption to proceed less from any attention to her, than from her\nladyship's great dislike of all such inelegant subjects of raillery as\ndelighted her husband and mother. The idea however started by her, was\nimmediately pursued by Colonel Brandon, who was on every occasion\nmindful of the feelings of others; and much was said on the subject of\nrain by both of them. Willoughby opened the piano-forte, and asked\nMarianne to sit down to it; and thus amidst the various endeavours of\ndifferent people to quit the topic, it fell to the ground. But not so\neasily did Elinor recover from the alarm into which it had thrown her.\n\nA party was formed this evening for going on the following day to see a\nvery fine place about twelve miles from Barton, belonging to a\nbrother-in-law of Colonel Brandon, without whose interest it could not\nbe seen, as the proprietor, who was then abroad, had left strict orders\non that head. The grounds were declared to be highly beautiful, and\nSir John, who was particularly warm in their praise, might be allowed\nto be a tolerable judge, for he had formed parties to visit them, at\nleast, twice every summer for the last ten years. They contained a\nnoble piece of water; a sail on which was to a form a great part of the\nmorning's amusement; cold provisions were to be taken, open carriages\nonly to be employed, and every thing conducted in the usual style of a\ncomplete party of pleasure.\n\nTo some few of the company it appeared rather a bold undertaking,\nconsidering the time of year, and that it had rained every day for the\nlast fortnight;--and Mrs. Dashwood, who had already a cold, was\npersuaded by Elinor to stay at home.\n\n\n", "feat_chapter_length": 1559.0, "feat_summary_name": "Chapter 12", "feat_summary_url": "https://web.archive.org/web/20180820034609/http://www.pinkmonkey.com/booknotes/monkeynotes/pmSenseSensibility27.asp", "target": "Mrs. Dashwood and her daughters are busy attending parties and balls. Marianne is in her element. She is overjoyed in the company of Willoughby, who showers much affection and attention on her. Elinor even feels left out at times. Deprived of friends of her own age, she is often thrown in the company of Mrs. Jennings and Lady Middleton. At such times she welcomes the presence of Colonel Brandon. Brandon often talks of Marianne and asks Elinor about her sister's preferences.", "feat_summary_analysis": "Notes Jane Austen paints the picture of an eighteenth-century upper middle-class society. The Dashwoods and Middletons are shown to be busy attending parties and balls. Their main occupation is socializing, and they take pleasure in entertaining people. Every young girl waits for a respectable young man to woo her, and her parents hope for a match between them. They lead a leisurely life, perhaps unusual to the modern reader. Marianne is exhilarated by the looks and manners of her lover. She does not care to understand his essential nature. Obsessed with Willoughby, she ignores Colonel Brandon and unconsciously hurts him. Blinded by her infatuation for Willoughby, she is not able to realize the worth of the Colonel or detect the intensity of his feelings. This chapter again emphasizes the difference in attitudes between Willoughby and Colonel Brandon. Both men are attracted to Marianne. Willoughby displays his affection by wooing Marianne, like a dashing hero would, while Colonel Brandon admires his lady love from a distance and silently hopes to win her favor. Willoughby is interested only in flirting with Marianne, but the Colonel, like a sincere person, looks forward to a lasting relationship. CHAPTER 12 Summary Marianne gets carried away by Willoughby's showy gestures. When he offers her a horse, she accepts it readily and talks about it to her sister. Elinor is shocked to learn this and asks Marianne to decline the offer, as it would prove too costly for them. Elinor observes Willoughby's behavior towards her sister and detects a note of intimacy in it. Margaret tells Elinor about her suspicion of an engagement between Marianne and Willoughby. Later, at Mrs. Jennings' insistence, Margaret gives a hint about Elinor's attachment to Edward, much to Elinor's embarrassment. Notes The chapter hints at the extent of the involvement of Marianne with Willoughby. Willoughby tries to impress Marianne by offering her a horse as a gift, and Marianne foolishly accepts the offer without giving a thought to the expenditure involved. Willoughby's superficiality and Marianne's gullibility are exposed in this episode. Chapter 12 also reveals the character of the youngest of the Dashwood girls. Margaret, one of the minor characters in the novel, is otherwise ignored by Austen. Only a few chapters give a glimpse into her personality. Margaret, like a typical teenager, gets excited over little things and jumps to conclusions easily. She derives pleasure from revealing secrets. She informs Elinor about the impending marriage between Marianne and Willoughby because she saw the young man taking a lock of hair from her sister . At the Park, she gives hints about the relationship between Elinor and Edward to Mrs. Jennings, much to the embarrassment of her sister. Like a reckless teenager, she is always in a hurry to impart information not meant to be disclosed publicly. CHAPTER 13 Summary Everyone is eagerly looking forward to their picnic at Whitewell. However, on the morning of the outing, a letter arrives for Colonel Brandon and alters the situation. The letter disturbs Brandon, and he informs the others about his decision to leave immediately for the town. The picnic is canceled, much to the disappointment of all, since it is not possible to proceed to Whitewell without the assistance of the Colonel. Sir John Middleton suggests that they should go for a ride in the carriage around the countryside. Marianne and Willoughby take a separate carriage. They visit Allenham on the sly. When Elinor learns about their visit, she is angry with Marianne for not observing the rules of propriety. Marianne justifies her action. Notes An element of suspense is introduced in this chapter. After the Colonel reads the letter, he turns grave and decides to leave for the town immediately. He evades the questions of Mrs. Jennings and declines to postpone his visit. After he leaves, Mrs. Jennings hints at the possibility of his visiting his illegitimate daughter, Miss Williams. Through this bit of information, Austen arouses the curiosity of the reader regarding the mysterious past of Colonel Brandon. Marianne and Willoughby are insensitive to the feelings of the Colonel and fail to sympathize with his plight. They criticize Brandon for spoiling the afternoon. Colonel Brandon comes across as a man in control of his emotions. Even though he is disturbed by the contents of the letter, he does not reveal his misery to others. Like a gentleman, he excuses himself from the party and bows to Marianne before taking his leave. His silence speaks volumes. The chapter relates one more incident which creates a clash between the good sense of Elinor and the sensibility of Marianne. Marianne makes a secret visit to Allenham with Willoughby but does not feel guilty about what she has done. Elinor's sense of decorum causes her to condemn her sister's actions, as she does not approve of Marianne's visiting a stranger's house with a man to whom she is not even engaged, at least not openly.", "feat_summary_length": 81.0, "feat_analysis_length": 819.0, "evaluation_predictions": [0, 37, 416, 1379, 6, 8, 192, 13, 135, 33, 3214, 544, 5, 328, 817, 10149, 4515, 24, 2003, 2999, 969, 1891, 160, 3, 9, 126, 4952, 11, 24, 255, 133, 114, 12, 698, 34, 28, 376, 38, 168, 5, 451, 1845, 7, 48, 1876, 406, 29457, 6, 68, 116, 255, 987, 7, 572, 255, 405, 59, 1845, 34, 6, 255, 845, 255, 19, 394, 29740, 28, 112, 388, 145, 28, 1321, 1307, 16, 8, 296, 5, 366, 79, 942, 541, 6, 1363, 5, 56, 4607, 969, 6456, 7, 24, 3, 88, 56, 453, 8, 4952, 552, 255, 54, 1988, 34, 274, 255, 3231, 1386, 17, 106, 21, 492, 6257, 3, 9, 3574, 234, 5, 8667, 5, 644, 4884, 2037, 1616, 7, 48, 6, 11, 2017, 3384, 7, 24, 132, 19, 46, 31249, 344, 135, 5, 86, 685, 6, 255, 317, 7, 24, 70, 3813, 19, 131, 24306, 5, 16689, 817, 7, 1289, 77, 127, 24, 255, 65, 1219, 160, 4806, 24, 255, 4054, 24, 255, 56, 36, 20111, 53, 1363, 5, 16309, 4607, 969, 1116, 5, 451, 92, 817, 7, 160, 4806, 81, 149, 3, 88, 1340, 326, 128, 6044, 6081, 13, 10149, 4515, 1268, 45, 8, 1767, 706, 31, 7, 3634, 5, 216, 17387, 15, 26, 165, 223, 11, 474, 34, 16, 112, 6743, 484, 5, 486, 80, 500, 6, 8667, 5, 1022, 687, 7, 1380, 125, 8, 564, 13, 841, 47, 30, 8, 2447, 5, 94, 47, 66, 182, 6613, 6, 11, 921, 8719, 7, 5, 621, 12104, 8, 1426, 13, 12574, 6, 8, 563, 2204, 7, 12, 281, 12, 3, 9, 786, 2052, 1069, 1084, 1386, 17, 6029, 5, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}
{"feat_bid": 110, "feat_is_aggregate": false, "feat_source": "gradesaver", "feat_chapter_path": "all_chapterized_books/110-chapters/20.txt", "feat_summary_path": "finished_summaries/gradesaver/Tess of the D'Urbervilles/section_2_part_5.txt", "feat_book_id": "Tess of the D'Urbervilles.chapter 20", "feat_summary_id": "chapter 20", "feat_content": null, "feat_summary": "{\"name\": \"Chapter 20\", \"url\": \"https://web.archive.org/web/20210410060617/https://www.gradesaver.com/tess-of-the-durbervilles/study-guide/summary-phase-3-chapters-16-24\", \"summary\": \"Tess had never in her recent life been so happy and would possibly never be so happy again. She and Tess stand between predilection and love. For Angel, Tess represents a visionary essence of woman, and calls her Artemis, Demeter, and other fanciful names, but she insists that he call her simply Tess. Tess seems to exhibit a dignified largeness of disposition and physique. The two are always the first to awake at the dairy house, where they feel an impressive isolation, as if they are Adam and Eve.\", \"analysis\": \"Hardy makes explicit that Tess's time at Talbothays dairy is an idyllic respite from her normal toil and hardship, yet states that this happiness will be short-lived, foreshadowing greater adversity for Tess Durbeyfield. Hardy compares Angel and Tess to Adam and Eve in the mornings, thus foreshadowing a later fall from perfection. It is the idealism and perfection that Tess finds at Talbothays that leads to this shaky foundation for her happiness; Angel Clare adores Tess as a representation of perfection. To Angel, Tess is a goddess such as Artemis or Demeter, a symbol of perfection rather than a person with obvious faults and foibles. There is a great irony in Angel's adoration for Tess; Angel exalts Tess as a goddess for her strength and disposition, yet this perfection comes from the adversity stemming from her greatest weakness\"}", "text": "\n\nThe season developed and matured. Another year's instalment of\nflowers, leaves, nightingales, thrushes, finches, and such ephemeral\ncreatures, took up their positions where only a year ago others had\nstood in their place when these were nothing more than germs and\ninorganic particles. Rays from the sunrise drew forth the buds and\nstretched them into long stalks, lifted up sap in noiseless streams,\nopened petals, and sucked out scents in invisible jets and\nbreathings.\n\nDairyman Crick's household of maids and men lived on comfortably,\nplacidly, even merrily. Their position was perhaps the happiest of\nall positions in the social scale, being above the line at which\nneediness ends, and below the line at which the _convenances_ begin\nto cramp natural feelings, and the stress of threadbare modishness\nmakes too little of enough.\n\nThus passed the leafy time when arborescence seems to be the one\nthing aimed at out of doors. Tess and Clare unconsciously studied\neach other, ever balanced on the edge of a passion, yet apparently\nkeeping out of it. All the while they were converging, under an\nirresistible law, as surely as two streams in one vale.\n\nTess had never in her recent life been so happy as she was now,\npossibly never would be so happy again. She was, for one thing,\nphysically and mentally suited among these new surroundings. The\nsapling which had rooted down to a poisonous stratum on the spot of\nits sowing had been transplanted to a deeper soil. Moreover she, and\nClare also, stood as yet on the debatable land between predilection\nand love; where no profundities have been reached; no reflections\nhave set in, awkwardly inquiring, \"Whither does this new current tend\nto carry me? What does it mean to my future? How does it stand\ntowards my past?\"\n\nTess was the merest stray phenomenon to Angel Clare as yet--a rosy,\nwarming apparition which had only just acquired the attribute of\npersistence in his consciousness. So he allowed his mind to be\noccupied with her, deeming his preoccupation to be no more than a\nphilosopher's regard of an exceedingly novel, fresh, and interesting\nspecimen of womankind.\n\nThey met continually; they could not help it. They met daily in that\nstrange and solemn interval, the twilight of the morning, in the\nviolet or pink dawn; for it was necessary to rise early, so very\nearly, here. Milking was done betimes; and before the milking came\nthe skimming, which began at a little past three. It usually fell\nto the lot of some one or other of them to wake the rest, the first\nbeing aroused by an alarm-clock; and, as Tess was the latest arrival,\nand they soon discovered that she could be depended upon not to sleep\nthough the alarm as others did, this task was thrust most frequently\nupon her. No sooner had the hour of three struck and whizzed,\nthan she left her room and ran to the dairyman's door; then up the\nladder to Angel's, calling him in a loud whisper; then woke her\nfellow-milkmaids. By the time that Tess was dressed Clare was\ndownstairs and out in the humid air. The remaining maids and the\ndairyman usually gave themselves another turn on the pillow, and did\nnot appear till a quarter of an hour later.\n\nThe gray half-tones of daybreak are not the gray half-tones of the\nday's close, though the degree of their shade may be the same. In\nthe twilight of the morning, light seems active, darkness passive;\nin the twilight of evening it is the darkness which is active and\ncrescent, and the light which is the drowsy reverse.\n\nBeing so often--possibly not always by chance--the first two persons\nto get up at the dairy-house, they seemed to themselves the first\npersons up of all the world. In these early days of her residence\nhere Tess did not skim, but went out of doors at once after rising,\nwhere he was generally awaiting her. The spectral, half-compounded,\naqueous light which pervaded the open mead impressed them with\na feeling of isolation, as if they were Adam and Eve. At this\ndim inceptive stage of the day Tess seemed to Clare to exhibit a\ndignified largeness both of disposition and physique, an almost\nregnant power, possibly because he knew that at that preternatural\ntime hardly any woman so well endowed in person as she was likely to\nbe walking in the open air within the boundaries of his horizon; very\nfew in all England. Fair women are usually asleep at mid-summer\ndawns. She was close at hand, and the rest were nowhere.\n\nThe mixed, singular, luminous gloom in which they walked along\ntogether to the spot where the cows lay often made him think of the\nResurrection hour. He little thought that the Magdalen might be\nat his side. Whilst all the landscape was in neutral shade his\ncompanion's face, which was the focus of his eyes, rising above the\nmist stratum, seemed to have a sort of phosphorescence upon it. She\nlooked ghostly, as if she were merely a soul at large. In reality\nher face, without appearing to do so, had caught the cold gleam of\nday from the north-east; his own face, though he did not think of\nit, wore the same aspect to her.\n\nIt was then, as has been said, that she impressed him most deeply.\nShe was no longer the milkmaid, but a visionary essence of woman--a\nwhole sex condensed into one typical form. He called her Artemis,\nDemeter, and other fanciful names half teasingly, which she did not\nlike because she did not understand them.\n\n\"Call me Tess,\" she would say askance; and he did.\n\nThen it would grow lighter, and her features would become simply\nfeminine; they had changed from those of a divinity who could confer\nbliss to those of a being who craved it.\n\nAt these non-human hours they could get quite close to the waterfowl.\nHerons came, with a great bold noise as of opening doors and\nshutters, out of the boughs of a plantation which they frequented at\nthe side of the mead; or, if already on the spot, hardily maintained\ntheir standing in the water as the pair walked by, watching them by\nmoving their heads round in a slow, horizontal, passionless wheel,\nlike the turn of puppets by clockwork.\n\nThey could then see the faint summer fogs in layers, woolly, level,\nand apparently no thicker than counterpanes, spread about the meadows\nin detached remnants of small extent. On the gray moisture of the\ngrass were marks where the cows had lain through the night--dark-green\nislands of dry herbage the size of their carcasses, in the general\nsea of dew. From each island proceeded a serpentine trail, by which\nthe cow had rambled away to feed after getting up, at the end of\nwhich trail they found her; the snoring puff from her nostrils, when\nshe recognized them, making an intenser little fog of her own amid\nthe prevailing one. Then they drove the animals back to the barton,\nor sat down to milk them on the spot, as the case might require.\n\nOr perhaps the summer fog was more general, and the meadows lay like\na white sea, out of which the scattered trees rose like dangerous\nrocks. Birds would soar through it into the upper radiance, and\nhang on the wing sunning themselves, or alight on the wet rails\nsubdividing the mead, which now shone like glass rods. Minute\ndiamonds of moisture from the mist hung, too, upon Tess's eyelashes,\nand drops upon her hair, like seed pearls. When the day grew quite\nstrong and commonplace these dried off her; moreover, Tess then\nlost her strange and ethereal beauty; her teeth, lips, and eyes\nscintillated in the sunbeams and she was again the dazzlingly fair\ndairymaid only, who had to hold her own against the other women of\nthe world.\n\nAbout this time they would hear Dairyman Crick's voice, lecturing the\nnon-resident milkers for arriving late, and speaking sharply to old\nDeborah Fyander for not washing her hands.\n\n\"For Heaven's sake, pop thy hands under the pump, Deb! Upon my soul,\nif the London folk only knowed of thee and thy slovenly ways, they'd\nswaller their milk and butter more mincing than they do a'ready; and\nthat's saying a good deal.\"\n\nThe milking progressed, till towards the end Tess and Clare, in\ncommon with the rest, could hear the heavy breakfast table dragged\nout from the wall in the kitchen by Mrs Crick, this being the\ninvariable preliminary to each meal; the same horrible scrape\naccompanying its return journey when the table had been cleared.\n\n\n", "feat_chapter_length": 1349.0, "feat_summary_name": "Chapter 20", "feat_summary_url": "https://web.archive.org/web/20210410060617/https://www.gradesaver.com/tess-of-the-durbervilles/study-guide/summary-phase-3-chapters-16-24", "target": "Tess had never in her recent life been so happy and would possibly never be so happy again. She and Tess stand between predilection and love. For Angel, Tess represents a visionary essence of woman, and calls her Artemis, Demeter, and other fanciful names, but she insists that he call her simply Tess. Tess seems to exhibit a dignified largeness of disposition and physique. The two are always the first to awake at the dairy house, where they feel an impressive isolation, as if they are Adam and Eve.", "feat_summary_analysis": "Hardy makes explicit that Tess's time at Talbothays dairy is an idyllic respite from her normal toil and hardship, yet states that this happiness will be short-lived, foreshadowing greater adversity for Tess Durbeyfield. Hardy compares Angel and Tess to Adam and Eve in the mornings, thus foreshadowing a later fall from perfection. It is the idealism and perfection that Tess finds at Talbothays that leads to this shaky foundation for her happiness; Angel Clare adores Tess as a representation of perfection. To Angel, Tess is a goddess such as Artemis or Demeter, a symbol of perfection rather than a person with obvious faults and foibles. There is a great irony in Angel's adoration for Tess; Angel exalts Tess as a goddess for her strength and disposition, yet this perfection comes from the adversity stemming from her greatest weakness", "feat_summary_length": 89.0, "feat_analysis_length": 138.0, "evaluation_predictions": [0, 37, 774, 13919, 11, 10281, 7, 5, 37, 5699, 13, 8, 13688, 348, 19, 3, 9, 1095, 286, 6, 28, 150, 174, 6096, 5542, 42, 666, 8, 96, 8056, 1926, 663, 7, 121, 1731, 12, 24268, 6869, 8979, 7, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}
{"feat_bid": 1232, "feat_is_aggregate": false, "feat_source": "shmoop", "feat_chapter_path": "all_chapterized_books/1232-chapters/09.txt", "feat_summary_path": "finished_summaries/shmoop/The Prince/section_9_part_0.txt", "feat_book_id": "The Prince.chapter 9", "feat_summary_id": "chapter 9", "feat_content": null, "feat_summary": "{\"name\": \"Chapter 9\", \"url\": \"https://web.archive.org/web/20210420060055/https://www.shmoop.com/study-guides/literature/prince-machiavelli/summary/chapter-9\", \"summary\": \"Rulers that come to power because of the support of the people are the total opposite of bloody conquers. Everyone loves 'em. They're not too smart, or even extra lucky, but just enough to get by. Our new ruler has three options for his new place: a monarchy where power goes to the nobles, a republic where power goes to the people, and anarchy. In monarchies, either the nobles or the people decide to concentrate all the power in one person, the king. Seems simple enough, but a king who comes to power because of the nobles will have a hard time. After all, the nobles have lots of power to throw around, too. Remember, you don't want anyone who can compete with you around, and these are the people with the weapons. What are the regular people going to do to you? Poke you with their potatoes? Bottom line: be friends with the people, because the nobles have too many tricks up their sleeves. More on nobles. There are two kinds, those who are totally 100% loyally part of your fan club and those who aren't. Out of those who aren't, there are two kinds. Those who are just scaredy-cats , and those who are planning something. The latter are the ones to watch out for because they will turn on you at the drop of a hat. Okay, back to the people. You need to be on their side. It's pretty easy, actually, because they basically just don't want to be oppressed and tortured. Also, if they thought you were going to be super mean, and you turn out to be okay, they will love you even more than if they loved you from the start. They're easy to please. Some people say that it's a bad idea to depend on the support of the people. Machiavelli just doesn't agree--he says that's only the case if you're stupid and think they'll fight for you or rescue you. That's not going to happen. But they can support you and not turn against you. Problems for the ruler supported by the people? When they want to become an absolute ruler, they need either give direct command or rule though other people who they give power to. The problem is, these people aren't always the most trustworthy--before you know it, everything is up in flames. So, make sure your people always need not only your government , but you specifically, and everything will be okay.\", \"analysis\": \"\"}", "text": "\nBut coming to the other point--where a leading citizen becomes the\nprince of his country, not by wickedness or any intolerable violence,\nbut by the favour of his fellow citizens--this may be called a civil\nprincipality: nor is genius or fortune altogether necessary to attain to\nit, but rather a happy shrewdness. I say then that such a principality\nis obtained either by the favour of the people or by the favour of the\nnobles. Because in all cities these two distinct parties are found,\nand from this it arises that the people do not wish to be ruled nor\noppressed by the nobles, and the nobles wish to rule and oppress the\npeople; and from these two opposite desires there arises in cities one\nof three results, either a principality, self-government, or anarchy.\n\nA principality is created either by the people or by the nobles,\naccordingly as one or other of them has the opportunity; for the nobles,\nseeing they cannot withstand the people, begin to cry up the reputation\nof one of themselves, and they make him a prince, so that under his\nshadow they can give vent to their ambitions. The people, finding\nthey cannot resist the nobles, also cry up the reputation of one of\nthemselves, and make him a prince so as to be defended by his authority.\nHe who obtains sovereignty by the assistance of the nobles maintains\nhimself with more difficulty than he who comes to it by the aid of\nthe people, because the former finds himself with many around him who\nconsider themselves his equals, and because of this he can neither rule\nnor manage them to his liking. But he who reaches sovereignty by popular\nfavour finds himself alone, and has none around him, or few, who are not\nprepared to obey him.\n\nBesides this, one cannot by fair dealing, and without injury to others,\nsatisfy the nobles, but you can satisfy the people, for their object is\nmore righteous than that of the nobles, the latter wishing to oppress,\nwhile the former only desire not to be oppressed. It is to be added also\nthat a prince can never secure himself against a hostile people, because\nof there being too many, whilst from the nobles he can secure himself,\nas they are few in number. The worst that a prince may expect from a\nhostile people is to be abandoned by them; but from hostile nobles he\nhas not only to fear abandonment, but also that they will rise against\nhim; for they, being in these affairs more far-seeing and astute, always\ncome forward in time to save themselves, and to obtain favours from him\nwhom they expect to prevail. Further, the prince is compelled to live\nalways with the same people, but he can do well without the same nobles,\nbeing able to make and unmake them daily, and to give or take away\nauthority when it pleases him.\n\nTherefore, to make this point clearer, I say that the nobles ought to\nbe looked at mainly in two ways: that is to say, they either shape their\ncourse in such a way as binds them entirely to your fortune, or they do\nnot. Those who so bind themselves, and are not rapacious, ought to be\nhonoured and loved; those who do not bind themselves may be dealt\nwith in two ways; they may fail to do this through pusillanimity and a\nnatural want of courage, in which case you ought to make use of them,\nespecially of those who are of good counsel; and thus, whilst in\nprosperity you honour them, in adversity you do not have to fear them.\nBut when for their own ambitious ends they shun binding themselves, it\nis a token that they are giving more thought to themselves than to you,\nand a prince ought to guard against such, and to fear them as if they\nwere open enemies, because in adversity they always help to ruin him.\n\nTherefore, one who becomes a prince through the favour of the people\nought to keep them friendly, and this he can easily do seeing they\nonly ask not to be oppressed by him. But one who, in opposition to\nthe people, becomes a prince by the favour of the nobles, ought, above\neverything, to seek to win the people over to himself, and this he may\neasily do if he takes them under his protection. Because men, when they\nreceive good from him of whom they were expecting evil, are bound more\nclosely to their benefactor; thus the people quickly become more devoted\nto him than if he had been raised to the principality by their favours;\nand the prince can win their affections in many ways, but as these vary\naccording to the circumstances one cannot give fixed rules, so I omit\nthem; but, I repeat, it is necessary for a prince to have the people\nfriendly, otherwise he has no security in adversity.\n\nNabis,(*) Prince of the Spartans, sustained the attack of all Greece,\nand of a victorious Roman army, and against them he defended his country\nand his government; and for the overcoming of this peril it was only\nnecessary for him to make himself secure against a few, but this would\nnot have been sufficient had the people been hostile. And do not let any\none impugn this statement with the trite proverb that \"He who builds on\nthe people, builds on the mud,\" for this is true when a private citizen\nmakes a foundation there, and persuades himself that the people will\nfree him when he is oppressed by his enemies or by the magistrates;\nwherein he would find himself very often deceived, as happened to the\nGracchi in Rome and to Messer Giorgio Scali(+) in Florence. But granted\na prince who has established himself as above, who can command, and is\na man of courage, undismayed in adversity, who does not fail in other\nqualifications, and who, by his resolution and energy, keeps the whole\npeople encouraged--such a one will never find himself deceived in them,\nand it will be shown that he has laid his foundations well.\n\n (*) Nabis, tyrant of Sparta, conquered by the Romans under\n Flamininus in 195 B.C.; killed 192 B.C.\n\n (+) Messer Giorgio Scali. This event is to be found in\n Machiavelli's \"Florentine History,\" Book III.\n\nThese principalities are liable to danger when they are passing from the\ncivil to the absolute order of government, for such princes either rule\npersonally or through magistrates. In the latter case their government\nis weaker and more insecure, because it rests entirely on the goodwill\nof those citizens who are raised to the magistracy, and who, especially\nin troubled times, can destroy the government with great ease, either\nby intrigue or open defiance; and the prince has not the chance amid\ntumults to exercise absolute authority, because the citizens and\nsubjects, accustomed to receive orders from magistrates, are not of\na mind to obey him amid these confusions, and there will always be in\ndoubtful times a scarcity of men whom he can trust. For such a prince\ncannot rely upon what he observes in quiet times, when citizens have\nneed of the state, because then every one agrees with him; they all\npromise, and when death is far distant they all wish to die for him;\nbut in troubled times, when the state has need of its citizens, then\nhe finds but few. And so much the more is this experiment dangerous,\ninasmuch as it can only be tried once. Therefore a wise prince ought to\nadopt such a course that his citizens will always in every sort and\nkind of circumstance have need of the state and of him, and then he will\nalways find them faithful.\n\n\n\n", "feat_chapter_length": 1217.0, "feat_summary_name": "Chapter 9", "feat_summary_url": "https://web.archive.org/web/20210420060055/https://www.shmoop.com/study-guides/literature/prince-machiavelli/summary/chapter-9", "target": "Rulers that come to power because of the support of the people are the total opposite of bloody conquers. Everyone loves 'em. They're not too smart, or even extra lucky, but just enough to get by. Our new ruler has three options for his new place: a monarchy where power goes to the nobles, a republic where power goes to the people, and anarchy. In monarchies, either the nobles or the people decide to concentrate all the power in one person, the king. Seems simple enough, but a king who comes to power because of the nobles will have a hard time. After all, the nobles have lots of power to throw around, too. Remember, you don't want anyone who can compete with you around, and these are the people with the weapons. What are the regular people going to do to you? Poke you with their potatoes? Bottom line: be friends with the people, because the nobles have too many tricks up their sleeves. More on nobles. There are two kinds, those who are totally 100% loyally part of your fan club and those who aren't. Out of those who aren't, there are two kinds. Those who are just scaredy-cats , and those who are planning something. The latter are the ones to watch out for because they will turn on you at the drop of a hat. Okay, back to the people. You need to be on their side. It's pretty easy, actually, because they basically just don't want to be oppressed and tortured. Also, if they thought you were going to be super mean, and you turn out to be okay, they will love you even more than if they loved you from the start. They're easy to please. Some people say that it's a bad idea to depend on the support of the people. Machiavelli just doesn't agree--he says that's only the case if you're stupid and think they'll fight for you or rescue you. That's not going to happen. But they can support you and not turn against you. Problems for the ruler supported by the people? When they want to become an absolute ruler, they need either give direct command or rule though other people who they give power to. The problem is, these people aren't always the most trustworthy--before you know it, everything is up in flames. So, make sure your people always need not only your government , but you specifically, and everything will be okay.", "feat_summary_analysis": null, "feat_summary_length": 414.0, "feat_analysis_length": 1.0, "evaluation_predictions": [0, 37, 3, 29, 291, 52, 1016, 817, 7, 178, 24, 8, 151, 33, 7403, 12, 36, 3, 21096, 57, 17243, 7, 6, 78, 79, 2204, 12, 143, 80, 13, 135, 3, 9, 22277, 1446, 13, 271, 3, 9, 21893, 5, 37, 1076, 113, 582, 3, 9, 9027, 45, 8, 2449, 278, 31, 17, 241, 12, 36, 16026, 250, 79, 43, 150, 1160, 68, 12, 22566, 8, 17243, 7, 11, 8, 151, 5, 328, 103, 59, 241, 12, 3356, 42, 22566, 8, 151, 250, 79, 1178, 8891, 70, 9331, 545, 5, 86, 3119, 6, 175, 192, 12311, 33, 435, 10, 8, 151, 1663, 12, 36, 16718, 42, 22566, 15, 26, 117, 8, 24708, 7, 241, 12, 661, 11, 22566, 8, 5169, 117, 11, 16, 119, 3119, 6, 132, 33, 386, 487, 6353, 10, 80, 19, 1044, 18, 27818, 42, 46, 7064, 725, 5, 37, 166, 19, 21, 8, 18407, 17243, 7, 12, 428, 95, 112, 579, 190, 8, 199, 13, 8, 151, 117, 8, 511, 19, 250, 8, 17243, 904, 54, 470, 1520, 30, 12, 8, 1017, 277, 250, 79, 33, 396, 186, 5, 37, 167, 359, 589, 24, 3, 9, 388, 54, 103, 19, 619, 28, 8, 337, 16588, 38, 3, 88, 405, 116, 3, 88, 65, 8, 337, 151, 5, 216, 54, 103, 394, 406, 8, 337, 887, 6, 84, 19, 514, 12, 143, 11, 1028, 4660, 15, 1444, 5, 100, 598, 24, 3, 88, 54, 1865, 2448, 168, 406, 8, 625, 17243, 7, 5, 4213, 6, 3, 88, 92, 845, 24, 3, 99, 3, 9, 568, 2992, 3, 9, 13062, 57, 8, 4971, 13, 8, 17243, 348, 6, 3, 15262, 34, 56, 36, 1842, 12, 1369, 8, 24337, 147, 12, 376, 5, 156, 3, 88, 1527, 8, 151, 339, 1058, 6, 258, 3, 89, 3535, 35, 7, 135, 139, 2852, 3, 9, 16054, 6, 237, 3, 99, 79, 33, 73, 10699, 107, 1329, 5, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}
{"feat_bid": 23042, "feat_is_aggregate": false, "feat_source": "sparknotes", "feat_chapter_path": "all_chapterized_books/23042-chapters/4.txt", "feat_summary_path": "finished_summaries/sparknotes/The Tempest/section_4_part_0.txt", "feat_book_id": "The Tempest.act ii.scene ii", "feat_summary_id": "act ii, scene ii", "feat_content": null, "feat_summary": "{\"name\": \"Act II, scene ii\", \"url\": \"https://web.archive.org/web/20210131162607/https://www.sparknotes.com/shakespeare/tempest/section5/\", \"summary\": \"Caliban enters with a load of wood, and thunder sounds in the background. Caliban curses and describes the torments that Prospero's spirits subject him to: they pinch, bite, and prick him, especially when he curses. As he is thinking of these spirits, Caliban sees Trinculo and imagines him to be one of the spirits. Hoping to avoid pinching, he lies down and covers himself with his cloak. Trinculo hears the thunder and looks about for some cover from the storm. The only thing he sees is the cloak-covered Caliban on the ground. He is not so much repulsed by Caliban as curious. He cannot decide whether Caliban is a \\\"man or a fish\\\" . He thinks of a time when he traveled to England and witnessed freak-shows there. Caliban, he thinks, would bring him a lot of money in England. Thunder sounds again and Trinculo decides that the best shelter in sight is beneath Caliban's cloak, and so he joins the man-monster there. Stephano enters singing and drinking. He hears Caliban cry out to Trinculo, \\\"Do not torment me! O!\\\" . Hearing this and seeing the four legs sticking out from the cloak, Stephano thinks the two men are a four-legged monster with a fever. He decides to relieve this fever with a drink. Caliban continues to resist Trinculo, whom he still thinks is a spirit tormenting him. Trinculo recognizes Stephano's voice and says so. Stephano, of course, assumes for a moment that the monster has two heads, and he promises to pour liquor in both mouths. Trinculo now calls out to Stephano, and Stephano pulls his friend out from under the cloak. While the two men discuss how they arrived safely on shore, Caliban enjoys the liquor and begs to worship Stephano. The men take full advantage of Caliban's drunkenness, mocking him as a \\\"most ridiculous monster\\\" as he promises to lead them around and show them the isle.\", \"analysis\": \"Analysis Trinculo and Stephano are the last new characters to be introduced in the play. They act as comic foils to the main action, and will in later acts become specific parodies of Antonio and Sebastian. At this point, their role is to present comically some of the more serious issues in the play concerning Prospero and Caliban. In Act I, scene ii, Prospero calls Caliban a \\\"slave\\\" , \\\"thou earth\\\" , \\\"Filth\\\" , and \\\"Hag-seed\\\" . Stephano and Trinculo's epithet of choice in Act II, scene ii and thereafter is \\\"monster.\\\" But while these two make quite clear that Caliban is seen as less than human by the Europeans on the island, they also treat him more humanely than Prospero does. Stephano and Trinculo, a butler and a jester respectively, remain at the low end of the social scale in the play, and have little difficulty finding friendship with the strange islander they meet. \\\" Misery acquaints a man with strange bedfellows,\\\" says Trinculo , and then hastens to crawl beneath Caliban's garment in order to get out of the rain. The similarity, socially and perhaps physically as well, between Trinculo and Caliban is further emphasized when Stephano, drunk, initially mistakes the two for a single monster: \\\"This is some monster of the isle with four legs\\\" . More important than the emphasis on the way in which Caliban seems to others more monster than man, is the way in which this scene dramatizes the initial encounter between an almost completely isolated, \\\"primitive\\\" culture and a foreign, \\\"civilized\\\" one. The reader discovers during Caliban and Prospero's confrontation in Act I, scene ii that Prospero initially \\\"made much of\\\" Caliban ; that he gave Caliban \\\"Water with berries in't\\\" ; that Caliban showed him around the island; and that Prospero later imprisoned Caliban, after he had taken all he could take from him. The reader can see these events in Act II, scene ii, with Trinculo and Stephano in the place of Prospero. Stephano calls Caliban a \\\"brave monster,\\\" as they set off singing around the island. In addition, Stephano and Trinculo give Caliban wine, which Caliban finds to be a \\\"celestial liquor\\\" . Moreover, Caliban initially mistakes Stephano and Trinculo for Prospero's spirits, but alcohol convinces him that Stephano is a \\\"brave god\\\" and decides unconditionally to \\\"kneel to him\\\" . This scene shows the foreign, civilized culture as decadent and manipulative: Stephano immediately plans to \\\"inherit\\\" the island , using Caliban to show him all its virtues. Stephano and Trinculo are a grotesque, parodic version of Prospero upon his arrival twelve years ago. Godlike in the eyes of the native, they slash and burn their way to power. By this point, Caliban has begun to resemble a parody of himself. Whereas he would \\\"gabble like / A thing most brutish\\\" upon Prospero's arrival, because he did not know language, he now is willfully inarticulate in his drunkenness. Immediately putting aside his fear that these men are spirits sent to do him harm, Caliban puts his trust in them for all the wrong reasons. What makes Caliban's behavior in this scene so tragic is that we might expect him, especially after his eloquent curses of Prospero in Act I, scene ii, to know better.\"}", "text": "SCENE II.\n\n_Another part of the island._\n\n _Enter CALIBAN with a burden of wood. A noise of thunder heard._\n\n_Cal._ All the infections that the sun sucks up\nFrom bogs, fens, flats, on Prosper fall, and make him\nBy inch-meal a disease! His spirits hear me,\nAnd yet I needs must curse. But they'll nor pinch,\nFright me with urchin-shows, pitch me i' the mire, 5\nNor lead me, like a firebrand, in the dark\nOut of my way, unless he bid 'em: but\nFor every trifle are they set upon me;\nSometime like apes, that mow and chatter at me,\nAnd after bite me; then like hedgehogs, which 10\nLie tumbling in my barefoot way, and mount\nTheir pricks at my footfall; sometime am I\nAll wound with adders, who with cloven tongues\nDo hiss me into madness.\n\n _Enter TRINCULO._\n\n Lo, now, lo!\nHere comes a spirit of his, and to torment me 15\nFor bringing wood in slowly. I'll fall flat;\nPerchance he will not mind me.\n\n_Trin._ Here's neither bush nor shrub, to bear off any\nweather at all, and another storm brewing; I hear it sing i'\nthe wind: yond same black cloud, yond huge one, looks 20\nlike a foul bombard that would shed his liquor. If it should\nthunder as it did before, I know not where to hide my head:\nyond same cloud cannot choose but fall by pailfuls. What\nhave we here? a man or a fish? dead or alive? A fish: he\nsmells like a fish; a very ancient and fish-like smell; a kind 25\nof not of the newest Poor-John. A strange fish! Were I\nin England now, as once I was, and had but this fish\npainted, not a holiday fool there but would give a piece of\nsilver: there would this monster make a man; any strange\nbeast there makes a man: when they will not give a doit to 30\nrelieve a lame beggar, they will lay out ten to see a dead\nIndian. Legged like a man! and his fins like arms! Warm\no' my troth! I do now let loose my opinion; hold it no\nlonger: this is no fish, but an islander, that hath lately\nsuffered by a thunderbolt. [_Thunder._] Alas, the storm is come 35\nagain! my best way is to creep under his gaberdine; there\nis no other shelter hereabout: misery acquaints a man with\nstrange bed-fellows. I will here shroud till the dregs of the\nstorm be past.\n\n _Enter STEPHANO, singing: a bottle in his hand._\n\n_Ste._ I shall no more to sea, to sea, 40\n Here shall I die a-shore,--\n\nThis is a very scurvy tune to sing at a man's funeral: well,\nhere's my comfort. [_Drinks._\n\n\n[_Sings._ The master, the swabber, the boatswain, and I,\n The gunner, and his mate, 45\n Loved Mall, Meg, and Marian, and Margery,\n But none of us cared for Kate;\n For she had a tongue with a tang,\n Would cry to a sailor, Go hang!\n She loved not the savour of tar nor of pitch; 50\n Yet a tailor might scratch her where'er she did itch.\n Then, to sea, boys, and let her go hang!\n\nThis is a scurvy tune too: but here's my comfort. [_Drinks._\n\n_Cal._ Do not torment me:--O!\n\n_Ste._ What's the matter? Have we devils here? Do 55\nyou put tricks upon 's with savages and men of Ind, ha? I\nhave not scaped drowning, to be afeard now of your four\nlegs; for it hath been said, As proper a man as ever went\non four legs cannot make him give ground; and it shall be\nsaid so again, while Stephano breathes at's nostrils. 60\n\n_Cal._ The spirit torments me:--O!\n\n_Ste._ This is some monster of the isle with four legs, who\nhath got, as I take it, an ague. Where the devil should he\nlearn our language? I will give him some relief, if it be\nbut for that. If I can recover him, and keep him tame, and 65\nget to Naples with him, he's a present for any emperor that\never trod on neat's-leather.\n\n_Cal._ Do not torment me, prithee; I'll bring my wood\nhome faster.\n\n_Ste._ He's in his fit now, and does not talk after the 70\nwisest. He shall taste of my bottle: if he have never drunk\nwine afore, it will go near to remove his fit. If I can recover\nhim, and keep him tame, I will not take too much for\nhim; he shall pay for him that hath him, and that soundly.\n\n_Cal._ Thou dost me yet but little hurt; thou wilt anon, I 75\nknow it by thy trembling: now Prosper works upon thee.\n\n_Ste._ Come on your ways; open your mouth; here is that\nwhich will give language to you, cat: open your mouth; this\nwill shake your shaking, I can tell you, and that soundly:\nyou cannot tell who's your friend: open your chaps again. 80\n\n_Trin._ I should know that voice: it should be--but he\nis drowned; and these are devils:--O defend me!\n\n_Ste._ Four legs and two voices,--a most delicate monster!\nHis forward voice, now, is to speak well of his friend;\nhis backward voice is to utter foul speeches and to detract. 85\nIf all the wine in my bottle will recover him, I will help\nhis ague. Come:--Amen! I will pour some in thy other\nmouth.\n\n_Trin._ Stephano!\n\n_Ste._ Doth thy other mouth call me? Mercy, mercy! 90\nThis is a devil, and no monster: I will leave him; I have\nno long spoon.\n\n_Trin._ Stephano! If thou beest Stephano, touch me,\nand speak to me; for I am Trinculo,--be not afeard,--thy\ngood friend Trinculo. 95\n\n_Ste._ If thou beest Trinculo, come forth: I'll pull thee\nby the lesser legs: if any be Trinculo's legs, these are they.\nThou art very Trinculo indeed! How earnest thou to be\nthe siege of this moon-calf? can he vent Trinculos?\n\n_Trin._ I took him to be killed with a thunder-stroke. 100\nBut art thou not drowned, Stephano? I hope, now, thou\nart not drowned. Is the storm overblown? I hid me\nunder the dead moon-calf's gaberdine for fear of the storm.\nAnd art thou living, Stephano? O Stephano, two Neapolitans\nscaped! 105\n\n_Ste._ Prithee, do not turn me about; my stomach is not\nconstant.\n\n_Cal._ [_aside_] These be fine things, an if they be not sprites.\nThat's a brave god, and bears celestial liquor:\nI will kneel to him. 110\n\n_Ste._ How didst thou 'scape? How camest thou hither?\nswear, by this bottle, how thou camest hither. I escaped\nupon a butt of sack, which the sailors heaved o'erboard, by\nthis bottle! which I made of the bark of a tree with mine\nown hands, since I was cast ashore. 115\n\n_Cal._ I'll swear, upon that bottle, to be thy true subject;\nfor the liquor is not earthly.\n\n_Ste._ Here; swear, then, how thou escapedst.\n\n_Trin._ Swum ashore, man, like a duck: I can swim\nlike a duck, I'll be sworn. 120\n\n_Ste._ Here, kiss the book. Though thou canst swim\nlike a duck, thou art made like a goose.\n\n_Trin._ O Stephano, hast any more of this?\n\n_Ste._ The whole butt, man: my cellar is in a rock by\nthe sea-side, where my wine is hid. How now, moon-calf! 125\nhow does thine ague?\n\n_Cal._ Hast thou not dropp'd from heaven?\n\n_Ste._ Out o' the moon, I do assure thee: I was the man\ni' the moon when time was.\n\n_Cal._ I have seen thee in her, and I do adore thee: 130\nMy mistress show'd me thee, and thy dog, and thy bush.\n\n_Ste._ Come, swear to that; kiss the book: I will furnish\nit anon with new contents: swear.\n\n_Trin._ By this good light, this is a very shallow monster!\nI afeard of him! A very weak monster! The 135\nman i' the moon! A most poor credulous monster! Well\ndrawn, monster, in good sooth!\n\n_Cal._ I'll show thee every fertile inch o' th' island;\nAnd I will kiss thy foot: I prithee, be my god.\n\n_Trin._ By this light, a most perfidious and drunken 140\nmonster! when's god's asleep, he'll rob his bottle.\n\n_Cal._ I'll kiss thy foot; I'll swear myself thy subject.\n\n_Ste._ Come on, then; down, and swear.\n\n_Trin._ I shall laugh myself to death at this puppy-headed\nmonster. A most scurvy monster! I could find in 145\nmy heart to beat him,--\n\n_Ste._ Come, kiss.\n\n_Trin._ But that the poor monster's in drink: an abominable\nmonster!\n\n_Cal._ I'll show thee the best springs; I'll pluck thee berries; 150\nI'll fish for thee, and get thee wood enough.\nA plague upon the tyrant that I serve!\nI'll bear him no more sticks, but follow thee,\nThou wondrous man.\n\n_Trin._ A most ridiculous monster, to make a wonder 155\nof a poor drunkard!\n\n_Cal._ I prithee, let me bring thee where crabs grow;\nAnd I with my long nails will dig thee pig-nuts;\nShow thee a jay's nest, and instruct thee how\nTo snare the nimble marmoset; I'll bring thee 160\nTo clustering filberts, and sometimes I'll get thee\nYoung scamels from the rock. Wilt thou go with me?\n\n_Ste._ I prithee now, lead the way, without any more\ntalking. Trinculo, the king and all our company else being\ndrowned, we will inherit here: here; bear my bottle: fellow 165\nTrinculo, we'll fill him by and by again.\n\n_Cal. sings drunkenly._] Farewell, master; farewell, farewell!\n\n_Trin._ A howling monster; a drunken monster!\n\n_Cal._ No more dams I'll make for fish;\n Nor fetch in firing 170\n At requiring;\n Nor scrape trencher, nor wash dish:\n 'Ban, 'Ban, Cacaliban\n Has a new master:--get a new man.\n\nFreedom, hey-day! hey-day, freedom! freedom, hey-day, 175\nfreedom!\n\n_Ste._ O brave monster! Lead the way. [_Exeunt._\n\n\n Notes: II, 2.\n\n 4: _nor_] F1 F2. _not_ F3 F4.\n 15: _and_] _now_ Pope. _sent_ Edd. conj. (so Dryden).\n 21: _foul_] _full_ Upton conj.\n 35: [Thunder] Capell.\n 38: _dregs_] _drench_ Collier MS.\n 40: SCENE III. Pope.\n [a bottle in his hand] Capell.]\n 46: _and Marian_] _Mirian_ Pope.\n 56: _savages_] _salvages_ Ff.\n 60: _at's nostrils_] Edd. _at 'nostrils_ F1. _at nostrils_ F2 F3 F4.\n _at his nostrils_ Pope.\n 78: _you, cat_] _you Cat_ Ff. _a cat_ Hanmer. _your cat_ Edd. conj.\n 84: _well_] F1 om. F2 F3 F4.\n 115, 116: Steevens prints as verse, _I'll ... thy True ... earthly._\n 118: _swear, then, how thou escapedst_] _swear then: how escapedst\n thou?_ Pope.\n 119: _Swum_] _Swom_ Ff.\n 131: _and thy dog, and thy bush_] _thy dog and bush_ Steevens.\n 133: _new_] F1. _the new_ F2 F3 F4.\n 135: _weak_] F1. _shallow_ F2 F3 F4.\n 138: _island_] F1. _isle_ F2 F3 F4.\n 150-154, 157-162, printed as verse by Pope (after Dryden).\n 162: _scamels_] _shamois_ Theobald. _seamalls, stannels_ id. conj.\n 163: Ste.] F1. Cal. F2 F3 F4.\n 165: Before _here; bear my bottle_ Capell inserts [To Cal.].\n See note (XII).\n 172: _trencher_] Pope (after Dryden). _trenchering_ Ff.\n 175: _hey-day_] Rowe. _high-day_ Ff.\n\n\n\n\n\n", "feat_chapter_length": 2642.0, "feat_summary_name": "Act II, scene ii", "feat_summary_url": "https://web.archive.org/web/20210131162607/https://www.sparknotes.com/shakespeare/tempest/section5/", "target": "Caliban enters with a load of wood, and thunder sounds in the background. Caliban curses and describes the torments that Prospero's spirits subject him to: they pinch, bite, and prick him, especially when he curses. As he is thinking of these spirits, Caliban sees Trinculo and imagines him to be one of the spirits. Hoping to avoid pinching, he lies down and covers himself with his cloak. Trinculo hears the thunder and looks about for some cover from the storm. The only thing he sees is the cloak-covered Caliban on the ground. He is not so much repulsed by Caliban as curious. He cannot decide whether Caliban is a \"man or a fish\" . He thinks of a time when he traveled to England and witnessed freak-shows there. Caliban, he thinks, would bring him a lot of money in England. Thunder sounds again and Trinculo decides that the best shelter in sight is beneath Caliban's cloak, and so he joins the man-monster there. Stephano enters singing and drinking. He hears Caliban cry out to Trinculo, \"Do not torment me! O!\" . Hearing this and seeing the four legs sticking out from the cloak, Stephano thinks the two men are a four-legged monster with a fever. He decides to relieve this fever with a drink. Caliban continues to resist Trinculo, whom he still thinks is a spirit tormenting him. Trinculo recognizes Stephano's voice and says so. Stephano, of course, assumes for a moment that the monster has two heads, and he promises to pour liquor in both mouths. Trinculo now calls out to Stephano, and Stephano pulls his friend out from under the cloak. While the two men discuss how they arrived safely on shore, Caliban enjoys the liquor and begs to worship Stephano. The men take full advantage of Caliban's drunkenness, mocking him as a \"most ridiculous monster\" as he promises to lead them around and show them the isle.", "feat_summary_analysis": "Analysis Trinculo and Stephano are the last new characters to be introduced in the play. They act as comic foils to the main action, and will in later acts become specific parodies of Antonio and Sebastian. At this point, their role is to present comically some of the more serious issues in the play concerning Prospero and Caliban. In Act I, scene ii, Prospero calls Caliban a \"slave\" , \"thou earth\" , \"Filth\" , and \"Hag-seed\" . Stephano and Trinculo's epithet of choice in Act II, scene ii and thereafter is \"monster.\" But while these two make quite clear that Caliban is seen as less than human by the Europeans on the island, they also treat him more humanely than Prospero does. Stephano and Trinculo, a butler and a jester respectively, remain at the low end of the social scale in the play, and have little difficulty finding friendship with the strange islander they meet. \" Misery acquaints a man with strange bedfellows,\" says Trinculo , and then hastens to crawl beneath Caliban's garment in order to get out of the rain. The similarity, socially and perhaps physically as well, between Trinculo and Caliban is further emphasized when Stephano, drunk, initially mistakes the two for a single monster: \"This is some monster of the isle with four legs\" . More important than the emphasis on the way in which Caliban seems to others more monster than man, is the way in which this scene dramatizes the initial encounter between an almost completely isolated, \"primitive\" culture and a foreign, \"civilized\" one. The reader discovers during Caliban and Prospero's confrontation in Act I, scene ii that Prospero initially \"made much of\" Caliban ; that he gave Caliban \"Water with berries in't\" ; that Caliban showed him around the island; and that Prospero later imprisoned Caliban, after he had taken all he could take from him. The reader can see these events in Act II, scene ii, with Trinculo and Stephano in the place of Prospero. Stephano calls Caliban a \"brave monster,\" as they set off singing around the island. In addition, Stephano and Trinculo give Caliban wine, which Caliban finds to be a \"celestial liquor\" . Moreover, Caliban initially mistakes Stephano and Trinculo for Prospero's spirits, but alcohol convinces him that Stephano is a \"brave god\" and decides unconditionally to \"kneel to him\" . This scene shows the foreign, civilized culture as decadent and manipulative: Stephano immediately plans to \"inherit\" the island , using Caliban to show him all its virtues. Stephano and Trinculo are a grotesque, parodic version of Prospero upon his arrival twelve years ago. Godlike in the eyes of the native, they slash and burn their way to power. By this point, Caliban has begun to resemble a parody of himself. Whereas he would \"gabble like / A thing most brutish\" upon Prospero's arrival, because he did not know language, he now is willfully inarticulate in his drunkenness. Immediately putting aside his fear that these men are spirits sent to do him harm, Caliban puts his trust in them for all the wrong reasons. What makes Caliban's behavior in this scene so tragic is that we might expect him, especially after his eloquent curses of Prospero in Act I, scene ii, to know better.", "feat_summary_length": 321.0, "feat_analysis_length": 546.0, "evaluation_predictions": [0, 37, 3, 29, 291, 52, 1016, 817, 7, 178, 24, 8, 8114, 18, 14318, 1489, 3478, 65, 118, 24614, 15, 26, 16, 3, 9, 5536, 5, 216, 19, 341, 5706, 45, 128, 773, 13, 1994, 6, 68, 3, 88, 523, 12, 19375, 112, 16370, 11, 59, 991, 376, 91, 13, 112, 194, 5, 216, 92, 4054, 24, 96, 11394, 6467, 89, 965, 33, 356, 1286, 140, 121, 3, 5, 7080, 29, 1497, 32, 2058, 7, 28, 3, 9, 6765, 3564, 5, 216, 317, 7, 34, 31, 7, 46, 3368, 49, 113, 8151, 26783, 4243, 17, 7, 116, 3, 88, 47, 30, 8, 3368, 5, 216, 3337, 7, 125, 48, 388, 19, 479, 44, 10, 3, 9, 2495, 6, 42, 3654, 42, 7267, 5, 94, 1416, 114, 3, 9, 18214, 6, 11, 3, 88, 744, 31, 17, 241, 12, 36, 7403, 5, 366, 3, 88, 1616, 7, 8, 1345, 13, 3, 9, 31250, 6, 3, 88, 2204, 7, 12, 7387, 365, 7852, 49, 26, 4477, 552, 8, 5536, 639, 223, 5, 5021, 106, 2058, 7, 8782, 21, 2448, 5, 216, 6750, 112, 293, 4782, 13, 2013, 11, 987, 7, 149, 3, 88, 54, 8303, 112, 643, 5, 621, 6663, 66, 112, 2013, 6, 79, 1731, 12, 2870, 5, 328, 9409, 147, 113, 225, 3011, 12, 284, 119, 5, 4213, 6, 79, 129, 139, 3, 9, 2870, 81, 213, 8, 11604, 225, 669, 112, 1612, 5, 299, 728, 541, 6, 79, 43, 150, 80, 12, 1350, 12, 5, 3910, 6, 79, 143, 694, 13, 135, 38, 79, 17582, 12, 2516, 70, 8024, 5, 1142, 258, 6, 79, 253, 1452, 2238, 16, 8, 2164, 5, 282, 1116, 38, 79, 1175, 6, 79, 3384, 24, 8, 192, 1076, 130, 9534, 57, 3, 9, 9412, 5536, 5, 1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}
{"context": "Provided is a universal Ku band LNB (9.75/10.600 GHz) which is fitted at the end of the dish and pointed at the correct satellite constellation; most digital receivers will receive the free to air channels. Some broadcasts are free-to-air and unencrypted, some are encrypted but do not require a monthly subscription (known as free-to-view), some are encrypted and require a monthly subscription, and some are pay-per-view services. To view the encrypted content a VideoGuard UK equipped receiver (all of which are dedicated to the Sky service, and cannot be used to decrypt other services) needs to be used. Unofficial CAMs are now available to view the service, although use of them breaks the user's contract with Sky and invalidates the user's rights to use the card.", "question": "What is the universal band that digital recievers will receive free to air channels on?", "answers.text": ["9.75/10.600 GHz", "universal Ku band", "Ku band"], "answers.answer_start": [37, 14, 24], "feat_id": ["57096c95200fba1400367fbe", "57096c95200fba1400367fbe", "57096c95200fba1400367fbe"], "feat_title": ["Sky_(United_Kingdom)", "Sky_(United_Kingdom)", "Sky_(United_Kingdom)"], "start_logits": [8.4765625, -3.705078125, -6.5390625, -5.15625, -4.43359375, -5.98828125, -6.52734375, -4.6875, -5.1328125, -6.2578125, -6.40625, -6.3359375, -6.1875, -5.453125, -6.62109375, -5.87890625, -6.35546875, -5.984375, -6.98046875, -2.134765625, 0.859375, -1.212890625, 5.80078125, 6.8671875, 5.46875, -0.00273895263671875, 6.73828125, 1.46875, 0.7421875, 2.103515625, -2.541015625, -1.4404296875, -2.703125, -0.1585693359375, -2.982421875, -1.0556640625, -1.27734375, -0.4833984375, -3.10546875, -3.720703125, -0.689453125, -2.23828125, -2.03515625, -1.8603515625, -4.3125, -2.33984375, -0.6572265625, -4.359375, -0.1734619140625, -3.380859375, -1.2890625, -0.8701171875, 0.57958984375, -0.74560546875, -2.443359375, 0.11944580078125, -0.5439453125, -1.451171875, -4.39453125, -3.8125, -3.373046875, -1.193359375, -4.9375, -3.54296875, -2.703125, -2.181640625, -1.845703125, -1.677734375, -4.4296875, -1.6181640625, -4.9765625, -5.12109375, -5.34765625, -4.5, -4.63671875, -1.6396484375, -4.453125, -4.73828125, -4.578125, -4.3046875, -4.1484375, -2.869140625, -4.40625, -1.9091796875, -4.66796875, -4.421875, -4.99609375, -4.99609375, -3.734375, -3.775390625, -4.53125, -3.970703125, -2.408203125, -3.115234375, -5.08203125, -4.62890625, -5.515625, -3.041015625, -5.48828125, -5.6015625, -5.85546875, -4.98046875, -5.3828125, -4.171875, -3.162109375, -4.53515625, -2.55859375, -4.84375, -4.61328125, -5.1328125, -5.046875, -3.34765625, -3.724609375, -2.61328125, -3.3046875, -5.34765625, -4.9609375, -4.03515625, -5.0859375, -2.71875, -5.3203125, -5.26171875, -5.515625, -4.75, -3.654296875, -4.44140625, -2.75390625, -3.697265625, -3.74609375, -2.626953125, -4.9296875, -4.7578125, -5.25, -3.134765625, -2.9296875, -1.5908203125, -3.947265625, -2.537109375, -3.208984375, -2.869140625, -4.46875, -4.15234375, -5.45703125, -5.4921875, -4.98046875, -3.26171875, -4.7109375, -3.501953125, -1.966796875, -3.95703125, -5.74609375, -5.234375, -3.982421875, -5.828125, -5.3671875, -5.51171875, -3.9453125, -5.3125, -5.58203125, -5.19140625, -4.421875, -5.37890625, -3.775390625, -5.33203125, -5.25390625, -4.1875, -3.626953125, -1.8525390625, -2.951171875, -5.21484375, -5.3359375, -4.7890625, -4.37890625, -5.17578125, -3.84375, -4.48046875, -3.98046875, -5.1640625, -4.62109375, -3.734375, -5.78515625, -4.734375, -3.470703125, -4.8671875, -4.27734375, -3.693359375, -5.98828125, -3.5546875, -5.28125, -2.705078125, -5.21484375, -3.34765625, -5.22265625, -5.05859375, -4.6484375, -3.85546875, -6.0703125, -4.65234375, -5.82421875, -4.46875, -4.75390625, -3.80859375, -4.484375, -2.134765625, -7.97265625, -7.9765625, -7.98046875, -7.98828125, -7.98828125, -7.98828125, -7.984375, -7.98046875, -7.984375, -7.984375, -7.984375, -7.9765625, -7.9765625, -7.9765625, -7.9765625, -7.9765625, -7.9765625, -7.9765625, -7.98046875, -7.9765625, -7.98046875, -7.98046875, -7.9765625, -7.97265625, -7.9765625, -7.98046875, -7.98046875, -7.98046875, -7.97265625, -7.96875, -7.97265625, -7.96875, -7.96875, -7.96484375, -7.95703125, -7.953125, -7.95703125, -7.96484375, -7.96875, -7.9765625, -7.9765625, -7.9765625, -7.98046875, -7.98046875, -7.98828125, -7.98828125, -7.9921875, -7.9921875, -7.99609375, -7.99609375, -8.0, -7.9921875, -7.9921875, -7.9921875, -7.98828125, -7.98828125, -7.9921875, -7.99609375, -7.9921875, -7.98828125, -7.9921875, -7.9921875, -7.9921875, -7.98828125, -7.9921875, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -7.98828125, -7.98828125, -7.98828125, -7.984375, -7.984375, -7.984375, -7.98828125, -7.984375, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.984375, -7.9921875, -7.9921875, -7.9921875, -7.98828125, -7.9921875, -7.98828125, -7.9921875, -7.99609375, -7.99609375, -7.99609375, -7.99609375, -7.98828125, -7.984375, -7.98046875, -7.984375, -7.98828125, -7.98828125, -7.9921875, -7.99609375, -7.99609375, -8.0, -8.0, -8.0, -8.0078125, -8.0078125, -8.0, -8.0, -8.0078125, -8.0078125, -8.0078125, -8.0, -8.0, -7.99609375, -7.9921875, -7.98828125, -7.9921875, -7.98828125, -7.984375, -7.98046875, -7.98828125, -7.98828125, -7.98828125, -7.98046875, -7.984375, -7.9921875, -7.99609375, -7.9921875, -7.98828125, -7.984375, -7.98046875, -7.9765625, -7.98046875, -7.98046875, -7.97265625, -7.95703125, -7.953125, -7.9609375, -7.9609375, -7.9609375, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.9765625, -7.98046875, -7.984375, -7.98046875, -7.984375, -7.98828125, -7.98828125, -7.9921875, -7.98828125, -7.9921875, -7.98828125, -7.984375, -7.984375, -7.98046875, -7.97265625, -7.97265625, -7.98046875, -7.984375, -7.984375, -7.984375, -7.98828125, -7.99609375, -7.99609375, -8.0, -7.99609375, -7.9921875, -7.99609375, -7.99609375, -8.0, -7.99609375, -7.9921875, -7.9921875, -7.9921875, -7.9921875, -7.99609375, -8.0, -8.0, -8.0, -8.0, -8.0, -8.0, -7.99609375, -7.99609375, -8.0, -8.0, -7.9921875, -7.984375, -7.98046875, -7.9765625, -7.9765625, -7.98046875, -7.98046875, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.984375, -7.98828125, -7.9921875, -7.9921875, -7.9921875, -7.9921875, -7.9921875, -7.99609375, -7.9921875, -7.9921875, -7.98828125, -7.98828125, -7.984375, -7.984375, -7.9921875, -7.99609375, -8.0, -8.0, -8.0078125, -8.0078125, -8.0078125, -8.015625, -8.015625, -8.015625, -8.015625, -8.0234375, -8.015625, -8.0078125, -8.0078125, -8.0078125, -8.0078125, -8.0078125, -8.015625, -8.0234375, -8.0234375, -8.015625, -8.015625, -8.015625, -8.015625, -8.015625, -8.0234375, -8.0234375, -8.0234375, -8.015625, -8.015625, -8.015625, -8.0078125, -8.0078125, -8.015625, -8.0078125, -8.0, -7.98828125, -7.9921875, -8.0, -8.0, -8.0078125, -8.0078125, -8.0, -7.99609375, -7.99609375, -8.0, -8.0, -8.0, -8.0, -8.0, -7.9921875, -7.984375, -7.984375, -7.98828125, -7.9921875, -7.9921875, -7.99609375, -8.0, -8.0, -8.0, -8.0, -8.0078125, -8.015625, -8.0234375, -8.0234375, -8.0234375, -8.0234375, -8.0234375, -8.0234375, -8.0234375, -8.015625, -8.015625, -8.015625, -8.015625, -8.0078125, -8.0, -8.0, -8.0078125, -8.0078125, -8.015625, -8.015625, -8.0078125, -8.0078125, -8.015625, -2.236328125], "end_logits": [8.375, -5.21875, -7.23828125, -7.23828125, -6.8359375, -5.3125, -7.1015625, -6.85546875, -6.7734375, -6.64453125, -4.6171875, -7.41015625, -7.390625, -7.29296875, -7.3046875, -6.9921875, -6.078125, -6.828125, -5.84375, -2.986328125, -1.64453125, -3.185546875, -0.53125, 0.65625, 1.234375, 4.5234375, 0.96435546875, 8.5390625, -1.0341796875, -1.2451171875, -3.05859375, -0.947265625, -2.205078125, -1.7109375, -3.119140625, -1.2470703125, 3.423828125, 6.38671875, -0.1595458984375, -3.73046875, -1.6123046875, -4.21875, -4.27734375, -2.00390625, -4.23828125, -3.6171875, 1.6044921875, -3.95703125, -2.35546875, -3.7890625, -3.697265625, -2.4609375, -0.57958984375, 2.609375, 1.568359375, -1.81640625, -2.283203125, 1.4755859375, -4.171875, -3.95703125, -4.25, -3.33203125, -5.1796875, -2.966796875, 0.86572265625, 1.1220703125, -3.20703125, -1.875, -5.48046875, -5.08203125, -5.8125, -5.671875, -5.86328125, -2.9765625, -5.3359375, -4.45703125, -4.99609375, -4.8671875, -3.689453125, -0.5615234375, -1.734375, -4.12890625, -5.54296875, -4.875, -5.24609375, -4.1796875, -1.8701171875, -5.4375, -5.9609375, -4.77734375, -5.55078125, -5.546875, -3.3515625, -0.8203125, -5.76171875, -5.63671875, -6.0703125, -5.4453125, -6.23046875, -5.7890625, -6.31640625, -2.28515625, -2.984375, -2.185546875, -4.1171875, -5.5234375, -5.2578125, -5.38671875, -4.48828125, -2.548828125, -5.4765625, -5.1640625, -5.37109375, -3.560546875, -1.9697265625, -3.064453125, -4.7421875, -4.91796875, -5.74609375, -4.6328125, -5.9921875, -5.37890625, -6.01171875, -3.224609375, -1.9404296875, -2.62109375, -5.12890625, -4.703125, -5.03125, -5.24609375, -5.3046875, -4.5, -2.73046875, -2.0234375, -3.859375, -3.271484375, -1.0556640625, -0.8134765625, -2.478515625, -0.572265625, -4.484375, -4.74609375, -5.53515625, -5.26953125, -5.71875, -4.3359375, -4.90625, -4.79296875, -2.265625, -1.5009765625, -3.6171875, -5.66796875, -5.046875, -6.296875, -5.26953125, -5.9765625, -4.8828125, -5.15625, -4.08203125, -5.04296875, -2.5, -4.1640625, -4.64453125, -5.86328125, -5.875, -2.193359375, -2.08984375, -2.8984375, -3.951171875, -2.513671875, -5.40625, -4.85546875, -4.46875, -5.9140625, -4.578125, -5.6015625, -3.03515625, -3.552734375, -5.00390625, -5.2109375, -6.1796875, -4.65234375, -4.69140625, -5.703125, -4.61328125, -4.28515625, -4.8515625, -3.517578125, -5.4453125, -2.029296875, -5.05078125, -4.546875, -4.67578125, -5.83984375, -4.765625, -4.4921875, -5.09375, -4.73828125, -6.0234375, -5.4140625, -5.71484375, -2.47265625, -2.8046875, -2.986328125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5546875, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5625, -8.5546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5390625, -8.5390625, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -8.5546875, -8.546875, -8.546875, -8.5390625, -8.5390625, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.546875, -8.5546875, -8.5546875, -3.115234375]}
{"context": "At the beginning of the 20th century, important advancement in geological science was facilitated by the ability to obtain accurate absolute dates to geologic events using radioactive isotopes and other methods. This changed the understanding of geologic time. Previously, geologists could only use fossils and stratigraphic correlation to date sections of rock relative to one another. With isotopic dates it became possible to assign absolute ages to rock units, and these absolute dates could be applied to fossil sequences in which there was datable material, converting the old relative ages into new absolute ages.", "question": "What did using fossils help change for scientists?", "answers.text": [""], "answers.answer_start": [-1], "feat_id": ["5a57f487770dc0001aeefefd"], "feat_title": ["Geology"], "start_logits": [9.3125, -3.935546875, -6.05078125, -5.125, -4.3046875, -5.46875, -5.125, -6.0234375, -5.19140625, -7.2578125, -2.2890625, -2.369140625, -3.275390625, -1.91015625, -4.34375, -3.623046875, -2.517578125, -4.23828125, -3.8828125, -1.158203125, -1.3076171875, -4.29296875, -0.572265625, -1.951171875, -3.61328125, -1.2333984375, -2.12890625, -0.0038051605224609375, 0.43115234375, -1.1201171875, 0.339111328125, 0.89794921875, 1.23046875, -0.5595703125, -3.04296875, -0.326171875, -1.328125, -0.92041015625, 2.28125, -1.1513671875, -2.482421875, -4.44140625, -2.67578125, -1.216796875, -2.095703125, 0.29150390625, 1.8974609375, 5.515625, 5.6484375, -1.548828125, 3.166015625, 0.96826171875, -1.638671875, -0.26904296875, -2.09765625, 1.9482421875, -2.94921875, 1.314453125, 0.619140625, 0.697265625, 0.95751953125, -2.015625, 1.8759765625, -2.482421875, -3.052734375, -2.439453125, 0.1041259765625, 0.859375, 1.58984375, -0.5078125, -3.9765625, -0.55029296875, -2.755859375, -4.125, -3.359375, -2.392578125, -1.2919921875, 0.28662109375, 1.19140625, -2.8359375, -3.41796875, -0.890625, -2.947265625, -3.541015625, -1.775390625, -2.779296875, -0.30029296875, 0.45263671875, -1.08203125, -3.7578125, -1.404296875, -2.16015625, -3.61328125, -2.609375, -0.345947265625, 1.4306640625, -1.072265625, -2.8359375, -4.09375, -2.435546875, -2.791015625, 0.043060302734375, -1.052734375, -3.23046875, -3.62109375, -1.23828125, -3.501953125, 0.6240234375, -3.48828125, -1.9775390625, -2.83203125, 1.6455078125, -0.138671875, 0.239990234375, -1.26953125, -1.16796875, -2.931640625, 1.341796875, 0.6962890625, -0.98974609375, -3.03125, -2.287109375, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.3046875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.3046875, -8.3046875, -8.3046875, -8.3046875, -8.3046875, -8.3046875, -8.296875, -8.296875, -8.3046875, -8.3046875, -8.3046875, -8.296875, -8.296875, -8.296875, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.2890625, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.3046875, -8.3046875, -8.296875, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.296875, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.2734375, -8.265625, -8.265625, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.296875, -8.2890625, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.2890625, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.296875, -8.3046875, -8.296875, -8.3046875, -8.3046875, -8.296875, -8.3046875, -8.3046875, -8.3046875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.28125, -8.2734375, -8.265625, -8.265625, -8.265625, -8.2734375, -8.265625, -8.265625, -8.265625, -8.265625, -8.265625, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.296875, -8.3046875, -8.3046875, -8.296875, -8.296875, -8.2890625, -8.2890625, -8.28125, -8.2890625, -8.2890625, -8.296875, -8.296875, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.265625, -8.265625, -8.265625, -8.265625, -8.265625, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.2734375, -8.265625, -8.265625, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.265625, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.296875, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.265625, -8.265625, -8.265625, -8.265625, -8.2734375, -8.2734375, -8.2734375, -8.265625, -8.265625, -8.2734375, -8.265625, -8.265625, -8.2578125, -8.265625, -8.265625, -8.265625, -8.265625, -8.2734375, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.28125, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.2890625, -8.28125, -8.2890625, -8.2890625, -8.2734375, -2.3515625], "end_logits": [9.3828125, -4.44140625, -6.61328125, -6.91015625, -4.7578125, -6.66796875, -5.76171875, -6.82421875, -4.5625, -5.48828125, -3.767578125, -4.38671875, -4.83203125, -3.794921875, -5.3046875, -5.265625, -3.76953125, -2.345703125, -2.015625, -3.3984375, -2.650390625, -4.82421875, -2.255859375, -1.134765625, -4.40234375, -2.6640625, -3.904296875, -3.5625, -3.126953125, -3.90625, -2.728515625, -2.044921875, -1.7216796875, 1.0986328125, -3.412109375, -1.921875, 0.83642578125, -3.21875, -0.2193603515625, -1.201171875, 1.759765625, -3.80859375, -3.8671875, 0.90380859375, 0.5244140625, -3.01953125, -2.32421875, -0.5595703125, 2.388671875, -3.021484375, -0.230712890625, 5.94921875, 3.087890625, -2.400390625, -2.30078125, -2.4296875, -1.2587890625, -3.24609375, -2.251953125, -3.30859375, -0.55029296875, -4.453125, -2.732421875, -3.900390625, -3.322265625, -1.5849609375, 1.77734375, -3.48046875, -0.448486328125, 0.022308349609375, -4.6875, 0.8779296875, -1.8330078125, -3.681640625, -2.328125, 3.65625, 1.8505859375, -3.15625, -2.287109375, -3.146484375, -2.044921875, 1.25390625, -3.4296875, -4.3828125, -3.287109375, -4.390625, -2.919921875, -2.548828125, 0.237060546875, -4.2109375, -2.587890625, 0.89990234375, -0.85791015625, -3.22265625, -3.689453125, -2.30078125, 0.255615234375, -4.359375, -5.4296875, -2.40234375, -4.4765625, -2.416015625, 0.74853515625, -4.6640625, -4.64453125, -3.912109375, -4.6953125, -2.82421875, -2.91796875, -0.04345703125, -1.7529296875, -2.322265625, -3.6875, -2.525390625, -3.16796875, 1.166015625, -4.26171875, -2.58203125, -2.44921875, 2.666015625, 1.3876953125, -3.767578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.5859375, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5546875, -8.546875, -8.546875, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.59375, -8.59375, -8.5859375, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.5859375, -8.5859375, -8.59375, -8.59375, -8.59375, -8.59375, -8.59375, -8.5859375, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.59375, -8.59375, -8.59375, -8.59375, -8.5859375, -8.5859375, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.5859375, -8.59375, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.5859375, -8.5859375, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.59375, -8.6015625, -8.59375, -8.59375, -8.59375, -8.5859375, -8.5859375, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.59375, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.59375, -8.59375, -8.6015625, -8.6015625, -8.59375, -8.59375, -8.59375, -8.59375, -8.59375, -8.59375, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.6015625, -8.59375, -8.59375, -8.59375, -8.59375, -8.59375, -8.5859375, -8.5859375, -8.578125, -8.5703125, -8.5703125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.5859375, -8.59375, -8.59375, -8.59375, -8.5859375, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5859375, -8.59375, -8.59375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.5859375, -8.59375, -8.59375, -8.5859375, -8.5859375, -8.5859375, -8.578125, -8.5703125, -8.5625, -8.5625, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.578125, -8.578125, -8.578125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5625, -8.5625, -8.5546875, -8.5546875, -8.5625, -8.5625, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.5703125, -8.578125, -8.578125, -8.5703125, -3.84375]}
{"context": "Packet mode communication may be implemented with or without intermediate forwarding nodes (packet switches or routers). Packets are normally forwarded by intermediate network nodes asynchronously using first-in, first-out buffering, but may be forwarded according to some scheduling discipline for fair queuing, traffic shaping, or for differentiated or guaranteed quality of service, such as weighted fair queuing or leaky bucket. In case of a shared physical medium (such as radio or 10BASE5), the packets may be delivered according to a multiple access scheme.", "question": "If there is no radio or 10BASE5, how are the packets delivered?", "answers.text": [""], "answers.answer_start": [-1], "feat_id": ["5a66797c846392001a1e1c4b"], "feat_title": ["Packet_switching"], "start_logits": [10.828125, -3.50390625, -4.66015625, -5.5390625, -3.8046875, -3.416015625, -5.48828125, -4.03515625, -5.01953125, -5.60546875, -5.84375, -4.3828125, -5.81640625, -5.20703125, -4.9609375, -5.87109375, -6.9921875, -3.177734375, -1.0478515625, -2.9375, -2.125, -3.359375, -3.869140625, -2.69921875, -2.876953125, -3.74609375, -2.263671875, -1.3896484375, -2.505859375, -4.30078125, -2.744140625, -3.494140625, -1.6708984375, -2.91015625, -4.5, -2.578125, -4.1484375, -4.125, -2.62890625, -1.1123046875, -3.095703125, -1.298828125, -0.51220703125, -3.12890625, -1.4677734375, -0.57861328125, -2.279296875, -2.107421875, -1.5224609375, -3.138671875, -3.501953125, -3.392578125, -2.6875, -1.794921875, -1.1181640625, -4.01953125, -3.630859375, -3.787109375, -1.3681640625, -4.0546875, -3.48828125, -2.34765625, -3.302734375, -3.67578125, -3.05859375, -1.8623046875, -3.0625, -1.298828125, -3.61328125, -1.2734375, -3.578125, -2.37890625, -1.412109375, -2.373046875, -3.2734375, -1.3037109375, -2.916015625, -3.2890625, -4.14453125, -1.66796875, -2.927734375, -4.30859375, -3.828125, -2.513671875, -1.228515625, -3.787109375, -1.435546875, -2.265625, -4.92578125, -1.990234375, -4.37890625, -3.939453125, -4.18359375, -0.85009765625, -2.00390625, -3.275390625, -3.544921875, -3.912109375, -1.3740234375, -4.34375, -2.37109375, -1.6962890625, 0.86865234375, -1.056640625, -2.744140625, 0.81201171875, 1.861328125, -0.309326171875, -0.488037109375, -3.6015625, -3.4140625, -4.0390625, -0.74951171875, -3.66796875, -0.9697265625, -2.8671875, -3.3671875, -2.935546875, -0.2213134765625, 2.46484375, 1.5185546875, 1.6455078125, -0.11004638671875, 1.59765625, 5.7109375, 1.0400390625, 3.65234375, 3.521484375, 0.470947265625, 0.332275390625, -1.53515625, -3.177734375, -7.609375, -7.61328125, -7.61328125, -7.61328125, -7.61328125, -7.61328125, -7.60546875, -7.609375, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.6015625, -7.59765625, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.609375, -7.609375, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.609375, -7.61328125, -7.61328125, -7.609375, -7.60546875, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.59765625, -7.59765625, -7.59765625, -7.59765625, -7.6015625, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.61328125, -7.6171875, -7.6171875, -7.6171875, -7.6171875, -7.62109375, -7.6171875, -7.61328125, -7.62109375, -7.6171875, -7.6171875, -7.61328125, -7.61328125, -7.60546875, -7.60546875, -7.609375, -7.609375, -7.609375, -7.609375, -7.6171875, -7.6171875, -7.61328125, -7.609375, -7.61328125, -7.6171875, -7.6171875, -7.6171875, -7.6171875, -7.6171875, -7.61328125, -7.609375, -7.60546875, -7.609375, -7.609375, -7.60546875, -7.60546875, -7.6015625, -7.59765625, -7.59375, -7.59375, -7.59375, -7.59765625, -7.6015625, -7.6015625, -7.59765625, -7.59765625, -7.59375, -7.59375, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.60546875, -7.6015625, -7.59765625, -7.6015625, -7.6015625, -7.6015625, -7.59375, -7.59375, -7.59765625, -7.59765625, -7.59765625, -7.6015625, -7.6015625, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.609375, -7.609375, -7.609375, -7.609375, -7.609375, -7.60546875, -7.6015625, -7.60546875, -7.60546875, -7.6015625, -7.6015625, -7.6015625, -7.6015625, -7.59765625, -7.59765625, -7.59765625, -7.59765625, -7.6015625, -7.60546875, -7.60546875, -7.609375, -7.60546875, -7.609375, -7.6015625, -7.59765625, -7.59765625, -7.59765625, -7.59375, -7.59765625, -7.59765625, -7.58984375, -7.58984375, -7.59375, -7.59375, -7.59375, -7.59375, -7.58984375, -7.59765625, -7.6015625, -7.59765625, -7.59765625, -7.59765625, -7.6015625, -7.60546875, -7.609375, -7.61328125, -7.609375, -7.61328125, -7.609375, -7.60546875, -7.61328125, -7.61328125, -7.61328125, -7.61328125, -7.609375, -7.609375, -7.6015625, -7.6015625, -7.60546875, -7.60546875, -7.60546875, -7.609375, -7.6171875, -7.6171875, -7.6171875, -7.61328125, -7.61328125, -7.62109375, -7.62109375, -7.6171875, -7.6171875, -7.61328125, -7.61328125, -7.609375, -7.609375, -7.609375, -7.60546875, -7.6015625, -7.6015625, -7.6015625, -7.6015625, -7.59765625, -7.59765625, -7.59765625, -7.59375, -7.59765625, -7.60546875, -7.61328125, -7.61328125, -7.609375, -7.609375, -7.60546875, -7.60546875, -7.609375, -7.609375, -7.60546875, -7.6015625, -7.59765625, -7.6015625, -7.60546875, -7.6015625, -7.6015625, -7.6015625, -7.60546875, -7.6015625, -7.6015625, -7.6015625, -7.60546875, -7.6171875, -7.6171875, -7.62109375, -7.62109375, -7.62109375, -7.61328125, -7.61328125, -7.62109375, -7.6171875, -7.61328125, -7.609375, -7.609375, -7.60546875, -7.6015625, -7.60546875, -7.609375, -7.609375, -7.61328125, -7.61328125, -7.6171875, -7.61328125, -7.61328125, -7.61328125, -7.61328125, -7.609375, -7.609375, -7.609375, -7.609375, -7.6015625, -7.59765625, -7.59375, -7.59375, -7.59375, -7.59375, -7.59765625, -7.59765625, -7.59375, -7.58984375, -7.58984375, -7.58984375, -7.59375, -7.59765625, -7.59765625, -7.59375, -7.58984375, -7.5859375, -7.5859375, -7.5859375, -7.5859375, -7.5859375, -7.58984375, -7.58984375, -7.58984375, -7.58984375, -7.59375, -7.6015625, -7.6015625, -7.6015625, -7.6015625, -7.6015625, -7.59765625, -7.6015625, -7.6015625, -7.59765625, -7.59375, -7.59375, -7.58984375, -7.5859375, -7.59375, -7.59765625, -7.59765625, -7.6015625, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.60546875, -7.6015625, -7.6015625, -7.59375, -7.5859375, -7.58984375, -7.58984375, -7.58203125, -7.58203125, -7.5859375, -7.58984375, -7.5859375, -7.5859375, -7.5859375, -7.5859375, -7.5859375, -7.58984375, -7.59375, -7.59765625, -7.59375, -7.58984375, -7.5859375, -7.5859375, -7.58203125, -7.57421875, -7.57421875, -7.5703125, -7.5703125, -7.578125, -7.578125, -7.58203125, -7.5859375, -7.58984375, -7.59375, -7.59765625, -7.6015625, -7.6015625, -7.60546875, -7.609375, -7.609375, -7.60546875, -7.60546875, -7.6015625, -7.59765625, -7.6015625, -7.60546875, -7.59765625, -7.59765625, -7.6015625, -7.6015625, -7.59765625, -7.6015625, -7.60546875, -7.609375, -7.61328125, -7.609375, -7.61328125, -7.61328125, -7.609375, -7.609375, -7.609375, -7.609375, -7.60546875, -7.60546875, -7.6015625, -7.59765625, -7.59375, -7.59375, -7.59375, -7.59765625, -7.59765625, -7.6015625, -7.60546875, -7.6015625, -7.6015625, -3.3046875], "end_logits": [10.9609375, -6.44140625, -6.7265625, -6.80078125, -5.25, -4.8515625, -6.45703125, -5.9765625, -6.3046875, -4.671875, -6.25, -6.12890625, -6.5625, -6.734375, -6.390625, -5.61328125, -5.8125, -5.15625, -2.27734375, -1.9599609375, -1.48046875, -3.525390625, -4.33203125, -2.662109375, -3.71484375, -4.6953125, -3.22265625, -2.5625, -3.306640625, -2.841796875, -0.82763671875, -4.328125, -3.025390625, -2.19140625, -4.88671875, -4.2109375, -2.505859375, -2.98828125, -1.955078125, -3.021484375, -3.912109375, -2.853515625, -2.615234375, -1.7021484375, -2.927734375, -1.9931640625, -2.068359375, -0.57177734375, -2.85546875, -3.443359375, -3.3984375, -2.86328125, 0.0014543533325195312, -2.947265625, -2.583984375, -4.44140625, -1.7861328125, -2.9765625, -3.01953125, -4.5859375, -2.580078125, -2.701171875, -0.474853515625, -1.7685546875, -3.462890625, -3.5546875, -4.44140625, -3.1875, -1.716796875, -2.474609375, -3.7421875, -3.25390625, -1.693359375, -0.80029296875, -3.791015625, -2.49609375, -3.05078125, -0.705078125, -3.533203125, -2.703125, -0.78173828125, -3.041015625, -4.18359375, -3.8984375, -2.05078125, -4.57421875, -2.388671875, -1.5830078125, -5.2578125, -0.12078857421875, -2.21484375, -4.47265625, -4.328125, -2.3359375, -2.736328125, -3.3515625, -0.8427734375, -4.2578125, -3.36328125, -3.865234375, -0.3359375, -1.4716796875, -3.828125, -3.61328125, -4.4921875, -2.923828125, -1.1201171875, -1.392578125, 2.330078125, -4.2421875, -4.79296875, -4.9609375, -2.49609375, -4.74609375, -3.771484375, -4.88671875, -1.83203125, -3.033203125, -2.798828125, -3.271484375, -2.787109375, -3.0078125, -4.15625, -1.5302734375, 0.0285186767578125, -2.228515625, -1.1640625, -0.1876220703125, 1.5439453125, 6.26953125, 3.912109375, -5.15625, -7.90625, -7.90625, -7.90234375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.89453125, -7.890625, -7.890625, -7.89453125, -7.89453125, -7.890625, -7.890625, -7.890625, -7.890625, -7.88671875, -7.88671875, -7.890625, -7.890625, -7.89453125, -7.89453125, -7.89453125, -7.8984375, -7.8984375, -7.8984375, -7.90625, -7.91015625, -7.91015625, -7.9140625, -7.90625, -7.90625, -7.91015625, -7.9140625, -7.91796875, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.90625, -7.90625, -7.91015625, -7.91015625, -7.9140625, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.91015625, -7.91015625, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.90625, -7.90625, -7.91015625, -7.90625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.90625, -7.91015625, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90625, -7.91015625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90234375, -7.90625, -7.90625, -7.91015625, -7.91015625, -7.91015625, -7.91015625, -7.91015625, -7.9140625, -7.9140625, -7.921875, -7.921875, -7.92578125, -7.92578125, -7.91796875, -7.9140625, -7.91796875, -7.91796875, -7.921875, -7.9140625, -7.91015625, -7.91015625, -7.90625, -7.90234375, -7.90234375, -7.90625, -7.90234375, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.89453125, -7.89453125, -7.8984375, -7.89453125, -7.89453125, -7.89453125, -7.89453125, -7.89453125, -7.89453125, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.90234375, -7.90234375, -7.90625, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.89453125, -7.89453125, -7.89453125, -7.88671875, -7.890625, -7.89453125, -7.89453125, -7.89453125, -7.89453125, -7.890625, -7.89453125, -7.8984375, -7.8984375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.890625, -7.89453125, -7.89453125, -7.89453125, -7.8984375, -7.90625, -7.91015625, -7.91796875, -7.921875, -7.921875, -7.91796875, -7.9140625, -7.921875, -7.92578125, -7.92578125, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.91015625, -7.90625, -7.90625, -7.90625, -7.90625, -7.91015625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90234375, -7.90625, -7.90625, -7.91015625, -7.90234375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.8984375, -7.8984375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90234375, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90234375, -7.8984375, -7.8984375, -7.90234375, -7.90625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90234375, -7.90625, -7.9140625, -7.91796875, -7.91796875, -7.91796875, -7.9140625, -7.91015625, -7.91015625, -7.9140625, -7.9140625, -7.9140625, -7.91015625, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.91015625, -7.9140625, -7.91015625, -7.91015625, -7.90625, -7.90625, -7.90234375, -7.90625, -7.90625, -7.90625, -7.90234375, -7.8984375, -7.8984375, -7.89453125, -7.890625, -7.89453125, -7.89453125, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.8984375, -7.8984375, -7.89453125, -7.89453125, -7.890625, -7.88671875, -7.8828125, -7.88671875, -7.88671875, -7.890625, -7.890625, -7.88671875, -7.88671875, -7.88671875, -7.88671875, -7.890625, -7.8984375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.890625, -7.890625, -7.8984375, -7.90234375, -7.8984375, -7.89453125, -7.890625, -7.890625, -7.89453125, -7.89453125, -7.8984375, -7.90234375, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90625, -7.90234375, -7.8984375, -7.8984375, -7.8984375, -7.89453125, -7.89453125, -7.890625, -7.890625, -7.890625, -7.890625, -7.890625, -7.890625, -7.890625, -7.89453125, -7.89453125, -7.8984375, -7.8984375, -7.89453125, -7.89453125, -7.890625, -7.890625, -7.89453125, -7.89453125, -7.890625, -7.88671875, -7.88671875, -7.88671875, -7.88671875, -7.890625, -7.890625, -7.890625, -7.89453125, -5.27734375]}
{"context": "Many complexity classes are defined using the concept of a reduction. A reduction is a transformation of one problem into another problem. It captures the informal notion of a problem being at least as difficult as another problem. For instance, if a problem X can be solved using an algorithm for Y, X is no more difficult than Y, and we say that X reduces to Y. There are many different types of reductions, based on the method of reduction, such as Cook reductions, Karp reductions and Levin reductions, and the bound on the complexity of reductions, such as polynomial-time reductions or log-space reductions.", "question": "What are two examples of different types of reduction?", "answers.text": ["Karp reductions and Levin reductions", "Cook reductions, Karp reductions"], "answers.answer_start": [469, 452], "feat_id": ["56e1c9bfe3433e1400423195", "56e1c9bfe3433e1400423195"], "feat_title": ["Computational_complexity_theory", "Computational_complexity_theory"], "start_logits": [5.79296875, -4.421875, -6.046875, -5.80859375, -6.2890625, -6.3671875, -5.30859375, -6.46484375, -6.734375, -6.125, -7.54296875, -1.88671875, -2.76953125, -1.9052734375, -3.693359375, -4.76171875, -3.611328125, -3.9609375, -3.419921875, -3.07421875, -4.47265625, -3.287109375, -2.609375, -4.0625, -3.216796875, -3.14453125, -4.44921875, -3.517578125, -2.7265625, -4.609375, -3.578125, -3.88671875, -4.55078125, -3.953125, -3.775390625, -4.4609375, -3.677734375, -3.544921875, -3.458984375, -2.5390625, -3.564453125, -4.796875, -3.677734375, -3.64453125, -4.1796875, -3.44140625, -4.11328125, -3.763671875, -2.90625, -4.9765625, -4.3125, -4.00390625, -4.4765625, -4.109375, -4.5390625, -4.734375, -2.44140625, -3.6953125, -3.103515625, -3.1875, -4.30859375, -4.5078125, -3.287109375, -3.501953125, -3.33203125, -2.48828125, -4.14453125, -3.01171875, -4.375, -2.81640625, -4.37109375, -3.478515625, -4.41796875, -3.337890625, -4.7890625, -3.517578125, -4.546875, -4.10546875, -3.58203125, -4.09765625, -3.947265625, -2.76171875, -3.3671875, -4.30078125, -3.27734375, -3.32421875, -0.408935546875, -3.5078125, -0.80419921875, 0.16943359375, -2.8359375, -4.50390625, -1.185546875, -2.33203125, 1.0419921875, -2.7578125, -0.89306640625, -0.19921875, -3.83203125, -0.93310546875, -1.6259765625, 2.0078125, 0.244873046875, 9.9140625, 1.173828125, -1.16015625, 1.4306640625, -1.1337890625, -0.1256103515625, -2.2265625, 0.253173828125, 1.3720703125, -2.04296875, -2.974609375, -0.79345703125, -0.294677734375, -3.453125, -1.6416015625, -0.416748046875, -4.61328125, -1.4541015625, -3.677734375, -1.68359375, -2.4765625, 3.78515625, -2.908203125, -2.208984375, -1.0751953125, -3.3203125, -1.1240234375, -3.611328125, -2.603515625, -1.2607421875, -3.24609375, -1.8857421875, -7.94921875, -7.9453125, -7.94140625, -7.9375, -7.94140625, -7.94140625, -7.9375, -7.93359375, -7.9296875, -7.92578125, -7.921875, -7.921875, -7.92578125, -7.92578125, -7.9296875, -7.9296875, -7.93359375, -7.93359375, -7.9296875, -7.9296875, -7.9375, -7.94140625, -7.9375, -7.94140625, -7.94140625, -7.93359375, -7.9296875, -7.92578125, -7.9296875, -7.9296875, -7.921875, -7.91796875, -7.9140625, -7.91015625, -7.90625, -7.91015625, -7.91015625, -7.9140625, -7.91796875, -7.921875, -7.921875, -7.92578125, -7.92578125, -7.9296875, -7.9375, -7.94140625, -7.9453125, -7.94921875, -7.9453125, -7.9453125, -7.94921875, -7.953125, -7.953125, -7.953125, -7.9453125, -7.9375, -7.93359375, -7.92578125, -7.92578125, -7.9296875, -7.9296875, -7.93359375, -7.93359375, -7.9375, -7.9375, -7.9375, -7.9375, -7.9453125, -7.953125, -7.953125, -7.953125, -7.953125, -7.9453125, -7.9453125, -7.94921875, -7.94921875, -7.9453125, -7.94140625, -7.9375, -7.9296875, -7.921875, -7.921875, -7.921875, -7.921875, -7.921875, -7.91796875, -7.91796875, -7.9140625, -7.91015625, -7.91015625, -7.91015625, -7.91796875, -7.91796875, -7.9140625, -7.921875, -7.91796875, -7.9140625, -7.9140625, -7.91796875, -7.91796875, -7.9140625, -7.90625, -7.90625, -7.90234375, -7.90234375, -7.90625, -7.90234375, -7.91015625, -7.9140625, -7.91796875, -7.91796875, -7.91796875, -7.91796875, -7.921875, -7.9375, -7.9375, -7.9375, -7.9375, -7.9375, -7.9296875, -7.92578125, -7.92578125, -7.92578125, -7.92578125, -7.921875, -7.921875, -7.91796875, -7.9140625, -7.9140625, -7.91796875, -7.91796875, -7.921875, -7.92578125, -7.92578125, -7.9296875, -7.9296875, -7.921875, -7.921875, -7.92578125, -7.9296875, -7.9375, -7.9296875, -7.921875, -7.921875, -7.91796875, -7.90234375, -7.90234375, -7.90625, -7.90625, -7.90234375, -7.8984375, -7.8984375, -7.90625, -7.91015625, -7.90625, -7.90234375, -7.91015625, -7.91796875, -7.91796875, -7.92578125, -7.93359375, -7.9296875, -7.9296875, -7.93359375, -7.9453125, -7.94921875, -7.94921875, -7.94140625, -7.9375, -7.92578125, -7.921875, -7.91796875, -7.91796875, -7.92578125, -7.9296875, -7.92578125, -7.9296875, -7.9296875, -7.93359375, -7.9375, -7.93359375, -7.94140625, -7.95703125, -7.9609375, -7.953125, -7.953125, -7.953125, -7.9453125, -7.94140625, -7.9453125, -7.9453125, -7.94140625, -7.9375, -7.93359375, -7.9296875, -7.921875, -7.91796875, -7.92578125, -7.92578125, -7.92578125, -7.921875, -7.92578125, -7.9296875, -7.92578125, -7.921875, -7.921875, -7.92578125, -7.93359375, -7.9296875, -7.9296875, -7.92578125, -7.921875, -7.9140625, -7.9140625, -7.9140625, -7.90625, -7.9140625, -7.921875, -7.92578125, -7.9296875, -7.92578125, -7.9296875, -7.93359375, -7.9453125, -7.94140625, -7.94921875, -7.953125, -7.9453125, -7.94921875, -7.94921875, -7.94921875, -7.94921875, -7.94140625, -7.9296875, -7.9296875, -7.92578125, -7.921875, -7.9296875, -7.93359375, -7.9375, -7.94140625, -7.94140625, -7.94921875, -7.94140625, -7.9453125, -7.94921875, -7.95703125, -7.953125, -7.94921875, -7.9453125, -7.9375, -7.9296875, -7.9296875, -7.9296875, -7.92578125, -7.92578125, -7.92578125, -7.92578125, -7.91796875, -7.91796875, -7.91796875, -7.921875, -7.92578125, -7.921875, -7.921875, -7.91796875, -7.90625, -7.8984375, -7.89453125, -7.8984375, -7.89453125, -7.89453125, -7.89453125, -7.89453125, -7.8984375, -7.8984375, -7.90234375, -7.90625, -7.91015625, -7.9140625, -7.921875, -7.91796875, -7.91796875, -7.921875, -7.92578125, -7.91796875, -7.9140625, -7.91015625, -7.90625, -7.90234375, -7.90625, -7.91015625, -7.9140625, -7.9140625, -7.91796875, -7.921875, -7.921875, -7.92578125, -7.9296875, -7.94140625, -7.9453125, -7.94140625, -7.93359375, -7.9296875, -7.91796875, -7.9140625, -7.91796875, -7.921875, -7.91796875, -7.91796875, -7.9140625, -7.9140625, -7.9140625, -7.9140625, -7.921875, -7.92578125, -7.921875, -7.92578125, -7.9296875, -7.921875, -7.9140625, -7.9140625, -7.91796875, -7.91796875, -7.90625, -7.90234375, -7.89453125, -7.88671875, -7.88671875, -7.890625, -7.89453125, -7.8984375, -7.90234375, -7.90625, -7.9140625, -7.9140625, -7.91796875, -7.92578125, -7.93359375, -7.9375, -7.93359375, -7.9375, -7.9296875, -7.921875, -7.921875, -7.921875, -7.921875, -7.91796875, -7.91796875, -7.921875, -7.921875, -7.921875, -7.921875, -7.9296875, -7.94140625, -7.94921875, -7.94921875, -7.953125, -7.94921875, -7.94921875, -7.953125, -7.95703125, -7.95703125, -7.9453125, -7.94140625, -7.9375, -7.9296875, -7.9296875, -7.9296875, -7.93359375, -7.9375, -7.9375, -7.94140625, -7.9453125, -7.9375, -7.9453125, -1.919921875], "end_logits": [5.5, -6.49609375, -7.4296875, -7.4375, -7.23046875, -7.3515625, -7.3671875, -6.87109375, -7.13671875, -6.14453125, -6.578125, -2.8984375, -3.42578125, -2.939453125, -1.939453125, -4.72265625, -3.111328125, -4.640625, -4.31640625, -3.673828125, -4.8359375, -4.63671875, -2.091796875, -2.662109375, -4.08203125, -2.904296875, -4.34375, -4.3203125, -3.125, -4.921875, -4.0, -3.45703125, -4.53125, -4.15625, -2.951171875, -2.88671875, -4.08203125, -3.96484375, -4.28125, -2.619140625, -3.267578125, -4.92578125, -4.6796875, -3.666015625, -4.66015625, -5.13671875, -3.955078125, -4.7890625, -3.2734375, -4.84375, -4.5859375, -3.154296875, -3.369140625, -5.30859375, -4.09375, -4.0546875, -4.0078125, -4.296875, -3.8359375, -2.8203125, -4.40234375, -4.79296875, -3.01171875, -4.40625, -4.24609375, -2.650390625, -4.54296875, -2.361328125, -3.60546875, -2.982421875, -4.37890625, -3.970703125, -4.69140625, -3.419921875, -4.7421875, -2.322265625, -2.822265625, -3.986328125, -4.26171875, -4.40625, -4.61328125, -3.501953125, -3.712890625, -4.578125, -2.001953125, -2.6875, -3.357421875, -4.8203125, -3.58203125, -3.537109375, -3.60546875, -4.8046875, -1.232421875, -2.013671875, -3.9140625, -4.34765625, -4.56640625, -2.82421875, -5.0, -0.6474609375, -2.29296875, -3.814453125, -3.029296875, 1.0244140625, 1.8642578125, -0.0148468017578125, -1.548828125, -0.341796875, 1.607421875, -1.3232421875, 3.640625, 9.421875, 4.71484375, -0.9111328125, -3.380859375, -2.212890625, -3.962890625, -4.203125, -1.5439453125, -4.90234375, 0.28662109375, -1.1708984375, -4.2265625, -3.67578125, -1.58984375, -3.93359375, -2.0703125, 0.355224609375, -2.869140625, -2.912109375, -3.943359375, -0.6875, 4.20703125, 2.40234375, -2.8984375, -8.375, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.3671875, -8.3671875, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.390625, -8.390625, -8.3828125, -8.3828125, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3671875, -8.359375, -8.3671875, -8.3671875, -8.375, -8.390625, -8.390625, -8.3828125, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.359375, -8.3515625, -8.359375, -8.359375, -8.359375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.359375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.3828125, -8.390625, -8.390625, -8.390625, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.375, -8.3671875, -8.375, -8.3828125, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.359375, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3671875, -8.375, -8.375, -8.3671875, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3359375, -8.3359375, -8.328125, -8.3359375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.359375, -8.3671875, -8.359375, -8.359375, -8.34375, -8.3359375, -8.3359375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.359375, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.3671875, -2.9453125]}
{"context": "In 1096, Crusaders passing by the siege of Amalfi were joined by Bohemond of Taranto and his nephew Tancred with an army of Italo-Normans. Bohemond was the de facto leader of the Crusade during its passage through Asia Minor. After the successful Siege of Antioch in 1097, Bohemond began carving out an independent principality around that city. Tancred was instrumental in the conquest of Jerusalem and he worked for the expansion of the Crusader kingdom in Transjordan and the region of Galilee.[citation needed]", "question": "When did Tancred lay siege to Antioch?", "answers.text": [""], "answers.answer_start": [-1], "feat_id": ["5ad4017a604f3c001a3ffd1f"], "feat_title": ["Normans"], "start_logits": [10.09375, -5.23046875, -6.078125, -4.90625, -6.03515625, -6.66796875, -6.12890625, -5.8125, -6.109375, -5.58203125, -7.03515625, -2.375, -0.055694580078125, 3.5234375, -0.1885986328125, -4.03515625, -2.712890625, -4.35546875, -4.65625, -3.138671875, -2.4296875, -4.66015625, -1.8203125, -4.28125, -4.12109375, -5.08203125, -4.21484375, -5.0546875, -1.6796875, -4.08984375, -4.22265625, -4.51953125, -2.30859375, -3.892578125, -5.19140625, -3.99609375, -3.45703125, -1.7666015625, -4.671875, -5.37890625, -4.953125, -4.078125, -3.744140625, -5.10546875, -2.3828125, -4.84375, -5.36328125, -3.298828125, -4.84375, -3.779296875, -2.203125, -4.33984375, -4.234375, -5.0625, -4.8984375, -4.40625, -5.0546875, -4.1875, -4.9140625, -3.384765625, -2.74609375, -4.16796875, -4.7734375, -3.181640625, -4.2421875, -2.541015625, -3.408203125, -2.08203125, 0.5029296875, -1.9267578125, -1.5419921875, -0.82275390625, -3.736328125, 0.24169921875, 2.568359375, 7.75390625, 1.494140625, -2.765625, -1.654296875, -4.01171875, -4.09765625, -4.41015625, -3.138671875, -4.79296875, -3.8828125, -3.150390625, -3.0390625, -3.63671875, -4.04296875, -3.6015625, -3.00390625, -1.1064453125, -4.80078125, -5.2265625, -5.36328125, -3.751953125, -5.265625, -3.771484375, -2.119140625, -4.64453125, -1.6796875, -5.109375, -3.775390625, -3.970703125, -4.89453125, -3.7734375, -2.591796875, -4.9453125, -3.326171875, -1.8408203125, -3.76953125, -4.2734375, -2.263671875, -3.927734375, -4.70703125, -4.859375, -3.650390625, -3.64453125, -5.203125, -2.4375, -4.6328125, -3.994140625, -3.984375, -6.00390625, -6.359375, -2.375, -7.9765625, -7.9765625, -7.97265625, -7.97265625, -7.97265625, -7.98046875, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.98046875, -7.9765625, -7.9765625, -7.98046875, -7.98046875, -7.984375, -7.984375, -7.984375, -7.984375, -7.9765625, -7.9765625, -7.984375, -7.98828125, -7.98828125, -7.98828125, -7.984375, -7.9765625, -7.97265625, -7.98046875, -7.984375, -7.98828125, -7.98828125, -7.98828125, -7.98046875, -7.97265625, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.96875, -7.96875, -7.96484375, -7.95703125, -7.96484375, -7.97265625, -7.97265625, -7.96875, -7.97265625, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.97265625, -7.97265625, -7.96875, -7.96484375, -7.96875, -7.96875, -7.96875, -7.97265625, -7.97265625, -7.97265625, -7.9765625, -7.97265625, -7.96875, -7.9765625, -7.98046875, -7.98046875, -7.984375, -7.98046875, -7.98046875, -7.98046875, -7.9765625, -7.98046875, -7.984375, -7.98828125, -7.98828125, -7.984375, -7.9765625, -7.97265625, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.98046875, -7.9765625, -7.97265625, -7.96875, -7.96875, -7.97265625, -7.97265625, -7.97265625, -7.97265625, -7.96875, -7.9609375, -7.9609375, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.9609375, -7.953125, -7.94921875, -7.9453125, -7.9453125, -7.95703125, -7.953125, -7.953125, -7.95703125, -7.953125, -7.9453125, -7.953125, -7.9609375, -7.96484375, -7.96484375, -7.96484375, -7.9609375, -7.9609375, -7.9609375, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.97265625, -7.97265625, -7.9765625, -7.9765625, -7.9765625, -7.96875, -7.96875, -7.97265625, -7.9765625, -7.98046875, -7.984375, -7.98046875, -7.9765625, -7.96875, -7.97265625, -7.97265625, -7.96875, -7.96875, -7.97265625, -7.97265625, -7.96875, -7.96875, -7.9609375, -7.95703125, -7.96484375, -7.96484375, -7.96875, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.9609375, -7.9609375, -7.96484375, -7.96875, -7.96875, -7.97265625, -7.96875, -7.9609375, -7.9609375, -7.9609375, -7.96484375, -7.96875, -7.96875, -7.96875, -7.97265625, -7.9765625, -7.97265625, -7.96875, -7.97265625, -7.9765625, -7.98046875, -7.98046875, -7.984375, -7.98046875, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.9921875, -7.99609375, -7.99609375, -7.9921875, -7.98046875, -7.9765625, -7.9765625, -7.98046875, -7.98046875, -7.984375, -7.984375, -7.98046875, -7.9765625, -7.96875, -7.96875, -7.9765625, -7.98046875, -7.98046875, -7.98046875, -7.98046875, -7.9765625, -7.96484375, -7.9609375, -7.95703125, -7.95703125, -7.9609375, -7.96484375, -7.96484375, -7.9609375, -7.9609375, -7.953125, -7.953125, -7.96484375, -7.96484375, -7.96484375, -7.96875, -7.97265625, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.97265625, -7.97265625, -7.97265625, -7.97265625, -7.97265625, -7.96875, -7.96484375, -7.96875, -7.96875, -7.97265625, -7.97265625, -7.9765625, -7.97265625, -7.97265625, -7.97265625, -7.9765625, -7.98046875, -7.984375, -7.984375, -7.98046875, -7.97265625, -7.9765625, -7.98046875, -7.98046875, -7.98046875, -7.984375, -7.9765625, -7.97265625, -7.96875, -7.97265625, -7.97265625, -7.97265625, -7.97265625, -7.97265625, -7.96484375, -7.95703125, -7.95703125, -7.96484375, -7.96484375, -7.96484375, -7.96484375, -7.9609375, -7.953125, -7.9453125, -7.94140625, -7.9453125, -7.94921875, -7.953125, -7.953125, -7.953125, -7.953125, -7.94921875, -7.94921875, -7.953125, -7.953125, -7.953125, -7.95703125, -7.953125, -7.94921875, -7.94921875, -7.94921875, -7.953125, -7.953125, -7.953125, -7.95703125, -7.95703125, -7.953125, -7.95703125, -7.96484375, -7.96875, -7.96875, -7.96875, -7.96875, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.96875, -7.96875, -7.97265625, -7.96484375, -7.96484375, -7.96875, -7.96875, -7.97265625, -7.9765625, -7.96875, -7.96484375, -7.9609375, -7.96484375, -7.96875, -7.97265625, -7.97265625, -7.97265625, -7.96875, -7.9609375, -7.95703125, -7.953125, -7.95703125, -7.95703125, -7.95703125, -7.95703125, -7.953125, -7.94921875, -7.9453125, -7.953125, -7.9609375, -7.9609375, -7.9609375, -7.9609375, -7.95703125, -7.953125, -7.953125, -7.95703125, -7.95703125, -7.9609375, -7.9609375, -7.95703125, -7.95703125, -7.953125, -7.95703125, -7.96484375, -7.96875, -7.96875, -7.96875, -7.96875, -7.96484375, -7.96484375, -7.96875, -7.9765625, -7.98046875, -7.984375, -7.98046875, -7.9765625, -7.97265625, -7.97265625, -7.9765625, -7.9765625, -7.98046875, -7.98046875, -7.9765625, -7.9765625, -7.97265625, -7.97265625, -7.9765625, -7.98046875, -7.984375, -7.984375, -7.98046875, -7.97265625, -7.97265625, -7.96875, -2.439453125], "end_logits": [10.2734375, -6.53515625, -6.50390625, -6.73046875, -6.6484375, -5.390625, -6.94140625, -6.671875, -6.69140625, -5.4375, -5.83203125, -3.369140625, -2.7890625, -0.1558837890625, 3.203125, -0.0033054351806640625, -2.30859375, -3.849609375, -4.65234375, -4.37109375, -3.6484375, -4.53515625, -3.546875, -3.546875, -1.021484375, -4.171875, -3.556640625, -4.3515625, -3.4453125, -3.646484375, -1.017578125, -4.4296875, -3.998046875, -1.189453125, -4.0859375, -4.625, -2.767578125, -4.5, -5.23046875, -2.4296875, -4.5859375, -5.1640625, -3.9296875, -5.30859375, -4.40234375, -3.5546875, -5.23828125, -3.21875, -2.482421875, -1.7685546875, -3.490234375, -3.505859375, -1.12109375, -4.2578125, -4.65625, -4.875, -4.50390625, -4.203125, -5.10546875, -4.4140625, -2.232421875, -4.69140625, -4.81640625, -3.90234375, -4.703125, -3.712890625, -1.7607421875, -1.5517578125, -2.150390625, -4.46875, -3.462890625, -4.30859375, -5.2109375, -1.9033203125, -2.1328125, 1.5302734375, 7.36328125, 2.85546875, -3.38671875, -3.2734375, -0.442138671875, -3.810546875, -3.646484375, -3.267578125, -4.3359375, -3.40625, -1.8720703125, -4.3046875, -4.671875, -2.212890625, -0.68505859375, -3.8984375, -4.95703125, -1.1552734375, -4.31640625, -3.986328125, -5.39453125, -5.15625, -3.677734375, -5.2265625, -1.17578125, -3.078125, -3.767578125, -4.11328125, -4.875, -5.04296875, -3.294921875, -5.09375, -4.6875, -2.658203125, -2.59375, -4.9453125, -4.3515625, -3.939453125, -2.001953125, -4.92578125, -5.5234375, -4.99609375, -5.85546875, -1.90234375, -2.091796875, -4.19921875, -4.2734375, -5.37890625, -4.578125, -3.369140625, -8.3671875, -8.359375, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3359375, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.3359375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.3515625, -8.359375, -8.3515625, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.3515625, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3359375, -8.3359375, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.3671875, -8.3671875, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.3359375, -8.3359375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.359375, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.3359375, -8.34375, -8.34375, -8.3515625, -8.34375, -8.3515625, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.34375, -8.3359375, -8.34375, -8.3359375, -8.3359375, -8.34375, -8.34375, -8.34375, -8.34375, -8.3515625, -8.3515625, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -8.34375, -3.447265625]}
{"context": "In October 2010, the open-access scientific journal PLoS Pathogens published a paper by a multinational team who undertook a new investigation into the role of Yersinia pestis in the Black Death following the disputed identification by Drancourt and Raoult in 1998. They assessed the presence of DNA/RNA with Polymerase Chain Reaction (PCR) techniques for Y. pestis from the tooth sockets in human skeletons from mass graves in northern, central and southern Europe that were associated archaeologically with the Black Death and subsequent resurgences. The authors concluded that this new research, together with prior analyses from the south of France and Germany, \". . . ends the debate about the etiology of the Black Death, and unambiguously demonstrates that Y. pestis was the causative agent of the epidemic plague that devastated Europe during the Middle Ages\".", "question": "What scientific journal in France published a prior analysis of the Black Death?", "answers.text": [""], "answers.answer_start": [-1], "feat_id": ["5a2eca47a83784001a7d2484"], "feat_title": ["Black_Death"], "start_logits": [11.328125, -3.015625, -5.125, -5.94921875, -5.921875, -5.04296875, -6.08984375, -5.75, -5.40625, -5.75390625, -6.43359375, -5.6953125, -5.41015625, -6.7890625, -7.08203125, -4.51953125, -2.224609375, -2.1953125, -1.7373046875, -3.484375, 1.4814453125, 1.7099609375, -3.814453125, -2.404296875, 0.06463623046875, 0.426513671875, 4.48828125, -1.8876953125, -1.314453125, -1.1748046875, -4.625, -4.33203125, -3.677734375, -5.31640625, -3.978515625, -3.162109375, -4.52734375, -5.65625, -4.9375, -4.66796875, -4.4453125, -4.06640625, -5.1328125, -4.01171875, -3.98046875, -4.96875, -1.6806640625, -4.4140625, -4.859375, -3.443359375, -4.55078125, -5.03125, -3.92578125, -3.548828125, -4.91796875, -4.296875, -4.47265625, -3.498046875, -3.84375, -5.3828125, -3.048828125, -5.31640625, -4.98828125, -5.484375, -3.576171875, -5.4453125, -5.109375, -3.205078125, -4.20703125, -3.810546875, -3.951171875, -4.12890625, -3.61328125, -5.359375, -2.708984375, -5.78125, -3.9453125, -4.90234375, -3.080078125, -5.2109375, -4.83984375, -4.6015625, -4.65234375, -2.951171875, -5.41015625, -5.59375, -3.654296875, -4.5234375, -1.5146484375, -5.2109375, -3.453125, -4.46484375, -4.75390625, -4.1640625, -3.3515625, -4.53125, -5.4140625, -4.1015625, -3.599609375, -5.1484375, -4.18359375, -4.3984375, -5.1875, -3.89453125, -5.8203125, -4.3359375, -5.69140625, -4.59765625, -4.0625, -5.91015625, -5.48046875, -4.49609375, -3.345703125, -5.8828125, -5.21484375, -4.05859375, -3.611328125, -5.44921875, -5.89453125, -4.66796875, -3.603515625, -5.6953125, -4.88671875, -5.02734375, -4.94921875, -5.09765625, -5.90234375, -4.75, -3.978515625, -3.658203125, -5.84375, -5.18359375, -5.40234375, -2.806640625, -4.125, -4.4921875, -3.6796875, -1.7109375, -5.65234375, -2.056640625, -5.6015625, -1.10546875, -5.47265625, -3.892578125, -4.9765625, -6.22265625, -6.25390625, -4.1015625, -5.04296875, -4.23046875, -5.76171875, -4.4765625, -3.810546875, -4.90234375, -5.765625, -4.19921875, -3.896484375, -5.75, -5.48828125, -5.19140625, -3.62890625, -5.890625, -6.14453125, -6.14453125, -4.359375, -5.15234375, -2.13671875, -5.8203125, -3.7421875, -5.03515625, -5.57421875, -4.81640625, -3.716796875, -4.90625, -5.43359375, -4.640625, -5.48828125, -4.20703125, -3.26953125, -3.77734375, -6.05078125, -4.703125, -4.4453125, -5.25, -4.86328125, -4.5390625, -4.9609375, -4.92578125, -4.4921875, -4.515625, -8.0859375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.1171875, -8.109375, -8.109375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.1015625, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.09375, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.0859375, -8.078125, -8.078125, -8.078125, -8.0859375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.109375, -8.109375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.1015625, -8.1015625, -8.109375, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.09375, -8.1015625, -8.09375, -8.0859375, -8.0859375, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.09375, -8.1015625, -8.109375, -8.109375, -8.1015625, -8.109375, -8.109375, -8.109375, -8.1015625, -8.109375, -8.109375, -8.1171875, -8.125, -8.125, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.1015625, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.1015625, -8.09375, -8.078125, -8.078125, -8.0703125, -8.0703125, -8.0859375, -8.0859375, -8.0859375, -8.078125, -8.078125, -8.078125, -8.0859375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.125, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1171875, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1015625, -8.09375, -8.09375, -8.0859375, -8.0859375, -8.0859375, -8.0859375, -8.078125, -8.078125, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.125, -8.1171875, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.1015625, -8.109375, -8.109375, -8.1015625, -8.09375, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.09375, -8.09375, -8.09375, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.09375, -8.09375, -8.0859375, -8.0859375, -8.0859375, -8.09375, -8.09375, -8.09375, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.109375, -8.1171875, -8.109375, -8.109375, -8.1015625, -8.1015625, -8.109375, -8.109375, -8.109375, -8.1171875, -8.1171875, -8.1171875, -8.109375, -8.109375, -8.109375, -8.109375, -8.125, -4.54296875], "end_logits": [11.25, -4.78515625, -6.0859375, -5.546875, -6.4921875, -4.61328125, -6.58203125, -6.61328125, -6.1328125, -5.41015625, -6.765625, -6.703125, -6.5078125, -5.14453125, -5.4296875, -5.7421875, -4.46875, -4.06640625, -2.251953125, -1.9326171875, -2.560546875, -2.2890625, -4.75390625, -0.9765625, -1.9375, -0.95849609375, -0.78857421875, -1.2099609375, -0.96630859375, 4.94140625, -2.43359375, -4.2578125, -2.060546875, -5.22265625, -5.1171875, -3.802734375, -2.107421875, -5.08203125, -5.484375, -5.55859375, -4.98828125, -3.517578125, -5.6171875, -5.7109375, -4.46484375, -5.53515625, -4.3203125, -4.46875, -3.8125, -4.1796875, -1.34765625, -5.19140625, -5.44140625, -5.05859375, -1.947265625, -4.08203125, -5.36328125, -4.56640625, -3.208984375, -5.32421875, -4.52734375, -4.921875, -3.37109375, -5.41015625, -4.8671875, -3.22265625, -6.171875, -2.498046875, -2.271484375, -4.1171875, -4.91796875, -5.64453125, -4.9296875, -5.71875, -3.6875, -5.53515625, -3.025390625, -5.171875, -3.99609375, -3.947265625, -4.10546875, -2.759765625, -5.8203125, -4.67578125, -3.96875, -4.046875, -2.689453125, -4.953125, -3.212890625, -4.12109375, -4.44140625, -1.0751953125, -4.8203125, -5.16015625, -4.140625, -3.076171875, -5.6875, -4.6953125, -2.51953125, -5.4921875, -5.24609375, -3.2265625, -5.89453125, -4.6328125, -5.671875, -5.14453125, -6.00390625, -5.0, -3.04296875, -5.5234375, -5.70703125, -5.0234375, -4.52734375, -4.5546875, -5.56640625, -5.765625, -5.51953125, -3.439453125, -5.48828125, -5.1484375, -4.1640625, -3.53125, -3.080078125, -5.46875, -4.33203125, -5.03125, -5.734375, -5.73828125, -5.23046875, -3.478515625, -3.44140625, -5.00390625, -5.7421875, -5.3125, -3.869140625, -6.0234375, -6.03515625, -1.66015625, -6.1640625, -2.431640625, -6.08203125, -0.72021484375, -3.44921875, -4.24609375, -4.9765625, -4.69921875, -4.4921875, -4.88671875, -6.046875, -4.06640625, -6.21875, -6.1015625, -5.69921875, -3.4296875, -6.45703125, -6.0703125, -5.83984375, -3.396484375, -3.03515625, -4.9296875, -5.12890625, -5.87109375, -5.6328125, -4.203125, -5.1796875, -5.90625, -4.1171875, -4.78125, -4.8515625, -1.79296875, -5.39453125, -5.66015625, -5.5625, -5.1796875, -5.13671875, -4.1796875, -5.84765625, -5.2890625, -4.203125, -2.96484375, -5.96875, -5.23828125, -3.84375, -6.1796875, -6.23046875, -5.59765625, -3.005859375, -3.607421875, -3.078125, -5.7421875, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3828125, -8.3828125, -8.375, -8.3828125, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.390625, -8.390625, -8.3984375, -8.3984375, -8.390625, -8.3984375, -8.390625, -8.390625, -8.3984375, -8.3984375, -8.3984375, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.390625, -8.390625, -8.390625, -8.390625, -8.3828125, -8.3828125, -8.390625, -8.390625, -8.390625, -8.390625, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3828125, -8.375, -8.375, -8.3828125, -8.3828125, -8.3828125, -8.3828125, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.375, -8.375, -8.375, -8.375, -8.375, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.3671875, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.359375, -8.359375, -8.359375, -8.3515625, -8.3515625, -8.359375, -8.359375, -8.359375, -8.359375, -8.3671875, -8.3671875, -8.359375, -8.3671875, -8.3671875, -8.3671875, -8.375, -5.76953125]}
{"id": "0", "predicted_queries": ["what was important to the success of the manhattan project", "why was the manhattan project important?", "what was important about the manhattan project", "why was the success of the manhattan project so important?", "who was the manhattan project a scientific project for", "what was the manhattan project important for", "why was the manhattan project a success", "how was the success of the manhattan project", "why was the manhattan project important to the success of the project?", "what is the importance of communication amongst scientific minds", "what was the importance of scientific communication for the success of the manhattan project", "what was the purpose of the manhattan project", "why was the manhattan project significant?", "why was the manhattan project important", "why did scientists believe in atomic power", "why did scientists and engineers have to communicate?", "why was the manhattan project a success", "what was the purpose of the manhattan project", "why did scientists and engineers want to be involved in the manhattan project", "why are the scientists so valuable", "which of the following was an important outcome of the manhattan project?", "why was the manhattan project successful", "why was the manhattan project an important scientific achievement", "what was the success of manhattan", "what was the result of the manhattan project", "why was communications important to the success of the manhattan project?", "why the manhattan project was important", "why is it important to know who is the manhattan project", "what was the most important accomplishment to the success of the manhattan project?", "why was the manhattan project an important achievement?", "why was the manhattan project important to the success of the atomic bomb", "how did the manhattan project impact scientists?", "what were the effects of the manhattan project", "what were the results of the manhattan project and how did they affect the public", "what was the manhattan project", "why did scientists contribute to the success of the manhattan project", "why was communication important in the manhattan project", "what was the effect of the manhattan project on the world", "what was the importance of communication in the success of the manhattan project?", "why was communications important to the success of the manhattan project?", "why was the manhattan project important", "what was the manhattan project", "why was the success of the manhattan project important", "why was manhattan project a success", "what was important about the manhattan project", "what benefited from the success of the new york nuclear bomb", "what was the significance to the success of the manhattan project?", "why is communication important", "why was the manhattan project an important achievement", "why did the manhattan project work", "what was the manhattan project's success", "what was the significance of the manhattan experiment", "how important was communication to the success of the manhattan project", "why is communication important to the success of the manhattan project?", "what was the importance of the manhattan project", "why did scientists believe the manhattan project had the greatest impact on science?", "what was a critical effect of the manhattan project?", "why did the manhattan project succeed", "what was the importance of the manhattan project", "why was the manhattan project important", "why was the manhattan project a success?", "what was the importance of communication and communication during the manhattan project", "why was the manhattan project significant?", "what was the importance of communication in the manhattan project?", "why was communication important to the success of the manhattan project?", "why was the manhattan project an important achievement", "what was important about the manhattan project", "why was the manhattan project a success", "why were the scientists at the manhattan project so successful?", "why did the manhattan project really work", "what was the success of the manhattan project", "what is the importance of communication during the manhattan project", "why was the manhattan project important", "why was communication important?", "what was the importance of communication in the success of the manhattan project?", "why was the manhattan project successful?", "which statement reflects the success of the manhattan project?", "why did the manhattan project succeed", "why was the manhattan project a great success", "why was the manhattan project important"]}
{"id": "1", "predicted_queries": ["what were a major contributions to the manhattan effort", "what impact did the manhattan project have on history", "what is the manhattan project impact on world", "what helped to end world war ii?", "why did the manhattan project help end world war ii?", "why did the manhattan project bring a end to world war ii?", "what helped bring the end of wwii and the beginning of a new era for the united states", "why did the manhattan project happen", "what was the manhattan project", "why was the manhattan project important", "why was the manhattan project necessary in wwii", "what brought an end to world war ii?", "what was the main purpose of the manhattan project?", "why was the manhattan project a success", "why did the manhattan project help bring ww2 to an end", "why was nuclear energy important during wwii", "what is the impact of manhattan project on the united states", "why did the manhattan project happen", "what did ww2 end with the manhattan project", "how did the manhattan project affect the world", "why was the manhattan project a success", "why did the manhattan project end wwii", "what was the effect of the manhattan project", "who helped bring the end of world war ii", "what impact did the manhattan project have on history", "what did the manhattan project do to the world", "what year did the manhattan project start", "why did the manhattan project occur", "what effect did the manhattan project have on the world?", "what year was the manhattan project?", "why was the manhattan project important to the united states", "how did the manhattan project help end world war ii", "how did the manhattan project help the end of", "why did the manhattan atomic bomb happen?", "what impact did the manhattan project have on history and science?", "what year did the manhattan project occur?", "what was the effect of the manhattan project", "the manhattan project and its atomic bomb what happened to the united states", "why did the manhattan project happen", "what impact did the manhattan project have on history. why", "why did the manhattan project help end world war ii", "why did the manhattan project help bring an end", "why did manhattan end", "what was the impact of the manhattan project", "why did the manhattan project end world war ii", "why did manhattan start the atomic bomb", "why did the manhattan project happen", "when did the manhattan project happen", "what impact did the manhattan project have", "how did the manhattan project impact history", "how did the manhattan project help wwii", "what effect did the manhattan project have on the world", "what were two key impacts of the manhattan project", "when did the manhattan project happen", "why did the manhattan project happen? why did they happen? why did they do it? why does it occur?", "how did the manhattan project impact the world?", "what helped the end of wwii", "how did wwii end in the manhattan project", "what helped end the manhattan project", "what helped to end the manhattan project", "which did the manhattan project accomplish?", "how did the manhattan project contribute to the end of ww2", "why does manhattan project affect history", "which of the following brought the end of ww2", "what impact did the manhattan project have in wwii", "what was the manhattan project", "why did the manhattan project and the atomic bomb happen", "what was the main outcome of the manhattan project", "what was the manhattan project?", "what was one of the major achievements of the manhattan project", "did the manhattan project end wwii", "why did the manhattan project happen", "why did the manhattan project end ww2", "what impact did manhattan project have on the atomic bomb?", "why did manhattan project happen?", "what was the impact of the manhattan project", "which event ended the manhattan project", "what was the impact of the manhattan project", "what was the main goal of the manhattan project", "why did the manhattan project contribute to the end of world war ii?"]}
{"id": "2", "predicted_queries": ["what is manhattan project", "why did manhattan happen", "what was the purpose of the manhattan project", "what was the manhattan project", "what was the purpose of the manhattan project", "why was the manhattan project successful?", "why was the manhattan project so successful", "what was the manhattan project purpose?", "why was the manhattan project a success?", "when was the manhattan project made", "why did people believe in the manhattan project", "which project was the main goal of the manhattan project?", "what was the main reason for the manhattan project", "why did manhattan project happen", "what was the manhattan project", "what was the manhattan project purpose", "how did the manhattan project help to solve the problems of the atomic bomb?", "why was the manhattan project a success essay", "which was the goal of the manhattan project", "why was the manhattan project called the manhattan project", "why was the manhattan project important", "what was the main objective of the manhattan project", "why did the manhattan project fail?", "what was the purpose of manhattan project", "what is the main goal of the manhattan project", "what was the manhattan project", "who was a key figure in the manhattan project", "why did manhattan happen?", "why did the manhattan project happen", "why did the manhattan project occur", "why was the manhattan project important", "what was the significance of the manhattan project", "why did they do the manhattan project essay", "what was the manhattan project", "which of the following was the goal of the manhattan project", "what was the manhattan project", "why did the manhattan project succeed", "what were the objectives of the manhattan project?", "why did the manhattan project succeed", "what was the manhattan project essay", "why did manhattan project work", "what was the manhattan project", "what is the main project of the manhattan project", "what was the manhattan project", "what was the manhattan project", "why was the manhattan project so successful", "what was the goal of the manhattan project", "what did the manhattan project do for the world", "what was the manhattan project", "what is the reason behind the manhattan project?", "why is the manhattan project important", "why did the manhattan project fail", "why was the manhattan project called a success", "what was the manhattan project", "what was the manhattan project and how did it impact the world", "which project was the main purpose of the manhattan project?", "what was the manhattan project", "what was the main goal of the manhattan project", "how the manhattan project was successful", "what was the main cause of the manhattan project? ephemeral", "why did manhattan project happen", "what was the goal of the manhattan project", "what was the significance of the manhattan project", "which event changed everything about the manhattan project?", "what is the manhattan project", "what is the significance of the manhattan project? essay", "why did the manhattan bomb happen", "why did the manhattan project happen", "why was the manhattan project a success", "what was the manhattan project", "why was manhattan bombing possible", "manhattan project definition essay", "how did the manhattan project help the united states make the atomic bomb", "why the manhattan project was important", "why did the manhattan project fail", "why did manhattan happen essay", "what is the manhattan project", "why was the manhattan project successful", "why did manhattan project succeed", "why did manhattan project work"]}
{"id": "3", "predicted_queries": ["who led the manhattan project", "who developed manhattan project", "what was manhattan project", "what was the name of the project that developed the first atomic bomb?", "who developed manhattan", "when did the manhattan project occur", "what was the manhattan project?", "what was the manhattan project", "who led manhattan project", "what year did the manhattan project begin", "what year did the manhattan project start", "what was the manhattan project", "what was the manhattan project", "what was the manhattan project", "who led the manhattan project", "what was the manhattan project?", "who led the manhattan project", "what was the manhattan project", "who started the manhattan project", "why isn't the manhattan project the first atomic bomb", "who led the manhattan project", "what year was the manhattan project", "which era was the manhattan project", "what was the manhattan project?", "what was the manhattan project", "what was the manhattan project", "why did they begin the manhattan project", "which war was the manhattan project?", "what was the manhattan project and why was it important in developing it?", "who was responsible for the development of the manhattan project", "what did the manhattan project do", "which atomic bomb was developed during the manhattan project", "what was the atomic bomb called", "who was responsible for the manhattan project", "which atomic bomb was developed during the manhattan project?", "during what year did the u.s. build the manhattan bomb?", "what is the manhattan project?", "what was the manhattan project", "which year was the manhattan project completed?", "what was the manhattan project", "when did the manhattan project start", "manhattan project definition", "when was the manhattan project", "how did manhattan project start", "who did manhattan project", "who designed the manhattan project?", "what was the manhattan project", "what was the manhattan project", "what was the manhattan project", "where was manhattan project", "when were the manhattan projects", "what year was the manhattan project conducted", "who was responsible for the invention of the manhattan project?", "what was the manhattan project", "when did the manhattan project start", "what was the manhattan project", "what was the manhattan project", "who led the manhattan project", "what was the purpose of the manhattan project", "who led the manhattan project", "who were the engineers who made the manhattan bomb", "when was the manhattan project", "who was the u.s. army corps of engineers under during the manhattan project?", "who was the manhattan project led by", "what was the manhattan project", "what was the manhattan project", "who developed atomic bomb", "when was manhattan project conducted", "what was the manhattan project", "what was the manhattan project", "who started manhattan project", "why is the manhattan project named", "who was involved with the manhattan project", "what did the manhattan project accomplish", "when was the manhattan project?", "what was the manhattan project", "what was manhattan project", "who was involved in the manhattan project", "what was the manhattan project", "what were the manhattan projects?"]}
{"id": "4", "predicted_queries": ["what is manhattan project", "what is the manhattan project interactive", "where are the manhattan project", "what is the manhattan project", "what was the first manhattan project website", "what was the manhattan project", "what is the manhattan project", "where is the manhattan project", "which website is the manhattan project", "what is the manhattan project", "where is the manhattan project located", "where is manhattan project?", "what is the history of the manhattan project", "what is the manhattan project", "which government agency is responsible for the manhattan project?", "what is the manhattan project", "what was the manhattan project", "who created the manhattan project", "what was the name of the first website based on the manhattan project", "what was the manhattan project?", "what site is the manhattan project", "where to find the manhattan project", "who is the manhattan project?", "where is the manhattan project located", "what was the manhattan project", "what is the manhattan project website", "manhattan project websites", "what website is the manhattan project", "when did the manhattan project begin", "what is the manhattan project", "what is manhattan project", "what is the name of a website that contains the manhattan project", "what year did the manhattan project begin", "manhattan project website", "what is manhattan project?", "what is manhattan project", "what is the manhattan project", "what is the manhattan project", "which agency is associated with the manhattan project", "where is the manhattan project", "what was manhattan project", "what was the manhattan project", "what site is the manhattan project on?", "who was the first website on the manhattan project", "what was manhattan project?", "the manhattan project website", "where is the manhattan project?", "who owns the manhattan project", "what is the manhattan project", "what is manhattan project wikipedia", "who is the manhattan project based on", "what is manhattan project", "what is the manhattan project?", "what information is available from the manhattan project website?", "where to find information about the manhattan project", "when was manhattan project published?", "where is the manhattan project", "what type of website is manhattan project", "what was the manhattan project", "what is the name of the website for the manhattan project", "where is the manhattan project", "what was the manhattan project", "who created the manhattan project", "what website is the manhattan project on", "the manhattan project website", "what is the manhattan project", "what was the manhattan project", "where is manhattan project website?", "where is the manhattan project website", "which is the website of the manhattan project", "what is the manhattan project website", "where is manhattan project located", "who is the manhattan project", "what is manhattan project", "what is manhattan project", "what website do you find about the manhattan project", "what is the manhattan project", "where is the manhattan project located", "what website was the manhattan project", "when was manhattan project published"]}
{"id": "5", "predicted_queries": ["when did the first atomic bomb hit", "when was the first nuclear bomb exploded", "what was the first atomic bomb", "when did the atomic age begin", "when was the first atom bomb sunk", "when was the atomic bomb discovered", "which atomic bomb was used in the manhattan project", "when was the atomic bomb discovered", "when did atomic bombs become a thing", "what year did the atomic bomb begin?", "what day was the new atomic bomb made", "where did the atomic bomb start", "when did atomic age start", "when did atomic age begin", "when and how long did the first atomic bomb occur", "when did the atomic age start", "where was the first nuclear explosion", "when did the atomic age start", "when was the first atomic bomb made?", "where was the atomic bomb conceived", "which was the first atomic bomb?", "how did atomic age start", "when did the nuclear age begin", "when is the atomic age began", "what was the name of the first bomb", "what was the first atomic bomb made of", "when did the first atomic bombs come out", "when was the first atomic bomb made", "when was the first atomic bomb", "when was atomic bomb created", "where did the atomic bomb originate", "what year did the atomic bomb come", "what was the atomic bomb and when was it invented", "when did the nuclear age begin", "when was the atomic age started in the united states", "why did the first atomic bomb occur", "who made the first atomic bomb", "where was the first atomic bomb discovered", "who discovered the first nuclear bomb", "when did the first atomic bomb come out", "when was the atomic bomb invented", "what was the name given to the atomic bomb that went off the ground?", "where was the first atomic bomb", "where was the nukes created", "what did the first atomic bomb start", "where was the first atomic bomb detonated", "when was atomic bomb invented", "when was the first nuclear bomb made", "who discovered the first nuclear weapons", "when was the nukes discovered", "when atomic age was discovered", "when did the atomic bomb come out", "when did the first atomic bomb hit", "who created the first atomic bomb", "what year did the nuclear age start", "when did the atomic bomb first hit", "where was the first atomic bomb placed", "when was the first atomic bomb built", "who made the first atomic bomb", "where was the first atomic bomb detonated", "when was the atomic era", "why was the first atomic bomb discovered", "what year did the atomic age start", "when did the atomic bomb hit", "when did the first atomic bomb occur", "what was the atomic bomb called when it was invented", "which scientist had nicknamed the nuclear age gadget", "what year was the first atomic bomb discovered", "what was the first atomic bomb", "what was the first nuclear bomb", "which atomic bomb is based on a true story", "what year did the nuclear bomb explode", "what was the first atomic bomb", "where did the atomic bomb originated", "what year was the atomic bomb invented", "what was the first atomic bomb", "when did the atomic age begin", "when did the atomic age begin", "when was the atomic bomb invented", "when was the atomic age began"]}
{"id": "6", "predicted_queries": ["manhattan project history", "which book is the author's contribution to the manhattan project?", "what was the manhattan project for?", "what was the significance of the manhattan project", "what was the manhattan project", "which book is not an attempt to document the origins and development of the manhattan project? p. 82-88. what is this book?", "what was the manhattan project", "what was the main idea behind the manhattan project", "what was the manhattan project", "how did the manhattan project begin", "what was the main goal of the manhattan project", "what was the manhattan project", "what year did the atomic bomb begin in the manhattan project?", "what was the purpose of manhattan?", "what were the theories behind manhattan bombing and why did they happen?", "how did the manhattan project start", "what was the manhattan project", "what was the manhattan project", "was the manhattan project the atomic bomb", "what is the main purpose of the manhattan project?", "who created manhattan", "when did the manhattan project begin", "when did manhattan start", "when was the manhattan project started", "manhattan project is based on what", "what was the manhattan project", "which author wrote about the atomic bomb and its effect on world war ii?", "what was the manhattan project", "where did the manhattan project originate?", "when did the manhattan project start", "what is the manhattan project", "what were the major causes of the manhattan ww2", "who was the manhattan project and why was it important", "what was the manhattan project", "when was the manhattan project developed", "what was the manhattan project?", "who created the manhattan project", "when did the manhattan project start?", "who developed the manhattan project", "was the manhattan project a u.s. atomic bomb", "what was the manhattan project", "what is the manhattan project", "when did the manhattan project began?", "what is the manhattan project", "why did the manhattan project start", "what was the manhattan project", "who was responsible for the manhattan project", "what is the main focus of the manhattan project", "who developed the manhattan project", "when did manhattan began", "who developed the manhattan project", "what is the manhattan project", "what did the manhattan project do", "what was the manhattan project", "what was the manhattan project?", "who was responsible for implementing the manhattan project?", "when did the manhattan project begin", "why was the manhattan project a success", "which was the first attempt to document the development and development of the manhattan project", "when was the manhattan project created", "when did the manhattan project begin", "what was the manhattan project", "what was the manhattan project?", "why was the manhattan project started", "why did manhattan project began", "who was the manhattan project", "which book is not about the manhattan project?", "what is the manhattan project", "what was the manhattan project", "what was the manhattan project", "what was the manhattan project", "which project attempted to document the origins and development of the manhattan project?", "what was the manhattan project", "what is manhattan project about", "what year was the manhattan project", "what was the manhattan project", "what was the manhattan project", "what was the manhattan project", "what was the main purpose of the manhattan project", "who was involved with the manhattan project"]}
{"id": "7", "predicted_queries": ["who was the director of manhattan", "what was the manhattan project ?", "who directed the manhattan", "how long did the manhattan project take", "when did the manhattan project begin", "who led the manhattan project", "who was a nuclear engineer and who designed the manhattan project", "who was the manhattan project led by", "who were the inventors of the manhattan project", "who was involved in the manhattan project", "who were involved in the manhattan project", "what was the manhattan project", "what was the manhattan project", "who was the manhattan project", "when was the manhattan project made", "what was the manhattan project", "who created the new nuclear weapons", "where did the manhattan project take place?", "who was involved with the manhattan bomb project", "what was the manhattan project in history", "when was the manhattan project started", "who was leading the manhattan project", "who led the manhattan project", "who designed the manhattan project", "who was the manhattan project led by", "who is the manhattan project lead by", "which of the following was the name given to the american project that designed the first nuclear bomb?", "which army contractor designed and made the first nuclear weapon?", "what was the name of the wwii nuclear bomb", "who was involved in manhattan project", "what was the manhattan project", "who was responsible for the invention of the first nuclear bomb", "when was manhattan project started", "who was part of the manhattan project?", "who designed the first nuclear bomb", "who led the manhattan project?", "who designed and built the nuclear bombs", "who led the manhattan project", "what was the manhattan project", "who designed the atomic bomb", "who was responsible for the manhattan project", "who directed the manhattan project", "what was the manhattan project?", "who designed the manhattan project", "what was the manhattan project designed for", "which scientist designed the manhattan project?", "who was leading the manhattan project", "who was the manhattan project led by", "what was the manhattan project", "who was involved with the manhattan project", "who led the manhattan project", "what was the role of the manhattan project in ww2", "who was the scientist who designed the manhattan project", "what was the manhattan project wwii", "what was the manhattan project", "what was the purpose of the manhattan project?", "who designed the manhattan project", "what was the manhattan project", "who led the manhattan project", "who led the manhattan project", "who was the director of the manhattan project", "who led the manhattan project", "what was the name of the atomic bomb made by the manhattan project", "who was responsible for the manhattan project", "who was the director of the manhattan project", "what year did the manhattan project start", "who was the director of the manhattan project", "who led manhattan project", "who made nuclear bomb", "who was the lead engineer on the manhattan project?", "who led the manhattan project", "who developed manhattan project nuclear weapons", "what is the manhattan project", "when were nuclear weapons invented", "who designed the first nuclear bomb", "who is the manhattan project led by", "what were the manhattan project", "who was the manhattan project lead by", "where was the manhattan project", "who led the manhattan project"]}
{"id": "8", "predicted_queries": ["when were the two atomic bombs discovered", "when did manhattan project start", "why was manhattan bombing", "when did the manhattan bomb explode", "when did the manhattan project happen and why", "what was the name of the first atomic bomb", "what year were the 2 atomic bombs made", "which year was the manhattan project begun", "when did manhattan project start", "why did the manhattan project happen", "when did the manhattan project begin", "when did manhattan bomb start", "when did the manhattan project start", "when was the manhattan project started", "when did manhattan project begin and end", "what year did the manhattan project occur", "when did the manhattan project begin?", "who started the manhattan project", "when was the manhattan project launched", "what was the name of the secret project that produced the 2 atomic bombs", "where did the manhattan project begin", "when did the manhattan project start", "the atomic bomb was sparked by what", "what was the name of the first atomic bomb", "what year did manhattan happen", "when did the new york atom bomb come out", "why did manhattan bomb occur", "when was manhattan bombing commenced", "what year did manhattan start", "what was the name of the first american atomic bomb", "what did the manhattan project accomplish", "when did the manhattan project start", "when was the manhattan project started", "when did the manhattan project start", "when was the manhattan project", "where did the manhattan project originate?", "what was the manhattan project and what did the army do", "why did the atomic bomb start", "what year did manhattan bomb", "where was the manhattan project started", "when did the manhattan project start", "when did the manhattan project start", "what was the manhattan project used for", "what year was the manhattan project", "who started the manhattan project", "when and where did u.s military begin the manhattan project", "what was the manhattan project and why was it necessary?", "what year did manhattan bomb", "what year did the manhattan bombing began", "what is manhattan project", "what year did the manhattan bomb start", "why did the manhattan project begin", "what year did the manhattan project start", "when did manhattan start", "when were the manhattan projects", "what year did the manhattan project start", "when did the manhattan project start", "when did the manhattan project began", "what year did the manhattan project start", "what was the last year the manhattan project started", "what was the manhattan project", "where did manhattan project start", "when did the manhattan project start", "in what year did the manhattan project happen", "what was the main purpose of the manhattan project", "what year was the manhattan bomb launched", "when was manhattan project started", "when did manhattan start", "why did the manhattan project begin", "when was the manhattan project started", "what year did manhattan happen", "when was the manhattan project conceived", "when did the atomic bomb start", "where did the manhattan project start", "when did the manhattan project start", "when was the manhattan project started", "when and where did the atomic bombs hit united states", "when did the manhattan project take place", "when did the manhattan project began", "when did the manhattan project start"]}
{"id": "9", "predicted_queries": ["why was hanford selected to build the b reactor", "where is hanford new york?", "who built a b reactor", "why was hanford selected as the manhattan project site", "hanford ohio is what river", "why was hanford selected for the manhattan project", "which river was the manhattan reactor located on", "where was hanford tx located", "which reactor located in nyc", "where was manhattan project located", "where was the hanford reactor built", "which of the following was selected as the location for the manhattan project's b reactor", "what was the significance of the manhattan project", "hanford sd is what river", "what river is in the p & b reactor", "what is the biggest river in the united states", "who built hanford nuclear power plant", "where is hanford tx located in the manhattan project", "what is the b reactor in manhattan located", "where is the b reactor located in manhattan", "why was hanford chosen as a site for the manhattan project?", "what type of river flowed into the pacific ocean?", "where is the b reactor at the manhattan project", "why was hanford chosen for the manhattan project", "why was hanford selected as a site for the manhattan project?", "what is the b reactor located on", "what was the name of the b reactor", "who constructed the b reactor in manhattan city, ny", "which river is the b reactor at hanford nebraska?", "what type of river is the b reactor in manhattan", "where is hanford ny", "why was hanford texas chosen for a manhattan reconstruction site", "where was hanford, ny", "why was hanford chosen for manhattan", "where was the b reactor", "where was hanford nuclear plant located", "what river does the b reactor flow into?", "why was hanford selected as a site for the manhattan project", "where is the b reactor site located", "which was chosen by the manhattan project to build a reactor", "where does the manhattan project's reactors operate?", "why was hanford chosen", "why was the hanford b reactor selected", "where is hanford nj b reactor", "what river is the largest in the pacific", "what was the location of hanford tx", "which site is the manhattan project's biggest source", "what was the hanford nuclear plant named for", "who was selected for the manhattan project", "where is the manhattan nuclear reactor located", "what was the purpose of the hanford reactor", "why was hanford selected", "what is hanford a", "why was hanford selected for the manhattan project", "where is hanford nuclear power rover", "where was the manhattan b reactor built", "why did manhattan choose hanford", "where is hanford", "where is hanford nuclear power facility", "what is the name of the river flowing into the pacific ocean", "what was the main reason hamford ohio was chosen as a site for the manhattan project's b reactor", "why manhattan project b reactor", "where was hanford nuclear site", "largest rivers in pacific ocean", "what was the manhattan project site", "where did the new hanford project take place", "what river was the b reactor on", "where is hanford nj", "why was hanford chosen", "what river runs through hanford nc", "what river flows into the pacific ocean", "why was hanford selected as the site for the manhattan project", "what is hanford nj", "where was hanford plant built", "where is hanford nuclear petrochemicals plant located", "what is the name of the river that flows into the pacific ocean from the coast to hanford co", "what is hanford", "where is hanford new york", "what river does manhattan use", "where is the manhattan reactor"]}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850042601/0199/000_6_93.jpg", "pub_date": "1850-04-26", "page_seq_num": 199, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7809894127760105, 0.9033842210645799, 0.9759197669114895, 0.9686468545492594], "score": 0.9396988749504089, "ocr": "i ] ' SOTICK, ** All Poreon* hnvjug demond* lyjnin*! llw Estate of Sheriff Ilnynos, will hand them in lejriilly atte*n d Those indebted rau?t ^ No a. 17 th Ordinary & AUm>* it", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850042601/0199/000_6_93.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850042601/0199.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850062101/0233/000_6_96.jpg", "pub_date": "1850-06-21", "page_seq_num": 233, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7707755514431682, 0.034655967101294774, 0.9555946659643496, 0.16309402680022966], "score": 0.9667678475379944, "ocr": "NjSW and fashionable and a O O D S ! ti.a w*^:..: i JL IIU DIIU3UIIUCI9 (IIC IIV? ICUUIVIIIJJ UIIU I opening large assortments of the newest and most fashionable Spring and GOODS, together with Domestics and Groceries of a 1 kinds, all of which they will dispose of on the most terms for cash. Call and examine before you purchase elsewhere. ALEXANDER & BARTON, at S. C.; ALEXANDER & NEVIL, at West Union S. 0. v2 nl tf 1850", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850062101/0233/000_6_96.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850062101/0233.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/000_6_96.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.5847871970226415, 0.038350385598862134, 0.7634712689295764, 0.12690160830561725], "score": 0.966152548789978, "ocr": "CITATION. J. B. Billingsly having applied to mo Letters of .<4dmlni8tmHon on the Es? of Andrew Billingslv, lute of Georgia, deo'd. The creditors are therefore cited to ap? before me on the 6th day of icaii iu biiuw cuu6u it jiuy mey unu wny said Letters should not bo granted. Oiven under my hand and seal 1850. W, D, STEELE, o. p. d,", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/000_6_96.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/001_6_94.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.584187512149178, 0.4891366684398712, 0.7645581141467342, 0.6359554692960014], "score": 0.9414758086204529, "ocr": "SOUTH CAOL.INA, PICKENS DISTRICT. L Roper, ?fc wife Metinda Roper, Applicants; vs. IVm. Kdent, Alexander JSdens, <k wife Esther Adams and wife Poll?, Adams, for the sale of the Real Samuel Edens dee'd. And it that Jesse Adams, nnd wife, Polly, without the limits of this rotate. It is therefore ordered that they do appear uirce monins irom the date nereot their consent to said Sail will be confessed. W. D. STEELE, o. p. d. Ordinary's Office.) 2,1850. f", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/001_6_94.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/003_6_91.jpg", "pub_date": "1850-02-23", "page_seq_num": 158, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.5834216077180835, 0.39780774588782947, 0.7665487714288359, 0.4897477512542432], "score": 0.9134277701377869, "ocr": "CITATION. Jane Trotter and John R. Trotter, hav ing applied to me for letter of on the Estate of Joeiah I rotter late of Pickens District dee'd. The and creditors are cited to appear me on the 25th inst to show cause if any they can, why said Letters of should not bo granted. Given under my hand and seal lltU 1850 \\XT T\\ Cfrnr^Y^Y n - ??. yj. u 1 i'JIIMIjVJ, o. p. d.", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158/003_6_91.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850022301/0158.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850051701/0213/000_6_92.jpg", "pub_date": "1850-05-17", "page_seq_num": 213, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7856446774419911, 0.8614492356402319, 0.9789163372473803, 0.957430473663522], "score": 0.9213156700134277, "ocr": "JYoticc. A jjfOod SnoKMAKKn, well cm find employment by making application to J.E.HAGOOD, Twelve MileS C. March Oth 1850. 42 tf, for sy-i! AT THIS OFFICE", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850051701/0213/000_6_92.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850051701/0213.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/000_6_98.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7939284853243576, 0.7037209490220324, 0.950290940107919, 0.7699742159397482], "score": 0.9884346723556519, "ocr": "rnm the pslaoe sell your Beeso Wax, Tallow, Feathers, Peas, Threshed and Dry Hides; for which you can get Goods for at low doivn cash prices at the store of benson <Si Taylor. Pickens O. II., s. c. July 25th. 10 cerht.", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/000_6_98.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/002_6_94.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7943537965860651, 0.6337740452169515, 0.9517967084871818, 0.703661231171313], "score": 0.9480907320976257, "ocr": "KOT1CR All persons having demands against the Estate of Nancy Ferguson lnte of I'ickcns District doe'd must hand them in legally attested, and these iiidc.htorl will make payment. J. G. FERGUSON, Kxeo'r Ufay Off 1350. X 4t", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/002_6_94.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/003_6_93.jpg", "pub_date": "1850-09-06", "page_seq_num": 278, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7937491322571446, 0.5749025193907374, 0.9482068914730427, 0.6346045624437949], "score": 0.9357951283454895, "ocr": "i S?I\\S OF TEMPERANCES 1'iCKENS ])1VIS10N, NO 21. Members of this Division are to meet hereafter on Saturday i o'clock, P. M. All members aro solicited to be at our next meeting, to assist in tho Installation of Oflicers elect, &c. M. M. NORTON, J?. S.", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278/003_6_93.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850090601/0278.jp2"}
{"filepath": "scu_henryjohnson_ver01/data/sn84026912/00211109981/1850030901/0169/001_6_95.jpg", "pub_date": "1850-03-09", "page_seq_num": 169, "edition_seq_num": 1, "batch": "scu_henryjohnson_ver01", "lccn": "sn84026912", "box": [0.7824606769662396, 0.03347925608300623, 0.9755928899458558, 0.23534961509396457], "score": 0.9510239958763123, "ocr": ". j ' JYO ALL persons having demands against the Estate of Elizabeth Stribling, deed, will hand them in legally attested, and those indebted mist make payment. T. M. Stribling, ) . , , M. S. Stribling. J Jan. 10, i860. 35 8m, GOODS\"! THE Subs, ribcr would again his friends, and the public generally, that he has just received a fresh supply fo ScaNoiiaVilc ! consisting in purtof the following articles, vir/ Calicoes, fioni C t? 20 cents per yard ; Shirting, bleached and brown ; Cambrics*, Lawns and Alpaccas ; Cloths, TweedB, Cnssimeres, ?fcc., for g? ntlemen's wear; Blankets, Ilats, Caps, Bonnets, (fee.; Umbrellas, and a variety of other articles, which he will sell very cheap for cash. S. R. MoFALL. Pickens C. IT.. Dec. 10, '49. 32-b", "place_of_publication": "Pickens Court House, S.C.", "geographic_coverage": ["South Carolina--Oconee--Walhalla", "South Carolina--Pickens--Pickens"], "name": "Keowee courier. [volume]", "publisher": "W.H. Trimmier", "url": "https://news-navigator.labs.loc.gov/data/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850030901/0169/001_6_95.jpg", "page_url": "https://chroniclingamerica.loc.gov/data/batches/scu_henryjohnson_ver01/data/sn84026912/00211109981/1850030901/0169.jp2"}
{"text": "Diesel model Winnie Harlow, who suffers from vitiligo, the same rare skin condition that singer Michael Jackson was diagnosed with, has been pictured enjoying a cozy night on the town with albino fashion star Shaun Ross. The pair attended a launch event for Popular magazine at Siren Studios in Hollywood, California, on Tuesday night, and were snapped holding hands while making their way into the venue. Winnie, 19, who was unveiled as one of the newest faces of fashion label Diesel earlier this year, was wearing a short and simple black and gold mini dress, which she accessorized with a pair of gold strappy heels. Scroll down for video . Looking cozy: Winnie Harlow, 19, who suffers from the same rare skin condition as Michael Jackson, was pictured hand-in-hand with albino model Shaun Ross on Tuesday night . Out on the town: The duo were attending the launch for Popular magazine at Hollywood venue Siren Studios . Skingraft black and gold dress . Get it from Pasar here . Visit site . This look is all types of yes. Winnie Harlow looks incredible in her leather tunic dress which features striking gold trims on the sleeves and hemline. The loose fit creates a flattering silhouette too. Winnie's dress is from LA-based fashion house Skingraft, and you can still buy it by clicking right to Paser's website now. It'll be your go-to party piece! It is however, slightly pricey coming in at $750, so if you want to add a golden standard to your style for less, why not check out these various finds below? We are particularly dazzled by this Mynt 1792 number at Nordstrom. A pair of strappy metallic heels will finish off your look to perfection! Choice's black and gold stamping dress . Visit site . Mynt 1792 color block dress at Nordstrom . Visit site . Maykool black and gold dress . Visit site . Dailylook fit and flare dress . Visit site . Meanwhile Shaun, 23, opted for a more low-key look, wearing an all-black ensemble, which he topped off with a unique tall baseball hat and a pair of leather sneaker-style boots. And while it appears to be the first time that the duo have been spotted enjoying an evening out together, it is likely not the first occasion that they have met. Both stars have made regular appearances on the catwalks at various Fashion Weeks, while Shaun has also starred in campaigns for the likes of Alexander McQueen and Givenchy. Coincidentally, the models also each had a helping hand from fellow fashion star Tyra Banks. Fashion stars: While Evan opted for an all-black ensemble, topped off with a bizarre baseball cap, Winnie wore a black and gold mini dress and strappy sandals . Rising stars: Both Shaun and Winnie have each achieved global recognition in the fashion indsutry, appearing in numerous high-profile fashion campaigns . Strut your stuff: Both Winnie (L), pictured at the Desigual fall/winter 2015 show, and Shaun (R), pictured on the catwalk in February, boast impressive runway credentials . Winnie, whose real name is Chantelle Brown-Young, was one of the contestants on Tyra's hit reality series America's Next Top Model, while Shaun made an appearance on the former model's eponymous talk show in 2009. Despite their cozy appearance, it's not thought that the two are dating - however Shaun did take the time to post a heartwarming message to the model on his Instagram account, just hours after the pair attended the Popular magazine event. Alongside an image of the two of them, Shaun wrote: 'So much fun last night @winnieharlow keep up the good work. From an original believer in you.' And it seems his sweet sentiments were reciprocated by Winnie, who posted a similar image on her own account, saying: 'Sweet nothings with my fly friend @shaundross'", "target": "Winnie, 19, was diagnosed with the rare condition when she was four-years-old .\nCondition causes a lack of melanin which forms white patches on the skin .", "feat_id": "12adad0b14c3207056f1bdcae1bf71d48ae85813", "evaluation_predictions": [2, 0, 21938, 324, 2482, 5481, 6, 753, 6, 54, 16061, 31, 14306, 718, 12713, 6, 5, 276, 3159, 3024, 1881, 14, 3250, 988, 2250, 21, 6443, 19, 6, 34, 57, 7092, 6218, 10, 23889, 363, 66, 19, 1076, 428, 1696, 2734, 999, 16065, 4012, 479, 20, 1763, 2922, 10, 1709, 515, 13, 17242, 4320, 23, 46026, 11863, 11, 3049, 6, 886, 6, 15, 294, 363, 479, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]}
{"text": "(CNN)When Melissa Atkins Wardy, author of \"Redefining Girly\" and a passionate advocate for fighting gender stereotypes, heard from a frustrated mom on Facebook, she knew she needed to do something. So she shared the mom's story. In a blog post, Wardy told how the mom, Veronica of Richland, Washington, wanted to buy \"Big Hero 6\" fabric to make pillows for her two children. The problem? The fabric didn't include two of the heroes from the movie: the female characters, Honey Lemon and GoGo. So Veronica decided to send an email to Springs Creative, the company that makes the fabric, saying that as a woman and an engineer, she was offended. She got an answer from the company but it didn't help. Girl empowerment ads like GoldieBlox: Do they work? A licensing manager for Springs Creative responded that the company has found that boys don't want girl characters on their things. \"Eeeww girls! Yuck! Haha,\" the licensing manager wrote. It will come as no surprise that Veronica was none too pleased to receive that response. \"I was frustrated and disgusted that a manager, and a female manager too, would laugh off my initial contact with the company. It was unprofessional. So I responded,\" Veronica told CNN. She asked that we not use her last name, in order to maintain her privacy. In an email back to the company, Veronica wrote, \"By eliminating the women in your fabric design, you are telling boys that it's OK to think girls are yucky, unworthy and less than a boy. \"You are also telling girls they are unworthy, unwanted and that it's un-cool to be smart and confident.\" What happened next shows that parents, aided by social media outrage, may have more leverage to combat gender stereotyping in our culture than they realize. And the \"Big Hero 6\" example -- along with a similar recent one involving TOMS, the shoes retailer -- suggests that manufacturers may be finally getting it, too. First, the rest of the story about Springs Creative and the \"Big Hero\" fabric: After sharing Veronica's story with her readers and her 6,700 Twitter followers, Wardy encouraged people to give Springs Creative a piece of their mind. She also invited them to tweet their own stories with the hashtag #IncludeTheGirls. Women responded in droves, pointing out how Black Widow, the female character in the popular \"Avengers\" superhero movie franchise, is often excluded from merchandise and how cereal boxes rarely include female characters. \"This sends the direct message to both boys and girls that females are forgettable, unimportant, undesirable. What a horrible thing to teach our children!\" said Wardy, who is also the founder and chief executive officer of Pigtail Pals & Ballcap Buddies, a company that makes empowering clothing for boys and girls. \"The prevailing theory is, 1. boys are the default audience, and 2. boys won't want an item with a girl on it,\" Wardy said. \"Yet, I talk with thousands of parents every week who say otherwise.\" Why trying to make our kids happy can backfire . Those parents are clearly making their voices heard. Because not too long after Veronica received her initial response from Springs Creative, Wardy said she got a call from the company, asking her to post a statement from Springs Creative on her site. \"It is sometimes difficult to hear negative feedback but the message was clear and we intend to act upon your message,\" the statement read. \"Most importantly, Springs Creative does not condone sexism in any shape or form and does not design products to shine a negative light on females OR males.\" The company said it would be talking with Disney \"immediately\" about additional designs for \"Big Hero 6\" that would incorporate all the characters. \"We would never intentionally offend any segment of the population. We are a strong company with positive morals and values and we respect and see both genders equally,\" said the statement. Springs Creative told CNN it would have no further comment. Veronica said she was surprised the company responded so quickly. \"I do not believe this would have happened without the Pigtail Pals and Ballcap Buddies community also raising their voices.\" The real March Madness: When will women's teams get equal buzz? Around the same time, Wardy heard from another follower about an issue with TOMS and wrote about it on her site. On the normally progressive retailer's Web landing page for kids were photos that some parents felt played into gender stereotypes. One photo suggested \"Playtime Approved\" shoes for boys, and the other, this one on a pink background, included the caption \"Little Ladies: adorn their feet for spring.\" \"Really, TOMS? Girls are not ornaments we adorn. Girls play, too!\" Wardy wrote on her Facebook page. Two hours later, Wardy received a comment from TOMS on her Facebook page, saying that the company completely agrees and that the wording has been changed to now say \"new arrivals for kids.\" \"We're really grateful whenever our community brings something like this to our attention,\" said Doug Piwinski, senior vice president, global marketing and communications for TOMS. \"Perhaps as much or more than any other brand, I mean we really listen to our customers in our community.\" So, here's my question: Are the two speedy responses from companies after women spoke out on social media more a sign that companies are truly getting it about gender stereotypes and girl and boy empowerment, or more a sign of the power of parents? Or are they a mixture of both? How to Super Bowl #LikeAGirl . Wardy said there's no doubt that companies are in business to protect their bottom line, and that will always be a motivator. But she said these back-to-back incidents show what can happen when parents make it clear they won't buy products from companies that sell gender stereotypes. \" 'Be not silent' is my mantra. Speak up!\" Wardy said. \"The success with Springs Creative and TOMS and other wins we've had in the past is an example of the power of parents (moms and dads) and children's advocates aggregating their voices to say, 'Enough is enough.' \" Veronica said it's a sign of the power of parents becoming \"more aware, reactive and using social media to make their voices heard by companies that market to children.\" She added, \"One voice can be dismissed; the hailstorm of voices collectively cannot be ignored so easily.\" It is clear, from these two examples, that parents using their voices online and with their wallets can encourage companies to change. There's no question that raising awareness about stereotypes helps, said Wardy. \"If companies aren't paying attention by now, they most certainly should be.\" Pink, princess-y and sexy too soon . Do you think more companies are getting the message to include girl characters on merchandise? Share your thoughts with Kelly Wallace on Twitter or CNN Living on Facebook.", "target": "A mom of two got upset when \"Big Hero 6\" fabric didn't include the two female characters .\nAnother mom called attention to gender stereotypes on a TOMS Web page .\nIn both cases, the companies responded quickly to answer parents' concerns .", "feat_id": "c38564e99702e22f2815b2c1cee4e9e797d286b0", "evaluation_predictions": [2, 0, 11701, 24885, 5986, 219, 6, 2730, 9, 22, 15638, 4550, 6074, 10847, 352, 60, 1317, 31, 10, 8164, 3795, 15, 622, 479, 264, 1373, 69, 527, 19, 5360, 8, 69, 231, 6, 5987, 599, 6059, 479, 264, 4446, 82, 7, 3545, 49, 308, 1652, 19, 5, 15493, 849, 1121, 46962, 133, 33722, 479, 6388, 14424, 2334, 7, 5, 22339, 3795, 18, 1047, 6, 584, 2786, 218, 75, 236, 1816, 3768, 15, 383, 479, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]}
{"text": "(CNN)Blinky and Pinky on the Champs Elysees? Inky and Clyde running down Broadway? Power pellets on the Embarcadero? Leave it to Google to make April Fools' Day into throwback fun by combining Google Maps with Pac-Man. The massive tech company is known for its impish April Fools' Day pranks, and Google Maps has been at the center of a few, including a Pokemon Challenge and a treasure map. This year the company was a day early to the party, rolling out the Pac-Man game Tuesday. It's easy to play: Simply pull up Google Maps on your desktop browser, click on the Pac-Man icon on the lower left, and your map suddenly becomes a Pac-Man course. Twitterers have been tickled by the possibilities, playing Pac-Man in Manhattan, on the University of Illinois quad, in central London and down crooked Lombard Street in San Francisco, among many locations: .", "target": "Google Maps has a temporary Pac-Man function .\nGoogle has long been fond of April Fools' Day pranks and games .\nMany people are turning their cities into Pac-Man courses .", "feat_id": "5776732bfe072fcac0a9cbe14162992255d0ad26", "evaluation_predictions": [2, 0, 1204, 21089, 34, 57, 23, 5, 1312, 9, 10, 367, 587, 274, 22890, 108, 1053, 3349, 10950, 6, 217, 26052, 10045, 8, 17888, 5456, 479, 20, 138, 6387, 66, 5, 8116, 12, 6407, 177, 294, 479, 85, 18, 1365, 7, 310, 35, 17449, 2999, 62, 1204, 21089, 15, 110, 14050, 11407, 6, 3753, 15, 5, 8116, 1554, 9360, 15, 5, 795, 314, 479, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]}
{"text": "(CNN)Would you want a TV program about your family history to include details of a distant, long-deceased relative who had owned slaves? Seriously, who in their right mind would want to be tarnished by the sins of an ancestor you had no connection to other than a remote bloodline? I wouldn't, and neither did Ben Affleck, who lobbied producers of a PBS show, \"Finding Your Roots,\" to remove any reference to his great-great-great grandfather Benjamin Cole, a Georgia slave owner in the mid-1800's, in an episode that looked at Affleck's family history. (Affleck revealed Cole's name Wednesday night.) Here's the thing that might surprise many, given the tendency of the media to exploit any potentially scandalous material: The show's producer, Harvard professor Henry Louis Gates Jr., apparently acquiesced to Affleck's request, because when the episode aired in October 2014, there was no mention of the star's slave-owning ancestor. Affleck's attempt to alter the content of the program only publicly became known a few days ago after WikiLeaks released hacked emails revealing an exchange between Gates and Sony Pictures chief Michael Lynton. When Gates asked how he should respond to Affleck's request to delete the material, Lynton responded, \"all things being equal, I would definitely take it out.\" And on Tuesday, Affleck, via Facebook, admitted that he had urged Gates to excise any reference to his slave-owning relative. Affleck explained, \"I didn't want any television show about my family to include a guy who owned slaves. I was embarrassed. The very thought left a bad taste in my mouth.\" Now Gates has publicly denied that he made his decision about the content of the program based on Affleck's request, but it seems likely that he did. After all, Affleck noted as much in his Facebook post, writing that Gates \"agreed with me on the slave owner but made other choices I disagreed with.\" And three other celebrities profiled on the series last season were shown to have been related to slave owners. So it's unlikely that it was simply happenstance that it left out any reference to Affleck's familial slave ownership connection. In any event, PBS has launched an internal review to determine if the show violated its own editorial standards. Whatever the results of the review, Affleck and Gates did the right thing. Let's be clear: \"Finding Your Roots\" is not an investigative news show; it's an entertainment program. In fact, as Affleck noted, much of the material is provided directly by the celebrity being profiled. It's not \"60 Minutes\" but more in the nature of a sophisticated profile of celebrities, using their marquee names to attract viewers. There's not even a hint that Affleck strong-armed the producers or made any type of threats against them if they included the information. In the emails between Gates and Lynton, which they presumably believed at the time were confidential and would remain so, there was no mention of undue pressure by Affleck. Instead, Gates simply noted that Affleck \"asked us to edit out something.\" After the emails were revealed, Gates issued a statement, saying, \"Ultimately, I maintain editorial control on all of my projects and, with my producers, decide what will make for the most compelling program. In the case of Mr. Affleck we focused on what we felt were the most interesting aspects of his ancestry -- including a Revolutionary War ancestor, a third great-grandfather who was an occult enthusiast, and his mother who marched for civil rights during the Freedom Summer of 1964.\" My view would be different if Affleck had a history of uttering racist remarks or engaging in racist conduct. That would have made the information truly newsworthy. But instead we have a man known for championing progressive causes, which I'm sure made him even more acutely sensitive that some on the right might possibly use this information against him in the future. Perhaps that's what Affleck meant in his Facebook post when he wrote that this information made him feel \"vulnerable.\" Affleck has noted that he regrets asking PBS to not include information about his \"distant relative.\" That's a nice gesture, but it was not needed. Affleck had every right to ask for the information about a long-deceased distant relative to be left out of the show. And PBS had the choice to include it or leave it out. I applaud PBS for doing the right thing at a time when media outlets rarely show any restraint on the lives of people in the public eye.", "target": "Ben Affleck admits he asked PBS show \"Finding Your Roots\" to avoid mentioning his slave-owning ancestor .\nDean Obeidallah says the actor and the show were right to leave the detail out .", "feat_id": "75fdaee82f6d0545a86b9d28b947186ce4b2a088", "evaluation_predictions": [2, 0, 1664, 11176, 20626, 18, 372, 12, 12338, 12, 12338, 10642, 21, 10, 20174, 1945, 11, 5, 1084, 12, 38510, 18, 479, 4967, 4347, 5977, 10100, 35, 3394, 74, 236, 10, 1012, 311, 59, 110, 284, 750, 7, 680, 1254, 9, 10, 13258, 6, 251, 12, 2794, 1755, 11835, 5407, 54, 56, 2164, 21934, 116, 264, 161, 11176, 20626, 56, 358, 235, 7, 1394, 13, 335, 7, 28, 314, 66, 9, 5, 311, 479, 5977, 10100, 161, 24098, 34, 1660, 41, 3425, 1551, 7, 3094, 114, 5, 311, 8245, 63, 8161, 2820, 479, 2, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1]}
{"id": 6014, "text": "What's the wather in Coleville, Kenya", "label": 3, "Generalization": "trimmed_train"}
{"id": 7285, "text": "what will the weather be like in Louisiana will it be colder then now", "label": 3, "Generalization": "trimmed_train"}
{"id": 5361, "text": "add gabrial mcnair to my Love In Paris list", "label": 5, "Generalization": "trimmed_train"}
{"id": 3041, "text": "Book a restaurant in Medford Lakes on Sep. 8, 2033 for essie, tonya and I", "label": 2, "Generalization": "trimmed_train"}