source_id
int64
1
4.64M
question
stringlengths
0
28.4k
response
stringlengths
0
28.8k
metadata
dict
1,771
I'm still not sure about the mechanics that lead to rabies being incurable. I know that it can be treated before any symptoms show up, but why is it that once symptoms show the person is a dead man walking?
This is because rabies is a viral infection of nervous tissue that propagates through peripheral nerves into the brain and causes brain tissue inflammation (encephalitis). As long as the virus is in the brain there is no way to get rid of it. The main trade-off here is that everything that would kill the virus will be as (or even more) aggressive against the brain tissue, and impairment of the latter will lead to really heavy deficits in vital functions like breathing and thermoregulation. The first manifestations of rabies are those due to brain damage. This means, the virus is already there and the brain is already fatally damaged.
{ "source": [ "https://biology.stackexchange.com/questions/1771", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/584/" ] }
1,859
I've thoroughly read the Wikipedia article on DNA sequencing and can't get one thing. There's some hardcore chemistry involved in the process that somehow splits the DNA and then isolates its parts. Yet DNA sequencing is considered to be a very computationally-intensive process . I don't get what exactly is being computed there - what data comes into computers and what computers compute specifically. What exactly is being computed there? Where do I get more information on this?
Computers are used in several steps of sequencing, from the raw data to finished sequence: Image processing Modern sequencers usually use fluorescent labelling of DNA fragments in solution. The fluorescence encodes the different nucleobase (= “base”) types (generally called A, C, G and T). To achieve high throughput, millions of sequencing reactions are performed in parallel in microscopic quantities on a glass chip, and for each micro-reaction, the label needs to be recorded at each step in the reaction. This means: the sequencer takes progressive digital photographs of the chip containing the sequencing reagent. These photos have differently coloured pixels which need to be told apart and assigned a specific colour value. As can be seen, this (strongly magnified; the image is < 100 µm across!) image fragment is fuzzy and many of the dots overlap. This makes it hard to determine which colour to assign to which pixel (though more recent versions of the sequencing machine have improved focussing systems, and the image is consequently crisper). Base calling One such image is registered for each step of the sequencing process, yielding one image for each base of the fragments. For a fragment of length 75, that’d be 75 images. Once you have analysed the images, you get colour spectra for each pixel across the images. The spectra for each pixel correspond to one sequence fragment (often called a “read”) and are considered separately. So for each fragment you get such a spectrum: (This image is generated by an alternative sequencing process called Sanger sequencing but the principle is the same.) Now you need to decide which base to assign for each position based on the signal (“base calling”). For most positions this is fairly easy but sometimes the signal overlaps or decays significantly. This has to be considered when deciding the base calling quality (i.e. which confidence you assign to your decision for a given base). Doing this for each read yields up to billions of reads, each representing a short fragment of the original DNA that you sequenced. Most bioinformatics analysis starts here; that is, the machines emit files containing the short sequence fragments . Now we need to make a sequence from them. Read mapping and assembly The key point that allows retrieving the original sequence from these small fragments is the fact that these fragments are (non-uniformly) randomly distributed over the genome, and they are overlapping . The next step depends on whether you have a similar, already sequenced genome at hand. Often, this is the case. For instance, there is a high-quality “reference sequence” of the human genome and since all the genomic sequences of all humans are ~99.9% identical (depending on how you count), you can simply look where your reads align to the reference. Read mapping This is done to search for single changes between the reference and your currently studied genome, for example to detect mutations that lead to diseases. So all you have to do is to map the reads back to their original location in the reference genome (in blue) and look for differences (such as base pair differences, insertions, deletions, inversions …). Two points make this hard: You have got billions (!) of reads, and the reference genome is often several gigabytes large. Even with the fastest thinkable implementation of string search, this would take prohibitively long. The strings don’t match precisely. First of all, there are of course differences between the genomes – otherwise, you wouldn’t sequence the data at all, you’d already have it! Most of these differences are single base pair differences – SNPs (= single nucleotide polymorphisms) – but there are also larger variations that are much harder to deal with (and they are often ignored in this step). Furthermore, the sequencing machines aren’t perfect. A lot of things influence the quality, first and foremost the quality of the sample preparation, and minute differences in the chemistry. All this leads to errors in the reads. In summary, you need to find the position of billions of small strings in a larger string which is several gigabytes in size. All this data doesn’t even fit into a normal computer’s memory. And you need to account for mismatches between the reads and the genome. Unfortunately, this still doesn’t yield the complete genome. The main reason is that some regions of the genome are highly repetitive and badly conserved, so that it’s impossible to map reads uniquely to such regions. As a consequence, you instead end up with distinct, contiguous blocks (“contigs”) of mapped reads. Each contig is a sequence fragment, like reads, but much larger (and hopefully with less errors). Assembly Sometimes you want to sequence a new organism so you don’t have a reference sequence to map to. Instead, you need to do a de novo assembly . An assembly can also be used to piece contigs from a mapped reads together (but different algorithms are used). Again we use the property of the reads that they overlap. If you find two fragments which look like this: ACGTCGATCGCTAGCCGCATCAGCAAACAACACGCTACAGCCT ATCCCCAAACAACACGCTACAGCCTGGCGGGGCATAGCACTGG You can be quite certain that they overlap like this in the genome: ACGTCGATCGCTAGCCGCATCAGCAAACAACACGCTACAGCCT ATCCCCATTCAACACGCTA-AGCTTGGCGGGGCATACGCACTG (Notice again that this isn’t a perfect match.) So now, instead of searching for all the reads in a reference sequencing, you search for head-to-tail correspondences between reads in your collection of billions of reads. If you compare the mapping of a read to searching a needle in a haystack (an often used analogy), then assembling reads is akin to comparing all the straws in the haystack to each other straw, and putting them in order of similarity.
{ "source": [ "https://biology.stackexchange.com/questions/1859", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/466/" ] }
1,943
Do any animals other than humans undergo menopause? Also, is there any difference between animals in captivity and animals in the wild as regards menopause? For example, even if menopause has been observed in a captive member of a particular ape species, do individuals of that species typically live long enough in the wild to also undergo menopause? I guess here's what I'm really getting at: is menopause a common thing in the animal kingdom, or is it only a common thing in humans?
Yes. Menopause is common for long-lived mammals. For instance, in the wild, killer whales go in a sort of menopause as reported in 2009 by Ward et al. Front Zool. 2009 Feb 3;6:4 . So it is not due to captivity. According to a Nature review, reproductive cessation has also been documented in non-human primates, rodents, whales, dogs, rabbits, elephants and domestic livestock (Packer et al. Nature. 1998; 392(6678):807-11 )
{ "source": [ "https://biology.stackexchange.com/questions/1943", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/784/" ] }
1,981
Somewhere I have read we share more than 99% of our genes with every other other person and 98% of our genes with chimpanzees. What does this mean? Don't we share 50% of our genes with our mother and 50% with our father? I've found an another article stating that.
There is a distinct difference between the 'genes' that we share, and the genome (the DNA) that the genes are made of. All humans (excluding genetic disorders) have the same genes, but the same gene in different individuals may have a slightly different DNA sequence, and this may be manifested in the different traits you can observe between people (eye colour, height, etc) or be ’silent’ (have no observable effect). So you therefore have 100% of the genes that your mother has. However, as stated in another answer, you inherit the different 'alleles', or versions, of the genes from your parents, and end up with ~50% of the alleles from each parents (but all the genes). With regard to species differences; many of the genes we inherit have evolved over millions (in fact billions) of years, and thus many of our genes are present in most other organisms (but in very different forms - the DNA). Chimpanzees are our closest relatives in evolutionary terms, and thus their genes are very similar to ours in the genome (~98% the same). But this only applies to the coding regions! Less than 2% of your genome actually codes for genes - the rest is mostly regulatory (not junk, as it used to be called), and this is where the true inter-species variation lies. So whilst we have ~98% homology in the protein-coding regions, this is MUCH less if you count the whole genome.
{ "source": [ "https://biology.stackexchange.com/questions/1981", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/695/" ] }
2,073
I'd be tempted to call nipples in men vestigial, but that suggests they have no modern function. They do have a function, of course, but only in women. So why do men (and all male mammals) have them?
The two key concepts here are: sex-specific selection , and the fact that males and females share the majority of genes 1) sex-specific selection Obviously, any population where females lacked nipples would be in trouble. Men, on the other hand, have no evolutionary need for them, but they don't pay much either - there is no strong selection against men with nipples. So at first sight, it seems that nipples are positively selected in females while seem to be quite neutral in males . 2) Males and females share the majority of genes If you consider two separate species where the two species undergo different selection pressures, you will just see one species evolve toward one optimum while the other one will independently evolve toward the other optima. However, males and females are not independent entities. The vast majority of our genes can be found in one sex as well as in the other sex. In other words, most male phenotypes do not evolve independently of female phenotypes . As a result of this interdependence, you can end up with the trait that is selected in one sex present in the other sex. Evolutionary equilibrium This is all much more rigorously defined in terms of selection coefficients and evolutionary pressure . Without going into the math, the questions of who has the highest selection coefficient and How differential is gene expression for this trait are important questions to predict the equilibrium trait value in both sexes. Lack of a strong selection pressure Finally, any trait that is seemingly not-useful has to have a significant disadvantage on the fitness of the organism to be selected out ( Why do some bad traits evolve, and good ones don't? ). Even if a trait is useless for both males and females it may persist. The case of females needing the trait just makes its elimination in males even more difficult, as explained above. However, in some mammalian species, the males do lack the nipples ( Evolutionarily, why do male rats and horses lack nipples? ).
{ "source": [ "https://biology.stackexchange.com/questions/2073", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/810/" ] }
2,157
Did animals evolve from plants? Did animals' ancestors have chloroplasts in their cells?
See this paper " Divergence time estimates for the early history of animal phyla and the origin of plants, animals and fungi " for information on the divergence estimates (I'm not sure if there are more recent papers discussing this). Plants, animals and fungi are eukaryotes, distinct from eubacteria and archaebacteria, which are prokaryotes. The difference being in the composition of the cell, particularly a nucleus contained within a membrane for eukaryotes, along with other membrane bound organelles, e.g. chloroplasts. They all share a common ancestor, according to this paper, that split 1.576 Bya (billion years ago) +/- 88 Mya (although it states the relationships are unresolved - it is often difficult to resolve relationships so deep in a tree). They form distinct groups known as Kingdoms under Linnaean based biological classification; the Fungi, Plantae and Animalia. Thus, in answer to your question, no, animals did not evolve from plants. Plants have chloroplasts in their cells, which provide the ability to produce energy via photosynthesis. It is thought that the chloroplast resulted from a symbiotic relationship between early plants and a cyanobacteria in that they both relied on each other for survival and so coevolved. Animals don't contain chloroplasts and instead contain an organelle called the mitochondria (although most plants also have mitochondria), which is also thought to have been a bacterial endosymbiont, probably related to rikettsias . Protists also contain chloroplasts. The protists are intermediate between all three groups and have been notoriously difficult to classify, being placed into a fourth Kingdom, the Protozoa, although this grouping has been contested. The current Cavalier-Smith system was proposed in 2004 and classifies life into 6 Kingdoms . Chloroplasts are thought to have evolved from a single endosymbiotic event in Archaeplastida, although there are evidence to suggest some secondary endosymbiotic events. Check out this paper for more information; figure 1 shows the relationships between the different groups and the endosymbiotic events. The Opisthokonts are the origin of the Fungi and Animalia kingdoms.
{ "source": [ "https://biology.stackexchange.com/questions/2157", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/408/" ] }
2,250
One of my friends said that I would die if I drank distilled water (we were using it in a chemistry experiment) I gave it a go and surprisingly did not die. I did a bit of Googling and found this It said that drinking only this kind of water could definitely cause death, as distilled water was highly hypotonic and it would make the blood cells expand and finally explode and ultimately cause death. I wanted to know exactly how much of this water on an average was needed to be consumed to cause death.
I'm extremely skeptical of @leonardo's answer. I suspect that what would happen if you drank only distilled water is nothing perceptible. The only place where concentrations of distilled water would ever be high enough to conceivably matter is in the tissues of the mouth and throat, and even there, the effect would be temporary. Compare drinking 8 glasses of either distilled or tap water every day. With tap water , you're looking at less than 200 ppm of Mg, Na, K, and Ca combined. That's less than 400mg of total mineral content per day. Given that the combined RDA of all of those minerals is on the order of 7g for an adult male , this is not nothing , but it's certainly small. Your dietary intake of these minerals probably varies by more than this daily, and your intestines, kidneys, sweat glands and mineral storage organs (like your bones and muscles) are constantly maintaining the mineral blood levels within a very narrow range, despite handling a throughput of several pounds of water and food daily. They might have to work slightly harder to manage this range if you drank nothing but distilled water, but in a healthy adult, normal intakes already vary by more than this amount without major problems. For example, the average American consumes more than 3.4 grams of sodium daily , while a low-sodium diet is on the order of 2g . Low-sodium diets have been widely studied in the medical literature, and are considered safe. As for pH, the lowered pH is caused by increased carbon-dioxide absorption to form carbonic acid. Just as carbon dioxide is more soluble in distilled water, it is less soluble in stomach acid, and may be burped out. Would you die of acidosis from drinking seltzer water all the time? If that were the case, I'm sure there would be big health warnings about drinking soda, while it seems relatively benign . Furthermore, your body produces and excretes (through the lungs) around 1kg of CO2 daily , dwarfing any extra CO2 you might get by drinking distilled water. If the small amounts of CO2 found in distilled water were dangerous, jogging would be invariably fatal. If you were to drink nothing but distilled water, and eat no food, you probably would die of hyponatremia within a few weeks. But you would also die of hyponatremia if you were to drink nothing but tap water, though perhaps slightly more slowly.
{ "source": [ "https://biology.stackexchange.com/questions/2250", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/872/" ] }
2,398
I remember hearing that trees and other plants actually obtain a large amount of their mass from the carbon floating in the air, not the ground beneath them. Does the makeup of air actually contain enough carbon to support this theory, and is a tree's surface area actually large enough to obtain the amount of carbon it needs directly from the air?
The vast majority of a tree's carbon comes from the air, which averages 0.03-0.04% by volume (300-400 ppmv) CO 2 . This is fixed through photosynthesis and eventually stored as glucose which the plant can then use for its metabolism. Doing some quick math, this means that in order to produce 1 kilogram of carbohydrates (e.g. cellulose) a plant needs to process on the order of 2000-3000 cubic meters of air (and ≈550 g or mL of H 2 O), which would fill a cube measuring 13-14 meters on a side. Note this is an ideal figure; a plant's fixing efficiency will likely fall as it depletes the air of CO 2 . Plants do take a great deal from the ground, namely water, fixed nitrogen (for proteins), phosphorous (for nucleic acids), and several ions (sodium, potassium, calcium, among others)
{ "source": [ "https://biology.stackexchange.com/questions/2398", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/926/" ] }
2,498
A few friends of mine told me that salt provides zero nutritional value to us, and in fact can harm our bodies. Now, these guys are medical students, and being an engineering student myself, I decided not to argue with them. The rest of this question assumes that this fact is true, so if it's not, you can just go ahead and call me out now... So here's my understanding of things: we 'like' doing things because of our instincts, which have slowly become refined over millions of years. For example, I 'like' eating foods with fat in it because my instinct compels me to do so. Fat is 'good' for my body, since it provides a lot of energy (obesity problems aside). So are there certain things, such as eating salt, that are not in fact beneficial in any way, and we only do these things because we were trained to as children? This is the only thing I could come up with, but it's not a very satisfying explanation for a few reasons. First, I think humans have been eating salt for a long time. This would mean that most likely, it is actually our 'instinct' to eat salt. Also, salt is eaten in every culture today, which has the same implication. So is there some better explanation?
In developed countries we usually consume enough salt (sodium to be exact) without actually adding table salt to food. Everything can become toxic when consumed in excess - even water - and when we frequently add more salt to foods, we tend to consume sodium in potentially harmful excess. That's what your friends are referring to. However, salt (sodium) is one of the most essential substances your body needs to stay alive, for several reasons. One of the main purposes of sodium is the upkeep of blood's osmolarity (i.e. concentrations of osmotically active compounds. Higher salt concentration on one side of a permeable membrane attracts water to that side - I'm sure you've heard that before). There are numerous systems in your body to make sure the osmolarity of blood is correct. If they fail and blood becomes hypo or hypertonic, your cells will be sucked dry or pumped full of water and in either case, burst and die. Look up the renin-angiotensin-aldosterone system for example: when the kidney filters blood, it reabsorbs or lets through water depending on the current blood osmolarity; leading to higher or lower amount of higher or lower concentrated urine. You drink lots, your blood is diluted, it becomes less tonic, kidney registers that and lets water through more, you urinate more. There are many more elements involved there, including blood pressure, nerve signals stimulating thirst or hunger of different kinds, some hormones etc. As you can see, there's a reason why the basic infusion given in hospitals to replace lost blood quickly isn't just water but normal saline. Delayed update to pick up some side aspects of your description: 1) There are of course things that humans do which have absolutely no value to them whatsoever. Anything that plays into the feel-good-reward-circuit in our brain can become such an unhelpful habit. Take smoking and drug consumption as examples. 2) About evolutionary relevance: Being a key player in maintaining body function, evolution selected for instictively liking salt. Simultaneously, most people will not like food that is extremely salty - a protective mechanism against excess.
{ "source": [ "https://biology.stackexchange.com/questions/2498", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/970/" ] }
2,527
Hydroxyapatite is the main component of tooth enamel. It contains phosphorus in the form of phosphates, pyrophosphates etc. that are found to exhibit the the property of phosphorescence. But why don't the teeth glow in the dark ?
Just to add a little more on the interface between optics and dentistry: Whilst teeth do not phosphoresce, they do in fact autofluoresce. The differential auto fluorescence of healthy tooth and carious tooth has been used for the early diagnosis of caries. ( Gugnani N, Pandit IK, Srivastava N, Gupta M, Gugnani S. Light induced fluorescence evaluation: A novel concept for caries diagnosis and excavation. J Conserv Dent 2011;14:418-22 and http://www.opticsinfobase.org/boe/abstract.cfm?uri=boe-2-1-149 ) To see teeth glow, or rather, fluoresce, they should be illuminated with short wavelength light, like blue light (wavelength 450 nm) and the teeth will glow green, which will be visible if the the blue light is filtered out. Also see http://www.inspektor.nl/dental/qlfmain.htm#QLF%99%20Basic%20Principle
{ "source": [ "https://biology.stackexchange.com/questions/2527", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/947/" ] }
2,705
Imagine that we take a population of horses, split them in half and place them in completely different environments. The two species will evolve separate from each other and because the environment is different, the outcome of evolution will be different. But at what point can you say that these horses have evolved into two different species? (I do know that they would probably go extinct if we conducted this exact experiment, but this experiment is just to give an example)
I think LuketheDuke's answer is an oversimplification of the biological species concept (possibly resulting from the dictionary having a poor definition). The definition he gives is one of many which are in current use, and is made redundant by many types of organism. It is important to recognise that because reproduction is not the same process in all organisms, genetic differentiation between individuals occurs in different ways for different groups. Let's take the definition given in LuketheDuke's answer... The major subdivision of a genus or subgenus, regarded as the basic category of biological classification, composed of related individuals that resemble one another, are able to breed among themselves, but are not able to breed with members of another species. Under this definition, lions and tigers (see ligers and tiglons , which are sterile hybrids between the two) would be considered one species, as would donkeys and horses (see mules and hinnys , again sterile hybrids). There are hundreds of other examples of pairs of animal species which can hybridise to produce sterile offspring. However, these animal hybrids usually only take place with human intervention, by delibrate breeding efforts. Thus we could extend the previous definition to include them... The major subdivision of a genus or subgenus, regarded as the basic category of biological classification, composed of related individuals that resemble one another, are able to breed among themselves, but do not breed freely with members of another species in the wild . That last part takes care of the ligers and tiglons. But what if we consider plants? Under the definition I just gave, most grasses (around 11,000 species) would have to be considered as one species. In the wild, most grasses will freely pollinate related species and produce hybrid seed, which germinates. You might then think we could just modify the definition to specify that the offspring must be fertile (i.e. able to reproduce with one another)... The major subdivision of a genus or subgenus, regarded as the basic category of biological classification, composed of related individuals that resemble one another, are able to breed among themselves, but do not breed freely with members of another species in the wild to produce fertile progeny . Unfortunately, the situation is still more complicated (we've barely started!). Often wild hybridisation events between plants lead to healthy, fertile offspring. In fact common wheat ( Triticum aestivum ) is a natural hybrid between three related species of grass. The offspring are able to breed freely with one another. Perhaps we could account for this by taking into account whether the populations usually interbreed, and whether they form distinct populations... The major subdivision of a genus or subgenus, regarded as the basic category of biological classification, composed of populations or meta-populations of related individuals that resemble one another, are able to breed among themselves, but do tend not to breed freely with members of another species in the wild to produce fertile progeny . This accounts for the grasses, but it still leaves a messy area when you have a hybridisation which establishes - until the hybrid population is segregated away from the parent populations it is unclear whether they still count as the same species. We could probably live with this situation, except for the fact that bacteria refuse to conform to it at all. Bacteria of the same species, or even very different species, can freely transfer genes from one to the other in conjugation , which combined with fission can result in perfectly replicable hybrids. This is such a common occurence that it breaks even the 'tend to' part of the previous definition, and members of a population can be doing this almost constantly, which negates the segregation requirement. Richard Dawkins had a go at defining around this, by stating that... two organisms are conspecific if and only if they have the same number of chromosomes and, for each chromosome, both organisms have the same number of nucleotides This partly gets around the bacterial problem and means that bacteria which result from conjugation are a new species. Unfortunately under this definition we might as well not ever bother trying to classify bacteria as billions of new species would be created every day - something which the medical profession might have something to say about. This definition would also mean that those with genetic diseases like trisomy 21 are not human. The final nail in the coffin of this attempt is that there are many species, including frogs and plants, which are very certainly considered a single species by taxonomists but which have some variety in the presence of small accessory chromosomes, which occur in different combinations between individuals. Let's consider one last option. We now live in the era of genomics where data about genomes of thousands of organisms is accumulating rapidly. We could try to use that data to build a species definition based upon similarity at the nucleotide level. This is often used for bacteria, by considering organisms with less than 97% nucleotide similarity to be different species. The major point I've been trying to make, though, is that species is not a natural concept. Humans need to be able to classify organisms in order to be able to structure our knowledge about them and make it accessible to people trying to link ideas together. But the natural world doesn't care about our definitions. Ultimately the species concept is different for different groups of organisms and will continue to change over time as our analytical methods and the requirements of our knowledge change. Note that I've deliberately skipped over many historical species concept ideas. The direct answer to your horse question is "it depends how you want to define a horse".
{ "source": [ "https://biology.stackexchange.com/questions/2705", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/611/" ] }
2,738
Why, from the natural selection point of view, do only two sexes exist for animals?
To get a non-circular answer to why humans and other mammals have only two sexes, it's helpful to take a look at our evolutionary history. While mammals possess several adaptations to a terrestrial life cycle, including internal fertilization and gestation, which require substantial anatomic specialization between males and females, these are all secondary features that evolved long after our aquatic ancestors had acquired two distinct sexes. Indeed, if we look at animals like fish, which reproduce via external fertilization, it's not at all obvious why they might not have more than two sexes. After all, for many aquatic animals, mating involves little more than the female and the male releasing their respective gametes into the water, where they meet and fuse to a form new zygote, which can then divide and grow into a new adult. Seen that way, there seems to be no reason why there could not be more than two "mating types", as in many fungi, such that gametes of any two distinct types could fuse into zygote. The answer lies in the fact that the male and female gametes aren't actually that similar: the female gametes, or eggs, are typically large cells that contain all the nutrients necessary for the new zygote to develop into a viable individual, whereas the male gametes, or sperm, are tiny and produced in huge numbers. This asymmetry is known as anisogamy , and modeling its origin has been an important topic in the theoretical study of evolution. Without going into details on the evolution of anisogamy, once it exists, it clearly forces the mating types to also split into two groups: there's no advantage in two microgametes (sperm) fusing, since the resulting zygote would lack the nutrients it needs to be viable, whereas the fusion of two macrogametes (eggs) would simply be inefficient — eggs, being large, are comparatively rare and expensive, and wasting two of them to produce only one offspring would be suboptimal even if the resulting zygote was viable. Nor is there really room in such a scheme for gametes of intermediate size: they'd be too small to fuse into a viable zygote with sperm, but too large to be produced in sufficient amounts to be effective in fertilizing eggs. Of course, there's nothing that would stop a single adult from producing both micro- and macrogametes, but such an adult would not really be a third sex — it would just be male and female at the same time, a mating strategy known as (simultaneous) hermaphroditism, which indeed occurs relatively often in nature. So, if pretty much all animals are anisogamous, why do fungi remain isogamous (and often have multiple mating types), then? Well, one explanation is that the main drivers for the evolution of anisogamy — sperm competition and transportation risk — don't really apply to fungi, which mate when two sessile haploid mycelia grow and come into contact with each other. Since the gametes are not motile, there's no advantage for either/any sex to produce more of them (at the cost of smaller size) in order to increase the chance of successful mating. Thus, isogamous mating works fine for the lifestyle of fungi, and having multiple mating types is then a useful adaptation to make successful mating between neighboring mycelia more likely.
{ "source": [ "https://biology.stackexchange.com/questions/2738", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1061/" ] }
2,875
A friend of mine told me once about a documentary movie he saw some years ago. On this movie he saw scientists talking about particular experiment. This experiment involved rats and probably electrical traps. The rat had to get to the cheese, there were traps on the shortest route to it, and obviously it got shocked few times. What is interesting is that my friend says that when they took its offspring (probably born later) they avoided those traps. I'm aware that its not how "genetic memory" works. Its not memory of individual, but of species (so it requires evolution). This is what I'm trying to explain to him, but he says "he knows what he saw". Anyway maybe someone here is aware of such an experiment . I believe that he is wrong about something (or conclusions drawn where changed later), so I would like to find out more about it. To sum up: Its not Tryon's Rat Experiment It involved: rats, traps (probably electrical), more then one path to cheese, rat's offspring and some sort of memory/learning amongst rats.
The phenomenon you're talking about was a fad in the 60's, called 'interanimal memory transfer'. It started out when James McConnell performed a later-discredited experiment in which he found that if you chopped up flatworms which had been exposed to some stresses, and fed them to other unexposed flatworms, the unexposed worms became wary of the source of stress quicker after eating their dead companions. He jumped to the conclusion that a 'memory molecule' was being transferred, and that the cannibal worms gained the food worms' memories of the stress. People then started looking to see if they could: repeat the experiments find the same phenomenon in other animals In the first case, nobody could replicate the experiments in worms, but because McConnell was such a PR genius he managed to convince the public that his results were valid (see Rilling, 1996 for more on this). In the second case, Frank et al. (1970) and others tried working with rats - I think this is the experiment you're talking about in the question. They found various interesting results including that if you trained rats to run through a maze by using particularly stressful negative reinforcement (like electrocution), then those rats' children would be able to learn the new maze much faster. However, Frank et al. didn't make the same mistake as McConnell - first of all they wondered if the parent rats might be leaving a scent trail. So they used duplicate mazes with the exact same design, putting the children into clean mazes. The children of adults who had already learned the maze continued to outperform the control rats - the explanation was not scent trails. Next they wondered whether it might be that the second generation rats had been born with a higher wariness as a result of the stress their parents suffered; i.e. it could be a hormonal transfer from mother to child (e.g. cortisol, the stress hormone). Frank et al. tested their hypothesis by torturing some rats for a while (rules about animal welfare were not strict in the 70's). They would lock some rats in a small jar and bash them about for a long time, then kill them, chop them up, and take out their livers. They fed the livers to other rats, and found that after eating the livers the other rats learned the maze much faster. They interpreted the results in what now seems a sensible light: the stressed rats were producing high concentrations of a stress-signalling molecule. When those rats either had children or were fed to other rats, they passed on high doses of the stress molecule. This raised the alterness and wariness of the receipient rats so that they were much quicker to learn which parts of the maze were dangerous. There is no evidence that the child rats actually 'remembered' the maze - they still had to find their way around, but they were extremely wary of the electrocution plates and so avoided them, finding the safest way to the end. This is not a case of genetic memory . Frank B, Stein DG, Rosen J . 1970. Interanimal “Memory” Transfer: Results from Brain and Liver Homogenates. Science 169: 399–402. Rilling M . 1996. The mystery of the vanished citations: James McConnell’s forgotten 1960s quest for planarian learning, a biochemical engram, and celebrity. American Psychologist 51: 589–598.
{ "source": [ "https://biology.stackexchange.com/questions/2875", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1126/" ] }
3,097
For some species the Darwin's theory evolution makes perfect sense. I can easily imagine how, for example, the giraffe has evolved to its current appearance: the natural selection was favoring individuals that could consume more vegetable food from trees using longer necks, and some individuals were getting at birth necks longer than average by pure genetic randomness and the long neck trait was being propagated to descendant individuals by means of genetic inheritance. I have no problem with understanding this kind of evolution. Now let's have a look at the bat and its relatives. The bat is one of the few mammals that have something to do with flying and the only one that took flying to the bird level. Paleontologically, first mammals date to the dinosaur era and initially looked similar to the present-day shrew (which looks much like a mouse). The question is: how in the world prehistoric mouse-like creatures could grow wings over time? It impossible to believe that some mouse-like individuals were getting wing-like limbs by mutation and the "wings" were growing out accompanied with the knowledge of how the "wings" can actually be used. Ok, then maybe first wings were tiny moth-size wings and then grew larger? But where natural selection would come into play in this case? Such mouse-like individuals would have no advantage over their wingless relatives and thus would not be able to transfer those wing-growing genes to their descendants, quite the contrary, such individuals with useless mutations that interfere with their ability to walk would be suppressed by natural selection and therefore "weeded out". So what is the story behind the bat's wings and is the Darwin's theory really able to support it?
Take a look at this little fellow: It's a flying squirrel — a shy little nocturnal rodent which lives in trees and, despite its name, does not actually fly. It does, however, have a skin membrane called a patagium between its fore and hind limbs which allows it to glide from tree to tree and thus evade ground predators. It's not hard to see how the flying squirrel's patagium may have evolved: after all, ordinary squirrels, to which the flying squirrel is indeed related, also spend most of their time in trees and avoid the ground, often performing quite impressive leaps to cross from one tree to another. With sufficient pressure to minimize time spent on the ground, any little morphological changes that allowed longer leaps would be favored by natural selection. Indeed, there are plenty of other groups of mammals which have independently evolved very similar adaptations to gliding . Given how many small arboreal mammals there are, this is perhaps not surprising. What's special about bats is not the fact that they possess flight membranes — it's that they're the only group of mammals, so far, to have taken the next step to actual powered flight.
{ "source": [ "https://biology.stackexchange.com/questions/3097", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1200/" ] }
3,177
We use electromagnetic communication everywhere these days. Cell phones, wifi, old-school radio transmissions, television, deep space communication, etc. I'm curious about some of the possible reasons we have never seen biological systems having evolved to use electromagnetic, i.e. radio, for communication. The one obvious exception to this are organisms that generate their own light, i.e. bioluminescence. Cuttlefish are masters of this, and many other species as well. It seems like bio-radio could have offered all kinds of evolutionary advantages for animals capable of using it. Are their basic physical limits in chemistry, or excess energy requirements or something that would basically have made this impossible? Or was this perhaps just something that life never evolved to use, but would otherwise be possible in evolution?
There is a very different mechanism for generation (and detection) of ultraviolet, visible and infrared light vs radio waves. For the first, it is possible to generate it using chemical reactions (that is, chemiluminescence , bioluminescence ) with a typical energy of order of 2 eV ( electronovolts ). Also, it is easy to detect with similar means - coupling to a bond (e.g. using opsins ). For much longer electromagnetic waves, and much lower energies per photon , such mechanism does not work. There are two reasons: typical energy levels for molecules (but it can be worked around), thermal noise has energies (0.025 eV) which are higher than radio wave photon energies (<0.001 eV) (it rules out both controlled creation and detection using molecules). In other words - radiation which is less energetic than thermal radiation (far infrared) is not suitable for communication using molecular mechanisms, as thermal noise jams transmission (making the sender firing at random and making the receiver being blind by noise way stronger than the signal). However, one can both transmit, and detect it, using wires. In principle it is possible; however, without good conductors (like metals, not - salt solutions) it is not an easy task (not impossible though).
{ "source": [ "https://biology.stackexchange.com/questions/3177", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1253/" ] }
3,192
Are "computational biology" and "bioinformatics" simply different terms for the same thing or is there a real difference?
I found this post by Russ Altman quite good. Below is his opinion about the two similar but distinct fields: Computational biology : the study of biology using computational techniques. The goal is to learn new biology, knowledge about living sytems. It is about science. Bioinformatics : the creation of tools (algorithms, databases) that solve problems. The goal is to build useful tools that work on biological data. It is about engineering. Just as a note: This is just one persons opinion and I have heard many other definitions for both of these terms. For example, one person I know mentioned that he believes computational biology is concerned with very theoretical research such as NP-hardness (ie. articles published in the Journal of Computational Biology). Other people think that bioinformatics is an applied field that is essentially using already published tools.
{ "source": [ "https://biology.stackexchange.com/questions/3192", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1176/" ] }
3,304
Layman here. So I have never really quite understood this facet of human evolution, (or any other for that matter), in that, I understand the evolutionary process, but I get lost on the 'border' cases. For example, we, as humans, evolved from monkeys, (to use the colloquial term, I am not a biologist by any measure). My question is, doesn't this mean that at some, discrete point, there had to have been a human, whose parents were not? If that is true, how does that work, in the sense that we now have species1 giving birth to species2. If not, then how exactly does this border case work? The only other alternative I see, is that the borders are 'fuzzy', but then that necessarily means that the definition of a species is itself fuzzy, which I understand is not the case. Thanks!
Actually, your last paragraph is more the case than not. There are currently three common definitions for delineating discrete species: 1) Phenotypically different from related species (looks or acts differently). 2) Produces viable offspring in the wild. 3) Some % of genetic difference. There are strengths to all three: 1) Very easy to ascertain and measure. 2) Most common conception of a species. 3) Genes control the first two, so genetic divergence gets to the heart of the matter. There are also weaknesses to all three: 1) Is notorious for mis-labeling and missing species. 2) Some species which can mate and produce fertile offspring under enclosed conditions do not do so in the wild (Tigers and Lions, for instance). 3) The amount of divergence has, thus far, been completely arbitrary. If there is a certain % or patterns of mutation required in the genome, science hasn't yet discovered it. The fuzzy definition of species, combined in the not-exactly-intuitive generational-type thinking required for understanding evolution, and the answer to your question is (at least to the best of my understanding) the following: Yes, at some point one of our ancestors gave birth to the first Homo sapien that was somehow genetically different from its parents. However, the magnitude of the difference is probably not as great as you might think. We've already observed our closest evolutionary cousins, the Bonobos, making basic tools through flint napping: http://www.newscientist.com/article/dn22197-bonobo-genius-makes-stone-tools-like-early-humans-did.html It's also possible that disputes between male chimpanzees are mediated by an older female: http://www.cpradr.org/Resources/ALLCPRArticles/tabid/265/ID/121/Primates-and-Me-Web.aspx And that both Chimpanzees and Capuchin monkeys can be taught the concept of currency (which, somewhat comedically, they then used for prostitution): http://www.nytimes.com/2005/06/05/magazine/05FREAK.html?ei=5090&en=af2d9755a2c32ba8&ex=1275624000&partner=rssuserland&emc=rss&adxnnlx=1118160068-1EGJuan4FJH1LooxHYd5/g&pagewanted=all Then there's the everlasting impact of Koko, the Silverback Gorilla who was taught - and perfectly capable of replying in - sign language: http://en.wikipedia.org/wiki/Koko_%28gorilla%29 The idea that humans jumped onto the scene with unforeseen amounts of intelligence and capability probably isn't what happened. Obviously we are capable of constructing and using the most advanced tools on the planet, but this is after several thousand generations of innovation. The very first human might have been more intelligent (or at least had the capacity to be), but otherwise probably fit in pretty well with its parents and other relatives since the vast majority of what we learn comes from our parents and personal experience. Then over time the number of individuals with the capacity for higher modes of thinking increased as a result of the genetic inheritance of whatever mutation created the first human. The first human, to put it simply, was successfully able to pass on their mutation which gave them our unique traits, and their offspring were also successful - until you have an entire population of humans living amongst each other. Eventually our innovative capacity lead, step by step, to our dominant position on the planet. Even now humans are yet evolving. Lactose tolerance (the ability to consume dairy products after childhood) is a very new trait among humans (and unprecedented among all mammals) only a few hundred generations old (roughly 10,000 years) that evolved twice in separate populations of humans (North Africa and Northern Europe). Our jaws are getting progressively smaller (which is why some people have to remove their wisdom teeth to maintain a straight smile - and some people don't have wisdom teeth at all), some muscles are disappearing (the Palmaris Longus is one example - it's present in about 80% of humans), and other subtle changes are occurring. Just don't make the mistake of equating "evolved" with "superior." Evolution is dictated by the ever-changing demands of the environments we find ourselves in, and what's beneficial today isn't guaranteed to be beneficial forever.
{ "source": [ "https://biology.stackexchange.com/questions/3304", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/816/" ] }
3,737
I've read many years ago in books, that the brain has no nerves on it, and if someone was touching your brain, you couldn't feel a thing. Just two days before now, I had a very bad migraine, due to a cold. It's become better now, but when I had it I felt my head was going to literally split in half, as the pain was literally coming from my brain. So it lead me to the question: How come people can get headaches if the brain has no nerves?
Brain, indeed, cannot feel pain, as it lacks pain receptors (nociceptors). However, what you feel when you have a headache is not your brain hurting -- there are plenty of other areas in your head and neck that do have nociceptors which can perceive pain, and they literally cause the headaches. In especially, many types of headaches are generally thought to have a neurovascular background, and the responsible pain receptors are associated with blood vessels. However, the pathophysiology of migraines and headaches is still poorly understood.
{ "source": [ "https://biology.stackexchange.com/questions/3737", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1470/" ] }
4,962
These three terms are often misused in the literature. Many researchers seem to treat them as synonyms. So, what is the definition of each of these terms and how do they differ from one another?
First, a note on spelling. Both "ortholog" and "orthologue" are correct, one is the American and the other the British spelling. The same is true for homolog and paralog. On to the biology. Homology is the blanket term, both ortho- and paralogs are homologs. So, when in doubt use "homologs". However: Orthologs are homologous genes that are the result of a speciation event . Paralogs are homologous genes that are the result of a duplication event . The following image, adapted (slightly) from [ 1 ], illustrates the differences: Part (a) of the diagram above shows a hypothetical evolutionary history of a gene. The ancestral genome had two copies of this gene (A and B) which were paralogs . At some point, the ancestral species split into two daughter species, each of whose genome contains two copies of the ancestral duplicated gene (A1,A2 and B1,B2). These genes are all homologous to one another but are they paralogs or orthologs? Since the duplication event that created genes A and B occurred before the speciation event that created species 1 and 2, A genes will be paralogs of B genes and 1 genes will be orthologs of 2 genes: A1 and B1 are paralogs A1 and B2 are paralogs . A2 and B1 are paralogs . A2 and B2 are paralogs . A1 and A2 are orthologs . B1 and B2 are orthologs This however, is a very simple case. What happens when a duplication occurs after a speciation event? In part (b) of the above diagram, the ancestral gene was duplicated only in species 2's lineage. Therefore, in (b) : A2 and B2 are orthologs of A1. A2 and B2 are paralogs of each other. A common misconception is that paralogous genes are those homologous genes that are in the same genome while orthologous genes are those that are in different genomes. As you can see in the example above, this is absolutely not true. While it can happen that way, ortho- vs paralogy depends exclusively on the evolutionary history of the genes involved. If you do not know whether a particular homology relationship is the result of a gene duplication or a speciation event, then you cannot know if it is a case of paralogy or orthology. References R.A. Jensen, Orthologs and paralogs - we need to get it right, Genome Biology , 2(8), 2001 Suggested reading: I highly recommend the Jensen article referenced above. I read it when I was first starting to work on comparative genomics and evolution and it is a wonderfully clear and succinct explanation of the terms. Some of the articles referenced therein are also worth a read: Koonin EV: An apology for orthologs - or brave new memes. Genome Biol , 2001, 2 :comment1005.1-1005.2. Petsko GA: Homologuephobia. Genome Biol 2001, 2 :comment1002.1-1002.2. Fitch WM: Distinguishing homologous from analogous proteins. Syst Zool 1970, 19 :99-113. (of historical interest, the terms were first used here) Fitch WM: Homology a personal view on some of the problems. Trends Genet 2000, 16 :227-31.
{ "source": [ "https://biology.stackexchange.com/questions/4962", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1306/" ] }
5,007
I would like to know if evolution is continuing to happen in modern humans, assuming things like existence of the nuclear family structure, fidelity to one partner, etc. It seems to me the answer would be NO because evolution depends on differential reproductive rates, but in the modern world, all male humans have roughly 2.5 (or whatever the number) kids. Add in the process of culturally modified selection pressure, and it seems to me that even an "unfit" male would end up having a couple of offspring. The fittest male (or female) is no better off than his or her contemporaries because of this "leveling" effect. However, the impression I get from the popular science media is that scientists think evolution is continuing to happen. I would like to know what the actual scientific consensus is, and why. Thanks.
It is certainly not true that "all male humans have roughly 2.5 (or whatever the number) kids". First of all, male and female humans have exactly the same reproductive rate. For obvious reasons, every time a male has offspring, a female must have had also. Last I checked neither male nor female humans are capable of parthenogenesis (certain popular religious beliefs notwithstanding). Second, let's assume that the 2.5 number is correct. That would be the average number of children per couple. That does not mean that all couples will have 2.5, or even that most couples will have 2.5. It just means that the average will be 2.5. If, for example you have one couple with 6 children, one with 2 and two with 1, the average will be (6+2+1+1)/(1+1+2)= 2.5. On to the main point. What does selection mean? In its simplest form, that the individual most likely to survive (the famous "fittest") is also most likely to reproduce. This is a very simple concept, the longer you live the higher your chances of managing to have offspring. If you die two weeks after birth it is going to be hard to manage to reproduce yourself. This has not changed. So, what does "fitness" mean? It can mean many things. If you are a warm blooded creature at the beginning of an ice age for example, it could mean being better at regulating your temperature than your peers. If you are a 21st century human, it could mean being funnier on twitter than your peers. The two are not fundamentally different. They can both be selected for or against. As long as one mate is chosen over another, selection is happening and the "fittest" (in each particular context) is most often selected. Add in the process of culturally modified selection pressure, and it seems to me that even an "unfit" male would end up having a couple of offspring. The fittest male (or female) is no better off than his or her contemporaries because of this "leveling" effect. "Culturally modified selection pressure", as you call it, is still selection pressure. Cultural factors can change what it means to be "the fittest" but there is no objective gold standard of "fitness". While it may be true that in modern human society, different characteristics are selected for than was the case with early Homo sapiens , this does not mean that "evolution is not occurring". On the contrary, it is occurring but perhaps it is moving in a new direction. In fact, this is essentially a circular argument. By definition, "fittest" means most likely to survive and reproduce. It does not mean strongest or fastest or prettiest. It just means whoever is better at reproducing. If that happens to be those individuals who are best at square dancing, then it is they who are the fittest. Take the example of a modern human with diabetes. Medicine allows diabetics to lead fully productive and largely normal lives. So, perhaps diabetes is no longer a selective criterion. This does not mean that the diabetic cannot be selected for or against based on their fitness on other scales. Whatever the selective pressure, whatever it may be that defines a "good mate", if selection is present then so is evolution. The only way to remove a species from the process of selection would be to have all (or none) individuals of each and every generation reproducing at the same rate. This is clearly not the case with humans. Surely not everyone around you has, or will have, children? There you go, selection! UPDATE: In answer to your comment, yes indeed, in order for a selective pressure to make itself felt and affect phenotype (at the species level), it needs to be constant across several generations. However, even the absence of selective pressure affects evolution. As others have mentioned below, active selection is not the only mechanism of evolution. Your main question however seems to be the following: If modern society (medicine etc) allows individuals that would not survive in the wild to reproduce, how does that affect evolution? The main points in my answer, and all others here, are: Even if we accept that modern humans have removed themselves from the purely "biological fitness"-based selection pressure (an assumption I am not at all sure is true), and assuming that this removal is constant enough over many generations (again unclear), even if all this is true, evolution is most certainly still occurring. It may even be faster since genotypes that would not survive in the wild persist in the gene pool, thereby increasing its diversity. As you point out in your comment below, for such social pressure to make itself felt, it needs to be constant across many generations. We are probably not there yet. Most importantly, as I said above, there is no such thing as an absolute biological fitness . When the ecosystem changes, so does the definition of fitness. Modern humanity's ecosystem, our habitat, is intimately connected with our culture and society. If an individual is better at reproducing in that context, then that individual is more fit.
{ "source": [ "https://biology.stackexchange.com/questions/5007", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/625/" ] }
5,148
If a hermaphrodite animal (like slug, snail, etc) finds a partner they can mate immediately. If another animal with "normal" reproduction (lets say a mouse) finds a partner they can only mate if they are opposite genders. So it seems logical that the hermaphrodite way of reproduction is more successful than the "normal" way. But it is not, as far as I know all higher developed species are using, the standard way of reproduction (male and female). Why? What are the disadvantages of hermaphroditism?
Firstly I'll clarify that you are talking about simultaneous hermaphrodites rather than sequential hermaphrodites (1st one sex, then the other e.g. the limpet Patella vulgata). It is perhaps easiest to address the question by countering it and asking why dioecy (2 sex systems/2 gonochoric types e.g. male and female) is better? As you have pointed out there are obvious advantages to being a hermaphroditic species such as more chance of mating - more likely to provide an advantage at very low population densities where interactions are infrequent. There are two key disadvantages of hermaphroditism which I will briefly cover but have been discussed in this paper and probably other costs. The first is energy costs. Maintaining the capacity to produce male and female gametes will be more costly than maintaining one. This gives the hermaphrodite a fitness disadvantage because energy is rarely an infinite resource. Therefore at higher population densities, when mating opportunities are not rare, the gonochoric individuals will have a higher fitness because they have more energy. Monogamy is also analogous to rare encounters but true monogamy is rare (1 partner for life). The second disadvantage of hermaphroditism is self fertilisation. This will cause an increase in homozygosity and lead to inbreeding depression (reduced fitness). So you are right to some extent... the hermaphrodite way of reproduction is more successful than the "normal" way. ...but the conditions which give rise to an hermaphroditic advantage are restricting. Overall, the above costs, combined with the obvious complexity of evolving the ability to produce male and female gametes, the ability to both fertilise and be fertilised, pregnancy and birth, and mating systems, mean that it is often more beneficial to be a dioecious species. Thus dioecy evolves. EDIT: Question Raised by @Single_Digit I have been pondering this question for a while and I get what RG255 is saying. I'm just not sure I entirely buy it. Take earthworms, for example. They are simultaneous true hermaphrodites (as far as I understand). The anatomy doesn't have to be that complex*. They simply have two genital openings (one for eggs and one for sperm) and they line up in a "69" (excuse the vulgarity) position. This should, in theory, minimize the inbreeding depression. However, it doesn't eliminate the maintenance of two sets of reproductive systems. But most organisms are not internally fertilized mammals with wildly complicated systems of internalized embryonic care. Most species lay a pile of eggs that a male squirts sperm on or squirt eggs while the male squirt sperm and then they hope for the best. I would think the advantages of simultaneous parenting (after all, many MANY species' males don't provide much in the way of child care) and its fitness advantage would vastly outweigh the burden of a second set of reproductive organs. With that said, I don't have a better explanation, but I find the question a very interesting one. The linked article is pay-walled, aside from the abstract, but I still disagree with some of its tenets. To me true hermaphroditism should be very common (I realize it isn't) in species that don't need two parents to raise offspring, but do benefit from some (as in one parent's) parental care. I recognize that it would do little to help species that merely dump gametes and leave because specialization of one reproductive system would likely do the job better and both genders equally contribute under that type of system. So, RG255 convince me! Clearly there are good reasons, since gender (or asexual repr) is the norm, but I need more/better evidence. Yes I realize they would need separate internal anatomies for each type of gamete, but still... My response: You have presented one example of hermaphroditism and used that as evidence that all species should be hermaphrodites. Earthworms are small slow creatures living in soil, I don't imagine they have high rates of encounter, and therefore low rates of encountering the opposite sex, therefore hermaphroditism would be favoured as discussed above. Further, you say most species are external fertilisers (do you have a reference for this?) and therefore it is not costly be a hermaphrodite. I don't see your logic there, the cost is not necessarily to do with the cost of bearing child, producing & maintaining the gonads and gametes is also a costly process. I would argue that this is extremely complex. This is not just on a morphological level but also physiological: in non-hermaphroditic species the sexes have very different, and often, conflicting gene expression and hormone production patterns. Hermaphrodites would not be able to optimize to the fulfilling both the male and female roles. Finally, you pointed out that the worms do not inbreed. Inbreeding avoidance does not have to be the cause of the hermaphroditism persisting, if the environment/other factors favour hermaphroditism. I never said that both were simultaneously necessary. I hope this clarifies it for you, if not please expand as to why, I am on here because I want to help people understand biology properly! Further response from @single_digit: Well fair enough about my external fertilizers comment. I don't have a reference, but I was thinking all multicellular life and I'd have to imagine that when you factor in plants, that external fertilization is relatively the norm (as is hermaphrodism (dioecy) for the plants). As to earthworms, I disagree about your description of them. Their densities are actually pretty high, so I'd wager they encounter each other frequently, so I'm not sure where that leaves them in terms of pressures for hermaphroditism. Your point on the physiologic/hormonal issues of maintaining the systems is one I haven't previously considered. I honestly don't have any clue as to how daunting (or simple) that is, but I'd imagine that the sophistication of the systems would play a pretty key role. Makes me wonder how much this has been researched in true hermaprhodites. I suppose the main thing I keep coming back to is the overwhelming disadvantage gender has in terms of potential to create offspring. Males in many (most?) species essentially act as little more than sperm donors, thus half the individuals have effectively zero fitness. That just seems like an overwhelming advantage for hermaphrodites. My Response Why do you consider half of the individuals to have zero fitness? Fitness is widely accepted as the number of offspring a parent produces because this is directly related to number of copies of their genes passed to the next generation. Sperm donor type males achieve increased fitness by mating as do females - with out the male they would never be fertilized. The key disadvantage of dioecy is the halved (assuming equal sex ratio) frequency of potential encounters that could lead to mating. The general disadvantages of hermaphroditism are inbreeding depression and high cost & complexity. Single_digit: Zero fitness isn't exactly correct, but if we look at parental care as conveying a survival advantage for K selected species, and huge numbers of offspring conveying an advantage for r-selected species (obviously the type of env affects this) does a deadbeat dad really optimize for either of these? Passing on genes is fine, but if offspring survival is low, does it matter? Does it simply boil down to the maintenance of two repr systems plus decreased fitness from inbreeding vs the increased reproductive success from extra child care? Or is there more? My response: r/K selection theory has generally been disregarded in the evolutionary biology community due to the substantial evidence against it so it is unhelpful to think of selection in this way. As long as the 2 sexes strategy is more successful at passing on genes than a hermaphroditic strategy it will (should) prevail. Dioecy will be more successful if the hermaphroditism introduces to much cost through production and maintenance of sexual organs/gamete and inbreeding whilst not attaining substantial gains from higher potential mating frequency. @Single_Digit Interesting about r/K selection. I hadn't heard that. Do you have any links? I'd be curious to learn more there. I incorrectly earlier made a comment about dioecy where I meant monecy. But this seems to beg the question, why is monecy/hermaphroditism so much more prevalent in plants? Obviously there are different survival pressures, but I'd think the same basic principles would apply as in animals, but the condition seems to be far more common than in animals. My Response I seem to remeber there being a reason in plants, don't have time to look it up right now. The work about r/K selection was Reznick/Stearns/Charlesworth. Reznicks is the most recent and more overview type paper - best place to start: http://www2.hawaii.edu/~taylor/z652/Reznicketal.pdf
{ "source": [ "https://biology.stackexchange.com/questions/5148", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/883/" ] }
5,416
When a human being exhales CO₂, what is, by the numbers, the main source of carbon atoms exiting the body in this way? I mean what class of cells, or which tissues are the biggest on a pie chart of where carbon atoms breathed out in the form of CO₂ molecules came from?
CO 2 is a product of Cellular Respiration , which generally takes Glucose and molecular Oxygen to produce Carbon Dioxide, water, heat, and allows ADP to be regenerated into ATP (or other various oxidation reactions). The Carbon comes from wherever the acetyl-CoA used in the Citric Acid Cycle came from - either carboyhydrates or fatty-acids (saturated carbon chains). Simplified reaction: C 6 H 12 O 6 (s) + 6 O 2 (g) → 6 CO 2 (g) + 6 H 2 O (l) + heat So, you are correct. CO 2 transferring out of the lungs is mostly the result of burning sugars (or fats) for energy (the regeneration of ADP/GDP with respect to human biology). To that end, the tissues that produce the most CO 2 will be the cell-types which constantly require energy. Nominally, muscle tissues . Per your comment, broken down fat, or rather, the process of Fatty-Acid Catabolism , results in the production of acetyl-CoA , which is a primary player in the Citric-Acid Cycle . The Citric Acid Cycle, which you should recognize as the Cycle that Pyruvate - the end result of Glycolysis (the breakdown of Glucose into 2x 3-Carbon Pyruvates) - also goes into after being converted into acetyl-CoA by Pyruvate Dehydrogenase. The sum of all reactions in the citric acid cycle is: Acetyl-CoA + 3 NAD + + Q + GDP + Pi + 2 H 2 O → CoA-SH + 3 NADH + 3 H + + QH 2 + GTP + 2 CO 2 So, for a basic breakdown with respect to CO2: Carbohydrates (Sugars, Starches) → Glucose → Pyruvate + ATP + NADH Pyruvate → Acetyl-CoA Lipids (fats) → Lipolysis → Acetyl-CoA Acetyl-CoA + ... + H 2 0 → ... + CO 2
{ "source": [ "https://biology.stackexchange.com/questions/5416", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/263/" ] }
5,524
Imagine humans were to colonize a distant planet and it was a single one-way trip. How many people would they need to bring? Obviously 2 is the minimum, but that would result in a lot of inbreeding. So what number is the minimum number of people you can have in an isolated community and still maintain a healthy diversity?
Actually it is a very important question for laboratory animals (and, I imagine, endangered species) and was calculated to be 25 couples. With any number of animals (including humans), there is always some inbreeding happening, but you can reduce it with the number of breeding pairs and careful pairing. When you get to 25 pairs (50 animals) and have complete control over pairing, you can sustain the genetic diversity practically infinitely (especially if you take into account spontaneous mutations). Of course, such control over who can have children with who (plus whether one is at all allowed to procreate and what will be the sex of their children!) would be questionable morally, so in case of populating a distant planet, we would need a larger group, to provide for sexual preferences, fertility problems etc. Some information on laboratory outbred stocks.
{ "source": [ "https://biology.stackexchange.com/questions/5524", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1480/" ] }
5,588
Mammals, reptiles, arachnids, insects, etc are all as far as I am aware symmetrical in appearance. Take a human for instance, make a line from the top of our head right down the middle. However, internally it is not the same. Our organs excluding the kidneys, lungs, reproductive organs, etc are not symmetrically placed in our body. Why do we not have an even number of each organ so it can be placed symmetrically? If we have a single organ why is it not placed in the middle like the brain or bladder is for instance? Is there some evolutionary advantage that led to this setup?
First, I think it worthwhile considering 'Why would internal symmetry be beneficial?' Developmental simplicity jumps to mind immediately. You can also consider relationship to external organs; the stomach and esophagus are lined up with the mouth which is symmetrical about the sagittal plane. Or maybe even balance; the lungs are large organs and if put to one side would likely cause locomotive issues. (Perhaps this is even an interesting topic for another question.) That said, I feel, at it's core the evolutionary advantage which led to the lack of ubiquitous internal symmetry is space . Simply put, there is only so much room inside an organism and every little counts. Thus, if there isn't a need for a particular organ to be mirrored about a plane then there is a benefit in putting elsewhere: utilization of space. I think a fantastic example of this is the human digestive tract. The key factor in the shape of the intestines is utilization of space, which directly affects the point at which is connects to the stomach, itself contributing to the asymmetrical shape of the stomach. One could envision other configurations, sure, and nature has. However, this configuration works quite well and the extraordinary use of limited space seems to outweigh all benefits of symmetry. To directly respond to your questions above: Question: Why do we not have an even number of each organ so it can be placed symmetrically? Response: Each organ addresses (or addressed) a need of the organism. Addressing that need with multiple organs working in concert has benefits and consequences, as does addressing the need with a single organ alone. These benefits and consequences are balanced throughout the evolution of an organism. Question: If we have a single organ why is it not placed in the middle like the brain or bladder is for instance? Response: I feel space. Again, there are benefits to symmetry but there are many other factors at play. Some of which, it seems, are more important than symmetry at times. Question: Is there some evolutionary advantage that led to this setup? Response: I hope this has been addressed - I don't claim to have 'answered' anything, this is a question for discussion. Other fuel for discussion: In thinking through this question I found myself able to rationalize why internal symmetry isn't necessary. However, I'd be interested in seeing opinions on why, then, external symmetry is so prevalent.
{ "source": [ "https://biology.stackexchange.com/questions/5588", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1827/" ] }
7,046
I've read that the eye color at birth for most humans and for cats may not always be the the true genetic color at first. This is due to the lack of melanin in the iris. This makes sense as there is no light in the womb to stimulate the production of melanin. My question(s) though is: Why does the lack of said melanin produce a blue/bluish colored iris? Why is it not say green, red, clear, etc?
The blue colour is an example of structural colour , caused by light interacting physically with something. Some examples of structural colour are the iridescence of insect wings and body surfaces (usually caused by repeating chitinous structures), and of certain birds feathers, as well as the non-iridescent colours of the blue and yellow macaw. In the case of the eye it is the stroma of the iris that is responsible. This is a network of fibrous tissue which scatters light. When light is scattered in this way (Rayleigh scattering) it is the short wavelengths which are most scattered. So when you look at the sky (away from the sun) you are seeing diffuse blue light created by this scattering in the atmosphere. In the case of the iris what you are seeing is light reflected from the eye being scattered within the iris, creating the diffuse blue colour. As you say in the question, everything else is down to melanin.
{ "source": [ "https://biology.stackexchange.com/questions/7046", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1827/" ] }
7,087
Every now and then I got a glimpse of this bird which I'm pretty sure is not native to Northern Germany where I live. There are at least three of these birds around but I usually only see something quick and green somewhere in the trees. I finally managed to get some decent pictures so I'm hoping someone can tell me what kind of bird this is. I'm curious what biological niche this bird is likely to fill and which native species it might compete with.
Almost definitely (I'm not a regular birder) European Green Woodpecker (latin name: Picus viridis ) and it is native to your area according to its species distribution map . "Green woodpeckers are the largest and most colourful woodpeckers native to Britain. They are easily recognised by their laughing ‘yaffle’ call, which they use to demarcate their territory. They also drum on trees, though the sound is not as resonant as that made by the other two British species (the greater and lesser spotted woodpeckers). Green woodpeckers survive on a diet of insects and have a particular fondness for ants. They return day after day to their favourite ant hill to feed." - BBC nature
{ "source": [ "https://biology.stackexchange.com/questions/7087", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1711/" ] }
7,302
Plants and animals have the following distinct properties: Plants live from solar energy by photosynthesis , they use solar energy to make sugar and oxygen out of carbon dioxide, which gives them energy. Animals live from the sugar and oxygen plants created and produce carbon dioxide for their energy. Animals can move across the planet while plants are tied to the ground. Clearly, animals have a harder time to survive with no plants within their reach than plants have without animals coming close. This is logical because solar energy is always there while plants are not. So my question is: Are there animals that can do photosynthesis? It's obvious that an animal with plant-like stateliness would be non-beneficial since it relies on eating other plants for it's energy and there may not always be plants within reach from it's spot. But animals using the sun and carbon dioxide for energy production does not sound so stupid. Night animals could also gather energy in their sleep. Much easier than plants, animals could make sure nothing blocks their sunlight. Many animals go through periods of hunger because food is scarce, for some of them this period is paired with high sunlight levels. (the dry season f.e.) (EDIT: This is just an idea, of course photosynthesis requires water, which is absent in the dry season . But still, in warm period with enough water, there's sometimes too much animals to feed from the available vegeation.) Some things I already took into consideration: I know that plants, because they are small in mass (compared to the area with which they can collect sunlight) and static, don't need nearly as much energy as animals do. Is this the main reason? I know that f.e. reptiles, but in fact all cold-blooded animals, already use the sun's energy. But they only use the heat from the sun to warm their bodies, they don't photosynthesize.
There are 5 answers, all "yes" (though the first one is disputable). First: there exists at least one animal which can produce its own chlorophyll : A green sea slug appears to be part animal, part plant. It's the first critter discovered to produce the plant pigment chlorophyll. The sea slugs live in salt marshes in New England and Canada. In addition to burglarizing the genes needed to make the green pigment chlorophyll, the slugs also steal tiny cell parts called chloroplasts, which they use to conduct photosynthesis. The chloroplasts use the chlorophyl to convert sunlight into energy, just as plants do, eliminating the need to eat food to gain energy. The slug in the article appears to be Elysia chlorotica . Elysia chlorotica is one of the "solar-powered sea slugs", utilizing solar energy via chloroplasts from its algal food. It lives in a subcellular endosymbiotic relationship with chloroplasts of the marine heterokont alga Vaucheria litorea. UPDATE : As per @Teige's comment, this finding is somewhat disputable. Second, animals need not produce their own Chlorophyll, and instead symbiotically host organisms that use Photosynthetis - e.g. algae and cyanobacteria. This approach is called Photosynthetic symbioses . Overall, 27 (49%) of the 55 eukaryotic groups identified by Baldauf (2003) have representatives which possess photosynthetic symbionts or their derivatives, the plastids. These include the three major groups of multicellular eukaryotes: the plants, which are derivatives of the most ancient symbiosis between eukaryotes and cyanobacteria; the fungi, many of which are lichenized with algae or cyanobacteria; and the animals. We, the authors, and probably many readers were taught that animals do not photosynthesize. This statement is true in the sense that the lineage giving rise to animals did not possess plastids, but false in the wider sense: many animals photosynthesize through symbiosis with algae or cyanobacteria. Please note that while most organisms known for this are fungi, and some rare invertebrates (corals, clams, jellyfish, sponges, sea anemones), there is at least one example of vertebrate like this - spotted salamander (Ambystoma maculatum) Non-chlorophyll synthesis A 2010 study by researchers at Tel Aviv University discovered that the Oriental hornet (Vespa orientalis) converts sunlight into electric power using a pigment called xanthopterin . This is the first scientific evidence of a member of the animal kingdom engaging in photosynthesis, according to Wikipedia. Another discovery from 2010 is possibly a second piece of evidence : University of Arizona biologists researcher Nancy Moran and Tyler Jarvik discovered that pea aphids can make their own carotenoids, like a plant. “What happened is a fungal gene got into an aphid and was copied,” said Moran in a press release. Their research article is http://www.sciencemag.org/content/328/5978/624 , and they did not consider it conclusive: The team warns that more research will be needed before we can be sure that aphids truly have photosynthesis-like abilities. Third, depending on how you understand Photosynthesis , you can include other chemical reactions converting sunlight energy . If the answer is "usual 6H2O + 6CO2 ----------> C6H12O6+ 6O2 reaction done via chlorophyll", then see answers #1,#2. But if you simply literally translate the term (synthesizing new molecules using light), then you can ALSO include the process of generating Vitamin D from exposure to sunlight that humans do thanks to cholesterol ( link ) Non-biological answer. As a side bonus, Ophiocordyceps sinensis is referred to as half-animal half-plant (not very scientifically IMHO). But it doesn't do photosynthesis.
{ "source": [ "https://biology.stackexchange.com/questions/7302", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1224/" ] }
7,932
In physics, "almost everything is already discovered, and all that remains is to fill a few unimportant holes." (See Jolly .) Therefore, on Physics SE, people are veering off into different directions: biology , for example. Thus, it happens that a question about bicycles generates some discussion about evolution in biology and animals with wheels. Three explanations are offered for the apparent lack of wheely animals (also on Wikipedia , where, by the way, most Physics SE questions are answered perfectly). Evolutionary constraints: "[A] complex structure or system will not evolve if its incomplete form provides no benefit to an organism." Developmental and anatomical constraints. Wheels have significant disadvantages (e.g., when not on roads). Now, I suggest that all three can be "solved". With time. With a symbiotic relationship between a wheel-like animal and a "driver"-like animal, although this gets awfully close to a "driver"-animal to jump onto an actual (man-made) wheel. (So, perhaps, you can suggest a better loophole around this constraint.) Roads are presumably not the only ecological niche where animals with wheels could thrive. I'm thinking of frozen lakes, although there skates would be better than wheels. What, therefore, is the explanation for there not being any wheeled animals? Please consider, in your answer, the counterfactual: What assumption of yours would be falsified once a wheely animal is discovered?
Wheels are possible on the molecular level — bacterial flagella are rotating cores inside a molecular motor, but wheels larger than the flagellum have not really been found. A single animal with a wheel is an improbable* development that would require a single animal have two separable parts (axle/wheel and body). [*read as: pretty much impossible ] It's hard to imagine how such a thing could evolve. A wheel and axle would need to be made of living tissue, otherwise it would be vulnerable to wear and tear. Wheels also have problems going over uneven terrain, which is really all terrain animals live in. It's difficult to imagine what sort of selection conditions would be strong enough to push animals away from legs. If you include driver-vehicle symbionts where the 'car' and 'wheel' are actually two animals, then they have evolved. Parasites can have all sorts of symbiotic control over their victims including as means of transport. The Jewel Wasp is one which is the most suggestive of what you may be thinking. The wasp stings its victim (a cockroach) in the thorax to immobilize the animal and then again just behind its head. After this, the wasp can ride the beetle, steering it by holding its antennae back to its nest where the roach is immobilized to feed the wasp larvae there. (see section "Pet cockaroaches" in this reference.) As to the three schools of thought you added to the question, I would probably rather say there were two strong arguments against. The first is whether there is an evolutionary path to wheels (argument 1 in your question), which I doubt. Given even a large amount of evolutionary time you will not see a naked human being able to fly on their own power. Too many structural characteristics of the body plan have been made to all be reversed so that wings or other means of aerial conveyance will show up. The same can be said for wheels when the body plans have fins/legs/and wings already. Argument 3, which I also tend to agree with, is perhaps more convincing. By the time a pair of animals makes a symbiotic relationship to do this, or a single macroscopic animal evolves wheels, they will literally develop legs and walk away. When life came onto the land this happened, and since then it's happened several times. It's sort of like saying that the random movement of water molecules might line up to run a stream uphill. There's just such a strong path downwards, that the statistical chances of you seeing it happen are nil. This is a hypothetical case, but arguing this in a convincing way I think you would need to lay out: a) an environment whose conditions created enough of a selective advantage for wheels to evolve over legs or other similar adaptations we already see. Perhaps based on the energy efficiency of wheels; b) some sort of physiological model for the wheels that convey a reasonable lifestyle for the wheel. There are lots of questions that would need to be satisfied in our thought experiment. Here are some: "the symbiotic wheel would be spinning constantly; if it died the driver creature would be completely defenseless"; "if the ground were bumpy, all these wheeled animals would get eaten"; "the wheel symbiont — how would it eat while its spinning all the time? Only fed by the driver? Even symbionts such as barnacles or lampreys on the flanks of sharks still have their own ability to feed." For many similar questions the same sort of discussion ensues where there are many disadvantages which outweigh advantages for animals. e.g. "why are all the flying animals and fish and plants even more similar to airplanes than helicopters?" Sorry if I seem negative, but way back in grad school I actually did go over some of these angles. UPDATE: First Gear found in a Living Creature . A European plant-hopper insect with one of the largest accelerations known in biology has been found to have gears ! (There's a movie on the article page. ) The little bug has gears in its exoskeleton that synchronize its two jumping legs. Once again selection surprises. The gears themselves are an oddity. With gear teeth shaped like cresting waves, they look nothing like what you'd find in your car or in a fancy watch. There could be two reasons for this. Through a mathematical oddity, there is a limitless number of ways to design intermeshing gears. So, either nature evolved one solution at random, or, as Gregory Sutton, coauthor of the paper and insect researcher at the University of Bristol, suspects, the shape of the issus 's gear is particularly apt for the job it does. It's built for "high precision and speed in one direction," he says. The gears do not rotate 360 degrees, but appear on the surface of two joints to synchronize them as they wind up like a circular spring. The gear itself is not living tissue, so the bug solves the problem of regenerating the gear by growing a new set when it molts (i.e. gears that continually regenerate and heal are still unknown). It also does not keep its gears throughout its lifecycle. So the arguments here still stand; the exception still supports the rule. Additional Note: In his book " the God Delusion " (Chapter 4 somewhere) Richard Dawkins muses that the flagellar motor is the only example of a freely rotating axle that he knows of, and that a wheeled animal might be a true example of 'irreducibly complexity' in biology... but the fact that there is no such example is probably to the point.
{ "source": [ "https://biology.stackexchange.com/questions/7932", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/-1/" ] }
8,282
How does spacing apart sodium and potassium channels allow the action potential to travel faster down the axon? This is the reason always cited for saltatory conduction and myelination, but my mental model of conduction tells me that the density of ion gates along the axon should not affect the speed of the AP. To illustrate, consider a myelinated axon. A wave of Na$^+$ from action potential site 1, a node of Ranvier, rushes into and quickly diffuses down the axon. (It travels in both directions, but backwards is still in the refractory period.) It diffuses through the myelinated region, its concentration always diminishing. Before it attenuates too much, however, it happens upon node of Ranvier 2, where it triggers another action potential. A new wave of Na$^+$ rushes in and the cycle repeats. This should be plain so far. Now imagine that there is actually a node of Ranvier halfway between node 1 and 2, called node 1.5. The wave of Na$^+$, on its way to node 2, happens to trigger an action potential at node 1.5, from which a wave of Na$^+$ pours in and either boosts the original wave or replaces it by taking its momentum. Now the reinforced wave proceeds to node 2 and triggers it just as soon as, perhaps even sooner than, if node 1.5 had not existed. Repeatedly insert nodes at higher densities until the situation is simply lack of myelination, and we conclude that unmyelinated axons can transmit an action-potential-triggering wave of Na+ as fast as or faster than a myelinated one. In short, my point of confusion is this: I cannot see how a higher density of gated channels can possibly slow down the wavefront of Na+ that triggers action potentials. If anything, the additional influxes of Na+ should speed up the all-important wavefront, assuming that new waves really "either boost the original wave or replace it by taking its momentum", and also assuming that the wavefront of Na$^+$ is really all-important for signal transmission, and also assuming that the mere presence of (voltage?) gated ion channels in the membrane does not significantly retard the wavefront. But the usual explanation for why saltatory conduction is faster than continuous conduction (a fact I hope is empirically and unambiguously established) relies on the putative slowing effect of ion channels on the signal fore. Please explain this effect in more detail, if it is not a misconception.
Short Answer Myelination acts as an electrical insulator and allows saltatory propagation. By reducing membrane capacitance and increasing membrane resistance, myelination increases the velocity of signal (i.e., Action Potential) propagation. If you want to see a really wonderfully simplified explanation, see this Quora post by Edward Claro Mader . Four great figures that Edward created show this phenomenon simply: Decreased Membrane Capacitance: Increased Membrane Resistance: Long Answer So you're right: myelination speeds up electrical conduction. Unmyelinated axon conduction velocities range from about 0.5 - 10 m/s, while myelinated axons can conduct at velocities up to 150 m/s -- that's 10-30x faster !! But why? ... Let's Look at Action Potentials & Signal Propagation: You can get a background of this process in numerous places (e.g., here ), so I will just mention this briefly: When the neuron is at rest, ions are distributed so that the inside of the neuron cell is more negatively charged than the outside. This creates an electrical potential, called the resting membrane potential, across the cell membrane. Sodium and potassium channels in the cell membrane control the flow of positively charged sodium (NA $^+$ ) and potassium (K $^+$ ) ions in/out of the cell to maintain this negative charge. During depolarization, the cell membrane essentially becomes more permeable allowing NA $^+$ to enter the cell. This causes that section of axon to have a positive charge relative to the outside. When this positive voltage is great enough (i.e., when an action potential is created), the influx triggers the same behavior in the neighboring section of the axon. Gradually, this positive charge on the inside of the cell moves down the length of the axon to the axon terminals. The Main Takeaway: In this process, action potential generation occurs repeatedly along the length of the axon . It's important to note two things about action potential propagation: Each action potential takes time to occur. The charge (i.e., voltage) that is created dissipates with $ \uparrow $ distance. Time for some Math & Physics: In fact, we have equations to calculate both the time a voltage change takes to occur and how current flow decreases with distance. You can read more about the mathematics behind this and passive membrane properties in general here and here . Importantly, these equations rely on two constants: length and time. The time constant, $\tau$ , characterizes how rapidly current flow changes the membrane potential. $\tau$ is calculated as: $$\tau = r_mc_m$$ where r $_m$ and c $_m$ are the resistance and capacitance, respectively, of the plasma membrane. Resistance? Capacitance? Huh?... Resistance = the measure of the difficulty to pass an electric current through a conductor. Capacitance = the ability of a structure to store electrical charge. A capacitor consists of two conducting regions separated by an insulator. A capacitor works by accumulating a charge on one of the conducting surfaces, which ultimately results in an accumulation of oppositely charged ions on the other side of the surface. In a cellular sense, increased capacitance requires a greater ion concentration difference across the membrane. The values of r $_m$ and c $_m$ depend, in part, on the size of the neuron: Larger cells have lower resistances and larger capacitances. Importantly, however, is that these variables also rely on membrane structure. c $_m$ (the capacitance of the membrane) decreases as you separate the positive and negative charges. This could be the result of additional cellular structures (e.g., sheaths of fat) separating intracellular and extracellular charges. r $_m$ (the resistance of the membrane potential) is the inverse of the permeability of the membrane. The higher the permeability, the lower the resistance. Lower membrane resistance means you lose ions quicker and therefore signals travel less far But why? This is where that length constant becomes important. The length constant, $\lambda$ , can be simplified to: $$ \lambda = \sqrt {\frac {r_m}{r_e + r_i} } $$ where, again r $_m$ represents the resistance of the membrane and r $_e$ and r $_i$ are the extracellular and intracellular resistances, respectively. (Note: r $_e$ and r $_i$ are typically very small). Basically, if the membrane resistance r $_m$ is increased (perhaps due to lower average "leakage" of current across the membrane) $\lambda$ becomes larger (i.e., the distance ions travel before "leaking" out of the cell increases), and the distance a voltage travels gets longer. Why am I telling you all of this?? How are the time constant and the space constant related to propagation velocity of action potentials? The propagation velocity is directly proportional to the space constant and inversely proportional to the time constant . In summary : The smaller the time constant, the more rapidly a depolarization will affect the adjacent region. If a depolarization more rapidly affects an adjacent region, it will bring the adjacent region to threshold sooner. Therefore, the smaller the time constant, the more rapid will be the propagation velocity. If the space constant is large, a potential change at one point would spread a greater distance along the axon and bring distance regions to threshold sooner. Therefore, the greater the space constant , the more rapidly distant regions will be brought to threshold and the more rapid will be the propagation velocity. Sooo.... If you increase the layer of cells around the membrane, you decrease the electric field imparted by extracellular ions, which allows intracellular ions to move more freely in the axon. In other words, you decrease the capacitance. As a result, you have more cations available to depolarize other parts of the membrane. If you decrease the permeability of the membrane (i.e., if you prevent ion pumps from moving ions in/out of the axon), you increase the resistance of the axon membrane, which allows for the voltage created in the action potential to travel farther before dissipating. By allowing the voltage to spread farther before necessitating the generation of another action potential, you reduce the time it takes for signal propagation. In other words, if you "block" ion pumps and decrease the concentration of anions near the axon membrane, you increase membrane resistance (r $_m$ ) and decrease membrane capacitance (c $_m$ ), respectively. Together, this decreases the time of electronic conductance through the axon (and thus increase conduction velocity ). Finally, to Myelin! Myelin greatly speeds up action potential conduction because of exactly that reason: myelin acts as an electrical insulator ! Myelin sheath reduces membrane capacitance and increases membrane resistance in the inter-node intervals, thus allowing a fast, saltatory movement of action potentials from node to node. Essentially, myelination of axons reduces the ability for electrical current to leak out of the axon. More specifically, myelin prevents ions from entering or leaving the axon along myelinated segments. As a result, a local current can flow passively along a greater distance of axon. So instead of having to contantly generate new action potentials along each segment of the axon, the ionic current from an action potential at one node of Ranvier provokes another action potential at the next node. This apparent "hopping" of the action potential from node to node is known as saltatory conduction . So Why not Just Myelinate the Entire Axon?? The length of axons' myelinated segments is important to the success of saltatory conduction. They should be as long as possible to maximize the speed of conduction, but not so long that the arriving signal is too weak to provoke an action potential at the next node of Ranvier. The nodes also can't be too frequent because, although adding a new node to the axon would increase its ability to generate sodium current, it would also increase the capacitance and thus diminish the effectiveness of other nearby nodes. Sources: Purves D, Augustine GJ, Fitzpatrick D, et al., eds. (2001). Neuroscience . 2nd edition. Sinauer Associates, Sunderland, MA. The Brain: Understanding Neurobiology Byrne, J.H. Chapter 3: Propagation of the Action Potential. Neuroscience Online . Univ. Texas. Understanding the Passive Properties of a Simple Neuron Quora Wikipedia
{ "source": [ "https://biology.stackexchange.com/questions/8282", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3538/" ] }
9,172
I made an answer on the Scifi.SE that can be read here . It is about how the characters in the story Jurassic Park might have gotten DNA for all the species shown. In my answer, I said this: Apes and Humans, for example, share over 99% of their genes. That means the difference between our species is less than 1% of our genes. In fact, all life on Earth shares about 50% of it's genes. but in the original posting (before someone edited it) I chose to use the word DNA instead of genes. He left this comment in the section to explain the edit: Sorry, I'm a biologist, I can't help it. Humans and apes share 99% similarity in the coding sequences of their DNA, the ~5% that codes for genes, not on all the DNA. I simplified this to genes for the answer. I have a basic high school understanding of DNA and genes, so I'm afraid I fail to see the difference between using "DNA" or using "genes" in my statement. I understand that genes are specific sequences of DNA that are used by the cell in some way. I understand that DNA is more generic, including all of the strands, whether they are used or not, whether they seem to code for something or not. So is it wrong then to say that apes and humans share 99% of their DNA or is it equally correct to say "genes"?
So, a quick molecular biology lesson. Proteins are the things that make up a good percentage of our cells (which make up a good percentage of us ), and are the things that do the work of the cells - many are catalysts and are known as "enzymes". Proteins are encoded by genes - while the statement that one gene codes for one protein is not quite correct (one gene can code for different variations of the same basic protein), it's a good way to think about things in this context. Genes are made up of DNA , a polymeric molecule that constitutes our chromosomes, the informational portion of which resides four “letters” (chemical bases). However, now we get to the key part — although all genes are made of DNA, not all the DNA of chromosomes makes up genes . In fact, as @terdon mentioned in a comment, only about 5% (or less) of the 4 billion letters in the total DNA — the genome — constitute genes - those sequences that directly code for protein. The function of the rest of the genome is not entirely clear. Some is regulatory, some may be structural, and may be “junk DNA”. However it’s stuck around for millions of years, so it we assume it must have some purpose. This non-coding DNA differs between species to a greater extent than the genes themselves do, so perhaps it somehow contributes to the differences between organisms. From AndroidPenguin Here are the links to a paper about the function of "junk" DNA from 2013. Summary in NY Times Abstract in Nature ENCODE threads on nature.com
{ "source": [ "https://biology.stackexchange.com/questions/9172", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3970/" ] }
9,320
I recently finished reading Contact by Carl Sagan. In the book they talk about a pattern in the transcendental number like pi or e, and comment that it is found in base 10 or however many fingers the race has to count with. When in the end they find a pattern in pi it is in base 11, which I found a strange choice since I can't think of an animal that has an uneven total number of fingers, and I would think that most evolution would result in a somewhat symmetrical design. Do any animal exist that has an uneven total number of fingers or equal lim, excluding polydactyly and oligodactyly?
Your conclusion relies on the supposition that all beings must count using their finger tips (or the most paralogous, "finger-like" limb). In fact, even within humans this is not necessarily true: the Yuki native people of California count in base 8 by counting the spaces between their fingers ; meanwhile the Oksapmin people of Papua New Guinea count in base 27 (an odd number!) via counting a range of different body parts . One can easily imagine counting in base 20 by counting on fingers and toes. Heck, the Sumerians used base 60 . And here's a scheme for counting in base 16 on your fingers . So, it's entirely plausible to count in base 11, even when assuming morphological symmetry. The beings just need to settle on precisely which 11 parts of their anatomy to count. As for your actual question, I am unaware of any species with an uneven total number of fingers and I would be surprised if we found one, based on an argument of developmental symmetry and overall (coarse-grained) evolutionarily conserved development plans within major clades of extant animals.
{ "source": [ "https://biology.stackexchange.com/questions/9320", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/4037/" ] }
9,419
Reading this question, Why are there no wheeled animals? , I wondered why no organisms seem to make use of the tensile and other strengths of metal , as we do in metal tools and constructions. I am obviously not talking about the microscopic uses of metal, as in human blood etc. Why are there no plants with metal thorns? No trees with "reinforced" wood? No metal-plated sloths? No beetles with metal-tipped drills? Or are there? I can think of some potential factors why there are none (or few), but I do not know whether they are true: Is metal too scarce near the surface? Are there certain chemical properties that make metal hard to extract and accumulate in larger quantities ? Is metal too heavy to carry around, even in a thin layer or mesh or tip? Can metal of high (tensile etc.) strength only be forged under temperatures too high to sustain inside (or touching) organic tissue, and is crystallised metal too weak ? Are functionally comparable organic materials like horn, bone, wood, etc. in fact better at their tasks than metal , and do we humans only use metal because we are not good enough at using e.g. horn to make armour or chitin to make drills? As a predator, I would like to eat a lot of vertebrates and save up the metal from their blood to reinforce my fangs... A bonus question: are there any organisms that use the high electric conductivity of metal? Animals depend upon electric signals for their nervous system, but I do not think nerves contain much metal. The same applies to the few animals that use electricity as a weapon.
There are some cases, as hinted at by the comments. But these are relatively small amount of metal. It's not that there is no metal available. Iron in particular is the fourth most common element in the earth's crust and soil that has a reddish color has iron in it. There are several reasons you don't see iron exoskeletons on animals all the time. Firstly, fully reduced (oxidation state 0) metal has a high energetic cost to create in reduced form. Iron is the second most common metal after aluminum on the earth's crust but it's almost entirely present in oxidized states - that's to say: as rust. Most biological iron functions in the +2/+3 oxidation state, which is more similar to rust than metal. Cytochromes and haemoglobin are examples of how iron is more valuable as a chemically active biological agent than a structural agent, using oxidized iron ions as they do. Aluminium, the most common metal on Earth, has relatively little biological activity - one might assume because its redox costs are even higher than iron . If there are some reasons why reduced biometal doesn't show up very often, inability of biological systems to deposit reduced (metallic) metals is not one of them. Bone and shell are examples of biomineralization where the proteins depositing the calcium carbonate or other oxides in the material are structured by the proteins to be stronger than they would be as a simple crystal. There are cases of admittedly small pieces of reduced metal being produced by biological systems. The Magnetosomes in magnetotactic bacteria are mentioned, but there are also cases of reduced gold being accumulated by microorganisms . I would say that while iron skeletons might seem to be an advantage, they are electrochemically unstable - oxygen and water will tend to oxidize (rust) them quickly and the organism would have to spend a lot of energy keeping it in working form. Electrical conductivity sounds useful, but the nervous system favors exquisite levels of control over bulk current flow, even in cases like electric eels, whose current is produced by gradients from acetylcholine . What's more, it is a fact that biological materials actually perform as well as or better than metal when they need to. Spider silk has a greater tensile strength than steel (along the direction of the thread). Mollusk shells are models for tank armor - they are remarkably resistant to puncture and breakage. The time it would take for metalized structures to evolve biologically might be too long - by the time the metalized version of an organ or skeleton got started, the bones, shells and fibers we know probably have a big lead and selective advantage.
{ "source": [ "https://biology.stackexchange.com/questions/9419", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1070/" ] }
9,437
It's bothered me for a while now. I understand why a parasitoid would do this, as it only temporarily requires the host, and that not all parasites kill their hosts. There seems to be no evolutionary advantage in killing a host, because the parasite relies on the host for resources. Yet some organisms, usually microscopic pathogens, seem to fatally damage the host with no immediate benefit to themselves. Why is this? I know this is asking for a broad soft answer, but I don't want the question to get bogged down by a specific species, although bonus points for using examples.
I can think of several (non-exclusive and probably non-exhaustive) hypotheses: Maladaptive . It is maladaptive. Maybe because it is a virus coming from another species (e.g. SIV and HIV) or because it is not adapted to our modern lifespan. Benefit of the host immune system to the parasite . Some parasites might benefit from host immune defence (e.g. sneezing helps bacteria to spread) and death is a consequence of the selection for increasing disease symptoms to the host. Pathogen's and host's fate . The pathogen's fate is not linked to the host's fate. This is especially true if the pathogens spread well (easily jump from one host to another) I guess or for parasitoïd because the pathogen leaves its parasitic life after the death of its single host. intra- and inter-host selection . Among hosts, there might have a selection for reducing resource consumptions and therefore for decreasing the probability for the host to die. But within a host (among individuals of a parasite population or even among parasite species), it is a prisoner's dilemma (tragedy of the commons) . The more you invest in foraging, the more competitive you are. This might not be adaptative at the population level but it is at the individual level. We might think of this prisoner's dilemma happening among individuals of a single parasite species or among several parasite species. You may want to have a look at the work of Martin Nowak on the subject incl. Consider for example his book; Evolutionary Dynamics . Consequence of harming on trade-offs . Harming an individual will cause him not to spend energy into reproduction in order that more energy is available for the pathogen use. Moreover, by causing symptoms, the infected individual will be sexually less attractive and will again have less opportunity to spend energy into reproduction. The pathogen does not mean much harm . When fighting pathogens, many of the symptoms we experience (such as fever typically) are actually caused by the immune system and not the pathogen itself. A maladaptive overreaction of the immune system can cause our death. The book Why we get sick by Randolph Nesse and George Williams, will probably interest you.
{ "source": [ "https://biology.stackexchange.com/questions/9437", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3553/" ] }
9,438
The recent news about a new supermassive virus being discovered got me thinking about how we define viruses as non-living organisms whilst they are bigger than bacteria, and much more complex than we first gave them credit for. What biological differences between viruses and cellular organisms have made viruses be deemed non-living?
If this is a topic that really interests you, I'd suggest searching for papers/reviews/opinions written by Didier Raoult. Raoult is one of the original discoverers of the massive Mimivirus and his work will lead you to some truly fascinating discussions that I couldn't hope to reproduce here. The main argument for why viruses aren't living is basically what has been said already. Viruses are obligate parasites, and while plenty of parasites are indeed living what sets viruses apart is that they always rely on the host for the machinery with which to replicate. A parasitic worm may need the host to survive, using the host as a source for energy, but the worm produces and synthesizes its own proteins using its own ribosomes and associated complexes. That's basically what it boils down to. No ribosomes? Not living. One advantage of this definition, for example, is that it is a positive selection (everyone "alive" has got ribosomes) which eliminates things like mitochondria that are sort of near the boundary of other definitions. There are examples on either side of something that breaks every other rule but not this one. Another common rule is metabolism and while that suffices for most cases some living parasites have lost metabolic activity, relying on their host for energy. However (and this is the really interesting part) even the ribosome definition is a bit shaky, especially as viruses have been found encoding things like their own tRNAs. Here are a few points to think about: We have ribosome encoding organisms (REOs), so why can't we define viruses as capsid encoding organisms (CEOs)? Comparing viruses to a living organism such as a human is absurd, given the massive differences in complexity. A virus, really, is just a vehicle or genetic material, and would be more rightly compared to a sperm cell. Is a sperm cell alive, or is it a package for genetic material that is capable of life once it has infected/fertilized another cell? The really large DNA viruses often create cytoplasmic features called virus factories. These look an awful lot like a nucleus. What is a nucleus anyway? Maybe it's just a very successful DNA virus that never left. Viruses can get viruses . I'll wind down here, but suffice to say that while our current definition may have sufficed for a while, and still does, it is no longer quite solid. In particular, there is a theory alluded to above that eukaryotic life itself actually formed because of viruses. I can expand on this if you like, but here are some great sources: Boyer, M., Yutin, N., Pagnier, I., et al. 2009. Giant Marseillevirus highlights the role of amoebae as a melting pot in emergence of chimeric microorganisms. PNAS . 106(51):21848-21853 ( http://dx.doi.org/10.1073/pnas.0911354106 ) Claverie, JM. Viruses take center stage in cellular evolution. 2006. Genome Biology . 7:110. ( http://dx.doi.org/10.1186/gb-2006-7-6-110 ) Ogata, H., Ray, J., Toyoda, K., et al. 2011. Two new subfamilies of DNA mismatch repair proteins (MutS) specifically abundant in the marine environment. The ISME Journal . 5:1143-1151 ( http://dx.doi.org/10.1038/ismej.2010.210 ) Raoult, D. and Forterre, P. 2008. Redefining viruses: lessons from Mimivirus. Nature Reviews Microbiology . 6:315-319. ( http://dx.doi.org/10.1038/nrmicro1858 ) Scola, B., Desnues, C., Pagnier, I., et al. The virophage as a unique parasite of the giant mimivirus. 2008. Nature . 455:100-104 ( http://dx.doi.org/10.1038/nature07218 )
{ "source": [ "https://biology.stackexchange.com/questions/9438", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3553/" ] }
9,993
We all know CO₂ as a waste product of metabolism . Does CO₂ have any helpful role , apart from having a role in pH of blood ?
Before I restrict the answer to human metabolism, I recon it is important to mention that CO 2 is the source of the carbon atoms of glucose in photosynthesis (in the Calvin cycle ). [In photosynthesis CO 2 is 'fixed']. Even with the above restriction, I am certain I cannnot do justice to every helpful aspect of CO 2 in mammalian metabolism, and I'll restrict myself to just one area that came to mind on reading your question: the requirement for carbon dioxide (in the form of bicarbonate) for fatty acid biosynthesis (FAS) and, in a bit more general sense, mammalian/bacterial biotin-dependent carboxylation reactions. Depeding on other contributions, I might be able to extend this a bit later. Salih Wakil showed that CO 2 is an absolute requiement for fatty acid biosynthesis, but carbon atoms from CO 2 do not appear in the fatty acid product . We now know that FAS begins with the carboxylation of acetyl-CoA to malonyl-CoA, catalyzed by the enzyme acetyl-CoA carboxylase . Acetyl-CoA, ATP and bicarbonate are the substrates for this enzyme, and malonyl-CoA is a key product. One of the many interesting properties of this enzyme is that it contains biotin , which (in this case) may be considered a carrier of 'active' CO 2 . This explains the requriement for carbon dioxide but why no carbon from CO 2 in the final product? It is now known that in subsequent FAS reactions, a derivative of malonyl-CoA condenses with a derivative of acetyl-CoA (I am simplifying here) to give a four-carbon compound with loss of CO 2 . Thus, carbon dioxide (in the form of bicarbonate) is an obligate requiement for mammalian fatty acid biosynthesis, but no CO 2 -derived carbon is incorporated into fatty acids. Carbon dioxide is also required for oxaloacetate formation from pyruvate. This reaction may be though of a method of 'filling up' a key Krebs Cycle intermediate (a so-called anapleurotic reaction). The enzyme here is pyruvate carboxylase and the substrates for the reaction are pyruvate, bicarbonate and ATP, with oxaloacetate being a key product. This enzyme also contains biotin and (like acetyl CoA carboxylase), CO 2 becomes covalently bound to biotin during the reaction cycle. Pyruvate-CoA carboxylase was discovered by Harland.G Wood and C. Werkman in bacteria (See here for a good reference on the early work on pyruvate carboxylase). Its discovery was very controversial because at the time it was thought that animal/bacterial cells could not 'fix' CO 2 ; that is it was though that CO 2 is only 'fixed' in photosynthesis. This discovery disproved that piece of dogmatism. A third enzyme that requires CO 2 as substrate (in the form of bicarbonate) is propionyl-CoA carboxylase . This enzyme occurs in mitochondria and functions in odd-chain fatty acid metabolism. It also contains biotin . I have concentrated on some biochemical aspects of your question. The three enzymes mentioned, acety-CoA carboxylase, pyruvate carboxylase and propionyl-CoA carboxylase all require CO 2 in the form of bicarbonate as substrate, all contain biotin , and (as far as I am aware) all play very central roles in mammalian metabolism. (They also all require ATP as substrate). Of the many interesting aspects of biotin , I'll mention just one. Egg white contains a protein, avidin , which binds biotin very, very tightly. In fact the biotin-avidin interaction is one of the strongest non-covalent interactions known. As far as I am aware, no-one knows the function of avidin in egg white. Some bacteria contain a similar (but evolutionarily unrelated) protein called streptavidin . No one knows the function of steptavidin either (again, as far as I am aware). The original Wood & Werkman paper: was published in the the Biochemical Journal in 1936 The utilisation of CO 2 in the dissimilation of glycerol by the propionic acid bacteria. Harland Goff Wood and Chester Hamlin Werkman. Biochemical Journal, Volume 30 , January 1936, pp 48-53
{ "source": [ "https://biology.stackexchange.com/questions/9993", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3615/" ] }
10,002
I found a seemingly diseased tree when I was out playing tennis yesterday... What is growing on this tree leaf? Is this a disease? If so, is it contagious? I have zero knowledge in botany, but I'm curious about what is happening to these trees. :)
This is actually not a gall as other answers have suggested. This is likely a fungus called Cedar-apple rust ( Gymnosporangium juniperi-virginianae ) . The fungus only thrives in the presence of both Juniperus virginiana (Eastern red cedar) and apple ( Malus spp.) trees. The leaf in the picture belongs to some species of the apple genus and the growths are aecia of G. juniperi-virginianae . You can read about this interesting fungi through Rutger's Plant & Pest Advisory here . You can see a picture of the fungi here , and I've included Sabrina Tirpak's (Rutgers PDL) photo of its aecia below: http://plant-pest-advisory.rutgers.edu/3859/ Below is a visual of the telia of the rust fungus on J. virginiana : (Photo source: Ada Hayden Herbarium )
{ "source": [ "https://biology.stackexchange.com/questions/10002", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/4155/" ] }
11,263
There are a bunch of different alignment tools out there , and I don't want to get bogged down in the maths behind them as this not only between software but varies from software version to version. There are two main divides in the programs; some use local alignments and others use global alignments. My question is threefold: What are the fundamental differences between the two? What are the advantages and disadvantages of each? When should one use either a global or local sequence alignment?
The very basic difference between a local and a global alignments is that in a local alignment, you try to match your query with a substring (a portion) of your subject (reference). Whereas in a global alignment you perform an end to end alignment with the subject (and therefore as von mises said, you may end up with a lot of gaps in global alignment if the sizes of query and subject are dissimilar). You may have gaps in local alignment also. Local Alignment 5' ACTACTAGATTACTTACGGATCAGGTACTTTAGAGGCTTGCAACCA 3' |||| |||||| ||||||||||||||| 5' TACTCACGGATGAGGTACTTTAGAGGC 3' Global Alignment 5' ACTACTAGATTACTTACGGATCAGGTACTTTAGAGGCTTGCAACCA 3' ||||||||||| ||||||| |||||||||||||| ||||||| 5' ACTACTAGATT----ACGGATC--GTACTTTAGAGGCTAGCAACCA 3' I shall give the example of the well known dynamic programming algorithms. In the Needleman-Wunsch (Global) algorithm, the score tracking is done from the (m,n) co-ordinate corresponding to the bottom right corner of the scoring matrix (i.e. the end of the aligned sequences) whereas in the Smith-Waterman (local), it is done from the element with highest score in the matrix (i.e. the end of the highest scoring pair). You can check these algorithms for details. You can adopt any scoring schemes and there is no fixed rule for it. Global alignments are usually done for comparing homologous genes whereas local alignment can be used to find homologous domains in otherwise non-homologous genes.
{ "source": [ "https://biology.stackexchange.com/questions/11263", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3553/" ] }
11,286
Why is ATP the most prevalent form of chemical energy storage and utilization in most cells?
I really like this question as it is such a fundamental underpinning of all life on the planet, yet there is such sparsity of actual information on its origins and why selection rewarded ATP use over anything else. Here I am talking generally since no specific studies exist in ATP vs other candidates. A lot of the below information is taken from a relatively old article mentioned in the comments by TomD that discusses: "Why nature chose phosphates." by Westheimer, 1987 . The article is very influential and has been cited over a thousand times since publication. Another article that came out in the same year that this question was asked "Why nature really chose phosphate." by Kamerlin et al., 2013 Some of the below arguments are more convincing than others, but all of them should be thought of when attempting to answer this question. Summary. ATP has ancestral dominance. Most other reasons derive from this. Alternative phosphate groups or other molecules may not provide enough energy. Alternatives may be toxic. Other molecules, particularly phosphates, are used for inefficient high energy bursts. Pi is a "good" leaving group. Phosphates are fundamentally able to be regulated through electrostatic manipulation. ATP synthase can efficiently reattach the Pi to ADP. Lots of Pi available to organisms because of it's ancestral dominance ("if it ain't broken, why fix it?" is at play). ATP can provide more energy if needed; it's scalable to the situation. (ADP becomes AMP + Pi) Easily usable by a variety of proteins. Why ATP? ATP is an efficient and relatively easily biosynthesised molecule that can fulfil multiple biochemical roles. Cells do have alternative energy carriers, some with more specialised roles, however, ATP is ubiquitous throughout our cells and inter-cellular spaces. There aren't a wealth of resources explaining why ATP is any better than other compounds, however, there is plenty of reasons why the phosphates are required. Why not the alternatives? Citric acids and their derivatives are a good candidate, with deductible groups and high bioavailability but they simply don't give enough energy to stabilise genetic material. Another tribasic candidate is arsenic acid. This is a fundamentally toxic compound, though, which isn't particularly great for living things. There are other phosphates too, and they are used in many organisms. In biology, they have specific functions, and not used as the general energy carrier. For example, creatine triphosphate provides a high energy phospho- anhydride bond, that is often used to quickly and anaerobically regenerate ATP, useful during high rate muscle activity for contraction. GTP is structurally very similar to ATP. GTPases are used more to initiate cellular signalling pathways. It is sometimes used as an energy source. This is a good example of an alternative energy carrier. Over the years, many proteins have specialised with a specific shape, and this chance is the primary reason behind ATP over GTP. In other words, the choice of ATP over GTP is primarily down to cellular preference of molecular shape. One of them had to emerge as being more widely used, and it was ATP that 'won'. Efficiency and simplicity. The reaction was once thought to be a relatively simple nucleophilic displacement. From the 2013 paper: ...this simplicity is deceptive, as, even in aqueous solution, the low-lying d-orbitals on the phosphorus atom allow for eight distinct mechanistic possibilities, before even introducing the complexities of the enzyme catalysed reactions. Traditionally one will be taught that ATP is such a chemically efficient way of storing and transporting energy. This is due to the ATP->ADP & Pi hydrolysis reaction. The phosphate groups in ATP are full of negative charges and these are repelling one another. This means that the third phosphate is a great leaving group and breaking the phospho- anhydride bond is a favourable reaction. ... ...But the story is a lot more complicated than that. The above explanation isn't really satisfying because those same negative charge forces are repulsive of the nucleophile that is attempting to complete ATP->ADP & Pi. A more comprehensive explanation would go along the lines of 'although a negative charge repulsion exists between the nucleophile of the protein and the phosphate, that high energy barrier can be overcome by electrostatic manipulation'. This allows an "on-off switch" for the hydrolytic reaction by tweaking the electrostatic environment. This is another great regulatory tool that the phosphates provide. This regulatory feature is important for signal and metabolic/catabolic cascades. When it comes to 'rebinding' the Pi to ADP, it is fairly easy since ADP seldom covalently binds to anything, which would require a lot of energy to recover the ADP. This also helps the bioavailability of free ADP to ATP synthase , an incredibly efficient enzyme, that uses membrane proton gradient to drive the production of ATP. Talking about actual numbers is difficult here as there is only data available from Rat hepatocytes. Who is to say mammals are representative of all organisms? The estimates of energy of hydrolysis range from ΔG˚ = -48 kJ mol-1 to -30.5 kJ mol-1 . Note that these are considerable, but not exceptional values, so it's easy for many different proteins, that need not be very specialized, to break the bond all over the body. I couldn't even find the numbers for the synthase reaction per ATP, but a single ATP synthase can produce up to 600 ATP per minute. The final point of this efficiency is that the elements in ATP are very abundant and established in the biosphere making it readily available. This makes the phosphates a convenient biomolecule. Multi-functionality. ATP is ubiquitous in the body, but in some cases more energy is needed than there are ATP available. In these times of need, ATP can be used to produce more energy, breaking another phosphoanhydride bond to become AMP+2Pi. AMP however is typically a signalling molecule. With the low activation energy required to break the phosphoanhydride bond, a multitude of enzymes, far too many to list here, can make use of ATP in order to gain energy towards the activation energy for many other functions.
{ "source": [ "https://biology.stackexchange.com/questions/11286", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/4254/" ] }
11,291
I read in Campbell that ....splicing and poly A tail addition may also occur while transcription is still under way. How can the poly(A) tail be added while transcription is still going on?
I really like this question as it is such a fundamental underpinning of all life on the planet, yet there is such sparsity of actual information on its origins and why selection rewarded ATP use over anything else. Here I am talking generally since no specific studies exist in ATP vs other candidates. A lot of the below information is taken from a relatively old article mentioned in the comments by TomD that discusses: "Why nature chose phosphates." by Westheimer, 1987 . The article is very influential and has been cited over a thousand times since publication. Another article that came out in the same year that this question was asked "Why nature really chose phosphate." by Kamerlin et al., 2013 Some of the below arguments are more convincing than others, but all of them should be thought of when attempting to answer this question. Summary. ATP has ancestral dominance. Most other reasons derive from this. Alternative phosphate groups or other molecules may not provide enough energy. Alternatives may be toxic. Other molecules, particularly phosphates, are used for inefficient high energy bursts. Pi is a "good" leaving group. Phosphates are fundamentally able to be regulated through electrostatic manipulation. ATP synthase can efficiently reattach the Pi to ADP. Lots of Pi available to organisms because of it's ancestral dominance ("if it ain't broken, why fix it?" is at play). ATP can provide more energy if needed; it's scalable to the situation. (ADP becomes AMP + Pi) Easily usable by a variety of proteins. Why ATP? ATP is an efficient and relatively easily biosynthesised molecule that can fulfil multiple biochemical roles. Cells do have alternative energy carriers, some with more specialised roles, however, ATP is ubiquitous throughout our cells and inter-cellular spaces. There aren't a wealth of resources explaining why ATP is any better than other compounds, however, there is plenty of reasons why the phosphates are required. Why not the alternatives? Citric acids and their derivatives are a good candidate, with deductible groups and high bioavailability but they simply don't give enough energy to stabilise genetic material. Another tribasic candidate is arsenic acid. This is a fundamentally toxic compound, though, which isn't particularly great for living things. There are other phosphates too, and they are used in many organisms. In biology, they have specific functions, and not used as the general energy carrier. For example, creatine triphosphate provides a high energy phospho- anhydride bond, that is often used to quickly and anaerobically regenerate ATP, useful during high rate muscle activity for contraction. GTP is structurally very similar to ATP. GTPases are used more to initiate cellular signalling pathways. It is sometimes used as an energy source. This is a good example of an alternative energy carrier. Over the years, many proteins have specialised with a specific shape, and this chance is the primary reason behind ATP over GTP. In other words, the choice of ATP over GTP is primarily down to cellular preference of molecular shape. One of them had to emerge as being more widely used, and it was ATP that 'won'. Efficiency and simplicity. The reaction was once thought to be a relatively simple nucleophilic displacement. From the 2013 paper: ...this simplicity is deceptive, as, even in aqueous solution, the low-lying d-orbitals on the phosphorus atom allow for eight distinct mechanistic possibilities, before even introducing the complexities of the enzyme catalysed reactions. Traditionally one will be taught that ATP is such a chemically efficient way of storing and transporting energy. This is due to the ATP->ADP & Pi hydrolysis reaction. The phosphate groups in ATP are full of negative charges and these are repelling one another. This means that the third phosphate is a great leaving group and breaking the phospho- anhydride bond is a favourable reaction. ... ...But the story is a lot more complicated than that. The above explanation isn't really satisfying because those same negative charge forces are repulsive of the nucleophile that is attempting to complete ATP->ADP & Pi. A more comprehensive explanation would go along the lines of 'although a negative charge repulsion exists between the nucleophile of the protein and the phosphate, that high energy barrier can be overcome by electrostatic manipulation'. This allows an "on-off switch" for the hydrolytic reaction by tweaking the electrostatic environment. This is another great regulatory tool that the phosphates provide. This regulatory feature is important for signal and metabolic/catabolic cascades. When it comes to 'rebinding' the Pi to ADP, it is fairly easy since ADP seldom covalently binds to anything, which would require a lot of energy to recover the ADP. This also helps the bioavailability of free ADP to ATP synthase , an incredibly efficient enzyme, that uses membrane proton gradient to drive the production of ATP. Talking about actual numbers is difficult here as there is only data available from Rat hepatocytes. Who is to say mammals are representative of all organisms? The estimates of energy of hydrolysis range from ΔG˚ = -48 kJ mol-1 to -30.5 kJ mol-1 . Note that these are considerable, but not exceptional values, so it's easy for many different proteins, that need not be very specialized, to break the bond all over the body. I couldn't even find the numbers for the synthase reaction per ATP, but a single ATP synthase can produce up to 600 ATP per minute. The final point of this efficiency is that the elements in ATP are very abundant and established in the biosphere making it readily available. This makes the phosphates a convenient biomolecule. Multi-functionality. ATP is ubiquitous in the body, but in some cases more energy is needed than there are ATP available. In these times of need, ATP can be used to produce more energy, breaking another phosphoanhydride bond to become AMP+2Pi. AMP however is typically a signalling molecule. With the low activation energy required to break the phosphoanhydride bond, a multitude of enzymes, far too many to list here, can make use of ATP in order to gain energy towards the activation energy for many other functions.
{ "source": [ "https://biology.stackexchange.com/questions/11291", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3615/" ] }
13,486
I am always so confused whether to do a chi square test or a t test in the sums given by my biostats teacher. Does anyone have a simple rule to decide this?
This is a very subtle question and I encourage you to read the Wikipedia articles on these different subjects (t-test, chi-squared test, p-value, etc) because the authors worked hard to combat common misconceptions about these commonly used statistical tests. Here is a rather oversimplified rule-of-thumb for these different tests: t-test: Used when you are looking at the means of different populations. For example, you might want to determine whether the difference in the mean gene expression level between treated and untreated cells is different, or if the gene expression level of cells in a certain environment differs from what you would expect in a null hypothesis. Assumptions: You are assuming that the populations you are looking at are normally distributed. The variance of the populations is not known (that would be a Z-test), but it is assumed that the variance of each population is the same. Finally, for the t-test to work, the samples of the data from the two populations are assumed to be independent. $\chi^2$ test: Several possibilities for this. The most common in biology is the Pearson $\chi^2$ test, which is used when you are looking at categorical data , like the number of pea plants with white or purple flowers and round or wrinkled seeds, and trying to see whether the number of individuals in each category is consistent with some null hypothesis (such as the number in each category you'd expect if the genes for flower color and seed shape are not linked). Assumptions: The data points were randomly and independently gathered from the population, and you have a reasonably large number of samples. I'd hate to have made a huge mistake, so please edit my answer and/or contribute your own if you think I am completely misrepresenting these topics!
{ "source": [ "https://biology.stackexchange.com/questions/13486", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3615/" ] }
13,680
In every non-life example I can envision, a copy of a copy is always a degraded or less pure version of the original unless some outside influence acts to correct the copy back toward the ideal represented by the original. Photocopies get blurrier with each generation. Casts from a mold are distorted from the original from which the mold was made. In fact, each cast degrades the mold itself. When data is copied on computers or across networks, parity checks verify that no mistakes were made, but even then, every long once in a while, combinations of errors can cause a false positive in a parity check. So given enough time, the copies would degrade. In eukaryotes, new individual organisms always begin as a zygote, so in all kingdoms, reproduction boils down to the genesis of a single cell. This involves correctly building the DNA as well as all of the other complex architecture of the cell. Why doesn't this cell degrade like every other example I can think of? In fact, cells are capable of such perfect reproduction that the system generally supports the introduction of additional randomness in order to promote the possibility of productive change. I can think of some probable contributing factors that make this work, but I must be missing something. I can't imagine that this model would actually work the way it does - so well in fact that the design actually improves over time. What am I missing or underestimating? Contributing Factors (I guess): Perfect Building Blocks: Cellular development follows a pattern at every level, and ultimately operates all the way down to the molecular level. At that level, nearly all building blocks are identical. Life is built of stable atoms, not something like plutonium, and in the rare event that an atom does change, the result is simply a different kind of atom, which still tends toward a stable form in the long term. Because the structures of life are ultimately made of stable components that are plentiful everywhere in the environment, the essential structures being copied are precise and can be copied precisely. Photocopies and casts are not precise to the molecular level, so copying them is more approximate by nature. Digital data propagation, however, is a very similar process. Bits are also theoretically perfect building blocks. Fitness Correction: When mistakes do degrade the reproduction process, rather than maintaining or randomly improving upon it, there is a correction mechanism that removes the defects from the process. Those defects do not survive to reproduce. This evolutionary process acts to keep the reproductive pattern focused back upon a theoretical ideal which is independent of a specific physical form to be copied. This seems like the most essential element of the explanation, because it is ultimately only through progression that digression can be avoided, but it is also the part that seems the most dubious. Astronomical quantities of defects would have to be produced before developing just one advantageous feature. I would expect living creatures to be 99% defective with only 1% surviving to breed. I would expect 99.9% of zygotes to expire without being born or sprouting from seed. I would expect all sexual organs (ovaries, testes, stamen, etc.), if not the majority of the whole body, to be mostly dead cells, with just a few successes surviving to fertilization. I would expect 99.9% of the genome to be experimental, almost completely unusable liability to the species. Essentially, I would expect premature death to far outweigh successful life everywhere and at all times. And even so, I would still expect evolution to be even slower than it has been. Mutation Management Mechanisms: I understand that there are mechanisms in reproduction that decrease the likelihood of mutation in more established and stable parts of the genome compared with sections that are more open for discussion - epigenetic structures, HOX genes, etc. Portions of all genomes have been established and functional for hundreds of millions of years, so I gather that there are mechanisms for protecting them (I suspect probably far more than we have yet discovered). Note: The numbers I present are fuzzy and are based not on calculations but on general impressions I get of the magnitude of the numbers involved and the relative rareness of useful mutations. Is there any place where this kind of calculation has been performed with more realistic approximations of probabilities?
You have clearly given this a lot of thought. Unfortunately, as @adam.r said, you are laboring under certain misapprehensions. The quick answer is that each generation does not "improve" on the last. That is a common misconception. In a bit more detail: First of all, your copying metaphor is a bad one. There was no "perfect original", I expand on this theme at length in my answer here but, briefly, all species are constantly changing. They are not moving away from a platonic ideal of the perfect species (or towards it for that matter), they are simply changing in response to the world around them. What's 'good' today is not necessarily 'good' tomorrow. Your copy machine metaphor does hold for changes from one generation to the next though. Copying DNA is fraught with errors. There is a huge cellular machinery in place whose only job is to catch and correct those errors. Nevertheless, many get through and result in diversity that can then be selected for or against through the process of natural selection. So, the copies do actually degrade. That, in fact, is the very basis of how evolution works. Another important point is that most changes are neutral. They have absolutely no effect one way or the other. There are many reasons for this but the main ones are The vast majority of DNA does not actually code for protein. What it does do is an area of active research but minor changes in sequences that don't code for protein are extremely unlikely to cause a change in phenotype. Almost all of the information necessary to produce a viable organism is in the genes , and genes represent a very small (~5% in human for example) percentage of the genome. Changes that affect the fitness of an individual are almost invariably found in the coding sequences of genes. This means that of the ~30 billion possible sites for mutation in any given cell, 95% of them (even less actually since only exons count and they're ~2%) will not cause a phenotypic effect. The genetic code is redundant. Basically, DNA is "read" in "words" of three "letters", the codons . Since there are 4 bases in the genome (A,C,T and G) this means there are 64 possible codons. Each codon specifies a particular amino acid (the building blocks of proteins) and a given sequence of codons will result in a specific sequence of amino acids. However, there are only 22 amino acids, many of which are specified by the same codon: As you can see in the image above, in most cases, changing the third letter of the codon does not affect the amino acid that will be specified. This means that even for those mutations (changes) that occur in the coding region of genes, the chances are relatively high that they won't actually result in any phenotypic change. If you change the genetic code but the changed codon still codes for the same amino acid there will be no change in phenotype. As for your contributing factors: Perfect Building Blocks : Nope, sorry this one is wrong. First of all there is no such thing as a minor change that involves changing an atom. Any change that happens at the atomic level is huge by definition. That kind of thing happens a the hearts of stars and in nuclear reactors. The chemical reactions in our body involve changing molecules not atoms. There is no such thing as a minor change really, if you replace one atom in a molecule by another, you are significantly changing the properties of that molecule (this is less true for large, complex macromolecules where some changes can indeed be minor). If you were to change, for example, a single atom in normal table salt ($NaCl$) from sodium to hydrogen, you would get $HCl$, hydrochloric acid and not something you want to put in your soup. There are no perfect building blocks, in biology nothing is perfect, that only happens in math. Also, the organism does not follow the same pattern from the organismal to the cellular to the molecular (never mind atomic) level. In fact, there are very different organizational principles at play at the different levels and the way that cells are organized (see here for example) has nothing to do with the way that a cell's contents are organized. Stability is overrated. In fact, our bodies contain loads of unstable (reactive) chemicals, oxygen being chief among them. By definition, chemical reactions involve changing molecules (not atoms, but we don't deal with that level, biological effects tend to be at the molecular, not atomic level). All reactions that go on in the factory that is your body involve the changing of one molecule into another. Fitness Correction: Actually, at the cellular level, the corrections try to faithfully reproduce the template they are copying from. When a cell copies itself, it will also copy its DNA. It does so by using its own DNA as a template. There is no "theoretical ideal", the cell has no information about the genome of its parent, only its own. As I mentioned above, there are various corrective mechanisms whose job it is to spot errors and correct them. They have no way of knowing whether a given change will be beneficial or harmful to the individual, as far as these processes are concerned, any change is bad and should be corrected. The only thing they do is try to make a daughter cell's genome identical to the parent cell's. When a change makes it past the cellular level, then it can be selected for or against based on whether it makes the individual carrying it more or less likely to reproduce. This, however, is not a directed process. It just happens. If a mutation makes a male blue whale stronger, it is more likely to be the one that catches up with the racing female and so more likely to reproduce. There is no direction other than the selective process itself. There is no one around comparing new individuals to an ideal and selecting accordingly. If you're better at reproducing than your peers, your genes will be selected. Actually, many many gametes are discarded. Many cells die. You just don't know about it because they die before you can see them. So deleterious (very bad) changes do occur. "I would expect 99.9% of the genome to be experimental, almost completely unusable liability to the species." In a way this is true. Despite recent findings , 98% of the human genome does not directly affect the phenotype. It is only the 2% that represents the protein coding parts of genes that has a direct effect on fitness. In fact, in the human genome specifically, there is a short sequence that does not code for any protein and does not (directly, though there are various theories about this) affect our phenotype, that has been making copies of itself and propagating in our genome for generations. Today, this sequence (Alu) represents ~10% of the human genome, that's twice as much as all our genes together! Mutation Management Mechanisms: The basic protection mechanism you mention in your question is quite simply death. Mutations that render housekeeping genes (like the HOX cluster) inactive kill the organism that carries them. That does not mean they don't occur, it simply means that when they occur, we don't see them because the individual carrying the mutation is dead (see point 3).
{ "source": [ "https://biology.stackexchange.com/questions/13680", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5018/" ] }
14,414
After my online research on the subject, I learnt that, biologically speaking, many scientists believe that there is no such thing as a race. Homo sapiens as a species is only 200,000 years old, which has not allowed for any significant genetic diversification yet, and our DNA is 99.99% similar. I've read statements that there can be more genetic variation inside a racial group than between different racial groups, meaning that, for example, two individuals from the same "race" can have less in common with each other than with an individual from another "race". Wikipedia on Race (human classification) quote : Scientists consider biological essentialism obsolete, and generally discourage racial explanations for collective differentiation in both physical and behavioral traits Q1: If Homo sapiens has no races (according to biologists), why are we so different morphologically? (hair/eyes/skin colour and even athletic performance seem to differ between human populations) Q2: Is it common for other species too, when genetically close populations have very different morphological traits? Are there any other mammal or animal species that exhibit biological diversity comparable to human diversity, and how do taxonomists treat these species? (excluding intentionally bred domestic species to keep the comparison fair) The question has been paraphrased to emphasize that it is the biological debate that is in question, not the sociopolitical . I.e., why is there no consensus in evidence and opinions of scientists?
Firstly, it's not true that you can't tell racial background from DNA. You most certainly can; it's quite possible to give fairly accurate phenotypic reconstruction of the features we choose as racial markers from DNA samples alone and also possible to identify real geographic ancestral populations from suitable markers. The reason that human races aren't useful is that they're actually only looking at a couple of phenotypic markers and (a) these phenotypes don't map well to underlying genetics and (b) don't usefully model the underlying populations. The big thing that racial typing is based on is skin colour, but skin colour is controlled by only a small number of alleles. On the basis of skin colour you'd think the big division in human diversity is (and I simplify) between white Europeans and black Africans. However, there is vastly more genetic diversity within Africa than there is anywhere else. Two randomly chosen Africans will be, on average, more diverse from each other than two randomly chosen Europeans. What's more Europeans are no more genetically distinct overall from a randomly chosen African than two randomly chosen Africans are from each other. This makes perfectly decent sense if you consider the deep roots of diversity within Africa (where humans originally evolved) to the more recent separation of Europeans from an African sub-population. It's also worth noting that the phenotypic markers of race don't actually tell you much about underlying heredity; for example there's a famous photo of twin daughters one of whom is completely fair skinned, the other of whom is completely dark skinned; yet these two are sisters. This is, of course, an extreme example but it should tell you something about the usefulness of skin colour as a real genetic marker.
{ "source": [ "https://biology.stackexchange.com/questions/14414", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5392/" ] }
15,082
What are 5' and 3' in DNA and RNA strands? Please clarify with some images and please use simple English.
The 5' and 3' mean "five prime" and "three prime", which indicate the carbon numbers in the DNA's sugar backbone. The 5' carbon has a phosphate group attached to it and the 3' carbon a hydroxyl (-OH) group. This asymmetry gives a DNA strand a "direction". For example, DNA polymerase works in a 5' -> 3' direction, that is, it adds nucleotides to the 3' end of the molecule (the -OH group is not shown in diagram), thus advancing to that direction (downwards).
{ "source": [ "https://biology.stackexchange.com/questions/15082", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5700/" ] }
15,514
I've often heard that a population, human or otherwise, will continue to grow as long as there is food available (assuming nothing else is killing them off). It makes sense: if you have food you can live, and if nothing is hunting you you'll survive to reproduce. I recently designed a piece of software to simulate an ecosystem, with groups of creatures of different species eating and hunting and reproducing alongside each other. It was very simplified (each animal had simple attack/defense/speed/stealth values, etc), but something became rapidly apparent: in every simulation the predators overwhelmed the prey, reproducing until their numbers could not be sustained by the herbivores, and leading to an inevitable die-off of both groups. I could delay the die-off by adjusting different values and initial population counts, but it would always happen eventually. The predators would eat and breed and eat and breed until the entire system collapsed. At first I thought it was just the product of my over-simplified system, but it got me thinking: what prevents predators from overpopulating in real life? It seems like the natural tendency would be for (for example) the sharks to continue breeding and eating until all the fish are gone, or the wolves to eat all the deer, etc. Obviously some predators have predators of their own, but that's just putting off the question: if the hyenas don't overpopulate because the lions eat them, then what's keeping the lions from overpopulating? I can't come up with anything that would prevent the apex predators from growing too numerous, then fighting each other over a dwindling prey population, then dying off entirely when there was no more food to find. Do predator populations self-regulate to prevent putting undo stress on their prey populations? Or is there some other mechanism to keep the predator hierarchy from becoming top-heavy?
No, I don't think auto-regulation explain much in the population sizes of predators. Group selection may explain such auto-regulation but I don't think it is of any considerable importance for this discussion. The short answer is, as @shigeta said [predators] tend to starve to death as they are too many! To have a better understanding of what @shigeta said, you'll be interested in understanding various model of prey-predator or of consumer-resource interactions. For example the famous Lotka-Volterra equations describe the population dynamics of two co-existing species where one is the prey and the other is a predator. Let's first define some variables… $x$ : Number of preys $y$ : number of predators $t$ : time $\alpha$ , $\beta$ , $\xi$ and $\gamma$ are parameters describing how one species influence the population size of the other one. The Lotka-Voltera equations are: $$\frac{dx}{dt} = x(\alpha - \beta y)$$ $$\frac{dy}{dt} = -y(\gamma - \xi x)$$ You can show that for some parameters the matrix for these equations have a complex eigenvalue meaning that the long term behavior of this system is cyclic (periodic behavior). If you simulate such systems you'll see that the population sizes of the two species fluctuate like this: where the blue line represents the predators and the red line represents the preys. Representing the same data in phase space, meaning with the population size of the two species on axes $x$ and $y$ you get: where the arrows shows the direction toward which the system moves. If the population size of the predators ( $y$ ) reaches 0 (extinction), then $\frac{dx}{dt} = x(\alpha - \beta y)\space$ becomes $\frac{dx}{dt} = x\alpha \space$ (which general solution is $x_t = e^{\alpha t}x_0$ ) and therefore the populations of preys will grow exponentially. If the population size of preys ( $x$ ) reaches 0 (extinction), then $\frac{dy}{dt} = -y(\gamma - \xi x)\space$ becomes $\frac{dy}{dt} = -y\gamma \space$ , and therefore the population of predators will decrease exponentially. Following this model, your question is actually: Why are the parameters $\alpha$ , $\beta$ , $\xi$ and $\gamma$ not "set" in a way that predators cause the extinction of preys (and therefore their own extinction)? One might equivalently ask the opposite question? Why don't preys evolve in order to escape predators so that the population of predators crushes? As showed, you don't need a complex model to allow the co-existence of predators and preys. You could describe your model a bit more accurately in another post and ask why in your model the preys always get extinct. But there are tons of possibilities to render your model more realistic such as adding spatial heterogeneities (places to hide for example as suggested by @AudriusMeškauskas). One can also consider other trophic levels, stochastic effects, varying selection pressure through time (and other types of balancing selection), age, sex or health-specific mortality rate due to predation (e.g. predators may target preferentially young ones or diseased ones), several competing species, etc.. I would also like to talk about other things that might be of interest in your model (two of them need you to allow evolutionary processes in your model): 1) lineage selection : predators that eat too much end up disappearing because they caused their preys to get extinct. This hypothesis has nothing to do with some kind of auto-regulation for the good of species. Of course you'd need several species of predators and preys in your model. This kind of hypothesis are usually considered as very unlikely to have any explanatory power. 2) Life-dinner principle . While the wolf runs for its dinner, the rabbit runs for its life. Therefore, there is higher selection pressure on the rabbits which yield the rabbits to run in average slightly faster than wolves. This evolutionary process protects the rabbits from extinction. 3) You may consider.. more than one species of preys or predators environmental heterogeneity partial overlapping of distribution ranges between predators and preys When one species is absent, the model behave just like an exponential model. You might want to make a model of logistic growth for each species by including $K_x$ and $K_y$ the carrying capacity for each species. Adding a predator (or parasite) to the predator species of interest ... and you might get very different results.
{ "source": [ "https://biology.stackexchange.com/questions/15514", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5917/" ] }
15,567
Can a human eat grass and digest it? Could it be possible to use it as food just like other plants such as wheat or beans?
To elaborate on A random zoologist's answer, the problem is that the human digestive system does not contain any cellulase enzymes. Cellulases are a class of enzymes that break down cellulose, the chief structural component of plants. You might be able to obtain a small amount of nutrition from grass or other cellulose-rich materials, but as the plant cell walls are made of cellulose, most of the plant material will be indigestible.
{ "source": [ "https://biology.stackexchange.com/questions/15567", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5925/" ] }
15,637
Is it a viral vs. bacterial thing? Is there just more variety among types of flu than other diseases, so that this year's vaccines don't cover next year's flu?
The flu virus changes rapidly so that the current vaccine doesn't work against the new strains. The way vaccines work is that they teach our immune system what to look out for. The vaccine contains bits of the virus but in a form that can't cause a proper infection, the body learns what to look for and next time before the virus can really get going the immune system kills it off first. In the case of flu, every year it looks different enough that the targeting mechanisms of our body don't recognise it. Flu being a RNA virus frequently mutates until it is slightly different. This is called antigenic drift, the changing of the antigens or the parts our body recognises. On top of that there's lots and lots of types of the influenza virus, that can not only infect humans but others which affect other animals. Occasionally the virus might combine with a random other strain making it completely new: an animal flu and human flu hybrid. These are the epidemics of swine or avian flu etc. This recombination is called antigenic shift. So each year scientists predict which viruses will affect us this coming year and grow them ready for vaccines. Of course there's some of the old virus floating around looking for someone to infect, but those infected can't be infected by it again if the immune system is working.
{ "source": [ "https://biology.stackexchange.com/questions/15637", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/4697/" ] }
15,676
My question is:- Only liquid water supports almost every living organism's metabolism, neither the vapour nor the condensed form of water does so. What is the chemical & the biological reason behind this fact?
The flu virus changes rapidly so that the current vaccine doesn't work against the new strains. The way vaccines work is that they teach our immune system what to look out for. The vaccine contains bits of the virus but in a form that can't cause a proper infection, the body learns what to look for and next time before the virus can really get going the immune system kills it off first. In the case of flu, every year it looks different enough that the targeting mechanisms of our body don't recognise it. Flu being a RNA virus frequently mutates until it is slightly different. This is called antigenic drift, the changing of the antigens or the parts our body recognises. On top of that there's lots and lots of types of the influenza virus, that can not only infect humans but others which affect other animals. Occasionally the virus might combine with a random other strain making it completely new: an animal flu and human flu hybrid. These are the epidemics of swine or avian flu etc. This recombination is called antigenic shift. So each year scientists predict which viruses will affect us this coming year and grow them ready for vaccines. Of course there's some of the old virus floating around looking for someone to infect, but those infected can't be infected by it again if the immune system is working.
{ "source": [ "https://biology.stackexchange.com/questions/15676", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5635/" ] }
16,470
I have recently been involved in collaborations that require me to model the population genetics of eukaryotic populations. I fear I may either be "re-inventing the wheel" or making conceptual mistakes (e.g. simplifying assumptions) in many of the techniques and decisions so far. I would very much appreciate recommendations of books about population/evolutionary genetics or micro evolution to deal with these fears. Preferable criteria are: Intuitively introduces key concepts. Emphasis on modelling with examples of problems and their solutions. Relatively short (I'm planning to read from cover to cover).
TL;DR I'd recommend Population Genetics: A Concise Guide (Gillespie) for an introduction to population/evolutionary genetics (thanks AGS for highlighting this big miss of mine on the first version of my answer). I'd recommend A Biologist's guide to mathematical modelling in evolution and ecology (Otto and Day) if you want to ensure your knowledge in mathematics by learning their application to evolutionary biology. General Entry Books to Population Genetics There are several books that offer an introduction to population genetics. I read Principles of Population Genetics (Hartl & Clarke) . I appreciated it but if I were you I think I would rather try Elements of population genetics (Charlesworth) or Population Genetics (Hamilton) . There is also Genetics of Populations (Hedrick) . I would tend to think that this last book presents lots of empirical population genetics data and doesn't take as much focus as the others in theoretical concepts (but I might be wrong). Gillespie's book Population Genetics: A Concise Guide is a classic. It is short, very easy to follow and pleasant to read. Gillespie's book might eventually be a little bit outdated but I would still highly recommend it. Emphasis on Analytical Modelling A Biologist's guide to mathematical modelling in evolution and ecology (Otto and Day) is a very good and very accessible book. It makes a good review about all subjects that are usually taught to first year students in Biology such as linear algebra for example. It is highly accessible and in the meantime it goes pretty far as it ends up talking about the application of diffusion equation in population genetics (Kimura's work among others). This book presents some important models in population genetics but as it aims to provide the tools for mathematical modelling in ecology and evolution it may under-considerate some fields of ecology and evolutionary biology. For example, the book does not talk about population structure nor about evolutionary game theory and there is little about Coalescent theory. Other books treating specific subjects within population genetics Coalescent Theory: an Introduction (John Wakeley) is a good book. I haven't read it completely for both time issues and because the math are a bit complicated for me. Coalescent theory offers a very important set of mathematical tools in evolutionary biology. There's also Mathematical population genetics (Ewens) . I am currently reading it. It is definitely not an introductory book and it really doesn't cover much of the most common fields in population genetics. If you are particularly interested in age-structured population, Evolution in age-structured populations (Charlesworth) is a very good book. Modeling evolution (Roff) offers some discussion on how to mathematically define fitness from phenotypic traits. While it is interesting I would not counsel you to buy it. Moreover, all the mathematics are quite basic and it aims to explain how to perform mathematical modelling with R which is to my opinion not essential to learn as other languages make a better job at dealing with math (Mathematica for example). Evolutionary Conservation Biology (Ferrière, Couvet and Dieckmann) is a very good book of conservation and conservation genetics. It develop some mathematical models that are of special interest to conservation of populations and communities. Ecology, Genetics and Evolution in Metapopulations (Hanski and Gaggiotti) is a book that may interest you as well. However it focuses much more on ecology than the other ones I cited above. Note: I haven't read it entirely. If you are interested in kin selection and level of selection, you might want to have a look at Major Transitions In Evolution (Maynard Smith and Szathmary) which is a classic (I have not read it though) or The Major Transitions in Evolution Revisited (Calcott and Sterelny) who encompass the opinion of many authors on the subject. Evolutionary Dynamics: Exploring the Equations of Life (Nowak) is also of interest esp. for those interested in epidemiology. Finally, you might want to have a look at the extremely well written and easy to read books by Dawkins such as The extended phenotype (Dawkins) for example. The Dawkins book are very popular and very very introductory. It offers more a way to think than the actual science behind evolutionary biology.
{ "source": [ "https://biology.stackexchange.com/questions/16470", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5005/" ] }
17,077
Why does evolution not make life longer for humans or any other species? Wouldn't evolution favour a long life?
Why do we age is a classical question in Evolutionary Biology. There are several things to consider when we think of how genes that cause disease, aging, and death to evolve. One explanation for the evolution of aging is the mutation accumulation ( MA ) hypothesis. This hypothesis by P. Medawar states that mutations causing late life deleterious (damaging) effects can build up in the genome more than diseases that cause early life disease. This is because selection on late acting mutations is weaker. Mutations that cause early life disease will more severely reduce the fitness of its carrier than late acting mutations. For example, if we said in an imaginary species that all individuals cease to reproduce at 40 years old and a mutation arises that causes a fatal disease at 50 years old then selection can not remove it from the population - carriers will have as many children as those who do not have the gene. Under the mutation accumulation hypothesis it is then possible for mutations to drift through the population. Another hypothesis which could contribute to aging is the antagonistic pleiotropy ( AP ) hypothesis of G.C. Williams. Pleiotropy is when genes have more than one effect, such genes tend to cause correlations between traits, height and arm length probably have many of the same genes affecting them, otherwise there would be no correlation between arm length and height (though environment and linkage can also cause these patterns)... Back to AP as an explanation for aging, if a gene improves fitness early in life, but causes late life disease it can spread through the population via selection. The favourable early effect spreads well because of selection and, just as with MA, selection can not "see" the late acting disease. Under both MA and AP the key point is that selection is less efficient at removing late acting deleterious mutations, and they may spread more rapidly thanks to beneficial early life effects. Also if there is extrinsic mortality (predation etc.) then the effect of selection is also weakened on alleles that affect late life. The same late-life reduction in the efficacy of selection also slows the rate at which alleles increasing lifespan spread. A third consideration is the disposable-soma model , a description by T. Kirkwood of life-history trade-offs which might explain why aging and earlier death could be favoured. The idea is that individuals have a limited amount of resources available to them - perhaps because of environmental constraints or ability to acquire/allocate the resources. If we then assume that individuals have to use their energy for two things, staying alive via repair and maintenance (somatic-maintenance) and making offspring (reproductive-investment), then any energy devoted to one will take away from the other. If an individual carries a gene that makes it devote all of its energy to somatic maintenance then its fitness will be very low (probably 0!) and that gene will not spread. If the level of maintenance required to live forever costs more energy than an individual can spare without suffering from low fitness (very likely) or can even acquire and efficiently convert in the first place (also very likely) then high-maintenance alleles will not spread (and aging & death will continue to occur). To go a little further, it is common for sexes to age differently (this is what I work on) and one possible explanation is that the sexes favour different balances of the trade off between somatic-maintenance and reproductive investment, this can lead to conflict over the evolution of genes affecting this balance and slow the rates of evolution to sex specific optima. This paper provides a good review of the area. To summarise , evolution has not managed to get rid of death via genetic disease etc. (intrinsic mortality) because the effect is only weakly selected against, and those alleles may provide some early life benefit, and resource limitation may also reduce the potential to increase lifespan due to trade-offs with reproductive effort. Adaptive evolution is not about the survival of the fittest but the reproduction of the fittest - the fittest allele is the one which spreads the most effectively. EDIT: Thanks to Remi.b for also pointing out some other considerations. Another thought is that of altruistic aging - aging for the good of the population (the population is likely to contain related individuals, you are related to all other humans to some degree). In this model aging is an adaptive process (unlike in MA where it is just a consequence of weak selection). By dying an individual makes space for it's offspring/relatives to survive (because resources are then less likely to limit populations). This will stop excessive population growth which could lead to crashes in the population and so, by dying earlier, an individual promotes the likelihood that its progeny will survive. Arguments of altruistic sacrifice are often hard to promote but recent work suggests that this is a more plausible model than once thought . Evolvabilty theories also suggest that aging is an adaptive process. These suggest that populations, composed of a mixture of young and old, have biases in how well adapted the members of the population are - where younger individuals are better adapted (because they were produced more recently it is likely that the environment is similar to the environment they are favoured in). Thus by removing the less well adapted individuals from a population via senescence and freeing up resources for younger better adapted individuals, a population evolves more rapidly towards it optimal state.
{ "source": [ "https://biology.stackexchange.com/questions/17077", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6563/" ] }
17,546
I've seen some articles which came in contradiction with each other. The first article was talking about flying dinosaurs, dinosaurs with feathers and so on. A couple of other articles are talking about misconceptions about dinosaurs one of them being that there are no flying dinosaurs but just flying reptiles (from scholastic.com and livescience.com ). So, which one is right? Also if possible please provide a source for argument. I cannot find the first article again.
Birds are both flying dinosaurs and flying reptiles. Yes, that's potentially confusing. To understand the apparent contradiction, you have to understand how modern classification of organisms works ( phylogenetic systematics ). Under the old (Linnean) classification system, Reptilia (reptiles) was an order and Aves (birds) was a separate order. Phylogenetic systematics, which has completely replaced the Linnean system, views all organisms as interrelated in a nested set of monophyletic groups (clades). It's like a set of venn diagrams, where all organisms fall into a giant circle and then successively smaller circles classify more and more specific groups. The clade Reptilia includes snakes, lizards, crocodiles, and lots of extinct groups, including dinosaurs. So all dinosaurs are reptiles. The clade Dinosauria includes all the extinct dinosaurs ( Stegosaurus , Triceratops , sauropods, etc.), including theropod dinosaurs, which include well known dinosaurs like Tyrannosaurus and Allosaurus . Based on a mountain on anatomical evidence, including lots of transitional fossils, living birds are a sub-group of theropod dinosaurs . So all birds (Aves) are theropod dinosaurs (Dinosauria: Theropoda). All dinosaurs are reptiles. Therefore, birds are dinosaurs and reptiles. They are just more closely related to dinosaurs than to other reptiles. The tricky part is that most people have an intuitive idea of what "reptiles" and "dinosaurs" are. To a systematist, whose job it is to classify organisms, these terms don't mean the same thing as they do to most people. Systematists think about groups like Reptilia and Dinosauria and how those groups are related to one another. So they have no problem saying that birds are dinosaurs and reptiles, because birds are nested within both of those groups. A few words about pterosaurs Along with birds and bats, pterosaurs are the other clade of vertebrates capable of powered, flapping flight. Pterosaurs fall within Reptilia (and Diapsida and Archosauria) along with Dinosauria, which includes birds. There are a lot of other extinct lineages in the tree that are not shown, e.g., ornithodirans that are not dinosaurs and not pterosaurs. Pterosaurs and birds share anatomical features that all reptiles, diapsids, archosaurs, and ornithodirans have, which is how we know that they are more closely related to each other than to other groups, like crocodiles. But their flight structures evolved independently and are anatomically distinct fro one another. So pterosaurs are flying reptiles but not flying dinosaurs. These images might help you understand the above explanation.
{ "source": [ "https://biology.stackexchange.com/questions/17546", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6788/" ] }
17,728
1: There seem to be cases where coma patients with a non-active brain (i.e. flat EEG) have regained full consciousness. => Apparently memory and knowledge are stored independent of brain activity. 2: There seem to be animals (e.g. hamsters) that can be frozen to complete organic inactivity and will regain full functionality after being thawed. => Apparently the stored memory does not depend on blood flow and other support. 3: From this I assume that quickly cooling a human brain to a temperature low enough to avoid decomposition would preserve the state of that brain that corresponds to that human's memories, knowledge, cogntivie abilities, and maybe consciousness at the time of cooling. => With the proper technology that "content" is theoretically retrievable. Q: How long would that state remain after death in a brain left at room temperature? Or in other words: How long does it take for decomposition to destroy memory? Addendum: The fact that the stored memory may not be accessible with current means is not relevant to my question. We cannot access the information stored in Linear A , but this unretrievability does not delete the information.
There are multiple levels of memory, some of which would die immediately, some of which would take some time. So the answer is: it depends; some immediately, some only very slowly. At the highest level, the current neuronal firing state of the brain encodes memory on a very short scale - working memory. The memory held on this level does not have a clear anatomical counterpart (but for the potential encoded in the synapses). It equals very short-term memory/STM sequences, such as the words you read just before you read the words you're reading right now. This memory is lost immediately when you lose consciousness, at least to some degree; as this memory is hard to even strictly distinguish from consciousness and attention (though see Jonides et al. 2008 ). Other forms of short-term memory/STM are stored in a slightly different form: short-term potentation, the adaption of neuronal responses following brief and intense stimulation. Spike Frequency Adaption/SFA is at an intermediate stage between this and the previous level. Short-term potentation and SFA decay within minutes or even seconds if they are not transferred into some more durable form of memory. Long-term memory (/LTM) stores have specific anatomical correlates; they are stored in, amongst others, the synaptic weights (i.e. the amount of influence the firing of one neuron has on another). Some forms of LTM are best located in cortical synapses, others in the hippocampus. An even more fundamental, long-term, durable storage form is the wiring itself; not just the weights, but the existence of a synapse between two points, or not. For example, an important part of early learning is synaptic pruning, where synapses which do not play a meaningful role die off, whereas those which connect functionally related brain areas remain. This pruning instantiates one form of learning, and the non-existence of a synapse is a form of memory. Synapses are comparatively stable. Even if the corresponding neurons die, in principle, the synapses still exist - and more importantly, the nonexistence of a synapse is even more durable. This form of memory can be observed in slice preparations of animals long dead. For a simple example, consider any experiment on the neuronal responses in slice preparations, which can be considered a form of (decontextualised) memory access. On the most extreme end, epigenetic adaptions and large-scale brain anatomy (which shows developmental traces) can be considered a form of memory that will remain intact until the whole structure rots away. However, the more direct answer to the question the OP is asking is that once a large amount of neurons have died (brain death), there is currently no power on earth that can access a non-trivial amount of memory. As long as this is averted, nontrivial amounts of memory can be recovered. For the parts that are lost immediately, see the source by Jonides et al. For more durable memory, you could look at for example Purves et al, Neuroscience .
{ "source": [ "https://biology.stackexchange.com/questions/17728", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/-1/" ] }
19,850
What causes the noise when you crack a joint? Is joint cracking harmful?
The exact mechanism is unclear. Here are some possible causes: rapid collapsing of cavities inside the joint [1]; rapid ligament stretching [1]; breaking of intra-articular adhesions [1]; escaping gases from synovial fluid [2]; movements of joints, tendons and ligaments [2]; mechanic interaction between rough surfaces [2], mostly in pathological situations like arthritis (and it is called crepitus [3]). There are no known bad effects of joint cracking [1, 4]. There are no long term sequelae of these noises, and they do not lead to future problems. There is no basis for the admonition to not crack your knuckles because it can lead to arthritis. There are no supplements or exercises to prevent these noises [4]. And no good effects either: Knuckle "cracking" has not been shown to be harmful or beneficial. More specifically, knuckle cracking does not cause arthritis [5]. References: Wikipedia contributors, "Cracking joints," Wikipedia, The Free Encyclopedia, http://en.wikipedia.org/w/index.php?title=Cracking_joints&oldid=617403659 (accessed July 22, 2014). The Library of Congress. Everyday Mysteries. What causes the noise when you crack a joint? Available from http://www.loc.gov/rr/scitech/mysteries/joint.html (accessed 22.07.2014) Wikipedia contributors, "Crepitus," Wikipedia, The Free Encyclopedia, http://en.wikipedia.org/w/index.php?title=Crepitus&oldid=615557134 (accessed July 22, 2014). Johns Hopkins Sports Medicine Patient Guide to Joint Cracking & Popping. Available from http://www.hopkinsortho.org/joint_cracking.html (accessed 22.07.2014) WebMD, LLC. Will Joint Cracking Cause Osteoarthritis? Available from http://www.webmd.com/osteoarthritis/guide/joint-cracking-osteoarthritis (accessed 22.07.2014)
{ "source": [ "https://biology.stackexchange.com/questions/19850", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/8424/" ] }
19,967
Besides religious prohibition, there are several non-religious arguments against eating pork. A few of which are: Pigs and swine are so poisonous that you can hardly kill them with strychnine or other poisons. Swine and pigs have over a dozen parasites within them, eg tapeworms, flukes, worms, and trichinae. There is no safe temperature at which pork can be cooked to ensure that they will be killed The swine carries about 30 diseases which can be easily passed to humans I would like to hear some scholarly verification regarding these points. Simple Yes-No-Yes will be enough, elaboration is welcome, though. Thank You
Pigs and swine are so poisonous that you can hardly kill them with strychnine or other poisons. This is a non-sequitur . An animal being poisonous does not imply that it resists to poison, nor the reverse is true. In any case, to the extent of my knowledge pigs do not produce any specific poison. Obviously, if you could provide a more specific claim, this could be tested a bit more in depth. The second part, instead, is plain false. You can definitely kill a pig with strychnine. Both the Merk veterinary manual and Diseases of swine, 9th edition report an oral lethal dose of 0.5-1 mg/kg. For comparison, the CDC reports a probable lethal oral dose of 1.5-2 mg/kg for humans. Swine and pigs have over a dozen parasites within them, eg tapeworms, flukes, worms, and trichinae. Sure, pigs do have parasites. Chapter 55 of Diseases of swine is specifically on parasitic infections. Now, do ALL pigs have them? The answer is no, some parasites are more common than other, and the amount of parasites depends on the health status of the farm. For instance: Northern Europe ( Roepstorff et al. 1998 ) In Denmark (DK), Finland (FIN), Iceland (I), Norway (N), and Sweden (S), 516 swine herds were randomly selected in 1986-1988. Individual faecal analyses (mean: 27.9 per herd) from eight age categories of swine showed that Ascaris suum, Oesophagostomum spp., Isospora suis, and Eimeria spp. were common, while Trichuris suis and Strongyloides ransomi-like eggs occurred sporadically. Large fatteners and gilts were most frequently infected with A. suum with maximum prevalences of 25-35% in DK, N and S, 13% in I and 5% in FIN. With the exception of the remarkably low A. suum prevalence rates in FIN, no clear national differences were observed. Oesophagostomum spp. were most prevalent in adult pigs in the southern regions (21-43% in DK and southern S), less common in the northern regions (4-17% adult pigs infected), and not recorded in I. I. suis was common in piglets in DK, I, and S (20-32%), while < 1% and 5% were infected in N and FIN, respectively. Eimeria spp. had the highest prevalences in adult pigs (max. 9%) without clear geographical differences. I. suis and Eimeria spp. were recorded for the first time in I, and I. suis for the first time in N. USA ( Gamble et al. 1999 ) To determine Trichinella infection in a selected group of farm raised pigs, 4078 pigs from 156 farms in New England and New Jersey, employing various management styles, were selected based on feed type (grain, regulated waste, non-regulated waste). [...] A total of 15 seropositive pigs on 10 farms were identified, representing a prevalence rate of 0.37% and a herd prevalence rate of 6.4%. A total of nine seropositive pigs and one suspect pig from six farms were tested by digestion; four pigs (representing three farms) harbored Trichinella larvae at densities of 0.003-0.021 larvae per gram (LPG) of tissue; no larvae were found in six pigs. China ( Weng et al. 2005 ): The prevalence of intestinal parasites was investigated in intensive pig farms in Guangdong Province, China between July 2000 and July 2002. Faecal samples from 3636 pigs (both sexes and five age groups) from 38 representative intensive pig farms employing different parasite control strategies were examined for the presence of helminth ova and protozoan oocysts, cysts and/or trophozoites using standard techniques. Of the 3636 pigs sampled, 209 (5.7%) were infected with Trichuris suis, 189 (5.2%) with Ascaris, 91 (2.5%) with Oesophagostomum spp., 905 (24.9%) with coccidia (Eimeria spp. and/or Isospora suis) and 1716 (47.2%) with Balantidium coli. These infected pigs were mainly from farms without a strategic anti-parasite treatment regime . However, note that Boes et al. 2000 reports higher percentages. The prevalence of helminths in pigs was investigated in five rural communities situated on the embankment of Dongting Lake in Zhiyang County, Hunan Province, People's Republic of China, in an area known to be endemic for Schistosoma japonicum. The helminth prevalences identified on the basis of faecal egg count analysis were: Oesophagostomum spp. (86.7%), Ascaris suum (36.7%), Metastrongylus spp. (25.8%), Strongyloides spp. (25.8%), Trichuris suis (15.8%), Globocephalus spp. (6.7%), Gnathostoma spp. (4.2%), Schistosoma japonicum (5.0%) and Fasciola spp. (1.3%). Kenya ( Nganga et al. 2008 ): A total of 115 gastrointestinal tracts (GIT) from 61 growers and 54 adult pigs were examined between February 2005 and January 2006. Seventy eight (67.8%) had one or more helminth parasites, of which thirty six (31.3%) were mixed infection. Ten types of helminth parasites encountered in descending order of prevalence were, Oesophagostomum dentatum (39.1%), Trichuris suis (32.2%), Ascaris suum (28.7%), Oesophagostomum quadrispinulatum (14.8%), Trichostrongylus colubriformis (10.4%), Trichostrongylus axei (4.3%), Strongyloides ransomi (4.3%), Hyostrongylus rubidus (1.7%), Ascarops strongylina (1.7%) and Physocephalus sexalutus (0.9%). There is no safe temperature at which pork can be cooked to ensure that they will be killed False. Proper cooking, as well as freezing (but see below) are effective in killing worms. The CDC suggest: The best way to prevent trichinellosis is to cook meat to safe temperatures. A food thermometer should be used to measure the internal temperature of cooked meat. Do not sample meat until it is cooked. USDA recommends the following for meat preparation. For Whole Cuts of Meat (excluding poultry and wild game) Cook to at least 145° F (63° C) as measured with a food thermometer placed in the thickest part of the meat, then allow the meat to rest for three minutes before carving or consuming. For Ground Meat (excluding poultry and wild game) Cook to at least 160° F (71° C); ground meats do not require a rest time. Also Curing (salting), drying, smoking, or microwaving meat alone does not consistently kill infective worms; homemade jerky and sausage were the cause of many cases of trichinellosis reported to CDC in recent years. Freeze pork less than 6 inches thick for 20 days at 5°F (-15°C) to kill any worms. Freezing wild game meats, unlike freezing pork products, may not effectively kill all worms because some worm species that infect wild game animals are freeze-resistant. Clean meat grinders thoroughly after each use. The swine carries about 30 diseases which can be easily passed to humans Again, sure pigs can carry diseases that can be passed to humans, but proper storing and cooking of meat is effective in getting rid of the great majority of bacteria. Finally in 2012 Public health England reported food poisoning caused by red meat as accounting for 17% of all food poisoning incidents, with pork accounting for 3%. By comparison, poultry accounted for 29% of food poisoning events (although people eat more poultry than red meat). Similarly, the CDC report on the Attribution of Foodborn Illness (1998-2008) puts red meat accounting for 12%, pork as accounting for 5.4% and poultry 9.8%.
{ "source": [ "https://biology.stackexchange.com/questions/19967", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5823/" ] }
20,486
Vomit comes from gastric acid, right? And in gastric acid there is HCl and HCl is corrosive (strong), how come when I vomit, it doesn't destroy things that it (as the vomit) hits (such as floor, table)?
First of all, it is corrosive. People which are bulimic often get problems with their teeth getting damaged by the permanent exposure to the acidic stomach fluids. See the paper for more information: Bulimia and tooth erosion Then it is a matter of concentration. According to Wikipedia, the concentration of the acid in the stomach is around 0.5% which is a pretty low concentration. Additionally the acid gets diluted when you eat or drink things. And last but not least not all things are very susceptible to a fast degradation by acids. Thing tend also not to disappear suddenly, if they come in contact with acids.
{ "source": [ "https://biology.stackexchange.com/questions/20486", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/8651/" ] }
20,489
Is there any relationship between heartbeat rate and life span of an animal? Do they belong to a cause-and-effect relationship or are they both caused by some phenomenons or a common cause?
Interestingly there is a inverse negative correlation between heart rate and life span, meaning the faster your heart rate is, the shorter is your lifespan. See this figure (from the paper 2 cited below): When the authors plotted the approximately total heartbeats vs. the lifespan, the amount of total heartbeats was in a pretty narrow corridor: So it seems that at least the hearts in mammals have a maximum number of strokes they could do. The obvious question what causes this phenomenon is not really answered. Since the metabolism of small animals is (compared to their weight) higher and also their oxygen consumption is higher because of that, it is hypothesized that this causes more reactive oxygen species and related damage which subsequently leads to an earlier death. See the references for more details: Rest heart rate and life expectancy. Heart rate, lifespan, and mortality risk Oxidative damage to DNA: relation to species metabolic rate and life span
{ "source": [ "https://biology.stackexchange.com/questions/20489", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/4254/" ] }
20,657
Some people say that it's awful that humans eat animals. They feel that it's barbaric, because you're killing life and then on top of that, you're eating it, and that you should eat vegetation instead. But isn't vegetation life too? Personally, I see no difference between animals and veg as all life has cells, dna etc So my question is, is it possible for humans to live healthy long lives without eating any type of life, i.e no animals, no plants, no cells (dead or alive) etc? If it is possible, how would it be done?
The answer to your question is yes it is certainly possible. At one time it was thought that there was something special about "organic" chemicals which meant that they could not be artificially synthesised out of fundamental elements. In 1828 Frederick Wöhler synthesised urea (CO(NH 2 ) 2 ) which is often taken as the first demonstration that the organic v inorganic distinction was not a sound one (for more on this see the Wikipedia article on Wöhler synthesis . As far as we know all essential human nutrients can be synthesised from inorganic ingredients, even complex molecules such as Vitamin B 12 . Other contributors have pointed out that organic pathways for synthesising our food have evolved over long periods to be very efficient - at least in the conditions prevailing on Earth. You haven't ruled out copying biochemical pathways using chemicals that are entirely of inorganic origin. Anyone trying to do this seriously could create glucose (for example) by artificially creating enzymes (perhaps via artificial DNA) to do the job. The thing is that we already have self-replicating and repairing machines to do that already (plants). There might be circumstances when we needed to use artificial synthesis. I can think of two science-fiction stories that deal with this question, the first of which goes into some detail: The Moon is Hell by John W. Campbell, in which astronauts are stranded on the moon and forced to make food from what they find there. Technical Error by Arthur C. Clarke, in which a man is accidentally rotated through the fourth dimension. His employers contemplate the difficulty caused by the "handedness" of many biological molecules meaning they would have to artificially synthesise many of his foods. It may be that a future expedition to Mars (say) might have to think about these things. A little searching fails to come up with standard inorganic syntheses of glucose and similar substances. The reason for this is almost certainly because it is so easy to use organic inputs. Glucose is easily made by the hydrolysis of starch. Starch is very common and cheap. Even l-glucose is usually made out of organically derived precursors (or sometimes even using d-glucose). UPDATE: sources etc One problematic question is: where do you get your input for making nutrients? As others have pointed out, exactly where to draw the line is difficult. This problem starts in defining what is alive in the first place. Do you count viruses (which can go down to a few thousand base pairs of RNA) or satellite viruses (STobRV has only 359 base pairs) or prions? In a sense these are "just" very large molecules. But then really simple bacteria are not many orders of magnitude more complex. As an aside most systems of ethics that do not permit eating meat do not make an alive/non-alive distinction, choosing some other aspect such as sentience, though Jainism comes close to doing so. The second problem is, if we reject living things as sources of food, how far removed from those living things are we allowed to get? You say no cells in any state including "dead". That would exclude (say) fruit even though most fruits are expressly created by plants in order to be eaten (and in some cases must be eaten) - something that vegans, jains, fruitarians and others would be happy with eating. If we could use dead material things would be much easier. But would you also include hydrocarbons (coal, oil, gas) which were once living organisms? If you do, then you are in difficulty because terrestrial carbon is recycled through the biosphere. All CO2 was (to a close approximation) once a part of a living thing. If you take that position then of course you are going to have to go off-planet to find your source chemicals and your problem becomes very much harder. I was assuming that you were restricting yourself to consuming cells that retain some of their cell structure but had not completely degraded. If that is where you draw the line then there are ample sources of raw materials on earth. Genetic modification is much more science fiction though not entirely impossible. Some nutrients could be made by humans without much difficulty. Our inability to manufacture vitamin C is down to one missing enzyme (L-gulono-gamma-lactone oxidase) which is present in most vertebrates (I think of mammals only guinea pigs, humans and some bats are unable to synthesise it). You could certainly imagine some very careful genetic modification changing humans so they no longer need to consume vitamin C. But photosynthesis would be much harder. Chloroplasts (which do the job in most plants) are really a very primitive form of life living in plant cells which may independently reproduce (and for that reason might be excluded by you - they aren't "cells" but they have membranes). They could easily end up in conflict with our mitochondria (since intracellular conflict between organelles is possible) and you would need to do enormous amounts of work to make human cells co-operate with them properly. More in keeping with your theme would be adding photosynthetic systems directly to human cells along with a suite of enzymes to manufacture all the things we cannot. That is of course in principle scientifically possible (since plants do it) but much harder than it looks. Living systems are very complicated and small changes can have unexpected consequences. Even very minor genetic modifications are problematic. The human autotroph is likely to be some way off.
{ "source": [ "https://biology.stackexchange.com/questions/20657", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/668/" ] }
20,731
It is well known that the European colonists brought many infectious diseases to the Americas, and that these had a deadly effect on the native populations, because they had no immunity to them. Were there any local infectious diseases to which the colonists were not immune? I’ve never heard of such. I’m not aware that the colonists suffered any epidemics, or that they brought any new and unusual diseases back to Europe. Why not? Is this merely an accident of history, that there were no infectious diseases in the Americas which did not already exist in Eurasia? Or is there some explanation?
In "Guns, Germs, and Steel" Jared Diamond includes quite a bit on this topic. His conclusion is that Europeans, and old world humans in general were much more exposed to their farm animals, often living in the same buildings. This allowed a much greater number of diseases to jump from animal to human, forcing us to development immunity against these pathogens. The native americans never domesticated as many animals, and weren't exposed to as many pathogens. As a result the foreign pathogens could freely move through their populations. So why did it only go one way? A lot more Europeans came to American than vice-versa, so there just wasn't as much opportunity for American pathogens to move to Europe. Additionally, the Europeans brought a lot of animals here, including cattle, horses, and pigs. These would have carried pathogens as well, again, very few American animals were taken to Europe.
{ "source": [ "https://biology.stackexchange.com/questions/20731", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/975/" ] }
20,912
Throughout high school, I remember learning about Darwin's theory of evolution as if it were near-fact. But something always seemed wrong about the ideas presented. Survival of the fittest Random mutation Natural Selection All of these things seem to account for some margin of evolutionary progress, but I always remained skeptical that the extremely complex features of life could have formed from these methods alone, even after hundreds of millions of years. Here's what I notice: Any time a species has needed the development of a specific feature to survive, it has developed that feature, and that feature precisely. I'm going to use this example: Turtles on an island where shrubbery grew higher up developed longer necks, to reach the leaves. I imagine that turtle looking up at that food, and sub-consciously wishing to get to it, constantly straining, for its entire lifetime. It seems plausible to me that we (advanced life) could have a biological mechanism to "write" needed alterations into either our own DNA or our reproductive DNA over time, triggering the very specific evolutionary developments necessary to our survival without relying on random mutation. My question: Is this possible? Does any similar mechanism exist that we know of? If not, how can so many specific (advanced) evolutionary leaps be otherwise explained?
This entire answer will be long, so read the short part first, then read the rest if you (or anyone else) is curious. Citations are included in the long section. I can include additional citations in the short section if needed. Long Story Short Your question touches on some common misconceptions about how the evolutionary process. Organisms don't "want" to evolve traits. Traits evolve through the biological processes of random mutation and natural selection. Organisms do not "want" to evolve traits. (Well, OK, I'd love to evolve an extra pair of hands but that is not possible.) Natural selection works by modifying existing traits. Your turtle can stare all she wants at food out of reach but she will not evolve a longer neck. Instead, natural variation exists among neck lengths of the turtles because of variation of the genes that determine features related to overall boxy size. Those individuals with longer necks may be able to get a bit more food, live a little longer, and reproduce a little more. They will pass along their genes to their offspring, so perhaps more of their offspring will also have longer necks. Over many generations, the turtles may have somewhat longer necks. A common misconception is that the traits of organisms are precisely adapted for a specific need. They are not, for a few reasons. First, natural selection occurs relative to the current environment. Adaptations that work well in one environment may not be so useful in another environment. Environments are rarely stable over evolutionary time so traits are subject to constant change. Next, as mentioned above, natural selection can only work on what traits are present. While an extra set of arms would be handy, I am a tetrapod. My four appendages, along with the appendages of all other tetrapods, trace back to our common ancestor. The appendages of all tetrapods are modifications of that ancestral trait. Finally, organisms haven't "sampled" the entire realm of possible mutations and combinations of mutations. In other words, a certain mutation or set of mutations might actually be able to adaptively improve a particular trait in the current environment but, if the mutations never occur, then the improvement can never happen. We only need to look at ourselves to realize how imperfectly adapted we are. We get bad backs and knees because our bodies weren't designed to walk upright. We evolved from quadrupedal organisms. This has happened so recently that changes in the structure of our knees and backs haven't yet evolved (and may never). Search the internet for the "blind spot" eye test. We have a mass of blood vessels in front of the retina of our eyes, which reduces our visual accuity. We often have to have teeth pulled from our jaws because the flattening of our face (relative to our australopithicine ancestors) has shorted our jaws. We don't have as much room for our teeth but we have not evolved a reduced number of teeth. As for human technology being able to make direct changes to our DNA to improve our adaptability, I would say no. While I do not have the ability to see into the future, the complexity of our genome, and more specifically how genes are regulated, suggests to me this would be a very daunting if not impossible task. See the long answer below for more on regulatory genes but the gist is that a small set of regulatory genes control most of the other genes (including other regulatory genes). The interactions are extremely complex and we have a detailed understanding of very few of these interactions. I speculate that affecting one such gene in a "positive" way is very likely to have many unintended negative consequences. Below are some simple math and other ideas to show you how mutations can lead to the many adaptive traits that you see among the diversity of life on earth. Long Story how can so many specific (advanced) evolutionary leaps be otherwise explained? Mutations occur at random throughout the genome. Most mutations will be neutral. That is, they are neither bad or good from an evolutionary viewpoint. The mutations are neutral because the genome for most organisms is non-functional. Mutations that occur in the functional regions of DNA (i.e., protein-encoding and related regions) are more likely to be detrimental (bad) because the mutation may negatively affect the function of the protein or even the ability to produce the protein. However, some mutations are beneficial. The mutation may actually enhance the functionality of the protein or even produce new proteins. A couple of factors have to be considered regarding mutations. The mutation rate is very low. For example, Kumar and Subramanian (2002) compared the DNA sequences of 5669 protein-encoding genes from 326 species of mammals. Their results suggested that the average mutation rate among mammals is 2.2 x 10 $^{-9}$ per base pair (bp) per year. This means that, on average, a point mutation has changed each DNA nucleotide position in the mammalian genome slightly more than twice (2.2 times) every billion (10 $^9$ ) years. That's a lot of time! However, this same rate occurs in every individual in the population, so you have to consider the population sizes of the organisms. So, let's do a simple exercise. Consider a species like the rock pocket mouse or another small mammal that has a very short generation time. For this simple example, let's assume the generation time is one year. That means that the mutation rate of 2.2 x 10 $^{-9}$ per bp per year would then correspond to 2.2 x 10 $^{-9}$ mutations per bp per generation. Generation time is important because new mutations are inherited only through reproduction. Assume the average mammalian diploid genome is about 6 billion (6 x 10 $^9$ ) nucleotides in size. The number of heritable mutations that occur in a single offspring is $$(6 \times 10^9) \times (2.2 \times 10^{-9}) = 13.2.$$ Next, assume that about 2.5% of the mammalian genome is composed of functional, transcribed sequences that may affect the phenotype (the traits of the organism). That means that, of all the mutations that occur in every offspring every generation, about 2.5% could potentially affect the phenotype. That is, $$13.2 \times 0.025 = 0.33.$$ Still a small number. But, now we have to account for population size. Small mammals, like mice and voles, generally have large population sizes. Assume that the population of rock pocket mice contains 100,000 reproducing individuals. If so, then $$0.33 \times 100,000 = 33,000,$$ which is the number of new heritable mutations that could occur in the population. Most of these mutations will be detrimental and removed from the population by natural selection but, if even a small fraction of these new mutations are beneficial, then natural selection can cause these beneficial mutations to increase rapidly in frequency in the population during future generations. In humans, Nachman and Crowell (2000) estimated that the average mutation rate was 2.5 x 10 $^{-8}$ mutations per bp per generation (not year), by comparing the genomes of humans and chimps. If we assume the same genome size and effective human population size of 500,000 individuals, then applying the same math suggests that 1,875,000 new mutations that potentially affect phenotype occur in the human population every generation. Again, only some of these will be beneficial but that is still the possibility of a number of new beneficial mutations. In evolutionary terms, a mouse or human generation is the blink of an eye. How long would it take for a beneficial mutation to spread through a population? That depends on two things. How beneficial is the mutation (called the strength of selection, s ) and the population size? To estimate how long it would take for a beneficial mutation to spread through a population, we can use the formula, $$t = \frac{2}{s}\mathrm{ln}(2N_e),$$ where $t$ is time in generations, $s$ is the strength of selection, and $N_e$ is the effective population size (number of reproducing individuals). For the strength of selection, let's assume $s=0.01$ , which is weak but positive natural selection. Going back to our rock pocket mice with $N_e = 100,000$ , then the beneficial mutation would be spread throughout the population in only 2441 generations (remember, we're talking evolutionary time so 2000 years is nothing). If $N_e = 10,000$ , the mutation spreads in only 1981 generations. If we increase the strength of selection t 0.2, then the times are 122 and 99 years for population sizes of 100,000 and 10,000 years, respectively. These "back of the napkin" calculations show just how quickly even weakly beneficial mutations can appear and spread throughout a population. Yet, this doesn't include other types of mutations like gene duplications that can also allow new proteins to evolve. For example, human ability to see red colors is due to a simple gene duplication (Nathans et al. 1996 and references therein). This duplication also explains the common form of red-green colorblindness. Whew! There's yet more to our mutational story. Consider humans and chimps, which are nearly identical from a genetic standpoint (between 96-99% depending on how you calculate it) yet they appear very different. If humans and chimps diverged from their common ancestor within the past five million years, how could they differ so much? This question was initially posted by [King and Wilson (1975)]. They argued that mutations to structural proteins (like those that compose bones and muscles) would not be enough to explain the phenotype differences between humans and chimps. The proposed that regulatory genes are the key to understanding the big differences. Regulatory genes are those that control other genes, by turning them on or off and other important functions. Changes to the regulatory genes can cause fairly rapid changes to the phenotype. This understanding has led to the broad (and fascinating) field of evolutionary developmental biology . This field focuses on how mutations in regulatory genes associated with development (from embryo to adult) have had a long-term evolutionary impact. The field is rich with examples, but one cool one is associated with duck feet and bat wings. Let's begin with the embryo. Most vertebrate embryos have membranes between the digits (fingers and toes) during an early stage of development. For most vertebrates, the membranes are lost later in development. The small flaps of skin you have between your fingers are the remnants of your embryonic membranes. A set of regulatory genes called BMPs (and a couple of others) are responsible for causing the loss of the membrane in vertebrates. However, through different sets of mutations, the BMPs are not able to function in duck feet and bat hands. Thus, they both end up with membranes between their digits ( Weatherbee et al. 2006 ). Thus, two different mutations block the same set of developmental genes, leading to novel adaptations in two very different types of vertebrates. One final example is the evolution of bird feathers from scales. As you may know, birds are evolved from dinosaurs. It turns out that bird feathers and alligator scales (alligators are birds closest living relative) use the same regulatory genes to develop. The genes are BMP2 and SHH (sonic hedgehog for fans of the old computer game) ( Harris et al. 2002 ). Other regulatory genes underlie the different types of feathers, like downy feathers and flight feathers (Harris et al. 2002). Literature Cited Harris, M.P. et al. 2002. Shh-Bmp2 Signaling module and the evolutionary origin and diversification of feathers. Journal of Experimental Biology 294: 160-178. King, M.-C. and A.C. Wilson. 1975. Evolution at two levels in humans and chimpanzees. Science 188: 107-116. Kumar, S. and S. Subramanian. 2002. Mutation rates in mammalian genomes. Proceedings of the National Academy of Sciences USA 99: 803-808. Nachman, M.W. and S.L. Crowell. 2000. Estimate fo the mutation rate per nucleotide in humans. Genetics 156: 297-304. Weatherbee, S.D. et al. 2006. Interdigital webbing retention in bat wings illustrates genetic changes underlying amniote limb diversification. Proceedings of the National Academy of Sciences USA 103: 15103-15107,
{ "source": [ "https://biology.stackexchange.com/questions/20912", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/19073/" ] }
21,159
I was thinking yesterday about insects (as there was a spider in the house, and I couldn't help but think of anything else, even though they aren't insects), and I started to wonder if ants sleep? After thinking about it for a while I decided that they might sleep, but then what would be the purpose of sleeping for them? My limited understanding of the need of sleep is that it is used for the brain to compartmentalise the events of the day and allow memories to be formed. But ants don't really have to think about much during the day, given that they act more as a collective than an individual. Or in the case of other insects, they have simpler more instinctive brains which rely on taxis, reflexes and kineses. So, do ants and other insects sleep (or do they have a different type of sleep to us) and what would the purpose of it be for them?
A quick search on Web of Science yields "Polyphasic Wake/Sleep Episodes in the Fire Ant, Solenopsis Invicta" ( Cassill et al., 2009 , @Mike Taylor found an accessable copy here ) as one of the first hits. The main points from the abstract: Yes, ants sleep. indicators of deep sleep: ants are non-responsive to contact by other ants and antennae are folded rapid antennal movement (RAM sleep) Queens have about 92 sleep episodes per day, each 6 minutes long. Queens synchronize their wake/sleep cycles. Workers have about 253 sleep episodes per day, each 1.1 minutes long. "Activity episodes were unaffected by light/dark periods." If you study the paper you might find more information in its introduction or in the references regarding why ants sleep, although there doesn't seem to be scientific consens. The abstract only says that the shorter total sleeping time of the workers is likely related to them being disposable.
{ "source": [ "https://biology.stackexchange.com/questions/21159", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6330/" ] }
21,216
I was just sitting with my hand next to my nose and I realized that air was only coming out of the right nostril. Why is that? I would think I would use both, it seems much more efficient. Have I always only been breathing out of my right nostril?
Apparently you're not the first person to notice this; in 1895, a German nose specialist called Richard Kayser found that we have tissue called erectile tissue in our noses (yes, it is very similar to the tissue found in a penis). This tissue swells in one nostril and shrinks in the other, creating an open airway via only one nostril. What's more, he found that this is indeed a 'nasal cycle', changing every 2.5 hours or so. Of course, the other nostril isn't completely blocked, just mostly. If you try, you can feel a very light push of air out of the blocked nostril. This is controlled by the autonomic nervous system. You can change which nostril is closed and which is open by laying on one side to open the opposite one. Interestingly, some researchers think that this is the reason we often switch the sides we lay on during sleep rather regularly, as it is more comfortable to sleep on the side with the blocked nostril downwards. As to why we don't breathe through both nostrils simultaneously, I couldn't find anything that explains it. Sources: About 85% of People Only Breathe Out of One Nostril at a Time Nasal cycle
{ "source": [ "https://biology.stackexchange.com/questions/21216", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9212/" ] }
21,507
We all suffer from common cold, and that, frequently. Why have we not developed immunity against it till now? By immunity I mean immunity as a species.
Long lasting immunity is obtained by means of the adaptive immune system , and mainly involves the development of antibodies that identify specific parts ( epitopes ) of the pathogen's proteins. Common cold is typically caused by a type of virus called rhinovirus . Viruses have very high mutation rates, which alter the sequence of the virus proteins, modifying their antigenic properties. This consequently alters the ability of antibodies to recognize a particular antigen. In other words, we do develop long lasting immunity against the virus that causes us a cold today, but the virus that causes us a cold a few months later is somewhat different, and the adaptive immune system has to start from scratch.
{ "source": [ "https://biology.stackexchange.com/questions/21507", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9186/" ] }
21,533
If I were to count my father, my grandfather, my great-grandfather, and so on up till, say chimps, or the most common ancestor, or whatever that suits the more accurate answer, how many humans would there have been in my direct lineage? And would it be almost the same for every human being currently living?
A quick back-of-the-envelope answer to the number of generations that have passed since the estimated human-chimp split would be to divide the the split, approximately 7 million years ago ( Langergraber et al. 2012 ), by the human generation time. The human generation time can be tricky to estimate, but 20 years is often used. However, the average number is likely to be higher. Research has shown that the great apes (chimps, gorilla, orangutan) have generation times comparatble to humans, in the range of 18-29 years ( Langergraber et al. 2012 ). Using 7 million years and 20 years yields an estimated 350000 ancestral generations for each living human. A more conservative estimate, using an average generation time of 28, would result in 250000 generations. However, some have argued that the human-chimp split is closer to 13 million years old, which would mean that approximately 650000 generations have passed (using a generation time of 20 years). The exact number of ancestral generations for each human will naturally differ a bit, and some populations might have higher or lower numbers on average due to chance events or historical reasons (colonizations patterns etc). However, due to the law of large numbers my guess would be that discrepancies are likely to have averaged out. In any case, the current estimates of the human-chimp split and average historical generation times are so uncertain, so that they will swamp any other effects when trying to calculate the number of ancestoral generations. However, this is only answering the number of ancestral generations. The number of ancestors in your full pedigree is something completely different. Since every ancestor has 2 parents, the number of ancestors will grow exponentially. Theoretically, the full pedigree of ancestors can be calculated using: $$N_\text{ancestors} = \sum_{i=1}^t 2^i \hspace{1em} \text{or} \hspace{1em} 2^{t+1}-2$$ where t is the number of generations. However, this will yield an unreasonably large number of ancestors (~$2.3*10^{105}$ over just 350 generations), since it assumes that all of your ancestors are unrelated. Basically, you run into something called pedigree collapse , which means that your pedigree will have many overlaps (due to inbreeding, overlapping generations etc), so all of your ancestors cannot be seen as unrelated. In practice, this means that the number of ancestors in successive generations will stop doubling for each generation you go back, and will eventually start shrinking, which will drastically reduce the number of unique ancestors. For more on this, see answers to the question Initial population when i count backwards? . That question is basically asking about the same issue, but less specifically. There might be studies that have tried to calculate the average number of ancestors to living humans, but I haven't seen any. Therefore, I cannot say anything more specific about the average number of unique ancestors for a living human individual.
{ "source": [ "https://biology.stackexchange.com/questions/21533", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3141/" ] }
21,578
If I understand evolutionary biology correctly, mammals first evolved on land as small, rodent-like creatures, in a time when reptiles were dominant on land. Eventually, they diversified into the species we know today. Some of these species, however, are aquatic - whales and dolphins readily spring to mind. Why did the ancestors of whales and dolphins leave the land to go to the oceans? How did they evolve from their original form to their superficially ichthyoid appearance today?
I'll focus on whales and dolphins (cetaceans) as you mention them by name and they are representative for other marine mammals such as seals or manatees. The evolution of cetaceans was one of the fascinating evolutionary mysteries. Clearly, they were mammals, but which mammals were their closest relatives? Clues to solve this mystery began to appear in the 1980s and 1990s. During the 1980s and into the 1990s, paleontologists discovered several fossils that were clearly land-based mammals but shared many skeletal features with cetaceans. These fossils, including Pakicetus [(Gingerich et al. 1983)] and Rodhocetus (Gingerich et al. 1994) , shared skeletal features that are unique to whales and to the Artiodactyla , commonly known as the even-toed mammals. Artiodactyls includes deer, sheep, pigs, bison, and hippopotamuses. Artiodactyls and the fossil whales share a unique skeletal feature of the ankle called an astrogalus, shown in the picture below. The astragalus is a "double pulley" structure that contributes to the ankle joint. This picture is taken from an excellent summary of whale evolution, provided by the Understanding Evolution site hosted by University of California at Berkeley. The astragalus is not present in other mammals. The fossil whales and modern cetaceans also share unique features of the skull around the area of the ear, called a tympanic bulla. Although all mammals have bullae (plural of bulla), the bullae of cetaceans and the whale fossils is unique compared to other mammals. For more on the bulla, see this Talk Origins page . More on fossil whales can be found at the Berkeley Comparative Museum of Paleontology . The many fossils that have been found are transitional forms that link artiodactyls and modern cetaceans. Source Around the same time as the fossil discoveries, genetic analysis added additional evidence supporting a relationship between the artiodactyls and cetaceans (Milinkovitch et al. 1993) . Although early genetic analytical techniques were not as robust as they are today, many genetic studies have since supported and refined the conclusions of Milinkovitch et al. Current evidence shows that the closest living relative of cetaceans are the hippos (see, for example Price et al. 2005 and Agnarsson and May-Collado 2008 ). The relationships are shown below in this figure from the Agnarsson and May-Collado paper. The dark lines are the artiodactyls and cetaceans, formally called the Cetartiodactyla. The question remains: why? The most likely explanation is that cetaceans evolved to exploit an unfilled ecological niche or adapted to new niches that formed as a result of plate tectonics or other types of environmental changes that occurred 50-55 million years ago . The niche describes all of the living and non-living resources needed by an organism to survive. Although land-based mammals were increasing in diversity, few or none were present in the oceans. The basic hypothesis is that the early whale-like artiodactyls, like Indohyus and Pakicetus were land-based (terrestrial) mammals that spent most of their time near the water's edge. Over time, they adapted to the niches in the ocean. Fossils like Ambulcetus and Rodhocetus showed clear evidence of swimming ability , with flattened tails and the enlarged rear feet. In addition, the nostrils shifted from the front of the face to the top of the head, which we recognize as the blowhole. The shift to the aquatic habitat allowed these species to exploit resources that were not available to land-based mammals, thereby reducing competition for the resources. Reduced competition allows more individuals to survive and reproduce. Similar scenarios are very likely for other marine mammals, such as seals or manatees. They evolved to take advantage of ecological niches that were not filled by other organisms. This basic concept, evolving to fill available niches, is a common outcome of the evolutionary process. The of adaptation of cetaceans and other mammals to the oceans may be similar to that of the hippopotamus . Hippos spend most of their time in the water, and they show many adaptations that allow them to live in the aquatic environment. The eyes and nostrils of the hippo are high on the head, which allows them to remain almost entirely submerged but still see and smell, as shown below. (Hippo photo by Johannes Lunberg , Flickr Creative Commons.) Hippos feed underwaters, they are heavy enough to walk on the bottom of the river, and the mate and give birth underwater. The young can suckle underwater. Clearly, hippos seem to be another mammal that is "returning to water." Similar types of processes must have occurred in cetaceans for them to adapt to the marine habitat. Citations Agnarsson, I. and L.J. May-Collado. 2008. The phylogeny of Cetartiodactyla: The importance of dense taxon sampling, missing data, and the remarkable promise of cytochrome b to provide reliable species-level phylogenies. Molecular Phylogenetics and Evolution 48: 964-985. Gingerich, P.D. et al. 1983. Origin of whales in epicontinental remnant seas: New evidence from the early Eocene of Pakistan. Science 220: 403-406. Gingerich, P.D. et al. 1994. New whale from the Eocene of Pakistan and the origin of cetacean swimming. Nature 368: 844-847. Milinkovitch, M.C. et al. 1993. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences. Nature 361: 346-348. Price, S.A. 2005. A complete phylogeny of the whales, dolphins and even-toed hoofed mammals (Cetartiodactyla). Biological Reviews 80: 445-473.
{ "source": [ "https://biology.stackexchange.com/questions/21578", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9458/" ] }
21,579
Ok, this may be just wild nonsense and I have to warn that my knowledge on the subject is limited. I was reading about how in some countries people choose to have children later in life. After that this question came to my mind? If human couples chose to have children later in life, lets say 40s 50s - disregarding keeping an younger self gamete preserved - wouldn't this result in the people less resistant to the effect of aging being unable to reproduce, creating a more longevous generation? thus enabling future generations to reproduce even later lenghtening the average lifespan of humans? ps: After reading this sounded a little too eugenic, by no means I'm trying to make this an legitimate theory or suggest an experiment, it's just a doubt - maybe good for some science fiction story...
I'll focus on whales and dolphins (cetaceans) as you mention them by name and they are representative for other marine mammals such as seals or manatees. The evolution of cetaceans was one of the fascinating evolutionary mysteries. Clearly, they were mammals, but which mammals were their closest relatives? Clues to solve this mystery began to appear in the 1980s and 1990s. During the 1980s and into the 1990s, paleontologists discovered several fossils that were clearly land-based mammals but shared many skeletal features with cetaceans. These fossils, including Pakicetus [(Gingerich et al. 1983)] and Rodhocetus (Gingerich et al. 1994) , shared skeletal features that are unique to whales and to the Artiodactyla , commonly known as the even-toed mammals. Artiodactyls includes deer, sheep, pigs, bison, and hippopotamuses. Artiodactyls and the fossil whales share a unique skeletal feature of the ankle called an astrogalus, shown in the picture below. The astragalus is a "double pulley" structure that contributes to the ankle joint. This picture is taken from an excellent summary of whale evolution, provided by the Understanding Evolution site hosted by University of California at Berkeley. The astragalus is not present in other mammals. The fossil whales and modern cetaceans also share unique features of the skull around the area of the ear, called a tympanic bulla. Although all mammals have bullae (plural of bulla), the bullae of cetaceans and the whale fossils is unique compared to other mammals. For more on the bulla, see this Talk Origins page . More on fossil whales can be found at the Berkeley Comparative Museum of Paleontology . The many fossils that have been found are transitional forms that link artiodactyls and modern cetaceans. Source Around the same time as the fossil discoveries, genetic analysis added additional evidence supporting a relationship between the artiodactyls and cetaceans (Milinkovitch et al. 1993) . Although early genetic analytical techniques were not as robust as they are today, many genetic studies have since supported and refined the conclusions of Milinkovitch et al. Current evidence shows that the closest living relative of cetaceans are the hippos (see, for example Price et al. 2005 and Agnarsson and May-Collado 2008 ). The relationships are shown below in this figure from the Agnarsson and May-Collado paper. The dark lines are the artiodactyls and cetaceans, formally called the Cetartiodactyla. The question remains: why? The most likely explanation is that cetaceans evolved to exploit an unfilled ecological niche or adapted to new niches that formed as a result of plate tectonics or other types of environmental changes that occurred 50-55 million years ago . The niche describes all of the living and non-living resources needed by an organism to survive. Although land-based mammals were increasing in diversity, few or none were present in the oceans. The basic hypothesis is that the early whale-like artiodactyls, like Indohyus and Pakicetus were land-based (terrestrial) mammals that spent most of their time near the water's edge. Over time, they adapted to the niches in the ocean. Fossils like Ambulcetus and Rodhocetus showed clear evidence of swimming ability , with flattened tails and the enlarged rear feet. In addition, the nostrils shifted from the front of the face to the top of the head, which we recognize as the blowhole. The shift to the aquatic habitat allowed these species to exploit resources that were not available to land-based mammals, thereby reducing competition for the resources. Reduced competition allows more individuals to survive and reproduce. Similar scenarios are very likely for other marine mammals, such as seals or manatees. They evolved to take advantage of ecological niches that were not filled by other organisms. This basic concept, evolving to fill available niches, is a common outcome of the evolutionary process. The of adaptation of cetaceans and other mammals to the oceans may be similar to that of the hippopotamus . Hippos spend most of their time in the water, and they show many adaptations that allow them to live in the aquatic environment. The eyes and nostrils of the hippo are high on the head, which allows them to remain almost entirely submerged but still see and smell, as shown below. (Hippo photo by Johannes Lunberg , Flickr Creative Commons.) Hippos feed underwaters, they are heavy enough to walk on the bottom of the river, and the mate and give birth underwater. The young can suckle underwater. Clearly, hippos seem to be another mammal that is "returning to water." Similar types of processes must have occurred in cetaceans for them to adapt to the marine habitat. Citations Agnarsson, I. and L.J. May-Collado. 2008. The phylogeny of Cetartiodactyla: The importance of dense taxon sampling, missing data, and the remarkable promise of cytochrome b to provide reliable species-level phylogenies. Molecular Phylogenetics and Evolution 48: 964-985. Gingerich, P.D. et al. 1983. Origin of whales in epicontinental remnant seas: New evidence from the early Eocene of Pakistan. Science 220: 403-406. Gingerich, P.D. et al. 1994. New whale from the Eocene of Pakistan and the origin of cetacean swimming. Nature 368: 844-847. Milinkovitch, M.C. et al. 1993. Revised phylogeny of whales suggested by mitochondrial ribosomal DNA sequences. Nature 361: 346-348. Price, S.A. 2005. A complete phylogeny of the whales, dolphins and even-toed hoofed mammals (Cetartiodactyla). Biological Reviews 80: 445-473.
{ "source": [ "https://biology.stackexchange.com/questions/21579", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9459/" ] }
21,715
When I watch wilderness specials for more than a few minutes, I notice a familiar pattern: predators are depicted as being alerted by the scent of blood. Wounded animals seem to make the best prey and predators seem to have a heightened awareness for the smell of blood. It would seem that it would then be a disadvantage to evolutionary survival for female organisms to menstruate. How do females of a species not attract predators to the signal of menstrual blood? Do female organisms in the wild actually menstruate? If so, is there a difference in the composition of menses that does not alert predators? How would this not at the very least give predators an idea of the general vicinity of the female? If wild animals excrete their menses, do they have ways in which they are able to mask the evidence of its release or are they somehow internalizing the tissue so that they are not released? If female organisms in the wild do menstruate, then why is this not a survival disadvantage?
Thanks to the other answer for pointing me in the right direction with some references. It seems that two biologists in the early 1990s had a back-and-forth over this topic in The Quarterly Review of Biology. 1,2 A statement of the problem: The function of menstruation is a central enigma of mammalian, and especially primate, reproductive physiology. Each cycle the uterus builds a glandular epithelium with a high secretory capacity and an elaborate microvasculature, only to reabsorb or void it with the menses if implantation does not oc-cur. Why does the endometrium not maintain a steady state of readiness for implantation by the blastocyst? What is the selective advantage of cyclical regeneration and regression? 1 One hypothesis 2 In 1993, Margie Profet hypothesized that menstruation is primarily advantageous as a defense against pathogens transported by sperm. During mammalian insemination, she stated, bacteria from the male and female genitalia cling to sperm tails and are transported to the uterus. Menstruation, triggered by the abrupt constriction (causing necrosis of endometrial lining) followed by dilation (causing shedding of said necrotic tissue), forces loose not only the endometrial lining but sperm-borne pathogens contained therein. In addition to shedding the uterine tissue harboring these bacteria, menstruation delivers immune cells to the uterine cavity, triggered by the mechanical pressure exerted via the shedding of endometrial lining. In this 50 page (!) article, Profet also points out that other mammals with covert menstruation take advantage of some of these same benefits, as the immunological stimulation includes phagocytosis of pathogens by cells that may be expelled in cervical/vaginal mucous. Further, proestrous bleeding (i.e. that preceding ovulation, 180 degrees off from the human cycle), which occurs in some mammals (domestic dog, coyote, etc), seems to serve a similar function. If not eliminated prior to estrus, these tenacious pathogens might otherwise attach to incoming sperm during estrus and ascend the oviducts. As to why humans and other primates are subject to overt bleeding in contrast to other mammals, she lays out a theoretical argument that selection pressure to menstruate should increase with decreasing per-cycle “fecundability” (the probability of pregnancy) because copulation not followed by bleeding risks infection. In contrast to, e.g., mice (98% fecundability), humans have some of the lowest fecundability rates, primarily due to “concealed” ovulation which de-couples copulation and ovulation. (Contrast this to most mammals whose females have a defined estrous period during which they are receptive to male sexual advances; the data for the existence of such a period in humans are controversial, and sexual behavior is driven primarily by “higher” social, environmental, and cognitive cues.) A different view 1 In response/objection to this paper, Beverly Strassman in the same journal published an article outlining an alternative hypothesis about the potential adaptive value of menstruation. She proposed a hypothesis based on energy conservation: [T]he uterine endometrium is shed/resorbed whenever implantation fails because cyclical regression and renewal is energetically less costly than maintaining the endometrium in the metabolically active state required for implantation. Her research determined that, in its regressed state (i.e. s/p endometrial shedding), oxygen consumption in the endometrial tissue is markedly declined, nearly sevenfold. Although this would seem to be a trivial component of whole-body metabolism, she argues otherwise: Metabolic rate is at least 7% lower, on average, during the follicular phase than during the luteal phase in women, which signifies an estimated energy savings of 53 MJ over four cycles, or nearly six days worth of food. Her argument shares with Profer’s the implication that mammals with lower fecundability are more likely to menstruate. In those with high probability of pregnancy at every cycle, the energetic benefits of ridding the body of the need to support endometrial lining (relevant only in the absence of pregnancy), are decreased. Her hypothesis also predicts the larger volume of menstrual shedding in humans and chimps in contrast to other mammals related to the increased uterine size relative to the female body (a ratio that is largely determined by the especially large head of the human fetus). Conclusion As noted in the comments, only primates have overt menstrual bleeding. The adaptive benefits have been variously explained, and it is probable that there is more than one operative explanatory model. Whatever the small decrement in survivalship incurred by the intermittent and uncontrolled depositing of blood in the wild, it is apparently outweighed in these species by the processes described above. References and Notes 1 . Strassmann, Beverly I. The Evolution of Endometrial Cycles and Menstruation The Quarterly Review of Biology, June 1996; Vol. 71, No. 2 pp 181-220. 2 . Profet, Margie. Menstruation as a Defense Against Pathogens Transported by Sperm . The Quarterly Review of Biology, Sept 1993; Vol. 68, No. 3 pp. 335-386. Note : Your comparison to urine and feces is an interesting one. Perhaps a vaginal sphincter would be a good idea…..were it not for men and babies….
{ "source": [ "https://biology.stackexchange.com/questions/21715", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5917/" ] }
21,772
Arthropods have 6 or more limbs and arthropods with 6 limbs appear to move faster than arthropods with 8 limbs so I wonder whether this might have something to do with fast and efficient locomotion. But, this is just a guess. I wonder what the official explanation is, if it exists.
Number of legs in terrestrial vertebrates Not only do mammals have four legs but actually all terrestrial vertebrates (which include mammals) have four legs. There are slight exceptions though as some lineages have lost their legs. Typically snakes have no legs anymore. Apesteguia and Zaher (2006) discuss the evolution of snakes legs reduction and report a fossil of snakes with a robust sacrum. Cetaecea (whales and friends) have lost their hind legs but we can still spot them on the skeleton. See for example the orca (killer whale, easily recognizable to its teeth) on the picture below. Pay attention to the small bones below its vertebral column at the level on the left side of the picture. I also want to draw attention to the importance of the definition of legs. I guess that we would call something a pair of legs if it is constructed using a similar developmental pathway than current existing legs. If we are using some broader definition, then a prehensile tail as found in some new world monkeys, for example, could be considered as a leg (but only a single leg, not a pair of legs obviously). A list of animals having a prehensile tail can be found here (Wikipedia) . Did you say Natural Selection? I think (might be wrong) that you have too selectionist a view of evolution. What I mean is that you are wondering why mammals have four legs and you're looking for an explanation of the kind "because mammal have this kind of need of locomotion and for this purpose four is the most optimal number of legs". Consider the following sentence: "If there is a need, natural selection will find a way!". This sentence is wrong! Evolution is not that easy. This false view of evolution is sometimes referred to as panselectionist. The reality is that it is not easy to evolve such a developmental pathway as drastic as having an extra pair of legs that are well integrated into the body of the carrier of this new trait. Such an individual would need a brain, a nerve code, a heart and some other features that are adapted to have extra legs. Also, assuming such a thing came to existence it is rather complicated to imagine how it could be selected for. To go slightly further, you have to realize that there are many stochastic processes in evolution (including mutation and random variation in reproductive success) and an organism is a piece of complex machinery and is not necessarily easily transformable to some other form that would be more efficient (have higher reproductive success). Often going from one form to another may involve a "valley crossing" meaning that if several mutations are needed, intermediate forms may have low reproductive success and therefore a high amount of genetic drift (stochasticity in reproductive success) to cross such valley of low reproductive success. See shifting balance theory . Finally, even if there is selection for another trait, it may take time for the mean trait in the population to shift especially if there is only little genetic variance. A complete discussion on why the sentence "If there is a need, natural selection will find a way!" is wrong would fill up a whole book. Gould (1979) is a classic article on the subject and is very easy to read even for a layperson. Why 4 legs? Terrestrial vertebrates have four legs because they evolved from a fish ancestor that had four members that were not too far from actual legs (members that could "easily" evolve into legs). This is what we call a phylogenetic signal . The explanation is as simple and basic as that. You can have a look at the diversity of terrestrial vertebrates here (click on the branches). Number of legs in invertebrates Arthropoda (Spiders (and other chelicerata), insects (and other hexapods), crustaceans (crabs, shrimps…) and Myriapoda (millipedes) and Trilobite as well)) evolved from a common ancestor who had a highly segmented body. From this ancestor, many groups have fused some segments. In these taxa, each pair of legs is attached to a particular segment (I don't think the segments are still visible in spiders today). In insects, for example, all 6 legs are attached to the thorax but to 3 different segments of the thorax, the pro- meso and meta-thorax (see below). As a side note, it is interesting to know that the wings in insects did not evolve from the legs (as it is the case in birds and bats). There are two competing hypotheses for the origin of insect wings. Wings either developed from gills or from sclerite (chitine plate, the hard part of the insect). When insect first wings, they actually evolved three pairs of wings (one on each segment of the thorax). At least one pair has then been lost in all modern species. In the diptera, a second pair of wings have been lost and are replaced by halteres, particularly easy to spot in craneflies (see below picture). In millipedes, the link between segmentation and legs is even more obvious (see picture below). You can have a look at the diversity of Arthropoda here (click on the branches). Pictures Update 1 Asking how likely it is for a given population to evolve a given trait is extremely hard to answer. There are two main issues: 1) a definition of the question issue and 2) a knowledge issue. When asking for a probability one always needs to state the a priori knowledge. If everything is known a priori, then there is nothing stochastic (outside quantum physics). So to answer the question one has to decide what we take for granted and what we don't. The second issue is a knowledge issue. We are far from having enough knowledge in protein biophysics (and many other fields) to answer that question. There are so many parameters to take into account. I would expect that creating a third pair of legs would need major changes and therefore one mutation will never be enough in order to develop a third pair of legs. But, no I cannot cite you any reference for this, I am just guessing! Following the wings example in insects. Insects have had three pairs of wings. While some mutation(s) prevented the expression of the third (the first actually) pair many of the genetic information for this third pair remain in the genotype of insects as they still use it for the two other pairs. Taking advantage of that, Membracidae (treehoppers) developed some features using a similar biochemical pathway than the one used to develop wings. Those structures are used as protection or batesian mimicry . Update 2 Let's imagine that an extremely unlikely series of mutations occur that create some rodent with 6-legs. Let's imagine this rodent with six legs has a larger heart in order to pump blood to these extra legs and it has a brain that is adapted to using six legs and some changes in its nerve cord so that it can control its 3rd pair of legs. Will this rodent have higher reproductive success than other individuals in the population? Well… let's imagine that with its six legs, it can run faster or whatever and has a very high fitness. How would the offspring of a six-leg mother (or father) and a four-leg father (or mother) look like? Will it be able to reproduce? See the issue is that it is hard for such trait to come to existence because 1) it needs many steps (mutations) and 2) it is hard to imagine how it could be selected for. For those reasons, there exist no vertebrates with 6 fully functional legs. Well, let's assume it does and in consequence, after 200 generations or so, the whole population is only made of 6-legged individuals. Maybe the species got extinct then and no fossil record has ever been found. This is possible. It is not because something has existed that we necessarily find something in the fossil record.
{ "source": [ "https://biology.stackexchange.com/questions/21772", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9573/" ] }
23,693
The little amount of body hair humans have don't seem to be of much use for keeping warm. Our Simian cousins on the other hand sport thick furs. At which point during the species evolution and why did humans lose their fur?
This is an interesting question, and there are a number hypotheses available to explain this phenomenon. The short answer (as far as I can say after my literature search) is that we don't know the answer for sure. The long version follows below. The main problem with all these hypotheses is that though they may have a valid point, a definitive hypothesis hasn't been demonstrated yet. All these hypotheses are listed in the first reference, with a ton of additional references in the paper. I will summarize the different hypotheses only briefly here; for details please read the paper. The second reference is also interesting. The point when this process started was after the last common ancestor of chimpanzee and humans when our two lines diverged. Chimpanzees are our closest relatives and still have hair coats, so this process must have started afterwards. Analyses of MC1R mutations (which affect pigmentation) suggest that human have been hairless for at least 1.2 million years. See reference 3 for details on this. Aquatic ape hypothesis (also known as aquatic ape theory): This hypothesis states that modern humans spent some time semi-aquatic. In this lifestyle fur does not insulate very well and this led to an evolutionary disadvantage. Cooling hypothesis: This hypothesis states that the modern humans lost their hair when they left the forests and started to live on the savannah. There they got too warm with their fur and finally lost it. This hypothesis sounds logical at first thought, but has a few problems. Naked humans have two problems: during the day they collect quite some heat via their skin, which requires them to have a cooling system (we sweat to cool us), and during cold nights we need a lot of internal energy to keep our temperature stable. Insulation however works both ways (not only keeps the warmth in, but also can keep heat out), and indeed some savannah monkeys have denser fur than their relatives in the forest. The cooling system will also lead to water loss and potential dehydration. Hunting hypothesis: This hypothesis states that humans started becoming carnivores and therefore had the need to run for extended periods of time to hunt for meat. This leads to thermal overload; without a fur they can release this heat much faster to avoid overheating. Bipedality hypothesis: This hypothesis assumes that modern humans, walking on two feet, have a lower direct influx of solar radiation. This lowers the chance for overheating. Allometry hypothesis: Allometry states that species which get bigger during evolution, do not have all their organs getting bigger at the same rate. The hypothesis states that humans got bigger, the number of hairs stayed the same, and finally got lost. Clothing hypothesis: One of the more illogical hypotheses, this assumes that hair loss wasn't critical for humans as they managed to make themselves clothes. Vestiary hypothesis: A mix of the cooling and the clothing hypothesis: Here it is assumed that hair loss is beneficial due to more cooling and that the negative effects of too much loss of heat were counteracted by the invention of artificial insulation. Neoteny hypothesis: Neoteny denotes the retention of of juvenile physical characteristics in adults. Humans are characterized as retarded in development (compared to the apes) and mature more slowly. Additionally, it is assumed that some characteristics (here loss of hair) of juvenile or fetal apes are maintained. Carrion-eating hypothesis: Another strange hypothesis, this assumes that man as a messy eater (like vultures and condors, which have naked necks) have an advantage of being hairless. Sex-related hypothesis: This hypothesis assumes that hairless skin is more sensitive to stimuli like touch, temperature and pain. This would allow more sensitive social contacts, especially between man and woman, but also between woman and child. Pubic hair is not explained by this hypothesis. Adaptation-against-ectoparasites hypothesis: Here it is assumed that naked humans are less prone to harbour ticks, fleas and other parasites which hide and live within fur. Apes have great social rituals of removing these within their group. References: Evolution of nakedness in Homo sapiens The Hairless Mutation Hypothesis Explains Not Only the Origin of Humanization from the Human/Ape Common Ancestor but also Immature Baby Delivery Genetic variation at the MC1R locus and the time since loss of human body hair.
{ "source": [ "https://biology.stackexchange.com/questions/23693", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/8913/" ] }
23,720
Is it possible for a woman to conceive from two different men and give birth to half-siblings?
Yes, this is possible through something called heteropaternal superfecundation (see below for further explanation). Of all twin births, 30% are identical and 70% are non-identical (fraternal) twins. Identical twins result when a zygote (one egg, or ovum, fertilized by one sperm) splits at an early stage to become twins. Because the genetic material is essentially the same, they resemble each other closely. Typically during ovulation only one ovum is released to be fertilized by one sperm. However, sometimes a woman's ovaries release two ova. Each must be fertilized by a separate sperm cell. If she has intercourse with two different men, the two ova can be fertilized by sperm from different sexual partners. The term for this event is heteropaternal superfecundation (HS): twins who have the same mother, but two different fathers. This has been proven in paternity suits (in which there will be a bias selecting for possible infidelity) involving fraternal twins, where genetic testing must be done on each child. The frequency of heteropaternal superfecundation in this group was found (in one study) to be 2.4%. As the study's authors state, "Inferences about the frequency of HS in other populations should be drawn with caution."
{ "source": [ "https://biology.stackexchange.com/questions/23720", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6124/" ] }
24,046
A normal camera can capture a rectangular image. If human eyes watch an area, what's the shape of the captured region? Rectangular? Half-spherical?
The capture area of the eye is a bit fuzzier and harder to define than that of a camera. A camera captures consistent, fully detailed data right up to the edge of its sensor, and no data at all beyond it. Captured data is clipped by an ideally uniform sensor, augmented a bit by the lens, and is well-defined during design and manufacturing. The eye can capture higher "resolution" near the center of its capture area and also has very little information about color near the edges (see also Peripheral Vision ); so it's not quite as clean cut depending on your goal of "capture area". The eye also has a bit of a " blind spot " near the middle, which our brains basically Photoshop out. Additionally, it varies from person to person. The effective capture area would really depend on your application (e.g. the "capture area" for, say, reading text, would be narrower than the area for, say, detecting motion). Here is a typical diagram for a single eye, showing just the ability to see something in that area (does not show details related to peripheral vision quality): Here is a typical diagram for both eyes combined, the solid white area is the overlap: Both of those images are from a 1964 NASA report detailing aspects of the human visual field. If you want the detailed answer to your question and more, you probably want to take a look at that. Note that our field of vision is very wide, those diagrams may not do it justice. As an experiment, close one eye, stare straight ahead and hold your arms straight out to the sides. Wiggle your fingers and slowly bring your arms forward until you can just see your wiggling fingers in your peripheral vision, and you will get an idea. As an added experiment, hold a piece of paper with text on it, and repeat the same experiment until you can read the text - this region will be extremely narrow and will give you an idea of how the quality of vision changes across the field. Also try with a colored object and bring it in until you can clearly identify the color. There are also some simplified mentions of it in wikipedia: http://en.wikipedia.org/wiki/Field_of_view#Humans_and_animals http://en.wikipedia.org/wiki/Human_eye#Field_of_view http://en.wikipedia.org/wiki/Visual_field#Normal_limits A good set of search keywords is "human field of vision" . There is also a nice related article entitled The Camera Versus the Human Eye .
{ "source": [ "https://biology.stackexchange.com/questions/24046", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/10230/" ] }
25,880
I was discussing this with my brother. I'm pretty sure I read somewhere that they can move. Thanks EDIT: By movement I mean long distance migration (preferably within the brain only).
The question is relatively broad and one should take into account that the brain not only consists of neurons , but also glial cells (supportive cells) and pre-mitotic neuronal stem cells . Furthermore, as critical fellow-scientists have indicated, developmental stage is very important, as the developing embryonic brain is very different from the adult brain. However, after sifting through various publications, the answer to the question is actually remarkably simple: Yes, brain cells migrate. In the adult brain glial cells migrate in the brain ( Klämbt, 2009 ). Glial cells are involved in a myriad of functions, but a notable example of migrating glial cells are the oligodendrocytes that migrate relative long distances to find their target axons onto which they wrap themselves to form the insulating myelin sheath ( Tsai and Miller, 2002 ). Neuronal stem cells migrate over long distances in response to injury ( Imitola et al., 2004 ) and they migrate from specific stem-cell locations (e.g., hippocampus and subventricular zone) to other regions ( Clarke, 2003 ). Post-mitotic, but non-differentiated neurons have been shown to migrate in the adult brain in fish ( Scott et al., 2012 ), and in mammals and non-human primates as well ( Sawada et al., 2011 ). Not surprisingly, glial cells, stem cells and neurons also migrate during embryonic development . Most notably, post-mitotic neurons destined to fulfill peripheral functions have to migrate over relatively long distances from the neural crest to their target locations ( Neuroscience, 2 nd ed, Neuronal Migration ).
{ "source": [ "https://biology.stackexchange.com/questions/25880", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/11562/" ] }
25,941
I know that it is common to say, "use hot water when washing your hands" or when you've got a cut, "wash your hands with warm water," etc. I was wondering, why is this the case? Since bacteria grow in warm environments, you would think that it might be beneficial for bacteria. Is this just another myth or is this actually true?
The bacteria wouldn't see any benefit from the warm water in the ~30-60 seconds you're washing your hands, neither would hot water "sterilize" your hands at temperatures you could tolerate. The reason you wash your hands with hot water is because the hot water+detergent soap mix is better for removing oil and dirt than cold water+detergent, which is supposedly where bacteria reside. Interestingly, there was a study published saying that washing with hot water doesn't have much of an effect on bacterial load. Hot water for handwashing--where is the proof? (Laestadius and Dimberg, 2005). I'd be interested to look more into their methods but the paper is behind a paywall and I don't have access at home. Also, this paper, Water temperature as a factor in handwashing efficacy by Michaels et al . is open and shows no evidence that hot water is any better than cold water for removal of microbes. [W]ater temperature exhibits no effect on transient or resident bacterial reduction during normal handwashing with bland soap.
{ "source": [ "https://biology.stackexchange.com/questions/25941", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/10401/" ] }
26,413
I'm just curious, how many mosquito "bites" (mosquitoes which have removed blood from a person) would it take to remove enough blood to put a person into shock? (Putting aside all reasons why it wouldn't happen, how many would it take?)
This question falls into different subquestions: 1. How much blood does a mosquito take when feeding? This is not so easy to answer, but there are publications which measure the volume of different mosquito species. Reference 1 lists volumes between 2.85 and 11.99µL per meal and mosquito. Reference 2 lists 3.07 and 5.71µL. To make the approximation a bit easier, let's assume that mosquitoes drink about 5µL per bite (which should be near enough). 2. How much blood does a human have? According to Wikipedia , humans have around 77mL blood per kilogram of body weight. If we take a 70kg human, we get around 5L of blood. 3. How many mosquitos does it take to get a human into shock, and how many to suck him out completely? According to the Medline, Hypovolemic shock occurs when a human loses about 1/5 (or more) of his blood volume. 1/5th of 5L is one litre. Since each mosquito sucks 5µL, this would take about 200.000 mosquitoes. To suck out all blood would take 1 million mosquitoes. (This is not possible since mosquitoes depend on an existing blood pressure, as reference 3 shows. If a capillary is empty due to massive blood sucking, they change to another.) Besides this theoretical (but interesting) calculation, there are some real problems about getting biten by so many mosquitos. First, this is a question of available skin. The human skin is about 2 square meters in size, which would require 100.000 bites per square meter. To break this down further, a square meter has 10.000 square centimeters, so there would be 10 mosquitos which need to bite you per square centimeter. Rather unlikely. Then each mosquito injects a mix of anti-coagulants, pain killers etc. prior to sucking to keep the blood from clotting and also to make sure you won't notice the bite immediately. As pointed out in the comments, this would already cause a lot of trouble and probably cause massive bleeding, since the effect of the anti-coagulants would sum up when biten by thousands of mosquitos. Additionally the body reacts by releasing histamines and since the amount would also be massive, this would cause real trouble and probably kill you. References: Regulation of blood meal size in the mosquito La Crosse Virus Infection Alters Blood Feeding Behavior in Aedes triseriatus and Aedes albopictus (Diptera: Culicidae) Visualizing Non Infectious and Infectious Anopheles gambiae Blood Feedings in Naive and Saliva-Immunized Mice
{ "source": [ "https://biology.stackexchange.com/questions/26413", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/11525/" ] }
27,511
I know for instance some cells are sexual, so, this got me wondering, do the males of all species that have distinct sexes have Y chromosomes?
Very short answer No, not all males of all sexual species have Y chromosomes. You might want to have a look to the Wikipedia page on sex-determination systems . Long answer Diversity among the species that reproduce sexually Not all species that have sexual reproduction have sexes. Yeasts, for example, have mating types but no sex. Diversity among the species that have sexes Sex is determined by both genetic and environmental factors. In some species, genetic factors are more important than environmental factors in other species it is the reverse. Species which sex is mostly determined by the genetics are said to have GSD (Genetic Sex Determination). For example, humans are GSD, as the female is XX and the male is XY . The species where sex is mostly determined by the environment are called ESD (Environmental Sex Determination). For examples, crocodiles are ESD as sex is determined by temperature. It is important to understand however that there is a whole continuum between these two extremes. Diversity among the species that are GSD Among the species that are GSD, some have sexual chromosomes some don't. Some have one locus (locus=position on a chromosome) that determines the sex, some have many loci (loci=plural of locus). Humans, for example, have sexual chromosomes ( X and Y ) and have only one locus which determines the sex. This locus is called SRY and it codes for a protein called TDF . Now you can split GSD with sexual chromosomes into two more categories (it is a bit more complex in reality): XY and ZW . XY are those species where the male is heterogametic ( XY ), while the female is homogametic ( XX ). In ZW systems, the male is homogametic ( ZZ ) and the female is heterogametic ( ZW ). Birds and some plants have ZW systems for example, while mammals (except "basal" mammals) and Drosophila have XY system. See also the post What determines sex in birds? Extra Information Dosage Compensation In species that have sex chromosomes, there is a difference in the number of copy of genes between the sexes. In eutherian mammals, for example, females have two copies of all the genes on the X chromosomes, while males only have one copy of most of these genes (plus a few Y chromosome genes). The set of methods to deal with this issue is called Dosage Compensation and there is also an impressive diversity dosage compensations. Comments on this diversity of sexual systems The diversity in a sex-determination system, dosage compensation and other things related to sex are impressive. It is even more impressive when we look at how many independent origins there are. Below are some other examples. The Amazon molly (a fish) is a species that have sexual reproduction but there are no males. The females have to seek for sperm in a sister species in order to activate the development of the eggs but the genes of the father from the sister species are not used. (see this article ) There are also hermaphrodites including sequential hermaphrodites (first male, then females or the opposite) in plants and animals. There are also species where populations are made of hermaphrodites and females and others where there are hermaphrodites and males (very uncommon). In some species, the sex is determined by social factors. In clownfish, the sex is determined by comparing its own size with the size of the other fishers living in the same anemone. In an ant species (or two species actually), males and females can both reproduce by parthenogenesis (some kind of cloning but with meiosis and cross-over) but they the meet they reproduce together and their offsprings are sterile workers. So males and females are just like two sister species that reproduce sexually to create an army to protect and feed them. See more information in this paper Here is a nice figure from Bachtrog et al. 2014 that offers an idea of the diversity of sex determination system (thank to @rg225 for pointing out this figure). Book suggestion The Evolution of Sex-Determination is a great book that may interest you.
{ "source": [ "https://biology.stackexchange.com/questions/27511", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/11652/" ] }
27,648
I was looking into the following problem: Obviously, the solution lies in how much energy either can output per unit of time. The total energy output of the sun is $3.8×10^{26} \frac{J}{s}$. The number of lions alone pales in comparison ($10^{12}$). However, I'm now trying to figure out how many lions it would take to have an output equal to the sun, but I seem to be having a hard time finding good data. What's the peak energy output of a lion per second (or where/how can I find such information)?
Wow, as an astrophysicist who has just logged into biology SE for the first time, I didn't think I'd have a question I could immediately answer. You are correct about the Sun's output, so what about the lion. If the lion is in its usual passive state, i.e. lying around as shown in your picture, then you would not go far wrong in treating them as black body radiators (well this will give you an upper limit, though the emissivity of human skin is quite high, so it should be a reasonable approximation.). To estimate a power I need a lion's temperature and its surface area. According to this site the body temperature of a lion is 311.33 Kelvin. I found a calculator that used the DuBois formula for surface area (for humans) and put in 440 pounds and 7 feet 10 for the weight and "height" of a (male, adult) lion - this returned a surface area of $3.6\ m^2$ (about twice a, male human, so sounds roughly ok). Now using the Stefan-Boltzmann formula $P = \sigma A T^4$, I get the power output of a "black body" lion to be about 2 kW. Thus $10^{12}$ lions have a power output of $2\times 10^{15}\ W$, which is 11 orders of magnitude less than the Sun. But now take the question at its most basic. Compared to the Sun, the lion is a pretty effective power generation unit. The Sun only generates $2\times 10^{-4}\ W/kg$, whereas a lion-based power source weighs in with a massive $10\ W/kg$! EDIT: Note that the calculation just assumes the Lion can produce this kind of power output whatever environment it is in. In practice a Lion absorbs a large fraction of this power from its surroundings and its internal metabolism does not need (and probably cannot) supply 2kW. Thus the 2kW should be reduced to some extent, though I'm not sure a simplistic $T^4 - T_{\rm env}^{4}$ calculation can be correct, unless one of you biologists tells me that a Lion's metabolism shuts down once the ambient (African) temperature approaches 311K (I guess in a human a lot of it goes in evaporating sweat?) Whatever, the order of magnitude of the answer is unchanged.
{ "source": [ "https://biology.stackexchange.com/questions/27648", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6433/" ] }
27,799
Why draw blood from veins rather than arteries? Is it more convenient or safer?
Veins have several advantages over arteries. From a purely practical standpoint, veins are easier to access due to their superficial location compared to the arteries which are located deeper under the skin. They have thinner walls (much less smooth muscle surrounding them) than arteries, and have less innervation, so piercing them with a needle requires less force and doesn't hurt as much. Venous pressure is also lower than arterial pressure, so there is less of a chance of blood seeping back out through the puncture point before it heals. Because of their thinner walls, veins tend to be larger than the corresponding artery in the area, so they hold more blood, making collection easier and faster. Finally, it is somewhat safer if a small embolism (bubble in the blood) is introduced into a vein rather than an artery. Blood flow in veins always goes to larger and larger vessels, so there is very little chance of a vessel being blocked by the embolism before the bubble reaches the heart/lungs and is hopefully destroyed. Blood flow in an artery, on the other hand, always moves into smaller and smaller vessels, eventually ending in capilllaries, and there is a chance that a bubble introduced by a blood draw (generally rare) or more commonly an intravenous line (IV) could block a small blood vessel, potentially leading to hypoxia in the affected tissues.
{ "source": [ "https://biology.stackexchange.com/questions/27799", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/11855/" ] }
27,898
In the never-ending debate raging in the audiophile community about sound quality and what humans can or cannot hear, it is very very very very incredibly often cited that the upper-limit of the audible range of human hearing is 20 kHz, give or take. Some indicate that this is a conservative estimate, and that the actual upper-limit is actually lower than that (~18 kHz). While others suggest that sounds could be heard or otherwise perceived up to about 25 kHz-30 kHz: Sampling rates higher than about 50 kHz to 60 kHz cannot supply more usable information for human listeners. And some others suggest that there is substantial variation between individuals around the upper limit: The human range is commonly given as 20 to 20,000 Hz, though there is considerable variation between individuals, especially at high frequencies So is there any biological evidence whatsoever that young, healthy humans can hear or otherwise perceive (or sense) sound waves above 20 kHz? And what would be a conservative estimate of the absolute upper limit of the audible spectrum for humans (i.e. usable sound information for human ears and senses)?
Yes, we can . By means of bone conduction we can hear up to 50 kHz, and values up to 150 kHz have been reported in the young ( Pumphrey, 1950 ). However, it is indeed generally agreed that 20 kHz is the upper acoustical hearing limit through air conduction. The reason for this is debated, but the transfer function of the ossicle chain in the middle ear is a suspected culprit in setting the upper frequency limit to 20 kHz ( Hemila et al., 1995 ). Hence, using normal speakers or headphones 20 kHz is a very reasonable absolute upper limit . Note that the Nyquist criterium necessitates higher sampling rates (at least 40 kHz), so your statement of using 50k-60k sound cards is correct. If you decide on using bone conduction aids, you might start to think on using higher sampling rates still. Here is an example of a commercially available bone conduction head set ( AfterShockz ): These devices have the potential to increase the upper limit because they bypass the middle ear and hence circumvent the limiting transfer function of the middle ear. They induce vibrations onto the temporal bone, that travel via the bone directly to the inner ear. See the following picture from The High Tech Society : As a side note: when you grow older the hearing sensitivities at high frequencies are severely reduced, and even the 6 kHz range is severely affected in the elderly (picture from John Perr's website ): Disclaimer: I haven't looked into the capabilities in terms of upper frequency limits of bone conduction head sets. I am just talking theoretical limits. References - Pumphrey, Nature 1950; 166 :571 - Hemila et al., Hear Res 1995; 85 :31-44
{ "source": [ "https://biology.stackexchange.com/questions/27898", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/5782/" ] }
28,177
Lately I have seen a number of unrelated "scientific" debates over whether certain substances should be outlawed because they are toxic to humans. My initial, informal reaction is usually to respond that anything is toxic to humans if you give them a sufficiently large dose. However, formally I don't know if that's really true for everything a human being could ingest in some way. I started to wonder if there were some substances that our body could handle unlimited amounts of without any negative consequences. As this question has been (correctly) identified as a bit vague, I'll try to explain what i'm looking for. For the purposes of this question, I'm willing to ignore the limitations of actually ingesting a given substance in "the usual way". For example, if you can't physically drink enough of some liquid fast enough to kill you without your stomach filling up and vomiting, but that same liquid injected intravenously could be lethal, I could consider that toxic. I also recognize that the body can only physically contain a certain volume of stuff, after which sheer pressure would cause it to fail; I'm more interested in "biochemical toxicity" as opposed to any physical damage (I just don't know the term for what I'm looking for.) In other words, one of my goals is to learn if, under laboratory conditions, a properly motivated researcher could always find a dose that would be toxic, regardless of the impracticality of a real person ingesting that dose under normal circumstances. So, with that qualification, my ultimate question is: Is there any substance we know of that is completely non-toxic to humans at arbitrarily large doses ingested over an arbitrarily short period of time?
I’ll answer this theoretically, since that’s how it has been posed. And if we’re ignoring practicalities, we may as well posit that the substance in question will be introduced directly into the bloodstream (This is, of course, simple to do in reality, but not how most people consume their non-toxic substances.) The easiest way to show that any unspecified substance can be toxic at an unlimited volume is to invoke the human body’s mechanisms for volume homeostasis. As mentioned in this answer , the human kidneys functioning optimally can produce up to ~ 25 L/day of urine. 1 This would require complete suppression of ADH (anti-diuretic hormone, a.k.a. arginine vasopressin), which would occur only if the “toxin” load were markedly hypotonic (think water). 2 There is therefore a theoretical maximum volume of any substance that can be dealt with by the body, which is something less than 25 L per day. (For any substance other than water, the maximum will be lower because ADH will not be as fully suppressed by a less hypotonic load.) A volume of any substance introduced into the bloodstream (including a product precisely mimicking the constituents of the bloodstream itself!) will overwhelm the body’s homeostatic mechanism. This will result in edema which is unpleasant and, in the case of pulmonary edema , certainly pathologic - a “toxidrome” in your scenario. In the case of hypotonic fluids, serum osmolality will also fall causing hyponatremia with all of its consequences. Summary : No, the human body can not tolerate an unlimited volume of anything, therefore there is no substance that is non-toxic "at any dose." 1. Christopher Lote. (2012). Principles of Renal Physiology. Springer New York. 2. No, you may not drink 25 liters of water per day. For one thing, urine can not be made with a tonicity of 0 to balance this (more like 60 mOsm/kg minimum). Additionally, ADH can rarely be completely suppressed, yielding a somewhat more concentrated urine and therefore lower tolerance for hypotonic intake before serum osmolality is compromised.
{ "source": [ "https://biology.stackexchange.com/questions/28177", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6548/" ] }
30,005
Some mammals can have a black, pink or spotted skin, depending on race - see for example humans or pigs. But I recently learned that this is not the case with mice. Even black furred mice have pink skin, and there is a rare mutation which produces black skinned mice. I was talking with a friend about cats and we got to wonder if (domestic) cats are the type of animal which can have dark skin, like pigs, or the type which doesn't, like mice. The tons of cat related sites on the Internet seem to all talk about black furred cats only, or about diseases presenting with skin discoloration, but they don't mention the skin color. So, which type of animal are cats?
Easy: look at images of hairless cats. You will see they can be not only all black, but also grey, spotted, pink, and a few other rarer colors. Also, take an average cat - and shave for surgery: Note pigmented skin matching dark stripes.
{ "source": [ "https://biology.stackexchange.com/questions/30005", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/1578/" ] }
30,116
Does DNA have anything like IF-statements, GOTO-jumps, or WHILE loops? In software development, these constructs have the following functions: IF-statements: An IF statement executes the code in a subsequent code block if some specific condition is met. WHILE-loops: The code in a subsequent code block is executes as many times as specified, or as long as a specific condition is met. Function calls: The code temporarily bypasses the subsequent code block, executing instead some other code block. After execution of the other code block the code returns (sometimes with some value) and continues the execution of the subsequent block. GOTO-statements: The code bypasses the subsequent code block, jumping instead directly to some other block. Are constructs similar to these present in DNA? If yes, how are they implemented and what are they called?
Biological examples similar to programming statements: IF : Transcriptional activator; when present a gene will be transcribed. In general there is no termination of events unless the signal is gone; the program ends only with the death of the cell. So the IF statement is always a part of a loop. WHILE : Transcriptional repressor; gene will be transcribed until repressor is not present. There are no equivalents of function calls. All events happen is the same space and there is always a likelihood of interference. One can argue that organelles can act as a compartment that may have a function like properties but they are highly complex and are not just some kind of input-output devices. GOTO is always dependent on a condition. This can happen in case of certain network connections such as feedforward loops and branched pathways. For example if there is a signalling pathway like this: A → B → C and there is another connection D → C then if somehow D is activated it will directly affect C , making A and B dispensable. Logic gates have been constructed using synthetic biological circuits. See this review for more information. Note Molecular biological processes cannot be directly compared to a computer code. It is the underlying logic that is important and not the statement construct itself and these examples should not be taken as absolute analogies. It is also to be noted that DNA is just a set of instructions and not really a fully functional entity (it is functional to some extent). However, even being just a code it is comparable to a HLL code that has to be compiled to execute its functions. See this post too. It is also important to note that the cell, like many other physical systems, is analog in nature. Therefore, in most situations there is no 0/1 (binary) value of variables. Consider gene expression. If a transcriptional activator is present, the gene will be transcribed. However, if you keep increasing the concentration of the activator, the expression of that gene will increase until it reaches a saturation point. So there is no digital logic here. Having said that, I would add that switching behaviour is possible in biological systems (including gene expression) and is also used in many cases. Certain kinds of regulatory network structures can give rise to such dynamics. Co-operativity with or without positive feedback is one of the mechanisms that can implement switching behaviour. For more details read about ultrasensitivity . Also check out " Can molecular genetics make a boolean variable from a continuous variable? "
{ "source": [ "https://biology.stackexchange.com/questions/30116", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/-1/" ] }
30,560
As long as we only look at humans the differences are clear: males have chromosomes XY, produce sperm and don't get pregnant. Females have chromosomes XX, produce egg cells and bear babies. But when you consider other species, things are more complicated: in birds, it's females who carry the Y chromosomes. In pipefish and sea horses, it's the males who get pregnant. So maybe the only reliable criterion to tell if an animal is a male or a female is looking at its reproductive cells, and decide if they look like spermatozoa or egg cells. But then there are male and female plants, where none of the methods above applies. So how do you tell, in general, who's male and who's female in a species? Or is the distinction arbitrary?
Sexes (male and female) are generally defined in terms of Anisogamy , which means that there are size differences between the gametes (i.e. the reproductive cells that fuse at fertilization). The sex with smaller gametes is defined as male and the sex with larger gametes is defined as female, and individuals that can produce both types of gametes are called hermaphrodites. This is the case in both animals and plants (plants have pollen vs. ovules and microsporangia vs. megasporangia), and the definition of sexes is therefore not dependent on chromosomal makeup as such or which sex that carries the young. Actual sex determiniation in a particular species is often based on chromosomal inheritance though, but other systems also exists (e.g. environmental cues or sequential hermaphroditism). Anisogamy also comes in several different types, where animals generally have Oogamy , where males have small mobile spermatozoa and females large stationary egg cells. More generally, Anisogamy is a special case of mating types in sexually reproducing organisms, where fertilization (on syngamy) generally can only occur between gametes of different mating types. In for instance fungi, gametes of different mating types are of the same size ( isogamous ) and they are therefore only labelled as mating types (e.g +/-) and not different sexes. Functionally, if we are simplifying the issue, male gametes can be viewed only as carriers of genetic information, while female gametes also contain the nutrients necessary for the early development of a newly formed embryo.
{ "source": [ "https://biology.stackexchange.com/questions/30560", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/15004/" ] }
30,579
My eyes tear up when cycling at 15 mph, which is nothing compared to bird airspeeds. Do birds continuously produce lots of tears and blink a lot, or do the eyes self-moisturize from the inside without need of blinking, or are their eye surfaces just dry most of the time and they don't mind?
Birds have a body part known as the nicitating membrane otherwise known as the "third eyelid". This part has become vestigial in humans, where it remains as the plica semilunaris . This image of a masked lapwing clearly shows its nicitating membrane in action, where it covers the eye in a horizontal motion. This is analogous to blinking in humans, and the membrane moisturises the eye and removes debris while the bird is in flight. This paper explains in detail how the peregrine falcon (the world's fastest bird) clears and moisturises its eyes when diving at speeds of over 300km/h.
{ "source": [ "https://biology.stackexchange.com/questions/30579", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/10055/" ] }
30,693
The oldest known virus is known to have infected prehistoric insects 300 million years ago. A virus is basically a parasitic strand if DNA or RNA encapsulated in a protein coat. It enters cells by "wearing" a protein coat made out of proteins needed by a certain cell (e.g. Lung cells and flu virus). Now, my question: Do we know how viruses naturally formed? To simplify the question, if we went back to the first virus, how would it form? Note that I am looking for a scientific answer, and not wild-ass speculation. While I can accept some degree of speculation the accepted answer will NOT be based entirely on speculation if it is avoidable.
One of the main points of contention in the study of virus evolution is whether or not they appear before the last universal cellular ancestor (LUCA) or afterwards (commonly accepted: genes that "escaped" from host organisms aka the escape hypothesis or vagrancy hypothesis). Basically though, the LUCA is the most recent ancestor that all organisms living on Earth are derived from. Increasing evidence support that ancestry of viruses may predate the LUCA, for example an idea is that there "was an 'ancient virus world' of primordial replicators that existed before any cellular organisms and that both RNA (first) and DNA (later) viruses originated at this time, donating some features to the first cellular organisms. However, "a competing theory is that RNA cells existed before the LUCA and that RNA viruses were parasites on these RNA cells that later evolved DNA as a way of escaping host cell responses." So basically, some theories support the pre-LUCA ancient virus origin and some support post-LUCA. Because it's impossible to replicate conditions from billions of years ago, several approaches using evolutionary genetics and probability models are recommended by the author of the paper, referenced below. He also discusses the specific supporting criteria for the theories that you can read in greater detail. Holmes, E. C. (2011). "What does virus evolution tell us about virus origins?" J Virol 85(11): 5247-5251.
{ "source": [ "https://biology.stackexchange.com/questions/30693", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/11674/" ] }
34,331
How can everyone have unique iris and fingerprints? After a certain amount of human beings have lived on earth, wouldn't it be possible to exhaust all possible combinations? The same principle applies to DNA. Lets say counting all the nucleotides on a strand of DNA we find that there are a total of $N$. We know there are 4 types of nucleotides, thus the total number of possible DNA sequences equals $4^N$. This is exponential, and since $N$ is immensely huge, $4^N$ will be unthinkably huge as well. However, since $4^N$ is a finite number, how can DNA be guaranteed to be unique? Doesn't that contradict the pigeon hole principle?
The uniqueness of irises and fingerprints are, as you said, limited to the number of possible permutations of irises and fingerprints. A similar problem exists in computer science, and is known as a hash collision . Given sufficient samples, there will always be a collision for a hash of finite size. However, the sample space is sufficiently large for iris and fingerprint analysis for this to not be a problem. A typical iris analysis system produces 2048 bits of entropy, while a typical fingerprint analysis system produces about 82 bits. Even accounting for the birthday problem , the information space is large enough that the chance of a given false positive is sufficiently low to prevent a random person from passing fingerprint/iris authentication. For comparison, the current world human population is 7.2 billion, or slightly under 33 bits. The risk of a hash collision occurring is small enough to be negligible. Of course, side-channel attacks against such biometric systems are relatively simple, but that's another issue altogether.
{ "source": [ "https://biology.stackexchange.com/questions/34331", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/15789/" ] }
34,409
I've read a lot about cockroaches but was unable to find how they contribute to the ecological environment. Does anyone know?
Short answer Cockroaches are an integral part of the food chain. Background Cockroaches are an important source of food for a number of organisms, such as arthropods, birds, and mammals. As such, they are an important part of the food chain. Cockroaches also play an important role in nutrient recycling . Most species of cockroach are detritus feeders and with the help of endogenous cellulases play an important role in degrading plant material. Some species, such as Cryptocercus , feed directly on wood and play a major role in lignocellulose digestion in temperate forests. Reference - Bell et al., Integr Comp Biol , 2008; 48 (4): 541-3
{ "source": [ "https://biology.stackexchange.com/questions/34409", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/15847/" ] }
34,546
Why is it when someone comes into contact with an electrical supply that their body freezes up and is unable to move away from the electrical source? Can someone explain this through a physiological perspective?
Interesting question! An important factor here is the let-go phenomenon , which is defined as the current level in the arm that will cause the hand to involuntarily grip the current source. When the fingers are wrapped around a large cable, most adults will be able to let go with a current of less than 6 mA. At 22 mA, however, more than 99% of adults will not be able to let go. Nearly all cases of inability to let go involve alternating current. Alternating current repetitively stimulates nerves and muscles, resulting in a tetanic (sustained) contraction that lasts as long as the contact is continued. If this leads to the subject tightening his or her grip on a conductor, the result is continued electric current flow through the person and lowered contact resistance. Given that the current flow in the forearm stimulates both the muscles of flexion and extension , it seems surprising that one cannot let go. However, the muscles of flexion are stronger , making the person unable to voluntarily let go (similar to the fact that a crocodile's jaws can be kept shut with your bare hands, but one should better not attempt to keep them open like that...). Direct currents below 300 mA have no let-go phenomenon, because the hand is not involuntarily clamped. Several different outcomes may occur when a person grasps a conductor giving 10 kV AC hand-to-hand voltage. Within 10 to 100 milliseconds, muscles in the current path will strongly contract. The person may grasp the conductor more tightly. However, mostly subjects are propelled away from the contact, likely due to generalized muscle contractions. Reference - Fish & Geddes, J Plastic Surg (2009); 9 : 407-21
{ "source": [ "https://biology.stackexchange.com/questions/34546", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9020/" ] }
34,683
I was watching a nice little video on youtube but couldn't help but notice how snappy smaller animals such as rats and chipmunks move. By snappy I mean how the animal moves in almost discrete states pausing between each movement. Is this a trivial observation or something inherent in the neuro-synapse or muscular make-up of these animals?
Short answer Intermittent locomotion can increase the detection of prey by predators (e.g. rats), while it may lead to reduced attack rates in prey animals (e.g., rats and chipmunks). It may also increase physical endurance . Background Rather than moving continuously through the environment, many animals interrupt their locomotion with frequent brief pauses. Pauses increase the time required to travel a given distance and add costs of acceleration and deceleration to the energetic cost of locomotion. From an adaptation perspective, pausing should provide benefits that outweigh these costs (Adam & kramer, 1998) . One potential benefit of pausing is increased detection of prey by predators. Slower movement speeds likely improve prey detection by providing more time to scan a given visual field. A second plausible benefit is reduced attack rate by predators. Many predators are more likely to attack moving prey, perhaps because such prey is more easily detected or recognized. Indeed, motionlessness (‘freezing’) is a widespread response by prey that detect a predator. A third benefit may be increased endurance . For animals moving faster than their aerobically sustainable speeds, the maximum distance run can be increased by taking pauses. These pauses allow the clearance of lactate from the muscles through aerobic mechanisms. PS: If you mean with 'snappy' not only that small animals move intermittently, but also 'fast', then Remi.b's answers nicely covers the story why small critters are quick. Basically, it comes down to Newton's second law , namely acceleration is inversely proportional to mass ( a = F/m ), but the size of muscle power is not . Hence, bigger animals have more mass and need a lot more force to build up to accelerate at the same speed. That build up of force needs time (ever witnessed the vertical lift-off of a space shuttle?) Hence, small critters accelerate quicker and allow them to move 'snappy'. Reference - Adam & kramer, Anim Behav (1998); 55 : 109–117
{ "source": [ "https://biology.stackexchange.com/questions/34683", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9020/" ] }
34,761
There is place in my house where I cut my nails. Here, there is an ant hole where an ant colony is seen. Whenever I cut my nails from here, they take my nails inside their hole. I was wondering what they do with them. Do they protect their houses with them or feed them to their young ones?
There are a number of papers studying the ability of fungi to metabolize keratin , the primary structural component of nails (as well as skin and hair). Ants are also known to cultivate fungi for nutrients, so this may simply be a case where the ants are bringing food for their "farm animals."
{ "source": [ "https://biology.stackexchange.com/questions/34761", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/16020/" ] }
35,180
The heart is a vital organ in our body, as it drives blood circulation. I was wondering if a heart keeps beating if it is separated from the body? If yes, then why?
Short version The heart has the ability to beat independently of the brain as long as it has oxygen. The heart will eventually stop beating as all bodily systems begin to stop working shortly after brain death. Remember the heart can beat, but your diaphragm and lungs won't. Hence the cardiac muscles undergo asphyxiation and die off. However, immediately after death, there is enough oxygenated blood in the body to keep the heart pumping for a while. Long version There is a simple explanation why. As you know every muscle in the body has to receive stimuli from the neuromuscular junctions (and subsequently the nervous system) in order to contract. The heart is a bit different in that it is not regulated by the brain, but the regulatory mechanisms lie within the heart itself. The heart conductive system contains a special group of cells called the pace maker cells (SA node) that fire at regular intervals and cause the heart to beat. Each heart beat is triggered by an electrical pacemaker - a group of cells in the heart that have the ability to generate electrical activity. They cause electrical impulses to spread over the heart and make it contract. The largest natural pacemaker of the heart is called the sinoatrial or SA node and is found in the right atrium. From it, specialised groups of cells that carry the electrical charge lead off to the rest of the heart. (Taken from here ) The brain regulates the rate of the heart beat sure, but it does not send the signals that cause the heart to beat in itself. In short, even after disconnection, the SA node still sends the impulse down the AV node and Purkinje fibres that spread out across the cardiac musculature and cause them to contract, causing the heart to beat. This will continue for a while till they run out of energy and stop. You can read more about it here: Wiki
{ "source": [ "https://biology.stackexchange.com/questions/35180", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/15862/" ] }
35,191
Trees use carbon dioxide and produce oxygen in the presence of sunlight. But is there any other source? If yes, are trees the most important source of oxygen, or is there any other source which produce more than trees do?
71% of the earth's surface is taken up by water . Not surprisingly therefore, the seas are an important source of oxygen. National Geographic claims that photosynthesis by phytoplankton (mostly single-celled phototrophs , such as cyanobacteria, green algae and diatoms) account for half of the earth's oxygen production . The other half, they claim, is produced on land by trees, shrubs, grasses, and other plants. The Ecology Global Network takes it a step further and claims that all marine plants (including phytoplankton) together produce 70 to 80 percent of the oxygen in the atmosphere . Based on these reports, hence, marine phototrophs account for 50 - 80% of the earth's oxygen production. With regard to terrestrial oxygen production, NASA reports that 30% of the land is covered by trees, and as much as 45 percent of the carbon stored on land is tied up in forests. So on land, trees are definitely large contributors to oxygen production.
{ "source": [ "https://biology.stackexchange.com/questions/35191", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/15862/" ] }
35,337
Across the electromagnetic spectrum, 400-700 nm is a narrow spectrum of frequencies and focused in the region of short wavelengths. For example, radio waves cover a large range of frequencies unexploited by the visual system. So what biological reason is there that evolved us to use such a small frequency bandwidth for vision?
Short answer The visible spectrum has the highest energy in sunlight at the earth's surface, explaining the gross location of the visible spectrum in life on earth. The specific frequency range varies across species and can be explained by species-specific survival strategies. Background When you look at the solar light spectrum at the earth's surface the visible spectrum has the highest intensity (fig. 1). Solar irradiation. Source: University of California . So it makes sense to use the range of frequencies that is represented most in sunlight as a starting point. Then the question becomes, why do humans utilize approximately 400 to 700 nm , and not infrared or UV? That can be explained because we do not need it. Our range has been hypothesized to be related to foraging behaviors and our visual system is particularly sensitive in the frequency range of the coloring of (ripe) fruits , which is thought to have been of great benefit to our hominid ancestors (Osorio & Vorobyev, 1996) . Why then do animals extend their vision into UV ? Many fish, amphibian, reptilian, avian, and some mammalian species use UV vision. Many birds can identify UV-reflected nectar and berries , and UV-reflecting plumages in birds, and scales in fishes are used for recognition (Shi & Yokoyama, 2003) . Moreover, some arthropod species are know to use UV vision to reduce light-reflection distortions under water, such as in the mantis shrimp that features 12 photoreceptor types (as opposed to four in humans) (Thoen et al ., 2014) . Why then do animals extend their dynamic range into the infrared ? A notable beneficial effect of perceiving infrared is the detection of body heat . The generation of heat is accompanied by the generation of infrared light. The detection of this emitted light is highly useful for nocturnal predators, like the rattle snake (Hartline & Newman, 1982) . References - Hartline & Newman, Sci Am (1982); 246 (3): 116-27 - Osorio & Vorobyev, Proc Roc Soc B (1996); 263 (1370) - Shi & Yokoyama, PNAS (2003); 100 (142003): 8308-13 - Thoen et al., Science (2014); 343 (6169): 411-3 Further Reading 1. Is our color vision calibrated to sky, vegetation, and blood? 2. Is there a physical reason for colors to be located in a very narrow band of the EM spectrum?
{ "source": [ "https://biology.stackexchange.com/questions/35337", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/16294/" ] }
35,370
I just finished watching a video where it was mentioned that nowadays birds are dinosaurs and non-avians dinosaurs could have feathers. I confirmed this from wikipedia: Birds are highly advanced theropod dinosaurs , characterised by feathers, a beak with no teeth, the laying of hard-shelled eggs, a high metabolic rate, a four-chambered heart, and a lightweight but strong skeleton. And: Direct fossil evidence of feathers or feather-like structures has been discovered in a diverse array of species in many non-avian dinosaur groups , both among saurischians and ornithischians. And this family tree of reptiles mentions: Archosauriformes (crocodiles, birds, dinosaurs and extinct relatives) And later in the Mesozoic era : The dinosaurs also developed smaller forms, including the feather-bearing smaller theropods . So, were these non-avian dinosaurs with feathers actually reptiles?
Source of information on Biology.SE This answer offers an introduction to phylogeny on the case study of dinosaurs and birds. If you are not at ease with the concept of monophyletic group, you should definitely have started with this introduction. This post is somewhat related. Origin of your misunderstanding The question is all about nomenclature (and a little bit of semantics). One can call reptiles whatever (s)he wants. The question is what do we define as being a reptile? And the answer is that there are two possible definitions, a common "bad" definition ( Definition 1 ) and a phylogenetic-based "good" definition ( definition 2 ). I think your confusion comes from the use of the same term to mean two different (but related) things. Definition 1: reptiles In general, when people talk about reptiles, they talk about turtles , Rhynchocephalia , Squamata and Crocodilia . In this sense, the term reptile is NOT a monophyletic group. In other words, all species being called reptiles (according to this definition) do not share a common ancestor who has no other descendants than the species being called reptiles. Definition 2: Reptilia There is a defined monophyletic group called Reptilia . Reptilia is a group that contains all Amniota except the Synapsida ( mammals and their extinct close relatives). In other words, Reptilia contains all generally called reptiles (as defined above) and all birds as well as all extinct species that are descendent from this same common ancestor. Exploring the tree of life by yourself You will find the tree of life on tolweb.org or on onezoom.org (see The best free and most up to date phylogenetic tree on the internet? for more info). Using tolweb.org: here are the roots of the tree of the Amniota . And you will probably want to search for the Dinosauria ( there ) and see how closely related they are to the birds but not so much to the turtles. Addressing your question directly If dinosaurs could have feathers, would they still be reptiles? If by reptiles you mean Reptilia , then whether a given dinosaur has feathers, endothermy, or an exoskeleton (!) doesn't change anything to the fact that this dinosaur is a reptile. If by reptiles you mean turtles , Rhynchocephalia , Squamata and Crocodilia , then whether a given dinosaur has feathers or not doesn't change anything to the fact that this dinosaur is NOT a reptile! Known Dinosaurs with feathers? Given that birds are the only animals that have feathers and that birds are dinosaurs, we don't know of any species that has feathers and that is not a dinosaur! However, when we think of dinosaurs, we usually don't think about a pigeon. Of course, the Archaeopteryx had feathers too. Archaeopteryx is an avian (bird-like) dinosaur. But even non-avian dinosaurs such as Velociraptor probably had feathers as well. More info about how closely related is Velociraptor to the birds (Aves) there on tolweb.org . You probably remember the so-called Velociraptor from Jurassic Park movie (on the left) but here is what a Velociraptor probably really looked like (on the right). The "velociraptors" from Jurassic park actually look more like a large Deinonychus without feathers than a Velociraptor (Thank you @Gaurav in the comments). I suspect because they chose Velociraptor because Deinonychus is much harder to pronounce and way less sexy sounding. Like this, tThe movie Jurassic Park deceived an entire generation about what a Velociraptor is! More information about what the species of Dinosaurs the Jurassic Park movie features in the fun video (in French) Le Vélociraptor from Max Bird. You might want to have a look at the post Were there any flying dinosaurs? that is very related. At least, all these big and extinct things with scales are dinosaurs, right? Well.... not exactly. There are species that many would call dinosaurs that are typically not considered as dinosaurs. Have a look at the MinuteEarth video called "What makes a dinosaur?" for more information in this regard. Fun and instructive videos Les dinosaures ont disparu ? from Max Bird and Jamy (in french) Le Vélociraptor from Max Bird (in French) What makes a dinosaur? from MinuteEarth
{ "source": [ "https://biology.stackexchange.com/questions/35370", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/16310/" ] }
35,415
Chromosome number differs across species. Is the amount of DNA comparable between organisms, just being split into smaller chunks in those species with more chromosomes, or do species have different genome sizes? If so, does the genome size correlate roughly with the complexity of the species?
Chart of C-values (the mass of DNA in a single haploid cell); there is no logical order to the groups: [ source ] Base pairs in haploid genome (some examples): Escherichia coli (bacterium): ~4.5 million Caenorhabditis elegans (nematode worm): ~100 million Homo sapiens (we all know what these are): ~3 billion Pinus taeda (coniferous tree): ~22 billion Prorocentrum micans (single-celled algae): ~245 billion From these data we can conclude: Different species do not have the same genome size. Genome size is not correlated with complexity. Organismal complexity can be hard to define but, qualitatively, I think we can all agree that a human is more complex than a single-celled alga. And yet, humans have a genome that is 80 times smaller. This is known as the C-value paradox. Note, however, that this paradox has been resolved after it was found that the genomes of most eukaryotes contain a large proportion of non-coding and repetitive DNA. Further reading: The C-value paradox, junk DNA and ENCODE by Eddy SR Eukaryotic Genome Complexity by Pray L
{ "source": [ "https://biology.stackexchange.com/questions/35415", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/9910/" ] }
35,446
There are plenty of different hand soaps out there, as well as hand sanitizers. Is there an advantage to soaps that claim that they're antibacterial vs soaps that just say soap? In particular I'm looking at Softsoap who offers normal soap and antibacterial soap. Examples: Normal: Antibacterial:
Short answer: There is no benefit for their use in households. Long answer: These soaps (see here for the complete list) contain the so called quaternary ammonium compounds Benzalkonium chloride and Cetrimonium chloride which indeed have antimicrobial properties. While they do not promote resistance to these compounds (see reference 1), their use is still not recommended, as their permanent use might dry out the skin, can cause contact allergies and the products released into the environment are also problematic. There are two studies, which compared the use of normal soap (which has some antibacterial properties on its own) to antibacterial soaps in household environments and found no differences. See article linked in reference 2 for a summary and references 3 and 4 for details on the studies. This doesn't mean that antibacterial soaps are useless at all, they simply make no sense in households. For hospitals or doctors they are an important tool to protect their patients before operations. But here detailed instructions for how long and how the hands have to be washed are provided. Hand washing is also followed by another disinfection step, which helps with efficiency. But this is very much different from the way people wash their hands at home. See reference 5 for some opinions here. References: Use of germicides in the home and the healthcare setting: is there a relationship between germicide use and antibiotic resistance? Plain soap as effective as antibacterial but without the risk Consumer antibacterial soaps: effective or just risky? Effect of antibacterial home cleaning and handwashing products on infectious disease symptoms: a randomized, double-blind trial. The Burning Question: Is It Safe to Use Antibacterial Soap?
{ "source": [ "https://biology.stackexchange.com/questions/35446", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/16041/" ] }
35,532
If a trait would be advantageous to an organism then why hasn't it evolved yet? Conversely, if a trait is not advantageous or mildly disadvantageous, why does it exist? In other words why does evolution not make the organism more "perfect"? This is a general question that would be applicable for any kind of trait. Please keep the answers precise and scientific. Read this meta post for more information: Questions asking for evolutionary reasons
During the process of selection, individuals having disadvantageous traits are weeded out. If the selection pressure isn't strong enough then mildly disadvantageous traits will continue to persist in the population. So the reasons for why a trait is not evolved even though it may be advantageous to the organism, are: There is no strong pressure against the individuals not having that trait. In other words lack of the trait is not strongly disadvantageous. The trait might have a tradeoff which essentially makes no change to the overall fitness. Not enough time has elapsed for an advantageous mutation to get fixed. This doesn't mean that the mutation had not happened yet. It means that the situation that rendered the mutation advantageous had arisen quite recently. Consider the example of a mutation that confers resistance against a disease. The mutation wouldn't be advantageous if there was no disease. When a population encounters the disease for the first time, then the mutation would gain advantage but it will take some time to establish itself in the population. The rate for that specific mutation is low and therefore it has not yet happened. Mutation rates are not uniform across the genome and certain regions acquire mutations faster than the others. Irrespective of that, if the overall mutation rate is low then it would take a lot of time for a mutation to arise and until then its effects cannot be seen. The specific trait is too genetically distant: it cannot be the result of a mutation in a single generation. It might, conceivably, develop after successive generations, each mutating farther, but if the intervening mutations are at too much of a disadvantage, they will not survive to reproduce and allow a new generation to mutate further away from the original population. The disadvantage from not having the trait normally arises only after the reproductive stage of the individual's lifecycle is mostly over. This is a special case of "no strong pressure", because evolution selects genes, not the organism. In other words the beneficial mutation does not alter the reproductive fitness. Koinophillia resulted in the trait being unattractive to females. Since most mutations are detrimental females don't want to mate with anyone with an obvious mutation, since there is a high chance it will be harmful to their child. Thus females instinctually find any obvious physical difference unattractive, even if it would have been beneficial. This tends to limit the rate or ability for physical differences to appear in a large & stable mating community. Evolution is not a directed process and it does not actively try to look for an optimum. The fitness of an individual does not have any meaning in the absence of the selection pressure. If you have a relevant addition then please feel free to edit this answer.
{ "source": [ "https://biology.stackexchange.com/questions/35532", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3340/" ] }
35,535
Is there a methodology to select a reasonable threshold for copy number variation in a CNV (SNP array) TCGA dataset, to define when there is a significative alteration? Can I download CNV data for normal samples and take the 95th percentile of distribution? Are there better methods? Update This is the percentiles plot of the two distribution (Tumor vs Normal) of values, for the same technology (SNP array) and the same genome (hg19). The tumor distribution has slightly more extreme values, though it is not enough in my opinion. For this reason I think I should not use a percentile score (the 5th and the 95th percentile of the normal samples distribution, for instance) to define the thresholds to call CNV alterations in the tumor samples.
During the process of selection, individuals having disadvantageous traits are weeded out. If the selection pressure isn't strong enough then mildly disadvantageous traits will continue to persist in the population. So the reasons for why a trait is not evolved even though it may be advantageous to the organism, are: There is no strong pressure against the individuals not having that trait. In other words lack of the trait is not strongly disadvantageous. The trait might have a tradeoff which essentially makes no change to the overall fitness. Not enough time has elapsed for an advantageous mutation to get fixed. This doesn't mean that the mutation had not happened yet. It means that the situation that rendered the mutation advantageous had arisen quite recently. Consider the example of a mutation that confers resistance against a disease. The mutation wouldn't be advantageous if there was no disease. When a population encounters the disease for the first time, then the mutation would gain advantage but it will take some time to establish itself in the population. The rate for that specific mutation is low and therefore it has not yet happened. Mutation rates are not uniform across the genome and certain regions acquire mutations faster than the others. Irrespective of that, if the overall mutation rate is low then it would take a lot of time for a mutation to arise and until then its effects cannot be seen. The specific trait is too genetically distant: it cannot be the result of a mutation in a single generation. It might, conceivably, develop after successive generations, each mutating farther, but if the intervening mutations are at too much of a disadvantage, they will not survive to reproduce and allow a new generation to mutate further away from the original population. The disadvantage from not having the trait normally arises only after the reproductive stage of the individual's lifecycle is mostly over. This is a special case of "no strong pressure", because evolution selects genes, not the organism. In other words the beneficial mutation does not alter the reproductive fitness. Koinophillia resulted in the trait being unattractive to females. Since most mutations are detrimental females don't want to mate with anyone with an obvious mutation, since there is a high chance it will be harmful to their child. Thus females instinctually find any obvious physical difference unattractive, even if it would have been beneficial. This tends to limit the rate or ability for physical differences to appear in a large & stable mating community. Evolution is not a directed process and it does not actively try to look for an optimum. The fitness of an individual does not have any meaning in the absence of the selection pressure. If you have a relevant addition then please feel free to edit this answer.
{ "source": [ "https://biology.stackexchange.com/questions/35535", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/3466/" ] }
35,569
I know what the effects are of a dangerous situation on the brain, i.e. , an activation of the hypothalamic-pituitary-adrenal (HPA) axis which eventually results in an increased heart rate and elevated blood pressure. However, I do not understand why enhanced blood circulation would result in a paling of the skin? Do red blood cells actively change direction?
Red blood cells are not equipped with a motor system to propel them through the blood stream. Instead, they are passively transported through the vasculature by the the pumping action of the heart. The effects of dangerous situations on the skin have to do with hormonal effects on the blood vasculature, and not with direct effects on red blood cells. Dangerous situations trigger the fight-fright-flight response, and is a direct result of adrenaline being released into the bloodstream. Adrenaline prepares the body to fight for its life. Adrenaline has a variety of effects including enhancing perspiration (or diaphoresis , which prepares the body for the increase in temperature associated with fleeing/fighting), dilation of the pupils (which increases light sensitivity, but reduces acuity), dry mouth (gastric juices and saliva production decreases because blood flow to the digestive system is decreased), enhanced smell and hearing , and a cool, pale skin . The cool and pale skin is caused by a reduced blood flow to the surface of the body, while blood flow to the arms, legs, shoulders, brain, eyes, ears and nose can be increased. Besides getting ready to run and fight, the body is preparing to think quickly and be aware of threats by hearing, seeing and smelling things better. Pulling blood away from the skin also helps decrease bleeding from cuts and scrapes (Source: Army, Navy & Air Force Australia ). Adrenaline stimulates alpha-adrenoreceptors in blood vessels, which causes the smooth muscles around the vessels to constrict (Bolli et al ., 1984) Adrenaline (epinephrine) released from the bloodstream dilates vessels in the skeletal muscle via beta-receptors, and constricts them in the digestive system and the skin through alpha-adrenergic receptors. Source: Marian University College, Indiana . Reference - Bolli et al ., J Hypertens (1984); 2 (3): S115-8
{ "source": [ "https://biology.stackexchange.com/questions/35569", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6124/" ] }
35,851
Ten years ago, I emailed a prominent lung specialist with my suggestion for a treatment for Tuberculosis. His lack of response led me to believe that the idea had no merit whatsoever – but I had no idea what the failings might be. I still don’t and I’m hoping someone will enlighten me as to why this is not worth exploring. The idea is based upon the fact that Mycobacterium Tuberculosis is aerobic – in fact Wikipedia states it “requires high levels of oxygen”. I’d heard that the TB “Sanatoriums” used to practice the treatment of breaking ribs on one side to collapse that lung and “rest” it. It seemed to me that this resting was actually starving the bacterium of Oxygen and killing the infestation. My suggestion is that we take advantage of having two lungs by inserting a pair of breathing tubes into the respiratory tract and into the head of the two bronchi: it may be necessary to use ultrasound or other imaging to accurately position the tubes. We feed pure Nitrogen into one tube, and 40/60 Oxygen/Nitrogen into the other – double Oxygen concentration. The patient therefore receives all their Oxygen requirements through one lung. After some period of time, when we judge that the bacteria in the “starved” lung are all dead, we switch the supplies to the 2 tubes and treat the other lung. Can anyone see why this idea is so flawed?
High oxygen concentration can be deleterious; it can induce oxidative damage. The systemic blood circulation would supply oxygen to the "oxygen-deprived" lung. Moreover, Mycobacteria can survive in anaerobic conditions. And what if both lungs are infected? There are many flaws in the proposed therapy. Adding this point from one of the comments below: There are several cases of extrapulmonary tuberculosis and in these cases treating just the lung would not make sense.
{ "source": [ "https://biology.stackexchange.com/questions/35851", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/14750/" ] }
36,079
Often the names of herbal ingredients in certain cosmetics products are given by their scientific names like Anthemis nobilis instead of chamomile or Lavandula angustifolia instead of lavender. Is there any reason why this practice is followed? Wouldn't those who have allergies to certain plant materials be better off reading "coriander leaf extract" instead of scratching their heads over what " Coriandrum sativum leaf extract" is? Why put something more complex when something simpler would be more beneficial to the consumer?
The use of a genus-species notation gives more exact information . For example there are multiple species of chamomile : There is Roman chamomile ( Chamaemelum nobile ), German chamomile ( Matricaria recutita , or Chamomilla recutita ) and Dyer's chamomile ( Anthemis tinctora ). The first two species are appraised for their medicinal properties and help to calm upset tummies and to aid sleep, among other things. The latter species, however, does not have these properties and is used for dyeing. This illustrates the fact why 'chamomile' alone is insufficient. Popularly, classifications of living organisms arise according to need and are often superficial. Anglo-Saxon terms such as 'worm' have been used to refer to any creeping thing including snakes, earthworms and intestinal parasites. The term 'fish' is used in shellfish, crayfish, and starfish. However, there are more anatomical differences between a shellfish and a starfish than there are between a bony fish and man. In science it has been the convention to use the genus-species notation since Carl Linnaeus introduced it in the 1700's . This formal classification serves as a basis for a relatively uniform and internationally understood nomenclature. A uniform classification system simplifies cross-referencing and retrieval of information. The Linnaean taxonomical system aids in this purpose and is widely used. The genus-species system can be extended by including subspecies and varieties. Many (plant) species don't even have an (English) trivial name. Taking your lavender example: there are some 39 Lavendula species known and obviously, many of them don't have a trivial name. Here one has to fall back to the Latin names to be sure what it is.
{ "source": [ "https://biology.stackexchange.com/questions/36079", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/16765/" ] }
36,241
I have heard (from multiple sources) that the current scientific opinion is that the human species arose in Africa. What are the reasons for this opinion? If possible, simple and non-technical explanations (as far as possible) would be appreciated.
There are two big prongs of the out of Africa theory or whichever name you wish to call it. Prong the first: fossil evidence. There are lots of different kinds of protohuman fossils. Homo erectus/ergaster are found all across Europe, Asia, and into Indonesia from about 1.5 million years or so until about 70 thousand years ago, where they stop showing up. Up until 125 thousand years ago anatomically modern humans were only found in Africa. About 70 thousand years ago they start showing up in the Middle East, and then they spread out roughly following these paths . The fossil record shows not-humans or almost-humans ( Homo erectus mostly) for millions of years, then humans show up at a certain point and then there's loads of human fossils. This point gets more recent as you get further from East Africa. Prong the second: genetic diversity. Starting with this paper (not sure if this is behind a paywall but the details are not important anyway) human mitochondrial DNA was compared using restriction enzyme mapping. This kind of mapping is super crude (roughly analogous to grinding pottery into a fine dust and grouping the dusts by color) and the original study was pretty limited by the computers available at the time. Nonetheless, they showed that the most genetically diverse geographical group was Africa, and furthermore that any two people from outside Africa are likely more closely related to each other than any two people inside Africa. Genetic diversity goes down the further away from East Africa you get, matching what you'd expect if humans hadn't been living there long. There have only been (very roughly) 60 generations since humans colonized New Zealand. All Maori people, therefore, are at most 58th cousins. All indigenous Australians are at most 1998th cousins. All Africans are at most 8000th cousins. More recently we've done proper sequencing on the mitochondrial DNA (actually knowing whats written there) and that's allowed much more precise estimation of this sort of thing, and estimation of the timeframes involved. The genetic evidence backs up the fossil record, by and large. (There are a few interesting examples where interbreeding with Neanderthals and maybe Denisovans can be detected, and that the settlement of the middle east by modern humans about 125 thousand years ago failed. They left no descendants.) Fun side consideration (warning, extra science, proceed with caution): all humans inherit their mitochondria from their mother, and all males inherit their Y-chromosomes from their father. This lets us trace matrilineal lines with a relatively high degree of accuracy, since mitochondria reproduce asexually. To clarify: your matrilineal line is your mother, and her mother, and so on. Your paternal grandmother is not part of your matrilineal line, nor are your aunts or sisters. These lines are statistically guaranteed to eventually converge on a single woman whose mitochondrial descendants now live in all of us. The reasons for this are complicated . There are actually lots of these women, since she inherited her mitochondria from her mother, ad infinitum (well, not infinitum. Ad failed-endocytosis-of-an-alpha-proteobacterium-leading-to-mitochondria doesn't roll off the tongue though). Science has tight estimates on the most recent mitochondrial ancestor, or "Mitochondrial Eve". To be clear: there were loads of other women alive at the time, and we inherit a lot of their non-mitochondrial DNA. Over millennia all those other women had fewer daughters, and their matrilineal lines died out. She lived about 200 thousand years ago, plus minus 20 thousand years. As a mathematical guarantee we'll never find her body or have a really tight estimate on how long ago she lived, but she's genetically guaranteed to exist. The same principle applies to patrilineal inheritance, but the estimates for the most recent ancestor of all Y-chromosomes are a little looser (200-300 thousand years ago). See here for a more detailed handling of Eve and what's going on there. In sum: old fossils only in Africa, everyone outside Africa is only 2800th cousins with each other or less, but intra-African relatedness is less than half that (more than twice as far away genetically).
{ "source": [ "https://biology.stackexchange.com/questions/36241", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/284/" ] }
36,620
It seems kind of anti-productive in terms of survival for a plant to produce an addictive chemical as that plant will constantly be sought after by animals that ingest it. In this instance, I'm looking for a possible general & inclusive answer here that would describe most plants that make this. Not a specific instance (although if provided as an example would be a plus). To appreciate the scope of this is terms of number of plants producing potentially addictive compounds - see this compendium: compendium of botanicals reported to produce toxic, physchoactive or addictive compounds
It's a matter of perspective. Most of the chemicals that are addictive to us humans (particularly alkaloids), and may be addictive for some other animals as well, are also insecticides. Lots of plants that we consider poisonous are good food for other species, and lots of plants that insects would consider poisonous are treats for us. This is a great example of the aimless nature of evolution. The plants that could successfully defend themselves against insects stabilize on a solution that happens to be bad for them in certain ways. Although, you would be hard pressed to find a better way to guarantee reproduction than being addictive to humans. Background reference Plant-insect coevolution and inhibition of acetylcholinesterase The defensive role of alkaloids in insects and plants Exploration of nature's chemodiversity: the role of secondary metabolites as leads in drug development Also of interest Bees prefer foods containing neonicotinoid pesticides
{ "source": [ "https://biology.stackexchange.com/questions/36620", "https://biology.stackexchange.com", "https://biology.stackexchange.com/users/6061/" ] }