source_id
int64 1
4.64M
| question
stringlengths 0
28.4k
| response
stringlengths 0
28.8k
| metadata
dict |
|---|---|---|---|
36,712 | I am not quite sure if it is true, but I read somewhere that within 7 years all the body's cells are replaced with new ones. I am not quite sure if it is cells or atoms. If it is then why do tattoos persist for so long? If the cells which were impregnated with the dye have been replaced, then why do the tattoos still remain? | First, tattoo pigment isn't injected into cells. If you were to puncture a cell with something the size of a tattoo needle, it would die - full stop. Many cells are destroyed in the process though, mostly by tearing, which initiates the wound healing process. So what actually happens is the particles lodge in between the cells of the dermis (the layer below the epidermis, or outer layer of skin) and new cells crowd around it as damaged cells are replaced. Since the particles in good tattoo ink are too big to be carried off by macrophages, they just sit there. That doesn't stop them from trying, though. Macrophages take up the pigment but are unable to escape with their garbage. Fibroblasts envelope the particles, both intracellularly and within the extracellular matrix they generate. At the end of a fibroblast's life, its contents are taken up by the same process - still too big to remove. Smaller particles will be carried off by macrophages capable of both consuming the particles and migrating into the lyphatic system, which is why some ink fades more than other kinds. Ink composed of fine particles would be expected to fade severely. New tattoos are also sharper because some of the ink that was injected is lodged in the epidermis, which is the layer that grows out and is shed over time. In this biopsy of a tattooed mouse, you can see how the epidermis has carried some of the pigment out of the skin while much of the dermal layer's pigment has been either removed lymphatically or enveloped: Source: Tattooing of skin results in transportation and light-induced decomposition of tattoo pigments--a first quantification in vivo using a mouse model. Thus, over time the pigment will be moved around a bit by this cellular activity, in fact deeper into the dermal layer on the whole. The intent of using laser light to remove tattoos is to break those particles down into smaller pieces burst any cells containing them - again initiating the wound healing process. However, unlike in previous cases, when macrophages reach the site they can now sweep the remaining particles away to the lymph nodes. Sources General - Tattoos and tattooing. Part II: Gross pathology, histopathology, medical complications, and applications. Process - Cutaneous Wound Healing Secondary sources: Fate of tattoo pigments in skin (pdf) How Laser Tattoo Removal Works - Smarter Every Day | {
"source": [
"https://biology.stackexchange.com/questions/36712",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/17202/"
]
} |
39,046 | I feel that I might have a complete misunderstanding here. If DNA has two strands, how does the machinery of RNA transcription determine which one to transcribe? | I'll keep this short and simple. The direction of transcription (which determines which strand is used as the template) is controlled by the promoter, which is a region of specific DNA motifs at the 5' end of a gene. RNA polymerase binds to the promoter, which orients it on the correct strand and in the correct direction, after which it can proceed to transcribe the gene. That great little animation is from this website. | {
"source": [
"https://biology.stackexchange.com/questions/39046",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/9448/"
]
} |
39,291 | Are there any non-mammalian animals that produce milk to feed their young, or are mammals the only milk-producing animals? | Short answer Technically, only mammals lactate. To lactate means to produce milk from the mammaries to feed a baby or young animal . Milk , in turn, is defined as the secretions from mammary glands. However, there are animals other than mammals that produce milk- like substances to feed their young. Background Both male and female pigeons ( Columba livia ) possess the ability to produce a nutrient substance, termed pigeon ‘milk’, to feed their young. A similar substance is produced by flamingos and male emperor penguins . The normal function of a crop is a food storage area located between the oesophagus and proventriculus where food is moistened before further break-down and digestion through the gastrointestinal tract (Fig. 1). Fig. 1. Schematic of the location of the 'milk'-producing crop in a pigeon (left) and a pigeon feeding its chick from its crop (right). Sources: ZME Science and Bird Ecology Study Group During the process of pigeon ‘lactation’, a curd-like substance is regurgitated from the crop to the chick. The dry-substance of pigeon ‘milk’ is 60% protein, 32-36% fat, 1-3% carbohydrate and some minerals, including calcium. It has been shown that pigeon ‘milk’ contains IgA antibodies, which provides evidence suggestive that it is more than a nutrients alone. The physiological mechanisms governing pigeon ‘milk’ production and delivery are unknown. It is well documented that the pigeon crop is responsive to the lactogenic hormone prolactin. However, the pigeon crop tissue during ‘lactation’ is structurally unrelated to the mammary glands in mammalians, because it is not glandular and secretory processes do not seem to be involved (Gillespie et al , 2011) . The similarity between this process and lactation in mammals is striking, but is a case of convergent evolution, where unrelated species independently evolve similar traits. 'Milk' production is also recorded in some fishes , where it is fed to their young in the form of a mucous secretion on the skin (Buckley, 2010) . Certain amphibians shed skin cells that are fed to the young. But the 'milk' of pigeons and doves is thought to be the most highly specialized of any non-mammalian 'milk' ( Australian Geographic, September 2011 ). References - Buckley et al ., J Exp Biol ; 213 : 3787-95 - Gillespie et al. , BMC Genomics (2011); 12 : 452 | {
"source": [
"https://biology.stackexchange.com/questions/39291",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6657/"
]
} |
39,664 | To be clear, I'm not doubting that Homo sapiens and Homo neanderthalensis did interbreed: of that much I'm convinced. Within the past few years I've seen an upcropping of pop-sci articles discussing the interbreeding between pre-historic species of humans. In everything that I see in these articles, as well as in scientific literature (my college Bio textbook, among others), I see these different human groups being referred to as separate species. This conflicts with my understanding of a species. Given the following definition, wouldn't Homo sapiens and Homo neanderthalensis be the same species? A species is often defined as the largest group of organisms where
two hybrids are capable of reproducing fertile offspring, typically
using sexual reproduction. ~Wikipedia Is this definition incorrect? Are the publications using "species" colloquially, as opposed to scientifically? Is "species" still a poorly defined concept? (see Ring Species ) Thanks! | Short answer The concept of species is poorly defined and is often misleading. The concepts of lineage and clade / monophyletic group are much more helpful. IMO, the only usefulness of this poorly defined concept that is the "species" is to have a common vocabulary for naming lineages. Note that Homo neanderthalis is sometimes (although it is rare) called H. sapiens neanderthalis though highlighting that some would consider neanderthals and modern humans as being part of the same species. Long answer Are neanderthals and modern humans really considered different species? Often, yes they are considered as different species, neanderthals being called Homo neanderthalis and modern humans are being called Homo sapiens . However, some authors prefer to call neanderthals Homo sapiens neanderthalis and modern humans Homo sapiens sapiens , putting both lineages in the same species (but different subspecies). How common were interbreeding between H. sapiens and H. neanderthalis Please, have a look at @iayork's answer . The rest of the post is here to highlight that whether you consider H. sapiens and H. neanderthalis to be the same species or not is mainly a matter of personal preference given that the concept of species is mainly arbitrary. Short history of the concept of species To my knowledge, the concept of species has first been used in the antiquity. At this time, most people viewed species as fixed entities, unable to change through time and without within-population variance (see Aristotle and Plato's thoughts ). For some reason, we stuck to this concept even though it sometimes appears to not be very useful. Charles Darwin already understood that as he says in On the Origin of Species (see here ) Certainly no clear line of demarcation has as yet been drawn between species and sub-species- that is, the forms which in the opinion of some naturalists come very near to, but do not quite arrive at the rank of species; or, again, between sub-species and well-marked varieties, or between lesser varieties and individual differences. These differences blend into each other in an insensible series; and a series impresses the mind with the idea of an actual passage. You might also want to have a look at the post Why are there species instead of a continuum of various animals? Several definitions of species There are several definitions of species that yield me once again to argue that we should rather forget about this concept and just use the term lineage and use an accurate description of the reproductive barriers or genetic/functional divergence between lineage rather than using this made-up word that is "species". I will below discuss the most commonly used definition (the one you cite) that is called the Biological species concept . Problems with the definition you cite A species is often defined as the largest group of organisms where two hybrids are capable of reproducing fertile offspring, typically using sexual reproduction. Only applies to species that reproduce sexually Of course, this definition only applies to lineages that use sexual reproduction. If we were to use this definition for asexual lineages, then every single individual would be its own species. In practice In general, everybody refers to this definition when talking about sexual lineages but IMO few people are correctly applying for practical reasons of communicating effectively. How low the fitness of the hybrids need to be? One has to arbitrarily define a limit of the minimal fitness (or maximal outbreeding depression) to get an accurate definition. Such boundary can be defined in absolute terms or in relative terms (relative to the fitness of the "parent lineages"). If, the hybrid has a fitness that is 100 times lower than any of the two parent lineages, then would you consider the two parent lineages to belong to the same species? Type of reproductive isolation We generally categorize the types of reproductive isolation into post-zygotic and pre-zygotic reproductive isolation (see wiki ). There is a lot to say on this subject but let's just focus on two interesting hypothetical cases: Let's consider two lineages of birds. One lineage has blue feathers while the other has red feathers. They absolutely never interbreed because the blue birds don't like the red and the red birds don't like the blue. But if you artificially fuse their gametes, then you get a viable and fertile offspring. Are they of the same species? Let's imagine we have two lineages of mosquitoes living in the same geographic region. One flying between 6 pm and 8 pm while the other is flying between 1 am and 3 am. They never see each other. But if they were to meet while flying they would mate together and have viable and fertile offsprings. Are they of the same species? Under what condition is the hybrids survival and fertility measured Modern biology can do great stuff! Does it count if the hybrid can't develop in the mother's uterus (let's assume we are talking about mammals) but can develop in some other environment and then become a healthy adult? Ring species in space As you said in your question, ring species is another good example as to why the concept of species is not very helpful (see the post Transitivity of Species Definitions ). Ensatina eschscholtzii (a salamander; see DeVitt et al. 2011 and other articles from the same group) is a classic example of ring species. Species transition through time Many modern lineages cannot interbreed with their ancestors. So, then people might be asking, when exactly did the species change occurred? What generation of parent where part of species A and offspring where part of species B. Of course, there is no such clearly defined time in which transition occurred. It is more a smooth transition from being clearly reproductively isolated (if they were placed to each other) from being clearly the same species. Practical issue - Renaming lineages How boring it would be if every time we discover the two species can in some circumstances interbreed, we had to rename them! That would be a mess. Time Of course, when we talk about a species we refer to a group of individuals at a given time. However, we don't want to rename the group of individuals of interest every time a single individual die and get born. This notion yield to the question of how long in time can a single species exist. Consider a lineage that has not split for 60,000 years. Was the population 60,000 years ago the same species as the one today? The two groups may differ a lot phenotypically and may actually be reproductively isolated if they were to exist at the same time. Special cases When considering a few special cases, the concept of species become even harder to apply. The Amazon molly (a fish) is a "species" that have "sexual intercourse" without having "sexual reproduction" and there are no males in the species! How is it possible? The females have to seek for sperm in a sister species in order to activate the development of the eggs but the genes of the father from the sister species are not used ( Kokko et al. (2008) ). In an ant "species", males and females can both reproduce by parthenogenesis (some kind of cloning but with meiosis and cross-over) and don't need each other to reproduce. In this respect, males could actually be called females. But they still meet to reproduce together. The offsprings of a male and a female (via sexual reproduction) are sterile workers. So males and females are just like two sister species that reproduce sexually to create a sterile army to protect and feed them ( Fournier et al. (2005) ). Bias It often brings fame to discover a large new species. In consequence, scientists might tend to apply a definition of species that allow them to tell that their species is a new one. A typical example of such eventual bias concern dinosaurs where many new fossils are abusively called a new species while they sometimes are just the same species but at a different stage of development (according to this TED ). So why do we still use the concept of species? Naming IMO, its only usefulness is that it allows us to name lineages. And it is very important that we have the appropriate vocabulary to name different lineages even if this brings us to make a few mistakes and use some bad definitions. The alternative use of the concept of lineage It is important though that we are aware that the concept of species is poorly defined and that if we need to be accurate that we can talk in terms of lineages. The main issue with the term lineage is not semantic and comes about the fact that gene lineages may well differ considerably from what one would consider being the "species lineage" as defined by the "lineages of most sequences"... but this is a story for another time. In consequence In consequence to the above issues, we often call two lineages that can interbreed to some extent by different species names. On the other hand, two lineages that can hardly interbreed are sometimes called by the same species name but I would expect this case to be rarer (as discussed by @DarrelHoffman and @AMR in the comments). Homo lineages I hope it makes sense from the above that the question is really not related to the special case of the interbreeding between the Homo sapiens and the Homo neanderthalis lineages. The issue is a matter of the definition of species. Video and podcast SciShow made a video on the subject: What Makes a Species a Species? For the French speakers, you will find an interesting (one hour long) podcast on the consequence of the false belief that the concept of species is an objective concept on conservation science at podcast.unil.ch > La biodiversité - plus qu'une simple question de conservation > Pierre-Henry Gouyon Here is a related answer | {
"source": [
"https://biology.stackexchange.com/questions/39664",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19425/"
]
} |
40,579 | Richard Dawkins in one of his videos says that Evolution is a fact and not just a theory. He goes on to say that man and chimpanzees both evolve from apes .
Is this correct (Is evolution a fact and did humans & chimps evolve from apes)? | A tiny bit of terminology Fact In popular culture, the term fact means "something that is true". I would consider a theory as being the closest concept in science to what is called a fact in the population culture. In natural sciences, the term fact is rarely used but would have the same meaning than the one in popular culture. The reason we are not often using this concept is that in science (nor in any other field of knowledge) one can never definitely know the truth. We can only have evidence that are congruent with a hypothesis or body of statements. In such case we talk about theory (see below). Theory In popular culture, "theory" is used to mean what the natural sciences call a "hypothesis." In the natural sciences, a theory is a body of thoughts/statements that is very well supported by loads of evidence. In science, a theory is not a hypothesis. For example: Theory of evolution , Theory of general relativity , transition state theory , etc. Note by the way that various definitions of theory are in use ( ref. ). The below answer respects the definition that I gave above. The scientific terminology presented above is actually a matter of philosophy and not science. If you need more information about the definitions of "theory", "fact" and other related terms, you may want to ask on Philosophy.SE . Stephen Jay Gould summarized the concepts of theory and facts nicely when saying [..] facts and theories are different things, not rungs in a hierarchy of increasing certainty. Facts are the world's data. Theories are structures of ideas that explain and interpret facts. In the answer below, I am using the scientific terminology. Your questions Is evolution true? Evolution is what is called a theory in natural science ( The Theory of Evolution a.k.a. modern evolutionary synthesis ), and it is extremely well-supported. Evolution is NOT a hypothesis. In other words, we have a lot of supporting evidence that living beings have evolved and are evolving. Did both humans and chimpanzees evolve from apes? Humans and chimpanzees are apes ( great apes to be more accurate). Both humans and chimpanzees evolved (and are still evolving) from a common ancestor who already was a great ape. We have a lot of evidence to support this common ancestry. What does the theory of evolution say? Understanding Evolution (by UC Berkeley) is a short and introductory course to evolutionary biology. Of course, there exist other good sources of information online such as Evolution and the tree of life by Khan Academy . We have a number of posts providing book recommendations for General biology ( Books for beginners and Introductory biology text for an outsider ) Intro to evolutionary biology ( Text Book Recommendation: Organic Evolution and Introductory books about evolution ) Intro to evolutionary genetics ( Books on population or evolutionary genetics? ) You will also find a lot of introductory posts on biology.SE such as for examples: Why do some bad traits evolve, and good ones don't? Is there a biological mechanism for evolution encoded into our DNA? Does it make sense to classify all humans in a single species? Why is a heritability coefficient not an index of how “genetic” something is? How could humans have interbred with Neanderthals if we're a different species? If dinosaurs could have feathers, would they still be reptiles? Why does evolution not make our life longer? Why don't mammals have more than 4 limbs? How to define “evolution”? How did some humans evolve to be white? Who are humans' closest relatives, after primates? Did cats evolve from monkeys ? or vice versa? Why do the ancestors of birds still exist? How does Natural Selection shape Genetic Variation? What are the evidence? Demonstrable and repeatable examples of evolution lists sources that list evidence. There are probably thousands of pieces of evidence listed in total, all explained in lay terms with links to the original article. Of course, this is just a small sample of the evidence we have. The post Is there any biological evidence that is not suggestive of or seems to disprove evolution? might be of interest too. Thanks to @CortAmmon's comment for correcting a very poorly phrased sentence. | {
"source": [
"https://biology.stackexchange.com/questions/40579",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19991/"
]
} |
41,683 | I went to the doctor today with my girlfriend, and the doctor said that she had a virus but doesn't know which one and she should let the infection heal with some rest. The fact that the doctor didn't know what type of virus she has bothers me. Do physicians/biologists not know all the different types of viruses out there? Is it not possible to identify all of them? | Do physicians/biologists not know all the different types of viruses out there? No, Biologists don't know all the viruses that exist out there. There's a lot ! We do know many of the ones infecting humans, though, especially the ones leading to the most common diseases. The fact that the doctor didn't know what type of virus she has bothers me. Without knowing any symptoms, your girlfriend likely had was some kind of influenza (flu), rhinovirus (cold), norovirus (diarrhea, etc) or respiratory syncytial virus (strong). That's just the most common virus infections. Identifying those is possible (see lab tests for norovirus or influenza ), but it's unnecessary in most cases. The thing is, no matter which of these she has, the medical advice will stay the same - rest and fluids. So identifying them is just going to add time and money. There are some cases where viral identification is done even for these diseases. For example, before giving an antiviral like Tamiflu, which is for example given to pregnant women with the flu . Before giving an antiviral, it should be established that she is indeed infected with the influenza virus . These tests are also done in patients who are hospitalized. In some countries and years, all influenza cases are screened to later know what strains of the virus infected how many people and how it spread. As an example, if the result of the test doesn't change the treatment, the influenza test is recommended against by the CDC . With a gastrointestinal issue where norovirus is suspected, nobody is going to make an identification for a straightforward case. | {
"source": [
"https://biology.stackexchange.com/questions/41683",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/20752/"
]
} |
42,050 | In my last question I asked why we don't see increased complexity in artificial life simulations of evolution. It seems I had fallen for a common misconception, that evolution was about improvement by increasing complexity . One comment discussing that post read "... he [David Deutsch] is falling for one of the biggest
misconceptions about evolution that you can, that evolution is about improvement . Evolution has simply only ever been about change..." However, when you look at the history of life you see increases in complexity. You see this increasing complexity evolving over billions of years, suggesting that it requires an explanation. My question If evolution is not about increasing complexity then how does so much complexity evolve? | I think possibly the problem here is the way you're approaching the issue. You're considering improvement as anything that increases the abilities or complexity of the organism—that isn't necessarily what an improvement is though. The outcome of natural selection is that the organism best equipped to survive/reproduce in a certain environment is the most successful . So, for example, thermophillic archaea do much better in 60°C-plus pools of water than humans do. Our capacity to process information, use tools, etc. doesn't actually confer much advantage in that situation. And there can be downsides to that kind of complexity as well, requiring more energy and longer developmental periods . So, natural selection in 60°C-plus pools of water gives you archaea, and in (presumably) the plains of East Africa, it gives you humans. The comment you quote mentions sickle-cell anaemia, which is a different example. While there is little benefit to having the sickle-cell anaemia allele in a temperate region, in those regions where malaria is endemic, heterozygosity can provide a survival advantage, and so the allele is maintained in the population. If you're someone living in a malaria-endemic region, and you don't have access to antimalarials, heterozygosity for the sickle-cell anaemia allele is arguably an improvement . It depends entirely on how you define the word. The fundamental principal of natural selection is that it favours the organism most suited to a particular environment. But, that isn't always the most complex organism. It's important not to confuse human-like with better . It isn't the universal endpoint of evolution to produce an organism similar to us, just the organism most suited to the environment in question. Also, to briefly address the previous question you asked—you asserted that we must be missing something from the process of evolution because we were unable to simulate it. You also pointed out that (in your opinion) we have sufficient computing power to simulate the kinds of organisms you're referring to. But natural selection is intrinsically linked to the environment it occurs in, so the simulation wouldn't just have to accurately simulate the biological processes of the organism, but also all of the external pressures the organism faces. I'd imagine that, in simulating evolution, that would be the real obstacle. | {
"source": [
"https://biology.stackexchange.com/questions/42050",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/10193/"
]
} |
42,273 | On his blog , Eric Turkheimer writes: [T]aken as a number, a unit of analysis, heritability coefficients are
funny things to aggregate on such a massive level. What exactly are
we supposed to make of the fact that twins studies in the
ophthalmology domain produced the highest heritabilities? Should eye
doctors, as opposed to say dermatologists, be rushing to the genetics
lab because their trait turns out to be more heritable? No. Whatever
else a heritability may be, it is not an index of how "genetic"
something is. It is not, for example, a useful indicator of how
successful gene-finding efforts are likely to be. If nothing else,
differences in reliability of measurement are confounded every
heritability tallied here. My point is this-- although it's nice to
know that on average everything is 50% heritable, it's hard to attach
much meaning to the number itself, or especially to deviations from
that number, to the fact that eye conditions have heritabilities
around .7 and attitudes around .3. Having two arms has a heritability
of 0. As I understand this, one reason Turkheimer believes heritability coefficients are not an index of how genetic a trait is is that they are confounded by varying levels of measurement error. So, for example, maybe the relatively low heritabilities in skin conditions compared to eye conditions are because there is more measurement error in relation to skin conditions. Turkheimer implies that there are other reasons why it's not appropriate to say a heritability coefficient is an index of "how genetic" something is. What are those other reasons? | Rather than discussing what heritability is not through wordy sentences, let's just talk about what heritability is . There are two "types of heritability": Heritability in the broad sense Heritability in the narrow sense . I will discuss a few concepts and slowly introduce the concept of heritability in both senses. Phenotypic trait The phenotype is the consequence of the genotype on the world. In brief, a phenotypic trait is any trait that an individual is made of! Quantitative trait A quantitative trait is any trait that you can measure and ordinate, that is any trait that you can measure with numbers. For example, height is a quantitative trait as you can say that individual A is taller than individual B which is itself taller that individual C . Variance of a quantitative trait In a population, different individuals can have different values for a given phenotypic trait $x$ . Because we are talking about quantitative traits we can calculate the variance of the trait in the population. Let's call this variance $V_P$ such as $$V_P=\frac{1}{N}\sum_i (x_i - \bar x)^2$$ In the above equation, $x_i$ is the value of the phenotypic trait $x$ of individual $i$ . $N$ is the population size (there are $N$ individuals in the population) and $\bar x$ is the average phenotypic trait $x$ in the population. $$\bar x = \frac{1}{N}\sum_i x_i$$ What is causing phenotypic variance Why would a population display any phenotypic variance? Why wouldn't we just look exactly the same? What explains these differences? For some traits, we see very little variance. To consider the example the OP gave in the post, the number of arms in the human population shows very little variance. However, there is quite a bit of variance in terms of the number of IQ, in terms of height or of weight. There are two (main) sources of variance that are underlying this phenotypic variance. The first one is the genetic variance and the second one is the environmental variance. We will call the genetic variance $V_G$ and the environment variance $V_E$ . If in a population, people vary a lot in terms of how many hamburgers they eat, then there is a non-negligible $V_E$ underlying the phenotypic variance $V_P$ for weight. If in a population, there is a lot of variation of genes affecting weight, then there is a non-negligible $V_G$ underlying the phenotypic variance $V_P$ for weight. By the way, a gene (or another non-coding sequence) that is polymorphic (i.e. has more than 1 allele in the population) and which explains some of the variance in the phenotypic quantitative trait is called a Quantitative Trait Locus (QTL). A locus is a sequence (of any length) on the genome. Math reminder Variances of uncorrelated variables can simply be added! For simplicity, we will assume for the moment that we are considering uncorrelated variables. As a consequence, we can express the phenotypic variance $V_P$ as a sum of the phenotypic variance that is due to environmental variance $V_E$ and the phenotypic variance that is due to genetic variance $V_G$ $$V_P=V_E+V_G$$ This equation is slightly simplified and this will affect the below calculations. See the section Other sources of phenotypic variance for more info. We can now talk about heritability! Heritability in the broad sense Heritability in the broad sense $h_B$ is defined as the fraction of phenotypic variance $V_P$ that is explained by genetic variance $V_G$ . In the equation, it gives: $$h_B=\frac{V_G}{V_P} = \frac{V_G}{V_E+V_G}$$ Heritability in the narrow sense Heritability in the narrow sense $h_N$ makes one further trick. We have to consider that the genetic variance $V_G$ that is underlying the phenotypic variance can itself be decomposed into a sum of variances. The variances that we like to consider the additive genetic variance $V_{G,A}$ and the dominance genetic variance $V_{G,D}$ . The additive genetic variance is the genetic variance that is due to additive interaction between alleles. The dominance of genetic variance is due to non-additive interactions between allele. We can now define the heritability in the narrow sense $h_N$ as the is defined as the fraction of phenotypic variance $V_P$ that is explained by the additive genetic variance $V_{G,A}$ . In the equation, it gives: $$h_N=\frac{V_{G,A}}{V_P} = \frac{V_{G,A}}{V_E+V_G} = \frac{V_{G,A}}{V_E+V_{G,A}+V_{G,D}}$$ In the special case, when all the genetic variance $V_G$ is exclusively done through additive interactions, then $V_{G,D} = 0$ and $V_{G,A}=V_G$ and therefore $h_N=h_B$ Interpretation of the heritability If all of the phenotypic variance is due to genetic causes (and regardless of whether there is a lot or a little variance), then $h_B=1$ . If all of the phenotypic variance is due to environmental variance, then $h_B=0$ . So what does a $h_B=0.3$ means? It means that 30% of the phenotypic variance is explained by genetic variance and that 70% of the phenotypic variance is due to environmental variance. So, what if there is no phenotypic variance in the population? if $V_P=0$ , then the heritability is undefined (as dividing by zero is undefined). However, in general, we tend to think that there is always a tiny bit of environmental variance and most people would just go on saying that heritability is 0 when $V_P=0$ . What will affect the heritability? A measure of heritability is true for one population, in one environment. If you change the population, add a few mutations for example, you might well create a polymorphic locus that is causing some phenotypic variance. If you put the same population in another environment, you could suddenly have more or less phenotypic variation due to environmental variance. Typically, if you measure heritability in the lab in a controlled and constant environment, then you will likely overestimate the heritability (as you underestimate $V_e$ ) compared to the same population that is living in a very heterogeneous environment. What heritability is not! If a trait has low heritability, it does NOT mean that it is (or is not) an adaptation. It only means that there is no genetic variance that explains the phenotypic variance. Why do we care about heritability? If there is no genetic variance for a trait, it means that the only way this trait can change through time is by changing the environment (or by creating a non-zero genetic variance through mutations). If there is a non-zero genetic variance and if there is a difference in fitness between individuals having different trait value then, the trait is under natural selection. The most commonly used index of heritability in the heritability in the narrow sense $h_N. $ Why do we care about $h_N$ ? Let $\bar x_t$ be the mean phenotypic value of the trait $x$ at time $t$ . One generation later, that is at time $t+1$ , the mean phenotypic value is $\bar x_{t+1}$ . Let's define the response of selection $R$ as the expected difference between these two quantities, that $R=E[\bar x_{t+1} - \bar x_t]$ . Let's define the strength of selection $S$ and the heritability in the narrow sense $h_N$ , then $$R=h_N \cdot S$$ As a consequence knowing $h_N$ allows us to predict the effect of selection on a given trait. This equation is called the breeder's equation (see this post about its interpretation). Other sources of phenotypic variance Saying $V_P=V_G+V_E$ is a little too simplistic. In reality, there are other sources of phenotypic variation such as variance due to epigenetic changes $V_I$ and variance due to developmental noise $V_{DN}$ for example. It is also sometimes very important to consider the covariance between any pair of such variance. So, the equation would more correct if stated as $$V_P = V_G + V_E + V_I + V_{DN} + COV(V_G, V_E) + COV(V_G, V_I) + COV(V_G, V_{DN}) + COV(V_E, V_I) + COV(V_E, V_{DN}) + COV(V_I, V_{DN})$$ Note that everyone is free to further decompose any of the above variance into a sum of variances as we did above for the genetic variance. For example, the environmental variance $V_E$ could be decomposed into the sum of the phenotypic variance due to variance in temperature $V_T$ and the phenotypic variance due to variance in precipitation $V_{\text{precipitation}}$ assuming the other types of environmental variances are negligible. | {
"source": [
"https://biology.stackexchange.com/questions/42273",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/10184/"
]
} |
42,745 | Zombies have been a part of popular culture for decades. The living dead rising up to take over the world is a terrifying concept, worthy of Hollywood blockbusters and television hits. Some of those zombie fiction stories are based on infection by viruses or other organisms. Is it possible to bring dead tissues back to life by virus infection ? | You must tell facts from fiction; viruses need living cells to replicate because they do not have the molecular machinery at hand to generate energy and construct building blocks essential to life. So no, viruses cannot bring back the dead or revitalize dead cells. One thing that comes close to it are the so-called zombie ants. These ants have been infected by a parasitic fungus that can take over the ant's nervous system (Fig. 1). Fig. 1. Zombie ant found in Brazil, infested with the fungus Ophyocordiceps . Source: National Geopgrahic . These fungi eventually kill their hosts, but before doing so they temporarily take over their nervous system. In the case of Ophyocordiceps unilateralis (Evans, 2011) , the spores lodge themselves into the ant's head through an exposed part of the ant’s exoskeleton. The fungus then infiltrates and targets the ant’s brain , taking control of the ant . Then it makes the ant leave its colony and head for a leaf that provides the ideal conditions for the fungus to grow. The ant crawls under the leaf and goes into a “death grip”—biting down hard on the leaf's major veins. This allows the fungus to slowly feed on it. When the fungus finishes growing, it eventually kills the ant and releases its spores (Source: Smithsonian ). The interesting thing is that the zombie ant not only provides shade and humidity when hanging under the leaf, it is also positioned directly on top of the ant’s colony , so when the spores burst out they fall on other ants and begin the cycle all over again. There are hundreds of mind-controlling fungi like this one, but the chances of this type of parasitoid fungus evolving to target humans as hosts are unlikely (Source: Smithsonian ). Reference - Evans, Commun Integr Biol (2011); 4 (5): 598–602 | {
"source": [
"https://biology.stackexchange.com/questions/42745",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/5343/"
]
} |
42,891 | The Zika virus was already present and known to the world (mostly in Southeast Asia) before the current outbreak. Why has the virus caused such an extreme outbreak? Has it mutated from its ancestral form such as that found in Southeast Asia? | There is one main answer to this question: The Zika virus spreads so fast because it never emerged in this part of the world. Hence there is no natural immunity available in the population and a lot of infections occur. Once this "first wave" of infections is over, the level within the population will fall drastically. Some more information on this topic can be found here . It is of course possible that the Zika virus has acquired a new mutation which adapts it better to humans and allows spreading much easier, but this is not yet known, since the situation in South America is still changing very fast with a lot of cases occurring and analysis going on. It still can be enough that the virus never emerged in Southern America and that there is no natural immunity available. According to the paper in reference 1 (which is only a brief communication) the sequences of the envelope proteins of the virus are similar to the strains circulating in Asia and do not carry novel mutations: The Surinam strains are the ones published in the paper mentioned above and are from South America. I haven't (yet) found any other analysis, but this will only be a matter of time. At the moment we cannot make a final statement on this although there is some speculation around. Edit 23/02/2016: There is still no final conclusion available, but there is an interesting paper available on the Biorxiv-Preprintserver, which analyses the mutation rate in the genomes of the publically available strains. It can be found in reference 2. Based on the available genomes, the author calculates the mutation rate of the Zika virus to about 10 Mutations/year. The virus is a RNA virus which have generally higher mutation rates than DNA viruses. In the analysis he finds a number of non-synonymous mutations (mutations which lead to a basepair exchange), as seen in table 2: Especially named is the M2634V mutation, but since this is in one of the envelope proteins, the author finds it relatively unlikely (although not completely), that this causes a much higher mutation rate. In the Diskussion of the paper he writes: The sudden spread of Zika to South and Central America does not appear
to have been due any particular change in the mosquito vector or
anything to make the Zika virus itself more virulent. But rather from
the fact that infected people are now able to fly rapidly from country
to country, thereby spreading the disease extremely easily. This means
there is little to stop the epidemic continuing to spread to further
areas of population which have little, if any, herd immunity against
the virus. Edit (23.10.2016): There is now an interesting website which builds a realtime phylogenetic tree from the data published (it can be found here ). The data also shows where in the virus the mutations occur: References: Zika virus genome from the Americas ZIKA - How Fast Does This Virus Mutate ? | {
"source": [
"https://biology.stackexchange.com/questions/42891",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19919/"
]
} |
43,095 | For me it seems reasonable that if I kept my gaze on a fixed point in a room with low light, a progressively brighter and better picture would appear before my eyes, just like a camera can see in the dark if the shutter speed is really slow, e.g. 4 seconds exposure. Why can't our brain do this trick as well (accumulate visual information over time)? Or is it a limitation of the eyes? edit: To further clarify what I'm after; I will show a concrete example from the world of photography (images taken from this website ). Here is an example where we have a series of underexposed images - this would be what the brain receives: Now, combining all of them with a simple add-operation reveals one image that has normal exposure. This seems like a simple trick for our powerful brain - surely it can add incoming signals? | For simplicity's sake, let's really reduce this to something like photography. A camera's aperture can stay open indefinitely, allowing the plate (or whatever is receiving and recording light) to "collect and save the effect of photons" over time, if you want to phrase it that way. That allows a camera to make images that our eyes never can, for example, of "star trails". The retina isn't like a photographic plate or a digital sensor's photosites (or pixels). It can't "collect and save" like a camera can. There is a "refresh rate", if you will, that disallows a collection and saving of light that doesn't apply to cameras, because cameras don't care if something in their vicinity is sneaking up on them and presenting a danger to their lives. Not being able to detect change rapidly is something that would be most inconvenient to survival. It is the time sampling with long exposures that really makes the magic of digital astrophotography possible. A digital sensor's true power comes from its ability to integrate, or collect, photons over much longer time periods than the eye. This is why we can record details in long exposures that are invisible to the eye, even through a large telescope. How Digital Cameras Work | {
"source": [
"https://biology.stackexchange.com/questions/43095",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/21721/"
]
} |
43,456 | I saw videos of octopuses crawling on the ground and I was wondering how long an octopus can survive when out of the water? Does it depend on either its size (i.e., does a big octopus from deep sea survive longer than a tiny octopus) or the species? | Short answer Under ideal conditions, an octopus may survive several minutes on land. Background Octopuses have gills and hence are dependent on water for the exchange of oxygen and carbon dioxide. Gills collapse on land because of the lack of buoyancy (source: UC Santa Barbara ). Octopuses have three hearts. Two of these are dedicated to move blood to the animal’s gills, emphasizing the animal's dependence on its gills for oxygen supply. The third heart keeps circulation flowing to the organs. This organ heart actually stops beating when the octopus swims, explaining the species’ tendency to crawl rather than swim (source: Smithsonian ). According to the Scientific American , crawling out of the water is not uncommon for species of octopus that live in intertidal waters or near the shore (Fig. 1). Because most species of octopus are nocturnal, we humans just don't see it often. Their boneless bodies are seemingly unfit for moving out of water, but it is thought to be food-motivated, e.g. shellfish and snails that can be found in tidal pools. Octopuses depend on water to breathe, so in addition to being a cumbersome mode of transportation, the land crawl is also a gamble. When their skin stays moist , a limited amount of gas exchange can occur through passive diffusion . This allows the octopus to survive on land for short periods of time, because oxygen is absorbed through the skin, instead of the gills. In moist, coastal areas it is believed they can crawl on land for at least several minutes . Mostly they go from pool to pool, never staying out of the water for extended periods. If faced with a dry surface in the sun, they will not survive for long (source: Scientific American ). Fig. 1. Octopus on land. Source: BBC Your sub questions; I think small octopuses may survive longer, since passive gas exchange is the mode of survival on land. In general, an increase in diameter causes the volume to increase with a third power, while surface increases with a power of two. Therefore, an increase in body size reduces the surface-to-volume ratio and leads to reduced gas exchange . Because passive gas exchange needs large surface-to-volume ratios, I am inclined to believe small octopuses may cope better with terrestrial environments. However, in hot, arid conditions it is likely a bigger one will have an advantage, because it can store more oxygen in its blood. In terms of species, I have to say I couldn't find any sources going in so much detail on this. Likely, as said, smaller species may do better in cool, moist conditions, while larger specimens may be better off in dry environments. Reference - Harmon Courage, Sci Am ; (November 2011) | {
"source": [
"https://biology.stackexchange.com/questions/43456",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/5702/"
]
} |
43,695 | Crocodiles have supposedly remained unchanged for millions of years, and several other species are considered as "living fossils" . How do such species remain so constant over time given that they will have had so much time to accumulate new mutations? | Evolution is a process of change by four mechanisms ; mutation, migration, drift, and selection. You are correct in thinking that, because crocodiles have been around for a long time, they could have accumulated many new mutations in that time, relative to other more recent species. However, mutation is only one of the important mechanisms underlying evolution. How different are ancestral and modern crocodiles? It seems the appearance of crocodiles has been fairly unchanged since their occurrence ~85 million years ago (mya). How can they remain so unchanged? Genetic variation may have been low in the ancestral population, this would reduce the potential for evolutionary change , as most change would have to occur through new mutations. It seems the populations of ancestral crocodiles were quite small , such that a genetic bottleneck may have occurred (which would reduce genetic variation ). Mutation rates seem to be relatively low in crocodiles (also see here ) which would reduce the rate at which novel mutation occurs, reducing the potential for evolution. Note that many mutations will be neutral in their effect (or "synonymous") so won't have an obvious phenotypic effect, so there may be substantial evolution at the genetic level despite the phenotypic similarity. Low rates of evolutionary change could suggests some other things may have also played a factor. Given that the populations have been through multiple genetic bottlenecks, genetic drift could have slowed down rates of evolution eroding genetic variance, removing rare mutations from the population . If selection has been fairly constant over time then there is less chance that changes will occur. If selection were to change and favour new adaptations then these are likely to spread , but if selection remains fairly constant over time then it will continue to favour the same mutations. After a long time of consistent selection it is likely that most mutations will be deleterious (have a negative effect) and be removed from the population by selection. Darwin suggested that living fossils could occur because the environment they are in has remained fairly constant (from this link ). | {
"source": [
"https://biology.stackexchange.com/questions/43695",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/21572/"
]
} |
44,140 | Red-green colorblindness seems to make it harder for a hunter-gatherer to see whether a fruit is ripe and thus worth picking. Is there a reason why selection hasn't completely removed red-green color blindness? Are there circumstances where this trait provides an evolutionary benefit? | Short answer Color-blind subjects are better at detecting color-camouflaged objects. This may give color blinds an advantage in terms of spotting hidden dangers (predators) or finding camouflaged foods. Background There are two types of red-green blindness: protanopia (red-blind) and deuteranopia (green-blind), i.e., these people miss one type of cone, namely the ( red L cone or the green M cone ). These conditions should be set apart from the condition where there are mutations in the L cones shifting their sensitivity to the green cone spectrum ( deuteranomaly ) or vice versa ( protanomaly ). Since you are talking color-"blindness", as opposed to reduced sensitivity to red or green, I reckon you are asking about true dichromats , i.e., protanopes and deuteranopes . It's an excellent question as to why 2% of the men have either one condition, given that: Protanopes are more likely to confuse:- Black with many shades of red Dark brown with dark green, dark orange and dark red Some blues with some reds, purples and dark pinks Mid-greens with some oranges Deuteranopes are more likely to confuse:- Mid-reds with mid-greens Blue-greens with grey and mid-pinks Bright greens with yellows Pale pinks with light grey Mid-reds with mid-brown Light blues with lilac There are reports on the benefits of being red-green color blind under certain specific conditions. For example, Morgan et al . (1992) report that the identification of a target area with a different texture or orientation pattern was performed better by dichromats when the surfaces were painted with irrelevant colors. In other words, when color is simply a distractor and confuses the subject to focus on the task (i.e., texture or orientation discrimination), the lack of red-green color vision can actually be beneficial. This in turn could be interpreted as dichromatic vision being beneficial over trichromatic vision to detect color-camouflaged objects . Reports on improved foraging of dichromats under low-lighting are debated, but cannot be excluded. The better camouflage-breaking performance of dichromats is, however, an established phenomenon (Cain et al ., 2010) . During the Second World War it was suggested that color-deficient observers could often penetrate camouflage that deceived the normal observer. The idea has been a recurrent one, both with respect to military camouflage and with respect to the camouflage of the natural world (reviewed in Morgan et al . (1992) Outlines , rather than colors, are responsible for pattern recognition . In the military, colorblind snipers and spotters are highly valued for these reasons (source: De Paul University ). If you sit back far from your screen, look at the normal full-color picture on the left and compare it to the dichromatic picture on the right; the picture on the right appears at higher contrast in trichromats, but dichromats may not see any difference between the two: Left: full-color image, right: dichromatic image. source: De Paul University However, I think the dichromat trait is simply not selected against strongly and this would explain its existence more easily than finding reasons it would be selected for (Morgan et al ., 1992) . References - Cain et al ., Biol Lett (2010); 6 , 3–38 - Morgan et al ., Proc R Soc B (1992); 248 : 291-5 | {
"source": [
"https://biology.stackexchange.com/questions/44140",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/152/"
]
} |
44,229 | I have heard that mother's milk is preferred over other baby foods, because it contains immunoglobulins (secretory IgA), and other essential nutrients. But why is mother's milk so special? Any mammalian milk, such as the widely available cow's milk, should presumably have a similar composition as human milk? What makes mother's milk in specific so healthy? Could the mere act of breastfeeding, in itself, lend to some beneficial outcome? | The phrase " Breast is best " is a hotly debated one (source: The Guardian and personal communications with many folks). The reason why we don't want to feed infants cow's milk is, however, anything but debated, because Cow's milk does not provide enough : Vitamin E Iron Essential fatty acids And because it contains too much : Protein Sodium Potassium (source: NIH's MedLine ) Further, mother's milk is generally free of pathogens , cow's milk may not be (source: Australian Unity ). However note that, unfortunately, HIV can hitchhike within the maternal white blood cells to the infant (Quintanilla, 1996) There are many benefits to mother and infant of breast milk. These benefits are, however, typically compared to the benefits over formula . No study will compare the benefits of mother's milk over cow's milk, simply because infants should never be fed cow's milk . The benefits of breast milk for the infant are the following: Breast milk a nearly perfect mix of vitamins, protein, and fat, all provided in an easily digestible form, as compared to formula; Breastfeeding lowers baby's risk of having asthma or allergies; Plus, babies who are breastfed exclusively for the first 6 months, without any formula, have fewer ear infections, respiratory illnesses, and bouts of diarrhea. They also have fewer hospitalizations and trips to the doctor (source: WebMD ). Breast milk contains a variety of growth factors, including EGF, BDNF and GDNF that may promote vascularization and neural development (Ballard & Morrow, 2014) . There are a host of immunoprotective factors present in breast milk. These proteins offer protection against diarrhoea, food allergies and infections. The immunoprotective components of human milk include, but are not limited to: Lactoferrin : binds to iron, thus rendering it unavailable to viruses, fungi and bacteria, which is an effective means of inhibiting their growth (Ballard & Morrow, 2014) ; Lysozymes: destroy viruses and bacteria by disrupting their integrity (source: NIH's MedLine ); Secretory IgA : immunoglobulins that destroy viruses and bacteria. Secretory IgA is believed to survive the harsh conditions of the intestines, especially in infants and is therefore active in the intestines of the baby. IgA can bind to pathological viruses and block their receptors necessary to invade the epithelial cells lining the intestinal wall. It also clumps bacteria together through cross-linking, which may affect their dispersion. Bacterial cell membranes, like shown in Salmonella, may be disrupted by IgA binding (Mantis et al ., 2011) . As mentioned by anongoodnurse in the comments; because mother and baby share the same habitat and hence encounter the same pathogens, the antibodies produced by the mother will be more beneficial to the baby than any other mammal on earth ; Human milk contains a variety of chemokines and cytokines that can cross the intestinal barrier, where they communicate with baby's cells to influence immune activity. Many cytokines and chemokines have multiple functions, and milk-borne cytokines may be grouped broadly into those that enhance inflammation or defend against infection, and those that reduce inflammation (Ballard & Morrow, 2014) ; Bifidus factor: promotes the growth of beneficial bacteria in the gut and limits the growth of disease-causing bacteria (source: NIH's MedLine ). A variety of immune cells, including macrophages, T cells, stem cells, and lymphocytes. In early lactation, the breastfed infant may consume as many as 10 10 maternal leukocytes per day. They can differentiate into dendritic cells that stimulate infant T-cell activity (Ballard & Morrow, 2014) . Breast milk changes in composition according to the infant's needs, something cow's milk can never accomplish; The first fluid produced by mothers after delivery is colostrum , which is distinct in volume, appearance and composition. Colostrum is produced in low quantities in the first few days postpartum and is rich in immunologic components such as secretory IgA, lactoferrin, leukocytes, as well as developmental factors such as epidermal growth factor. It contains relatively low concentrations of lactose, indicating its primary functions to be immunologic and trophic rather than nutritional. Levels of sodium, chloride and magnesium are higher and levels of potassium and calcium are lower in colostrum than later milk ( Ballard & Morrow, 2014) . For more complete reviews on the immunochemistry of breast milk, please refer to Ballard & Morrow (2014) and Mantis et al . (2011) The mother also benefits : Breastfeeding burns extra calories, so it can help mothers to lose pregnancy weight faster; Breast feeding releases the hormone oxytocin , which helps the uterus return to its pre-pregnancy size and may reduce uterine bleeding after birth; Breastfeeding lowers the risk of breast and ovarian cancer. It may lower the risk of osteoporosis; Breastfeeding has been linked to higher IQ scores in later childhood in some studies (source: WebMD ); During lactation, menstruation ceases, offering a form of contraception; Mothers who breastfeed are less likely to develop breast cancer later in life; Breastfeeding is more economical than formula feeding; Hormones released during breast-feeding create feelings of warmth and calm in the mother (source: NIH's MedLine ). In terms of bonding : Skin-to-skin contact during breastfeeding, and eye contact all help a baby bond with the mother and feel secure. Oxytocin release is known to promote the bonding with bubba. A newly born person can cause dramatic changes in the life of mommie (and daddy!), and a steady release of oxytocin promotes the bonding and love of mommie for the bubba (source: WebMD ). References - Ballard & Morrow, Pediatr Clin North Am (2013); 60 (1): 49–74 - Mantis et al ., Mucosal Immunology (2011) 4 : 03–611 - Quintanilla, Nurs Times , (1996); 92 (31): 35-7 | {
"source": [
"https://biology.stackexchange.com/questions/44229",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/22506/"
]
} |
44,590 | Homing pigeons ( Columba livia ) have been prized for their navigational abilities for thousands of years. They’ve served as messengers during war, as a means of long-distance communication, and as prized athletes in international races. ( Source ) Do all homing pigeons just pick a direction, and fly "straight" home, or do they all follow certain "tunnels" or "roads" to get closer to their home area, before heading home? (similar to cars getting on a highway between two regions) Does any information about that exist? I'd be interested to know if pigeons released in the same area (with different target locations in one common direction) tend to do follow the same paths, or if it's just a chaotic crisscross. | They have mental maps of landmarks, which they use as well as "compass" cues: ... experienced birds can accurately complete their memorized routes by using landmarks alone. Nevertheless, we also find that route following is often consistently offset in the expected compass direction, faithfully reproducing the shape of the track, but in parallel. -- Pigeons combine compass and landmark guidance in familiar route navigation Landmarks are more important than compass cues in general, and pigeons develop their own landmark maps: we show that homing pigeons (Columba livia) not only come to rely on highly stereotyped yet surprisingly inefficient routes within the local area but are attracted directly back to their individually preferred routes even when released from novel sites off-route. This precise route loyalty demonstrates a reliance on familiar landmarks throughout the flight, which was unexpected under current models of avian navigation. -- Familiar route loyalty implies visual pilotage in the homing pigeon That means that different birds do use different routes: Here, we demonstrate that birds develop highly stereotyped yet individually distinctive routes over the landscape, which remain substantially inefficient. -- Homing pigeons develop local route stereotypy In fact the same bird might use different routes over time as it learns new landmarks: a wide intraindividual variability was observed in repeated tosses at the same site; some pigeons remained faithful to the first route, whereas other birds tried successive new routes which, in most cases, were significantly shorter than previous ones. This result indicates that pigeons try, and are actually able, to improve their performance in subsequent releases from the same site. -- Pigeon homing: The influence of topographical features in successive releases at the same site | {
"source": [
"https://biology.stackexchange.com/questions/44590",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/22747/"
]
} |
44,868 | It is known that HIV is usually transmitted by direct blood or body fluid contact between an infected individual and a healthy person (like blood transfusion or needle sharing): Suppose a mosquito bites an individual suffering from AIDS and in the process sucks up some T cells infected with HIV along with RBCs. Then it bites another person not suffering from the disease, and transfers these infected T cells. Isn't there a high probability of the second individual contracting HIV? | No, this is not possible. There are a few reasons for that, but most important are that the only thing a mosquito injects is its own saliva, while the blood is sucked into the stomach where it is digested. To be able to infect other people HIV would need to be able to leave the gut intact and then also be able to replicate in the mosquitos which it cannot do, due to the missing of the CD4 antigen on the surface of the insect cells. These are needed as a surface receptor for the virus to bind and enter the cells. This is also true for other blood sucking insects like bed bugs or fleas. Other pathogens can do this, examples would be Yellow fever or Malaria . In Yellow fever the virus first infects epithelial cells of the gut, then enters the blood system of the insect to finally end up in the salivary glands, where the virus is injected together with the saliva into the biten person. In Malaria the pathogen is also able to leave the gut region and mature in the salivary glands. HIV can only be transmitted through blood (either through direct transmission, operations etc.), through semen (cum), pre-seminal fluid (pre-cum), rectal fluids, vaginal fluids, and breast milk. See reference 3. References: Why Mosquitoes cannot transmit AIDS Can we get AIDS from mosquito bites? HIV Transmission Risk: A Summary of Evidence | {
"source": [
"https://biology.stackexchange.com/questions/44868",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/17230/"
]
} |
45,143 | This question here addresses the controversy of whether humans are more closely related to bonobos or chimps. My question is - which group of animals are are closest relatives, beyond primates? Or which group of animals are all primates most closely related to? | Short answer It is a flying lemur (there exist only 2 species). Flying lemurs and primates are together a sister clade to treeshrews . Easy source of information Have a look at the post The best free and most up to date phylogenetic tree on the internet? . In short, you can have a look at onezoom.org , tolweb.org or opentreeoflife.org by yourself! Tree of life of placental mammals Here is a screenshot coming from tolweb.org. In this tree, there are polytomies showing everything that is unknown. This tree was last updated in 1995 and there are also clades that we now know were misplaced including the bats (as commented by @NoahSnyder). It is not handy to make a good screenshot from onezoom.org or opentreeoflife.org so I just welcome you to explore the tree of life by yourself on onezoom.org or opentreeoflife.org to get a better representation of the reality. Tree of Supraprimates Supraprimates (= Euarchontoglires ) include all primates and a few of the most related clades. Stealing the tree from @Gwenn's answer, here is the tree of Supraprimates [ Here is the original tree from Janecka et al. (2007) Here we see that flying lemurs (= Dermoptera ) is a sister clade of primates (ignoring the extinct plesiadapiformes ) and treeshrews (= Scandentia ) are a sister clade of flying lemurs and primates together. Below I briefly talk about these three clades and about their position on the phylogenetic tree. Flying lemurs Flying lemurs is a small clade that contains only two extant species, both found in the family of colugos . Note that flying lemurs are not lemurs (which is confusing). Here is what a flying lemur look like The position of flying lemurs on the phylogenetic tree has always been quite uncertain. In the tolweb.org screenshot above, flying lemurs (= Dermoptera ) is a sister clade to bats (= Chiroptera ) and together they are sister clade to treeshrews and primates. However, Janecka et al. (2007) placed flying lemurs as the sister clade to primates. Together flying lemurs and primates are a sister clade to tree shrews. Tree shrews Treeshrews is a clade of 20 species native from southeast Asia. Before, the era of phylogenetic comparisons, treeshrews were mistakenly thought to be part of the Insectivora . Extinct clade of Plesiadapiforms Although they are represented above as a sister clade of primates, it is possible that they the fossil we found are just individuals coming from the lineage giving rise to primates. As such, they would not be a clade aside from primates. Below is an artistic representation of what they may have looked like. Introduction on phylogenetic trees As the question is quite introductory, I presume you might want to improve your understanding of phylogenetic trees. You might want to make sure, you understand what a monophyletic group (=clade) is and understand why a chimpanzee and a human are both equally related to any species of treeshrews. Here are two sources of information for you: Understanding Evolution (UC Berkeley) > The history of life This answer on Biology.SE | {
"source": [
"https://biology.stackexchange.com/questions/45143",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/23137/"
]
} |
45,694 | I understand that based on their tertiary structure, intrinsic proteins have hydrophobic non-polar R-groups on their surface and that they 'interact with the hydrophobic core of the cell membrane to keep them in place'. But how does the hydrophobicity of both the protein and the cell membrane prevent the protein from moving? | Proteins can move around the membrane. Most proteins do move within the membrane. The membrane is a liquid crystal and has fluid behaviour . Specifically, this is due to the membrane being in a gel-state. This gel state allows phase behaviour which means that the protein is able to move around on the surface. This results in an effect that is often referred to as the fluid mosaic model . Proteins tend not to move out of the membrane. The protein doesn't leave the membrane as a result of the transmembrane helix being very hydrophobic. This hydrophobicity and the hydrophobicity of the lipid tails means that they self-associate. A better way of describing it is that they fiercely dissociate from the water. A molecular dynamics simulation showed that even in simulations the membrane will readily self-assemble as a result of the hydrophobicity. This is achieved by a few properties of the TMH sequence. There is a large amount of hydrophobic residues like leucine. At either end of the helix are large aromatic residues called the aromatic belt. Further is the electrostatic satisfaction offered by Gunnar von Heijne's famous positive inside rule and the recently identified negative-outside rule present in helices with evolutionary pressure to optimise anchorage. (Image source: Baker et al ., 2017 ) Cymer et al. published a study showing the free energies associated with each part of the transmembrane protein helix (figure below). The overall ΔG for a transmembrane helix in the membrane is ~-12kcal mol −1 . This means that the association of the helix in the membrane is typically spontaneous. (Image source: Cymer et al., 2015 ) | {
"source": [
"https://biology.stackexchange.com/questions/45694",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/17632/"
]
} |
46,231 | I've just read in a book that birds' guts can digest almost all the consumed seeds with the exception of mistletoe and loranthus (which stays stuck on the branches). On the other hand, I know that the co-evolution with birds caused the enlarging of the fruits - for the fruit trees as an advantage in fast spreading. But how do exactly birds spread the seeds they consume if they're digested in their guts? | Birds may indeed digest seeds under conditions of rest. It has been postulated that almost all current knowledge on mechanisms of internal seed dispersal has been obtained from experiments with resting animals. A study with the mallard Anas platyrhynchos (common wild duck), claimed to be quantitatively one of the most important seed dispersing animals in aquatic habitats in the Northern Hemisphere, has shown that physical activity affects gut passage survival and retention time of ingested plant seeds. The authors fed seeds of nine common wetland plants to mallards trained to subsequently swim for six hours. They compared gut passage survival of seeds against a control treatment with resting mallards. Intact gut passage of seeds increased significantly with mallard activity (up to 80% in the fastest swimming treatment compared to the control), and hence revealing reduced digestive efficiency due to increased metabolic rates . This enhances the dispersal potential of ingested seeds. An extensive work-out after a meal generally slows down metabolism, as blood is redistributed to the musculature and away from the digestive tract. These findings imply that seed dispersal potential by mallards calculated from other experiments with resting birds may be underestimated. Reference - Kleyheeg et al ., Oikos (2015); 124 (7): 899–907 | {
"source": [
"https://biology.stackexchange.com/questions/46231",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6124/"
]
} |
46,424 | I own a small lake. Give or take it is about 50 meters wide and 100 meters long (or 160 feet wide, 320 feet long), with a max depth of around 2 meters / 6.5 feet. One third of the lake is surrounded by forest, the rest is grass / small enclaves of tress. The lake absorbes only rainwater from the surrounding residential area. There is a small outlet towards a much larger lake close by. The lake was recently dredge to remove many years of plantlife that had almost turned it into a swamp. The lake has a large number of mosquitoes. There is also quite many frogs and a few birds that live near the lake. What can I do to decrease the amount of mosquitoes in the lake? For example, can I set up certain nesting boxes that will attract birds or bats that will eat a large number of mosquitoes? Can I release certain fish that thrive on mosquites? It is in Scandinavia. EDIT The shorelines are sharp and most of the vegatation has recently been removed. The lake was recently completely emptied and about 2 meters (or more) of vegatation and soil was removed. The lake has previously been contaminated which was cleaned away. I guess this means that a very large part of the ecosystem has been removed, a few fish did manage to survive, but not very many. | There are a number of environmentally destructive methods that would be effective, including draining the lake, covering the surface with a continuous layer of oil, or adding toxins to the water, but I'm assuming you're looking for a method that will have the minimum possible off-target effect. Different mosquito species breed in different habitats and are thus susceptible to different control strategies, so good photos of some adults might help, but I'm assuming here that you've correctly identified the lake as the breeding site. If there are any other possible breeding sites in the area please add them to your question. If the assumptions above are correct then, broadly speaking, your best options are habitat modification or biological control. I'm not going to go into chemical control here since as stated above I assume you want low environmental and financial cost; if this is incorrect let me know. Habitat modification : regularly removing
plant growth within the lake and trimming vegetation overhanging the edges will limit the ability of mosquito larvae to escape predators and may have some effect. However, the recent management you describe has
probably gone some way towards this (did you
notice whether the mosquito problem got any better after the plants
were removed?) Biological control : introduce predators or parasites into the environment. Plenty of species eat adult mosquitoes but there aren't really any that primarily feed on them (unless they're the only food source available) and many adult mosquitoes will have laid eggs already - the most effective strategy will be to target the immature population. Larvivorous fish have been shown to be effective in many parts of the world, for example fish in the genus Gambusia ('mosquito fish'). I don't know of any that have been shown to be effective and can thrive as far north as Scandinavia, but if you stock the lake with fish (combined with managing vegetation as above) I'd be surprised if you don't see some improvement. Biological control, part 2 : Use Bti ( Bacillus thuringiensis var. israelensis ) . This is a bacterium that produces toxins which are highly specific to dipterans and don't really affect anything else. You can buy the bacterium in various formulations including sprays, tablets etc. I'm mainly familar with its use for controlling container-breeding mosquitoes, but this paper describes its use in large lakes so should give you some idea of dose required, optimal application method and time to reapplication. Without knowing more about your budget, available time/manpower etc I can't really help you choose between these but I suspect #3 is your best bet. | {
"source": [
"https://biology.stackexchange.com/questions/46424",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/9136/"
]
} |
47,797 | My thoughts are that maybe the TB antigens necessary to produce an immune response are proteins; therefore they can be digested in the stomach and small intestine. But I may be wrong though. I am confused why I can't say the same for polio vaccine. | There are different polio vaccines - one live (attenuated) vaccine which is given orally and one inactivated, which is injected. The main reason for using the live orally vaccine is that it provides excellent immunity (better than the inactivated) since it uses the natural infection route (oral-faecal) in the body where it enters through cells in the intestine. Besides that, it is also much less expensive than the inactivated form, which is a big thing when doing mass immunisations in developing countries. The live vaccine, however, may mutate back into a more infectious form as you shed live (attenuated) viruses after the immunisation, so these are not used anymore. Now we are very close to the eradication of the poliovirus. The risk of getting new infections is viewed as being too high these days. See this paper for more information: "Vaccine-derived polioviruses and the endgame strategy for global polio eradication." | {
"source": [
"https://biology.stackexchange.com/questions/47797",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/20461/"
]
} |
47,957 | I understand that turtles are reptiles because like all reptiles, they have scales on their body. But turtles (specifically sea turtles) live on both land and water, very much like amphibians. Also, don't sea turtles have more of a moist skin unlike reptiles? So is there any anatomical difference which makes turtles different from amphibians? | Amphibians are not defined for having a moist skin, neither are reptiles defined for having scales on their body. In biology, organisms (elements) are grouped according to their evolutive history in monophyletic groups, also known as clades . Basicaly, a monophyletic group is A group consisting of an ancestral and all its descendants. "Tetrapoda" is a monophyletic group, formed by vertebrates with four limbs. Inside Tetrapoda, there are two groups: "Amphibia" and "Amniota". Amphibians are non-amniotes tetrapods, and we have some doubt if they are a monophyletic group. Amniotes, on the other hand, are tetrapods having an amniotic egg, including you and me, and they form a monophyletic group. The amniotes are divided in two monophyletic group: "Mammals", which are amniotes with a synapsid skull, and "Reptiles", which are amniotes with diapsid skulls (I'm using "reptiles" as synonym of Sauropsida). Reptiles include turtles, lizards, snakes, alligators and dinosaurs (which include the birds: all birds are dinosaurs). It doesn't matter if a animal has or has not scales, or if it lays eggs or if it is viviparous, or if it has 5 fingers or 3 fingers: All the descendants of a given ancestor are included in the monophyletic group that contains that ancestor. Turtles, despite being strange or somehow different, are descendants from the same most recent commom ancestor of Reptilia... that's why turtles are reptiles (and that's why birds are reptiles as well). To make this more clear, have a look at this cladogram (from Hickman, Integrated Principles of Zoology): The apomorphy that defines the tetrapods is "paired limbs". You have Amphibia to the left and Amniota to the right, whose apomorphy is " egg with extraembrionic membranes". Inside them, you have Reptilia, whose apomorphies are "skull with upper and lower fenestra and beta-keratin in epidermis". Turtles came from an ancestor with these characteristics. So, turtles belong to the monophyletic group of "Reptiles". Post scriptum : You wrote that "turtles (specifically sea turtles) live on both land and water, very much like amphibians". Just a curiosity: the reason why sea turtles leave the water (sea) from time to time shows exactly that they are not amphibians! Amphibians, being non-amniotes, have eggs that survive under water (actually, with few exceptions, they need to be under water). Turtles, on the other hand, are amniotes, and the amniotic egg cannot be laid under water. That's why the turtles have to leave the water to lay eggs: because, contrary to the amphibians, they cannot lay eggs under water. | {
"source": [
"https://biology.stackexchange.com/questions/47957",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/24250/"
]
} |
48,200 | I have been following documentaries about crocodiles and amazingly, crocodiles and hippos apparently seem to live happily in the same pond together without attacking each other. Why is it so? Like no matter how strong hippo is, its soft skin is no match to the brutal jaws of a crocodile? | Skin First, you are being misled by your wrong assumption that hippos have soft skin. Hippos have a 5 cm thick skin! For fun, here is a picture of a hippo skin. They are big and pretty fast An adult hippo weighs on average 1.5 and 1.3 tons for males and females respectively (with a record at 4.5 tons) and can run up to 30 km/h on land and up to 8 km/h in water (according to wikipedia > hippopotamus ). They have an aggressive nature Hippos are aggressive animals (esp. males). Hippos kill about 500 people a year (against 1000 for crocodiles) according to this BBC article (but estimates seem to vary quite a bit from source to source). They have serious teeth Hippos have a big mouth with very long teeth. Lower canines are 50cm (19.7 inches) long (see wikipedia citing Estes 1991 )! Hippos live in herd As suggested by @ChinmayKanchi in the comments, because hippos live in a herd, a crocodile that attacks a hippopotamus might have to deal with more than one enemy. Videos You can find here a video fight between a crocodile and a hippopotamus (thanks to @TahlaIrfan) and here is a video of a lion waking up a hippo. You will easily find other videos on YouTube. | {
"source": [
"https://biology.stackexchange.com/questions/48200",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/14852/"
]
} |
48,207 | I'm doing research on lactose intolerance and am curious if disaccharidases (enzymes that break down disaccharides) require a cofactor or coenzyme to function? Reviews or references would be greatly appreciated. | Skin First, you are being misled by your wrong assumption that hippos have soft skin. Hippos have a 5 cm thick skin! For fun, here is a picture of a hippo skin. They are big and pretty fast An adult hippo weighs on average 1.5 and 1.3 tons for males and females respectively (with a record at 4.5 tons) and can run up to 30 km/h on land and up to 8 km/h in water (according to wikipedia > hippopotamus ). They have an aggressive nature Hippos are aggressive animals (esp. males). Hippos kill about 500 people a year (against 1000 for crocodiles) according to this BBC article (but estimates seem to vary quite a bit from source to source). They have serious teeth Hippos have a big mouth with very long teeth. Lower canines are 50cm (19.7 inches) long (see wikipedia citing Estes 1991 )! Hippos live in herd As suggested by @ChinmayKanchi in the comments, because hippos live in a herd, a crocodile that attacks a hippopotamus might have to deal with more than one enemy. Videos You can find here a video fight between a crocodile and a hippopotamus (thanks to @TahlaIrfan) and here is a video of a lion waking up a hippo. You will easily find other videos on YouTube. | {
"source": [
"https://biology.stackexchange.com/questions/48207",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/24365/"
]
} |
49,180 | I know all about how the fossil record shows more human-like species coming about over time, and how modern testing proves we have genetic similarities with other animals. All that says is we have similar genetic blueprints to animals in the past and present. How do we know these similarities are caused by having a common ancestor? | We don't know , and we never will. Science doesn't work that way. But evolution is the simplest hypothesis that is both falsifiable and consistent with lots of experimental data. Therefore it is the currently accepted scientific theory. I would agree that genetic similarities between current species does not in itself suggest that they evolved from a common ancestor. But knowing the genome sequence of various species let's you do much more than simply measure pairwise similarity between species. The structure of genetic variation (losses, duplications, inversions, mutations ... ) also fits with evolutionary models. And crucially, genome sequences confirm predictions made by the evolutionary theory --- evolution is not just a post-hoc explanation of data, it has actually been tested many times over, and has never been falsified. A good example is the sequencing of the human and chimpanzee genomes. We knew long before any genome was sequenced that humans have 23 chromosomes (23 pairs), while chimpanzees have 24. If the theory of evolution is correct and we do have a common ancestor, then that ancestor should have 24 chromosomes, like the chimps do, and it must be that in humans, one chromosome is a fusion of two ancestral chromosomes$^*$. This is a strong, testable prediction: if we don't find this arrangement of chromosomes, then evolution is proven wrong! In the 1980's, the sought fusion chromosome was found using high-resolution cytogenetic banding: it's chromosome 2. Modern genome sequencing later localized the precise fusion point on the human chromosome. Also, the fossil record provides a timeline, not just a bunch of more or less similar organisms. In general, we don't find old fossils of modern-day animals (including ourselves), but we do find old fossils of species that no longer exist today. And when piecing together the findings, it looks like there is a sequence of gradual changes over time. That's a pretty good clue. What hypothesis might fit this data? If you are suspicious about the theory of evolution --- which is fine, you should think critically about everything in science! --- then you must look for an alternative hypothesis which is falsifiable and fits the data. (Note that "god made everything" is not a falsifiable hypothesis, since it makes no testable predictions, and therefore not relevant to science.) If you come up with anything, let us know! $^*$ As pointed out in comments, a priori one could imagine other rearrangements between the ancestor genome and the chimpanzee/human genomes that give the same result, but I believe this is the simplest hypothesis. | {
"source": [
"https://biology.stackexchange.com/questions/49180",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/16696/"
]
} |
49,209 | How has evolution created our blood, lungs and the heart? We can't exist without blood, which transports the oxygen to all areas of our body. However, the blood needs a lung, which gives it the oxygen to transport. The blood also needs something which lets it flow through the whole body, which are our veins. And in order to allow the blood to flow through our veins, an organ is needed to pump the blood, which is our heart. We also need a brain which controls all that, and the brain in turn needs the blood in order to function right. Evolution makes very slow steps....."it just doesn't jump". So, How did evolution manage to create all that? | While others have addressed the big picture aspects of your question, I think it would be useful to look at the specifics. Have a look at the heart (or more accurately, the hearts ) of the earthworm: They're nothing more than veins with some pumping muscles wrapped around them. It seems almost a stretch to call them hearts, they are shaped so different from what we think of as a heart proper. Also, note the earthworm's lungs, or rather, lack of them. It doesn't have any! Why not? It doesn't need them. It gets enough oxygen through its skin via osmosis. It's only larger organisms that need dedicated systems to concentrate oxygen from the surrounding environment. So, the worm has a simpler system (no chambered heart, no lungs) that works. All vertebrates descended from a common ancestor that was very similar to this earthworm. It had simple hearts, and no lungs. You can follow the evolution of the human heart through fish heart: which is a more sophisticated pumping vessel with two chambers. Amphibians evolved from fish, reptiles from amphibians, and mammals from reptiles. In this diagram, you will find that the heart becomes more sophisticated and efficient in each: So, this should give you a good idea of the evolution of the human heart from simpler, working system. I won't take the time to draw out the evolution of blood vessels or lungs; maybe someone else will, or you can google them yourself, the information is readily out there. But they all follow the same pattern: gradual, incremental improvements on working, simpler systems. | {
"source": [
"https://biology.stackexchange.com/questions/49209",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/25342/"
]
} |
49,214 | In the Krebs cycle, where do the hydrogens and electrons that NAD+ and FAD accept come from? It seems that citric acid only loses two hydrogens because it starts out with eight hydrogens and then becomes oxaloacetic acid, which has four hydrogens. | While others have addressed the big picture aspects of your question, I think it would be useful to look at the specifics. Have a look at the heart (or more accurately, the hearts ) of the earthworm: They're nothing more than veins with some pumping muscles wrapped around them. It seems almost a stretch to call them hearts, they are shaped so different from what we think of as a heart proper. Also, note the earthworm's lungs, or rather, lack of them. It doesn't have any! Why not? It doesn't need them. It gets enough oxygen through its skin via osmosis. It's only larger organisms that need dedicated systems to concentrate oxygen from the surrounding environment. So, the worm has a simpler system (no chambered heart, no lungs) that works. All vertebrates descended from a common ancestor that was very similar to this earthworm. It had simple hearts, and no lungs. You can follow the evolution of the human heart through fish heart: which is a more sophisticated pumping vessel with two chambers. Amphibians evolved from fish, reptiles from amphibians, and mammals from reptiles. In this diagram, you will find that the heart becomes more sophisticated and efficient in each: So, this should give you a good idea of the evolution of the human heart from simpler, working system. I won't take the time to draw out the evolution of blood vessels or lungs; maybe someone else will, or you can google them yourself, the information is readily out there. But they all follow the same pattern: gradual, incremental improvements on working, simpler systems. | {
"source": [
"https://biology.stackexchange.com/questions/49214",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/25343/"
]
} |
50,528 | Today, August 8th, is Earth Overshoot Day (EOD) for 2016, the day when humanity supposedly has consumed the natural resources available from the planet for the year 2016; we're now running a deficit, somehow. At least if your believe the calculations of the Global Footprint Network (GFN), the think tank behind this concept. EOD is well reported by media every year, and perhaps it does some good as an ecology awareness thing. But is the idea scientifically sound? EOD is based on the ecological footprint concept. The ecological footprint of a person (measured in hectares) is the area of the earth required to extract the natural resources needed to sustain that person: to grow crops, keep farm animals, obtain natural resources for consumables, etc. It's a very complex thing to calculate, and of course people argue about what the correct formula should be. One article by Willis Eschenbach (2010) goes into some depth and argues that the formula used by GFN vastly overestimates the footprint. I don't know who is right, but it does seem like the footprint is very difficult to estimate, so we should probably be careful with drawing strong conclusions. But I have a more fundamental problem with EOD. Regardless of how it's calculated, the claim that we have today "overshot" our yearly earth-budget, at 8 months out of 12, means that we are consuming about 1.5 of the available food and natural resources available; or that the footprint of humanity is 1.5 Earths. This is not some kind of parable: GFN really claims that we have exhausted our natural resources, by a wide margin, and that this has been going on since the 1970's. My question is, what are we all living on then? As of today there should be no more food around, or any other natural-derived product for that matter. If GFNs estimate is correct, shouldn't humanity be long dead? Shouldn't we expect 1/3 of the earth's "surplus" population to die off pretty quickly? Doesn't the fact that we're not dead prove that EOD is wrong? Isn't it physically impossible for our total footprint to exceed 1 Earth? EDIT: Nice to see that this question stirred a lot of debate! :) I think several answers bring up one key point that resolves the problem: GFN defines the footprint not as the actual area required for production at present (which must be < 1 Earth), but the area required for sustainable production (which is larger). Exactly how the sustainable area is defined is still mysterious to me, but I guess it is at least theoretically possible. | TL;DR: it's a simplified measure of sustainability, but accurate enough to be useful for public engagement EOD is hosted and calculated by Global Footprint Network (GFN), an international think tank. The GFN estimates national and global net supply and demand for renewable resources, specifically: food and fiber products, livestock and fish products, timber and other forest products, space for urban infrastructure, and carbon sequestration. From the website : Global Footprint Network measures a population’s demand for and
ecosystems’ supply of resources and services. These calculations then
serve as the foundation for calculating Earth Overshoot Day. On the supply side, a city, state, or nation’s biocapacity represents
its biologically productive land and sea area, including forest lands,
grazing lands, cropland, fishing grounds, and built-up land. On the demand side, the Ecological Footprint measures a population’s
demand for plant-based food and fiber products, livestock and fish
products, timber and other forest products, space for urban
infrastructure, and forest to absorb its carbon dioxide emissions from
fossil fuels. The results are reported in 'global hectares', the area which would be required using global average productivity, to aid intercomparability. The methodology was published in 2013 (Borucke &al 2013) . So, to answer the question in your title ("Earth overshoot day: is it a sound concept?"), data quality may be an issue (I haven't pored over the paper in detail) but the basic methodology is arguably appropriate for the question they're asking. The only issue I might have is that they effectively consider land and sea use to be interchangeable, but I'm not sure the alternative would be an improvement. To answer the second part of your question ("what are we all living on then?"), it is possible to harvest more from a system than it can sustainably produce . Exceeding this harms the future productivity of the system. To take the specific examples named for EOD: Overharvesting plant-based food and fibre products can result in soil acidification, soil erosion, and/or soil salinification ; Overharvesting livestock and fish products can result in overgrazing and/or overfishing ; Overharvesting timber and other forest products results in deforestation ; Using more space for urban infrastructure reduces the availability of land for the other examples on this list; Producing more carbon emissions than can be absorbed by its forest leads to an increase in atmospheric carbon, resulting in climate change . Ultimately, while 'Earth Overshoot Day' is a public engagement activity, there is a reasonably robust and transparent methodology behind it which is good enough for the job. Remember: all models are wrong, some models are useful. | {
"source": [
"https://biology.stackexchange.com/questions/50528",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/15695/"
]
} |
51,236 | If you watched the last Olympics like me you probably also observed that most medallists in running events were black. Why is that? I discussed this with university grad friends and researchers and we only came up with hypotheses but nobody had an actual explanation. Is it cultural, genetic, other reasons or nobody really know? Update: Sprint and distance running requiring different attributes for being the best, let separate this question in two parts: 1) Sprint (i.e. 100m) and 2) Distance running (@Forest already provided a great answer for this) . Note: I know this question can potentially bring disrespectful answers/comments, but I'm hopeful that this site and its members can answer this interesting question. Otherwise, I'll simply erase my question. | It's an interesting question and one that has been asked before. NPR did a story in 2013 on this topic, but their question was a bit more focused than just "why are so many black people good runners?" The observation that led to their story wasn't just that black people in general were over-represented among long-distance running medalists, but that Kenyans in particular were over-represented. Digging deeper, the story's investigators found that the best runners in Kenya also tended to come from the same tribal group: the Kalenjin. I'm not going to repeat all the details in that story (which I encourage you to read), but the working answer that the investigators came up with is that there are both genetic traits and certain cultural practices that contribute to this tribe's success on the track. Unfortunately, from the point of view of someone who wants a concise answer, it is very difficult to separate and quantify the exact contributions that each genetic and cultural modification makes to the runners' successes. Pubmed also has a number of peer-reviewed papers detailing the Kalenjin running phenomenon, but I could only find two with free full-access and neither had the promising title of "Analysis of the Kenyan distance-running phenomenon," for which you have to pay. Insert annoyed frowning face here. I did a quick search of some Kenyan gold medalist runners in the 2016 Olympics and sure enough, several (though certainly not all) are Kalenjin. I'm less sure about the Ethiopian runners, since most research that I found online seems to focus on the Kenyans, but I'd feel safe hypothesizing that something similar can explain their dominance at the podium. So, the short answer to your question is that it's not just "black people" who dominate the world of competitive long-distance running, but that very specific subsets of people (who, as it turns out, are black) do display a competitive advantage and that both genetics and culture account for much of this advantage. | {
"source": [
"https://biology.stackexchange.com/questions/51236",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/24947/"
]
} |
51,491 | I found this insect inside of my shoe. It is approximately 1cm in length and less than half a centimetre wide. It was found in the Netherlands, in the province Gelderland. Close shot Distant shot Upside down What kind of insect is that? Edit: As @fileunderwater suggested: the question is "close" but not identical.
I think that the suggested duplicate will only provide an identification of the family of the insect, but nothing more precise and specific. Therefore, the answers for the 2 questions vary. | It is the larva of Harmonia axyridis (Asian lady beetle). The image posted by timbernasley is more accurate because the larva you have shown is in its late instar ,a stage not an early as this one. Here's the link: Wikipedia | {
"source": [
"https://biology.stackexchange.com/questions/51491",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19521/"
]
} |
52,289 | In Hofstadter's Gödel, Escher, Bach: An Eternal Golden Braid (GEB), the following claim appears: ...in the species Felis catus , deep probing has revealed that it is indeed possible to read the phenotype directly off the genotype. The reader will perhaps better appreciate this remarkable fact after directly examining the following typical section of the DNA of Felis catus : ...CATCATCATCATCATCATCAT...( OP note: truncated because, you get it) Is this true? A cursory search for the DNA of Felis catus gives me this 1996 paper by Lopez, Cevario, and O'Brien and the given sequence does not appear – there are some instances of "CAT" but not repeated enough to make it as remarkable as claimed in GEB. I don't know enough Biology to judge the veracity of this claim. Some points I am considering are: GEB is full of wordplays. However, the tone of this part of the text does not sound like one to me. GEB was written/published around 1978. The paper I linked to – which was cited by some 236 others according to Google – was published in 1996, way after GEB's time. If my impression that Lopez et al.'s work is significant because it is the first time Felis catus has been sequenced, then there is no way Hofstadter could've known of it when he wrote GEB. Then again, I don't know enough Biology that there might be some nuance to Lopez et al.'s paper that I'm missing (i.e., the results of the paper might not be mutually exclusive to the claim made in GEB). GEB has reference notes and bibliography and there is no reference cited to back this claim. However, GEB does not attempt to be a rigorous academic thesis and the references is only called upon more when Hofstadter quotes other works directly while the bibliography is a list of readings which the reader may want to check out, regarding the main thesis of the book. So are cats recursions with no base cases? | The Felis catus genome has been published, annotated, and updated quite a bit since 1996, including spans of so-called intergenic regions, which are basically scaffolding and other structures, along with perhaps some unidentified genes, pseudogenes, regulatory sequences, etc. Basically, pretty much the entire DNA sequence is available now, not just the gene sequence of the mitochondrial genome, which was what was published in the 1996 paper you referenced. Mitochondria are the power plants of the cell, but are just an organelle that happens to contain its own DNA; they are separate from the chromosomal DNA in the nucleus. All of this is available for free (if you know where to look) at the National Center for Biotechnology Information (NCBI), part of the National Library of Medicine (NLM) at the National Institutes of Health (NIH) in the United States. Other sites are also available, such as Ensembl , a joint project between the European Bioinformatics Institute (EMBL-EBI), part of the European Molecular Biology Laboratory (EMBL), and the Wellcome Trust Sanger Institute (WTSI). Both institutes are located on the Wellcome Trust Genome Campus in the United Kingdom. So, to the genome. Genomic sequences can be searched in a couple of different ways, depending on what you're looking for, but the most common way is to use BLAST, the Basic Local Alignment and Search Tool. As the name implies, it takes sequences as input and searches one against the other, aligning the results as best as possible using certain algorithms that the user can define and tweak. The BLAST web interface to the cat genome is here . You don't need to worry about any of the other options here except the "Enter Query Sequence" box. FASTA format is just using the single-letter abbreviations for nucleotides (AGCT), all strung together. The genome we're searching is of an Abyssinian cat named Cinnamon: Cinnamon, the cat which was chosen to be the definitive genetic model for all cats in the feline genome project. Image courtesy of the College of Veterinary Medicine at the University of Missouri . To start with, I typed in CATCATCATCAT and to my surprise got back over 200 hits, covering every chromosome the cat has. So, I doubled the length of the input to 8 CAT s, and got back the same result set. Unfortunately, 12 CAT s was too many (and really, it is too many), so I worked backwards. The final results are here (sorry, link expires 10/13/16. To regenerate, go to BLAST link above and enter CATCATCATCATCATCATCATCATCATCAT ). Apparently, popular wisdom is incorrect, and Felis catus chromosomes really contain 10 CAT s each, one more than is needed for their 9 lives. No word yet as to why this may be, but scientists are presumably working on it. | {
"source": [
"https://biology.stackexchange.com/questions/52289",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/26898/"
]
} |
53,082 | Saw this bird outside my apartment in College Station, Texas and have never seen anything like it before!
It is about the size of a hand. | It is American Woodcock, Scolopax minor . Superbly camouflaged against the leaf litter, the brown-mottled American Woodcock walks slowly along the forest floor, probing the soil with its long bill in search of earthworms. Unlike its coastal relatives, this plump little shorebird lives in young forests and shrubby old fields across eastern North America. Its cryptic plumage and low-profile behavior make it hard to find except in the springtime at dawn or dusk, when the males show off for females by giving loud, nasal peent calls and performing dazzling aerial displays. The newborns are even more camouflaged in downs. References: Audubon All about birds | {
"source": [
"https://biology.stackexchange.com/questions/53082",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27526/"
]
} |
53,380 | Chlorophyll and hemoglobin are very similar molecules, as far as I understand. The important difference being one using an iron atom and the other a magnesium atom. Do any organisms use both to get energy from both oxygen and solar rays? If not, is there any good explanation of why? And do organisms that use chemosynthesis also use macro molecules similar to chlorophyll and hemoglobin? | tl;dr: Yes, all plants breathe.— I'm not sure whether I understand the question correctly; because all plants use respiration! Some of the organic high-energy substances produced by photosynthesis are later "burnt" to produce energy in the same "respiration" process used by animals, producing CO 2 . The difference to animals is that green plants synthesize their carbs (including the ones they burn for energy), fat and proteins from thin air, so to speak, while animals must eat them. These antithetic processes, photosynthesis and respiration, are often tied to the day-night cycle. When light is available, the plants-only photosynthesis dominates so that the plant consumes CO 2 and emits oxygen; at night, when photosynthesis becomes impossible, the usual common-place respiration causes the plant to consume oxygen and emit CO 2 , just like animals. Only as long as the plant is growing, this cycle is tilted towards photosynthesis so that more oxygen is emitted than absorbed: the excess carbon and hydrogen is sequestered in the plant's growing biomass. But when the plant dies, all this high-energy biomass is burnt by animals and micro-organisms, making the overall balance carbon- and oxygen-neutral. 2 So how do plants breathe — or rather, exchange gases with the atmosphere in general — if they don't have lungs or gills? The key is the large surface area of typical plants with leaves. Seen in this light, a tree looks well-designed for filtering stuff out of the atmosphere. Consider these two images. The first one is a lobe of a human lung 3 . The second one is a tree... or is it? I found John W. Kimball's page about gas exchange in plants accessible and full of interesting information. Central to our discussion are three facts: A plant's living cells, including the ones in the stem, are never far from the surface. The rate (or "speed") of respiration, i.e. oxidizing carbohydrates, is lower than in animals. (Plants do not perform physical labor with muscles and do not have a brain, which are the two main energy consumers in the human body.) Photosynthesis happens mostly in the thin leaves. Because of these factors — smaller amounts of gases per time over shorter distances — plants do not need high-volume, long-distance gas transport in the fashion most large animals do, with blood circulation. The gas travels between and through the cells as needed, guided and regulated by mechanisms detailed in Kimball's text. The fluid traveling through the stem provides (lots of) water to the leaves in the upward direction and nutrients to the living cells downward, but apparently does not carry (much) gas. The Arbor Day Foundation has a nice page detailing a tree trunk's structure with information about each layer's function. (I didn't know that the cells in the heartwood — the inner part of the trunk — are dead and do not participate in the transport of nutrients or water. 1 ) Your question seems to be triggered by a perceived similarity between the molecule giving blood its red color, hemoglobin, and the molecule which gives plants their green color, chlorophyll. True, both are organic molecules with metal atoms embedded, but they are quite different, even apart from their color. Hemoglobin is a protein with a fairly complex spatial structure; look at the image on the Wikipedia page. It weighs as much as 64,000 hydrogen atoms, i.e. it has a molar mass of about 64,000 g/mole. Chlorophyll is also an organic molecule, i.e. it has carbon chains and rings, but it is not a protein. (In living cells Chlorophyll molecules are embedded in a protein complex, arranging them to work together; that is a different thing.) It does not fold in space, partly because it is not as big. Its molar mass is only close to 900 g/mole, almost 80 times lighter than hemoglobin. A model of one variety can be found on its Wikipedia page, too. The jobs the two molecules do also are fairly different, even though both have to do with oxygen. Hemoglobin has a transport job. It binds oxygen efficiently. The spongy, blood-heavy lung tissue absorbs oxygen, which dissolves in the blood and is bound to the hemoglobin swimming around in it. There is a lot of hemoglobin in our blood, increasing the blood's capacity for oxygen transport by a factor of 70 compared to just dissolving oxygen in water (and it dissolves actually quite well in water!). Thus, hemoglobin does not synthesize anything but simply transports gases, mainly oxygen, through the body to where they are needed. Some athletes dope by collecting their own hemoglobin and re-injecting it before a competition, thus increasing oxygen supply for their muscles. Chlorophyll does not transport molecules but instead does some heavy chemical lifting. It absorbs light to harvest its energy through the mechanism called photosynthesis. The details are fairly complicated , but the big picture is not: It is a reversal of respiration, or chemically a reversal of oxidation , called reduction: Oxygen is separated from the hydrogen in H 2 O and carbon in CO 2 and given off to the air. Doing this consumes the same amount of energy which is released during oxidation (be it by fire or by metabolization in the plant). The emerging oxygen-poor(er) compounds can be oxidized later elsewhere to release that energy, or can be used as building blocks for new cells. 1 My girlfriend thinks I'm stupid not to know that ;-). 2 Unless it is buried and taken out of the biosphere, fossilizing to peat and eventually coal, tar and mineral oil. Then the net CO 2 balance of a plant's life is indeed negative, i.e. the plant has removed CO 2 from the atmosphere; until somebody excavates the fossil fuels, re-injects them into the biosphere and and restores former CO 2 levels and all the tropical climate which made the old jungles grow so well. 3 From wikipedia, https://upload.wikimedia.org/wikipedia/commons/a/a1/Lungs_diagram_detailed.svg . By Patrick J. Lynch, medical illustrator, via Wikimedia Commons. The "tree" is actually the same lobe, rotated and colored. | {
"source": [
"https://biology.stackexchange.com/questions/53380",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/8025/"
]
} |
53,577 | From my layman understanding, animals that inject venom into the bloodstream by biting or poking are venomous. And ones that harm you when you eat them are poisonous. Are there any animals (or plants) that fit both descriptions? I'm guessing eating a venomous rattlesnake will give you an upset stomach but not cause enough damage to be classified as poisonous. And I'm pretty sure poisonous tree frogs don't bite into their prey and inject them with anything. | That is certainly an interesting question! First, to clarify definitions: To be considered venomous the toxic substance must be produced in specialized glands or tissue. Often these are associated with some delivery apparatus (fangs, stinger, etc.), but not necessarily. To be poisonous, the toxins must be produced in non-specialized tissues and are only toxic after ingestion. Interestingly, many venoms are not poisonous if ingested. [1] I know of at least three species that produce both poison and venom. One is a snake (although not a rattlesnake, which are, in fact, edible): Rhabdophis tigrinus , which accumulates toxins in its tissues, but also delivers venom via fangs. [2] The other two are frogs: Corythomantis greeningi and Aparasphenodon brunoi , which have spines on their snout that they use to deliver the venom. [3] [1] Meier and White (eds.). 1995. Handbook of clinical toxicology of animal venoms and poisons. Boca Raton, Fla.: CRC Press, 477p. [2] Hutchinson et al. 2007. Dietary sequestration of defensive steroids in nuchal glands of the Asian snake Rhabdophis tigrinus. PNAS 104( 7 ): 2265-2270. [3] Jared et al. 2015. Venomous frogs use heads as weapons. Current Biology 25 , 2166-2170. | {
"source": [
"https://biology.stackexchange.com/questions/53577",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27920/"
]
} |
55,286 | Millions of colors in the visible spectrum can be generated by mixing red, green and blue - the RGB color system. Is there a basic set of smells that, when mixed, can yield all, or nearly all detectable smells ? | There are about 100 (Purves, 2001) to 400 (Zozulya et al ., 2001) functional olfactory receptors in man. While the total tally of olfactory receptor genes exceeds 1000, more than half of them are inactive pseudogenes . The combined activity of the expressed functional receptors accounts for the number of distinct odors that can be discriminated by the human olfactory system, which is estimated to be about 10,000 (Purves, 2001) . Different receptors are sensitive to subsets of chemicals that define a “ tuning curve .” Depending on the particular olfactory receptor molecules they contain, some olfactory receptor neurons exhibit marked selectivity to particular chemical stimuli, whereas others are activated by a number of different odorant molecules. In addition, olfactory receptor neurons can exhibit different thresholds for a particular odorant. How these olfactory responses encode a specific odorant is a complex issue that is unlikely to be explained at the level of the primary neurons (Purves, 2001) . So in a way, the answer to your question is yes, as there are approximately 100 to 400 olfactory receptors. Just like the photoreceptors in the visual system, each sensory neuron in the olfactory epithelium in the nose expresses only a single receptor gene ( Kimball ). In the visual system for color vision there are just three (red, green and blue cones - RGB) types of sensory neurons, so it's a bit more complicated in olfaction. References - Purves et al , Neuroscience , 2 nd ed. Sunderland (MA): Sinauer Associates; 2001 - Zozulya et al ., Genome Biol (2001); 2 (6): research0018.1–0018.12 Sources - Kimball's Biology Pages | {
"source": [
"https://biology.stackexchange.com/questions/55286",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/29083/"
]
} |
56,476 | Although blue foods exist, they're rare enough compared to other foods for food preparers to use blue plasters as a convention. The natural colour of a given food is due to pigments that have some biological origin. Is there any evolutionary reason why these are rarely blue? | Short answer Blue color is not only rare in edible organisms - Blue color is rare in both the animal and plant Kingdoms in general. In animals, blue coloring is generated through structural optic light effects, and not through colored pigments. In the few blue-colored plants, the blue color is generated by blue pigment, namely anthocyanins. The reason for the scarcity of blue pigments remains unknown as far as I know. Background The vast majority of animals are incapable of making blue pigments, but the reason appears to be unknown, according to NPR . In fact, not one vertebrate is known to be able to. Even brilliantly blue peacock feathers or a blue eye, for example, don't contain blue pigment. Instead, they all rely on structural colors to appear blue. Structural colors are brought about by the physical properties of delicately arranged micro- and nanostructures. Blue morpho butterflies are a great example of a brilliant blue color brought about by structural colors. Morphos have a 6-inch wingspan — one side a dull brown and the other a vibrant, reflective blue. The butterflies have tiny transparent structures on the surface of their wings that scatter light in just the right way to make them appear a vibrant blue. But if you grind up the wings, the dust — robbed of its reflective prism structures — would just look gray or brown. Similarly, the poison dart frog is blue because of the iridiphores in its skin, which contain no pigment but instead feature mirror-like plates that scatter and reflect blue light (source: By Bio ). Morpho and poison dart frog. sources: Wikipedia & LJN Herpetology Similarly, in the Kingdom of plants less than 10 percent of the 280,000 species of flowering plants produce blue flowers. In fact, there is no true blue pigment in plants and blue is even more rare in foliage than it is in flowers. Blue hues in plants are also generated by floral trickery with the common red anthocyanin pigments. Plants tweak, or modify, the red anthocyanin pigments to make blue flowers, including pH shifts and mixing of pigments, molecules and ions. These complicated alterations, combined with reflected light through the pigments, create the blue hue (source: Mother Nature Network ). But why the blue pigments are so scarce, seems to be unknown as far as I know ( MNN , NPR , Science blogs ) Sources - MNN - NPR - Photobiology | {
"source": [
"https://biology.stackexchange.com/questions/56476",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/26567/"
]
} |
56,939 | Start codon AUG also codes for methionine and without start codon translation does not happen. And even the ambiguous codon GUG codes for methionine when it is first. So does this mean that all proteins start with methionine as the first amino acid. | You are correct in thinking that since the translation of mRNA begins with AUG, which codes for methionine, then all proteins should contain a methionine at their N-terminus ( aka start site). But, it is indeed not so. First of all, I want to mention about variations in start codon. As you say, AUG is not the only, but actually the most common, start codon, and it codes for methionine in eukaryotes, or formylmethionine in prokaryotes but only at the start site. But, this start codon can also vary and become GUG or even UUG, coding for valine and leucine respectively. And the twist is, it still codes for methionine or formylmethionine 1 . In rare cases, such as heat shock, other codons like CUG, ACG, AUA and AUU, are also used for initiation 2 . It is so because start codon itself is not sufficient to begin translation, other nearby factors, like the Shine-Dalgarno sequence, or initiation factors, also play a role. One such factor is the initiation tRNA. At the beginning of translation, tRNA Met or tRNA fMet binds to the small subunit of ribosome. So, whatever be the start codon, the first amino acid will be methionine 3 . Now, coming back to the main question, N-terminal methionine, although being the first amino acid, is not present at N-terminus of all proteins. This is because of a process that is known as post-translational modification. After a polypeptide is completely translated from mRNA, it is modified at different places by different enzymes, which are regulated by different (internal or external) factors. There are more than a hundred post-translational modifications known 4 , one of which is the removal of methionine from the N-terminus of a polypeptide. N-terminal methionine is removed from a polypeptide by the enzyme methionine aminopeptidase 5 . The question which immediately comes to mind is Why are proteins modified after translation? Well, there can be various different causes of it. First of all, post-translational modifications are regulated by many factors, and this process is called post-translational regulation 6 . Another point is cell targeting. Attaching different groups to polypeptides makes them more stable at their target location. For example, by attaching lipid molecules to polypeptides (in a process called lipidation) makes the polypeptide more stable and suitable for cell membranes 4 . A yet another factor is increasing stability. Yes, you read it right, in some cases, N-terminal methionine can destabilize a protein! For example, an extra N-terminal methionine not only destabilizes but also disrupts the native folding configuration of $\alpha$-lactalbumin 7 . There can be numerous other factors too, which promote removal of N-terminal methionine from polypeptides. Thus, in short, No, not all proteins contain a methionine at their N-terminus . I hope this helps! References: 1. Touriol, C., Bornes, S., Bonnal, S., Audigier, S., Prats, H., Prats, A.-C. and Vagner, S. (2003), Generation of protein isoform diversity by alternative initiation of translation at non-AUG codons. Biology of the Cell, 95: 169–178. doi:10.1016/S0248-4900(03)00033-9 2. Ivanov IP, Firth AE, Michel AM, Atkins JF, Baranov PV. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences. Nucleic Acids Research. 2011;39(10):4220-4234. doi:10.1093/nar/gkr007. 3. Sherman, F., Stewart, J. W. and Tsunasawa, S. (1985), Methionine or not methionine at the beginning of a protein. Bioessays, 3: 27–31. doi:10.1002/bies.950030108 4. Post-translational modification - Wikipedia 5. Liao, Y.-D., Jeng, J.-C., Wang, C.-F., Wang, S.-C. and Chang, S.-T. (2004), Removal of N-terminal methionine from recombinant proteins by engineered E. coli methionine aminopeptidase. Protein Science, 13: 1802–1810. doi:10.1110/ps.04679104 6. Wolfgang Schumann; Wolfgang Schumann (Prof. Dr. rer. nat.) (2006). Dynamics of the bacterial chromosome: structure and function. Wiley-VCH 7. Chaudhuri, T. K., Horii, K., Yoda, T., Arai, M., Nagata, S., Terada, T. P., & Kumagai, I. (1999). Effect of the extra N-terminal methionine residue on the stability and folding of recombinant alpha-lactalbumin expressed in Escherichia coli . Journal of Molecular Biology, 285(3), 1179–1194. doi:10.1006/jmbi.1998.2362 | {
"source": [
"https://biology.stackexchange.com/questions/56939",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/24016/"
]
} |
57,114 | Why do electrocardiogram waves go P, Q, R, S, T and not like A, B, C, D? Is there any specific reason behind this? | Interesting question! I searched briefly and came up with an answer from this short paper . I won't repeat all the details of the paper, but to be not a completely link-only answer I will give a brief summary: The technology used at the time was a lot different than modern ECG leads: it used a Lippman capillary electrometer that used moving mercury to detect brief current changes. With this relatively primitive device, there were 4 apparent features in the trace, which were named A B C D (earlier, a different physiologist saw only two ventricular features that he logically named V1 and V2). However, it was known that this primitive measurement was not showing the actual electrical signal, but rather a filtered version due to the physics of the mercury in the tube, which was subject to inertia and friction. When a physiologist used mathematics to essentially "deconvolve" the filtered signal to get the original signal back, he plotted both curves next to each other: one labeled A B C D, the other labeled P Q R S T (note that in this deconvolved version of the trace, there were 5 components rather than 4). As for the choice of P Q R S T, the source I reference notes that these were the letters commonly used by Descartes, and since then have been commonly used to refer to series of variables when one needs to distinguish between ABCD, XYZ, etc. Later measurements that directly displayed the 5-component PQRST wave continued to use that terminology. Original: Einthoven W. Ueber die Form des menschlichen electrocardiogramms. Arch Gesamte Physiol.. 1895;60:101–123. Reproduced in: Hurst, 1998 References: Hurst, J. W. (1998). Naming of the waves in the ECG, with a brief account of their genesis. Circulation, 98(18), 1937-1942. | {
"source": [
"https://biology.stackexchange.com/questions/57114",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/30133/"
]
} |
57,128 | How forgetting things is helpful for the brain or the human body biologically? This web page After some moment of being rude, selfish, or weak, either we are able to put it behind us, or the person who suffered at the result of our imperfection moves on. The reason for this is our ability to forget about it. We forget not because we have an imperfect hippocampus (our brain’s memory organ); it's actually an evolved solution. The ability to lose information allows new information to come in that is more relevant, more pertinent to an ongoing reality. Forgetting allows us to update. and this Huffington post article According to a study in Nature, our awareness is limited to only three or four objects at any given time. To be able to think at your highest level, you therefore must be very efficient at filtering out all of the background noise: Your racing thoughts, the ringing phone, your neighbor’s barking dog, and the list goes on. The Nature study found that when participants were asked to “hold in mind” certain objects while ignoring others, there are significant variations in how well each of us can keep irrelevant objects out of our awareness. The researchers concluded that our memory capacity is therefore not simply about storage space, but rather “how efficiently irrelevant information is excluded from using up vital storage capacity.” provide some backgrounds. | Short answer It has been shown that loss of long-term memories may enhance the retrieval of others. Short-term working memory is explicitly designed to be volatile and non-lasting. However, there are many other types of memories where memory loss may not be explicitly beneficial, or even outright debilitating such as in the case of Alzheimer's or stroke. Background First off all, there are many types of memories , including sensory memory, motor memory, short-term (working) memory, long-term memory, explicit & implicit memory, declarative & procedural memory and so on. Hence, because the question is quite broad, I will focus on long-term memory, short term-memory and sensory memory to discuss that memory loss can be beneficial, neutral, or detrimental. Beneficial effects of loosing memories Long-term memory is probably what you are after and there are studies in that field that have linked the loss of memories to enhanced processing of other memories. More specifically, there are adaptive benefits of forgetting, namely a reduced demand on cognitive controls during future acts of remembering of other stored information. Even more specific: retrieval of memories after forgetting others are thought to reduce the necessary engagement of functionally coupled cognitive control mechanisms that detect ( anterior cingulate cortex) and resolve ( dorsolateral and ventrolateral prefrontal cortex ) mnemonic competition (Kuhl et al ., 2007) . The improvement of particular memory processes by forgetting others may be linked to them being closely related. Indeed, motor tasks more remote do not benefit much from forgetting unrelated ones (Shea & Right, 1991) . Inherently volatile memory Short-term working memory is explicitly designed to aid in on-demand task performance. Short term memory is for example used to remember a set of components (e.g., colors) and use that information to deal with a certain task at hand ( which objects depicted here match the colors you just saw? ). If all these memories would be retained, tasks dependent on working memory would not be possible. Sensory memory an ultra-short term memory that is kept only for very short amounts of time, allowing people to, e.g. , track a light and make a symbol or letter out of it before the information is funneled to the short term-memory. Neutral effects of loss of neural function: a side track off memory lane However, forgetting may be simply another example of the use it or lose it principle that applies to pretty much everything in the human body; when you don't walk, the bones in the legs will weaken along with the musculature used for locomotion. Similarly, when the inner ear or the retina becomes dysfunctional and degenerate, the deafferented auditory nerve and optic nerve start to degenerate, respectively. The associated deafferented sensory cortices will slowly be taken over by other adjacent cortical areas due to the plasticity of the cortex . In blind folks, for example, the tactile and auditory cortices have been shown to take over the primary visual cortex. Given that the visual cortex is huge compared to the tactile and auditory cortex, one would expect substantial increase in performance on tactile and acoustic tasks in blind folks. Yet, this is debated (Stronks et al, 2015) . In fact, normally sighted folks can learn braille as well as their blind peers, suffice they get an equal amount of practice. In other words, practice is the key, not enhanced areas of cortex being available per se . Hence, 'forgetting' to see or 'forgetting' to hear is, as far as my knowledge goes, not associated with any benefits whatsoever , barred a minority of studies that showed a slight benefit of being blind in auditory tasks (Stronks et al., 2015) . Pathological memory loss - not so good : However, forgetting of memories may also be pathological; think of the impaired short-term memory of Alzheimer's patients, or amnesia due to stroke . Forgetting is not always beneficial. References - Kuhl et al ., Nature Neurosci (2007); 10 : 908-14 - Shea & Right, Res Quarterly Exercise Sport (1991); 62 (3) - Stronks et al ., Brain Res (2015); 1624 : 140–52 | {
"source": [
"https://biology.stackexchange.com/questions/57128",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/28778/"
]
} |
57,145 | A recent study has provided evidence that two types of equine (horse) herpes viruses have an unusually broad host range. This fact supports which of the following statements? a. The lytic cylce occurs in horses while the lysogenic cycle occurs only in other species. b. The virus is transmitted from one host to another by mosquitoes. c. In a population of horses, many of the individuals will become infected d. Horses, rhinoceroses, and polar bear can become infected e. In an individual horse, many different type of cells will be infected According to the answer key, the answer is D. My question is why isn't E also a correct answer? I thought host range means "the range of cells that can act as a host to a virus". | Short answer It has been shown that loss of long-term memories may enhance the retrieval of others. Short-term working memory is explicitly designed to be volatile and non-lasting. However, there are many other types of memories where memory loss may not be explicitly beneficial, or even outright debilitating such as in the case of Alzheimer's or stroke. Background First off all, there are many types of memories , including sensory memory, motor memory, short-term (working) memory, long-term memory, explicit & implicit memory, declarative & procedural memory and so on. Hence, because the question is quite broad, I will focus on long-term memory, short term-memory and sensory memory to discuss that memory loss can be beneficial, neutral, or detrimental. Beneficial effects of loosing memories Long-term memory is probably what you are after and there are studies in that field that have linked the loss of memories to enhanced processing of other memories. More specifically, there are adaptive benefits of forgetting, namely a reduced demand on cognitive controls during future acts of remembering of other stored information. Even more specific: retrieval of memories after forgetting others are thought to reduce the necessary engagement of functionally coupled cognitive control mechanisms that detect ( anterior cingulate cortex) and resolve ( dorsolateral and ventrolateral prefrontal cortex ) mnemonic competition (Kuhl et al ., 2007) . The improvement of particular memory processes by forgetting others may be linked to them being closely related. Indeed, motor tasks more remote do not benefit much from forgetting unrelated ones (Shea & Right, 1991) . Inherently volatile memory Short-term working memory is explicitly designed to aid in on-demand task performance. Short term memory is for example used to remember a set of components (e.g., colors) and use that information to deal with a certain task at hand ( which objects depicted here match the colors you just saw? ). If all these memories would be retained, tasks dependent on working memory would not be possible. Sensory memory an ultra-short term memory that is kept only for very short amounts of time, allowing people to, e.g. , track a light and make a symbol or letter out of it before the information is funneled to the short term-memory. Neutral effects of loss of neural function: a side track off memory lane However, forgetting may be simply another example of the use it or lose it principle that applies to pretty much everything in the human body; when you don't walk, the bones in the legs will weaken along with the musculature used for locomotion. Similarly, when the inner ear or the retina becomes dysfunctional and degenerate, the deafferented auditory nerve and optic nerve start to degenerate, respectively. The associated deafferented sensory cortices will slowly be taken over by other adjacent cortical areas due to the plasticity of the cortex . In blind folks, for example, the tactile and auditory cortices have been shown to take over the primary visual cortex. Given that the visual cortex is huge compared to the tactile and auditory cortex, one would expect substantial increase in performance on tactile and acoustic tasks in blind folks. Yet, this is debated (Stronks et al, 2015) . In fact, normally sighted folks can learn braille as well as their blind peers, suffice they get an equal amount of practice. In other words, practice is the key, not enhanced areas of cortex being available per se . Hence, 'forgetting' to see or 'forgetting' to hear is, as far as my knowledge goes, not associated with any benefits whatsoever , barred a minority of studies that showed a slight benefit of being blind in auditory tasks (Stronks et al., 2015) . Pathological memory loss - not so good : However, forgetting of memories may also be pathological; think of the impaired short-term memory of Alzheimer's patients, or amnesia due to stroke . Forgetting is not always beneficial. References - Kuhl et al ., Nature Neurosci (2007); 10 : 908-14 - Shea & Right, Res Quarterly Exercise Sport (1991); 62 (3) - Stronks et al ., Brain Res (2015); 1624 : 140–52 | {
"source": [
"https://biology.stackexchange.com/questions/57145",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/26628/"
]
} |
57,361 | I have been observing my cat and found that when confronted with an unknown item, she will always use her front left paw to touch it. This has me wondering if animals exhibit handedness like humans do? (and do I have a left handed cat?) One note of importance is that with an unknown item, her approach is always identical, so possibly using the left paw means allowing a fast possible exit based on how she positions her body. This question is related to Are there dextral/sinistral higher animals? . However, I question the "paw-ness" as a consequence of how the cat is approaching new items (to be ready to flee), whereas the other question remarks about the high number of "right-pawed" dogs and questions the influence of people for this preference. | Short Answer Yes. handedness (or Behavioral Lateralization ) has been documented in numerous vertebrates (mammals, reptiles and birds) as well as invertebrates. This includes domestic cats (see Wells & Millsopp 2009 ). Long Answer There have been numerous studies that have documented behavioral lateralization in many groups of animals including lower vertebrates (fish and amphibians), reptiles (even snakes!), birds and mammals. More recent work (e.g., Frasnelli 2013 ) has also shown that lateralization can also occur in invertebrates. In other words, "handedness" (or pawedness, footedness, eyedness, earedness, nostriledness,
toothedness, breastedness, gonadedness, etc.) occurs rather extensively across the animal kingdom. These studies suggest that the evolution of brain lateralization , often linked to lateralized behaviors, may have occurred early in evolutionary history and may not have been the result of multiple independent evolutionary events as once thought. Although this view of brain lateralization as a highly conserved trait throughout evolutionary history has gained popularity, it's still contested (reviewed by Bisazza et al. 1998 ; Vallortigara et al. 1999 ). Note: Laterality of function may manifest in terms of preference (frequency) or performance (proficiency), with the former being far more often investigated. And no, right-handedness is not always dominant. But Why? One hypothesis is that brain lateralization was the evolutionary result of the need to break up complex tasks and perform them with highly specialized neuronal units to avoid functional overlap (i.e., to account for "functional incompatibility"). In humans, many hypotheses have been developed including: division of labor, genetics, epigenetic factors, prenatal hormone exposure, prenatal vestibular asymmetry, and even ultrasound exposure in the womb. Snake studies (see below) have suggested lateralization behavior can be dictated by environmental conditions (specifically, temperature). Other work ( Hoso et al. 2007 ) suggest that lateralization could be the result of convergent evolution. In this case, snakes developed feeding aparati that allow them to better consume more-common dextral species of snails. Note: dextral (meaning "clockwise") is a type of chirality -- another form of "handedness" Reviews: Lateralization in non-human primates : McGrew & Marchant 1997 . Lateralized behaviors in mammals and birds :
Bradshaw & Rogers 1993; Rogers & Andrew 2002 . Lateralized behaviors in lower vertebrates : Bisazza et al. 1998 ; Vallortigara et al. 1999 . Some Examples: Invertebrates Some spiders appear to favor certain appendages for prey handling and protection ( Ades & Novaes Ramires 2002 ). Octopi (or octopodes ) preferably use one eye over the other ( Byrne et al. 2002 ; with seemingly no preference for right/left at the population level: Byrne et al. 2004 ) and also apparently have a preferred arm ( Byrne et al. 2006 ). Fish Preferential ventral fin use in the gourami ( Trichogaster trichopterus ). [ Bisazza et al . 2001 ]. Preferential eye use in a variety of fish species [ Sovrano et al . 1999 , 2001 ]. Amphibians Lateralization of neural control for vocalization in frogs ( Rana pipiens ). [ Bauer 1993 ]. Preferential use of hindlimbs ( Robins et al . 1998 ), forelimbs ( Bisazza et al . 1996 ) and eyes ( Vallortigara et al . 1998 ) in adult anurans. Snakes Preferential use of right hemipenis over left under warm conditions. [ Shine et al . 2000 ]. Coiling asymmetries were found at both the individual and population levels. [ Roth 2003 ]. Birds Tendency for parrots to use left-feet when feeding. [ Friedmann & Davis 1938 ]. Mammals Pawdness in mice. [ Collins 1975 ]. left forelimb bias in a species of bat when using hands for climbing/grasping. [ Zucca et al. 2010 ] Behavior experiments show domesticated cats show strong preference to consistently use either left or right paw and that the lateralized behavior was strongly sex related (in their population: ♂ = left / ♀ = right). [ Wells & Millsopp 2009 ]. Non-human Primates Posture, reaching preference, tool use, gathering food, carrying, and many other tasks. See McGrew & Marchant (1997) for review. Citations Ades, C., and Novaes Ramires, E. (2002). Asymmetry of leg use during prey handling in the spider Scytodes globula (Scytodidae). Journal of Insect Behavior 15: 563–570. Bauer, R. H. (1993). Lateralization of neural control for vocalization by the frog ( Rana pipiens ). Psychobiology , 21, 243–248. Bisazza, A., Cantalupo, C., Robins, A., Rogers, L. J. & Vallortigara, G. (1996). Right-pawedness in toads. Nature , 379, 408. Bisazza, A., Rogers, L. J. & Vallortigara, G. (1998). The origins of cerebral asymmetry: a review of evidence of behavioural and brain lateralization in fishes, reptiles and amphibians. Neuroscience and Biobehavioral Reviews , 22, 411–426. Bisazza, A., Lippolis, G. & Vallortigara, G. (2001). Lateralization of ventral fins use during object exploration in the blue gourami ( Trichogaster trichopterus ). Physiology & Behavior , 72, 575–578. Bradshaw, J. L. & Rogers, L. J. (1993). The Evolution of Lateral Asymmetries, Language, Tool Use and Intellect . San Diego: Academic Press. Byrne, R.A., Kuba, M. and Griebel, U. (2002). Lateral asymmetry of eye use in Octopus vulgaris. Animal Behaviour, 64(3):461-468. Byrne, R.A., Kuba, M.J. and Meisel, D.V. (2004). Lateralized eye use in Octopus vulgaris shows antisymmetrical distribution. Animal Behaviour, 68(5):1107-1114. Byrne, R.A., Kuba, M.J., Meisel, D.V., Griebel, U. and Mather, J.A. (2006). Does Octopus vulgaris have preferred arms?. Journal of Comparative Psychology 120(3):198. Collins RL (1975) When left-handed mice live in righthanded worlds. Science 187:181–184. Friedmann, H., & Davis, M. (1938). " Left-Handedness" in Parrots. The Auk, 55(3), 478-480. Hoso, M., Asami, T., & Hori, M. (2007). Right-handed snakes: convergent evolution of asymmetry for functional specialization. Biology Letters , 3(2), 169-173. McGrew, W. C., & Marchant, L. F. (1997). On the other hand: current issues in and meta‐analysis of the behavioral laterality of hand function in nonhuman primates. American Journal of Physical Anthropology , 104(S25), 201-232. Robins, A., Lippolis, G., Bisazza, A., Vallortigara, G. & Rogers, L. J. (1998). Lateralized agonistic responses and hindlimb use in toads. Animal Behaviour , 56, 875–881. Rogers, L. J. & Andrew, R. J. (Eds) (2002). Comparative Vertebrate Lateralization . Cambridge: Cambridge University Press. Roth, E. D. (2003) . ‘Handedness’ in snakes? Lateralization of coiling behaviour in a cottonmouth, Agkistrodon piscivorus leucostoma , population. Animal behaviour , 66(2), 337-341. Shine, R., Olsson, M. M., LeMaster, M. P., Moore, I. T., & Mason, R. T. (2000). Are snakes right-handed? Asymmetry in hemipenis size and usage in gartersnakes ( Thamnophis sirtalis ). Behavioral Ecology , 11(4), 411-415. Sovrano, V. A., Rainoldi, C., Bisazza, A. & Vallortigara, G. (1999). Roots of brain specializations: preferential left-eye use during mirror-image inspection in six species of teleost fish. Behavioural Brain Research , 106, 175–180. Sovrano, V. A., Bisazza, A. & Vallortigara, G. (2001). Lateralization of response to social stimuli in fishes: a comparison between different methods and species. Physiology & Behavior , 74, 237– 244. Vallortigara, G., Rogers, L. J., Bisazza, A., Lippolis, G. & Robins, A. (1998). Complementary right and left hemifield use for predatory and agonistic behaviour in toads. NeuroReport , 9, 3341–3344. Vallortigara, G., Rogers, L. J. & Bisazza, A. (1999). Possible evolutionary origins of cognitive brain lateralization. Brain Research Reviews , 30, 164–175. Wells, D. L., & Millsopp, S. (2009). Lateralized behaviour in the domestic cat, Felis silvestris catus . Animal Behaviour , 78(2), 537-541. Zucca, P., Palladini, A., Baciadonna, L. and Scaravelli, D. (2010). Handedness in the echolocating Schreiber's long-fingered bat ( Miniopterus schreibersii ). Behavioural processes , 84(3): 693-695. | {
"source": [
"https://biology.stackexchange.com/questions/57361",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/21175/"
]
} |
57,369 | How does philosophy define life? And how does it overlap and contrast with the concepts and nuances of other sciences such as biology, chemistry, physics and mathematics? | Short Answer Yes. handedness (or Behavioral Lateralization ) has been documented in numerous vertebrates (mammals, reptiles and birds) as well as invertebrates. This includes domestic cats (see Wells & Millsopp 2009 ). Long Answer There have been numerous studies that have documented behavioral lateralization in many groups of animals including lower vertebrates (fish and amphibians), reptiles (even snakes!), birds and mammals. More recent work (e.g., Frasnelli 2013 ) has also shown that lateralization can also occur in invertebrates. In other words, "handedness" (or pawedness, footedness, eyedness, earedness, nostriledness,
toothedness, breastedness, gonadedness, etc.) occurs rather extensively across the animal kingdom. These studies suggest that the evolution of brain lateralization , often linked to lateralized behaviors, may have occurred early in evolutionary history and may not have been the result of multiple independent evolutionary events as once thought. Although this view of brain lateralization as a highly conserved trait throughout evolutionary history has gained popularity, it's still contested (reviewed by Bisazza et al. 1998 ; Vallortigara et al. 1999 ). Note: Laterality of function may manifest in terms of preference (frequency) or performance (proficiency), with the former being far more often investigated. And no, right-handedness is not always dominant. But Why? One hypothesis is that brain lateralization was the evolutionary result of the need to break up complex tasks and perform them with highly specialized neuronal units to avoid functional overlap (i.e., to account for "functional incompatibility"). In humans, many hypotheses have been developed including: division of labor, genetics, epigenetic factors, prenatal hormone exposure, prenatal vestibular asymmetry, and even ultrasound exposure in the womb. Snake studies (see below) have suggested lateralization behavior can be dictated by environmental conditions (specifically, temperature). Other work ( Hoso et al. 2007 ) suggest that lateralization could be the result of convergent evolution. In this case, snakes developed feeding aparati that allow them to better consume more-common dextral species of snails. Note: dextral (meaning "clockwise") is a type of chirality -- another form of "handedness" Reviews: Lateralization in non-human primates : McGrew & Marchant 1997 . Lateralized behaviors in mammals and birds :
Bradshaw & Rogers 1993; Rogers & Andrew 2002 . Lateralized behaviors in lower vertebrates : Bisazza et al. 1998 ; Vallortigara et al. 1999 . Some Examples: Invertebrates Some spiders appear to favor certain appendages for prey handling and protection ( Ades & Novaes Ramires 2002 ). Octopi (or octopodes ) preferably use one eye over the other ( Byrne et al. 2002 ; with seemingly no preference for right/left at the population level: Byrne et al. 2004 ) and also apparently have a preferred arm ( Byrne et al. 2006 ). Fish Preferential ventral fin use in the gourami ( Trichogaster trichopterus ). [ Bisazza et al . 2001 ]. Preferential eye use in a variety of fish species [ Sovrano et al . 1999 , 2001 ]. Amphibians Lateralization of neural control for vocalization in frogs ( Rana pipiens ). [ Bauer 1993 ]. Preferential use of hindlimbs ( Robins et al . 1998 ), forelimbs ( Bisazza et al . 1996 ) and eyes ( Vallortigara et al . 1998 ) in adult anurans. Snakes Preferential use of right hemipenis over left under warm conditions. [ Shine et al . 2000 ]. Coiling asymmetries were found at both the individual and population levels. [ Roth 2003 ]. Birds Tendency for parrots to use left-feet when feeding. [ Friedmann & Davis 1938 ]. Mammals Pawdness in mice. [ Collins 1975 ]. left forelimb bias in a species of bat when using hands for climbing/grasping. [ Zucca et al. 2010 ] Behavior experiments show domesticated cats show strong preference to consistently use either left or right paw and that the lateralized behavior was strongly sex related (in their population: ♂ = left / ♀ = right). [ Wells & Millsopp 2009 ]. Non-human Primates Posture, reaching preference, tool use, gathering food, carrying, and many other tasks. See McGrew & Marchant (1997) for review. Citations Ades, C., and Novaes Ramires, E. (2002). Asymmetry of leg use during prey handling in the spider Scytodes globula (Scytodidae). Journal of Insect Behavior 15: 563–570. Bauer, R. H. (1993). Lateralization of neural control for vocalization by the frog ( Rana pipiens ). Psychobiology , 21, 243–248. Bisazza, A., Cantalupo, C., Robins, A., Rogers, L. J. & Vallortigara, G. (1996). Right-pawedness in toads. Nature , 379, 408. Bisazza, A., Rogers, L. J. & Vallortigara, G. (1998). The origins of cerebral asymmetry: a review of evidence of behavioural and brain lateralization in fishes, reptiles and amphibians. Neuroscience and Biobehavioral Reviews , 22, 411–426. Bisazza, A., Lippolis, G. & Vallortigara, G. (2001). Lateralization of ventral fins use during object exploration in the blue gourami ( Trichogaster trichopterus ). Physiology & Behavior , 72, 575–578. Bradshaw, J. L. & Rogers, L. J. (1993). The Evolution of Lateral Asymmetries, Language, Tool Use and Intellect . San Diego: Academic Press. Byrne, R.A., Kuba, M. and Griebel, U. (2002). Lateral asymmetry of eye use in Octopus vulgaris. Animal Behaviour, 64(3):461-468. Byrne, R.A., Kuba, M.J. and Meisel, D.V. (2004). Lateralized eye use in Octopus vulgaris shows antisymmetrical distribution. Animal Behaviour, 68(5):1107-1114. Byrne, R.A., Kuba, M.J., Meisel, D.V., Griebel, U. and Mather, J.A. (2006). Does Octopus vulgaris have preferred arms?. Journal of Comparative Psychology 120(3):198. Collins RL (1975) When left-handed mice live in righthanded worlds. Science 187:181–184. Friedmann, H., & Davis, M. (1938). " Left-Handedness" in Parrots. The Auk, 55(3), 478-480. Hoso, M., Asami, T., & Hori, M. (2007). Right-handed snakes: convergent evolution of asymmetry for functional specialization. Biology Letters , 3(2), 169-173. McGrew, W. C., & Marchant, L. F. (1997). On the other hand: current issues in and meta‐analysis of the behavioral laterality of hand function in nonhuman primates. American Journal of Physical Anthropology , 104(S25), 201-232. Robins, A., Lippolis, G., Bisazza, A., Vallortigara, G. & Rogers, L. J. (1998). Lateralized agonistic responses and hindlimb use in toads. Animal Behaviour , 56, 875–881. Rogers, L. J. & Andrew, R. J. (Eds) (2002). Comparative Vertebrate Lateralization . Cambridge: Cambridge University Press. Roth, E. D. (2003) . ‘Handedness’ in snakes? Lateralization of coiling behaviour in a cottonmouth, Agkistrodon piscivorus leucostoma , population. Animal behaviour , 66(2), 337-341. Shine, R., Olsson, M. M., LeMaster, M. P., Moore, I. T., & Mason, R. T. (2000). Are snakes right-handed? Asymmetry in hemipenis size and usage in gartersnakes ( Thamnophis sirtalis ). Behavioral Ecology , 11(4), 411-415. Sovrano, V. A., Rainoldi, C., Bisazza, A. & Vallortigara, G. (1999). Roots of brain specializations: preferential left-eye use during mirror-image inspection in six species of teleost fish. Behavioural Brain Research , 106, 175–180. Sovrano, V. A., Bisazza, A. & Vallortigara, G. (2001). Lateralization of response to social stimuli in fishes: a comparison between different methods and species. Physiology & Behavior , 74, 237– 244. Vallortigara, G., Rogers, L. J., Bisazza, A., Lippolis, G. & Robins, A. (1998). Complementary right and left hemifield use for predatory and agonistic behaviour in toads. NeuroReport , 9, 3341–3344. Vallortigara, G., Rogers, L. J. & Bisazza, A. (1999). Possible evolutionary origins of cognitive brain lateralization. Brain Research Reviews , 30, 164–175. Wells, D. L., & Millsopp, S. (2009). Lateralized behaviour in the domestic cat, Felis silvestris catus . Animal Behaviour , 78(2), 537-541. Zucca, P., Palladini, A., Baciadonna, L. and Scaravelli, D. (2010). Handedness in the echolocating Schreiber's long-fingered bat ( Miniopterus schreibersii ). Behavioural processes , 84(3): 693-695. | {
"source": [
"https://biology.stackexchange.com/questions/57369",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/29455/"
]
} |
57,479 | As far as I know, humans have 23 pairs of chromosomes, each one which contains a particular amount of genes. But in the "last" pair, men have a XY pair chromosome, and women have a XX pair chromosome. Does the missing "leg" of the XY pair make men to have fewer genes than women, and if so, how many genes do each sex have? | It is true that the Y chromosome is shorter than the X chromosome and that there are more genes on the X chromosome. Do men have fewer genes? One could (mis)understand three things in the expression "number of genes". Number of gene copies (see Copy Number Variation ) Number of genes Number of alleles Thanks to @GerardoFurtado for correcting my semantic in the comments. 1. Number of gene copies From the statement that there are fewer genes on the Y chromosome, one can conclude that men have fewer genes copies than woman. This is the intuition the OP seemed to have. 2. Number of genes Men also have an X chromosome. So men have the standard genes present on the X chromosome (but they only have a single copy of it while women have two copies; btw you might be interested in dosage compensation ). Because women do not have a Y chromosome and because there are a number of genes on the Y chromosome that are not present on the X chromosome, men have genes that female don't have at all. Therefore women have fewer genes than men. 3. Number of alleles There is not much reason to expect that one gender would be more heterozygote than the other at autosomes (=non sexual chromosomes). Some may hypothesize that women may have more heterozygosity than men if there is stronger selection among sperm than among ovules or things like that but let's not get down this complicated path. One one hand women have more gene copies and therefore might experience more heterozygosity, one the other hand, men have more genes and would therefore eventually carry more alleles. I don't know which side wins! Did you mean number of genes per cell or per individual? So far I assumed you were interested about the number of genes (or gene copies) per cells but if you want to compare whole individuals than it is a different story! Men are on average taller and therefore have more cells. Therefore if you compare the body-wide number of gene copies, women will have fewer gene copy on average (Thanks to @JM97 comment). | {
"source": [
"https://biology.stackexchange.com/questions/57479",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/38948/"
]
} |
57,594 | I'm developing neural networks comprised of just 3 to 10 layers of virtual neurons and I'm curious to know if there are any insect brains out there with fewer than a thousand neurons? Are there any tiny creatures with small numbers of neurons? Do neuronal maps exist for those simple nervous systems? | Short answer As far as I know, a complete neural map (a connectome) is only available for the roundworm C. elegens , a nematode with only 302 neurons (fig. 1). Fig. 1. C. elegans (left, size: ~1 mm) and connectome of C. elegans (right). sources: Utrecht University & Farber (2012) Background Looking at the least complex of animals will be your best bet and nematodes (roundworms) like Caenorhabditis elegans are definitely a good option. C. elegans has some 300 neurons . Below is a schematic of phyla in Fig.2. You mention insects; these critters are much more complex than roundworms. The total number of neurons varies with each insect, but for comparison: one of the lesser complex insects like the fruit fly Drosophila already has around 100k neurons, while a regular honey bee has about one million (source: Bio Teaching ). Complexity of the organism is indeed an indicator of the number of neurons to be expected. Sponges, for instance (Fig. 1) have no neurons at all, so the least complex of animals won't help you. the next in line are the Cnidaria (Fig. 2). The Cnidaria include the jelly fish, and for example Hydra vulgaris has 5.6k neurons . So why do jelly fish feature more neurons? Because size also matters. Hydra vulgaris can grow up 15 mm , while C. elegans grows only up to 1 mm. See the wikipedia page for an informative list of #neurons in a host of species. A decent neuronal connectivity map (a connectome ) only exists for C. elegans (Fig. 1) as far as I know, although other maps (Drosophila (Meinertzhagen, 2016) and human ) are underway. References - Farber, Sci Am February 2012 - Meinertzhagen, J Neurogenet (2016); 30 (2): 62-8 Fig. 2. Phyla within the kingdom of animalia . source: Southwest Tennessee University College | {
"source": [
"https://biology.stackexchange.com/questions/57594",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19073/"
]
} |
57,674 | This answer mentions that the C. elegans hermaphrodite has exactly 302 distinct neurons . This has made it a very effective model for a variety of types of biological research, including neurology and cell differentiation. It is also currently the only organism with a completely mapped connectome . But the word "always" made me wonder - has a viable specimen ever been verified to naturally have a number of neurons other than 302 ? Not as a result of an experiment, just naturally? | According to the highly respected WORMATLAS: A Database of Behavioral and Structural Anatomy of Caenorhabditis elegans , the number is invariable in this animal, one of the most studied in the world. There are 302 neurons in the nervous system of C. elegans; this number is invariant between animals. Each neuron has a unique combination of properties, such as morphology, connectivity and position, so that every neuron may be given a unique label. Groups of neurons that differ from each other only in position have been assigned to classes. There are 118 classes that have been made using these criteria, the class sizes ranging from 1 to 13. Thus C. elegans has a rich variety of neuron types in spite of having only a small total complement of neurons. (Emphasis mine) From the above, you might guess that the number of synapses are not, however. The full list of synapses for hermaphrodite (including larval stages) and adult male are currently being reviewed and revised for the Wormwiring Project. All data comes from re/analysis of the sections for the hermaphrodite N2U, N2T, N2W and JSE animals, and male N2Y and n930 animals. The total counts of both electrical and chemical synapses are likely to be substantially higher than what was reported in the Mind of a Worm. Would I be surprised if someone found a different number in a particular specimen? No more so than when people are born with four kidneys, a parasitized twin, etc. Edited to Add : An article, Mutations that affect neural cell lineages and cell fates during the development of the nematode Caenorhabditis elegans has identified mutations with more or fewer neurons: Specifically, unc-83 and unc-84 mutations affect certain precursor cells that generate both neural and nonneural descendants; lin-22 and lin-26 mutants lead to the generation of supernumerary neural cells with a concomitant loss of nonneural cells; lin-4, lin-14, lin-28, and lin-29 mutants perturb global aspects of developmental timing, altering the time of appearance (or preventing the appearance) of both neural and nonneural cells ... However, access to the paper is restricted, and I don't know if these mutations were induced (most likely were.) HT to @canadianer for the link that led to my link. | {
"source": [
"https://biology.stackexchange.com/questions/57674",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27918/"
]
} |
57,695 | I am a private individual and I want my exomes sequenced, I don't know of any place that will keep my data confidential as I read reports of companies sharing this data with insurance companies. I tried looking into a number of university research centers but none of them sequence DNA of private individuals. Does anybody know of any university that does WES of individuals or a place which can keep my information confidential? Many thanks in advance for your replies! | According to the highly respected WORMATLAS: A Database of Behavioral and Structural Anatomy of Caenorhabditis elegans , the number is invariable in this animal, one of the most studied in the world. There are 302 neurons in the nervous system of C. elegans; this number is invariant between animals. Each neuron has a unique combination of properties, such as morphology, connectivity and position, so that every neuron may be given a unique label. Groups of neurons that differ from each other only in position have been assigned to classes. There are 118 classes that have been made using these criteria, the class sizes ranging from 1 to 13. Thus C. elegans has a rich variety of neuron types in spite of having only a small total complement of neurons. (Emphasis mine) From the above, you might guess that the number of synapses are not, however. The full list of synapses for hermaphrodite (including larval stages) and adult male are currently being reviewed and revised for the Wormwiring Project. All data comes from re/analysis of the sections for the hermaphrodite N2U, N2T, N2W and JSE animals, and male N2Y and n930 animals. The total counts of both electrical and chemical synapses are likely to be substantially higher than what was reported in the Mind of a Worm. Would I be surprised if someone found a different number in a particular specimen? No more so than when people are born with four kidneys, a parasitized twin, etc. Edited to Add : An article, Mutations that affect neural cell lineages and cell fates during the development of the nematode Caenorhabditis elegans has identified mutations with more or fewer neurons: Specifically, unc-83 and unc-84 mutations affect certain precursor cells that generate both neural and nonneural descendants; lin-22 and lin-26 mutants lead to the generation of supernumerary neural cells with a concomitant loss of nonneural cells; lin-4, lin-14, lin-28, and lin-29 mutants perturb global aspects of developmental timing, altering the time of appearance (or preventing the appearance) of both neural and nonneural cells ... However, access to the paper is restricted, and I don't know if these mutations were induced (most likely were.) HT to @canadianer for the link that led to my link. | {
"source": [
"https://biology.stackexchange.com/questions/57695",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27903/"
]
} |
57,971 | When people get sick, they often develop a fever. What is the effect of an increased body temperature on viruses and bacteria in the body? Is it beneficial to the infected body? Importantly, often fever-reducing agents like aspirin are prescribed when people are sick. Doesn't this counteract any benefits of fever? | Fever is a trait observed in warm and cold-blooded vertebrates that has been conserved for hundreds of millions of years (Evans, 2015) . Elevated body temperature stimulates the body's immune response against infectious viruses and bacteria. It also makes the body less favorable as a host for replicating viruses and bacteria, which are temperature sensitive (Source: Sci Am ). The innate system is stimulated by increasing the recruitment, activation and bacteriolytic activity of neutrophils . Likewise, natural killer cells ' cytotoxic activity is enhanced and their recruitment is increased, including that to tumors. Macrophages and dendritic cells increase their activity in clearing up the mess associated with infection. Also the adaptive immune response is enhanced by elevated temperatures. For example, the circulation of T cells to the lymph nodes is increased and their proliferation is stimulated. In fact, taking pain killers that reduce fever have been shown to lead to poorer clearance of pathogens from the body (Evans, 2015) . In adults, when body temperature reaches 104 o F (40 o C) it can become dangerous and fever reducing agents like aspirin are recommended (source: eMedicine ) Reference - Evans, Nat Rev Immunol (2015); 15 (6): 335–49 | {
"source": [
"https://biology.stackexchange.com/questions/57971",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/28324/"
]
} |
58,169 | I recently read in my Ecology course notes that a mosquito feeding on human blood is not considered as a parasite. However, since it sucks blood from the human body, shouldn't it be regarded as a parasite, just like lice and ticks? | A mosquito is a biological parasite, it is not a medical parasite. There are two definitions of parasite. A biological/ecological definition and a medical/physiological interaction definition. A parasite in biological terms is an organism that benefits from a parasitic relationship; a parasitic relationship being a non-mutual relationship between species, in which one species benefits at the expense of the other. Generally the host is not killed by a small number of parasites. When the host is killed the organism is usually called predator or parasitoid. A parasite in medical terms is an organism that lives on or in a host and gets food from or at the expense of its host. The difference is small but important; only the medical definition requires the parasite to live in or on the host for prolonged periods. It is a much narrower definition. Biologically, a female mosquito is an indirect ectoparasite, it can be facultative or obligate depending on the species. It harms its host to benefit itself, that is all that is needed to be a parasite by the biological/ecological definition. And just like a leech or vampire bat it is hemophagic and leaves the host as soon as it is done feeding. Brood parasites are another great example of a biological parasite that does not live on or in the host. So a cuckoo would be a biological parasite but not a medical parasite. When you consider the function and practice of medical science the more narrow definition makes sense, they are not concerned with parasites that are not going to stick around or not affect the host organism's physiology directly. By the narrower medical definition, none of these organisms are parasites even though by the biological/ecological definition they are. Consider the wiki or a paper on parasite evolution vs say the CDC to see the difference. | {
"source": [
"https://biology.stackexchange.com/questions/58169",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/31223/"
]
} |
58,176 | 1. Some sources (including the current Tag-info at biology SE) state; biophysics is the adoption of techniques / methodologies from physics to study biological systems. The use of method s from the physical sciences to aid in the study of biological systems… Bio-SE- Tag biophysics . Biophysics or biological physics is an interdisciplinary science that applies the approaches and methods of physics to study biological systems… Wikipedia ( permalink ). Biophysics — the branch of biology that applies the methods of physics to the study of biological structures and processes… Dictionary.com 2. According to other sources, biophysics is the subject concerned with how the laws or phenomena of physics work in living systems. “The subject of biophysics are the physical principles underlying all process of living systems.” Google Book: Biophysics, An introduction , By Ronald Glaser ( permalink ). Biophysics is a bridge between biology and physics. ... Biophysics looks for principles that describe patterns. If the principles are powerful, they make detailed predictions that can be tested. --- Biophysical society These two, although apparently quite similar (and I agree, have overlapping areas) basically indicate completely different things. The first group of definitions refer to techniques and methodologies ; such as “how does an electron microscope work?”, or “what could be the best strategy to separate membrane-lipids?”, or “how could you identify cells with the expression of certain RNA”; etc. The second group refers to the physical principles applicable to living systems. Such as “why do phospholipids form a bilayer?” or “how do brain waves reach the scalp?” or “how does a humming bird move its wings when it hovers in a stationary manner?” or “what are the mechanisms working in the path of transport through phloem?”. Now my question is: Is there a dual and different meaning, or use of the term ‘biophysics’? | A mosquito is a biological parasite, it is not a medical parasite. There are two definitions of parasite. A biological/ecological definition and a medical/physiological interaction definition. A parasite in biological terms is an organism that benefits from a parasitic relationship; a parasitic relationship being a non-mutual relationship between species, in which one species benefits at the expense of the other. Generally the host is not killed by a small number of parasites. When the host is killed the organism is usually called predator or parasitoid. A parasite in medical terms is an organism that lives on or in a host and gets food from or at the expense of its host. The difference is small but important; only the medical definition requires the parasite to live in or on the host for prolonged periods. It is a much narrower definition. Biologically, a female mosquito is an indirect ectoparasite, it can be facultative or obligate depending on the species. It harms its host to benefit itself, that is all that is needed to be a parasite by the biological/ecological definition. And just like a leech or vampire bat it is hemophagic and leaves the host as soon as it is done feeding. Brood parasites are another great example of a biological parasite that does not live on or in the host. So a cuckoo would be a biological parasite but not a medical parasite. When you consider the function and practice of medical science the more narrow definition makes sense, they are not concerned with parasites that are not going to stick around or not affect the host organism's physiology directly. By the narrower medical definition, none of these organisms are parasites even though by the biological/ecological definition they are. Consider the wiki or a paper on parasite evolution vs say the CDC to see the difference. | {
"source": [
"https://biology.stackexchange.com/questions/58176",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/25568/"
]
} |
58,874 | I found a beautiful scarce-swallowtail butterfly in my storeroom, but it was kind of frozen and couldn't fly away. So, I put it on my terrace in the sun. After a little bit, it flew a few meters away and fell. I was wondering what could these beings eat, so that I can help it...
Any answers would be great appreciated!
Thanks in advance | Adult butterflies don't eat! I mean.... not in the sense of chewing on food. They rather drink. They get their nutrients via ingestion of liquid substances. Their mouth consists of a long tube called a proboscis that acts as a straw. What do butterflies feed on? The vast majority of butterflies eat nectar from flowers. Many species are quite specialized and feed on the nectar of a few species only. There are a few exceptions though. Some species feed on tree sap, dung, mud (see mud-puddling ), pollen, or rotting fruit. Butterflies are attracted to sodium and may as well try to feed on human sweat but I doubt there exist any species would get a non-negligible source of nutrients from human sweat. Coming to exceptions, you should definitely consider reading @DmitryGrigoryev's answer as well. What do caterpillars feed on? Of course, you are probably aware that butterflies have a complex (-ish) life cycle. The larva is called a caterpillar, while the adult is called a butterfly. So what do caterpillars eat? Caterpillars have mandibles , so they can chew tissues and not just drink. Most caterpillars eat leaves and other plants parts. Again, many species are specialized to only a few plant species. There are of course exceptions. For example in the Phengaris genus, (such as the famous large blue ( Phengaris arion ) , caterpillars live in ant colonies and mimic the larvae of these ants. Some of them are able to trick the ants into feeding them as though they were ant larvae (e.g. Phengaris alcon , Phengaris rebeli ). Others (e.g. the aforementioned Phengaris arion ) will act as predators and eat the real ant larvae! When the butterflies emerge from their cocoons after metamorphosis, the ants finally figure out the trickery and start attacking the butterfly. The butterfly has therefore very little time to try to fly away from the colony before getting killed. It is a critical life stage for individuals of this species. How to feed a butterfly? This section exists thanks to @Rodrigo's recommendation. As a substitute of nectar one can simply use sugar water. The optimal sugar concentration (in mass-mass) is around 35% ( Kim et al. 2011 ) although it likely varies among species. Kim et al. 2011 explains that what limits optimal sugar concentration for insects is the viscosity of the solution. Too much sugar renders the solution too viscous and difficult to forage on. Interestingly, the ability to drink viscous solutions depends upon the drinking technic (active suction, capillary suction or viscous dipping) which vary, not among butterflies but among insects. The article is interesting. | {
"source": [
"https://biology.stackexchange.com/questions/58874",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/31853/"
]
} |
58,891 | I am working on a tool for SNP calling in polyploid plants. To test my method, I need a list of housekeeping genes common in almost all plants. For my case, these genes must be single copy (ie each HK gene should have no paralogs). Briefly I need a list of genes that are: House keeping Single copy Common in almost all genomes, or genomes of a taxa Any help is appreciated. | Adult butterflies don't eat! I mean.... not in the sense of chewing on food. They rather drink. They get their nutrients via ingestion of liquid substances. Their mouth consists of a long tube called a proboscis that acts as a straw. What do butterflies feed on? The vast majority of butterflies eat nectar from flowers. Many species are quite specialized and feed on the nectar of a few species only. There are a few exceptions though. Some species feed on tree sap, dung, mud (see mud-puddling ), pollen, or rotting fruit. Butterflies are attracted to sodium and may as well try to feed on human sweat but I doubt there exist any species would get a non-negligible source of nutrients from human sweat. Coming to exceptions, you should definitely consider reading @DmitryGrigoryev's answer as well. What do caterpillars feed on? Of course, you are probably aware that butterflies have a complex (-ish) life cycle. The larva is called a caterpillar, while the adult is called a butterfly. So what do caterpillars eat? Caterpillars have mandibles , so they can chew tissues and not just drink. Most caterpillars eat leaves and other plants parts. Again, many species are specialized to only a few plant species. There are of course exceptions. For example in the Phengaris genus, (such as the famous large blue ( Phengaris arion ) , caterpillars live in ant colonies and mimic the larvae of these ants. Some of them are able to trick the ants into feeding them as though they were ant larvae (e.g. Phengaris alcon , Phengaris rebeli ). Others (e.g. the aforementioned Phengaris arion ) will act as predators and eat the real ant larvae! When the butterflies emerge from their cocoons after metamorphosis, the ants finally figure out the trickery and start attacking the butterfly. The butterfly has therefore very little time to try to fly away from the colony before getting killed. It is a critical life stage for individuals of this species. How to feed a butterfly? This section exists thanks to @Rodrigo's recommendation. As a substitute of nectar one can simply use sugar water. The optimal sugar concentration (in mass-mass) is around 35% ( Kim et al. 2011 ) although it likely varies among species. Kim et al. 2011 explains that what limits optimal sugar concentration for insects is the viscosity of the solution. Too much sugar renders the solution too viscous and difficult to forage on. Interestingly, the ability to drink viscous solutions depends upon the drinking technic (active suction, capillary suction or viscous dipping) which vary, not among butterflies but among insects. The article is interesting. | {
"source": [
"https://biology.stackexchange.com/questions/58891",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/1916/"
]
} |
59,493 | I want to go straight from bwa mem alignment to BAM format as I don't need the SAM file and it takes up too much space. How do I achieve this? | For directly outputting a sorted bam file you can use the following: bwa mem genome.fa reads.fastq | samtools sort -o output.bam - Optionally using multiple threads: bwa mem -t 8 genome.fa reads.fastq | samtools sort -@8 -o output.bam - | {
"source": [
"https://biology.stackexchange.com/questions/59493",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/32305/"
]
} |
59,497 | For a lab course we have been assigned to "remove a stop codon, using mutagenesis, that is in the middle of a gene in order for the full gene to be expressed. This will then fluoresce." To do this we are considering site directed mutagenesis, which can replace the stop codon, however is this a good method? Are there any alternatives to SDM using Quikchange that are better? What are the pros and cons of the SDM we are thinking of performing? To see if we succeeded we will then use DNA sequencing and gel electrophoresis. Our overall plan looks like this: Gathering plasmids from E. coli Gel electrophoresis of the plasmid DNA Perform the mutagenesis using Quikchange Transformation by heat-shock PCR Use a lac promoter to produce the gene protein One issue I could think of was, how do we make sure the primers carrying the mutation don't anneal to each other due to their complementarity? Is overlap-extension a good alternative? Are there any advantages to using transposon-based or point-directed mutagenesis? Thank you! | For directly outputting a sorted bam file you can use the following: bwa mem genome.fa reads.fastq | samtools sort -o output.bam - Optionally using multiple threads: bwa mem -t 8 genome.fa reads.fastq | samtools sort -@8 -o output.bam - | {
"source": [
"https://biology.stackexchange.com/questions/59497",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/30284/"
]
} |
59,617 | I came across this plant yesterday (14th May) and was wondering what it might be? Would anybody know the scientific name and if it's indigenous to the UK (personally I doubt it is)? The plant grows in an Asian style garden near Cumnock, Scotland . Close up of leaves: | This is the " Acer palmatum " or Japanese maple, which shows a wide variety of different leaf forms (from here ): Specically you found "Acer palmatum dissectum 'Red Dragon'", for more information look here (picture also from this site): | {
"source": [
"https://biology.stackexchange.com/questions/59617",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27854/"
]
} |
59,688 | Why does cutting onions cause tears? From a couple of sites, I found that it is because of sulfuric acid produced by onions. But I could not find more details. What is the biochemical pathway by which onions cause tears? Also, which compound is responsible for it? If it is enzyme-catalyzed reaction, can we just stop the production of this enzyme without causing any side-effects? | Interesting question! The cause of tears and itching is the chemicals produced by onion ( Allium cepa ). Lets go into some details. Onions, coming from the family Liliaceae (also containing garlic, chives, scallions and leeks) store compounds known as amino acid sulfoxides, and the one we are talking about here is S-1-propenyl-L-cysteine sulfoxide (abbreviated as PRENCSO), also calles isoalliin (due to its similarity with alliin found in garlic). When onion is damaged (cut, chewed, etc.), an enzyme alliinase converts PRENCSO into 1-propenyl sulfenic acid. This compound is then converted into propanethial-S-oxide by an enzyme lachrymatory factor synthase (earlier this reaction was considered spontaneous). The reaction looks like this: Propanethial-S-oxide is the major cause of the flavor and aroma of onion. However, it is a volatile compound i.e. vaporizes very quickly. When its vapors reach the eye, it causes tears because of being a lachrymator ( aka tear gas) i.e. as soon as it comes in contact with cornea, it triggers a nervous response which leads to activation of lachrymal (tear) glands. PS: when propanethial-S-oxide comes in contact with cornea, a small amount of it reacts with water to form sulfuric acid. This sulfuric acid is the cause of itching and irritation in eyes due to onion. Also, scientists are now trying to genetically either modify or stop the production of lachrymatory factor synthase enzyme to produce tearless onions. This (modification) has even been achieved to a high efficiency, as another answer discusses. However, making tearless onions could prove harmful to the crop in several ways, as discussed here . EDIT: As asked in comments, I will add some details about how the sulfuric acid is produced from the reaction between propanethial-S-oxide and water. The only resource I could find giving some details about this was Marta Corzo-Martínez, 2014 . They summarize the complete pathway in the following diagram: After applying some common chemistry principles, the concerned reaction turns out to be: $\ce{4~C_3H_6SO~+~4~H_2O \rightarrow 4~C_3H_6O~+~H_2SO_4~+~3~H_2S}$ As you see, one of the products of hydrolysis of propanethial-S-oxide is hydrogen sulfide ($\ce{H_2S}$). Just like $\ce{H_2SO_4}$, $\ce{H_2S}$ also causes irritation in the eyes (its effect on eyes has been well documented, see Lambert et al , 2006 as an example). Thus, the produced $\ce{H_2S}$ only increases the irritation and itching in the eyes caused due to $\ce{H_2SO_4}$. BONUS: Another interesting point here is runny nose. propanethial-S-oxide is actually the compound responsible for the smell and flavor of onions. But, it causes tears by exciting the lachrymal glands i.e. reflexive lachrymation. propanethial-S-oxide excites the trigeminal nerve (the fifth cranial nerve) causing activation of lachrymal glands. Interestingly, the nerve endings of trigeminal nerve are also present in the nose, along with the eyes. So, this compound can also activate the lachrymal glands from your nose, and since the lachrymal duct is joined from eyes to nose, you can also experience runny nose along with tears and irritation in eyes. References: Propanethial-S-oxide | University of Bristol Alliin | Wikipedia Tear Gas | Wikipedia Timothy William Lambert, Verona Marie Goodwin, Dennis Stefani, Lisa Strosher, Hydrogen sulfide ($\ce{H_2S}$) and sour gas effects on the eye. A historical perspective, Science of The Total Environment, Volume 367, Issue 1, 15 August 2006, Pages 1-22, ISSN 0048-9697, https://doi.org/10.1016/j.scitotenv.2006.01.034 Encyclopedia of Perception, Volume 1 -
E. Bruce Goldstein,
SAGE, 2010 The Neurology of Lacrimation – How an Ear Infection Can Cause Dry Eye -
by Noelle La Croix, DVM, Dip. ACVO | {
"source": [
"https://biology.stackexchange.com/questions/59688",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/26541/"
]
} |
59,755 | I have been learning about recombination frequencies, but an still getting a bit confused despite having gone over many of the links in Google regarding them. I was wondering if someone could verify whether the following is correct. To calculate recombiation frequencies and thus create a genetic map from this, you have to have true breeding parents for two or more different genes. You have to cross these parents, so that you have an F1 generation consisting only of heterozygotes You then have to backcross the F1 individuals with either of the parents. If these genes are all located on different chromosomes you will just get independent chromosome segregation and therefore a 50/50 chance of each allele occuring with the other one in the progeny. Whereas if they occur on the same chromosome, then in the F1 heterozygotes the alleles from each parent will only segregate differently into the gametes if recombination occurs. To calculate the recombination frequencies we therefore take the number of offspring for which the combination of these two alleles is different from that observed in the parents- we call these the recombinants. Is this correct? | Interesting question! The cause of tears and itching is the chemicals produced by onion ( Allium cepa ). Lets go into some details. Onions, coming from the family Liliaceae (also containing garlic, chives, scallions and leeks) store compounds known as amino acid sulfoxides, and the one we are talking about here is S-1-propenyl-L-cysteine sulfoxide (abbreviated as PRENCSO), also calles isoalliin (due to its similarity with alliin found in garlic). When onion is damaged (cut, chewed, etc.), an enzyme alliinase converts PRENCSO into 1-propenyl sulfenic acid. This compound is then converted into propanethial-S-oxide by an enzyme lachrymatory factor synthase (earlier this reaction was considered spontaneous). The reaction looks like this: Propanethial-S-oxide is the major cause of the flavor and aroma of onion. However, it is a volatile compound i.e. vaporizes very quickly. When its vapors reach the eye, it causes tears because of being a lachrymator ( aka tear gas) i.e. as soon as it comes in contact with cornea, it triggers a nervous response which leads to activation of lachrymal (tear) glands. PS: when propanethial-S-oxide comes in contact with cornea, a small amount of it reacts with water to form sulfuric acid. This sulfuric acid is the cause of itching and irritation in eyes due to onion. Also, scientists are now trying to genetically either modify or stop the production of lachrymatory factor synthase enzyme to produce tearless onions. This (modification) has even been achieved to a high efficiency, as another answer discusses. However, making tearless onions could prove harmful to the crop in several ways, as discussed here . EDIT: As asked in comments, I will add some details about how the sulfuric acid is produced from the reaction between propanethial-S-oxide and water. The only resource I could find giving some details about this was Marta Corzo-Martínez, 2014 . They summarize the complete pathway in the following diagram: After applying some common chemistry principles, the concerned reaction turns out to be: $\ce{4~C_3H_6SO~+~4~H_2O \rightarrow 4~C_3H_6O~+~H_2SO_4~+~3~H_2S}$ As you see, one of the products of hydrolysis of propanethial-S-oxide is hydrogen sulfide ($\ce{H_2S}$). Just like $\ce{H_2SO_4}$, $\ce{H_2S}$ also causes irritation in the eyes (its effect on eyes has been well documented, see Lambert et al , 2006 as an example). Thus, the produced $\ce{H_2S}$ only increases the irritation and itching in the eyes caused due to $\ce{H_2SO_4}$. BONUS: Another interesting point here is runny nose. propanethial-S-oxide is actually the compound responsible for the smell and flavor of onions. But, it causes tears by exciting the lachrymal glands i.e. reflexive lachrymation. propanethial-S-oxide excites the trigeminal nerve (the fifth cranial nerve) causing activation of lachrymal glands. Interestingly, the nerve endings of trigeminal nerve are also present in the nose, along with the eyes. So, this compound can also activate the lachrymal glands from your nose, and since the lachrymal duct is joined from eyes to nose, you can also experience runny nose along with tears and irritation in eyes. References: Propanethial-S-oxide | University of Bristol Alliin | Wikipedia Tear Gas | Wikipedia Timothy William Lambert, Verona Marie Goodwin, Dennis Stefani, Lisa Strosher, Hydrogen sulfide ($\ce{H_2S}$) and sour gas effects on the eye. A historical perspective, Science of The Total Environment, Volume 367, Issue 1, 15 August 2006, Pages 1-22, ISSN 0048-9697, https://doi.org/10.1016/j.scitotenv.2006.01.034 Encyclopedia of Perception, Volume 1 -
E. Bruce Goldstein,
SAGE, 2010 The Neurology of Lacrimation – How an Ear Infection Can Cause Dry Eye -
by Noelle La Croix, DVM, Dip. ACVO | {
"source": [
"https://biology.stackexchange.com/questions/59755",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6136/"
]
} |
60,018 | I've been reading my textbook and it refers to prions as a normal protein with a helpful function but it can turn into a disease causing form. However, I look in my other textbook and it refers to the word prion as solely being a disease causing protein. I'd like to know which is the correct definition. Ie. Would I be correct in saying "The prion protein is normally involved in synaptic transmission but can turn into a disease causing form"? Thanks in advance! | The normal isoform of the protein is called PrP C , which stands for cellular prion protein , while the infectious isoform is called PrP SC , which stands for scrapie prion protein . According to Riesner (2003): The biochemical properties of the prion protein which is the major, if not only, component of the prion are outlined in detail. PrP is a host-encoded protein which exists as PrP C (cellular) in the non-infected host, and as PrP Sc (scrapie) as the major component of the scrapie infectious agent. (emphasis mine) If you search for "cellular prion protein" you're gonna find several papers that use the name prion protein to the normal isoform. Some examples: Prado, M., Alves-Silva, J., Magalhães, A., Prado, V., Linden, R., Martins, V. and Brentani, R. (2004). PrPc on the road: trafficking of the cellular prion protein. Journal of Neurochemistry, 88(4), pp.769-781 . Ramljak, S. (2008). Physiological function of the cellular prion protein (PrPc_1hnc). 1st ed. Berlin: Logos-Verl . Pantera, B., Bini, C., Cirri, P., Paoli, P., Camici, G., Manao, G. and Caselli, A. (2009). PrP c activation induces neurite outgrowth and differentiation in PC12 cells: role for caveolin-1 in the signal transduction pathway. Journal of Neurochemistry, 110(1), pp.194-207 . Martins, V., Mercadante, A., Cabral, A., Freitas, A. and Castro, R. (2017). Insights into the physiological function of cellular prion protein . And many others. Therefore, following this nomenclature, the answer to your question ( "Would I be correct in saying 'The prion protein is normally involved in synaptic transmission but can turn into a disease causing form'?" ) is yes . The difference is the adjective: cellular or scrapie. Finally, pay attention to this: you have two different questions here. In the title you say "Is prion a term used..." , but in the last paragraph you say ""Is the prion protein normally involved in..." . As extensively discussed in the other answer , the term prion alone (instead of prion protein ) is normally used only when referring to the abnormal isoform. More on that here: https://www.cdc.gov/prions/pdfs/public-health-impact.pdf Source: Detlev Riesner; Biochemistry and structure of PrPC and PrPSc. Br Med Bull 2003; 66 (1): 21-33 . | {
"source": [
"https://biology.stackexchange.com/questions/60018",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/32267/"
]
} |
60,042 | I teach A&P for bio non majors. I have a special needs student whose accommodation requires a word bank for any anatomy identification questions I have on the exam. I would like to present the student with a 'master wordbank' (presumably hundreds of words in length) that would act as a word bank for all the exams in the course. I'm surprised to be unable to find much of anything online. Has anyone seen something like this? | The normal isoform of the protein is called PrP C , which stands for cellular prion protein , while the infectious isoform is called PrP SC , which stands for scrapie prion protein . According to Riesner (2003): The biochemical properties of the prion protein which is the major, if not only, component of the prion are outlined in detail. PrP is a host-encoded protein which exists as PrP C (cellular) in the non-infected host, and as PrP Sc (scrapie) as the major component of the scrapie infectious agent. (emphasis mine) If you search for "cellular prion protein" you're gonna find several papers that use the name prion protein to the normal isoform. Some examples: Prado, M., Alves-Silva, J., Magalhães, A., Prado, V., Linden, R., Martins, V. and Brentani, R. (2004). PrPc on the road: trafficking of the cellular prion protein. Journal of Neurochemistry, 88(4), pp.769-781 . Ramljak, S. (2008). Physiological function of the cellular prion protein (PrPc_1hnc). 1st ed. Berlin: Logos-Verl . Pantera, B., Bini, C., Cirri, P., Paoli, P., Camici, G., Manao, G. and Caselli, A. (2009). PrP c activation induces neurite outgrowth and differentiation in PC12 cells: role for caveolin-1 in the signal transduction pathway. Journal of Neurochemistry, 110(1), pp.194-207 . Martins, V., Mercadante, A., Cabral, A., Freitas, A. and Castro, R. (2017). Insights into the physiological function of cellular prion protein . And many others. Therefore, following this nomenclature, the answer to your question ( "Would I be correct in saying 'The prion protein is normally involved in synaptic transmission but can turn into a disease causing form'?" ) is yes . The difference is the adjective: cellular or scrapie. Finally, pay attention to this: you have two different questions here. In the title you say "Is prion a term used..." , but in the last paragraph you say ""Is the prion protein normally involved in..." . As extensively discussed in the other answer , the term prion alone (instead of prion protein ) is normally used only when referring to the abnormal isoform. More on that here: https://www.cdc.gov/prions/pdfs/public-health-impact.pdf Source: Detlev Riesner; Biochemistry and structure of PrPC and PrPSc. Br Med Bull 2003; 66 (1): 21-33 . | {
"source": [
"https://biology.stackexchange.com/questions/60042",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6061/"
]
} |
60,654 | I was wondering why dogs shouldn't eat chocolate. Can't dogs just excrete the indigestible component in their droppings? It's common knowledge that dogs shouldn't eat chocolate. What I don't know is why chocolate would kill them, from a specifically biological perspective. | The reason is simple: Chocolate contains cocoa which contains Theobromine . The darker the chocolate is (meaning the more cocoa it contains) the more theobromine it contains. This is a bitter alkaloid which is toxic to dogs (and also cats), but can be tolerated by humans. The reason for this is the much slower metabolization of theobromine in the animals (there are reports for poisonings of dogs, cats, birds, rabbits and even bear cubs) so that the toxic effect can happen. Depending on the size of the dog, something between 50 and 400g of milk chocolate can be fatal. As mentioned by @anongoodnurse the cocoa content in milk chocolate is the lowest and much higher the darker the chocolate gets. The poisoning comes from the Theobromine itself, which has different mechanisms of action: First it is an unselective antagonist of the adenosine receptor , which is a subclass of G-protein coupled receptors on the cell surface which usually bind adenosine as a ligand. This influences cellular signalling. Then it is a competitive nonselective phosphodiesterase inhibitor , which prevents the breakdown of cyclic AMP in the cell. cAMP is an important second messenger in the cell playing an important role in the mediation of signals from the outside of the cells via receptors to a reaction of a cell to changing conditions. The levels of cAMP are tightly controlled and the half-life of the molecule is generally short. Elevated levels lead to an activation of the protein kinase A , an inhibition TNF-alpha and leukotriene synthesis and reduces inflammation and innate immunity. For references see here . The LD 50 for theobromine is very different among species (table from here ), with LD 50 as the lethal dose killing 50% of the individuals and TD lo the lowest published toxic dose: The LD 50 also differs between different breeds of dogs, so there are online calculators available to make an estimation, if there is a problem or not. You can find them for example here and here . The selective toxicity makes it even an interesting poison for pest control of coyotes, see reference 4 for some details. References: Chocolate - Veterinary Manual Chocolate intoxication The Poisonous Chemistry of Chocolate Evaluation of cocoa- and coffee-derived methylxanthines as toxicants
for the control of pest coyotes. | {
"source": [
"https://biology.stackexchange.com/questions/60654",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/33104/"
]
} |
60,706 | I know most creatures take time to learn some things. Birds take some time to fly. Human beings take some time walk or stand. But in the case of the deer species, it's different. It can stand the same day it's born. Why is this so? | If you compare placental mammals in how much time they need to start walking, you'll see that deer are no exception. Humans are an exception. Hypothesis of Obstetrical Dilemma The hypothesis of Obstetrical Dilemma states that humans are born premature. We very much think this is because if we were to be born more developed (like other mammals), our big brain would not be able to make its way through the pelvis. Also, bipedalism leads to a narrower pelvis making the passage of the big brain even more problematic. For this reason, human babies are very dependent on the care of their parents for a long time. This hypothesis is called the Obstetrical dilemma (see Rosenberg 1992 , Weiner et al. 2008 among many other papers as well as several books such as Ancient Bodies, Modern Lives for example). Counter arguments to the Hypothesis of Obstetrical Dilemma Note however that this hypothesis comes with a few potential contradictions, such as the fact that human gestation is no shorter than the gestation of humans' sister species. Indeed, in chimpanzees, for example, gestation lasts 243 days on average against 280 days on average for humans. These counter-arguments can be found in Dunsworth et al. 2012 . Thanks to @MattThrower and @AdamDavis for their helpful comments. | {
"source": [
"https://biology.stackexchange.com/questions/60706",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/-1/"
]
} |
60,718 | All mammals that I can think of have a high degree of bilateral symmetry (In fact, almost every animal I can think of is like this). So why is the human heart not exactly in the middle of the body? An effect of this is that one lung is slightly smaller. Are there any evolutionary theories on why this came to be? | First of all, let me make it clear that the heart is at the vertical centre of the body -- it is not shifted towards left (or right). However, it is slightly tilted towards the left in most cases. In some cases, it is tilted towards the right, and the condition is called Dextrocardia . For why it is so, lets look at what the heart does. Below is a diagram of double circulation (from here ). As you see, the highest pressure needs to be generated for pumping oxygenated blood into the body. Thus, the left ventricle needs the thickest muscles for this purpose. And due to these extra muscles, the heart appears extended and seems shifted towards left. Coming to the evolutionary perspective, it is important to mention that humans are not the only organisms with this feature. Indeed, displacement of the heart towards the left is a conserved feature in all vertebrates ( Fishman et al , 1997 ). See this answer for more information. Coming to genes, bending of the heart towards one side is actually controlled by the NODAL gene during development. See this diagram (from Jensen et al , 2013 ): Tilting occurs in two phases, one during the first four and a half months of intrauterine life and the other, which is actually a 45° rotation to the median plane, later. During the early development of the heart, a process called cardiac looping happens and the straight heart tube develops a bend (see diagram). The NODAL gene, along with the Lefty1 and Lefty2 genes, regulates the speed and direction of cardiomyocyte movement during the development of the heart, leading to this asymmetry. To confirm it, researchers knocked out the spaw/nodal gene from a zebrafish and found randomized development of heart, even symmetric heart, as the result(!) (see Walmsley, 1958 and Rohr et al , 2008 ). Now, talking about why this happened in the first place, and why it is so conserved among vertebrates, we need to ask ourselves a basic question: what good would a symmetrical heart be? External symmetry is preferred (probably) because it helps in locomotion; it would be quite difficult to move with your two legs placed away from your center of gravity. But when we talk about internal symmetry, conditions drastically change. We get a major restrictive factor here: space. And limited space always dominates other factors. Seeing that the structure of the heart is necessarily pointed towards one side, it becomes difficult to make it symmetrical. (The only option IMO is to have another pointed end at the right side.) In this case again, what advantage would a symmetrical heart provide? None. And it might even be harmful since having an even bigger heart would mean making both lungs smaller. Thus, a symmetrical heart would only prove to be a liability rather than an asset. See this question for more information. | {
"source": [
"https://biology.stackexchange.com/questions/60718",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/19127/"
]
} |
60,846 | Given the following: bruises are caused by minor trauma which breaks blood vessels beneath the skin, causing bleeding the mechanism by which bleeding stops is clotting blood clots inside the body have an unfortunate tendency to get into the bloodstream and cause blockages, leading to severe problems such as strokes or heart attacks why is it that people don't die from bruises? What mechanism does the human body have to keep this from happening? | blood clots inside the body have an unfortunate tendency to get into the bloodstream and cause blockages, leading to severe problems such as strokes or heart attacks This statement is primarily true only for blood clots within blood vessels , especially in the veins. When you are talking about bruising, you are talking about clots outside of the vasculature. When a blood clot occurs in an artery, it can block that artery or break off, flow downstream, and block some smaller distal vessel. These events are most severe when they affect crucial organs like the brain and heart ("stroke" or "heart attack"), though of course any organ can be damaged in this way. However, blood clots in arteries can't ever directly affect a tissue that is not distal from where the clot starts, because they can never pass through capillaries or travel backward. When a blood clot occurs in a vein and is dislodged, it can follow the increasingly larger venous system back to the heart, where it can cause a pulmonary embolism (blockage in the lungs) or, via a patent foramen ovale, travel to the left-side circulation and end up anywhere, including the coronary arteries or blood vessels of the brain. Similarly, clots that form in the venous return from the lungs to the heart or in the left side of the heart itself can travel anywhere (except the lungs) and create a blockage. For a clot outside the vasculature, for it to have an effect somewhere else systemically it must re-enter the vasculature. This is simply not possible in most situations, because the vessels involved are very small, and during bleeding the blood is flowing out of vessels: there is no pressure gradient to push the clot back into the vessels. In more severe cases of injury where major vessels are involved, clotting in those major vessels can indeed be a problem, but not for common occurrences of bruising. (see also @anongoodnurse's answer that contains a good clarification of what exactly a bruise is, as well as how there are risks from very serious bruises but not the same way the original question implied) | {
"source": [
"https://biology.stackexchange.com/questions/60846",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6683/"
]
} |
61,020 | I think this is a fairly common observation that if one does some significant amount of exercise, he/she may feel alright for the rest of the day, but it generally hurts bad the next day . Why is this the case? I would expect that if the muscles have undergone significant strain (say I started pushups/plank today), then it should cause pain while doing the strenuous activity, or during rest of the day, but it happens often that we don't feel the pain while doing the activity or even on that day, but surely and sorely feel it the next day. Another example - say after a long time, you played a long game of basketball/baseball/cricket. You generally don't feel any pain during the game/that day, but there is a good chance it will hurt bad the next day. I am trying to understand both - why does the pain not happen on that day, and why it does, the next day (or the day after that). | Unlike the conventional wisdom, the pain you feel the next day (after a strenuous exercise) has nothing to do with lactic acid. Actually, lactic acid is rapidly removed from the muscle cell and converted to other substances in the liver (see Cori cycle ). If you start to feel your muscles "burning" during exercise (due to lactic acid), you just need to rest for some seconds, and the "burning" sensation disappears. According to Scientific American : Contrary to popular opinion, lactate or, as it is often called, lactic acid buildup is not responsible for the muscle soreness felt in the days following strenuous exercise. Rather, the production of lactate and other metabolites during extreme exertion results in the burning sensation often felt in active muscles. Researchers who have examined lactate levels right after exercise found little correlation with the level of muscle soreness felt a few days later. (emphasis mine) So if it's not lactic acid, what is the cause of the pain? What you're feeling in the next day is called Delayed Onset Muscle Soreness ( DOMS ). DOMS is basically an inflammatory process (with accumulation of histamine and prostaglandins), due to microtrauma or micro ruptures in the muscle fibers. The soreness can last from some hours to a couple of days or more, depending on the severity of the trauma (see below). According to the "damage hypothesis" (also known as "micro tear model"), microruptures are necessary for hypertrophy (if you are working out seeking hypertrophy), and that explains why lifting very little weight doesn't promote hypertrophy. However, this same microtrauma promotes an inflammatory reaction (Tiidus, 2008). This inflammation can take some time to develop (that's why you normally feel the soreness the next day ) and, like a regular inflammation, has as signs pain, edema and heat. This figure from McArdle (2010) shows the proposed sequence for DOMS: Figure : proposed sequence for delayed-onset muscle soreness. Source:
McArdle (2010). As anyone who works out at the gym knows, deciding how much weight to add to the barbell can be complicated: too little weight promotes no microtrauma, and you won't have any hypertrophy. Too much weight leads to too much microtraumata, and you'll have trouble to get out of the bed the next day. EDIT : This comment asks if there is evidence of the "micro tear model" or "damage model" (also EIMD, or Exercise-induced muscle damage). First, that's precisely why I was careful when I used the term hypothesis . Second, despite the matter not being settled, there is indeed evidence supporting EIMD. This meta-analysis (Schoenfeld, 2012) says: There is a sound theoretical rationale supporting a potential role for EIMD in the hypertrophic response. Although it appears that muscle growth can occur in the relative absence of muscle damage, potential mechanisms exist whereby EIMD may enhance the accretion of muscle proteins including the release of inflammatory agents, activation of satellite cells, and upregulation of IGF-1 system, or at least set in motion the signaling pathways that lead to hypertrophy. The same paper, however, discuss the problems of EIMD and a few alternative hypotheses (some of them not mutually exclusive, though). Sources: Tiidus, P. (2008). Skeletal muscle damage and repair. Champaign: Human Kinetics . McArdle, W., Katch, F. and Katch, V. (2010). Exercise physiology. Baltimore: Wolters Kluwer Health/Lippincott Williams & Wilkins . Roth, S. (2017). Why Does Lactic Acid Build Up in Muscles? And Why Does It Cause Soreness?. [online] Scientific American. Available at: https://www.scientificamerican.com/article/why-does-lactic-acid-buil/ [Accessed 22 Jun. 2017] . Schoenfeld, B. (2012). Does Exercise-Induced Muscle Damage Play a Role in Skeletal Muscle Hypertrophy?. Journal of Strength and Conditioning Research, 26(5), pp.1441-1453 . | {
"source": [
"https://biology.stackexchange.com/questions/61020",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/24819/"
]
} |
62,532 | As the question states, got curious and I was wondering if monogamy is an innate human behaviour or is it because of how we built society (religion, traditions, etc.)? Let's say we go back in time, would we see humans settling down with a single partner at a time and caring for their children as a couple for life or would they reproduce with several leaving the mothers with their children? Thanks! | Humans are believed to be mostly serial monogamists with a noticeable components of secret cheating . Serial monogamy means most will have a single partner at a time but will likely have several partners throughout their life, there is however an under current (~15%) of hidden cheating in most studied populations. Also I say mostly becasue human behavior is plastic and nearly every possible combination exists, albeit in small numbers. Males do have a stronger tendency to seek multiple partners at the same time, which makes biological sense. like many social species you really have several mating strategies coexisting, often in the same head. Our large brains allow for more flexible approach to strategies. In other animals exclusive (one mate forever) monogamy is exceptionally, almost breathtakingly rare, (not counting animals that only ever mate once). The Azara's night monkey is one of the few that has been backed by genetic research. Almost every monogamous species ever studied either has some rate of cheating, or is serial monogamous. | {
"source": [
"https://biology.stackexchange.com/questions/62532",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/30578/"
]
} |
62,557 | Say pathogenic bacteriaA makes toxinA, which had D-amino acids instead of L-amino aids, does this difference in chirality cause a different conformational change in the receptor or enzyme, thus leading to either deactivation of the enzyme or signal transduction pathway or activation of a different pathway? I understand what chirality is in the concept of organic chemistry — rotating plane polarized light, ingold-prelog system etc; however I never leaned what structural feature of chiral molecules changes the way they react inside a cell. I do NOT understand HOW changes in chirality can be associated with cellular toxicity. links: https://www.ncbi.nlm.nih.gov/pubmed/24752840 http://www.jomb.org/uploadfile/2014/0113/20140113053743849.pdf https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3960212/ | Humans are believed to be mostly serial monogamists with a noticeable components of secret cheating . Serial monogamy means most will have a single partner at a time but will likely have several partners throughout their life, there is however an under current (~15%) of hidden cheating in most studied populations. Also I say mostly becasue human behavior is plastic and nearly every possible combination exists, albeit in small numbers. Males do have a stronger tendency to seek multiple partners at the same time, which makes biological sense. like many social species you really have several mating strategies coexisting, often in the same head. Our large brains allow for more flexible approach to strategies. In other animals exclusive (one mate forever) monogamy is exceptionally, almost breathtakingly rare, (not counting animals that only ever mate once). The Azara's night monkey is one of the few that has been backed by genetic research. Almost every monogamous species ever studied either has some rate of cheating, or is serial monogamous. | {
"source": [
"https://biology.stackexchange.com/questions/62557",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/32886/"
]
} |
62,877 | I just was bitten by a bug!!! It is 3mm long and has large pincers. Here is a photo: I live in Colorado. Any help identifying it would be great. | It's a larva of a green lacewing (Family Chrysopidae). Yes, they can bite hard but you're not its intended victim and they're not only harmless but beneficial as they're aggressive predators of aphids and other soft bodied plant pests. I can't be specific to what species of lacewing as they look fairly similar. Another larva that looks very similar to yours. Source from BugGuide.net What the adult looks like (remember,they're an entire insect family so there are differences but not to most people). Source also from BugGuide.net | {
"source": [
"https://biology.stackexchange.com/questions/62877",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/34128/"
]
} |
64,507 | They're not poisonous or anything, so it can't be aposematism. As far as I know it doesn't come from diet like the flamingo. They're not apex predators, so they can't get away with it (like tigers), and honestly it seems like a big risk factor given how many species prey upon them. As well as something that would make hunting more difficult for them. I understand they prefer dense brush, and I think hunting during low light hours, but orange against green is about as starkly contrasting as it gets. So does that just leave sexual selection? One of their sexes thinks it's pretty, basically? Or is there some other reason for it, one that might have something to do with the rest of the odd coloring? | Their fur colour is actually a pretty good camouflage | {
"source": [
"https://biology.stackexchange.com/questions/64507",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/35537/"
]
} |
64,522 | I found a commercial reagent called in vivo-jetPEI® from Polyplus-Transfection that is able to delivery mRNA in vivo. I'm planning to do an experiment with it, but I'm worry about how to synthesise mRNA and purify them clean enough to inject to living body.
I also found a recommended Kit called HiScribe T7 High Yield RNA Synthesis Kit that can help me to synthesise mRNA but I'm not sure if I can use the final product for an in vivo injection. Anyone have any experience with it? | Their fur colour is actually a pretty good camouflage | {
"source": [
"https://biology.stackexchange.com/questions/64522",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/25624/"
]
} |
64,735 | DNA is known to have a double-helical structure. Do any other molecules have this structure? | A few examples: Starch A polymer of glucose that can form a double helix and functions primarily as energy storage in plants. [ image source ] f-Actin Filamentous actin forms a helical structure with two strands of polymerized g-actin. This is a structural component of the cytoskeleton . [ image source ] Coiled Coil Protein motif with a helical structure formed by two (or more) α-helices . Coiled coils are found in a diverse range of proteins from structural proteins like keratin to transcription factors like c-Fos . [ image source ] Gramicidin A peptide-based antibiotic that has been shown to form membrane spanning double helices. [ image source ] | {
"source": [
"https://biology.stackexchange.com/questions/64735",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/35681/"
]
} |
64,743 | It has always been said that sexual reproduction produces offsprings which are superior to their parents, due to the variations which they acquire causing them to survive better in their environment. That's because we can think of meiosis occurring at some level of their life cycle resulting in the variations in the final offspring.
But what when we talk about bisexual organisms, might they be plants, animals or any other life form? Can't there be variations in their offsprings if they produce them asexually? It's like when they undergo gamete formation in different male and female structure present in that single parent, they'll surely undergo meiosis(if the parent is not haploid undoubtedly) forming the gametes which are dissimilar in their genetic makeup. When these fertilize, shouldn't they show variations? | A few examples: Starch A polymer of glucose that can form a double helix and functions primarily as energy storage in plants. [ image source ] f-Actin Filamentous actin forms a helical structure with two strands of polymerized g-actin. This is a structural component of the cytoskeleton . [ image source ] Coiled Coil Protein motif with a helical structure formed by two (or more) α-helices . Coiled coils are found in a diverse range of proteins from structural proteins like keratin to transcription factors like c-Fos . [ image source ] Gramicidin A peptide-based antibiotic that has been shown to form membrane spanning double helices. [ image source ] | {
"source": [
"https://biology.stackexchange.com/questions/64743",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/35689/"
]
} |
64,822 | I was drinking a glass of milk the other day and that got me thinking that no other animal to my knowledge drinks milk past their infant stages. One could argue that cats might but it isn't good for them to do. Are humans the only animal that are able to drink milk as adults and not have it cause issues? Of course, I know some people do have lactose intolerance too. | Good observation! Gene coding for the lactase Gene LCT Mammals have a gene (called LCT C/T-13910 ) coding for the lactase enzyme, a protein able to digest lactose . Lactose is a disaccharide sugar found in milk. Expression of LCT In mammals, the gene LCT is normally expressed (see gene expression ) only early in development, when the baby feeds on his/her mother's milk. Some human lineages have evolved the ability to express LCT all life long, allowing them to drink milk and digest lactose at any age. Today, the inability to digest lactose at all ages in humans is called lactose intolerance . Evolution of lactose tolerance in human Three independent mutations Tishkoff et al. 2007 found that the ability to express LCT at an old age has evolved at least three times independently. Indeed, they found three different SNPs (stands for Single Nucleotide Polymorphism; it is a common type of mutation), two of them having high prevalence in Africa (and people of African descent) and one having high prevalence in Europe (and people of European descent). The three SNPs are G/C-14010 , T/G-13915 and C/G-13907 . Pastoralist populations Lactose tolerance is much more common in people descending from pastoralist populations than in people descending from non-pastoralist populations, suggesting a strong selection for lactose tolerance Durham 1991 . Selective sweep On top of that, Tishkoff et al. 2007 focusing on the locus 14010 (one of the three SNP's mentioned above) showed that there is a clear selective sweep (which is a signature of past and present selection) around this locus . They estimated the age of the allele allowing lactose tolerance at this locus (allele C is derived, the ancestral being G ; see nucleotide ) at around 3,000 to 7,000 years (with a 95% confidence interval ranging from 1,200 to 23,200 years) and a selection coefficient of 0.04 - 0.097 (with a 95% confidence interval ranging from 0.01 to 0.15). I recommend reading Tishkoff et al. 2007 . It is a classic, is short and is relatively easy to read, even for someone with only basic knowledge in evolutionary biology. Are humans the only animal that is able to drink milk as adults? I don't really know... but I would think so, yes! Drink vs digest thoroughly As @anongoodnurse rightly said in his/her answer "Drink" and "digest thoroughly" are two different things Pets According to many dog health websites (such this one for example) claim that there is also variance among dogs where some dogs are lactose tolerant and others are lactose intolerant. I could not find any paper on the underlying genetics of lactose intolerance in dogs or other pets. It is not impossible our pets have also been under selection to be able to digest lactose as we humans could have given milk to them. It is also possible that pets do not actually produce any lactase at adult age but rather that some pets are just able to deal with having indigestible lactose in their guts! But then again, "Drink" and "digest thoroughly" are two different things . Tits and robins in 20th century England A funny and famous case is the case of blue tits and robins in the 20th century, in England. At that time, in England, the milkman was bringing the milk at home in the morning and would leave glass bottles with a simple aluminum cap in front of people's home. At some point, blue tits and robins learnt that by pecking through the aluminum they can get access to the milk. See this (non-peer-reviewed) article that tells the story. Somewhat related There are already a number of good posts on milk digestion in humans on Biology.SE. Consider having a look at: What inactivates pepsin in infants? and Seriously, do humans produce rennin? Are there any non-mammalian species known that lactate? Can an adult without genetic lactase persistence still develop a tolerance for dairy foods? | {
"source": [
"https://biology.stackexchange.com/questions/64822",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/35749/"
]
} |
65,273 | Most human cancers are not (very?) contagious (perhaps besides a couple of incidents). But the Tasmanian devil seems to have a form of cancer which is contagious. Now what makes the difference between a contagious cancer and a non contagious cancer in the DNA mutations of a cell? | There are two relatively common contagious cancers: Tasmanian Devil Facial Tumor , and Canine Transmissible Venereal Tumor . Both are truly contagious cancers, in that the cancer cells themselves are transmitted from one host to the next, and expand and cause disease in each successive host. (There was also a contagious cancer of hamsters, which has long since gone extinct, and there are some transmissible tumors in clams and oysters; the latter don't have immune systems that are remotely similar to dogs, Devils, or humans.) It's believed that one key aspect of the Devil Facial Tumor is that Tasmanian Devils are immunologically closely related. Normally, cancer cells from one host would be a tissue graft in a different individual and would be rapidly rejected as with any allograft. However, immunologically closely related individuals can tolerate each others' grafts, and it's believed that this is part of what allows the Devil tumor to spread -- a lack of genetic diversity among Tasmanian Devils. Major histocompatibility complex class I and class II genes have extremely low levels of sequence divergence in the devil population from the Tasmanian east coast (Siddle et al., 2007a, 2007b). ... The lack of diversity at MHC loci, coupled with weak responses of east coast devils to allogeneic mixed lymphocyte culture, has led to the suggestion that this population may be functionally identical at MHC loci, thus permitting the spread of DFTD as an allograft. -- Clonally transmissible cancers in dogs and Tasmanian devils The genetic diversity explanation is widely accepted, but it hasn't been formally proven and there are a number of points that suggest that it isn't the whole story. There are several other molecular features of the tumor that probably make it less immunogenic (see the review The role of MHC genes in contagious cancer: the story of Tasmanian devils ) and the full story probably involves a combination of these things. CTVT is different. It's astonishingly ancient (it apparently arose in a dog, or a wolf, 11,000 years ago and has been passed from dog to dog continuously since), so it's obviously very successful at what it does, but it's not at all understood how it does it. Dogs are genetically pretty diverse and definitely don't tolerate arbitrary grafts from each other, so that's not the explanation. Lots of other possible explanations have been put forward, most of which point to various immunological features of the tumor; however, while that's clearly an important point, none of the things people have implicated are unique to CTVT -- tumors invariably have immune suppressive abilities and don't have the same ability to spread. (Going back to the Devil tumors, the low expression of MHC molecules on the cancer cells is probably a factor there too, but it's important to understand that low MHC expression is almost universal among tumors , including the vast, vast majority that can't transmit.) Summary: There do exist a very small number of truly contagious cancers. The reasons for their transmissibility are not fully understood. Genetic diversity and immune evasion are probably two of the causes. | {
"source": [
"https://biology.stackexchange.com/questions/65273",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/21595/"
]
} |
65,955 | While walking back from our routine evening stroll through the hills, we stumbled upon some insect(?). It was the size of an index finger, and it appeared to have some sort of wings. While I tried to take pictures of it, it started turning towards me with it 'claws'. Additional info: Origin: Romania, in the hills Date/time: 17 August 2017, 19:15, sunset Warm sunny day, just started to cool down, 19 degrees celcius My wife doesn't want to go outside anymore unless she knows what it is, and she won't allow me to go and pet it. | That's some kind of mole cricket (Gryllotalpidae). According to this website there's only three species found so far in Romania: Gryllotalpa gryllotalpa Gryllotalpa stepposa Gryllotalpa unispina It's most likely you've encountered a specimen of the first species as it's the most common and widespread one in Europe, Gryllotalpa gryllotalpa : | {
"source": [
"https://biology.stackexchange.com/questions/65955",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/36578/"
]
} |
66,019 | Excuse my ignorance but I've always been curious about this... For example, a frog is red, but it starts living in a green forest. Over time the frog becomes green to camouflage. But a gene can't see and I'm sure there's no mechanism for color info to be transmitted to individual genes from the brain. So how does a gene know to pick green over, say, blue? | Using your example, the gene doesn't know anything. Mutations cause some of the offspring of the red frog to turn green, some to turn blue, some to turn fluorescent yellow, and some stay red. Birds can't see the green ones as well as the others, so more green frogs survive and make more green frogs. The red frogs, the fluorescent yellow ones, the blue ones, mostly get eaten. After a few generations, almost all the frogs are green -- not because the gene knew anything, not because the mutations went in any direction, but because all the other changes were counterproductive and got eaten. The gene doesn't know anything. It's just a bunch of chemicals that randomly react with cosmic rays, chance, whatever. Most of the changes are irrelevant or actively bad, and the frog that's carrying those particular chemicals doesn't survive. But sometimes the change benefits the frog carrying the particular chemicals and then the frog sends those chemicals down to its progeny. Obviously this is hugely over-simplified. A short and simple intro to the basics of evolution is Understanding Evolution , by UC Berkeley. | {
"source": [
"https://biology.stackexchange.com/questions/66019",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/36637/"
]
} |
66,664 | Edit: This question is very similar to this and related to this one (though the latter focuses on homology instead of scaling laws). However, the answer to this question is far more comprehensive , in particular it offers a plausible explanation why horse legs evolved as they did (vs human or even rhino legs). Large grazing mammals such as horses, moose, and cows tend to have relatively thin legs despite being up to ~1000kg. For example, this rider's and her horse's legs appear to have about the same cross-sectional area both for below and above the "knee": If this horse is 500 kg (a mid-range mass for horses), each leg would have to support 125 kg, compared to only 37.5 kg for a 75 kg adult. Why don't we see a corresponding difference in cross-section? | Elephant, rhinoceros, &c all have much thicker legs in proportion. The answer, I think, lies in the fact that the animals you mention all evolved as cursorial animals (that is, they run to escape predators). Less mass in the lower leg means it swings easier, so the animal can run faster. There are two things you're apparently not noticing in that picture. First, the the horse's lower leg is almost entirely bone (and some tendon), and it's bone that does the supporting. The propulsive power comes from the large muscles of the hip, thighs, and shoulders. Second, the lower part of the leg (with the white wrappings) is not anatomically equivalent to the human's lower leg, but to the bones of the hand and foot. You can see this if you look closely at the rear leg in that picture. The femur, equivalent to the human's thigh, ends at the knee just above the belly line. Then the tibia extends about halfway down, ending at another joint which you might think is the knee, but which is called the 'hock' in horse-speak. The white-wrapped part is a metatarsal, equivalent to human foot bones, then there pastern bones equivalent to human toe bones, ending in the hoof/toenail. So consider that you can, if reasonably fit, walk around on tiptoe without crushing your foot and toe bones, then imagine the end result of your ancestors having done this for the last several tens of millions of years :-) PS: With horses, there is some effect from human selection, too. Racing & show breeds tend to have thin lower legs, draft horses & working breeds have proportionately thicker ones. My first horse, a thorobred/arab mix, had legs about as thick as my wrists (granted, I'm a fairly muscular guy); my current mustang, about the same height & weight, has legs about twice as thick. | {
"source": [
"https://biology.stackexchange.com/questions/66664",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/4321/"
]
} |
67,227 | I've been checking life expectancy figures for men versus women in many countries of the world and the figures for men sometimes are terrifying. Countries like Russia have a 12 years gap in disfavor of men. Developed countries have usually a 4-5 years gap in disfavor of men. My country Argentina has a 7 years gap. African countries and middle east countries where supposedly women have a harder life because of religion have usually a 3 years gap in disfavor of men. So far I haven't found a single country where men lives more than women. Now I know there are more men than women who dies in homicides, suicides, work accidents, wars, etc. men are more likely to get addictions because of depression, etc. but aside of all that, is there any biological reason why men lives less than women everywhere? | There are both biological and social factor for that: Biological Females have two X chromosomes. When mutations in genes of the X chromosome occur, females have a second X to compensate. Males, on the other hand gave just one chromosome X and all genes its genes express themselves, even those lethal or deleterious. Females have better resistance to biological aging and hormones and the role of women in reproduction are known to be associated to greater longevity (e.g. estrogen offers some protection against heart disease because it facilitates elimination of bad cholesterol while testosterone has been linked to violence and risk taking). The female body evolved to accommodate the needs of pregnancy and breast feeding hence deals better with making reservation. This ability has been linked to a female's better ability to cope with overeating and eliminating excess food Social This "advantage" women seem to have was once nullified by the status and life conditions they had back then, as the risks and the burden of pregnancy and the lack of attention to health and rights women had in a way more misogynist world. Given the economic, social and political changes that the world experienced, a general progress in female life conditions took place and women have not only regained their biological advantage, but have gone beyond it, achieving higher life expectation. Social and comportamental factor are involved in this higher longevity: Women tend to engage in fewer risky and bad for health behaviors than men do, e.g. men have more problems than women with alcoholism, smoking and road accidents. The world is still very sexist and the gender roles to be played would expose men to higher risks. Regarding to work, for instance, although women nowadays participate in the work force, their professional activities remain different and are less prejudicial to their health (on average). Also regarding to very sexist gender roles, men are expected to be strong and manly and powerful and women are expected to be gracious young and beautiful. As a result of that, women are more attentive to their body and health, engage themselves in more healthy activities and benefit more from medicine and science. Men on the other hand submit their bodies to challenges from early ages and tend to neglect their bodies needs. You can have access to detailed statistics (male/female, country by country, life expectancy and other health data) here: http://www.who.int/gho/publications/world_health_statistics/2016/Annex_B/en/ And also, read more about the issue here: https://www.scientificamerican.com/article/why-is-life-expectancy-lo/ http://www.who.int/mediacentre/news/releases/2016/health-inequalities-persist/en/ https://en.wikipedia.org/wiki/List_of_countries_by_life_expectancy#cite_note-10 | {
"source": [
"https://biology.stackexchange.com/questions/67227",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/38948/"
]
} |
68,327 | Male and female brains are wired differently according to this article : Maps of neural circuitry showed that on average women's brains were highly connected across the left and right hemispheres, in contrast to men's brains, where the connections were typically stronger between the front and back regions. But since learning in the brain is associated with changes of connection
strengths between neurons, this could be or not the result of learning.
What about physical differences from birth? Are there differences in size, regions, chemical composition, etc. from birth? | Short answer Yes, men and women's brains are different before birth. Background First off, learning effects versus genetic differences is the familiar nature versus nurture issue. Several genes on the Y-chromosome , unique to males, are expressed in the pre-natal brain. In fact, about a third of the genes on the Y-chromosome are expressed in the male prenatal brain (Reinius & Jazin, 2009) . Hence, there are substantial genetic differences between male and female brains. Importantly, the male testes start producing testosterone in the developing fetus. The female hormones have opposing effects on the brain as testosterone . In neural regions with appropriate receptors, testosterone influences patterns of cell death and survival , neural connectivity and neurochemical composition . In turn, while recognizing post-natal behavior is subject to parenting influences and others, prenatal testosterone may affect play behaviors between males and females, whereas influences on sexual orientation appear to be less dramatic (Hines, 2006) . The question is quite broad and I would start with the cited review articles below, or if need be, the wikipedia page on the Neuroscience of sex differences . References - Hines, Eur J Endocrinol (2006); 155 : S115-21 - Reinius & Jazin, Molecular Psychiatry (2009); 14 : 988–9 | {
"source": [
"https://biology.stackexchange.com/questions/68327",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/38948/"
]
} |
69,069 | The following commentator writes : Chili peppers don’t taste as hot in space as they do on Earth. Nobody knows why. We know that the 'hot' feeling of chilli peppers is caused by Capsaicin . We read : Capsaicin inside the pepper activates a protein in people’s cells called TRPV1. This protein’s job is to sense heat There appears to be some question about the cause of the 'spicy' taste of chilli peppers. My question is: What is the reason that chilli peppers don't taste as hot in space? | TL;DR All food taste bland in space, not only chilli. The claim in that tweet ( "Chili peppers don’t taste as hot in space as they do on Earth" ) is not exactly correct because, the way it's worded, it gives the impression that only chilli peppers have a different taste. In fact, astronauts/cosmonauts use more chili and other spices than they regularly do on Earth, for a reason: they say that food in space (microgravity) taste bland. All food, not only chili. Since the beginning of space flight, astronauts report that food taste different in microgravity. According to the Scientific American article When It Comes to Living in Space, It's a Matter of Taste (Romanoff and Romanoff, 2017): Many said that flavors are dulled and they crave fare that is spicier and considerably more tart than they would prefer on Earth. So, due to the food tasting so bland, astronauts in fact use more chili and other spices than they normally do on Earth: It's possible that hot sauce and salsa could be key ingredients to the success of a manned mission to Mars. The kicked-up condiments already came close to causing a mutiny on the International Space Station (ISS) in 2002 when astronaut Peggy Whitson threatened to bar entry to the crew of the visiting shuttle Atlantis unless they came bearing a promised resupply of the spicy stuff. Only when shuttle commander Jeff Ashby announced that he had the goods did Whitson say, "Okay, we'll let you in then." Whitson was joking, but the need for astronauts to be able to spice up their food while in orbit is no laughing matter. However, it's still unknown why food taste bland in microgravity. Also, there is no consensus about that fact, to start with: There's little scientific data to back up astronauts' claims that taste changes in space, despite a number of studies since the 1970s on the effect of microgravity on the sense of taste and smell. In essence [...] study participants were split on the matter. For those that report a change in the taste, some hypothesis were proposed: One of the most prominent physiological changes associated with spaceflight has to do with fluid shifting from the lower to the upper parts of the body because of weightlessness. This facial and upper-body swelling also creates significant nasal congestion, and because odor is essential to the sense of taste, a decrease in the perception of flavors would occur. And also: The shuttle has a "sterile" smell, which when combined with other odors, such as the scent of their rinse-free shampoo, can be somewhat distracting. However, there is little scientific evidence supporting this fluid-shifting hypothesis. According to Vickers et al. (2001), reproducing that fluid-shift in a simulated microgravity, where people had a head-down bed rest, has no effect on the threshold sensitivity of tastants. The same lack of changes in the taste and smell sensitivity under simulated microgravity was found by Olabi et al. (2002). Despite that, this fluid-shifting hypothesis is supported by NASA (Nasa.gov, 2017) in an educational resource for kids: From the early 1960s, astronauts found that their taste buds did not seem to be as effective when they were in space. Why does this happen in space? This is because fluids in the body get affected by the reduced gravity conditions (also called fluid shift). On Earth, gravity acts on the fluid in our bodies and pulls it into our legs. In space, this fluid is distributed equally in the body. This change can be seen in the first few days of arriving in space when astronauts have a puffy face as fluid blocks the nasal passages. The puffy face feels like a heavy cold and this can cause taste to be affected in the short term by reducing their ability to smell. The same source says: When food seems to lose its flavor, astronauts usually ask for condiments, such as hot sauces, to give food some intensity of taste . A variety of condiments are available for the crewmembers to add to their food such as honey, and sauces like soy sauce, BBQ, and taco. (emphasis mine) Conclusion For reasons yet unknown, it seems that all food (not only chilli peppers) taste bland in microgravity. To cope with that, astronauts rely on chili and other hot spices. Sources: Romanoff, J. and Romanoff, J. (2017). When It Comes to Living in Space, It's a Matter of Taste. [online] Scientific American. Available at: https://www.scientificamerican.com/article/taste-changes-in-space/ [Accessed 26 Dec. 2017]. Nasa.gov. (2017) [online] Available at: https://www.nasa.gov/sites/default/files/files/Taste-in-space-TLA-FINAL.pdf [Accessed 26 Dec. 2017]. VICKERS, Z., RICE, B., ROSE, M. and LANE, H. (2001). SIMULATED MICROGRAVITY [BED REST] HAS LITTLE INFLUENCE ON TASTE, ODOR OR TRIGEMINAL SENSITIVITY. Journal of Sensory Studies, 16(1), pp.23-32. Olabi, A., Lawless, H., Hunter, J., Levitsky, D. and Halpern, B. (2002). The Effect of Microgravity and Space Flight on the Chemical Senses. Journal of Food Science, 67(2), pp.468-478. | {
"source": [
"https://biology.stackexchange.com/questions/69069",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/5417/"
]
} |
69,304 | I've always wondered why cells have only one nucleus, as having multiple would seemingly prevent mutation. Are there examples of organisms with multiple nucleuses? If not, is there a reason? | Are there examples of cells with more than one nucleus? Yes, they are called Multinucleate cells . There are two types of multinucleated cells Syncytia Coenocytes I highly recommend having a look at this answer for the definitions. Examples of Syncytia include Osteoclasts Skeletal muscle fibers (thanks @kmm) Examples of Coenocytes include Codium (Thanks @GerardoFurtado; see picture below) Blastoderms early in the development of a fruit fly Are there examples of organisms with multiple nucleuses? Side note: The plural of nucleus is nuclei In many fungi, during sexual reproduction, a fusion of cytoplasm happen early in the mycelium but a fusion of the nucleus happens only very late (just before sporulation). This is a type of Coenocytic mycelium. In these species, non-negligible fractions of their cells are multinucleated. There are endosymbiotic and endoparasitic eukaryotes in other eukaryotes that would result in a cell containing several nuclei but that would not count I would guess as the nuclei belong to different species. Picture of Codium. The entire algea is a single multinucleated cell. | {
"source": [
"https://biology.stackexchange.com/questions/69304",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/31498/"
]
} |
71,312 | Is there a point where too much CO 2 is bad for a plant? Basically when there is too much CO 2 in the air can a plant get sick? Since plants photosynthesize and need CO 2 to generate glucose and store starch, and since chemical reactions are pushed toward their end product when the reagent concentrations are increased, one would expect that more CO 2 would be better, at least lead to increased growth and survival rates. Is there a ceiling where CO 2 gets toxic? | Short answer It has been shown that plants may already suffer from doubling the atmospheric CO 2 concentration from 340 to 610 ppm, something that might happen during the next hundred years or so based on current emissions. Background A popular science website tells us that an excess of carbon dioxide (CO 2 ) reduces the rate of transpiration of some plants. This is so because the stomata , which are the openings of the leaves (Mansfield & Majernik, 1970) and used for exchanging gases as well as water vapor (transpiration) will close when there is too much CO 2 in the air, or other polutants such as SO 2 . As transpiration drops, the water flow from the soil to the leaves also drops, causing a runoff of water.This in turn stalls nutrient uptake. Indeed, doubling the present-day CO 2 concentration to 610 ppm does not necessarily lead to increased growth and may in fact inhibit growth due to excess starch formation in the leaves, indicating it's simply stored as backup energy, nothing else (Coviella & Trumble, 1999) . It is believed that plants might be near their saturation point and cannot eliminate CO 2 faster than they are doing right now. Somehow plants also become more susceptible to insect foraging when CO 2 concentration increases. Note however, that CO 2 tolerances are species dependent. Most research in this arena has focused on common crops. CO 2 tolerance in for example cotton plants is low, and starch buildup has been observed in the entire plant, but especially in the root systems and the stem (Hendrix et al ., 1994) . Other species, such as wheat and rice are less prone to effects of elevated CO 2 (source: Nature ). References - Coviella & Trumble, Conservation Biology (1999); 13 (4): 700–12 - Hendrix et al ., Agricult Forest Meteorol (18994); 70 (1–4): 153-62 - Mansfield & Majernik, Environmental Pollution (1970); 1 (2): 149-54 Source - Earth untouched | {
"source": [
"https://biology.stackexchange.com/questions/71312",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/40997/"
]
} |
71,641 | Is LSD broken down into other compounds by enzymes or hormones? If so, at what point and where in the body does this happen? I researched several papers appearing in a google search , but unfortunately I did not understand most of it. | Short answer LSD appears to be enzymatically broken down in the liver. Background First off, hormones do not break down anything; enzymes are the work horses that mediate metabolism. According to a review paper (Passie et al ., 2008) , humans metabolize LSD into structurally similar metabolites (Fig. 1) by NADH-dependent microsomal liver enzymes to the inactive 2-oxy-LSD and 2-oxo-3-hydroxy LSD. LAE is formed through enzymatic N-dealkylation of the diethylamide
radical at side chain position 8. Di-hydroxy-LSD and nor-LSD are also metabolites, as well as 2-oxo-LSD, 13- and 14-hydroxy-LSD as glucoronides, lysergic acid ethyl-2-hydroxyethylamide (LEO), and trioxylated LSD. Note that the monoamine oxidase (MAO) system is unlikely to break down LSD. MAO are enzymes that catalyze the oxidation of monoamines . Monoamine neurotransmitters contain one amino group that is connected to an aromatic ring by a two-carbon chain (such as -CH 2 -CH 2 -). This structure is not present in LSD (fig. 1). A cursory Google Scholar search did not yield any relevant hits ('LSD' + 'monoamine oxidase'), loosely indicating that MAO is unlikely to be involved in LSD metabolism. However, as I suspect some self-help here - I am unsure about MAOI and LSD interactions, and I highly discourage any toying around with MAO inhibitors and any drug in general. For example, 5-HT is a typical example of an MAO substrate and LSD impinges on 5-HT 2A receptors. Hence, interactions in pharmacodynamics with combined LSD and MAOI intake are likely to occur. Fig. 1. LSD metabolites. source: Passie et al . (2008) Reference - Passie et al ., CNS Neuroscience & Therapeutics (2008); 14 : 295–314 | {
"source": [
"https://biology.stackexchange.com/questions/71641",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/41274/"
]
} |
72,388 | I'm currently in the middle of writing a story, and one of the story elements threw up a question for me. In this story, there are two siblings, who are only one or two months apart in age. As they grow older, they start to question how this age difference is even possible. How could their mother have had another child after just a month of giving birth to the first child? They suspect that they're not related and don't actually have the same mother, and it turns out that it's true. I want to know if that suspicion is justified. I began to think of ways two siblings can be less than the usual nine months apart in age and yet still be related to each other. One idea I had was of twins, one of whom is born earlier, while the other had to stay inside the womb for another month for whatever medical reason. Basically, my question is: can you have siblings (with the same mother and father), who are less than nine months apart in age? And if yes, how? | What do you mean by siblings? If by siblings, you accept cases of individuals having the same father but not the same mother, then of course, it is possible! Below, I will assume you are referring to full siblings (eventually twins). Age gap between twins According to the huffingtonpost , there is a case of two twins that were born 87 days apart. On average, the age gap between two twins is rather of the order of 15 minutes ( Rayburn et al., 1984 ). Cousins that "look like" full sibs Imagine family A has a pair of homozygotic twin daughters. Family B has a pair of homozygotic twin sons. If the sons of family B mate with the daughters of family A, then the offspring will be cousins but will have a relatedness of two full siblings. One can of course extend this kind of crazy scenario to any number of generations apart. Superfetation I discovered the concept of superfetation in @froimovi's answer . From wikipedia Superfetation (also spelled superfoetation and superfœtation – see fetus) is the simultaneous occurrence of more than one stage of developing offspring in the same animal. It is not believed that it occurs naturally in humans. There have been 10 reported cases of possible superfetation in humans. As @1006a rightly pointed, the two babies might well be delivered during the same labour though. If they are delivered during the same labour, then they will have the same age counting from birth but different age counting from the time of fertilization. Uterus didelphys See @Bakuriu's answer ! Human intervention Other alternatives would require some human intervention. For example, fertilization could have happened in vitro and the eggs were implanted in two different wombs. One womb could be a surrogate mother and the other one could be either another surrogate mother or the woman who actually donated the ovules. Plenty of cloning techniques could yield two full siblings to be less than two months apart. Also, techniques of ex utero pregnancy could be used (although I am not sure we have the technology ready for that). Note that human cloning is illegal in many countries. | {
"source": [
"https://biology.stackexchange.com/questions/72388",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/-1/"
]
} |
72,914 | I found two of these objects near a creek in Missouri. They feel like they are made out of bone but they do not look like any bone I have seen before. They also appear as though the could be some sort of plant part. I am having a very difficult time identifying them and any help would be appreciated. | Those are isolated turtle bones : Specifically, they are part of the carapace, or upper shell. The projections would articulate with the backbone. The "toothlike" structure at the other end projects down toward the margin of the shell. Based on the size, and the fact that you are in Missouri, I'm guessing they are snapping turtle bones. Here's a photo of the inside of a snapping turtle shell : They are a little hard to make out, but you can faintly see the marginal projections. | {
"source": [
"https://biology.stackexchange.com/questions/72914",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/6635/"
]
} |
72,917 | I have came across a few genes that show different nucleotide sequence in different databases. I then found out that the sequences are actually reverse complement of each other. How do i determine which is the actual nucleotide sequence of a gene,and not the reverse complement version of it? | Those are isolated turtle bones : Specifically, they are part of the carapace, or upper shell. The projections would articulate with the backbone. The "toothlike" structure at the other end projects down toward the margin of the shell. Based on the size, and the fact that you are in Missouri, I'm guessing they are snapping turtle bones. Here's a photo of the inside of a snapping turtle shell : They are a little hard to make out, but you can faintly see the marginal projections. | {
"source": [
"https://biology.stackexchange.com/questions/72917",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/40273/"
]
} |
73,866 | Is it possible to kill yourself by holding your breath? This question is obviously copied from Quora , but I had heard it as a fact that we cannot kill ourselves by holding our breath and I'm looking for a referenced answer. | Short answer Healthy people cannot hold their breaths until unconsciousness sets in, let alone commit suicide. Background According to Parkes (2005) , a normal person cannot even hold their breath to unconsciousness, let alone death. Parkes says: Breath‐holding is a voluntary act, but normal subjects appear unable
to breath‐hold to unconsciousness. A powerful involuntary mechanism
normally overrides voluntary breath‐holding and causes the breath that
defines the breakpoint. Parkes explains that voluntary breath‐holding does not stop the central respiratory rhythm. Instead, breath holding merely suppresses its expression by voluntarily holding the chest at a certain volume. At the time of writing, no simple explanation for the break point existed. It is known to be caused by partial pressures of blood gases activating the carotid arterial chemoreceptors . They are peripheral sensory neurons that detect changes in chemical concentrations, including low oxygen (hypoxia) and high carbon dioxide (hypercapnia). Both hypoxia and hypercapnia are signs of breath holding and both are detected by the chemoreceptors. These receptors send nerve signals to the vasomotor center of the medulla which eventually overrides the conscious breath holding. The breaking point can be postponed by large lung inflations, hyperoxia and hypocapnia, and it is shortened by increased metabolic rates. Reference - Parkes, Exp Physiol (2006); 91 (1): 1-15 | {
"source": [
"https://biology.stackexchange.com/questions/73866",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/42048/"
]
} |
74,887 | Typically, people call viruses some kind of organic compounds that cannot reproduce autonomously and which lower the fitness of their hosts. Even the word "virus" means "venom" in Latin. But from the perspective of natural selection, one would expect those organic compounds that cannot reproduce autonomously, but which would increase the fitness of their hosts, to be more widespread. One can see an analogy with bacteria: people are more aware of harmful bacteria and even such words as "microbe" are perceived as somewhat harmful (among non-biologists for sure). But we know that an animal body contains many more useful bacteria than harmful ones, and animals have their own microflora, which are necessary for survival. The same must be true for viruses: those viruses which were useful (or at least unharmful) to their hosts would be passed more easily to other organisms since their hosts would have a selective advantage. So, do such beneficial for their direct hosts viruses exist? If so, what are they called? What are the examples? | Do they exist? Yes What are they called? Marilyn Roossinck calls them viral mutualistic symbiotes. She has an excellent review here . What are some examples? My personal favorite is GB-Virus C, or Hepatitis G , which appears to slow the progression of HIV using a number of different mechanisms: Box 1. Summary of the effects of GBV-C infection in HIV-positive individuals GBV-C infection downregulates HIV entry co-receptors CCR5 and CXCR4, and increases secretion of their ligands RANTES, MIP-1α, MIP-1β and SDF-1. In vitro GBV-C NS5A and E2 proteins inhibit X4- and R5-tropic HIV replication, and NS5A protein downregulates CD4 and CXCR4 gene expression. HIV-infected individuals positive for GBV-C E2 antibodies have survival benefit over HIV-infected individuals with neither GBV-C viremia nor E2 antibodies; in vitro GBV-C E2 antibodies immunoprecipitate HIV particles and inhibit X4- and R5-tropic HIV replication. GBV-C induces activation of interferon-related genes and pDCs. GBV-C promotes Th1 polarization and the NS5A protein contributes to this effect. GBV-C infection reduces surface expression of activation markers on T lymphocytes, suggesting its role in T cell activation signaling pathways. GBV-C protects the T cell from Fas-mediated apoptosis and as a result of its effect on immune activation may also play a role in protecting lymphocytes from activation-induced cell death. GBV-C viremia reduces IL-2-mediated T cell proliferation suggesting a significant interaction between GBV-C, IL-2 and IL-2 signaling pathways. Endogenous retroviruses As @mbrig recalls in the comments, there are a number of retroviruses that have inserted themselves into the germ line. Those are called endogenous retroviruses , and they interact with the host genome in a number of ways. Some are even translated: Proteins produced from ERV env genes have also been demonstrated to function as restriction factors against exogenous retroviral infection | {
"source": [
"https://biology.stackexchange.com/questions/74887",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/36486/"
]
} |
76,096 | Many times have I heard that anti-vaccine people are dangerous even to the vaccinated population. Is that true? If so, how can it be? People say that germs will attack them, and soon they would eventually grow and spread even toward general population which actually got its vaccines. I mean it's so counter-intuitive: if I'm vaccinated even when disease will spread I shouldn't be in danger. | Biology is rarely black or white, all or nothing. Protective immunity is generally not an on/off switch, where from the moment you're vaccinated you're infinitely resistant for the rest of your life. You shouldn't expect that, having received a smallpox vaccine, you could have billions of smallpox viruses squirted directly into your lungs and shrug it off without noticing. Given that (fairly obvious) fact, you should immediately think of scenarios where vaccinated people are still at risk of disease following exposure to unvaccinated people. What about older people who were vaccinated 20 years ago, 50 years ago? What about people whose immune systems are slightly weakened through lack of sleep or obesity or stress? Any of these vaccinated people might well be protected against a brief encounter, but not against, say, being in an airplane seat for 18 hours beside an infected child shedding huge amounts of virus, or caring for their sick child. It's all sliders, not switches. You can have a slight loss of immunity (4 hours sleep last night) and be protected against everything except a large exposure (your baby got infected and won't rest unless you hold him for 8 hours). You can have a moderate loss of immunity (you were vaccinated twenty years ago) and be protected against most exposures, but you're sitting next to someone on the subway for an hour. You may have a significant loss of immunity (you're a frail 80-year-old) and still be protected against a moderate exposure, but your grandchild is visiting for a week. | {
"source": [
"https://biology.stackexchange.com/questions/76096",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/44906/"
]
} |
76,852 | Yesterday I had a BBQ with some friends. The sun had already set and the only light source left (besides some ambient light from the world around) was a low energy light bulb. After a while I started to see lighting changes in the faces of my friends and the number plates of their cars. It felt like someone toggled the light very fast. When looking at the wall or the light directly I didn't notice any flickering. In my country the power grid is running at 50 Hz. Is it possible that I actually saw the flickering caused by the alterations in the power grid or am I just going insane? | Short answer Yes, the flickering of a light bulb may be noticeable, and yes, that's directly related to the mains frequency. However, since the flickering of a bulb is about two times higher than the temporal limits of our visual system, it is unlikely to be perceivable. Background The temporal resolution of the visual system can be quantified in a number of ways. As you are referring to a relatively simple flickering stimulus, the critical flicker fusion frequency is probably the most relevant. At a certain critical frequency, a flickering stimulus will appear as a continuous stimulus. This critical flicker fusion frequency limit is around 50 Hz, but variable between 5 - 50 Hz, dependent on the lighting conditions (Kalloniatis & Luu) , see Fig. 1 below. For example, the turn signal of a car is obviously flickering (flickering in the 1 Hz region). But an object displayed on a standard flat-screen computer seems steady. A monitor's refresh rate is typically 60 Hz, which is indeed above the critical flicker fusion frequency (Holcomb, 2009) . However, the good old CRT screens can sometimes seem to be flickering. The mains, as you indicate, is indeed 50 Hz (Europe, Australia) or 60 Hz (US), and indeed the flickering is at this frequency. Similarly, well functioning fluorescent tubes seem to flicker on occasion (when they are reaching their end they start to flicker too, but that's because of a failure of the device rather than the mains frequency peaking through). Due to a similar effect, light bulbs may seem to flicker too. However, because of the sine wave characteristic of the mains alternative current, featuring two peaks per wavelength (a negative and positive peak, the flickering of a light bulb is actually two times the mains frequency , or 100 - 120 Hz. This is quite far above the critical flicker fusion limit and hence will likely not be noticeable. It's interesting to see that you mention that it was around sunset. Scotopic vision (night vision) is mediated mainly by the rod photoreceptors. The rod visual system mediates gray scale vision at low-lighting. While spatial resolution is poor, it's very well adapted to process fast-moving stimuli. Hence, the flicker fusion frequency under scotopic viewing conditions may indeed be higher; i.e. , flickering of light bulbs may not be perceived during the day (Federov & Mkrticheva, 1938) . Nice add-on there. To add to this as alluded to in the comments, whether the flicker of mains-grid powered appliances are actually visible depends on a lot of factors other than flicker frequency. CRT screens, for instance, may have improved phosphors that have delayed response times, 'smearing' out the flickering into invisibility. In other words, it's not a simple matter of 'ON' and 'OFF'. Likewise, light bulbs heat up and hence the temperature difference might not be noticeable to us, as the temporal flickering depends on heating and cooling of the wire. Fig. 1. Flicker fusion as a function of stimulus intensity. Note that the shape of this graph means that photopic vision is less sensitive to temporal changes; the intensity scale relates to the stimulus intensity, as alluded to in the other answer. Scotopic vision to promote the temporal resolution of vision in the sense mentioned in this answer alludes to the ambient lighting conditions conditions. source: Kalloniatis & Luu (2007) References - Federov & Mkrticheva, Nature ; 142 : 750–1 - Holcomb, Trends Cog Sci 2009 ; 13 (5): 216-21 - Kalloniatis & Luu, WebVision, chapter "Temporal Resolution" 2007 | {
"source": [
"https://biology.stackexchange.com/questions/76852",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/45546/"
]
} |
77,246 | Do oysters feel pain when you bite into the inside, or when you crack open the shell? I tried google searching it to no avail. When you bite inside the oyster or when you break the shell to open the oyster, does it feel pain? EDIT: (Since some people think that mine is a duplicate) I'm asking if the oysters feel pain when we eat the inside, or when we crack open their shell. To the least of my knowledge, ants and oysters have a different body so I don't know if they do feel pain. | There are fundamental problems with defining what it means for an animal to feel pain, especially when the animal is a life form as different from us as an oyster. I wasn't able to find any specific info online about oysters, but there is quite a bit of information that allows us to reason by analogy with related species. Oysters are molluscs, and molluscs do have brains and sensory systems, but their level of sophistication varies a lot. Cephalopod molluscs, such as squid, octopuses, and cuttlefish, have extremely sophisticated nervous systems, and it has been argued (Peter Godfrey-Smith, Other minds, 2016), that we should think of intelligence as having arisen twice on earth through parallel evolution: once in vertebrates and once in the cephalopods. Cephalopods have sophisticated communication systems, and they can use tools and solve problems. There has been extensive research on pain in cephalopods . So it's inherently pretty plausible that cephalopods can (in some difficult to define sense) suffer and feel pain, and by extension that their less advanced cousins the oysters can as well. However, the nervous system of an oyster is much more rudimentary than that of a cephalopod. A better analogy might be with snails, and there is some research on snails. They avoid damaging stimuli, have opioid systems, and respond to morphine and naloxone analogously to humans (e.g., showing less aversion to a hot plate when they've been dosed with morphine). So it seems likely to me that oysters can feel pain (for some reasonable definition of the word), but this whole area is one where people don't really know the answers to the questions or how to construct the philosophical foundations. | {
"source": [
"https://biology.stackexchange.com/questions/77246",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/45915/"
]
} |
77,587 | I am trying to make a point to someone that just because two plants share a family and one plant is safe for human consumption, it does not follow that the other plant also is safe for human consumption. Can anyone provide an example I can use as proof? | The most classic example if you want to win this argument would be the family Solanaceae . Also referred to as the Nightshade family, it includes the deadly nightshade or Atropa belladonna and many other plants not safe to eat. Other members of the family are tomatoes, peppers, potatoes, and more. Plant families can be massively diverse, and toxicity doesn't really have much relationship to family. Most of the compounds that are found in plants that are toxic are found in other non-toxic plants as well: dose is crucial. | {
"source": [
"https://biology.stackexchange.com/questions/77587",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/46225/"
]
} |
78,135 | Here is a question from the book SAT II Success Biology E/M (where the SAT is the exam taken by the American high school students): Which of the following statements is true about mutations? (A) Rates
tend to be very high in most populations. (B) generally lethal (C)
irreversible (D) Only certain gene locations are affected. (E) source
of genetic variation In my opinion, we can definitely eliminate A, B, and D. Then, I struggle between C and E since I think mutations are definitely a source of genetic variation but are as well generally irreversible (I've found evidence on different websites, including this http://hawaiireedlab.com/wpress/?p=154 where the author writes that only some mutations are reversible). In the end, I think I should have probably gone with E because C can be seen as having some exceptions. Then, here is the book explanation for this question: The correct answer is (C). These recent conclusions about
mutations—recall that Darwin did not know of mutations—are all the
reverse of those listed in the choices, with the exception of choice
(C), the correct answer. Rates, in fact, tend to be below in
populations, mutations are generally not lethal, any gene location can
be affected, and they are felt to be the source of genetic variation.
Darwin felt over-production of offspring was the source of potential
variation. The answer is C here. However, I didn't particularly understand why E wasn't considered a correct answer. Could you please explain why C, and not E, is correct? | Going through the possible answers (A) Rates tend to be very high in most populations. This is a very unclear statement. What does "high" mean? In humans, the average mutation rate per reproduction per nucleotide is of the order of $10^{-8}$ ( Rahbari et al., 2016 ) (hence of the order of 10 - 100 mutations for the whole genome). Whether someone wants to call that high or low is up to this person original intuition. (B) generally lethal No, that's wrong ( Robert et al., 2018 ) (C) irreversible It is a little unclear. By "irreversible", do they mean that the function of the gene (or of any other functional element in the genome) cannot be restored or do they mean that a specific mutation cannot be exactly undone by a future mutation. In both cases, however, it would be wrong! Mutations that restore the function of a gene (or any other genomic functional element) are called reverse mutations (aka. suppressor mutations ; I personally don't know of any difference between the concepts of reverse mutation and suppressor mutation). Most reverse mutations are likely to act via a second mutation that restores the function of the gene rather than undoing the previous mutation. It does not mean however that it is impossible a mutation that perfectly undoes a previous mutation. Consider a substitution inverting A into T . A reverse mutation could do just the opposite. (D) Only certain gene locations are affected. Mutation rate varies throughout the genome but all of the genome is subject to some non-zero mutation rate. (E) source of genetic variation Yes, mutations are the ultimate source of genetic variation in populations, while genetic drift and directional selection removes variation. As other users have highlighted in their answers, many mutations (incl. synonymous mutations but not only and soma mutations) do not bring up any the underlying genetic variance of phenotypic traits. These details are however mainly irrelevant; what matters is that it still remain true that (some) mutations increase genetic variance. We could also add the complication as to wonder whether by "genetic variance", they meant "genetic variance underlying phenotypic variance" (which is its standard usage) or "genetic variance where one allele is given an arbitrary value and another (problem arising for loci with more than 2 alleles segregating). More information about the terminology and the math when it comes to quantifying genetic variance in the post Why is a heritability coefficient not an index of how “genetic” something is? What I would have answered The correct answer is (C) . These recent conclusions about mutations—recall that Darwin did not know of mutations—are all the reverse of those listed in the choices, with the exception of choice (C), the correct answer. Rates, in fact, tend to be below in populations, mutations are generally not lethal, any gene location can be affected, and they are felt to be the source of genetic variation. Darwin felt over-production of offspring was the source of potential variation. I disagree. To me, B and D are wrong, A is unclear, C is slightly unclear but wrong in both interpretations I can think of and E is correct. I would have answered E . About the justification given Rates, in fact, tend to be below in populations [..] This piece of the sentence is not even grammatically correct. Below what? It highlights that A is unclear. they are felt to be the source of genetic variation The term "felt" is poorly chosen here IMO, but this piece of the sentence seems to rather give credit to answer E . I think, whoever wrote this answer mistakenly wrote C instead of E Darwin felt over-production of offspring was the source of potential variation. Really, who cares about Darwin thoughts on the subject here?! But in any case, this sounds like a misrepresentation of Darwin's ideas. More info can be found in Charlesworth and Charlesworth (2009) and also maybe this post | {
"source": [
"https://biology.stackexchange.com/questions/78135",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/35928/"
]
} |
78,422 | A parcel has been delivered and contaminated by a person who has the flu. For how long would the parcel be an effective disease vector? | How long should I wait before handling the parcel to avoid contracting the virus? If you use gloves, or don't touch your face and just wash your hands after opening, you don't have to wait at all. If you don't use gloves or want to pick your nose, rub your eyes, or fiddle with your beard while opening the package, wait 24 hours if the package is nonporous, and 2 hours if it is not. Generally, whether contaminated or not, don't lick, eat, inhale, or rub your eyes with the package :) Influenza and similar respiratory viruses are transmitted by large droplets, aerosols, and fomites . Your package is a fomite, an object that can be contaminated and transmit disease. There is some debate about what mode of transmission is most significant for influenza, but fomites definitely do transmit influenza and similar viruses. In a study of homes and daycare centers with children who had an active influenza infection, 59% of home objects that were tested were positive for influenza. It's reasonably likely that your package was, at least at some point, contaminated. @LDiago's answer is useful here, but deserves some clarification. The UK National Health Services information cited in that answer comes from this seminal study . I'm not entirely happy with the wording on the NHS website, though. Virus survives on nonporous surfaces for 24-48 hours. Virus is transferred from nonporous surfaces to hands in detectable amounts for 24 hours. If your package is paper, the relevant test is transfer from cloth or paper. Virus survives for 8-12 hours, and is measurably transferred to hands after 15 minutes to 2 hours. In any case, virus transferred to hands from a fomite survives for only 5 minutes. Infection from fomites, however, requires virus to be transferred from the fomite to (typically) the hand, and then from the hand to respiratory tract epithelium. Inoculation of nasal passageways is sufficient for infection in laboratory conditions. Conjunctival and oral inoculation may also play a role. You can read more about this in Cecil Medicine Ch. 372 and Murray Medical Microbiology Ch 59. | {
"source": [
"https://biology.stackexchange.com/questions/78422",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/31741/"
]
} |
78,792 | If a cancerous cell enters the body of a healthy person from someone else's blood or something, will that healthy person get cancer? In human beings. | Can a cancer cells from someone else's body cause cancer in a healthy person? No. Cancer cells from another person cannot cause cancer in a healthy person. The rare cases of transmissible tumors all involve unhealthy or not yet developed persons. Transmission of tumor cells from one individual to another happens, but is quite rare, and in all cases involves some compromise or reduced development of the immune system. Though tumor cells do metastasize in an individual, when this occurs, tumor seeds must be able to evade the immune system and find an environment suitable for adhesion and replication. Tumor associated cells (non cancerous cells that regulate the microenvironment to make it favorable for growth and replication) are discussed in this seminal paper on cancer biology by Hannahan and Weinberg . There are similarities to infectious processes, but cancer is not measles. Tumor cells don't shed in comparable numbers, aren't adapted for immune escape in a separate host, and don't express appropriate adhesion proteins for portals of entry on a new host or readily induce tumor associated niches in a new host. The cases where person-to-person transmission of cancer via tumor cell inoculation does occur seem to demonstrate more how cancer cells are not infectious agents. Donor-related tumors in transplant patients occur in immunosuppressed patients, but are still rare. The low frequency of transmission seems to be due, in part, to screening. The fact that we see this at all demonstrates the significance of transmission route and immune escape. Maternal-fetal, and in utero twin-twin seem to be exceedingly rare, but have occurred, again, demonstrating the existence, but poor efficiency of transmission. Here, the fetus has an undeveloped immune system. I would not consider this case to be cancer cells causing cancer in a healthy person. Inoculation of volunteers with tumor cells in a problematic series of experiments at Sloan Kettering in the 50s, transplantation of tumor cells into patients with other cancers, resulted in growth, recurrence after excision, and death in some cases. Transplantation into healthy volunteers (yes, they did this) resulted in nodules that spontaneously regressed. This experiment has since been interpreted as evidence for immune system control of transplanted tumor system in healthy individuals, as compared to growth and progression in a receptive niche in a cancer patient. So person-to-person transmission of cancer cells is rare and requires an immunosuppressed or undeveloped host, or a host who already has cancer. There are no documented cases of person-to-person transmission to a healthy individual, and documented cases of failed transmission despite a surgical attempt. This is because, unlike an infectious microbe, in a healthy individual, there is not a suitable receptor for adhesion at an exposed or accessible site, a suitable environment for replication, and adaptations for immune escape by tumor cells in the original host are not effective in a new host. As a side note, there are contagious cancers in other species, but this doesn't seem to be particularly relevant to a question about whether cancer can be transmitted between two humans. Many cancers have transmissible risk factors (e.g., human herpesvirus-8, hepatitis B and C viruses, human papilloma virus 16 and 18, and others) | {
"source": [
"https://biology.stackexchange.com/questions/78792",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/47054/"
]
} |
78,927 | In my textbook, it is written that the binomial name of mango is Mangifera indica and the binomial name of a bee is Apis indica . Now in the name the second part is the name of species. But mango and bee are not the same species. One is a tree and the o,ther is an animal. Then why is their second name the same? | In short, we do not think about the uniqueness of the second part of the binomial (the species epithet) but about the uniqueness of the binomial itself (the genus and the species epithet). Thus, the unique binomial of mango is Mangifera indica and the unique binomial of bee is Apis indica . For more detail, see this question . To complicate matters slightly, plants and animals are governed by different nomenclatural codes. So it is possible for a plant to have the exact same binomial as an animal. These are called "hemihomonyms." For more detail, see this question . However, a plant cannot have the same binomial as another plant, and an animal cannot have the same binomial as another animal. In this specific case, the authors probably chose to give both species the epithet indica because they are associated with the Indian subcontinent, which is the root of that word. | {
"source": [
"https://biology.stackexchange.com/questions/78927",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/40372/"
]
} |
78,967 | I'm a Chemistry student learning about periodic trends. I know that in (many organisms') cellular respiration, oxygen serves as the final electron acceptor due to its high electronegativity. However, applying the periodic trends, fluorine is more electronegative than oxygen, and the noble gas neon even more so than fluorine. Why aren't either of these the final electron acceptor? I know that in some organisms, the final electron acceptor is sulfur. But I've never heard of it being fluorine or neon. Why? | One of the main reasons that modern(!) biology uses oxygen as an electron acceptor is availability. Around 2.45 billion years ago , oxygen (O $_2$ ) started being built up in the atmosphere (which actually killed off a lot of the lifeforms/bacteria at that point). Since then, oxygen consuming lifeforms were able to establish themselves. Before that, most organisms probably used mainly (elemental) hydrogen as electron acceptors. Apart from not really being available in the atmosphere, there are other reasons why fluorine or neon don't make for good biological electron acceptors: While elemental fluorine (F $_2$ ) is indeed extremely electronegative, this makes it so reactive that it: a) could not be controlled by biology [the reactivity of oxygen is why it killed so many bacteria in the first place] and b) just does not occur (or at least remain in) in the elemental state in nature (there is no measurable F $_2$ in our atmosphere ). Neon (and other noble gases) are in theory also quite electronegative, actually so much so, that they never* occur without their electrons and therefore don't react at all. *It's somehow possible to form noble-gas compounds , but it requires very specific chemical reaction conditions, that mostly occur under controlled man-made conditions (and are not good for biological life forms). | {
"source": [
"https://biology.stackexchange.com/questions/78967",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/47386/"
]
} |
79,047 | There're over 7 billion people in the world and every one of them is different from everyone else. Is it possible that there are two people so different that they belong to different species (in the sense that they cannot reproduce to produce fertile offspring)? This doesn't have to mean that there's someone in the world who's completely unable to reproduce with everyone else, just that these two individuals are so different that they can't reproduce with each other (they can still reproduce with other people who can reproduce with the other individual - a ring species system). I'm particularly interested in an answer based on how much the genome varies between people vs. how much they vary against our closest relatives (such as Neanderthals). For example if humans and Neanderthals share 99% of their genes, and the largest variation among current humans is 0.001% of genes, then the answer to this question would be "no". | One of the main reasons that modern(!) biology uses oxygen as an electron acceptor is availability. Around 2.45 billion years ago , oxygen (O $_2$ ) started being built up in the atmosphere (which actually killed off a lot of the lifeforms/bacteria at that point). Since then, oxygen consuming lifeforms were able to establish themselves. Before that, most organisms probably used mainly (elemental) hydrogen as electron acceptors. Apart from not really being available in the atmosphere, there are other reasons why fluorine or neon don't make for good biological electron acceptors: While elemental fluorine (F $_2$ ) is indeed extremely electronegative, this makes it so reactive that it: a) could not be controlled by biology [the reactivity of oxygen is why it killed so many bacteria in the first place] and b) just does not occur (or at least remain in) in the elemental state in nature (there is no measurable F $_2$ in our atmosphere ). Neon (and other noble gases) are in theory also quite electronegative, actually so much so, that they never* occur without their electrons and therefore don't react at all. *It's somehow possible to form noble-gas compounds , but it requires very specific chemical reaction conditions, that mostly occur under controlled man-made conditions (and are not good for biological life forms). | {
"source": [
"https://biology.stackexchange.com/questions/79047",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/38828/"
]
} |
79,381 | Protein life times are, on average, not particularly long, on a human life timescale.
I was wondering, how old is the oldest protein in a human body? Just to clarify, I mean in terms of seconds/minutes/days passed from the moment that given protein was translated. I am not sure is the same thing as asking which human protein has the longest half-life, as I think there might be "tricks" the cell uses to elongate a given protein's half-life under specific conditions. I am pretty sure there are several ways in which a cell can preserve its proteins from degradation/denaturation if it wanted to but to what extent? I accept that a given protein post-translationally modified still is the same protein, even if cut, added to a complex, etc. etc. And also, as correlated questions: does the answer depend on the age of the given human (starting from birth and accepting as valid proteins translated during pregnancy or even donated by the mother)? What is the oldest protein in a baby's body and what is in a elderly's body? How does the oldest protein lifetime does in comparison with the oldest nucleic acid/cell/molecule/whatever in our body? | Crystallin proteins are found in the eye lens (where their main job is probably to define the refractive index of the medium); they are commonly considered to be non-regenerated. So, your crystallins are as old as you are ! Because of this absence of regeneration, the accumulate damage over time, including proteolysis, cross-linkings etc., which is one of the main reasons why visual acuity decays after a certain age: that is where cataracts come from . The cloudy lens is the result of years of degradation events in a limited pool of non-renewed proteins. Edit : A few references: This article shows that one can use 14C radiodating to determine the date of synthesis of lens proteins, because of their exceptionally low turnover: Lynnerup, "Radiocarbon Dating of the Human Eye Lens Crystallines Reveal Proteins without Carbon Turnover throughout Life", PLoS One (2008) 3:e1529 This excellent review suggested by iayork (thanks!) lists long-lived proteins (including crystallins) and how they were identified as such:
Toyama & Hetzer, "Protein homeostasis: live long, won’t prosper" Nat Rev Mol Cell Biol. (2013) 14:55–61 | {
"source": [
"https://biology.stackexchange.com/questions/79381",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/39861/"
]
} |
82,495 | The Phys.org article Scientists discover first organism with chlorophyll genes that doesn't photosynthesize says "For the first time scientists have found an organism that can produce chlorophyll but does not engage in photosynthesis. It is referring to the new paper in Nature A widespread coral-infecting apicomplexan with chlorophyll biosynthesis genes (paywalled). "This is the second most abundant cohabitant of coral on the planet and it hasn't been seen until now," says Patrick Keeling, a University of British Columbia botanist and senior researcher overseeing the study published in Nature. "This organism poses completely new biochemical questions. It looks like a parasite, and it's definitely not photosynthetic. But it still makes chlorophyll." [...] Chlorophyll is the green pigment found in plants and algae that allows them to absorb energy from sunlight during photosynthesis. "Having chlorophyll without photosynthesis is actually very dangerous because chlorophyll is very good at capturing energy, but without photosynthesis to release the energy slowly it is like living with a bomb in your cells," Keeling says. Question: Why is it that "Having chlorophyll without photosynthesis is actually very dangerous" and "like living with a bomb"? | Chlorophyll absorbs photons (light). The energy in the photon extracts an electron from a molecule of water. Electron transfer creates intermediate superoxide and hydroxyl radicals from the oxygen and hydrogen from the donor water molecule. In normal photosynthesis, these radicals are quickly used to power the reduction of NADP to NADPH and the synthesis of ATP from ADP. NADPH and ATP in turn power the synthesis of sugars from carbon dioxide and water, via the Calvin cycle . These radicals are highly reactive. If they hang around and don't get used properly in redox reactions, they will just as happily attack DNA, proteins, and structural lipids within the cell, and are therefore dangerous. In normal plant cells that get too much sun, for instance, free radicals can build up and cause cell damage . My guess is that the author's "bomb" is made up of higher concentrations of these radicals within a cell with no apparent machinery to perform the downstream (photosynthetic) chemical reactions needed to consume them safely. Edit I skimmed the (sadly, paywalled) paper , and it sounds like my guess was right, that it is indeed these radicals that are the danger from having chlorophyll, with no light-independent (Calvin cycle) mediated reactions to safely consume the energy in them: Chlorophyll itself has no natural biological function outside of
photosynthesis, so if photosystems are indeed absent, corallicolids
must have evolved a novel use for either chlorophyll or its closely
related precursors or derivatives. However, these molecules generally
function in light harvesting, which would be destructive to cellular
integrity without the coupling of the resulting high-energy compounds
to photosynthesis. Other possibilities are functions in light sensing,
photo-quenching or the regulation of haem synthesis, but these too
leave open the question of what the cell would do with the highenergy end products. What's not clear to me is that the genes that help generate chlorophyll are expressed, but the cells are unpigmented. I don't see any explanation where the chlorophyll and associated proteins are localized in the cell — seems like a missing part of the paper, or I missed that part when skimming. Or perhaps the organism has evolved interesting and novel ways to manage the damage caused by these oxygen radicals, or has other mechanisms for consuming them, yet to be identified. Should motivate further research, especially if these organisms share ancestry with malaria and toxoplasmosis — there might be something interesting to learn that would help with eliminating these diseases. I imagine a biochemical "radical bomb" could be very handy for destroying parasites, if there was a way to expose them to light or some other source of photons; perhaps some drug therapies could target the relevant genes and induce the parasite to destroy itself. Interesting paper. | {
"source": [
"https://biology.stackexchange.com/questions/82495",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/27918/"
]
} |
84,089 | According to CBC : Mad cow disease is the common name for a condition known technically as bovine spongiform encephalopathy, or BSE. [...] The only known source of mad cow disease is from animal-based feed contaminated with tissue from a diseased animal. The original source of BSE is believed to have been feed containing tainted meat from sheep with a related disease called scrapie. As prions are proteins, I would expect any that were contaminating food to be broken down to amino acids by the proteases in the digestive system. Why does this not occur? | Proteases are enzymes in your digestive system that help break down food, acting like molecular-sized scissors that cut up proteins . Proteases have clefts, or subpockets , into which proteins fit, where the substrate (protein) gets cut. Infectious or pathogenic prions are resistant to proteases , because of their three-dimensional shape, which hides away parts of the prion that would normally fit in proteases and which would cause the prion to be digested. Prions that do not cause disease — normal prions — have a different three-dimensional shape that allow them to fit into proteases, and so they are not resistant to digestion : A wealth of evidence contends that the infectious pathogen causing the prion diseases, also referred to as spongiform encephalopathies, is solely comprised of PrPSc, the pathogenic isoform of the prion protein (21-23). Both PrPSc and its normal cellular counterpart, PrPC, are encoded by a cellular gene (2, 19). Physical and molecular characterization of PrPSc and PrPC has failed to reveal any chemical differences between the two isoforms (32). However, PrPSc acquires distinctive conformational characteristics upon its conversion from PrPC. Whereas PrPC is soluble in most detergents and can be easily digested by proteases, PrPScis insoluble in detergents and maintains a protease-resistant core, designated PrP27-30, which polymerizes into amyloid (25). Dr. Neena Singh also discovered that prions "piggyback" or attach to another protein called ferritin, as they make their way through the digestive system: Disease-causing prions are thought to have passed into people when they ate beef from infected cattle, triggering the brain wasting condition called new-variant Creutzfeldt-Jakob disease, or vCJD. But researchers have not been sure exactly how prions enter the body. To find out, Neena Singh and her team at Case Western Reserve University in Cleveland, Ohio, mimicked the process of eating and digesting infected meat. They mashed up brain tissue that contained prions from patients who had a form of Creutzfeldt-Jakob disease. They then exposed it to a range of harsh digestive enzymes from the mouth, stomach and intestine, which normally break proteins into pieces. Prions, which are known to be enormously tough, escape this attack almost unscathed, they showed, as does a second type of protein called ferritin, which stores iron and is abundant in meat. The two proteins seem to stick together, they report in the Journal of Neuroscience . The researchers next added the digested slurry to a lab model of the human gut: a growing sheet of cells from the intestinal lining. By attaching fluorescent tags to the two proteins, they showed that they are transported through the cells hand-in-hand. "Prions probably ride piggyback" through the gut wall into the body, Singh says. Attaching to ferritin may provide additional protection from digestion, insofar as this removes prions from the digestive system, where proteases are concentrated. | {
"source": [
"https://biology.stackexchange.com/questions/84089",
"https://biology.stackexchange.com",
"https://biology.stackexchange.com/users/43228/"
]
} |
Subsets and Splits